Datasets:

danieladeeko
/

proccessed_ccdv

Dataset card Data Studio Files Files and versions Community

Split (3)

train · 120k rows

article stringlengths 0 682k	abstract stringlengths 146 3.69k
infantile systemic hyalinosis and juvenile hyaline fibromatosis are very rare hereditary disorders which usually occur in arabs and exceedingly rare in indians. hyaline fibromatosis syndrome (hfs, online mendelian inheritance in man 228600) is a rare autosomal recessive condition characterized by deposition of amorphous, hyaline material in skin and visceral organs. infantile systemic hyalinosis (ish) and juvenile hyaline fibromatosis (jhf) are two variants of hfs. ish is distinguished from jhf by hyaline deposits in multiple organs, recurrent infections, and death within the first 2 years of life. a 2.5-year - old female patient born of second - degree consanguineous marriage and normal full - term vaginal delivery presented with four painless swellings over scalp of 6 months duration slowly increasing in size along with raised lesions over face and perianal region of 5 months duration increasing in number. she had fever, cough, and cold for 6 days duration with history of recurrent hospital admissions in the past for bronchopneumonia and diarrhea. her mother gave a history of inability to move limbs over the past 1 year and inability to stand and walk till date. there was no similar history in siblings, parents, or other family members. on examination, four bilateral, nontender, and mobile swellings of sizes ranging from 4 cm 5 cm to 7 cm face showed depressed nasal bridge with multiple 15 mm asymptomatic nontender skin colored to pink papules clustered over bilateral nasolabial folds, nose, perioral area, eyebrows, and pinna [figure 2 ]. similar multiple, tiny, shiny, pink, moist papules were seen around anal orifice. a pink, fleshy, linear plaque of size 15 polydactyly was present in the left hand with hyperpigmented indurated plaques over bilateral elbows, knees, and knuckles [figure 4a c ]. flexion contractures of elbow and knee joints leading to a frog - like position were noticed [figure 1a ]. four bilateral, nontender, mobile cystic swellings of sizes ranging from 4 cm 5 cm to 7 cm 6 cm were seen over scalp (a and b). surface of one swelling showed hemorrhagic crusting and bleeding (c) face showed depressed nasal bridge with multiple 15 mm asymptomatic non - tender skin coloured to pink papules clustered over bilateral nasolabial folds, nose, perioral area, eyebrows (a) and pinna (b, c) multiple, tiny, shiny, pink, moist papules seen around anal orifice (a, b). a pink fleshy linear plaque of about 15 cm was seen in natal cleft and lower back (a) polydactyly was present in the left hand with hyperpigmented indurated plaques over bilateral elbows, knees and knuckles (a - c). dental examination showed nodular gum hyperplasia (d) a differential diagnosis of deposition disorder, hyalinosis, and stiff skin syndrome was proposed. complete blood count showed hemoglobin (8 g / dl), total leukocyte count of 15,200/mm mean corpuscular volume, and decreased mean corpuscular hemoglobin (mch) concentration and mch whereas peripheral blood smear revealed microcytic hypochromic anemia. ultrasound of the skull showed superficial fluid filled lesions with no communication with inner side of the skull. histopathological examination of papule from perianal region showed thickened dermis with abundant hyalinized eosinophilic ground substance [figure 5a ]. higher magnification (400) showed a few spindle cells in abundant hyalinized eosinophilic ground substance with chondroid appearance at few places [figure 5b ]. stain [figure 6 ] but was negative with alcian blue or masson 's trichrome stains, thereby ruling out mucopolysaccharidosis and collagen deposition disorder, respectively. patient was advised physiotherapy for release of contractures and surgical excision of scalp tumors under care of pediatric surgeon. (a) thickened dermis with abundant hyalinized eosinophilic ground substance (h and e, 100). (b) few spindle cells in abundant hyalinized eosinophilic ground substance with chondroid appearance at few places (h and e, 400) hyaline material stained magenta pink (periodic acid hfs (online mendelian inheritance in man 228600) is a rare autosomal recessive condition caused by homozygous or compound heterozygous mutation in the gene encoding capillary morphogenesis protein-2 (cmg2 or antxr2) on chromosome 4q21. most frequent in arab with around < 70 cases of jhf and < 20 cases of ish were reported worldwide till date. recent research suggests focal synthesis of glycosaminoglycan and hyaluronic acid. recently, absent pro - alpha2 collagen chain and an absent collagen type 3 along with increased synthesis and decreased degradation of type 1 collagen have been suggested. abnormalities begin in the first few months of life with progressive flexor joint contractures causing a frog - like position and inability to stand and walk. face shows peculiar features such as deep set eyes, depressed nasal bridge, square box head, and prominent forehead. characteristic skin lesions are papulonodular skin lesions, gingival hypertrophy, and thickened hyperpigmented macules / patches over bony prominences of the joints. radiological examination of the long bones may show delayed skeletal maturation, severe osteopenia, bony erosions, and lucent defects. ish is distinguished from jhf by hyaline deposits in multiple organs, recurrent infections, protein - losing enteropathy, failure to thrive, and death within the first 3 years of life recurrent chest infections being the leading cause of death. hypochromic microcytic anemia, low albumin, moderately elevated white blood cells count, and platelet count may be present. clinical differentials include congenital generalized fibromatosis, nodular amyloidosis, faber 's disease, winchester disease, mucopolysaccharidosis neurofibromatosis, neonatal onset multisystem inflammatory disease (nomid). histopathology or electron microscopy of skin tissue is needed to establish the diagnosis. histopathological examination of a typical papulonodular skin lesion shows deposition of an amorphous hyaline, eosinophilic substance in which spindle - shaped cells are embedded the material is pas positive and diastase resistant and does not stain with alcian blue. early surgical excision is recommended by few authors to prevent new lesions in jhf, but recurrences are frequent. genetic counseling includes informing the parents that at conception next child has a 25% chance of being affected. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. hfs is a relatively new term coined recently to include cases of ish, jhf, and intermediate cases with overlapping features of both. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. hfs is a relatively new term coined recently to include cases of ish, jhf, and intermediate cases with overlapping features of both. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. hfs is a relatively new term coined recently to include cases of ish, jhf, and intermediate cases with overlapping features of both.	hyaline fibromatosis syndrome (hfs) is rare autosomal recessive disease characterized by the deposition of amorphous hyaline material in skin and visceral organs. it represents a disease spectrum with infantile systemic hyalinosis (ish) being the severe form and juvenile hyaline fibromatosis (jhf) being the mild form. dermatologic manifestations include thickened skin, perianal nodules, and facial papules, gingival hyperplasia, large subcutaneous tumors on the scalp, hyperpigmented plaques over the metacarpophalangeal joints and malleoli, and joint contractures. ish shows a severe visceral involvement, recurrent infections, and early death. we report a case of 2.5-year - old female patient who presented with hfs who had overlapping features of both ish and jhf. to the best of our knowledge, very few cases of hfs have been reported in indian literature till date.
a choroidal hemangioma is an uncommon benign vascular tumor of the choroid that can be either circumscribed or diffuse. in our experience, diffuse choroidal hemangiomas in asian patients often require multiple photodynamic therapy (pdt) treatment sessions. five sessions of pdt treatment were required over a period of 1 year and a final optical coherence tomogram 3 months later revealed resolution of subretinal fluid and the choroidal hemangioma. this case report illustrates that a single application of pdt using standard published parameters was insufficient to achieve the destruction of the enlarged vessels. the decision for repeat treatment was based on subretinal fluid recurrence, rather than complete tumor regression. our case report supports previous suggestions that larger dilated vessels in the vascular network of a choroidal hemangioma might affect the efficacy and selectivity of pdt in treating the eyes of asian patients which may explain the need for multiple treatments. choroidal hemangioma is an uncommon benign vascular tumor of the choroid that can be either circumscribed or diffuse.1 diffuse choroidal hemangiomas, usually associated with sturge weber syndrome (sws), are more likely to develop secondary retinal detachment.2 diffuse choroidal hemangiomas have been treated using many modalities including radiotherapy, antivascular endothelial growth factor, and photodynamic therapy (pdt).2 theoretically, pdt has ideal properties for such treatment as it offers site - specific tumor destruction while sparing the overlying retina and retinal vasculature.3 to date, there have been only six case reports of successful single pdt treatment for diffuse choroidal hemangiomas.2 we present a case report to illustrate a case of diffuse choroidal hemangioma that was refractory to a single treatment. a 7-year - old boy with sws presented with blurring of vision in the left eye (os) with increasing hypermetropia (8.0 d to 11.0 d) over a period of 6 months. at presentation, his best - corrected visual acuity (bcva) was 20/20 right eye (od) and 20/150 os. fundus examination of the left eye revealed a diffuse, orange choroidal tumor with overlying exudative retinal detachment (rd). b - scan ultrasound confirmed the presence of a diffuse choroidal hemangioma with thickening of the choroid and associated rd (figure 1). verteporfin was infused at a concentration of 6 mg / m, and an 83-second treatment was conducted with a 689 nm visulas 690s photodynamic therapy laser system (carl zeiss meditec, inc., ag, jena, germany) that was delivered at 50 j / cm with an intensity of 600 mw / cm. five partially overlapping, maximally large spots (5200 m) were applied to the diffuse choroidal hemangioma. optical coherence tomography was used to monitor treatment response (figure 1a and figure 2). however, because of persistent choroidal thickening and subretinal fluid, additional sessions of pdt, as described, were applied 2, 3, and 4 months post - presentation (a total of four sessions), with persistent subretinal fluid at ocular coherence tomography (oct) thicknesses of 557 m, 507 m, and 407 m, respectively. these further treatments finally resulted in elimination of the subretinal fluid and the overlying exudative rd (oct retinal thickness at fovea 337 m), and bcva improved to 20/40 os. a year later, on routine follow - up, the patient presented with recurrence of subretinal fluid diagnosed on oct and a reduction in bcva to 20/100 os. a fifth session of pdt treatment applied and a final oct 3 months later revealed resolution of subretinal fluid and the choroidal hemangioma (oct retinal thickness at fovea 300 m) with a stable final bcva of 20/100 os. this case report exemplifies our experience with asian patients with diffuse choroidal hemangiomas, who often require multiple treatments with pdt (unpublished). a single application of pdt using currently prescribed parameters is insufficient to destroy the enlarged vessels. this experience is similar to previous reports from china describing circumscribed choroidal hemangiomas.4 the decision for repeat treatment was based on subretinal fluid recurrence, rather than on complete tumor regression. however, our patient was refractory to treatment, requiring a total of five pdt sessions. factors such as timing of laser application, absorption wavelength, and laser dose characteristics influence the efficacy of pdt.5 however, it has been suggested that patients of asian descent may respond differently to pdt treatment,6 possibly due to inherent differences in the retina, such as increased pigmentation in the retinal pigment epithelium. in another study involving chinese patients, it was suggested that the larger dilated vessels in the vascular network of a choroidal hemangioma might affect the efficacy and selectivity of pdt.4 diffuse choroidal hemanogiomas associated with sws are uncommon but require aggressive treatment to prevent visual loss from exudative rd, and possibly, subsequent sequelae such as amblyopia	backgrounda choroidal hemangioma is an uncommon benign vascular tumor of the choroid that can be either circumscribed or diffuse. in our experience, diffuse choroidal hemangiomas in asian patients often require multiple photodynamic therapy (pdt) treatment sessions.methodswe here provide a case report of a 7-year - old boy with sturge weber syndrome who presented with diffuse choroidal hemangioma in the left eye. five sessions of pdt treatment were required over a period of 1 year and a final optical coherence tomogram 3 months later revealed resolution of subretinal fluid and the choroidal hemangioma.resultsfinal visual acuity was 20/100 in the left eye with resolution of subretinal fluid. this case report illustrates that a single application of pdt using standard published parameters was insufficient to achieve the destruction of the enlarged vessels. this experience is similar to previous chinese reports on circumscribed choroidal hemangiomas. the decision for repeat treatment was based on subretinal fluid recurrence, rather than complete tumor regression.conclusionour case report supports previous suggestions that larger dilated vessels in the vascular network of a choroidal hemangioma might affect the efficacy and selectivity of pdt in treating the eyes of asian patients which may explain the need for multiple treatments.
parasitic infections which emerge in wildlife may have a significant effect on individuals and populations (mller, 2005). this is especially a critical issue in the conservation of threatened species (thompson., 2010). therefore, understanding the role of infectious and parasitic agents in wildlife populations, such as how they can influence fitness and in severe cases lead to population decline or extinction, requires accurate data on the diversity and load of potential pathogens in natural ecosystems, especially at the local scale (smith., 2009). the appearance and spread of new parasites in populations of wild animals is not well documented. most co - evolution studies are conducted with microbial organisms under laboratory conditions, taking advantage of their short generation times (levin and lenski, 1983, buckling and rainey, 2002, gandon., 2008). however, such simplified artificial models do not reflect the situation in wild populations where infected animals are additionally affected by a number of environmental factors. the difficulty in conducting such studies in wildlife results from both the difficulty in capturing the start point of the introduction of a new pathogen to a population and problems associated with long - term continuous acquisition of material for research. the european bison (bison bonasus l., 1758) is one of the last mega - herbivores to survive in europe. extinct in the wild at the beginning of 20th century, it was restored back to the wild from captive survivors. nowadays there are over 3500 european bison in the wild distributed in 35 isolated populations (raczyski, 2015). bison numbers are growing ; however, only five populations number more than 200 individuals. apart from small herd size, isolation and low genetic variation due to a severe genetic bottleneck after extinction in the wild (tokarska., 2011), diseases and parasites (pucek., 2004) are the main threats to bison. the oldest and largest population of bison is in the biaowiea primeval forest (bpf) (984 individuals, in both the polish and belarusian parts of bpf), constituting the core of the global population of the species. since reintroduction to the wild in 1952, this population has been parasitologically investigated and monitored at differing intensities. a total of 88 species of parasites have been discovered in european bison, with an increasing trend in species richness as well as in the prevalence and intensity of infections (drd, 1995, karbowiak. this may be a result of transmission from other wild ruminants and cattle, or the increased contact rate between bison in winter due to large aggregations arising from supplementary feeding in fixed locations (radwan. one of the most pathogenic parasites discovered, the blood - sucking nematode ashworthius sidemi schulz, 1933 was first found in bison in bpf in 2000. the other blood - sucking nematode haemonchus contortus was described in bison in bpf in the 1960s, but only in captivity (drd, 1961, drd, 1967). a. sidemi was also found in the neighboring knyszyn forest in 2009 (demiaszkiewicz., 2009b). the species is characteristic of asiatic deer, especially sika deer cervus nippon, and was probably transmitted to poland from red deer cervus elaphus from ukraine and slovak republic, where sika deer has been previously introduced (kotrl and kotrl, 1973, kotrl and kotrl, 1973, 1977, drd., 1998, demiaszkiewicz., the parasite was found in ne and se poland in species such as red deer, roe deer capreolus capreolus, moose alces alces, and european bison (drd., 2003, a. sidemi was also found in deer in france (ferte.,, the presence of a. sidemi was genetically confirmed in cattle, which indicates possible transmission from wildlife to livestock (moskwa., 2015). previous studies from bpf have shown the influence of winter bison aggregation on a. sidemi and coccidia infection (radwan., 2010, pyziel., 2011) and on the seasonal pattern of parasite egg excretion (koodziej - sobociska., the aim of our study was the long - term analysis of the invasive a. sidemi spread since its appearance in the free ranging population of european bison in bpf and to determine the factors affecting its intensity. we hypothesized that after the new, invasive parasite was introduced to the bison population, a phase of rapid growth in prevalence and intensity of a. sidemi was due to the susceptibility of the animals to infection and a higher likelihood of disease transmission. in the bison population, we presume that a. sidemi spread is significantly favoured by the high bison densities in large herds which form at fixed locations where supplementary winter feeding is provided, as well as biological factors such as age and sex. knowledge about the spread of this parasite in wild hosts and particularly about factors which influence its prevalence and intensity may help to model the spread of emerging diseases in wildlife and guide the conservation management of wild endangered fauna. bison were culled by rifle by biaowiea national park staff, as approved by the management plan. the bison population in bpf has been regulated, on average, by approximately 11% annually since the 1970s through culling or translocation (hayward., 2011, biaowiea national park staff culled bison under permissions issued each year by the ministry of environment and the general directorate for environmental protection (warsaw, poland). tissue samples were collected from culled animals under the permission of the provincial wildlife conservator in the years 19992005, and from 2006 under permissions issued each year by the ministry of environment, general directorate for environmental protection (warsaw, poland) and regional directorate for environmental protection (bialystok, poland). for this research the guidelines of the polish nature conservation act adopted on october 16, 1991 (dz.u. nr 99, poz.1079) and on april 16, 2004 (dz.u. 2004 nr 92 poz. the study was conducted in the biaowiea primeval forest (bpf ; 5229-5237n, 2331-2421e) located on the polish - belarusian border. it is one of the best preserved lowland forests in europe inhabited by well - preserved communities of animals. the polish part of the forest (600 km) is covered mainly by deciduous and mixed tree stands (94%) ; open habitats constitute the remaining 6% (sokoowski, 2004). the climate of bpf is transitional between atlantic and continental type with clearly marked cold and warm seasons. mean annual temperature between 2000 and 2015 was + 8.0 c ; mean temperature of the coldest month, january, was 3.5 c, and the warmest, july, was + 19.9 c. the vegetative season lasts, on average, 215 days (range : 198238) and was calculated according to tylkowski (2013). snow cover persisted from 41 to 120 days per year with a maximum recorded depth of 55 cm. the studied bison population is widespread in the polish part of bpf across an area of 800 km (kowalczyk., 2013). the population of 522 individuals, i.e. 15% of all wild living bison (raczyski, 2015), is isolated from the population in the belarussian part of the forest by a fence constructed on the border in 1981(kowalczyk., 2012). during snow - free periods bison males live solitarily (62% of males) or in small bull groups (up to 8 ind.), while females with calves and sub - adults roam in mixed groups numbering, on average, 1115 individuals (krasiska and krasiski, 1995, krasiska., 2000). herd size increases during the rutting season (august october). in winter, bison are supplementary fed with different intensities and aggregate around seven main feeding sites. supplementary fed bison stay in a limited area for up to five months creating herds of up to 100 individuals. during the first part of the winter they consume hay stored in roofed haystacks in fixed locations ; later in winter, the supplementary food (usually hay) is delivered to the forest floor in these locations. some bison roam in winter out of the feeding sites, usually utilizing hay left by farmers on mowed meadows out of the forest or grazing on winter crops of rape and cereals (hofman - kamiska and kowalczyk, 2012, kowalczyk., 2011, kowalczyk., 2013). there is relatively low number of cattle grazing in neighboring to the forest pastures, however around 15% of bison, occasionally or seasonally and mainly from autumn until early spring, forage on pastures utilized also by cattle (kowalczyk., 2013). this indicates possibility of interspecies parasite transmission (moskwa., 2015). no infected animals were recorded (drd, 1961, drd., to 2000, 41 bison were investigated and no a. sidemi was found (drd., 1989, in 20002001, three of the 19 investigated bison were infected with a. sidemi, but due to incomplete data on bison sex, age, and body weight or herd size, they were not included in the model, but were used for prevalence calculations. from 2002 to 2015, 165 culled bison were investigated (from 4 to 22 individuals per winter season) (see table 1). five individuals which had been released from captivity into the wild were excluded from the analysis due to their infection by a high number of nematodes (max. this may have resulted from their different susceptibility to infection, related to their lack of contact with the parasite in captivity as a result of regular deworming. the contents of the whole of the abomasa and a 1 m long section of the duodena of culled bison were examined by scraping and sedimentation method (drd., 1998, the sediment preserved in 23% formalin was diluted with water up to 2 l and thoroughly mixed. a 200 ml aliquot was examined in small portions under a dissecting microscope in order to collect all helminths. after evaporation of the alcohol, non - permanent preparations were made from all selected nematodes for species identification., 1994, jacquiet., 1997 and drd. (1998) and the number of a. sidemi were counted. for the analysis of infection intensity we used 160 individuals with a full set of data from 2002 to 2015. to model which factors affected a. sidemi infection intensity (actual number of nematodes), we used the following set of independent variables : bison sex, age, body weight, herd size, feeding intensity, and the number of years since parasite introduction. herd size was determined during the annual inventory of bison in bpf carried out by biaowiea national park staff. examined bison were divided into three groups depending on the intensity of supplementary feeding provided in winter : intensively fed bison food delivered to the feeding sites three to five times a week ; less intensively fed bison food delivered once a week, and non - fed bison bison not utilizing feeding sites. bison age was expressed in three age classes : juveniles (up to 1 year old), sub - adults (23 years old) and adults (over 3 years old). we checked for multi - collinearity among explanatory variables, and the following non - correlated (r < 0.5) most informative covariates were included in the final model : bison sex, age, body weight, herd size and number of years since introduction. then, we fitted negative binomial generalized linear models (negative binomial glm) to count data, which dealt with observed model over - dispersion (zuur., 2009). the number of a. sidemi per animal was set as a dependent variable and as main effects, we applied bison age, sex, body mass, and as interactive effects : number of years since introduction with herd size and body mass. the akaike information criterion (aic) with second - order correction for small sample size (aicc ; burnham and anderson, 2002) was used for model ranking. beforehand, out of the set of all possible combinations of models, based on model nesting, we excluded more complex versions of models which had lower aicc scores (richards, 2008, richards., 2010). we checked the normality and homoscedasticity in the distribution of the final model residuals by inspecting the quantile - quantile distribution plot and model residuals against plots of fitted values (estimated responses). all statistical analyses were performed in the r program (version 3.1.2 ; r development core team, 2012). prevalence of a. sidemi infection increased rapidly from 0% in 1999, by 9% in 2000, 25% in 2001, reaching 100% in 2004 (fig. 1). sidemi invasion, the median infection intensity was 2890 and varied from 0 to 44,310 nematodes per animal (fig. 2). after its introduction in 2000, infection intensity increased, reaching the highest median infection intensity of 8200 a. sidemi in the winter of 2008/2009. afterwards, a significant decline in the median infection intensity was observed to the minimum value of 410 nematodes in the winter of 2014/2015 (nbglm : slope = 0.22 + -0.09, z = 2.45, p = 0.01) (fig. 2). in 20022006, bison herd size, from which studied individuals originated ranged from 4 to 104 individuals and did not differ significantly across years. then, from 2007, herd size significantly decreased (2007 max herd size = 75 individuals, 2015 = 31 individuals ; p < the size of the bison herds was strongly correlated with the intensity of supplementary winter feeding (fig. the size of the bison herds utilizing provided forage grew as the frequency and amount of food delivered to feeding sites increased. model selection (based on the aicc criteria) for the considered negative binomial generalized linear model (glm) revealed that changes in a. sidemi infection intensity were statistically significantly associated with bison age, and the interactive effects between herd size and the number of years since introduction. a. sidemi infection intensity was the highest in sub - adults (median : 10,835 nematodes), medium in adults (median : 2955) and the lowest in juveniles (median : 1700) (fig. 5). this was also confirmed by a loess model (local polynomial regression) infection intensity grew up to the age of approximately 3842 months, then it dropped and after 75 months remained at a fairly stable level (fig. 6). the positive effect of bison herd size on a. sidemi infection intensity increased significantly with the number of years since nematode introduction (table 3, fig. 7). though the final model indicated that bison sex did not have a significant effect on a. sidemi infection intensity, we found significant differences between sexes when only adult individuals were considered (males 1785 nematodes, females 3982) (fig. 8, mann - whitney test, w = 954, p = 0.027). in this paper we analysed the spread of a pathogenic parasite in a wild ungulate from the initial phase of its progression. this was possible due to the long - term parasitological studies conducted on european bison in bpf ; this enabled the capture of the initial phase of the invasive blood - sucking nematode introduction, and the investigation of its spread over the following years. such studies are of great importance because they allow for modelling the spread of a new parasite in a population, and its impact on the host population (anderson and may, 1978, hudson., 1998) and ecological processes (thomas., 1999, long term field studies of host and parasite populations represent the ideal approach to analyse the dynamics and consequences of co - evolution because they allow the direct detection of host and parasite reciprocal influences (decaestecker., 2007). however, the full course of new parasite introduction and spread in wild vertebrates is difficult to accurately trace. recently, host - parasite interactions in the extreme environment of the arctic have been reviewed by kutz. the authors, based on studies of parasites of holarctic ruminants such as moose (alces alces), muskoxen (ovibos moschatus) and caribou (rangifer tarandus), concluded that insights gained from studying the history and ecology of host parasite systems in the arctic will be central to understanding the role that climate change is playing in these complex systems (hoberg., 2007, kutz., 2012, hoberg., 2012, steele., 2013, it can also guide wildlife management and conservation throughout the arctic, and be generalized to provide insights into host parasites influence host populations causing deleterious effects on their hosts (anderson and may, 1979, prado., 2009), and so they are constantly forced to adapt to one another (schmid - hempel, 2011). short phylogenetic parasite - host relationships are known to be more pathogenic for the host than longer co - existing relationships (gandon., 2008). our study revealed that ten years after a. sidemi introduction, its infection intensity dropped significantly and prevalence varied between 89 and 100%. the question is whether several years of interaction with the pathogen adaptive mechanisms to limit the number of parasites was developed ? most co - evolution studies are conducted with microbial organisms under laboratory conditions taking advantage of their short generation times (levin and lenski, 1983, buckling and rainey, 2002, gandon., 2008), and these studies are n't comparable with mega - herbivore species such as european bison. long - term co - evolution sometimes leads to a relatively stable relationship tending towards commensalism or mutualism and the establishment of parasite - host balance, as it is in the evolutionary interest of the parasite that its host thrives (rook, 2007). although we have not investigated the immunological parameters, it could be expected, based on other host - parasite interaction studies, that co - evolution could have appeared, or will appear in a. sidemi - bison interactions and affect the course of invasion. due to the lack of data on this topic european bison are characterized by very low genetic variation (the lowland line of the european bison originates from only seven founders) ; this raises the questions about the relationship of genetic diversity to the infection of the species by numerous new parasites and the increasing prevalence and intensity of these infections (tokarska., 2009, tokarska., 2011). there is considerable evidence that at least part of the natural variation in resistance to nematode infection is under genetic control (wakelin, 1985, barger, 1989, stear., 1999). however, analysis of the impact of genetic factors (the major histocompatibility complex) on the intensity of a. sidemi infection in bison has shown that despite high sequence divergence, neither the alleles nor drb heterozygosity were significantly associated with infection intensity (radwan., 2007,, the risk associated with the occurrence of any new pathogen in a population of a species with such a limited gene pool should be taken into account. blood - sucking parasites, such as a. sidemi, are strongly pathogenic (osiska., 2010), especially as a cause of anaemia (stefaski, 1968, gatongi., 1998). a study by boughton and hardy (1935) revealed that 2000 h. contortus females can suck 30 ml of blood per day ; thus the high infection intensity of a. sidemi (reaching 44,300 nematodes) observed in bison in bpf may cause significant blood loss resulting in a serious impact on host condition (koodziej - sobociska. moreover, the histopathological examination of tissue from infected bison showed infiltrations of inflammatory cells in the walls of the abomasa and duodena (mainly lymphoid cells and eosinophils, as well as hyperaemia, oedema and lesions of mucosa and proliferation of lymphatic follicles) at various levels of intensity (osiska., 2010). such serious histopathological lesions connected with a deterioration in blood parameters in infected animals (koodziej - sobociska., 2016b) confirm the parasite potentially has a strong impact on the bison population. there are many mechanisms and factors involved in parasitism : the immune system, toxins, behavioural traits, population density and others (solomon., 2015). one of the major host defence mechanisms is immunity, which is influenced by factors such as age, sex and nutritional status (bush., 2001, pea., 2004, cornell., 2008). the higher a. sidemi infection intensity in sub - adult bison compared to juveniles could be due to longer exposure to the parasite. difference between results obtained from young animals to these from adults is probably connected to an immature immune system. young animals, with immature immune systems, are the most susceptible to infection and disease and they spread a high number of infective eggs into the environment in their faeces (woolhouse, 1998, cornell., 2008, neonates and juvenile ruminants are very susceptible to paratuberculosis infection, and that this is related to a high degree of exposure from their mothers and an immature immune system (thakur., 2013). also in captive bison, it was found that young bison are usually characterized by the heaviest infection levels and suffer the most severe consequences (treboganova, 2010). in bpf, the youngest bison (up to one year old) have a lower parasitic load than sub - adults. we hypothesize that this could be a result of both the short exposure time of the host to the parasite, and maternal antibodies ingested by bison calves which provide immunological protection (jackson and nazar, 2006, hurley and theil, 2011). the suckling period in bison lasts up to one year (krasiska and krasiski, 2013). however, most calves are born in may july, and by winter are already a few months old and eat hay provided at feeding sites (krasiska and krasiski, 2013) which exposes them to infectious agents in the contaminated environment (radwan., 2010, our detailed analysis of infection dynamics in relation to age showed that infection intensity grew with age up to approximately 3842 months, then dropped, and after 75 months, when bison are fully mature, remained at a fairly stable level. by adulthood animals have developed a stronger immunity and usually harbour lower infection levels (brass and stevens, 1982, kethineni., the lower infection intensity that we observed in bison bulls stands in opposition to the widely observed patterns of the higher susceptibility of males to parasitosis (addis, 1946, solomon, 1966, alexander and stimson, 1988, zuk and mckean, 1996). this phenomenon is explained by the association between testosterone and the immune system ; thus, sexually mature male vertebrates are often more susceptible to infection and carry higher parasite burdens in the wild (zuk and mckean, 1996). recent studies have revealed that male - biased parasitism is not universal and that there are many other factors that can influence parasite infection such as the age of individuals, sexual size dimorphism, hormone levels, individual host variability (e.g. behavioural, physiological), and immunocompetence (kiffner., 2013). we suggest that the behavioural traits may be responsible for the lower parasitic load in bulls. bison males live solitarily (62% of males) or in small bull groups (up to 8 individuals), while females with calves and sub - adults roam in groups numbering, on average, 1115 individuals (krasiska and krasiski, 1995, krasiska., 2000). this leads to sexual segregation and much lower contact rates between males and other bison, which decreases the risk of parasite transmission. additionally, pregnant and lactating females are immunosuppressed and therefore more susceptible to infection (lloyd, 1983, krishnan., 1996). european bison have an average gestation period of 264 (range 254270) days (krasiska and krasiski, 2013) and similarly to closely related species such as american bison (bison bison), can give birth each year (wilson., 2002). also, during a four year study 60% of cows gave birth to at least 3 calves. moreover, the infection intensity is not an effect of just one season, but may be influenced by pregnancies in previous years. these data support the higher a. sidemi infection intensity observed in bison females in bpf. we found that herd size, as a factor which significantly shapes a. sidemi infection intensity in bison, became increasingly important the longer the parasite was present in the host population. this means that the highest infection intensities were recorded in the biggest bison herds, where the winter supplementary feeding of bison was intensive. the role of herd size increased, the longer the time since the first detection of the parasite. this indicates that during the initial phase, the new parasite spread more successfully even in small herds, probably due to the high susceptibility of the host to the new pathogen. after the host population became saturated with the parasite, other factors such as herd size increasingly shaped the dynamics of the disease. in large herbivore management, supplementary feeding is mainly intended to reduce herbivore impact on agriculture, to enhance body condition and reproductive performance (kozak., 1995), or to supply endangered animals with food or water in crucial periods of their annual life cycle (loarie., 2009). most of the free - ranging bison populations inhabiting forests are supplementary fed in winter to mitigate migrations and reduce farm crop depredation (kerley. however, research conducted in the last few years has showed that supplementary feeding may have negative long - term effects on bison and increase parasitic load (radwan., 2010, this is a consequence of bison aggregation in fixed locations for several months of the year and may lead to environmental contamination by parasites and their more efficient transmission (radwan., 2010). increasing intensity of supplementary feeding leads to higher aggregation and larger herds and reduces bison mobility and ranging (schneider, 2008). this may be more severe during cold winters when bison occupy much smaller winter ranges (krasiska., 2000). an annual survey of parasite excretion in bison dung showed an increase in their prevalence and number during winter months (koodziej - sobociska., 2016a). increased winter densities of bison at feeding sites influences the parasitic load of this herbivore, especially in intensively fed herds (radwan., 2010, our results have shown that the level of a. sidemi infection is dependent on the herd size and that the herd size is strongly correlated with the intensity of supplementary feeding. this in turn may shape the demographic composition and the overall fitness of the european bison populations (hayward. management practices also influence the quick spread and growth of infection intensity in bison, especially at the end of winter when bison are in a poorer condition (hayward., 2015, koodziej - sobociska. the results of this study indicate a strong need to modify supplementary feeding in order to scatter the herds, increase bison ranges and as a consequence reduce parasite transmission. actions implemented in bpf during the bison conservation program in 20062010 aimed to split large winter aggregations of bison (numbering initially up to 104 individuals), which resulted in an increase in the number of winter herds and a reduction in their size., we would predict increased parasitic load strongly related to the herd size and supplementary feeding intensity. our study, for the first time, has allowed for the long - term analysis of parasite invasion in a large herbivore in the wild : from the appearance of the parasite, through the period of rapid increase in prevalence and intensity of the infection, to the stabilization phase in the host - parasite system. the spread of animals into new areas, due to climate change and environmental modification, can affect the occurrence and spread of parasitic infections to new areas and new species. knowledge about the course of biological invasions and the factors influencing them in wildlife can help in the modelling, prediction, prevention, or even reduction of the emergent diseases. this is especially important in the conservation management of rare and endangered species. in recent years, bison have been introduced to new places in europe ; therefore, knowledge about the processes of emergent diseases and the determination of factors influencing the severity of pathogen and parasite infections can help to design conservation management that reduces the risk of infection spread and therefore the consequences for populations of this unique and other wild species.	the full course of new parasite introductions in wild animals is difficult to accurately trace. we documented and analysed the invasive blood - sucking nematode ashworthius sidemi (trichostrongylidae) introduction and spread in european bison (bison bonasus) from the initial phase of its progression. in the polish part of the biaowiea primeval forest (bpf) the parasite was first found in 2000. from 2002 to 2015, 165 culled bison were investigated. the prevalence and intensity of a. sidemi schulz, 1933 infection increased over the following years, reaching 100% of investigated bison four years after introduction and a maximal median intensity of 8200 nematodes per animal in the winter of 2008/2009. afterwards, a significant decline of median infection intensity was observed to the minimum value of 410 nematodes per animal. between 2011 and 2014 prevalence varied from 89 to 100%. among the factors analysed, the number of years since introduction, herd size, age and sex proved to significantly influence infection intensity. a higher infection intensity was recorded in sub - adults compared to juveniles and adults. males had significantly lower infection intensity than females, but this was the case for adults only. the highest infection intensities were recorded in the biggest bison herds, where the winter supplementary feeding of bison is intense. moreover, the longer the parasite was present in the host population, the more important herd size became as a factor. our study indicates that it is not solely biological factors that determine the spread of a newly detected parasite in wildlife, but that management practices can also have a strong influence. this is especially important in endangered species under intensive human care as the management practices may pose a threat to the species.
the high prevalence of child obesity remains a global public health concern. in response to the increasing number of overweight and obese children, government and non - government agencies in many countries have invested in programs that address modifiable factors (for example, diet, physical activity and screen time) associated with obesity. the return on intervention investments appear promising with some countries reporting a stabilization in child obesity rates at a population level, but others are yet to observe evidence of a plateau. the stabilization of child obesity rates is positive for public health, but there is strong evidence that child obesity remains unequally distributed across subgroup populations, and that in some countries obesity trends among children from socially disadvantaged backgrounds and certain ethnicities are not stabilizing. the evidence suggests that some child obesity interventions are effective ; however, changing obesogenic factors is not a linear process, rather, change is time dependent and complex, and involves interactions between biology, environment and behavior. these interactions may differ across population groups, which may explain why the current interventions are not having the desired impacts in socially disadvantaged communities. serial population surveillance of children 's obesity status is essential to monitor prevalence estimates over time to guide preventive policies and interventions, and to broadly assess the returns on investments in child obesity prevention programs. the purpose of this study was to investigate trends, and the socioeconomic distribution, of measured overweight, obesity and abdominal obesity among children aged 418 years between 1985 and 2015 collected by a state population surveillance program of children 's weight and weight - related behaviors. five representative cross - sectional surveys of children aged 418 years living in new south wales (nsw ; 2015 pop 7.6 mil), australia, were analyzed to examine change in weight status at five time points : 1985, 1997, 2004, 2010 and 2015. sample size for 1985 were based on detecting a 5% group difference with 90% power and 0.05 and for 1997200420102015 surveys a 10% group difference with 80% power and -level of 0.05. all surveys were school - based and used comparable sampling frames that were based on a two - stage probability sample (school and student). the sampling frame comprised all nsw schools with the exception of special schools (for example, blind, sport) and schools with enrollments < 180 students (due to cost and small student numbers). within each sector, the schools were ordered by location (based on geo - location codes to identify rural and urban schools), gender, socioeconomic status (ses) and school size. the sample of schools was therefore representative of sector (government, independent, catholic schools), location (rural and urban), gender composition and ses. that is, the proportions of students from across the different combination of stratification variables were similar to those in the population of eligible students. schools were sampled from each education sector proportional to enrollment in that sector, and students from one to two randomly selected classes in each target grade were invited to participate. the study protocols are comparable for each survey year and included information on the child 's school level (primary or secondary school), sex, date of birth and postcode of residence. height (m), weight (kg) and waist circumference (cm) were measured in socks, over one layer of light clothing by trained field staff using standard procedures. waist circumference was measured at the level of the narrowest point between the lower intercostal border and iliac crest with a steel anthropometric tape measure. body mass index (bmi ; kg m) was calculated from height and weight and children categorized as overweight and obese using the international obesity taskforce age - sex adjusted cut - points. waist - to - height ratio (whtr) is an indicator of abdominal obesity and was calculated as waist circumference divided by height and dichotomized as a ratio < or 0.5. children 's home postcode was a proxy measure of ses using the australian bureau of statistics ' socioeconomic index for areas (seifa) index of relative socioeconomic disadvantage. seifa summarizes census - obtained socioeconomic indicators for geographic areas including income, educational attainment, unemployment and proportion of people in unskilled occupations. seifa scores from the national census most proximal to the survey year were used to rank students into low, middle and high tertiles according to ses background. 1985 data originate from the australian health and fitness survey, a national survey (n=8484) of children aged 815 years conducted between may and october 1985. primary and high schools were randomly selected from each education sector, stratified by state, and students were selected at random within schools. nsw data (n=2955) were extracted and 1986 census data were used to determine ses. 1997 data are from the nsw schools fitness and physical activity survey (nswsfpas), a representative nsw population survey of children aged 517 years in primary and high schools (n=5518) conducted between february and march 1997. 200420102015 data are from the nsw schools physical activity and nutrition survey (spans). spans are representative nsw population surveys of children aged 418 years, in primary and high schools (2004 n=5402 ; 2010 n=8058 ; 2015 n=7557) conducted between february and march. 2006 census data were used to determine ses for 2004, and 2011 census data for 2010 and 2015 ses. the australian health and fitness survey was approved by the state director general of education, and nswsfpas and spans were approved by the university of sydney human research ethics committee, nsw department of education and nsw catholic education commission. for each survey, data were analyzed in december 2015 using sas enterprise guide (5.1 ; sas institute, cary, nc, usa). the prevalence for each bmi category were calculated using proc surveyfreq, which takes into account the survey design and the clustering of data by school and year level. overall associations between survey year and overweight, obesity and whtr0.5 prevalence were tested using the rao - scott chi - square test. logistic models were used to explore the relationships between the probability of being overweight, obese and whtr0.5 with survey year, sex, school level and ses tertile modeled as nominal factors and age as a covariate. school and year level were identified as cluster variables in order to account for the design effect of the surveys. interactions between survey year and sex, school level and ses tertile were calculated to assess whether the odds of being overweight, obese and whtr0.5 by sex, school level or ses tertile changed differentially across the years of the surveys. the significance level was 0.05 and 0.1 for interaction terms. 1985 data originate from the australian health and fitness survey, a national survey (n=8484) of children aged 815 years conducted between may and october 1985. primary and high schools were randomly selected from each education sector, stratified by state, and students were selected at random within schools. nsw data (n=2955) were extracted and 1986 census data were used to determine ses. 1997 data are from the nsw schools fitness and physical activity survey (nswsfpas), a representative nsw population survey of children aged 517 years in primary and high schools (n=5518) conducted between february and march 1997. 200420102015 data are from the nsw schools physical activity and nutrition survey (spans). spans are representative nsw population surveys of children aged 418 years, in primary and high schools (2004 n=5402 ; 2010 n=8058 ; 2015 n=7557) conducted between february and march. 2006 census data were used to determine ses for 2004, and 2011 census data for 2010 and 2015 ses. the australian health and fitness survey was approved by the state director general of education, and nswsfpas and spans were approved by the university of sydney human research ethics committee, nsw department of education and nsw catholic education commission. for each survey, written consent by students and their care providers were required for participation. data were analyzed in december 2015 using sas enterprise guide (5.1 ; sas institute, cary, nc, usa). the prevalence for each bmi category were calculated using proc surveyfreq, which takes into account the survey design and the clustering of data by school and year level. overall associations between survey year and overweight, obesity and whtr0.5 prevalence were tested using the rao - scott chi - square test. logistic models were used to explore the relationships between the probability of being overweight, obese and whtr0.5 with survey year, sex, school level and ses tertile modeled as nominal factors and age as a covariate. school and year level were identified as cluster variables in order to account for the design effect of the surveys. interactions between survey year and sex, school level and ses tertile were calculated to assess whether the odds of being overweight, obese and whtr0.5 by sex, school level or ses tertile changed differentially across the years of the surveys. the significance level was 0.05 and 0.1 for interaction terms. the response rates and sociodemographic characteristics of children by survey year are shown in table 1. in total, 27 808 children participated across all survey years. bmi categorization data were available on 26 801 children (96.4%) and whtr data were available on 26 263 children (94.4%). figure 1 shows prevalences for overweight, obesity and whtr0.5 for children in primary school by survey year and sex. the only significant change in the prevalence of overweight was between 1985 and 2015 and only among boys (p=0.043) with the prevalence increasing relatively by 53 percentage points. similarly, the only statistically significant change in the prevalence of obesity was between 1985 and 2015 where the prevalence of obesity increased more than threefold among boys (p=0.044) and sixfold among girls (p=0.006). the prevalence of whtr0.5 significantly changed between 1985 and 2015 in boys (p<0.001) and girls (p<0.001) also between 1997 and 2015 in boys (p<0.001) and girls (p<0.001) and between 2010 and 2015 the prevalence increased relatively by 27 percentage points among boys (p=0.019). figure 2 shows prevalences for overweight, obesity and whtr0.5 for adolescents in high school by survey year and sex. significant changes in the prevalence of overweight were observed between 1985 and 2015 in boys (p=0.002) and girls (p<0.001), between 1997 and 2015 in boys (p=0.006) and girls (p<0.001) and between 2010 and 2015 in boys (p=0.021) and girls (p<0.001). between 2010 and 2015 the prevalence of overweight increased relatively by 20 and 38 percentage points in boys and girls, respectively. the prevalence of obesity among adolescents was very low in 1985. the only significant change in the prevalence of obesity was between 1997 and 2015 in boys (p=0.022) : a relative increase of 33 percentage points. significant changes in the prevalence of whtr0.5 were observed between 1985 and 2015 in boys (p<0.001) and girls (p=0.014), between 1997 and 2015 in boys (p<0.001) and girls (p=0.011) and between 2010 and 2015 in boys (p<0.001). figure 3 shows the odds of children and adolescents from low ses backgrounds being overweight, obese and having abdominal obesity (whtr0.5) at each survey time point, by school level, compared with peers from high ses backgrounds. in primary school children, the odds of being overweight were 32 and 77% higher among children from low ses backgrounds compared with children from high ses backgrounds in 2010 and 2015, respectively. in high school, ses differences in the prevalence of overweight were apparent in 2015, with the odds of overweight being 64% higher among adolescents from low compared with high ses backgrounds. significant ses differences in the prevalence of obesity have been apparent among primary school children since 1997. between 1997 and 2010, the odds of obesity were between 1.73 and 1.97 times higher among children from low, compared with children from high ses backgrounds increasing to 2.36 in 2015. similarly, among adolescents in high school, significant ses differences in the prevalence of obesity were apparent from 2004 onwards. the odds of being obese for adolescents from low ses backgrounds were 1.842.79 times higher than adolescents from high ses backgrounds. significant ses differences in the prevalence of whtr0.5 have been apparent among primary school children since 2004. in 2004 and 2010, the odds of whtr0.5 were 90 and 97% higher among children from low, compared with children from high ses backgrounds with the odds increasing to 2.34 in 2015. among adolescents in high school, significant ses differences in the prevalence of whtr0.5 were apparent from 2010 onwards. the odds of whtr0.5 were 2.57 and 2.79 times higher in 2010 and 2015, respectively, for adolescents from low ses backgrounds compared with adolescents from high ses backgrounds. bmi density plots of children from low and high ses backgrounds in 1997 and 2015, by school level and sex, are presented in figure 4. in contrast to high ses children and adolescents, there is a clear temporal right shift and decreased kurtosis in the distributions for children and adolescents from low ses backgrounds, and these differences were greater among adolescents in high school compared with children in primary school. the 1997 and 2015 distributions curves are aligned closer for the high ses tertile compared with the variability between survey years of the low ses tertile. this study reports on 30-year trends in the prevalence of overweight and obesity, and uniquely, whtr0.5 in australian children and adolescents. in this study, overweight and obesity have not significantly increased among primary school children nor has the prevalence of obesity increased in high school adolescents since 1997, a finding that has been previously suggested. the addition of 2015 estimates shows that since 2010, and in contrast to primary school children, there were significant increases in the prevalence of overweight among adolescents, increasing from 17 to 22%. while the 2015 prevalence of overweight was similar for adolescent boys and girls (~22%), the prevalence among girls increased by 8% after being stable at approximately 16% for the previous 18 years. this is the first study to report on the prevalence and trends of abdominal adiposity in australian children and adolescents. the prevalence of whtr0.5 has significantly changed between 1985 and 2015 in children and adolescents, including an increase between 2010 and 2015. with the exception of 2004, the prevalence of abdominal obesity was around twice the prevalence of obesity in primary school children and adolescent boys and approximately 30 relative percentage points higher in adolescent girls. it is not clear why whtr0.5 rates have increased and obesity rates have remained stable but the increase in abdominal obesity is of concern. bmi is a surrogate measure of total adiposity that does not distinguish between fat and fat - free mass nor does it describe body fat distribution, which may be a more important to than total adiposity. whtr measures fat accumulation around the abdominal area, which is associated with less favorable cardiometabolic profiles in children and in adults. hence, while both measure adiposity, determining which of these measures is the optimal for obesity screening is still being debated. whtr appears to add additional information in terms of discriminating obesity - related cardiometabolic risk, compared with bmi, and in children who are overweight or obese it may identify children who need medical intervention. alternatively the temporal increase in abdominal obesity may reflect a right shift in bmi distribution. we used the iotf obese category (equivalent to a bmi 30 kg m at age 18 years) ; however, the proportion of australian children in morbid obese category has significantly increased between 1985 and 2012. children with morbid obesity (equivalent to a bmi 35 kg m at age 18 years) represented 11% of children with obesity in 1985 increasing to 23% in 2012 and children with severe obesity (bmi140% of the 95th percentile or a bmi40 kg m) represented 19% of children with obesity in 1985 and increased to 32% in 2012. further research is required to examine the association between more extreme obesity categories and whtr0.5, but the current findings suggest certain obesogenic factors are influencing abdominal obesity, especially in adolescent boys. this may reflect changes to environmental cues that influence epigenetic mechanisms that influence the distribution of fat and suggests that more research is required. the reason for a lower whtr0.5 prevalence in 2004 is not clear and further exploration of the data is required to understand this paradox. although the field staff for each survey were trained in anthropometric measurement and their inter - rater reliability assessed, measurement error must be considered, given there was no concomitant decrease in the prevalence of obesity. we found that obesity and whtr0.5 were strongly and positively associated and that the majority of children and adolescents who were in the obese category also had a whtr0.5. these findings are similar to a study of 14 493 children aged 518 years, which showed children in the overweight and obese bmi categories with a whtr<0.5 had a cardiometabolic risk approaching that of children in the normal bmi category. in children and adolescents who are overweight and obese, an increasing whtr was significantly associated with increased cardiometabolic risk with the greatest associations observed in children with obesity. a clear, consistent and concerning finding in this study was the unequal distribution of adiposity indicators within survey years, between children and adolescent from low ses, compared with peers from high ses backgrounds. overall, the prevalence was significantly higher among children and adolescents from low ses compared with peers from the high ses backgrounds, especially for obesity and whtr0.5. differences in the prevalence of overweight between low and high ses children and adolescent began in 2010, and in 2004 for abdominal obesity among primary school girls, while the difference for obesity rates in children began in 1997 and 2004 among adolescents. the increasing ses disparities in obesity and abdominal obesity are especially concerning and suggest that urgent intervention is needed in low ses populations. australia is not alone in identifying ses disparities in children and adolescents with studies in the us and europe recently reporting similar findings of social inequality in child overweight and obesity. while many factors are involved in the increase in overweight and obesity, including biology, there is strong evidence on the adverse impact of the obesogenic environment on lifestyle behaviors. obesity intervention mapping tools are available ; however, within the real - world situation there is no system that accurately documents obesity prevention programs delivered across multiple sectors and settings. it is, however, reasonable to consider that the background influence of the up - stream policy has contributed to change in children and adolescent 's weight status. in nsw, investment in child obesity prevention strategies has remained a government priority with establishment of linkages between academic sectors and the health system to coordinate investments across agencies and sectors. the evidence indicates the need to invest in the childhood years (that is, birth to age 12 years) to influence the prevention of unhealthy weight gain and to reduce the burden of chronic disease and future medical costs. hence, much of the investment in nsw has focused on the early childhood and primary school years ; and the current findings suggest some success from that investment. our findings show that the prevalence of overweight and of obesity have remained stable among primary school children since 1997, but not among adolescents (high school) where the prevalence of overweight has significantly increased between 2010 and 2015. the implementation of child obesity prevention programs in nsw began around 2006 and was primarily targeted within the primary school setting. hence, the increase in overweight among adolescents may reflect the lack of investment in this age group, who would have received only minimal exposure to primary school - based obesity prevention initiatives. the increase and higher prevalence of overweight in adolescents is worrying given the strong evidence of the tracking of bmi from adolescence into adulthood. although inter - country prevalence comparisons are difficult because of difference in bmi categorization systems and data presentations, the 2015 rates presented here suggest that rates of obesity are lower than those of us and uk children. similarly, the overall prevalence of abdominal obesity in 2015 was 13.9%, which was substantially lower than the us prevalence of 32.9% in 2012 for similarly aged children. study strengths include comparable survey methods, large representative samples of children, measured anthropometry, and trained field staff using standard protocols and quality control procedures to ensure reliability. a potential limitation is the response rate ; however, these have remained relatively constant over time, usually greater than 60%, and are higher than similar school based and household surveys of australian children 's weight status. earlier research examining non - response bias in the 2004 survey suggested there was no difference in the prevalence of overweight and obesity between participating and non - participating students. ethics restrictions prevent routine examination of non - responder bias at each survey point, which raises the issue of whether population surveillance surveys which benefit public health should have passive (that is, opt - out) rather than active consent. finally, our sampling frame was designed to be representative of nsw children, and while nsw is australia 's most populous state, the findings may not necessarily be generalizable to all australian children. since 1997, the prevalence of overweight and obesity has not significantly changed in children, nor has the prevalence of obesity significantly changed since 1997 in adolescents. conversely the prevalence of overweight has significantly changed across survey periods in adolescents, with significant increases observed between 2010 and 2015. abdominal obesity, a marker of cardiometabolic risk, has significantly increased between 1985 and 2015 and prevalence rates at each survey time point are around twice that of obesity. there are clear and persistent ses inequalities in the distribution of overweight, obesity and whtr, with children and adolescents from low ses backgrounds more likely to be in unhealthy weight categories and this disparity has increased over time. this finding suggests that the current delivery of obesity prevention programs to socially disadvantaged areas is either not adequately reaching into these communities, or the programs do not address the necessary obesogenic factors need to ameliorate the social gap in obesity prevalence.	background / objective : to report 30-year (19852015) prevalence trends in overweight, obesity and abdominal obesity among children by school level and socioeconomic status (ses).subjects / methods : five cross - sectional, population child surveys (age 418 years ; n=27 808) conducted in 19851997200420102015 in new south wales, australia. outcomes were prevalence of measured overweight, obesity and waist - to - height ratio (whtr0.5) by sex, school level (children (primary) and adolescents (high)) and ses tertile.results:in 2015, the prevalences of overweight, obesity and whtr0.5 in children were 16.4%, 7.0% and 14.6%, respectively, and in adolescents 21.9%, 17.2% and 4.6%, respectively. obesity prevalence has not significantly changed in children or adolescents since 1997, nor since 2010 (children, p=0.681 ; adolescents, p=0.21). overweight has not significantly changed in children since 1997, but has in adolescents since 1985, with a relative increase of 16 percentage points (p<0.001) between 2010 and 2015. whtr0.5 prevalence has significantly changed since 1985, except in adolescent girls between 2010 and 2015. between 2010 and 2015 the relative increase in whtr0.5 was 17 and 40 percentage points in children and adolescent boys, respectively. significant disparities in prevalence rates between children and adolescents from low and high ses backgrounds began in 2010 for overweight, since 1997 for obesity and since 2004 for whtr0.5. differences between ses groups have become larger over the past 18 years.conclusions:since 1997, obesity has remained stable, and overweight has stabilized in children, not in adolescents. whtr0.5 significantly increased between 1985 and 2015, with prevalence rates at each survey around twice the obesity prevalence. compared with high ses children and adolescents, the risk of overweight, obesity and whtr0.5 was significantly higher for low ses children and adolescents. the findings are highly relevant to policy makers involved in child obesity prevention interventions and highlight the need for better targeted interventions among children and adolescents from low ses backgrounds, and adolescents in particular.
in patients with alzheimer 's disease (ad), plaques comprised of aggregated -amyloid peptides (a) accumulate in specific areas of the brain as a consequence of the proteolytic processing of the single - pass transmembrane amyloid precursor protein (app). these a deposits trigger prolonged inflammation, neuronal death, and progressive cognitive decline. a peptides are derived from app by -site cleavage by an aspartic protease (bace) producing a membrane - bound cooh - terminal c99 fragment followed by a complex proteolytic event (involving presenilin and nicastrin) at the c99 transmembrane - localized position [35 ]. an alternative app processing pathway also exists in which membrane - proximal (-site) cleavage by matrix metalloproteinases (tace, adam 10) replaces position utilization producing a membrane - anchored c83 fragment. subsequent -site processing of the c83 product results in generation of the nontoxic p3 peptide [3, 6 ]. the broad - spectrum protease plasmin also degrades a [79 ] and activation of plasmin decreases a peptide levels. plasmin - mediated proteolysis of app, moreover, appears to involve the site (either as a direct or indirect target) resulting in decreased a production, thus suggesting a protective role for the plasmin cascade in the central nervous system. indeed, plasmin levels in the brains of ad patients are considerably reduced further supporting a causal relationship between deficient activity of the plasmin - generating proteolytic system and accumulation of a in the progression of ad. several members of the serine protease inhibitor (serpin) superfamily exhibit neurotrophic, neuroprotective, or neuropathophysiologic activities depending on the specific cell type and pathways involved. these include serpinf1, serpini1 (neuroserpin), serpine1 (plasminogen activator inhibitor type-1 ; pai-1), serpine2 (nexin-1), and serpina3. pai-1, in particular, has multifunctional roles in the central nervous system as it both maintains neuronal cellular structure and initiates signaling through the erk pathway. pai-1 directly influences the plasmin - dependent pericellular proteolytic cascade by regulating the conversion of plasminogen to plasmin by urokinase- and tissue - type plasminogen activators (upa / tpa) (figure 1). pai-1 immunoreactivity in the central nervous system of ad patients was associated with senile plaques and ghost tangle structures consistent with the earlier colocalization of pa and pai-1 in plaque structures which are sites of sustained inflammation. recent findings in tg2576 and tgcrn8 transgenic mice, engineered to express brain - targeted swedish mutant a and the double swedish / v717f mutant a, respectively, under control of the hamster prion promoter and exhibit age - dependent a plaque development (at 12 and 3 months, resp) as well as cognitive deficiencies, established that tpa activity was significantly decreased compared to controls. this decline correlated with corresponding increases in pai-1 expression specifically in areas of the brain where tpa activity was reduced (hippocampus, amygdala). since direct a peptide injection increased pai-1 expression and whereas a removal from the hippocampal region required both tpa and plasminogen, it appears that a functional tpa - plasmin axis is required for a clearance. while pai-1 may be neuroprotective in specific acute injury settings (eg, tpa - triggered neuronal apoptosis), chronically elevated pai-1 levels likely promote a accumulation by inhibiting plasmin - dependent degradation (figure 1). several reports described elevated tgf-1 levels in brain biopsies from patients with parkinson 's disease, ad, and stroke [2022 ]. this growth factor is likely to influence the onset and progression of ad at several levels. increased brain expression of tgf-1 correlates with a angiopathy, and transgenic mice that overexpress tgf-1 in astrocytes exhibit early onset a deposition. tgf-1, moreover, induces astrocyte app expression through a tgf-1-responsive agac smad - binding element in the app promoter ; subsequent a production, moreover, was enhanced by tgf-1 signaling. since the pai-1 gene is also transcriptionally upregulated by tgf-1 [19, 25 ], the coordinate overexpression of pai-1 and increased a generation in response to elevated tgf-1 in the brains of ad patients may dispose to disease progression. collectively, these findings raise the possibility that targeting tgf-1-inducible genes (eg, pai-1, app) may have therapeutic benefit in the setting of ad. the regulation of tgf-1-activated genes (ie, pai-1) is largely transcriptional [19, 25, 27, 28 ] with the pai-1 gene subject to complex combinatorial expression controls involving the major transcription effectors p53, sp1, and members of the myc family [19, 29, 30 ]. prominent tgf--response elements in the human pai-1 promoter include the hexanucleotide e box motif (5-cacgtg-3 ; as in the pe1, pe2, hre-2 sites) and closely related sequences recognized by the basic helix - loop - helix / leucine zipper (bhlh - lz) transcription factors of the myc family (eg, myc, max, tfe3, usf-1, and usf-2) [3136 ]. this e box element likely functions, therefore, as a platform for recruitment of both positive and negative regulators of pai-1 expression [3739 ]. recent uv crosslinking and tethered dna affinity chromatographic analyses identified the bhlh - lz protein upstream stimulatory factor-1 (usf-1) as a major pai-1 e box - recognition factor. specific e box mutations that ablate usf-1 binding to a pai-1 target deoxyoligonucleotide probe (ca tc) effectively attenuated tgf-1-stimulated pai-1 promoter - driven cat reporter activity. the human pai-1 promoter, however, harbors several additional tgf--responsive elements, including three e box - adjoining smad sequences located just 5 of the pe2 site [32, 33, 35, 41 ]. since an engineered two - base - pair mutation cacgtg caattg in a serum - responsive pai-1 e box attenuated growth state as well as tgf-1-dependent transcription, this same dinucleotide substitution was incorporated into a luciferase reporter construct bearing the immediate 806 base pairs of the human pai-1 5 upstream region. initial truncation approaches did, in fact, confirm that a major (albeit not the only) tgf-1-responsive element resided within the most proximal 606 base pairs of the human pai-1 promoter. specific disruption of the pe2 region e box element by site - directed mutagenesis significantly attenuated tgf-1-mediated pai-1 transcription (figure 2). the consequences of usf binding to the pai-1 pe2 e box site may be more complex, however, than simple motif occupancy. indeed, certain e box - recognition factors including usf-1 and usf-2 effectively induce dna bending. cooperative interactions between sp1 and/or p53 with usf proteins, for example, may be dependent on usf - initiated modifications to dna conformation allowing distally spaced factors important in expression control to interact with resulting effects on pai-1 transcription. chromatin immunoprecipitation recently confirmed that the pai-1 pe2 e box site is an in vivo usf target motif. since an intact consensus pe2 region e box sequence is necessary for a maximal transcriptional response to growth factors, it was important to identify any additional requirements for pe2 e box - occupancy that might influence site residence including the smad - binding agac elements implicated in tgf-1-dependent app expression. pe1 and pe2 probes recognition appeared dependent solely on an intact 5-cacgtg-3 motif since nuclear factor binding to individual pe1 and pe2 target constructs was successfully blocked by short double - stranded deoxyoligonucleotides containing a consensus e box flanked by non - pai-1 sequences whereas a mutant e box (5-caattg-3) bait failed to compete. it was important, however, to confirm these results using site - specific mutants within the context of native pai-1 promoter sequences (eg, the pe2 region backbone) in order to assess the potential contributions of the smad - binding elements, e box flanking nucleotides (such as the aat trinucleotide spacer between the pe2 e box and the first upstream smad site), and the cacgtg motif to nuclear protein binding (figure 2). a recent study established that the major protein / dna interactions in the pe2 segment were, in fact, e box - dependent and did not require accessory sites since mutation of all three smad - binding sites (agac cttg) or removal of the att spacer did not affect usf occupancy of the pe2 region e box. while the cacgtg core is a target for occupancy by at least seven members of the bhlh - lz transcription factor family (usf-1, usf-2, c - myc, max, tfe3, tfeb, tfii - i), usf proteins have a preference for c or t at the 4 position in the presence of mgcl2. indeed, the human pai-1 gene has a t at the 4 site of the pe2 region e box as well as a purine at + 4 and 5 and a pyrimidine at + 5 (a5t4c3a2c1g+1t+2g+3g+4c+5), all of which facilitate usf binding. chromatin immunoprecipitation of the pe2 region e box site in the human pai-1 gene, moreover, indicated a dynamic occupancy by usf subtypes (usf-1 versus usf-2) as a function of growth state. an exchange of pe2 e box usf-1 homodimers with usf-2 homo- or usf-1/usf-2 heterodimers, furthermore, closely correlated with pai-1 gene activation. this switch may well determine the transcriptional status of the pai-1 gene in quiescent versus growth factor - stimulated culture conditions [38, 45 ]. site occupancy and transcriptional activity additionally require conservation of the pe2 core e box structure as the cacgtg cacgga and tccgtg dinucleotide substitutions (in the rat gene) and a cacgtg caattg or tccgtg replacement (in the human gene), with retention of pai-1 flanking sequences, resulted in loss of both competitive binding and growth factor - dependent reporter activity [19, 44 ]. the cacgtg tccgtg mutation is particularly relevant since bhlh proteins with e box - recognition activity have a conserved glutamate important for interaction with the first two nucleotides (ca) in the e box motif. these data are also consistent with the known hexanucleotide preference (cacgtg or cacatg) of usf proteins [39, 47, 48 ]. to further dissect the role of usf in tgf1-mediated pai-1 transcription in vivo, a dominant - negative usf construct (a - usf) a - usf effectively titers away functional usf proteins by forming highly stable interactions with native usf proteins ; such usf / a - usf heterodimers, however, are unable to bind dna due to replacement (in the a - usf construct) of the basic dna - binding residues with an acidic domain. a - usf transfection effectively attenuated tgf-1-induced pai-1 expression establishing the importance of usf family transcription factors in pai-1 gene control [19, 50, 51 ]. the molecular mechanisms associated with the tgf-1-initiated e box - dependent pai-1 gene control and the collateral smad - mediated app induction / tgf--directed a processing in specific central nervous system cell types remain to be clarified. the available data, however, clearly suggest that these two responses to tgf-1 are linked in the pathophysiology of human neurodegenerative disease. it has become apparent, moreover, that pai-1 overexpression is a likely major contributory if not a causative event in ad progression. our current understanding of the pathways utilized by the tgf-1 to stimulate the pai-1 transcription (summarized in figure 3) indicate that this growth factor activates a kinase cascade, at least partially as a function of epidermal growth factor receptor mobilization (either through the release of the appropriate ligands or the direct receptor transactivation), involving mek, erk1/2, and perhaps p38 [4951 ]. pharmacological approaches, use of dominant - negative constructs, and kinase assays suggest that src family kinases and ras gtpase are upstream of mek - erk - p38 in this model of induced pai-1 expression [50, 51 ]. map kinases, in turn, interact with nuclear transcription factors including members of the usf family that, once phosphorylated, bind as dimers to e box motifs in the pai-1 promoter to modulate gene expression [19, 26, 38, 40, 50, 51 ]. genetic perturbation of pai-1 synthesis in specific areas of the brain (with dominant - negative usf or pai-1 antisense vectors) or delivery of pai-1 neutralizing antibodies may effectively stimulate upa- and/or plasmin - dependent target substrate degradation (eg, a) or at least attenuate the rate of a accumulation (figures 1 and 3). the continued identification of regulatory points in the pai-1 expression control network (figure 3) and recent identification of tgf-1-response sites (as well as the involved nuclear factors) in the app and pai-1 promoters [19, 38, 40, 52 ] may provide new molecular targets for the therapy of neurodegenerative syndromes associated with pai-1 upregulation. indeed, specific serpins (including pai-1) have already been suggested as potential novel therapeutic targets for stroke and cerebral ischemia. the tgf-1 gene, furthermore, is also usf - regulated suggesting that interference with usf - dependent transcriptional events may have widespread therapeutic implications. tpa and upa convert plasminogen to the active, broad - spectrum, protease plasmin both at the cell surface and in the immediate pericellular space. plasmin, in turn, degrades target substrates (eg, app, a) directly as well as indirectly through downstream activation of matrix metalloproteinases (mmps). inhibition of mmp activity (gm6001, timp) has confirmed their participation in plasmin - initiated proteolysis. most importantly, this cascade is effectively attenuated by overexpression (or exogenous addition) or pai-1 which blocks tpa and upa catalysis inhibiting, thereby, plasmin generation. topography of the pai-1p806-luc reporter construct illustrating the two (pe1 and pe2) e box sequences. site - directed mutagenesis and luciferase assays clearly indicated that an intact e box at the pe2 site is required for maximal tgf-1-induced pai-1 transcription in human epithelial cells. pathways involved in the regulation of pai-1 expression and function in response to tgf-1 stimulation. positve influences are depicted in black arrows ; effective inhibitors defined pharmacologically or by use of dominant - negative constructs (dn) are highlighted in red (detailed in).	amyloid peptide (a) aggregates, derived from initial -site proteolytic processing of the amyloid precursor protein (app), accumulate in the brains of alzheimer 's disease patients. the plasmin - generating cascade appears to serve a protective role in the central nervous system since plasmin - mediated proteolysis of app utilizes the site, eventually generating nontoxic peptides, and plasmin also degrades a. the conversion of plasminogen to plasmin by tissue - type plasminogen activator in the brain is negatively regulated by plasminogen activator inhibitor type-1 (pai-1) resulting in attenuation of plasmin - dependent substrate degradation with resultant accumulation of a. pai-1 and its major physiological inducer tgf-1, moreover, are increased in models of alzheimer 's disease and have been implicated in the etiology and progression of human neurodegenerative disorders. this review highlights the potential role of pai-1 and tgf-1 in this process. current molecular events associated with tgf-1-induced pai-1 transcription are presented with particular relevance to potential targeting of pai-1 gene expression as a molecular approach to the therapy of neurodegenerative diseases associated with increased pai-1 expression such as alzheimer 's disease.
nocturia is defined as waking at night to void urine, and nocturia has been reported in 58 - 90% of people over 50 years of age, with the prevalence of nocturia increasing with age. this condition can significantly impair a patient 's perception of their well being and often warrants treatment, especially when the patient must wake twice or more per night [15 ]. nocturia is associated with impaired health, deterioration in sleep, and quality of life. it has also been associated with an increased risk of death after adjusting for age, cardiac disease, diabetes mellitus and stroke. the increased mortality may to some extent be explained by an increased risk of falls, which is one consequence of nocturia [7, 8 ]. a quarter of the falls occur at night, and more than a quarter of these nocturnal falls occur during trips to the toilet. nocturia is often attributed to benign prostatic hyperplasia (bph) in men, but a causal relation is uncertain, although the two conditions may be associated in older individuals. nocturia is often found to respond less satisfactorily than other lower urinary tract symptoms (luts) after medical or surgical treatment of bph. sleep disturbance is a common experience of older adults, many of whom depend on prescribed sedatives. although one report outlines the improvement of nocturia through the use of a hypnotic agent, there are no reports, to our knowledge, that address the actual effect of hypnotic agents on patients with nocturia after a diagnosis of insomnia. the aim of the present study was to determine whether zolpidem, a nonbenzodiazepine hypnotic agent, would be useful for patients dissatisfied with nocturia and suspected to have sleep disturbance after monotherapy with tamsulosin. a total of 35 male outpatients (age 50 years) with a complaint of nocturia with luts suggestive of bph were enrolled in the present study from september 2005 to august 2006. the enrolled patients experienced 2 or more episodes of nocturia per night and had a nocturia - quality of life (qol) score of 4 or more. nocturia qol score (table 1) was used as a simple tool to measure the satisfaction of patients with symptoms of nocturia. uroflowmetry studies were performed on each patient according to the criteria of the international continence society. abdominal ultrasonography was performed on each patient to determine prostate volume and post - voided residual and to rule out any urinary system abnormality. patients with prostate cancer, abnormal prostate findings on digital rectal examination (nodularity or induration), or psa values of 4 ng / ml were excluded from the study. the exclusion criteria also included the use of medications for the control of bladder symptoms and use of hypnotics. quality of life the patients were assessed using the score for the seventh question of the international prostate symptom score (ipss), the athens insomnia scale (ais) and the nocturia - qol score. the ais, an instrument that measures the intensity of sleep - related problems, was used as a screening tool for the diagnosis of insomnia. enrollment and follow - up of patients in the present study are shown in figure 1. after assessment at baseline, the 35 patients were administered tamsulosin (0.2 mg / day) for 4 weeks before re - assessment. a nocturia - qol score of 3 was regarded as indicating patient satisfaction with nocturia (defined as group a), and a nocturia - qol score of 4 was regarded as indicating patient dissatisfaction with nocturia. patients dissatisfied with nocturia and with sleep disturbances (ais 6) received additional treatment with zolpidem 5 - 10 mg once per night for 2 weeks (defined as group b). all values are expressed as the mean (sd), with statistical significance inferred at a value of p < 0.05 unless otherwise specified. demographic and other baseline characteristics of all patients (n = 35) and group a (n = 15) and group b (n = 16) patients are presented in table 2. mean prostate volume was 19.59.8 ml, and mean max flow rate and post - voided residual were 11.3 3.6 ml / s and 47.2 29.8 ml, respectively. differences in mean values of age, prostate volume, max flow rate and post - voided residual were not significant between group a and group b. demographics and other baseline characteristics ns - not significant (mann - whitney u test) the score at baseline and post - treatment for the ipss, qol index, nocturia episodes, nocturia - qol and ais are shown in table 3. in all patients, monotherapy with tamsulosin for 4 weeks significantly improved ipss (18.9 3.8 to 9.9 3.0, p < 0.001), qol (4.5 0.9 to 3.2 0.9, p < 0.001), nocturia episodes (3.4 0.7 to 2.6 1.0, p < 0.001), nocturia - qol (5.5 0.6 to 4.3 1.5, p < 0.001) and ais (11.7 3.6 to 9.1 3.1, p 0.001). effects of tamsulosin / zolpidem on nocturia in patients with benign prostatic hyperplasia ipss - international prostate symptom score, qol - quality of life, ais - athens insomnia scale, all and group a - monotherapy with tamsulosin for 4 weeks, group b - combination therapy with tamsulosin and zolpidem for 2 weeks, after treatment - after treatment with tamsulosin, after additional treatment - after treatment with tamsulosin and zolpidem. p < 0.001, ns : p 0.05 (wilcoxon signed - rank test) among all patients, a reduction in the nocturia - qol score (3) was observed in 15 patients (group a), but 20 patients were not satisfied with symptoms of nocturia (nocturia - qol 4). in group a, monotherapy with tamsulosin significantly reduced the ipss (18.3 3.7 to 8.7 3.2, p < 0.001), qol (4.4 0.6 to 2.5 0.6, p < 0.001), nocturia episodes (3.3 0.6 to 1.7 0.5, p < 0.001) and ais (11.2 3.6 to 7.9 3.1, p < 0.001). among the 20 patients not satisfied with symptoms of nocturia (nocturia - qol 4), 16 patients (group b) were suspected of having sleep disturbances (ais 6). in group b, treatment with tamsulosin only did not result in a significant reduction in nocturia episodes (3.4 0.9 to 3.3 0.8) and nocturia - qol score (5.7 0.5 to 5.6 0.5), although significant reductions in ipss (18.9 4.1 to 10.4 2.6, p < 0.001), qol (4.6 1.0 to 3.8 0.6, p < 0.001) and ais (12.9 3.3 to 10.6 2.9, p < after additional treatment with tamsulosin and zolpidem for 2 weeks, significant decreases in nocturia episodes (3.3 0.8 to 1.9 0.7, p < 0.001), nocturia - qol (5.6 0.5 to 3.6 1.1, p < 0.001) and ais (10.6 2.9 to 6.8 2.5, p < bph can cause bladder outlet obstruction and induce secondary bladder overactivity and reduction of functional bladder capacity, which may result in filling symptoms including nocturia. therefore, urologists often treat patients whose chief symptom is nocturia with modalities for bph, including conservative medical treatment and surgical intervention. in regard to degrees of improvement, nocturia is the lowest among the seven individual symptoms included in the ipss. unlike the other six symptoms, nocturia is markedly influenced by various factors other than bph, and other approaches might be required for the treatment of nocturia [10, 12 ]. nocturia is associated with various factors of pathologic conditions such as cardiovascular disease and diabetes mellitus, anxiety and primary sleep disorders, and behavioral and environmental factors. the underlying pathophysiologic process of nocturia consists of three main conditions : polyuria, nocturnal polyuria, and bladder storage problems. however, nocturia can be secondary to awakening and sleep disturbances rather than to nocturnal polyuria in patients with sleep disturbances from other causes. the present study showed that monotherapy with tamsulosin significantly improved the ipss and qol scores, and a reduction in the nocturia - qol score (3) was observed in 15 (43%) group a patients. interestingly, a significant improvement in ais was also seen in group a. djavan that tamsulosin improves nocturia and sleep disturbances (by increasing the number of hours of undisturbed sleep) in luts / bph. thus, the results of the present study suggest that the improvement of nocturia by monotherapy with tamsulosin may improve sleep disturbances. the ais was developed as a brief and easily administered selfassessment questionnaire for estimating the severity of insomnia encountered in a large variety of clinical and research settings. the ais can be used in clinical practice and research, not only to reliably measure the intensity of sleep difficulty, but also to assist in establishing the diagnosis of insomnia. when diagnosing individuals with a score of 6 or higher as insomniacs, the scale has a sensitivity of 93% and specificity of 85%. subjectively, sleep disturbances were observed in 80% (16/20) of patients who did not show a decrease in nocturia - qol score of 3) by monotherapy with tamsulosin. in these patients (group b), additional 2-week combination therapy with tamsulosin and zolpidem significantly reduced nocturia episodes, ais and nocturia - qol score, indicating that improvement of sleep disturbances may contribute to improve symptoms of nocturia. in addition, these results suggest that improvement in the number of nocturia episodes may be closely related to improvement in the nocturia - qol score. recently, song and ku showed that zolpidem improved the frequency of nocturia unresponsive to treatment by an alpha - blocker (terazosin or tamsulosin) in men with luts. in the present study, patients were selected in whom sleep disturbance appeared to be a cause of nocturia after evaluation using the nocturia - qol score and the ais. the nocturia - qol score is a simple and useful tool for evaluating disease - specific qol related to nocturia. a problem identified in the present study was that objective efficacy, determined by assessing nocturia episodes from the frequency - volume chart, was not evaluated. there may be poor agreement between the subjectively estimated nocturnal frequency from the ipss and chart - determined nocturnal frequency. however, the change in qol related to nocturnal frequency could be evaluated with the nocturia - qol score. yoshimura. reported that sleep and general - related qol in the mildly nocturic patient were more greatly affected by trouble sleeping due to night - time frequency than by the frequency of nocturnal urinary voiding per se. they suggest that the strategy for treatment of nocturia may be improved if urologists clearly distinguish whether nocturic patients are bothered by trouble sleeping. therefore, we believe that it is beneficial to use the nocturia - qol score and ais to identify the cause of deterioration in qol by nocturia - related sleep disturbance and to treat with hypnotic agents. the present study is limited in that we could not directly compare the effect of combination therapy (tamsulosin with zolpidem) with monotherapy (tamsulosin alone) in group b after monotherapy with tamsulosin for 4 weeks. however, after additional treatment with tamsulosin and zolpidem for 2 weeks, significant decreases in episodes of nocturia and nocturia - qol and ais scores were observed, whereas ipss and qol scores did not decrease significantly. therefore, the effect is not due to the longer exposure to tamsulosin but rather to the addition of zolpidem. in this study, patients were given 0.2 mg tamsulosin once daily. a 0.4-mg dose of tamsulosin is routinely used in north america and europe to treat bph. however, previous studies show that lower doses of tamsulosin than those used in western countries are equally effective for treating symptomatic bph in asian patients. hypnotics such as zolpidem may be useful as additional treatment in patients unresponsive to treatment by an alpha 1-blocker such as tamsulosin in patients in whom the etiology of nocturia is associated with sleep disturbances. the zolpidem used in the present study has a low propensity to cause clinical next - day residual effects, withdrawal, dependence or tolerance. in animal studies, zolpidem has weaker myorelaxant and anticonvulsant effects than the benzodiazepines because of the selectivity of zolpidem for benzodiazepine 1 receptors. reported that zolpidem increased bladder capacity via a gaba - ergic mechanism in cerebral infarction rats and suppressed urine excretion via a pathway that was not through activation of vasopressin v2 receptors in water - loaded and brattleboro rats. therefore, zolpidem may improve nocturia via an increase in bladder capacity and a decrease in urine excretion. in the present study, no remarkable side effects or voiding disturbances therefore, we believe that zolpidem is considered safe for bph patients and is suitable for use as a hypnotic agent in patients complaining of nocturia. the ais is useful for evaluating patients with sleep disturbance that appears to be a cause of nocturia. the effectiveness of tamsulosin on nocturia in patients with bph is limited when the etiology of nocturia is associated with sleep disturbances. in such patients, hypnotic agents such as zolpidem	introductionwe examined the efficacy of combination therapy with 1-blocker tamsulosin and hypnotic zolpidem in patients who had suffered from sleep disturbance associated with nocturia.material and methodsa total of 35 patients diagnosed with nocturia with lower urinary tract symptoms (luts) suggestive of benign prostatic hyperplasia (bph) were studied. after treatment with tamsulosin for 4 weeks, 16 patients dissatisfied with nocturia (nocturiaquality of life index 4) and suspected to have sleep disturbance (athens insomnia scale 6) received additional treatment with tamsulosin and zolpidem for 2 weeks. outcomes were evaluated by the international prostate symptom score (ipss) and quality of life index (qol), athens insomnia scale (ais) and nocturia - quality of life index (nocturia - qol).resultsafter monotherapy with tamsulosin, significant reductions in ipss (18.9 3.8 to 9.9 3.0, p < 0.001), qol (4.5 0.9 to 3.2 0.9, p < 0.001) and nocturia episodes (3.4 0.7 to 2.6 1.0, p < 0.001) were observed. however 20 patients were dissatisfied with nocturia (nocturia- qol 4). among 20 patients, 16 patients were suspected to have sleep disturbances (ais 6). in these patients, additional therapy with tamsulosin and zolpidem significantly reduced nocturia episodes (3.3 0.8 to 1.9 0.7, p < 0.001), ais (10.6 2.9 to 6.8 25, p < 0.001) and nocturia qol (5.6 0.5 to 3.6 1.1, p < 0.001) compared with patients after treatment with tamsulosin only.conclusionscombination therapy with tamsulosin and zolpidem may be useful for patients with bph dissatisfied with nocturia and suspected to have sleep disturbance.
human papillomavirus (hpv) is the main cause of cervical cancer, the third most common cancer in women. there is, however, growing evidence linking genital hpv infection to other anogenital cancers (anus, vulva, vagina, and penis) and head and neck cancers in both men and women [311 ]. hpv is carried by both females and males and can spread with high (up to 0,6 per act for hpv16) transmission probability, and most (up to 7080%) people will get infected during their lifetime. thus, hpv can be characterised as a ubiquitous, sexually transmitted infection (sti) causing significant disease burden in both sexes, but especially in women with up to 6 - 7% lifetime risk of developing cervical cancer in latin america. of the estimated 530000 annual cases of cervical cancer, its standardised incidence ratio (world, 100) is substantially higher in the developing countries (116) than in the developed countries (60). it is important to note that cervical cancer is the most common cancer in women in most parts of africa, central america, southern asia, and melanesia. it is also the most important cause of years of life lost in latin america and the caribbean, and among cancers in the populous regions of sub - saharan africa and south - central asia. furthermore, largely due to changes in sexual risk taking behaviour and (in some countries) dynamic state of epidemics by high - risk (hr) hpv types [15, 16 ], the number of cervical cancer cases has been predicted to rapidly increase (up to 90%) by 2020 in developing countries if no intervention is implemented [17, 18 ]. it has been established that the hpv attributable proportion in cancers of the anus, vagina, penis, vulva, oropharynx, and oral cavity is 25% or higher [8, 11, 1921 ]. there are clear signs that the incidence of most hpv - related cancers is increasing. the incidence rates of anal cancer in scotland and england have nearly doubled in both women and men from 1986 to 2003. increase in the incidence of anal cancer is also reported in australia. in the developed countries, also the incidence of hpv - related head and neck cancer is rapidly increasing especially in males and in the younger birth cohorts [5, 6, 911, 24 ]. in australia, netherlands, sweden, and usa, the incidence of hpv - related tonsillar cancer has rapidly increased during recent years [7, 23, 25, 26 ]. most of the genital infections with hrhpv type(s) are asymptomatic and heal without treatment. the risk of cervical cancer increases as the hrhpv infection persists. over 70% of cervical cancers are attributed to hpv types 16 and 18 and approximately 20% to hpv types 31, 33, 35, 45, 52, and 58 [3, 27 ]. precancerous cervical lesions usually appear within 5 years in individuals with an established persistent infection with hpv types 16 and 18. a majority of other hpv - related cancers are also attributable to hpv types 16 and 18. for example, it is estimated that 24% of cancers in the mouth are associated with hpv and 95% of these cancers are attributable to hpv types 16 and 18. over 80% of anal cancers are associated with hpv and 92% of these cancers are attributable to hpv types 16 and 18. thus, it can be assumed that targeting hpv types 16 and 18 and a remarkable proportion of phylogenetically related hrhpv types (31, 33, 45) by prophylactic vaccination [2830 ] would play a significant role in preventing all hpv - related cancers. prevention of hrhpv infections could decrease the incidence of numerous cancers in both sexes [5, 31 ]. in healthy men, hpv infection in the genital tract alike other stis, hpv transmits more easily from men to women than from women to men. male circumcision and use of condoms prevent the spreading of hrhpv infections, which probably explains the low incidence of cervical cancer in countries such as israel where circumcision is widespread [3, 33 ]. racial differences have been reported showing that african - americans are less likely to have hpv - positive head and neck (oropharyngeal) cancers [34, 35 ]. reasons for the recent increase of oropharyngeal hpv - related cancers, especially in younger male birth cohorts in the developed countries, are not clear, but changes in sexual behaviour, efficiency of hpv transmission through oral sex, and lack of protective immunity from hrhpv infections of the genital mucosae have been suggested [6, 36 ]. various studies indicate that a high number of lifetime sexual partners, tobacco smoking, parity, oral contraceptive use, and coinfections with chlamydia trachomatis and hiv increase the risk of acquisition of hrhpv infection [3742 ]. the impact of cofactors on the acquisition of infections with multiple hrhpv types has not been studied largely [43, 44 ]. stis are a serious health problem in developing countries, and several studies indicate that conventional stis increase the likelihood of hiv transmission. hpv infections in both females and males are also risk factors for hiv acquisition [4648 ]. it is also highly likely that hpv - related neoplasia progresses faster in hiv - positive people. cervical cancer is a disease which can be prevented. similar to liver cancer that is secondary to hepatitis b infection application of cervical cytology in population - based screening programmes has significantly lowered the incidence of cervical cancer in developed countries. cervical cancer incidence and mortality decreased markedly in the nordic countries, europe, canada, and usa due to the implementation of cervical cytology in health care, most notably in population - based screening programmes [5154 ]. mortality from cervical cancer has also substantially declined since the 1960s in europe, but there are still large country - specific differences. cervical cancer mortality is substantially higher in eastern europe than in other parts of europe. increases in the incidence of and mortality from cervical cancer have been reported in the last 15 years resulting from hpv epidemics and a drop in the number of women participating in the screening programmes. mortality rates of cervical cancer are lower than incidence rates with a ratio of mortality to incidence of 55%. survival rates are, however, lower in the developing countries [5658 ], and the differences in the ratios of mortality to incidence between developing and developed countries are significant. the differences can be explained by the stage at which cancer is detected, access to health services, and adequacy of treatment. currently there are two licensed prophylactic hpv vaccines, a bivalent vaccine (cervarix) against hpv types 16 and 18 and a quadrivalent (gardasil) vaccine against hpv types 6, 11, 16, and 18 available (fda 2006 ; emea 2007). in order to be prophylactic, both vaccines need to be administered before the individual is exposed to hpv types covered by the vaccine. according to reports from the major phase iii trials, the vaccines prevent from 97 to 98% of infections caused by hpv types 16 and 18 [59, 60 ]. both vaccines have shown a significant cross - protection also against hpv types 31 and 45 [28, 29 ]. the bivalent vaccine has also shown cross - protection against hpv types 33 and 51. as indicated above, over 70% of cervical cancers are attributed to hpv types 16 and 18, and approximately 20% to hpv types 31, 33, 35, 45, 52, and 58 [3, 27 ] which fits the cross - protection efficacy and reported 87% overall vaccine efficacy against cin3 +. it is assumed that both hpv vaccines, in preventing hrhpv infections, prevent other hpv - related cancers besides cervical cancer with high to moderate efficacy. it is known that the existing vaccines are most efficient for antibody production when administered to early adolescents. both males and females had higher antibody responses at the age of 915 compared to the age of 1626 [62, 63 ]. there is, however, no concrete information available on long - term (> 10 years) efficacy of the vaccines and necessity for a booster. one model has predicted an over 20-year protection but at the moment the predictions rely only on assumptions. it is not known if hiv infection will affect the efficacy of hpv vaccines, but smoking does not seem to affect hpv vaccine - induced antibody response. booster doses work very well and produce higher antibody levels when measured one month later. hiv positivity as such does not hamper development of hpv antibodies following natural infection, whereas smoking does. type replacement, that is, how nontargeted hrhpv types that may have competitive advantage will behave following mass vaccination, is an open question, but the likelihood of the kind of type replacement seen following bacterial vaccination is small due to the different biology of viral and bacterial infections [68, 69 ]. according to who, 22 countries in low - resource regions have included an hpv vaccine in their vaccine programmes. adopted vaccination strategies include offering the vaccine only to 1215-year - old girls or only to a certain proportion of the female population of the same age. the vaccination strategies are in line with the results of numerous cost - effectiveness studies which suggest that with high vaccine coverage (75%) vaccination of males would not be cost effective [7182 ]. vaccinating males becomes cost effective by assuming a low to moderate (30%50%) coverage in females. the assumptions behind these recommendations and the superior cost - effectiveness of female vaccination strategy are that the health service system covers all the regions equitably and that adolescent girls have both access to the health services and are willing to use it. however, the probability of preventing other hpv - related cancers both in females and males has not been taken into account. emerging information on hpv - related cancers in men may change the conclusions of cost - effectiveness modelling. in australia, it is estimated that one quarter of the preventable cancers are in men, but this most likely varies between countries. there is not enough information on how vaccinating males would change the transmission of hpv, but it is possible that vaccinating only females could result in an increase in hpv transmission like in the case of rubella vaccination and rubella acquisition by young adult females in the uk. british data also suggests that due to sexual behaviour characteristics british men are at greater risk of being exposed to, contracting, and transmitting hpv infection than females. it is important to estimate if this assumption is true, and the extent of the possible difference. overall, the highly infectious nature (high transmission probability) of hpv supports the idea of vaccinating both sexes. it is also possible that vaccinating the same number of males and females as in the female - only vaccination strategy would decrease the prevalence of hrhpv infections slightly in a steady state of hrhpv epidemics and in dynamic state of the hrhpv epidemics (as is the case in many countries), and it is likely that the impact of male vaccination would be higher. the questions concerning hpv vaccine efficacy on males and the possible effect of vaccination on hpv transmission are valid as it is known that the vaccine against herpes simplex virus type 2 is not effective on males but it could still have a profound effect on hsv-2 occurrence through herd immunity provided viral shedding is significantly reduced. prevention of infectious diseases comparable to hpv with vaccines is based on producing herd immunity through a sufficient coverage in susceptible individuals to reduce transmission. the quadrivalent hpv vaccine is proven efficacious in males, likely prevents hpv transmission, and has been shown to reduce hpv 6/11-associated disease burden. vaccinating males is currently not recommended by the who, but the impact of herd immunity on female cancers and other hpv - related cancers may need to be reconsidered [89, 90 ]. high vaccine coverage is needed to produce herd immunity, and sufficient coverage has been achieved only in the uk (75%) and australia (70%). in the netherlands (50%), germany (40%), and usa (25%), the coverage is neither enough to protect significant proportions of females nor to produce herd immunity. protection is effective on an individual level, but in the absence of herd immunity the unvaccinated remain unprotected. at present, the questions concerning coverage in both sexes and the magnitude of herd immunity remain open [65, 87, 90 ]. mathematical models suggest that vaccinating both males and females could produce herd immunity and an impact both on hrhpv prevalence and occurrence of cervical cancer with considerably lower coverage than vaccinating females only [12, 89, 90 ]. this could be a decisive factor in the low - income areas where there are problems with access to health services. other reports indicate better results (reduction of hpv prevalence in unvaccinated females by 8696% versus 731%) with a vaccine coverage of 80% in females and males versus 80% in females only, but there is no evidence - based data available yet. the need for cervical cancer prevention is the greatest in developing countries where the burden of cervical cancer and other hpv - associated cancers is the heaviest, and preventive measures have not been / cannot be implemented consistently. from the point of view of global justice, the prevention of cervical cancer should be a priority in countries where its burden is the heaviest. the global alliance for vaccines and immunisation (gavi) considers hpv vaccines among the vaccines that would have the biggest impact on the disease burden in developing countries. within the developing countries (and in some developed or middle - income countries), the situation in rural regions with major problems of access to health services poses various questions concerning equity and justice. in the reality of overall scarce resources, rural regions tend to suffer the most. this is exemplified in how screening has failed to make an impact in developing countries and especially in rural regions with problems of access to all cervical cancer prevention health services, including screening, diagnosis, treatment, and followup [53, 94 ]. the poor (80%, prioritizing vaccinating younger girls before school attendance drops questionable herd immunity effect, marginalized females excluded ; unrealistic targeting a coverage of > 80%, prioritizing vaccinating younger girls before school attendance drops need for boosters ? questionable herd immunity effect, marginalized females excluded ; vaccinating females and males at the age of 1215 : targeting a coverage of > 40% in all regions, cost effectiveness, acceptance of the vaccine for boys?marginalization tackled by the herd immunity effect ? targeting a coverage of > 40% in all regions, acceptance of the vaccine for boys ? marginalization tackled by the herd immunity effect ? vaccinating females and males when school attendance is at the highest (1012 years of age) : targeting a coverage of > 50% in all regions, acceptance of the vaccine for boys?marginalization tackled by the herd - immunity effect. targeting a coverage of > 50% in all regions, acceptance of the vaccine for boys ? all strategies would be school based with community outreach activities in regions where school attendance is low and equally there would be a need for information campaigns to adolescents, service providers, decision makers, schools, and parents. information campaigns for both sexes with a notion to all hpv - related cancers might further increase the acceptance of hpv vaccine. it would also be important to address local or cultural issues which are linked to vaccines. in terms of hpv vaccine coverage in developed countries, school - based demonstration projects have shown promise in terms of coverage and compliance. in a universal school - based vaccination programm the adolescents who go to school may bring also nonattendees to the vaccination site. school attendance of girls has increased in developing countries from 78% in 1990 to 85% in 2005 [125, 126 ]. the gender gap between boys and girls has disappeared in east asia, latin america, and eastern and southern africa and is diminishing both in urban and rural regions and within economic quintiles [125, 127 ]. school - based programmes may not be feasible if sufficient resources are not allocated to providers. school attendance in girls during adolescence may be lower than is needed for effective coverage, and certain high - risk groups might not be reached at all [124, 129 ]. the project funded by path, an american ngo, in peru, uganda, india, and vietnam reached coverage of 8095% in 914-year - old girls in selected schools demonstrating a high acceptability of the hpv vaccine. the path project is also producing vital practical information on introducing hpv vaccines in developing countries (e.g., in certain cultures parents do not have documentation concerning date of birth, there may be undue concerns for fertility, emphasis on cancer prevention, etc.). even though hpv vaccination shares many barriers with cervical screening, it seems that barriers linked to acceptation of hpv vaccine might be easier to deal with. for those females who agreed to be vaccinated, completion of the three - dose regimen was over 90% in peru. it is not clear whether vaccination rates such as these would be achievable in a nonresearch setting. optional preventive strategies, regional strategies, or mixed strategies, offering vaccination only to girls in some wealthier regions, and to both sexes in certain low - income regions could tackle the problems linked with coverage and access. in some areas, it might be more feasible to have boys vaccinated because of higher school attendance, and this could lessen problems of coverage even though fewer girls would be reached. other preventive acts such as male circumcision and use of condoms make this a problem which has a solution that includes actions by both males and females. tackling the problem as gender - free problem might promote vaccine acceptance and create political will. hence, the proposed add - ons would include vaccinating both sexes to achieve maximal coverage and acceptance. targeting the early adolescents when school attendance is at the highest but before sexual debut might be a problem. in a study conducted in south africa, some parents expressed their fear that vaccination at 11 years or older would already be too late. the questions concerning dosage are closely linked with logistics, vaccine storage, vaccine acceptability, and cost effectiveness. the present vaccines are administered in three doses, but it is possible that a two - dose regimen could be enough to provide protection. this would have a significant effect mainly on costs but equally to vaccine acceptability and accessibility. in a study on kenyan women, the acceptability of a three - dose vaccine regimen was only 31% compared to 86% for a one - dose regimen. it is known that present vaccines do not provide effective protection in a one - dose regimen but a two - dose regimen remains possible. further cost - effectiveness studies are needed taking into account other hpv - related cancers besides cervical cancer. regional characteristics and problems linked with access and coverage vaccination strategies including catch - up vaccination in older females or addressing early adolescents after the sexual debut should be linked with the most accessible screening and treatment methods such as the single visit approach (via and cryotherapy) to ensure that the means of prevention would protect those who may be already hpv infected and for whom the prophylactic vaccine can not be effective. information about hpv vaccination and hpv - related cancers continues to emerge, but more research is needed especially on the long - term impact of vaccination, duration of protection, male vaccination, and reduction of hpv transmission. the gavi alliance subsidises the provision of vaccines to the poorest countries and is currently reviewing hpv vaccine as a candidate for sustainable financing. even with secured financing, there is no simple answer concerning which strategy should be adopted in the developing countries. hpv vaccination is the most promising way to prevent cervical and other hpv - related cancers in developing countries. vaccination strategies have an important effect on the success of any vaccination programme. in the case of hpv, it is crucial to reach at least 70% of females or 4050% of both sexes before sexual debut. optional preventive strategies, regional strategies, or mixed strategies in rural low - income regions could solve the problems linked with hpv vaccination coverage, access, and acceptability. regional characteristics affect fundamentally the feasibility of hpv vaccination strategies as it has already been proven with screening. differences between regions in terms of access to health services increase the need to adopt region - specific hpv vaccination strategies that are not currently deemed as cost effective. emerging information on hpv - related cancers in both women and men and the feasibility of achieving high vaccine coverage in rural regions might produce different results in terms of cost effectiveness, and this might result as a change in strategic aims and recommendations. targeting rural low - resource regions with specific vaccination strategies should be a priority from the point of view of ethics and public health. the number of cervical cancer cases is estimated to increase dramatically in developing countries if no intervention is implemented, and the trend is probably even stronger in regions where access to health services is limited. whatever option is chosen, it is vital to merge any vaccination strategy with appropriate screening methods and sexual education.	cervical cancer and other human papillomavirus- (hpv-) related cancers are preventable, but preventive measures implemented in developing countries and especially in low - income rural regions have not been effective. cervical cancer burden derived from sexually transmitted hpv infections is the heaviest in developing countries, and a dramatic increase in the number of cervical cancer cases is predicted, if no intervention is implemented in the near future. hpv vaccines offer an efficient way to prevent related cancers. recently implemented school - based hpv vaccination demonstration programmes can help tackle the challenges linked with vaccine coverage, and access to vaccination and health services, but prevention strategies need to be modified according to regional characteristics. in urban regions who - recommended vaccination strategies might be enough to significantly reduce hpv - related disease burden, but in the rural regions additional vaccination strategies, vaccinating both sexes rather than only females when school attendance is the highest and applying a two - dose regime, need to be considered. from the point of view of both public health and ethics identification of the most effective prevention strategies is pivotal, especially when access to health services is limited. considering cost - effectiveness versus justice further research on optional vaccination strategies is warranted.
as a vital neurotransmitter, acetylcholine (ach) activates ion channels and g protein coupled receptors (gpcrs) through its interactions with nicotinic and muscarinic (machr) acetylcholine receptors, respectively. among the five machrs, subtypes 1, 4, and 5 (m1, m4, and m5) are most strongly associated with normal central nervous system (cns) functioning. the m2 and m3 subtypes are more broadly expressed in the periphery on smooth muscle and glandular tissues such that aberrant overactivation of these receptors leads to the adverse effects associated with nonselective muscarinic agonists. designing orthosteric small - molecule muscarinic ligands with sufficient selectivity over the other four machrs has long been a problem due to the highly conserved environment of the ach binding site (the orthosteric site). a prudent response to instances such as this has been to abandon orthosteric - acting molecules in favor of ligands that interact at allosteric sites (sites that are topographically and structurally distinct from the endogenous agonist binding site). we have employed this approach to identify a range of high quality muscarinic ligands with positive allosteric modulation (pam) or negative allosteric modulation (nam) at many of the cns - important machrs : m1 pams, m4 pams, m5 pams, and a novel m5 nam. currently, m5 is the least characterized of the machrs because of its low expression level and until recently an absence of selective activators and inhibitors. nevertheless, phenotypic observations of m5 knockout (ko) mice, m5 receptor localization studies, and experiments utilizing nonselective, orthosteric muscarinic ligands highlight this receptor s therapeutic potential. m5 ko mice display decreased prepulse inhibition (a model of psychosis) and cognitive deficits associated with cns neuronal and cerebrovascular abnormalities. the loss of m5 machrs in ko mice prevents their cns vasculature from dilating in response to ach, which could have implications for cerebral hypoperfusion as related to alzheimer s disease, schizophrenia, ischemic stroke, and migraine. collectively, these data support the role of a m5 pam in the treatment of numerous cns diseases. here we report the development of the first cns penetrant m5 pam, which is structurally distinct from our previously reported isatin - containing m5 pams. our initial foray into m5 pams began with the identification of a nonselective m1, m3, m5 pam as a confirmed hit from an m1-focused high throughput screening (hts) campaign. although very high levels of m5 selectivity were engendered through a strategically placed substituent on the isatin core, we were unable to detect these m5 pams in rodent cns. as such, we performed a high throughput screen directly interrogating m5 functional activity in conjunction with the scripps research institute molecular screening center (srimsc). for this campaign, we used a triple addition protocol (compound addition followed by low and high concentrations of orthosteric agonist (ach)) to screen the mlpcn collection of 360 000 compounds. this screening strategy allows for the identification of activators (agonists and pams) while also surveying for inhibitors (nams and antagonists). single concentration - point screening experiments in chinese hamster ovary (cho) cells stably expressing the human m1, m4, and m5 receptors identified 3920 m5 hits (1.07% hit rate). hits were triaged based on activity in untransfected cells, structural tractability, and the elimination of frequent hitters. the most attractive m5 activators were purchased from commercial sources and reconfirmed using 10-point concentration response curves (crc). these triple - add crc experiments resulted in the identification of nine confirmed m5 pams, nine m5 antagonists, and zero m5 agonists. structurally, the most promising of the m5 pam hits, 1 (figure 1), represented a novel chemotype for an m5 pam and offered a wide range of straightforward modifications due to its highly modular appearance. the broad range of planned modifications to 1, shown in figure 1, could readily be accomplished by employing the synthesis route shown in scheme 1. starting from the n - boc protected carboxylic acid core 2, peptide coupling with an amine introduced the first alkyl group on amide 3. deprotonation of this amide was followed by the addition of an alkylating agent (e.g., ethyl iodide) and a crown ether, necessary to facilitate the introduction of the second alkyl group, providing 4. removal of the boc protecting group under standard anhydrous hcl conditions provided the salt 5. the amine of 5 was then sulfonylated to provide the hts hit 1. alternatively, this secondary amine could be functionalized through reactions with a wide range of electrophiles (e.g., acid chlorides, isocyanates, alkyl halides, etc.). although the synthesis route was quite flexible, when applied to many of the modifications proposed in figure 1, the sar was disappointingly rigid. a litany of modifications were not tolerated and resulted in a complete loss of m5 activity : (1) removal of n - benzyl or n - ethyl moiety to provide a secondary amide, (2) cyclizing the ethyl group back to the piperidine, (3) relocating the carbonyl to produce the acetamide or benzamide analogs, (4) replacing the amide with a sulfonamide, (5) replacing the piperidine with an azetidine or [1.3.0 ] bicycle, (6) replacing the sulfonamide with an amide, urea, or carbamate, and (7) any alkylsulfonamide in place of an arylsulfonamide. the failure of these global modifications suggested that an improvement in potency would require a better understanding of the m5 pam sar brought about by more modest modifications. reagents and conditions : (a) benzylamine, hatu, dcm, dipea, 95% ; (b) naotbu, et - i, 15-crown-5, thf, 88% ; (c) hcl, dioxane, 99% ; (d) 1,4-benzodioxan-6-sulfonyl chloride, dcm, dipea, 70%. initial improvements in pam potency were provided by modifications to the arylsulfonamide (table 1). the unadorned phenylsulfonamide 6a showed slightly improved potency over the hts hit ; however, potency could be further improved through the introduction of methoxy groups at the para and meta positions. interestingly, the 3,4-dimethoxy analog 6e displayed slightly reduced efficacy (achmax) relative to the hts hit and may speak to the preference for sulfonamides with more planar aryl groups at this location. substitution at the ortho position was clearly disfavored as indicated by 6d and the sulfonamide regioisomer of the hts hit 6f. a sampling of alternative monocyclic heteroaryl groups (6g m) did not provide improved activity. building on the importance of substituents at the 3 and 4 positions, we explored a range of bicyclic heteroarylsulfonamides with annulated rings spanning these two positions. in particular, the benzofuranyl (6o) and indazolylsulfonamides (6p and 6q) provided hm5 pams with ec50 of 1.62.4 m, representing an approximately 3-fold improvement over the naked phenylsulfonamide. hm5 pec50 and ach max data reported as averages sem from our calcium mobilization assay ; n = 34 determinations ;, not determined. hm5 pec50 and ach max data reported as averages sem from our functional calcium mobilization assay ; n = 34 determinations ;, not determined. employing sulfonamides structurally related to those appearing in table 1, we explored changes to the western region of 1 and were gratified that introduction of a methyl group at the benzylic position improved potency while demonstrating enantiospecific activity (table 2). while the (s)-enantiomer 7a was inactive at hm5, the (r)-methyl enantiomer 7b demonstrated a 3-fold improvement in potency relative to its des - methyl analog 6b. although slight, improvements in hm5 pam potency were realized with the incorporation of 2,3-dihydroindenyl and the 6- and 5-indazolylsulfonamides (7e, 7f, and 7 g, respectively). pec50 and ach max data reported as averages sem from our calcium mobilization assay ; n = 35 determinations ;, not determined. simultaneously, we were exploring modifications to the western aryl ring in the context of the indazole sulfonamides and identified a number of productive alterations depicted in table 3. systematically moving a fluorine around the phenyl ring revealed that substitution at the 2 and 3 positions was favored, with a trend in preference for the 3-fluoro 8b. most notably, the 3-methyl analog 8f yielded a submicromolar potency (hm5 ec50 = 0.87 m). this potency was mirrored by the analogous 2-methyl analog 8 g and prompted a further exploration of substituents at the ortho position. the 2-chloro (8i) and 2-trifluoromethyl (8j) groups provided further improvements in potency, but interestingly the 3- and 4-trifluoromethyl analogs (8k and 8l, respectively) possessed greatly reduced activity and illustrated the frequently steep nature of allosteric sar. the two most potent ortho - substituted analogs (cl and cf3) with the 6-indazolylsulfonamide were also examined in the context of the 5-indazolylsulfonamide (8 m and 8n) and found to be among the most potent hm5 pams prepared to date. specifically, 8n, displaying a hm5 pam ec50 = 0.19 m, was 8-fold more potent than its des - cf3 congener (6p, table 1). disappointingly, addition of a methyl group in the (r) configuration to 8n, analogous to the compounds in table 2, resulted in a 10-fold decrease in potency (hm5 ec50 = 2.4 m, structure not shown). hm5 pec50 and ach max data reported as averages sem from our calcium mobilization assay ; n = 35 determinations ;, not determined. in vitro metabolite identification experiments performed on 7 while we were simultaneously exploring modification to this n - ethyl group with variations at other locations, a concise but still representative description of these efforts can be summarized in the context of the highly optimized 8n and its analogs appearing in table 4. although not bearing the optimized 5-indazolylsulfonamide shown in table 4, early results indicated that groups smaller than ethyl (i.e., hydrogen or methyl) resulted in a complete loss of, or greatly diminished, activity at hm5 (respectively, structures not shown). the ethyl group in 8n could be extended without incurring a loss in potency as demonstrated by the n - propyl analog 9a. however, the other three - carbon isomers (9b d) all suffered a > 10-fold drop in activity. attempts to mitigate metabolism through the introduction of polarity on the terminus of the ethyl group in 8n similarly engendered an unacceptable decrease in activity upon introduction of a hydroxyl (9f) or even a single fluorine atom (9 g). given the complete absence of activity demonstrated by the cyclopropyl analog 9d, it was surprising to find that the cyclobutyl version (9e) displayed mid - micromolar potency. supporting the hypothesis that alkyl branching is not well tolerated directly adjacent to the amide nitrogen (i.e., 9c e) but that larger alkyl groups could be present more distally, the sec - butyl analog 9h was equipotent to its n - propyl conger (9a). furthermore, even larger alkyl groups at this location (9i k) displayed consistently high levels of activity. unfortunately, none of these modifications could shift the primary route of metabolism away from this region of these molecules while maintaining high levels of m5 pam activity, nor could they attenuate an inherently high rate of in vitro metabolism (i.e., rat hepatic microsomal clint > 500 ml min kg). however, 9d was able to reduce intrinsic microsomal clearance by an order of magnitude, but this came at the expense of losing all hm5 activity. a subset of m5 pams were further assessed for their ability to enhance the potency of ach at the hm5 receptor using a fluorescence based calcium mobilization assay. experimentally, a fixed concentration of pam (10 m) or vehicle was added prior to the addition of a concentration response curve (crc) of ach, and the left shift in potency of ach was determined as the ratio (fold shift) of the potency in the absence and presence of pam. as shown in table 5, the hts hit 1 produced a fold shift of 2.3, while the more potency - optimized analogs showed at least twice that value. four of the most potent compounds from tables 2 and 3 (7b, 7 g, 8j, and 8n) gave fold shift values in the 7- to 12-fold range, similar to earlier m5 pams. ach fold - shift data, for compounds at 10 m, reported as averages sem from our calcium mobilization assay and represent leftward shifts in ach potency ; n = 34. although 7 g and 8n displayed similar fold shift values, 8n was superior to 7 g with respect to hm5 pam potency and by virtue of its superior muscarinic subtype selectivity profile. the muscarinic subtype selectivity profile for 8n across the five human and rat receptor subtypes can be seen in figure 2. 8n shows no activity at hm2 or hm4 (the natively gi / o coupled machrs ; our assays employed cells co - transfected with chimeric gqi5 to facilitate m2/m4 coupling to ca mobilization) and displays greater than 10-fold selectivity over hm1 and hm3 (the gq coupled machrs). the lower potencies, combined with lower efficacies, at hm1 (hm1 pam ec50 = 5.4 m, achmax = 52%) and hm3 (hm3 pam ec50 = 2.1 m, achmax = 67%) when compared to those for 8n at hm5 (hm5 pam ec50 = 0.19 m, achmax = 96%) may actually afford a greater than 10-fold selectivity window. interestingly, when assessed at the rat muscarinic receptors, the level of subtype selectivity diminished and rm1 was now closest in potency to rm5. muscarinic subtype selectivity profile of 8n : (a) human selectivity (hm5 ec50 = 0.19 m, hm4 ec50 > 30 m, hm3 ec50 = 2.1 m, hm2 ec50 > 30 m, hm1 ec50 = 5.4 m) ; (b) rat selectivity (rm5 ec50 = 0.61 m, rm4 ec50 > 30 m, hm3 ec50 = 3.1 m, hm2 ec50 > 30 m, hm1 ec50 = 2.0 m). data represent the mean sem from at least three independent determinations employing highly expressing cell lines with similarly high expression levels of muscarinic receptors. 8n has no inhibitory effect on [h]nms binding (97.1% max), while the control (atropine) inhibits [h]nms binding in a concentration dependent manner (ki = 1.47 nm, 1.8% max). (b) acetylcholine affinity shift profile of 8n. increasing fixed concentrations of 8n result in progressive left shifts of the ach inhibition curve, with a maximal shift of approximately 15. the pharmacology of 8n was further profiled in radioligand binding experiments (figure 3). increasing concentrations of 8n or atropine (control) were incubated with a fixed concentration of [h]n - methylscopolamine (nms, 0.3 nm, an orthosteric antagonist) and membranes expressing the hm5 receptor. while atropine displaced [h]nms binding in a concentration dependent manner, 8n had no effect on [h]nms binding (figure 3a), suggesting that 8n interacts with the hm5 receptor via an allosteric mechanism. to further characterize the interaction of 8n with the hm5 receptor, increasing fixed concentrations of 8n were incubated with a crc of ach in the presence of a fixed concentration of [h]nms (0.4 nm) to determine the effect of 8n on the affinity of ach. 8n shifted the ach competition curve leftward by 15-fold (figure 3b), further demonstrating its function as a pam, acting through modulation of the potency and affinity of ach. however, it has yet to be defined what in vitro properties are required for a hm5 pam to generate a specific in vivo outcome. only now are we beginning to amass the necessary tool compounds to explore this question. interestingly, this novel class of hm5 pams showed a clear preference for the gq coupled machrs over the gi / o coupled receptors, which is reminiscent of the nonselective pan - gq pam hts hit that served as the progenitor for three previous m5 pam probe molecules and an m1 selective pam. this similarity points to the possibility of a common allosteric binding site and the high probability that further sar will reveal completely selective m5 pams from this series. to more broadly explore this new scaffold s potential for nonmuscarinic, off - target activity, 8n was submitted to eurofin s pan labs lead profiling screen. this battery of radioligand binding assays consists of 68 common gpcrs, ion channels, and transporters where the test compound (8n) was present at 10 m. remarkably, 8n showed a significant response (> 49% radiologand displacement ; see supporting information for complete results) in just two assays : cannabinoid cb1 receptor (50% displacement) and 1 receptor (53% displacement). however, these binding results do not guarantee functional activity and the mid - range values did not prompt functional determinations. encouraged by these initial results, 8n was characterized in a variety of dmpk assays (table 6). from an in vitro standpoint, 8n displayed minimal metabolic stability with a very high hepatic microsomal intrinsic clearance in rat and human (clint ; rat, 2600 ml min kg ; human, 540 ml min kg) and a correspondingly high predicted hepatic clearance in both species (clhep ; rat, 68 ml min kg ; human, 20 ml min kg), on par with hepatic blood flow. a low fraction unbound in plasma was observed for rat and human (fu, plasma ; rat, 0.014 ; human, 0.015) and in rat brain homogenate (fu, brain ; rat, 0.011). in rodents (male, sprague dawley rats, 1 mg / kg iv, n = 3), similar instability was observed after intravenous dosing ; 8n displayed high clearance (66 ml min kg), a moderate volume of distribution (1.6 l kg), and a short half - life (t1/2, 22 min). a modest total brain - plasma partition coefficient (kp = 0.36) was also determined from these experiments (15 min after administration) ; however, the unbound brain - plasma partition coefficient (kp, uu = 0.28) tempers the attractiveness of 8n as a highly cns penetrant compound. still, the high permeability determined in caco-2 cells (papp = 2.5 10 cm / s) represents an attractive starting point to further optimize cns exposure. determined using clint values in the well - stirred model of organ clearance not corrected for fraction unbound in plasma. in summary, we have developed 8n (also referred to as ml380 or vu0481443), which is among the most potent m5 pams reported to date (hm5 ec50 = 190 nm, rm5 ec50 = 610 nm) and is m5 preferring with some functional activity remaining at m1 and m3. this compound will be a useful tool to further investigate the in vitro properties of the m5 receptor as more advanced pams are identified. this novel chemotype distinguishes itself from our previously published isatin - containing m5 pams in its ability to be detected within the cns even though its partition coefficients (kp and kp, uu) are less than optimal. however, the highly modular nature of this ligand will allow for continued structural optimization to further improve potency, selectivity, metabolic stability, and cns penetration. continuing efforts around this scaffold are in progress and will be reported in due course. the general chemistry, experimental information, and syntheses of key compounds are supplied in the supporting information. purity for all final compounds was > 95%, and each showed a parent mass ion consistent with the desired structure (lcms). to a solution of 1-boc-4-piperidinecarboxylic acid (2.00 g, 8.72 mmol, 1 equiv) and dipea (4.48 ml, 26.2 mmol, 3 equiv) in dcm (30 ml, 0.3 m) was added 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hcl (2.51 g, 13.1 mmol, 1.5 equiv), hydroxybenzotriazole (1.77 g, 13.1 mmol, 1.5 equiv), and ethylamine hcl (1.42 g, 17.5 mmol, 2.0 equiv). the mixture was stirred for 2 h at room temperature before being quenched with aqueous nahco3. the organic layer was separated, and the aqueous layer was extracted with dcm. the combined organic layers were washed with brine, dried over mgso4, filtered, and concentrated under reduced pressure. the residue was purified via silica gel column chromatography to give 1.89 g of 1-boc-4-(ethylcarbamoyl)piperidine (83% yield). to a solution of 1-boc-4-(ethylcarbamoyl)piperidine (50.0 mg, 0.195 mmol, 1 equiv) and 15-crown-5 (77.4 l, 0.390 mmol, 2 equiv) in thf (2 ml, 0.1 m) was added naobu (28.1 mg, 0.293 mmol, 1.5 equiv). the mixture was stirred for 30 min at room temperature before adding 2-(trifluoromethyl)benzyl bromide (59.4 l, 0.39 mmol, 2 equiv). after 16 h, the mixture was concentrated under reduced pressure and the residue partitioned between h2o and dcm. the organic layer was separated, and the aqueous layer was extracted with dcm. the combined organic layers were concentrated under reduced pressure and the residue was purified via gilson preparative lc (mecn / water/0.1% tfa gradient as the mobile phase through a c-18 column) to obtain 1-boc-4-(ethyl(2-(trifluoromethyl)benzyl)carbamoyl)piperidine. to a solution of 1-boc-4-(ethyl(2-(trifluoromethyl)benzyl)carbamoyl)piperidine in dcm was added mp - tsoh (5 equiv). the mixture was filtered, and the resin was rinsed with meoh before washing with nh3/meoh to elute product. solvent was removed under reduced pressure to give 43 mg of pure 4-(ethyl(2-(trifluoromethyl)benzyl)carbamoyl)piperidine (70% yield, two steps). to a solution of 4-(ethyl(2-(trifluoromethyl)benzyl)carbamoyl)piperidine (20 mg, 0.063 mmol, 1 equiv) and dipea (33 l, 0.20 mmol, 3 equiv) in dcm was added 1h - indazole-5-sulfonyl chloride (21 mg, 0.095 mmol, 1.5 equiv). the mixture was allowed to stir for 2 h at room temperature and was then quenched with meoh and concentrated under reduced pressure. the residue was purified via gilson preparative lc (mecn / water/0.1% tfa gradient as the mobile phase through a c-18 column) to obtain 4.2 mg of 8n (15% yield). hrms (tof, es+) c23h26n4o3f3s [m + h ] calcd mass 495.1678, found 495.1679. h nmr (1:1.25 rotamer ratio, denotes minor rotamer, 400.1 mhz, cdcl3) (ppm) : 8.31 (s, 1h) ; 8.25 (m, 1h) ; 7.78, 7.72 (d, j = 8.8 hz, 1h) ; 7.687.57 (m, 2h) ; 7.52, 7.46 (t, j = 7.6 hz, 1h) ; 7.38, 7.32 (t, j = 7.6 hz, 1h) ; 7.217.13 (m, 1h) ; 4.76, 4.64 (s, 2h) ; 3.953.86, 3.853.76 (m, 2h) ; 3.41, 3.22 (q, j = 7.2 hz, 2h) ; 2.602.46 (m, 2h) ; 2.372.26 (m, 1h) ; 2.111.92 (m, 2h) ; 1.911.81, 1.741.65 (m, 2h) ; 1.161.05 (m, 3h). c nmr (1:1.35 rotamer ratio, denotes minor rotamer, 100.6 mhz, cdcl3) (ppm) : 174.70 ; 141.40, 141.34 ; 136.29, 135.77 ; 135.95 ; 132.67, 132.31 ; 129.31, 129.19 ; 127.94, 127.86 ; 127.90 (q, j = 30.3 hz) ; 126.65 (q, j = 5.3) ; 126.47 ; 126.26 (q, jcf = 245 hz) ; 126.04 (q, j = 5.6 hz) ; 122.81, 122.73 ; 122.66 ; 110.92, 110.89 ; 46.94, 44.23 ; 45.64, 45.46 ; 42.12, 41.87 ; 37.96, 37.68 ; 28.48, 28.27 ; 14.44, 12.67.	a functional high throughput screen identified a novel chemotype for the positive allosteric modulation (pam) of the muscarinic acetylcholine receptor (machr) subtype 5 (m5). application of rapid analog, iterative parallel synthesis efficiently optimized m5 potency to arrive at the most potent m5 pams prepared to date and provided tool compound 8n (ml380) demonstrating modest cns penetration (human m5 ec50 = 190 nm, rat m5 ec50 = 610 nm, brain to plasma ratio (kp) of 0.36).
cell - matrix adhesion involves several processes including integrin binding, cell spreading, and flattening against the substrate. cultured cells, that spread out on ligand coated surfaces, rearrange their cytoskeleton and begin to move. these focal complexes grow into mature focal contacts, also called focal adhesions (fas). focal adhesions contain over 100 different proteins, including integrins, adapter proteins, and intracellular signaling proteins. clustered integrins anchor actin filaments to the cell membrane and link them with the extracellular matrix (ecm) through adapter proteins such as talin and vinculin. the adapter protein paxillin links integrins to signaling proteins, forming a scaffold for src kinases, the focal adhesion kinase (fak), or the p21-activated kinase (pak) [25 ]. the turnover of fas in moving cells is driven by small gtpases of the rho subfamily. fa formation and disassembly at the leading edge is driven by rac1 and the localized suppression of rho activity. rho proteins are active in the gtp - bound state and inactive in the gdp - bound state. in their active conformation rho proteins the cycling between these states is governed by guanine nucleotide exchange factors (gef) and gtpase activating proteins (gap), which catalyse the exchange of gdp to gtp or stimulate the intrinsic gtp hydrolase, respectively. a critical amino acid for gap - induced as well as for intrinsic gtpase activity is gln-63 in rhoa (gln-61 in rac1 and cdc42). gln-63/61 is deamidated by cytotoxic necrotizing factors (cnf), a class of autotransporter toxins produced by uropathogenic e. coli (cnf1 - 3) or y. pseudotuberculosis (cnfy) [7, 8 ]. deamidation results in inhibition of gap - induced as well as of intrinsic gtpase activity, resulting in so called constitutively active rho proteins. cnf1-induced activation of rho proteins leads to the assembly of f - actin in prominent stress fibers, membrane ruffles, and filopodia. cnf1 triggers cell spreading of monocytes and epithelial cells. in cnf1-treated epithelial cells, cell spreading was accompanied by the formation of vinculin - positive fas and the phosphorylation of fa proteins, including the focal adhesion kinase (fak) and paxillin. cnf1 exhibited antiapoptotic activity, which has been attributed to its capability of inducing cell spreading. cnf1-treated cells finally acquire a multinucleated phenotype, which seems to be based on inhibited cytokinesis with ongoing cell cycle progression. in this study, the effects of cnf1 on cell - matrix adhesion are analysed using functional cell adhesion assays. cnf1 strongly increases cell - matrix adhesion of suspended hela cells and decreased the susceptibly of cells to trypsin - induced cell detachment. increased cell - matrix adhesion is further presented to contribute to reduced cell migration. increased cell - matrix binding is also observed upon treatment of hela cells with isomeric cnfy, that specifically deamidates rhoa. the following reagents were obtained from commercial sources : dapi (40.6-diamidino-2-phenylindole) (serva), hoechst 33342 (cambrex), rhodamine - conjugated phalloidin (sigma). the following reagents were obtained from commercial sources : rhoa (mab-26c4), rac1 (mab-23a8) (santa cruz) ; -actin (mab ac-40) (sigma) ; cdc42 (mab-44) (bd transduction laboratories) ; ps144/141-pak1/2 (mab ep656y) (abcam) ; vinculin (mab hvin-1) (abcam) ; horseradish peroxidise - conjugated secondary antibodies (rockland) ; anti - rabbit igg alexa fluor 488 goat secondary antibody (invitrogen). cnf1 from e. coli and cnfy from y. pseudotuberculosis were expressed as gst fusion proteins in e. coli and purified by affinity chromatography using glutathione - sepharose, as described earlier. hela cells were maintained in dulbecco 's minimal essential medium supplemented with 100 g / ml penicillin, 100 u / ml streptomycin, 1 mm sodium pyruvate, and 10% fcs at 37c in a humidified atmosphere containing 5% co2. the migration assay was performed in a boyden chamber using 8 m pore diameter 24-well transwell filter inserts (corning). suspended cells were directly placed on the membrane or allowed to adhere for 2 h. cell migration was stimulated by fcs, present in the bottom solution for 5 h. cells on the upper membrane surface were scraped with a cotton swab, and cells on the bottom surface stained with hoechst 33342. after incubation at 37c for 15 min, cells were analyzed by fluorescence microscopy using a zeiss axiovert 200 m (excitation 365 nm, emission 420 nm). establishment of cell - matrix binding of suspended cells : hela cells were treated with the indicated toxin for 2 h and suspended by trypsin. suspended cells were seeded onto cell culture dishes (polystyrol) coated with or without fibronectin. at the indicated time points, the medium containing nonadherent cells was removed, and attached cells were documented by phase contrast microscopy. susceptibility towards trypsin - induced cell detachment : adherent hela cells were treated with the indicated toxin for 2 h. cells were incubated with trypsin for the indicated time and the medium with suspended cells was removed. the samples were washed with pbs and incubated with 5% bsa in pbs at room temperature for 1 h. primary antibody was diluted in pbs and samples were incubated at room temperature for 1 h. subsequently, cells were incubated with an alexa fluor 488 conjugated secondary antibody diluted to 1 : 1000 in pbs and dapi (1 g / ml) for 1 h at room temperature. cover slides were fixed using prolong antifade (invitrogen) and analysed by fluorescence microscopy using leica confocal microscope inverted-2. effector pull - down assay were performed using the rho binding domain of rhotekin, encoding the n - terminal 90 amino acids of rhotekin (c21), or the rac / cdc42 binding crib domain (amino acids 56272 of pak1). hela cells were lysed in binding buffer (50 mm tris ph 7.4, 150 mm nacl, 5 mm mgcl2, 5 mm dtt, 1 mm pmsf, protease inhibitor complete (roche), and 1% np-40) at 4c by sonification. the cell lysate was centrifuged at 13.200 g for 10 min, and the supernatant was incubated for 60 min with gst - c21(rhotekin) (rhoa) and gst - pak - crib (rac1/cdc42) immobilized to sepharose beads. positive control was treated with 10 mm edta and 100 m gtp[s ] at 30c for 15 min to exchange the nucleotide. the complex of rho protein and gtp[s ] was stabilized by the addition of 60 mm mgcl2. bound rho proteins were eluted by incubation in laemmli lysis buffer at 95c for 10 min and subjected to sds - page and western blot analysis. membranes were blocked with 5% non - fat - dried milk for 60 min. subsequently, the membrane was incubated with primary antibody at 4c over night, and secondary antibody conjugated with horseradish peroxidase for 1 h at room temperature. blots were analysed by chemiluminescence reaction of ecl femto using kodak image station 440 cf. statistical analysis was performed using microsoft excel and p values were analysed between two groups of data with a two - tailed student 's t - test. p 0.05 ; p 0.01, p 0.001. the morphology of hela cells was analysed upon treatment with either cnf1 or cnfy for 24 h. cnf1, that deamidates rhoa, rac1, and cdc4 induced pronounced formation of actin stress fibres, membrane ruffles and lamellipodia and filopodia, as visualized in cells stained with rhodamine - phalloidin (figure 1(a)). cnfy, that deamidates rhoa, induced the formation of pronounced actin stress fibres, but the formation of membrane ruffles or filopodia was less pronounced, indicating that cnfy activated rhoa in hela cells (figure 1(a)). rhoa deamidation results in inhibited contractile ring formation in cytokinesis ; cells treated with either cnf1 or cnfy undergo cell cycling but omit cytokinesis. therefore, cnf1-/cnfy - treated cells were binucleated and exhibited an increased cell size (figure 1(a)). rhoa exhibited reduced electrophoretic mobility upon 2 h of treatment with cnf1 (figure 1(b)), indicating rhoa deamidation. deamidated rhoa was present in cnf1-treated cells over a time period of 12 h (figure 1(b)). cnfy comparably induced rhoa deamidation upon treatment for 2 h (data not shown). deamidated rac1 has been reported to be rapidly degraded in a proteasome - dependent manner [18, 19 ]. the protein level of rac1 was reduced, whereas the levels of rhoa or cdc42 were almost constant in hela cells (figure 1(b)), corroborating former observations. to provide direct evidence on the activation of rho proteins, the relative cellular concentrations of activated rho proteins were determined using effector pull - down assay exploiting the rho - binding domain of rhotekin for rhoa and the pak - crib domain for rac1 and cdc42. upon cnf1 treatment, the cellular levels of rhoa - gtp, rac1-gtp, and cdc42-gtp in contrast, the cellular level of selectively rhoa - gtp was increased in cnfy - treated hela cells (figure 1(c)). hela cells were further treated with toxin b from c. difficile strain vpi10463 (tcdb), a broad - spectrum inhibitor of rho proteins [20, 21 ]. in tcdb - treated cells, the levels of active rhoa - gtp, rac1-gtp, or cdc42-gtp were significantly reduced (figure 1(c)), indicating that glucosylation of rho proteins resulted in their inactivation. cnf1 thus activated rhoa, rac, and cdc42, while cnfy specifically activated rhoa. following the hypothesis, that cnf1-induced activation of rho proteins results in increased cell - matrix binding, the capability of suspended cells of establishing cell - matrix binding and cell spreading on fibronectin - coated polystyrol was analysed over time (figure 2(a)). suspended cells that bound to the matrix were initially rounded and then begin to spread out. cells treated with either cnf1 or cnfy more efficaciously bound to the matrix compared to nontreated cells (figures 2(a) and 2(b)). at later time points (30 min), cell - matrix binding of cnf - treated and untreated cells was comparable (figure 2(b)). cell - matrix binding was completely blocked upon inhibition of rho proteins by tcdb (figure 2(b)), confirming the critical role of rho proteins in cell - matrix binding. cnf1-treated cells more rapidly spread out compared to cnfy - treated or nontreated cells on fibronectin - coated polystyrol (figure 2(c)), as quantified in terms of spread per total cells. cell spreading on polystyrol was clearly delayed compared to spreading on fibronectin - coated polystyrol (figures 2(c) and 2(d)). cnf1 increased cell spreading also on the polystyrol matrix, while cell spreading of cnfy - treated cells was comparable to nontreated cells (figure 2(d)). cell spreading was specifically triggered by cnf1 (not cnfy), which correlated with the capability of cnf1 of activating rac1 (figure 1(c)). the consequences of the cnf - induced activation of rho proteins to cell - matrix adhesion were further analysed in terms of the susceptibility of cells to trypsin - induced cell detachment. upon treatment with cnf1 or cnfy (less pronounced), trypsin - induced cell detachment was delayed (figures 3(a) and 3(b)). in contrast, inhibition of rho proteins by tcdb strongly increased the susceptibility towards trypsin - induced cell detachment, showing that rho proteins were required for the establishment of cell - matrix adhesions (figures 2(a)2(d)). treatment with cnf1 or cnfy triggered cell - matrix binding and increased the persistence of pre - established cell - matrix adhesion. the transition of cell - matrix adhesions from the initial punctate focal complexes into the mature elongated form, the focal adhesions (fas), has been attributed to the activity of rho proteins [22, 23 ]. to check if cnf1 induced fa formation, hela cells were stained for actin and vinculin, with the latter being an established fa marker. elongated structures with a longitudinal length of 1.5 m were considered as fas. the number of fas per cells strongly increased upon treatment with cnf1 (figures 4(a) and 4(b)). thereby, cnf1-induced formation of stress fibres and fas was completely abolished upon treatment with the rock inhibitor y-27632. rhoa - rock signalling was critical for fa formation in nontreated as well as in cnf1-treated cells. furthermore, rock inhibition by y27632 induced cell spreading in cnf1-treated cells (figure 4(a)). pronounced cell spreading upon initial cell - matrix binding was exclusively observed in cnf1- (not in cnfy-) treated cells, suggesting that cell spreading depended on rac1/cdc42 activation rather than on rhoa activation. next, the activity of the rac1/cdc42 effector protein pak, another fa component, was analysed in fas exploiting a phosphospecific antibody recognizing ps144/141-pak1/2, the activated form of pak1/2 (figure 4(b)). cnf1 induced a pronounced increase of active pak - positive fas compared to nontreated or cnfy - treated cells. this observation showed that cnf1 (not cnfy) activated pak1/2, reflecting specific activation of rac1/cdc42 by cnf1. cell spreading thus correlated with the pronounced increase of pak - positive fas in cnf1-treated cells. finally, the hypothesis was followed that increased cell - matrix adhesion affects the migration of cnf - treated cells. hela cells were treated with the cnf toxins for 2 h and then allowed to adhere on a transwell membrane. cell migration was stimulated using a serum gradient (boyden chamber transwell migration experiment). under these conditions, about 50% of nontreated cells migrated through the membrane within a time period of 5 h (data not shown). therefore, adherent cells were pretreated with the toxins for 2 h, suspended by trypsination, placed onto the boyden chamber membrane, and directly allowed to migrate. under this condition, about 50% of nontreated cells migrated through the membrane within a time period of 5 h (data not shown). the migration of suspended cells was completely blocked upon tcdb treatment (figure 5). interestingly, treatment of suspended cells with either cnf1 or cnfy did not affect cell migration (figure 5). suspended cells pretreated with cnf1 or cnfy migrated with an efficacy comparable to that of nontreated cells (figure 5). deamidation of rho proteins thus reduced cell migration under the condition of pre - established cell - matrix adhesion. in this study, the effects of rho - modifying toxins on cell adhesion are analysed to dissect distinct roles of rho proteins in cell adhesion. in particular, the application of the rhoa - specific cnfy is exploited to dissect the role of rhoa activation to the observed effects. cell - matrix binding is strongly increased by both cnf1 and cnfy to comparable extent, showing that increased cell - matrix binding of cnf1-/cnfy - treated depends on rhoa deamidation. cell matrix - binding of tcdb - treated cells is completely prevented, showing that the activity of rho proteins is required for cell - matrix binding. cell spreading is specifically triggered by cnf1 (not cnfy), suggesting that cell spreading rather depended on rac1/cdc42-dependent rather than rhoa - dependent signaling pathways. furthermore, the rhoa effector protein rock seems to negatively regulate cell spreading, as cell spreading of cnf1-treated cells is increased upon inhibition of the rock by y-27632. cell - matrix binding and cell spreading include the formation of focal contacts, which maturate into elongated focal adhesions (fas) [22, 23 ]. activation of rho proteins by cnf1 strongly increased the number of vinculin - positive fas per cells. the fas formation depends on rhoa / rock signalling in cnf1- and nontreated hela cells, as rock inhibition by y-27632 completely blocks fas formation. the latter observation is consistent with the view that the elongated form of fas depends on the presence of stress fibres, which formation is inhibited upon y-27632 treatment. the increased number of fas in cnf1-treated cells (compared to nontreated cells) likely results from cnf1-mediated activation of rho proteins, which reportedly drives the maturation of focal contacts into focal adhesions [22, 23 ]. the rac1/cdc42 effector protein pak1/2 is also regarded as a component of fas. in cnf1- (not cnfy-) treated the number of ps144/141-pak1/2-positive fas, that is, fas with activated pak1/2, is strongly increased. interestingly, active pak has been suggested to promote fa disassembly and cell detachment [3, 24 ]. although active pak is present at the fas of cnf1-treated cells, these cells exhibited a reduced susceptibility of cells to trypsin - induced cell detachment compared to cnfy - treated and nontreated cells. the activation of rhoa - dependent and other rac1/cdc42-dependent pathways that positive regulates cell attachment (including those regulating cell spreading) obviously overbalances cell detachment driven by active pak1/2 in cnf1-treated cells. cnfy - treated cells exhibit a reduced susceptibility of cells to trypsin - induced cell detachment compared to nontreated cells, showing that the activation of rhoa - dependent pathways is sufficient for increased cell adhesion. the consequences of increased cell adhesion of cnf1-/cnfy - treated cells on cell migration is differentially analysed in adherent and suspended cells. suspended cells treated with either cnf1 or cnfy migrated to an extent comparable to that of nontreated cells. thus the presence of deamidated rho proteins per se did not inhibit cell migration. in contrary, this may explain, why migration of cnf1-treated suspended cells is slightly (not significantly) increased. in contrast, the migration of suspended cells was completely blocked upon tcdb pre - treatment. this observation illustrates that activity of rho proteins and cell - matrix adhesion are both prerequisites for cell migration. the matrix adhesion of suspended tcdb - treated cells is completely blocked, based on the fact that the activity of rho proteins is required for cell - matrix adhesion. the analysis of cell migration of adherent cells revealed that migration of cnf1-/cnfy - treated cells is reduced. against the background that the deamidation of rho protein per se does not reduce cell migration this process mainly depends on rhoa and correlates with the observation of this study that both cnf1 and cnfy reduce cell migration. rhoa deamidation may thereby prevent fa disassembly and loss of cell adhesion at the cell rear of adherent cells, which remains to be analysed in detail. in conclusion, cnf1 and cnfy both reduce cell migration specifically under the condition of pre - established cell - matrix adhesion. this observations makes cnf toxins an interesting tool, as it allows the dissection of the role of rho proteins in cell adhesion (cnf sensitive) from the role of rho proteins in other processes (cnf insensitive) of the migrating cells. in adherent epithelial cells, integrin - mediated cell survival is promoted through several pathways including the phosphatidylinositol 3-kinase (pi3k)-akt pathway. the detached cells undergo a type of apoptotic cell death, also referred to as anoikis. against this background, cnf1 has been presented to preserve epithelial cells from apoptosis induced by various stimuli [13, 28, 29 ]. two distinct mechanisms thereby may be responsible for the antiapoptotic activity of cnf1 : (i) activation of rac1/cdc42 suppresses apoptosis in a pi3k / akt - dependent manner [27, 29, 30 ] ; (ii) increased cell adhesion preserves cells from detachment and subsequent anoikis [13, 28 ]. given that increased cell adhesion is sufficient for preserving the detachment of epithelial cells, cnfy should exert antiapoptotic activity as well, an aspect of the activity of cnfy that remains to be investigated.	cytotoxic necrotizing factors (cnfs) encompass a class of autotransporter toxins produced by uropathogenic e. coli (cnf1) or y. pseudotuberculosis (cnfy). cnf toxins deamidate and thereby constitutively activate rhoa, rac1, and cdc42. in this study, the effects of cnf1 on cell - matrix adhesion are analysed using functional cell - adhesion assays. cnf1 strongly increased cell - matrix binding of suspended hela cells and decreased the susceptibly of cells to trypsin - induced cell detachment. increased cell - matrix binding was also observed upon treatment of hela cells with isomeric cnfy, that specifically deamidates rhoa. increased cell - matrix binding thus appears to depend on rhoa deamidation. in contrast, increased cell spreading was specifically observed upon cnf1 treatment, suggesting that it rather depended on rac1/cdc42 deamidation. increased cell - matrix adhesion is further presented to result in reduced cell migration of adherent cells. in contrast, migration of suspended cells was not affected upon treatment with cnf1 or cnfy. cnf1 and cnfy thus reduced cell migration specifically under the condition of pre - established cell - matrix adhesion.
gingival recession is one of the most common aesthetic and functional concerns associated with periodontal tissues. it is defined as the displacement of soft tissue margin apical to cemento enamel junction with exposure of root surface. gingival recession is well documented in populations having a good standard of oral hygiene and also in those with a high plaque index (pi). a host of factors lead to gingival recession, e.g., alveolar bone dehiscence, gingival quality and quantity, high muscle attachment and frenal pull, iatrogenic factors, localized inflammatory processes, hard tooth brushes, traumatizing tooth brushing and tooth malposition. the possible consequences of gingival recession are : compromised aesthetics, dentinal hypersensitivity, cervical abrasions, plaque retention and gingival bleeding, risk of root caries and, also, fear of losing teeth. various techniques have been introduced to the field of cosmetic periodontology since grupe and warren first described the subsequently, a number of surgical techniques have been proposed such as pedicle grafts, regenerative techniques and bilaminar procedures. of these, the bilaminar technique using subepithelial connective tissue graft (sctg) seems to be the most promising for root coverage, with a 65 - 98 mean percentage of root coverage. in spite of its promising results, sctg has its own limitations, such as lack of graft availability, need for a second surgical site, proximity to palatine neurovascular complex and unaesthetic tissue contour at the recipient site. to overcome some of these drawbacks and to accomplish optimum root coverage, an alternate technique using platelet concentrate pcg is an enhanced concentration of platelets processed from platelet - rich plasma and incorporated into two layers of properly trimmed collagen sponge. because the platelet concentrate has a higher number of platelets per millimeter, it is expected that it contains a higher concentration of growth factors to accelerate / enhance regeneration. moreover, as donor site graft procurement is avoided, there is less post - surgical discomfort involved as well as a relatively unlimited source of graft material availability with this procedure. hence, pcg can be a viable alternative to sctg for the treatment of gingival recession. twelve patients, fulfilling the selection criteria, were selected for the study from the outpatient department of periodontics and oral implantology of our institution. twenty - four sites in 12 patients (each patient having near - identical miller 's class - i or ii gingival recession defects on contralateral teeth of same arch) were randomly assigned into experimental site - a (sctg) and experimental site - b (pcg) as per the split mouth design. patients between 18 and 60 years of agepatients with miller 's class - i or ii gingival recession defects measuring 2 mm on anterior teeth or premolars, on the contralateral sides of the same arch or one in each quadrantin good systemic health (with no history of drug intake known to affect the periodontium)no history of surgical treatment in the delineated area for at least 2 years prior to the studyteeth involved in the study are vital and free of faulty restorations. patients between 18 and 60 years of age patients with miller 's class - i or ii gingival recession defects measuring 2 mm on anterior teeth or premolars, on the contralateral sides of the same arch or one in each quadrant in good systemic health (with no history of drug intake known to affect the periodontium) no history of surgical treatment in the delineated area for at least 2 years prior to the study teeth involved in the study are vital and free of faulty restorations. patients unable to perform routine oral hygiene procedurespatients who are known smokersany uncontrolled local or systemic diseases that might contraindicate periodontal surgeryteeth showing trauma from occlusion. patients unable to perform routine oral hygiene procedures patients who are known smokers any uncontrolled local or systemic diseases that might contraindicate periodontal surgery teeth showing trauma from occlusion. the surgical procedure and possible alternatives were discussed and informed consent was obtained from the patients. the study protocol was approved by the ethical committee of the institution. before surgery, all the patients received professional oral prophylaxis, oral hygiene instructions and occlusal adjustments as per the individual requirements. a customized acrylic stent was made with guiding grooves on each experimental tooth angled toward the deepest part, i.e. midfacial part of the recession. the following clinical parameters were assessed : pi (silness and loe 1964), gingival index (gi) (loe and silness 1963), pocket depth (pd), vertical recession depth (vrd) and clinical attachment level (cal). a visual analogue scale (0 - 5) form, with 0 indicating negligible discomfort and 5 indicating unbearable pain, all the pre - operative measurements were performed using a unc 15 probe by the same examiner who also performed all the surgeries. a second examiner who was masked to the surgical procedure evaluated the clinical sites post - operatively. this evaluation included color match, tissue texture and contour of the surgical area in comparison with the adjacent tissue. the scoring was from 1 (most favorable) to 4 (least favorable). contralateral sites were assigned at random to one of the surgical techniques (sctg or pcg) by the flip of a coin. after the extraoral skin preparation was done with 5% povidone iodine solution, the patient was asked to rinse his / her mouth with 10 ml of 0.2% chlorhexidine digluconate solution for 1 min. following local infiltration with 2% lidocaine a horizontal right angle incision was then made into the adjacent interdental papilla at or slightly coronal to the level of the cemento enamel junction (cej) of the tooth presenting the defect. two divergent vertical incisions were given starting at least 0.5 mm from the gingival margin of the adjacent teeth and extending into the alveolar mucosa. the intrasulcular, horizontal right angle incision and the vertical incisions were connected and a trapezoidal full - thickness flap was raised 3 - 4 mm apical to the bone dehiscence ; from there, a partial - thickness dissection was then performed apically to allow for coronal positioning of the flap [figure 1a d ]. (a) recession depth ; (b) recession width ; (c) crevicular horizontal and vertical incisions given ; (d) full - thickness flap elevation done the preparation of the recipient site included the de - epithelization of the papillae adjacent to the defect. the exposed, affected root surface was scaled and planed and subsequently root biomodification was done with a fresh tetracycline solution (125 mg tetracycline hydochloride/1 ml of saline) for 1 min. the edel trap door (1974) approach was adopted for harvesting a connective tissue graft of 1.5 - 2.0 mm from the palate using a no. the graft was placed over the recipient site such that its coronal margin was located at the cej and its apical margin at least 3.0 mm apically beyond the base of the defect. coronal advancement of the partial - thickness flap was done so as to completely cover the graft without tension. the coronally positioned flap was secured in position by independent sling sutures using 5 - 0 vicryl sutures. independent interrupted sutures were placed along the vertical incision line for close approximation [figure 2a and b ]. (a) liu 's class iii type a incision design (trap door) ; (b) split - thickness flap elevation done a laboratory centrifuge having a maximum speed of 3500 rpm was used. the blood collection tubes were blue top 10 ml vaccutainers containing 1.5 ml, 3.2% sodium citrate solution. 8.5 ml of venous blood was drawn and transferred to two 10 ml blue top vaccutainers. these vaccutainers were then placed into the centrifuge and subjected to a 1 spin for 10 min at 1300 rpm, which led to the separation of whole blood into the lower rbc region and an upper straw - colored plasma region. the straw - colored plasma was drawn into a syringe, moving the needle from above downwards up to the rbc layer or into the first 1 - 2 mm of that layer. the contents of the 10 ml syringe were then expressed into red top vaccutainers and were subjected to a second spin for 10 min at 2000 rpm (gonshor technique for prp preparation). the contents of each tube consisted of an upper portion of clear yellow supernatant serum, containing fibrinogen and a very low concentration of platelets, the bottom layer, often red tinged, consisting of highly concentrated platelet - rich plasma (cprp). the cprp - soaked collagen sponge was trimmed to the size of the measured defect. once the collagen sponge was soaked with cprp, 10% cacl2 was added to cprp in the ratio of 1:20 along with whole blood. the pcg of desired dimension was transferred to the recipient site using a similar technique as described for sctg [figure 3a c ]. the surgical site was then covered with an aluminum foil over which a non - eugenol (coe pack) periodontal pack was given. (a) platelet - rich plasma ; (b) platelet concentrate graft (prp + collacote) ; (c) platelet concentrate graft sutured to recipient site patients were instructed to avoid brushing their teeth in the treated area for 2 weeks but to rinse their mouth with 10 ml of 0.2% chlorhexidine digluconate solution twice daily for 10 min. the periodontal pack (coe - pack) was removed on 1-week recall and the surgical site was irrigated gently with saline. systemic antibiotics (amoxicillin 500 mg t.i.d. for 5 days) and analgesics (ibuprufen 400 mg b.i.d. for 3 days) were prescribed. patients were seen at 1 week and 1, 3, 6 and 12 months for post - operative follow - up [figure 4 ]. after 4 weeks, the patients were instructed in mechanical plaque control of the treated tooth region using a soft bristled tooth brush and a roll technique. twelve months post - operative a priori power analysis was performed to determine that 12 patients and 24 sites was an adequate sample size to conduct the study. all the clinical parameters recorded were subjected to the following statistical analysis : (1) paired t - test for intragroup and (2) unpaired t test for intergroup comparisons were performed. significance level for rejection of the null hypothesis patients between 18 and 60 years of agepatients with miller 's class - i or ii gingival recession defects measuring 2 mm on anterior teeth or premolars, on the contralateral sides of the same arch or one in each quadrantin good systemic health (with no history of drug intake known to affect the periodontium)no history of surgical treatment in the delineated area for at least 2 years prior to the studyteeth involved in the study are vital and free of faulty restorations. patients between 18 and 60 years of age patients with miller 's class - i or ii gingival recession defects measuring 2 mm on anterior teeth or premolars, on the contralateral sides of the same arch or one in each quadrant in good systemic health (with no history of drug intake known to affect the periodontium) no history of surgical treatment in the delineated area for at least 2 years prior to the study teeth involved in the study are vital and free of faulty restorations. patients unable to perform routine oral hygiene procedurespatients who are known smokersany uncontrolled local or systemic diseases that might contraindicate periodontal surgeryteeth showing trauma from occlusion. patients unable to perform routine oral hygiene procedures patients who are known smokers any uncontrolled local or systemic diseases that might contraindicate periodontal surgery teeth showing trauma from occlusion. the surgical procedure and possible alternatives were discussed and informed consent was obtained from the patients. the study protocol was approved by the ethical committee of the institution. before surgery, all the patients received professional oral prophylaxis, oral hygiene instructions and occlusal adjustments as per the individual requirements. a customized acrylic stent was made with guiding grooves on each experimental tooth angled toward the deepest part, i.e. midfacial part of the recession. the following clinical parameters were assessed : pi (silness and loe 1964), gingival index (gi) (loe and silness 1963), pocket depth (pd), vertical recession depth (vrd) and clinical attachment level (cal). a visual analogue scale (0 - 5) form, with 0 indicating negligible discomfort and 5 indicating unbearable pain, was completed by the patients. all the pre - operative measurements were performed using a unc 15 probe by the same examiner who also performed all the surgeries. a second examiner who was masked to the surgical procedure evaluated the clinical sites post - operatively. this evaluation included color match, tissue texture and contour of the surgical area in comparison with the adjacent tissue. the scoring was from 1 (most favorable) to 4 (least favorable). contralateral sites were assigned at random to one of the surgical techniques (sctg or pcg) by the flip of a coin. after the extraoral skin preparation was done with 5% povidone iodine solution, the patient was asked to rinse his / her mouth with 10 ml of 0.2% chlorhexidine digluconate solution for 1 min. following local infiltration with 2% lidocaine, an intrasulcular incision was given on the buccal aspect of the involved tooth. a horizontal right angle incision was then made into the adjacent interdental papilla at or slightly coronal to the level of the cemento enamel junction (cej) of the tooth presenting the defect. two divergent vertical incisions were given starting at least 0.5 mm from the gingival margin of the adjacent teeth and extending into the alveolar mucosa. the intrasulcular, horizontal right angle incision and the vertical incisions were connected and a trapezoidal full - thickness flap was raised 3 - 4 mm apical to the bone dehiscence ; from there, a partial - thickness dissection was then performed apically to allow for coronal positioning of the flap [figure 1a d ]. (a) recession depth ; (b) recession width ; (c) crevicular horizontal and vertical incisions given ; (d) full - thickness flap elevation done the preparation of the recipient site included the de - epithelization of the papillae adjacent to the defect. the exposed, affected root surface was scaled and planed and subsequently root biomodification was done with a fresh tetracycline solution (125 mg tetracycline hydochloride/1 ml of saline) for 1 min. the edel trap door (1974) approach was adopted for harvesting a connective tissue graft of 1.5 - 2.0 mm from the palate using a no. 15 scalpel blade. the graft was placed over the recipient site such that its coronal margin was located at the cej and its apical margin at least 3.0 mm apically beyond the base of the defect. coronal advancement of the partial - thickness flap was done so as to completely cover the graft without tension. the coronally positioned flap was secured in position by independent sling sutures using 5 - 0 vicryl sutures. independent interrupted sutures were placed along the vertical incision line for close approximation [figure 2a and b ]. (a) liu 's class iii type a incision design (trap door) ; (b) split - thickness flap elevation done a laboratory centrifuge having a maximum speed of 3500 rpm was used. the blood collection tubes were blue top 10 ml vaccutainers containing 1.5 ml, 3.2% sodium citrate solution. 8.5 ml of venous blood was drawn and transferred to two 10 ml blue top vaccutainers. these vaccutainers were then placed into the centrifuge and subjected to a 1 spin for 10 min at 1300 rpm, which led to the separation of whole blood into the lower rbc region and an upper straw - colored plasma region. the straw - colored plasma was drawn into a syringe, moving the needle from above downwards up to the rbc layer or into the first 1 - 2 mm of that layer. the contents of the 10 ml syringe were then expressed into red top vaccutainers and were subjected to a second spin for 10 min at 2000 rpm (gonshor technique for prp preparation). the contents of each tube consisted of an upper portion of clear yellow supernatant serum, containing fibrinogen and a very low concentration of platelets, the bottom layer, often red tinged, consisting of highly concentrated platelet - rich plasma (cprp). the cprp - soaked collagen sponge was trimmed to the size of the measured defect. once the collagen sponge was soaked with cprp, 10% cacl2 was added to cprp in the ratio of 1:20 along with whole blood. the pcg of desired dimension was transferred to the recipient site using a similar technique as described for sctg [figure 3a c ]. the surgical site was then covered with an aluminum foil over which a non - eugenol (coe pack) periodontal pack was given. (a) platelet - rich plasma ; (b) platelet concentrate graft (prp + collacote) ; (c) platelet concentrate graft sutured to recipient site the edel trap door (1974) approach was adopted for harvesting a connective tissue graft of 1.5 - 2.0 mm from the palate using a no. 15 scalpel blade. the graft was placed over the recipient site such that its coronal margin was located at the cej and its apical margin at least 3.0 mm apically beyond the base of the defect. coronal advancement of the partial - thickness flap was done so as to completely cover the graft without tension. the coronally positioned flap was secured in position by independent sling sutures using 5 - 0 vicryl sutures. independent interrupted sutures were placed along the vertical incision line for close approximation [figure 2a and b ]. (a) liu 's class iii type a incision design (trap door) ; (b) split - thickness flap elevation done the blood collection tubes were blue top 10 ml vaccutainers containing 1.5 ml, 3.2% sodium citrate solution. 8.5 ml of venous blood was drawn and transferred to two 10 ml blue top vaccutainers. these vaccutainers were then placed into the centrifuge and subjected to a 1 spin for 10 min at 1300 rpm, which led to the separation of whole blood into the lower rbc region and an upper straw - colored plasma region. the straw - colored plasma was drawn into a syringe, moving the needle from above downwards up to the rbc layer or into the first 1 - 2 mm of that layer. the contents of the 10 ml syringe were then expressed into red top vaccutainers and were subjected to a second spin for 10 min at 2000 rpm (gonshor technique for prp preparation). the contents of each tube consisted of an upper portion of clear yellow supernatant serum, containing fibrinogen and a very low concentration of platelets, the bottom layer, often red tinged, consisting of highly concentrated platelet - rich plasma (cprp). the cprp - soaked collagen sponge was trimmed to the size of the measured defect. once the collagen sponge was soaked with cprp, 10% cacl2 was added to cprp in the ratio of 1:20 along with whole blood. the pcg of desired dimension was transferred to the recipient site using a similar technique as described for sctg [figure 3a c ]. the surgical site was then covered with an aluminum foil over which a non - eugenol (coe pack) periodontal pack was given. (a) platelet - rich plasma ; (b) platelet concentrate graft (prp + collacote) ; (c) platelet concentrate graft sutured to recipient site patients were instructed to avoid brushing their teeth in the treated area for 2 weeks but to rinse their mouth with 10 ml of 0.2% chlorhexidine digluconate solution twice daily for 10 min. the periodontal pack (coe - pack) was removed on 1-week recall and the surgical site was irrigated gently with saline. systemic antibiotics (amoxicillin 500 mg t.i.d. for 5 days) and analgesics (ibuprufen 400 mg b.i.d. for 3 days) were prescribed. patients were seen at 1 week and 1, 3, 6 and 12 months for post - operative follow - up [figure 4 ]. after 4 weeks, the patients were instructed in mechanical plaque control of the treated tooth region using a soft bristled tooth brush and a roll technique. a priori power analysis was performed to determine that 12 patients and 24 sites was an adequate sample size to conduct the study. all the clinical parameters recorded were subjected to the following statistical analysis : (1) paired t - test for intragroup and (2) unpaired t test for intergroup comparisons were performed. a statistically significant mean increase of pi at 6 and 12 months from baseline was recorded in both groups, with the sctg group presenting statistically higher values than the pcg group. a statistically significant mean increase of gi was recorded in both groups at the 12 months follow - up. there was a statistically highly significant reduction in the mean recession depth and gain in cal for both groups at 6 and 12 months post - operatively. for the sctg group, the mean recession depth reduced 2.33 0.11 mm (84.73%) at 6 months and 2.21 0.13 mm (80.36%) at 12 months from baseline ; for the pcg group, the mean recession depth reduced 2.12 0.05 mm (84.80%) at 6 months and 1.96 0.02 mm (78.40%) at 12 months from baseline [table 1 ]. a statistically highly significant mean reduction in cal of 2.42 0.21 mm for the sctg group and 1.92 0.16 mm for the pcg group at 12 months from baseline measurements was recorded. the mean percentage root coverage of 85 15.23% at 6 months from baseline declined to 83 14.5% at 12 months in the sctg group and from 86 17.29% at 6 months from baseline to 77 18.42% at 12 months in the pcg group, showing a statistical significance (p < 0.05) between the 6- and 12-month follow - ups within the groups. comparison of the midfacial (in mm) recession depths in group a and group b at different time intervals comparison of percentage of root coverage at 6 months and 12 months in exp a and b, and intergroup a statistically highly significant gain of mean width of keratinized gingiva at 12 months was noticed in the sctg group (2.63 0.30 mm), whereas in the pcg group, a mean gain of 0.71 0.04 mm was recorded (p < 0.005). a statistically significant mean reduction in probing depth at 12 months was recorded in the sctg group, while in the pcg group the mean probing depth remained unaltered. on comparison of the post - surgical discomfort levels (psdls) between the two sites, the sctg group presented with higher values at 1 week of follow - up and, by 1 month, there was complete reduction in the psdls in both the groups [table 3 ]. comparison of psdl in group a and group b at baseline, 1 week and 1 month by the unpaired t - test on comparison of the aesthetic evaluation scores, the pcg group yielded a clinically better gingival texture and contour. the ultimate goal of periodontal therapy is the complete regeneration of periodontal - supporting tissue. over the years, a variety of periodontal plastic surgical approaches have been presented for the treatment of gingival recession defects. chambrone, sukakava, aruajo, pustiglioni, chambrone under the cochrane collaboration in 2009, ascertained the superiority of sctgs over the other periodontal plastic surgical approaches for root coverage. in spite of its promising results, the results of this study demonstrated that both techniques, the autogenous sctg or the pcg, covered by a coronally positioned flap, were effective in the treatment of shallow gingival recession defects (2 mm) with significant root coverage (87% and 80% for sctg and pcg, respectively) and clinical attachment gain (2.42 0.21 mm for the sctg group and 1.92 0.16 mm for the pcg group) at 12 months the difference between the two procedures in terms of recession reduction and attachment gain are not statistically significant. the sctg procedure resulted in a statistically significant gain in width of keratinized gingiva when compared with the pcg group, while the pcg procedure resulted in less post - surgical discomfort and superior aesthetic outcomes. the mean percentage root coverage with sctg in the present study was 87%, which is in agreement with the results of the studies of wang, jahanke. and the significant amount of root coverage achieved is attributed to tensionless flap closure and adopting the suturing technique proposed by zuchelli. optimal gingival thickness at the recession site, optimal donor tissue thickness and stringent post - surgical care were ensured. in the present study, it is documented that platelets begin to release their growth factors immediately, with almost 70% of the stored growth factors released within 10 min and 100% within the first hour of their activation. this could have accelerated the formation of an insoluble fibrin network, providing a scaffold for cell migration, proliferation and upregulation of collagen synthesis in extracellular matrix as per the healing model proposed by wilderman and wentz, thereby presenting a consistent probing depth throughout the study. in the present study, a statistically significant increase in width of keratinized gingiva in the sctg group (1.50 0.56 mm to 4.13 0.86 mm) was seen, as with the other studies in which an effort to fully cover the graft were made. a shortcoming with pcg was the quick dissolution of the carrier and shrinkage of the graft, which in turn failed to support and stabilize the overlying flap. this problem was compensated by stabilizing the flap margin 1 - 2 mm coronal to the cej. although the present study obtained significant root coverage in both the groups, in agreement with the results of the studies of cheung., the mean recession depth of these defects fall into the shallow recession category, which can contribute to the absence of a significant difference between the experimental groups. to the best of our knowledge, there has been no other study published where deeper recession defects have been treated with pcg. this could be one of the drawbacks of our study ; hence, further studies need to be carried out. the psdl values were recorded by asking the patients to rate their psdl on a visual analogue scale according to their subjective feelings. the difference in psdl was judged to be statistically significant for the sctg group (p = 0.002, p < 0.05) at 1 week follow - up, which can be attributed to the second surgical site in the sctg group. an aesthetic evaluation was performed in the treated sites at 12 months of follow - up, where the pcg group presented superior aesthetics, especially in terms of contour and texture, when compared with the sctg group, which might be attributed to accelerated early wound healing. in addition, thickness of tissue after surgery was more compatible with the adjacent tissue. within the limits of the study, both the pcg and the sctg techniques resulted in a significant amount of root coverage. the pcg technique required less time and was less invasive, resulting in better aesthetic outcomes with lower psdl values. although the clinical findings following pcg use need to be corroborated with histological observations and more long - term studies need to be conducted, this technique shows promise in the treatment of recession defects.	objective : the objective of this study was to clinically evaluate and compare the efficacy of platelet concentrate graft (pcg) with that of subepithelial connective tissue graft (sctg) using a coronally advanced flap technique in the treatment of gingival recession.materials and methods : twelve patients with a total of 24 gingival recession defects were selected and randomly assigned either to experimental site - a (sctg) or experimental site - b (pcg). the clinical parameters were recorded at baseline up to 12 months post - operatively and compared.results:the mean vertical recession depth (vrd) statistically significantly decreased from 2.50 0.48 mm to 0.54 0.50 mm with pcg and from 2.75 0.58 mm to 0.54 0.45 mm with sctg at 12 months. no statistically significant differences between the treatments were found for vrd and clinical attachment level (cal), while keratinized tissue width (ktw) gain was statistically significant.conclusion:both the sctg and the pcg group resulted in a significant amount of root coverage. the pcg technique was less invasive and required minimal time and clinical maneuver. it resulted in superior aesthetic outcome and lower post - surgical discomfort at the 12 months follow - up.
therefore, the current dentistry, which must be based on scientific evidences, has been searching for alternatives and new techniques on a regular and evolutionary basis. periodontics is a branch of dentistry that searches for solutions in the construction of the facial esthetics, in which the harmony between lips, teeth and gums is extremely important. lips define the esthetic zone of what is considered a smile frame. according to the literature, some aspects should be observed in order to rate each patient 's type of smile. the excessive gingival display when a patient smiles (from 4 mm or more), known as gummy smile, along with a short clinical crown of the maxillary anterior teeth characterize esthetic problems. there are different etiologies of gummy smile, such as : excessive vertical bone growth, dentoalveolar extrusion, short upper lip, upper lip hyperactivity, altered passive eruption and the combination of some of these factors. there is an adequate treatment for each kind of etiology, and two or more techniques can be associated. when gummy smile is caused by excessive gingival tissue partially covering the anatomical crown of the teeth (which is also caused by altered passive eruption), a resective gingival surgery (gingivoplasty) is recommended. thus, a surgical technique to position the gingival margin more apically should be planned, without exposing the root surface, observing the amount of keratinized gingiva and the relationship between the cement - enamel junction, the gingival margin and the alveolar bone crest. however, some cases are not solved only through gingival recontouring (gr) because the amount of gingival display on smile is still significant. in search of a more satisfactory result and a more harmonious smile, this study proposes to demonstrate a new surgical technique with the combination of gr + the traction and containment surgery of the elevator muscle of upper lip and wing of nose (emulwn). such a technique requires the knowledge of anatomy, location and insertions of the emulwn. in the literature, this muscle is described as being long and slender, extending from the frontal process of the maxilla at the level of the eye 's angle up to the upper lip. before it is inserted in the lip, the muscle sends fibers to the wing of the nose skin. then, it is divided into medial and lateral cords ; the lateral cord raises and everts the upper lip and raises, deepens and increases the curvature of the upper part of the nasolabial groove. the medial cord pulls the lateral branch superiorly, displaces the circumalar groove laterally and changes its curvature : it is a dilator of the nostrils. in the technique this surgical technique was first demonstrated in a corpse from the miami anatomical research center (marc) [figures 1 - 4 ]. this technique is considered a surgical innovation and has not been reported in the scientific literature yet. photo illustrating the vestibule of the upper arch in a human corpse (marc). anatomical details of the anterior third of the arch (keratinized gingiva and alveolar mucosa). vertical incision on the labial frenum and horizontal incisions on a superficial layer of the mucogingival line up to the height of the canines image after the divulsion and separation of the external epithelium from the mucosa with the use of goldman - fox scissors, exposing and pulling the lateral bundle of the elevator muscle of the upper lip and wing of nose bilaterally containment of the muscle bundles with an absorbable suture thread in the highest portion of the inserted gingiva on both sides sutures made with a 4 - 0 silk thread in the horizontal incisions and in the vertical incision on the labial frenum patient cm, a 30-year - old female, came to the clinic of specialty in periodontics at positivo university relating her dissatisfaction with her smile after the removal of a fixed orthodontic appliance, which she had worn for 2 years. on clinical examination, it was found that her periodontal condition was satisfactory, but she wanted to improve the esthetics of her smile because it showed too much of her gum [figure 5 ]. it was observed that, after the analysis of her facial thirds, which looked increased, the patient had too much gingival display while smiling, an extreme case of gummy smile measuring 7 mm from the gingival margin to the lower border of the upper lip [figure 6 ]. initial photo of the smile before the surgery measurement of the gummy smile, with the help of a periodontal probe, with 7 mm of gingival display a probing clinical depth with an average of 3 mm from the anterior teeth up to the second right and left maxillary premolars was detected through the use of a periodontal probe. the gr technique was an option given to the patient in order to eliminate these 3 mm. to soften the image of the remaining 4 mm - gum display when the patient smiled, a releasing technique to contain bilaterally the elevator muscle of upper lip and wing of the nose was chosen. firstly, the technique of gr was used under the effect of an infiltrative infraorbital anesthesia on both sides of the upper arch. the gingival groove was fully measured and marked in its maximum depths through the use of a periodontal probe in order to identify the homogeneity of the probing values. afterwards, a superficial delimitation joining the markings previously made was made with a scalpel blade 15. in addition, intrasulcular incisions were made in order to remove the gingival tissue that partially covered the anatomical crown of the teeth. a slight elevation of the flap was made with a molt periosteal elevator and the flap was kept in the keratinized gingiva in order to loosen the fibers and avoid the recurrence of the gingival margin on the crown of the teeth. the upper part of the inserted gingiva was fully preserved in order to support the sutures, which will contain the elevator muscle of upper lip and wing of nose. some suspensory sutures were made after the repositioning of the flap [figures 7 - 10 ]. markings of the depth of gingival sulcus with a periodontal probe or a crane kaplan probe. union of these markings with an internal bevel incision the excess of gingival tissue is removed with the use of an orban knife. note the significant increase of the dental crowns traction of the elevator muscle of the upper lip and wing of nose with an absorbable suture thread. sutures in a deep layer between the muscle and the upper portion of the keratinized gingiva continuous suture made with a 4 - 0 silk thread on the labial frenum and in between the mucosa and the keratinized gingiva subsequently, a vertical incision was made on the labial frenum and two more horizontal incisions were made on the mucogingival line, starting from the frenum incision up to the height of the canines. the flap was carefully divulsed with goldman fox scissors and also a curved hemostat, separating the external epithelium from the muscle bundle mucosa, on both sides, at the height of the lateral incisors and canines. with an absorbable suture thread, the elevator muscle of upper lip and wing of nose was pulled downwards, repositioning its bundle nearer the highest portion of the keratinized gingiva. simple sutures were made, as many as necessary, in order to contain the pulled muscle in this position. the procedure ended up with a continuous suture in the labial frenum and in the horizontal incisions with the use of a 4 - 0 silk suture thread. the external stitches should be removed in 10 - 15 days time [figure 11 ]. it was brought down to show less gingiva the esthetics of the smile showed an improvement at just 13 days post - surgery. the present study demonstrated a new surgical technique with the combination of gr + the traction and containment surgery of the emulwn. the objective was to reduce the shortening of the upper lip and, therefore, the lowering of the smile line toward a more esthetic height. through a simple ambulatory procedure, under local anesthesia, excellent results were achieved. as a result of the socio - economic development, the expectations of patients searching for esthetic treatments have undoubtedly become a challenging goal, especially because such expectations are often created from famous people 's esthetic standards. esthetic principles do not only follow dental parameters but also gingival parameters, and the ideal result is the integration of these factors with the person 's face and smile. it is important to assess the patients expectation and understanding of the possible therapeutic solutions as the result of such a treatment plan may not meet their expectation. in cases of a high or gummy smile, some cosmetic procedures are available and began to be studied in patients with facial paralysis since 1973. the technique described confronts existing techniques such as silicon implants on the bottom of the vestibule at the base of the anterior nasal spine, the infiltration of the botulinum toxin a and the resective procedures in the muscles that are responsible for the upper lip mobility ; these techniques also have favorable esthetic results. more recently, a lip repositioning surgery technique aimed to treat the excessive gingival display, removing a strip of outlined mucosa by a superficial split thickness dissection, leaving the connective tissue exposed. this procedure obtained 80% average reduction in gingival display considering only 6 months of follow - up. in the present study, the esthetic result remained for a 12-month follow - up. also, the elevator muscle of the upper lip and wing of nose is pulled downwards, repositioning its bundle nearer the highest portion of the keratinized gingiva, avoiding shortening of the vermillion length and mucocele formation. as the nasolabial musculature greatly influences the harmony and the smile esthetics, some authors, who have been researching it, reported the connection between the nasal septum muscle and the excessive upper lip lifting, operating on this muscle through a plastic surgery technique of containment, resulting in a visible reduction in the gummy smile. the technique reported in this article demonstrates that the containment of a muscle bilaterally is more efficient than the simple containment of the septum nasal depressor muscle, which is located in the center of the upper lip, resulting in better upper lip lowering. furthermore, the containment of the muscle can be carried out on just one side, correcting the cases of asymmetrical upper lip, when a patient lifts one side of the upper lip more than the other side while smiling that once the myotomy allows the muscle to reunite, the repositioning of the upper lip in a lower situation turns this muscle into a longer one. one of the objectives of this approach is to maintain the muscular action, as opposed to the injection of botulinum toxin type a. when the botulinum toxin is used, the septum nasal depressor muscle is paralyzed ; however, this technique has its drawbacks such as limited time of action and an undesired muscular blocking that can possibly cause unaesthetic effects. the surgical technique presented here may have a more traumatic post - operative period, but the result of it is undoubtedly more durable and esthetic. this specific case clearly showed satisfactory esthetic results, which, besides lowering the upper lip, provided the containment of it, preventing its eversion and keeping its original width when the patient smiled. the present study proposed to demonstrate a new surgical technique with the combination of gr + the traction and containment surgery of the emulwn. it appears that the treatment modality (myotomy) proposed by ishida. provides similar benefits in terms of gingival display reduction however, the surgery of rhinoplasties is a much more aggressive approach with irreversible outcomes and greater potential post - operative morbidity, such as paresthesia. also, dentists can easily perform the technique presented here with an intraoral access. the present study aimed to reduce the shortening of the upper lip and, therefore, the lowering of the smile line toward a more esthetic height. through a simple ambulatory procedure, under local anesthesia, regardless of the fact that gummy smile has many causes, this technique represents another therapeutic option in order for patients to obtain a more harmonious and natural smile. however, the patient needs follow - up for some years so that any risk of recurrence can be assessed, especially in cases of upper lip hyperactivity. thus, the containment surgery of the emulwn may prove to be a successful esthetic alternative. the esthetics is part of the current dentistry ; therefore, it is crucial to work in full knowledge of the biological principles that guide it in order to harmonize face and smile as well as maintaining periodontal health through the control of biofilm and the attention to a supportive periodontal therapy. the containment surgery of the muscle of upper lip and wing of nose should be considered as a possible treatment for gummy smile, and when this treatment is used in association with gr and other restorative treatments, the outcome is excellence in smile esthetics. it is necessary, however, to carry out a long - term follow - up of these cases in order to establish the effectiveness of this treatment in maintaining the height of the smile line for a long time.	the containment of the elevator muscle of the upper lip and wing of nose was used for the treatment of patients with gummy smile. this technique had corrected esthetic alterations of smile, reducing the upper lip elevation, which results in a smaller gingival display. an upper lip lengthening as well as a reduction in the upper lip shortening when the patient smiled could be observed. the high smile line was corrected without compromising the labial harmony. this study presents an innovative and effective therapeutic option to obtain a natural and harmonious smile. the patient expressed a high degree of satisfaction.
chest radiographs (cxrs) are routinely utilized to access changes in status of newborns and infants in the neonatal intensive care setting and often lead to changes in management. differences in image interpretation have been attributed to multiple factors including differences in the interpreters knowledge base, experience level, and access to the clinical scenario. inconsistent radiograph image quality due to patient movement, exposure setting alterations, and low lung volumes are a few of the many variables limiting assessment, and many researchers have demonstrated significant inter - observer variability in interpretation. the advent of picture archiving and communication system (pacs) has allowed the user to manipulate the images by altering the brightness (window level) and/or contrast (window width) of each radiograph while developing their impression. this manipulation will vary the appearance of the radiograph, and in effect, each user will be basing their impression on their own uniquely obtained image. this resulting image will be different from the image that their colleagues will generate to help them come to their impression. the purpose of this study is to determine the agreement of cxr impressions among radiologists and neonatologists and help determine the effect of image manipulation with pacs on reported diagnosis. the study was approved by the university and affiliated teaching hospitals research ethics board (reb), and patient informed consent was waived by the reb. this prospective cohort study included 60 nonconsecutive patients from the neonatal intensive care unit (nicu) (age range : 1 day to 3 months ; 34 females, 26 males ; gestational age range : 2632 weeks) who had undergone cxrs as part of their routine care during a 3-month period in 2011. patients included in the study had cxrs performed on variable days during their stay in the nicu. all patients had an underlying history of surfactant deficiency disease with follow - up radiographs ordered due to a concern of disease progression respiratory status. images in which the cxr was combined with the abdomen were excluded from the study as well. the radiographs were obtained using 60 kvp and 1.5 mas, the standard technique in the department. the sixty sets of frontal cxrs, each consisting of one previous and one recent examination, totaling 120 cxrs, were randomly placed as acquired into two identical viewers on pacs (ge centricity 3.2, ge healthcare it, barrington, illinois, usa) used in the imaging department. the normally scanned requisition for the study was not included and each set of radiographs was sequentially numbered from1a / b to 60a / b. the previous or earlier study was placed to the right of the most recent study as per the department 's usual routine. three radiologists with a median length of expertise of 14 years (range : 525 years) along with three neonatal intensive care unit (nicu) physicians with a median length of expertise of 16 years (range : 225 years), each reviewed all 60 sets of frontal chest images in each of the two viewers. each interpreter was instructed to provide a solitary impression of overall improved, no change, or disease progression each interpreter reviewed the 60 sets of cases in one viewer in their usual manner with manual windowing / manipulation as judged needed. each interpreter (neonatologist or radiologist) reviewed the 60 sets of cases within the second viewer after an independent person (a radiologist) performed image windowing and contrast adjustment to best optimize the cxr appearance and to best match appearance with the previous study performed on that patient. the interpreters were not allowed to independently manipulate the appearance of the cxrs in this second viewer to come to their impression of whether the recent examination was improved, disease progression, or unchanged. three interpreters began their review of the radiographs in the first viewer and the other three interpreters began with the second viewer. the time span between full review of the radiographs in one viewer and the completion of assessment of the radiographs in the other viewer ranged from 1 to 12 days. percent agreement was calculated between all six observers and separately for radiologists and neonatologists, for each of the two methods used in determining their impressions (allowing image manipulation / windowing and not allowing image manipulation / windowing). similarly, the percent reporting opposing views, i. e., improved versus disease progression and vice versa, was calculated. statistical significance was assessed using chi - square test ; the magnitude of the difference in agreement and opposition between manipulated and nonmanipulated impressions was assessed using relative risk (rr) and 95% confidence intervals (ci). the within observer kappa and the percent agreement, opposing, and unchanged impressions between manipulated and nonmanipulated methods were calculated. armonk, ny : ibm corp.) and microsoft excel were used to conduct the analysis. this prospective cohort study included 60 nonconsecutive patients from the neonatal intensive care unit (nicu) (age range : 1 day to 3 months ; 34 females, 26 males ; gestational age range : 2632 weeks) who had undergone cxrs as part of their routine care during a 3-month period in 2011. patients included in the study had cxrs performed on variable days during their stay in the nicu. all patients had an underlying history of surfactant deficiency disease with follow - up radiographs ordered due to a concern of disease progression respiratory status. images in which the cxr was combined with the abdomen were excluded from the study as well. the radiographs were obtained using 60 kvp and 1.5 mas, the standard technique in the department. the sixty sets of frontal cxrs, each consisting of one previous and one recent examination, totaling 120 cxrs, were randomly placed as acquired into two identical viewers on pacs (ge centricity 3.2, ge healthcare it, barrington, illinois, usa) used in the imaging department. the normally scanned requisition for the study was not included and each set of radiographs was sequentially numbered from1a / b to 60a / b. the previous or earlier study was placed to the right of the most recent study as per the department 's usual routine. three radiologists with a median length of expertise of 14 years (range : 525 years) along with three neonatal intensive care unit (nicu) physicians with a median length of expertise of 16 years (range : 225 years), each reviewed all 60 sets of frontal chest images in each of the two viewers. each interpreter was instructed to provide a solitary impression of overall improved, no change, or disease progression each interpreter reviewed the 60 sets of cases in one viewer in their usual manner with manual windowing / manipulation as judged needed. each interpreter (neonatologist or radiologist) reviewed the 60 sets of cases within the second viewer after an independent person (a radiologist) performed image windowing and contrast adjustment to best optimize the cxr appearance and to best match appearance with the previous study performed on that patient. the interpreters were not allowed to independently manipulate the appearance of the cxrs in this second viewer to come to their impression of whether the recent examination was improved, disease progression, or unchanged. three interpreters began their review of the radiographs in the first viewer and the other three interpreters began with the second viewer. the time span between full review of the radiographs in one viewer and the completion of assessment of the radiographs in the other viewer ranged from 1 to 12 days. percent agreement was calculated between all six observers and separately for radiologists and neonatologists, for each of the two methods used in determining their impressions (allowing image manipulation / windowing and not allowing image manipulation / windowing). similarly, the percent reporting opposing views, i. e., improved versus disease progression and vice versa, was calculated. statistical significance was assessed using chi - square test ; the magnitude of the difference in agreement and opposition between manipulated and nonmanipulated impressions was assessed using relative risk (rr) and 95% confidence intervals (ci). the within observer kappa and the percent agreement, opposing, and unchanged impressions between manipulated and nonmanipulated methods were calculated. armonk, ny : ibm corp.) and microsoft excel were used to conduct the analysis. overall, there was more agreement in cxr interpretations when images could not be manipulated. one hundred percent agreement in image impression (whether thought to be improved, disease progression or unchanged) between all six observers (three radiologists, three neonatologists) was only seen in 3 of the 60 cases (5%) when allowing image manipulation while 100% agreement was seen in 8 of the 60 cases (13%) when there was no manipulation of the images allowed (chi - square = 2.5, p = 0.11) [table 1 ]. hence, the clinicians were 2.9 times more likely (95% ci 0.7, 14.8) to agree on image impressions when no manipulation of the images was permitted. there was 100% agreement between all three radiologists in 21 of the 60 cases (35%) when there was independent manipulation and 25 of the 60 cases (42%) without image manipulation (rr = 1.3, 95% ci 0.63.0). there was 100% agreement between all three nicu physicians in 8/60 (13%) of cases with independent manipulation and 18/60 (30%) of the cases when no manipulation was allowed (rr = 2.8, 95% ci 1.07.8). overall, there were fewer opposing radiograph impressions when image manipulation was not allowed as compared to when manipulation / windowing was permitted [table 1 ]. there were opposing image impressions (improved versus disease progression, vice versa) between all six interpreters in 37/60 (62%) of manipulated images and 29/60 (48%) of cases with no manipulation of images, resulting in a 40% decrease in opposing impressions when images could not be manipulated (rr = 0.6, 95% ci 0.31.3). radiologists were less likely to report opposing impressions between the two methods compared to the neonatologists. among the three radiologists, there were opposing impressions in 17/60 (28%) with manipulation and 12/60 (20%) with no manipulation of images (rr = 0.6, 95% ci 0.31.6). with the nicu physicians, there were opposing impressions in 24/60 (40%) with manipulation and 11/60 (18%) when no manipulation was allowed (rr = 0.3, 95% ci 0.10.8). assessment of sixty sets of frontal chest radiographs without versus with the ability of to manually manipulate the images radiologists were 3.5 times more likely than neonatologists to have 100% agreement on radiograph impressions when they had the ability to manipulate the image (95% ci 1.39.7) [table 2 ]. radiologists were also 1.7 times more likely to have 100% agreement on image interpretation when manipulation was not allowed (rr = 1.7, 95% ci 0.73.8) and 0.6 times less likely to have opposing impressions when manipulation was permitted (rr = 0.6, 95% ci 0.31.4). however, in some instances, the results were not statistically significant, primarily due to the small number of clinicians involved. assessment of 60 sets of frontal chest radiographs with and without the ability to manually manipulate the images : radiologists versus neonatologists cxr interpretation is a routine essential requirement in the daily care of patients, particularly important in the nicu setting. changes in the radiographic appearance result in a change in management in a significant percentage of patients. this has led to potential solutions such as double and triple reading of studies which are both costly and time - consuming. more recent research has shown even less inter - observer agreement on digital compared to analog studies. numerous factors can contribute to poor image quality, such as patient and cassette positioning, exposure techniques, body habitus, and motion, and the radiographic images obtained are often suboptimal. these variations in image quality and appearance often result in the interpreting clinician attempting to optimize the appearance by manipulating / windowing the image on pacs. the effect of this independent, individualized ability to manipulate the radiographic images has not been well documented. our study demonstrates an adverse effect in regards to the agreement in image interpretation when manipulation on pacs system is performed. the poorer inter - rater agreement was more significant among the nicu physicians, possibly due to less experience in image manipulation as compared to the radiologists who perform these maneuvers on a daily basis. the study also demonstrates overall poor agreement in image interpretation which has been shown in the medical literature. particularly, concerning is the percentage of opposing radiograph impressions which could result in significant changes to patient care and outcome. the ability to manipulate the appearance of the cxr images on pacs led to an increase in opposing interpretations in our study and raised the question of whether clinicians access to image windowing / manipulation is of benefit to the patient. access to pacs and the ability to manipulate radiographic images independently by health care providers have increased in most hospital and patient care systems lately. this has been found to be very beneficial in regards to access data and patient radiographs ; however, the potential disadvantages have not been elucidated. further studies to demonstrate the impact on patient care and hospital costs are needed to help guide future endeavors by researchers, hospitals, and industry to improve our consistency in image interpretation. novel and improved methods are needed to optimize image quality and allow for more reliable and consistent interpretation and comparison of radiographs. a pitfall of the study is the lack of a gold standard in the diagnosis of the radiograph abnormality. the study was designed to assess agreement between interpreters ; therefore, accuracy per se was not deemed pertinent. all interpreters were specialists in their fields who routinely accessed the pacs as part of their daily routine of caring for patients. the inter - observer variability was thus regarded as a limitation of the test itself and not related to radiologist / neonatologist expertise. the dictating of the 60 sets of cxrs may have allowed for some patient recognition, and potential bias, although the lack of patient identification, the similar appearance of these types of studies and the alternating use of viewers are thought to have minimized this problem. a pitfall of the study is the lack of a gold standard in the diagnosis of the radiograph abnormality. the study was designed to assess agreement between interpreters ; therefore, accuracy per se was not deemed pertinent. all interpreters were specialists in their fields who routinely accessed the pacs as part of their daily routine of caring for patients. the inter - observer variability was thus regarded as a limitation of the test itself and not related to radiologist / neonatologist expertise. the dictating of the 60 sets of cxrs may have allowed for some patient recognition, and potential bias, although the lack of patient identification, the similar appearance of these types of studies and the alternating use of viewers are thought to have minimized this problem. agreement in cxr interpretation is poor, with conflicting impressions common with both neonatologists and radiologists. the ability to manipulate the images on pacs has resulted in a decrease in agreement in the interpretation of these studies. new methods to standardize image appearance and allow improved comparison with previous studies should be sought to improve clinician agreement in interpretation consistency and advance patient care.	objective : variability in image interpretation has been attributed to differences in the interpreters knowledge base, experience level, and access to the clinical scenario. picture archiving and communication system (pacs) has allowed the user to manipulate the images while developing their impression of the radiograph. the aim of this study was to determine the agreement of chest radiograph (cxr) impressions among radiologists and neonatologists and help determine the effect of image manipulation with pacs on report impression.materials and methods : prospective cohort study included 60 patients from the neonatal intensive care unit undergoing cxrs. three radiologists and three neonatologists reviewed two consecutive frontal cxrs of each patient. each physician was allowed manipulation of images as needed to provide a decision of improved, unchanged, or disease progression lung disease for each patient. each physician repeated the process once more ; this time, they were not allowed to individually manipulate the images, but an independent radiologist presets the image brightness and contrast to best optimize the cxr appearance. percent agreement and opposing reporting views were calculated between all six physicians for each of the two methods (allowing and not allowing image manipulation).results : one hundred percent agreement in image impression between all six observers was only seen in 5% of cases when allowing image manipulation ; 100% agreement was seen in 13% of the cases when there was no manipulation of the images.conclusion:agreement in cxr interpretation is poor ; the ability to manipulate the images on pacs results in a decrease in agreement in the interpretation of these studies. new methods to standardize image appearance and allow improved comparison with previous studies should be sought to improve clinician agreement in interpretation consistency and advance patient care.
the sensation of pain accompanies the majority of human diseases, alerting the body to the presence of harmful stimuli. pain may be modulated by a series of behavioral events, since, in addition to transmission of the stimulus that is causing the pain, the process also involves different emotional, environmental, and cognitive factors [2, 3 ]. nociception involves activating sensorial neurons that transmit the nociceptive stimulus at spinal and supraspinal levels [4, 5 ]. furthermore, following tissue damage, nociceptors are activated through the release of various mediators such as excitatory amino acids, protons, peptides, and cytokines that, in turn, act on specific receptors, activating various signaling cascades, which will result in the nociceptor membrane depolarization through the activation of second messengers or the sodium or calcium entry into the cell [3, 68 ]. substances that are able to block these signal pathways, both at central and peripheral levels, represent important tools for pain control. the current pharmacological treatment of pain consists in three main groups : central analgesics (opioids), peripheral analgesics (nonsteroidal antiinflammatory drugs - nsaids), and adjuvant drugs (antidepressants, anticonvulsants, and local anesthetics) [10, 11 ]. reactive oxygen species (ros) and reactive nitrogen species (rns) are involved in various physiological and pathological processes, including inflammation and pain. ros / rns production and their strong chemical reactivity with biomolecules such as proteins, lipids, and dna may result in some harmful alterations such as the destruction of cell membranes by lipid peroxidation and dna denaturation, leading to changes in protein synthesis and cell duplication. medicinal plants contain a variety of bioactive compounds such as terpenes, which are composed of essential oils [1416 ]. the terpenoids found in the greatest abundance in essential oils are the monoterpenes and the sesquiterpenes ; however, diterpenes may be present when the essential oils are extracted using organic solvents. various studies have shown a possible association between the antinociceptive and antioxidant properties of a substance. in this respect, various compounds of vegetable origin found in abundance in nature have been evaluated. the terpenes with confirmed antinociceptive and antioxidant properties include the monoterpenes carvacrol and citronellal, as well as the diterpene and rographolide. phytol (3,7,11,15-tetramethylhexadec-2-en-1-ol) is a diterpene, a member of the group of branched - chain unsaturated alcohols (figure 1) [20, 21 ]. it is the product of chlorophyll metabolism in plants ; hence, phytol is abundantly available in nature. phytol is known to inhibit the growth of staphylococcus aureus and to block the teratogenic effects of retinol. nevertheless, no reports have been published describing the effect of phytol on the central nervous system (cns). therefore, the objective of the present study was to characterize the antinociceptive activity of phytol using in vivo animal models and to evaluate its antioxidant activity in vitro. dr. thomas george laboratory of the federal university of paraiba and were subsequently separated into groups of 8 animals. the animals were kept under standard environmental temperature conditions (21 1c) with 12-hour light / dark cycles (lights on at 6:00 am) and with access to food and water ad libitum until 1 hour prior to the experimental procedures. all the experimental protocols were approved by the committee for the care and use of animals of the federal university of paraiba (approval number 0104/11) and were conducted in accordance with the current guidelines for the care of laboratory animals and with the ethical guidelines for studies on experimental pain in conscious animals. the number of animals and the intensity of the noxious stimuli used were the minimum required to demonstrate the consistent effects of treatment with the drugs under evaluation. the following drugs were used : 2-deoxyribose, acetic acid, aaph (2,2-azobis[2-methylpropionamidine]dihydrochloride), diazepam, formalin, griess reagent, hydrogen peroxide, indomethacin, morphine, phosphate buffer, sodium nitroprusside, thiobarbituric acid (tba), thiobarbituric acid reactive species (tbars), trichloroacetic acid, trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid), and phytol (97% pure) (figure 1). the presence of abdominal contortions induced by an intraperitoneal injection of acetic acid was considered nociceptive behavior, characterized by abdominal muscle contractions followed by stretching of the hind limbs [25, 26 ]. for this experiment, groups of 8 mice received the following types of pretreatment : vehicle, phytol at the doses of 25, 50, 100, and 200 mg / kg, indomethacin (10 mg / kg), or morphine (10 mg / kg). thirty minutes after pretreatment, the animals received intraperitoneal injections of a 0.85% solution of acetic acid (0.1 ml/10 g) and were then placed in individual polyethylene boxes. five minutes later, the number of abdominal contortions was recorded during a 10-minute observation period. a significant reduction in the number of contortions compared to the group treated with vehicle alone was considered to constitute an antinociceptive response [2830 ]. the formalin test was conducted in a similar manner to that described by hunskaar and hole. in this test, a formalin solution is injected into the subplantar region of the animal 's paw, provoking stimulation of nociceptors. the nociceptive response consists of two phases, the first normally occurring in the first five minutes following the formalin injection (neurogenic response) and the second phase occurring 1530 minutes after the formalin injection (inflammatory response). groups of 8 mice were used in this experiment and received the following types of pretreatment : vehicle (control group), phytol (25, 50, 100, and 200 mg / kg), morphine (10 mg / kg), or indomethacin (10 mg / kg). thirty minutes later, 20 l of a 2.5% formalin solution (0.92% formaldehyde in saline solution) was injected into the subplantar region of the right hind paw of each mouse. these animals were then placed in the observation boxes, and the total time that the animals spent licking the paw in which the formalin injection was given was recorded during the first five minutes (first phase) and from 15 minutes to 30 minutes following the injection (second phase). antinociception was defined as a reduction in paw - licking time compared to the control group [26, 33 ]. this method, first described by woolfe and macdonald, consists of quantifying the reaction time to the thermal stimulus caused by a plate heated to a temperature of 53 1c, based on a pain threshold that, depending on the type of fiber, ranges from 43 to 53c. nociception is classified as present when the animal raises (an attempt to jump) or licks one of its hind paws [10, 33 ]. the animals that spent more than 15 seconds on the hot plate (model 7406, le, letica scientific instruments, panlab s.l., the mice were divided into groups of 8 animals each and treated with vehicle (0.1 ml/10 g), phytol at the doses of 25, 50, 100, and 200 mg / kg, and morphine (10 mg / kg) intraperitoneally. the evaluations were carried out at intervals of 30, 60, and 120 minutes after the respective treatments. the animals were left on the plate for a maximum of 30 seconds to avoid tissue lesions [10, 35 ]. this procedure was first described by dunham and miya and is used to detect motor incoordination caused by pharmacological agents such as muscle relaxants or drugs that depress the central nervous system. the rotarod device consists of a rod of 35 cm in length and 54 cm in width that rotates at an adjustable speed at a height of 45 cm. it is separated into four equal segments by plastic discs (insight, model eff 412). the animals were first screened without the administration of any substances, the selection criterion being to remain on the rotating rod of the device at a constant speed of 7 rotations per minute (7 rpm) for at least three minutes [38, 39 ]. twenty - four hours after screening, the selected mice were divided into groups of 8 animals each. the total time during which they remained on the rod was evaluated, in up to three repetitions, for three minutes, at different time intervals (30, 60, and 120 minutes) following an intraperitoneal injection of phytol (25, 50, 100, and 200 mg / kg), diazepam (4 mg / kg), or vehicle. a tbars assay was used to quantify lipid peroxidation in vitro, and an adapted tbars method was used to measure the antioxidant capacity of phytol in vitro using egg yolk homogenates as a lipid - rich substrate. briefly, egg yolk was homogenized (1% w / v) in 20 mm phosphate buffer (ph 7.4), and 1 ml of homogenate was sonicated and then homogenized with 0.1 ml of phytol at different concentrations. lipid peroxidation was induced adding 0.1 ml of aaph solution (0.12 m). the control group received only the vehicle (0.05% tween 80 dissolved in 0.9% saline solution). samples (0.5 ml) were centrifuged with 0.5 ml of trichloroacetic acid (15%) at 1200 g for 10 minutes. an aliquot of 0.5 ml of the supernatant was mixed with 0.5 ml thiobarbituric acid (tba) (0.67%) and heated at 95c for 30 minutes. after cooling, absorbance of the samples was measured on a spectrophotometer at 532 nm. the results were expressed as the percentage of tbars formed by aaph alone (induced control). the formation of oh (hydroxyl radical) by fenton 's reaction was quantified using 2-deoxyribose oxidative degradation. the principle of the assay is quantification of the 2-deoxyribose degradation product, malondialdehyde, through its condensation with 2-thiobarbituric acid (tba). briefly, typical reactions were triggered by adding fe (final concentration of 6 mm feso4) to solutions containing 5 mm 2-deoxyribose, 100 mm h2o2, and 20 mm phosphate buffer (ph 7.2). to measure the antioxidant activity of phytol against hydroxyl radicals, different concentrations of phytol were added to the system before the addition of fe. reactions were carried out for 15 minutes at room temperature and were stopped by adding 4% phosphoric acid (v / v) followed by 1% tba (w / v, in 50 mm naoh). absorbance was measured at 532 nm, and results were expressed as mda equivalents formed by fe and h2o2. nitric oxide was generated from the spontaneous decomposition of sodium nitroprusside in 20 mm phosphate buffer (ph 7.4). once generated, no interacts with oxygen to produce nitrite ions, which were measured using the griess reaction. the reaction mixture (1 ml) containing 10 mm sodium nitroprusside (snp) in phosphate buffer and phytol at different concentrations a 0.5 ml aliquot was taken and homogenized with 0.5 ml griess reagent. the extent to which the nitric oxide generated was inhibited was measured by comparing the absorbance values of negative controls (only 10 mm sodium nitroprusside and vehicle) and assay preparations. the data obtained are reported as means sem and were evaluated using one - way analysis of variance followed by dunnett 's test or student 's t - test followed by the neuman - keuls test. data were analyzed using the graphpad prism software version 5.01 (19922007, graphpad software inc.). the percentage of inhibition by an antinociceptive agent was determined using the following formula : (1)%inhibition=[(controlexperiment)control]100. phytol (25, 50, 100, and 200 mg / kg, i.p.) significantly reduced the number of abdominal contortions induced by acetic acid in mice compared to the control group, with 81.7%, 95.4%, 100%, and 100% of inhibition, respectively, (p 0.05). as shown in figure 5, phytol (0.9, 1.8, 3.6, 5.4, and 7.2 ng / ml) resulted in the removal of hydroxyl radicals at all the concentrations tested compared to the control group. the 0.9 ng / ml concentration of phytol led to an increase in the removal of hydroxyl radicals of 9.66% and 8.62% compared to the 5.4 and 7.2 ng / ml concentrations, respectively. the 1.8 ng / ml concentration of phytol resulted in an increase in the removal of the hydroxyl radicals of 6.69%, 12.84%, and 11.80% compared to the concentrations of 3.6, 5.4, and 7.2 ng / ml, respectively. phytol (0.9, 1.8, 3.6, 5.4, and 7.2 ng / ml) was able to reduce nitrite production at all the concentrations evaluated, as shown in figure 6. trolox, a synthetic analog of -tocopherol used as a standard antioxidant, reduced nitrite production by 59.76%. the 7.2 ng / ml concentration of phytol no led to an increase in the removal of nitrite production when compared to the 0.9, 1.8, 3.6, and 5.4 ng / ml concentrations, respectively, (p > 0.05). the results of this study showed that phytol has an antinociceptive effect in several models of nociception as well as antioxidant properties against free radicals generated in vitro. in our study, we used chemical (acetic acid and formalin tests) and thermal (hot plate test) models of nociception in mice to investigate the antinociceptive effect of phytol. the use of multiple models is essential for the detection of the antinociceptive properties of a substance, since stimuli different types of pain reveal the antinociceptive profile of the drug [46, 47 ]. the test of abdominal contortions induced by acetic acid is described as a classic model of inflammatory visceral nociception and is widely used as a pharmacological tool for the evaluation of new agents with analgesic and/or anti - inflammatory properties. it is a simple and very sensitive method, since it is able to detect the antinociceptive effect of central (opioids) and peripheral (nsaids) analgesics, muscle relaxants, and sedatives [4850 ]. at the cell level, the protons resulting from dissociation of acetic acid depolarize sensory neurons by interacting with acid - sensitive ion channels (asics) or indirectly by promoting of the release of several inflammatory mediators (prostaglandins, histamine, substance p, among others) [1, 3 ], stimulating primary afferent neurons to increase release of glutamate and aspartate. in addition, the nociception caused by acetic acid is associated with increased production of lipoxygenase in the peritoneal cavity, which promotes the stimulation of primary sensory c fibers [49, 52, 53 ]. our results showed that phytol produces an inhibition of nociception in mice by significantly reducing the number of abdominal contortions. the results also showed that the drugs used as standard, indomethacin and morphine, caused a significant inhibition of this parameter. although these results may suggest a powerful antinociceptive effect of phytol, this test alone is unable to demonstrate whether the antinociception was central or peripheral. the formalin test, which consists of a biphasic model of nociception, was used to assess the mechanism by which an animal responds to continuous nociception generated by tissue damage [50, 54 ]. the data obtained show that phytol suppressed both phases in the formalin test, and the effect being more pronounced in the second phase, which suggests that phytol has both central and peripheral antinociceptive activity and may be associated with an anti - inflammatory effect. furthermore, we demonstrated that morphine inhibited both phases, whereas indomethacin inhibited only the second phase. to provide a confirmation of the central antinociceptive effect of phytol, we used the hot plate test, since this test is sensitive and specific for drugs that act through a central mechanism [5557 ], while peripherally acting analgesics are inactive [47, 58 ]. the results indicate that phytol in the tested doses increased reaction time (latency) to the thermal stimulus. thus, the increase in nociceptive threshold of mice treated with phytol along with the reduction of nociception in the first phase of the formalin test revealed strong evidence of its antinociceptive activity mediated by central mechanisms. in doses tested, there was no prejudice to the locomotor performance of animals. the antioxidant activity of phytol was also investigated in this study, since there is a relationship between these two activities, as demonstrated by guimares.. several lines evidence indicate that oxidative stress has a crucial role in signaling of nociception and is involved in the process of pain (neuropathic and inflammatory) [59, 60 ]. from the in vitro methods used, we showed that phytol was able to reduce the production of free radicals, and this activity can be attributed to their structural feature, since phytol is a branched - chain unsaturated alcohol and its antioxidant properties may be related to the hydroxyl group (oh) present in its molecule. probably, phytol, by reacting with a free radical, donates hydrogen atoms with an unpaired electron (h), converting free radicals into less reactive species [17, 61 ]. the antioxidant activity was evaluated by tbars assay that is a method used to quantify lipid peroxidation, which corresponds to a cell membrane damage caused by oxidative stress. its decomposition produces molecular nitrogen and carbonyl radicals, which in turn react with thiobarbituric acid, resulting in the formation of tbars [13, 6264 ]. phytol, at all concentrations tested, was able to prevent lipid peroxidation by inhibiting the amount of tbars formed. similar results were obtained with trolox, a synthetic analogue of -tocopherol, used as standard antioxidant. this result suggests that phytol can exert an antioxidant activity that protects the lipid biomolecules. scavenger assay is a method widely used to evaluate the antioxidant activity of a substance based on the ability scavenger of free radicals formed in less reactive species. the oh is an extremely reactive species capable of causing damage to dna, proteins, and lipids [64, 6668 ]. in our study, we demonstrated that phytol produced the removal of oh, exhibiting antioxidant activity which may be capable of inhibiting cell damage caused by this radical. this method is based on the production of no from the decomposition of sodium nitroprusside in aqueous solution. no, in turn, interacts with oxygen to produce nitrite ions, which have strong oxidizing power, reacting with various biological molecules, which leads to cell damage [17, 69 ]. substances with acting no - scavenger compete with oxygen, leading to reduced production of nitrite, characterizing the antioxidant activity [64, 70 ]. in this study, phytol significantly decreased the production of nitrite, demonstrating once again its antioxidant property against damage caused by free radicals. several studies show that inhibition of reactive oxygen (ros) and reactive nitrogen (rns) species may be associated with control of the central and peripheral sensitization in various pain states [17, 71 ]. the results suggest that phytol at concentrations tested is most efficient in removal of the hydroxyl radical, and once produced, a great reduction on formation of this free radical increased significantly in function of concentration tested and when compared to antioxidants effects against the tbars and nitrite levels. therefore, the results obtained in this study demonstrate that phytol produces antinociceptive activity in mice, suggesting central and peripheral effect, without changing the motor function of animals. the antinociceptive activity may be associated with the antioxidant activity of phytol as demonstrated by in vitro methods used. therefore, the results obtained in this study demonstrate that phytol produces antinociceptive activity in mice, suggesting central and peripheral effect, without changing the motor function of animals. the antinociceptive activity may be associated with the antioxidant activity of phytol as demonstrated by in vitro methods used. more studies are needed to elucidate the possible action mechanisms that mediate the central and peripheral antinociception, as well as the antioxidant activity of phytol against other free radical generating systems and with other different concentrations of this diterpene evaluated in this study, since the concentrations tested were more efficient in removing the hydroxyl radical.	the objective of the present study was to evaluate the antinociceptive effects of phytol using chemical and thermal models of nociception in mice and to assess its antioxidant effects in vitro. phytol was administered intraperitoneally (i.p.) to mice at doses of 25, 50, 100, and 200 mg / kg. in the acetic acid - induced writhing test, phytol significantly reduced the number of contortions compared to the control group (p < 0.001). in the formalin test, phytol reduced significantly the amount of time spent in paw licking in both phases (the neurogenic and inflammatory phases), this effect being more pronounced in the second phase (p < 0.001). phytol also provoked a significant increase in latency in the hot plate test. these antinociceptive effects did not impaire the motor performance, as shown in the rotarod test. phytol demonstrated a strong antioxidant effect in vitro in its capacity to remove hydroxyl radicals and nitric oxide as well as to prevent the formation of thiobarbituric acid reactive substances (tbars). taken as a whole, these results show the pronounced antinociceptive effects of phytol in the nociception models used, both through its central and peripheral actions, but also its antioxidant properties demonstrated in the in vitro methods used.
the calcium ion (ca) is a ubiquitous intracellular messenger during and immediately after an ischemic period, and it influences the cascade of events that lead to subsequent neuronal injury.1 under ischemic conditions, release of glutamate from the neurons and glia activates the n - methyl - d - aspartate (nmda) receptor and triggers the rapid translocation of ca from extracellular to intracellular spaces in cerebral tissues.2,3 experimental results indicate that ca can have a harmful effect on neurons under acute ischemic conditions. the harmful effects of ca have been studied in regard to its relationship with prevention of neuronal injury in acute ischemia. one small - scale study showed a significant reduction in mortality and neurological impairment after the administration of nimodipine (a calcium antagonist).4 furthermore, collective results suggest that early therapy with oral nimodipine favorably influences the course of acute ischemic stroke.5 in contrast to a previously held belief,6,7 recent studies suggest that elevated serum calcium levels within 24 hours of stroke onset are associated with smaller infarction volumes and better clinical outcomes after hospital discharge.8,9 interestingly, appel. reported that serum calcium levels at both extremes are associated with greater mortality, and noted optimal long - term survival for a distinct range of serum calcium levels.10 in this study, based on the physiologic character of ca in ischemic conditions, we hypothesized that elevated levels of serum calcium and albumin - corrected calcium may be associated with a poor outcome after stroke in terms of neurologic severity at discharge and mortality. acute stroke patients admitted to seoul national university hospital between october 2002 and september 2008 within 7 days of symptom onset were identified from a prospective stroke registry database, and analyzed for this study. the information collected from each patient included stroke subtype as classified by the trial of org 10172 in acute stroke treatment (toast) criteria,11 the national institutes of health stroke scale (nihss) score at the time of admission, thrombolytic treatment during the hyperacute period, and the modified rankin scale (mrs) score at discharge (the latter was used as a measure of early functional outcome after stroke). the institutional review board approved the study despite the absence of patient consent due to its retrospective nature and minimal risk to participants [irb no. this included gender, age, height, body weight, and vascular risk factors such as hypertension (previous use of antihypertensive medication and systolic blood pressure > 140 mmhg or diastolic blood pressure > 90 mmhg at discharge), diabetes (previous use of a glucose - lowering medication and fasting blood glucose > 7 mmol / l or postprandial blood glucose after 2 hours > 11.1 mmol / l at discharge), hyperlipidemia (previous use of a lipid - lowering medication and total cholesterol > 6.0 mmol / l or low - density lipoprotein cholesterol > 4.14 mmol / l at discharge), and current smoking.12,13,14 we also collated patient laboratory data, which included serum levels of glucose, hemoglobin a1c, total cholesterol, high - density lipoprotein cholesterol, triglycerides, low - density lipoprotein, albumin, and calcium. albumin - corrected calcium levels were calculated using the formula : albumin corrected calcium (mg / dl) = serum calcium (mg / dl) + 0.8 [4-serum albumin (g / dl)].15 the vital status of the participants was ascertained using data obtained from statistics korea, a governmental statistical office that manages demographic statistics in korea, which has been used and considered as reliable data in previous studies.16,17 differences between the groups were analyzed using the test for categorical variables and the student t - test or the mann - whitney u test for continuous variables. to test for significant associations between mrs distribution at discharge and serum levels of calcium or albumin - corrected calcium, ordinal logistic regression analyses was used, taking the 6 categorized mrs score (i.e., mrs scores 5 and 6 combined) as a dependent variable under the assumption of proportional odds. in addition, cox proportional hazard models were constructed to test the effects of serum calcium or albumin - corrected calcium levels on mortality after stroke. for ordinal logistic regression models and cox proportional hazard models, adjusted variables with p values 9.2 for calcium and t1 9.28 for albumin - corrected calcium), and the tertiles were chosen based on sample size. serum calcium and albumin - corrected calcium levels were analyzed as continuous data in model 2. values have been presented as frequencies (percentages), meansstandard deviations, or medians [interquartile ranges (iqr) ], as appropriate. acute stroke patients admitted to seoul national university hospital between october 2002 and september 2008 within 7 days of symptom onset were identified from a prospective stroke registry database, and analyzed for this study. the information collected from each patient included stroke subtype as classified by the trial of org 10172 in acute stroke treatment (toast) criteria,11 the national institutes of health stroke scale (nihss) score at the time of admission, thrombolytic treatment during the hyperacute period, and the modified rankin scale (mrs) score at discharge (the latter was used as a measure of early functional outcome after stroke). the institutional review board approved the study despite the absence of patient consent due to its retrospective nature and minimal risk to participants [irb no. this included gender, age, height, body weight, and vascular risk factors such as hypertension (previous use of antihypertensive medication and systolic blood pressure > 140 mmhg or diastolic blood pressure > 90 mmhg at discharge), diabetes (previous use of a glucose - lowering medication and fasting blood glucose > 7 mmol / l or postprandial blood glucose after 2 hours > 11.1 mmol / l at discharge), hyperlipidemia (previous use of a lipid - lowering medication and total cholesterol > 6.0 mmol / l or low - density lipoprotein cholesterol > 4.14 mmol / l at discharge), and current smoking.12,13,14 we also collated patient laboratory data, which included serum levels of glucose, hemoglobin a1c, total cholesterol, high - density lipoprotein cholesterol, triglycerides, low - density lipoprotein, albumin, and calcium. albumin - corrected calcium levels were calculated using the formula : albumin corrected calcium (mg / dl) = serum calcium (mg / dl) + 0.8 [4-serum albumin (g / dl)].15 the vital status of the participants was ascertained using data obtained from statistics korea, a governmental statistical office that manages demographic statistics in korea, which has been used and considered as reliable data in previous studies.16,17 differences between the groups were analyzed using the test for categorical variables and the student t - test or the mann - whitney u test for continuous variables. to test for significant associations between mrs distribution at discharge and serum levels of calcium or albumin - corrected calcium, ordinal logistic regression analyses was used, taking the 6 categorized mrs score (i.e., mrs scores 5 and 6 combined) as a dependent variable under the assumption of proportional odds. in addition, cox proportional hazard models were constructed to test the effects of serum calcium or albumin - corrected calcium levels on mortality after stroke. for ordinal logistic regression models and cox proportional hazard models, adjusted variables with p values 9.2 for calcium and t1 9.28 for albumin - corrected calcium), and the tertiles were chosen based on sample size. serum calcium and albumin - corrected calcium levels were analyzed as continuous data in model 2. values have been presented as frequencies (percentages), meansstandard deviations, or medians [interquartile ranges (iqr) ], as appropriate. however, we excluded patients with history of an intracranial hemorrhage (n=232), transient ischemic attack (n=124), and those without information on important clinical variables (n=15) or functional outcomes (n=27). as a result, 1,915 stroke patients were enrolled in this study. of these, 1,184 were men and 731 were women. the mean serum calcium and albumin - corrected calcium levels on admission were 8.970.58 mg / dl and 9.070.49 mg / dl respectively, and the median initial nihss score was 4 [2, 7 (iqr) ]. the mean follow - up period was 917609 days (range 1 - 2,248 days). the mortality rate was 1.6% (31 patients) at 1 month post - admission, and the overall mortality rate was 17.3% (332 patients). table 2 presents the results of multivariable ordinal logistic regression analyses of the effects of serum calcium and albumin - corrected calcium levels on discharge mrs scores. model 1 identified the second [adjusted odds ratio (or) 1.32 (95% confidence interval [ci ] 1.07 - 1.61) ; p<0.01 ] and third [or 1.24 (95% ci 1.01 - 1.53) ; p=0.04 ] tertiles of the serum calcium level and the third [or 1.24 (95% ci 1.01 - 1.53) ; p=0.04 ] tertile of the albumin - corrected calcium level as independent risk factors for a poor discharge outcome. among the confounders, variables with p values a significant relationship was also observed in model 2 using serum calcium [or 1.19 (95% ci 1.03 - 1.38) ; p=0.02 ] and albumin - corrected calcium levels [or 1.21 (95% ci 1.01 - 1.44) ; p=0.03 ] as linear variables. details of multivariable ordinal logistic regression analysis results are summarized in table 3. in terms of mortality, multivariable analysis was performed using cox proportional hazard regression analysis models (table 4). model 1 identified the third tertile [adjusted hazard ratio (hr) 1.40 (95% ci 1.07 - 1.83) ; p=0.02 ] of albumin - corrected calcium level as an independent risk factor for long - term mortality. the relationship between albumin - corrected calcium level and mortality was also found to be significant when albumin - corrected calcium level was analyzed as a linear variable [mg / dl ; hr 1.46 (95% ci 1.16 - 1.84) ; p<0.001, model 2 ]. in addition, male gender, age, serum glucose level, serum triglyceride level, serum albumin level, stroke subtype, and nihss scores on admission were found to be significantly associated with long - term mortality by multivariable analysis (table 5). however, no significant association was found between serum calcium level and long - term mortality. the present study shows that high levels of albumin - corrected calcium are associated with a poor discharge outcome and a higher incidence of mortality after acute ischemic stroke. this association was found using the highest tertile model and the continuous 1 mg / dl increase model. furthermore, the association between the discharge outcome and serum calcium level was also found to be significant when we used serum calcium levels in a continuous 1 mg / dl increase model. however, in the tertile model, the middle tertile was found to be more strongly associated with a poor outcome than the highest tertile. with regard to mortality, serum calcium and albumin - corrected calcium showed discrepant results as the association between mortality and albumin - corrected calcium level was identified by the highest tertile model and the continuous 1 mg / dl increase model, but these relations were not found for serum calcium. the differences in the results obtained for the serum calcium and albumin - corrected calcium levels may be explained by the physiologic characteristics of ca. about half of the calcium in the serum accordingly, changes in protein concentration alone cause changes in total calcium without affecting the physiologically and clinically important ionized calcium, and thus, adjustment of the total serum calcium concentration for albumin is essential when attempting to detect abnormal values.18 for these reasons, albumin - corrected calcium is a better parameter for evaluating the effect of calcium at the cellular level when directly measured ionized calcium concentration is not available. the underlying biological mechanism responsible for the poor short - term outcome and increased mortality associated with elevated albumin - corrected calcium levels has not been established. experimental studies have demonstrated that influx of ca into neuronal cells is a mechanism of ischemic cell death. glutamate - stimulated ca influx into cultured neurons by ca, and elevated ca levels after nmda receptor stimulation has been observed repeatedly using fluorescent probes.19,20 furthermore, it has also been shown that inhibition of the effectors of ca toxicity, such as calmodulin,21 calcineurin,22 or neuronal nitric oxide synthase,23 protects neurons against the toxic effects of excitatory amino acids. these studies suggest that elevated extracellular ca levels increase the risk of early neuronal death caused by nmda receptor - mediated ca intracellular influx. mitochondrial dysfunction also contributes to delayed neuronal death, and it was established decades ago that massive calcium accumulation triggers mitochondrial damage.24 increases in mitochondrial permeability are caused by the formation of high conductivity proteinaceous pores that allow the passage of ions and molecules.25,26 furthermore, mitochondria exposed to calcium swell and release their contents.25 in addition, oxidative stress and mitochondrial calcium accumulation activate mitochondrial permeability transition and lead to depolarization - coupled production of reactive oxygen species.27 this relationship between calcium and mitochondria may explain the association of the calcium level with a poor neurological outcome in stroke. first, our study was conducted in a retrospective manner, and patients without calcium level, height, or admission nihss data were excluded from the analysis. however, only 2.12% of all potential participants were excluded, and thus, we believe that the quality of the data was acceptable. second, we used discharge mrs scores as a measure of short - term neurological outcome, and thus, these scores were allocated at different times after stroke onset ; the 3-month follow - up nihss and mrs scores were not collected. however, mrs was administered when medically and neurologically stabilized patients were transferred to rehabilitation services or discharged to home, and mrs scores at discharge may better represent the severity of early neurologic involvement compared to the 3-month follow - up scores because of individual differences in medical care. third, none of the patients in our study had hypercalcemia (calcium level 12.0 mg / dl). due to the retrospective nature of our study, we were unable to correct this issue. fourth, information regarding stroke location, lesion volume, and post - discharge medical care quality, the well - known factors associated with short and long - term clinical outcomes of ischemic stroke patients, was not captured in this study. fifth, serum albumin level could be an important interacting variable for the relationship between albumin - corrected calcium level and stroke outcome. a thorough statistical analysis for such a relation was not performed in the current study. however, albumin - corrected calcium level was a significant prognostic factor for short- and long - term stroke outcomes, after adjusting for serum albumin level. finally, the calcium level was checked once on the day of admission, whereas ovbiagele. reported that serum calcium levels obtained within 72 - 96 hours of stroke onset are of prognostic significance.28 however, the annual intra - individual calcium level variation is only~2%, and calcium transport from the extracellular area into neuronal cells would not be sufficient to change serum levels to the degree noted in our study.29 thus, we argue that the timing of the calcium level measurements is not important in the context of this study. we found that higher albumin - corrected calcium levels were of prognostic significance in terms of early neurologic outcome and long - term mortality after acute ischemic stroke. furthermore, albumin - corrected calcium showed a more clear association in our results than serum calcium. prospective studies with direct measurements of calcium ion concentrations at various times after stroke onset are required to obtain more information regarding the pathophysiologic role of ca in ischemic neuronal injury.	background and purposean elevated intracellular calcium level is known to be a major initiator and activator of ischemic cell death pathway ; however, in recent studies, elevated serum calcium levels have been associated with better clinical outcomes and smaller cerebral infarct volumes. the pathophysiological role played by calcium in ischemic stroke is largely unknown.methodsacute stroke patients from a prospective stroke registry, consecutively admitted during october 2002-september 2008, were included. significant associations between the modified rankin scale distribution at discharge and serum calcium or albumin - corrected calcium were identified using ordinal logistic regression analysis. cox proportional hazard models were used for survival analysis.resultsmean serum calcium and albumin - corrected calcium levels of the 1,915 participants on admission were 8.970.58 mg / dl and 9.070.49 mg / dl, respectively. second [adjusted odds ratio 1.32 (95% confidence interval 1.07 - 1.61) ] and third [1.24 (1.01 - 1.53) ] tertiles of serum calcium level and the third [1.24 (1.01 - 1.53) ] tertile of albumin - corrected calcium level were found to be independent risk factors for a poor discharge outcome. significant relationships were observed with serum calcium [1.19 (1.03 - 1.38) ] and albumin - corrected calcium [1.21(1.01 - 1.44) ] as linear variables. however, only albumin - corrected calcium was associated with long - term mortality, third tertile [adjusted hazard ratio 1.40 (1.07 - 1.83) ], and increase by 1 mg / dl [1.46 (1.16 - 1.84)].conclusionselevated albumin - corrected serum calcium levels are associated with a poorer short - term outcome and greater risk of long - term mortality after acute ischemic stroke.
calciphylaxis is a rare disease entity first described by bryant and white in 1898 to characterize a syndrome exemplified by vascular calcifications with cutaneous necrosis. attempts to shed light on its pathophysiology was undertaken by selye. in 1962 using a rat model to induce calcinosis through a series of experimental steps [2, 3 ]. the condition was reproduced in nephrectomized rats as well as those challenged with sensitizers such as parathyroid hormone (pth) and vitamin d [2, 3 ]. a series of sensitization events appears necessary to alter the calcium homeostasis prior to the induction of systemic calcinosis with another challenger agent [2, 3 ]. therefore, patients can develop calciphylaxis even after renal transplantation or in the absence of end - stage renal disease such as hyperparathyroidism [46 ]. as the disease is multifactorial, many predisposing conditions contribute to the development of this serious disease, including morbid obesity, diabetes mellitus, malnutrition, liver disease, misuse of vitamin d and calcium - based phosphate binders, or coumadin intake [47 ]. the disease first gained notoriety after gipstein. reported a series of 11 patients with calciphylaxis with concurrent end - stage renal disease. since his description, the incidence appears to be increasing within the last decade, afflicting 1%4% of patients with end - stage renal disease [4, 6 ]. attempts to characterize this patient population seem to concentrate on caucasians with a female to male ratio of 3 to 1 [4, 6 ]. although end - stage renal disease (esrd) is the most likely culprit to result in disorders of calcium homeostasis, other conditions such as secondary hypercalcemia, hyperparathyroidism, sarcoidosis, or underlying connective tissue disease can also be potential etiologies to this disease entity. the typical cutaneous manifestations of calciphylaxis, also seen in calcinosis cutis, comprise exquisitely tender and firm lesions with ninety percent located in the lower extremities. the skin lesions of stellate purpura and livedo reticularis seen as a result of this disease arise from microthrombus formation within the small vessels [9, 10 ]. both proximal and distal lesions can occur although the proximal lesions are usually located on the thighs and the lower abdomen. the proximal location helps to distinguish this disease from vascular causes of lower extremity skin necrosis. this is the case of a 56-year - old caucasian woman with extensive medical problems who initially presented with bilateral firm thigh lesions that are extremely painful and tender to touch (figure 1). her past medical history is complicated by type ii diabetes, morbid obesity (bmi > 35), and medically managed chronic renal insufficiency with a baseline creatinine level of 3.0 mg / dl. interestingly, the patient had a history of poor wound healing following a hysterectomy in the past. initial management consisted of a skin biopsy of these thigh lesions which led to the confirmation of calciphylaxis. histologically, there were extensive calcifications within the subcutaneous tissue and small blood vessels (figures 2 and 3). surveillance chemistries revealed a preoperative intact pth level of 737 pg / ml, with concurrent calcium level of 9.7 mg / dl, chloride level of 107 mmol / l, and phosphate level of 8.4 mg / dl. preoperative vitamin d levels were examined and showed a normal total 25 hydroxy - vitamin d levels of 39 ng / ml. intraoperatively, the patient was found to have an enlarged nodular goiter as well as a 1.3-cm papillary carcinoma of the thyroid. surprisingly, the patient was also found to have four normal parathyroids but an aberrantly located adenoma within the thymic tissue of the mediastinum, weighing 0.62 grams (figure 4). intraoperative pth level remained elevated (> 300 pg / ml) after excisional biopsy of three normally appearing parathyroid glands. finally, the levels fell to 79 pg / ml after the removal of the enlarged adenoma, with a postoperative repeat value of 57 pg / ml. postoperatively, the patient 's thigh wound started to granulate with immediate improvement in her thigh pain. historically, the first reported case of calciphylaxis from hyperparathyroidism was described by ellis and barr in 1951. the authors reported findings of a 29-year - old female with metastatic recurrent parathyroid carcinoma who had classic lesions of calciphylaxis during autopsy findings. the recognition of this disease entity follows the early descriptions of selye. in laboratory models of calciphylaxis [2, 3 ]. as the understanding of calciphylaxis became more widespread, reported cases of unusual causes of calciphylaxis also became more frequent [4, 5 ]. a search into the available data in the english literature identified a total of 15 other cases of patients with calciphylaxis secondary to primary hyperparathyroidism, with half of them being reported in the last decade [9, 1122 ] (table 1). the majority of patients succumbed to their disease due to the progressive nature of the disease. however, a few patients did benefit from early parathyroidectomy and medical optimization [9, 1218 ]. initial reports of calciphylaxis secondary to nonrenal - related causes were usually a result of autopsy findings [11, 19, 20 ]. bogdonoff and colleagues associated two autopsy findings of calciphylaxis with parathyroid adenomas in those patients in 1956. subsequently, anderson. and winkelman. also found parathyroid adenomas on autopsy findings of two sixty - two year old females and a sixty year old female in 1968 and 1970, respectively [9, 20 ]. with better understanding of the physiology of hyperparathyroidism and its effects on calcium homeostasis, surgeons are taking a more active role in treating this disease to decrease serum calcium levels in the hope of controlling the systemic manifestations associated with hypercalcemia. winkelman. introduced parathyroidectomy as a management option in these patients and reported the first patient recovering from calciphylaxis caused by hyperparathyroidism in 1970. the second published report of a patient surviving after parathyroidectomy for hyperparathyroidism causing calciphylaxis was by khafif. in 1989, on a 71-year - old female. despite the more aggressive approach undertaken recently, patients with calciphylaxis still have a guarded prognosis, with 80% succumbing to their disease secondary to recurrent skin infections [10, 23 ]. hafner. reported a survival advantage for patients who underwent parathyroidectomy in comparison to those who did not. reported in their series that parathyroidectomy was not associated with a survival advantage in patients with end - stage renal disease [10, 24 ]. calciphylaxis is not always a disease secondary to unopposed parathyroid hormone production from an aberrant gland. presented an interesting case of a patient with hypercalcemia that was successfully managed with steroids and immunosuppression alone [4, 13 ]. there are also cases of calciphylaxis without association with renal failure or hyperparathyroidism reported in the literature. this also correlates with the finding that patients with end - stage renal failure can have progressive calciphylaxis following renal transplantation and normalization of their parathyroid levels. it appears that once the disease process initiates following sensitization with hyperparathyroidism, there is difficulty in resetting the calcium homeostatic switch. however, parathyroidectomy may be the only option in these difficult cases especially with documented hyperparathyroidism, as evidenced by favorable results with early intervention recently. this patient illustrates the various etiologies that can lead to calciphylaxis as well as the difficulty in managing this disease entity. her disease presented with calciphylaxis secondary to primary hyperparathyroidism that improved with the use of parathyroidectomy. however, her chronic renal insufficiency and dysregulation of electrolyte balances initially suggested secondary hyperparathyroidism as the culprit for her calciphylaxis. only during the surgery vitamin d, though replete in this patient, can sometimes be a contributor to the development of hyperparathyroidism when deficient. in patients with calciphylaxis, early parathyroidectomy may still play a role in improving their cutaneous disease, especially in cases of hyperparathyroidism.	calciphylaxis, or calcific uremic arteriolopathy, commonly affects people with end - stage renal disease and carries with it a high rate of morbidity and mortality. here, we present the unusual case of a 56-year - old woman, with extensive medical problems, who developed calciphylaxis in the presence of primary hyperparathyroidism. our patient initially presented with bilateral, exquisitely tender thigh lesions. the diagnosis of calciphylaxis was rendered histologically by extensive calcification of the subcutaneous blood vessels. subsequent parathyroidectomy identified the presence of a hyperactive mediastinal parathyroid adenoma, weighing 0.62 grams. postoperatively, the patient had normalization of hypercalcemia and parathyroid hormone levels, with subsequent healing of her thigh wounds. currently, there have been sixteen cases described in the english literature, with only nine being offered a potentially therapeutic parathyroidectomy. it is contingent upon the vigilant physician to diagnose and properly manage this difficult yet treatable condition.
	we studied the effects of weight loss and non - weight - bearing exercise (swimming) on blood and organ lead and essential metal concentrations in rats with prior lead exposure. nine - week - old female sprague - dawley rats (n = 37) received lead acetate in their drinking water for 2 weeks, followed by a 4-day latency period without lead exposure. rats were then randomly assigned to one of six treatment groups : weight maintenance with ad libitum feeding, moderate weight loss with 20% food restriction, and substantial weight loss with 40% food restriction, either with or without swimming. blood lead concentrations were measured weekly. the rats were euthanized after a 4-week period of food restriction, and the brain, liver, kidneys, quadriceps muscle, lumbar spinal column bones, and femur were harvested for analysis for lead, calcium, copper, iron, magnesium, and zinc using atomic absorption spectrophotometry. both swimming and nonswimming rats fed restricted diets had consistently higher blood lead concentrations than the ad libitum controls. rats in the substantial weight loss group had higher organ lead concentrations than rats in the weight maintenance group. rats in the moderate weight loss group had intermediate values. there were no significant differences in blood and organ lead concentrations between the swimming and nonswimming groups. organ iron concentrations increased with weight loss, but those of the other metals studied did not. weight loss also increased hematocrits and decreased bone density of the nonswimming rats. the response of lead stores to weight loss was similar to that of iron stores because both were conserved during food restriction in contrast to decreased stores of the other metals studied. it is possible that weight loss, especially rapid weight loss, could result in lead toxicity in people with a history of prior excessive lead exposure.imagesfigure 1figure 2figure 3figure 4figure 5
the lifetime risk of urolithiasis is estimated to be between 5% and 12% in europe and the united states. acute renal colic is commonly observed in emergency rooms and is usually described as an acute flank pain radiating to the groin. it is often caused by ureteral stones. because up to 98% of ureteral calculi of 0.05) (table 2). mucosal injury was observed in 3 patients (4.48%) in group a and in 9 patients (5.66%) in group b. hematuria, which occurred in 6 patients in group b, was considered a minor intraoperative complication (grade 1 complication according to the modified clavien classification system) like mucosal injury. after ureteroscopic stone removal, swl was performed to manage the remaining fragments in 3 patients (4.48%) in group a and in 6 patients (3.77%) in group b. flexible urs was performed in 6 patients in group b. no significant difference was found between the two groups in terms of the need for additional procedures (p>0.05). stone - free rates were 89.55% (60 of 67) and 89.93% (143 of 159) in groups a and b, respectively. the procedure was unsuccessful in 2 patients (2.98%) in group a and in 6 patients (3.77%) in group b. residual fragments were present in 5 patients (7.46%) in group a and in 10 patients (6.29%) in group b, and all fragments were confirmed by non - contrast spiral computed tomography after suspicious plain abdominal radiographic findings after urs. in group a, the 2 patients (2.98%) who underwent unsuccessful urs had stones located in the proximal ureter. in the 5 patients (7.46%) with residual fragments (> 3 mm), the stones were located in the proximal ureter in 3 and in the distal ureter in 2. mean stone size was 8.4 mm (range, 7 to 15 mm) in the 7 patients who underwent an unsuccessful procedure or who had residual fragments of > 3 mm. in group b, evaluation of the 6 patients in whom the procedure was unsuccessful showed that stone migration into the renal pelvis and severe kinking with a relatively narrowed ureteral segment preventing stone access were underlying reasons for failure during lithotripsy. severe edema formation and bleeding due to large, impacted calculi and migration of disintegrated fragments into the renal pelvis during lithotripsy were the causes of the residual fragments in group b. obstructive ureteral calculi are the most common cause of severe colic pain evaluated and treated in an emergent manner. most ureteral stones can be reasonably expected to be uneventfully passed, and if successful, this strategy is less costly and less invasive than any other option. ureteral stones with a diameter of less than 5 mm will pass in up to 98% of cases, but for stones with a diameter of greater than 7 mm, the overall likelihood of spontaneous passage is low. when active ureteral stone treatment is warranted, the best procedure to choose depends on several factors, such as stone size and location, operator experience, patient preference, available equipment, and related costs. because of its noninvasive and practical nature, swl is the preferred therapeutic option and is performed after the onset of renal colic to relieve stones and related problems. however, swl is more successful for the management of proximal ureteral calculi and its success rates tend to decrease for distal stones and stones treated in an emergency setting. furthermore, published data demonstrate that urs could play a major role in these selected cases. urs represents a safe and minimally invasive procedure for the management of ureteral stones, and technologic advancements have made it a highly successful procedure with low complication rates. regarding the success rates of urs, the american urological association ureteral stones guidelines panel summary report found a stone - free rate of 56% for stones of 1 cm in the proximal ureter as compared with rates of 89% and 73% for stones in the distal ureter, respectively. in the present study, the overall stone - free rate was 89.8% and increased to 97.6% when only stones in the distal ureter were considered. the overall complications rate was 7.96%, which decreased to 2.7% when only stones of < 10 mm were considered. these results are in accordance with published data for electively scheduled urs, which ranges from 86.6 to 94.6% for all ureteral stones and from 95.6 to 100% for distal stones. highly effective stone fragmentation and reasonably lower complication rates have resulted in the application of emergency urs in selected cases. the possible reasons for adopting this approach are the need for prolonged anti - inflammatory and analgesic medication to prevent additional colic attacks and an expected protracted hospitalization period. however, this approach has some limitations, which include decreasing the chance of conservative management and spontaneous passage of calculi without the use of interventions that require the patient being under anesthesia. thus, it seems that, depending on stone - related and patient - related factors, preferred treatment management, that is, medical, emergency urs, or elective urs, is a matter for joint decision making by the physician and the informed patient. the findings of the present study and published data demonstrate that the removal of ureteral calculi immediately after the first colic attack should significantly decrease readmission rates to emergency departments, and thus decrease analgesic medication and economic costs originating from prolonged hospitalization and loss of work. furthermore, our comparison of the complication rates in our two study groups showed that emergency urs can be ideal for relieving the colic pain and morbidity associated with spontaneous passage. in addition, cost analysis showed that total charges (initial procedures, additional procedures, radiographs, postoperative office visits) were less when urs was performed emergently. this study is limited by its retrospective nature and a relatively small cohort. however, in the absence of international guidelines regarding the ureteroscopic management of ureteral stones in an emergency setting, the results of this study suggest the need for emergency urs. emergency urs appears to be an effective and safe procedure for the treatment of obstructive ureteral stones that provides immediate relief from colic pain and allows ureteral stones to be fragmented. nonetheless, it should be borne in mind that this procedure requires specific technical expertise and dedicated facilities. we recommend that an additional large - scale study that includes other parameters be conducted to confirm our findings.	purposeto evaluate the efficacy and safety of the ureteroscopic management of ureteral stones immediately after a first colic attack.materials and methodswe retrospectively analyzed the data of 226 patients with obstructive ureteral stones who underwent ureteroscopy with stone retrieval. the 67 patients in group a underwent ureteroscopy within 48 hours of admission to our emergency department, whereas the 159 patients in group b underwent ureteroscopy more than 48 hours after admission. the chi - square test was used to evaluate and compare stone - free status, auxiliary procedures, and complications and the kruskal - wallis and fisher 's exact tests were used to analyze qualitative data.resultsmean stone sizes in groups a and b were 2.411.62 mm and 4.112.64 mm, respectively. no patient experienced a major complication during or after the procedure. stone - free rates were 89.55% and 89.93%, respectively.conclusionsemergency ureteroscopy in cases of obstructive ureteral stones is both safe and effective and offers the advantages of immediate stone fragmentation and the relief of acute - onset colic pain.
the incidence of urinary tract stone disease is increasing. according to the national health and nutrition examination survey, as of 2012, 10.6% of men and 7.1% of women in the united states are affected by renal stone disease, compared to just 6.3% of men and 4.1% of women that were affected in 1994. further, within the affected population the gender gap has narrowed substantially and the incidence of stone disease in pediatric urology patients continues to be on the rise. the purpose of this article is to explore the existing literature in an effort to identify the potential effects that changes in diet, life - style and obesity have had on the increasing incidence of nephrolithiasis. this in turn may provide a better understanding of the extent to which modifiable risk factors play a role on stone formation and what measures may be undertaken for disease prevention in view of these changing trends. one of the more striking new trends appears to be the increased incidence of stone formation in women. the increase in incidence of women affected by urinary tract stone disease has outpaced that of men. although nephrolithiasis continues to be more common in men, the incidence rate ratio of men to women with urinary tract stones has narrowed from 3.4 to 1.3. the new data is based on resource utilization studies that have examined national databases, hospital admissions and outpatient care. one hypothesis for the disproportionate increase in stone disease in women is related to obesity. in 1998, a study based on two large cohorts : the nurses health study (n = 89,376 women) and the health professionals follow - up study (hpfs) (n = 51,529 men) curhan. found that the prevalence and incidence of calcium oxalate stone disease was directly associated with body mass index (bmi). further, the magnitude of association was significantly stronger for females that it was for males. the age - adjusted prevalence odds ratio for stone disease in women with a bmi of > 32 kg / m compared to those with a bmi of 21 - 22.9 kg / m was 1.76 while in men, the ratio was 1.38. similarly, the incidence odds ratio based on bmi for women was 1.89 compared to 1.19 for men. these findings were confirmed by nowfar. using the nationwide inpatient sample database, which contains information on approximately 20% of hospital stays in the united states. they reported that a significant positive correlation exists between obesity and nephrolithiasis for both genders ; however, obese females were more likely to develop stones than obese males. they hypothesize that this may explain the decrease from 1998 to 2003 in the male - to - female ratio for stone risk from 1.6:1 to 1.2:1. one contradictory study from germany concluded that obese men are more prone to stone formation than obese women. a follow - up prospective study by taylor. examined the effect of obesity and weight gain on the incidence of nephrolithiasis in subjects based on gender and age over a 46 year old span. the study evaluated 3 cohorts : hpfs (n = 45,988 men), the nurses health study i (n = 93,758 women, age range at baseline 34 - 59), and the nurses health study ii (n = 101,877 women, age range at baseline 27 - 44). they reported that the relative risk for development of nephrolithiasis in men whose weight was > 220 lbs compared to those 8 servings of spinach per month compared < 1 serving, the authors concluded that dietary oxalate was not a major risk factor in development of nephrolithiasis. vitamin c supplementation, which may be metabolized to oxalate, was not associated with an increased risk of stone formation in women in a prospective study by curhan. in contrast, the use of combined calcium and vitamin d supplements in post - menopausal women, was found to increase the incidence of nephrolithiasis compared to the placebo group over the course of 7 years. increased intake of caffeinated, high - sugar content beverages has long been assumed to contribute to the rise in the prevalence of urinary stone disease. surprisingly, a study by curhan. showed that consumption of 8-oz of caffeinated coffee and tea decreased the risk of stone formation in women by 10% and 8%, respectively. the same amount of wine decreased the risk by 59% while grape fruit juice increased the risk by 44%. the interplay of obesity and other components of the metabolic syndrome have been linked to stone formation through varied postulated pathophysiologies including increased urinary oxalate excretion, increased uric acid production and defects in ammoniogenesis. hypertension as well other metabolic changes, associated with obesity may lead to the formation of stones. in a study conducted at the university of naples by cappuccio. specifically, the prevalence of urolithiasis in treated hypertensives was found to be in 32.8% of the subjects, compared to 13.4% in the normotensive subjects. in a later prospective 8-year study, the incidence of kidney stone disease was found to be greater in hypertensive men with no evidence of stone disease at baseline. over the course of 8 years, 16.7% of men developed renal calculi, compared to 8.5% of normotensive male subjects. this suggests that hypertension is a predictor for urinary stone disease, rather than a consequence of renal damage following the development of renal calculi. examined the effects of obesity on urinary ph and urinary stone composition and reported an inverse correlation between patients bmi and urinary ph. patients with higher bmi 's were found to have lower urinary ph and higher occurrence rates of urate, calcium oxalate and calcium phosphate stones. a prior study by chou. however, the percentage of uric and calcium oxalate stones was also found to be higher in obese than non - obese patients. in chou 's study, the prevalence of calcium oxalate stones in obese patients was found to be 34.9%, compared to 23.1% in patients with normal weight. similarly, the prevalence of uric acid stones was 7.7% for the obese group and 2.8% for the normal weight group. interestingly, a study by daudon., which looked at 27,980 calculi, collected between the years 1976 and 2001, analyzing their composition via infrared spectroscopy, found that females tend to have a preponderance for calcium phosphate and struvite stones, presumably due to increased susceptibility to urinary infections. the same study also found that the prevalence of uric acid stones tends to increase with age for both sexes. these studies suggest that if obesity and aging are linked to the evolving epidemiology of stone disease, one would anticipate a change in the frequency of stone compositions in female stone formers. in a german study by siener,., the authors also found a positive inverse relationship between bmi and urinary ph in both genders. in obese individuals there was an increase in urinary excretion of uric acid, sodium, ammonium, and phosphate. an association between obesity and an increase in urinary oxalate excretion was noted only in females, but not in the male participants of the study. conversely, an increase in urinary calcium excretion was associated with obesity in men but was not noted in women. according to the authors, as bmi increased, there was no increase in excretion of inhibitors of stone formation, such as magnesium and citrate. interestingly, girls are more susceptible to nephrolithiasis than boys. in the study by novak., based on inpatient admission for pediatric urolithiasis in 2003, the healthcare cost and utilization project kids inpatient database showed a female predominance in this age group, with a slightly higher predominance in boys within the first decade only. according to the study by sas., the greatest rate increase in incidence of pediatric renal stone disease between 1996 and 2007 was seen in caucasians adolescent girls. based on the data, the authors cite an increase in pediatric nephrolithiasis cases from 7.9/100,000 patients in 1996 to 18.5/100,000 patients in 2007, with female to male ratio of 1.4:1. the study was an estimate based on an analysis of a statewide database of south carolina emergency room visits. in 2012, a 25-year population based study by dwyer. it examined 207 children under the age of 18 with computerized tomographic imaging confirming stone disease in olmsted county, minnesota. they reported a 4% increase per year in the incidence rate during the period of 25 years. the numbers were in large part due to the rise in incidence in the 12 - 17 year old age group. nationwide studies are not yet available. however, such dramatic regional increases in incidence is nevertheless concerning. most of the pediatric renal stone disease is of idiopathic etiology, with only 9 - 24% having a type of identifiable underlying cause such a metabolic, neurological or congenital urinary system structural abnormality. multiple factors, which predispose children and adolescents to form renal calculi have been proposed. pediatric stone composition and urinary metabolic stone risk parameters are distinct from those of adults. although renal stone formation has a linear association with the age of the patient, pediatric patients tend to form a greater percentage of calcium - based stone than adults. conversely, there are fewer cases of uric acid stones than in the adult population. the reason for this discrepancy has been associated with a higher urinary ph within a pediatric population seen in adults. it should be noted that the risk of pediatric struvite stones has decreased ; perhaps related to advancements in diagnosis and management of urinary tract infections as well as management of anatomical and neurological conditions associated with urinary infections. with the rise of childhood obesity, large bmi has long been assumed to contribute to the pediatric stone disease epidemic. however, a recent study by kieran. the authors stratified 62 boys and 50 girls with urolithiasis according to their bmi 's into lower percentile body weight patients, those with normal weight, and upper percentile body weight patients. patients with lower percentile body weight were found to have an earlier presentation of the disease while the highest percentage of stone patients was found to belong to the normal weight category. 49.1% of patients belonged to the normal weight category, compared to 41.1% in the heavier children. further, obesity did not increase the risk for the development of larger size calculi or the need for more surgical procedure in comparison to other weight categories. kim. compared 110 of pediatric cases with urolithiasis to 396 matched controls in a case - control study and reported no association between high bmi and urolithiasis. however, the authors noted that the black race and medicaid payer status were associated with a lower risk of stone disease. indeed, lack of concrete evidence linking obesity and renal stone disease in pediatric patients has led some to postulate that perhaps changes in diet rather than bmi serves as a culprit for urolithiasis in children. shi. reported that renal uric acid and oxalate were found to vary with body fat and free glucocorticoids. urinary calcium was associated with dietary intake of sodium and protein, but not bmi in healthy children. according to a 2010 published report by us institute of medicine, the average dietary intake of sodium for kids aged 6 - 11 has increased from 200 mg in the 1970s to 3000 mg in the 2000s. matlaga. observed a strong correlation between nephrolithiasis and hypertension as well as diabetes in children less than 6 years of age. hypertension was found to be a significant risk factor for nephrolithiasis in children 10 years of age and younger while diabetes mellitus was found to be a risk factor for children younger than 5 years. this study confirmed that obesity was not associated with a higher risk for stones. in 2012, kokorowski. published a conflicting report on association of urolithiasis with systemic conditions and obesity among pediatric patients. in their analysis of 9,843 cases of urolithiasis and 39,047 controls, stone formers were found to have a higher prevalence of obesity and hypertension, compared to controls. additionally, type 1 diabetes mellitus was seen less in patients with nephrolithiasis, compared to controls. in an effort to determine the urine risk factors that pre - dispose pediatric patients to urinary stone formation bergsland. identified hypercalciuria as the principal difference between stone - forming children and their non - stone forming relatives and normal counterparts. surprisingly, other urinary characteristics, associated with adult stone formers, namely low urinary volume, hyperoxaluria, hypocitraturia, and low urinary ph were not found to play a major risk factor in stone formation in children. it appears the forces driving changes in the epidemiology of stone disease in children may be different than those in adults. in both adults and children, the increased use of cross - sectional imaging may be playing a role. according to an article by stratton., between 1996 and 1999 the use of ct scans as a diagnostic modality for children 15 years of age and younger increased 96%. obesity epidemics, aging demographics, dietary indiscretions, global warming ; all likely play a role in stone disease. unfortunately, all of these parameters point to a rise in risk the stone - age is upon us.	the epidemiology of kidney stones is evolving not only is the prevalence increasing, but also the gender gap has narrowed. what drives these changes ? diet, obesity or environmental factors ? this article will review the possible explanations for a shift in the epidemiology, with the hope of gaining a better understanding of the extent to which modifiable risk factors play a role on stone formation and what measures may be undertaken for disease prevention in view of these changing trends.
shallow portions of major continental strike - slip faults are exposed to brittle deformation conditions. at crustal levels 34 km, kakirites (heitzmann, 1985) dominate such strike - slip faults, the porosity is therefore high, and vertical fluid flow is dominant resulting in fluid rock interaction and formation of fault gouge (caine., 1996 ; wibberley., 2008). in terms of fluid motion, this crustal section is considered to represent the hydrothermal convection zone (saishu., 2014). ductile fabrics respectively plastically formed fabrics are generally missing within quartzofeldspathic fault rocks at these shallow crustal levels. in contrast, evaporitic rocks show plastic behavior even at low temperatures and pressures (rutter, 1986). consequently, the presence of viscously behaving rocks like evaporites (halite, gypsum) at such shallow levels may significantly change the fault zone architecture and related porosity and permeability structure. evaporitic layers frequently act as detachment horizons (e.g. de paola., 2008 and references therein). however, evaporitic strike - slip fault zones are rare (schorn and neubauer, 2014) and detailed descriptions of the internal structure of such shear zones are hampered by intense and quick surface weathering of friable mylonitic gypsum. furthermore, structures and fabrics of secondary tectonic origin within evaporitic sequences are often misinterpreted as primary, depositional features, as outlined by schreiber and helman (2005). here we present structural observations from the comeglians - paularo strike - slip shear zone in the southern alps, which propagated entirely through the subvertically tilted gypsum - dominated member of the lower bellerophon formation. in such a case the steeply dipping trend of a rheologically weak layer entirely controls propagation and the structural trend of the shear zone, whereas in strike - slip fault systems within gently to moderately dipping sedimentary successions, the lithology virtually does not play a major role. there, fault location in the cover rocks is primarily controlled by the strength of the basement rocks (mandl, 1987 ; wilcox., 1973). a change in trend of the bellerophon formation also seems to control the position of fault termination. such terminations are geometrically and kinematically complex and a number of distinct brittle structures such as extensive and compressive horsetails are often associated with fault tips (sylvester, 1988 and references therein). we demonstrate how the ductilely behaving shear zone accommodates n s shortening and dextral displacement by two mechanisms, (1) non - coaxial and coaxial deformation and (2) a compressive horse - tail at the western fault termination. this paper first gives an overview of the geological and tectonic setting of the comeglians - paularo shear zone. then we describe detailed field observations of the internal fault structures and then assess the microscale deformation structures. in the discussion, we focus on the low - temperature fabrics and assess the role of viscously behaving evaporites within the otherwise brittle shallow crust for the hydrothermal convection zone. the fella - sava fault, and its western extension, the comeglians - paularo shear zone apparently form the northern boundary of a seismogenic zone, which is affected by intense seismicity with dominant n s thrusting. on a large scale, the active dextral comeglians - paularo shear zone / fella - sava fault represents the pliocene - recent southern boundary of the east - directed lateral extruding block. the study area is located in the (eastern) southern alps, which are bordered in the north by the periadriatic fault, the major strike - slip fault of the alpine orogen (handy., 2010). the n - ward moving adriatic microplate and the southern alps at its front act as a rigid indenter. north of the periadriatic fault, part of the shortening is accommodated by lateral extrusion and tectonic escape to the east along e - trending strike - slip faults and n - trending extensional detachments (fig. 1) (ratschbacher., 1991a, 1991b). the dextral periadriatic fault in the south and the sinistral innsbruck - salzburg - amstetten (isam), salzach - enns - mariazell - puchberg (semp) and mur - mrz faults in the north (fig. eastward extrusion starts in the oligocene mainly on the isam and periadriatic faults (wlfler., 2011). in the early miocene activity migrates to the semp fault, which then defines the northern border of the extrusion block. a successive rejuvenation of fault activity from the northernmost faults (e. g. isam fault) to the more in the se located faults (e. g. mur - mrz fault) has been suggested by wlfler. the eastern sector of the periadriatic fault is transected by the dextral ca. nw se striking mll valley and lavanttal faults, which were active during the miocene and pliocene (pischinger., 2008). based on the opening of the gorenjska basin since late miocene times a displacement shift to the fella - sava fault is evident (fodor., 1998 ; the comeglians - paularo shear zone is the westernmost segment of the fella - sava fault (e.g. venturini., 2009a). lateral offsets of 3060 km (fodor., 1998 ; pinter., 2006 ; vrabec., 2006) or up to 6570 km (placer, 1996) along the fella - sava fault have been inferred. the long - term slip rate for the last 20 ma has been reported to range from 1 to 5 mm / a (jamek rupnik., 2012). ongoing dextral offset of 1.2 mm / a was reported for the central fella - sava fault in slovenia, whereas no movement was observed along its eastern part and along the periadriatic fault within the scope of the same study (vrabec., 2006). se contraction and large e w oriented shear strain with strain rates of 20 ppb / a (grenerczy, 2013). the steeply southward dipping fella - sava fault can be traced to the ne corner of the gorenjska basin (poljak, 2007), where it disappears beneath neogene sediments. an eastward continuation of the fault to celje and to the croatian border has been assumed (fig. 1, placer, 1996 ; plenicar, 2009). between the periadriatic and the fella - sava fault systems en echelon sedimentary basins formed along left - stepping oversteps (vrabec. the fella - sava fault separates mainly the ladinian schlern formation in the south from the permian grden formation and part of the bellerophon formation in the north (selli, 1963). its westernmost segment was introduced by gortani (1926) as the comeglians - paularo line and later mapped in detail by braga. the comeglians - paularo shear zone developed within the gypsiferous member of the bellerophon formation (venturini., 2009a) and approximately juxtaposes the older pre - variscan basement with its pennsylvanian cover in the north with permian to mesozoic post - variscan sedimentary strata in the south (venturini. the entire sedimentary succession is steeply tilted to the south (merlini., 2002). reconstruction of the evolution of the main river system of friuli (tagliamento river) indicates a watershed between the fella - sava fault and the friuli foreland up to messinian times (monegato and stefani, 2010 ; monegato., the supposed river along the fella - sava fault probably drained eastwards into the gorenjska and similar slovenian basins (dunkl., 2005 ; monegato and stefani, 2010). in zanclean times, the watershed migrated northwards and the e w drainage along the fella - sava fault was captured by the southward dewatering tagliamento river moneg (monegato and stefani, 2010). the southern alps are tilted southward and are divided into a basement, the carnic alps, which are exposed along the periadriatic fault, and the southalpine cover unit (fig. both parts represent sedimentary mega - sequences : the carnic alps show the evolution of an early paleozoic passive continental margin of the pre - variscan cycle (rantitsch, 1997), whereas the southalpine cover unit represents the upper post - variscan cycle (schnlaub and heinisch, 1993). the basement of the carnic alps contains a nearly continuous geological section ranging from late ordovician to early pennsylvanian, which is overprinted by both the variscan and the alpine orogenies (e.g. brime., upper ordovician clastic sediments are overlain by thick devonian shelf margin carbonates. during the earliest visan, the extensional regime shifted to a contractional regime and mississippian synorogenic flysch was deposited (mader., 2007). a pennsylvanian unconformity separates the folded and faulted variscan basement from the post - variscan cover. the deposition of the cover started with intracontinental siliciclastic molasse sediments (leppig., 2005) the relative sea level changed as a result of gondwana glaciation and shelf and later massive limestone were deposited during stages of high sea - level (krainer, 2007). a hiatus indicates regression at the end of the lower permian during which the carbonate platform was partly destructed (schnlaub, 1992). the semiarid grden formation, with conglomerates, sandstones and fine - clastic layers subsequently, a west to east progressing transgression began (cassinis., 2011) and the grden formation locally interfingered with the marine bellerophon formation (venturini, 1990). the upper permian bellerophon formation (stratigraphic log in fig. 2b) was originally a gently to the se dipping carbonate ramp located between sabkhas in the west and an open marine regime in the east (schnlaub, 1992 and references therein). the bellerophon formation was deposited in the shallow tropical bellerophon sea, an embayment of the paleo - tethys (posenato, 2010). the bellerophon formation is divided into two parts : the lower part contains evaporites and cataclastic dolomite at the base (massari and neri, 1997). the gypsiferous member acted as a major dcollement horizon in the southalpine unit (schnborn, 1999). the upper part of the bellerophon formation consists of shoal - water deposits of dolomite, often tectonically brecciated, while the uppermost part is made up of bituminous limestone (massari and neri, 1997) deposited during a regression (scholger., 2000 and references therein). in the study area, the permian bellerophon formation is approximately 260 m thick (discenza and venturini, 2002) and is concordantly overlain by the lower triassic werfen formation. during the opening of the alpine tethys in jurassic times, the southalpine cover unit represents part of the passive continental margin of the adriatic plate and sedimentation continued until the eocene (bertotti., 1993 ; carminati., the southalpine unit shows no or only a very low - grade metamorphic overprint (e.g. brime., 2008 ; rantitsch, 1997 and references therein). in the variscan basement, the metamorphic grade increases from east to west and from south to north (sassi., 2004 and references therein), and a cretaceous age (eo - alpine) for the metamorphism the width of the comeglians - paularo shear zone varies from 100 to 500 m and depends on the thickness of the gypsum - bearing member of the bellerophon formation. the high erodibility of gypsum within the shear zone led to the formation of e w striking linear valleys and mountain passes in between (fig. approximately 11 km west of comeglians the valley changes its strike from e w to ene n s draining confluents of the tagliamento river cross the shear zone perpendicularly. in the area around paluzza and comeglians, the rivers degano and bt are dextrally deflected along the shear zone and lateral offsets of 0.5 km respectively 1 km of the drainages are evident (fig. in addition to detailed field observations we performed map interpretation in order to characterize the brittle, large - scale structures associated with the comeglians - paularo shear zone. a schematic overview of the whole shear - zone (fig. 5b d) of the rio turiea valley in the east (fig. 5b, after venturini, 1990), the area around comeglians in the west (fig. 5c, after venturini., 2002) and the western termination of the shear zone (fig 5d, after cantelli., 1960) are presented. along the gypsiferous comeglians - paularo shear zone 5) dextral nw se striking riedel shears (b in fig. 5) and sinistral nnw 5) developed. in the area around the rio turiea valley venturini (1990) described sw- vergent folds with axes plunging to the se parallel to the riedel shears (b in fig. 5). in the area near comeglians, a restraining bend (d in fig. 5c, 2) with ene wsw striking thrusts and folds with sse - vergency is consistent with the dextral movement of the main shear zone. 5d) parallel to the trend of the valley the e w gypsum - bearing strike - slip shear zone passes into a ene wsw striking thrust fault (g in fig. the thrust fault transported sandstones of the permian grden formation over triassic carbonates and gypsum is lacking along the thrust (fig. the thrust accommodates, therefore, dextral displacement along the comeglians - paularo shear zone. further structures were formed during a different deformation event : the structures e and f are interpreted as conjugate strike - slip fault system indicating n s shortening. we performed detailed structural studies, including measurements of the penetrative foliation s1 and stretching lineations l1, fold - axes (f2) and shear bands between paularo and the valley west of comeglians (fig. outcrop locations and results of orientation data, including composite diagrams, are given in fig. structural investigations along the shear zone revealed that the entire gypsiferous part of the lower bellerophon formation is strongly deformed in a ductile respectively plastic manner representing the shear zone. brittle behavior is restricted to boudinaged dolomitic layers within gypsum and more competent lithologies of the wall rocks. although poorly exposed, a sharp contact between foliated gypsum and brittely deformed bedded dolomites in the hangingwall respectively footwall was observed in a few outcrops (e.g., locations 1, 2 and 9 of fig. these rocks represent the damage zone adjacent to the gypsum - bearing fault core (according to caine., 1996). the subvertical mylonitic foliation s1 and the stretching lineation l1 are the most prominent micro- and meso - scale structure (fig. the foliation of gypsum - rich rocks generally dips steeply to the s to sse (fig. 4). the foliation dips steeply to the ese consistent with its location within the restraining bend. gypsum attains its maximum thickness and is mined commercially in an opencast (photo ii in fig. 2). l1 dominantly trends wsw ene and plunges mostly eastward with an angle between 10 and 25. only at locations 13 (fig. the stretching lineation l1 is defined by stretched and/or elongated millimeter - sized gypsum grains and rigid dolomite clasts. the latter indicate a non - coaxial deformation component and show asymmetric pressure shadows clearly indicating dextral sense of shear (fig. no significant variations of type and strain of fault rocks were observed along - strike of the shear zone. shear bands dip moderately to steeply to the ssw, the associated fault striae plunge gently to the w and show dextral or normal movement (fig. 4). in the western part of the comeglians - paularo shear zone, subvertical shear bands with subhorizontal lineation (fig., 1979a, 1979b) also indicate dextral movement of the northern block to the sw. in the trail of the shear bands, the dark dolomite formed pinch - and - swell shaped boudins with visible dextral displacement. additionally, 6c) were found. gently plunging fold axes show a wide scatter with a preferential trend to the e to se (fig. the folds are isoclinal, containing a cm - spaced axial plane foliation s1 and a stretching lineation l1. the foliation s1 and the stretching lineation l1 are refolded during the younger event during which open folds (f2) with moderately s - dipping axial plane foliation s2 were formed. the same e all thin sections were cut parallel to the lineation and perpendicular to the foliation and are composed of mylonitic gypsum. 0.050.2 mm) and matrix supported, with gypsum as matrix (figs. 7 and 8). the gypsum grains are mostly subhedral, subrounded, inequigranular and elongated parallel to the stretching lineation. this is consistent with the preservation of micro - shear zones as shown in fig. 8a c) shows one generation of gypsum whereas in type 2 (fig. only the older generation is deformed, in type 3 both gypsum generations are deformed and recrystallization is common. macroscopically, the mylonitic foliation and the stretching lineation are visible in all microfabric types. the grain size of gypsum in type 1 varies from 10 to 50 m, in type 2 from 30 to 220 m and in type 3 from 30 to 150 m. in type 1 (fig. 8c) the matrix is inequigranular, the grains are elongated and undulatory extinction is visible, the grain boundaries are diffuse and interlobate. 8f) has an inequigranular matrix and subhedral grains, the grain boundaries are polygonal and triple points are visible. two generations of gypsum are present in type 2, the older grains are fine - grained with sutured grain boundaries, the younger grains are large, elongated and show undulatory extinction. fig. 8h illustrates a disintegrated grain next to grains of the older generation with polygonal grain boundaries and triple points. 8i) is foliated, the matrix is fine - grained and inequigranular, the grain boundaries are interlobate and few triple points were found. the majority of the porphyroclasts is symmetric, consisting of carbonate and showing eye - shaped patterns with tails consistent to the principal matrix lineation. in some porphyroclasts (fig. 9e) with stair stepping tails indicate dextral shear sense consistent with observations at outcrop - scale. in fringes around many porphyroclasts, two stages of crystal growth are visible ; the fringe at the strain cap (passchier and trouw, 2005) is even - grained and blocky and fibrous at the tails (fig. the fibers are straight, parallel to the lineation and represent the x - direction of the finite strain. the existence of fibrous structures indicates conditions with a high fluid pressure and solution transfer during deformation (passchier and trouw, 2005). we interpret this as a result of extension parallel to the foliation s1 and lineation l1. the new data on the comeglians - paularo shear zone show ductile fabrics along the entire length of the subvertical to steeply ca. the country rocks in the north and south are less affected by strike - slip deformation. there mainly riedel - type brittle fault zones, oversteps and bends can be observed. for simplification, the gypsum - bearing part of the comeglians - paularo shear zone can be considered as the fault core and the adjacent brittely deformed country rocks as damage zones applying the model of caine. the above mentioned riedel - type brittle fault zones are considered as separate systems, each with a separate fault core (without gypsum) and a separate damage zone. in the following discussion we first focus on the low - temperature ductile deformation of the gypsum rocks and its potential implications on fluid flow. finally we address the role of the fella - sava fault and comeglians - paularo shear zone for earthquake distribution and propagation. the microfabric study of gypsum mylonites reveals extremely small grain sizes and the lack of significant annealing and recrystallization structures. most gypsum grains of microfabrics type 1 and 2 are undulose and amoeboid grain boundaries indicate bulging as the main deformation mechanism. even in the partly recrystallized gypsum grains of microfabrics type 3 amoeboid / interlobate deformation microstructures prevail and grain sizes remained small in contrast to what is observed in many other gypsum - dominated evaporitic deformation zones (de paola., 2008). the absence of annealing indicates that no thermal overprint following deformation occurred and that no hydrous, hot fluids invaded the comeglians - paularo shear zone. we expected both plastic and cataclastic behavior of gypsum as described by de paola. within the comeglians - paularo shear zone with dominant gypsum, low - temperature ductile respectively plastic deformation occurred while in the adjacent damage zone brittle deformation prevailed. in all investigated outcrops, gypsum was found as the sole sulfate mineral, and no bassanite or anhydrite was observed. in experiments, gypsum dehydrates at 100 c to bassanite, at temperatures of 140 c a further alteration to anhydrite takes place (brantut., 2011). the absence of evidence for dehydration and annealing structures in thin - sections indicates deformation temperatures well below 100 c. we did not find any indication (e.g. coarse, undeformed gypsum grains, loss of foliation and lineation) for rehydration processes as observed within many other deformed gypsum - dominated deformation zones (de paola., 2008 ; de paola. this implies dry country rocks and limited fluid flow also in the damage zones adjacent to the shear zone. the presence of gypsum results in low porosity and low permeability at shallow crustal levels. the core of the shear zone acts as a barrier and impedes fluid flow as indicated by the absence of rehydration products. thus it potentially separates two different convection zones of thermal waters within the adjacent damage zones, which dissolve gypsum from shear zone boundaries. sulfur - bearing thermal waters are known at comeglians and at the fella - sava fault in the east (fig. 4) (e.g. italiano., 2009 ; petrini., 2011). applying the model of caine. (1996), the shear zone is a barrier for fluid flow, whereas the adjacent damage zones represents a conduit. the missing annealing is in contrast to gypsum - rich shear zones observed elsewhere, e.g., in the appennines (de paola., 2008 ; de paola., 2007) or northern calcareous alps (leitner and neubauer, 2011 ; schorn and neubauer, 2011), where higher temperature conditions are assumed and access of hydrous fluids resulted in pervasive recrystallization of gypsum rocks. the parallel strike of adjacent units and the resulting lack of convincing piercing points renders determination of the amount of structural the fella - sava fault difficult. based on structurally offset oligocene and triassic rocks, fodor. (1998) and references therein inferred a displacement of 3040 km for the easternmost part. 20 km as indicated by the northern margin of the gorenjska (ljubljana) basin. (2006) suggest a transfer of parts of the displacement to the pull - apart gorenjska basin (fig. (placer, 1999), presenting a transition zone toward the slovenian basin and the bosnian basin in the n and e (plenicar, 2009). the comeglians - paularo shear zone has been assumed to be the western extension of the fella - sava fault, (placer, 1999 ; plenicar, 2009). a contact of the comeglians - paularo shear zone with the valsugana thrust has also been discussed (venturini., 2009a and references therein). as a matter of fact displacement along a fault decreases towards its tips (e.g. barnett., 1987). no movement will be observed at the tip and fault internal deformation will accommodate strain (e.g. froitzheim., 2006). further to the west of comeglians, the gypsum member of the bellerophon formation changes its strike from e w to ene wsw and is thrusted onto the triassic werfen formation (g in fig. 5c), which accommodated part of the dextral displacement and consider it to be the western tip of the shear zone. if this is correct, dextral splay faults close to the western end around comeglians (b in fig. 5b) could be considered as extensive horsetails, which partly accommodated the lateral displacement, too. such shortening has been found by kinematic and paleostress analyses by peresson and decker (1997) who ascribed a late miocene age to this compressional event. along the comeglians - paularo shear zone we observe accommodation of n s shortening and dextral displacement by a major pure shear and a subordinate simple shear component. the subsimple shear zone and shows evidence for a combination of two stretching faults (means, 1989, 1990) as illustrated by an interpretative sketch in fig. symmetric boudins, - and -porphyroclasts and additional extension veins within the clasts (fig. a subordinate simple - shear component is evidenced by asymmetric clasts, shear bands, micro - shear zones, en chelon structures and block rotation with internal antithetic shear. at the surface, the comeglians - paularo shear zone delimits a zone of widespread seismic activity in the south from a zone of insignificant seismicity in the north (fig. present - day or historical seismicity is restricted to a few minor earthquakes (e.g. paluzza ml 4.8, 1956 ; de panfilis, 1959 ; feliziani and marcelli, 1965, 1966 ; reinecker and lenhardt, 1999). along its eastern extension, the fella - sava fault, the large historical earthquake of 1348 a. d. (intensity of ca. 10) was recently placed on the fault (tiberi., 2012). in 1895, ljubljana was destroyed by a major earthquake (mm 6.1 earthquake ; ribari, 1982), which was rather located within the gorenjska basin than on the fella - sava fault itself. ongoing n s thrusting activity within the gorenjska basin has recently been documented by folded quaternary sediments and the active vodice reverse thrust fault n of ljubljana (jamek rupnik., 2013 and references therein). we speculate that the occurrence of gypsum along the western fault trace (comeglians - paularo shear zone) may have absorbed stresses by viscous behavior and thus may have prevented earthquake nucleation. in contrast, the predominance of carbonate - dominated sequences along the eastern segment of the fault may have favored earthquake nucleation. south of the comeglians - paularo shear zone along a parallel fault in the area of tolmezzo few larger earthquakes (international seismological centre, 2011) with dextral focal mechanisms (bressan., 1998 ; willingshofer and cloetingh, 2003) this observation supports the theory of further southward migration of the displacement due to the younging of fault activity from the periadriatic fault to southern parallel faults (vrabec., 2006). thus the fella - sava fault represents the southernmost and the semp and mur - mrz faults the northern boundaries of the extruding blocks during late miocene / pliocene reactivation and ongoing lateral extrusion (caporali., 2013 ; grenerczy, 2013). structural observations along the comeglians - paularo shear zone allow the following major conclusions:we corroborate that the comeglians - paularo shear zone represents the westernmost extension of the fella - sava fault. it terminates west of comeglians with a horse - tail type thrust.the rheologically weak, gypsum - dominated lithology determines shear zone propagation and termination. fault rocks are gypsum - mylonites with a consistently developed steep e w striking foliation and a subhorizontal stretching lineation.missing dehydration products of gypsum and the lack of annealing indicate unusually low temperatures < 100 c during mylonitic deformation of the gypsum. resulting low porosity and low permeability may lead to the core of the shear zone acting as a barrier, impeding fluid flow.the structural and fabric elements are generally consistent in style and orientation at all scale and suggest pure shear e w extension during n s shortening and subordinate dextral displacement along the shear zone.the subsimple shear zone is confined by two stretching faults with stretching occurring within the rheologically weak gypsum layer in between.both internal stretching within the gypsum and brittle structures like the horsetail west of comeglians accommodated portions of the displacement at the comeglians - paularo shear zone. the displacement migrated from along the periadriatic fault southward to the fella - sava fault and as earthquake data suggests, even further to the south during recent times.the comeglians - paularo shear zone impedes fluid flow and possibly earthquake propagation. we corroborate that the comeglians - paularo shear zone represents the westernmost extension of the fella - sava fault. fault rocks are gypsum - mylonites with a consistently developed steep e w striking foliation and a subhorizontal stretching lineation. missing dehydration products of gypsum and the lack of annealing indicate unusually low temperatures < 100 c during mylonitic deformation of the gypsum. resulting low porosity and low permeability may lead to the core of the shear zone acting as a barrier, impeding fluid flow. the structural and fabric elements are generally consistent in style and orientation at all scale and suggest pure shear e w extension during n s shortening and subordinate dextral displacement along the shear zone. the subsimple shear zone is confined by two stretching faults with stretching occurring within the rheologically weak gypsum layer in between. both internal stretching within the gypsum and brittle structures like the horsetail west of comeglians accommodated portions of the displacement at the comeglians - paularo shear zone. the displacement migrated from along the periadriatic fault southward to the fella - sava fault and as earthquake data suggests, even further to the south during recent times.	based on structural and fabric analyses at variable scales we investigate the evaporitic gypsum - dominated comeglians - paularo shear zone in the southern alps (friuli). it represents the lateral western termination of the brittle fella - sava fault. missing dehydration products of gypsum and the lack of annealing indicate temperatures below 100 c during development of the shear zone. despite of such low temperatures the shear zone clearly exhibits mylonitic flow, thus evidencing laterally coeval activity of brittle and viscous deformation.the dominant structures within the gypsum rocks of the lower bellerophon formation are a steeply to gently s - dipping foliation, a subhorizontal stretching lineation and pure shear - dominated porphyroclast systems. a subordinate simple shear component with dextral displacement is indicated by scattered -clasts. both meso- and microscale structures are characteristic of a subsimple shear type of deformation with components of both coaxial and non - coaxial strain. shortening in a transpressive regime was accommodated by right - lateral displacement and internal pure shear deformation within the comeglians - paularo shear zone. the shear zone shows evidence for a combination of two stretching faults, where stretching occurred in the rheologically weaker gypsum member and brittle behavior in enveloping lithologies.
purpureocillium lilacinum (thom) formerly paeciliomyces lilacinus (thom) is a non - melanized, ubiquitous, environmental, filamentous mold. infection caused by this species, now referred to as purpureocilliosis, is sporadic and usually limited to immunosuppressed humans or animals. p. lilacinum has been most frequently described as the cause of hyalohyphomycosis in humans, a dog, a cat, and reptiles. in humans, disease due to p. lilacinum is increasing in importance as the population of immunosuppressed individuals grows and immunosuppressive drugs become more effective and more frequently prescribed. it is of particular concern in patients with indwelling devices or intraocular lens implants, which contribute to it being considered an emerging fungal pathogen. in rare cases, it is diagnosed in humans and animals without underlying immunosuppressive disease or demonstrable evidence of immunosuppression. in order chelonia, p. lilacinum has been associated with disease in a number of species, including chinese soft - shelled turtles (trionyx sinens), an aldabra tortoise (dipsochelys dussemieri), fly river turtles (carettochelys insculpta), a greek tortoise (testudo graeca), and an ornate slider (trachemys ornate). susceptibility of sea turtles to p. lilacinum has been represented by a case of disseminated granulomas in a hawksbill sea turtle (eretmochelys imbricata), as the cause of mycotic pneumonia in a group of commercially raised green sea turtles (chelonia mydas), and as the cause of mycosis in loggerhead sea turtles. a 12 year - old female loggerhead sea turtle (caretta caretta) cared for at a public aquarium was found dead in its exhibit after a history of abnormal buoyancy and decreased appetite of several weeks duration, and a necropsy was performed. the sea turtle had been maintained for 5.5 years in a multi - taxa exhibit tank (7.75 m diameter1.2 m deep) that held 72,000 l of synthetic saltwater at 25 to 26.1 c and 20 ppt salinity. the most notable macroscopic postmortem finding was that of firm, hemorrhagic lungs with scattered, firm, yellow, well demarcated foci of pneumonia (fig. tissue samples of lung and other coelomic viscera obtained at necropsy were fixed by immersion in 10% formalin and submitted to the connecticut veterinary medical diagnostic laboratory (storrs, ct, usa), where they were trimmed and routinely processed for paraffin embedment and histologic sectioning. swabs of frozen tissue samples of lung were streaked onto sabouraud dextrose agar and inhibitory mold agar with gentamicin (0.05 histopathologic evaluation revealed severe, multifocal and focally extensive, heterophilic and granulomatous pneumonia and pleuritis, with multiple heterophilic granulomas extending into ectatic faveolar spaces and expanding the pleura. in several regions, faveolar septae and pleura were expanded by infiltrates of degenerate heterophils together with proteinaceous edema and fibrin (fig. innumerable, intertwined, non - melanized, septate fungal hyphae were located in granulomas and lining the luminal surfaces of affected faveolar septae. hyphae were 2.5 to 4 m wide, had parallel walls, and were readily demonstrable using silver stains. diagnostic fruiting structures, e.g. conidiophores, conidiogenous cells and conidia, were evident in histologic sections of the lung in foci of pneumonia and pleuritis (fig. bacteria were present along with hyphae in faveolae in some instances, and bacterial cultures of samples of lung (performed at a different veterinary diagnostic laboratory) yielded moderate growth of klebsiella oxytoca and alpha - hemolytic streptococcus, and light growth of proteus mirabilis and enterococcus sp. there was concurrent ulcerative bacterial cystitis and renal lesions, which included interstitial fibrosis, tubular degeneration and necrosis, and membranous glomerulopathy. fungal cultures of swabs from the lung grown on sabouraud dextrose agar and inhibitory mold agar with gentamicin (0.05 g / l) yielded two hyaline molds after 4 days of incubation at 30 c. these were subsequently referred to the fungus testing laboratory (university of texas health science center at san antonio, san antonio, tx) for species identification and were accessioned into their culture collection as isolate numbers uthsc 1030 and 1031. they were identified as beauveria bassiana and p. lilacinum, respectively, based upon their macroscopic and microscopic features on potato flakes agar and carnation leaf agar (prepared in - house) after 6 days incubation at 25 c. b. bassiana displayed small, white, granular colonies and produced its smooth, subglobose conidia (23 m) in discrete masses along the hyphae from denticles on a geniculate rachis. phenotypic features used to identify p. lilacinum included mauve - colored colonies with a pale reverse, finely - roughened conidiophores giving rise to dense clusters of phialidic conidiogenous cells supported on metulae and chains of oval to subglobose conidia borne from these conidiogenous cells. morphologic features of fruiting structures of the fungus identified in foci of pneumonia and pleuritis were identical to those of the p. lilacinum isolate recovered from the lung, thereby confirming its etiologic role in the pulmonary lesions (fig. in this case of mycotic pneumonia and pleuritis, fruiting structures diagnostic for p. lilacinum and comparable to those in culture were recognized in histologic tissue sections in anatomic association with pulmonary lesions. morphology on fungal culture has previously been combined with morphologic features observed histologically to identify p. lilacinum infections in humans, turtles and a cat. identification of p. lilacinum based on its microscopic morphology alone, either in the host or in culture, is difficult since p. lilacinum could be misidentified as either a penicillium or a paecilomyces species, such as p. variotii, due to similarities in reproductive structures. the color of the colony on a plant - based medium such as potato flakes agar (pfa) clearly distinguishes these genera / species, however, which for p. lilacinum, penicillium spp., and most paecilomyces spp. would be violet to mauve, some shade of green, or tan to brownish, respectively. because all of the above are common environmental fungi that can be present as laboratory contaminants, the clinical significance of their isolation this concern is further intensified when the anatomic location of the sample is inherently non - sterile and available to contamination or colonization by an environmental mold, e.g. the skin, mouth or nasal cavity. histopathologic identification of morphologically compatible fungal structures in lesions can be the key to ascribing significance to isolates from clinical samples and is indispensible in determining whether an isolate represents a contaminant, colonization or bona fide infection. the phenomenon of fruiting or conidial production in tissue is rare in human fungal infections, where it is mostly seen with chronic cavitary pulmonary aspergillosis ; its occurrence in fungal infections in animals is less well known. in general, it is rare that histopathologic examination alone can provide the genus and species of a fungus. this is especially true in cases where hyaline filamentous hyphae are seen in tissue, which makes this case particularly unique and re - emphasizes the need for thorough histopathologic examination toward the most exacting description possible in the context of the anatomic and pathologic features of the case. although no fruiting structures were observed for a beauveria species in the multiple histologic sections examined, this does not rule out the possibility that not - fruiting fungal hyphae of b. bassiana could also have been present. it is not implausible that an infection by two fungi could have occurred in this turtle. the occurrence of dual fungal infections in human medicine has been reported to be as high as 20%. like p. lilacinum, b. bassiana is ubiquitous in the environment and capable of being isolated from indoor air ; it too produces hyaline, septate hyphae, which are indistinguishable from those produced by p. lilacinum. additionally, b. bassiana has been identified as an agent of mycotic pleuritis and pulmonary disease in a turtle, e.g. a captive pond slider (trachemys scripta). in cases of dual fungal infections, it may be that only the most abundant fungus is recognized ; if the second fungus is isolated in culture but not recognized in tissue section, then histopathologic and culture results will appear discrepant. pcr was attempted on formalin - fixed, paraffin - embedded tissue from affected areas of lung, but the tissue was unsuitable for fungal pcr testing because dna was not amplifiable from any tissue block using primers and pcr conditions that amplify a fragment of a common housekeeping gene (data not shown). given these data and the possibility that it could have been an environmental contaminant, the b. bassiana isolate was considered less significant to the origin or progression of the pulmonary lesions in this case. fungal infection is often associated with poor cellular immunity and can be predisposed by environmental conditions such as overcrowding, high population density, stress, poor water quality and, in the case of cold stunned turtles, a drop in environmental and, hence, body temperature. in this case, however, the turtle was well acclimated to its surroundings, and all water quality parameters were within normal limits. it is unknown if the concurrent cystitis and renal lesions affected the overall immune status of this turtle. a complete immunologic evaluation was not performed on this sea turtle ; so, the immune status of this individual before death is open to speculation. on the other hand, p. lilacinum has been described in humans and animals without underlying predisposing factors or immunosuppression. in summary, this case demonstrates the infrequently encountered phenomenon of fruiting or conidial production in tissue, and it reiterates the importance of having a histological correlate to fungal culture when environmental fungi are isolated. even though fungal culture remains the gold standard for diagnosis of purpureocilliosis, since p. lilacinum is a common environmental fungus, the results of culture in the absence of a histologic correlate should be interpreted with care. poikilotherms represent a broad group of animals of veterinary concern in which environmental factors, specifically temperature, exert significant influence on immunologic processes. as a result, these animals can be susceptible to infection by opportunistic environmental fungi, some of which may be emerging in their public and veterinary health relevance.	purpureocillium lilacinum and beauveria bassiana were isolated from lung sampled at necropsy of a 12 year - old female loggerhead sea turtle (caretta caretta) that had displayed abnormal buoyancy. histopathologic evaluation revealed pleuritis and pneumonia with non - melanized, septate hyphae and fruiting structures identical to those of p. lilacinum. this case emphasizes the importance of a histological correlate to fungal culture when environmental fungi are isolated and demonstrates the infrequent phenomenon of fruiting or conidial production in tissue.
amp v. myriad treats genetic material as a product of nature : the genome is a natural resource that scientists discover but do not invent. the genome clearly fits the definition of a natural resource : something that is found in nature and is necessary or useful to humans. by accepting this fact, the supreme court positioned medical genetics under the framework of natural resource law and, in effect, recast medical genetics as an extractive, rather than inventive, industry. extractive industries such as mining, fishing, and energy wind farms discover natural resources and develop infrastructures to extract them from their natural settings and convert them into products and services people can use. that is what medical geneticists do, using infrastructures that include laboratories, databases, biobanks, and health information systems. the infrastructures use innovative technologies that may be eligible for intellectual property protection, but the resources themselves are not. resource law grants rights including exclusive rights to people who discover or commercially develop natural resources, but it differs from patent law in important ways explored later in this article. treating the genome as a natural resource in no way implies that it is a bulk, undifferentiated commodity. some resources (such as gravel) are fungible, but others (such as the rock containing the hope diamond) have unique features. the gene deposits found in each individual have unique attributes meaningful to geneticists, just as gold mines have distinctive geological and chemical characteristics significant to metallurgists. calling the genome a natural resource states no position on whether genetic data should be public or private property some are public goods (the atmosphere) ; others can be privately owned (farmland). natural resource entitlements have been debated through the millennia as intensely as genetic data ownership is debated today. under the old res nullius doctrine, rarely used today, it let private owners stake claims as in the klondike gold rush. it grants surface landowners a right to subsurface minerals and results in private ownership and trading of mineral rights. many nations instead embrace state ownership rooted in postclassic roman law circa 230530 ad which vests mineral rights in the state as representative of the people. the united states uses accession doctrine for minerals under private land but public ownership of resources off shore and under public lands. an advantage of resource law is that exclusive rights to extract natural resources typically carry reciprocal civic duties. for example, the us bureau of ocean energy management, acting for the american people, allocates exclusive rights to produce oil from 8,000 oil and gas leases covering 1.7 billion acres of the outer continental shelf. qualified producers bid for the privilege of commercially developing each lease, agreeing to share part of the wealth they extract with the government and to develop the lease diligently and subject to environmental and other requirements. even when resources are privately owned, governments impose environmental, reclamation, and other civic duties by regulation. had genes originally been framed as natural resources rather than as patentable subject matter, myriad 's exclusive right to extract commercial value from the breast cancer 1 (brca1) and brca2 genes might have carried with it, for example, duties to share data about the clinical validity and utility of the gene variants that myriad detected. instead, myriad was able to treat data derived from brca testing as one of the spoils of patent exclusivity, strangely resurrecting the ancient res nullius doctrine for genetic information. after november 2004, myriad chose as it had every legal right to do to stop contributing data to public databases and now holds proprietary data on genetic variants of unknown significance that help decipher the clinical meaning of brca tests. commenting on the world 's mining and petroleum industries, the extractive industries transparency initiative notes that 3.5 billion people live in resource - rich countries. still, many are not seeing the benefits from extraction of their natural resources. sadly, under the gene patenting regime of the past 2 decades, americans did not see the full benefits from extraction of their genomic resources. many insights extracted from their genes are locked away in proprietary databases. in medical genetics, the theoretically minable resource includes the genomes and the clinical information of all living human beings, plus those of any deceased individuals for whom such information has been preserved. in practice, the available resource base is considerably smaller because most people now alive will never undergo genetic testing. the world health organization estimates that 2.6 billion people half the developing world lack even a simple improved latrine and 1.1 billion people has no access to any type of improved drinking source of water. these unplumbed souls are unlikely to have their genomes sequenced and are not part of the resource base from which medical genetics can extract useful discoveries. other unrecoverable genomes include those of insured people who lack a clinical indication that makes genetic testing medically necessary, the uninsured who can not afford testing, and uncurious sorts who simply do not care. this leaves a potential recoverable resource base of perhaps a few tens of millions of genomes that will be studied (in whole or in part) during the next 2050 years. all the valuable goods and services that medical genetics will deliver in our lifetimes must be extracted from this limited resource pool. natural resource law frames the challenge as how to provide the best stewardship of this resource so as to maximize the extraction of useful benefits. the amp v. myriad decision already is enhancing competition by reducing patent barriers that blocked laboratories from offering certain kinds of test. there is a risk that competition may reduce the extraction of useful knowledge from the limited pool of genomes being tested. to infer the clinical meaning of particular gene variants, when the meaning is not already known, requires large population samples of genetic information that has been linked with clinical information about the tested individuals. according to a well - known principle of resource economics, when multiple operators work in a common - pool (shared) resource (cpr), they can extract more value by coordinating their efforts, and competition produces waste. in medical genetics, waste takes the form of lost or delayed opportunities to extract statistically significant new insights into the clinical validity or utility of particular gene variants. individual genetic findings are, in effect, nonrenewable resources because a person who has a gene extracted by one laboratory is unlikely to have that same gene tested again. genetic data are health information, subject to privacy and human - subject protection laws that perpetuate fragmentation once it exists. under the health insurance portability and accountability act (hipaa) privacy rule, for example, sharing data generally requires patient authorization, although hipaa flips to a so - called liability - rule regime that overrides the need for patient permission in various circumstances. hipaa 's liability rules, for example, allow unconsented access for public health activities, for research pursuant to a waiver approved by an institutional review board or privacy board, or if data are deidentified. hipaa grants individuals a degree of control over their data that is strikingly similar to what they would enjoy if they actually owned their data : property rights also sometimes flip to liability - rule protection, as when buildings are condemned for public safety or to build a highway. only a few states recognize patient property rights in data, but hipaa constrains data sharing in a surprisingly similar way. once fragmentation occurs, laws such as hipaa make it hard to reassemble the comprehensive data resources needed to discover new genotype phenotype relationships. a widespread misconception is that data can be deidentified to comply with hipaa and then assembled into useful data commons for such research. deidentified data, although useful for some purposes, have very limited value if the goal is to study the clinical validity and utility of gene variants. such studies require data resources that link individuals ' genetic results with their clinical information. this linkage requires at least some identifying information, to verify that genetic and clinical records relate to the same individual. data commons must be assembled through other legal pathways, such as obtaining individual authorization / consent, or investing labor and building information infrastructure to reconnect data in ways that satisfy one of hipaa 's other liability rules. distributed data networks such as the us food and drug administration 's 100-million - person mini - sentinel system exemplify this latter approach. data stay within each data holder 's privacy firewall, but data holders cooperate to convert their data into interoperable formats and respond to external queries in a privacy - compliant manner. in theory, but lawfully shared data are partly rivalrous (subject to supply constraints) because there is a finite supply of the required labor and infrastructure. gene patents, whatever their flaws, had the beneficial effect of consolidating commercial exploitation of specific genes under the management of patent monopoly holders. myriad reports a 3% rate of brca variants of unknown significance, whereas european brca testing services report a 20% rate of variants of unknown significance. although not independently verifiable, myriad 's figure seems consistent with experience in other extractive industries, where exclusive operators tend to be effective managers of cprs. in a total resource pool of 1 million patients undergoing brca testing, a unitized effort that tests all million patients is more likely to extract statistically significant findings about rare gene variants than are five laboratories each doing 200,000 tests. resource lawyers point to the disastrous example of the east texas oil field, which, when discovered, was the largest oil reservoir in the world. because of its size, many operators leased acreage above it and competed to produce oil from the cpr. by 1931, their uncoordinated efforts were leaving 8090% of the oil permanently trapped in the rocks below. they invested $ 200 million (about a billion in today 's dollars) in duplicative oil wells. the texas governor sent in troops to impose production quotas that reduced the waste, but, even then, the better solution, which most producing states embrace, is compulsory unitization of cprs. unitization appoints an exclusive operator to manage the cpr on behalf of all competing producers, who divide the proceeds using a preset formula. compulsory unitization proved politically infeasible in east texas amid disputes over the profit - sharing formula. unitization tends to be more acceptable ex ante (before production begins) when competitors are behind a veil of ignorance about how rich their own portion of the resource may prove to be. after amp v. myriad, proprietary databases may become even more fragmented than they are today. even if laboratories in aggregate test many patients, they may not be able to connect the dots to interpret what the results mean. research investments may suffer as private - sector laboratories expand advertising in an intense competition for market share, which is crucial to a laboratory 's capacity to extract statistically significant findings that improve its future ability to interpret the tests it offers. competition thus has the potential to impede discoveries that could improve genetic test interpretation and the clinical application of genetic test results. nations often do choose technically suboptimal production of their natural resources in pursuit of other important values. a competitive genetic testing industry has offsetting advantages, such as lowering the cost of tests and letting patients seek confirmatory testing before important medical decisions. moreover, patent - created monopolies are not the only (or the best) way to avoid coordination problems. gene patenting may go down in economic history as the most wasteful failure of natural resource management since the east texas oil field. other approaches can reap benefits of a competitive genetic testing industry while still promoting coordinated discovery and innovation. experience shows that neither the state nor the market is uniformly successful in managing cprs. a portfolio of approaches often is required. voluntary cooperation sometimes emerges ; there are examples of self - organized, self - governing collectives that have managed irrigation, meadowlands, and forests over hundreds of years. efforts to develop voluntary, donative genetic data commons have produced successes and public entities such as the national institutes of health have promoted data sharing and helpful policy reforms. a laboratory 's right to mine the genome could be conditioned on sharing information about the variants it detects while doing so. the centers for medicare and medicaid services administers regulations under the clinical laboratory improvement amendments of 1988 (clia) and has broad rulemaking authority in this area. the agency seemingly could amend its regulations to require data sharing by laboratories that perform genetic tests. these requirements would only apply prospectively, however. forcing laboratories to share past data raises problems under the constitution 's takings clause, which prevents the government from confiscating private assets without just compensation. when the federal government imposes new regulatory duties nowadays, it often relies on public / private partnerships rather than creating new federal bureaucracies. professional bodies such as the american college of medical genetics and genomics (acmg) could help the centers for medicare and medicaid services identify needed types of data sharing to reduce waste. as a condition of clia certification, the centers for medicare and medicaid services could require laboratories to deposit such data into a shared database, which could be operated as a financially self - sustaining public / private partnership. if the centers for medicare and medicaid services fails to act, the states have a long history with conservation to prevent waste of natural resources, although a state - led solution loses the benefits of nationally scaled coordination and some scholars question the competence of state conservation commissions to set science policy. the flaw in this scheme is its impact on incentives to invest in developing new information resources. if lab a deposits 99 clinically significant genotype phenotype correlations in a public database, and lab b deposits just 1, then lab a arguably deserves 99% of the revenues lab b earns by using the shared data resource. unless an appropriate revenue - sharing formula is agreed, mandatory data deposit rewards free riders and chills investment in data creation. public funding plays a crucial role in genetics, but private investment is also needed. the scholarly and scientific communities have strong norms favoring data sharing at no cost. such norms favor static efficiency over dynamic efficiency or, in noneconomic jargon, they kill the goose that lays the golden egg. dynamic efficiency focuses on how to ensure abundant supplies of useful data for the future and is essential to sustainable discovery. expropriating the fruits of private investment the united states is the only nation that maintained private ownership of its large energy and resource infrastructures throughout the 20th century. many nations nationalized such assets at midcentury. as the 20th century ended, however, governments worldwide were turning back to private infrastructure ownership to restore efficiencies lost by placing assets under public ownership. commentators who call for myriad to disclose its data at no charge acknowledge that myriad invested its own capital to develop these resources. some scholars call it an asymmetry that private laboratories use publicly financed data resources while refusing to share their privately developed data. this is asymmetrical only if driving our cars on public highways obligates each of us to let the public sit in our own living rooms. market - based approaches are a subclass of voluntary solutions that add price incentives to the other incentives to cooperate. experience with other resources suggests that market - based solutions are the best way to achieve dynamic efficiency and sustainability. environmental laws that the united states passed in the 1970s drew heavily on ethical environmentalism, which grounds duties to protect the environment in moral and aesthetic rationales. modern regulations reject command - and - control tactics in favor of such efficiency - oriented instruments as tradeable permits, corrective taxes, and other tools designed to replicate the conditions of a well - functioning market. a market for genetic data could promote sharing while incentivizing investments to develop future data resources, but there are moral concerns about commoditizing patients ' health data. congress foresaw this dilemma in 2009 when passing the health information technology for economic and clinical health (hitech) act. under most states ' laws, laboratories do not own the data they hold and thus have no legal basis to sell it. it does, however, let laboratories charge a reasonable, cost - based fee for services to prepare and transmit data that they share for research under hipaa waivers without patient authorization. sharing data consumes labor and uses database infrastructure that data holders have invested to create. hitech 's cost - based fee, had it been implemented properly, could have strengthened incentives to share data. hitech does not overtly let data holders charge a price for data, but their expenses and capital invested to develop the data are costs of data preparation that presumably can be recovered through the cost - based fee. laboratories that receive data gratuitously as a by - product of providing paid testing services seemingly have zero data - development costs to recover, but laboratories that actively invest to enhance the value of their data sets presumably could track those expenditures and recover them as data - preparation costs. cost - based fees thus create incentives that are surprising similar to market - based prices, provided the fees let investors recover a reasonable return on their invested capital. over the past 125 years, the supreme court has pondered whether it is constitutional for the government to force the use of regulated, cost - based fees in many different infrastructure contexts. to be constitutional, a cost - based fee for infrastructure services must be set high enough to let investors recoup the following : (i) variable and fixed costs of providing the services, (ii) capital they invested to develop their infrastructures, and (iii) a reasonable profit margin (rate of return on capital). a fee that offers no reasonable prospect that private investors can earn a return on invested capital is confiscatory and violates the takings clause. modifications to the hipaa privacy rule that went into effect on 23 september 2013 set the cost - based fee too low by omitting this third item : a return on capital invested in data development and database infrastructure. making matters worse, the 2012 case of mayo collaborative services v. prometheus laboratories prevents laboratories that discover clinically useful genotype phenotype relationships from obtaining method patents to protect this sort of discovery. many laboratories have invested heavily in data infrastructure, and much more investment is required. as things stand, laboratories seemingly have no way to earn a return on these investments, other than by hoarding data as trade secrets and using their databases to add value to their own genetic testing services. viewed this way, the problem is not that laboratories refuse to share genetic data. the problem is a defective hipaa privacy rule that inflicts financial losses on laboratories that do share. the long - term solution is to challenge the constitutionality of hipaa 's cost - based fee. this court challenge could be brought by aggrieved database investors or by patients and researchers denied access to needed data - related services because investors are unwilling to supply them under hipaa 's inadequate fee structure. in light of precedents from other infrastructure industries, the odds of a successful constitutional challenge appear rather good. an interim solution is to arrange virtual data access through a distributed data network, instead of using hipaa waivers to move data across privacy firewalls into a centralized data commons. virtual access is not as good as real access to data but beats the alternative of no access, if data holders refuse to supply data at hipaa 's cost - based fee. researchers needing to use a laboratory 's data would send a question to the laboratory, which would supply research services (rather than the raw data) to answer the question and transmit the answer. well - crafted research contracts can help researchers control the methodology and audit the results. consider sale of protected health information to encompass payments a covered entity may receive in the form of grants, contracts, or other arrangements to perform programs or activities, such as a research study, because any provision of protected health information to the payer is a byproduct of the service being provided. data holders have incentives to supply research services because they can negotiate free - market rates instead of hipaa 's cost - based fee. clinical test interpretation services also appear eligible for market pricing. these could include stand - alone interpretation services that help patients assess the clinical significance of variants of unknown significance detected by tests done at competing laboratories. a little - known hipaa fact is that using an individual 's data for treatment purposes can include treatment of other people. treatment uses of data do not require individual authorization or a waiver, so the cost - based fee would not apply. antitrust sanctions are available if laboratories with unique and essential database assets demand monopolistic prices. compulsory data disclosure would force sharing of existing data while potentially destroying incentives to invest in sustainable data resources for the future. solving this problem requires a portfolio of voluntary approaches that supplements donative and publicly funded data commons with market - oriented solutions that have worked well in other natural resource industries. in medical genetics, the theoretically minable resource includes the genomes and the clinical information of all living human beings, plus those of any deceased individuals for whom such information has been preserved. in practice, the available resource base is considerably smaller because most people now alive will never undergo genetic testing. the world health organization estimates that 2.6 billion people half the developing world lack even a simple improved latrine and 1.1 billion people has no access to any type of improved drinking source of water. these unplumbed souls are unlikely to have their genomes sequenced and are not part of the resource base from which medical genetics can extract useful discoveries. other unrecoverable genomes include those of insured people who lack a clinical indication that makes genetic testing medically necessary, the uninsured who can not afford testing, and uncurious sorts who simply do not care. this leaves a potential recoverable resource base of perhaps a few tens of millions of genomes that will be studied (in whole or in part) during the next 2050 years. all the valuable goods and services that medical genetics will deliver in our lifetimes must be extracted from this limited resource pool. natural resource law frames the challenge as how to provide the best stewardship of this resource so as to maximize the extraction of useful benefits. the amp v. myriad decision already is enhancing competition by reducing patent barriers that blocked laboratories from offering certain kinds of test. there is a risk that competition may reduce the extraction of useful knowledge from the limited pool of genomes being tested. to infer the clinical meaning of particular gene variants, when the meaning is not already known, requires large population samples of genetic information that has been linked with clinical information about the tested individuals. according to a well - known principle of resource economics, when multiple operators work in a common - pool (shared) resource (cpr), they can extract more value by coordinating their efforts, and competition produces waste. in medical genetics, waste takes the form of lost or delayed opportunities to extract statistically significant new insights into the clinical validity or utility of particular gene variants. individual genetic findings are, in effect, nonrenewable resources because a person who has a gene extracted by one laboratory is unlikely to have that same gene tested again. genetic data are health information, subject to privacy and human - subject protection laws that perpetuate fragmentation once it exists. under the health insurance portability and accountability act (hipaa) privacy rule, for example, sharing data generally requires patient authorization, although hipaa flips to a so - called liability - rule regime that overrides the need for patient permission in various circumstances. hipaa 's liability rules, for example, allow unconsented access for public health activities, for research pursuant to a waiver approved by an institutional review board or privacy board, or if data are deidentified. hipaa grants individuals a degree of control over their data that is strikingly similar to what they would enjoy if they actually owned their data : property rights also sometimes flip to liability - rule protection, as when buildings are condemned for public safety or to build a highway. only a few states recognize patient property rights in data, but hipaa constrains data sharing in a surprisingly similar way. once fragmentation occurs, laws such as hipaa make it hard to reassemble the comprehensive data resources needed to discover new genotype phenotype relationships. a widespread misconception is that data can be deidentified to comply with hipaa and then assembled into useful data commons for such research. deidentified data, although useful for some purposes, have very limited value if the goal is to study the clinical validity and utility of gene variants. such studies require data resources that link individuals ' genetic results with their clinical information. this linkage requires at least some identifying information, to verify that genetic and clinical records relate to the same individual. data commons must be assembled through other legal pathways, such as obtaining individual authorization / consent, or investing labor and building information infrastructure to reconnect data in ways that satisfy one of hipaa 's other liability rules. distributed data networks such as the us food and drug administration 's 100-million - person mini - sentinel system exemplify this latter approach. data stay within each data holder 's privacy firewall, but data holders cooperate to convert their data into interoperable formats and respond to external queries in a privacy - compliant manner. in theory, but lawfully shared data are partly rivalrous (subject to supply constraints) because there is a finite supply of the required labor and infrastructure. gene patents, whatever their flaws, had the beneficial effect of consolidating commercial exploitation of specific genes under the management of patent monopoly holders. myriad reports a 3% rate of brca variants of unknown significance, whereas european brca testing services report a 20% rate of variants of unknown significance. although not independently verifiable, myriad 's figure seems consistent with experience in other extractive industries, where exclusive operators tend to be effective managers of cprs. in a total resource pool of 1 million patients undergoing brca testing, a unitized effort that tests all million patients is more likely to extract statistically significant findings about rare gene variants than are five laboratories each doing 200,000 tests. resource lawyers point to the disastrous example of the east texas oil field, which, when discovered, was the largest oil reservoir in the world. because of its size, many operators leased acreage above it and competed to produce oil from the cpr. by 1931, their uncoordinated efforts were leaving 8090% of the oil permanently trapped in the rocks below. they invested $ 200 million (about a billion in today 's dollars) in duplicative oil wells. the texas governor sent in troops to impose production quotas that reduced the waste, but, even then, much of the recoverable oil was forever lost. the better solution, which most producing states embrace, is compulsory unitization of cprs. unitization appoints an exclusive operator to manage the cpr on behalf of all competing producers, who divide the proceeds using a preset formula. compulsory unitization proved politically infeasible in east texas amid disputes over the profit - sharing formula. unitization tends to be more acceptable ex ante (before production begins) when competitors are behind a veil of ignorance about how rich their own portion of the resource may prove to be. after amp v. myriad, proprietary databases may become even more fragmented than they are today. even if laboratories in aggregate test many patients, they may not be able to connect the dots to interpret what the results mean. research investments may suffer as private - sector laboratories expand advertising in an intense competition for market share, which is crucial to a laboratory 's capacity to extract statistically significant findings that improve its future ability to interpret the tests it offers. competition thus has the potential to impede discoveries that could improve genetic test interpretation and the clinical application of genetic test results. nations often do choose technically suboptimal production of their natural resources in pursuit of other important values. a competitive genetic testing industry has offsetting advantages, such as lowering the cost of tests and letting patients seek confirmatory testing before important medical decisions. moreover, patent - created monopolies are not the only (or the best) way to avoid coordination problems. gene patenting may go down in economic history as the most wasteful failure of natural resource management since the east texas oil field. other approaches can reap benefits of a competitive genetic testing industry while still promoting coordinated discovery and innovation. experience shows that neither the state nor the market is uniformly successful in managing cprs. a portfolio of approaches often is required. voluntary cooperation sometimes emerges ; there are examples of self - organized, self - governing collectives that have managed irrigation, meadowlands, and forests over hundreds of years. efforts to develop voluntary, donative genetic data commons have produced successes and public entities such as the national institutes of health have promoted data sharing and helpful policy reforms. a laboratory 's right to mine the genome could be conditioned on sharing information about the variants it detects while doing so. the centers for medicare and medicaid services administers regulations under the clinical laboratory improvement amendments of 1988 (clia) and has broad rulemaking authority in this area. the agency seemingly could amend its regulations to require data sharing by laboratories that perform genetic tests. these requirements would only apply prospectively, however. forcing laboratories to share past data raises problems under the constitution 's takings clause, which prevents the government from confiscating private assets without just compensation. when the federal government imposes new regulatory duties nowadays, it often relies on public / private partnerships rather than creating new federal bureaucracies. professional bodies such as the american college of medical genetics and genomics (acmg) could help the centers for medicare and medicaid services identify needed types of data sharing to reduce waste. as a condition of clia certification, the centers for medicare and medicaid services could require laboratories to deposit such data into a shared database, which could be operated as a financially self - sustaining public / private partnership. if the centers for medicare and medicaid services fails to act, the states have a long history with conservation to prevent waste of natural resources, although a state - led solution loses the benefits of nationally scaled coordination and some scholars question the competence of state conservation commissions to set science policy. the flaw in this scheme is its impact on incentives to invest in developing new information resources. if lab a deposits 99 clinically significant genotype phenotype correlations in a public database, and lab b deposits just 1, then lab a arguably deserves 99% of the revenues lab b earns by using the shared data resource. unless an appropriate revenue - sharing formula is agreed, mandatory data deposit rewards free riders and chills investment in data creation. public funding plays a crucial role in genetics, but private investment is also needed. the scholarly and scientific communities have strong norms favoring data sharing at no cost. such norms favor static efficiency over dynamic efficiency or, in noneconomic jargon, they kill the goose that lays the golden egg. dynamic efficiency focuses on how to ensure abundant supplies of useful data for the future and is essential to sustainable discovery. the united states is the only nation that maintained private ownership of its large energy and resource infrastructures throughout the 20th century. many nations nationalized such assets at midcentury. as the 20th century ended, however, governments worldwide were turning back to private infrastructure ownership to restore efficiencies lost by placing assets under public ownership. commentators who call for myriad to disclose its data at no charge acknowledge that myriad invested its own capital to develop these resources. some scholars call it an asymmetry that private laboratories use publicly financed data resources while refusing to share their privately developed data. this is asymmetrical only if driving our cars on public highways obligates each of us to let the public sit in our own living rooms. market - based approaches are a subclass of voluntary solutions that add price incentives to the other incentives to cooperate. experience with other resources suggests that market - based solutions are the best way to achieve dynamic efficiency and sustainability. environmental laws that the united states passed in the 1970s drew heavily on ethical environmentalism, which grounds duties to protect the environment in moral and aesthetic rationales. modern regulations reject command - and - control tactics in favor of such efficiency - oriented instruments as tradeable permits, corrective taxes, and other tools designed to replicate the conditions of a well - functioning market. a market for genetic data could promote sharing while incentivizing investments to develop future data resources, but there are moral concerns about commoditizing patients ' health data. congress foresaw this dilemma in 2009 when passing the health information technology for economic and clinical health (hitech) act. hitech added data sales restrictions to the hipaa privacy rule. under most states ' laws, laboratories do not own the data they hold and thus have no legal basis to sell it. it does, however, let laboratories charge a reasonable, cost - based fee for services to prepare and transmit data that they share for research under hipaa waivers without patient authorization. sharing data consumes labor and uses database infrastructure that data holders have invested to create. hitech 's cost - based fee, had it been implemented properly, could have strengthened incentives to share data. hitech does not overtly let data holders charge a price for data, but their expenses and capital invested to develop the data are costs of data preparation that presumably can be recovered through the cost - based fee. laboratories that receive data gratuitously as a by - product of providing paid testing services seemingly have zero data - development costs to recover, but laboratories that actively invest to enhance the value of their data sets presumably could track those expenditures and recover them as data - preparation costs. cost - based fees thus create incentives that are surprising similar to market - based prices, provided the fees let investors recover a reasonable return on their invested capital. over the past 125 years, the supreme court has pondered whether it is constitutional for the government to force the use of regulated, cost - based fees in many different infrastructure contexts. to be constitutional, a cost - based fee for infrastructure services must be set high enough to let investors recoup the following : (i) variable and fixed costs of providing the services, (ii) capital they invested to develop their infrastructures, and (iii) a reasonable profit margin (rate of return on capital). a fee that offers no reasonable prospect that private investors can earn a return on invested capital is confiscatory and violates the takings clause. modifications to the hipaa privacy rule that went into effect on 23 september 2013 set the cost - based fee too low by omitting this third item : a return on capital invested in data development and database infrastructure. making matters worse, the 2012 case of mayo collaborative services v. prometheus laboratories prevents laboratories that discover clinically useful genotype phenotype relationships from obtaining method patents to protect this sort of discovery. many laboratories have invested heavily in data infrastructure, and much more investment is required. as things stand, laboratories seemingly have no way to earn a return on these investments, other than by hoarding data as trade secrets and using their databases to add value to their own genetic testing services. viewed this way, the problem is not that laboratories refuse to share genetic data. the problem is a defective hipaa privacy rule that inflicts financial losses on laboratories that do share. the long - term solution is to challenge the constitutionality of hipaa 's cost - based fee. this court challenge could be brought by aggrieved database investors or by patients and researchers denied access to needed data - related services because investors are unwilling to supply them under hipaa 's inadequate fee structure. in light of precedents from other infrastructure industries, an interim solution is to arrange virtual data access through a distributed data network, instead of using hipaa waivers to move data across privacy firewalls into a centralized data commons. virtual access is not as good as real access to data but beats the alternative of no access, if data holders refuse to supply data at hipaa 's cost - based fee. researchers needing to use a laboratory 's data would send a question to the laboratory, which would supply research services (rather than the raw data) to answer the question and transmit the answer. well - crafted research contracts can help researchers control the methodology and audit the results. consider sale of protected health information to encompass payments a covered entity may receive in the form of grants, contracts, or other arrangements to perform programs or activities, such as a research study, because any provision of protected health information to the payer is a byproduct of the service being provided. data holders have incentives to supply research services because they can negotiate free - market rates instead of hipaa 's cost - based fee. clinical test interpretation services also appear eligible for market pricing. these could include stand - alone interpretation services that help patients assess the clinical significance of variants of unknown significance detected by tests done at competing laboratories. a little - known hipaa fact is that using an individual 's data for treatment purposes can include treatment of other people. treatment uses of data do not require individual authorization or a waiver, so the cost - based fee would not apply. antitrust sanctions are available if laboratories with unique and essential database assets demand monopolistic prices. compulsory data disclosure would force sharing of existing data while potentially destroying incentives to invest in sustainable data resources for the future. solving this problem requires a portfolio of voluntary approaches that supplements donative and publicly funded data commons with market - oriented solutions that have worked well in other natural resource industries.	the supreme court 's recent decision in association for molecular pathology v. myriad genetics portrays the human genome as a product of nature. this frames medical genetics as an extractive industry that mines a natural resource to produce valuable goods and services. natural resource law offers insights into problems medical geneticists can expect after this decision and suggests possible solutions. increased competition among clinical laboratories offers various benefits but threatens to increase fragmentation of genetic data resources, potentially causing waste in the form of lost opportunities to discover the clinical significance of particular gene variants. the solution lies in addressing legal barriers to appropriate data sharing. sustainable discovery in the field of medical genetics can best be achieved through voluntary data sharing rather than command - and - control tactics, but voluntary mechanisms must be conceived broadly to include market - based approaches as well as donative and publicly funded data commons. the recently revised health insurance portability and accountability act privacy rule offers an improved but still imperfect framework for market - oriented data sharing. this article explores strategies for addressing the privacy rule 's remaining defects. america is close to having a legal framework that can reward innovators, protect privacy, and promote needed data sharing to advance medical genetics.genet med 16 7, 504509.
to date, more than 50 million cancer survivors have been treated with radiotherapy worldwide.1) it is well documented that radiotherapy can induce a type of vascular disease, termed vasculopathy.2)3) in addition, it has become increasingly evident that cranial radiation therapy increases the risk of stroke for cancer survivors.4)5) although radiation - induced occlusive vasculopathies are well documented, little is known about the characteristics of radiation - induced intracranial aneurysms and their optimal treatment strategy. these events are believed to be a rare complication, and to our knowledge, only 26 cases have been reported in the literature.6) herein, we report the case of a woman in whom an anterior communicating artery aneurysm developed eight years after she underwent cranial radiation therapy for a chondrosarcoma, located in the sphenoid sinus. this 69-year - old woman was found to have a large mass destroying her sphenoid sinus when she lost vision in her right eye eight years prior to current presentation (fig., there appeared to be a chance of injuring the internal carotid artery (ica). the anterior communicating artery was widely patent on the balloon test occlusion, and no vascular abnormalities, including aneurysm, were identified by the catheter angiography (fig. she underwent gross - total resection of the tumor at that time without any adverse event, and a pathological examination confirmed the diagnosis of chondrosarcoma. she subsequently underwent cranial radiation therapy (total dose of 59.4 gy) as adjuvant treatment. she was clinically monitored throughout the next eight years with serial magnetic resonance imaging (mri). during this time, she demonstrated no new neurological deficit except slight cognitive decline, and none of the mris showed any sign of residual or recurrent tumor (fig. the patient presented to the emergency room due to severe headache and a slightly drowsy mentality, and computed tomography (ct) revealed intracerebral hemorrhage and subarachnoid hemorrhage (fig. the patient underwent catheter angiography, which revealed an aneurysm of the anterior communicating artery and luminal narrowing and irregularity in the petrous and lacerum segments of the right ica (fig. we suspected that the anterior communicating artery aneurysm had ruptured and attempted endovascular treatment with coil embolization. however, the tortuosity of the bilateral a1 segments of the anterior cerebral arteries (acas) and the broad neck of the aneurysm made the endovascular treatment difficult. the wall of the aneurysm was very rubbery, and the surgical clip slipped from the neck of the aneurysm. after several surgical clipping attempts, the neck of the aneurysm was clipped, and a booster clip was used to reinforce the primary clip. ct angiography performed ten days after surgery revealed the small, residual neck of the aneurysm, but the patient 's state was stationary (fig. 4a). at 14 days after surgery, the patient 's mental state worsened, and a ct revealed rebleeding from the aneurysm ; catheter angiography demonstrated that the clips had slipped from the aneurysm (fig. we performed emergency surgery using a contra - lateral craniotomy and confirmed that the clips had slipped from the aneurysm ; new clips were applied around the aneurysm neck. however, three days after the 2 operation, the patient became semicomatose, and ct and catheter angiography revealed rebleeding and the slip of the clips, respectively. after the repeated failure of surgical clipping, we performed endovascular trapping from the right distal a1 to the aneurysm (fig. after the procedure, the final catheter angiogram showed complete obliteration of the aneurysm and intact flow of the bilateral a2s (fig. 4d). after the endovascular treatment, her neurological state was semi - comatose, and we continued conservative management. one month after the endovascular treatment, there was massive bleeding from her nasal cavity, and catheter angiography showed a rupture of the lacerum segment of the right ica, suggesting carotid blow out syndrome (fig. we performed endovascular coil embolization of the ruptured site in the lacerum segment of the right ica as a life - saving procedure (fig. the patient did not recover from the semi - comatose state and was discharged home in a bed - ridden state. this 69-year - old woman was found to have a large mass destroying her sphenoid sinus when she lost vision in her right eye eight years prior to current presentation (fig., there appeared to be a chance of injuring the internal carotid artery (ica). the anterior communicating artery was widely patent on the balloon test occlusion, and no vascular abnormalities, including aneurysm, were identified by the catheter angiography (fig. she underwent gross - total resection of the tumor at that time without any adverse event, and a pathological examination confirmed the diagnosis of chondrosarcoma. she subsequently underwent cranial radiation therapy (total dose of 59.4 gy) as adjuvant treatment. she was clinically monitored throughout the next eight years with serial magnetic resonance imaging (mri). during this time, she demonstrated no new neurological deficit except slight cognitive decline, and none of the mris showed any sign of residual or recurrent tumor (fig. the patient presented to the emergency room due to severe headache and a slightly drowsy mentality, and computed tomography (ct) revealed intracerebral hemorrhage and subarachnoid hemorrhage (fig. the patient underwent catheter angiography, which revealed an aneurysm of the anterior communicating artery and luminal narrowing and irregularity in the petrous and lacerum segments of the right ica (fig. we suspected that the anterior communicating artery aneurysm had ruptured and attempted endovascular treatment with coil embolization. however, the tortuosity of the bilateral a1 segments of the anterior cerebral arteries (acas) and the broad neck of the aneurysm made the endovascular treatment difficult. we stopped the endovascular treatment and surgically clipped the aneurysm. during the microsurgery, the wall of the aneurysm was very rubbery, and the surgical clip slipped from the neck of the aneurysm. after several surgical clipping attempts, the neck of the aneurysm was clipped, and a booster clip was used to reinforce the primary clip. ct angiography performed ten days after surgery revealed the small, residual neck of the aneurysm, but the patient 's state was stationary (fig. 4a). at 14 days after surgery, the patient 's mental state worsened, and a ct revealed rebleeding from the aneurysm ; catheter angiography demonstrated that the clips had slipped from the aneurysm (fig. we performed emergency surgery using a contra - lateral craniotomy and confirmed that the clips had slipped from the aneurysm ; new clips were applied around the aneurysm neck. the patient 's neurological state immediately after the 2 operation was deeply drowsy. however, three days after the 2 operation, the patient became semicomatose, and ct and catheter angiography revealed rebleeding and the slip of the clips, respectively. after the repeated failure of surgical clipping, we performed endovascular trapping from the right distal a1 to the aneurysm (fig. after the procedure, the final catheter angiogram showed complete obliteration of the aneurysm and intact flow of the bilateral a2s (fig. after the endovascular treatment, her neurological state was semi - comatose, and we continued conservative management. one month after the endovascular treatment, there was massive bleeding from her nasal cavity, and catheter angiography showed a rupture of the lacerum segment of the right ica, suggesting carotid blow out syndrome (fig. we performed endovascular coil embolization of the ruptured site in the lacerum segment of the right ica as a life - saving procedure (fig. the patient did not recover from the semi - comatose state and was discharged home in a bed - ridden state. recent studies have proposed that long - term survivors of brain tumor are at risk for late - occurring cerebrovascular accidents and strokes.5)7) these studies have suggested that this risk is related to cranial radiation therapy. however, a subsequent subarachnoid hemorrhage can be life threatening and often results in severe disability or death. the aneurysm may have occurred by iatrogenic trauma to the artery during the previous surgery. iatrogenic injury leading to aneurysm formation has been described previously.8) but several features of her aneurysm suggest that it might have been induced by radiation therapy. (1) its location was similar to that of the tumor and was within the irradiated field. (2) the wall of the aneurysm was very rubbery and differed from that of a typical saccular aneurysm. (3) catheter angiography performed prior to the cranial radiation therapy demonstrated the absence of an aneurysm. (4) additionally, there were potentially fatal bleeds from dual lesions within the irradiated field : aneurysm rupture and ica rupture. these events imply that there were diffuse vascular changes in the cerebral vessels within the irradiated field. several features of the ica rupture also indicated that its occurrence may be related to radiotherapy. the angiographic findings of luminal narrowing and irregularity in the petrous and lacerum segments of the right ica noted on the catheter angiography when she presented to the emergency room were absent on the catheter angiography performed prior to the cranial radiation therapy. even though this finding may be atherosclerotic changes due to aging, to our knowledge, there are few reports regarding the spontaneous rupture of this ica segment resulting only from atherosclerotic change. however, several reports have described suspected common carotid artery vasculopathy and rupture after radiation therapy.9)10) in addition, in this case, it was very difficult to treat the radiation - induced aneurysm with surgical clipping or endovascular coil embolization. previous reports have proposed that special attention must be paid in the treatment of radiation - induced aneurysms because these aneurysms differ from typical saccular aneurysms by virtue of their shape and location.11) in summary, with the increase in the number of survivors of brain tumors treated with cranial radiation therapy, a large number of patients presenting with fatal hemorrhage from radiation induced - aneurysms may also be observed. because of the diffuse vascular changes in the cerebral vessels within the irradiated field, special attention must be paid to their treatment.	we report herein a case of a radiation - induced aneurysm. a 69-year - old woman presented with subarachnoid hemorrhage. eight years previously, she had undergone cranial radiation therapy (total dose of 59.4 gy) as adjuvant therapy after surgical resection for a chondrosarcoma that was destroying her sphenoid sinus. the patient underwent catheter angiography, which revealed an aneurysm of the anterior communicating artery and luminal narrowing and irregularity in the petrous and lacerum segments of the right internal carotid artery. we attempted surgical clipping of the aneurysm, but there was repeated bleeding. finally the aneurysm was treated with endovascular trapping. potentially fatal bleeding also occurred from her internal carotid artery, which had also been irradiated during the previous cranial radiation therapy. we stopped the bleeding with endovascular coil embolization. because of diffuse vascular changes of the cerebral vessels within irradiated fields, special attention must be paid to their treatment.
during open - heart surgery, protamine is used after weaning the patient from cardiopulmonary bypass (cpb) in order to reverse the anticoagulation effects of heparin. however, protamine shows a wide spectrum of adverse effects, ranging from minimal cardiovascular deterioration to cardiovascular collapse, which can threaten the life of the patient. a 54-year - old female with a history of gross hematuria due to acute tubular necrosis 1 month previously was admitted for symptomatic mitral regurgitation. aorto - bicaval cpb was initiated, the patient was cooled to 32c, and antegrade blood cardioplegia was administered. the patient underwent successful mitral valve annuloplasty with a 28-mm carpentier - edwards physio annuloplasty ring (edwards lifesciences llc, irvine, ca, usa) and the creation of new chordae with gore - tex 6 - 0 sutures. the effects of heparin were reversed by the slow intravenous injection of 160.2 mg of protamine sulfate. approximately 10 minutes after the completion of protamine administration, airway pressure was gradually increased under volume - controlled ventilation with a tidal volume of 350 ml. approximately 30 minutes after the completion of protamine administration, tidal volume was 80 ml under pressure - controlled ventilation, and the peak inspiratory pressure was 40 cm h2o. at that time, the patient s lung was not expanded in the operative field with manual ventilation. her systolic pressure was down to 50 mm hg and oxygen saturation was down to 60%. after 30 minutes of cpb assistance, the patient s hemodynamics had completely recovered, but her tidal volume was 170 ml with pressure - controlled ventilation, with a peak inspiratory pressure of 30 cm h2o. with extracorporeal membrane oxygenator (ecmo) assistance, the patient was transferred to the intensive care unit. following 4 hours of ecmo assistance, the patient s tidal volume was 380 ml under pressure - controlled ventilation, with a peak inspiratory pressure of 20 cm h2o and a positive end - expiratory pressure of 5 cm h2o. after weaning from ecmo with 50% fio2, arterial blood gas analysis showed a paco2 of 38 mm hg, a pao2 of 128 mm hg, and 98.7% o2 saturation. the patient was transferred to the operating room for removal of the ecmo cannulae and wound closure. the patient had an uneventful postoperative recovery and was discharged on the 22nd postoperative day. protamine is a polycationic peptide that is used to reverse the anticoagulant effects of heparin, a group of low - molecular - weight proteins contained in fish sperm. when injected intravenously, the basic protamine combines with the acidic heparin to form a neutral salt, thus eliminating the anticoagulation properties of heparin. the incidence of such adverse reactions has been reported to vary from 0.06% to 10.6%. moreover, the incidence of catastrophic reactions to protamine during cardiovascular surgery has been reported to be 0.13%. these include events, whether or not caused directly by protamine, that occurred within 30 minutes of the initiation of protamine, lasted longer than the 5-minute period of protamine infusion, and met one or more of the following criteria : (1) a decrease in systemic arterial blood pressure (either systolic or mean, compared to baseline blood pressure before protamine administration) after protamine administration of 25% of baseline or a decrease of 10% requiring inotropic medications, reinstitution of cpb, or use of an intra - aortic balloon pump ; an (2) increase in pulmonary arterial pressure of at least 25% resulting in a decrease of systemic arterial blood pressure as defined in (1) ; (3) non - cardiogenic pulmonary edema, defined as any decrease in pao2 requiring an increase in ventilatory support (increase in the percent oxygen delivered, ventilator rate, or positive end - expiratory pressure) in the absence of evidence of cardiac failure (decreasing cardiac output or increase in pulmonary capillary wedge pressure) ; and (4) bronchospasm (the use of bronchodilator therapy for either an increase in peak inspiratory airway pressure of more than 5 mm hg or wheezing). thromboxane is generated when complement activation produces a sufficient concentration of c5a anaphylatoxin fragments to elevate plasma levels. clinically insignificant increases in pulmonary pressure without hemodynamic changes are not considered to be adverse events. this process may lead to cross - linking with the antibody surfaces, which then initiates a process of cell degranulation. adverse reactions may also be associated with the interaction between protamine and complement - fixing antiprotamine immunoglobulin g (igg) antibodies. moreover, adverse responses to protamine seem to be related to the formation of protamine - heparin complexes, which appear to activate the classical complement cascade with the subsequent generation of anaphylatoxins. a significant risk of in - hospital mortality exists among patients who suffer an adverse intraoperative event after protamine administration. protamine - related events may therefore account for a meaningful proportion of mortalities after cpb. although a causal link between protamine and subsequent adverse events can not be made definitively without a randomized trial, adverse events after protamine administration can be viewed as markers of subsequent mortality. further studies to confirm these findings, as well as the development and testing of protamine alternatives or prophylactic therapies, are required to determine if mortality can be reduced. the american hospital formulary service recommendation for dosing states that no more than 50 mg of the drug should be administered in any 10-minute period. in the absence of a safe and efficient agent for the reversal of heparin, when the risk of adverse reactions to protamine overrides the risk of extensive bleeding, spontaneous reversal of heparin is acceptable. the treatment of adverse responses to protamine is based on supporting the affected organs and reducing the effects of histamine. aggressive resuscitative efforts must be initiated immediately, including the restoration of cpb when possible. viaro. suggested the use of methylene blue as a novel experimental approach to prevent and treat hemodynamic complications caused by the use of protamine after cpb. according to those authors, 6 patients presented anaphylactoid adverse reactions to protamine and were successfully treated with a methylene blue bolus infusion of 1.5 mg / kg (120 mg), followed by continuous infusion of another 120 mg diluted in 5% dextrose. patients who have had previous protamine injections during cardiovascular surgery, patients with diabetes who are taking protamine - containing insulin, patients with allergies to fish, and vasectomized patients potentially should be routinely tested for such sensitivity and be appropriately premedicated. additionally, when a severe adverse reaction to protamine is suspected, we postulate that heparin should not be reversed, despite a greater risk of bleeding and subsequent re - exploration. we report a case of catastrophic bronchial spasm due to an anaphylactic reaction to protamine. the patient was managed successfully by a bronchodilator, steroid treatment, and extracorporeal membrane oxygenation.	fatal anaphylactic reactions to protamine sulfate during cardiac surgery are very rare. we report a case of catastrophic bronchial spasm due to an anaphylactic reaction to protamine. the patient was managed successfully using a bronchodilator, steroid treatment, and extracorporeal membrane oxygenation.
a portion of the arterial pressure wave travelling towards the extremities is reflected back from peripheral impedance points. in healthy individuals, the reflected wave returns to the aorta during diastole. with age and in the presence of vascular disease, arterial compliance decreases, and the arteries become stiff, thereby reducing the transit time for the incident and reflected waves. consequently, the reflected wave arrives at the aorta during systole of the same cardiac cycle augmenting the central blood pressures. this augmentation of central pressure can be quantified by augmentation index (aix), defined as the percentage of the central pulse pressure attributed to the reflected pulse wave. aix has been shown to be associated with cardiovascular risk, predicts the presence or absence of coronary artery disease (cad) [2, 3 ], and has been shown to be an independent predictor of cardiovascular events and all - cause mortality in select patient populations [4, 5 ]. conventionally, aix is obtained from pressure waveforms via applanation tonometry of the carotid or radial arteries. recently, it has been demonstrated that aix can be measured from digital pulse wave volumes by peripheral arterial tonometry (pat) [6, 7 ], and that it is associated with ventricular - vascular coupling. the value obtained by aix derived by pat correlates with that obtained by conventional radial applanation tonometry ; however, they can not be used interchangeably since the actual values do not match since they are obtained from two distinct vascular beds via two different methods. therefore, we sought to evaluate the association between pat - derived aix and cardiovascular risk factors (crfs) and/or cad. study 1146 patients recruited from the cardiology clinic at tufts medical center in boston were enrolled in the study. subjects were instructed to fast overnight and to refrain from smoking, caffeine, or alcohol on the day of testing. 146 patients recruited from the cardiology clinic at tufts medical center in boston were enrolled in the study. subjects were instructed to fast overnight and to refrain from smoking, caffeine, or alcohol on the day of testing. study 240 consecutive patients undergoing clinically indicated nonemergent left heart catheterization were retrospectively identified for inclusion into this study. as part of the standard catheterization protocol, blood pressures were measured within the femoral artery, ascending aorta, and the left ventricle using a 6-french end hole fluid - filled catheter and a pressure manometer prior to injection of any contrast agent. pressures within the ascending aorta were considered as the central blood pressure (cbp) in the study.the presence or absence of the following cardiovascular risk factors was assessed in all the subjects from both substudies : male gender, hypertension (systolic blood pressure > 140 mmhg, diastolic blood pressure > 90 mmhg, or being on an antihypertensive medication), hyperlipidemia (serum cholesterol > 220 mg / dl or taking lipid - lowering medication), diabetes mellitus (fasting blood glucose > 140 mg / dl or on oral hypoglycemics or insulin), family history of cad (first - or second - degree relatives with premature cad), postmenopausal women, and smoking (having smoked at least five times per day within last month). cad was defined as the presence of ischemia or infarction on single - photon emission - computed tomographic (spect) nuclear myocardial perfusion imaging or > 50% stenosis of an epicardial coronary artery by angiography.patients with moderate to severe heart failure (nyha class iii - iv, lvef 140 mmhg, diastolic blood pressure > 90 mmhg, or being on an antihypertensive medication), hyperlipidemia (serum cholesterol > 220 mg / dl or taking lipid - lowering medication), diabetes mellitus (fasting blood glucose > 140 mg / dl or on oral hypoglycemics or insulin), family history of cad (first - or second - degree relatives with premature cad), postmenopausal women, and smoking (having smoked at least five times per day within last month). cad was defined as the presence of ischemia or infarction on single - photon emission - computed tomographic (spect) nuclear myocardial perfusion imaging or > 50% stenosis of an epicardial coronary artery by angiography. patients with moderate to severe heart failure (nyha class iii - iv, lvef 45 yrs in men and > 55 yrs in women, male gender, menopause, hypertension, hypercholesterolemia, cigarette smoking, diabetes mellitus and family history of cad) were tabulated as nominal variables. depending upon the total number of crfs per patient, the study population was divided into tertiles, including those with 5 crfs. analysis of variance (for parametric data) with scheffe post hoc testing was performed to assess difference in continuous variables between groups. binary logistic regression analysis (0.05 to enter, 0.10 to remove) was used to evaluate for relationship between aix and cad and to evaluate for potential confounders including age, gender, height, heart rate, presence of hypertension, hypercholesterolemia, diabetes mellitus, tobacco use, and family history of cad. a receiver operator characteristic (186 subjects (129 men, 57 women) with an average age of 59 1 years were enrolled. 55% patients had cad, 52% patients had hypertension, 24% were diabetic, 58% had hypercholesterolemia, 44% were smokers, and 35% had family history of cad. a significant association was observed between pat - aix and age (r = 0.265, p 5 crfs (5.65 2.55%, p =.02, figure 1). pat - aix in patients with 35 cardiac risk factors was not significantly different than in those with either 5 crfs. pat - aix was significantly higher amongst cad+ patients (1.01 1.6%) as compared to cad patients (5.46 1.7%, p =.008, figure 2). to examine the ability of pat - aix to predict cad+, the area under the roc curve yielded a value of 0.604 (p 5 crfs had a significantly higher pat - aix as compared with those having only a few crfs. similarly, when the prevalence of cad was assessed across tertiles of pat - aix, it was noted that patients in the highest tertile had a significantly higher prevalence of cad as compared to those in the lower tertiles. pat - aix was able to discern the presence or absence of cad amongst a heterogeneous patient population with varying in cardiovascular risk. the classification performance of peripheral aix was assessed by generating a receiver - operated characteristic curve which revealed an auc of 0.604. however, after adjusting for traditional risk factors such as age, sex, heart rate, height, weight, hypertension, diabetes mellitus, hypercholesterolemia, smoking, and family history of premature coronary heart disease, aix lost its statistical significance. thus, pat - derived aix is not an independent predictor of cad in this population. the importance of assessing central blood pressure lies in the fact that traditionally measured brachial artery blood pressure is often a poor representation of actual central pressures. due to pressure wave amplification, the brachial systolic pressure can be up to 20 mmhg higher than the aortic systolic pressure [1517 ]. since the left ventricle works against pressures within the ascending aorta, aortic pressures play a significant role in the pathophysiology of cardiac disease. as such, aortic systolic and pulse pressures can be considered as novel cardiovascular risk factors since they are predictors of cardiovascular events, target organ damage, and mortality. compared to brachial systolic and pulse pressure, aortic pulse pressure appears to be a better predictor of the presence and extent of coronary atherosclerosis [19, 20 ] and restenosis after coronary intervention. furthermore, a reduction in central blood pressure results in a reduction in cardiac hypertrophy, vascular thickness, and adverse cardiac events [2224 ]. for example, a 10 mmhg reduction in aortic pulse pressure has been shown to translate into a 1315% reduction in cv events and all - cause mortality [25, 26 ]. in alignment with data published by munir., our study reveals that aix measured by pat also closely correlates with central aortic blood pressures. we do acknowledge certain limitations in this study. while it has been suggested that arterial stiffness and augmented pressure from wave reflections make the most significant contributions to the digital volume pulse inflection point, vascular correlates or pat - aix remain unexplored. it is true that spect imaging results do not always correlate with severity of coronary artery stenosis. however, we chose stress testing because it provides physiologic information regarding ischemia and prior infarction. while spect imaging does not confer 100% sensitivity and specificity, this technique is a reliable, noninvasive assessment of myocardial ischemia / infarction. in substudy 2, central pressures were obtained using conventional fluid - filled catheters, rather than high - fidelity pressure transducers. in addition, aix was not obtained simultaneously during catheterization when actual central pressure values were obtained. pat has been under investigation over recent years as a technique for assessment of vascular endothelial function. the present data suggest that this simple, noninvasive technique may also provide information regarding augmentation index. our findings suggest that finger - derived aix may be comparable to applanation tonometry for measurement of augmentation index and evaluation of cardiovascular risk. however, as observed by haller., although the values of aix obtained by pat correlate with that obtained by conventional radial applanation tonometry, they can not be used interchangeably since the actual numbers do not match. further validation is warranted in large scale studies comparing pat - aix with that obtained by the current gold standard radial applanation tonometry in a wider patient population.	background. augmentation index (aix) is traditionally obtained from pressure waveforms via arterial applanation tonometry. we sought to evaluate the association between aix obtained from peripheral arterial tonometry (pat) with cardiovascular risk factors (crf) and coronary artery disease (cad). methods. 186 patients were enrolled in the study. the presence or absence of crfs and cad was assessed in each subject. aix was calculated by an automated algorithm averaging pulse wave amplitude data obtained via pat. central blood pressures were assessed in a subset of patients undergoing clinically indicated cardiac catheterization. results. an association was observed between aix and age, heart rate, systolic blood pressure, mean arterial pressure, pulse pressure, body weight and body mass index. aix was significantly lower in patients with 5 crfs (p =.02). cad+ patients had significantly higher aix compared to cad patients (p =.008). area under the roc curve was 0.604 (p <.01). in patients undergoing cardiac catheterization, after adjusting for age, height and heart rate, aix was a significant predictor of aortic systolic and pulse pressures (p <.05) conclusion. aix derived from pat correlates with cardiac risk factors and cad. it may be a useful measure of assessing overall risk for coronary artery disease.
it allows the clinicians to better time gestation - specific antenatal screening tests, reduces erroneous labelling of pregnancies as very preterm, preterm, and small - for - gestational - age, and decreases the risk of inappropriate induction of labour [15 ]. in the first trimester, there is a very little biologic variation in fetal size compared with later trimesters. it is therefore a good time in pregnancy to determine gestational age by ultrasound where the crown - rump length (crl) is measured and compared to published reference charts. in contrast, dates calculated from the first day of the last menstrual period (menstrual age) may have inaccuracies arising from imprecise recollection of dates, variation in the timing of ovulation, or time to conception. a number of crl reference charts have been proposed and different versions are in common use (table 1). most of these charts are based on menstrual age to estimate gestational age at the day of the ultrasound examination, based on modest sample sizes, generated many years ago using ultrasound machines of poorer resolution, or used transabdominal measurements (which gives poorer pictures relative to a transvaginal approach) [68 ]. as such, there is considerable variability between current reference charts, and estimated gestational age can vary significantly depending on which chart is used. it should be possible to generate very accurate reference charts by using a large in vitro fertilisation (ivf) cohort where crl measurements could be correlated with gestational age precisely calculated from date of fertilisation. accuracy could be further enhanced by using measurements obtained from high - resolution transvaginal scans by sonologists specialising in women 's health. we examined crl lengths at 69 weeks of gestation measured in a large ivf cohort where gestational age could be calculated from date of fertilisation. we assessed the ability of six commonly used reference charts to accurately date these pregnancies. given all these charts showed inaccuracies in their ability to date these ivf pregnancies, we developed a new reference chart based on ivf dates in a singleton cohort. we retrospectively obtained clinical details on 1268 singleton ivf pregnancies conceived using a fresh embryo transfer cycle, had a transvaginal first trimester ultrasound done between 6 (+ 1d) to 9 (+ 0d) weeks of gestation where crl were measured, and progressed to viability (> 24 weeks of gestation). these were identified from a total cohort of 4971 first trimester ultrasound reports of ivf and naturally conceived pregnancy scans. pregnancies that resulted from frozen embryos transfer, complicated by fetal structural anomalies, delivered before 24 weeks, or had missing data were all excluded. of our cohort of 1268 pregnancies, 84 were scanned twice, and 2 pregnancies were scanned three times, giving a total population size of 1182. in these pregnancies with multiple scans, all data were included in the analysis as discrete values. we restricted our analysis to those who had fresh embryo transfer since we were concerned with the need to add the time from egg pickup to freezing, together with the time from subsequent thawing to transfer might introduce inaccuracies. we determined gestational age on the day of the ultrasound (ivf dates) by nominating the day of egg pickup and fertilisation as day 14 of gestation. we first compared ivf dates with estimated dates determined using six existing reference charts : australian society for ultrasound medicine (asum), hadlock., note that some charts did not have corresponding gestational ages for all measurements which accounts for the variability in sample size seen in the comparison of charts. we then generated reference charts using the crl measurements and ivf dates by smoothing out the data (see statistical analysis below), which we named the monash chart. to validate our chart, we obtained crl measurements from an ivf twin cohort (fresh embryo transfer) at 6 (+ 1d) to 9 (+ 0d) weeks of gestation where gestational age was calculated (fertilisation age + 14 days). taking each twin as a discrete measurement, we determined the accuracy of all six existing reference charts and the monash chart in estimating gestational age. we then applied all six existing reference charts and our chart to estimate gestational age of crl measurements obtained from 3052 consecutive first - trimester singleton ultrasound scans pregnancies at 69 weeks of gestation. ethics approval was obtained before we commenced the study (project 05063, monash surgical private human research ethics committee, clayton, vic, australia). for this retrospective database study where we used de - identified data in aggregate, all examinations were performed at three ultrasound centres that exclusively perform women 's health ultrasounds. all ultrasounds were transvaginal, done on advanced technology laboratories hdi 5000 ultrasound machines by experienced sonographers. after confirmation of a live intrauterine pregnancy, the crl was measured in the midsagittal plane by the placement of ultrasound callipers at the outer edges of the head and rump of the fetus, excluding the limbs and yolk sac. for comparison of data, an unpaired student 's t - test was used to compare two groups with continuous variables that were normally distributed and nonparametric data was compared using mann - whitney u test. nonparametric data was expressed as median and interquartile range, while parametric data was expressed as mean (standard deviation). to determine the relationship between true gestational age and crl, we constructed a scattergram, plotting crl lengths against true gestational age in our singleton ivf cohort (figure 1(a)). investigation using fractional polynomial regression analysis revealed that a straight line best described the mean. the standard deviation (sd) varied very little at every week of gestational age, which was unsurprising given our significant cohort size. the goodness of fit was determined by a plot of the standard deviation score or standardised residual which was normally distributed. to develop the monash chart, a linear prediction plot was fitted to the scattergram (figure 1(a)) and appeared to be the best model to fit the data with a very narrow 95% confidence interval (figure 1(b)). the final crl reference chart was derived from the equation describing the line of best fit. when we compared the six existing crl reference charts to either ivf dates or to gestational ages derived for the monash chart, we calculated the mean differences of the gestational ages from the six charts from either the ivf true gestational age or the monash chart gestational age (depending on the analysis being undertaken), and compared them with paired t - tests. we identified 1268 first trimester ultrasound scans done at 6 (+ 1d) to 9 (+ 0d) weeks of gestation where gestational age at the day of the ultrasound could be precisely determined using the ivf dates. we calculated ivf dates by noting the number of days from fertilisation until the date of the ultrasound assessment. since day of egg pickup is day 14 of gestation by convention, an extra 14 days were added to this number in order to calculate the ivf dates. we noted the raw crl measurement in millimetres and compared gestational age estimated by six existing crl reference charts with actual ivf dates. we found the mean gestational age estimated by all these charts varied significantly to ivf dates (p 24 weeks of gestation. first, it would validate the use of our chart for twins, a situation where calculation of estimated delivery dates is especially important given obstetric risks. secondly, the use of ivf pregnancies again allows accurate determination of gestational age by calculating ivf dates. while there may be differences in growth between twins and singletons in late pregnancy, there is no evidence that differences in crl between singletons and twins exist. biological differences in crl as large as millimetres at this early gestation would be very unlikely. the mean (sd) maternal age of the ivf twin cohort was 33 (3.9) years, mean (sd) gestation at birth was 36 (2.5) weeks ' gestation. mean birthweight for twin 1 was 2492 (548) gms and twin 2 was 2467 (576) gms. median (range) treatment cycle number was 3 (115) and the median (range) number of embryos transferred was 2 (13). in this cohort of ivf twins, predicted gestational age from the six existing reference charts was significantly different from ivf dates, with mean differences ranging from 1.1 days to 2.3 days (p 0.0005). only the monash chart was not statistically significantly different to ivf dates in the twin cohort (p = 0.6835). we next applied our chart to crl measurements obtained from 3052 consecutive first - trimester viability ultrasounds. the purpose was to see whether the monash chart would pragmatically alter expected dates of delivery compared to existing charts. we found dates derived from our chart were significantly different to the existing reference charts (mean difference in estimated gestation ranged from 1.8 days to 1.8 days ; p 0.0047 for all charts, see table 5). ultrasounds performed at 69 weeks ' gestation are done very often, where gestational age is derived from the crl measurements. we have developed a potentially highly accurate crl reference chart to date pregnancies at the viability ultrasound. while others have proposed crl charts based on ivf dates before, they have been based on small numbers (36160 participants) [6, 1518 ]. in contrast, ours was generated from a more sizable population (n = 1268). given a possible association between shorter than expected crl and miscarriage, we validated the performance of our chart using an independent twin cohort, and showed in a further cohort of 3052 consecutive ultrasounds it would materially alter dates if it used instead of any of six preexisting charts. hence we believe our chart may possibly be the most accurate of any published chart to date pregnancies between 69 weeks of gestation. in addition, we found inaccuracies in the ability of commonly used charts to estimate gestational age among ivf singleton and twin cohorts where exact dates are known. while some showed only very slight differences in the estimation of dates compared to ivf dates (e.g., 0.57 days mean difference for daya chart) and others showed larger differences (2.1 days for asum chart), all were highly statistically different (table 3). of further concern is the fact that there appears to be significant disagreement between existing charts where some given crl lengths, predicted gestational age can vary by many days depending on which chart is referenced. in order to determine precisely gestational age on the day of the ultrasound scan, we have necessarily derived our reference chart from an ivf population. while there may be some differences in final birthweight among those conceived by ivf compared to spontaneous conceptions given variations of even a millimetre or two would represent significant proportional differences in length at these early gestations, we consider it unlikely the monash chart would not be valid for spontaneously conceived pregnancies. in this study, we were unable to generate a reference chart that encompassed crl reference ranges across the whole first trimester. the reason is that crl measurements were rarely performed across 911 weeks of gestation among our ivf cohort. the likely reason is that being ivf pregnancies, clinicians had exact dates with which to time the late first trimester ultrasound to 12 + weeks of gestation, when nuchal translucency is best assessed. we attempted modelling a chart incorporating these late first trimester crl lengths, but we could not be confident that the integrity and high accuracy of the 69 week chart we report was maintained. also, we did not include gestations under 6 weeks given crl at (6 + 1) is already just 1 mm, and it is not possible for ultrasound to accurately measure differential crl lengths present at earlier gestations. nevertheless, we believe our chart is still clinically useful since many spontaneous pregnancies will have the first ultrasound between 69 weeks of gestation. strengths of our study includes the fact we only used measurements obtained from high - resolution transvaginal ultrasounds of crls at centres that exclusively perform obstetrics and gynecological ultrasounds. also, we utilized a large cohort, reflected by the fact that the 95% confidence intervals are very narrow (figure 1). accurate dating is important since obstetric management throughout pregnancy is strongly based on gestational age. for instance, the first trimester nuchal translucency measurements are most accurate if performed during the 12th week of gestation. many units offer an induction of labour at exactly ten to fourteen days after the expected date of delivery, and no later given concerns that stillbirth rates may increase more steeply beyond two weeks after the expected date of delivery. a cochrane systematic review concluded that accurate dating indeed reduces the rates of induction of labour for postdates. at the thresholds of viability, many would offer conservative management if a delivered baby is judged to be around 23 weeks + 3 days of gestation, but may consider actively resuscitating a baby estimated to have reached 24 weeks + 2 days of gestation. therefore, it is important to be as accurate as possible in determining gestational age. in conclusion, we have generated the monash chart that we believe may be the most accurate crl chart reference chart yet proposed to date pregnancies at 69 weeks ' gestation.	accurate determination of gestational age underpins good obstetric care. we assessed the performance of six existing ultrasound reference charts to determine gestational age in 1268 singleton ivf pregnancies, where true gestational age could be precisely calculated from date of fertilisation. all charts generated dates significantly different to ivf dates (p < 0.0001 all comparisons). thus we generated a new reference chart, the monash chart, based on a line of best fit describing crown - rump length across 6 + 1 to 9 + 0 weeks of gestation (true gestational age) in the ivf singleton cohort. the monash chart, but none of the existing charts, accurately determined gestational age among an independent ivf twin cohort (185 twin pairs). when applied to 3052 naturally - conceived singletons scans, the monash chart generated estimated due dates that were different to all existing charts (p 0.004 all comparisons). we conclude that commonly used ultrasound reference charts have inaccuracies. we have generated a crl reference chart based on true gestational age in an ivf cohort that can accurately determine gestational age at 69 weeks of gestation.
some researchers have argued that sleep disturbances experienced with the increase of age can be linked to the other changes, including the significant increase of medical and mental health problems and lifestyle alterations. it is estimated that 30 - 45% of the world s population complaint from sleep disorders[49 ] and its prevalence increases with age. it is predicted that the population of elderly reaches to 10 millions in iran by the year 2019. it has shown that poor quality sleep is the third most common health problem of older adults, ranking behind headaches and gastrointestinal disorders. a large study has suggested that 42% of older adults with age more than 65 year had difficulty initiating and maintaining sleep with an annual incidence rate of approximately 5%. insomnia is the most prevalent consequence of physical disorders that is commonly associated with sleep latency (more than 30 min), difficulty with sleep maintenance, or early awakening. bedtime and sleeping difficulties are the major factors affecting sleep quality and account for 15 - 35% of these difficulties and secondly, low sleep quality is an indicator of many illnesses. physical and cognitive symptoms of people with poor sleep quality are tiredness, loss of concentration, weariness, low threshold for pain, anxiety and nervousness, irrational thoughts, hallucinations, loss of appetite, constipation, and being more accident prone. it is also well known that sleeping problems cause tension, delay in wound healing, increase of pain, and difficulties in performing daily activities. older adults are hospitalize three times more than persons lower than 65 year of age and their long of stay is also more. although patients may appear to sleep in hospital, it may not be refreshing or restorative. several reports can be found in relation to the prevalence of sleep disturbances in older adults ; however, the quality of sleep in hospitalized older adults have not been studied so much in recent years. because the trend of the aging of population and due to the effects of sleep on the elderly s health and quality of life, the lack of an up - to - date study on the quality of sleep in elderly patients with physical disorders and specially the hospitalized elderly patients, specially from iran and the middle - east region and the responsibility of nurses to have adequate information about the sleeping patterns and sleep problems of their clients. this study was conducted to evaluate the quality of sleep and its related risk factors in hospitalized older patients in kashan s hospitals, iran 2009. a cross - sectional study was conducted on a sequential sample of 400 hospitalized older patients in the university hospitals in kashan, iran. this study received ethical approval from the ethics committee of kashan university of medical sciences (kaums). this study consecutively recruited patients aged 65 and older admitted to surgical and medical wards of the university teaching hospital between june 1, 2009 and october 31, 2009. the inclusion criteria were : age 65 or above, able to communicate either by speaking or writing and not being in an elderly hospice before the study. exclusion criteria were : patients unable of answering questionnaires because of severe speech disorders (aphasia, dysarthria) or severe hearing loss ; length of stay (los) in hospital less than 7 days and patients suffering from cognitive impairment according to the short portable mental status questionnaire (spmsq). the spmsq is a 10-question, reliable and easy to use test to evaluate the cognitive function in older adults. in our study the sample size was calculated based on the previous report which estimated that 47% of hospitalized older patients have some form of sleep disorders. 1) personal information form and 2) the farsi pittsburgh sleep quality index (fpsqi). the personal information form included the following information : demographic information such as age, gender, education level, and marital status and ten questions related to type of ward in which the patient was hospitalized (medical and surgical), daytime napping, los, using hypnotics at hospital, previous hospitalization experience, medical disorder, type of sleep disorders and sociopersonal, physical, and environmental factors. the psqi is a self - rated instrument that frequently was used to measure the quality and patterns of sleep in older adults. the questionnaire is simple, easily completed, and all of the self - rated items are grouped into seven individual components of subjective sleep quality, sleep latency, length of sleep, sleeping habit, sleep disorders, use of sleeping medication, and daytime dysfunction over the last week. a global sum of 6 or greater indicates a poor quality of sleep. the original english version of the psqi was initially translated into farsi. subsequently, a faculty member with a good knowledge of english performed a retrograde translation into english. reliability was calculated using the cronbach s alpha internal consistency coefficient (= 0.82). the first step was to determine the relationship between the dependent variable (sleep quality) with independent variables using univariate analysis included chi - square or fisher exact tests for qualitative variables and t - test and anova for quantitative variables. in order to remove the distorting effect of the variables the variables which had a significant relationship (p < 0.05) or close to significant level (p < 0.2) with the dependent variable (sleep quality) were entered into the model with the enter method. for explicating the intensity of correlation in the final model, the odds ratio (or) a cross - sectional study was conducted on a sequential sample of 400 hospitalized older patients in the university hospitals in kashan, iran. this study received ethical approval from the ethics committee of kashan university of medical sciences (kaums). this study consecutively recruited patients aged 65 and older admitted to surgical and medical wards of the university teaching hospital between june 1, 2009 and october 31, 2009. the inclusion criteria were : age 65 or above, able to communicate either by speaking or writing and not being in an elderly hospice before the study. exclusion criteria were : patients unable of answering questionnaires because of severe speech disorders (aphasia, dysarthria) or severe hearing loss ; length of stay (los) in hospital less than 7 days and patients suffering from cognitive impairment according to the short portable mental status questionnaire (spmsq). the spmsq is a 10-question, reliable and easy to use test to evaluate the cognitive function in older adults. in our study the sample size was calculated based on the previous report which estimated that 47% of hospitalized older patients have some form of sleep disorders. 1) personal information form and 2) the farsi pittsburgh sleep quality index (fpsqi). the personal information form included the following information : demographic information such as age, gender, education level, and marital status and ten questions related to type of ward in which the patient was hospitalized (medical and surgical), daytime napping, los, using hypnotics at hospital, previous hospitalization experience, medical disorder, type of sleep disorders and sociopersonal, physical, and environmental factors. the psqi is a self - rated instrument that frequently was used to measure the quality and patterns of sleep in older adults. the questionnaire is simple, easily completed, and all of the self - rated items are grouped into seven individual components of subjective sleep quality, sleep latency, length of sleep, sleeping habit, sleep disorders, use of sleeping medication, and daytime dysfunction over the last week. a global sum of 6 or greater indicates a poor quality of sleep. subsequently, a faculty member with a good knowledge of english performed a retrograde translation into english. reliability was calculated using the cronbach s alpha internal consistency coefficient (= 0.82). the first step was to determine the relationship between the dependent variable (sleep quality) with independent variables using univariate analysis included chi - square or fisher exact tests for qualitative variables and t - test and anova for quantitative variables. in order to remove the distorting effect of the variables the variables which had a significant relationship (p < 0.05) or close to significant level (p < 0.2) with the dependent variable (sleep quality) were entered into the model with the enter method. for explicating the intensity of correlation in the final model, the odds ratio (or) was utilized and the significance level was considered as 0.1. four hundred hospitalized older patients with an average age of 71.8 (5.6) participated in this study. the average of total score of sleep quality of the patients was 7.3 (4.8) and 220 subjects (55%) had a poor sleep quality. the mean score of sleep quality was 10.9 (3.5) in the subjects with poor sleep and 2.9 (1.3) in group with good sleep quality. the demographic and clinical characteristic of patients is stated in [table 1 ] according to sleep quality. in univariate analysis, significant difference was observed among sleep quality and gender (p < 0001), marital status (p < 003), literacy level (p < 0001), type of ward (p < 0001), and the using hypnotic in hospital (p < 0001). however, gender, los and day time napping did not have significant relationship with sleep quality. characteristics of the 400 hospitalized older adult patients in the study according to sleep quality the mean score of sleep quality did have a significant relationship with the medical disorder (p < 0001). the most important diseases that had negative effect on sleep quality were the respiratory complications. the mean score of sleep quality had a significant relationship with the type of sleep disturbance (p < 0001) ; those individuals who had delay in sleeping had a poor sleep quality. the mean score of sleep quality had statistically significant relationship with physical (p < 0001), and environmental factors (p < 012) but did not have a significant relationship with sociopersonal factors [table 2 ]. the highest mean score of sleep quality in the sociopersonal dimension was sleep habits change, in the physical dimension was dyspnea and at environmental dimension was light. the quality of sleep scores (mean sd) of hospitalized older adults according to medical disorder, type of sleep disorders and sociopersonal, physical, and environmental factors in multivariate analysis, the variables of gender (or = 0.342), literacy level (or = 0.470), type of ward (or = 0.592), previous hospitalization experience (or = 2.336), using hypnotic in hospital (or = 3.633) stayed in the model that had a statistical relationship with the sleep quality [table 3. ] multiple logistic regression model for determining the predictors of sleep quality in hospitalized older adult patients the results showed that more than half of the hospitalized older adults had poor sleep quality. previous studies have shown that aging is accompanied with changes in the circadian rhythm, sleep structure and its quality. in addition, the hospitalized patients spend a long time in bed, during the day, which interferes with their circadian rhythm and night sleep. however ; some researchers argue that this is not a result of the aging process per se. the sleep disturbances experienced with the increase of age can be linked to the increase of medical problems and life style changes. this may specially be true for the hospitalized older adults. according to dogan., hospitalized older adults had a lower sleep quality than nonhospitalized controls. the results of lei. it is also generally known that the hospital environment could negatively affect the sleep quality. several factors have contributed to this negative effect such as changes in the patients normal environment, temperature, noise produced by machines and staff, anxieties and worries in relation to illnesses and not carrying out their home responsibilities, pain, breathing problems, pre- and postsurgical problems and lack of physical activity. we found that the chance of having a good sleep quality was more in men than women. this finding was consistent with the results of kiejna. who reported that gender was one of the four factors related to sleep disorder. researchers have also shown that hormonal changes have an important role in structural changes of sleep among older women. this study found that sleep quality of married older adults was better than divorced or widowed persons and individuals who were living alone. have also found that being divorced results in sleep disorders in the population over 65 years of age. have also reported that being divorced and widowed or being single are important risk factors for sleep problems. adib - hajbaghery and akbari have also reported that amount and quality of social support significantly affect the old peoples health and disability. thus, the single older adults with lack of social relations may be more susceptible to decline than others. therefore, we may conclude that the lack of familial and social support can negatively affect the sleep quality of the older patients. several previous researchers have also reported that socioeconomic factors such as education level, occupation, and income have significant relationship with sleep quality.[193538 ] it seems that illiterate persons are less familiar with problem solving methods. also the economical situation of these individuals is inappropriate and hospitalization exerts an additional load on the household s economy that results in more stresses and sleep disturbance. this study a significant relationship was observed between sleep quality and the type of ward. this finding was in contrast to the findings of some of previous studies, that the sleep quality of patients in medical units was better than that of patients in surgical units. although fear of being in a strange environment, anxieties related to the illness, and pre- or postsurgical periods may negatively affect the sleep quality, our patients in medical units were frequently suffering of problems such as dyspnea, cough, and nocturia that can not be easily eradicated and therefore have negatively affected their sleep quality. on the other hand, the most popular problem in surgical units was pain that perhaps was treated with analgesics. therefore, the patients in surgical units had a better sleep quality than the ones in medical units. sleep quality of the older patients who had previous hospitalization experience had been reduced 2.33 times that is congruent with the results of other studies. the reason for this issue might be the sense of hopelessness due to treatment of chronic illness in the older patients. it seems that the effect of prior hospitalization on sleep quality ought to be examined more. this study showed that the sleep quality of older patients who took hypnotic had been reduced 3.63 times. using hypnotic for a long time had a reversal effect on sleep quality. nurses should also assess the elderly patients sleep habits and provide them before the prescription of hypnotics or sedative drugs. on the other hand, medications with limited said effects and a low dosage should be used for the elderly people. results of this study, same as other studies, did not show any relationship between the duration of stay and the sleep quality. the reason for this difference might be due to different abilities of adaptation among the older individuals in different regions of the world or it might be due the difference in design of studies. no significant relationship was found between sleep quality and daytime napping that is congruent with lai s study. daytime napping would increase with age because the older adults have an increased opportunity to nap. previous studies have also shown that difficulty in falling asleep or in maintaining sleep is common among the older adults and may result in poor sleep quality, increased probability of falls, decreased concentration and memory, and overall decrease in quality of life. in this research, the sleep quality was worse among the patients who suffered from respiratory diseases compared with the other diseases. in addition, considering the physical symptoms, the lowest sleep quality was related to the patients with dyspnea. it seems that respiratory diseases create more persistent symptoms such as cough and dyspnea that not only require frequent interventions by the nursing staff, but also interfere with the onset or maintenance of sleep. this finding was consistent with the report of wooten who conducted a study on management of sleep disorders in the elderly. have also reported that the noises produced by other patients or their visiting relatives, environmental light, changes in sleep habits and nursing cares performed at night were among the most sleep disturbing factors for hospitalized elderly. this study showed that using hypnotics at hospitals, previous hospitalization experience, type of ward, literacy level, and gender were the most important factors affecting the sleep quality in the hospitalized elderly. knowing these factors can assist nurses in proper planning and for preventing sleep disturbance of the older adults. we did not have the information about the patients sleep before the elderliness and we did not examine the patients regarding the primary sleep disorders either.	context : sleep is an effective factor in the process recovery from diseases. many variables affect the sleep quality of hospitalized older patients.aim:this study was conducted to evaluate the quality of sleep and its related risk factors in hospitalized older patients in kashan s hospitals, iran 2009. settings and design : a cross - sectional study was carried out on a sample of 400 hospitalized older adults in the hospital of kashan, iran.materials and methods : the farsi pittsburgh sleep quality index (fpsqi) was used for gathering data. a global sum of 6 or greater indicates a poor quality of sleep. statistical analysis used : data were analyzed using the chi - square test, t - test, anova, and binary logistic regression at the multivariate model.results:the overall quality of sleep of the patients in this study was poor. in the final regression model, sex (or = 0.342), level of education (or = 0.470), type of ward (or = 0.592), previous hospitalization experience (or = 2.336), and use of hypnotics in hospital (or = 3.633) were the most important predictors of sleep quality. the most prevalent sleep disturbing factors were worries and anxiety, environmental noises and pain. however, the most negative effects on the psqi mean score were reported to be from dyspnea, environmental lights, and changes in the sleep habits. quality of sleep also had significant relationship with sleep latency (p = 0.001) and having a respiratory disorder.conclusions:the knowledge of sleep disturbing factors in hospitalized older adults might help in planning preventive strategies to improve quality of sleep.
have many perceived benefits, including increased accessibility and social connection, efficiency in the workplace, convenience, and improved safety. however, in recent years, there has been increasing public interest in the negative consequences of mobile phone use. in one saudi arabian study, 44.4% of participants related common health complaints such as headache, trouble concentrating, memory loss, hearing loss, and fatigue to their mobile phone use. another saudi arabian study suggested that 3%-4% of mobile phone users exhibit problems such as tension, fatigue, sleep disturbance, and dizziness related to their mobile phone use, and over 20% complain of headaches. accidents caused by distracted driving [3, 4 ] have been highlighted as a public health concern. in addition, anecdotal observation and media reports suggest that the number of self - professed cell phone addicts and compulsive users of crack - berries and other smartphones has increased as mobile phones have become ubiquitous. public recognition of this phenomenon is reflected in the many websites and blogs addressing the issue, as well as numerous articles in the popular press describing cell phone addiction. though stories have appeared in publications such as the new york times, the los angeles times, and http://www.forbes.com/ for many years, the academic literature surrounding problematic mobile phone use remains fairly limited, even when compared to other behavioral addictions such as pathological gambling, problematic internet use, and problem video gaming [810 ]. while addiction is a term commonly used and arguably overused in society, the conceptualization of addiction remains controversial even among researchers and clinicians who specialize in substance use disorders and addictive behaviors. indeed, the diagnostic and statistical manual of mental disorders, fourth edition text revision [dsm - iv - tr ] did not include a condition called addiction. rather, it described substance abuse and substance dependence as distinct psychiatric disorders, and failed to include discussion of addictive behaviors that do not involve substance use. furthermore, the recently released diagnostic and statistical manual of mental disorders, fifth edition (dsm-5) describes substance use disorders using the following 11 criteria : (1) use in larger quantities or over longer amounts of time than initially intended, (2) a desire to cut down or control use, (3) spending a great deal of time obtaining, using, or recovering from the substance, (4) craving, (5) recurrent substance use resulting in a failure to fulfill major role obligations, (6) continued use despite social / interpersonal problems, (7) neglect of other important activities because of substance use, (8) use in situations in which it is physically hazardous, (9) continued use of the substance despite adverse physical or psychological consequences associated with use, (10) tolerance, and (11) withdrawal symptoms. though the dsm - iv - tr and dsm-5 do not include any disorders related to the problematic use of technology, pathological gambling is included in dsm - iv as a diagnosable condition under the category of impulse control disorders not elsewhere classified, and in dsm-5 as the first behavioral addiction. even though pathological gambling does not involve the use of a chemical substance, the similarities between the diagnostic criteria for substance use disorders and pathological gambling are striking. in general terms, both may be described as disorders involving loss of control over a compulsive, time- and resource - consuming behavior, which persists in the face of adverse consequences, with continued escalation of the behavior and/or withdrawal symptoms from reduction of the behavior. similarly, it was suggested as early as 1982 (i.e., well before the widespread use of mobile phones) that pathological use of technology may exist in the form of technodependence. the constructs of internet addiction and problem video gaming are gaining both clinical and empirical support [10, 14 ]. in addition, though problematic mobile phone use has not, to date, been recognized as a diagnosable condition, experts in the field are debating its inclusion as one. while evidence is scarce regarding a true addiction to mobile phones, data from recent studies suggest that some mobile phone users exhibit serious problematic behaviors analogous to the diagnostic criteria for substance use disorders or pathological gambling. these symptoms include preoccupation with mobile phone - based communication, excessive time or money spent on mobile telephones / communication plans, use of cellular devices in socially inappropriate or even physically dangerous situations (e.g., texting while driving an automobile), adverse effects on relationships, increased frequency or duration of mobile phone communication, and anxiety when separated from one 's telephone or when without an adequate cellular signal [1619 ]. given these findings, it seems plausible that the consequences and psychological dependence seen in problematic mobile phone use (like pathological gambling and problematic internet and video game use) seem to parallel substance use and dependence and may be important to consider as a potential diagnostic entity and target of intervention. in order to evaluate the extent to which problematic mobile phone use may be related to other addictive behaviors to date, research on problematic mobile phone use has been limited by the lack of validated diagnostic criteria or standardized assessment measures. for this study, we operationally defined problematic mobile phone use as any pattern of mobile phone use resulting in subjective distress or impairment in important areas of functioning. given that some individuals have legitimate reason to use their mobile phone very frequently (e.g., for work obligations) and are able to do so without negative consequences, we believed it was important to distinguish we expected rates of mobile phone use to be higher among individuals who exhibited symptoms of problematic mobile phone use, just as substance abusers generally tend to use substances in greater quantities / frequencies than nonabusers. however, as with substance use disorders, we did not feel that high frequency use should be considered a symptom of the condition. for this study, quantity of use was not included as a component of problematic mobile phone use, except that individuals ' subjective assessment of their use as excessive and troublesome was considered. the purpose of the present study was to develop an english language measure of problematic mobile phone use symptoms, based on adaptations of the dsm-5 substance use disorder criteria. the study followed a similar methodology to that utilized in previous studies regarding behavioral addictions [10, 20 ]. specifically, our overarching hypotheses for this study included the following.symptoms of problematic mobile phone use can be measured reliably and validly using a self - report questionnaire. scores on the preliminary measure of problematic mobile phone use developed for this study will correlate significantly with an existing measure of cellular phone dependency, which was validated on asian samples. symptoms of problematic mobile phone use will correlate positively with frequency and intensity of mobile telephone usage. symptoms of problematic mobile phone use can be measured reliably and validly using a self - report questionnaire. scores on the preliminary measure of problematic mobile phone use developed for this study will correlate significantly with an existing measure of cellular phone dependency, which was validated on asian samples. symptoms of problematic mobile phone use will correlate positively with frequency and intensity of mobile telephone usage. first, flyers advertising the study were posted around the university campus, the health science center, and in public locations including a mobile phone store. individuals who were interested in study participation called the research team to obtain a survey packet or to arrange a time to complete the survey. second, university students were recruited for the study via announcements made in various undergraduate and graduate level courses. questionnaires were passed out with a self - addressed, stamped envelope for participants to return the survey to the research team. third, other participants learned of the study via word - of - mouth and made contact with members of the research team in order to participate. completion of the full study questionnaire required 2030 minutes, and no compensation was provided to study participants. data were collected from 244 individuals (68.4% female) who ranged in age from 18 to 75 years old (m = 29.8 years old, sd = 14.1 years). participants were self - identified as caucasian (74.4%), hispanic / latino (11.3%), asian / pacific islander (9.2%), african american / black (2.5%), or other (2.5%). the sample included university students (37.7%), individuals employed full - time (32.6%), individuals employed part - time (17.4%), and individuals who were not currently employed or in school (12.2%). annual income was reported by 86.5% of the sample and ranged from $ 0 to $ 190,000 (m = $ 24,562, sd = $ 35,587). a pool of 69 potential items for the pump scale was developed by the first author based upon (1) informal interviews with several self - identified cell phone addicts who contacted the first author to discuss their mobile phone usage, (2) adaptation of the dsm - iv criteria for substance use disorders, and (3) review of existing measures assessing consequences of excessive internet use. these items were reviewed by 4 undergraduate research assistants for clarity but were not specifically pretested to assess psychometric properties before the questionnaires were distributed. after reviewing the proposed criteria for substance use disorders in the dsm-5, which was not yet published, the first and second authors together selected 22 items for inclusion in the scale. item selection was guided by the rational method, with the authors together choosing the 2 items that best reflected each of the 11 substance use disorder criteria proposed by the dsm-5 task force on substance - related disorders. all items were rated on a 5-point scale ranging from 1 = strongly disagree to 5 = strongly agree. scale analysis was utilized to assess psychometric properties of the individual items and the scale as a whole. the cpdq was originally developed in japan, to assess cellular phone dependency among japanese university students. it was later translated from japanese to thai and was used to study high school and university students in thailand. kawasaki and colleagues also published an english translation of the cpdq in the report of their research. for the present study, some items from this english translation were reworded slightly to more closely match the accepted local vernacular. though it taps the domain of cell phone addiction, the cpdq was not developed on the basis of either dsm - iv or dsm-5 criteria for substance use disorders and does not include items that would be considered reflective of abuse criteria per dsm - iv - tr guidelines. rather, items solely assess respondents ' perceived dependence on their cellular phone (e.g., i would feel worse if i lost my cellular phone than if i lost my wallet and items are rated on a 4-point scale ranging from not true at all to true. the cpdq has demonstrated good reliability and validity in non - english - speaking populations [18, 19, 22 ]. in addition, internal consistency for the current sample was excellent (=.91). it was developed for the present study as a general measurement of mobile phone use and does not attempt to distinguish excessive usage or identify consequences or symptoms associated with mobile phone use. items assess the amount of time spent utilizing various components of cellular phones (e.g., phone minutes, text messaging, emailing, internet access, and video game play). items are rated on a 6-point scale ranging from never to constantly. participants also completed 3 self - assessment questions regarding perceptions of their mobile phone usage. all statistical analyses were conducted using pasw 17.0. in order to address isolated cases of missing data, mean substitution was utilized for subscales in which at least 80% of the data were complete. participants reported having a mobile phone for an average of 7.29 years (sd = 3.73, range = 020 years). the majority of respondents (88.8%) reported having a personal cellular phone with a monthly contract, 6.6% reported having a personal cellular phone with a prepaid contract, and 1.2% reported sharing a cellular phone with at least one other person. (i.e., i would feel relieved if i was somewhere that my cell phone did not work and i sometimes wish i could get rid of my cell phone) had extremely low item total correlations (.05 and.15, resp.). after first considering their theoretical importance, it was decided that these items should be deleted from the final scale, as they did not appear to fit the overall construct of problematic mobile phone use. the final pump scale demonstrated excellent internal consistency (20 items, =.94). removal of any item would have resulted in a negative impact on the scale alpha. a principal components analysis was utilized to assess the factor structure of the 20-item pump scale. results supported a one - factor solution, with factor loadings for all items.48. the one - factor solution explained 49.05% of the variance, meeting carmines and zeller 's criterion. analysis of the scree plot also supported a one - factor solution, with the eigenvalue of the first component (9.86) far exceeding the eigenvalue of the second component (1.45), which was not significantly different from the remaining eigenvalues. scores on the pump scale ranged from 20 to 82 (m = 38.40, sd = 16.11) out of a possible score of 100. pump scores were compared to scores on the cellular phone dependency tendency questionnaire (cpdq), the cell phone use questionnaire (cuq), and the self - assessment items. it is noteworthy that pump scale total scores were not associated with the length of time the individual has owned a mobile phone (pearson r =.08, ns) or with the amount of money spent per month for mobile phone minutes (pearson r =.04, ns). however, pump scale scores were positively correlated with the amount of time spent engaging in any form of mobile phone use (see table 1), as well as the amount of money spent for text messaging service (r =.27, p <.001). as seen in table 1, pump scale scores also correlated positively with perceptions of excessive mobile phone usage, including self - reported feelings of addiction to the mobile phone. the purpose of the present study was to develop and validate a self - report measure of problematic mobile phone use (i.e., cell phone addiction) for english - speaking respondents, based on criteria utilized for other addictive behaviors. the problematic use of mobile phones (pump) scale demonstrated a single - factor structure, with excellent internal consistency. it also displayed convergent validity when compared to an existing measure of cellular phone dependency [the cpdq ], items measuring the frequency and intensity of cellular phone use behaviors (the cuq), and self - reported feelings of addiction to the mobile phone. these data provide preliminary support for the use of the pump scale in research examining problematic mobile phone use in english - speaking samples. most participants did not report symptoms, but it is noteworthy that a significant minority of respondents endorsed experiencing harm to their relationships, finances, and safety as a result of excessive phone use or use in inappropriate circumstances. some respondents also acknowledged subjective loss of control over escalating phone use, as well as withdrawal - like symptoms when unable to use their phone. finally, individuals who reported more symptoms of problematic mobile phone use on the pump scale were more likely to endorse feeling these findings support the popular construct of problematic mobile phone use (sometimes referred to as cell phone addiction) and suggest that this area merits further study. when considering these findings, it is important to acknowledge some limitations of the present study. first, like many instrument development studies, the sample was relatively small (n = 244) and was comprised of individuals recruited through convenience. many of the participants were recruited from a college campus, and some were recruited from a mobile phone store, which may have introduced selection bias. thus, the generalizability of results to the population as a whole may be limited. second, the use of self - report, particularly regarding past behaviors and experiences, may have introduced biases due to faulty recall, social desirability, or shared methods variance. obtaining more objective measures (i.e., mobile phone records, collateral reports) would strengthen the data. third, no gold standard measure (i.e., accepted formal diagnostic criteria) exists for problematic mobile phone use. therefore, it was not possible to assess the operating characteristics of the pump scale. future research is needed to identify the cut - point(s) of the pump scale for the purpose of detecting clinically significant symptoms. it must also be emphasized that the construct of problematic mobile phone use is not yet well - studied or supported in the literature. clearly, some individuals use their mobile phones more than others, but the reasons for this may be multifaceted. however, problematic mobile phone use appears to extend beyond frequency of use, to the extent that mobile phone use produces social, occupational, and psychological distress ; it may be useful to identify these symptoms as potential targets for prevention and intervention. finally, future studies should elucidate the mechanisms underlying problematic mobile phone use, in order to determine whether it exists as a primary phenomenon or alternatively is a symptom of other underlying pathology (e.g., anxiety disorders, impulse control deficits, personality factors). the long - term goal of research into problematic mobile phone use should be to effectively identify and treat problem users or those at risk for problematic use and ultimately to maximize communication utility of mobile technology while minimizing resulting dysfunction.	this study aimed to develop and assess the psychometric properties of an english language measure of problematic mobile phone use. participants were recruited from a university campus, health science center, and other public locations. the sample included 244 individuals (68.4% female) aged 1875. results supported a unidimensional factor structure for the 20-item self - report problematic use of mobile phones (pump) scale. internal consistency was excellent (= 0.94). strong correlations (r =.76, p <.001) were found between the pump scale and an existing scale of cellular phone dependency that was validated in asia, as well as items assessing frequency and intensity of mobile phone use. results provide preliminary support for the use of the pump scale to measure problematic use of mobile phones.
spinocerebellar ataxia type 3 (sca3) is one of nine polyglutamine expansion diseases and the most common dominantly inherited ataxia in the world. while certain symptoms in sca3 may respond to symptomatic therapy, there is still no effective treatment for this relentlessly progressive and fatal neurodegenerative disease. sca3 is caused by a cag repeat expansion in the atxn3 gene, resulting in an abnormally long polyglutamine stretch in the encoded atxn3 protein. because expression of mutant atxn3 is an early and necessary step in disease pathogenesis, strategies to reduce expression of the disease gene itself are high on the list of potential therapies.2, 3, 4, 5, 6 mice lacking the homologous atxn3 gene appear normal, suggesting that human atxn3 may not be an essential protein. additionally, in a doxycycline - regulatable transgenic mouse model of sca3, reducing production of mutant atxn3 transcripts via doxycycline treatment beginning at 9 weeks eliminated disease features. this result implies that treatment at an early symptomatic stage, prior to extensive irreversible tissue damage, holds promise for sca3 therapy. among gene suppression approaches, viral - mediated gene therapy has been explored by us and others in mouse models of sca3. in transgenic mice expressing the full human atxn3 disease gene, bilateral delivery of small interfering rna targeting atxn3 to the deep cerebellar nuclei (dcn) was well tolerated and led to sustained suppression of mutant atxn3 in the cerebellum, but it did not rescue motor deficits and the lifespan in these mice. because degeneration in patients with sca3 extends beyond the cerebellum to include selective brainstem nuclei, the striatum, and the thalamus, effective gene therapy for sca3 may require broader cns delivery. additional rnai studies targeting atxn3 succeeded in preventing motor deficits in a lentiviral mouse model of sca3 in which expanded atxn3 was virally delivered to the cerebellum,2, 5 but these studies have not yet been replicated in mouse models expressing mutant atxn3 throughout the cns. antisense oligonucleotides (asos) represent a therapeutic non - viral gene suppression approach that is increasingly being tested in neurodegenerative and metabolic disorders. asos are short single strands of chemically modified oligonucleotides that selectively bind complementary mrna via watson - crick hybridization to drive rnase h - mediated cleavage of the targeted mrna. asos targeting disease - causing genes have been tested in rodent models of various neurodegenerative disorders and have advanced into human clinical trials, including asos for spinal muscular atrophy (sma), familial amyotrophic lateral sclerosis (als), and huntington s disease (hd).11, 12, 13, 14, 15, 16 asos targeting atxn3 have been developed and tested in cellular and in vivo models of sca3, with some limitations.6, 17, 18, 19, 20, 21 allele - specific asos that selectively target the cag repeat expansion in an effort to preserve wild - type atxn3 function have been tested in sca3 cellular models, but the ubiquity of cag repeats in the human transcriptome may pose challenging off - target effects.17, 18, 19, 20 splice - switching asos have also been developed but failed to achieve greater than 50% knockdown of full - length mutant atxn3 in the aso - treated mouse cerebellum and did not preserve the deubiquitinating function of atxn3.6, 21 here we evaluate the efficiency of non - allele - specific asos targeting human atxn3 in two complementary transgenic mouse models of sca3 : the yeast artificial chromosome (yac) mjd - q84.2 (q84) model expressing the full - length human atxn3 disease gene with 84 cag repeats, and the cytomegalovirus (cmv) mjd - q135 (q135) model expressing a single human atxn3 isoform from an atxn3 cdna with 135 cag repeats.22, 23 overall, two candidate asos led to widespread delivery and efficient silencing of mutant human atxn3 with no immune response in the q84 mouse model of sca3. our results support the continued development of anti - atxn3 asos as therapy for sca3. to identify active atxn3 asos, asos complementary to human atxn3 coding and non - coding regions were screened at a single dose in hepg2 cells, a human cell line that expresses atxn3 transcripts. following aso treatment, the ability of the asos to suppress normal atxn3 transcripts was quantified (figure 1a). the most active asos were subjected to dose response to determine their in vitro median inhibitory concentration (ic50), and from these, five anti - atxn3 asos with similar ic50s (1.22 m) (figure 1b) targeting coding or non - coding regions of the human atxn3 transcript were selected for further characterization (figure 1c). all five anti - atxn3 asos, denoted aso-1 through aso-5, as well as a scrambled control aso (aso - ctrl), shared a 5 - 8 - 5 2-o - methoxyethyl (moe) gapmer design with phosphorothioate backbone modifications, as well as 5-mer blocks of moe - modified ribonucleotides flanking an 8-mer block of deoxynucleotides without sugar modifications (figure 1d). this moe gapmer design has previously been shown to increase stability and potency of asos and is the design taken into clinical trials for als and hd.14, 24, 25 to assess target efficiency of asos in patient cells, sca3 patient - derived fibroblasts (gm06153) were transfected with aso candidates, aso - ctrl, or pbs vehicle alone. gm06153 fibroblasts are heterozygous for the mutant atxn3 allele harboring a cag expansion with 71 repeats and a non - pathological repeat of 23. cells were transfected with asos (4 m) and harvested 48 or 72 hr later for rna or protein assessment, respectively. all five asos targeting atxn3 robustly suppressed atxn3 transcript and protein levels (p 50%) atxn3 protein levels in the cerebellum, diencephalon, and cervical spinal cord. the top aso candidates also caused a marked reduction in hmw aggregated atxn3 in the diencephalon, detectable on denaturing gels. in contrast to the robust suppression in q84 mice, we failed to observe robust aso - mediated reduction of mutant atxn3 in a second transgenic model, the q135 mouse. this lack of efficacy was not due to insufficient delivery, since aso-5 reduced endogenous atxn3 levels in q135 mice much as it did in q84 mice. decreased potency of aso targeting in q135 mice may result from key differences between cdna - derived and full - length transgenic models of disease. first, the exclusion of any intronic sequences in the atxn3 transcript of q135 may significantly alter rna processing dynamics of the mutant transcript, which could have direct effects on aso targeting capacity. in addition, q135 mice express a single isoform of human atxn3, the mrna structure of which may be less accessible to aso binding than other isoforms. in support of this argument, two previous studies investigating aso therapy for the polyglutamine disease spinal bulbar muscular atrophy (sbma) noted much less suppression of the targeted transcript in a cdna transgenic mouse model than in a mouse model of sbma expressing the full - length gene.33, 34 future studies could include other biologically relevant models of sca3 such as recently available knock - in models to further validate aso potency. we further assessed the tolerability of the three most effective asos in vivo. aso-2 and aso-5 proved to be safe and well tolerated, as evidenced by the absence of astrocytic or microglial activation after treatment. aso-5 even decreased transcript levels of the microglia marker iba1 in q84 mice, suggesting a partial rescue of neuroinflammatory changes that occur in sca3 patient brains as well as in transgenic sca3 mouse models.22, 36 in contrast to aso-2 and aso-5, aso-4 caused significant elevation of gfap transcript levels in the diencephalon and increased astrocytic invasion into the dcn. although aso-4 was designed to have low off - targeting potential, the apparent toxicity in fibroblast and animal models of disease do not support further development of aso-4 as a potential therapeutic in sca3. importantly, the lack of an overt immune response following endogenous atxn3 suppression, either in the presence or absence of the human disease protein, supports previous findings that atxn3 is likely not an essential protein and that non - allele - specific silencing of atxn3 may be well tolerated as a therapeutic approach.7, 8 future studies may employ additional in vivo safety and toxicity evaluations, such as transcriptome analysis or stereology in treated sca3 mice. the immediate next step is to move the safe and efficacious asos, aso-2 and aso-5, into a long - term trial to assess their impact on behavioral phenotypes and animal survival. while hemizygous q84 mice used in these studies express the full - length human atxn3 gene, they display relatively subtle behavioral phenotypes. for a long - term trial, we will need to employ homozygous q84 mice, which recapitulate numerous aspects of the human disease including quantifiable motor deficits, robust aggregate pathology, and early lethality.3, 23 in summary, we have established the first proof of concept for aso efficacy and tolerability in a sca3 mouse model of disease. all animal procedures were approved by the university of michigan committee on the use and care of animals (ucuca). yacmjd84.2q - c57bl/6 and cmvmjdq135-c57bl/6 transgenic mice were housed in cages with a maximum number of five animals and maintained in a standard 12-hr light / dark cycle with food and water ad libitum. genotyping was performed using dna isolated from tail biopsy at the time of weaning, as previously described. yacmjd84.2q transgenic mice hemizygosity was determined by standard pcr using gotaq green master mix (promega) to amplify a fragment of the atxn3 transgene with primer sequences 5-tggccttcacatggatgtgaa and 5-ccagtgactactttgattcg, and normalizing to a genomic fragment of mouse atxn3 chromosome 7 with primer sequences 5-ctctgtacagacagggagatgtgag and 5-gaggatgcaaaggagccaagtgacc. bolus, anesthetized with 100 mg / kg ketamine per 10 mg / kg xylazine intraperitoneally, and perfused transcardially with pbs. the five candidate anti - atxn3 asos and scrambled control aso used in this study are 18 nucleotides in length with eight unmodified deoxynucleotides with a native sugar - phosphate backbone flanked by five moe - modified ribonucleotides on the 5- and 3-termini with a phosphorothioate backbone. these asos were designed to target the intron, exon, or 3-utr of human atxn3. oligonucleotides were synthesized as described previously.37, 38 asos were solubilized in pbs (without ca or mg). sca3 patient - derived fibroblasts (gm06153) containing an expanded atxn3 allele (23q/71q) were obtained from coriell cell repositories. fibroblasts were maintained at 37c and 5% co2 in dmem (hyclone) supplemented with 15% fetal bovine serum. hepg2 cells were obtained from atcc and maintained in eagle s minimum essential medium (emem) (atcc) supplemented with 10% fbs, 1% non - essential amino acid (neaa), and 1% sodium pyruvate. hepg2 cells were electroporated at 165 v in 100 l media with 20,000 cells / well on the btx high - throughput electroporation system (harvard apparatus). following electroporation, cells were transferred to a collagen - coated plate and placed in an incubator overnight. twenty - four hours post - treatment, cells were washed with pbs and then lysed with gtc for rna purification. sca3 patient - derived fibroblasts were plated into 12-well plates at 80,000 cells / well density in supplemented dmem 2 days prior to transfection. aso transfections were performed using lipofectamine ltx with plus reagent (life technologies) at a final aso concentration of 4 m / well according to the manufacturer s instructions. cells were harvested 48 hr after transfection in trizol (invitrogen) for rna analysis or 72 hr after transfection using radioimmunoprecipitation assay (ripa) buffer containing protease inhibitors (complete mini ; roche diagnostics) for protein analysis. total rna was isolated from transfected fibroblasts and dissected brain tissue using trizol reagent according to the manufacturer s protocol (invitrogen). reverse transcription was performed on 1 g total rna using the iscript cdna synthesis kit according to the manufacturer s instructions (bio - rad). iq sybr green qpcr was performed on the diluted cdna following the manufacturer s protocol (bio - rad). analysis was performed using average adjusted relative quantification using the following primers : human atxn3 (5-gaagctgaccaactcctgc-3 and 5-cttctaacactcgttccagg-3), mouse beta actin (5-gaacggacagccatgggcggg-3 and 5-gtgtgtccccaagccccacg-3), mouse gfap (5-gaaaaccgcatcaccattcc-3 and 5-cttattgacctcaccatcccg-3), mouse iba1 (5- ccaccgtgtcagaatccac-3 and 5-atgctgggcaagagatct-3), human gapdh (5-ctccgggtgatgcttttcct and 5-acatgtaaaccatgtagttgaggt), and mouse atxn3 (5-tgtcttgttacagaaagatcag and 5-gttacaagaacagagctgact). protein lysates from sca3 fibroblasts were produced by lysis in ripa buffer containing protease inhibitors (complete mini), followed by centrifugation. protein lysates from the perfused and dissected mouse forebrain, diencephalon, cerebellum, and cervical spinal cord were produced by lysis and homogenization in ripa buffer containing protease inhibitors (complete mini) via dounce homogenizers, followed by sonication and centrifugation. total protein concentrations of extracted supernatants were determined using the bicinchoninic acid (bca) method (pierce) and stored at 80c. a total of 50 g total mouse brain protein lysate or 5 g total fibroblast protein lysate was resolved in 10% sds - polyacrylamide electrophoresis gels and transferred to polyvinylidene difluoride (pvdf) membranes. membranes were incubated overnight at 4c with various antibodies : mouse anti - atxn3 (1h9) (1:1,000, mab5360 ; millipore), rabbit anti - mjd antibody (1:10,000 ; paulson.), mouse anti - gapdh (1:5,000, mab374 ; millipore), or rabbit anti--tubulin (1:5,000, s2144 ; cell signaling technology). bound primary antibodies were visualized by incubation with a peroxidase - conjugated anti - mouse or anti - rabbit secondary antibody (1:10,000 ; jackson immunoresearch laboratories) followed by treatment with an enhanced chemiluminescence (ecl)-plus reagent (western lighting ; perkinelmer) and exposure to autoradiography films. six sex - matched q84, q135, or wild - type littermates were included per experimental treatment group. for each injection, a small incision was made, the skull was exposed, and a small burr hole was drilled at the proper coordinates : anterior - posterior, + 0.3 mm ; mediolateral, 1.0 mm ; and dorsoventral, 3.0 mm relative to the bregma. three minutes after the needle (7758 - 04 ; hamilton) connected to a 10-l syringe (7653 - 01 ; hamilton) was placed into the proper coordinates, a total of 500700 g aso diluted in 10 l pbs (without ca or mg) was delivered at an infusion rate of 0.5 l / s using an injection pump (umc4 ; world precision instruments). for all aso studies in q84 mice, mice received 500 g of the five active asos or control aso. in the q135 aso studies, mice received 500 g aso-4, 700 g aso-5, or 700 g aso - ctrl. five minutes after the infusion was completed, the needle was retracted at a rate of 1 mm / s. the incision site was sutured with synthetic absorbable sutures (v1d397 ; vet one) and the mouse was allowed to recover in a temperature - controlled environment. following surgery, weight, grooming activity, and home cage activity whole brains perfused with pbs and the right hemispheres were post - fixed for 48 hr at 4c in 4% paraformaldehyde solution and immersed in 30% sucrose until saturated, and 40 m was sagittally sectioned on a sledge microtome (sm200r ; leica biosystems). brain sections were subjected to a basic antigen retrieval, washed, blocked, and incubated overnight at 4c in primary antibody supplemented with 0.025% triton x-100, 0.5% bsa, and 5% serum from the host line for secondary antibodies (donkey or goat). primary antibodies used in these studies included the following : mouse anti - atxn3 (1h9) (1:1,000, mab5360 ; millipore), rabbit anti - aso (1:5,000, ionis pharmaceuticals), rabbit anti - neun-488 conjugated (1:1,000, abn78a4 ; millipore), mouse anti - gfap (1:1,000, 3670 ; cell signaling technology), and rabbit anti - iba1 (1:1,000, 019 - 19741 ; wako chemicals). primary incubated sections were then washed and incubated with the corresponding secondary alexa fluor 488 or 568 antibodies (1:1,000 ; invitrogen). all sections were stained with dapi (sigma) for 15 min at room temperature, mounted with prolong gold antifade reagent (invitrogen), and imaged using an ix71 olympus inverted microscope or nikon - a1 confocal microscope. conceptualization, l.r.m, g.r., g.h., h.b.k., h.l.p., h.s.m.	the most common dominantly inherited ataxia, spinocerebellar ataxia type 3 (sca3), is an incurable neurodegenerative disorder caused by a cag repeat expansion in the atxn3 gene that encodes an abnormally long polyglutamine tract in the disease protein, atxn3. mice lacking atxn3 are phenotypically normal ; hence, disease gene suppression offers a compelling approach to slow the neurodegenerative cascade in sca3. here we tested antisense oligonucleotides (asos) that target human atxn3 in two complementary mouse models of sca3 : yeast artificial chromosome (yac) mjd - q84.2 (q84) mice expressing the full - length human atxn3 gene and cytomegalovirus (cmv) mjd - q135 (q135) mice expressing a human atxn3 cdna. intracerebroventricular injection of asos resulted in widespread delivery to the most vulnerable brain regions in sca3. in treated q84 mice, three of five tested asos reduced disease protein levels by > 50% in the diencephalon, cerebellum, and cervical spinal cord. two asos also significantly reduced mutant atxn3 in the mouse forebrain and resulted in no signs of astrogliosis or microgliosis. in q135 mice expressing a single atxn3 isoform via a cdna transgene, asos did not result in similar robust atxn3 silencing. our results indicate that asos targeting full - length human atxn3 would likely be well tolerated and could lead to a preventative therapy for sca3.
gtpase of the immunity - associated protein family (gimaps), also termed immune - associated nucleotide - binding proteins (ians), are a relatively recently described, uncharacterized protein family of putative small gtpases conserved among vertebrates and higher plants [14 ]. the original publications describing the different human, mouse, and rat gimap family members used a variety of different names for the genes generating confusion. thus, the gimap nomenclature followed also in this minireview was introduced by the hugo gene nomenclature committee and includes the human, mouse, and rat orthologs (table 1). small gtp (guanosine triphosphate) binding proteins, also known as small gtpases, ras - like gtpases, or ras superfamily of gtp binding proteins, regulate key cellular functions in virtually all living organisms. they are involved in signal transduction events and regulation of gene expression in almost all cell types, including the cells of the immune system [2628 ]. the ras superfamily can be subclassified into ras, rho, rab, and arf families, and the closely related g family of the heterotrimeric g proteins, which sometimes are excluded from the ras superfamily. the ras proteins induce signaling pathways that include a variety of second messengers, such as calcium and camp. the ras superfamily proteins play key roles in a variety of cellular functions in the immune system, such as cell migration, t - cell anergy [31, 32 ], antigen presentation, and radical formation. the gimap family members have unique primary structures and, thus, they define a new family of g proteins distinct from the ras superfamily and the heterotrimeric g proteins. the expression of gimaps in vertebrates has been shown to be highest in the cells of the immune system, although a more ubiquitous expression has also been suggested. several studies have associated gimaps with immunological functions, such as thymocyte development and apoptosis regulation in lymphocytes. all vertebrate species examined so far have gimap genes in tight clusters in their genome [3, 4, 12 ]. the seven functional human gimap genes and one pseudogene are clustered on chromosome 7q36.1 and there are eight functional mouse gimaps clustered on chromosome 6 and seven functional genes in rat chromosome 4 [13, 25 ]. the ongoing sequencing project of the genome of danio rerio (zebrafish) has revealed the existence of gimap orthologs also in a lower vertebrate. the genomic organization of human, mouse and rat gimap genes is depicted in figure 1. homolog searches in available corn, soybean, and tobacco genomes by liu. came up with one to two homologs of gimap / ian genes in each genome. however, searches within the well - characterized genomes of the unicellular organisms saccharomyces cerevisiae (baker 's yeast) and schizosaccharomyces pombe (fission yeast), or invertebrates, such as caenorhabditis elegans (free - living roundworm) and drosophila melanogaster (fruit fly) did not reveal any homologs of the gimap gene family. thus, gimap genes exist only in vertebrates and angiosperm (i.e., flowering) plants and the yet poorly characterized cellular functions of the gimap proteins are specific for vertebrates and higher plants. gimap / ian proteins emerged before plants and animals split into their own evolutionary paths. phylogenetic analyses of both protein and genomic sequences [3, 4 ] showed that human and mouse gimaps 1, 4, 5, 6, 7, and 8 form highly orthologous pairs, and, thus, suggest that a gene duplication event in a common ancestor of rodents and primates gave rise to these genes. the phylogenetic analyses by liu. place the arabidopsis and rice ians to a clade distinct from the mouse and human gimap proteins, thus indicating that the gene duplication events have taken place after the divergence of vertebrates and plants. gimap8 makes an exception by having three gtpase domains, which is extremely unusual not only for gimaps, but for small gtpases in general, too. thus, its molecular size is 74.9 kda, making it by far the largest gimap protein. the gtpase domain with the five motifs g1-g5 characteristic for all small gtpases is included in the aig1 domain, named after the prototype gene aig1 found in arabidopsis thaliana (avrrpt2-induced gene). the aig1 domain is found in all gimap and ian proteins and besides the gtpase motifs, it contains a conserved box, which is characteristic for all aig1 domain gtpases. all human gimaps also contain putative coiled coil domains which suggest protein - protein interactions. some gimaps, namely, gimap1, 2, 4, and 5, contain putative transmembrane domains in their cooh - terminal ends and gimap7, gimap6, gimap1, and gimap2 have basic amino acids in their nh2- or cooh - terminus with weak similarity to endoplasmic reticulum- (er)-localization signals. however, localization studies found gimap4 mainly in cytosol [12, 14 ] but also in er and golgi and in membrane fraction of fractionated cd4 t - lymphocytes. gimap1 has been reported to localize in er and gimap7 in er and golgi. human gimap4 was shown to be able to bind guanosine nucleotides gtp and gdp but not gmp or other nucleotide triphosphates atp, ctp or ttp. it has a carboxy - terminal iq domain, which is known to bind calmodulin, a second messenger molecule involved in, among other cellular processes, tcr signaling, and activation of nfat in t - cells [14, 37 ]. the iq motif usually consists of ~23 residues and contains the consensus sequence hydrophobqxxxrxxxxrxxxr / k, where hydrophob is a hydrophobic residue. this motif was proven to be functional in murine gimap4 and, furthermore, seems to be absent from other gimap protein family members. also the putative phosphoylation sites of murine gimap4 were shown to be functional, since mouse gimap4 was phosphrorylated rapidly after 10 minutes of pma / ionomycin stimulation in primary splenocytes. the phosphorylation was mediated by pkc since it was inhibited by a pkc inhibitor, rottlerin. four of the six putative phosphorylation sites of mouse gimap4 are also found in human gimap4. cell surface expression of leukocyte markers cd4 and cd8 defines the stages of t - cell development in the thymus. during the development process, thymocytes mature from cd4cd8 double negative (dn) cells into cd4cd8 double positive (dp) cells and finally into single positive (sp) cd4 or cd8 cells which exit the thymus and enter the periphery (figure 2). the dn cells are further categorized according to their cd44 and cd25 cell surface expression : (1) dn1 (cd44cd25), (2) dn2 (cd44cd25), (3) dn3 (cd44cd25), and (4) dn4 (cd44cd25). furthermore, the dn4 cells pass through a cd4cd8 immature single positive (isp) stage before developing into dp cells. the different maturation stages are phenotypically and functionally distinct. the expression of gimap genes is strictly regulated during t - cell development in the thymus. dion. studied the expression of rat gimaps in different thymic subpopulations and observed a significant elevation in expression of all rat gimaps but gimap 4 genes between the dn and dp stages. the expression patterns for gimap1, 6, 8, and 9 during thymocyte development were very similar showing the highest expression in the dp stage. mouse gimap 3, 4, 5, and 7 expression was increased during the transition from cd4cd8 dp thymocytes into cd4 or cd8 sp thymocytes. while shrna mediated knockdown of mouse gimap4 hade no effect on thymocyte development in fetal thymic organ culture model shrna mediated knockdown of mouse gimap3 and gimap5 disturbed thymocyte development.. showed that gimap3 was needed for optimal positive selection of sp cd4 and cd8 t - cells and gimap5 was important for optimal development of dp thymocytes. it has also been shown that the proportion of cd4cd8 sp thymocytes was somewhat reduced in gimap5 mice. expression of mouse gimap4 protein during thymocyte development has been studied in more detail by poirier. and schnell.. it was not detectable in dn1, dn2, dn3, or dp thymocytes whereas high levels of gimap4 were expressed in sp cd4 cells and dn4 cells [1, 14 ]. the development of thymocytes in rag mice is blocked at the dn3 stage but in vivo administration of anti - cd3 antibody allows a low number of thymocytes to proceed up to the dp - stage. this system allows for the enrichment of the low - frequency cell subsets from the different developmental stages, namely, dn3, dn4, and isp, as well as dp cells. using the rag2 model, schnell. demonstrated that mouse gimap4 transcript was absent in differentiation arrested rag2 dn3 thymocytes while it was present in high amounts in dn4, in lower amounts in isp, and absent in dp cell subsets of anti - cd3 treated rag2 mice. similar results were obtained by poirier. with a rag fetal thymic organ culture (ftoc) model where thymocytes from rag mice blocked at the dn3 stage were cultured in vitro with anti - cd3 antibodies. the antibody treatment resulted in the transient expression of gimap4 protein between the dn3 and dp developmental stages. the transitions both from dn3 to dn4 stages and from dp to sp stages require tcr - mediated signals, and, thus, the results described above indicate that gimap4 expression is directly or indirectly induced by tcr - mediated signals during thymocyte development. however, gimap4 mice showed no significant role for gimap4 in t - cell development in thymus. thus, gimap4 seems to be dispensable for t - cell development, although its expression is tightly regulated during the development process. gimaps have been studied in most detail in apoptotic functions and in t - helper (th) cell differentiation and these processes are depicted in figures 3 and 4 and discussed below. mouse gimap1 was first identified by krcken. as a gene expressed in the spleens of mice infected with plasmodium chabaudi malaria. c57bl/10 mice are capable of self - healing the p. chabaudi malaria infection and this immunity is suppressed by testosterone. in the absence of testosterone the immunity progresses to a long - lasting protective immunity upon rechallenge. once acquired, the immunity is testosterone independent and mediated by spleen cells. the high expression of gimap1 in the spleen cells of p. chabaudi infected mice was strongly associated with the acquisition of the testosterone - resistant, immunity - mediating phenotype and was observed to be highest in macrophages with lower expression in b cells and t - cells. later it was shown that the expression of gimap1 in the spleens of the immune mice remains constitutively high for at least 13 weeks postinfection. surprisingly, however, a later study detected no upregulation of mouse gimap1 mrna or protein in spleen cell lysates from mice infected with p. chabaudi and this phenomenon could not be explained. mouse gimap1 has also been reported to be upregulated by p53 during apoptosis in a mouse myeloid leukemia cell line ltr6. a conditional knockout of gimap1 in murine lymphocytes led to severe reduction of mature t and b cells but there was little effect on immature thymocytes. both human and mouse gimap1 orthologs are preferentially expressed in the spleen with some expression in the lymph nodes. more detailed analysis of gimap1 protein expression in mouse splenic, thymic, and bone marrow cell populations revealed gimap1 expression in t (cd3 +) and b (b220 +) cells, dn, dp, and cd4 + and cd8 + sp thymocytes, as well as in nk / nkt (nk1.1 +) cells. interestingly, gimap1 was expressed at significant levels in 5 out of 11 tested lymphoid cancer cell lines, namely c1498, tk-1, a20 and p815. its expression was induced by th1 promoting cytokine il-12 whereas its expression was downregulated by il-4, a th2-inducing cytokine. promoter analysis of human gimap1 gene revealed the existence of multiple silencer elements in the promoter. stamm. studied a large 6.2 kb fragment containing also the first intron (from 3760 to + 2419). deletion of sequences from the first intron and from the 5 flanking area resulted in inducible promoter activity indicating the removal of silencers. the smallest promoter clone of 0.8 kb (from 760 to + 76) was highly active in jurkat cells thus suggesting that it contained all the elements necessary for active transcription. gimap3-ps is a pseudogene in humans and gimap3 is not annotated in the rat genome. mouse gimap3 gene expression was detected at low levels in spleen, but no expression was detected in thymus, liver, or kidney. however bcr / abl is a chimeric oncogenic protein generated from translocation between chromosomes 9 and 22 resulting in the so - called philadelphia chromosome. bcr / abl has constitutive tyrosine kinase activity and has been shown to activate several signal transduction pathways, such as ras, raf, myc, and stat. gimap4 protein expression is highly regulated at the post - transcriptional level [14, 15 ]. during t- and b - cell activation by anti - cd3/anti - cd28 and cd40-ligand / il-4 stimulation, respectively, the mrna level expression of gimap4 was shown to be quite stable. however, gimap4 protein level started to decrease after 4 days of t - cell activation and was undetectable at day 6. similarly, yet more rapidly, b - cell activation resulted in the reduction of gimap4 protein already after two days of activation. the rapid activation induced phosphorylation / dephosphorylation / degradation of mouse gimap4 observed by schnell the expression of rat gimap4 protein was approximately 10-fold greater in wild type lymph node (ln) t - cells compared to ln t - cells from lyp / lyp (gimap5) rat. it is not known whether this is due to gimap4 and gimap5 interaction in some shared biochemical pathway or a result of the altered activation status of t - cells from lyp / lyp animals. the latter seems plausible in the light of the findings by cambot. and schnell. while the majority of the peripheral t - cells of wt animals are resting g0 cells, the t - cells in lyp / lyp rats are a mixture of semiactivated cells and recent thymic emigrants (rte) [43, 44 ]. although gimap4 knockout seemed to be redundant for t - cell development as well as selection and activation of t - cells in vivo, the knockout had a significant effect on t - cell apoptosis. a convenient method for measuring apoptosis is the staining of exposed phosphatidylserine (ps) on plasma membrane with fluorochrome labeled annexin v and measuring the accumulation of propidium iodide (pi) in the nucleus after alterations in plasma membrane permeability. when mature splenic t - cells from wild - type and gimap4 mice were induced to apoptosis, the number of apoptotic (ps / pi) cells was greater among the gimap4 t - cells than the wt t - cells and the number of dead cells were reduced accordingly, that is, the cells executed apoptosis with slower kinetics. furthermore, the accumulation of apoptotic cells could be inhibited by caspase inhibitors, and there were no changes in caspase-3 activation between apoptotic ko and wt t - cells. this indicated that gimap4 acts downstream of caspase-3 and plays a role rather in the execution than the induction phase of apoptosis. a similar, but less marked effect was found in t - cells of the inbred brown norway (bn) rat, which carries a natural hypomorphic variant of the gimap4 gene. further support for the proapoptotic function of gimap4 came also from the findings of nitta., who showed that ectopic expression of gimap4 in immature mouse thymocytes led to increased apoptosis. furthermore, gimap4 protein was shown to associate with the proapoptotic bcl-2 family protein bax but not other bcl-2 family members [12, 45 ]. although schnell. and carter. showed that gimap4 is largely a cytosolic protein filn. found it to be expressed in the membrane fraction of human cd4 + t - helper cells. gimap4 expression was furthermore shown to be tightly regulated during early human cd4 + t - helper cell differentiation towards th1 and th2. proteomic analysis of il-4 regulated membrane proteins revealed downregulation of gimap4 during early th2 differentiation and it was further shown that il-12 upregulated gimap4 expression during th1 differentiation. the expression of two distinct isoforms of gimap4 in response to il-12 and il-4 was also studied and it was shown that they followed a similar expression pattern in response to the studied cytokines, although the short isoform was more highly abundant. rnai studies further showed that gimap4 protein expression was negatively regulated by stat6 in response to il-4r signaling during th2 differentiation. human gimap5 mrna expression showed very wide tissue distribution among most human tissues outside the central nervous system [17, 18 ]. it seemed to localize to the mitochondrial membrane although localization to the centrosome / er / plasma membrane or to a distinct sedimentable subcellular fraction outside er and mitochondria has also been detected. the regulation of gimap5 gene expression remains largely unknown but it has been shown that gimap5 is a transcriptional target of notch signaling in jurkat cells. an extensively studied genetic defect of lymphopenia (i.e., lyp, also called iddm2) in diabetes - prone biobreeding rat (bbdp) was shown to be caused by a frameshift mutation in the gimap5 gene [2023 ]. this frameshift deletion of 1 bp introduces a premature stop codon leading to a truncated protein product. this deletion was absent in the diabetes resistant bb (bbdr) rat [20, 21 ]. it closely resembles human type 1 diabetes and is a consequence of th1-mediated destruction of pancreatic islet cells characterized by high levels of ifn- and il-12 [48, 49 ]. the bbdp rat has severe, life - long t - cell lymphopenia [43, 50 ] caused by increased apoptosis and shortened life - span of recent thymic emigrants and peripheral t - cells [5153 ]. furthermore, peripheral lyp / lyp t - cells display normal ca signaling and proliferation in response to tcr crosslinking. interestingly, the in vitro life - span of lyp / lyp b cells is not affected by the mutation. the lymphopenic phenotype of the bbdp rat argues for anti - apoptotic function for gimap5. the studies with the mutated gimap5 in bbdp rat by pandarpurkar., keita., and pino. and with human gimap5 by sandal. mitochondrial membrane potential was found to be lower in bbdp t - cells than in bbdr t - cells. the lack of full - length gimap5 in bbdp rat t - cells lead to er stress signaling and c / ebp homologous protein-(chop)-mediated apoptosis. the bbdp rat t - cells also display an impaired tcr - stimulated ca response which suggests that gimap5 is a regulator of calcium responses in t - lymphocytes. moreover, knockdown of gimap5 by rnai in jurkat t - cells resulted in increased apoptosis. gimap5 mice exhibit peripheral t - cell lymphopenia, especially of cd8 t - cells. overexpression of human gimap5 in jurkat t - cell line resulted in increased resistance to okadaic acid or -irradiation induced apoptosis. the anti - apoptotic function of gimap5 was shown to be upstream of caspase-3. however, more recent studies by dalberg. were contradictory to the earlier findings and showed a proapoptotic function for human gimap5. they showed that gimap5 knockdown by rnai did not affect the number of apoptotic cells but overexpression of gimap5 in both jurkat t - cells and nave t - cells led to increased apoptosis. furthermore, they showed that while expression of the wt rat gimap5 led to increased apoptosis of the cells, the expression of the truncated gimap5-lyp in c58, a rat t - cell line, led to a very rapid death of the transfected cells. albeit the results obtained by different research groups seem contradictory, they may only indicate that the role of gimap5 in apoptosis is dependent on the activation status of the cells and the availability of growth factors. when the rat gimap5-lyp mutation was backcrossed into pvg - rt1 rat strain the lyp / lyp rats developed a spontaneous, progressive, inflammatory bowel disease with th2 characteristics. indeed, the purified lyp / lyp cd4cd45rc cells produced increased amounts of il-4 but similar amounts of ifn- compared to control wt cells. also the expression of il-4 and il-13 was higher in the lyp / lyp cells compared to wt. accordingly, chemical mutation of mouse gimap5 led to severe intestinal inflammation and wasting disease. a common polyadenylation polymorphism in the human gimap5 gene was associated with the risk to autoimmune systemic lupus erythematosus (sle) and with the increased prevalence of ia-2 autoantibodies in patients with type i diabetes. this polymorphism produces an inefficient polyadenylation signal to the 3 part of the gimap5 mrna and leads to increased proportion of nonterminated mrna. there are a growing number of reports describing a functional role for gimap family proteins in lymphocyte biology and we have discussed the role of gimaps in t - lymphocyte functions. determining, for example, the interaction partners, site of action, and signaling pathways will strengthen our knowledge of the function of this highly interesting novel family of gtpases.	(gimaps) gtpase of the immunity associated protein family are a novel protein family of putative small gtpases. gimaps are mainly expressed in the cells of the immune system and have been associated with immunological functions, such as thymocyte development, apoptosis of peripheral lymphocytes and t helper cell differentiation. gimaps have also been linked to immunological diseases, such as t cell lymphopenia, leukemia and autoimmune diseases. in this review we examine the role of gimap proteins in t - lymphocyte biology.
a 56-year - old male patient visited emergency room of our hospital with myalgia, chill and fever of 38.0c. he revealed intrahepatic ductal dilatation on the abdomen ct and positive antibody test for clonorchis sinensis. we conducted him brain mri which showed bitemporal signal change with enhancement and edema more prominently on the right side (figure 1a). he was transferred to our neurology department. on cerebrospinal fluid (csf) study, white bood cell count was 8/mm (100% lymphocyte) with normal glucose (52 mg / dl) and increased protein (92 mg / dl). electroencephalography (eeg) showed 57 hz medium to high amplitude background slowing without epileptiform discharge. csf hsv type 1 polymerase chain reaction (pcr) was positive whereas csf hsv type 2 pcr was negative. we managed him with intravenous acyclovir (30 mg / kg / day) for 3 weeks. except for slight drowsiness and memory impairment, the other neurologic deficit was not found. about hospital day, he showed characteristics change with irritability, overeating, and inappropriately increased sexual desire. we considered these phenomena as kluver - busy syndrome and tried him escitalopram (10 mg / day), valproic acid (1,000 mg / day) and quetiapine (25 mg / day) and these medications had some effect. on hospital day, he was discharged from hospital with memory deficit and mild general weakness. after 10 days he was admitted our department again with delusion and visual hallucination. through neurological examination, we found out that he got still memory impairment and newly developed mild weakness on his left limbs with nm (video). on follow - up cerebrospinal fluid study, white bood cell count was 30/mm (100% lymphocyte) with normal glucose (42 mg / dl) and increased protein (80 mg / dl). follow - up brain mri showed signal change on bilateral white matter and right thalamus and internal capsule and bilateral temporal cortical laminar necrosis (figure 1b, c). brain perfusion spect with technetium-99 m ethyl cysteinate dimer [tc-99 m ethyl cysteinate dimer (ecd) ] reveals perfusion decrease in the right fronto - parieto - temporal cortices, thalamus, and basal ganglia (figure 1d). eeg showed brief or long runs of periodic isolated triphasic waves on right frontotemporal electrode. and then we conducted eeg - electromyography (emg) monitoring, which showed no cortical electrical change with myographic pauses that were related with negative myoclonic jerks (figure 2). the duration of these electrical pauses ranged from 50 to 250 milliseconds (ms). we concluded that the cause of nm was due to subcortical brain damage such as right thalamic lesion and the right internal capsule lesion resulted in left hemiparesis. and we added clonazepam to phenytoin. his nm got better with improvement of weakness and discharged from hospital with constant memory impairment after two - month hospitalization. asterixis may be seen with metabolic encephalopathy including hepatic, renal and respiratory failure, drug intoxication, and electrolyte imbalance. in such cases these features have led to the perception that asterixis represents a non - specific and non - localising abnormality of the motor system. in contrast to bilateral nm, unilateral cases are relatively uncommon and have been associated with a variety of focal cerebral lesions.6 previous study of stroke cases found 30 patients with nm out of 1,550 acute stroke patients and the lateral thalamus was the most frequently involved site with nm. but, other sites of brain such as basal ganglia, midbrain, pons and cerebellum were also involved.7 the pathogenic mechanism for nm remains unclear. the postural stability or tonic control of the extremities is related to multiple brainstem spinal pathways such as the vestibulospinal, reticulospinal, or rubrospinal tracts. the ventrolateral nucleus of the thalamus is the area in which cerebellar - rubral or vestibulocerebellar fibers converge, and is also connected with the prefrontal area.7 in our patient, the follow - up brain mri showed the lesions in right thalamus and internal capsule. so we supposed the pathophysiological cause of nm might be the lesion in the lateral thalamic region close to the internal capsule. hsv encephalitis is a morbid disease, with a 70% mortality rate in the absence of treatment and 10% with current antiviral therapy.1 movement disorders related to hsv encephalitis are not commonly reported in the existing literature. chorea, ballism, choreoathetosis and myoclonus have been infrequently cited in the literature as a clinical presentation of hsv encephalitis. the brain parenchymal damage due to hsv encephalitis may involve the thalamus or its pathways, the movement disorder may be observed. this is probably attributed to the fact that not every patient was examined with the stretching of the arm in previous hsv encephalitis. in this case nm with the deterioration of brain lesions in the course of recovery might be caused by whether the relapse or natural course of hsv encephalitis., there is clinical deterioration, neuropsychologic deficits, expansion of the lesions in mri, and presence of viral replication or reactivation in the csf proven by pcr for hsv type 1 dna.8 we think in our case, the finding that the follow - up csf hsv type 1 pcr became negative means it was not the relapse. a previous report showed mri deterioration in hsv encephalitis despite clinical recovery.8 an immune - mediated process is suspected to be responsible for the mri progressive changes. we suppose that clinical deterioration of this case might be correlated with severe brain mri deterioration. emg silent periods are usually longer in duration (100400 ms) as compared to subcortical myoclonus. subcortical nm is usually confirmed by the emg studies which clearly demonstrated that the involuntary movements were synchronous with loss of muscle tonus and emg silence without any detectable eeg correlate.5 in this case, emg silent periods were 50250 ms in duration and any detectable eeg correlate was not present. these findings were compatible with subcortical nm. in the literatures, treatment of subcortical nm antiepileptic drugs such as carbamazepine, valproic acid, phenytoin, lamotrigine and oxcarbazepine have been reported to be able to induce or aggravate nm. on the contrary, levitracetam, valproic acid and ethosuximide have been reported to be able to improve nm.5 initially we treated him with valproic acid for kluver - busy syndrome, then the patient got nm. but considering the unilaterallity of nm, controlateral thalamic lesion was more responsible for nm (allowing for valproic acid effect). next visit, we treated him with phenytoin instead of valproic acid because of his first eeg finding of periodic isolated triphasic waves on right frontotemporal electrode, which could elicit cortical nm. the improvement may be related with drug effect or the healing process of right thalamic lesion. the patient showed negative myoclonus on his left arm and leg. when he was instructed to raise his both legs at supine position, his left leg drifted down with arrhythmical and jerky movements which were associated with brief loss of hip flexor and knee extensor muscles tone. because of his left leg weakness the examiner s hands supported his both legs. and then when he outstretched his both arms with hand pronation at supine position, his left hand also showed slight drift with irregular and jerky movements which were associated with the loss of finger and wrist extensor muscles tone.	various neurologic manifestations of herpes simplex virus (hsv) encephalitis have been reported on the literatures. chorea, ballism, choreoathetosis and myoclonus were reported as movement disorders which might be related with brain lesion by hsv encephalitis, but negative myoclonus (nm) has never been reported before. nm can be characterized as a shock - like involuntary jerky movement caused by a sudden, brief interruption of muscle activity. we experienced a case of hsv encephalitis with nm in unilateral arm and leg. in polygraphic monitoring, electroencephalography (emg) silent periods are 50250 ms in duration with no detectable emg correlate.
the present study utilized an experimental design via pre - test and post - test in three groups. the participants were selected from the child psychiatry clinic of ibn - e - sina psychiatric hospital in mashhad using convenience sampling. this sample size was calculated using g power software version 3.1 with alpha = 0.05 and a high effect size based on the study of klingberg. (47). inclusion and exclusion criteria were as follows : inclusion criteria : 1-children aged 6 to 12 years ; 2- diagnosis of adhd based on the dsm - tr criteria by a child and adolescent psychiatrist ; 3- taking ritalin and 4-having normal iq score ; 4- signing the consent form by mothers.exclusion criteria : 1-children who were taking any other medications were excluded from the study. inclusion criteria : 1-children aged 6 to 12 years ; 2- diagnosis of adhd based on the dsm - tr criteria by a child and adolescent psychiatrist ; 3- taking ritalin and 4-having normal iq score ; 4- signing the consent form by mothers. exclusion criteria : 1-children who were taking any other medications were excluded from the study. the present sample was randomly assigned into three research groups as follows : 1) parent training group for 12 mothers ; 2) working memory group consisting of 12 children ; 3) the combined group comprising 12 children along with their mothers. in this group, children benefited from working memory training and their mothers participated in parent training sessions. parent and working memory trainings were conducted by a clinician with a masters degree and supervised by a phd in child psychology. the participants of the three groups were concurrently under medication that was the same (ritalin) for all the subjects. also, the dosage of the medication was similar in all the participants according to their weight, so the three groups were homogeneous in this respect. to collect the required data, the present study employed the following instruments : the snap - iv is a revision of the swanson, nolan and pelham (snap) questionnaire (61). the items from the dsm - iv criteria for attention deficit hyperactivity disorder (adhd) are included for the two following subsets of symptoms : inattention (items 1 to 0) and hyperactivity / impulsivity (items 10 to 18). scoring procedure is as follows : each item is scored on a likert - scale type ranging 0 - 3 (never = 0, sometimes = 1, often = 2, always = 3). the total score is then divided by 18 and each subtype is divided by 9. to determine the cut - off point, the designers of the scale utilized mean and standard deviation of 1.65(61, 62). (1386) estimated the total cut - off point and the cut - off point of the subtypes of adhd - i and adhd - h as 1.57, 1.1, and 1.9, respectively. the total reliability of the scale and the reliability of the subscales calculated via cronbach s alpha were found to be 0.97, 0.90, 0.76, respectively, (62). in a similar vein, sadroaldin., (1386) reported the reliability estimates of the scale calculated via test - retest, cronbach s alpha and split - half reliability coefficients among a sample of iranian children as 0.82, 0.90, and 0.76, respectively (63). this scale was utilized in the present study as a diagnostic test as well as pre - test and post - test to study the decline of the symptoms. child behavior checklist (cbcl) which is appropriate for children within the age range of 6 - 18 years is completed by the parents according to the participant s condition over the preceding six months. cbcl comprises three sections : a) demographic information ; b) competence and adaptive functioning criteria ; c) dsm and experience - based scales. each item is rated on a scale ranging from 0 (not true), to 1 (somehow true) and 2 (totally or often true). the total reliability of the instrument estimated via cronbach s alpha was 0.97 and it was 0.94 via test - retest. minaee s (1385) study demonstrated that cronbach s alpha estimated for competence and adaptive functioning ranged from 0.65 to 0.91, cronbach s alpha calculated for dsm was acceptable and ranged from 0.62 to 0.92. cronbach s alpha computed for the subscales of adhd in each form was found to be between 0.92 and 0.78. it is worth mentioning that cbcl was employed in the present study in order to diagnose the patients and examine the reduction of the symptoms of adhd.. these interviews can vary by the objective, structure and source of data collection (66). in the present study, the diagnostic clinical interviews based on dsm - iv - tr criteria were conducted by a child and adolescent psychiatrist. working memory training software was designed by khodadady, mashhadi and amani (1388) ; compatible with its english version made by the cogmed company, this software in a form of a computer game presents different tasks to improve the visual and auditory working memory (67). the current version, the wisc - iv, was produced in 2003. the wisc - iv is divided into fifteen subtests, ten of which formed a part of the previous wisc iii. the five new subtests include three core tests : picture concepts, letter - number sequencing, matrix reasoning and two supplemental tests : cancellation and word reasoning. the wisc - iv generates a full scale iq (fsiq) which represents overall cognitive ability. the four other composite scores are verbal comprehension index (vci), perceptual reasoning index (pri), processing speed index (psi) and working memory index (wmi).some studies were conducted to examine the scale s reliability and validity in iran. there was a significant correlation between wisc - iv, raven s progressive matrices and wisc ii (68, 69). the present study was conducted in several phases. in the first phase, after the diagnosis was made by a child and adolescent psychiatrist, snap - iv rating scale and cbcl test were completed by the mother. in the second phase, the wechsler intelligence scale for children - fourth edition was implemented in order to homogenize the groups in terms of their iqs and to examine whether the participants had any intelligence incompetency. the third phase included the random assignment of the participants in the treatment groups and the onset of the treatment. after conducting the pre - tests, the training program derived from the barkley s model was offered to the parent training group over eight private sessions. the training issues consisted of the following 10 steps : step 1 : introducing adhd and presenting an overviewstep 2 : understanding parent - child relationshipstep 3 : improving positive attention skillsstep 4 : developing positive attention skills and enhancing child acceptancestep 5 : creating a coupon - based economy at homestep 6 : supplementing response coststep 7 : using timeoutstep 8 : managing children s behaviour in public placesstep 9 : making preparations for restraining school problemsstep 10 : back - up sessions step 1 : introducing adhd and presenting an overview step 2 : understanding parent - child relationship step 3 : improving positive attention skills step 4 : developing positive attention skills and enhancing child acceptance step 5 : creating a coupon - based economy at home step 6 : supplementing response cost step 7 : using timeout step 8 : managing children s behaviour in public places step 9 : making preparations for restraining school problems step 10 : back - up sessions during the last session, snap - iv rating scale and cbcl test were completed again by mothers. in the working memory training group, after performing pre - tests, children were required to take part in individual sessions. besides, visual and auditory computer - based rewards encouraged the child to sustain his / her effort. at the end of the eighth training session, the post - tests were performed. in the combined group, after completing the pre - tests, both trainings were concurrently presented for the mother and her child. post - test was performed in the last session. before testing the research hypotheses, the wisc - iv intelligence test was conducted to ensure the homogeneity of the participants regarding their intelligence level. the present study utilized an experimental design via pre - test and post - test in three groups. the participants were selected from the child psychiatry clinic of ibn - e - sina psychiatric hospital in mashhad using convenience sampling. this sample size was calculated using g power software version 3.1 with alpha = 0.05 and a high effect size based on the study of klingberg. (47). inclusion and exclusion criteria were as follows : inclusion criteria : 1-children aged 6 to 12 years ; 2- diagnosis of adhd based on the dsm - tr criteria by a child and adolescent psychiatrist ; 3- taking ritalin and 4-having normal iq score ; 4- signing the consent form by mothers.exclusion criteria : 1-children who were taking any other medications were excluded from the study. inclusion criteria : 1-children aged 6 to 12 years ; 2- diagnosis of adhd based on the dsm - tr criteria by a child and adolescent psychiatrist ; 3- taking ritalin and 4-having normal iq score ; 4- signing the consent form by mothers. exclusion criteria : 1-children who were taking any other medications were excluded from the study. the present sample was randomly assigned into three research groups as follows : 1) parent training group for 12 mothers ; 2) working memory group consisting of 12 children ; 3) the combined group comprising 12 children along with their mothers. in this group, children benefited from working memory training and their mothers participated in parent training sessions. parent and working memory trainings were conducted by a clinician with a masters degree and supervised by a phd in child psychology. the participants of the three groups were concurrently under medication that was the same (ritalin) for all the subjects. also, the dosage of the medication was similar in all the participants according to their weight, so the three groups were homogeneous in this respect. to collect the required data, the present study employed the following instruments : the snap - iv is a revision of the swanson, nolan and pelham (snap) questionnaire (61). the items from the dsm - iv criteria for attention deficit hyperactivity disorder (adhd) are included for the two following subsets of symptoms : inattention (items 1 to 0) and hyperactivity / impulsivity (items 10 to 18). scoring procedure is as follows : each item is scored on a likert - scale type ranging 0 - 3 (never = 0, sometimes = 1, often = 2, always = 3). the total score is then divided by 18 and each subtype is divided by 9. to determine the cut - off point, the designers of the scale utilized mean and standard deviation of 1.65(61, 62). (1386) estimated the total cut - off point and the cut - off point of the subtypes of adhd - i and adhd - h as 1.57, 1.1, and 1.9, respectively. the total reliability of the scale and the reliability of the subscales calculated via cronbach s alpha were found to be 0.97, 0.90, 0.76, respectively, (62). in a similar vein, sadroaldin., (1386) reported the reliability estimates of the scale calculated via test - retest, cronbach s alpha and split - half reliability coefficients among a sample of iranian children as 0.82, 0.90, and 0.76, respectively (63). this scale was utilized in the present study as a diagnostic test as well as pre - test and post - test to study the decline of the symptoms. child behavior checklist (cbcl) which is appropriate for children within the age range of 6 - 18 years is completed by the parents according to the participant s condition over the preceding six months. cbcl comprises three sections : a) demographic information ; b) competence and adaptive functioning criteria ; c) dsm and experience - based scales. each item is rated on a scale ranging from 0 (not true), to 1 (somehow true) and 2 (totally or often true). the total reliability of the instrument estimated via cronbach s alpha was 0.97 and it was 0.94 via test - retest. minaee s (1385) study demonstrated that cronbach s alpha estimated for competence and adaptive functioning ranged from 0.65 to 0.91, cronbach s alpha calculated for dsm was acceptable and ranged from 0.62 to 0.92. cronbach s alpha computed for the subscales of adhd in each form was found to be between 0.92 and 0.78. it is worth mentioning that cbcl was employed in the present study in order to diagnose the patients and examine the reduction of the symptoms of adhd.. these interviews can vary by the objective, structure and source of data collection (66). in the present study, the diagnostic clinical interviews based on dsm - iv - tr criteria were conducted by a child and adolescent psychiatrist. working memory training software was designed by khodadady, mashhadi and amani (1388) ; compatible with its english version made by the cogmed company, this software in a form of a computer game presents different tasks to improve the visual and auditory working memory (67). the wisc - iv is divided into fifteen subtests, ten of which formed a part of the previous wisc iii. the five new subtests include three core tests : picture concepts, letter - number sequencing, matrix reasoning and two supplemental tests : cancellation and word reasoning. the wisc - iv generates a full scale iq (fsiq) which represents overall cognitive ability. the four other composite scores are verbal comprehension index (vci), perceptual reasoning index (pri), processing speed index (psi) and working memory index (wmi).some studies were conducted to examine the scale s reliability and validity in iran. there was a significant correlation between wisc - iv, raven s progressive matrices and wisc ii (68, 69). after the diagnosis was made by a child and adolescent psychiatrist, snap - iv rating scale and cbcl test were completed by the mother. in the second phase, the wechsler intelligence scale for children - fourth edition was implemented in order to homogenize the groups in terms of their iqs and to examine whether the participants had any intelligence incompetency. the third phase included the random assignment of the participants in the treatment groups and the onset of the treatment. after conducting the pre - tests, the training program derived from the barkley s model was offered to the parent training group over eight private sessions. the training issues consisted of the following 10 steps : step 1 : introducing adhd and presenting an overviewstep 2 : understanding parent - child relationshipstep 3 : improving positive attention skillsstep 4 : developing positive attention skills and enhancing child acceptancestep 5 : creating a coupon - based economy at homestep 6 : supplementing response coststep 7 : using timeoutstep 8 : managing children s behaviour in public placesstep 9 : making preparations for restraining school problemsstep 10 : back - up sessions step 1 : introducing adhd and presenting an overview step 2 : understanding parent - child relationship step 3 : improving positive attention skills step 4 : developing positive attention skills and enhancing child acceptance step 5 : creating a coupon - based economy at home step 6 : supplementing response cost step 7 : using timeout step 8 : managing children s behaviour in public places step 9 : making preparations for restraining school problems step 10 : back - up sessions during the last session, snap - iv rating scale and cbcl test were completed again by mothers. in the working memory training group, after performing pre - tests, children were required to take part in individual sessions. besides, visual and auditory computer - based rewards encouraged the child to sustain his / her effort. at the end of the eighth training session, the post - tests were performed. in the combined group, after completing the pre - tests, both trainings were concurrently presented for the mother and her child. post - test was performed in the last session. before testing the research hypotheses, the wisc - iv intelligence test was conducted to ensure the homogeneity of the participants regarding their intelligence level. due to gender differences prevalent in adhd subjects, the frequency in each group favored boys. in addition, the children of the parent training group had the lowest age average in comparison with their counterparts in the other groups. the highest frequency within the combined treatment group and working memory treatment group were related to the second grade primary school children ; the highest frequency within the parent training group consisted of first grade primary school participants. the results of mancova revealed no significant differences among the three groups regarding their verbal comprehension iq, perceptual reasoning, processing time and total score (wilksl= 0.74, f= 0.95, p > 0.05). this plausibly demonstrates the homogeneity of the groups. in the current study, it was hypothesized that combined treatment in comparison with working memory training method, and parent training treatment per se are more effective in suppressing the adhd symptoms. the following table shows the descriptive statistics of the three groups including means and p < 0.05, p < 0.001 standard deviations. table 1 indicates means and standard deviations of the participants scores in combined treatment group, working memory training group and parent training group on snap and cbcl tests. the dependant variables in this analysis included the scores of attention deficit symptoms, hyperactivity/ impulsivity and the total symptoms of snap test as well as the scores of the inattention symptoms (experience - based scales) and adhd clinical symptoms (dsm - based) contained in cbcl test. pre - test scores were regarded as control variables and group represented the independent variable. the results indicated that the test is significant (c2 (14) = 229.38, p<0.001) ; this demonstrates a significant correlation among the dependant variables (68). the result of leven s test of error variance homogeneity was not significant (p.0.05) which suggests that error variance was equal across all the levels of group variable. there was a significant difference among the groups in symptoms reduction (wilksl= 0.12, f48, 10 (= 9.09, p<.0.05). as indicated in table 3, the three groups displayed significant differences in the following variables : attention deficit symptoms (f2)8&2)= 17.56, p < 0.001, 2=0.56), hyperactivity / impulsivity symptoms (f2) 8 & 2)= 10.48, p<0.001, 2=0.43), total symptoms (f2) 8 & 2)= 13.78, p<0.001, 2=0.50), attention problems (experience - based scales) (f2 (8 & 2)= 10.39, p<0.001, 2=0.42), and adhd symptoms based on dsm (f2 (8 & 2)= 5.32, p<0.05, 2=0.28). comparative analysis of treatment groups employing multiple comparisons (lsd) suggested a significant difference between the combined treatment group and the two other groups in all the variables of snap and cbcl tests. the results indicated a significant difference between the combined treatment group and parent training group in suppressing the symptoms of attention deficit in snap test (p<0.05). a significant difference was also found between the combined treatment group and working memory training group (p<0.001). furthermore, a significant difference was found (p<0.001) between the combined treatment group and working memory training group in the decline of total symptoms of snap test. moreover, a significant difference (p<0.05) was observed between the combined treatment group and working memory training group in deficit (experience - based scales) of cbcl test. the difference in attention problems (experience - based scales) was also significant between the combined treatment group and parent treatment group (p<0.001). moreover, a significant difference was detected between the combined treatment group and working memory training group (p<0.01) as well as between the combined treatment group and parent training group (p<0.05) in reducing clinical symptoms of adhd (based on dms). table 1 indicates means and standard deviations of the participants scores in combined treatment group, working memory training group and parent training group on snap and cbcl tests. the dependant variables in this analysis included the scores of attention deficit symptoms, hyperactivity/ impulsivity and the total symptoms of snap test as well as the scores of the inattention symptoms (experience - based scales) and adhd clinical symptoms (dsm - based) contained in cbcl test. pre - test scores were regarded as control variables and group represented the independent variable. the results indicated that the test is significant (c2 (14) = 229.38, p<0.001) ; this demonstrates a significant correlation among the dependant variables (68). the result of leven s test of error variance homogeneity was not significant (p.0.05) which suggests that error variance was equal across all the levels of group variable. there was a significant difference among the groups in symptoms reduction (wilksl= 0.12, f48, 10 (= 9.09, p<.0.05). as indicated in table 3, the three groups displayed significant differences in the following variables : attention deficit symptoms (f2)8&2)= 17.56, p < 0.001, 2=0.56), hyperactivity / impulsivity symptoms (f2) 8 & 2)= 10.48, p<0.001, 2=0.43), total symptoms (f2) 8 & 2)= 13.78, p<0.001, 2=0.50), attention problems (experience - based scales) (f2 (8 & 2)= 10.39, p<0.001, 2=0.42), and adhd symptoms based on dsm (f2 (8 & 2)= 5.32, p<0.05, 2=0.28). comparative analysis of treatment groups employing multiple comparisons (lsd) suggested a significant difference between the combined treatment group and the two other groups in all the variables of snap and cbcl tests. the results indicated a significant difference between the combined treatment group and parent training group in suppressing the symptoms of attention deficit in snap test (p<0.05). a significant difference was also found between the combined treatment group and working memory training group (p<0.001). furthermore, a significant difference was found (p<0.001) between the combined treatment group and working memory training group in the decline of total symptoms of snap test. moreover, a significant difference (p<0.05) was observed between the combined treatment group and working memory training group in deficit (experience - based scales) of cbcl test. the difference in attention problems (experience - based scales) was also significant between the combined treatment group and parent treatment group (p<0.001). moreover, a significant difference was detected between the combined treatment group and working memory training group (p<0.01) as well as between the combined treatment group and parent training group (p<0.05) in reducing clinical symptoms of adhd (based on dms). various treatment methods for adhd have been presented so far, among which working memory training as a psychosocial method has received substantial support (42, 46, 47, 51, 53). plethora of research provides evidence that parent training as an evidence - based method is a well established treatment for children with adhd (9). although, research strongly supports the effectiveness of the combination of adhd interventions (2, 9, 56, 57 - 59), the effectiveness of the combined methods of working memory training and parental training has not been investigated so far. therefore, the objective of the present study was to examine the effectiveness of barkley s parent training program, working memory training and the combination of these two interventions for children with adhd. the results of the present study demonstrated that combined treatment in comparison with the other two methods suppressed the clinical symptoms of adhd more significantly. hence, it can be concluded that the finding of the present study are consistent with that of other national and international studies, and we recommend combined method as an effective treatment for individuals with adhd (56 - 59). it is worth mentioning that the most significant reductions of hyperactivity / impulsivity symptoms, after combined treatment group, were observed in the group of parent training. this finding, in particular, indicates the positive impact of changes in parents coping strategies with children s hyperactivity / impulsivity symptoms. this confirms the finding of previous research that supports parent training approaches in reducing adhd symptoms of children (3, 9, 25 - 29). in addition, the present research revealed that after the combined treatment group, the second most significant reduction of children s attention deficit symptoms occurred in working memory training group. previous researches highlighted the effectiveness of working memory training and regarded this method superior to other psychosocial treatments (42, 46, 48 - 50, 52, 53). the findings of this study, congruent with previous researches, indicate that parent training program is more effective in reducing the hyperactivity / impulsivity symptoms (2) and working memory training has a better effect on inattention symptoms of adhd (46). therefore, it seems safe to claim that combined treatment of working memory training and parental training has the best effectiveness on reducing both hyperactivity / impulsivity and inattention symptoms. a combination of working memory training and parent training as a new approach within the domain of combined treatment methods of adhd tends to not only impact the processes, functioning, and interactions between parents and children but also directly influences the children s memory functioning as one of the key modules of adhd. substantial research provides evidence for the effectiveness of combined interventions in helping children with adhd (9, 55, 59). moreover, combined method can be taken into account as a treatment approach in reducing symptoms and improving deficiencies associated with adhd. thus, further researches are required to encompass a larger sample of children with adhd to differentiate various treatment methods in terms of their effectiveness and based on the sub - types of the disorder and they should also involve long - term follow ups.	objectivethe aim of the current study was to examine the effectiveness of barkley s parent training program, working memory training and the combination of these two interventions for children with attention deficit hyperactivity disorder (adhd).methodsin this study, 36 participants with adhd (aged 6 to 12 years) were selected by convenience sampling. revision of the swanson, nolan and pelham (snap) questionnaire (snap iv), child behavior checklist (cbcl) and clinical interviews were employed to diagnose adhd. wechsler intelligence scale for children - fourth edition was also implemented. the participants were randomly assigned to the three intervention groups of barkley s parent training program, working memory training and the combined group. snap - iv and cbcl were used as pre - tests and post - tests across all three groups. data were analyzed using mancova (spss version18).resultsthere was a significant difference (p < 0.05) in the decline of attention deficit and hyperactivity /impulsivity symptoms between the combined treatment group and working memory training group and also between the combined treatment group and the parent training group in snap. in terms of attention problems (experience - based subscales) of cbcl, there was a significant difference (p < 0.001) between the combined treatment group and working memory training group. furthermore, compared to the working memory training and parent training groups, the combined group demonstrated a significant decline (p < 0.01) in clinical symptoms of adhd (based on dsm).conclusionit was revealed that combined treatment in comparison with the other two methods suppressed the clinical symptoms of adhd more significantly.
in the 1950s, pulse - chase experiments using radioactive precursors showed that ~95% of the rna made in mammalian nuclei is degraded within minutes. at the time, no credible reason could be proposed for this astonishing turnover, and only later did we discover it results from the destruction of non - coding rnas and intronic regions within coding transcripts. while such synthesis and destruction appears utterly wasteful, it is nevertheless an integral part of metabolism. at the molecular level for example, for every 100 transcripts initiated by a bacterial polymerase in vitro and in vivo, ~99 abort within ~10 nucleotides. these aborting transcripts are not contained in current catalogs of transcripts made using rna - seq, as they are too short to be mapped. eukaryotic polymerases then undergo a structural transition on escape from the promoter, but many stall and/or abort prematurely after 20500 nucleotides to give the promoter - proximal peak seen by rna - seq. consequently, the production of each full - length sense transcript is accompanied by the synthesis of > 100 shorter products. in a human cell, the associated energy costs must be marginal, as typically nine - tenths of a message will now be spliced out and degraded. unfortunately, there is little data on the half - lives of prematurely - terminated products, but it is likely they will be less than those of an intron (typically ~5 min) simply because they are so much shorter. note that even the machines that we expect to perform precisely also initiate inefficiently ; most unique sequences in dividing human cells are present in equimolar amounts, but ~200-bp segments from origins of replication are in excess and are presumably generated as dna polymerases abort. (a) strings of red spheres depict nucleotides (nts) incorporated into ~300 transcripts being copied from sense / anti - sense strands of a 15-kbp gene in a cell population. most polymerases abort prematurely to yield short unstable transcripts of 210 nucleotides from both strands, a few pause / abort after generating unstable transcripts of 20500 nucleotides, and only one generates a stable full - length transcript. the numbers of transcripts in each class are not known, and are included for illustrative purposes only ; however, there are probably so many short aborting ones of 210 nucleotides that the same general conclusion can be drawn irrespective of precise numbers. (b) after 20 ms (when an elongating polymerase incorporates ~1 labeled nucleotide ; yellow), most incorporated label is in short transcripts that soon abort and are quickly degraded ; the long transcript contains one label, which goes undetected using most current methods. (c) after 5 min (when a polymerase incorporates ~15 000 nucleotides), the one stable transcript is completely filled with label ; however, label incorporated early during the pulse into the many short aborting transcripts has turned over (and so goes undetected). imagine that we could see every nucleotide in every transcript copied from a typical human gene as it is incorporated during a 20-ms pulse (when a polymerase adds ~1 nucleotide), and know what its fate might be (fig. as the process is so inefficient, most labels at the end of the pulse will be in the many short transcripts that soon abort (and are degraded rapidly, probably within seconds). only a tiny fraction will be in molecules that contribute to the stable transcriptome. now imagine we repeat the experiment using a 5 min pulse (long enough for a polymerase to transcribe the gene ; fig. all transcripts labeled early on will have been degraded, and the few contributing to the stable transcriptome will contain a much higher fraction of label (because they are both stable and longer). as traditional methods usually require pulses of > 5 min to allow detection of the full - length rna (usually the one of interest), they completely miss the rapidly turning - over fraction. in contrast to transcription, current reviews see a ribosome initiating efficiently, and then most being able to translate all the way to a termination codon without mishap although some will stall to be rescued by pathways like those involved in non - stop and no - go decay. most products made by ribosomes are also seen as stable, with the half - life of a typical human protein being ~20 h (this average covers a wide range varying from minutes to tens of hours). if production is efficient, and most products are stable, then the efficiency of translation must be very different from that of transcription ! genome sequences are annotated using complex assumptions, and it remains difficult to predict which segments encode open - reading frames (orfs) that are translated into protein, especially when those segments are short. for example, it was initially assumed that orfs should be longer than 300 nucleotides, but ~10% of mouse orfs are shorter than this, and both ribosome profiling (a method for monitoring ribosome binding along a message) and proteomics show that many such short orfs (sorfs) are translated, whether they lie in genic or non - coding rnas. about 50% of human mrnas also encode upstream open - reading frames (uorfs) of 9 nucleotides (median length 48 nucleotides) ; many of these uorfs are as evolutionarily conserved as orfs, and are translated into products that are present in 102,000 copies in the cell. for example, translation of uorfs reduces expression of associated orfs, and mutations introducing a uorf into the 5 leader of the mrna encoding cdkn2a predisposes individuals to melanoma, in ldlr to familial hypercholesterolemia, and in cftr to cystic fibrosis. some products of sorfs are also medically important, like gnrh1 in hormonal signaling, ccl / cxcl members in innate immunity, and defensins in pathogen protection. only now are the dedicated pipelines needed for their detection being developed, with 74 new human peptides at the tip of the iceberg being found in a recent survey. experiments using short pulses have uncovered an incredibly - high turnover of newly - made peptides. these short pulses were being used in an attempt to solve an old chestnut whether or not translation occurs in nuclei and we now digress to discuss this. studies in the 1950s showed that isolated nuclei could incorporate radiolabeled amino acids into acid - insoluble protease - sensitive material, and this provoked a debate about whether this (apparently nuclear) synthesis was due to contamination by cytoplasmic ribosomes. subsequently, it was shown that protein synthesis in bacteria is often spatially coupled to transcription, and it was expected it would be the same in eukaryotes. but the discovery of introns seemed to provide a good reason why such coupling should not occur : if nuclear ribosomes translated introns which possess many termination codons too many truncated peptides would be produced, and some would surely be toxic. clearly, restricting intron - containing rna to nuclei, and translation of intron - free mrna to the cytoplasm, this killed the idea that any translation might occur in nuclei. from time to time, the debate concerning nuclear translation has been re - opened. for example, translation is involved in proofreading mrna during nonsense - mediated decay (nmd). nmd involves the detection of inappropriately - placed termination codons in transcripts and degradation of the faulty rna. as some nmd may occur in human nuclei, and as a translating ribosome is the only known mechanism able to detect stop codons, this points to some nuclear ribosomal activity. (however, contrary findings indicate that nmd is predominantly cytoplasmic in yeast and mammals.) thus, when hela cells are permeabilized and allowed to extend nascent peptides by ~15 residues in the presence of a translational precursor like biotin - lys - trna (and triphosphates required for transcription), ~10% of the label in newly - made protein is nuclear ; this signal is reduced by incubation with transcriptional inhibitors, which suggests that some translation is biochemically coupled to transcription. more recently, cells were pulsed for 5 min with puromycin (a structural mimic of aminoacyl - trna), permeabilized, and fixed ; puromycin is incorporated by ribosomes into c - termini of nascent peptides, and it was then immuno - localized using an anti - puromycin antibody. however, in both cases cells were permeabilized, and so critics can say cytoplasmic ribosomes were now able to enter nuclei to give rise to artifactual signals. and although initiation factors, ribosomal proteins, and 80s ribosomes are all found in the nucleoplasm close to transcription sites, this might be expected : ribosomes are made in nucleoli and have to be exported through the nucleoplasm to get to the cytoplasm. we can then summarize this digression as follows : since introns were discovered, the overwhelming consensus has been that all translation occurs in the cytoplasm. baboo. revisited the question whether there was any nuclear translation using intact cells, and pulses too short to allow peptides made by cytoplasmic ribosomes to enter nuclei during the pulse. azido - homoalanine (aha) is a met analog that possesses a reactive azide group, and aha - containing peptides can be localized after clicking hela cells (or primary diploid human cells) were fed aha for periods as short as 5 s (during which a ribosome in a living cell polymerizes ~25 residues, or ~one - sixteenth the length of a typical protein). results obtained using a 2 min aha pulse are illustrated in figure 2, and they are astonishing in two respects. first, there is clear nuclear signal which appears brighter than the cytoplasmic one, although integration over the larger cytoplasmic area shows nuclei contain slightly less than half of all signals. signals are reduced by pretreatment with translational inhibitors (so ribosomes are involved), and increased by pretreatment with a proteasomal inhibitor (so label is in protein). second, signals in both compartments disappear during chases with half - lives of less than a minute, so that almost none remains after 5 min. figure 2. hela cells were starved of met for 15 min to deplete pools, pulsed for 2 min 2 mm aha, and chased (05 min ; 0.2 mm met without aha). after fixation and clicking on alexa 555, dna was counterstained with dapi, images collected using a wide - field microscope, and fluorescence intensities of alexa 555 (sd) seen during the chase in the cytoplasm and nucleus normalized relative to values at 0 min. (b) after a 2 min aha pulse, nuclei appear the brightest ; however, integration over the larger area of the cytoplasm indicates that this compartment contains slightly more signal. (c) if the 2 min pulse is followed by a 5 min chase, essentially no signal is seen. (d) alexa 555 fluorescence in both nucleus and cytoplasm declines rapidly during a chase. from baboo. essentially similar results are obtained using two structurally - unrelated precursors puromycin (immunolocalized as above) and heavy amino acids. in the latter case, amino acids were tagged with n (or c), and distributions of incorporated n (or c) were mapped using a mass spectrometer attached to a microscope an approach called nanosims (high - resolution secondary - ion mass spectrometry). in a variant experiment, hela cells were incubated for 2 min in both [c]amino acids and [n]amino acids ; then, (cn) ions derived from both nucleus and cytoplasm could be detected. signals were again sensitive to ribosomal inhibitors, and decayed with half - lives of < 1 min. this is consistent with the coupling by a ribosome of two different amino acids into one peptide bond, followed by the rapid destruction of that bond. the answer is simple : we should only expect to detect it using a pulse that is roughly the length of the half - life, and such short pulses have not been used previously. how can these results be reconciled with the known ~20 h half - life of the mature proteome ? once we remember that this half - life was measured using pulses lasting days, the answer is again simple. just as only a tiny fraction of label incorporated during a short pulse is found in the one stable transcript in figure 1, a 5 s or 2 min pulse should not be expected to label much of the mature proteome if a substantial amount of abortive translation and rapid turnover occurs. but we should expect more labels to be incorporated into that mature proteome using longer pulses, and it is. thus, if the experiment in figure 2c is repeated using 10 min and 1 h pulses, progressively more signals survive the 5 min chase. finally, making a peptide is energetically costly, so how can the system support such waste ? again the answer is simple : the cost must be marginal, as it is for transcription. the extraordinary turnover is simply explained if the efficiency of translation is like that of transcription. just as the polymerization of one full - length transcript is associated with an unproductive turnover of many shorter ones (fig. 1), we suggest that the polymerization of each full - length peptide is regulated by the synthesis of many shorter peptides that are rapidly degraded. we envisage the scale of the peptide abortion has been underestimated, with perhaps only one in 20 initiated ribosomes translating all the way to a termination codon to generate a product that will contribute to the mature proteome. we speculate that most recently - initiated ribosomes abort close to the beginning of uorfs, sorfs, and orfs because they fail to escape (like an rna polymerase) into a structure that allows stable elongation (fig. 3) ; then, the resulting short peptides (combined with those made by translating to ends of many uorfs and sorfs) are degraded rapidly. figure 3. a model illustrating how dark - matter peptides (green lines i - iii) and the mature proteome (iv) might arise. most initiated ribosomes terminate prematurely (giving i and iii), and some translate to the end of the uorf (giving ii) ; the resulting peptides are rapidly degraded (half - life < 1 min), to give rise to the astonishing turnover seen using short pulses. a minority of ribosomes translates the whole orf (giving iv) ; such peptides are the ones detected conventionally using long pulses (they are generally stable and contribute to the mature proteome). from baboo this dark - matter world of aborting peptides has been hidden from our view for reasons much like those that had obscured dark - matter rna. (1) as illustrated in figure 1, such a fraction can only be detected using a pulse time roughly the order of the half - life, and then so little label is incorporated that biochemical detection is challenging. (2) translation was traditionally monitored by incubation in radioactive amino acids, followed by protein precipitation with trichloroacetic acid and scintillation counting ; however di- and/or tri - peptides (and probably longer ones too) are not precipitated and so were missed using this traditional approach. short peptides are retained during the fixation used for microscopy, compared with the traditional acid extraction.) (3) short peptides are also missed during gel electrophoresis ; those with < 100 residues run together in most gels at the front, and those with < 10 remain unresolved even in dedicated gels. in both cases, they are difficult to detect because they bind proportionally less of any stain, and/or pass through membranes without binding during blotting. (4) if shorter than ~12 residues, they become indistinguishable from the background produced by proteasomes. (5) by analogy with a polymerase, a recently - initiated ribosome may bind less tightly to its mrna than one that has translated further and so might be more likely to detach. this could explain why ribosome profiling uncovers only a small peak of bound ribosomes near initiation codons (as unstable ones detach), and why translation inhibitors increase the area of this peak by freezing unstable ones on the message. (6) most peptides with < 6 peptides can not be mapped uniquely within the human proteome by mass spectrometry, and so are missed using current approaches. the abortive synthesis and turnover probably play additional important roles including : (1) a nuclear ribosome might proofread a pre - mrna as it is being made to see if it has been spliced appropriately (and so does not contain premature termination codons). then, the faulty rna and truncated peptide produced as a by - product would be degraded (it was stated earlier that the discovery of introns killed the idea that translation might occur in nuclei because ribosomes must be prevented from translating intron - containing transcripts ; however, a nuclear ribosome would not see a termination codon in an intron if that ribosome was so placed it could only act on the transcript once splicing had occurred.) (2) if such nuclear proofreading of mrnas is error - prone, perhaps the system has a second go with a cytoplasmic ribosome at detecting a mis - spliced transcript once that transcript reaches the cytoplasm (with consequential degradation of truncated peptides produced as by - products). (3) some mechanism must also exist to weed out the many non - coding transcripts like the anti - sense promoter transcripts (which are immediately degraded) from the few sense ones that go on to contribute to the stable transcriptome. again, ribosomes acting co - transcriptionally as part of the nmd machinery could sense the difference between the two (as non - coding transcripts probably contain many stop codons). (4) many more proteins than hitherto expected may misfold during synthesis, to be degraded immediately. (5) in the special case of antigen - presenting cells, some newly - made peptides may be processed rapidly, and the resulting fragments used in the defense against infection. in all these cases whether it be nuclear ribosomes that specialize in proofreading newly - made transcripts, or cytoplasmic ones dedicated to mass - production the result is the same : inefficient translation, abortive production, and rapid degradation of resulting peptides. the discovery of any new world always raises many questions. for example, how many different fractions of short peptides are there in a cell, how quickly does each one turn over, and what are the associated energy costs ? critically, we also need to establish what roles the peptides in each fraction might play, and what additional effects the turnover might have. thus, fluorescent tagging of proteins and super - resolution microscopy allow us to monitor interactions in living cells in ever - sharper detail. moreover, we can use new bioinformatic pipelines to identify sorfs, ribosome profiling to see if they are translated, and however, we have seen that many challenges remain, especially in detecting and mapping short peptides. and like their counterparts in the rna world	astrophysicists use the term dark matter to describe the majority of the matter and/or energy in the universe that is hidden from view, and biologists now apply it to the new families of rna they are uncovering. we review evidence for an analogous hidden world containing peptides. the critical experiments involved pulse - labeling human cells with tagged amino acids for periods as short as five seconds. results are extraordinary in two respects : both nucleus and cytoplasm become labeled, and most signals disappear with a half - life of less than one minute. just as the synthesis of each mature mrna is regulated by the abortive production of hundreds of shorter transcripts that are quickly degraded, it seems that the synthesis of each full - length protein in the stable proteome is regulated by an apparently wasteful production and degradation of shorter peptides. some of the nuclear synthesis is probably a byproduct of nuclear ribosomes proofreading newly - made rna for inappropriately - placed termination codons (a process that triggers nonsense - mediated decay). we speculate that some dark - matter peptides will play other important roles in the cell.
the 2,5-oligoadenylate (2 - 5a) synthetase (oas)/rnase l system is a uniquely regulated innate immune pathway that restricts viral infections (reviewed in reference 1). the interferon (ifn) inducible oas family of proteins include pathogen recognition receptors for viral double - stranded rna (dsrna) that synthesize 2 - 5a from atp. in mice, the enzymatically active species of oas include oas1a, oas2, and oas3 (reviewed in reference 2). 2 - 5a binds with high affinity and specificity to the latent cytoplasmic endoribonuclease, rnase l, causing its dimerization and activation (3). rnase l then cleaves both viral and cellular single - stranded regions of rna, predominantly at upu and upa dinucleotides (4), leading to inhibition of viral replication in vivo (5). the rnase l antiviral mechanism varies, depending on the types of rna molecules that are cleaved (reviewed in reference 1). if the rna substrate for rnase l is viral genomic single - stranded rna, even a single cleavage event per viral genome might prevent replication. cleavage of viral mrna is a mechanism that could potentially apply to rna and dna viruses with different replication strategies. in addition, degradation of cellular rna, including rrna in intact ribosomes, could damage host cell machinery required for protein synthesis (6, 7). also, rnase l restricts viral infections by causing apoptosis through an unknown mechanism involving jun n - terminal kinase (jnk) (5, 6, 8). rnase l activation results in autophagy in a pathway involving jnk and protein kinase r (pkr) that can either enhance or decrease viral replication (9, 10). finally, rnase l indirectly controls viral infections by enhancing viral induction of ifn- induction in some cell types and in animals (11). rnase l amplifies ifn- induction by producing small rna cleavage products from cellular or viral rna that interact with rig - i and mda5 (11, 12). accordingly, rnasel mice produce less ifn-, as measured in serum, after infection with encephalomyocarditis virus (emcv) (intraperitoneally) or sendai virus (intranasally) than do wild - type (wt) mice (11). the small rna cleavage products produced by rnase l that enhance ifn- production can be either cellular (self) or viral (nonself) and typically have some double - strand regions, a 5-hydroxyl, and a phosphate at the 2,3-cyclic terminus (11, 12). previously we showed in human hepatoma huh7 cells that rnase l released a small rna product from the ns5b region of hepatitis c virus (hcv) genomic rna that bound to rig - i, causing displacement of its repressor domain, stimulating its atpase function, and propagating signaling through the mitochondrial antiviral signaling protein (mavs) to the ifn- gene (12). the small rna from hcv rna was also shown to induce a hepatic innate immune response when injected into mice. similarly, an mrna of parainfluenza virus 5 activated type i ifn production, independently of the encoded protein, by a pathway involving rnase l and mda5 (13). also rnase l was shown to be a factor in type i ifn induction in response to herpes simplex virus 2 infection (14). recently, we reported large differences (up to 100-fold) in basal expression of different oas isoforms between different types of primary mouse cells (15). notably, bone marrow - derived macrophages (bmms), as well as primary microglia, brain resident macrophages, expressed the highest levels of different oas isoforms compared with several other primary cell types. in a separate study, peritoneal macrophages (p - macs) in addition, we previously compared basal levels of rnase l in 9 rodent and 11 human cell lines (17). the mouse and human macrophage - like cell lines raw264.7 and u937, respectively, were among the cell lines expressing the highest levels of rnase l protein. in the same study, different mouse fibroblast cell lines (nih 3t3, svt2, and l929) were shown to express relatively low levels of rnase l protein. however, the effect of rnase l on ifn induction might vary, depending on where the ifn is measured, the subtype of ifn being measured, the type of virus and its route of infection, and the type of cells that are infected. here we have investigated the last of these variables, namely cell - type - specific effects of rnase l on ifn induction. levels of mrnas for rnasel and different oas genes were monitored by quantitative reverse transcription - pcr (qrt - pcr) in mef cell lines, bmms, peritoneal macrophages (p - macs), and freshly isolated splenic macrophages (fig. compared to mefs, bmms had elevated levels of mrnas for rnasel (200-fold), oas1a (9-fold), oas2 (34-fold), oas3 (7-fold), and oasl1 (32-fold) (fig. oas1a, oas2, and oas3 encode oas isoforms that are enzymatically active, whereas oasl1 encodes a protein that lacks the ability to synthesize 2 - 5a and is a negative regulator of type i ifn synthesis (18). similarly, compared to mefs, p - macs had increased levels of mrnas for rnasel (260-fold), oas1a (7-fold), oas2 (19-fold), oas3 (3-fold), and oasl1 (8-fold). to control for possible activation of macrophages in vitro, splenic macrophages were isolated by fluorescence - activated cell sorter (facs) and immediately processed for rna isolation followed by qrt - pcr. splenic macrophages also had increased basal levels of mrnas for rnasel (142-fold), oas1a (4.6-fold), oas2 (2.2-fold), and oas3 (3.5-fold) ; however, oasl1 mrna levels were unchanged. these findings show enhanced basal mrna expression of rnasel and most enzymatically active isoforms of oas in macrophages compared with mefs. western blot assays were done to monitor differences in rnase l protein levels. whereas rnase l was observed in wild - type bmms, p - macs, and splenic macrophages, however, in wt mefs, low levels of rnasel mrna were detected by qrt - pcr, and low levels of rnase l protein were apparent by monitoring characteristic, discrete rrna cleavage products during poly(ri):poly(rc) (pic) transfection or encephalomyocarditis virus (emcv) infection (fig. the rrna fragments were, however, produced at much higher levels in p - macs and bmms than in mefs (fig. consistent with our prior results (11), 2 - 5a transfection induced ifn- in wt mefs but not in rnasel mefs, as determined by enzyme - linked immunosorbent assay (elisa) (fig. in contrast, 2 - 5a transfection failed to induce ifn- in either wt or rnasel bmms (fig. we verified uptake of 2 - 5a and activation of rnase l in bmms with rrna cleavage assays (data not shown). basal levels of oas and rnase l regulate induction of ifn- by virus or pic. (a) basal levels of rnasel and oas1a, oas2, oas3, and oasl1 mrnas were determined by qrt - pcr with total rna isolated with mirvana rna kits (lifetechnology) with oas primers described previously (15) and with rnasel forward primer : 5 taggcgaacacatcaatgagga 3 and reverse primer 5 ctgcctctggaacgctgag 3. rna expression relative to gapdh (glyceraldehyde-3-phosphate dehydrogenase) mrna was expressed as 2, where ct represents the threshold cycle (ct) of the gene of interest the ct of gapdh. the data are shown as the means standard deviation (sd) calculated from a minimum of 3 (up to 6) biological replicates. mefs immortalized with simian virus 40 (sv40) t antigen were cultured in rpmi 1640 with 10% fetal bovine serum (fbs) (5). isolation and culture conditions for bmms and thioglycolate - elicited p - macs were as described previously (24, 25). splenic macrophages were isolated by facs with fluorescein isothiocyanate (fitc)-conjugated rat anti - mouse cd11b igg2b (bd pharmingen ; catalog no. 557396, clone m1/70) and allophycocyanin - conjugated rat anti - mouse f4/80 igg2b (bio - rad / abd serotec ; product code mca497apc) as described previously (25). (b) western blots of the different cell - type extracts were performed with rabbit polyclonal antibody against murine rnase l (b. k. jha, b. dong, and r. h. silverman, unpublished data) and antibody to -actin (sigma - aldrich). (c) cells were either infected with emcv (a gift from ian m. kerr, london, united kingdom) (moi of 0.1) for 16 h or were lipofectamine 2000 (life technologies) transfected with pic (sigma - aldrich) at 2 g / ml for 6 h. total rna was isolated with trizol (life technologies), and rrna degradation was monitored in rna chips with an agilent 2100 bioanalyzer. (d) transfections of (2-5) p3a3 (10 m) with lipofectamine 2000 (life technologies) and mock transfections were done for 18 h. ifn- levels in the cell supernatant were determined by elisa (pbl assay science). the lower limit of detection of ifn- in the elisa was about 15 pg / ml (dashed line). (e and f) ifn- concentrations were measured by elisa from media of cells (e) transfected with pic (at the indicated concentrations) for 8 h or mock transfected or (f) infected with emcv (moi of 1 or 2) for 16 h. values are means from biological triplicate assays sd. (g) emcv yields following infection (moi of 0.1) at 8 h postinfection determined from the culture supernatant by plaque assay on ifnar mef indicator cells as described previously (5). two - tailed t tests were done., p < 0.001 ;, p < 0.05. to determine effects of rnase l on ifn- induction by dsrna similar to our prior study (11), rnase l enhanced ifn- induction to a much greater extent in wt mefs than in rnasel mefs (fig. remarkably, however, the effect of rnase l on ifn induction was reversed in both bmms and p - macs. ifn- accumulated to higher levels in rnasel bmms (6.5-fold) and p - macs (4.5-fold) than in wt p - macs and bmms (in response to 2 g per ml of pic) (fig., however, there was no effect of rnase l deletion on pic induction of ifn- in bmms and p - macs, suggesting that toll - like receptor 3 (tlr3)-mediated induction of ifn was unaffected by rnase l (19) (data not shown). to extend these studies to viral induction of ifn- viral infection induced ifn- in wt mefs but not in rnasel mefs (fig. again, there was a reversal of the effect of rnase l on ifn- induction in the myeloid cell types. deletion of rnase l increased ifn- production in response to emcv infection by about 2-fold in p - macs and bmms (fig. 1f). to determine if the differences in viral induction of ifn- were related to the antiviral effect of rnase l, after one cycle of virus growth (8 h at a multiplicity of infection [moi ] of 0.1), viral yields were measured by plaque assays on type i ifn receptor (ifnar) mef indicator cells. viral yields were increased 85-, 8-, and 5-fold in rnasel mefs, p - macs, and bmms, respectively, compared to the corresponding wt cells (fig. therefore, rnase l deficiency resulted in higher viral yields in mefs than in p - macs and bmms. these results are consistent with the observation that rnase l gene knockout increased ifn- production in p - macs and bmms but decreased ifn- production in mefs. in the rnasel mefs, the decrease in ifn- production in combination with a loss of nuclease activity likely combined to cause an increase in emcv titers. in rnasel bmms, the absence of nuclease activity normally provided by rnase l overrides the increase in ifn levels, allowing virus to replicate to higher titers in rnasel than in wt macrophages. apoptosis is known to occur in cells that sustain high levels of rna damage due to rnase l activity (5, 6, 8). therefore, cell viability and apoptosis were monitored in cell types expressing low and high basal levels of oas and rnase l. there was no effect on cell viability of pic transfection in wt mefs or rnasel mefs as determined by 3-(4,5-dimethyl-2-thiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2h - tetrazolium (mts) colorimetric assays (fig. in contrast, pic transfection reduced viability of wt p - macs or bmms by ~2-fold, whereas pic transfection had no effect on viability of rnasel p - macs or bmms. similarly, no apoptosis was detected in pic - transfected wt or rnasel mefs as determined by lack of caspase 3/7 activation (fig. however, caspase activation assays showed that pic transfection induced apoptosis of wt p - macs and bmms, but not in rnasel p - macs and bmms (fig. these results were confirmed by monitoring poly(adp - ribose) polymerase (parp) cleavage in western blots (fig. cleaved parp was observed after pic transfection of wt bmms and p - macs but not in identically treated wt mefs. however, while emcv reduced viability of wt bmms by about 2.5-fold, a smaller (1.2-fold) reduction of viability was observed in emcv - infected rnasel bmms (fig. emcv appears to have caused necrotic death of mefs, as there was no measurable apoptosis as determined by lack of caspase 3/7 activity (fig. in contrast, emcv infection caused apoptosis of wt bmms but not of rnasel bmms, as determined by caspase 3/7 activity assays (fig. in addition, parp cleavage assays showed viral induction of apoptosis in wt bmms and wt p - macs but not in wt mefs (fig. these findings show that rnase l contributes to apoptosis of bmms and p - macs in response to either pic transfection or emcv infection. however, low levels of oas isoforms and rnase l in wt mefs are insufficient to induce apoptosis in response to either pic transfection or emcv infection. (a) cells were transfected with pic (2 g / ml) for 12 h. cell viability was quantified by mts colorimetric assays (promega). (b) caspase 3/7 activation was determined with an apo - one homogeneous caspase 3/7 kit (promega) after pic transfection (2 ng to 2 g / ml for 8 h). (c) western blots with antibody to uncleaved parp and cleaved parp (cparp) (cell signaling ; catalog no. 9542) or to -actin (sigma - aldrich) from cells transfected with pic (2 g per ml) for 12 h. (d) cells were infected with emcv (moi of 1.0) for 24 h, and cell viability was measured by mts assays. (e) activation kinetics for caspase 3/7 activity during emcv infection (moi of 1.0) at the indicated times postinfection. results are means sd of three biological replicates., p < 0.0001 ;, p < 0.05 ; ns, not significant. (f) parp cleavage in response to emcv infections at an moi of 1.0 for 8 h as determined in western blots. our results show that, paradoxically, rnase l can either enhance or reduce ifn- induction by viral infection, depending on basal levels of 2 - 5a pathway enzymes oas and rnase l. rnase l generates small rna molecules from either self (cellular) or nonself (viral) rna that activate the rig - i or mda5/mavs / tbk / irf3 axis that drives transcription of the ifn- gene (11, 12). however, this phenomenon occurs only in cell types, such as mefs, that have relatively low basal levels of oas isoforms and rnase l. in cell types, such as macrophages, that have high basal levels of oas (15) and rnase l (fig. 1a), there is a different outcome reduced rather than increased production of ifn- following viral infection. rnase l is known to cleave both viral and cellular rna molecules, including both mrna and rrna in intact ribosomes (7, 20). the damage to cellular rna by rnase l, resulting in inhibition of protein synthesis (6, 21) and apoptosis (5, 6, 8), is the likely cause of reduced ifn synthesis in macrophages. the rnase l - mediated suppression of ifn production in macrophages occurs despite high expression of the ifn - stimulated gene products rig - i and mda5 (15) that function in signaling to the ifn- gene. furthermore, mda5 expression as determined by qrt - pcr was 35-fold higher in bmms than in mefs (data not shown). we previously reported that induction of ifn- in response to 2 - 5a transfection was partially reduced in mda5 or rig - i mefs compared with wt mefs (11). these findings highlight the robustness of rnase l activity in myeloid cells that results in the degradation of mrna and rrna, thereby reducing ifn induction despite high levels of mda5, a protein that senses both pic and emcv (22). we propose that viral infections of cell types that mediate tissue integrity (such as fibroblasts) produce higher levels of type i ifns as a result of rnase l and the small rnas that it generates. the amplification of ifn production contributes to tissue protection (11). in virus - infected macrophages, high basal levels of oas and rnase l result in lower levels of type however, despite different patterns of the type i ifn response, both mefs and macrophages contribute to host survival. in a prior study, using the murine coronavirus mouse model, we found that rnase l activity in liver sinusoidal resident macrophages, kupffer cells, seems to prevent spread of the virus into the liver parenchyma and the consequent development of hepatitis (23). in this manner,	abstractthe interferon (ifn)-inducible antiviral state is mediated in part by the 2,5-oligoadenylate (2 - 5a) synthetase (oas)/rnase l system. 2 - 5a, produced from atp by oas proteins in response to viral double - stranded rna, binds to and activates rnase l. rnase l restricts viral infections by degrading viral and cellular rna, inducing autophagy and apoptosis, and producing rna degradation products that amplify production of type i interferons (ifns) through rig - i - like receptors. however, the effects of the oas / rnase l pathway on ifn induction in different cell types that vary in basal levels of these proteins have not been previously reported. here we report higher basal expression of both rnase l and oas in mouse macrophages in comparison to mouse embryonic fibroblasts (mefs). in mefs, rnase l gene knockout decreased induction of ifn- by encephalomyocarditis virus infection or poly(ri):poly(rc) (pic) transfection. in contrast, in macrophages, rnase l deletion increased (rather than decreased) induction of ifn- by virus or pic. rna damage from rnase l in virus - infected macrophages is likely responsible for reducing ifn- production. similarly, direct activation of rnase l by transfection with 2 - 5a induced ifn- in mefs but not in macrophages. also, viral infection or pic transfection caused rnase l - dependent apoptosis of macrophages but not of mefs. our results suggest that cell - type - specific differences in basal levels of oas and rnase l are determinants of ifn- induction that could affect tissue protection and survival during viral infections.
markov modeling is frequently used to estimate the costs and consequences of two or more interventions for a specific condition.1 in these models, the consequence of each treatment is often estimated in terms of quality - adjusted life - years (qalys). in order to calculate the qalys accrued, the life years are weighted by the quality of life, also referred to as the utility. in the uk, utility estimates should preferably be obtained by valuing the answers of the generic euroqol-5 dimension (eq-5d) questionnaire using the uk value set.2 however, analysts may be unable to obtain eq-5d utilities valued by the national value set and therefore be forced to use foreign eq-5d utilities.3 furthermore, evidence shows that foreign utilities of the eq-5d-3l are not transferable to another country because of differences in living standards, health care system performance, and cultural differences between countries. cross - country differences are due to a mixture of differences in : 1) how people in each country report problems along the five dimensions,4 2) how different populations value these problems,5 and 3) how the value sets are elicited and modeled.6 thus, the choice of value set will consequently influence the cost - effectiveness results.5,715 therefore, analysts are advised to adjust foreign utilities of the eq-5d, before applying them in an economic evaluation conducted from a national perspective.7 in a worst - case scenario, application of unadjusted utilities may lead to biased cost - effectiveness results and wrong decision - making. although adjustment of foreign utilities is advised, no such method has been developed. the present study aimed to develop a method for adjusting mean utilities of the 3 level version of the eq-5d (eq-5d-3l) to increase their transferability from one country to another. if foreign mean utilities of the eq-5d-3l identified through a literature review could be adjusted to increase their transferability, more utility data could be considered relevant and pooled. this would improve precision in the estimated mean utility and hence improve accuracy and precision of the corresponding cost - effectiveness result.3 the study investigated if it was possible to develop a simple mathematical model, ie, a simple equation, which could be used to adjust a foreign mean utility, valued by either the dutch, german, or spanish value sets, to make it reflect uk preferences for health. if a dutch, german, and spanish mean utilities could be adjusted to reflect uk preference for health, it would increase the foreign utilities transferability to a uk setting. although four value sets from specific countries are used to develop a method for adjusting mean utilities to increase their transferability from one country to another, the countries merely serve as an example. the method could have been developed using the value sets from any country. seven datasets containing eq-5d-3l answers were used to develop methods for adjusting foreign utilities to increase their transferability. the eq-5d-3l answers in each dataset were then valued using four different time trade - off value sets. as such, four mean utilities were obtained from each dataset using the value sets from : the uk,16 the netherlands,17 germany,18 and spain.10 this allowed for three pairwise comparisons of : 1) uk mean values vs dutch mean values ; 2) uk mean values vs german mean values ; and 3) uk mean values vs spanish mean values. for each of these three comparisons, a regression model was fitted using the mean uk utilities as the dependent variable and the other country s mean utilities as the independent variable. the coefficient from these three regression models enabled to adjust : 1) spanish mean utilities to uk mean utilities ; 2) german mean utilities to uk mean utilities ; and 3) dutch mean utilities to uk mean utilities. to investigate the performance of the method for adjusting mean utilities from one country to another, the method was validated on an external dataset.9 the four value sets were chosen to illustrate that utilities can be adjusted to increase their transferability for two reasons. a previously published study applied the same four value sets to their eq-5d-3l responses in a study of acute cough / lower respiratory tract infections at five time - points.9 these five mean utilities for each of the four value sets could be used as an external dataset in which the three equations for adjusting mean utilities could be validated. the second is that the choice enabled the assessment of whether adjustment increases transferability when value sets are comparable (figure 1a ; the spanish and the uk value set), and whether adjustment is feasible when the value sets differ at both high and low values (figure 1b ; the german and the uk value set), and if adjustment is feasible when high values are comparable between value sets but low values are not (figure 1c ; the dutch and the uk value set). seven datasets containing eq-5d-3l answers from six studies were used to generate an estimation dataset containing seven mean utility values from each of the four countries.1924 the studies included a trial which included patients with human immunodeficiency virus,20 a representative sample of the adult population in the north denmark region,23 a trial comparing case - management to current treatment for patients suffering from chronic obstructive pulmonary disease,24 a trial comparing a telehealthcare intervention to current treatment for chronic obstructive pulmonary disease patients,21 a mapping study within cardiovascular disease,19 and a trial investigating allergy patients quality of life on days with and without symptoms, hereby providing two mean values for the estimation dataset.22 from each of these studies, descriptive tables of frequencies of observed eq-5d-3l health states were kept and this made it possible to attach the uk value set and the three foreign value sets to the same data. hereby, seven mean utility values were obtained from each of the four value sets10,1618 (table 1). three regression models were estimated using the uk mean utility as the dependent variable and either the dutch, the german, or the spanish mean utility as the independent variable. this was done to predict : 1) uk mean utility values from dutch mean utilities ; 2) uk mean utility values from german mean utilities ; and 3) uk mean utility values from spanish mean utilities. it was deliberately chosen to restrict the functional form for the regression to simple linear regression. in many valuation studies, an n3 term is included to capture the known interaction effect. although the interaction effects must be tended to in valuation studies, it is not self - evident that there are any such relationships between mean utilities from two countries. the relationship may be a simple linear relationship. parsimonious models were therefore chosen as the aim of the present study to show that methods for adjusting mean utilities can be developed. formally, the regression model for predicting a mean uk utility value from a dutch mean utility value could be written as utilityjuk=0+1utilityjnlwhere the index j identifies the dataset (j=1, 2, n), utilityj and utilityj are the mean utilities of the eq-5d-3l valued by the uk and the dutch value set, respectively. the coefficient 0 is the expected mean uk utility when the mean dutch utility equals zero. the coefficient 1 is the marginal increase in the mean uk utility at increasing values of mean dutch utility. it was chosen to present the root mean squared error, the mean absolute error, and the r - squared for each of the regression models for descriptive purposes. all regression models were generated in stata version 13.1 (statacorp lp, college station, tx, usa). in a study involving 1,327 patients with acute cough / lower respiratory tract infection, eq-5d-3l data were collected in the netherlands, germany, spain, and four other countries at five time - points. the eq-5d-3l data from the netherlands, germany, and spain were valued both with the country s value set and the uk value set (table 2). these results were used to assess the performance of the three equations on external data. the first was drawn to compare the agreement between the observed foreign mean utilities and the observed uk mean utilities. the second was drawn to compare the agreement between the adjusted foreign mean utilities and the observed uk mean utilities. using these pairwise plots, it was possible to assess if there was better agreement between the observed mean uk utility and the adjusted foreign mean utility than there was between the observed mean uk utility and the observed foreign mean utility. the study investigated if it was possible to develop a simple mathematical model, ie, a simple equation, which could be used to adjust a foreign mean utility, valued by either the dutch, german, or spanish value sets, to make it reflect uk preferences for health. if a dutch, german, and spanish mean utilities could be adjusted to reflect uk preference for health, it would increase the foreign utilities transferability to a uk setting. although four value sets from specific countries are used to develop a method for adjusting mean utilities to increase their transferability from one country to another, the countries merely serve as an example. the method could have been developed using the value sets from any country. seven datasets containing eq-5d-3l answers were used to develop methods for adjusting foreign utilities to increase their transferability. the eq-5d-3l answers in each dataset were then valued using four different time trade - off value sets. as such, four mean utilities were obtained from each dataset using the value sets from : the uk,16 the netherlands,17 germany,18 and spain.10 this allowed for three pairwise comparisons of : 1) uk mean values vs dutch mean values ; 2) uk mean values vs german mean values ; and 3) uk mean values vs spanish mean values. for each of these three comparisons, a regression model was fitted using the mean uk utilities as the dependent variable and the other country s mean utilities as the independent variable. the coefficient from these three regression models enabled to adjust : 1) spanish mean utilities to uk mean utilities ; 2) german mean utilities to uk mean utilities ; and 3) dutch mean utilities to uk mean utilities. to investigate the performance of the method for adjusting mean utilities from one country to another, the four value sets were chosen to illustrate that utilities can be adjusted to increase their transferability for two reasons. a previously published study applied the same four value sets to their eq-5d-3l responses in a study of acute cough / lower respiratory tract infections at five time - points.9 these five mean utilities for each of the four value sets could be used as an external dataset in which the three equations for adjusting mean utilities could be validated. the second is that the choice enabled the assessment of whether adjustment increases transferability when value sets are comparable (figure 1a ; the spanish and the uk value set), and whether adjustment is feasible when the value sets differ at both high and low values (figure 1b ; the german and the uk value set), and if adjustment is feasible when high values are comparable between value sets but low values are not (figure 1c ; the dutch and the uk value set). seven datasets containing eq-5d-3l answers from six studies were used to generate an estimation dataset containing seven mean utility values from each of the four countries.1924 the studies included a trial which included patients with human immunodeficiency virus,20 a representative sample of the adult population in the north denmark region,23 a trial comparing case - management to current treatment for patients suffering from chronic obstructive pulmonary disease,24 a trial comparing a telehealthcare intervention to current treatment for chronic obstructive pulmonary disease patients,21 a mapping study within cardiovascular disease,19 and a trial investigating allergy patients quality of life on days with and without symptoms, hereby providing two mean values for the estimation dataset.22 from each of these studies, descriptive tables of frequencies of observed eq-5d-3l health states were kept and this made it possible to attach the uk value set and the three foreign value sets to the same data. hereby, seven mean utility values were obtained from each of the four value sets10,1618 (table 1). three regression models were estimated using the uk mean utility as the dependent variable and either the dutch, the german, or the spanish mean utility as the independent variable. this was done to predict : 1) uk mean utility values from dutch mean utilities ; 2) uk mean utility values from german mean utilities ; and 3) uk mean utility values from spanish mean utilities. it was deliberately chosen to restrict the functional form for the regression to simple linear regression. in many valuation studies, an n3 term is included to capture the known interaction effect. although the interaction effects must be tended to in valuation studies, it is not self - evident that there are any such relationships between mean utilities from two countries. the relationship may be a simple linear relationship. parsimonious models were therefore chosen as the aim of the present study to show that methods for adjusting mean utilities can be developed. formally, the regression model for predicting a mean uk utility value from a dutch mean utility value could be written as utilityjuk=0+1utilityjnlwhere the index j identifies the dataset (j=1, 2, n), utilityj and utilityj are the mean utilities of the eq-5d-3l valued by the uk and the dutch value set, respectively. the coefficient 0 is the expected mean uk utility when the mean dutch utility equals zero. the coefficient 1 is the marginal increase in the mean uk utility at increasing values of mean dutch utility. it was chosen to present the root mean squared error, the mean absolute error, and the r - squared for each of the regression models for descriptive purposes. all regression models were generated in stata version 13.1 (statacorp lp, college station, tx, usa). in a study involving 1,327 patients with acute cough / lower respiratory tract infection, eq-5d-3l data were collected in the netherlands, germany, spain, and four other countries at five time - points. the eq-5d-3l data from the netherlands, germany, and spain were valued both with the country s value set and the uk value set (table 2). these results were used to assess the performance of the three equations on external data. the first was drawn to compare the agreement between the observed foreign mean utilities and the observed uk mean utilities. the second was drawn to compare the agreement between the adjusted foreign mean utilities and the observed uk mean utilities. using these pairwise plots, it was possible to assess if there was better agreement between the observed mean uk utility and the adjusted foreign mean utility than there was between the observed mean uk utility and the observed foreign mean utility. three regression models were estimated to obtain three equations for adjusting mean utilities and the results are summarized in table 3. in general, the foreign mean utility values were highly correlated to the mean uk utility values. the coefficients of the model predicting mean uk utility from the mean spanish utility had a 0 close to 0.0 and a 1 close to 1.0. as such, the mean spanish utilities were not systematically different from the mean uk utilities. both the dutch and the german mean utility were systematically higher than the mean uk utilities as the 0 in their regressions were below zero and the 1 in was above 1.0. altman plots drawn to assess the equations ability to adjust foreign mean utilities to make the values more transferable and thereby applicable in economic evaluation performed from a uk perspective. when comparing the agreement between the observed mean uk utilities and the adjusted mean dutch utilities, figure 2a, to the agreement between the observed mean uk utilities and the observed mean dutch utilities, figure 2b, it is seen that agreement was better when using the equation to adjust the foreign utilities, ie, figure 2a. likewise, the adjusted mean german utilities were most comparable to the observed mean uk utilities. however, this was not the case for the mean spanish utilities. when applying the equation for adjusting mean spanish utilities of the eq5-d-3l, a slight systematic bias was induced. as such, the observed mean spanish utilities were directly transferable to the uk setting, whereas observed mean dutch and german utilities benefitted from being adjusted, using the respective regression models. three regression models were estimated to obtain three equations for adjusting mean utilities and the results are summarized in table 3. in general, the foreign mean utility values were highly correlated to the mean uk utility values. the coefficients of the model predicting mean uk utility from the mean spanish utility had a 0 close to 0.0 and a 1 close to 1.0. as such, the mean spanish utilities were not systematically different from the mean uk utilities. both the dutch and the german mean utility were systematically higher than the mean uk utilities as the 0 in their regressions were below zero and the 1 in was above 1.0. altman plots drawn to assess the equations ability to adjust foreign mean utilities to make the values more transferable and thereby applicable in economic evaluation performed from a uk perspective. when comparing the agreement between the observed mean uk utilities and the adjusted mean dutch utilities, figure 2a, to the agreement between the observed mean uk utilities and the observed mean dutch utilities, figure 2b, it is seen that agreement was better when using the equation to adjust the foreign utilities, ie, figure 2a. likewise, the adjusted mean german utilities were most comparable to the observed mean uk utilities. when applying the equation for adjusting mean spanish utilities of the eq5-d-3l, a slight systematic bias was induced. as such, the observed mean spanish utilities were directly transferable to the uk setting, whereas observed mean dutch and german utilities benefitted from being adjusted, using the respective regression models. it is known that international utility values can not blindly be transferred to a national setting as eq-5d-3l responses and value sets may differ for multiple reasons. as such, utility values from foreign studies this study developed a method for adjusting mean utilities to make them transferable from one country to another. the method presented does not handle potential differences in eq-5d-3l responses it merely predicts what the mean utility would have been if another value set had been used. in the present study, the case of adjusting utilities to uk preference for health was chosen. however, the principal could be applied to develop equations for adjusting utilities from any country to a particular country. our results showed that the equations for adjusting utilities were successful in adjusting the dutch and german utilities. this was evident as the adjusted dutch and german mean utilities were closer to the observed uk mean utilities than the observed dutch and german mean utilities were. as such, the adjustment of dutch and german mean utilities made them transferable to the uk setting. it is important to note that the equation for adjusting mean utilities from a particular country to make them transferable to the uk may also work the other way around be rearranging it slightly. the equation for adjusting dutch utilities to a uk setting can be rearranged to adjust uk utilities to a dutch setting : utilityuk=1.2030utilitynl0.1965utilitynl=(utilityuk+0.1965)/1.2030 as such, it is only necessary to generate a single good equation for adjusting mean utilities between two countries. it is not certain that a simple linear relationship as the one presented in this paper is suitable for the entire range of mean utility values and further attention should be directed at this in future research. likewise, this paper shows that foreign mean utilities may be adjusted to increase their transferability but it does not assess whether the error in the mean estimate, ie, the standard error, should also be adjusted. furthermore, our results suggested that mean utilities obtained by valuing eq-5d-3l answers using the spanish value set are comparable to mean utilities obtained by valuing eq-5d-3l answers using the uk value set. in other words, the spanish utilities did not need to be adjusted to be transferable to the uk setting because the two value sets are very sufficiently comparable. however, a more formal rule for when adjustment is needed needs to be developed. many countries guidelines for economic evaluation have taken a position toward the transferability of utilities between countries.11 it appears that more recent versions of guidelines pay an increasing attention to the issues with the transferability of utilities and are more restrictive in their acceptance of data from other countries. the implication of the method presented in this study is that mean utilities of the eq-5d-3l obtained from international studies could easily be adjusted to increase their transferability to a national setting. by making more utilities identified from a literature review relevant to a decision analytic model be adjusted, the means for use of foreign value sets could potentially mean that more data could be pooled, hereby improving precision and providing better information for decision - makers. failing to adjust mean utilities from international studies before using them in a national economic evaluation will lead to biased cost - effectiveness results, if there are country - specific differences in health perception. international pharmaco - economic guidelines take different standpoints on the transferability of utility values.11 two out of 27 guidelines consider utilities generalizable, three consider utilities transferable under extreme circumstances, three consider utilities transferable with adaptation, three do not consider utilities transferable, and the remaining 16 guidelines do not state an opinion on the matter.11 like the majority, the dutch, german, and spanish guidelines do not state whether utilities can be considered transferable, while the uk guidelines do not consider utilities as transferable. although the adjustment method presented in this paper is not sufficient to suggest that utilities should be considered transferable in pharmaco - economic guidelines, it can increase the transferability of utilities regardless of the local guideline s standpoint. the adjustment method presented in this study showed a promising ability to adjust a foreign mean utility, making the value transferable to the uk setting. the feasibility of developing such methods was strengthen by the validation of the method on external data which showed that the equations from the regression models were able to adjust the dutch and german mean utilities to make them reflect the mean which would have been obtained if the eq-5d-3l data had been valued with the uk value set. however, the appropriateness of foreign eq-5d-3l data in uk economic evaluations could be questioned. when an economic evaluation is informed by using eq-5d-3l data collected in a foreign country and applying the national value set to the data, an important, often implicit, assumption is made. the assumption is that the distribution of eq-5d-3l health states observed in particular severity of a given condition does not vary, ie, respondents in the two countries answer the eq-5d-3l in sufficiently similar ways. in order to apply the method presented in this study, the same assumption applies. this assumption might be somewhat problematic as culture, country of origin, and income may impact the respondent s answers to the eq-5d-3l.4 however, this assumption is often accepted by the national institute for health and care excellence (nice) in the uk as descriptive eq-5d data from multinational trials can be used to inform economic evaluations as long as the uk value set is applied. as such, the assumption that the distribution of eq-5d-3l health states observed in particular severity of a given condition does not vary between the countries and should not hinder the pragmatic analyst in adjusting foreign mean utility values to make them reflect national preferences for health. there are, however, several other issues which should be addressed before this novel method can become a routinely used method for adjusting foreign utilities. the method is limited by the sample size which, in this case, is the number of mean utility values. while the regression lines fitted to these seven observations showed a good correlation, the lack of data points limits the credibility of the method. in addition, the range of the values was narrow which in turn limits the range in which the method could be applied. however, the validation on external data proved that the equations for adjusting dutch and german mean utilities worked within the range where they were developed. more data would also enable the exploration of which functional form yields the best adjustments over a wider range of mean values. the present study did not include value sets which have been elicited using methods other than time trade - off. however, value sets elicited using other preference elicitation methods may also be used to calculate qalys and equations for adjusting foreign mean utilities valued by value sets that applied other preference elicitation methods could be estimated in the same manner as the equations shown in this paper. the adjustment method presented in this study showed a promising ability to adjust a foreign mean utility, making the value transferable to the uk setting. the feasibility of developing such methods was strengthen by the validation of the method on external data which showed that the equations from the regression models were able to adjust the dutch and german mean utilities to make them reflect the mean which would have been obtained if the eq-5d-3l data had been valued with the uk value set. however, the appropriateness of foreign eq-5d-3l data in uk economic evaluations could be questioned. when an economic evaluation is informed by using eq-5d-3l data collected in a foreign country and applying the national value set to the data, an important, often implicit, assumption is made. the assumption is that the distribution of eq-5d-3l health states observed in particular severity of a given condition does not vary, ie, respondents in the two countries answer the eq-5d-3l in sufficiently similar ways. in order to apply the method presented in this study, the same assumption applies. this assumption might be somewhat problematic as culture, country of origin, and income may impact the respondent s answers to the eq-5d-3l.4 however, this assumption is often accepted by the national institute for health and care excellence (nice) in the uk as descriptive eq-5d data from multinational trials can be used to inform economic evaluations as long as the uk value set is applied. as such, the assumption that the distribution of eq-5d-3l health states observed in particular severity of a given condition does not vary between the countries and should not hinder the pragmatic analyst in adjusting foreign mean utility values to make them reflect national preferences for health. there are, however, several other issues which should be addressed before this novel method can become a routinely used method for adjusting foreign utilities. the method is limited by the sample size which, in this case, is the number of mean utility values. while the regression lines fitted to these seven observations showed a good correlation, the lack of data points limits the credibility of the method. in addition, the range of the values was narrow which in turn limits the range in which the method could be applied. however, the validation on external data proved that the equations for adjusting dutch and german mean utilities worked within the range where they were developed. more data would also enable the exploration of which functional form yields the best adjustments over a wider range of mean values. the present study did not include value sets which have been elicited using methods other than time trade - off. however, value sets elicited using other preference elicitation methods may also be used to calculate qalys and equations for adjusting foreign mean utilities valued by value sets that applied other preference elicitation methods could be estimated in the same manner as the equations shown in this paper. the present study showed that it is feasible to develop and validate regression models for adjusting mean utility estimates valued by foreign value sets that are systematically different from the national value set. the paper showed that adjustment has the potential to increase the transferability of a foreign utility to a national setting.	backgroundforeign utilities of the eq-5d-3l (3-level version of the euroqol-5 dimension of health questionnaire) are not readily transferrable to economic evaluations conducted from a national perspective. it has been advised to avoid transferring mean utilities from one country to another without adjusting them ; yet no such method exists.purposethe present study aimed to develop a method for adjusting mean utilities to increase their transferability from one country to another.methodsseven datasets containing eq-5d-3l answers were valued using value sets from four countries : the uk, the netherlands, germany, and spain. hereby, seven mean utility values were obtained for each country. this allowed for three pairwise comparisons : 1) uk mean values vs dutch mean values ; 2) uk mean values vs german mean values ; and 3) uk mean values vs spanish mean values. for each of these three comparisons, a regression model was fitted using the mean uk utilities as the dependent variable and the other country s mean utilities as the independent variable. the coefficients from the three regression models were validated using results from a published article containing mean utilities obtained by valuing the eq-5d-3l data using all four value sets.resultsthe findings suggested that adjustment of foreign utilities may increase transferability between countries where value sets are not comparable. it was possible to adjust the mean utilities valued by the dutch and german value sets to make them reflect mean uk utilities as there were substantial differences between these value sets. transferability of the spanish mean utility values was not improved as the spanish and uk value sets are sufficiently similar.conclusionit is feasible to adjust foreign mean utilities of the eq-5d-3l to make them reflect national preferences for health.
it is a complex clinical syndrome that involves memory impairment, behavioral disorders, and personality changes1. the main features of dementia are reduced cognitive ability, neurological and psychiatric symptoms, and functional disability2. alzheimer s disease (ad) has a similar clinical presentation to vascular dementia, but they differ because the onset of ad typically occurs in old age. in addition, ad symptoms are irregular and fluctuating3, which includes frontal lobe symptoms such as impairments in executive cognitive functions such as attention, planning, and cognitive processing speed4. as a result, people with ad experience severe behavioral changes such as depression, behavioral delay, psychomotor slowness, and anxiety5. ad is associated with damage to the hippocampus and entorhinal cortex6, which progresses to the prefrontal, right parietal posterior, occipital, and temporal lobes of the cerebral cortex, as well as to the nigrostriatal cells7. as elderly patients with dementia age, they show reductions in abilities such as sight, balance control, vestibular function, and proprioceptive sensation. these reductions contribute to physical inactivity, cognitive impairment8, increased muscle stiffness, and functional limitations, which result in reduced activities of daily living, weight gain, and muscle loss. physical weakness the emotional disorders that occur in 4050% of elderly patients with dementia decrease quality of life, negatively impact other health conditions, and impair cognitive function10, 11. the complicated characteristics of elderly patients with dementia are interrelated and contribute to progressive impairment. therefore, an integrated approach is necessary in order to improve health and preserve functional ability and quality of life and for elderly patients with dementia12. the present study investigated the effects of combined cognitive and fine motor activity therapies on the degree of dementia, depression, and activities of daily living in elderly patients with the ad. participants were 26 patients with ad who were at least 65 years old, and who attended the gyeonggi s senior center. inclusion criteria were as follows : no exercise habits, cdr 0.55 points, a diagnosis of ad, no regular cognitive rehabilitation treatment after onset of dementia, and ability to understand simple verbal instructions. participants were excluded if they had vascular dementia by stroke, diagnosis of other dementia, fracture or musculoskeletal disorder13, or brain surgery. the present study was approved by sahmyook university institutional review board (syuirb2014 - 027) and each subject was able to follow instructions and gave informed consent by signing an approved consent form ; thus, the rights of human subjects were protected. characteristics of the combined fine motor skill and cognitive therapy group were : 3 males and 10 females, mean age of 80.15 5.21 years, mean height of 156.15 10.38 cm, mean weight of 54.08 9.32 kg, and duration after ad onset of 5.46 3.71 years. characteristics of participants in the control group were : 2 men and 11 women, mean age of 80.00 6.90 years, mean height of 151.46 6.94 cm, mean weight of 53.46 12.24 kg, and duration after ad onset of 5.77 3.41 years. thirty - nine participants were divided into either the cognitive intervention group with fine motor activities (n = 20) or the control group (n = 19). four of 29 participants in the experimental group had limited participation, and 3 participants in the experimental group abandoned the study. in the control group, both groups were treated with 5 mg donepezil just prior to sleep, once daily for 12 weeks. participants in the experimental group engaged in fine motor activities for 60 min, thrice a week for 12 weeks. cognitive therapy with fine motor activities consisted of coloring, singing14, matching picture cards, playing instruments, physically interactive games (ball toss, bowling, and ring toss), doing puzzles15, chopsticks games, janggial football, and a fishing game. therapy was conducted using a chair or a wheelchair with armrests and back, a desk, and small tools. first, a physical therapy program occurred for 5 min in order to release shoulder and neck tension by stretching and clapping. dementia was assessed using the korean convenience mental state examination (korean - mini mental state examination, k - mmse). k - mmse primarily assesses cognitive ability, is highly reliable (cronbach s = 0.98), and consists of scales to assess disorientation, memory, visual ability, concentration, calculation, verbal language, writing, reading, and configuration abilities16. the degree of dementia in elderly patients with ad was assessed using the clinical dementia scale (clinical dementia rating, cdr). the cdr assesses both alzheimer s dementia and the severity of different types of dementia. it consists of 6 subscales, including memory, orientation, judgment and problem - solving, social activities, family life and hobbies, and personal hygiene. cdr data are analyzed with a complex algorithm and yield scores from 05 points, with higher numbers indicating more severe dementia (cronbach s = 0.90)17. overall degeneration associated with dementia was assessed with the global deterioration scale (gds). the gds is most widely used as the basis for determining drug therapy for patients with dementia. it evaluates declining cognition and social functioning, and consists of subscales for memory, orientation, judgment and problem - solving skills, social activities, family life and hobbies, and hygiene or grooming (cronbach s = 0.93)18. the korean form of the geriatric depression scale (kgds) was used to assess depression. the kgds is useful for administration to elderly people who are healthy, ill, or have impaired cognition, and consists of 30 scale items. depression is classified as mild (1418 points), moderate (1921 points), or severe (22 points or more) (cronbach s = 0.94)19. the mbi consists of the following 10 subcategories : personal hygiene, bathing, eating, toileting, climbing stairs, dressing, adjustable stool use, urine control, walking or wheelchair use, and transferring to chair or bed, which are scored to a maximum total of 100 points (cronbach s = 0.90)20. descriptive statistics were used to describe participant characteristics, and independent sample t - tests and tests assessed homogeneity between groups. paired t - tests were used to evaluate changes before and after the k - mmse, cdr, gds, kgds, and mbi. independent t - tests were used to test differences in demographic characteristics between groups. k - mmse, cdr, gds, kgds, and mbi scores improved in the experimental group but only kgds scores improved for participants in the control group. however, there were no significant differences between the groups for any of the variables (p<0.05) (table 1table 1.comparison of outcome measures with groups and between groups (n=26)parametersvalueschange valuescognitive therapy group (n=13)control group (n=13)cognitive therapy group (n=13)control group (n=13)prepostprepostpost - prepost - precognitive parametersk - mmse (score)18.62 (2.46)22.08 (2.62)15.08 (3.54)14.54 (4.40)3.46 (1.85)0.54 (4.87)degree of dementiacdr (score)2.38 (0.87)1.73 (0.78)2.23 (0.83)2.50 (1.38)0.65 (0.62)0.26 (0.78)gds (score)5.15 (0.89)4.46 (1.12)4.85 (1.46)5.08 (1.32)0.69 (0.63)0.23 (0.92)depression parameterskgds (score)15.08 (6.47)11.46 (6.03)10.38 (9.96)9.38 (10.27)3.62 (3.66)0.92 (3.37)adl parametersmbi (score)55.54 (15.30)60.92 (12.95)56.77 (19.55)55.23 (21.73)5.38 (6.19)1.38 (8.48) values are mean (sd), k - mmse : korea - mini mental state examination, cdr : clinical dementia rating, gds : global deterioration scale, kgds : korea geriatric depression scale, mbi : modified barthel index. values are mean (sd), k - mmse : korea - mini mental state examination, cdr : clinical dementia rating, gds : global deterioration scale, kgds : korea geriatric depression scale, mbi : modified barthel index. the purpose of this study was to investigate the effects of cognitive therapy with fine motor activities on cognition, degree of dementia, depression, and activities of daily living in elderly patients with ad. cdr scores and gds scores were significantly decreased in the experimental group compared to the control group (p<0.05). in a previous study, spector22 administered a cognitive stimulation program that included using money, a ball game, and a word game, which was realistic training for patients with dementia. patients were assigned to either the experimental group (n = 115) or the control group (n = 86). the experimental group participated in the cognitive stimulation program and the control group received only general medical intervention. there were significant increases in the experimental group mmse scores compared to the control group (p<0.05). yamanaka15 assessed a cognitive stimulation program for patients with dementia, which also occurred for 45 min twice per a week for 7 weeks. the experimental group (n=26) participated in a cognitive stimulation program that included word puzzles, word games, physically interactive games, puzzles, using tools, number card games, and using money. mmse scores were significantly increased in the experimental group compared to the control group (p<0.05). eleven participants in the experimental group were participated in face - name associated training with errorless learning and spaced retrieval training, as well as memory training. eleven participants in the control group participated in face - name associated training with errorless learning, as well as memory training. this study showed increased cognition, similarly to the findings of spector22 and yamanaka15. the degree of dementia also decreased, similarly to the findings of jean23. in order to increase cognitive functioning, aerobic exercise or strength training however, a recent study demonstrated that the effects of exercise are mediated via synaptic plasticity mechanisms or neuron generation24, 25. brain areas responsible for the hand function are utilized, so fine motor activity should improve cognitive functioning due to stimulating both the premotor cortex and also the nerves of the other cortex. the degree of dementia in elderly patients with ad is thought to significantly decrease because of increasing the cognitive function. depression can occur at any age, and it is a mental illness with both social and personal effects. cognitive impairment and dementia risk increase in elderly patients with depression26. an experimental group (n = 11) was offered exercise programs with cognitive activities for 20 min thrice a week, for 12 weeks. a control group (n = 9) was provided only with cognitive activities for 20 min thrice a week, for 12 weeks. general physical therapy was offered to both groups for 30 min, 5 times a week, for 12 weeks. both groups had significantly decreased gds scores (p < 0.05) but there was no difference between groups. kerse26 used the otago program with 193 elderly people with depression, for 30 min thrice a week, for 6 months. the experimental group (n = 97) participated in upper extremity exercise programs from the otago exercise program and the control group (n = 96) had only a social visit. as a result, gds-15 scores significantly decreased in both groups (p < 0.001), but there was no difference between groups. in this study, kgds was used to assess depression in elderly patients with alzheimer s dementia. kgds scores decreased significantly in the experimental group compared to the control group (p < 0.05). the present study found decreased depression, similarly to the results of yoon19 and kerse26. depression includes impairment in cognitive functioning and decreased ability to perform activities of daily living due to alzheimer s dementia. however, cognitive treatment with fine muscle activity improved not only cognitive function and the ability to participate in activities of daily living, but also decreased depression. the variation in findings between studies likely results from differences in study durations, participants, and treatment methods. physical activity is necessary to the elderly, who are often concerned about the possibility of declining health, including social support, lack of exercise, discomfort, and falls. decreased abilities of elderly patients with dementia to perform activities of daily living contribute to difficulties with walking or climbing stairs, which increase the probability of a fall, followed by entering a medical institution, and incurring the associated medical costs27. tsolaki28 investigated gait and balance in 176 elderly people with mild cognitive impairment. there were 20 sessions once a week for 12 weeks. the experimental group (n = 104) participated in cognitive training, including naming objects and numbers backwards. activities of daily living significantly increased in the experimental group (p < 0.001). in the present study, the mbi measured ability of elderly patients with ad to perform daily living tasks, and found that mbi was significantly increased in the experimental group compared to the control group. our findings demonstrating increased activities of daily living are similar to results reported by tsolaki28. fine muscle activities with cognitive therapy improved hand manipulation for elderly patients with ad, improved sensation and function of the hand, and improved performance of activities of daily living. although not a replacement for a walker, a cane, or other suitable balance treatments, improved hand function contributes to reducing fear to perform activities of daily living for elderly patients with alzheimer s disease. executive function in elderly patients with ad was advanced due to various activities such as coloring, using chopsticks, jenga and block play, mosaics, puzzles, jigsaw puzzles, playing instruments, singing, and tossing a ball. mbi scores of 5074 points indicate a moderate level of independence in daily life. therefore, although the mbi scores increased from 5.38 points to 60.92 points for elderly patients with ad in the present study, these patients still require assistance.	[purpose ] this study evaluated the effects of combined fine motor skill and cognitive therapies on cognition, depression, and activities of daily living in elderly patients with alzheimer s disease (ad). [subjects and methods ] twenty - six participants comprised 2 groups. the experimental group (n=13) received combined fine motor skill and cognitive therapy, and the control group (n=13) received only general medical care. [results ] the experimental group showed improvements in cognition, degree of dementia, depression, and activities of daily living compared to the control group. however, there were no significant differences between the two groups. [conclusion ] these results suggest that combined fine motor skill and cognitive therapy improves cognition, degree of dementia, depression, and daily living in elderly patients with ad. these therapies would therefore be effective as general medical care strategies.
laparoscopic adrenalectomy, first reported by gagner, is the standard of care for management of adrenal diseases. recent technological advances in the form of newer energy sources, such as ultrasonic shears and the vessel - sealing system, have made performance of such advanced laparoscopic surgical procedures safer. these devices have led to decreased operative blood loss and risk of thermal injuries compared with blood loss and thermal injuries with conventional electrocoagulation. they provide an excellent alternative to clips, sutures, and staplers, both during open and laparoscopic surgery. the vessel - sealing system is a bipolar system that uses thermal energy to permanently seal vessels, including 7 mm in diameter without dissection. we report our initial experience with clipless and sutureless laparoscopic surgery using ultrasonic shears and the vessel - sealing system for removal of adrenal and extra - adrenal tumors. between march 2004 and may 2007, we operated on 10 patients who had adrenal tumors and 4 patients who had extra - adrenal tumors by using the laparoscopic ultrasonic shears and the ligasure vessel - sealing system. of the 10 patients with adrenal tumors, 8 had a mass in the right adrenal and 2 had in the left adrenal. three of 4 patients with extra - adrenal masses were males, and all 3 presented with hypertension. in 2 patients, the extra - adrenal tumor was located in the para - aortic region, inferior to the hilum of the left kidney. in the remaining 2 patients, the demographic, clinical, and operative details of the patients are listed in table 1. clinical and operative data clinical features of pheochromocytoma were present in 10 of 14 patients. all patients underwent a detailed workup, including history, physical examination, laboratory evaluation, and estimation of 24-hour urinary catecholamines. ultrasound, contrast enhanced computed tomography (cect) and magnetic resonance imaging (mri) were used as imaging methods for localization. meta - iodo - benzyl - guanidine (mibg) scans were also used in all the patients with suspected pheochromocytoma. the patients underwent laparoscopic surgery via a transperitoneal approach with the patient in the lateral position. no clips or sutures were used during the entire surgery in any of the patients. surgery could be completed in all the cases by using the energy devices ultrasonic shears and the ligasure vessel - sealing system. the mean operative blood loss was 70 ml (range, 10 to 150). blood loss could be defined as minimal (not requiring suction during the procedure ; 150 ml). two patients had minimal blood loss, 9 had mild blood loss, and 3 had moderate blood loss. histopathological examination (table 2) revealed pheochromocytoma in 7 patients, 6 with adrenal masses and one with an extra - adrenal mass. of the 4 extra - adrenal tumors, one patient had pheochromocytoma, and the remaining 3 had benign nerve sheath tumors, though 2 of these patients had presented with hypertension and other clinical features of pheochromocytoma. of 10 adrenal tumors, the histopathological examination in other patients with adrenal tumors included cortical adenoma in 2 patients and angiolipoma in 1 patient. this young patient, a physician by profession, had clinical features of pheochromocytoma and an mibg scan suggestive of adrenal pheochromocytoma. however, his 24-hour urinary catecholamines were normal. moreover, the mass was small and of doubtful significance. postoperative final histopathological diagnosis (n = 14) four patients with pheochromocytoma developed significant hypotension in the immediate postoperative period. they were kept overnight in an intensive care unit and treated with fluids and inotropic support. all patients had an uneventful recovery following surgery and were discharged from the hospital after an average postoperative stay of 2 days (range, 1 to 7). since gagner performed the first laparoscopic adrenalectomy (la) in 1992, this approach has been used extensively for the treatment of adrenal pathology and is considered the standard of care. the advantages of laparoscopy over the open approach have been discussed in a number of reports. these include less pain, minimal blood loss, shorter operative time, faster recovery of bowel function, and reduced hospital stay. the surgery has been made easier by the introduction of newer energy sources for hemostasis like the ligasure vessel - sealing system and ultrasonic coagulator. the ligasure system is a unique bipolar system that seals vessels up to 7 mm by application of precise pressure and thermal energy. it uses thermal energy to breakdown the elastin and collagen of the vessel wall leading to apposition of the vessel wall. this process operates under the control of a feedback mechanism and stops when the vessel gets completely sealed off. this seal has been reported to have burst strength comparable to that of mechanical devices like clips and ligatures. during laparoscopic adrenalectomy, control of adrenal veins the use of the ligasure vessel - sealing system does not require isolation of the adrenal veins. moreover, it produces a seal of partially denatured protein with no risk of dislodgement as the lumen of the vessel gets obliterated. we used the ligasure system in 10 patients with adrenal tumors and 4 patients with extra - adrenal tumors. in most patients, ultrasonic shears were also used for initial dissection followed by the use of the vessel - sealing system. all tumors were removed laparoscopically by using the transperitoneal approach with the patient in the lateral position. the retroperitoneal approach for removal of adrenal tumors at our institution including pheochromocytomas has been described. however, we prefer the transperitoneal approach for laparoscopic removal of larger tumors. one of the extra - adrenal tumors located inferior to the left renal vein was removed by using a novel transperitoneal, transmesocolic approach without mobilization of the left colon. the conversions during laparoscopic adrenalectomy are mainly due to uncontrollable bleeding, large tumor size, and periadrenal fibrosis. thus, there was no case with excessive bleeding, and the use of the ligasure device and harmonic shears played an important role in minimizing blood loss. only 2 reports in the literature describe the use of the ligasure vessel - sealing device during laparoscopic adrenalectomy. in both of these studies, the ligasure device was the sole instrument used for hemostasis. in a series of 23 laparoscopic adrenalectomies in which the ligasure device was used, the reported operative time was 57 minutes (range, 30 to 75) for unilateral adrenalectomy. however ; the average size of the adrenal mass in this series was 4 cm. the higher operating time in our series (mean, 138 minutes) can be attributed to the fact that the average size of the adrenal tumors was 6.2 cm and that half of the cases were pheochromocytomas. another reason for longer operating time for pheochromocytomas is that the surgery has to be frequently halted due to intraoperative blood pressure fluctuations. similar results have been reported for pheochromocytomas in a series of 100 cases of laparoscopic adrenalectomy. the average tumor size and the operative time for pheochromocytomas in this series were 6.3 cm and 2.5 hours, respectively. the mean operative time for the whole group was 123 minutes (range, 80 to 210). there are a number of reports on the use of the ligasure system for laparoscopic splenectomy (ls). romano reported less blood loss and a lower conversion rate in 10 patients who underwent splenectomy performed with this device. the authors concluded that use of the ligasure device results in less blood loss, lower operative time, and increased safety when used for splenectomy. moreover, compared with the ultrasonic coagulator, endostapler, and even clips if disposable clip applier is used, it is more cost - effective. gelmini reported that use of the ligasure vessel - sealing system is associated with less operative time and increased safety. in their series of 63 consecutive patients who underwent laparoscopic splenectomy (ls), the ligasure vessel - sealing system was the only instrument used for hemostasis. according to the authors, the low operative blood loss was mainly attributable to the use of this bipolar vessel - sealing system. the ligasure system has also been used for several other thoracic and abdominal procedures, both open and laparoscopic. its use has been reported for nephrectomy, donor - nephrectomy, colectomy, adrenalectomy, hepatic resection, hysterectomy, and appendectomy. the ligasure vessel - sealing system has made surgery easier to perform with a decrease in operating time. it also leads to a lower conversion rate, possibly as a result of decreased bleeding. the instrument is not only effective for sealing blood vessels ; it can be used for dissection as well. the precise feedback control mechanism ensures minimal lateral spread of energy, limited to less than 1.5 mm beyond the area of application. in obese patients with fat around vessels, individual dissection, and isolation of blood vessels is not required, which can minimize the chances of their avulsion and troublesome bleeding. the contraindications for using the vessel - sealing system are few and include a large vein on the right side. based on our initial experience, we feel that newer energy devices like ultrasonic shears and the ligasure vesselsealing system are useful tools that facilitate safe laparoscopic excision of adrenal and extra - adrenal tumors. their use during these advanced laparoscopic procedures leads to reduced blood loss, shorter operating time, and a lower conversion rate.	background : newer, energy - based devices like the ultrasonic coagulator (harmonic scalpel, ethicon endo - surgery, inc., cincinnati, oh) and the ligasure vessel - sealing system (valleylab, boulder, co) are increasingly being used in advanced laparoscopic procedures. use of these devices has resulted in shorter operative time, less blood loss, and lower conversion rates. we present our experience with these devices for laparoscopic removal of adrenal and extra - adrenal tumors.methods:ten patients with adrenal tumors and 4 with extra - adrenal tumors were operated on laparoscopically with the ultrasonic shears and ligasure vessel - sealing system. the entire surgery was carried out using these energy - based devices without using any clips or sutures.results:no conversions were necessary. none of the patients experienced any major intraoperative or postoperative bleeding. the mean size of the tumor was 6.2 cm (range, 3 to 8). the mean operative time was 123 minutes (range, 80 to 210), and the mean blood loss was 70 ml (range, 10 to 150). histopathology revealed pheochromocytomas in 7 patients.conclusions:use of the ligasure vessel - sealing device along with ultrasonic shears for laparoscopic removal of adrenal and extra - adrenal tumors is safe and effective.
pollution has wide - ranging consequences, for health as well as in other sectors. following a health impact assessment of particulate matter emissions, this study aims to quantify the labour market consequences of particulate emissions as part of a cost - benefit analysis of mitigation efforts. the costs include the actual mitigation costs as well as the disutility (and costs) of those who are forced to reduce their emissions, while the benefits include the utility of a cleaner air as well as the benefits associated with lower levels of pollution. among the benefits from reduced air pollution this study focuses on some of these gains, namely, the productivity gains from lower pollution - related morbidity and mortality. for practical reasons, the gains are quantified by means of assessing their opposite measure : the costs of increased pollution. air pollution impacts on health through increased incidence and mortality of a number of diseases. in this analysis, we focus on the increase in incidence of coronary heart disease, stroke, lung cancer, and chronic obstructive pulmonary disease (copd), all of which are associated with increased levels of fine particulate (pm2.5) emissions. miller. found that women who were exposed to an increase in the level of pm2.5 by 10 microgram per m had a relative risk (rr) of 1.21 (95% cl : 1.041.42) of experiencing a coronary heart disease event and 1.35 (95% cl : 1.081.68) of experiencing an episode of stroke. similarly, pope iii. found a rr of 1.14 (95% cl : 1.041.23) for lung cancer in both genders when particulate emissions increased by 10 micrograms per m. the rr for copd related to particulate emissions was also 1.14 for a similar increase in both genders. based on findings on mortality related to particulate emissions [4, 6 ], we assumed that the rr for cardiovascular events following exposure to particulate emissions for men was lower than that for women. tentatively, therefore, we assumed that the rr of cardiovascular disease in exposed men was 1.29 and the rr for coronary heart disease in men exposed to particulate emissions was 1.175. instead we applied similar rr estimates for the two genders relating to pulmonary diseases. when analysing health or social consequences of a risk factor such as air pollution in an epidemiological framework, it is necessary to identify exposed and nonexposed individuals. however, when examining the labour market consequences of air pollution, such an approach may not be feasible since all individuals in industrialised countries are exposed to some degree of air pollution. the health effects and the associated labour market consequences also, exposure may be related to transport habits and other parameters that are not easily measured at population level. our approach to measuring exposure was therefore to express exposure to air pollution as the health effects of air pollution. more precisely, we developed a framework where the labour market consequences of diseases were assessed based on assumptions of the rr of disease incidence when exposed to air pollution. basically, we considered the measurable health effects of air pollution as being an expression of overall exposure to air pollution. we focused on incidence instead of prevalence because we wished to capture the effects of particulate emission - related disease on both morbidity and mortality. merely focusing on prevalence would underestimate the mortality impact, because survivors make up a relatively larger share of the prevalent population, compared to their share of the incident population. this applies to any disease study, as simple mathematics dictate that since mortality is often higher in severe cases of a given disease, the prevalent population can be construed as relatively healthier than the incident population. the aim of this paper was to quantify potential productivity gains due to improved health following a mitigation of air pollution through reduction of small particulate (pm2.5) emissions. practically, we have approached this task by quantifying the productivity costs of health consequences of existing particulate emissions and assumed that this present cost can be saved when mitigation succeeds. in this study, we have applied known health effects of pollution on labour market behaviour. health effects on labour market behaviour was either productivity costs due to death or early retirement, or relative wage losses, that is, workers with a disease or reduced health will receive a lesser wage increase. the productivity costs due to mortality and premature departure from the labour market constitute the societal costs of disease, while the wage loss expresses a loss to the individual worker. we assessed the labour market consequences of the four diseases in a register - based analysis. we used disease as an expression of exposure and thus identified a patient group as the exposed and a control group as the nonexposed. the control group was identified such that they were as comparable to the patient group as possible. the difference in labour market affiliation and wage developments were considered as being attributable to disease and thus air pollution. in calculations of changes in costs patients with at least one hospital admission caused by coronary heart disease (icd10 diagnoses i2025), stroke (icd10 : i6069), lung cancer (icd10 : c33 - 34), or copd (icd10 : j4144) were identified in the danish national hospital register. in addition, individuals that had died from these diseases but had not been hospitalised for the disease while alive were identified in the national causes of death register. the identified patients were matched with a reference group of nonpatients, henceforth called the control group. both groups were followed for a period of 10 years, with 1998 being the baseline year and 1999 the year of first hospital contact for coronary heart disease patients, lung cancer patients, and stroke patients. due to hospitalisation occurring late in the disease history for copd patients, we defined two groups of copd patients, the first having their first hospitalisation in 1999, like the three other diseases, and the second having their first hospitalisation in 2006. we adopted a wash - out period of 5 years (199498) during which patients could not have had any health care contacts related to the analysed disease. the rationale of the wash - out period was to ensure that cases were in fact incident and had not been hospitalised for their disease previously. for each disease, we selected a control group amongst the entire adult danish population, using individual, nearest neighbour matching by propensity scores [7, 8 ] comprising age in one - year intervals, comorbidities (a charlson index excluding the analysed disease), marital status, national origin, length of education, socioeconomic status, and area of residence. controls with the analysed disease occurring before or after 1999 were excluded. for both patients and controls, we obtained data for annual, gross wages, and labour market affiliation from the national registers at statistics denmark. for those patients that were in the labour market at baseline (1998), labour market affiliation was analysed using duration analysis (cox regression). individuals were considered to be in the labour market when they were employed, self - employed, or unemployed. if they deceased or received age pension, disability pension, or early retirement, they were considered outside the labour market. the duration model estimated the excess risk of leaving the labour market for patients compared to controls by modelling lm (labour market affiliation) as a function of ds (disease) (see table 1 for abbreviations of variables). the resulting hazard ratio (hr) for the ds parameter expresses the increased risk of leaving the labour market due to mortality or morbidity among patients, when compared to controls. since confounding factors have been taken into account in the matching procedure, there is no need to apply adjustment in the model. indeed, further adjustment would cause overadjustment for the covariates by including their effect twice. we tested whether the proportional hazards assumption was sustained, using the proportionality test option in proc phreg of sas. wage consequences were analysed using a difference - in - difference approach. for each patient, the wage development from 1998 to 2000 was recorded and compared to the wage development for the matched controls, using the same period. only individuals with a labour market income in both years hence, pensioners and others having only a nonlabour market income were excluded from this analysis of wage development. also people leaving the labour market due to pension (or death) were excluded. the crude wage development over the period 19982000 was compared between patients and controls. the wage loss related to disease the increased risk of leaving the labour market due to disease, multiplied by the annual wage of a control person, constitutes the average productivity cost of leaving the labour market too soon due to disease. similarly, the wage loss computed via ($ \mathopen { } \oldleft (\text { ii}\oldright) \mathclose { } $) relates to the total wage loss due to disease. the productivity costs of particulate emission relating to both the labour market withdrawal and the wage loss are computed by multiplying the two with the elevated risk of disease due to particulate emission, that is, rr-1. the particulate emission related productivity costs per person are transformed to population - based figures using incidence of disease. for incidence, we have used data on first - ever hospital admissions and causes of death figures for individuals aged 5070 years. the productivity cost (pcpollution) of disease was estimated by multiplying the excess risk of disease incidence (rr-1) with the excess risk of leaving the labour market (hr-1) and the average wage of patients in 2000, being the first calendar year after the event : (ii)pcpollution=(rr1)(hr1)wagepatients2000. similarly for wage differences, (iii)wlpollution=(rr1)wldisease. equations ($ \mathopen { } \oldleft (\text { ii}\oldright) \mathclose { } $) and ($ \mathopen { } \oldleft (\text { iii}\oldright) \mathclose { } $) express labour market consequences per patient. in order to arrive at the socioeconomic gain of mitigation of particulate emissions, the labour market consequences per patient should be related to incidence as shown in the following : (iv)number of saved cases = incidence beforeincidence after = incidence before(1rr)incidence before=(1 - 1rr)incidence before, where rr is the relative risk of disease incidence when exposed to particulate emissions. incidence figures are related to the age group 5070, and results should therefore be interpreted as savings per 100,000 population aged 5070. we computed the gain for one year and also accumulated the cost over a ten - year period. the results for the ten - year period were computed, considering that a smaller share of the population is in the labour market each year, due to labour market withdrawal in the preceding years. also, future costs were discounted by 3 per cent per year in order to obtain the net present value. cost figures are expressed in 2000-euro 's using an exchange rate of 1 = 7.5 dkk. individual data were stored at statistics denmark which ensured full compliance with all confidentiality laws and regulations. for all four diseases, there was a statistically significant higher risk of leaving the labour market for patients with the four diseases in comparison with nondiseased controls. the impact of disease on labour market affiliation shown in table 2 indicates that there is a productivity loss associated with these diseases. table 3 displays wages at baseline (1998) and two years later (in 2000). wage developments were used for calculation of difference - in - difference : did controls experience a better development in wages than patients ? all wages were converted to 2000-fixed prices. from table 3, it appears that there were only minor differences between patients and controls in terms of wage increases. the exception is lung cancer, where the disease apparently has a beneficial impact on wage development. it should be noted that, due to poor survival, very few lung cancer patients remain in the labour market after onset of disease, and those who do may not be typical. when interpreting the results in table 3, it should be noted that the figures only relate to the individuals who were still in the labour market. those who left the labour market due to disease or death were excluded from these calculations. hence, the population figures do not reflect the entire matched study population, but only those still in the labour market in 2000. table 4 summarises the productivity costs of an increase in particulate emissions at 10-microgram per m at patient and societal level. hence, it combines the findings of tables 2 and 3 on the productivity costs of disease to the impact of particulate emissions on these diseases. in table 4, the productivity costs of disease are multiplied by the elevated risk of disease when exposed to increased particulate emissions. the resulting productivity costs from a 10-microgram increase in particulate emission are presented as the average per exposed person, per 100,000 population aged 5070 years in the first year and per 100,000 population aged 5070 years accumulated over ten years. during the ten - year period, almost all patients have left the labour market. the results in the last two columns of table 4 are computed according to ($ \mathopen { } \oldleft (\text { iv}\oldright) \mathclose { } $) and hence represent a saving that can be harvested when mitigation efforts succeed. in the first year after disease incidence, the productivity cost of a 10-microgram per m increase in particulate emission amounts to about 1.8 million euro per 100,000 population in the age group 5070. assuming a linear effect, the accumulated impact of one year 's incidence amounts to more than 9 million euro over a ten - year period. we have found that pollution - related disease impacts on labour market affiliation, and therefore there is a societal gain from reducing air pollution. this finding points towards an important consequence of particulate emissions on labour market affiliation through health effects and hence indicates that a potential productivity gain may arise from successful mitigation of air pollution. to our knowledge we also looked at the wage development and compared patients suffering pollution - related disease and controls. the analysis was designed as a comparison of a group of exposed individuals with a group of controls. the control group was selected using a propensity score approach, aiming at achieving a comparable control group with characteristics similar to the exposed group. by selecting a control group that was as similar to the patient group as possible, we aimed to analyse the counterfactual : what would have happened if they had not become ill. one challenge of this exercise is the selection of the characteristics that comprise the propensity score : that is, determining which characteristics of patients and controls are important in the analysis of labour market affiliation and wages. in the analysis, we have used a variety of available socioeconomic variables in the composition of the propensity score. therefore, socioeconomic and demographic parameters that may impact on labour market behaviour should be captured by the matching procedure, at least to some extent. one of the disadvantages of the propensity score approach is that not all characteristics weigh the same in the score and more minor variations may not be captured. the variables that weigh the most in the propensity score are those contributing the most to explain disease occurrence. this weighing of variables is not possible when matching is conducted using individual variables, which was one of the reasons we did not adopt that approach. another option of course would be regression analyses on the entire population including adjustment for relevant covariates. such an approach could include application of instrumental variables, addressing potential unobservable individual effects. though this may be part of explaining the relation between disease and labour market behaviour, we chose to focus on relative effects instead, in a trial - like setup. these include age, gender, and length of education, but also socioeconomic status and comorbidity. other variables may also be important in explaining the complex relation between pollution, health, and labour market behaviour. we suggest that the relation between labour market behaviour and health is as complex as reflected in our model, and perhaps even more so. while acknowledging this, we may tentatively conclude that a decrease in particulate emissions may be associated with reduced disease incidence and mortality which may have a positive impact on labour market affiliation and productivity. the evidence of smoking as an important risk factor for disease dates several years back [11, 12 ]. compared to smoking this should be borne in mind, in particular when analysing diseases such as copd and lung cancer, in which smoking is an important risk factor. if the studies that describe interactions between mortality and air pollution do not capture the effect of smoking as an effect modifier sufficiently, the impact of air pollution on health may be slightly overestimated. it is also possible that other risk factors interact with smoking and pollution exposure, causing some uncertainty in our findings. nevertheless, it remains clear that particulate emissions incur significant costs due to their health effects and that mitigation of emissions would be associated with a substantial saving to society. we have illustrated how the potential impact of air pollution may influence social production by application of a matched study design that renders a study population similar to that of a trial. we found that there is a significant productivity cost related to the health effects of pollution. these results suggest that there may be a productivity gain associated with mitigation of particulate emissions. further economic research could incorporate our findings into a cost - benefit analysis of a given mitigation intervention. in addition, our findings could be supported by further epidemiological research into the association between air pollution and disease.	the objective of this study was to analyse the productivity cost savings associated with mitigation of particulate emissions, as an input to a cost - benefit analysis. reduced emissions of particulate matter (pm2.5) may reduce the incidence of diseases related to air pollution and potentially increase productivity as a result of better health. based on data from epidemiological studies, we modelled the impact of air pollution on four different diseases : coronary heart disease, stroke, lung cancer, and chronic obstructive pulmonary disease. we identified individuals with these diseases and modelled changes in disease incidence as an expression of exposure. the labour market affiliation and development in wages over time for exposed individuals was compared to that of a reference group of individuals matched on a number of sociodemographic variables, comorbidity, and predicted smoking status. we identified a productivity cost of about 1.8 million euro per 100,000 population aged 5070 in the first year, following an increase in pm2.5 emissions. we have illustrated how the potential impact of air pollution may influence social production by application of a matched study design that renders a study population similar to that of a trial. the result suggests that there may be a productivity gain associated with mitigation efforts.
in the past decades, polymer solar cells have attracted more and more scientific attention due to their advantages, such as low cost, light weight, easy fabrication, and the possibility to fabricate flexible devices, compared with inorganic solar cells [1 - 5 ]. however, the limited dissociation of photoexcitation at weak electric field and poor charge transport in the polymer affects their applications. along with the discovery of photo - induced fast charge transfer between conjugated polymer and c60, the possibility of all plastic photovoltaic cells with conjugated polymers and c60 derivatives as basic materials resulted in a large short - circuit current and a high power conversion efficiencies [6 - 9 ]. although more effective dissociation of photogenerated excitons can occur on the interfaces of polymer and c60 in polymer fullerene bulk heterojunction solar cells, electron mobility is still poor and imbalance between electron and hole results in carrier recombination during transmission in solar cells. a good photoconductive device requires not only efficient charge separation, but also efficient transport of charge carriers to the electrodes. the blends of conjugated polymer and inorganic nanocrystals have exhibited excellent photoconductive properties because the inorganic semiconductor nanocrystals can efficiently dissociate the photogenerated excitons and have high electron mobility. moreover, the dependence of the band gap of nanocrystals on particle radius can make it absorb light with tunable wavelengths and the compensated light harvest of nanocrystal and conjugated polymer enlarged the absorption range. in recent years, binary nanocrystals such as cus, zno, tio2, cds, and cdse have been investigated extensively for their technological applications in optoelectronics [10,13 - 17 ], but few study have been reported for the application of ternary - alloyed nanocrystals synthesized in aqueous solutions in the solar cells. the band gap of ternary - alloyed nanocrystals can be adjusted by controlling not only particle radius but also the composition of ternary - alloyed nanocrystals [18 - 20 ]. most of devices based on polymer fullerene blend configurations suffer from reduced voc because of the large band offset between the electron donor and acceptor materials. in order to increase the voc and efficiency in such devices, the donor fullerene blend devices, where the electron affinity of the fullerene derivative was modified leading to a change in the voc. the application of zncdte - alloyed nanocrystals can provide continuous control of the band offset over a large range by controlling not only particle radius but also the composition and leads to increased voc values in hybrid devices. we prepared zncdte nanocrystals in aqueous solutions according to the method that have been reported. then, the phase - transfer method was used to transfer zncdte nanocrystals into a xylene solution, which is combined with the blend of meh - ppv + c60 in xylene to fabricate composite devices. the comparison of the spectral response of photocurrent of the meh - ppv : c60 (+ zncdte) nanocomposite device with that of the pristine meh - ppv and meh - ppv : c60 devices was made. the results from voltage current characteristics showed that the conversion efficiency of devices with the 40% weight ratios of zncdte nanocrystals is doubled compared with the devices without blending zncdte nanocrystals. zncdte nanocrystals were synthesized according to the method we have reported. in brief, thioglycolic acid was added into the mixed precursor solutions of cd(ch3coo)2 2h2o and zn(ch3coo)2 2h2o, which was adjusted to ph = 9 by using the solution of 2 mol / l sodium hydroxide, followed by adding a freshly prepared oxygen - free nahte solution with vigorous stirring under nitrogen atmosphere. then, the solution was heated to 105 c for 3 h, and zncdte - alloyed nanocrystals were formed. finally, zncdte - alloyed nanocrystals were precipitated by addition of isopropyl alcohol and then centrifuged when the solution was cooled to room temperature. cetyltrimethyl ammonium bromide (ctab) was used to precipitate the alloyed nanocrystals as the surfactant. and then the precipitation was re - dispersed in xylene after being dried and combined with the xylene solution of meh - ppv : c60with different nanocryshals concentrations. ito - coated glass substrate was first cleaned for sample preparation by detergent and distilled water in an ultrasonic bath, respectively. poly(3,4- ethylenedioxythiophene):poly(styrenesulfonate) (pedot : pss) was spin - coated on top of ito - coated glass substrates as the polymer anode to smoothen the substrate surface, and this was followed by thermal treatment for several minutes. the active layers of the solar cells were prepared from the blends of meh - ppv : c60(6:1.5 mg / ml) and zncdte - alloyed nanocrystals with different weight ratio in xylene. the weight ratios of zncdte to meh - ppv : c60are 10 wt% (d11), 20 wt% (d12), 40 wt% (d13), and 70 wt% (d14), respectively. after stirring for about 3 h, the blends of meh - ppv : c60and zncdte nanocrystals in xylene were spin - coated onto the pedot : pss substrates. al electrodes were deposited onto the blend active layers in sequence through a shadow mask on top of the active layer by vacuum thermal evaporation as cathode. the shadow mask defines an active area of 2 mm. for the sake of comparison, the undoped meh - ppv : c60device (d10) was fabricated with the same processes as mentioned. the obtained structure of devices is ito / pedot : pss / meh - ppv : c60(+zncdte)/al. schematic diagrams of the devices structure the spectral response of photocurrent and current voltage curves were recorded by a keithley 2410 source measure unit both in the dark and under illumination. the incident light from a xe lamp was passed through a monochromator in spex fluorolog-3 spectrophotometer to select a wavelength at 500 nm with an intensity of 16.7 mw / cm. the spectral responses of photocurrent were also obtained by illumination with the light from a xe lamp, which was passed through a monochromator to select wavelengths between 400 and 700 nm. transmission electron microscopy (tem) images were performed on a hitachi h-700 transmission electron microscope. high - resolution transmission electron microscopy (hr - tem) study was carried out on a philips tecnai f30 microscope at an acceleration voltage of 300 kv. x - ray photoelectron spectra (xps) were recorded by a vg mkii x - ray photoelectron spectrometer with monochromatized al ka radiation as the excitation source. x - ray diffraction (xrd) pattern was measured by philips apd-10 x - ray diffractometer with graphite monochromatized cu ka radiation (= 0.154178 nm). zncdte nanocrystals were synthesized according to the method we have reported. in brief, thioglycolic acid was added into the mixed precursor solutions of cd(ch3coo)2 2h2o and zn(ch3coo)2 2h2o, which was adjusted to ph = 9 by using the solution of 2 mol / l sodium hydroxide, followed by adding a freshly prepared oxygen - free nahte solution with vigorous stirring under nitrogen atmosphere. then, the solution was heated to 105 c for 3 h, and zncdte - alloyed nanocrystals were formed. finally, zncdte - alloyed nanocrystals were precipitated by addition of isopropyl alcohol and then centrifuged when the solution was cooled to room temperature. cetyltrimethyl ammonium bromide (ctab) was used to precipitate the alloyed nanocrystals as the surfactant. and then the precipitation was re - dispersed in xylene after being dried and combined with the xylene solution of meh - ppv : c60with different nanocryshals concentrations. ito - coated glass substrate was first cleaned for sample preparation by detergent and distilled water in an ultrasonic bath, respectively. poly(3,4- ethylenedioxythiophene):poly(styrenesulfonate) (pedot : pss) was spin - coated on top of ito - coated glass substrates as the polymer anode to smoothen the substrate surface, and this was followed by thermal treatment for several minutes. the active layers of the solar cells were prepared from the blends of meh - ppv : c60(6:1.5 mg / ml) and zncdte - alloyed nanocrystals with different weight ratio in xylene. the weight ratios of zncdte to meh - ppv : c60are 10 wt% (d11), 20 wt% (d12), 40 wt% (d13), and 70 wt% (d14), respectively. after stirring for about 3 h, the blends of meh - ppv : c60and zncdte nanocrystals in xylene were spin - coated onto the pedot : pss substrates. al electrodes were deposited onto the blend active layers in sequence through a shadow mask on top of the active layer by vacuum thermal evaporation as cathode. the shadow mask defines an active area of 2 mm. for the sake of comparison, the undoped meh - ppv : c60device (d10) was fabricated with the same processes as mentioned. the obtained structure of devices is ito / pedot : pss / meh - ppv : c60(+zncdte)/al. the spectral response of photocurrent and current voltage curves were recorded by a keithley 2410 source measure unit both in the dark and under illumination. the incident light from a xe lamp was passed through a monochromator in spex fluorolog-3 spectrophotometer to select a wavelength at 500 nm with an intensity of 16.7 mw / cm. the spectral responses of photocurrent were also obtained by illumination with the light from a xe lamp, which was passed through a monochromator to select wavelengths between 400 and 700 nm. transmission electron microscopy (tem) images were performed on a hitachi h-700 transmission electron microscope. high - resolution transmission electron microscopy (hr - tem) study was carried out on a philips tecnai f30 microscope at an acceleration voltage of 300 kv. x - ray photoelectron spectra (xps) were recorded by a vg mkii x - ray photoelectron spectrometer with monochromatized al ka radiation as the excitation source. x - ray diffraction (xrd) pattern was measured by philips apd-10 x - ray diffractometer with graphite monochromatized cu ka radiation (= 0.154178 nm). the particles are nearly spherical and the average size is less than 10 nm. characterization of synthesized zncdte - alloyed nanocrystals.atem image, bhrtem image, cxps spectra, dthe xrd patterns (the vertical lines below indicate the diffractions from the standard pattern of cubic zncdte nanocrystals), andethe absorption spectrum of the zncdte - alloyed nanocrystals hr - tem image of zncdte nanocrystals (fig. 2b) shows regular lattice fringes with a spacing of 0.35 nm, which corresponds to the (111) plane of zncdte. the features at 405 and 412 ev for the zncdte nanocrystals are known to stem from cd 3d. the peaks at 573 and 583 ev are from te 3d, and the peak of 1021 and 1045 ev also appear with the presence of zn 2p states, respectively. this result can confirm the existence of cadmium, zinc, and tellurium species in the zncdte nanocrystals. xrd patterns show obvious broadening phenomena, which indicate the small size of the alloyed nanocrystals. the crystal structures of zncdte can be assigned as cubic structures, with the presence of characteristic (111), (220), and (311) peaks in the xrd patterns. figure 3 shows the spectral response of photocurrent of the hybrid device for wavelengths from 400 to 700 nm with the nanocomposite structure of ito / pedot : pss / meh - ppv : c60 (+ zncdte)/al. for the sake of comparison, the spectral response of photocurrent of the devices with single layer of meh - ppv and with blend layer of meh - ppv : c60 are also shown. as shown in fig. 3, the photocurrent of the meh - ppv : c60 (+ zncdte) nanocomposite device is more enhancive than that of meh - ppv and meh - ppv : c60 devices, which result from photogeneration and transport mechanism of charge carriers in meh - ppv : c60 (+ zncdte) nanocomposite device. due to the poor electron mobility in the polymer and the lack of interfaces for dissociation of photogenerated excitons the photocurrent for meh - ppv : c60 (+ zncdte) nanocomposite device is more enhanced than that of the meh - ppv : c60 device. in nanocomposite devices, the inorganic nanocrystals easily aggregate to form some regions surrounded by regions of polymers. with enough content of nanocrystals in the composite film, these regions will grow to form a connected network in the film. in the homogeneous film, the exciton dissociation interface between polymer and zncdte nanoparticles cross through the nanocomposite film and much more electrons photogenerated by the incident photon through the device are contributed to the photocurrent. consequently, the enhanced photocurrent response is obtained in meh - ppv : c60 (+ zncdte) nanocomposite device. spectral response of photocurrent of a pristine meh - ppv device, a meh - ppv : c60device, and a meh - ppv : c60 (+ zncdte) nanocomposite device containing 40 wt% zncdte nanocrystals figure 4 shows the characteristics of photocurrent of five devices based on meh - ppv : c60 (0%, d10) and meh - ppv : c60 (+ zncdte) blends with different weight ratios (10%, 20%, 40%, 70%) of zncdte under illumination. it can be observed clearly that with the increasing ratio of the zncdte - alloyed nanocrystals, the short - circuit current density (jsc) values increase gradually, but when the ratio is up to 70%, jsc get decreased. appropriately increasing zncdte content in the blend film will generate more percolation pathways, which should help the transport of electrons and increases the photocurrent, so the maximum output power increase. we obtained the highest jsc value when the ratio of zncdte is 40 wt% in the blend film. in addition, the built - in potential for carrier injection into the devices is also an important factor in increasing the photocurrent. as well known, the trend of built - in potential can be reflected in the change of the open - circuit voltage (voc) of devices. a similar trend to jsc 5), only when the ratio is 10%, the voc is almost unchanged. with the low nanocrystal blending, the voc of meh - ppv : c60-only device is preserved until a threshold representing the formation of zncdte - alloyed nanocrystals networks across the device is reached. at this point, the voc rises to approach that of the complete heterojunction. with the formation of zncdte - alloyed nanocrystals networks by increasing the concentration of crystals, they will be many surface states on the surface of the zncdte. the fermi level of aluminum is partially pinned to the surface states close to the lowest unoccupied energy levels of zncdte (as shown in fig. in many bulk inorganic semiconductors and metal junctions, the fermi level of the metal is pinned to the surface states of the semiconductor within the band gap. zncdte - alloyed nanocrystals substitute the cathode to form a new limitation for built - in potential (as shown in fig.. therefore, the voc increased, when the concentration of zncdte is high enough. but if the concentration is too high, the jscvocpmax, ff, and decline sharply. first, excessively increasing zncdte in the blend film leads to the decrease of the polymer content, which may decrease the contribution of meh - ppv to the light absorption and destroy the interpenetrating pathway for holes transport, thus resulting in a decrease of values. second, due to the limit of solubility of zncdte - alloyed nanocrystals in polymer, the nanocomposite device with the 70% high blending concentration has displayed the uniformity of nanocoposite film. the dispersion of zncdte - alloyed nanocrystals in meh - ppv + c60 blend can not be well unified with the increasing alloyed nanocrystals concentration, which leads to decreasing of ff of nanocomposite devices. the concentration of alloyed nanocrystals plays an important role in optimizing photovoltaic properties of the nanocomposite devices. characteristics of photocurrent of meh - ppv : c60 device and meh - ppv : c60 (+ zncdte) nanocomposite device with different zncdte ratios under illumination at the wavelength of 500 nm with the intensity of 16.7 mw / cm photocurrent voltage characteristics of composite devices with meh - ppv : c60 (+ zncdte) as the active layer, along with the undoped meh - ppv : c60 (d10) device in comparison of the composite devices with different zncdte:[meh - ppv + c60 ] weight ratios of 10 wt% (d11), 20 wt% (d12), 40 wt% (d13), and 70 wt% (d14) vocopen - circuit voltage, jscshort - circuit current density (under = 500 nm with the light intensity of 16.7 mw / cm),fffill factor, pmaxthe maximum output power, and the power conversion efficiency the current voltage curves in the dark (open squares) and under illumination (closed circles) of 16.7 mw / cmat 500 nm of devices with different zncdte ratiosad11,bd12,cd13, anddd14 schematic ofvocin ito / pedot : pss / meh - ppv : c60(+zncdte)/al blend film devices with concentration of zncdte. for an undoped meh - ppv : c60device, vocis dominated by the system of meh - ppv : c60(voc1). with the increasing concentration of zncdte, the limitation for resultingvoc, corresponding to an meh - ppv : c60 (+ zncdte) composite device, at the negative electrode gradually shifts towards the lumo energy level of zncdte (vocn). when the lumo of acceptor (zncdte) completely acts as the limitation forvoc, the resultingvoccan be expressed byvoc2 in summary, we have presented the photovoltaic properties of the meh - ppv : c60(+zncdte nanocrystals) composite device. the experimental results show that the devices with blending zncdte nanocrystals exhibited an enhanced photocurrent. we investigated the effect of different zncdte:[meh - ppv + c60 ] weight ratios on the performance of the devices. when the weight ratio is not higher than 40%, the short current densityjscand the open - circuit voltagevocincreased with the increasing weight ratio of zncdte nanocrystals. the characteristics of the devices degraded when the concentration of zncdte nanocrystals is too high up to 70%. the power conversion efficiency is doubled and the short current is close to triple by blending zncdte nanocrystals with the concentration of 40%. this work was supported by trans - century training program foundation for the talents of natural science by the state education commission, key project of chinese ministry of education (no. 105041), national natural science & foundation committee of china (nsfc) (project nos. 90401006 and 10434030), state key project of basic research (2003cb314707) and the key laboratory of specially functional materials and advanced manufacturing technology, south china university of technology, ministry of education, china.	the photovoltaic properties of solar cell based on the blends of poly[2-methoxy-5-(2-ethylhexoxy-1,4-phenylenevinylene) (meh - ppv), fullerene (c60), and zncdte - alloyed nanocrystals were investigated. comparing the spectral response of photocurrent of the meh - ppv : c60(+zncdte) nanocomposite device with that of the devices based on meh - ppv : c60and pristine meh - ppv, one can find that the nanocomposite device exhibits an enhanced photocurrent. in comparing the composite devices with different zncdte:[meh - ppv + c60 ] weight ratios of 10 wt% (d11), 20 wt% (d12), 40 wt% (d13), and 70 wt% (d14), it was found that the device d13exhibits the best performance. the power conversion efficiency () is improved doubly compared with that of the meh - ppv : c60device.
ten children with a clinical and/or radiologic evidence of white matter involvement were identified from a cohort of 46 pediatric patients, 18 years of age and younger, with a range of nmdar - abs associated neurologic syndromes. between 2009 and 2013, patients were referred, based on clinician decision, from 6 pediatric neurology centers to the clinical neuroimmunology service at the oxford radcliffe hospital trust for serum and/or csf nmdar antibody testing and/or advice on further antibody testing. as antibodies to myelin oligodendrocyte glycoprotein (mog) and aquaporin-4 (aqp4) have been associated with demyelinating disorders, sera from all 10 cases and the other 36 nmdar - ab positive patients were tested for both these antibodies. nmdar, aqp4, and mog antibodies were measured using cell - based assays in routine clinical use (sera at 1:20 dilution for nmdar and aqp4 and 1:160 for mog ; csf at 1:2 dilution for nmdar) as previously described. for these cell - based assays, the binding of serum immunoglobulin g to the surface of human embryonic kidney cells, transfected with complementary dna encoding the auto - antigens (mog courtesy of m. reindl, innsbruck), was visualized using a fluorescence - labeled alexafluor 568 secondary antibody (molecular probes, eugene, or), and the results were assessed by at least 2 independent observers (y.h., the outcomes, as measured by the range of difficulties the patients were experiencing, were retrieved from the patient 's medical records or, if unavailable, were obtained directly from the patient 's primary pediatric neurologist. full recovery was defined by the absence of medical, educational, and social concerns reported from parents, school, and the patient 's primary clinician. ethical approval for ethical approval for this study was from the oxfordshire regional ethical committee a (07/q1604/28). out of a total of 46 patients identified consecutively from 6 centers, 10 patients (cases 110 ; 5 male ; age range 1.318 years, median 8.5 years ; see table 1) were identified with a significant white matter involvement. they were classified as having 3 neurologic syndromes : brainstem encephalitis (n = 3), herpes simplex virus encephalitis (hsve) relapsing with a distinct leukoencephalopathy (n = 2), and acquired demyelination syndromes (ads) (n = 5). their clinical features, imaging, and treatment responses are described below and summarized in table 1 and figures 1 and 2. the remaining 36 nmdar - ab positive patients had minimal or absent white matter involvement ; 28 of these had typical nmdar - ab encephalitis (cases 1138 ; 8 male ; age range 217 years, median 11 years ; see table 2). of the remaining 8 patients, 1 presented with a neurologic relapse following hsve, and 7 had a partial phenotype (cases 3946 ; 2 male ; age range 118 years, median 11 years ; see table 3). only 1 patient, a 15-year - old girl with classical nmdar - ab encephalitis, had an ovarian teratoma. nmdar - abs were positive in the csf in 10 of 11 patients tested with typical nmdar - ab encephalitis, in 2 of 3 tested with the partial phenotype, and in all 3 tested with white matter syndromes ; serum levels were higher than csf in all paired samples. all patients were empirically investigated by their physicians to exclude a range of infective, alternative inflammatory, and neurometabolic etiologies, of which none were identified. clinical and paraclinical features of 10 nmdar antibody positive patients with distinct clinicoradiologic white matter syndrome (a, b) case 1, who presented with a brainstem syndrome. axial t2 fluid - attenuated inversion recovery (flair) images showing hyperintensity in the midbrain and mesial temporal lobe (arrows in a), which subsequently resolved on follow - up imaging performed at 2 months when the patient had relapsed with a polysymptomatic encephalopathy (b). (c, d) case 2, who presented initially with a brainstem syndrome followed by periods of recurrent encephalopathy. axial t2-weighted images 6 months after her initial brainstem syndrome revealed diffuse global cortical atrophy (c). imaging during an encephalopathic episode 5 years later revealed new white matter changes (arrow in d) and further atrophy. (e h) two patients with neurologic syndromes following herpes simplex virus encephalitis (hsve). serial axial t2 flair images of case 4 (e g) showing localized cortical changes in the left thalamus and occipital lobe (arrows in e) on initial imaging that progressed, demonstrating significant bilateral white matter signal changes in the parieto - occipital region 2 months later (arrows in f) when the patient presented with significant worsening of cognitive, behavioral, and motor regression. following treatment and improvement of symptoms, follow - up neuroimaging 2 months later demonstrated a significant resolution of this white matter change (g). axial t2-weighted image of case 5 at relapse 2 months after hsve showing extensive bilateral but asymmetrical cystic encephalomalacia centered on the temporo - insular regions (only parietal changes shown) characteristic of hsve, but in addition demonstrating the characteristic leukoencephalopathic changes seen globally (arrows in h). at time of relapse with left optic neuritis, brain imaging in case 8 showed subtle periventricular white matter signal change on a t2-weighted image (arrow demonstrating one periventricular lesion in i). imaging of case 9 showing midbrain (arrow in j), capsular (arrow in k), and thalamic changes (not shown) on axial t2 flair. axial t2 flair image of case 10 demonstrating patchy subcortical white matter changes (l). (a c) cases 13 presented initially with brainstem encephalitis ; cases 1 and 2 relapsed with encephalopathy, psychiatric features, movement disorder, and dysautonomia. case 3 had a monophasic illness and did not have any of the clinical characteristics of nmdar - ab encephalitis. (d, e) cases 4 and 5 presented with herpes simplex virus encephalitis (hsve) and then had a neurologic relapse, which correlated with raised nmdar - abs in both serum and csf and demonstrated a clinical response to immunotherapy with reduction of antibody levels. (f) case 8 presented with optic neuritis and poor visual recovery, which prompted a neuroinflammatory screen and the identification of the antibody positivity. she only received a course of steroids 1 year into her illness and 3 years later had a neurologic relapse. (g) case 9 presented initially with 2 episodes of acute disseminated encephalomyelitis (adem) and relapsed at 1 year with optic neuritis. he was also mog - ab positive, which remain detectable even when nmdar - abs are no longer detectable and when the patient had clinically recovered. (h) case 10 had recurrent episodes of hyperventilation, dizziness, and double vision ; did not receive any treatment ; and both her clinical and radiologic features remained unchanged. ab = antibody ; csf ab 10 = nmdar antibody titers in csf (all between 1:20 and 1:50) multiplied by 10 to provide visibility in comparison to serum levels ; ivig = iv immunoglobulin ; ivmp = iv methylprednisolone ; leukoe = radiologic leukoencephalopathy ; lt = left ; mmf = mycophenolate mofetil ; nmdar = nmda receptor ; on = optic neuritis ; plex = plasma exchange ; rt = right ; serum ab titer = titer measured by endpoint dilution. clinical and paraclinical features in patients with nmdar - ab encephalitis clinical and paraclinical features of 8 patients with atypical nmdar - ab mediated cns disorder three patients had encephalopathy, predominant brainstem signs (cranial neuropathies and ataxia), and neuroimaging findings of brainstem abnormalities, or a clinical syndrome unequivocally localized to the brainstem. case 1 (m, age 18) had brainstem changes at presentation (figure 1a) but evolved to a polysymptomatic encephalopathy, with resolution of the brainstem changes (figure 1b). nmdar - abs were only detected a year later after a relapse but fell with immunotherapies with a good clinical response (figure 2a). case 2 (f, age 10) presented 3 weeks after first symptoms when her encephalopathy worsened with intractable seizures, movement disorder, and hyperpyrexia. she had recurrent periods of encephalopathy (figure 2b) associated with radiologic features of a leukoencephalopathy (figure 1d) that progressed over the following 5 years (figure 2b), when serum and csf nmdar - abs were first identified. case 3 (m, age 5), the most recent patient, presented with brainstem signs and cranial nerve enhancement ; nmdar - abs were identified within a few weeks of onset. he made a full recovery with steroids and plasma exchange (plex) (figure 2c). since we and others recognized a relationship between hsve relapses and nmdar - abs, we have identified 2 additional patients, cases 4 and 5 (m, age 2 ; f, age 16 months), with nmdar - abs in serum and csf (table 1) during neurologic relapses with substantial leukoencephalopathy on imaging (figure 1, e h) occurring within 2 months of hsve (headache, fever, seizures, typical imaging, and csf herpes simplex virus [hsv ] pcr positivity). case 4 presented with cognitive, behavioral, and motor decline, and case 5 presented with a further encephalopathic illness with new - onset movement disorder. both were treated with iv immunoglobulin (ivig) or plex, which resulted in clinical improvement and reduction of nmdar - ab titers (figure 2, d and e). five patients presented with ads classified according to the international pediatric ms study group criteria. case 6 (f, age 6) and case 7 (m, age 9), with bilateral optic neuritis, were treated with iv methylprednisolone followed by a weaning course of oral prednisolone. case 8 (f, age 11) presented with right optic neuritis and poor visual recovery ; she only received a course of oral steroids 1 year later and relapsed 3 years later with left optic neuritis and new brain lesions (figures 1i and 2f). case 9 (m, age 8) presented with adem, relapsed at 1 month with a second encephalopathic illness and imaging evidence of new brainstem lesions (figure 1j), and developed right and left optic neuritis at 12 and 13 months, respectively. at this stage, he was treated with mycophenolate mofetil with good visual recovery, no further relapse, and a reduction in nmdar - ab levels (figure 2 g). case 10 (f, age 10) had an unusual presentation of recurrent episodes of hyperventilation, dizziness, and double vision lasting from 2 days to more than 2 weeks (figure 2h). she has not been treated as the relevance of the nmdar - ab in her clinical and radiologic syndrome remains unclear. the mean follow - up time in the cohort was 34 months (median 30, range 860), and this was not significantly different between the patients with white matter syndromes (mean 27, median 30, range 854) and the other patients with nmdar - abs (mean 36, median 37, range 860). overall in the white matter patients, 6 of the 7 patients (85%) who were treated acutely improved following immunotherapy with steroids, ivig, and plex, either individually or in combination. at relapse, patients who were treated late (n = 2) or untreated (n = 1) had either a poorer outcome or persistence of symptoms. in 6 of the 7 patients with serial samples available, there were relationships between nmdar - ab titers and severity of clinical syndrome (figure 2, a mog antibodies did not disappear after treatment in case 9, even when nmdar - abs became undetectable and after clinical recovery (figure 2 g). serum levels of nmdar - abs ranged from 1:100 to 1:1,000 at the earliest sample available, with csf levels (cases 25) from 1:20 to 1:50. it is important that both serum and csf nmdar - ab titers were negative during the hsve that preceded nmdar - ab relapse in case 4 (figure 2d) ; the relevant samples were not available for case 5. after immunotherapies, antibody levels fell in all patients and became undetectable in cases 1, 3, 8, and 9. mog antibodies were found in only 3 of the 5 patients with ads (cases 6, 7, and 9) (table 1). cases 110 presented with distinct white matter changes, either radiologic changes compatible with the respective clinical syndromes (brainstem encephalitis and ads group) or a leukoencephalopathy in addition to the radiologic changes commonly observed within the relevant phenotype (brainstem encephalitis and hsve). these patients were radiologically distinct from the nmdar - ab encephalitis cases (table 1), where only 6 of 28 (21%) had abnormal neuroimaging, all sparing the white matter (p < 0.0001, fisher exact test). although 3 patients had classical nmdar encephalitis, in cases 1 and 2, these episodes were remote from the first neurologic syndrome (brainstem encephalitis), and in case 5, the nmdar - ab encephalitis occurred following hsve. in addition, 7 of the 10 cases (70%) had recurrent neurologic episodes, compared to only 6 of 28 patients (21%) with typical nmdar - ab encephalitis or 10 of 36 cases (28%) without white matter involvement (p = 0.003 and 0.02, respectively ; fisher exact test). oligoclonal bands were positive in the csf in 1 of 3 patients tested with white matter disorder compared to 14 of 18 with typical nmdar - ab encephalitis, although this was not statistically significant (p = 0.18, fisher exact test). finally, those patients with white matter disorders were more likely to have mog antibodies (30% vs 0% ; p = 0.008, fisher exact test) than those without white matter involvement. three patients had encephalopathy, predominant brainstem signs (cranial neuropathies and ataxia), and neuroimaging findings of brainstem abnormalities, or a clinical syndrome unequivocally localized to the brainstem. case 1 (m, age 18) had brainstem changes at presentation (figure 1a) but evolved to a polysymptomatic encephalopathy, with resolution of the brainstem changes (figure 1b). nmdar - abs were only detected a year later after a relapse but fell with immunotherapies with a good clinical response (figure 2a). case 2 (f, age 10) presented 3 weeks after first symptoms when her encephalopathy worsened with intractable seizures, movement disorder, and hyperpyrexia. she had recurrent periods of encephalopathy (figure 2b) associated with radiologic features of a leukoencephalopathy (figure 1d) that progressed over the following 5 years (figure 2b), when serum and csf nmdar - abs were first identified. case 3 (m, age 5), the most recent patient, presented with brainstem signs and cranial nerve enhancement ; nmdar - abs were identified within a few weeks of onset. he made a full recovery with steroids and plasma exchange (plex) (figure 2c). since we and others recognized a relationship between hsve relapses and nmdar - abs, we have identified 2 additional patients, cases 4 and 5 (m, age 2 ; f, age 16 months), with nmdar - abs in serum and csf (table 1) during neurologic relapses with substantial leukoencephalopathy on imaging (figure 1, e h) occurring within 2 months of hsve (headache, fever, seizures, typical imaging, and csf herpes simplex virus [hsv ] pcr positivity). case 4 presented with cognitive, behavioral, and motor decline, and case 5 presented with a further encephalopathic illness with new - onset movement disorder. both were treated with iv immunoglobulin (ivig) or plex, which resulted in clinical improvement and reduction of nmdar - ab titers (figure 2, d and e). five patients presented with ads classified according to the international pediatric ms study group criteria. case 6 (f, age 6) and case 7 (m, age 9), with bilateral optic neuritis, were treated with iv methylprednisolone followed by a weaning course of oral prednisolone. case 8 (f, age 11) presented with right optic neuritis and poor visual recovery ; she only received a course of oral steroids 1 year later and relapsed 3 years later with left optic neuritis and new brain lesions (figures 1i and 2f). case 9 (m, age 8) presented with adem, relapsed at 1 month with a second encephalopathic illness and imaging evidence of new brainstem lesions (figure 1j), and developed right and left optic neuritis at 12 and 13 months, respectively. at this stage, he was treated with mycophenolate mofetil with good visual recovery, no further relapse, and a reduction in nmdar - ab levels (figure 2 g). case 10 (f, age 10) had an unusual presentation of recurrent episodes of hyperventilation, dizziness, and double vision lasting from 2 days to more than 2 weeks (figure 2h). she has not been treated as the relevance of the nmdar - ab in her clinical and radiologic syndrome remains unclear. the mean follow - up time in the cohort was 34 months (median 30, range 860), and this was not significantly different between the patients with white matter syndromes (mean 27, median 30, range 854) and the other patients with nmdar - abs (mean 36, median 37, range 860). overall in the white matter patients, 6 of the 7 patients (85%) who were treated acutely improved following immunotherapy with steroids, ivig, and plex, either individually or in combination. at relapse, patients who were treated late (n = 2) or untreated (n = 1) had either a poorer outcome or persistence of symptoms. in 6 of the 7 patients with serial samples available, there were relationships between nmdar - ab titers and severity of clinical syndrome (figure 2, a mog antibodies did not disappear after treatment in case 9, even when nmdar - abs became undetectable and after clinical recovery (figure 2 g). serum levels of nmdar - abs ranged from 1:100 to 1:1,000 at the earliest sample available, with csf levels (cases 25) from 1:20 to 1:50. it is important that both serum and csf nmdar - ab titers were negative during the hsve that preceded nmdar - ab relapse in case 4 (figure 2d) ; the relevant samples were not available for case 5. after immunotherapies, antibody levels fell in all patients and became undetectable in cases 1, 3, 8, and 9. mog antibodies were found in only 3 of the 5 patients with ads (cases 6, 7, and 9) (table 1). cases 110 presented with distinct white matter changes, either radiologic changes compatible with the respective clinical syndromes (brainstem encephalitis and ads group) or a leukoencephalopathy in addition to the radiologic changes commonly observed within the relevant phenotype (brainstem encephalitis and hsve). these patients were radiologically distinct from the nmdar - ab encephalitis cases (table 1), where only 6 of 28 (21%) had abnormal neuroimaging, all sparing the white matter (p < 0.0001, fisher exact test). although 3 patients had classical nmdar encephalitis, in cases 1 and 2, these episodes were remote from the first neurologic syndrome (brainstem encephalitis), and in case 5, the nmdar - ab encephalitis occurred following hsve. in addition, 7 of the 10 cases (70%) had recurrent neurologic episodes, compared to only 6 of 28 patients (21%) with typical nmdar - ab encephalitis or 10 of 36 cases (28%) without white matter involvement (p = 0.003 and 0.02, respectively ; fisher exact test). oligoclonal bands were positive in the csf in 1 of 3 patients tested with white matter disorder compared to 14 of 18 with typical nmdar - ab encephalitis, although this was not statistically significant (p = 0.18, fisher exact test). finally, those patients with white matter disorders were more likely to have mog antibodies (30% vs 0% ; p = 0.008, fisher exact test) than those without white matter involvement. three distinct white matter clinicoradiologic syndromes brainstem encephalitis, leukoencephalopathy following hsve, and cns demyelination were identified in 10 of 46 (22% ; 95% confidence interval 11%36%) consecutive children from 6 centers in the uk in whom nmdar - abs were detected. the antibodies were present at high titers (up to 1:1,000), and all available csfs were positive (up to 1:50). collectively, relapses were seen in 63% (5/8) of our cohort (excluding the 2 hsve cases), a rate higher than that seen in our classical nmdar encephalitis patients (28% ; 6/28) or than previously reported. this included 2 of the 3 patients with brainstem encephalitis, usually a monophasic disease, and 3 of the 5 patients (60%) in the ads group, in which relapses are seen in 25% of patients. nevertheless, there was a good response to immunotherapies once the antibodies were detected, and improvement broadly paralleled serum nmdar - ab levels over the following months. it is well known that antibodies can diffuse into the area postrema, as in neuromyelitis optica, and other brainstem regions may also be permeable, as inferred recently from rodent studies. however, although brainstem encephalitis is assumed to be due to autoimmune and inflammatory etiologies, no disease - defining autoantibodies have been defined to date. brainstem encephalitis does share clinical features with nmdar - ab encephalitis, and it was suggested that one of the original reported cases of bickerstaff brainstem encephalitis had features of nmdar - ab encephalitis. hypoventilation, probably due to disruption of the medullary - pontine respiratory network and leading to ventilator dependency despite the improvement of the encephalopathy, was seen in case 3. typically, however, brainstem involvement in nmdar - ab encephalitis manifests as autonomic symptoms such as hyperthermia, blood pressure liability, arrhythmias, hypersalivation, and urinary incontinence, and is usually seen more frequently in adults than in children. distinct episodes of classical nmdar - ab encephalitis were observed in 2 of the 3 patients with brainstem encephalitis. although the nmdar - ab positivity in both cases (cases 1 and 2) could only be determined in sera taken during relapses, when they were polysymptomatic, the identification of nmdar - abs (serum and csf) in case 3 during the acute phase of brainstem encephalitis suggests that the initial brainstem event in all 3 patients could represent a localized form of nmdar - ab mediated brainstem inflammation. early and optimal treatment, as in case 3, may prevent the subsequent evolution to a more generalized nmdar - ab encephalitis. there have been recent reports that nmdar - abs, often with choreoathetosis, can be identified before and/or during neurologic relapses following hsve. the distinct white matter changes seen in both the hsve relapse patients (figure 1, e h) are atypical for nmdar encephalitis, although we have previously described this radiologic feature in 1 child who relapsed following hsve, and these striking leukoencephalopathic changes were also evident in a patient in the brainstem encephalitis group (case 2, figure 1, c and d). following immunotherapy, both patients with hsve improved clinically, and, in the 1 patient imaged after treatment, significant radiologic improvement was demonstrated. the relevance of leukoencephalopathy in these syndromes requires further evaluation ; its detection by mri could be a useful biomarker for patients at risk of relapses after hsve or brainstem encephalitis, with obvious treatment implications. there is a growing interest in the role of cns antibodies in demyelination, stemming from the discovery of aqp4 antibodies in neuromyelitis optica and detection of mog antibodies in a range of ads, although the clinical use of mog antibodies as a marker of disease activity and prognosis is still being evaluated. of interest, 3 of the 5 patients in the ads group, 2 with bilateral optic neuritis (cases 6 and 7) and 1 (case 9) who presented with adem followed by recurrent optic neuritis, had antibodies to mog as well as nmdar. both these demyelinating phenotypes are recognized in children with mog antibodies, suggesting that these antibodies may have contributed to the clinical picture in addition to the nmdar - abs. an association between nmdar antibodies and cns demyelination has been recognized in individual cases with both monophasic and relapsing syndromes, but it is unknown whether these antibodies are causative or secondary to the demyelination. as nmdars are activated on oligodendrocytes following ischemia, the white matter may be a target for antibodies following prior or recurrent neurologic insults ; this could be the case in our patients who had either a distinct previous neurologic syndrome (hsve and brainstem encephalitis) or frequent relapses of demyelination. furthermore, upregulation of nmda receptor subunits, in particular highly calcium permeable nr2b - containing and magnesium - insensitive nr3a nmdars, appears to increase the vulnerability of the white matter to injuries in the developing brain, and such age - specific nmdar subunit composition could also predispose children with an actively myelinating cns to developing leukoencephalopathies, thus explaining the high rate of white matter involvement in this pediatric nmdar - ab positive cohort. experimental studies looking at the role of nmdars in white matter suggest their importance in remyelination and the regenerating optic nerve, which could possibly explain the slow visual recovery seen in cases 6 and 8 ; if they are induced secondary to the demyelination, the nmdar - abs may cause a loss of function and reduce this beneficial response to nerve injury. it was the leukoencephalopathy, and the less severe but distinct white matter changes, that drew our attention to these patients. in fact, advanced neuroimaging techniques are starting to identify white matter abnormalities in patients with anti - nmdar encephalitis with no apparent abnormality on conventional imaging, suggesting that perturbations in white matter tracts are more widespread than previously thought. these could be mediated by direct antibody binding to nmdar on oligodendrocytes, as discussed above, and/or secondary to neuronal glutamate - mediated excitotoxicity. although the improvement following immunotherapy in our patients with white matter disorders could simply reflect the natural history of these conditions, the poorer outcomes of those untreated or treated later and the parallel reduction or resolution of antibody levels provide evidence that whatever the origins and roles of the nmdar - abs, their removal can be helpful. only 3 of 10 patients with white matter syndromes had csf available for testing. however, in each of the patients reported here, including the 11 with typical nmdar - ab encephalitis, serum levels were higher than those in the paired csfs. although the added sensitivity of csf nmdar - ab evaluation has recently been reported, whether serum analysis without an available paired csf can result in a the definition of a false - positive requires a gold standard clinical diagnosis, which, in the context of an expanding phenotype such as that described here, can not be established. moreover, since nmdar - abs can remain detected in both serum and csf after the patient has recovered, a positive result does not necessarily reflect false positivity but merely that the antibodies are not causing a detectable neurologic syndrome. our suggestion would be that csf testing, if unavailable initially, should be performed if the serum is negative with a strongly suggestive clinical phenotype or, conversely, can be used to provide further support for the clinical relevance of the serum antibodies in patients in whom the clinical features are less typical. other limitations of this study include the retrospective nature of the cohort collection and the small sample size that is further confounded by the heterogeneous clinical phenotypes. further studies are now required to confirm our observation that children and adults with nmdar - abs can present with these distinct clinicoradiologic white matter syndromes and to determine whether, and if so how, nmdar - abs bind to white matter, in which patients and clinical syndromes it could be relevant, and the treatment implications. yael hacohen : acquisition of data, analysis or interpretation of data, drafting / revising the manuscript, study concept or design. camilla buckley : acquisition of data, drafting / revising the manuscript, study concept or design. angela vincent : analysis or interpretation of data, drafting / revising the manuscript, study concept or design, study supervision. ming lim : analysis or interpretation of data, drafting / revising the manuscript, study concept or design, study supervision. this work was supported by the national institute for health research (nihr) oxford biomedical research centre based at oxford university hospitals nhs trust and the university of oxford (y.h.) ; the oxford university clinical academic graduate school (y.h.) ; the nhs specialized services for rare diseases (neuromyelitis optica ; p.w. and a.v.) ; and eruk, uk - us fulbright commission and ms society (s.r.i.). yael hacohen, leslie jacobson., sunil pullaperuma, and ata siqddqui report no disclosures relevant to the article. jean - pierre lin is chair of the british paediatric neurology association movement disorders special interest group and is medical advisor to the european dystonia federation and faculty of dystonia europe ; has received research grants from action medical research, the dystonia society (uk), and guy 's and st thomas ' charity ; and has acted as a consultant and received funding for travel and speaker honoraria from medtronic ltd. michael g. pike receives research grants from action medical research and ms society and has received a meeting support grant from euroimmun. evangeline wassmer receives research grants from action medical research and ms society ; has received travel grants from ucb, shire, and biogen idec ; has received educational grants to organize meetings from merck serono, novartis, bayer, and biogen idec ; and has received speaker 's fees from merck serono and consultancy fees from genzyme. patrick waters is supported by the nhs national specialized commissioning group for neuromyelitis optica and by the nihr oxford biomedical research centre. sarosh irani serves on the scientific advisory board for encephalitis society and has received an nihr fellowship, department of health, uk. angela vincent serves / has served on scientific advisory boards for the patrick berthoud trust, the brain research trust, and the myasthenia gravis foundation of america ; has received funding for travel and a speaker honorarium from baxter international, inc. and biogen, inc. ; serves as an associate editor for brain ; receives royalties from the publication of clinical neuroimmunology (blackwell publishing, 2005) and inflammatory and autoimmune disorders of the nervous system in children (mac keith press, 2010) ; receives / has received research support from the european union, nihr biomedical research centre oxford, euroimmun ag, and the sir halley stewart trust ; and has received musk antibody royalties and consulting fees from athena diagnostics, inc. ming lim receives research grants from action medical research and ms society ; receives research support grants from the london clinical research network and evelina appeal ; has received consultation fees from csl behring ; received travel grants from merck serono ; and was awarded educational grants to organize meetings by novartis, biogen idec, merck serono, and bayer. sarosh irani, patrick waters, angela vincent, and the university of oxford hold patents and/or receive royalties and payments for antibody assays in neurologic diseases.	objective : to report the clinical and radiologic findings of children with nmda receptor (nmdar) antibodies and white matter disorders.method:ten children with significant white matter involvement, with or without anti - nmdar encephalitis, were identified from 46 consecutive nmdar antibody positive pediatric patients. clinical and neuroimaging features were reviewed and the treatment and outcomes of the neurologic syndromes evaluated.results:three distinct clinicoradiologic phenotypes were recognized : brainstem encephalitis (n = 3), leukoencephalopathy following herpes simplex virus encephalitis (hsve) (n = 2), and acquired demyelination syndromes (ads) (n = 5) ; 3 of the 5 with ads had myelin oligodendrocyte glycoprotein as well as nmdar antibodies. typical nmdar antibody encephalitis was seen in 3 patients remote from the first neurologic syndrome (2 brainstem, 1 post - hsve). six of the 7 patients (85%) who were treated acutely, during the original presentation with white matter involvement, improved following immunotherapy with steroids, iv immunoglobulin, and plasma exchange, either individually or in combination. two patients had escalation of immunotherapy at relapse resulting in clinical improvement. the time course of clinical features, treatments, and recoveries correlated broadly with available serum antibody titers.conclusion:clinicoradiologic evidence of white matter involvement, often distinct, was identified in 22% of children with nmdar antibodies and appears immunotherapy responsive, particularly when treated in the acute phase of neurologic presentation. when observed, this clinical improvement is often mirrored by reduction in nmdar antibody levels, suggesting that these antibodies may mediate the white matter disease.
the present paper focuses particularly on one of the simplest and most potent lysophospholipids, lysophosphatidic acid (lpa), and summarizes recent knowledge on its biological impact on human and ruminant reproduction. lysophosphatidic acid is a simple phospholipid that exerts many physiological and pathological actions on various cell types, such as cell proliferation and differentiation, cytoskeletal rearrangement, cell - to - cell interactions, and tumorigenesis. so far lpa has been detected in many various biological fluids such as serum and plasma [57 ], tears, ascites, seminal plasma, and follicular fluid. moreover, it can also be produced in various cell types like endometrial cells [12, 13 ], ovarian cells [12, 1416 ], mast cells, erythrocytes, neurons, and many others. while the precise mechanism of lpa metabolism within most types of cells is still unclear, two general pathways of lpa production have been demonstrated. in the first pathway phosphatidic acid (pa) is produced from phospholipids (pls) by phospholipase d (pld), also called autotaxin (atx) or from diacylglycerol by diacylglycerol kinase. in both pathways there is deacylation of pa to lpa by phospholipase (pla)-type enzymes. in the second pathway, pls are first converted to lysophospholipids (lpls) by the action of secretory (spla2), ps - pla1, and lecithin - cholesterol acyltransferase (lcat), and then the lpl is converted to lpa by atx. the first pathway is mainly involved in cellular lpa production, while the second pathway is involved in lpa production in extracellular body fluids, especially in serum and plasma. these various ways of lpa synthesis reflect multiple levels of regulation or deregulation in the organism being at different physiological or pathological status cancers, pregnancy, hypertension, prostate disease, or obesity. moreover, lpa - dependent different signaling pathways have clear therapeutic repercussions since pharmaceutical drugs targeting certain enzymes would differ from those targeting other lpa biosynthetic pathways [26, 27 ]. in mammals, lpa exerts its action via at least six high affinity, transmembrane g - protein - coupled receptor (gpcr) types, lpar1lpar6, and possibly through a nuclear receptor ppar [22, 2831 ]. for example, lpar1 is highly expressed in the nervous system, lpar2 in immune organs such as the thymus and spleen, and lpar3 in reproductive organs such as the ovary and uterus [7, 16, 34, 35 ]. on the other hand, lpar4, lpar5, and lpar6 we can find lpar4 expression in the ovary, lpar5 expression in the small intestine, spleen, dorsal root ganglion, and embryonic stem cells. however, there is also much evidence of an aberrant expression of lpa receptors in certain diseases, meaning especially different types of cancer [37, 38 ]. the influence of lpa on the reproductive system function of the female has been examined and described for about 30 years. since the first reports published by jarvis. in women, various abnormalities in reproductive performance on different regulatory levels due to lpa signaling and lpars knockout have been also reported in many farm animals including ruminants [34, 35, 40 ]. physiologically, lpa and its active lpars have been documented to be present in female reproductive organs, such as uterus [20, 41, 42 ], ovary [43, 44 ], and placenta [43, 45, 46 ] as well as in the amnion - derived cells in vitro. interestingly serum atx level was higher in women than in men, suggesting possible influence of lpa on the female reproduction. follicular fluid of the human preovulatory follicle contains lysophospholipase d atx which is responsible for local lpa production from lysophosphatidylcholine (lpcs). however lpa in ovaries is produced not only from follicular fluid 's lpcs, but also from lpcs in granulosa cells and oocytes. in follicular fluid taken from women programmed for in vitro fertilization the amount of lpa increases with the time of incubation with atx in 37c. serum atx activity from patients receiving ovarian stimulation was higher than in women with natural cycles. moreover, chen. demonstrated mrna expression of three lpa receptors, lpar1, lpar2, and lpar3, in the granulosa - lutein cells from women undergoing in vitro fertilization. lpa signaling plays many crucial roles in ovarian function such as ovulation, for example. before ovulation lpa elevated the level of il-8, expressed its chemotactic activity for neutrophils, started the inflammatory reaction, and in consequence led to tissue degradation and rupture of the follicle. during the luteal phase human ovary exhibits complete tissue remodeling with the stages of growth, differentiation, and regression. in the early luteal phase granulosa and theca cells lpa through the upregulation of il-8 and il-6 stimulated the multistep process of new vessels formation in the cl. moreover, lpa induced expression of angiogenic cytokines, il-6, and il-8, in granulosa - lutein cells from women undergoing in vitro fertilization. thus, the authors concluded that the induction of these cytokines by lpa, through its receptor and nuclear factor - kappab - dependent pathway, in the stimulated ovaries may contribute to ovarian hyperstimulation syndrome. more than a decade ago tokumura. suggested the involvement of lpa signaling in maintenance of human pregnancy. these authors demonstrated increasing levels of lpa and serum atx / lysopld activity during pregnancy. the elevated levels of serum lpa found during pregnancy were reported to arise from both the placenta and the fetus. in the human placenta lpa can be produced locally by trophoblasts atx and thereby control trophoblast proliferation, differentiation, feto - maternal immune interaction, and placental vascular remodeling. during early pregnancy lpa, through induction of il-8, could stimulate the process of angiogenesis in the placenta. kim. also found that lpa modulated cellular activity and stimulated proliferation of human amnion cells in vitro. moreover, jarvis. documented high lysopld activity in human placental tissues, with the highest in the amnion. the authors suggested that high lysopld activity in the amnion proclaimed that lpa might be involved in the regulation of labor, due to the direct implications of this membrane in the initiation of the labor. moreover, jeng. demonstrated that lpa upregulated transcriptional activity of oxytocin (ot) receptors in vitro which resulted in sensitization of myometrial cells to ot. in uterus in the end of gestation the sensitivity of myometrium to ot increases robustly, which in turn induces uterine contractions leading to labor. other important process in induction and maintenance of smooth muscle contraction is stress fiber formation. lpa enhanced stress fiber formation in human myometrial cells in vitro and thereby increased the efficiency of uterine contractions in the beginning of labor. the process of embryo implantation includes interaction between the endometrium and the embryo (adhesion and invasion), inflow of innate immune cells, and vascularization. lpa has been presented to be involved in implantation on many various levels. in human decidual cells, it also stimulated chemotaxis of nk cells and monocytes by inducing the transcription of mcp-1 and gro-, respectively, and thereby contributed to regulation of the innate immunity of the fetus. documented that lpa activated lymphocytes and dendritic cells that induced inflammatory reaction which is essential in the process of implantation. moreover, in an in vitro model of embryo implantation lpa increased the outgrowth of embryos on decidual cells. through il-8 stimulation lpa participated in new vessels formation around the embryo. the pleiotropic roles of lpa in the function of the reproductive tract are demonstrated not only by the increased amount of lpa in body fluids and in the area of reproductive organs but also by the tissue - specific, regulated expression of its receptors. wei. demonstrated that lpar3 levels decreased in the middle and late secretory endometrium (when the implantation occurs) of women with endometriosis. decreased lpar3 expression was correlated with the expression of other uterine receptivity biomarkers, such as osteopontin or hoxa10, all regulated by progesterone (p4). the authors claimed that reduced expression of these genes may explain p4 resistance associated with endometriosis. detected high levels of lpar2 and lpar3 gene expression in the placentas of patients with gestational hypertension and preeclampsia. moreover, it has been documented that lpa elevated arterial blood pressure and vasoconstriction. taking into consideration, increasing levels of lpa during pregnancy and lpa involvement in elevating blood pressure, we might suppose the adverse effects of this lipid in the terminating stages of pregnancy. in addition, accumulation of lpa in blood contributed to platelet - monocyte coaggregate formation as well as enhanced platelet aggregation and adhesion which in turn might have resulted in thrombosis during pregnancy. also presented the direct association of elevated levels of lpa in blood circulation with induction and/or progression of systemic vascular dysfunction seen in patients with preterm labor or preeclampsia. on the other hand, lpa might also contribute indirectly to infection - related preterm labor via the induction of arachidonic acid (aa) metabolites. presented elevated levels of lpc, the substrate for lpa, and aa in human uterine endometrial cells exposed to extracts from pathogens involved in intrauterine infection. lpa signaling may also play a role in pathogenesis of both benign and malignant endometrial tumors. billon - denis. presented lpa influence on the growth of leiomyomas or fibroids. treatment of leiomyoma tumor - derived cell line with lpa entailed dna synthesis through erk activation. the authors also proposed that lpa produced in leiomyomas in vivo may have been involved in tumor cell proliferation. there are also reports indicating that lpa promoted endometrial cancer invasion via the induction of matrix metalloproteinase-7 (mmp-7) [64, 65 ]. used the cervical cancer cell line, hela, to study the roles of lpa in cervical cancer. in these studies, suggested the involvement of the upregulation of lpar2, but not lpar1 or lpar3, in the mammary gland carcinoma pathogenesis in the breast cancer of postmenopausal women. other studies from breast cancer cell lines indicated that both lpar1 and lpar2 mediated lpa - induced chemotaxis in breast carcinoma cells. boerner. demonstrated that lpa - dependent overexpression of egf receptor (a prognostic indicator of a poor outcome in tumors) was involved in breast cancer progression. ovarian cancer is the most thoroughly studied cancer with respect to lpa signaling in carcinogenesis. there are two types of data in the literature, demonstrating the direct and indirect roles of lpa in the pathogenesis of the tumors. sutphen. and xu. demonstrated that elevated levels of lpa in the plasma and ascites of ovarian cancer patients, promoted ovarian cancer cell proliferation. lpa signaling may also exert its role in ovarian cancers indirectly through regulating telomerase, involved in tumor progress, il-6 and il-8 involved in tumor angiogenesis, or cox-2, correlated with possibility of metastasis. moreover, the regulation of lpars may also play a significant role in lpa signaling in ovarian cancer. wang. proved that lpar2 and lpar3 were upregulated in ovarian cancer tissues.. demonstrated that lpar3 was a key receptor for mediating the chemotactic activity of lpa in ovarian tumors. on the other hand, lpar1 was demonstrated to be the key receptor in mediating ascitic lpa effects on other cells. overlooking the available data in the literature on the role of lpa in human reproduction we can summarize that the past decade shaded new light on the importance of lpa signaling not only under physiological but also pathological conditions. lpa is produced locally in human reproductive tissues and controls ovarian cycle and pregnancy as well as various abnormalities in the female reproductive tract. engagement of lpa in the maintenance of pregnancy manifests by its action on the uterus, ovary, fetal membranes, and placenta. lpa can also affect the fetus itself by controlling the process of implantation and vascularization of the embryo. however, there are also reports on adverse effects of lpa in the female reproduction, especially during tumorigenesis. since in the available literature there are often registered opposite effects of lpa on the reproductive performance in human as well as the research on human tissues is ethically restricted and new lpa - targeted therapeutic strategies are demanded, it is important to find a good animal model to study lpa influence on the function of the female reproductive organs. properly designed studies to examine the effects of lpa on the reproductive performance in humans should be done in human subjects. however, this is very hard to accomplish, since human studies are difficult to carry out because of their typical complexity and dependence on mostly retrospective data rather than the treatment - based outcomes measured in animal models including the bovine one. moreover, all the complications in the design and interpretation of human studies, combined with the ethical issues regarding experimentation in humans, continuously increase interest in studies that utilize animal models. on the other hand, the relevance of studies performed in animal models to human health has been questioned many times in the literature, since in almost all animals used as a model many weak points can be found. taking above arguments into consideration, it has been well documented in the literature that the cow can be one of the quite relevant animal models for studying human reproduction. in the bovine reproduction we can find many similar aspects in the ovarian physiology, early embryo development, pregnancy as well as assisted reproductive techniques [79, 80 ]. therefore, we believe that the cow model has broad applicability and may be used to extend investigations to different physiologic / pathologic states and to other species including humans. moreover, the bovine model ensures a greater availability of biological material compared to studies in human. in the bovine ovary, boruszewska. demonstrated atx and pla2 expression in bovine granulosa cells, which documented the possibility of lpa synthesis in bovine follicles, with atx playing the major role in this process (figure 1). lpa was also detected in picomole concentrations in the bovine cl throughout the estrous cycle and early pregnancy. the concentration of lpa in the cl increased from days 24 to days 1719 of the estrous cycle and during the estrous cycle was significantly higher than during early pregnancy. the detected presence of lpa as well as enzymes responsible for lpa synthesis and specific lpars in the cl tissue and the follicle indicate that bovine ovary can be a site of lpa synthesis during the estrous cycle and early pregnancy [7, 16, 81 ]. in ruminant uterus, the influence of lpa on the endometrial function was studied for the first time by liszewska. in sheep. the authors found increased levels of lpa in ovine uterus at the time of early pregnancy, suggesting that lpa signaling contributed to the cross - talk between mother and embryo at the beginning of gestation. in the cow, we were the first to demonstrate that lpa is locally produced and released from bovine endometrium during estrous cycle and early pregnancy. we found significantly higher concentration of lpa in the blood taken from uterine vein on days 1719 of the estrous cycle than in the blood from jugular vein. lpa concentration in the bovine endometrium did not differ either during estrous cycle or early pregnancy (before implantation) ; however, it was significantly higher on days 1719 of pregnancy than on days 1719 of the estrous cycle. studying intracellular localization of the enzymes responsible for endometrial lpa synthesis, we demonstrated that atx and pla2 were immunoexpressed both in epithelial and stromal cells [82, figure 1 ].. also found that lpa concentration was significantly higher in epithelial than instromal cells and atx and pla2 expression was higher in epithelial than instromal cells in bovine endometrium. this study demonstrated that epithelial cells are the main source of lpa in the bovine endometrium. similarly, in sheep, liszewska. found apical localization of atx in glandular and luminal cells of endometrium. liszewska. also documented that atx level was 4- to 5-fold higher in the ovine uterus than in the trophectoderm. the authors postulated that lpa detected in the ovine uterus may be due to atx activity on the maternal side. however, in ovine conceptuses elevating expression of atx was also demonstrated, which documented that the trophectoderm may also contribute to the production of lpa during pregnancy. the data obtained in cows and sheep strongly suggest thatepithelial cells of the bovine endometrium are the main source of lpa inthese species. however, a supporting role of stromal cells in lpa synthesis can not be excluded. the potential role of lpa depends on both its local concentration and the distribution of lpars in the area of reproductive tissues. in the bovine follicle, boruszewska. detected all types of lpars at mrna level in granulosa cells (figure 1) however, lpar1 transcript abundance was approximately 16- to 23-fold higher than expression of lpar2, lpar3, and lpar4 mrna. in the bovine cl however, of the four lpars examined, lpar2 and lpar4 were expressed the most strongly in the bovine cl [16, figure 1 ]. in the bovine cl, high expression of lpar4 compared with the other receptors during the estrous cycle and early pregnancy, as well as the dynamic changes of lpar2 and lpar4 during early pregnancy, probably accounts for the contribution of lpa to different events during the estrous cycle and pregnancy, namely, the contribution to p4 secretion, modulation of interferon (ifn) action during early pregnancy, or modulation of luteolysing cytokines action in the cl at the late luteal stage. the data obtained by kowalczyk - zieba. in the bovine cl do not completely agree with the results of budnik and brunswig - spickenheier, who showed that lpa exerted its actions on bovine luteal cells only via lpar2. the mrna expression of all lpars in granulosa cells as well luteal cells indicates that the bovine follicle and the cl represents a target for lpa action in the bovine reproductive system. in sheep, liszewska. demonstrated that the expression of lpar1 and lpar3 in the ovine endometrium was regulated according to the estrous cycle. on the other hand, at day 12 of pregnancy, expression of both lpar1 and lpar3 in the endometrium was significantly reduced in comparison with day 12 of the estrous cycle. the authors supposed that the decrease of lpars expression in the endometrium was the result of the beginning of rapid growth and elongation of the ovine embryo, as well as modulation by various factors from conceptus origin. however, in the ovine trophectoderm during the peri - implantation period lpar1 and lpar3 expression was the most abundant at the time of embryo implantation. moreover, liszewska. demonstrated perinuclear / nuclear and membrane localizations of lpar1 in ovine conceptuses and trophectoderm cells cultivated in vitro, whereas lpar3 was found only in the cell membrane in both systems. in the ovine uterus, lpar1 was predominantly present in the stromal tissue, whereas lpar3 was mostly detected in the epithelial structures. in the bovine endometrial tissue lpar1 expression increased from early to late luteal stage of the estrous cycle and reached the highest level at late luteal stage and on days 1719 of early pregnancy. on the other hand, lpa1 expression on days 810 of pregnancy was lower than that on days 1719 of pregnancy but higher than on days 810 of the estrous cycle. boruszewska. found higher lpar1 expression in stromal than in epithelial cells. these results are in agreement with the fact that lpa on days 810 and 1618 of the estrous cycle and early pregnancy stimulated prostaglandin (pg) e2 synthesis only in the in vitro cultured stromal cells [13, 40 ]. the overall results suggest that lpa in bovine endometrium is produced mainly by epithelial cells and affects mostly stromal cells acting via lpar1. studying receptor and intracellular mechanism of lpa action in the ovine trophectoderm cells, liszewska. found that lpa stimulated the phosphorylation of erk1/2 in vitro and a specific antagonist of lpar1 and lpar3 receptors (vpc32183) blocked this effect. this study directly evidenced that lpars operate and are functionally coupled to signal transduction mechanisms in trophectoderm cells. in other cell types, the activation of erk1/2 accounts for the proliferative effect of lpa. therefore, liszewska. claim that lpa amongst other factors in the uterus may be involved in the elongation of the conceptus during the peri - implantation period in the sheep as well as in mediating the cellular differentiation required for ovine embryo implantation. [34, 85 ] also reported that lpa stimulated changes in the organization of actin and tubulin architecture in ovine trophectoderm cells as well as in uterine epithelial cells in vitro. therefore the authors suggested that lpa may be involved in the mechanisms regulating morphological changes both in the embryo and the uterus during conceptus adhesion to the uterus in ewes during the implantation process liszewska. the studies concerning receptor and intracellular mechanisms of lpa action in the bovine endometrial cells revealed that lpa stimulated pge2 production, cell viability, and intracellular calcium ion mobilization in the cultured stromal endometrial cells via lpar1 receptor activation. in ruminants, the dynamic lpa synthesis and lpars expression and action in the follicle, cl and uterus suggest that lpa plays autocrine and/or paracrine roles in the reproductive tract acting via various active lpars. in bovine follicles, were the first to demonstrate the influence of lpa on e2 synthesis and secretion in the granulosa cells (figure 1). the authors documented that lpa and lpa together with fsh stimulated e2 production by cultured granulosa cells in vitro [81, figure 1 ]. since e2 promotes follicular development by regulating steroid production and the expression of gonadotrophin receptors in the bovine granulosa cells [8890 ], boruszewska. presumed that lpa participated in ovarian follicle growth and differentiation it has been well documented that e2 secretion is stimulated by fsh [91, 92 ], which acts by binding to specific, transmembrane fsh receptor (fshr) [88, 89 ]. documented that lpa and lpa together with fsh stimulated fshr gene expression in bovine granulosa cells. boruszewska. also investigated the effect of lpa on the e2 synthesis pathway. granulosa cells are able to convert thecal androgens to e2 by cytochrome p450 aromatase (cyp19a1) and 17-hydroxysteroid dehydrogenase- (17-hsd-) catalyzed reactions [88, 90, 92, 93 ]. in the study of boruszewska., lpa did not influence cyp19a1 transcript level, while treatment with lpa, fsh, and lpa together with fsh resulted in increased 17-hsd mrna expression in granulosa cells (figure 1). concluding, lpa stimulates e2 production and fsh action in granulosa cells of the bovine ovarian follicle via increased expression of the fshr and 17-hsd genes, which in turn might account for the participation of lpa in ovarian follicle growth and differentiation. in ruminants in vivo action of lpa it was demonstrated that lpa administered into aorta abdominalis affected p4 and pg secretion during the luteal phase of the estrous cycle. the dose of 1 g lpa administered into the aorta abdominalis stimulated p4 and pge2 concentration in the blood.. also showed that the inhibition of endogenous lpa action via the infusion of lpa1 receptor antagonist (ki16425) caused the decrease of p4 and pge2 concentrations, which suggested lpa influence on both endometrium and the cl.. found that in the heifers infused deeply into the vagina, near the cervix of the uterus with 1 mg lpa, spontaneous luteolysis was prevented, and the functional lifespan of the cl was prolonged in comparison with animals of the control group (figure 2). the possibility of lpa action on p4 synthesis in the steroidogenic cells of the bovine cl was confirmed in the in vitro studies of kowalczyk - zieba.. the authors found that lpa stimulated p4 secretion via stimulation of 3-hydroxysteroid dehydrogenase/5-4 isomerase (3hsd) expression in steroidogenic cl cells. we also found that lpa did not express only direct luteotropic action but also indirect luteoprotective role inhibiting cytokine mediated regression of the bovine cl. we examined the possibility of lpa - dependent modulation of tumor necrosis factor (tnf) and ifn actions at the late luteal stage when the luteolysing cytokines act the most. it has been documented before that tnf together with ifn can serve as mediators of luteolytic actions of pgf2 via inhibiting p4 production and stimulating apoptosis of the cultured bovine luteal cells [9496 ]. physiologically, in the organism, not only activated macrophages and lymphocytes produce tnf and ifn but also fibroblasts and endothelial cells [97, 98 ]. sakumoto. demonstrated that total amount of tnf and ifn rise significantly just after initiation of luteolysis, as the reason of a great amount of lymphocytes infiltrating the cl at this time. moreover, skarzynski. demonstrated before that tnf in low concentrations caused luteolysis (decreased p4 level), which could be augmented by various factors, including ifn. concerning the possibility of lpa - dependent modulation of tnf and ifn actions at the late luteal stage, woclawek - potocka. demonstrated that lpa reversed the inhibitory effect of tnf and ifn on p4 synthesis in the cultured bovine steroidogenic cells. these data are consistent with previous data obtained in vivo that lpa administered into aorta abdominalis or intravaginally increased p4 secretion in the cows during the luteal phase of the estrous cycle [7, 40 ]. in heifers, lpa - dependent prevention of the spontaneous luteolysis and prolongation of the functional lifespan of the cl in vivo were also reported before. these results seem to be important because the midluteal stage represents a critical period in the cl lifespan for p4 secretion. hypothesized that at the midluteal stage of estrous cycle, if the female becomes pregnant, that continued secretion of p4 from the cl can be directly supported by lpa or indirectly by reversing luteolyting action of tnf and ifn. woclawek - potocka. also documented that lpa suppressed tnf- and ifn-induced luteal cell apoptosis (figure 1), which is known to occur during structural luteolysis [102, 103 ]. in the bovine cl it was demonstrated that lpa inhibited the stimulatory effect of tnf and ifn on the expression of one of the mitochondrial regulatory proteins, bax, which in turn orientates the cells towards the survival state. in addition, apoptosis on the receptor level can also be initiated via tnf super family receptors (tnfrs).. demonstrated that tnf induced apoptotic cell death of cultured bovine luteal cells mainly acting via tnfr1, whereas tnfr2 is the type of the receptor associated mainly with the prosurvival action of this cytokine in the organism. in the study of woclawek - potocka, lpa inhibited only the stimulatory effect of tnf and ifn on tnfr1 expression in the cultured steroidogenic luteal cells on days 812 of the estrous cycle. the fas antigen (fas) also belongs to the tnf super family receptors which together with fas ligand (fasl) transmit basic signals controlling intercellular apoptosis pathway.. found that in the presence of lpa, tnf and ifn did not stimulate fas and fasl expression in the cultured steroidogenic luteal cells on days 812 of the estrous cycle. moreover, it has been documented before that the inhibition of intraluteal p4 action by various specific antagonists amplified fas l - mediated apoptosis viathe increase of fas and initiation of caspase (casp)8 and casp3 expressions as well as casp3 activity in cultured bovine luteal cells. high levels of casp8 directly initiate cleavage of an effector casp3, thereby initiating the execution phase of apoptosis. during apoptosis executed through the mitochondrial pathway, active casp8 stimulates the binding of proapoptotic casp to mitochondria and inhibits association of antiapoptotic bcl-2. this leads to the leakage of cytochrome c from the mitochondria into the cytosol, which in turn promotes formation of the apoptosome and triggers activation of the effector casp3. in the bovine cl, however, in the bovine cl the onset of apoptosis is not observed until p4 production has declined [108, 109 ]. in this aspect woclawek - potocka surmised that in the bovine cl, in the presence of lpa, p4 secretion was supported and also tnf and ifn could not induce apoptosis (figure 1). moreover, lpa reversed tnf- and ifn-induced apoptosis via inhibition of the stimulatory effect of the cytokines on the expression of bax, fas - fasl system, tnfr1, and casp3 activity in the cultured steroidogenic luteal cells, which orientated these cells towards the survival state. demonstrated that lpa had strong effect on p4 and pge2 secretion on days 1518 of early pregnancy (figure 3). moreover, the authors proved that blocking the effect of endogenous lpa by administration of vpc32183 significantly decreased pregnancy rate compared with control and lpa - treated heifers [40, figure 3 ]. lpa - induced pge2 secretion in vivo may indirectly support cl function [110, 111 ] and have roles in establishing and maintaining pregnancy [112, 113 ]. thus the authors suggested that lpa could be a luteoprotective factor in the bovine endometrium during both the estrous cycle and early pregnancy establishment in the cow. the data obtained in the above studies seem to be important because the examined time frame (days 1518) represent a critical period in the establishment of pregnancy. this is the time of the highest ifn production by the conceptus, just before implantation ; therefore, the interactions between lpa and ifn can not be excluded. the interactions between lpa and ifn were studied in vitro by kowalczyk - zieba. in bovine cl. the authors investigated whether lpa had a direct effect on p4 secretion from bovine luteal cells and whether it modulated ifn action in the luteal cells in vitro.. found that lpa stimulated p4 secretion from steroidogenic cl cells of the midluteal phase through stimulation of 3hsd expression in these cells (figure 1). these results are important because the midluteal stage represents a critical period in the cl lifespan for secretion of p4. hypothesized that at the examined time of estrous cycle, if the female becomes pregnant, continued secretion of p4 from the cl can be also supported by lpa. however, kowalczyk - zieba. did not find any modulation of ifn action on p4 secretion in the luteal cells of the bovine cl. on the other hand, kowalczyk - zieba. proved that lpa augmented ifn -dependent stimulation of ubiquitin - like ifn - stimulated gene 15 kda protein (isg15) and 2,5-oligoadenylate synthase (oas1) expression in the steroidogenic cells of the bovine cl (figure 1). these two genes are expressed in the bovine cl of both cyclic and pregnant cows regardless of pregnancy status but are upregulated only during early pregnancy [115, 116 ]. the data obtained in cows prove that lpa can be an additional auxiliary luteotropic factor acting in the cl and in the endometrium during both the estrous cycle and early pregnancy establishment. in ruminants, uterine pgs are crucial components in the regulation of estrous cycle and early pregnancy. prostaglandin f2 is the major luteolytic agent, whereas pge2 has luteoprotective and antiluteolytic properties [111, 117 ]. therefore, achieving an optimal pgf2 to pge2 ratio is essential for endometrial receptivity, maintenance of cl action, and p4 secretion as well as accurate pregnancy establishment. the dynamic pg synthesis and action in the bovine endometrium [111, 117, 118 ] and possible interactions between lpa and pgs as well as mechanisms of lpa synthesis [119, 120 ] were well evidenced in the literature. tested the hypothesis, whether lpa signaling affected endometrial aa metabolism not only in rodents [120122 ] and human but also in cattle. in the bovine endometrium, positive correlation between lpar1 and pges expression at early pregnancy was demonstrated. moreover, lpar1 expression was negatively correlated with the expression of pgfs during early pregnancy. the authors claimed that these correlations explained that pge2 and lpa act similarly and that pgf2 and lpa act differently during early pregnancy in cow. there are also data in the literature on the intracellular and enzymatic mechanisms of lpa- dependent stimulation of pg synthesis in the bovine endometrium [7, 40 ]. in the bovine uterus, lpa stimulated pge2 synthesis via pges mrna stimulation only in stromal cells on days 810 and 1618 of the estrous cycle and pregnancy [13, 40 ]. moreover, lpa inhibited pgf2 synthesis via pgfs mrna stimulation only in epithelial cells on days 810 and 1618 of pregnancy [13, 40 ]. suggested that lpa is an additional luteoprotective factor in the bovine endometrium during both the estrous cycle and early pregnancy. since pge2 stimulates cl function [110, 111 ] and has roles in establishing and maintaining pregnancy [112, 124 ], lpa, via stimulation of its synthesis, may be an important factor contributing to the establishment of pregnancy in the bovine endometrium. woclawek - potocka. also suggested that this effect might be additionally augmented by lpa - dependent inhibition of pgf2 synthesis during early pregnancy. the above data seem to be important, because the examined time frames are crucial phases during early pregnancy. first, days 810 represent the time of immunological pregnancy establishment as shown by kelemen., barnea., and majewska. moreover, days 810 after conception have recently been considered to be crucial in terms of early embryonic loss. in cattle, the major percentage of embryo loss occurs before day 16 following breeding, with some evidence pointing to greater losses before day 8 in high - producing dairy cows. on days 1618 of early pregnancy represent the time of the highest ifn production by the conceptus, just before implantation. therefore, the interactions between lpa and ifn at these phases can not be excluded. the data obtained in cows is consistent to a certain extent with data obtained in ovine trophectoderm cultured cells, in which lpa induced pgf2 and pge2 release. however, the authors of this study excluded the possibility of the effect of lpa on pg release via changes in the mrna expression of pges and pgfs. liszewska. claimed that, in the case of trophectoderm cells, the phosphorylation of pla2 by extracellular signal regulated kinase (erk) is a critical step in the sequence of events leading to mobilization of aa, as was demonstrated previously by an. in jurkat t cells in humans. liszewska. hypothesized, that in trophectoderm cells, lpa - mediated phosphorylation of erk may have caused rapid activation of pla2 that resulted in a burst of pg synthesis independent of any modifications in gene expression. however, there are also reports in human and rats that lpa increased pge2 synthesis in human monocytic and ovarian cancer cells [130, 131 ] as well as rat mesangial cells [132, 133 ] via upregulation of ptgs2. moreover, in mice, targeted deletion of lpar3 receptor resulted in implantation defects accompanied by a reduction in ptgs2 expression and the levels of pge2 and pgi2. despite different intracellular mechanisms of lpa - induced pg synthesis in the cow and ewe, a new biological function for lpa interaction with pgs in the contribution of pregnancy establishment in cows and in the regulation of the implantation process and embryonic development in ewes was designated in ruminants. there is overwhelming evidence in many studies using a ruminant model that lpa signaling can have significant consequences for reproductive health. the effects of lpa depend on many various conditions such as the target tissue and physiological status of the animal as well as the phase of the estrous cycle or pregnancy. however, the most important issue connected with lpa signaling is the fact that there is the possibility of lpa synthesis directly in the area of the reproductive tissues. therefore, it is crucial to examine carefully the effects of this biologically active compound on reproductive outcomes using animal models that can the most closely mimic reproductive processes in human. in spite of many limitations in conducting well - designed human studies, information gathered from already published ones combined with the large number of the studies already available in ruminants, clearly demonstrate that lpa has the ability to influence the reproductive performance of an adult female.	lysophosphatidic acid (lpa) through activating its g protein - coupled receptors (lpar 16) exerts diverse cellular effects that in turn influence several physiological processes including reproductive function of the female. studies in various species of animals and also in humans have identified important roles for the receptor - mediated lpa signaling in multiple aspects of human and animal reproductive tract function. these aspects range from ovarian and uterine function, estrous cycle regulation, early embryo development, embryo implantation, decidualization to pregnancy maintenance and parturition. lpa signaling can also have pathological consequences, influencing aspects of endometriosis and reproductive tissue associated tumors. the review describes recent progress in lpa signaling research relevant to human and ruminant reproduction, pointing at the cow as a relevant model to study lpa influence on the human reproductive performance.
in recent years, there has been considerable interest in the clinical significance of subthreshold depression (ie, the presence of clinically relevant depressive symptoms that do not meet the full criteria of a major depressive episode [mde ]) in adolescence.1 subthreshold depressive symptoms among adolescents are highly prevalent and are a considerable health problem.2 several studies suggest that childhood and adolescent subthreshold depression are associated with severe impairment3,4 and with the future risk of developing an mde,57 which is similar to findings in adult populations.8,9 although the participants were children and adolescents 99%). in this study, 2,494 freshmen were screened using the bdi - ii as part of the checkup, and 2,281 freshmen 99%). in this study, 2,494 freshmen were screened using the bdi - ii as part of the checkup, and 2,281 freshmen < 20 years of age at the point of entry into university responded. in the present study, subthreshold depression was defined as the presence of any depressive symptoms, as measured by the bdi - ii, that do not meet the full criteria for an mde. it has been shown that a cutoff score of 18 in the bdi - ii yields a sensitivity of 94% and a specificity of 92% and that a cutoff score of 10 yields a sensitivity of 100% and a specificity of 70%.24 on the basis of a previous study,24 we created three groups using the bdi - ii scores (the low - symptom group : bdi - ii score 10, the middle - symptom group : bdi - ii score = 1117, and the high - symptom group : bdi - ii score 18). participants were categorized into the symptom groups as follows : low - symptom group (n=1,918), middle - symptom group (n=276), and high - symptom group (n=87). for the low- and middle - symptom groups, we contacted randomly selected students by mail via the hiroshima university information system. as there were only a few students in the high - symptom group, we contacted all students in this group. at this point of contact some students (low - symptom group : n=72, middle - symptom group : n=62, high - symptom group : n=68) who were interested in study participation were provided detailed information regarding this study. after obtaining consent, all potential participants (low - symptom group : n=68, middle - symptom group : n=57, high - symptom group : n=66) then, the participants were selected according to the study s inclusion and exclusion criteria of the cidi. follow - up was done every two months (2, 4, 6, 8, 10, and 12 months later), for one year, to assess depressive symptoms using the bdi - ii. at the 12-month follow - up the ethics committee of hiroshima university approved the study and the study protocol, and written informed consent was obtained from all participants. we analyzed the data of 172 students who completed the bdi - ii and cidi at baseline and 12 months later. first, we calculated descriptive data and investigated the baseline differences in the demographic data using analysis of variance (anova) and tests. a previous study has reported that bdi - ii consists of two subscales (somatic affective and cognitive).22,23 we examined whether there were significant differences in these two subscale scores within each group, and we also compared them between different groups. second, we conducted linear mixed modeling with time and group as factors to examine differences in change over 1 year. thus, the predictors in the models were time, group, and time group. third, we conducted fisher s exact test to examine differences in the incidence of mde between the three groups. subsequently, if there were significant differences in the results of the fisher s exact test, residual analysis between the three groups was conducted to explore them. fourth, after we examined whether there were dispersions of slope in our participants, we conducted a growth mixture modeling (gmm) to identify subtypes of longitudinal trajectories in depressive symptoms. to examine model fit with latent trajectories, we used the bayesian information criteria (bic) and the entropy.2729 finally, we examined how many participants from the bdi - ii groups were present in different classes. statistical analyses of anova, tests, and fisher s exact test were done using spss version 22.0 (ibm corporation, armonk, ny, usa) for windows. linear mixed modeling and gmm analyses were carried out using the r statistical computing environment (version 3.2.1 ; http://www.r-project.org/), together with the lcmm package.30 after obtaining written informed consent, a trained interviewer conducted the cidi face - to - face, and participants completed the scales. one participant in the middle - symptom group and 12 participants in the high - symptom group were excluded because they either met the criteria for major depression in the past year or had a lifetime history of bipolar disorder. finally, 176 participants were selected based on the inclusion and exclusion criteria. the flow of participants is described in figure 1. sixty - six participants in the low - symptom group, 56 participants in the middle - symptom group, and 54 participants in the high - symptom group met the eligibility criteria. sixty - six freshmen in the low - symptom group (100%), 55 in the middle - symptom group (98.2%), and 51 in the high - symptom group (94.4%) completed the follow - up assessment 12 months later. one participant in the middle - symptom group and three participants in the high - symptom group were excluded because they did not receive the assessments at the 12-month follow - up. we examined whether there were significant differences in age, gender distribution, and clinical characteristics between the three groups by conducting anova and tests. the age, gender distribution, history of major depression, and comorbidity of anxiety disorders did not differ significantly between the three groups. one - way anovas yielded significant differences between the three groups for bdi - ii scores. we then conducted multiple comparisons for each of the scales, which yielded significant differences between the three groups for bdi - ii scores. next, we examined whether there were significant differences in the two subscales for the three groups. the results of an anova indicated that there were no significant differences in the two subscales within each group. we also conducted an anova to examine significant difference in the two bdi - ii subscales between the three groups. the results of the anovas showed that there were significant differences in bdi - ii scores between the three groups. we conducted linear mixed modeling to examine significant differences between the seven time points the bdi - ii was administered (figure 2). there was no significant interaction between all groups, but the main effects of the middle - symptom group (estimate = 5.14, standard error [se ] = 0.86, t - value = 5.98, p<0.01) and the high - symptom group (estimate = 8.89, se = 0.88, t - value = 10.14, p<0.01) were significant. the multiple comparisons revealed significant differences between the three groups (mean of the low - symptom group = 4.81, mean of the middle - symptom group = 9.95, and mean of the high - symptom group = 13.69, p<0.01), but there was no main effect of time (estimate = 0.12, se = 0.11, t - value = 1.06, p=0.29). next, we examined whether there were statistical dispersions of the slope within the group. the results indicated that the dispersions of the slope were large (= 34.7, degrees of freedom [df ] = 2, p<0.01). the linear mixed modeling was inappropriate for analyzing longitudinal data, if the variance of the slope in longitudinal data was large.31 result of linear mixed modeling indicated that dispersions of the slope in our participants were large (= 34.7, df = 2, p<0.01). therefore, to identify particular change of depressive symptoms, we used a gmm to analyze the data. the results indicate that six classes were estimated. to identify the number of latent trajectory classes the results revealed that the bic scores were lowest for the three - class solution (one - class = 7,028.59, two - class = 6,967.61, three - class = 6,943.98, four - class = 6,972.57, five - class = 6,961.77, six - class = 6,986.12). based on a previous study,32 we also calculated the entropy. the average latent class probabilities for most likely latent class membership by latent class for the three - class model was very good (class 1 = 0.94, class 2 = 0.91, and class 3 = 0.90). we named each class as follows : class 1 was the stable group, class 2 was the decreasing group, and class 3 was the increasing group. there was no significant change in depressive symptoms in the stable group (n=65). the stable group included 63 participants from the low - symptom group and 2 participants from the middle - symptom group. the decreasing group (n=81) demonstrated a significant decrease in depressive symptoms during the 12 months (p<0.01). the decreasing group included 3 participants from the low - symptom group, 49 participants from the middle - symptom group, and 29 participants from the high - symptom group. the increasing group (n=26) revealed a significant increase in depressive symptoms during the 12 months (p<0.05). the increasing group included 4 participants from the middle - symptom group and 22 participants from the high - symptom group. three students in the high - symptom group developed an mde by the 12-month follow - up, whereas no one in the low- and middle - symptom groups did. we conducted fisher s test to examine differences in the incidence of mde among the three groups, and found significant differences between the three groups ((2) = 4.85, p<0.05). results revealed a significant difference in the incidence of mde between the high - symptom group and the other groups (p<0.05). after obtaining written informed consent, a trained interviewer conducted the cidi face - to - face, and participants completed the scales. one participant in the middle - symptom group and 12 participants in the high - symptom group were excluded because they either met the criteria for major depression in the past year or had a lifetime history of bipolar disorder. finally, 176 participants were selected based on the inclusion and exclusion criteria. the flow of participants is described in figure 1. sixty - six participants in the low - symptom group, 56 participants in the middle - symptom group, and 54 participants in the high - symptom group met the eligibility criteria. sixty - six freshmen in the low - symptom group (100%), 55 in the middle - symptom group (98.2%), and 51 in the high - symptom group (94.4%) completed the follow - up assessment 12 months later. one participant in the middle - symptom group and three participants in the high - symptom group were excluded because they did not receive the assessments at the 12-month follow - up. we examined whether there were significant differences in age, gender distribution, and clinical characteristics between the three groups by conducting anova and tests. the age, gender distribution, history of major depression, and comorbidity of anxiety disorders did not differ significantly between the three groups. one - way anovas yielded significant differences between the three groups for bdi - ii scores. we then conducted multiple comparisons for each of the scales, which yielded significant differences between the three groups for bdi - ii scores. next, we examined whether there were significant differences in the two subscales for the three groups. the results of an anova indicated that there were no significant differences in the two subscales within each group. we also conducted an anova to examine significant difference in the two bdi - ii subscales between the three groups. the results of the anovas showed that there were significant differences in bdi - ii scores between the three groups. we conducted linear mixed modeling to examine significant differences between the seven time points the bdi - ii was administered (figure 2). there was no significant interaction between all groups, but the main effects of the middle - symptom group (estimate = 5.14, standard error [se ] = 0.86, t - value = 5.98, p<0.01) and the high - symptom group (estimate = 8.89, se = 0.88, t - value = 10.14, p<0.01) were significant. the multiple comparisons revealed significant differences between the three groups (mean of the low - symptom group = 4.81, mean of the middle - symptom group = 9.95, and mean of the high - symptom group = 13.69, p<0.01), but there was no main effect of time (estimate = 0.12, se = 0.11, t - value = 1.06, p=0.29). next, we examined whether there were statistical dispersions of the slope within the group. the results indicated that the dispersions of the slope were large (= 34.7, degrees of freedom [df ] = 2, p<0.01). the linear mixed modeling was inappropriate for analyzing longitudinal data, if the variance of the slope in longitudinal data was large.31 result of linear mixed modeling indicated that dispersions of the slope in our participants were large (= 34.7, df = 2, p<0.01). therefore, to identify particular change of depressive symptoms, we used a gmm to analyze the data. the results indicate that six classes were estimated. to identify the number of latent trajectory classes the results revealed that the bic scores were lowest for the three - class solution (one - class = 7,028.59, two - class = 6,967.61, three - class = 6,943.98, four - class = 6,972.57, five - class = 6,961.77, six - class = 6,986.12). the average latent class probabilities for most likely latent class membership by latent class for the three - class model was very good (class 1 = 0.94, class 2 = 0.91, and class 3 = 0.90). we named each class as follows : class 1 was the stable group, class 2 was the decreasing group, and class 3 was the increasing group. there was no significant change in depressive symptoms in the stable group (n=65). the stable group included 63 participants from the low - symptom group and 2 participants from the middle - symptom group. the decreasing group (n=81) demonstrated a significant decrease in depressive symptoms during the 12 months (p<0.01). the decreasing group included 3 participants from the low - symptom group, 49 participants from the middle - symptom group, and 29 participants from the high - symptom group. the increasing group (n=26) revealed a significant increase in depressive symptoms during the 12 months (p<0.05). the increasing group included 4 participants from the middle - symptom group and 22 participants from the high - symptom group. three students in the high - symptom group developed an mde by the 12-month follow - up, whereas no one in the low- and middle - symptom groups did. we conducted fisher s test to examine differences in the incidence of mde among the three groups, and found significant differences between the three groups ((2) = 4.85, p<0.05). additionally, we conducted residual analysis among the three groups. results revealed a significant difference in the incidence of mde between the high - symptom group and the other groups (p<0.05). to the best of our knowledge, the present study is the first to rigorously assess depressive symptoms (low - symptom group, middle - symptom group, and high - symptom group) in late adolescence over a 1-year period with the use of bimonthly assessments to improve the accuracy of reported symptoms and the onset of depression. first, we found that late adolescents with high depressive symptoms (subthreshold depression) were split between the increasing and decreasing depressive symptoms groups, whereas the majority of the low and middle symptoms group remained stable over a 12-month period. second, in comparison with late adolescents with low and middle depressive symptoms, those with high symptoms (subthreshold depression) had an elevated risk of later depression. only 29% and 39% of the participants who were contacted, respectively, from low- and middle - symptom groups participated in the study, whereas 78% of those in the high - symptom group participated. it has been reported that the severity of depression is the most important predictor of using university psychiatric services, and therefore, highly depressed students might have searched and accessed psychiatric services more than other students,33 which might have increased the participation rate of students with high depressive symptoms compared to students with low or middle depressive symptoms. the present longitudinal research focused on the symptomatic changes of subthreshold depression in late adolescents. based on the result of linear mixed modeling, the bdi - ii mean scores of the high - symptom group remained high throughout the year. however, the gmm results, which take into account individual differences, indicated that half of the participants in the high - symptom group showed an increase in depressive symptoms during the 12 months, whereas other participants experienced a decrease in symptoms. thus, it seems that half of the participants in the high - symptom group were not at risk for developing an mde. on the contrary, from results of linear mixed modeling and gmm, both individual and mean scores of the bdi - ii scores in the low - symptom group remained stable in low depressive symptoms over the year. although the middle - symptom group mean scores did not change over the year from results of linear mixed modeling, most participants in this group showed a decrease in the depressive symptoms over the 12 months from the result of gmm. in addition, our data revealed that subthreshold depression (high depressive symptoms) might increase the likelihood of developing an mde over time. the number of participants meeting the criteria for mde during the year was only 3 of 172 students ; however, it was noted that all were from the high - symptom group and had subthreshold depression. in the present study, therefore, the 1-year incidence of mde in the high - symptom group was 5.8%. in a longitudinal study, klein tested whether subthreshold depression among youth escalates or predicts the onset of full - syndrome depressive disorder. among those adolescents (aged 1418 years) with a history of subthreshold depressive disorder at baseline, 11.0% escalated to a full - syndrome depressive disorder during the year.34 fergusson also showed that subthreshold depression in late adolescence (ages 1718 years) increased the risk of an mde (27.4%) at age 1821 years. the rate of an mde development in our cohort is somewhat lower than reported in other studies,5,6,34 which might reflect the lower prevalence of mental disorders in japan compared to western countries.26,3538 moreover, an alternative explanation for the low prevalence rate may be the timing of assessments in this study. since the first assessment took place during a very stressful time period (admission), the prevalence rates at baseline may not be comparable to other studies. first, although there were significant differences in the incidence of mde between the three groups at the 1-year follow - up, the length of follow - up (12 months) was relatively short. it is necessary to conduct a long - term follow - up study, because only three participants developed an mde, whereas half of the participants showed an increase in depressive symptoms in the high - symptom group. second, our results showed that depressive symptoms were the highest at the checkup before university admission and had reduced when entering the follow - up study. a possible explanation for the decrease in symptoms is that the timing of the assessments contributed to this effect. for example, at the baseline measurement, late adolescents were not yet free from a highly stressful situation with regard to entrance examinations and were uneasy about the entrance into the university, which is a major transition point. as the adolescents acclimated to university, their stress and depression levels may have decreased by 2 months later. however, the depression levels in all the three groups were characterized by, on average, a relatively stable course after the first 2 months. third, participants in this study were recruited from only one specific university and enrollment in a single year. the homogeneity of the specific sample may limit the generalizability of our results to community or clinical populations. future studies should examine similar hypotheses among adolescents in other japanese provinces to determine if the current findings can be replicated and, consequently, be generalized. finally, we have not excluded the possibility that the high - symptom group might be characterized by particular personal features. however therefore, it would be necessary to investigate personal features of subjects in future studies. despite its clinical importance, adolescent subthreshold depression remains a largely neglected topic.2 whereas the majority of the less symptoms group remains stable over time, some late adolescents with subthreshold depression show an increase in depressive symptoms and develop an mde during 1 year. therefore, it is necessary for us to rigorously assess the changes in subthreshold depressive symptoms over time in the late adolescents.	purposedespite its clinical importance, adolescent subthreshold depression remains a largely neglected topic. the aims of this study were to accurately identify the natural course of depressive symptoms and the risk for developing major depressive episode (mde) in late adolescents with subthreshold depression over 1 year.patients and methodsone hundred and seventy - two participants < 20 years of age (mean age : 18.32 years, standard deviation : 0.50), who did not meet the full criteria for an mde, were selected from 2,494 screened freshmen based on the beck depression inventory, 2nd edition (bdi - ii). we conducted a cohort study of three groups (low-, middle-, and high - symptom groups) divided based on bdi - ii scores, over a 1 year period with the use of bimonthly assessments. temporal changes of depressive symptoms were analyzed using linear mixed modeling and growth mixture modeling.resultsfirst, we found that late adolescents with subthreshold depression (high depressive symptoms) were split between the increasing and decreasing depressive symptoms groups, whereas the majority of the less - symptoms group remained stable during 1 year. second, in comparison with late adolescents with less depressive symptoms, those with subthreshold depression had an elevated risk of later depression.conclusionsome late adolescents with subthreshold depression had increased depressive symptoms and developed an mde during 1 year. therefore, it is necessary for us to rigorously assess the changes in subthreshold depressive symptoms over time in late adolescents.
	dna methylation (5-methylcytosine, 5mc) plays critical biological functions in mammals and plants as a vital epigenetic marker. the ten - eleven translocation dioxygenases (tet1, 2, and 3) have been found to oxidize 5mc to 5-hydroxymethylcytosine (5hmc) and then to 5-formylcytosine (5fc) and 5-carboxylcytosine (5cac) in mammalian cells. we report herein three mushroom tet homologues from coprinopsis cinerea that can mediate 5mc oxidation. specifically, one homologue (cc1g_05589, cctet) shows similar activity to its mammalian tet homologues. biochemically, cctet actively converts 5mc to 5hmc, 5fc, and 5cac under natural conditions (ph 7.0). interestingly, converts the majority of 5mc to 5fc under slightly acidic (ph 5.8) and neutral conditions. kinetics analyses of the oxidation by cctet under neutral conditions indicate that conversion of 5mc to 5hmc and 5hmc to 5fc are faster than that of 5fc to 5cac, respectively. our results provide an example of a tet homologue in a non - mammalian organism that exhibits full 5mc - to-5cac oxidation activity and a slight preference to producing 5fc. the preferential accumulation of 5fc in the in vitro oxidation reactions under both neutral and acidic conditions may have biological implications for 5mc oxidation in fungi species.
a 40-year - old man sought evaluation of a 4-year - history of perianal and perineal pain, including the testes and penis. in this patient, there was no notable history of trauma or disease. on mri and ct scans, which included the abdomen and pelvis, there were normal findings. at the time of admission, the patient had a visual analog scale (vas) of 8/10. the patient had the persistent presence of pain, which was characterized as bursting and explosive. due to the presence of pain, the patient could not assume a sitting position for more than 5 minutes. four years before the initial onset of pain, the patient had been working as aresearch staff in the us. at the time, the patient sought evaluation in a urology department under the assumption that the condition originated from the prostate gland. following evaluation, the patient was considered normal without a discernible etiology for the pain. the patient was therefore transferred to a pain clinic, where the patient was given oral medications (gabapetin 1,800 mg / day and methadone) in an outpatient setting. however, these procedures had no effect in reducing the pain. in early february 2007, the patient sought evaluation in an outpatient clinic in the us due to aggravation of the pain in a lying position, and underwent blockage of the ganglion impar ; the vas decreased from 8/10 to 4/10. because the effect was sustained for approximately 1 day, the patient could not ambulate for 2 months. during this period, thereafter, the patient underwent blockage of the ganglion impar on two occasions. following this, the pain decreased to a vas of 4/10. when the pain was severe, however, it was a vas of 8/10. every 3 months, the patient underwent blockage of the ganglion impar 4 times with the use of steroids 40 mg each, 4 times. in september 2008, the patient was recommended to undergo the blockage of the ganglion impar by radiofrequency ablation. a diagnostic blockage was first performed using 0.5% bupivacaine 2 ml because the patient was concerned about the destruction of the nerve ganglion. the patient was monitored clinically, and 3 months later, the vas of 8/10 had decreased to 5/10. approximately 1 week later, however, the pain recurred with a vas of 7 - 8/10. the severity of pain was not significantly different from the pain which existed prior to treatment. the patient was therefore motivated to have blockage of the ganglion impar using bont - a. for blockage of the ganglion impar, the patient was placed in a prone position. this area was chosen as a puncture point. using a c - shaped image intensifier, a 22 g, 10 cm block needle in which the terminal part was bent at an angle of 30 degrees was advanced to a distance of 6 cm. following infusion of 2 ml of contrast media, the lateral and anterior - posterior views were evaluated (fig. 1, 2). based on the spread pattern of the contrast media, the infusion was performed with a concomitant use of 0.5% bupivacaine 1 ml and bont - a 80 u. the vas of 7 - 8/10 decreased to 3/10, but the vas increased to 5/10 two months following the blockage. accordingly, with the use of bont - a, 2 months following the blockage, the ganglion impar was blocked using 0.5% bupivacaine 2 ml and bont - a 100 u. when the patient underwent blockage using bont - a again, the vas decreased to 2/10 and this was maintained for 6 months. the patient perceived the presence of perineal pain (a vas of 5/10) during the sexual intercourse, which led to the third session of blockage of the ganglion impar at the same dose, which diminished the vas to 2/10. at present, 3 months following the last treatment, other than perineal pain (a vas of 4/10), the patient has had no problems in performing activities of daily living and work, including sitting and walking. the patient has maintained a vas of 2/10. to evaluate the degree of disability due to chronic pain during activities of daily living, the pdi has seven categories, such as activities associated with family / home responsibilities, recreation, social activities, occupation, sexual behaviors, self - care, and life - support activities, and scores are given with a scale ranging from 0 (no disability) to 10 (total disability). according to the pdi, scores were 10, 9, 10, 10, 10, 7, and 1, respectively, prior to treatment. following the third session of blockage of the ganglion impar using bont - a, the pdi scores were greatly improved to 2, 2, 2, 2, 4, 3, and 0, respectively. currently, the patient has had a satisfactory outcome and is receiving follow - up observation. the etiology for cpp may include benign causes, such as chronic prostatitis and chronic proctitis, as well as malignant causes, such as carcinoma of the pelvic organs. the ganglion impar is a solitary retroperitoneal structure at the level of the sacrococcygeal junction and it marks the termination of the paravertebral sympathetic chain. the ganglion impar receives the nerve fibers from the sympathetic and parasympathetic nervous system, which are present in the lumbar and sacral regions, and it is responsible for the distribution of sympathetic nerve fibers in the organs around the pelvis or reproductive organs. the sympathetic nervous system is associated with myriads of pain syndromes. a blockage of the sympathetic nerve fibers has therefore been used to alleviate pain. in addition, blockage of the ganglion impar has been used extensively to treat anal or perianal sweating, rectal tenesmoid pain, and coccygodynia [1 - 3 ]. there exist various methods to block the ganglion impar, such as local anesthetics, concomitant use of local anesthetics and steroids, alcohol or phenol, and neurolysis by radiofrequency ablation. botulinum toxin is a potent neurotoxin which is extracted from the exotoxin of clostridium botulinum, which proliferates in contaminated foods and triggers the occurrence of food poisoning. bont - a binds to the presynaptic nerve endings and blocks the secretion of acetylcholine, thus causing a flaccid muscle paralysis. this chemodenervation transiently occurs, and while minimizing the systemic side effects, it persistently reduces or abolishes the activities of muscles, sweat glands, or muscles of contraction for several months. accordingly, the use of bont - a is effective in treating diseases associated with an excessive contraction of the muscles, including strabismus, blepharospasm, unilateral blepharospasm, and abnormal muscle tension in the neck. attempts have also been made to treat various types of headaches, lower lumbar pain, myofascial pain syndrome, and crps with bont - a [6,10 - 12 ]. recent studies have suggested that bont - a has an effect on the secretion of neurotransmitters which are involved in the recognition of pain secondary to the analgesic effect due to muscle relaxation [6 - 8 ]. analgesic mechanisms of bont - a can mainly be divided into peripheral, spinal, and cerebrocortical mechanisms. according to cui, the peripheral mechanisms are of interest based on the finding that the subcutaneous solar administration of bont - a had a significant analgesic effect in an experimental model of pain induced using formalin in rats. in cases of neurogenic inflammation, with the initiation of secretions of substances, such as substance p, cgrp, and glutamate, local vasodilation, plasma leakage, and the destruction of mast cells occur. owing to these inflammatory events, bradykinin, atp, histamine, and serotonin, which are known to provoke hypersensitivity of peripheral nociceptors, it has been reported that bont - a blocks the early stage of these chain reactions of neurogenic inflammation and thereby reduces pain. park. clarified that bont - a effectively reduced mechanical, cold allodynia in an animal experimental model of neuropathy., an intradermal injection of bont - a had a direct analgesic effect in patients with local chronic neuropathy associated with allodynia. these reports provide a theoretical basis for the availability of bont - a for the treatment of neuropathies. the activity of central pain receptors immediately after pain stimulation can be measured based on the expression of c - fos, genes associated with the early expression of pain. bont - a blocks the secretion of neurotransmitters which are involved in the pathophysiology of neurogenic inflammation, such as glutamate, secreted from the primary afferent pain receptor fibers. bont - a therefore reduces the extensive activity of dorsal horn neurons of the spinal cord, which has been confirmed based on the decreased expression of c - fos. bont - a is involved in the blockage of secretion of the above - mentioned inflammatory mediators and suppresses the expression of c - fos occurring immediately after pain sensation. it can therefore be concluded that bont - a suppresses peripheral sensitization, and this leads to central desensitization. as described herein, in addition to the peripheral and spinal cord effects of bont - a, the effects on the central nervous system have also been examined in many studies. with respect to the finding that bont - a causes alterations in the sensory pattern via the neural axis, including the cerebral cortex, it has been reported that major mechanisms altering the overall recognition of pain by bont - a originate from the neuroplastic reorganization of excitatory and inhibitory balances. through experimental results that bont - a has an anti - nociceptive effect via axonal transport to the central nervous system following peripheral injection, it has been demonstrated that the central nervous system is involved in the mechanisms by which bont - a reduces pain. alcohol and phenol, which have been commonly used for neurolysis, can not accurately predict drug spread, and therefore these agents can not block nerves selectively. alcohol and phenol cause irreversible destruction. furthermore, alcohol and phenol have been reported to induce novel pain. in cases of pain in which radiofrequency ablation is used, there exist specialized equipment, such as an electrostimulating device and a minute controller. there is a lower possibility that complications might occur in cases in which neurolysis is performed. the size and location of lesions can be controlled. of the methods for blocking ganglion impar in which ganglion impar is blocked, however, an approach is commonly made via the anococcygeal ligament. because a cannula has a linear form, an accurate approach can not be made to the ganglion impar. accordingly, as an alternative method to radiofrequency ablation, blockage of the ganglion impar was performed using bont - a. performed blockage of lumbar sympathetic ganglia in patients with crps, and compared treatment outcomes between the group in which 0.5% bupivacaine 10 ml was used alone and a group in which concomitant use of 75 u bont - a and 0.5% bupivacaine was attempted. as a result, the decrease in vas was markedly greater and the analgesic period was prolonged in the group in which bupivacaine 10 ml and 75 u bont - a was concomitantly used for blockage of the ganglion impar. this is an example demonstrating the sympathetic nerve block effect of bont - a based on clinical studies rather than animal experiments, which provides a basis for the sustained effect and the decrease in vas as compared with cases in which the patient underwent blockage of the ganglion impar using conventional types of local anesthetics. accordingly, as shown in animal experiments in which formalin was used, the mechanism of bont - a is not referred to as direct destruction of nerve fibers, rather based on blockage of pain - controlling neurotransmitters. a reversible, transient analgesic effect is considered one of the advantages in the current case, and. in agreement with an experimental animal reports by kim. in which bont - a caused no marked histopathologic changes as compared with cases in which blockage was done using alcohol or phenol, and the effects were persistently present for > 1 month. in the current case, the use of bont - a for blockage of the ganglion impar was safer than neurolysis based on the previous types of chemical or high - frequency ablation. the effects were superior to cases in which local anesthetics were solely used, and the analgesic period was prolonged. based on these advantages, bont - a is proposed as a new method for blocking the sympathetic nervous system. aside from these advantages, there are also disadvantageous in that bont - a can pose a safety issue. bont - a is rather expensive and requires serial use. in association with this, in adults weighing 70 kg in which the ld50 of bont - a amounts to 3,000 u, the common clinical dose is at most 25 - 100 u and it can therefore be considered very safe. bont - a is used at 3 - 6 month intervals, and the proportion of antibody formation has been reported to be < 4%. the problem that the drug effect is lost due to the formation of antibodies following repeated use can also be resolved. it it has been reported that the use of bont - a reduces the amount of analgesic drugs, the need for treatment, and the length of hospital stay associated with the side effects of drugs. together, these features may overcome the cost associated with bont - a. because the number of cases in which bont - a has been used for the blockage of ganglion impar is limited, further clinical studies and application are needed.	chronic perineal pain is an often encountered problem, which produces a great degree of functional impairment and frustration to the patient and a challenge to the treating physician. the reason for this problem is that the region contains diverse anatomic structures with mixed somatic, visceral and autonomic innervations affecting bladder and bowel control and sexual function. a blockade of nociceptive and sympathetic supply to the perineal region, supplied through the ganglion impar has been shown to benefit patients with chronic perineal pain. several options to this block have been described that chemical neurolysis, radiofrequency ablation etc. although the analgesic effect of botulinum toxin type a (bont - a) has long been considered secondary to its action for muscle relaxation, bont - a also affects the release of the neurotransmitters that are involved in pain perception. we describe a patient who was successfully given ganglion impar block with bont - a.
peristalsis has been studied in vivo and in vitro, but other factors, such as intra - abdominal pressure, respiration, and the pressure of adjacent structures among others, have received little attention. peristalsis is considered to be myogenic in origin, with neuro - hormonal factors playing only a modulatory role [14 ]. three types of cells have been identified in the upper urinary tract : atypical and typical muscle cells and renal interstitial cells. the atypical smooth muscle cells, which are preferentially located in the proximal regions of the upper urinary tract, act as the essential pacemaker of pyeloureteric motility. it has been suggested that a urine flow - dependent mechanism triggers ureteral peristalsis in the upj (uretero - pelvic junction). the initiation and control of ureteral peristalsis is considered to be under the influence of, but not triggered by, the rate of urine flow, while the cyclic release of ca from internal stores acts as an essential mechanism underlying autorhythmicity in the upper urinary tract. the intra - abdominal pressure is the pressure normally detected in the abdominal cavity, which is obviously above the atmospheric pressure (or is equal to it). the first observations on this were published by marey (1863) and heinricus (1890). later on, iap gained more importance in connection with the diagnosis of urinary and bowel disorders. in 1986 graw and bahl published an article about an active artificial ureter with autonomous energy supply driven by the intra - abdominal pressure fluctuations caused by the respiratory movements. the effect of intra - abdominal pressure is very complex and our knowledge about it is very limited. what is known is that it exists according to the respiratory movements, and is therefore permanently changing. hence, it influences all organ functions included in this integrated hydraulic system (thorax and abdomen), among them the cardiovascular system, the respiratory system, and the urine flow too. then an international organization was launched (the world society of the abdominal compartment syndrome - wsacs). following the third wsacs congress, malbrain. listed the cardiovascular and respiratory effects of elevated intra - abdominal pressure on 33 measurable parameters. in this order of ideas this iap, as a permanently changing pressure force, may act as a hydraulic pumping force on the urinary tract, which is situated in close contact with the abdomen. the value of the iap plays a minor role in this process, while what is really important is the fluctuation of the pressure (at high or low level). therefore, very high intra - abdominal pressures may not induce hydronephosis, since they are variable (for example in case of ascites the iap is high, but varies according to respiratory movements also.) iap can be measured in several ways. one dimensional, lubrication theory analysis shows that peristalsis can pump urine from kidney into bladder only at relatively low mean rates of urine flow. at high flow rates the peristaltic contractions do not pump, but rather hinder the flow of urine through the ureter. according to malbrain the abdominal cavity and the organs behave according to pascal 's law, as they are similar to fluids [15, 16 ]. this also means that the pressure measured at a specific location in the abdominal cavity reflects the iap characteristics of the whole abdominal cavity ; however, the fact that the abdominal organs do not behave absolutely as fluids has been proven by measurements that revealed a pressure gradient from the diaphragm to the pelvis. keulenauer and al. wrote the following in their review : the abdomen truly behaves as a hydraulic system. the physical dual valves. if these valves are placed in a flexible tube and the wall of the tube is put under pressure (p4), the fluid can only flow in one direction. provided the external pressure is high enough, valve 2 opens and lets the fluid flow out. once the external pressure (p4) ceases, the pressure between the two valves (p2) also decreases and falls under the pressure of the adjacent segments (p1 and p3). at this point, the fluid can flow into the intervalvular segment of the tube, but only from one direction (from p1). the repetition of the process presented above results in one - way flow (pumping). several examples can be found in the human body, for example the valves in the veins and lymphatic vessels. two valves within a flexible vessel may work according to the principles of the physical dual valves. they prevent the backflow of blood or lymphatic fluid, and they pump blood towards the heart using the mechanical energy of the surrounding muscles (fig. it is important that not only real valves but also valve - like anatomical structures and the special geometrical arrangement of certain structures can work as biological valves (biological valve structure). the terminal segment of the ureter is a good example, as passing through the wall of the urinary bladder it can be closed by increasing the intravesical pressure. in a wider sense, all anatomical structures that allow the flow of a certain fluid in only one direction (for example the renal pelvic border or the mucous membrane of the bowel) work as biological rectifying valves. peristalsis is considered to be myogenic in origin, with neuro - hormonal factors playing only a modulatory role [14 ]. three types of cells have been identified in the upper urinary tract : atypical and typical muscle cells and renal interstitial cells. the atypical smooth muscle cells, which are preferentially located in the proximal regions of the upper urinary tract, act as the essential pacemaker of pyeloureteric motility. it has been suggested that a urine flow - dependent mechanism triggers ureteral peristalsis in the upj (uretero - pelvic junction). the initiation and control of ureteral peristalsis is considered to be under the influence of, but not triggered by, the rate of urine flow, while the cyclic release of ca from internal stores acts as an essential mechanism underlying autorhythmicity in the upper urinary tract. the intra - abdominal pressure is the pressure normally detected in the abdominal cavity, which is obviously above the atmospheric pressure (or is equal to it). the first observations on this were published by marey (1863) and heinricus (1890). later on, iap gained more importance in connection with the diagnosis of urinary and bowel disorders. in 1986 graw and bahl published an article about an active artificial ureter with autonomous energy supply driven by the intra - abdominal pressure fluctuations caused by the respiratory movements. the effect of intra - abdominal pressure is very complex and our knowledge about it is very limited. what is known is that it exists according to the respiratory movements, and is therefore permanently changing. hence, it influences all organ functions included in this integrated hydraulic system (thorax and abdomen), among them the cardiovascular system, the respiratory system, and the urine flow too. then an international organization was launched (the world society of the abdominal compartment syndrome - wsacs). following the third wsacs congress, malbrain. listed the cardiovascular and respiratory effects of elevated intra - abdominal pressure on 33 measurable parameters. in this order of ideas this iap, as a permanently changing pressure force, may act as a hydraulic pumping force on the urinary tract, which is situated in close contact with the abdomen. the value of the iap plays a minor role in this process, while what is really important is the fluctuation of the pressure (at high or low level). therefore, very high intra - abdominal pressures may not induce hydronephosis, since they are variable (for example in case of ascites the iap is high, but varies according to respiratory movements also.) iap can be measured in several ways. one dimensional, lubrication theory analysis shows that peristalsis can pump urine from kidney into bladder only at relatively low mean rates of urine flow. at high flow rates the peristaltic contractions do not pump, but rather hinder the flow of urine through the ureter. according to malbrain the abdominal cavity and the organs behave according to pascal 's law, as they are similar to fluids [15, 16 ]. this also means that the pressure measured at a specific location in the abdominal cavity reflects the iap characteristics of the whole abdominal cavity ; however, the fact that the abdominal organs do not behave absolutely as fluids has been proven by measurements that revealed a pressure gradient from the diaphragm to the pelvis. keulenauer and al. wrote the following in their review : the abdomen truly behaves as a hydraulic system. if these valves are placed in a flexible tube and the wall of the tube is put under pressure (p4), the fluid can only flow in one direction. provided the external pressure is high enough, valve 2 opens and lets the fluid flow out. once the external pressure (p4) ceases, the pressure between the two valves (p2) also decreases and falls under the pressure of the adjacent segments (p1 and p3). at this point, the fluid can flow into the intervalvular segment of the tube, but only from one direction (from p1). the repetition of the process presented above results in one - way flow (pumping). several examples can be found in the human body, for example the valves in the veins and lymphatic vessels. two valves within a flexible vessel may work according to the principles of the physical dual valves. they prevent the backflow of blood or lymphatic fluid, and they pump blood towards the heart using the mechanical energy of the surrounding muscles (fig. it is important that not only real valves but also valve - like anatomical structures and the special geometrical arrangement of certain structures can work as biological valves (biological valve structure). the terminal segment of the ureter is a good example, as passing through the wall of the urinary bladder it can be closed by increasing the intravesical pressure. in a wider sense, all anatomical structures that allow the flow of a certain fluid in only one direction (for example the renal pelvic border or the mucous membrane of the bowel) work as biological rectifying valves. a literature search was performed, using the keywords,, peristalsis,,, ureteral motility,,, upper urinary tract motility, and,, intra - abdominal pressure. figure 3 presents two parallel images of the urinary tract, one showing the biological structure, the other introducing the urinary tract from a mechanical point of view. the essentials of the new hypothesis are as follows : from a mechanical point of view, the urinary tract can be considered as a dual valve structure, in which two dual valves can be identified. after entering the pyelon, urine can not flow back to the renal parenchyma, as the renal. the second valve can be found at the junction between the ureter and the urinary bladder, that is, the ureterovesical junction (uvj). the first biological dual valve consists of the two rectifying valves and the connecting flexible tube, and this whole structure is equivalent to the upper urinary tract. the second valve is the sphincter urethras, which surrounds and closes the proximal part of the urethra. the second biological dual valve consists of these structures and is equivalent to the lower urinary tract (with the extrasphincteric part of the urethra). from an anatomical point of view, the upper urinary tract lies on a hard posterior wall at the back of the abdominal cavity, adjacent to several blood vessels. the front wall of the abdomen and the diaphragm move perpetually with respiration, and there is regular movement in the bowels and pulsation in the blood vessels. the iap changes with these motions, which also affect the urinary tract directly due to its close connection with the intestines and blood vessels. therefore, all the conditions of an energy - saving one - way pump (i.e. urine transport) are provided in the upper urinary tract : the flexible tube (the ureter), the two rectifying valves (the renal pyelon border and the uvj) and an external, variable positive pressure. the pelvis forms a stiff external shell that diminishes the effects of the external pressure on iap. figure 3 presents two parallel images of the urinary tract, one showing the biological structure, the other introducing the urinary tract from a mechanical point of view. the essentials of the new hypothesis are as follows : from a mechanical point of view, the urinary tract can be considered as a dual valve structure, in which two dual valves can be identified. after entering the pyelon, urine can not flow back to the renal parenchyma, as the renal. the second valve can be found at the junction between the ureter and the urinary bladder, that is, the ureterovesical junction (uvj). the first biological dual valve consists of the two rectifying valves and the connecting flexible tube, and this whole structure is equivalent to the upper urinary tract. the second valve is the sphincter urethras, which surrounds and closes the proximal part of the urethra. the second biological dual valve consists of these structures and is equivalent to the lower urinary tract (with the extrasphincteric part of the urethra). from an anatomical point of view, the upper urinary tract lies on a hard posterior wall at the back of the abdominal cavity, adjacent to several blood vessels. continuous movements and the ever - changing iap are characteristics of the abdominal cavity. the front wall of the abdomen and the diaphragm move perpetually with respiration, and there is regular movement in the bowels and pulsation in the blood vessels. the iap changes with these motions, which also affect the urinary tract directly due to its close connection with the intestines and blood vessels therefore, all the conditions of an energy - saving one - way pump (i.e. urine transport) are provided in the upper urinary tract : the flexible tube (the ureter), the two rectifying valves (the renal pyelon border and the uvj) and an external, variable positive pressure. the pelvis forms a stiff external shell that diminishes the effects of the external pressure on iap. supposing that the hypothesis of the dual valves is correct, an explanation is required to show how this hypothesis matches the role of peristalsis. in the development of a comprehensive model, the following two facts are useful : according to all observations made to date, if the amount of urine secreted reaches a critical point, the urine flows as an unbroken fluid column.we do not know exactly how this fluid column moves, although this is the situation that can be explained most easily and obviously via the mechanism of dual - valve pumping!the following new definitions need to be introduced for better understanding of the comprehensive hypothesis, besides the definition of bolus volume bv, which means the amount of urine (fluid) transported by one peristaltic (p) wave : minimum bolus volume (bvmin) is the minimum amount of urine that is able to pass the p wave along the ureter. starter bolus volume (bvstart) is the minimum amount of urine that is able to start a p wave, i.e. induce the minimal pressure in the pyelon that can be detected by the atypical cells. when the bvstart does not reach the bvmin, the p wave subsides in the pyelon or at the pyelo uretheral border.above the maximum bolus volume (bvmax), the urine boluses unite to form a fluid column. flow volume (fv) is equal to or larger than bvmax, and this flow of urine forms a fluid column.bvstart, -min, -max, and fv may differ in every human body, although normal ranges may be defined. according to all observations made to date, if the amount of urine secreted reaches a critical point, the urine flows as an unbroken fluid column. we do not know exactly how this fluid column moves, although this is the situation that can be explained most easily and obviously via the mechanism of dual - valve pumping ! the following new definitions need to be introduced for better understanding of the comprehensive hypothesis, besides the definition of bolus volume bv, which means the amount of urine (fluid) transported by one peristaltic (p) wave : minimum bolus volume (bvmin) is the minimum amount of urine that is able to pass the p wave along the ureter. starter bolus volume (bvstart) is the minimum amount of urine that is able to start a p wave, i.e. induce the minimal pressure in the pyelon that can be detected by the atypical cells. when the bvstart does not reach the bvmin, the p wave subsides in the pyelon or at the pyelo uretheral border. above the maximum bolus volume (bvmax), the urine boluses unite to form a fluid column. flow volume (fv) is equal to or larger than bvmax, and this flow of urine forms a fluid column. bvstart, -min, -max, and fv may differ in every human body, although normal ranges may be defined. the comprehensive hypothesis states that both transport mechanisms are responsible for urine transport in the upper urinary tract and that they work at the same time. during the transport of small amounts of urine, peristalsis has the main role, while at higher levels of secretion, urine is passed according to the mechanism of dual - valves. as the dual - valve structure and the iap are constant, this type of transport is presumably constant as well, and thus it works in parallel with p. it is also probable that p does not subside above the bvmax, but helps with transport. p stops only above a certain fv, when the tightness of the ureter wall blocks the p wave. the cooperation between p and dual - valve transport is probably regulated by the neuro - endocrine system (for example, it may adjust the two types of transport between bvmin and bvmax, or it may stop p at a certain fv by detecting the tightness of the ureter wall). dual - valve transport also occurs in the lower urinary tract, although the (stiff) bones of the pelvis restrict the significance of the hydraulic pump (the iap). the human body should be observed and explained as an integrated system. the abdomen, the chest, and the retroperitoneum do not exist and function separately, but comprise an integrated hydraulic system (the wall consisting of the chest and the internal organs behaving as a fluid), divided into two compartments by the diaphragm. this hydraulic system includes and regulates the flow processes of the body, such as blood and lymphatic flow, bowel movements, urine transport, and respiration. there is undoubtedly a strong link between the elements (circulation, respiration, and excretion) of this system. a new hypothesis based on a mechanical valve model of urinary tract function has been introduced above. this new hypothesis observes and explains the function of the urinary tract within the functioning of the whole body, which means the following : the urinary tract may be considered to consist of dual - valves from a structural point of view.the dual - valve mechanism combined with peristalsis allows better explanation of the function of the upper urinary tract in particular.the flow in the urinary tract must be studied integrally within the body.more accurate information on the characteristics (e.g. flexibility) and function of the upper urinary tract can be gained from the measurement of bvstart, -min, -max, and fv.further experiments are necessary to judge the accuracy of the author 's findings. the urinary tract may be considered to consist of dual - valves from a structural point of view. the dual - valve mechanism combined with peristalsis allows better explanation of the function of the upper urinary tract in particular. more accurate information on the characteristics (e.g. flexibility) and function of the upper urinary tract can be gained from the measurement of bvstart, -min, -max, and fv.	introductionuntil now, peristalsis has been the only known method of urine transport. the main objective of this paper was to study urinary tract function especially the upper urinary tract, the ureter from a new mechanical point of view. the physical (physical dual valves) and biological basis (biological dual valves) of a new functional model is presented based on previous observations and knowledge.methodsa review of the literature was performed, with special emphasis on ureter motility.resultsafter analyzing the anatomy and physiology of the urinary tract, complemented by basic physical observations, the authors have developed a new valve - mechanical model of urinary tract function. a comprehensive mechanical hypothesis is also presented, integrating the role of peristalsis.conclusionsthe authors believe that the new theory enhances previous knowledge. from a structural point of view, the urinary tract may be considered to consist of dualvalves. the dual - valve mechanism combined with peristalsis allows better explanation of the function of the upper urinary tract in particular. the main conclusion is that the flow in the urinary tract must be studied integrally within the body. this new theory does not contradict well - known and acknowledged theories, and moreover, it may help solve certain medical problems.
colonoscopy is considered as one of the most commonly performed medical procedures and deemed to be safe. however, the complication rates are increasing as its use is growing due in part to the successful promotion of colorectal cancer screening and prevention guidelines. post - colonoscopy, the incidence of colonic perforation (cp), is rare with an estimation of 0.19 - 0.21%. though intraperitoneal perforation is common, extra - peritoneal perforation with pneumoperitoneum, pneumomediastinum, and subcutaneous emphysema is exceedingly rare. a 64-year - old african american female with past medical history significant for hypertension and cerebral aneurysm status after repair presented with sudden onset of diffuse chest and abdominal pain. she described the pain as persistent, dull in nature, non - radiating and aggravated by movement. she also complained of shortness of breath and two episodes of non - bloody, non - bilious vomiting. before colonoscopy, she was in her usual state of health. for the current procedure, she had adequate bowel preparation and the findings were positive for wide mouthed diverticulosis of the sigmoid colon without other associated findings. no biopsy was performed. clinical examination revealed normal vital signs with subcutaneous emphysema and air crepitus at the base of her neck bilaterally and on the anterior chest wall. computed tomography (ct) scan of the chest, abdomen and pelvis revealed massive free retroperitoneal and intraperitoneal air and massive pneumomediastinum with extensive gas dissecting throughout the neck (fig. (b) ct scan of the abdomen and pelvis with massive free retroperitoneal and intraperitoneal air. she was admitted to the intensive care unit for close monitoring and was managed conservatively with bowel rest, intravenous fluids and broad spectrum antibiotics. the patient condition improved without the need for surgical intervention, her diet was gradually advanced and a repeat ct scan of the chest, abdomen and pelvis after 4 days showed interval improvement of the pneumomediastinum and pneumoperitoneum. she was discharged in a stable condition and advised to follow up with outpatient medical clinic. the incidence of colorectal perforation following colonoscopy has been reported to range between 0.16% in diagnostic colonoscopies and 0.44% in therapeutic colonoscopies. risk factors for perforation include advanced age, inflammatory bowel disease, diverticulitis, malignant masses and performance of therapeutic procedures such as polypectomy [2 - 4 ]. literature suggests sigmoid colon as the most commonly involved site for perforation followed by the cecum, which could be explained by anatomic variations, frequent location of diverticula, polyps and subsequent therapeutic interventions predisposing to thermal or mechanical injuries. three different mechanisms describe the cause of perforation : pneumatic perforation, mechanical perforation, and perforation associated with therapeutic colonoscopy. over distension by insufflated air can cause rupture of colon wall leading to pneumatic perforation while shaft or tip of the endoscope which excessively pressured the intestinal lumen can cause mechanical perforation. therapeutic colonoscopy associated perforations likely result after colon polypectomy, pneumatic dilation, endoscopic mucosal resection and electroceutical injury caused by snares or hot biopsy forceps use. with polypectomy, this risk rises to 0.3 - 1%, and with hydrostatic balloon dilatation of colonic strictures, higher rate (4.6%) may be expected [7, 8 ]. rarely, after colonoscopy, air can accumulate in certain extra - peritoneal body cavities such as the mediastinum, scrotum, subcutaneous tissues, or pleura. the subcutaneous tissue offers the least resistance to expansion and thus, subcutaneous emphysema is usually the first to manifest. the soft tissues in the neck are connected via a continuum of facial planes with the mediastinal cavity, which creates the pneumoperitoneum. furthermore, rupture of the mediastinal pleura due to a high pressure of insufflated air may lead to pneumothorax. patients with cp can present with symptoms and signs of peritonitis (mainly abdominal pain and tenderness) within several hours after the completion of colonoscopy. as the patients with therapeutic colonoscopies tend to have a smaller size of the perforation as compared to diagnostic, these have a delay in presentation compared [12 - 14 ]. the suspicion of cp should be kept in mind, if a patient has fever, abdominal pain or distention following the colonoscopic examination, even several days after the procedure. these patients can be diagnosed and treated for cp on the basis of generalized peritonitis without the radiologic evidence of perforation. in clinically in doubt, a plain x - ray of the abdomen should be taken to rule out intraperitoneal air. ct scanning and magnetic resonance imaging are also of great help to identify the free gas. water - soluble contrast enema can be used to confirm a concealed perforation. the management of cp has been a controversial issue, though it is effectively managed by both conservative and non - conservative (operative) strategies [16, 17 ]. these patients should be closely monitored for clinical improvement which is usually seen within 24 - 48 h. if there is no improvement or worsening of condition, surgical interventions can be opted. recently, another valid approach has been reported in patients with small lesions and without signs of peritonitis, where endoscopic clipping is followed by conservative treatment. surgical treatment is indicated when there is evidence of peritonitis signs, the presence of the distal obstruction to the perforation site and the worsening or no improvement after conservative treatment [8, 19 ]. in conclusion, during a colonoscopy, physicians should be aware of this rare complication as failure to recognize and treat such complications can be unsurprisingly fatal. in conclusion, during a colonoscopy, physicians should be aware of this rare complication as failure to recognize and treat such complications can be unsurprisingly fatal.	colonoscopy is performed for both diagnostic and therapeutic indications. although rare, associated complications can be quite serious. the frequency of these complications depends mainly on the skills of the physicians doing the procedure, and the diagnostic or therapeutic indications. major complications include adverse anesthetic related events, aspiration pneumonia, bleeding, and colonic perforation. we present a rare case of a post - colonoscopy perforation presenting with subcutaneous emphysema and free mediastinal, and intra - peritoneal air. the patient was successfully managed conservatively with complete resolution of symptoms.
taking into consideration all these aspects, in what follows we present a model of an individualized therapy, in a case of bipolar affective disorder. it is the case of a 44-year - old male patient, included in our psychiatric records in 1997, with the diagnosis bipolar affective disorder type i (manic - depressive psychosis) ; for the past two years he was admitted five times for affective episodes, especially of manic type (four of them), while the latest one, which needed hospitalization, was of the depressive type. after the improvement of the symptomatology, specific of the acute phase, the patient, in the phase of remission, participated in cognitive psychotherapy sessions, associated to maintenance pharmacotherapy (antidepressants plus mood stabilizers). the hereditary - collateral history reveals that his 20-years old son was diagnosed with schizophrenia, paranoid type, in 2004. the onset of his latest affective episode was favored by the reduction of his compliance with the medication (the patient says he failed to take his treatment for approximately ten days, as he was very busy at work - he works as an engineer in a private construction company) - and by the association of psycho - traumatic factors, such as the risk of unemployment, generated by his frequent relapses that needed hospitalizations and a large number of medical leaves, his family s conflictual state, generated by financial problems and his son s disease. the purpose of the first psychotherapy sessions was to educate the patient regarding the bipolar disorder, the characteristics of the treatment he needed to follow and the importance of the compliance with the treatment, the particularities of the affective symptoms, as well as their attentive monitoring. it begins by establishing an agenda specific to each session. at the end of each session, the patient was asked to summarize what he had understood from the session in question, and we agreed on the conclusions of the session. the patient is helped to become aware of his own thoughts, about which he knows very little, so that he can analyze the extent to which these thoughts trigger and maintain his emotions and behaviors that make him suffer and that he wants to change. therefore, he is explained how cognitive therapy can help him, when he is depressed or choleric, thinks in an illogical and systematically negative way and acts to his own detriment without realizing it. he will learn to identify and eliminate these negative thoughts, in order to be more productive. the patient is also explained that this disorder manifests by symptoms found in two different poles, one made of joy and the other one of sadness (it opposes during the day the image of joy to the endless night of depression). to illustrate the symptomatology of this disorder, we used the patient s previous experiences and he was provided with written informative material. in the following session, the patient s knowledge was evaluated and he was provided with the necessary clarifications. i informed the patient of the physical, emotional, cognitive and behavioral symptoms, characterizing the manic and the depressive episode, as well as the characteristics of the euthymic state. we began with the presentation of the characteristics of the latest affective (depressive) episode. this list was initiated during the psychotherapy session : for the depressive episode, he mentioned a decrease in his capacity to focus, for the manic episode, the feeling that his thoughts and ideas were too many and he could not deal with them, and for the euthymic state, the capacity of reading the newspaper daily and of successfully performing all his activities. he continued his list at home, as homework, with the help of his family and friends feedback. the patient was informed of the prodromes of the manic episode : the decrease of the need to sleep ; irritability ; exaggerated optimism ; involvement in numerous activities ; logorrhea ; accelerated idea flow ; increased sociability ; distractibility, and the prodromes of the depressive episode : low interest in different activities ; little communication with the people around ; sadness ; sleep disorders ; increased tiredness ; low concentration capacity ; low motivation. for instance, an early sign of the manic episode is the fact that sometimes he finds the colors brighter, more vivid. these prodromes generally occur in a social context, like in the patient s case, which is why the patient s attendance of these psychotherapy sessions plays an important role in identifying and monitoring them. as homework, the patient made a graph of the daily evolution of the changes in his affective, cognitive and behavioral area and physical symptoms, which were evaluated, depending on certain daily activities : his capacity of watching his favorite tv show to the end, the performance of his proposed daily activities, medication administration. in order to identify the behavioral and cognitive changes in the manic episode, the over - stimulating factors were evaluated, in order to limit their negative effect. thus, i found out that almost every evening, before going to bed, the patient would talk on the telephone to his employees to establish the schedule for the following day. this determined the frequent emergence of his sleep disorders and the decrease in his need to sleep and a risk of manic decompensation. this way, we established the clear limits of the duration of his phone conversations, which must end at least one hour before bed, in order for the patient to be able to perform relaxing activities, without having the tv or radio on. as the patient expressed his worry that he might lose important ideas that he could communicate to his employees, he was advised to write down all his ideas. he was forbidden to perform his evening activities in the room where he sleeps and instead of telephone conversations, he should prefer the company of his family and making a list with activities for the following day. after his dysfunctional thoughts were identified, cognitive restructuration was initiated, namely, the patient was instructed to use, as well as he could, his capacity of logical elaboration of cognitive answers. he used a thought record sheet, which was completed between sessions, containing : the date, situation, emotions, associated dysfunctional thoughts, and possible rational thoughts. these were generated by teaching the patient to ask himself the following question : what else could i think in situation x ? or, what else could someone else think in a similar situation ?, what did i use to think in a similar situation, before becoming depressive ? the patient was taught to perform his activities according to a well established programme : for the prodromes of the manic episode, he was recommended to engage himself only in calm activities, to extend his resting hours, to reduce stimulating or exciting factors, to reduce the number of his activities ; for the depressive episode : to occupy his time with an increasing number of activities, and subsequently make a plan for the performance of his activities at work. the patient s evolution was favorable, meaning that his psychiatric disorder remission was consolidated, he increased his compliance with the treatment and the patient appreciated the importance of monitoring his own symptoms and solving psychosocial problems, thus consolidating a process of assisted resilience. i presented this case and its therapeutic management with the purpose of highlighting the assisted resilience process in these situations and also the possibility to individualize the therapy, according with each case situation. the psycho - educational programmes approach the following aspects : educating patients, ensuring their education and access to specific organizations for an appropriate therapeutic management. the organizations that offer care and support to patients and their families play an important role in the long - term management of the treatment of bipolar affective disorders in reducing the costs of the treatment and the burden of the family and community. these manners of organization will help the patient reintegrate in active productive life, especially for patients with a long evolution and frequent relapses. within the therapy for bipolar patients, all these roles must be shared by several family members and they should ask for the help of support groups of families and patients. the organizations support and information therefore, a better co - operation between patients, their families, psychiatrists, family physicians, governmental agencies is desirable to improve the quality of the psychiatry services. for the increase in the long - term efficiency of the therapy of psychiatric disorders in general, separate institutions were created for ambulatory, semi - ambulatory and hospital cares. for a long time, it was believed that by creating competition between the three types of facilities, the ambulatory would manage to limit the number of individuals who use the semi - ambulatory care system and both of them would limit the number of admissions in the psychiatric hospital. this way, the ambulatory unit could have functioned like a filter, allowing only severe cases use intramural facilities. despite all these, the hospital institutions continued to do what they were doing before and even more, under the pressure of the others. as the semi - mural facilities develop too slowly, as an alternative to intramural care, the ambulatory and extramural centers were invaded not only by psychiatric patients with a diagnosis in compliance with the dsm / icd, but especially by an increasing number of clients with psychosocial problems. for the past eight or ten years, fusions have occurred between psychiatric hospitals, mental health centers, group homes etc. nowadays, there are integrated mental health organizations that can deliver any care product to almost any place. the first is professional, in order to ensure the continuity of cares ; the other is economic, offering the benefit to a large organization and several possibilities to decentralize its functions and place them closer to the population. the interest in the economic aspects of the treatment of bipolar affective disorder is not only scientifically important, but it aims at improving different aspects of life quality. there is a series of prejudices related to patients with different psychiatric disorders, especially those with affective disorders, namely : the consequences of a psychiatric disorder are less harmful than those generated by somatic conditions ; the consequences of psychic disorders are relatively fixed, with small possibilities of improvement ; treatments are relatively inefficient, which is why social investments are very small. despite all these, social costs reflect in the decrease of the number of active days and the increase in the absence from work, productivity decrease, as well as costs associated with the legal system related to the aggressiveness risk. the elements whose costs are the hardest to evaluate are the reduction of the possibilities to complete one s education, divorces or family problems. the improvement of life quality must consider the identification of that priority group of patients whose life quality we will try to improve, in order to have higher social benefits. therefore, we should not focus only on reducing affective symptomatology, because, from the point of view of patients or their family members, functional rehabilitation is much more important.	morbidity, mortality and economic consequences of bipolar affective disorder are very important to be evaluated because many of the costs entailed by this psychiatric disorder come from indirect costs due to inadequate diagnosis and treatment and from the characteristics of the affective symptoms itself. psychotherapy focuses on diagnosis and the newest pharmacotherapy determines a decreasing of the morbidity of the disorder and also of its social and economic burden. however, more studies are necessary, with more heterogeneous patients, to find more predictors regarding the psychosocial consequences and to find more information about the prognosis of the bipolar disorder.in this context, in this paper we discuss the role of assisted resilience and the individualization of the therapy of bipolar affective disorder, especially that the resilience must be seen as a continuum and can be used anytime and in any situation, according to the theory of geanellos. this idea is reflected in a case presentation of a patient with the diagnosis of bipolar disorder.
transcription is the synthesis of an rna molecule complementary to the dna template by the action of several enzymes. transcription, whether prokaryotic or eukaryotic, has three main sequential events such as initiation, elongation, and termination [1, 2 ]. initiation is the most important step and involves the binding of rna polymerase to double - stranded dna. elongation is the covalent addition of nucleotides to the 3 end of the polynucleotide chain, and termination involves the recognition of the transcription termination sequence and the release of rna polymerase [1, 2 ]. the sequence of dna that is transcribed into an rna molecule is called a transcription unit and it usually encodes at least one gene. transcription is considerably more complex in eukaryotic cells as compared to bacteria. in bacteria, all the genes are transcribed by a single rna polymerase, but the eukaryotic cells contain multiple different rna polymerases that transcribe various classes of genes. this enhanced complexity of eukaryotic transcription most probably facilitates the sophisticated regulation of gene expression needed to direct the activities of the many different cell types of multicellular organisms. three distinct nuclear rna polymerases are responsible for transcribing different classes of genes in eukaryotic cells. the ribosomal rnas (rrnas) and transfer rnas (trnas) are transcribed by rna polymerases i and iii, and the protein - coding genes are transcribed by rna polymerase ii to yield mrnas [3, 5 ]. for efficient transcription, rna polymerase requires other proteins, commonly known as transcription factors (tfs), to produce the transcript. tfs or sequence - specific dna - binding factor is a protein that specifically binds to dna sequence and controls the stream of genetic information from dna to mrna. tfs along with other proteins in a complex control the transcription by promoting (activator), or blocking (repressor) the recruitment of rna polymerase to specific genes (figure 1). the main functions of tfs are to bind to rna polymerase, to bind another tf, and to bind to cis - acting dna sequences. tfs usually work in groups or complexes forming multiple interactions which allow for varying degrees of control over rates of transcription. in eukaryotes genes are generally in an off state, thus tfs mainly work to turn on the gene expression. while in bacteria the genes the eukaryotic genes generally contain a promoter region upstream from the gene and/or enhancer region upstream or downstream from the gene with some motifs that are specifically recognized by different types of tfs. one distinct quality of tfs is that they have dna - binding domains (dbds) that give them the ability to bind to specific promoter or enhancer sequences. the binding of tfs triggers the other tfs to bind and this creates a complex that ultimately facilitates binding by rna polymerase, thus initiating the process of transcription [3, 4 ]. the basal transcription complex and rna polymerase ii bind to the core promoter of protein encoding gene which is normally within about 50 bases upstream of the transcription initiation site. further transcriptional regulation is controlled by upstream control elements (uces), generally present within about 200 bases upstream of the initiation site (figure 1). sometimes tata box, present in the core promoter for pol ii, the highly conserved dna recognition sequence for the tata - box - binding protein, tbp, helps in the assembly of transcription complex at the promoter (figure 1). general transcription factors (gtfs) are an important class of tfs essential for transcription (figure 1). generally gtfs do not bind to dna, but they form part of the large transcription preinitiation complex which interacts with rna polymerase directly (figure 1). the most common gtfs are transcription factors iia (tfiia), tfiib, tfiie, tfiif, and tfiih [3, 6 ]. malaria caused by the mosquito - transmitted parasite plasmodium falciparum is the most serious and widespread parasitic disease of humans. malaria is the cause of enormous number of deaths every year in the tropical and subtropical areas of the world. among four species of plasmodium, p. falciparum causes the most fatal form of malaria [7, 8 ]. each year, approximately two hundred and twenty - five million people become infected with malaria and around 781,000 die as a result according to the world health organization 's 2010 world malaria report. the malaria parasite has 14 chromosomes, more than 7000 genes and a four - stage life cycle as it passes from humans to mosquitoes and back again [7, 10 ]. p. falciparum has a complex life cycle that involves defined morphological stages accompanied by the stage - specific gene expression in both the human and mosquito host, but the mechanisms of transcriptional control in this parasite are not well known. but it also has exclusive patterns of gene expression and an at - rich genome. the genome analysis reveals a relative paucity of transcription - associated proteins and specific cis - regulatory motifs. these observations have led to reflect a reduced role for the tfs in transcriptional control in the parasite. it has been suggested that protein levels during the life cycle of malaria parasite are controlled through posttranscriptional mechanisms, thus it is possible that posttranscriptional regulation may play a major role in the control of gene expression in p. falciparum. the comparisons of mrna and protein levels across seven major developmental stages of the p. falciparum life cycle were conducted. even though reasonably high correlations were observed between the transcriptome and proteome of each stage, a considerable fraction of genes was found to display a delay between the peak abundance of mrna and protein. the quantitative protein expression profiling during the schizont - stage of the p. falciparum development revealed that extensive posttranscriptional regulation and posttranslational modifications occur in malaria parasites. these observations further support that the posttranscriptional gene regulation events are widespread and of presumably great biological significance during the intraerythrocytic development of p. falciparum. in a recent interesting study, it has been reported that pfclks (cyclin - dependent kinase - like kinase) play crucial role in malaria parasites erythrocytic replication, presumably by participating in gene regulation through the posttranscriptional modification of mrna. the rate of mrna decay is also an essential aspect of post - transcriptional regulation in all organisms. the half - life of each mrna is precisely related to its physiologic role and thus plays an important role in determining levels of gene expression. by using genome - wide approach to describe mrna decay in p. falciparum, it was observed that the rate of mrna decay increases severely during the asexual intraerythrocytic developmental cycle. as global efforts to eradicate malaria have been unsuccessful, there is a vital requirement to decipher the biology of plasmodium and in particular the mechanisms of gene regulation that manage its developmental cycle, so as to propose novel strategies to fight malaria. these are myb1 protein, high mobility group box (hmgb) proteins, and the apetala2 (ap2) domain - containing proteins. this family of proteins was first characterized in the avian myeloblastosis virus (amv). myb proteins, highly conserved in eukaryotes, belong to tryptophan cluster family and regulate gene expression by binding to dna. their characteristic myb dbd of approximately 50 residues contains three tandem repeats (r1, r2, and r3) with three frequently spaced tryptophan residues [18, 19 ]. the structure of the myb domain is similar to the helix - turn - helix motif of prokaryotic transcriptional repressors and eukaryotic homeodomains. myb proteins bind dna in a sequence - specific manner and regulate the expression of genes involved in differentiation and growth control. myb protein was recognized in the p. falciparum genome by aligning about 200 nonredundant eukaryotic myb proteins and generating a consensus sequence analogous to the characteristic dna - binding domain. this consensus was used as query for the plasmodium database which resulted in the annotation of a 414 amino acid long open reading frame pfmyb1. initially, only one myb domain (r2) was identified in pfmyb1 but the alignment of complete sequence of pfmyb1 (plasmodb number pf13_0088) with the dbd of three proteins, ddmybh, ddmyb2, and ddmyb3 of dictyostelium discoideum resulted in the recognition of three myb domains situated in the c - terminus of the protein as in ddmyb2 and ddmyb3 of d. discoideum, whereas in most of the myb proteins dbd is located in the n - terminus. however, in place of tryptophan, pfmyb1 contains imperfect repeats with a tyrosine or a phenylalanine. moreover, a critical cysteine residue, which is conserved as the tryptophan residues was also found in r1 and r2, and it most likely plays a role in redox regulation. this detailed computational analysis of pfmyb1 confirmed that it is a genuine myb protein conserved in all the plasmodium species. it was further reported that pfmyb1 is expressed throughout all the erythrocytic developmental stages of the parasite (rings, early and late trophozoites, as well as early and late schizonts). the expression was analyzed in two different clones of p. falciparum, 3d7 and the gametocyte - less f12 derived from 3d7, and the difference in the mrna profile resides in a lower expression of the pfmyb1 transcript in the ring stage of f12 compared to 3d7, followed by a quick increase in early f12 trophozoites. myb - dna - binding activity was observed with a prototype (mim-1) and two putative plasmodium myb regulatory elements, pfmap1 (map kinase) and pfcrk1 (cdc2-related protein kinase) genes. these genes were originally reported to be expressed preferentially during erythrocytic asexual and sexual stages, respectively [21, 22 ]. this interaction was confirmed to be specific since it was inhibited by specific competitors and anti - pfmyb1 antibody in band - shift assays. during erythrocytic development, the band - shift profiles were clearly different in the 3d7 and the gametocyte - less f12 clones, in contrast to the transcript level. in a follow - up study, the same group used long double - stranded rna (dsrna) to reduce the cognate messenger and encoded protein and reported that the parasite cultures treated with dsrna of pfmyb1 showed growth inhibition. as a result of this dsrna inhibition, the parasite mortality occurred during trophozoite to schizont stages of the development suggesting that pfmyb1 is essential for parasite growth. they have also shown that pfmyb1 binds to a number of promoters such as the promoter of phosphoglycerate kinase, calcium - dependent kinase, tata - binding protein, proliferating cell nuclear antigen, phosphatase, histones, and cyclin - dependent kinase within the parasite nuclei, and therefore directly regulates the key genes involved in cell cycle regulation and progression. in eukaryotes, the high - mobility - group (hmg) box nuclear factors are highly conserved throughout evolution. hmg box domain is composed of around 80 amino acids folded in three -helices arranged in an l shape, and this domain is involved in dna binding. hmg box proteins can bind to non - b - type dna structures such as cruciform and distorted at - rich dna sequences in a nonsequence - specific fashion. this binding triggers dna bending and assists the binding of nucleoprotein complexes that in turn repress or activate transcription. hmg box proteins actively participate in chromatin remodeling by increasing nucleosome sliding and accessibility of the chromatin. the gene for pfhmg consisted of one putative dna - binding domain contained within a single exon. the amino acid sequence revealed that pfhmg lacks the acidic c - terminal domain, which is present in the hmg of higher eukaryotes and interacts with basic proteins such as histones [24, 26 ]. the northern blot analysis of pfhmg rna expression showed that hmg is expressed in all the stages of the asexual erythrocytic life cycle, with the highest level of transcript at early schizont stages. in another study, four putative p. falciparum hmg box proteins including one previously reported pfhmgb1 was annotated within chromosome 12, pfhmgb2 and pfhmgb3 on chromosomes 8 and 12, and pfhmgb4 within chromosome 13, respectively. pfhmgb1 (plasmodb number pfl0145c) and pfhmgb2 (plasmodb number mal8p1.72) are small proteins under 100 amino acids long and contain one characteristic hmg box domain similar to b - box of mammalian hmgb1 [27, 28 ]. pfhmgb4 (plasmodb number mal13p1.290) encodes a 160 amino acids long protein, but pfhmgb3 is a larger protein (2,284 amino acid), with two hmg box domains and several additional putative functional motifs, including one myb domain. the sequence analysis showed that the pfhmgb1 contains 45, 23, and 18%, while pfhmgb2 shares 42, 21, and 17% homology with saccharomyces cerevisiae, human, and mouse hmg box proteins, respectively. the in vitro studies performed with both the recombinant proteins showed that they were able to interact with distorted dna structures and bend linear dna. these proteins were expressed in both asexual- and gametocyte - stage cells, and pfhmgb1 is preferentially expressed in asexual erythrocytic stages and pfhmgb2 in gametocytes. the subcellular localization study revealed that both factors were present in the nucleus, but pfhmgb2 was also detected in the cytoplasm of gametocytes. on the basis of differences in their levels of expression, subcellular localizations, and capabilities for binding and bending dna, these factors most likely have role in transcriptional regulation of plasmodium development. in an interesting study it was reported that pfhmgb1 and pfhmgb2 are effective inducers of proinflammatory cytokines such as tnf from mouse peritoneal macrophages. these observations imply that secreted pfhmgb1 and pfhmgb2 are most likely responsible for producing host inflammatory immune responses associated with malaria infection. the role of hmgb2 protein in regulation of sexual stage gene expression was evaluated by disrupting the plasmodium yoelii gene encoding hmgb2. it is in vivo function in the vertebrate host the mouse and the mosquito anopheles stephensi was studied. it has been reported that the parasites lacking pyhmgb2 develop into gametocytes but have severe impairment of oocyst formation. it was also shown that pyhmgb2 is not required for asexual growth, but it is involved in controlling the genes which are important for oocyst development in the mosquito. these results suggest that the protein expression in sexual stages is transcriptionally and translationally regulated, where pyhmgb2 acts as an important regulator of sexual stage development. activator protein-2 (ap-2) or apetala2 family of transcription factors constitutes a family of closely related and evolutionarily conserved proteins that bind to the dna consensus sequence gccnnnggc and stimulate target gene transcription. four different isoforms of ap-2 have been identified in mammals, termed ap-2,,, and [30, 31 ]. these proteins share a characteristic helix - span - helix motif at the carboxyl terminus, which, together with a central basic region, mediates dimerization and dna binding. the amino terminus contains a proline / glutamine - rich domain, which is responsible for transcriptional activation. the general functions of the family appear to be the cell - type - specific stimulation of proliferation and the suppression of terminal differentiation during embryonic development. the proteins are able to form hetero- as well as homodimers [30, 31 ]. the ap-2 factors are primarily localized in the nucleus, where they bind to the target sequences and regulate the target gene transcription. using a comparative genomic analysis, it has been shown that the apicomplexans possess this ap2 family of proteins which is commonly known as apiap2. about 2027 members of this apiap2 family are present in different genomes, and p. falciparum apiap2 gene family has 27 members, which are largely conserved across plasmodium species. all of these are expressed throughout the four stages of the intraerythrocytic development cycle [31, 32 ]. each of these proteins contain one to four copies of the ap2 dna - binding domain and similar to plants, these domains in apiap2 proteins are also approximately 60 amino acids long and are found in both single- and tandem - domain arrangements [31, 32 ]. by using protein - binding microarrays, the dna - binding specificities of two apiap2 proteins representing different classes of ap2 domain architectures from p. falciparum were demonstrated. the gene with plasmodb number pf14_0633 encodes an 813-aa protein, which shows high level of expression during the ring stage of development. it contains a single 60 amino acids ap2 domain and an adjoining at - hook dna - binding domain. pf14_0633 has orthologues in all the sequenced plasmodium genomes and all the other sequenced apicomplexan genomes. the other apiap2 gene with plasmodb number pff0200c shows high level of expression in late - stage parasites and encodes a 1,979 amino acid protein containing two ap2 domains in tandem. these two ap2 domains are linked with each other by a conserved 17 amino acid sequence. the orthologous tandem ap2 domains of pff0200c share ~95% amino acid sequence identity, but the individual ap2 domains of pff0200c share only 35% identity with each other. these ap2 domains specifically bind with unique dna sequence motifs that are found in the upstream regions of different sets of genes that are coregulated during asexual development. interestingly, despite the sequence deviation between apiap2 proteins from distantly related apicomplexan species (p. falciparum and cryptosporidium parvum), the dna - binding specificities of orthologous pairs of ap2 domains are highly conserved, that is, tgcatgca, although their downstream targets may vary. using pexel / vts search, it was reported that ap2 proteins do not have motifs for apicoplast targeting, mitochondrial transit, endoplasmic reticulum trafficking, transmembrane domains, or host cell surface targeting but the classical lysine- and arginine - rich nuclear localization signals were identified concluding that this protein family consisted of tfs. the plasmodium - based global yeast two - hybrid study suggested that apiap2 proteins interact with each other and with chromatin - remodeling factors, plasmodium histone acetyltransferase gcn5. the binding to chromatin - remodeling factors may help in the recruitment of these complexes to specific chromosomal locations and facilitate interaction with the core transcription machinery. the crystal structure of the dna - bound dimer of the ap2 domain of pf14_0633 exhibits many of the canonical features of similar dna - binding domains. the structure of pf14_0633 shows that it dimerizes through a three dimensional domain - swapping mechanism in which the -helix of one protomer is packed against the -sheet of its dimer mate. it was further reported that the dimerization of the ap2 domain of pf14_0633 aligns cys76 residues of each monomer with one another with enough proximity to permit the disulfide bond formation. it was interesting to note that the cys76 residue is conserved in all the orthologues of pf14_0633 in plasmodium spp. this dna - induced dimerization of the ap2 domain of pf14_0633 facilitates the conformational rearrangement of the rest of the protein or its interaction partners and this concurrently loops out intervening dna among pairs of binding sites enriched in the upstream regions of a set of sporozoite - specific genes. in a recent comprehensive study, the global dna - binding specificities for the entire p. falciparum apiap2 family of dna - binding proteins was biochemically and computationally characterized. their results revealed that the majority of proteins bind diverse dna sequence motifs and occur in functionally related sets of genes. in a number of proteins, multiple ap2 domains within the same apiap2 protein in addition to high affinity primary motif interactions, the interactions with secondary motifs were also observed. by mapping these sequences throughout the parasite genome, the results of this study the overall studies on apiap2 family of proteins in p. falciparum suggest that these proteins are main components of gene regulation in the parasite. although further work is needed in order to determine how apiap2 proteins function as transcriptional regulators. but the dna - binding sequence specificity of these proteins, their conservation across apicomplexa, and the extremely consistent expression patterns of their predicted downstream targets suggest their vital function in regulating parasite development. during its asexual life cycle, the p. falciparum develops into several distinct morphological forms occupies various compartments in its human host and often faces drug treatment. the microarray - based transcriptomic studies of these stages reported remarkable changes in the steady - state mrna levels of several genes, suggesting that differential gene expression is essential for development. it is well established now that gene regulation in p. falciparum consists of a bulk transcriptional event characteristic of the majority of genes from which differential expression of a minority of genes is selected by a combination of pretranscriptional and posttranscriptional mechanisms. therefore, the modulation of expression of the targeted genes is the outcome of the blend of these diverse interactions. for example, a member of the hmgb was identified in entamoeba histolytica and some myb family members were characterized from trichomonas vaginalis (reviewed in). the information compiled in this paper suggests that p. falciparum indeed contains few tfs which are responsible for the gene regulation in various stages of its development. relatively, little is known about how the parasite uses these few tfs to globally regulate the transcription in order to produce the proteins essential for its development and pathogenesis. it has been suggested that combinatorial gene regulation might be the general mode of transcriptional regulation in p. falciparum or it can be assumed that the effect of various tfs on gene expression is additive. therefore a very useful anti - plasmodial approach should be to target and inactivate one or more of these tfs with drugs. this strategy will directly or indirectly affect the gene regulation and consequently the function of several downstream genes and crucial biological processes. due to the effect on numerous genes this approach will be very helpful, and it will be relatively difficult for the parasite to develop resistance to this line of drugs.	transcription is a process by which the genetic information stored in dna is converted into mrna by enzymes known as rna polymerase. bacteria use only one rna polymerase to transcribe all of its genes while eukaryotes contain three rna polymerases to transcribe the variety of eukaryotic genes. rna polymerase also requires other factors / proteins to produce the transcript. these factors generally termed as transcription factors (tfs) are either associated directly with rna polymerase or add in building the actual transcription apparatus. tfs are the most common tools that our cells use to control gene expression. plasmodium falciparum is responsible for causing the most lethal form of malaria in humans. it shows most of its characteristics common to eukaryotic transcription but it is assumed that mechanisms of transcriptional control in p. falciparum somehow differ from those of other eukaryotes. in this article we describe the studies on the main tfs such as myb protein, high mobility group protein and apia2 family proteins from malaria parasite. these studies show that these tfs are slowly emerging to have defined roles in the regulation of gene expression in the parasite.
sigmoid diverticulosis has a prevalence of up to 60% in 70-year - old individuals, of whom 1025% may progress to diverticulitis and a further 1025% of these may develop complications such as abscess formation, perforation or fistulas. the mortality rate has been demonstrated to be 0.55%. the most common symptoms include left lower abdominal pain lasting for a few days, fever, nausea and vomiting, and abdominal tenderness and rigidity during clinical examination. false diverticulum, e.g. only the mucosa and submucosa herniate through the muscular layer of the gut. risk factors include, among others, obesity and chronic constipation. the pathophysiological process of sigmoid diverticulitis is primarily thought to be erosions caused by pressure exerted in the sigma, in combination with feces and microbial toxins which form microabscesses. these erosions develop into ulcers which may then perforate, either covered by peritoneum, or freely, into the abdominal cavity. toxic epidermal necrolysis (ten) is caused by a severe inflammatory reaction, most probably of autoimmune origin. it is characterized by cytotoxic t - lymphocytes and other cytokine pathways, causing keratinocyte apoptosis and thereby disruption of the epidermis from the dermis of the skin. it presents clinically with fever, itchy eyes, pain upon swallowing and cutaneous efflorescences such as erythematous purpuric macules on the trunk and proximal upper extremities as well as on the lips and oral, conjunctival and genital mucosae. the epidermal skin lesions progress to full - walled necrosis, materializing as epidermal detachment and resulting in blisters. a positive nikolsky sign can be elicited, and the skin resembles wet cigarette paper when detached. stevens - johnson syndrome affects less than 10% of the total body surface area (tbsa) and has an incidence of approximately 6 cases per million persons per year, with an average mortality rate of 15%. ten involves more than 30% of the tbsa and affects approximately 2 persons per year with an average mortality rate of 2550% [2, 3 ]. a 91-year - old female was admitted to our emergency department shortly after having been found lying in the shower at home. the patient had lived by herself up to that point and presented with a medical history of arterial hypertension and spinal arthrosis. she had been taking mefenamic acid and paracetamol, but the latter had been changed to metamizole a pyrazolone derivative approximately 3 weeks prior to admission. taking the patient 's history was complicated by her age and dementia, and retrospectively, possibly due to a delirious state. on admission, the patient reported having suffered burns from a stove. she then took a shower where she slipped and fell, and was burnt additionally by the hot water. clinically, she presented with epidermal lysis on both thighs and proximal upper extremities, totaling approximately 7% of the tbsa, which in the context of the reported burning, were interpreted as second - degree burns (fig. the skin showed no adherence to the underlying tissue and could be stripped off without effort. a slight reddish rash was noted on both breasts and the lower abdomen and was interpreted as a reaction to the bandages. she presented with a distended abdomen, tender to the touch in the left lower quadrant, lacking rebound tenderness. laboratory studies showed elevated c - reactive protein of 169 mg / l and leucocytes of 33,100/l. moreover, she presented with lymphocytopenia (lymphocyte count 500/l), renal insufficiency (creatinine 121 mol / l) and a hypokalemia level of 2.7 mmol / l. free air in the abdominal cavity and signs suggestive of perforated sigmoid diverticulitis were observed (fig. the condition was managed by emergent sigmoid colectomy with colostomy (hartman 's procedure). in the course of intubation and surgery, a rapid progression of the epidermal detachment was noted on the abdomen, spreading to 3040% of her tbsa. a direct nikolsky sign could be elicited, and an attempt at an indirect sign was negative. following surgery, renal function deteriorated progressively. during the following 2 days, further cutaneous vesicles developed, the epidermolysis generalized and the patient became increasingly delirious. after 3 days, she showed signs of apneic breathing, after which we decided on palliative treatment. the matter under discussion is whether the perforated sigmoid diverticulitis in our patient developed due to the epidermolysis resulting from an adverse reaction to medication, or whether it evolved independently. a review of the literature shows very few cases of simultaneous ten with ulcerative gastrointestinal disease, and only 1 case of ten with perforated sigmoid diverticulitis. a study from 1991 by chosidow. three out of the 4 patients showed severe mucosal erosive lesions in the small intestine ; similar changes were also found in the colon of all patients. epithelial cell necrosis could be observed predominantly in the sigmoid and rectum, resulting in detachment of the epithelial lining. similarly, very few other cases have been published describing superficial erosions with bleeding throughout the colon in the context of ten [5, 6, 7, 8, 9, 10, 11 ]. these cases, however, were not complicated by perforation of the colon, as ours was. to date, only 1 case of sigmoid perforation in the presence of ten has been reported, by carter and mitchell. the patient presented with cutaneous changes characteristic of ten, in addition to renal insufficiency. in the course of 1 week, the patient complained of worsening abdominal pain associated with coffee - ground emesis and blood per rectum. an abdominal ct scan revealed a pneumoperitoneum, upon which surgical exploration was carried out. fecal peritonitis, complete necrosis of the terminal ileum as well as multiple colonic perforations along the sigmoid and cecum were identified. an ileal resection and total colectomy histological workup of the resected specimen demonstrated complete necrosis of the ileum and focal necrosis of the colon, with several areas of linear mucosal ulcerations showing lymphohistiocytic inflammatory infiltrate. after a long course of antibiotics and supportive there are very few reported cases of perforated ulcerative conditions in the gastrointestinal tract due to mucosal necrolysis. some authors suggest a similar immunologic pathogenesis as for toxic epidermal necrolysis [11, 12 ]. endoscopic biopsies have shown an increase in lymphoid cells, with no abnormal number of neutrophils or existence of crypt abscesses. histological workup demonstrated pathological changes characteristic of diverticulitis, but no lymphocytic infiltrate characteristic of ten. however, our patient had lymphocytopenia, possibly indicating migration of lymphocytes to dermal tissues. also, her medication had been changed from paracetamol to metamizole approximately 3 weeks prior to developing ten, corresponding to the time average reported so far. in all cases reported to date, patients presented with abdominal pain, bloody diarrhea or blood per rectum, usually simultaneous to the development of skin lesions. diagnosis was supported by colonoscopy showing mucosal erosions, predominantly in the sigmoid and rectum. our patient did not present with the abovementioned symptoms, and colonoscopy could not be performed due to the upcoming surgery. only carter and mitchel have reported free sigmoid perforation in the presence of ten from which the patient recovered successfully. patients discussed in other cases, as well as ours, died, proving the severity of the condition. the condition 's outcome can be estimated using the scorten score. our patient acquired a score of 4 points (age > 40 years, tbsa affected > 10%, serum urea nitrogen > 28 mg / dl, bicarbonate < 20 mmol / l), which is associated with a mortality of 60%. this may be indicative that an early and aggressive surgical approach is crucial in order to successfully avoid abdominal sepsis and increase survival rates. she presented with an affected tbsa and temporal development similar to previously reported cases of ten with intestinal involvement., ten has a low incidence rate, but continues to result in serious, potentially fatal outcomes. although the condition predominantly affects the skin, other areas such as the oral, esophageal as well as colonic (especially the sigmoid) mucosae may be affected. it has been shown that gastrointestinal involvement may increase mortality dramatically by rapidly progressing to transmural ulcerations causing fecal peritonitis. medical staff must therefore be alert to all patients with ten who complain of abdominal discomfort.	even though the incidence of toxic epidermal necrolysis (ten) is low, it is also associated with a high mortality rate. the condition predominantly affects the skin, but may also affect the gastrointestinal tract, dramatically increasing mortality. we present a case of perforated sigmoid diverticulitis in the presence of ten. the patient was taking medication, known to be a risk factor, and presented an affected total body surface area and temporal development similar to previously reported cases of ten. characteristic abdominal symptoms, however, were missing. gastrointestinal involvement in ten appears to be a poor prognostic factor ; medical staff must therefore be alert to patients with ten who complain of abdominal discomfort. the exact pathogenesis, however, remains unclear.
briefly, gst - tagged rat -arrestin1 in the pgex4 t vector was transformed into bl21(de3) cells, large scale expression cultures were grown in terrific broth, and induced with 1 mm iptg for 16 hr at 16 c. cell pellets were lysed in 20 mm hepes ph 7.4, 150 mm nacl, 1 mm pmsf and 2 mm dtt using a micro fluidizer, and the lysate was bound to glutathione sepharose at 4 c for 2 hr. beads were washed in lysis buffer and -arrestin1 was eluted by overnight incubation with thrombin at 4 c. -arrestin1 was then purified with a hitrap q column and eluted by a linear gradient of nacl. peak fractions were pooled and purified protein was dialyzed in 20 mm hepes ph 7.4 and 150 mm nacl. the phage library was panned against biotinylated -arrestin1 bound to v2rpp and immobilized on streptavidin beads. beads were washed three times and bound phages were amplified by infecting e. coli xl-1 blue cells. amplified phage were precipitated and used for a second and third round of panning. to select against fabs that bind to the inactive conformation of -arrestin1, beads coated with the -arrestin1:v2rpp complex were first incubated with phage and then with 1 m non - biotinylated -arrestin1. subsequently, phage were eluted with dithiothreitol (dtt) and resulting clones were used for single point elisa to test their selectivity towards -arrestin1 bound to v2rpp. -arrestin1 was incubated with either non - phosphorylated v2 vasopressin peptide (v2rnp) or v2rpp in a 1:3 molar ratio for 30 min at 25 c. subsequently, purified fabs were added at a 1:2 molar ratio with -arrestin1 and incubated for additional 30 min at 25 c. then, pre - washed protein a beads (pierce) were added to the reactions and incubated for 30 min at 25 c. beads were washed 4 times with 1 ml buffer (20 mm hepes ph 7.4, 150 mm nacl) and proteins were eluted with sds - page gel loading buffer. fab30 displayed the greatest difference in its ability to co - immunoprecipitate -arrestin1 between v2rnp and v2rpp and was therefore chosen for further characterization (reis & lefkowitz, manuscript in preparation). sf9 insect cells were co - infected with baculovirus encoding an n - terminal flag tagged 2-v2r (a chimeric receptor with 2ar residues 1 to 341 and v2 vasopressin receptor residues 328 through 372) and grk2-caax (grk2 with a membrane tethering prenylation signal). following viral infection for 72 hours at 27 c, cells were incubated with 10 m isoproterenol at 37 c for 15 min to induce receptor phosphorylation. membranes were extensively washed in order to remove isoproterenol used for receptor phosphorylation. for radioligand binding, membranes were incubated with 60 pm [i ] cyanopindolol (ge healthcare lifescience) in radioligand binding buffer (50 mm tris, ph 7.4, 50 mm potassium acetate, 0.5 mm magnesium chloride, 1 mm ascorbic acid) with varying concentrations of freshly prepared isoproterenol. binding reactions were performed in parallel, with 1 m -arrestin1 (residues 1 - 393) incubated either in the presence or absence of 10 m fab30. binding reactions were incubated for 90 min at 27 c, followed by rapid harvesting on a gf - b filter and scintillation counting in a packard gamma counter. competition binding data were analyzed by a non - linear curve - fitting procedure where low and high affinity values were computed globally using a two - site binding model (graphpad prism). the f - test was used to test whether fab30 significantly altered the amount of 2-v2r coupled to -arrestin. purified, phosphorylated 2-v2r was prepared bound to the potent agonist 2ar agonist bi-167107 and incubated at a concentration of 1 m with 3 m -arrestin1 with and without fab30 at 25 c for 2 hours in a buffer comprised of 20 mm hepes, ph 7.4, 150 mm nacl, 0.01% mng (lauryl maltose neopentyl glycol). beads were washed and protein was eluted with 5 mm edta and 0.25 mg / ml flag peptide and elution fractions were analyzed on a 4 - 20% sds - page gel and stained with coomassie. -arrestin1 (20 m) was incubated with v2rpp (27 m) for 30 min at 25 c. an excess of fab30 was added and the complex was incubated for 1 hour at 25 c. the -arrestin1:v2rpp : fab30 complex was purified from excess fab30 and v2rpp by size exclusion chromatography in 20 mm hepes ph 7.5, 150 mm nacl, and 1 mm tcep. the purified complex was concentrated to 8 mg / ml using a centrifugal concentrator (vivaspin, ge healthcare). crystals were grown in hanging drops containing 1 l of complex solution and 0.5 l of a well solution composed of 17% peg 3350, 0.1 m hepes ph 7.5, and 0.2 m l - proline. drops were stored at 20 c and crystals appeared within 24 hours and grew to full size within 3 days (fig. crystals were flash frozen in liquid nitrogen after a 30 second soak in 19% peg 3350, 0.1 m hepes ph 7.5, 0.2 m l - proline, and 20% ethylene glycol. diffraction data were collected at the advanced photon source gm / ca - cat beamline 23id - d. although typical crystals grew to over 300 m in two dimensions, and over 100 m in the third dimension, we utilized a 10 m - sized beam to collect multiple full datasets from the highest quality regions of the crystal. a full dataset from the single best region of the crystal was indexed, integrated, and scaled with hkl-2000. the structure of the complex was solved by molecular replacement using phaser. due to the conformational changes observed for -arrestin1, it proved necessary to first search for fab30 (pdb i d : 3eff ; fab2, with the complementary determining regions omitted, was used as a search model for fab30), followed by only the c - domain of -arrestin1 (pdb i d : 1jsy). a subsequent search for the n - domain of -arrestin1 failed in multiple attempts ; the n - domain was then manually placed to fit the electron density. a significant decrease in rfree upon rigid body refinement of the n - domain provided confidence in the final molecular replacement solution. the resulting model was then iteratively refined by building regions of -arrestin1, v2rpp, and fab30 in coot and refining in phenix. we utilized translation libration screw - motion (tls) refinement with groups defined within phenix. for the v2rpp, the amino - acid register was determined by the strong electron density resulting from electron - rich phosphates on phosphoserine and phosphothreonine residues. as shown in fig. s7, the electron density for the v2rpp was clear, permitting confident placement of most side chains. we used molprobity to assess statistics for the final model of the -arrestin1:v2rpp : fab30 complex. supplementary table 1 outlines statistics for data collection and refinement. briefly, gst - tagged rat -arrestin1 in the pgex4 t vector was transformed into bl21(de3) cells, large scale expression cultures were grown in terrific broth, and induced with 1 mm iptg for 16 hr at 16 c. cell pellets were lysed in 20 mm hepes ph 7.4, 150 mm nacl, 1 mm pmsf and 2 mm dtt using a micro fluidizer, and the lysate was bound to glutathione sepharose at 4 c for 2 hr. beads were washed in lysis buffer and -arrestin1 was eluted by overnight incubation with thrombin at 4 c. -arrestin1 was then purified with a hitrap q column and eluted by a linear gradient of nacl. peak fractions were pooled and purified protein was dialyzed in 20 mm hepes ph 7.4 and 150 mm nacl. the phage library was panned against biotinylated -arrestin1 bound to v2rpp and immobilized on streptavidin beads. beads were washed three times and bound phages were amplified by infecting e. coli xl-1 blue cells. amplified phage were precipitated and used for a second and third round of panning. to select against fabs that bind to the inactive conformation of -arrestin1, beads coated with the -arrestin1:v2rpp complex were first incubated with phage and then with 1 m non - biotinylated -arrestin1. subsequently, phage were eluted with dithiothreitol (dtt) and resulting clones were used for single point elisa to test their selectivity towards -arrestin1 bound to v2rpp. -arrestin1 was incubated with either non - phosphorylated v2 vasopressin peptide (v2rnp) or v2rpp in a 1:3 molar ratio for 30 min at 25 c. subsequently, purified fabs were added at a 1:2 molar ratio with -arrestin1 and incubated for additional 30 min at 25 c. then, pre - washed protein a beads (pierce) were added to the reactions and incubated for 30 min at 25 c. beads were washed 4 times with 1 ml buffer (20 mm hepes ph 7.4, 150 mm nacl) and proteins were eluted with sds - page gel loading buffer. fab30 displayed the greatest difference in its ability to co - immunoprecipitate -arrestin1 between v2rnp and v2rpp and was therefore chosen for further characterization (reis & lefkowitz, manuscript in preparation). sf9 insect cells were co - infected with baculovirus encoding an n - terminal flag tagged 2-v2r (a chimeric receptor with 2ar residues 1 to 341 and v2 vasopressin receptor residues 328 through 372) and grk2-caax (grk2 with a membrane tethering prenylation signal). following viral infection for 72 hours at 27 c, cells were incubated with 10 m isoproterenol at 37 c for 15 min to induce receptor phosphorylation. membranes were extensively washed in order to remove isoproterenol used for receptor phosphorylation. for radioligand binding, membranes were incubated with 60 pm [i ] cyanopindolol (ge healthcare lifescience) in radioligand binding buffer (50 mm tris, ph 7.4, 50 mm potassium acetate, 0.5 mm magnesium chloride, 1 mm ascorbic acid) with varying concentrations of freshly prepared isoproterenol. binding reactions were performed in parallel, with 1 m -arrestin1 (residues 1 - 393) incubated either in the presence or absence of 10 m fab30. binding reactions were incubated for 90 min at 27 c, followed by rapid harvesting on a gf - b filter and scintillation counting in a packard gamma counter. competition binding data were analyzed by a non - linear curve - fitting procedure where low and high affinity values were computed globally using a two - site binding model (graphpad prism). the f - test was used to test whether fab30 significantly altered the amount of 2-v2r coupled to -arrestin. purified, phosphorylated 2-v2r was prepared bound to the potent agonist 2ar agonist bi-167107 and incubated at a concentration of 1 m with 3 m -arrestin1 with and without fab30 at 25 c for 2 hours in a buffer comprised of 20 mm hepes, ph 7.4, 150 mm nacl, 0.01% mng (lauryl maltose neopentyl glycol). beads were washed and protein was eluted with 5 mm edta and 0.25 mg / ml flag peptide and elution fractions were analyzed on a 4 - 20% sds - page gel and stained with coomassie. -arrestin1 (20 m) was incubated with v2rpp (27 m) for 30 min at 25 c. an excess of fab30 was added and the complex was incubated for 1 hour at 25 c. the -arrestin1:v2rpp : fab30 complex was purified from excess fab30 and v2rpp by size exclusion chromatography in 20 mm hepes ph 7.5, 150 mm nacl, and 1 mm tcep. the purified complex was concentrated to 8 mg / ml using a centrifugal concentrator (vivaspin, ge healthcare). crystals were grown in hanging drops containing 1 l of complex solution and 0.5 l of a well solution composed of 17% peg 3350, 0.1 m hepes ph 7.5, and 0.2 m l - proline. drops were stored at 20 c and crystals appeared within 24 hours and grew to full size within 3 days (fig. crystals were flash frozen in liquid nitrogen after a 30 second soak in 19% peg 3350, 0.1 m hepes ph 7.5, 0.2 m l - proline, and 20% ethylene glycol. diffraction data were collected at the advanced photon source gm / ca - cat beamline 23id - d. although typical crystals grew to over 300 m in two dimensions, and over 100 m in the third dimension, we utilized a 10 m - sized beam to collect multiple full datasets from the highest quality regions of the crystal. a full dataset from the single best region of the crystal was indexed, integrated, and scaled with hkl-2000. the structure of the complex was solved by molecular replacement using phaser. due to the conformational changes observed for -arrestin1, it proved necessary to first search for fab30 (pdb i d : 3eff ; fab2, with the complementary determining regions omitted, was used as a search model for fab30), followed by only the c - domain of -arrestin1 (pdb i d : 1jsy). a subsequent search for the n - domain of -arrestin1 failed in multiple attempts ; the n - domain was then manually placed to fit the electron density. a significant decrease in rfree upon rigid body refinement of the n - domain provided confidence in the final molecular replacement solution. the resulting model was then iteratively refined by building regions of -arrestin1, v2rpp, and fab30 in coot and refining in phenix. we utilized translation libration screw - motion (tls) refinement with groups defined within phenix. for the v2rpp, the amino - acid register was determined by the strong electron density resulting from electron - rich phosphates on phosphoserine and phosphothreonine residues. as shown in fig. s7, the electron density for the v2rpp was clear, permitting confident placement of most side chains. we used molprobity to assess statistics for the final model of the -arrestin1:v2rpp : fab30 complex.	the functions of g - protein coupled receptors (gpcrs) are primarily mediated and modulated by three families of proteins : the heterotrimeric g proteins, the g - protein coupled receptor kinases (grks), and the arrestins1. g proteins mediate activation of second messenger - generating enzymes and other effectors, grks phosphorylate activated receptors2, and arrestins subsequently bind phosphorylated receptors and cause receptor desensitization3. arrestins activated by interaction with phosphorylated receptors can also mediate g protein - independent signaling by serving as adaptors to link receptors to numerous signaling pathways4. despite their central role in regulation and signaling of gpcrs, a structural understanding of -arrestin activation and interaction with gpcrs is still lacking. here, we report the crystal structure of -arrestin1 in complex with a fully phosphorylated 29 amino acid carboxy - terminal peptide derived from the v2 vasopressin receptor (v2rpp). this peptide has previously been shown to functionally and conformationally activate -arrestin15. to capture this active conformation, we utilized a conformationally - selective synthetic antibody fragment (fab30) that recognizes the phosphopeptide - activated state of -arrestin1. the structure of the -arrestin1:v2rpp : fab30 complex shows striking conformational differences in -arrestin1 compared to its inactive conformation. these include rotation of the amino and carboxy - terminal domains relative to each other, and a major reorientation of the lariat loop implicated in maintaining the inactive state of -arrestin1. these results reveal, for the first time at high resolution, a receptor - interacting interface on -arrestin, and they suggest a potentially general molecular mechanism for activation of these multifunctional signaling and regulatory proteins.
however, variations in the facial nerve have been reported and they increase the risk of facial nerve injury during parotid surgery. herein, we report a unique case of a parotid tumor in conjunction with a facial nerve anomaly. key pointswe report a new variation in the facial nerve pattern, and an unusual relationship with the retromandibular vein during parotid surgery.clinicians should recognize this facial anomaly and the unusual relationship with the retromandibular vein to avoid injuring the facial nerve during parotid surgery. we report a new variation in the facial nerve pattern, and an unusual relationship with the retromandibular vein during parotid surgery.clinicians should recognize this facial anomaly and the unusual relationship with the retromandibular vein to avoid injuring the facial nerve during parotid surgery. we report a new variation in the facial nerve pattern, and an unusual relationship with the retromandibular vein during parotid surgery. clinicians should recognize this facial anomaly and the unusual relationship with the retromandibular vein to avoid injuring the facial nerve during parotid surgery. we report a new variation in the facial nerve pattern, and an unusual relationship with the retromandibular vein during parotid surgery.clinicians should recognize this facial anomaly and the unusual relationship with the retromandibular vein to avoid injuring the facial nerve during parotid surgery. we report a new variation in the facial nerve pattern, and an unusual relationship with the retromandibular vein during parotid surgery. clinicians should recognize this facial anomaly and the unusual relationship with the retromandibular vein to avoid injuring the facial nerve during parotid surgery. a 22-year - old female presented to our department with left infra - auricular swelling present for > 2 years. a physical examination revealed a solitary, firm, nontender, mobile, and 3-cm sized mass in the left parotid gland. a computed tomography scan of the neck demonstrated a 3.2 2.3 cm well - defined, heterogeneously enhancing mass in the left parotid gland (figure 1). neck computed tomography scan demonstrates a 3.2 2.3 cm well - defined, heterogeneously enhancing mass in the left parotid gland. based on these observations, the preoperative diagnosis was a left - side superficial parotid tumor. a modified face lift incision was performed and a skin flap was elevated anteriorly, exposing the parotid gland. we found the main trunk of the facial nerve in the anticipated location and the nerve was dissected anteriorly and superiorly. we observed 2 unusual nerves ascending to the preauricular region and connecting to the facial nerve. after superficial parotidectomy preserving the facial nerve including the 2 unusual nerves, the 2 unusual nerves were found to connect to the temporofacial division from the main trunk of the facial nerve and were confirmed to be the facial nerve using the neurophysiological intraoperative monitoring (nim) 2.0 system (medtronic ; minneapolis, mn) (figure 2). in addition, an anomalous relationship was detected between the retromandibular vein and the facial nerve. the retromandibular vein was lateral to the cervicofacial division and medial to the temporofacial division (figure 2). two unusual nerves (arrows) connected to the temporofacial division from the facial nerve main trunk are detected after superficial parotidectomy, and the retromandibular vein (arrowheads) is lateral to the cervicofacial division but medial to the temporofacial division. this study was approved by the institutional review board of the chonnam national university hwansun hospital. therefore, understanding surgical landmarks for the facial nerve is essential for safe and effective parotid surgery. the most commonly used surgical landmarks are the stylomastoid foramen, the tympanomastoid suture, the posterior belly of the digastric muscle, the tragal pointer, and the retromandibular vein. among these landmarks, several reports have found that the retromandibular vein is medial to the facial nerve in up to 90% of cases. however, in the present case, retromandibular vein was lateral to the cervicofacial division and medial to the temporofacial division. however, we observed 2 unusual nerves connecting the temporofacial division in the present case. a limitation of this report is that we never found the origin of these unusual nerves. in conclusion, we report a new variation in the facial nerve pattern, and an unusual relationship with the retromandibular vein during parotid surgery. clinicians should recognize this facial anomaly and the unusual relationship with retromandibular vein to avoid injuring the facial nerve during parotid surgery. intraoperative nerve monitoring and careful dissection are important to avoid intraoperative facial nerve injury, particularly in patients with a facial nerve anomaly.	abstractthe branching pattern of the facial nerve varies among individuals. these variations increase the risk of facial nerve injury during parotid surgery. we report a new variation of the facial nerve and an unusual relationship with the retromandibular vein during parotid surgery.clinicians should recognize this facial anomaly and the unusual relationship with the retromandibular vein to avoid injuring the facial nerve during parotid surgery.
diabetes mellitus is one of the most common metabolic disorders in the world (1, 2). the number of patients with this disease is predicted to reach over 366 million people in 2030 (4). in recent years, increasing prevalence of diabetes mellitus as a chronic disease has prompted investigators to find ways to control it. researchers are always looking for non - pharmacologic and nutritional approaches to improve the control of type 2 diabetes with a lower cost. in 1958, mertz discovered that brewer s yeast has a potent effect on hypoglycemic role of insulin (5).this discovery led to the isolation of glucose tolerance factor (gtf) from brewer s yeast. nowadays, in gtf - related studies, the yeast is used as an applicable matter (6). gtf facilitates binding of insulin to the target cells by creating a triple complex between gtf, insulin, and its receptors on target cell membranes. gtf not only potentially increases insulin effects, but also may reduce cholesterol and triglyceride levels (8). different results have been reported from various studies about effects of brewer s yeast on lipid profile. a study reported no significant changes in the levels of serum lipoproteins after supplementation with brewer s yeast (9). other studies showed beneficial effects of brewer s yeast on serum total cholesterol, triglyceride and hdl - c levels in comparison with chromium chloride (10, 11). in a clinical trial in iran, the authors observed significant reductions in triglyceride levels, total cholesterol and ldl - c and significant increased in hdl - c levels after supplementation with brewer s yeast (12). moreover, hypertension is one of the complications of type 2 diabetes mellitus, which will accelerate cardiovascular, and nephropathy complications in diabetes mellitus (13, 14). also high triglycerides and low hdl - c levels are among the complications of diabetes, so monitoring the rate of their changes is of special importance (15). the current study is different in terms of sample size, research method, number of tablets, duration of intervention, and age of samples comparing with previous research studies. this study aimed to investigate the effect of brewer s yeast supplementation on blood pressure and serum lipoproteins in patients with type 2 diabetes. among 1200 cases with type 2 diabetes mellitus referring to diabetes clinic of dezful ganjavian hospital, 90 patients with type 2 diabetes were recruited by simple random sampling. six participants were excluded, 4 of them due to irregular consumption of pills, one patient due to lack of willingness to continue collaboration, and one due to pregnancy. inclusion criteria were diagnosis of type 2 diabetes by a physician, age range of 3555 years and diabetes lasted more than two years. exclusion criteria were cardiovascular diseases, hepatitis, renal diseases, gout, parkinson s, depression, consumption of steroidal and non steroidal anti - inflammatory drugs or monoamine oxidase inhibitors and insulin therapy. this trial was registered in iranian registry of clinical trials (irct), no.irct138807062513n1. medical, drugs & supplements history, anthropometric measurements and demographic data were collected at the first interview. then, in a double - blind clinical trial, included individuals were randomly divided into 2 groups receiving brewer s yeast tablets (42 patients) and placebo (42 patients). the brewer s yeast group received 6 tablets of brewer s yeast daily manufactured by health aid ltd. placebo group received 6 placebo tablets daily with similar shape, color and size to the brewer s yeast tablets. placebo tablets consisted of cellulose microcrystalline compounds, magnesium stearate, caramel, malt and stearic acid, and were manufactured by health aid ltd. the subjects were asked not to make any changes in their diet, oral diabetes medications, blood pressure - lowering drugs, lipid lowering agents and their usual physical activity during the intervention. weight, body mass index, systolic and diastolic blood pressure levels, fasting serum triglyceride, total cholesterol, ldl - c and hdl - c were measured before and after 12 weeks of intervention in both groups. twenty - four hour dietary recall questionnaires were completed by a trained dietitian at baseline and at the twelfth week for both groups. in addition, the researchers followed up consumption of the pills regularly every 2 weeks by telephone. furthermore, tablets were delivered to the subjects alternately in three stages (once per month) to better control and to ensure the correct and regular consumption of tablets by patients. of all patients, height and weight were measured before and after the treatments by a trained dietitian in the same and standard situations. german) while patients were in fasting state with minimal clothing and height was measured by seca wall height gauge (seca 206, seca gmbh & co. kg. systolic and diastolic blood pressures were measured by a trained physician by using a mercury sphygmomanometer (diplomat - presameter desk model by error tolerance of + / 3 mmhg, rudolf riester gmbh bruckstr. 31 d-72417 jungingen germany) while the patients were sitting on the chair for at least 5 minutes before the measurements. to be more accurate, an average of three times measured values in each session was reported. to minimize human measurement errors between before and after the intervention measurement of total serum cholesterol was done by colorimetric method using commercially available kit (cat no.10 - 508 ziestchem diagnostics tehran, iran) with sensitivity of 1 mg / dl. serum triglyceride was measured by colorimetric method using biochemistry kit (cat no.10 - 525 ziestchem diagnostics tehran, iran) with sensitivity of 4 mg / dl. serum hdl - c concentrations were measured by enzymatic methods using biochemistry kit (cat no.10 - 507 ziestchem diagnostics tehran, iran), with sensitivity of 1 mg / dl. ldl - c concentrations in serum were automatically measured using enzymatic methods by elitech kits (cat no.ldld-0230 seppim.france) with sensitivity of 0.3 mg / dl by autoanalyzer hitachi 911. data from 24-hour food recall were analyzed by using food processor ii software (fpii, ver2. kolmogorov smirnov test was used for assessing the normality of data distribution. to compare qualitative data, chi - square test and to compare quantitative data, independent t- test, pair t - test and analysis of covariance were used. among 1200 cases with type 2 diabetes mellitus referring to diabetes clinic of dezful ganjavian hospital, 90 patients with type 2 diabetes were recruited by simple random sampling. six participants were excluded, 4 of them due to irregular consumption of pills, one patient due to lack of willingness to continue collaboration, and one due to pregnancy. inclusion criteria were diagnosis of type 2 diabetes by a physician, age range of 3555 years and diabetes lasted more than two years. exclusion criteria were cardiovascular diseases, hepatitis, renal diseases, gout, parkinson s, depression, consumption of steroidal and non steroidal anti - inflammatory drugs or monoamine oxidase inhibitors and insulin therapy. this trial was registered in iranian registry of clinical trials (irct), no.irct138807062513n1. medical, drugs & supplements history, anthropometric measurements and demographic data were collected at the first interview. then, in a double - blind clinical trial, included individuals were randomly divided into 2 groups receiving brewer s yeast tablets (42 patients) and placebo (42 patients). the brewer s yeast group received 6 tablets of brewer s yeast daily manufactured by health aid ltd. placebo group received 6 placebo tablets daily with similar shape, color and size to the brewer s yeast tablets. placebo tablets consisted of cellulose microcrystalline compounds, magnesium stearate, caramel, malt and stearic acid, and were manufactured by health aid ltd. the subjects were asked not to make any changes in their diet, oral diabetes medications, blood pressure - lowering drugs, lipid lowering agents and their usual physical activity during the intervention. weight, body mass index, systolic and diastolic blood pressure levels, fasting serum triglyceride, total cholesterol, ldl - c and hdl - c were measured before and after 12 weeks of intervention in both groups. twenty - four hour dietary recall questionnaires were completed by a trained dietitian at baseline and at the twelfth week for both groups. in addition, the researchers followed up consumption of the pills regularly every 2 weeks by telephone. furthermore, tablets were delivered to the subjects alternately in three stages (once per month) to better control and to ensure the correct and regular consumption of tablets by patients. of all patients, height and weight were measured before and after the treatments by a trained dietitian in the same and standard situations. german) while patients were in fasting state with minimal clothing and height was measured by seca wall height gauge (seca 206, seca gmbh & co. kg. systolic and diastolic blood pressures were measured by a trained physician by using a mercury sphygmomanometer (diplomat - presameter desk model by error tolerance of + / 3 mmhg, rudolf riester gmbh bruckstr. 31 d-72417 jungingen germany) while the patients were sitting on the chair for at least 5 minutes before the measurements. to be more accurate, an average of three times measured values in each session was reported. to minimize human measurement errors between before and after the intervention measurement of total serum cholesterol was done by colorimetric method using commercially available kit (cat no.10 - 508 ziestchem diagnostics tehran, iran) with sensitivity of 1 mg / dl. serum triglyceride was measured by colorimetric method using biochemistry kit (cat no.10 - 525 ziestchem diagnostics tehran, iran) with sensitivity of 4 mg / dl. serum hdl - c concentrations were measured by enzymatic methods using biochemistry kit (cat no.10 - 507 ziestchem diagnostics tehran, iran), with sensitivity of 1 mg / dl. ldl - c concentrations in serum were automatically measured using enzymatic methods by elitech kits (cat no.ldld-0230 seppim.france) with sensitivity of 0.3 mg / dl by autoanalyzer hitachi 911. data from 24-hour food recall were analyzed by using food processor ii software (fpii, ver2. kolmogorov smirnov test was used for assessing the normality of data distribution. to compare qualitative data, chi - square test and to compare quantitative data, independent t- test, pair t - test and analysis of covariance were used. eighty - four subjects (21 men and 63 women) with mean age of 46.3 6.1 years finished the study. the group taking brewer s yeast included 42 patients (11 men and 31 women) and the group - taking placebo included 42 patients (10 men and 32 women). there was not any statistically significant differences between two groups regarding gender distribution (p=0.8, chi - square test). no significant differences observed between recipient of brewer s yeast and placebo groups in terms of age and anthropometric measurements (independent sample t - test). moreover, at the end of the intervention differences of anthropometric variables between two study groups were not statistically significant. there was not any statistically significant differences between two groups regarding anti - hypertensive drug usage (=0.513, p=0.632), anti - dyslipidemia drug usage (=0.431, p=0.662) before intervention (table 1). in terms of energy, macronutrients and micronutrients in the beginning and at the end of the intervention, study groups were not significantly different from each other (independent t - test, table 2). there were no significant differences within each group in terms of energy, macro - and micronutrients during the intervention (paired t - test, table 2). there were no significant differences for blood pressure and serum lipoproteins between two groups at baseline (independent t - test, table 3). after the intervention, systolic and diastolic blood pressures significantly decreased in the group taking brewer s yeast (p=0.007 and p=0.001 respectively, paired t - test). after adjusting for baseline systolic and diastolic blood pressures, the final systolic and diastolic blood pressures were statistically significant between the groups (p=0.05 and p=0.03 respectively, ancova, table 3). percents of changes for systolic and diastolic blood pressures during intervention in brewer s yeast group were significantly different from placebo group (p=0.02 and p= 0.002 respectively, independent t - test, fig., triglyceride, ldl - c and hdl - c levels were significantly reduced in - group taking brewer s yeast (p=0.002, p= 0.001 and p= 0.001 respectively, paired t - test, table 3). eighty - four subjects (21 men and 63 women) with mean age of 46.3 6.1 years finished the study. the group taking brewer s yeast included 42 patients (11 men and 31 women) and the group - taking placebo included 42 patients (10 men and 32 women). there was not any statistically significant differences between two groups regarding gender distribution (p=0.8, chi - square test). no significant differences observed between recipient of brewer s yeast and placebo groups in terms of age and anthropometric measurements (independent sample t - test). moreover, at the end of the intervention differences of anthropometric variables between two study groups were not statistically significant. there was not any statistically significant differences between two groups regarding anti - hypertensive drug usage (=0.513, p=0.632), anti - dyslipidemia drug usage (=0.431, p=0.662) before intervention (table 1). in terms of energy, macronutrients and micronutrients in the beginning and at the end of the intervention, study groups were not significantly different from each other (independent t - test, table 2). there were no significant differences within each group in terms of energy, macro - and micronutrients during the intervention (paired t - test, table 2). there were no significant differences for blood pressure and serum lipoproteins between two groups at baseline (independent t - test, table 3). after the intervention, systolic and diastolic blood pressures significantly decreased in the group taking brewer s yeast (p=0.007 and p=0.001 respectively, paired t - test). after adjusting for baseline systolic and diastolic blood pressures, the final systolic and diastolic blood pressures were statistically significant between the groups (p=0.05 and p=0.03 respectively, ancova, table 3). percents of changes for systolic and diastolic blood pressures during intervention in brewer s yeast group were significantly different from placebo group (p=0.02 and p= 0.002 respectively, independent t - test, fig., triglyceride, ldl - c and hdl - c levels were significantly reduced in - group taking brewer s yeast (p=0.002, p= 0.001 and p= 0.001 respectively, paired t - test, table 3). in this study, taking 1800 mg of brewer s yeast per day reduced systolic and diastolic blood pressures in patients with type 2 diabetes. dietary sodium, potassium, magnesium and calcium are among factors influencing blood pressure. according to table 2 no changes can be seen in these micronutrients between the two study groups during the intervention. thus, significant reduction in systolic and diastolic blood pressures can be due to supplementation with brewer s yeast. in a study conducted by hata and colleagues, fermented milk containing the yeast saccharomyces cerevisiae after 8 weeks, systolic and diastolic blood pressures were significantly reduced (16). however this study was performed with a shorter time, its results, is confirmed by ours. in addition, kanauchi and colleagues conducted an in vitro trial on spontaneous hypertensive rats as case and mild hypertensive rats as control group. significant decrease in systolic blood pressure in spontaneous hypertensive rats was shown in this study (17). masuda in a study on the shr rats observed that after feeding the rats with sour milk containing brewer s yeast and lactobacillus helveticus, blood pressure decreased significantly (18). there are different theories on the mechanism of brewer s yeast effects on blood pressure. blood pressure lowering effects of brewer s yeast is attributed to its biological peptides, potassium, magnesium and calcium (17, 19). it seems that the biological peptide named krf814 is derived from hydrolysis of brewer s yeast by alkaline phosphatase. this biological peptide can reduce the activity of angiotensin - converting enzyme and thereby may decrease blood pressure (17). in the present study, despite significantly decreased triglyceride and ldl - c and significantly increased hdl - c in brewer s yeast consumers, no significant differences could be detected compared with placebo group at the end of the study. in explorations, which studied the effects of brewer s yeast on serum triglyceride in people with normal levels of triglyceride, no significant difference has been found (9, 10, 20). although, in studies on the effects of brewer s yeast on serum triglyceride in patients with hypertriglyceridemia, significant difference has been found (11,12). it seems that lack of significant changes in serum triglyceride levels may be due to their normal initial levels. in the case of brewer s yeast effects on serum cholesterol, several studies have been done, but no significant decreases observed in total cholesterol levels and neither did we (10, 12). related to brewer s yeast effects on ldl - c, other studies did not show any significant changes between the intervention groups. in present study, despite significant increases in hdl - c levels in - group receiving brewer s yeast, no significant differences between the two trial groups were observed. in studies conducted by racek and colleagues and wang and colleagues also, no significant change in hdl - c level of the subjects was obtained (9, 10). in some studies, hdl - c increased significantly after consumption of brewer s yeast compared with controls. in comparison with ours, in mentioned studies, the subjects were older and were suffering from dyslipidemia (11, 14). among factors affecting serum lipoproteins, are intake of macronutrients, micronutrients and their ratios that in the above - mentioned studies, have not been well controlled. so it seems that one of the strengths of current study is controlling nutrient intake by statistical analyses. in a meta - analysis study, on brewer s yeast effects in patients with type 2 diabetes from 1996 to 2008 revealed that conflicting results in various studies were due to major limitations including : small size (7, 20), short duration of intervention (21), non - randomized design (11) and different doses of supplementation (12, 21). therefore, it is suggested that these limitations must be eliminated in future clinical trials ; also nutrients intake and correlation between biopeptides and blood pressure should take into the account (22). supplementation with 1800 mg / day brewer s yeast in addition to usual treatments can have a modest beneficial effect on systolic and diastolic blood pressure in patients with type 2 diabetes. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors.	backgroundthis study was conducted to investigate the effects of brewer s yeast supplementation on serum lipoproteins and blood pressure in patients with type 2 diabetes mellitus.methods:in a randomized double blind clinical trial, 90 adults with type 2 diabetes mellitus were recruited, and divided randomly into 2 groups, trial group received brewer s yeast (1800 mg / day) and control group received placebo for 12 weeks. weight, bmi, food consumption (based on 24 hour food recall), fasting serum lipoproteins (cholesterol, triglyceride, ldl - c, hdl - c), systolic and diastolic blood pressures were measured before and after the intervention. data analyses were performed by statistical package for social sciences ver. 18.0, and the statistical tests included independent t - test, paired t - test, kolmogorov - smirnov and analysis of covariance. this trial was registered in iranian registry of clinical trials (irct), no.irct138807062513n1.results:eighty-four subjects (21 men and 63 women) aged 46.36.1 years completed the study. after 12 weeks supplementation, systolic and diastolic blood pressures were decreased in the group receiving brewer s yeast (4.11.5, p=0.007 and 5.70.6, p=0.001 respectively). no - significant changes in ldl - c, hdl - c, triglyceride and cholesterol were shown.conclusion:supplementation with brewer s yeast besides the usual treatment of type 2 diabetes mellitus can reduce systolic and diastolic blood pressures in diabetic patients.
biliary cast syndrome is defined as the presence of casts within the intra- and/or extrahepatic bile ducts, causing obstruction and cholangitis, eventually complicated by multiple strictures, ductal dilation, and/or liver microabscesses.1,2 this is an uncommon condition, but is more frequently described in liver transplant patients.3,4 only a few reports have described biliary cast syndrome in nonliver transplant patients ; these included patients with antiphospholipid antibody syndrome, b - cell non - hodgkin lymphoma, cholecystectomy, and those who had undergone allogeneic hematopoietic stem cell transplantation.4 - 10 the exact pathogenesis of biliary casts remains uncertain ; however, many factors have been suggested as playing an etiological role in their formation. theoretically, anything that increases viscosity and/or hinders the flow of bile may precipitate cast formation. therefore, biliary sludge is known to be a prerequisite for cast formation.4 here we present one case of biliary cast syndrome, which developed in a nonliver transplant patient who had biliary sludge for a long period of time, providing evidence that long - standing biliary sludge may lead to cast formation. an 80-year - old man was admitted with a complaint of abdominal pain and fever. the patient 's history included brain surgery due to head trauma approximately 1 year ago ; he had remained in a bed - ridden state since then. the patient had a blood pressure of 109/66 mm hg, a heart rate of 122 beats / min, a respiration rate of 30 breaths / min, and a body temperature of 38.4. physical examination revealed tenderness at right upper quadrant of abdomen. laboratory examination revealed a hemoglobin of 14.2 g / dl (normal range, 13 to 17) ; white blood cell, 29,900/mm (normal range, 4,000 to 10,000) ; platelet, 296,000/mm (normal range, 130,000 to 350,000) ; total bilirubin, 2.5 mg / dl (normal range, 0.22 to 1.2) ; aspartate aminotransferase (ast), 742 iu / l (normal range, < 40) ; alanine aminotransferase (alt), 422 iu / l (normal range, < 40) ; alkaline phosphatase (alp), 1,593 iu / l (normal range, 66 to 220) ; and -glutamyl transpeptidase 1,321 we performed percutaneous transhepatic cholecystostomy for the purpose of immediate decompression of the biliary tract. follow - up tubography via percutaneous cholecystostomy showed multiple tubular filling defects in the extrahepatic bile duct (fig. endoscopic retrograde cholangiopancreatography (ercp) revealed the same features ; therefore, we performed endoscopic sphincterotomy followed by basket retrieval of the black colored tubular structures from the extrahepatic bile duct (fig. histology of the biliary tubular structures showed aggregates of bile pigmented amorphous materials, consistent with biliary cast (fig. currently, almost 16 months after the removal of the biliary cast, he was found to be asymptomatic and maintained a normal range of liver biochemistries. one year before admission, he had suffered head trauma after falling from his bicycle. he underwent emergent brain surgery, followed by management in the intensive care unit (icu) for several weeks. after that, he was stable but remained in a bedridden state. at approximately 1 month after the brain surgery, his liver biochemistry, which had remained in the normal range since admission, began to deteriorate : a bilirubin of 0.5 mg / dl, ast of 51 iu / l, alt of 92 iu / l, alp of 361 iu / l, and -glutamyl transpeptidase of 525 iu / l. we performed an investigation of possible causes for abnormal liver biochemistry, such as drugs, viral infections, and etc. however, an abnormal ultrasonographic finding, gallbladder distention filled with a large amount of sludge, was proven to be the only cause of abnormal liver biochemistry (fig., the patient did not show acute cholangitis ; in addition, he maintained stable vital signs and had no complaints. considering the poor general status with bed - ridden state, he received only supportive care with intermittent blood tests. 5 shows the patient 's liver biochemistry during the past year, showing wax and wane, with constant deterioration, since 4 months before developing acute cholangitis and being admitted to the hospital. pathophysiology of biliary cast formation is unclear ; however, hepatic infarction, fasting related gall bladder hypocontractility, biliary infection, biliary ischemia due to hypotension induced sepsis, bile pigment load due to absence of a gallbladder after cholecystectomy, and benign biliary stricture are included in suggested factors for biliary cast formation in nonliver transplant patients.4 - 10 these conditions are eventually predisposed to hindrance of bile flow, and thereby result in biliary sludge formation. this case provided evidence to demonstrate that the presence of long - standing biliary sludge may lead to development of biliary casts. we initially noticed gallbladder sludge in the patient at about 1 month after brain surgery. development of gallbladder sludge can be explained by the brain surgery and an icu setting, which both appear to be recognized risk factors for sludge formation due to gallbladder hypocontractility.11 the gallbladder sludge then migrated into the bile duct over a long period of time, which can be explained indirectly by long - standing and gradually increased abnormal liver biochemistry ; biliary cast formation might then have developed and was observed as acute cholangitis in the present case. there is no recommended standard management protocol for removal of biliary casts and each case should be viewed individually. although data are limited, five of eight nonliver transplant patients (table 1) underwent successful removal of biliary casts by ercp only. therefore, ercp is thought to be a reasonable step to take prior to considering laparotomy, particularly in nonliver transplant patients. however, reports on liver transplant patients showed that endoscopic management was still effective only in 25% of liver transplant patients with cast formation and that many patients experiencing endoscopic treatment required retransplantation.12,13 in conclusion, our case is a great example of biliary cast syndrome, showing that long - standing biliary sludge may lead to cast formation.	development of biliary casts is very unusual, especially in patients who have not undergone liver transplantation. variable causes of biliary cast formation in nonliver transplantation patients have been suggested. however, stasis of bile flow and/or gallbladder hypocontractility is known to eventually result in the promotion of biliary sludge and subsequent cast formation. here we present one case of biliary cast syndrome, which developed in a nonliver transplant patient who had biliary sludge for a long period of time, providing evidence that long - standing biliary sludge may lead to cast formation.
1,3-dichloro-2-propanol (dcp) is a member of the broad chemical class halohydrins. dcp is a semivolatile liquid used in high volume as an intermediate in the production of epichlorohydrin (ech), 1,3-dichloropropene, and 1,2,3-trichloropropane. workers may be exposed to 1,3-dcp via inhalation, dermal, or oral exposure during the manufacture and use of these chemical agents. exposure to dcp may also occur from ingestion of food containing hydrochloric acid - hydrolyzed vegetable protein or from drinking water in which ech polyamine polyelectrolytes are used as flocculants and coagulants for water purification. thermal degradation, metabolism, or hydrolysis of the flame retardant tris(1,3-dichloropropyl) phosphate (fyrol fr-2) might also be a source of consumer exposure to dcp. in subchronic drinking water or gavage studies (doses up to 100 mg / kg / day) in male and female sprague dawley rats, dcp caused decreased body weights, increased liver and kidney weights, and histopathological changes in the stomach, kidney, liver, and nasal tissue. in chronic drinking water studies (doses up to 240 mg / l), dose - related increases in the combined incidences of hepatocellular adenoma and carcinoma in the liver, squamous cell papilloma and carcinoma in the tongue / oral cavity, follicular cell adenoma and carcinoma in the thyroid, and the combined numbers of renal tubular adenoma and carcinoma in the kidney (males only) have been reported in male and female rats. in numerous bacterial and mammalian test systems in vitro, dcp was genotoxic in the presence and absence of metabolic activation. in humans, dcp is known to be moderately toxic via inhalation, ingestion, and skin contact. acute hepatitis was reported in 5 of 12 workers exposed to an unknown concentration, likely via inhalation from the cleaning of a dcp manufacturing tank. in these individuals, dcp plasma levels at approximately 48 h after exposure were 200 ng / ml. two of the five workers died from hepatic failure, and autopsy showed hepatocellular necrosis in one of the individuals. dcp is listed by the international agency for research on cancer (iarc) as being possibly carcinogenic to humans (group 2b). california epa listed dcp on the proposition 65 list of chemicals as known to cause cancer in humans. this assessment included consideration of the prospective metabolism of dcp to carcinogenic metabolites, ech and glycidol, and toxic metabolites, dichloroacetone (dca) and 3-monochloropropane-1,2-diol. ech is carcinogenic in experimental animals following exposure via drinking water (375 to 1500 mg / l), gavage (2 and 10 mg / kg), and inhalation (30 and 100 ppm)., there is no direct evidence for the formation of ech or dca following exposure to dcp in rodents or humans. indirect evidence includes common metabolites observed in animals administered dcp and ech. following oral administration of 50 mg dcp / kg daily for 5 days in male sprague dawley rats, -chlorolactate (5% of the dose), n, n-bis(acetyl)-s, s-(1,3-bis(cysteinyl))propan-2-ol (1%), and n - acetyl - s-(2,3-dihydroxypropyl)cysteine were detected in urine. similar metabolites were observed following oral administration of ech and hence ech was proposed as an intermediate in the metabolism of dcp. in another study, following a single subcutaneous injection of dcp at 68 mg / kg in male wistar rats, 1,2-propanediol (0.43% of the dose) and 3-chloro-1,2-propanediol (0.35%) were detected in the 24 h urine. on the basis of these observations, two main metabolic pathways were proposed, as shown in figure 1, one via the formation of ech and one via the formation of dca. several in vitro and in vivo studies reported the ability of dcp to deplete gsh and to induce and/or be metabolized by cyps. in wistar rats, diethyldithiocarbamate provided significant protection against dcp hepatotoxicity and inhibited enzyme markers for cyp2e1 activity ; ech was proposed to be the toxic intermediate. in rat hepatocyte cultures, isoniazid increased the rate and extent of gsh depletion as well as the toxicity, whereas cyanamide did not, confirming the involvement of cyp2e1 in the metabolism of dcp. pretreatment of cultures with 1-aminobenzotriazole (a cyp inhibitor) prevented the toxicity of dcp, whereas pretreatment with diethyl maleate or buthionine sulfoximine (depletion of gsh or inhibition of gsh synthesis) increased its toxicity. the observation that pyridine in the microsomal incubations reduced gsh depletion but did not completely eliminate depletion suggests the existence of a second pathway, which was thought to be dca as a metabolite of dcp via the action of alcohol dehydrogenase or cyps. proposed metabolic pathway of dcp in rodents. adapted with permission from ref (20). the genotoxic and carcinogenic potency of dcp is thought to arise mainly due to the metabolism of dcp to ech and/or dca, although, as pointed out earlier, there is no direct evidence in the literature for the formation of these metabolites. this is likely due to the reactive nature of these electrophilic metabolites that are postulated to be short - lived in vivo. dcp was nominated to the national toxicology program (ntp) by the national institute of environmental health sciences for toxicological characterization, including metabolism and disposition, reproductive toxicity, and carcinogenicity studies. unambiguous identification of ech and/or dca from the metabolism of dcp is critical for deciding whether further toxicity and carcinogenicity studies of dcp are needed. therefore, the purpose of the current work is (1) to develop a sensitive analytical method to detect ech and dca in selected biological matrices, (2) to investigate the half - lives of ech and dca in selected biological matrices in vitro to determine the feasibility of detecting these reactive metabolites in vivo, and (3) to investigate the formation of ech and dca in adult male and female harlan sprague dawley rats following oral exposure to dcp. the dose was set at 50 mg / kg based on the rat ld50 values as well as the doses used in toxicity studies. dcp was obtained from acros organics (geel, belgium) with a specified purity of 99.5%. ech was obtained from aldrich chemical co. (st. louis, mo) with a vendor purity of 99.9%. prior to use in studies, the identity of dcp and ech was confirmed by a combination of gc - ms and h and c nmr spectroscopy. purity, estimated by a combination of gc - fid and gc - ms, was 99.4 and 99.9%, respectively, for dcp and ech. (h5)()-epichlorohydrin (ech - d5) (98.7 atom % d ; 98.8% chemical purity) and (h5)1,3-dichloro-2-propanol (dcp - d5) (98.8 atom % d ; 98.1% chemical purity) was from c / d / n isotopes (pointe - claire, quebec, canada). ethyl acetate and methyl tert - butyl ether were obtained from aldrich chemical co. (st. ten microliters of ech in acetonitrile was added to 90 l of rat blood, rat plasma, rat liver homogenate (250 mg / ml), or mouse blood at 37 c or on ice to give a final ech concentration of 1 or 80 m. samples were mixed and incubated for 5, 15, 30, and 60 min. at the end of the reaction, 100 l of ethyl acetate containing an internal standard mixture (1 m ech - d5) was added, and the samples were vortex mixed and centrifuged. the supernatant was transferred into a microcentrifuge tube containing 10 mg of 3a molecular sieves, vortex mixed, and centrifuged. standards were prepared containing 0.1, 0.25, 0.5, 1.0, and 2.5 m ech, prepared by adding 10 l of ech in acetonitrile and 90 l of internal standard in ethyl acetate. samples were analyzed by the gc - ms method developed (but not validated) below. a method involving the extraction of blood with ethyl acetate and drying the ethyl acetate extract with 3a molecular sieves followed by gas chromatography mass spectrometry (gc - ms) in positive ion chemical ionization mode was developed and validated to quantify dcp and ech as described below. the recovery of dca from all matrices evaluated was extremely low, likely due to its high reactivity, and hence was not evaluated any further. solvent calibration curves for dcp and ech were prepared in ethyl acetate over the range 0.01, 0.025, 0.05, 0.1, 0.2, 0.5, and 1 m. matrix calibration curves were prepared using 90 l of rat blood, plasma, or liver homogenate prepared in water (250 mg / ml) in a microcentrifuge tube, to which 10 l of a spiking solution of analytes in acetonitrile was added to give final concentrations of 0.01, 0.025, 0.05, 0.1, 0.2, 0.5, and 1 m in matrix. calibration curves were also prepared in water similar to that for the matrix calibration curves except that 90 l of water was used in place of biological matrix. following the addition of 100 l of ethyl acetate containing the internal standard mixture (0.25 m dcp - d5 and ech - d5), samples were vortex - mixed and centrifuged for 5 min. the ethyl acetate layer was dried in a second microfuge tube containing 10 mg of 3a molecular sieves. after vortex mixing, the sample was centrifuged, and the ethyl acetate layer was transferred to a 200 l silanized insert in a 1.5 ml amber gc vial. the method was validated in blood using solvent and matrix standard curves prepared as above. to evaluate the extracted sample storage stability, six sets of quality control (qc) rat blood samples, each with four replicates, were prepared at 0.025 m (low qc), 0.1 m (medium qc), and 0.5 m (high qc) and were processed as described above. another set was stored in an autosampler tray for 48 h at room temperature. four sets were stored at 20 c for 1 week, 3 months, or 6 months prior to analysis. one set of samples was subjected to three freeze thaw cycles during a 1 week storage period. study samples were prepared similar to that for the matrix calibration curve samples as described above without the addition of the spiking solution containing dcp and ech standards. all samples were analyzed on an agilent 6890 gc equipped with a programmable temperature vaporization inlet coupled to an agilent 5973 msd (agilent technologies, santa clara, ca) operated in positive chemical ionization mode with selected ion monitoring, with the exception of samples from female rats administered 25 mg / kg ech by gavage and male and female rats administered 1 mg / kg ech by intravenous injection (see below). one microliter was injected via pulsed splitless injections onto a db-5 ms ui column (30 m 0.25 mm i.d 0.25 m, thickness) (agilent technologies, santa clara, ca). the injector was programmed from 75 c (0.1 min) to 200 c (0.5 min) at 500 c / min with a pulse pressure of 50 psi at the time of injection. the gc oven temperature was maintained at an initial temperature of 30 c (1 min) and then ramped at 5 c / min to 50 c. late eluting compounds were removed by increasing the oven temperature to 200 c at 80 c / min. dcp, dcp - d5, ech, and ech - d5 were eluted at 6.65, 6.60, 4.02, and 3.99 min, respectively. mass spectrometer parameters were as follows : ion source temperature, 110 c ; quadrupole temperature, 106 c ; and transfer line temperature, 150 c. samples from female rats administered 25 mg / kg ech by gavage and male and female rats administered 1 mg / kg ech by intravenous injection and corresponding calibration curves (with extension of the calibration curve to 8 points, including 0.005 m) were analyzed on an agilent 7890a gc coupled to an agilent 7000 triple quadrupole mass spectrometer (agilent technologies, santa clara, ca). all gc and mass spectrometer conditions were the same as those given above except for the following : the injector temperature was constant at 150 c, the ion source temperature was 150 c, and the total run time was ca. 8 min with dcp, dcp - d5, ech, and ech - d5 eluting at 4.10, 4.06, 3.15, and 3.12 min, respectively. in all cases, ions monitored were m / z 111 (dcp), 116 (dcp - d5), 93 (ech), and 98 (ech - d5). calibrations for both dcp and ech were performed using seven - point standard curves prepared in rat blood. a 1/x weighted linear regression equation was calculated for dcp and ech, relating the response ratios of the analyte / internal standard to its concentration in matrix standard. all studies were conducted at rti international (rtp, nc) and were approved by the rti institutional animal care and use committee. animals were housed in a facility that is fully accredited by the association for assessment and accreditation of laboratory animal care international. animal procedures were in accordance with the guide for the care and use of laboratory animals. male and female harlan sprague dawley rats (males, 235277 g ; females, 184232 g ; 810 weeks old at dosing) with implanted jugular vein cannulae were obtained from harlan laboratories (indianapolis, in). the animals were quarantined for up to 6 days before they were used in a study. animals were provided certified ntp 2000 wafer diet (zeigler brothers, gardners, pa) and city tap water (durham, nc) ad libitum. during the quarantine and study periods, room temperature was maintained at 22 2 c and relative humidity was maintained within 35 to 65%, with a 12 h light / dark cycle. oral dose formulations of dcp were prepared at 10 mg / ml in deionized water on the morning of use and stored on wet ice. dose formulations were diluted 1:20 with acetonitrile and quantified by gc with a flame ionization detection against a calibration curve from 11000 g / ml. oral and intravenous dose formulations of ech were prepared in deionized water at 0.2 and 5 mg / ml and in sterile isotonic saline at 0.5 mg / ml, respectively, on the morning of use and stored on wet ice to prevent any hydrolysis of ech. ech dose formulations were analyzed by gc - ms following extraction with chloroform and quantified against a calibration curve from 0.04 to 1000 g / ml. dcp dose formulations were also analyzed for the presence of ech using the same procedure as that used for the analysis of ech dose formulation. male or female rats (3 rats per sex per group) were administered a single oral dose of dcp at 50 mg / kg or ech at 1 and 25 mg / kg. oral doses were administered via intragastric gavage using a syringe equipped with a ball - tipped 16-gauge stainless steel gavage needle in a dose volume of 5 ml / kg. male or female rats (3 rats per sex per group) were administered a single intravenous dose of ech at 1 mg / kg. doses were administered via the tail vein using a syringe equipped with a 23-guage needle in a dose volume of 2 ml / kg. after dosing, blood was collected into a heparinized syringe via indwelling jugular cannulae from 3 animals per each time point. a blood sample was also collected from each animal prior to dosing, and the cannulae were refilled with heparinized isotonic saline. blood collection time points were as follows : predose, 5, 15, and 30 min and 1, 2, 4, and 6 h (oral, 50 mg / kg dcp by gavage) ; predose, 5, 10, 15, 30, 60, and 90 min (25 mg / kg ech by gavage) ; predose, 5, 10, 15, 30, 45, 60, and 90 min (1 mg / kg ech male rats by intravenous) ; and predose, 5, 10, 15, 20, 25, 30, and 45 min (1 mg / kg ech female rats by intravenous). following blood collection immediately upon collection, blood was weighed in a 1.5 ml plastic centrifuge tube, an equal volume (based on the weight of blood in the tube and the density of ethyl acetate) of internal standard solution (0.25 m each of dcp - d5 and ech - d5 in ethyl acetate) was added to the tube, and the sample was vortex - mixed. tubes were immediately placed on wet ice after internal standard addition and before subsequent extraction steps. the samples were centrifuged, and the ethyl acetate was removed, dried with 3a molecular sieves, and analyzed by gc - ms as described above for dcp and ech. for each analyte, a triplicate standard curve and qc toxicokinetic analysis was conducted using winnonlin software, version 5.2 (pharsight corporation). individual animal data was modeled, with input for the dose of dcp or ech administered to calculate the dose - normalized area under the curve in blood for dcp or ech. parameters estimated were as follows : t1/2, half - life of elimination ; cmax, maximum concentration ; cmax / d, dose - adjusted maximum concentration ; tmax, time at which the maximum concentration was achieved ; auc(0t), area under the blood concentration vs time curve to last time point ; auc(0t)/d, dose - adjusted area under the blood concentration vs time curve to last time point ; auc(0), area under the blood concentration vs time curve to infinity ; auc(0), dose - adjusted area under the blood concentration vs time curve to infinity ; and vz / f, volume of distribution adjusted to bioavailability of test chemical. various approaches including solid - phase microextraction and solvent extraction methods coupled with detection by electron capture or mass spectrometry with electron ionization, negative ion chemical ionization, or positive ion chemical ionization were investigated to detect and quantify ech and dca, the postulated reactive metabolites of dcp, in biological matrices. solvent extraction followed by drying over molecular sieves and analysis by gc - ms in the positive ion chemical ionization mode was found to be the most promising method and was selected as the final method. plasma, blood, and liver homogenate were evaluated to determine the most suitable matrix to detect these reactive metabolites in vivo. in addition, samples were processed on ice to prevent hydrolysis and/or reaction of ech and dca in biological matrices. the recovery of dca from all biological matrices investigated was very poor. the clearance of ech from liver homogenate, blood, and plasma was evaluated at 37 c and on ice at ech concentrations of 1 or 80 m. ech was relatively stable in blood and plasma, but it rapidly cleared in liver homogenate and was not detectable at any of the time points measured. the half - lives estimated for ech in blood and plasma are shown in table 1. in rat, ech cleared more rapidly in blood compared to that in plasma, and at 37 c, the half - life in rat plasma was between 50 and 53 min, compared with between 20 and 25 min in rat blood. decreasing the temperature resulted in a substantially longer half - life in both blood and plasma (table 1). at 37 c, ech was cleared in mouse blood more slowly than in rat blood, with a half - life between 43 and 45 min. the initial concentration of ech had no effect on half - life at 37 c ; however, on ice, the estimated values were longer at higher concentration in both rat blood and plasma (table 1). therefore, the final method was optimized for the analysis of dcp and ech in blood. with sample stability being a concern, the additional manipulation of samples to generate plasma was avoided by choosing blood as the matrix of choice for in vivo studies. half - life was determined from semi log plots of ech concentration vs time curve using the equations y = a e, and half - life = 0.693/k. to investigate the effect of the sample matrix on extraction efficiency, standard curves were prepared for dcp and ech in ethyl acetate, water, and blood. the accuracy of response of dcp in blood or water was similar and was 94102% of the solvent standard. similar results were observed for ech, with a response between 91 and 112% over the concentration range examined. the data indicates efficient extraction of both dcp and ech with ethyl acetate from blood and water and an absence of a matrix effect. the analytical method was validated to quantitate dcp and ech in blood over the concentration range from 0.005 to 1 m ; the method was linear (r > 0.997), accurate (relative error 15%), and precise (relative standard deviation 15%) for the quantitation of both dcp and ech over the concentration range of 0.005 to 1 m. stability of analytes in blood extracts was verified using qc samples prepared at low, mid, and high concentrations for up to 48 h at room temperature (105, 98.3, and 102%), 1 week frozen (102, 103, and 106%), and after three freeze thaw cycles (109, 96.1, and 102%). for dcp, dilution into the concentration range of method was verified for samples above the highest standard. because two analyses needed to be conducted on each sample, with ech in the range and dcp above the range, the dilution was verified for dcp only. additional standards of dcp in ethyl acetate were prepared in the range of 2400 m and were diluted with 0.25 m dcp - d5 in ethyl acetate to be in the range of 0.10.6 m. dcp dose formulations were analyzed for the presence of ech prior to administration in animals. ech was detected in the 10 mg / ml dcp dose formulation by gc with flame ionization detection, with a peak area corresponding to approximately 0.1% of that of dcp. the peak area ratio did not appear to change when dcp was sampled immediately after being dissolved in water or after 24 h at room temperature. the concentration of ech in the dcp dose formulations was determined by gc - ms. the dcp and ech concentrations in the dcp formulation administered in male rats were 9.54 and 0.000424 mg / ml, respectively, and in female rats, 10.13 and 0.00041 mg / ml, respectively. these data indicate that animals received negligible amounts of ech via administration of dcp. the doses of dcp administered in male and female rats were 49.8 1.6 mg / kg (0.386 0.014 mmol / kg) and 50.7 1.6 mg / kg (0.393 0.014 the estimated doses of ech administered in male and female rats via the dcp formulation were 2.23 0.08 g / kg (0.0239 0.0009 mol / kg) and 1.81 0.07 g / kg (0.0197 0.0007 the dose of dcp administered in male rats was approximately 22 500-fold higher than ech on a mass basis and 16 140-fold higher on a molar basis. similarly, the dose of dcp administered in female rats was approximately 27 830-fold higher than ech on a mass basis and 19 963-fold higher on a molar basis. ech was detected in blood following administration of dcp in both male and female rats starting from about 5 min through 120 min. ech concentrations fell within the calibration range in blood of animals following administration of dcp ; however, for dcp, the concentration for the majority of samples was substantially above the calibration range. therefore, analyses were conducted with two runs per sample : first, with analysis for ech followed by dilution of the samples into the range for quantitation of dcp. blood concentration vs time profiles in male and female rats are shown in figure 2a and b for dcp and ech, respectively. for dcp, the parameters were similar between male and female rats, with an elimination half - life between 42 and 44 min. the apparent volume of distribution exceeded the reported aqueous body water volume in rats of 0.688 ml / kg, suggesting extensive distribution of dcp into the peripheral compartment. the maximum ech concentration, cmax, was detected at 10 and 13.7 min following administration of dcp in males and females, respectively. ech was eliminated in male rats (half - life, 33.2 min) slightly faster than that in female rats (half - life, 47.9). as seen with dcp, other toxicokinetic parameters estimated for ech were very similar between males and females. for both males and females, the apparent volume of distribution was lower than the reported aqueous body water volume in rats, suggesting limited distribution of ech into the peripheral compartment. blood (a) dcp and (b) ech concentration vs time profiles following a single oral administration of 50 mg / kg dcp in male and female harlan sprague dawley rats. initially, a group of male rats was administered a single dose of 1 mg / kg by gavage, but no ech was detectable in blood at time points ranging from 5 min to 6 h. a higher dose of ech was then used. the oral doses of ech administered to male and female rats were 26.2 0.3 mg / kg (0.283 0.003 mmol / kg) and 25.3 1.1 mg / kg ech was detected up to 1590 min following administration in male and female rats. blood concentration vs time profiles in male and female rats are shown in figure 3, and toxicokinetic parameters obtained from noncompartmental analysis are given in table 3. a sex difference in toxicokinetics was observed following administration of ech in male and female rats. cmax and auc(0) were about 3-fold lower in females compared with that in males, suggesting that females received less internal dose of ech than males following oral administration of ech. ech was eliminated in females (half - life, 20.1 min) faster than in males (half - life, 33.8 min). blood concentration vs time profiles following a single oral administration of 25 mg / kg ech in male and female harlan sprague dawley rats. the intravenous doses of ech administered in male and female rats were 1.02 0.02 mg / kg (0.0111 0.0002 mmol / kg) and 1.03 0.03 mg / kg (0.0111 0.0003 blood concentrations of ech fell rapidly in male rats following administration and were below the limit of quantitation (loq) of the analytical method in some animals at 30 min and in all rats at 45 min. therefore, in female rats, blood was collected only up to 45 min following administration. in general, concentrations start falling below the lowest standard of 0.005 m between 10 and 25 min in females. as a result, for one animal, the concentration after 10 min was determined by interpolation below the loq in order to have sufficient data points for toxicokinetic analysis. blood concentration vs time profiles in male and female rats are shown in figure 4, and toxicokinetic parameters obtained from noncompartmental analysis are given in table 4. in general, toxicokinetic parameters between males and females were similar except that, as observed following oral administration, ech was eliminated in females (half - life, 3.1 min) faster than in males (half - life, 6.51 min). blood concentration vs time profiles following a single intravenous administration of 1 mg / kg ech in male and female harlan sprague dawley rats. area under the ech concentration vs time curve following oral and intravenous administration of ech, after adjusting for the dose, was used to estimate oral bioavailability of ech. for male rats, auc(0)/dose following oral and intravenous administration was 42.9 and 827 m min kg / mmol, respectively. therefore, the oral bioavailability was estimated to be 5.2% ((42.9/827) 100). similarly for female rats, auc(0)/dose following oral and intravenous administration was 14.4 and 676 m min kg / mmol, respectively. therefore, the oral bioavailability estimated for females was 2.1% ((14.4/676) 100). although ech and dca were proposed to be reactive species, to the best of our knowledge, there is no direct evidence for the formation of these metabolites from exposure to dcp. the work described here is the first report of the formation of ech in rodents following exposure to dcp. in this study, the feasibility of detecting dca and ech in dcp - administered animals was investigated by developing a sensitive analytical method to detect these metabolites and by identifying a suitable matrix. the high reactivity of dca in blood, plasma, and liver homogenate in vitro precluded its investigation ; dca was cleared in these matrices with a half - life 1 min. ech rapidly disappeared in the liver homogenate. in the presence and absence of diethyl maleate (gsh depleter) or cyclohexene oxide (epoxide hydrolase inhibitor), we confirmed in vitro that 80% of the loss of ech in liver homogenate was due to epoxide hydrolase activity and 18% was due to the reaction of ech with gsh (data not shown). although the estimated half - life of ech in plasma was longer than that in blood, the time necessary to prepare plasma from blood from animals would result in loss of ech. therefore, blood was selected as the preferred matrix for detecting ech following administration of dcp or ech in rats. processing samples on ice slowed the hydrolysis of ech on blood and plasma in situ and hence was incorporated into the final method. an analytical method was developed and validated for successful quantitation of ech in blood with a limit of quantitation of 0.01 m, which was subsequently extended to 0.005 m. ech was detected and quantified in blood following oral administration of dcp in male and female rats. to the best of our knowledge, trace levels of ech were detected in dcp dose formulations corresponding to 0.0239 and 0.0197 mol ech / kg administered in males and females, respectively, suggesting that animals received negligible amounts of ech compared to dcp via administration of dcp. the initial dose of 1 mg (10.8 moles) ech / kg used for gavage administration in male rats produced no detectable ech in blood, indicating that the extremely low levels of ech in the dose of dcp administered would not have caused the ech in blood from dcp - dosed rats. these data along with the low bioavailability of ech in male (5.2%) and female rats (2.1%) following oral administration provide evidence for the formation of ech following oral administration of dcp in rats. ech was detected in blood from rats following a single oral dose of 25 mg / kg (half - life of 33.8 and 20.1 min in males and females, respectively) or a single intravenous dose of 1 mg / kg (half - life of 6.51 and 3.14 min in males and females, respectively). in a study by rossi., following a single oral dose of 50 mg / kg ech in male cd1 swiss albino mice, levels of ech were below the limit of quantitation (50 ng / ml) of the analytical method used ; however, ech was detected following an oral dose of 200 mg / kg. the peak blood ech concentration reported at 5 min following administration was 0.49 0.13 g / ml. the estimated half - life in mice (5.5 min) was much shorter than that observed in male rats (33.8 min) following oral administration of ech in our study, indicating a clear species difference in the disposition of ech following oral administration. following administration of dcp in male and female rats, the maximum ech concentration was achieved 13.7 min. there was no clear sex difference in the disposition of ech in rats except that the half - life in males (33.2 min) was slightly shorter than that of female rats (47.9 min). this may be partially explained by the reported higher microsomal epoxide hydrolase activity in males compared to that in females. in a pilot study, ech was also detected and quantified in male b6c3f1/n mice following oral administration of 25 mg / kg dcp (data not shown) ; ech was rapidly eliminated in blood with a half - life of 10.1 min in male mice compared to a half - life of 33.2 in rats. in addition, cmax and auc were about 10-fold and 40-fold lower in male mice compared with those in male rats, showing a clear species difference in the disposition of ech following administration of dcp. the percentage of the dose of dcp converted to ech in rats following oral administration of dcp in rats was estimated in several ways. an initial evaluation used auc(0) values for ech following oral administration of ech and following oral administration of dcp. in male rats, for ech, the dose - adjusted auc(0) was 42.9 m min kg / mmol following oral administration of ech, and auc(0) was 4.02 m min following oral administration of dcp (tables 2 and 3). therefore, the dose of ech formed in dcp - treated (0.386 mmol / kg dcp) male rats was estimated to be 0.094 mmol / kg (4.02 m min/42.9 m min kg / mmol) ; this is equivalent to ca. 24% (0.094/0.386 100) conversion of dcp to ech in male rats. similarly, in female rats, for ech, dose - adjusted auc(0) was 14.4 m min kg / mmol following oral administration of ech, and auc(0) was 4.67 m min following oral administration of dcp (tables 2 and 3). 50 mg / kg (or 0.393 mmol / kg) dcp - treated female rats was estimated to be 0.324 mmol / kg (4.67 m min/14.4 m min kg / mmol) ; this is equivalent to ca. 82% (0.324/0.393 100) conversion of dcp to ech in female rats. these estimates may be higher than actual values since ech may be hydrolyzed in the gut following oral administration of ech, leading to lower auc(0) following oral administration of ech. this is supported by the estimated low oral bioavailability of 5.1 and 2.1% in males and females, respectively. an alternative approach was then used that avoids the issue of absorption, using the auc(0) following intravenous administration of ech to estimate the percent dcp converted to ech. following intravenous administration, the dose - adjusted auc(0) values were 827 and 676 m min kg / mmol in males and females, respectively (table 4). on the basis of this, the dose of ech in dcp - treated rats can be calculated as 0.00486 mmol / kg (4.02 m min/827 m min kg / mmol) and 0.00696 mmol / kg (4.67 m min/676 m min kg / mmol), which is equivalent to 1.26% (0.00486 mmol ech/0.386 mmol dcp 100) and 1.78% (0.006961 mmol ech/0.393 mmol dcp 100) of dcp converted to ech in male and female rats, respectively. these values may be slightly underestimated because ech, once formed in the liver from the metabolism of dcp, can undergo hydrolysis and gsh reaction, thereby decreasing the amount entering systemic circulation. therefore, we concluded that the percent dose of dcp converted to ech in male and female rats following a single oral exposure to dcp was 1.26% and 1.78%, respectively. the investigation into the formation of dca from the metabolism of dcp proved to be unsuccessful due to its rapid disappearance. indirect evidence for the formation of dca could be provided by the analysis of further metabolites such as glutathione conjugates and protein adducts. however, the major conjugation products of dcp and ech separately administered to male rats were the same : n - acetyl - s-(2,3-dihydroxypropyl)cysteine and n, n-bis - acetyl - s, s-(bis - cysteinyl)-2-hydroxypropane. in addition, n - acetyl - s-(3-chloro-2-hydroxypropyl)cysteine, reported to be a metabolite of ech (gingell.), is also expected to be a metabolite of dcp. this was confirmed by investigation of the reaction of gsh with dcp or ech (unpublished observations). the formation of adducts from reaction of ech with globin has been described, and several adducts were identified, including 2,3-dihydroxypropylvaline (which is not specific for ech but can be formed by reaction with glycidol) and chlorohydroxypropylvaline, which, although formed by ech, could also be formed by reaction of 3-chloro-1,2-propanediol. therefore, glutathione conjugates, mercapturic acids, or protein adducts could not be used to distinguish dcp and ech. the biological conversion of dcp to ech has been demonstrated in bacteria and is catalyzed by haloalcohol dehalogenases in gram - positive and -negative bacteria. production of ech from dcp has been reported in a biochemical reactor containing escherichia coli expressing haloalcohol dehalogenase and epoxide hydrolase. similarities between the active sites of the bacterial haloalcohol dehalogenase and mammalian epoxide hydrolases have been drawn. the mechanism by which this conversion occurs and its location within the body should be investigated further to understand the toxicity and carcinogenicity of dcp. it has been suggested that the observed toxicity and carcinogenicity of dcp in rodents is due to the formation of a reactive metabolite, epichlorohydrin (ech). to date, there is no direct evidence for the formation of ech following exposure of rodents to dcp. the work described here in reports the first unambiguous detection of ech following oral administration of dcp in rodents. following a single oral dose of 50 mg / kg dcp, 1.26% and 1.78% of the administered dose toxicokinetics of ech in male and female rats were similar in males and females, eliminating ech with a half - life of 33.2 and 47.9 min, respectively.	the observed toxicity and carcinogenicity of 1,3-dichloro-2-propanol (dcp) in rodents is thought to be due to the formation of reactive metabolites, epichlorohydrin (ech) and dichloroacetone (dca). however, there is no direct evidence for the formation of these metabolites from exposure to dcp in rodents due to the challenges of measuring these reactive intermediates directly in vivo. the objective of this work was to investigate the metabolism of dcp to ech and dca in vivo by first developing a sensitive analytical method in a suitable biological matrix and analyzing samples from rats administered dcp. dca reacted rapidly in vitro in rat blood, plasma, and liver homogenate, precluding its detection. because ech rapidly disappeared in liver homogenate, but was relatively long - lived in plasma and blood in vitro, blood was selected for analysis of this metabolite. following a single oral dose of 50 mg / kg dcp in male or female harlan sprague dawley rats, ech was detected in blood with a maximum concentration reached at 13.7 min. ech was cleared rapidly with a half - life of ca. 33 and 48 min in males and females, respectively. following a single oral dose of 25 mg / kg ech in male and female rats, the elimination half - life of ech was ca. 34 and 20 min, respectively ; the oral bioavailability of ech was low (males, 5.2% ; females, 2.1%), suggesting extensive first pass metabolism of ech following oral administration. the area under the concentration vs time curve for ech following oral administration of dcp and intravenous administration of ech was used to estimate the percent of the dcp dose converted to ech in rats. on the basis of this analysis, we concluded that in male and female rats following oral administration of 50 mg / kg dcp, 1.26% or 1.78% of the administered dose was metabolized to ech, respectively.
organophosphorus ester pesticides (ops) are mainly used as agricultural and domestic insecticides, leading to increasing numbers of cases of toxic effects on humans and livestock. ops poisoning can result in neurotoxicity, myocardial damage, microvascular dysfunction, cytotoxicity, respiratory failure, and functional disorder of immune system. in human [1, 2 ]. a key mechanism of intoxication of ops is the irreversible inhibition of acetylcholinesterase (ache) and resulting in the accumulation of acetylcholine (ach) and overstimulation of its receptors. however, cholinergic hyperexcitability can not account for all of the neurological, behavioral, and cardiovascular system manifestations arising from exposure to ops. there is evidence for a wide range of novel targets that are more sensitive than ache to exposure to ops [2, 4 ]. it has been reported that some ops altered vascular contractility and exacerbated ops - induced hypertension in acetylcholinesterase - independent manner [5, 6 ]. the response to vasoactive agents is altered by treatment with paraoxon in hens ischiadic arteries [7, 8 ]. however, whether paraoxon directly modulates the function of vascular endothelium and/or smooth muscle cells in rabbits has not been examined. it has been demonstrated that paraoxon blocked gaba, nmda, glycine, nicotinic and muscarinic receptor, and chloride channels in neurons [4, 9 ]. it has been also reported that paraoxon inhibited ca inflow during the action potential and could downregulate ca - activated k channels leading to a reduction of the afterhyperpolarization and an increase in snail neurons firing [10, 11 ]. however, there are some inconsistent results between calcium homeostasis and paraoxon in nonneuronal cells [12, 13 ]. thus in this study, we investigated the effect of paraoxon on vascular contractility in rabbits thoracic aortic rings and calcium homeostasis in aortic smooth muscle cells. acetylcholine (ach), sodium nitroprusside (snp), phenylephrine (phe), potassium chloride (kcl), n - nitro - l - arginine (l - nna), atropine, paraoxon (pxn), verapamil hydrochloride, nicotinamide, ryanodine, tetraethylammonium (tea - ci), hepes, egtazic acid, csoh, csci, mgatp, and tetrodotoxin (ttx) were purchased from sigma - aldrich (st. louis, mo, usa), paraoxon was dissolved in ethanol in organ baths experiment and in dmso in measurement of ca current experiment. the thoracic aortas were dissected from male new zealand rabbits (2.0 0.3 kg, supplied by the animal center of south china university) killed by exsanguination after anesthesia with pentobarbital sodium (80 mg / kg, iv). the adhering perivascular tissue was removed carefully. the thoracic aortas were cut into ring segments, 4 to 5 mm in length. the aortic endothelium was removed by inserting a plastic club into the lumen followed by gentle rubbing in some experiments. each ring was then placed in a 10 ml organ bath and mounted on two stainless steel hooks, one of which was fastened to the bath and the other connected to a strain gauges for measurement of isometric force. the organ bath was filled with krebs solution at 37c and bubbled with a mixture of 95% o2 + 5% co2. the rings were equilibrated for 60 minutes under a resting tension of 2.0 g and the solution was changed at 20-minute intervals. the integrity of the endothelium was affirmed by the addition of the endothelium - dependent vasodilator, ach (1 m), after contractions had been induced by 1 m phe. this was similarly made with the denuded vessels in order to exclude any endothelial function. after phe and ach were washed out with krebs solution, the aortic rings were contracted by 50 mm kcl. after recording the contractile tension of each ring following stimulation with 50 mm kcl, the baths were washed out with krebs solution. the contractile responses were expressed relative to those measured for the 50 mm kcl - induced contraction in the test experiments [14, 15 ]. paraoxon was added to the incubation system 30 minutes prior to or during the contraction induced by phe or kcl. endothelium - denuded thoracic aortic rings were contracted by phe in the presence of snp (1 nm) without paraoxon administration. in some other experiments, thoracic aortic contractions were performed in the absence of extracellular ca using ca - free krebs solution containing 1 mm edta. the concentrations of inhibitors or antagonists used in our study were as follows : l - nna (no synthase inhibitor ; 30 m), verapamil (l - type voltage - dependent ca channels blocker ; 55 m), atropine (a specific muscarinic receptors antagonist ; 5 m), ryanodine (ryanodine receptors blocker ; 30 m), and nicotinamide (adp - ribosyl cyclase inhibitor ; 6 mm). the thoraotic aortic rings were pretreated with each inhibitor for 20 minutes and then contractions were induced by 1 m phe or 80 mm kcl. the thoracic aortic rings without endothelium were washed three times with ca - free krebs solution containing 1 mm edta and then exposed to the same buffer for 15 minutes. the thoracic aortic rings were pretreated with 30 m paraoxon for 30 minutes and then stimulated with kcl (80 mm). after 30 minutes incubation, cacl2-(10 m to 10 m) induced contractions were measured for each aortic ring. the aortic rings were loaded with fura-2 acetoxymethyl ester (fura-2 am) through incubation in krebs solution at ph 7.4, containing 10 m fura-2 am and 0.025% pluronic f-127 at room temperature for 2 hours. after fura-2 am loading, extracellular fura-2 am was washed off in krebs solution. then, the aortic rings were longitudinally cut open and pinned onto a block of silicone elastomer, which was fixed onto a base plate of the flow chamber. after vessel fixing, the flow chamber was placed on an inverted microscope equipped with a spectrophotometer and perfused with krebs solution. then, the fura-2 am - loaded vessels were visualized through an inverted fluorescence microscope to perform measurements of fura-2 am microfluorometry. the ratio of the fluorescence intensities at alternating 340 nm (f340) and 380 nm (f380) excitation wavelengths was monitored to measure intracellular calcium concentration ([ca]i). the aortic tissues were allowed to recover for 30 minutes and then exposed for 30 minutes to ca - free 80 mm k solution containing 1 mm na2-edta. subsequently, they were perfused with the same high - k solution supplemented with 0.1, 0.3, 1, and 3 mm cacl2. tissue was then washed several times in ca - free 80 mm k solution until baseline was recovered. after incubating with paraoxon (30 m) for 30 minutes, cumulative perfusion of cacl2 induced a second concentration - dependent increase in [ca]i. male new zealand rabbits weighing approximately 2.0 kg were stunned by heavy blow on the head. five to 10 segments (610 mm in length) of thoracic aortas were quickly dissected free of connective tissue in ice - cold solution containing 4.7 mm kcl, 145 mm nacl, 1.2 mm nah2po4, 2 mm pyruvic acid, 1.17 mm mgso4, 0.02 mm edta, 0.1 mm cacl2, 5 mm d - glucose, and 10 mg / ml bovine serum albumin (bsa). thoracic aortas were placed in an isolation solution : 4.2 mm kcl, 120 mm nacl, 25 mm nahco3, 1.2 mm mgcl2, 0.6 mm kh2po4, 1 mg / ml bsa, 0.1 mm cacl2, and 11 mm d - glucose, ph 7.4, when bubbled with 5% co2 and 21% o2 (at room temperature). the arteries were cut into 4 to 5 mm segments, which were then digested in isolation solution containing papain (1.0 mg / ml), bsa (1 mg / ml), and dithiothreitol (1 mg / ml) for 10 minutes at 37c. the artery segments were then transferred to isolation solution containing collagenaseii (0.36 mg / ml), 0.1 mm cacl2, dithiothreitol (1 mg / ml), and bsa (1 mg / ml) for 10 minutes at 37c. the tissue was then washed 10 times in ice - cold isolation solution without collagenase and triturated gently with polished pasteur pipettes to separate the individual cells. freshly isolated cells with characteristic elongated morphology of vascular myocytes were added directly to the chamber and allowed to adhere for 10 to 15 minutes for whole - cell patch - clamp electrophysiology. isolated aortic smooth muscle cells were placed in the experimental chamber (0.4 ml) mounted on the stage of an inverted microscope (ix-70 olympus, tokyo, japan). after setting to the bottom of chamber, the cells were superfused with external solution for 15 minutes at a rate of 2~2.5 ml / min at 25c. transmembrane currents were recorded using an axopatch amplifier (200b, axon instruments, usa). patch - clamp pipettes were manufactured from borosilicate glass capillaries (gc 150t-7.5, clark electromedical instruments, london, uk). the resistance of the patch pipette was 24 m, when filled with electrode internal solution. liquid junction potential between the pipette solution and external solution was corrected after the pipette tipped into the external solution. after gigaseal formation, the membrane was ruptured with a gentle suction to obtain the whole - cell voltage - clamp configuration. to minimize the duration of capacitive current, membrane capacitance and series resistance were compensated after membrane rupture. the external solution was changed to na - free solution in which na was replaced by equimolar tetraethylammonium chloride (tea - ci). na current was also inactivated at the holding potential of 40 mv and blocked by tetrodotoxin (ttx, 2 10 mol / l). computer - generated voltage or current pulses were programmed using the pclamp 8.0 software (axon instruments, usa). all experiments were carried out at room temperature (22~24c) [17, 18 ]. the electrode internal solution for whole - cell recording contained (in mm) 3 mgatp, 140 cscl, and 10 hepes, and 10 egtazic acid, and ph was adjusted to 7.2 with csoh. the external solution was composed of (in mm) 140 tea - cl, 2.0 mgcl2, 1.5 cacl2, 10 glucose, 10 hepes, and 0.002 ttx, gassed with 100% o2, and the ph was adjusted with naoh to 7.3~7.4 [17, 18 ]. paraoxon was dissolved in dmso and diluted in external solution at the concentrations of 0.3, 3, and 30 statistical comparisons were made using one - way anova plus bonferroni multiple comparison tests. the effect of pre - treatment with paraoxon on contraction induced by phe or high concentration of k was investigated in rabbits thoracic aorta. the maximum contractions of aorta rings induced by 1 m phe were decreased by pretreatment with paraoxon (30 m), regardless of the presence (41.20% 11.05%) or absence (38.87% 8.74%) of endothelium (figure 1(a)). the vasoconstriction of aortic rings induced by 80 mm kcl was also attenuated by pretreatment with paraoxon (30 m) regardless of the presence (42.42% 8.57%) or absence (40.09% 6.18%) of endothelium (figure 1(b)). meanwhile, l - nna (30 m), an inhibitor of no synthesis, had little effect on the inhibitive effect of paraoxon on 1 m phe - induced vasoconstriction, but sodium nitroprusside (1 nm), a donor of no, significantly attenuated 1 m phe - induced vasoconstriction in endothelium - denuded aortic rings (figure 1(a)). furthermore, atropine (5 m), a specific muscarinic receptors antagonists had also little effect on the inhibitory effect of paraoxon on 1 m phe - induced vasoconstriction in endothelium - denuded thoracic aortic rings (figure 1(a)). as shown in figure 1(c), paraoxon at a concentration of 30 m significantly inhibited 1010 m of concentration phe - induced constriction in thoracic aortic rings without endothelium. likewise, pretreatment with 30 m paraoxon also significantly attenuated 40100 mm kcl - induced vasoconstriction in endothelium - denuded thoracic aortic rings (figure 1(d)). as shown in figure 2(a), treatment of paraoxon (30 m) resulted in vasodilation in the thoracic aortic rings without endothelium that had been precontracted by phe (1 m). the relaxant effect lasted for 35 minutes after treatment with paraoxon (30 m). as well, paraoxon induced vasodilation in thoracic aortic rings without endothelium contracted previously by 80 mm kcl (figure 2(b)). to investigate the involvement of extracellular ca in the inhibitory effect of paraoxon on vasoconstriction, thoracic aortic rings were washed and incubated with ca - free krebs solution. as shown in figures 3(a) and 3(b), a lack of extracellular ca almost completely inhibited phe (94.1% 1.6%) and kcl- (78.3% 2.2%) induced vasoconstriction. under ca - free conditions, paraoxon failed to inhibit vasoconstriction (figures 3(a) and 3(b)). these results showed that the effect of paraoxon on phe- or kcl - induced contraction depended on extracellular ca. paraoxon did not relax either phe- or kcl - induced vasoconstriction in the presence of 55 m verapamil (figure 3(c)). the decrease of vasoconstriction induced by paraoxon was also abolished by verapamil (figure 3(d)). ryanodine and nicotinamide, ca - induced ca release pathway blocker, also had no influence on the effect of paraoxon on phe- or kcl - induced contraction (figure 3(e)). as shown in figure 3(f), to investigate the effect of paraoxon on ca influx - induced vasoconstriction, cacl2 was administrated cumulatively [10 m10 m ] to the aortic rings which had been incubated in ca - free krebs solution. to activate ca influx into the smooth muscle cells, the aortic rings were stimulated with kcl (80 mm) prior to the cumulative addition of cacl2. addition of cacl2 increased the contractile tension of the endothelium - denuded aortic rings in concentration - dependent manner. the contraction induced by the cumulative addition of cacl2 was attenuated by pre - treatment with paraoxon in endothelium - denuded aortic rings. to investigate whether paraoxon attenuated phe- and kcl - induced vasoconstriction in the thoracic aorta mainly through inhibiting ca influx, the effect of paraoxon on vascular smooth muscle [ca]i was measured in thoracic aorta without endothelia. cacl2 induced a rise in vsm [ca]i in ca - free 80 mm k solution, and the first and second concentration - dependent responses were similar. as shown in figure 4, changes in vsm [ca]i measured as the fluorescence ratio in thoracic aorta in response to cacl2 in 80 mm k solution after treatment with 30 m paraoxon for 30 minutes. [ca]i were significantly attenuated by treatment with paraoxon (30 m) for 30 minutes. moreover, treatment with 1 m atropine did not influence the paraoxon- (30 m) mediated inhibition of the cacl2-stimulated [ca]i rise (figure 4). l - type calcium current (ica, l) in thoracic aortas smooth muscle cells was evoked by a depolarizing step pulse from the holding potential of 40 mv to 0 mv at the frequency of 0.1 hz. paraoxon (0.3, 3, and 30 m) inhibited the peak amplitude of ica, l (figure 5). current - voltage (i - v) curve of l - type calcium current was obtained by a number of depolarizing step pulses (350 ms) from the holding potential of 40 mv to test potentials between 50 mv and 50 mv. ica, l was activated at 30 mv and the peak amplitude occurred at the potential of 0 mv. paraoxon (0.3, 3, and 30 m) upshifted the i - v curve (figure 6(a)), but the current density at test potential of 0 mv was significantly decreased only in paraoxon (30 m) group compared with the control group (figure 6(b)). organophosphorus ester pesticides (ops) are well acknowledged to have the potential to result in severe, acute toxicity through the phosphorylation of serine residues of acetylcholinesterase (ache) and the subsequent accumulation of ach. however, many researchers have reported additional noncholinesterase actions for ops. it has been shown that ops could interact directly with targets other than acetylcholinesterase [20, 21 ]. at the cellular level, the main targets of ops include receptors, enzymes, ion channels, cell signaling molecules, and cytoskeletal elements. [2224 ]. likewise, there is multiple evidence that ops can interact with targets other than ache in the cardiovascular system [25, 26 ]. paraoxon is the active metabolite of parathion which is one of the most acutely toxic organophosphorus ester pesticides. we examined the effect of paraoxon on the vasoconstrictor - induced contraction in rabbits thoracic aortic rings. the results showed that paraoxon (30 m) attenuated significantly both phe- and kcl - induced aortic contraction regardless of the presence or absence of aortic endothelium. our findings also showed that l - nna had little effect on the inhibitory effect of paraoxon on phe - induced contraction, while snp inhibited phe - induced contraction in endothelium - denuded aortic rings. these results suggested that paraoxon attenuated vascular contraction independent of generation of no by the endothelia. but l - nna markedly increased the response to phe in the presence of aortic endothelium. this may be explained by the fact that l - nna decreases the production of endothelium - derived relaxing factor, which results in an increase of vascular sensitivity to vasoconstrictor. meanwhile, atropine had also little effect on the inhibitory effect of paraoxon on phe - induced contraction in endothelium - denuded aortic rings. phe can bind to -adrenoceptor on the plasma membrane, leading to the activation of phospholipase c, which produces inositol 1-, 4-, 5-triphosphate (ip3) and diacylglycerol (dg). vascular smooth muscle contraction is then triggered by an increase in [ca]i induced by ca mobilization from the sarcoplasmic reticulum and a membrane depolarization - stimulated ca influx from the extracellular spaces. this vasoconstrictor- induced ca inflow from the extracellular spaces is principally mediated by l - type ca channels. release of ca from sarcoplasmic reticulum is mainly mediated by ip3 receptors and ryanodine receptors, both of which contribute to the transient increase in [ca]i. ryanodine receptor is activated by influx of ca from the extracellular spaces, usually called ca - induced ca release. in addition, various types of k channels exist in vascular smooth muscle cell. the k current hyperpolarizes the vascular smooth muscle cell membrane and prohibits the entry of ca through closing the l - type ca channels, resulting in vasorelaxation. so high environmental k level leads to membrane depolarization and increases the entry of ca from extracellular spaces. our results showed that the degree of aortic contraction was significantly decreased in ca - free medium and/ or the presence of the l - type ca channel inhibitor, verapamil. our findings also showed that ryanodine and nicotinamide, ca - induced ca release pathway blockers, had little effect on the action of paraoxon, but blockade of extracellular ca entry in the absence of extracellular ca or use of verapamil abolished the effect of paraoxon on contraction in rabbits thoracic aorta. moreover, pre - treatment with paraoxon (30 m) decreased contractions induced by the cumulative addition of cacl2. these data suggested that the suppressive effect of paraoxon on vascular contraction was involved in the extracellular ca influx, but not the release of ca from the sarcoplasmic reticulum. the results suggested that pre - treatment with paraoxon attenuated significantly the transient increase in [ca]i in vascular smooth muscle cells of the rabbits thoracic aorta. ca inflow from the extracellular spaces is mainly mediated by l - type calcium channels. so we investigated the effect of paraoxon on l - type calcium current (ica, l) in isolated thoracic aortas smooth muscle cells of rabbits. the results showed that paraoxon (30 m) decreased significantly l - type calcium current. therefore we inferred that paraoxon attenuated vasoconstrictor - induced contraction through inhibiting ca influx via blocking l - type calcium channels in vascular smooth muscle cells of the rabbits. calcium homeostasis is a highly controlled process, essential for various cellular functions including the contraction of smooth muscle and skeletal muscle, transmitter release, the cell excitability, and cell death [34, 35 ]. the interaction of some ops with membrane ca channels has been reported [36, 37 ]. soman has been shown to decrease calcium entry through voltage - dependent calcium channels in bullfrog peripheral sympathetic neurons. methyl parathion and malathion inhibit the [ca]i rise induced by nicotinic agonist in bovine adrenal chromaffin cells. exposure of sn56 cells to 10 m paraoxon for 18 hours significantly decreases the ca mobilization elicited by carbachol. however, there are some different results about the effects of organophosphates on ca homeostasis. reported that paraoxon did not have any influence on the [ca]i in tracheal smooth muscle cells of guinea pigs, whereas sun. found an enhanced ca release and influx mechanisms in presence of paraoxon in the human parotid cell - line hsy., we have demonstrated that paraoxon attenuates vasoconstrictor - induced contraction and induces vasodilation through inhibiting ca influx in the rabbits thoracic aorta.	we investigated the effect of paraoxon on vascular contractility using organ baths in thoracic aortic rings of rabbits and examined the effect of paraoxon on calcium homeostasis using a whole - cell patch - clamp technique in isolated aortic smooth muscle cells of rabbits. the findings show that administration of paraoxon (30 m) attenuated thoracic aorta contraction induced by phenylephrine (1 m) and/or a high k+ environment (80 mm) in both the presence and absence of thoracic aortic endothelium. this inhibitory effect of paraoxon on vasoconstrictor - induced contraction was abolished in the absence of extracellular ca2 +, or in the presence of the ca2 + channel inhibitor, verapamil. but atropine had little effect on the inhibitory effect of paraoxon on phenylephrine - induced contraction. paraoxon also attenuated vascular smooth muscle contraction induced by the cumulative addition of cacl2 and attenuated an increase of intracellular ca2 + concentration induced by k+ in vascular smooth muscle cells. moreover, paraoxon (30 m) inhibited significantly l - type calcium current in isolated aortic smooth muscle cells of rabbits. in conclusion, our results demonstrate that paraoxon attenuates vasoconstrictor - induced contraction through inhibiting ca2 + influx in the rabbits thoracic aorta.
	termine. first demonstrated that sequential dissociative extraction and fractionation procedures with protease inhibitors could provide a convenient approach for the study of mineral compartment constituents. the primary extraction regimen used 4 m guanidine hcl to remove most of the protein from the nonmineralized phase of bone. subsequently, edta - guanidine was used to remove the mineral - phase components. these methods discriminate on the basis of physical - chemical association with a mineral phase rather than on the specific gene products of a particular cell. in the present discussion emphasis is directed at a group of divalent cation binding proteins isolated from the mineral compartment of bone. the localization, synthesis, and chemical characteristics of osteonectin, bone sialoproteins i and ii, and bone acidic glycoprotein-75 are discussed and offered as possible sites for perturbation by the environment with lead exposure.imagesfigure 1.figure 2.figure 2.figure 2.figure 3.figure 3.figure 3.figure 3.
the kindlins represent a class of focal adhesion proteins implicated in integrin activation. they comprise three evolutionarily conserved members, kindlin-1 (fermt,1, c20orf42, urp1 ; chromosome 20p12.3), kindlin-2 (fermt2, mig2, plekhc1, unc112, ; chromosome 14q22.1) and kindlin-3 (fermt3, unc-112 related protein 2 ; chromosome 11q13.1), that share considerable sequence and structural similarities.1 the kindlins have a bipartite ferm (four point one protein, ezrin, radixin, moesin) domain interrupted by a pleckstrin homology domain and can bind directly to various classes of integrins as well as participating in inside out integrin activation.2 the f3 sub domain of the ferm domains of all three kindlins contains a crucial phosphotyrosine binding (ptb) fold resembling that of talin.3,4 the relationship between kindlins and integrin signaling was explored by initial studies on c.elegans embryos harboring homozygous mutations in unc-112, the worm ortholog of kind1. these embryos develop a paralyzed, arrested elongation at two - fold (pat) phenotype due to failure of organization of pat3/integrin in body muscle wall.5 functionally, kindlins primarily mediate protein protein interactions and lack catalytic domains.6 in recent years they have emerged as a key class of adaptor molecules involved in integrin activation.7 loss - of - function mutations in kindlin-1 and kindlin-3 cause kindler syndrome and leukocyte adhesion deficiency - iii syndrome, respectively. kindler syndrome was in fact the first human genetic disorder clinically associated with kindlins. it is caused by mutation of kindlin-1 and is characterized by skin blistering, severe periodontitis and poililodermia.8,9 no human disease has yet been associated with kindlin-2 gene pathology, however kindlin-2 knockout mice die in early embryonic stage indicating the essential role it plays in development. for instance, kindlin-1 is predominantly expressed in the epidermis and only weakly expressed in the dermis, while kindlin-3 expression is restricted exclusively to hematopoietic tissues, where it is the dominant form of kindlins expressed. on the other hand, kindlin-2 is ubiquitously expressed in most parts of the body.10 these differential expression patterns may in part explain the distinctive phenotypes that result from the loss of different kindlins. for instance, as noted above, the kindlin-2 homolog in c. elegans, unc-112 is essential for embryonic development.11 also, loss of kindlin-2 in mice results in pre- implantation embryonic lethality and knockdown of kindlin-2 in zebrafish reveals a strong relationship between cardiac development and the function of kindlin-2.12 consistent with the restricted expression of kindlin-3 in hematopoietic tissues, mice lacking kindlin-3 show severe osteoporosis, hemorrhage and defects in the erythrocyte membrane skeleton, and die within one week after birth.13,14 kindlin-1 shares 62% sequence similarity with kindlin-2 and 49% with kindlin-3. until now, the evolutionary aspects of kindlin structure and function have not been addressed. in this study we studied the natural forces shaping the evolution of the kindlin family of proteins by comparing different evolutionary trends in different vertebrate clades. a phylogenetic analysis of three kindlin family members illustrates the phylogenetic history of kindlin paralogs and also documents the duplication events leading to the formation of these paralogs from one single ancestral kindlin. we show that the original kindlin arose at least as early as simple metazoans, such as hydra. we also explored the effect of functional constraints on the evolution of these three paralogs in vertebrates and found evidence that purifying selection is a major force shaping the evolution of kindlins. relative levels of kindlin-1, kindlin-2 and kindlin-3 transcripts were determined by real - time rt - pcr using sybr green. triplicate samples of each pcr mixture, each containing 4.7 l of power sybr green pcr master mixture (applied biosystems), 0.3 l of a 10 pmol/l of primer mixture, 0.3 l of cdna, and water to a total volume of 10 l were transferred into a 96-well plate on an abi 7500 fast real time pcr system (applied biosystems). the samples were initially incubated at 95c for 3 min, followed by 45 cycles with 95c for 15 s, 60c for 60 s. dissociation curves were generated after each pcr run to ensure that a single, specific product was amplified. the results were analyzed with the comparative cycle threshold (ct) method. for normalization, we used the expression level of -actin (actb). the pcr primers are shown in table 1. in order to explore the evolutionary history of kindlins, sequences of the complete transcripts and the corresponding protein sequences of all three kindlins (kindlin-1, kindlin-2 and kindlin-3) from different species were extracted from ncbi (http://www.ncbi.nlm.nih.gov) and ensemble (http://www.ensembl.org) genome browsers (table 2). after alignment using clustalw program,15 all positions containing gaps and missing data were eliminated, because of the possible ambiguity of the alignments. this stringent approach reduced the risk of misinterpretations the evolutionary history was inferred by using the maximum likelyhood method (ml) as implemented in the treefinder (tf) program package.16 the tf support values indicate the reliability of internal branches. the analyses of amino acid sequences were performed using the wag2000 model17 applying eight classes of rate heterogeneity among sites (8). a neighbor joining analysis18 on amino acid sequences was done by the mega 4 program.19 the reliability of the nj tree was estimated by the bootstrap method, based on 1000 pseudo replicates. a variety of methods were employed to explore the functional constraints shaping the evolution of kindlins. pairwise comparison of the number of synonymous nucleotide substitutions per synonymous (ds) site and non - synonymous nucleotide substitutions per non - synonymous site (dn) was carried out by using nei - gojobori method.20 in addition to pairwise methods, the dn / ds ratio in different branches of the maximum - likelihood tree was estimated using the codon - based genetic algorithm implemented in the ga - branch program available at the data - monkey server (http://www.datamonkey.org/help/gabranch.php). this approach assigns each branch to an incrementally estimated class of dn / ds ratios without requiring a specification of the branches a priori and is both less parameterized and more user friendly than a fully local model.21 evolutionary distance between all possible pairs of kindlin paralogs was estimated by tajima s relative rate test.22 each pair of paralogs was compared with amphioxus protein sequences taken as an out - group. realtime pcr analyses of the expression pattern of kindlins revealed distinct patterns of kindlin expression. as expected, kindlin-2 was expressed almost ubiquitously in all six of the tissues tested, while kindlin-1 showed a one hundred - fold lower expression in each of these tissues with the exception of human kidneys where the expression level is low but significant. 1). these results are very much in agreement with existing data on the expression patterns of kindlin proteins, which also show the ubiquitous nature of kindlin-2 expression and the tissue specific expression of both kindlin-1 and kindlin-3.10 phylogenetic analysis was carried out on the amino acid sequences of kindlin proteins, with the phylogenetic tree rooted by orthologous genes from invertebrate species (fig. notably, an nj analysis on the same data predicted the same topology (fig. the resulting phylogenetic tree is very well supported for most branches except for the deep divergences of branchisotoma floridae and strongylocentrotus purpuratus and one leading to the grouping of xenopus laevis kindlin-2 with the mammals. otherwise the vertebrate relationships for each kindlin ortholog are resolved in a manner concomitant with previous phylogenomic analyses,23 indicating a reliable evolutionary reconstruction among the kindlin families. the phylogeny exhibits a topology of the form (a)(bc) ie, kindlin-1 and kindlin-3 form a cluster while kindlin-2 forms an out - group. it appears that in invertebrates before the divergences of arthropods, a single ancestral kindlin had its ancient origin in hydra. this gene than underwent a lineage specific duplication event in insects, giving rise to two kindlin paralogs. although no study exists to date on the roles of kindlins in insects, it is plausible to assume that because of the diversity found in insects, the duplicated copies were maintained in response to selection pressures impacting this highly diverse group. one of the two kindlins was lost in other higher phyla before the origin of vertebrates ie, echinoderms (strongylocentrotus purpuratus) urochordates (ciona intestinalis), cephalochordates (amphioxus) and hemidchordates (saccoglossus kowalevskii). however, the remaining single kindlin gene copy underwent two duplication events in vertebrates that may have occurred together with two rounds of genome duplication. regardless of the exact mechanism, these events gave rise to three kindlin paralogs : kindlin-1, kindlin-2 and kindlin-3. more data is still required to determine whether these kindlin gene duplication events in the fish were due to whole genome duplications or individual segmental gene duplication. whatever was the cause of this duplication, it is evident from our analyses that three vertebrate kindlin paralogs originated after duplication events in the fish genome and were maintained in all subsequent vertebrate forms, probably due to the selection pressures that have promoted the diverse and complicated morphological and physiological properties of vertebrates.2427 it is important to notice that branch lengths of kindlin-2 are quite short when compared to both kindlin-1 and kindlin-3. very short branch lengths for kindlin-2 on the phylogenetic tree indicate that this gene has experienced a slower evolutionary rate than its paralogs. this result is congruent with existing experimental studies on kindlin genes.9,10,13,14 for instance, kindlin-2 is a ubiquitously expressed gene playing its structural and functional roles in broad array of tissues.10 it has been indicated in various studies that ubiquitously expressed genes tend to evolve slowly compared to those with tissue specific expression.28 as noted previously, kindlin-1 and kindlin-3 are expressed in specific tissues (epithelial tissues and the hematopoietic system, respectively) (fig. 1), and it is therefore commensurate that the evolutionary rate of these paralogs is much higher than that of kindlin- 2. in support of this are kindlin knock out studies for all three kindlins which show that kindlin-2 knockout mice die during early embryogenesis.29 in contrast to the milder phenotypes of kindlin-1 and kindlin-3, these studies support the idea that kindlin-2 is under tighter functional constraint than kindlin 1 and 3. comparison between non - synonymous and synonymous substitutions in orthologous transcript sequences can reveal the selective pressure that shapes the evolution of these genes. the ratio between non - synonymous substitution per non - synonymous site to synonymous substitution per synonymous site dn / ds or omega () indicates whether the evolution of genes is due to adaptive selection or due to neutral evolution. a value of more than 1 suggests that the gene is under positive selection. a value close to 1 suggests that a gene is under neutral selection and is experiencing neutral evolution. however, a value of less than 1 indicates that a gene is under the influence of negative or purifying selection. the nei - gojobori method we employed to estimate the dn / ds ratio clearly showed values below one, (ie, dn / ds < 1) for all the three kindlin paralogs in all of the vertebrate species compared for this analysis (table 3). interestingly, the value for kindlin-2 was much lower (at least ten fold less) than values for either of the other two kindlins. similarly the analysis within and between mammalian and non - mammalian groups clearly showed the same pattern observed in individual pairwise comparisons between different species ie, the absence of any positive selection whatsoever in all the groups.. this difference may result from the high substitution rate often seen in fish genomes, leading to higher dn / ds ratios. kindlin-2 in both mammals and non - mammals showed values of ds similar to kindlin-1 and kindlin-3, but with much lower values of dn, thereby producing greatly lowered values of (table 4). to gain further insight into the lineage specific nature of the selective pressures acting on each branch of the phylogenetic tree this method, unlike the branch site method, does not require the manual selection of branches of interest to identify evidence for positive or negative selection. because the ga branch method does not require the user to select branches of interest, or that testing be performed one branch at a time, it experiences reduced statistical instability while also offering improved interpretability for poorly supported models. in addition, inferences based on multiple models (as opposed to a null - alternative pair) are less vulnerable to model misspecification. in our study, ga - branch analysis selected a model with five classes of. in total, 72% of branches are assigned to a of 0.037, named as class d, with the remaining 28% of branches assigned to four additional classes, designated a, b, c and e, with values of 0.102, 0.050, 0.037 and 0.026, respectively. none of the branches studied show any trend for positive selection, with the probability of positive selection being 0% for each branch of the tree. notably, here again the very low value of (0.013) for kindlin-2 indicates that it is evolving under the influence of much stronger negative selection than kindlin-1 and kindlin-3 (fig. 4 and table 5). in short, whether calculated by pairwise comparison or by lineage specific analysis, dn / ds ratios consistently indicate that vertebrate kindlins have been evolving under the influence of purifying selection, with kindlin-2 under much stronger negative selection than kindlin-1 and kindlin-3. for instance, if adaptive selection was the main force for kindlin divergence rather than purifying selection, we would expect that the functional roles of kindlins may be diverse. in fact, the hallmark function of kindlins is integrin activation and all the other higer order functions associated with kindlins, including cell migration, cell spreading, cell adhesion, cellular signaling and cancer promotion are associated with the ability of kindlins to activate integrin. on the other hand, these higher order processes impacted by kindlins through integrin activation are so essential for organism survival and viability that very strong functional constraints exist over kindlin evolution. the more stringent functional constraint of kindlin-2 compared to either of its two counterpart paralogs is likely due to the fact that it is expressed ubiquitously in the body while kindlins 1 and 3 are tissue specific. for studying the evolutionary distances between different kindlin paralogs, this test involves pairwise comparison of protein sequences from kindlin paralogs of each species while using the orthologous kindlin sequences from amphioxus (branchiostoma floridae) as an out - group (table 6). these tests produced intriguing results which, in correlation with phylogenetic data, show that kindlin-2 has undergone relatively limited divergence compared to both kindlin-1 and kindlin-3, of which kindlin-3 is indicated to be most divergent. interestingly, it seems that kindlin-2 is the representative of the original ancient amphioxus kindlin which underwent two duplications in fish giving rise to kindlin-1 and kindlin-3. there are two important reasons to believe that kindlin-2 is the representative of the unduplicated ancestral kindlin gene, whose duplication in vertebrates gave rise to two other paralogs. firstly the tajima test clearly shows that kindlin-2 is closest to amphioxus kindlin, with very low levels of divergence evident compared to kindlin-1 and kindlin-3. secondly, kindlin-2 is not only a ubiquitously expressed protein but also the only kindlin protein expressed in embryonic stem cells. although no study has been conducted to explore the expression pattern of kindlins in amphioxus, c. elegans studies suggest that this unduplicated kindlin is expressed ubiquitously in all tissues including the embryonic stem cell.5 therefore if the amphioxus kindlin is an ortholog of c. elegans kindlin, it should also exhibit the same expression pattern, making vertebrate kindlin-2 a strong candidate as the representative of the ancestral unduplicated kindlin protein. no species specific asymmetry was found in the divergence pattern of any of the three kindlin paralogs which is in agreement with the generally accepted principle that paralogs evolve at similar rates in different species.30 relatively high divergence of kindlin-1 and kindlin-3 relative to kindlin-2 can be explained by analyzing the expression pattern of the proteins.10 during evolution, from amphioxus to higher vertebrates, the expression pattern of the two paralogs have diverged. our analysis of kindlin expression patterns in human tissue samples clearly shows that unlike kindlin-2, which is expressed ubiquitously, both kindlin-1 and kindlin-3 present tissue specific expression patterns (fig. similarly, ussar have shown in their study that both kindlin-1 and kindlin-3 are expressed predominantly in epithelial tissues and the hematopoietic system respectively.10 the distinct expression patterns of all three kindlins in vertebrates thus supports the subfunctionalization model of gene duplication.31 it seems likely that that the function of the ancestral unduplicated kindlin was subfunctionalized in vertebrates in part due to the divergence of kindlin expression location. thus, while kindlin-1 and kindlin-3 are expressed exclusively in epithelial and hematopoietic tissues, respectively, kindlin-2 being the representative of ancestral kindlin gene is expressed in a variety of tissues, in a pattern less ubiquitous than the original unduplicated kindlin gene. ultimately, it seems that this subfunctionalization of kindlin expression patterns may have provided a degree of selective advantage associated with the diversification of higher order functions performed by integrins in various tissues. realtime pcr analyses of the expression pattern of kindlins revealed distinct patterns of kindlin expression. as expected, kindlin-2 was expressed almost ubiquitously in all six of the tissues tested, while kindlin-1 showed a one hundred - fold lower expression in each of these tissues with the exception of human kidneys where the expression level is low but significant. 1). these results are very much in agreement with existing data on the expression patterns of kindlin proteins, which also show the ubiquitous nature of kindlin-2 expression and the tissue specific expression of both kindlin-1 and kindlin-3.10 phylogenetic analysis was carried out on the amino acid sequences of kindlin proteins, with the phylogenetic tree rooted by orthologous genes from invertebrate species (fig. notably, an nj analysis on the same data predicted the same topology (fig. 3). the resulting phylogenetic tree is very well supported for most branches except for the deep divergences of branchisotoma floridae and strongylocentrotus purpuratus and one leading to the grouping of xenopus laevis kindlin-2 with the mammals. otherwise the vertebrate relationships for each kindlin ortholog are resolved in a manner concomitant with previous phylogenomic analyses,23 indicating a reliable evolutionary reconstruction among the kindlin families. the phylogeny exhibits a topology of the form (a)(bc) ie, kindlin-1 and kindlin-3 form a cluster while kindlin-2 forms an out - group. it appears that in invertebrates before the divergences of arthropods, a single ancestral kindlin had its ancient origin in hydra. this gene than underwent a lineage specific duplication event in insects, giving rise to two kindlin paralogs. although no study exists to date on the roles of kindlins in insects, it is plausible to assume that because of the diversity found in insects, the duplicated copies were maintained in response to selection pressures impacting this highly diverse group. one of the two kindlins was lost in other higher phyla before the origin of vertebrates ie, echinoderms (strongylocentrotus purpuratus) urochordates (ciona intestinalis), cephalochordates (amphioxus) and hemidchordates (saccoglossus kowalevskii). however, the remaining single kindlin gene copy underwent two duplication events in vertebrates that may have occurred together with two rounds of genome duplication. regardless of the exact mechanism, these events gave rise to three kindlin paralogs : kindlin-1, kindlin-2 and kindlin-3. more data is still required to determine whether these kindlin gene duplication events in the fish were due to whole genome duplications or individual segmental gene duplication. whatever was the cause of this duplication, it is evident from our analyses that three vertebrate kindlin paralogs originated after duplication events in the fish genome and were maintained in all subsequent vertebrate forms, probably due to the selection pressures that have promoted the diverse and complicated morphological and physiological properties of vertebrates.2427 it is important to notice that branch lengths of kindlin-2 are quite short when compared to both kindlin-1 and kindlin-3. very short branch lengths for kindlin-2 on the phylogenetic tree indicate that this gene has experienced a slower evolutionary rate than its paralogs. this result is congruent with existing experimental studies on kindlin genes.9,10,13,14 for instance, kindlin-2 is a ubiquitously expressed gene playing its structural and functional roles in broad array of tissues.10 it has been indicated in various studies that ubiquitously expressed genes tend to evolve slowly compared to those with tissue specific expression.28 as noted previously, kindlin-1 and kindlin-3 are expressed in specific tissues (epithelial tissues and the hematopoietic system, respectively) (fig. 1), and it is therefore commensurate that the evolutionary rate of these paralogs is much higher than that of kindlin- 2. in support of this are kindlin knock out studies for all three kindlins which show that kindlin-2 knockout mice die during early embryogenesis.29 in contrast to the milder phenotypes of kindlin-1 and kindlin-3, these studies support the idea that kindlin-2 is under tighter functional constraint than kindlin 1 and 3. comparison between non - synonymous and synonymous substitutions in orthologous transcript sequences can reveal the selective pressure that shapes the evolution of these genes. the ratio between non - synonymous substitution per non - synonymous site to synonymous substitution per synonymous site dn / ds or omega () indicates whether the evolution of genes is due to adaptive selection or due to neutral evolution. a value of more than 1 suggests that the gene is under positive selection. a value close to 1 suggests that a gene is under neutral selection and is experiencing neutral evolution. however, a value of less than 1 indicates that a gene is under the influence of negative or purifying selection. the nei - gojobori method we employed to estimate the dn / ds ratio clearly showed values below one, (ie, dn / ds < 1) for all the three kindlin paralogs in all of the vertebrate species compared for this analysis (table 3). interestingly, the value for kindlin-2 was much lower (at least ten fold less) than values for either of the other two kindlins. similarly the analysis within and between mammalian and non - mammalian groups clearly showed the same pattern observed in individual pairwise comparisons between different species ie, the absence of any positive selection whatsoever in all the groups. this difference may result from the high substitution rate often seen in fish genomes, leading to higher dn / ds ratios. kindlin-2 in both mammals and non - mammals showed values of ds similar to kindlin-1 and kindlin-3, but with much lower values of dn, thereby producing greatly lowered values of (table 4). to gain further insight into the lineage specific nature of the selective pressures acting on each branch of the phylogenetic tree this method, unlike the branch site method, does not require the manual selection of branches of interest to identify evidence for positive or negative selection. because the ga branch method does not require the user to select branches of interest, or that testing be performed one branch at a time, it experiences reduced statistical instability while also offering improved interpretability for poorly supported models. in addition, inferences based on multiple models (as opposed to a null - alternative pair) are less vulnerable to model misspecification. in our study, ga - branch analysis selected a model with five classes of. in total, 72% of branches are assigned to a of 0.037, named as class d, with the remaining 28% of branches assigned to four additional classes, designated a, b, c and e, with values of 0.102, 0.050, 0.037 and 0.026, respectively. none of the branches studied show any trend for positive selection, with the probability of positive selection being 0% for each branch of the tree. notably, here again the very low value of (0.013) for kindlin-2 indicates that it is evolving under the influence of much stronger negative selection than kindlin-1 and kindlin-3 (fig. 4 and table 5). in short, whether calculated by pairwise comparison or by lineage specific analysis, dn / ds ratios consistently indicate that vertebrate kindlins have been evolving under the influence of purifying selection, with kindlin-2 under much stronger negative selection than kindlin-1 and kindlin-3 for instance, if adaptive selection was the main force for kindlin divergence rather than purifying selection, we would expect that the functional roles of kindlins may be diverse. in fact, the hallmark function of kindlins is integrin activation and all the other higer order functions associated with kindlins, including cell migration, cell spreading, cell adhesion, cellular signaling and cancer promotion are associated with the ability of kindlins to activate integrin. on the other hand, these higher order processes impacted by kindlins through integrin activation are so essential for organism survival and viability that very strong functional constraints exist over kindlin evolution. the more stringent functional constraint of kindlin-2 compared to either of its two counterpart paralogs is likely due to the fact that it is expressed ubiquitously in the body while kindlins 1 and 3 are tissue specific. for studying the evolutionary distances between different kindlin paralogs, tajima s relative rate test was employed. this test involves pairwise comparison of protein sequences from kindlin paralogs of each species while using the orthologous kindlin sequences from amphioxus (branchiostoma floridae) as an out - group (table 6). these tests produced intriguing results which, in correlation with phylogenetic data, show that kindlin-2 has undergone relatively limited divergence compared to both kindlin-1 and kindlin-3, of which kindlin-3 is indicated to be most divergent. interestingly, it seems that kindlin-2 is the representative of the original ancient amphioxus kindlin which underwent two duplications in fish giving rise to kindlin-1 and kindlin-3. there are two important reasons to believe that kindlin-2 is the representative of the unduplicated ancestral kindlin gene, whose duplication in vertebrates gave rise to two other paralogs. firstly the tajima test clearly shows that kindlin-2 is closest to amphioxus kindlin, with very low levels of divergence evident compared to kindlin-1 and kindlin-3. secondly, kindlin-2 is not only a ubiquitously expressed protein but also the only kindlin protein expressed in embryonic stem cells. although no study has been conducted to explore the expression pattern of kindlins in amphioxus, c. elegans studies suggest that this unduplicated kindlin is expressed ubiquitously in all tissues including the embryonic stem cell.5 therefore if the amphioxus kindlin is an ortholog of c. elegans kindlin, it should also exhibit the same expression pattern, making vertebrate kindlin-2 a strong candidate as the representative of the ancestral unduplicated kindlin protein. no species specific asymmetry was found in the divergence pattern of any of the three kindlin paralogs which is in agreement with the generally accepted principle that paralogs evolve at similar rates in different species.30 relatively high divergence of kindlin-1 and kindlin-3 relative to kindlin-2 can be explained by analyzing the expression pattern of the proteins.10 during evolution, from amphioxus to higher vertebrates, the expression pattern of the two paralogs have diverged. our analysis of kindlin expression patterns in human tissue samples clearly shows that unlike kindlin-2, which is expressed ubiquitously, both kindlin-1 and kindlin-3 present tissue specific expression patterns (fig. similarly, ussar have shown in their study that both kindlin-1 and kindlin-3 are expressed predominantly in epithelial tissues and the hematopoietic system respectively.10 the distinct expression patterns of all three kindlins in vertebrates thus supports the subfunctionalization model of gene duplication.31 it seems likely that that the function of the ancestral unduplicated kindlin was subfunctionalized in vertebrates in part due to the divergence of kindlin expression location. thus, while kindlin-1 and kindlin-3 are expressed exclusively in epithelial and hematopoietic tissues, respectively, kindlin-2 being the representative of ancestral kindlin gene is expressed in a variety of tissues, in a pattern less ubiquitous than the original unduplicated kindlin gene. ultimately, it seems that this subfunctionalization of kindlin expression patterns may have provided a degree of selective advantage associated with the diversification of higher order functions performed by integrins in various tissues. they play an important role in cell migration, cell spreading and cancer progression through a core molecular mechanism of integrin activation. in this study we have shown that the ancestral kindlin gene was an unduplicated single gene found in organisms as primitive as hydra. this gene then underwent a lineage specific duplication in insects, giving rise to two kindlin paralogs, while the three paralogs of kindlin found in vertebrates are the result of duplication events that occurred in fish. of the three kindlins, kindlin-2 has undergone the least evolutionary divergence, probably due to stringent functional constraints it associated with its virtually ubiquitous expression pattern in body tissues and especially in embryonic stem cells. on the other hand both kindlin-1 and kindlin-3 showed significantly greater divergence as a result of significantly weaker functional constraints, possibly resulting from their subfunctionalization into very specific portions of the body. the comparison of synonymous to non - synonymous substitutions both by a pairwise method as well as a lineage specific method also indicate that all three kindlins have been evolving under strong negative selection.	kindlin proteins represent a newly discovered family of evolutionarily conserved ferm domain - containing proteins. this family includes three highly conserved proteins : kindlin-1, kindlin-2 and kindlin-3. all three kindlin proteins are associated with focal adhesions and are involved in integrin activation. the ferm domain of each kindlin is bipartite and plays a key role in integrin activation. we herein explore for the first time the evolutionary history of these proteins. the phylogeny of the kindlins suggests a single ancestral kindlin protein present in even the earliest metazoan ie, hydra. this protein then underwent duplication events in insects and also experienced genome duplication in vertebrates, leading to the kindlin family. a comparative study of the kindlin paralogs showed that kindlin-2 is the slowest evolving protein among the three family members. the analysis of synonymous and non - synonymous substitutions in orthologous kindlin sequences in different species showed that all three kindlins have been evolving under the influence of purifying selection. the expression pattern of kindlins along with phylogenetic studies supports the subfunctionalization model of gene duplication.
dengue (den) fever is the most diagnosed traveler - related illness, with 390400 million cases / year worldwide1,2 and an incidence rate of ~2.5%5% of > 2 billion people at risk.3 however, only an estimated 3%8% of symptomatic travelers are den virus (denv)-positive via serological tests.4 infection with one denv serotype may cause a range of symptoms (eg, asymptomatic, flu - like). simultaneous and/or sequential infection with different serotypes increases the risk of serious illnesses such as den hemorrhagic fever (dhf) and den shock syndrome, which could lead to death.5 often, patients are unaware of initial infection and experience severe symptoms when secondary infection with another serotype occurs.5 a greater understanding of human travel patterns between den - endemic countries and the united states may improve risk assessments and identify potential routes of entry for denv. the geographic ranges of the four denv serotypes are expected to expand with international travel as humans are the primary reservoirs.6 this increases the likelihood of multi - serotype epidemics that could impact public health. risk assessments showing the impact of travel on denv importation are essential to understand the role of human travel in pathogen spread. pan america can be categorized into four regions, that is, north america, central america, south america, and caribbean. most den cases among us citizens occur as a result of endemic transmission in puerto rico, a us territory.7 in 2010, 162,058,000 visitors entered the united states.8 of those, 1,197,866 were brazilian.9 den is endemic in brazil where all four serotypes of denv circulate.10 travelers returning to the united states from brazil accounted for 70% of imported den cases between 1998 and 2008.11,12 globally, > 2 billion people / year are at risk for den infection and > 21,000 den - related deaths / year occur ; yet, the range of possible symptoms makes it difficult for medical diagnoses without a serological test.13 studies have identified young age, high body mass index, female sex, virus serotypes, and virus genotype as risk factors for severe den.13 patients recovering from dhf may experience symptoms such as fatigue for up to six months.13 these increased risks are important due to the economic burden of lost work time and associated medical costs.14,15 a study of 2012 healthcare costs in the philippines reported $ 345 million ($ 3.26 per capita) spent in direct medical costs for patients with den.16 pan american residents spend ~$2.1 billion / year for den - related medical costs.17 in the united states, each person hospitalized with den pays ~$17,803 and less severe cases cost ~$1,610.17 the median cost of medical treatment throughout pan america is $ 1,227.17 costs vary substantially between countries due to the value of currency and variation in expenses, that is, difference in costs between hospitals.18 adequate healthcare facilities are not accessible to all patients with den, hence underreporting likely occurs.19 denv was first isolated in 1943, and serological tests were subsequently made available.19 currently, den cases are diagnosed based on symptoms rather than serological tests that are used simply to confirm infection for research.19 before 1970, den had only been detected in nine countries ; however, by 1996, 102 countries had experienced epidemics.20 in 1962, a comprehensive mosquito control effort was developed and implemented by the brazilian government, pan american health organization (paho), and the rockefeller foundation.19 although this effort attempted to eradicate the primary denv vector, aedes aegypti l., reinfestation occurred when plans deteriorated due to the loss of political interest.12,19 insufficient community participation and lack of support from the health sector added to the deterioration of the eradication program.19 by 1980, den outbreaks increased globally, and in 1981, cuba experienced an outbreak with 344,203 cases, including > 10,000 dhf cases and > 150 deaths.19 from 2000 to 2012, all four denv serotypes were found in pan america, causing the highest number of cases to date.19 a. aegypti and aedes albopictus skuse are the two primary vectors of denv and are distributed through pan america.13 a. albopictus, a day - biting species originally found in asia, began geographic expansion in the 1980s and is still expanding today.21 this anthropophilic mosquito species was introduced into the united states in 1985 from asia in a shipment of tires.14,2224 a. aegypti takes multiple blood meals ; hence, this species may infect multiple humans during a single gonotrophic cycle.25 this mosquito species will stop blood feeding when disturbed and either return to the same host or a different host to complete a blood meal.14,15 rapid expansion of international and domestic human travel, urban sprawl, and insufficient vector control may facilitate the geographic expansion of denv.19 here, we conduct a risk assessment for 20012012 based on (1) residents and den cases in 51 pan american countries, (2) visitors from 51 pan american countries traveling to the united states, and (3) us residents traveling to den - endemic pan american countries. travel statistics for 51 pan american countries were tabulated from the compendium of tourism statistics and the office of travel and tourism industries for 20012012 (table 1).9 countries were categorized by region (ie, north america, central america, south america, and caribbean), and populations for 51 countries were tabulated.26 for the purposes of this study, north america includes canada and the united states, while mexico is included in central america. the number of clinically reported den cases was collected from the paho10 and the centers for disease control and prevention (cdc) (j. lehman, personal communication). the number of den cases was compared to the annual travel statistics and populations for each region. regions with the most visitors to the united states were ranked, and further analyses were conducted for 18 countries whose residents visited the united states most frequently. the incidence rate per 100,000 people was determined ([the number of den cases reported in the country / the population of the country ] 100,000). due to unreported data, canada was excluded from north america for the purposes of calculating incidence rate. to determine the potential risk of traveling to an endemic country and becoming infected, the number of united states citizens traveling to each region was multiplied by the incidence rate for that region. the cdc provided information on den cases imported into the united states by citizen travelers from 2003 to 2011 (j. lehman, personal communication). the number of imported den cases from each of the same 18 pan american countries (residents visited the united states most frequently) was divided by the total number of cases for each year in each country to determine the country where the highest rate of incidence occurred in united states travelers. maps were created for 2004, 2008, and 2012 to show spatiotemporal trends for the countries relevant to our study. we generally observed yearly increases in international travel to the united states from all regions of pan america from 2001 to 2012 (fig. 1). for the time period studied, most pan american den cases occurred in brazil (south american region), with > 1 million cases reported in 2010 alone (table 1). for us citizens, the highest number of imported den cases were observed in continental us travelers visiting the dominican republic, closely followed by puerto rico (caribbean region). table 1 shows that reported clinical cases of den have increased where surveillance systems have become a priority, such as brazil (mandatory reporting started in 2007). the south american region had the highest number of den cases over the 12 years studied (fig. incidence rates in all regions have increased since 2001 with the worst epidemics occurring in 2010 (fig. studied, brazil (third highest number of travelers to united states) showed the highest number of den cases. the den incidence rate was highest in the south american region (341 cases/100,000 people in 2010), primarily attributed to brazil. the caribbean and south american regions both experienced den epidemics in 2010, while central america had an epidemic in 2009 (fig. however, there is a large population difference between the south american region and other regions such as the caribbean, and figure 3 accounts for these differences, that is, regional incidence with the population taken into account. figures 46 show den incidence in 2004, 2008, and 2012, respectively. in 2004, countries with higher incidence rates have at least three denv serotypes circulating (eg, brazil, venezuela, and mexico), and its residents travel to the united states most frequently. table 2 shows that the number of denv serotypes in most countries increased between 2004 and 2012. caution is advised in interpreting figures 1 and 2 since most countries did not mandate den reporting until 2009. most us citizens experiencing den acquired the illness while visiting the dominican republic, closely followed by puerto rico (caribbean region). countries endemic for den pose a higher risk for travelers than nonendemic countries and thus create a higher risk for denv incidence and spread. as travel and geographic range of potential denv vectors continue to increase, incidence of den will likely increase.14 there is also an increased risk of introducing new denv serotypes into nave populations. regions that are visited frequently and where all four denv serotypes are prevalent (eg, south america) pose the greatest risk to travelers. a. albopictus and a. aegypti are both found in the united states ; hence, traveler - imported cases are a concern for some regions since local mosquito populations may contribute to subsequent transmission. florida had 125 locally transmitted cases from 2009 to 2014, while hawaii (four cases in 2011), texas (24 cases from 2013), and new york (one case in 2013) also experienced locally transmitted cases.15,27 in the united states, there were 177 imported human den cases reported from 22 different states in 2009, 642 imported cases from 39 states in 2010, 245 imported cases from 32 states in 2011, 544 imported cases from 34 states in 2012, 772 imported cases from 41 states in 2013, and 357 imported cases from 37 different states in 2014 (j. lehman, personal communication27). until 2009, den was not a nationally reportable disease in many pan american countries, including the united states ; hence, cases prior to 2009 may be underreported. some countries only report serologically positive cases ; hence, physician - diagnosed cases (relying solely on symptoms) may be underreported.10 increases in den cases reported here after 2009 may be an indication of improved surveillance in addition to increasing incidence of cases. while underreporting and misdiagnosis remain an issue for calculating denv transmission risk, we observed increases in case frequency for the period studied. many patients infected with one serotype of denv are asymptomatic or experience flu - like symptoms and do not seek medical treatment.28 others can not afford to go to the doctor or do not have easy access for treatment and, therefore, go unreported.14 there is a lack of uniform application of the case definition of den, and some countries have instituted their own case definitions.29 in addition, complicated reporting systems and/or lengthy reporting requirements may reduce motivation of health care workers to submit positive test results.3 underreporting impacts public health because it is an enormous barrier to obtaining an accurate risk assessment. in belo horizonte, brazil, the level of reporting of hospitalized patients with den was ~63% between 1997 and 2002.30 identification of denv via cell culture or nucleic acid detection (polymerase chain reaction) requires sophisticated laboratories,31 and there is limited accuracy in rapid tests.3 as a result, the mobilization of resources from the local, national, and international communities for the elimination of the vector and better infection care3 needs improvement. there is no den vaccine,32 and there is great concern for people already infected with one or more serotypes regarding their reaction to a vaccine.33 with > 43 million travelers entering the united states by air from pan american countries, the risk for travel - related den exists. continued surveillance, improved den - reporting systems, and risk assessment are needed to prevent further den expansion and reduce the risk of importation.	the objective of this study was to improve risk assessments of travel on dengue (den) virus (denv) distribution. we investigated the exposure risk of us citizens traveling to den - endemic pan american countries. the number of den cases reported in 51 pan american countries from 2001 to 2012 was compared to the population of the same countries. the number of us travelers visiting the pan american countries was categorized by region, and travel - related den infections were analyzed. us residents visiting the dominican republic exhibited the highest traveler - related den incidence. brazil showed the most den cases in its residents (> 1 million reported cases in 2010). the number of den cases continues to rise as does international travel and the geographic range of potential denv vectors. denv risk assessments may be improved by analyzing the possible routes of entry. underreporting remains an issue for calculating denv transmission risk by country and region.
osteoporosis is characterized by low bone mass and microarchitectural deterioration of bone tissue, leading to increased bone fragility and a consequent increase in fracture risk. consequently, noninvasive techniques for measuring bone mineral density (bmd) play an important role in the clinical diagnosis of osteoporosis and in monitoring its progression. dual x - ray absorptiometry (dxa) and quantitative computed tomography (qct) are the most common tools for measuring bmd. dxa determines bmd in two dimensions, including both trabecular and cortical bone, with the results expressed as areal density (grams per square centimeter). qct allows measurement of volumetric trabecular bone density without superimposition of cortical bone and other tissues, with the results expressed in milligrams per cubic centimeter of calcium hydroxyapatite. dxa and qct findings can not be compared directly, and sometimes the diagnosis indicated by bmd findings differs between the two modalities. therefore, we compared the detection rate of osteoporosis for posteroanterior dxas (pa - dxa) with the rate for qct and analyzed the reasons for the differences between the two. between february 2010 and february 2013, we reviewed data, for our study, for 194 postmenopausal women who underwent qct and areal spinal and hip dxa in our department with an interval between qct and dxa scans of two months. study exclusion criteria included a history of multiple myeloma, rheumatoid arthritis, ankylosing spondylitis, systemic lupus erythematosus (sle), connective tissue disease, metabolic and endocrine diseases, or bone tumors. dxa measurements were obtained using a prodigy dxa scanner (ge, lunar, madison, wi, usa) and were analyzed using the manufacturer 's software. the dxa t - score vertebrae from l1 to l4 and the left hip were scanned in the supine position using posteroanterior projections. the t - score for l1l4 and for the femoral neck plus the total hip measurement by dxa were used to diagnose osteoporosis. we used the diagnostic criteria established by the world health organization (who) in 1994. qct measurements were obtained with an aquilion 64-slice ct scanner (toshiba, tokyo, japan) with a solid mindways qct phantom (mindways software inc. elliptical regions of interest were put in the midplane of three vertebral bodies (l2l4) in the trabecular bone automatically, avoiding the cortical bone of the vertebrae. for the bmd of spinal trabecular bone, thresholds of 120 mg / cm for osteopenia (equivalent to a dxa t - score of 1.0 sd) and 80 mg / cm for osteoporosis (equivalent to a dxa t - score of 2.5 sd) were suggested by the international society for clinical densitometry in 2007 and by the american college of radiology in 2008. to estimate the degree of spinal degeneration and abdominal aortic calcification (aac), two radiologists who were blinded to the bmd results independently reviewed lumbar ct images. the difference between the osteoporosis detection rates for dxa versus qct was analyzed using the chi - square test. the 140 study participants ranged in age from 47.1 to 85.9 years (mean : 63.2 8.1 years). the interval time between dxa and qct scans ranged from 0 to 43 days (mean : 4.3 9.7 days). the bmd of l1l4 as measured by dxa ranged from 0.575 to 1.621 g / cm (mean : 0.973 0.169 the trabecular bmd of the lumbar spine as measured by qct ranged from 5.0 to 199.4 mg / cm (mean : 81.7 34.8 mg / cm). the osteoporosis detection rates for lumbar pa - dxa, lowest bmd of the femoral neck and total hip, lowest bmd for spinal and hip dxa, and lumbar qct were 17.1%, 12.9%, 20.0%, and 46.4%, respectively (table 1). the intragroup detection rates for qct versus dxa were significantly different (p < 0.01), with qct detecting osteoporosis more frequently than spinal and hip dxa, did. of the 140 participants, 41 (29.3%) were found by qct but not by dxa to have osteoporosis. of these, 7 (17.1%) had single or multiple vertebral fractures (figure 1). all 41 (100%) had vertebral osteophytes or end plate sclerosis, 33 (80.5%) had facet joint osteoarthritis, 14 (34.1%) had spinous process osteophytes, and 25 (61.0%) had aac. in addition, 3 participants had bone islands or focal sclerosis (figure 2). the diagnostic criteria for dxa established by who in 1994 have long been used as the gold standard in the clinical diagnosis of osteoporosis. the sites most commonly measured are the lumbar spine and hip. our study showed a significant difference in osteoporosis detection rates between dxa and qct, providing clinical evidence that qct has a greater diagnostic sensitivity than dxa. osteoporosis, spinal degeneration, and aac are most commonly seen in the elderly, and the consequences of these conditions are more serious with increased age. this is why it can be problematic to use dxa rather than qct ; even though clinical findings may indicate osteoporosis, dxa may still indicate that bmd is normal. a possible explanation for the superior performance of qct may be spinal degeneration and calcinations in the soft tissue around the spine. yu. reported that bmd measured by pa - dxa was significantly higher in patients with spinal degenerative joint disease changes than in those without such changes, particularly when osteophytes were present at the vertebral bodies and facet joints. indicated that the presence of osteophytes is associated with higher bmd when measured with dxa. our results show that spinal degeneration and aac may be associated with the overestimation of bmd and the underestimation of osteoporosis by dxa. several clinical techniques for bmd measurement are available, including dxa, qct, and ultrasound, each with its own advantages and shortcomings. appropriate choice of technique and measurement site is important for the accurate diagnosis of osteoporosis. found that, under the who classification, women with spinal osteoarthritis were more likely to be given a diagnosis of osteoporosis of the femoral neck and hip than those without spinal osteoarthritis but less likely to receive such a diagnosis when bmd was based on the pa spine (14.4% versus 24.5%). recommended that, in women aged 65 years and older who are likely to have spinal osteoarthritis, dxa of the hip be used for identification of osteoporosis. however, dxa of the hip still includes cortical bone, so, findings can be influenced by degenerative changes, leading to a decrease in the ability to detect osteoporosis. in our study, the detection rate of osteoporosis at any spinal or femoral site by dxa was significantly lower than the rate for qct, and no femoral site was superior to the pa spinal site. it may measure bmd more accurately and reproducibly, especially in patients with spinal deformity, severe degenerative changes, extreme obesity, or low body mass index. qct may be particularly useful in china, where dxa scanners are not available in most areas. found that vertebral fractures were present in 18.3% of asymptomatic postmenopausal women and that 11.0% to 18.7% of individuals with clinical osteoporosis would have been classified as having normal bone by bmd criteria alone. ling. reported that vertebral fractures were present in 15% of women aged 50 years or older in beijing. in our study, we found vertebral fractures in 17.1% of women in whom qct but not dxa showed osteoporosis as our study demonstrated, qct may avoid the overestimation of bmd by dxa associated with spinal degeneration, aac, and other sclerosis lesions, such as bone islands. qct may be more sensitive for detecting osteoporosis, but this must be validated in a larger population.	objective. to compare the osteoporosis detection rates in postmenopausal women when measuring bone mineral density (bmd) with quantitative computed tomography (qct) in the spine versus dual x - ray absorptiometry (dxa) in the spine and hip and to investigate the reasons for the discrepancy between the two techniques. methods. spinal volumetric bmd was measured with qct, and areal spinal and hip bmds were measured with dxa in 140 postmenopausal women. we calculated the osteoporosis detection rate for the two methods. lumbar ct images of patients who had a discrepancy between qct and dxa findings were reviewed to evaluate vertebral fractures, spinal degeneration, and abdominal aortic calcification. results. for the entire 140 patients, the detection rate was 17.1% for dxa and 46.4% for qct, a significant difference (p < 0.01). of the 41 patients with conflicting diagnoses, 7 whose diagnosis by qct was osteoporosis had vertebral fractures even though their dxa findings did not indicate osteoporosis. varying degrees of spinal degeneration were seen in all of the 41 patients. conclusion. qct may avoid the overestimation of bmd by dxa associated with spinal degeneration, abdominal aortic calcification, and other sclerotic lesions. it may be more sensitive than dxa for detecting osteoporosis in postmenopausal women.
infectious and inflammatory processes, however, can induce new vessel growth causing corneal neovascularization, which leads to scarring, edema, and blindness. corneal neovascularization affects an estimated 4.1% of all patients presenting to general ophthalmology offices in the us a meta - analysis has shown a significantly higher risk of corneal graft rejection with increased number of corneal quadrants affected by neovascularization prior to keratoplasty. corneal neovascularization is thought to occur through the imbalance of angiogenic and antiangiogenic protein factors. vascularized human corneas have been shown to have significant upregulation of vascular endothelial growth factor (vegf), matrix metalloproteinases (mmp), and basic fibroblastic growth factor (bfgf)., san francisco, ca) is a monoclonal antibody that targets human vegf (vegf) and has been studied as a potentially potent therapy for corneal neovascularization. antiangiogenic monotherapy with a drug such as bv, which targets vegf alone, however, may not provide the best long - term therapy since inhibition of one antiangiogenic factor can result in the upregulation of others leading to acquired drug resistance. in addition, lymphangiogenesis has been identified as an important process involved in the pathogenesis of corneal graft rejection. endostatin, in contrast to bevacizumab, has been identified as a potent inhibitor of both neovascularization and lymphangiogenesis [68 ]. another potential deficiency of bv therapy is its association with systemic side effects seen during trials of its use in age - related macular degeneration, including bleeding, hypertension, and stroke [912 ]. thus, an angiogenesis inhibitor that blocks multiple promoters of angiogenesis with few systemic side effects is desired. as a 20 kda fragment of collagen xviii, it modifies 12% of the human genome in order to downregulate angiogenesis with few systemic side effects [1315 ]. by affecting multiple angiogenic pathways simultaneously, endostatin may allow for a much lower possibility of drug resistance. in contrast to the noted hypertension found with bv use in human studies [17, 18 ], endostatin was noted to decrease systolic blood pressure by almost 10 mmhg when dosed daily in animal studies. endostatin was initially studied in preclinical models of corneal neovascularization and tumor models [20, 21 ]. despite high expectations, human endostatin had a limited response in phase i and ii human cancer clinical trials largely due to two deficiencies. second, approximately 50% of the recombinant human endostatin used in the clinical trials lacked four amino acids at the nh2 terminus, which resulted in a nonfunctional molecule due to an inability to bind zinc. in order to engineer a more stable form of endostatin, fc - endostatin (fce) was developed by fusing endostatin to the fc region of an igg molecule. the presence of the fc portion increases the half - life to greater than one week and conserves the molecule 's zinc affinity. this increase in half - life is similar to the role of the fc domain in bv, which increases the molecule 's half - life to weeks rather than hours. fce was recently shown to be effective in a rodent model of high - grade glioma using various delivery methodologies. we set out to evaluate the safety and antiangiogenic efficacy of subconjunctival injection of fce using a rabbit vegf - induced corneal neovascularization model. this paper is the first published assessment of fce as a potential therapy for corneal neovascularization. eight male new zealand white rabbits, each weighing 4.5 to 6.5 kg (robinson industry farms, mocksville, nc) were used. care and treatment of all rabbits were in strict agreement with the association for research in vision and ophthalmology (arvo) statement for the use of animals in ophthalmic and vision research and with the approval of the johns hopkins university animal care and use committee. rabbits were housed in standard animal facilities, one animal per cage, and given free access to food and baltimore city water. for intracorneal implantations and subsequent operative microscope examinations the animals were anesthetized with a mixture of xylazine 10 mg / kg (butler schein, dublin, oh) and ketamine 2 mg / kg (butler schein, dublin, oh). the ocular surface was anesthetized with topical 0.5% proparacaine hydrochloride (alcaine, alcon, fort worth, tx). pain control was provided, as needed, with subcutaneous injection of buprenorphine hcl 0.1 mg / kg (bedford labs, bedford, oh). ethylene - vinyl acetate copolymer (40% vinyl acetate by weight, elvax 40p) (du pont co., wilmington, de) was prepared as previously described. briefly, human vegf (peprotech, rocky hill, nj) was incorporated into the ethylene - vinyl acetate copolymer (evac) matrix. evac (130 mg) was dissolved in methylene chloride (1.8 ml) and vegf (20 g) was added. the mixture was poured into cylindrical glass molds measuring 5 mm 220 mm and placed in 20c for 48 hours and the methylene chloride was allowed to passively evaporate. the vegf polymer was then cut into uniform pellets of size 1 mm 1 mm 0.5 mm. rabbits were placed under general anesthesia and topical 0.5% proparacaine hydrochloride was applied to the corneal surface. 5% povidone - iodine was applied on the ocular surface for antisepsis. at the center of the cornea, a 2 mm horizontal incision was placed to the midstromal level using the bevel of a 16 gauge needle (bd, franklin lakes, nj). two micropockets were made from the incision towards 6 and 12 o'clock by dissecting the corneal stroma with an iris spatula (figure 1). one vegf polymer was placed at the end of each micropocket 2 mm apart from the limbus. a total of 32 vegf polymer pellets were placed (2 pellets per cornea, one at 6 o'clock and one at 12 o'clock). each eye received a subconjunctival injection, one half of each dose was injected at 6 and 12 o'clock in proximity to each vegf polymer, with either 0.125 ml of 0.9% normal saline (ns), 0.1 ml of 25 mg / ml bv, 0.125 ml of 20 mg / ml human fce (fce 20) (bio x cell, west lebanon, new hampshire), or 0.125 ml of 2 mg / ml human fce (fce 2). a volume of 0.125 ml of fce was used in order to approximate the mg concentration of bv 25 mg / ml. subconjunctival injections were performed twice weekly starting on the day of surgery : days 0, 5, 8, and 12. corneal neovascularization was assessed via operative microscopy (carl zeiss, germany) on days 0, 5, 8, 12, and 15. the corneas were digitally imaged, and the images were analyzed using imagej software (nih.gov). to have a single standardized value that incorporated both vessel length and number of vessels, we calculated an angiogenesis index (ai), as previously described by tamargo.. briefly, the number of new vessels associated with each vegf polymer was given a numbered score : 0 = no vessels, 1 = < 10 vessels, 2 = 10 vessels with a visible iris, and 3 = 10 vessels with no visible iris. neovessel length was assessed as distance from the limbus to the leading edge of the new vessels in millimeters (mm). ai was then calculated as (1)ai = vessel length mmvessel number score.given that the greatest vessel length achievable was 2 mm (distance to the vegf polymer from the limbus) and the highest vessel number score was 3, the ai ranged from 0 to 6. after fixation in formalin, corneas were removed and cut in half at the midline, one vegf polymer pellet in each half. all cornea halves were embedded in paraffin with the cornea - sclera border facing down, sectioned, and stained with hematoxylin and eosin (h&e). the extent of neovascularization was analyzed and photographed using digital, light microscopy (bx41, olympus, japan ; diagnostic instruments, inc., sterling heights, mi). total sample size was 32 with measurements of neovascularization taken on days 5, 8, 12, and 15. vessel length and ai values recorded throughout the observation period were analyzed for statistical significance using a repeated measures 2-way analysis of variance (2-way anova). post hoc analysis was performed using the bonferroni test to correct for multiple comparisons (graphpad prism 5.0, ca). the representative images taken on days 0, 8, and 15 before and after treatment with bv and fce are shown in figure 2. while ns control developed corneal vessels nearly 2 mm length, all treatment groups had a statistically significant decrease in vessel length compared to ns on all observation days (p < 0.001). fce 2 significantly decreased vessel length more than fce 20 on days 12 and 15 (p < 0.05). bv inhibited vessel length significantly more than fce 2 on days 12 and 15 (p < 0.05). bv decreased vessel length significantly more than fce 20 on days 8, 12, and 15 (p < 0.01). ai provided a more comprehensive analysis of the neovascularization as it reflects a more direct assessment of neovessel density. all treatment groups showed a significant decrease in the ai compared to ns on all observation days (p < 0.001). fce 2, when compared to ns, decreased ai by a factor of 8.0-fold, 7.0-fold, 8.8-fold, and 6.8-fold on days 5, 8, 12, and 15, respectively. fce 20, when compared to ns, decreased ai by a factor of 68-fold, 2.7-fold, 3.6-fold, and 2.4-fold at days 5, 8, 12, and 15, respectively. bv decreased ai compared to ns by a factor of 138-fold on day 15, with no vessel growth at days 5, 8, and 12. a significant difference in ai was not found between bv and fce 2 during the study period, although bv appeared to have a nonsignificant qualitative improvement over fce 2 during the study period. bv was found to have a significantly smaller ai than fce 20 on days 8, 12, and 15 (p < 0.01). by day 15, ai of fce 2 was significantly smaller than fce 20 (p < 0.01). the cornea sections within the ns group showed the greatest corneal neovascularization with a relative increase in both vessel number and vessel circumference when compared with the treatment groups (figure 5). the neovascularization present in the bv group was primarily isolated to the superficial stroma and showed a relative decrease in circumference. fce corneal sections revealed decreased neovascularization, with decreased vessel circumference, when compared with ns but a greater amount than corneas within the bv group. there was no notable histological difference between the neovascularization that occurred in the fce 2 group and the fce 20 group. subconjunctival injection of fce was found to be well tolerated and to significantly decrease corneal neovascularization in a rabbit model of vegf - induced neovascularization. although bv inhibited the corneal neovascularization best in this model, no statistical difference was identified between fce 2 and bv. fce 20 had an early decrease in neovascularization noted on day 5, but this benefit was less than that noted by fce 2 on day 8. no corneal ulcers, edema, infection, or conjunctival necrosis was noted as a result of either the subconjunctival injection of fce or bv. the purpose of this study was as a proof of concept to determine the safety and relative efficacy of fce in inhibiting corneal neovascularization. we chose to use a vegf - induced corneal neovascularization model and as a positive control bv, a monoclonal antibody to vegf, was used. in the short time course of this study human fce, however, was found to be noninferior to bv, representing an important finding. fce may be more effective than bv on a multicytokine angiogenesis model given its known multitargeted antiangiogenic effect. fce 2 was found to outperform the higher concentration fce 20 by the completion of the experiment on day 15. initially, fce 20 had an impressive decrease in neovascularization on day 5, but this effect had weaned by day 15. this finding had been described by celik., who noted the antitumor activity of endostatin to have a biphasic dose - response curve [22, 27 ]. efficacy is found to proportionally increase until an optimal dose is reached with higher doses resulting in decreased response. a biphasic dose - response curve has been noted in studies of other antiangiogenic cytokines such as interferon- (ifn-) [27, 28 ] and the diabetes medication rosiglitazone, a known tumor cell angiogenesis inhibitor. further dose response analysis will need to be performed within the corneal neovascularization model to fully characterize the dose - response relationship. the first limitation comes as a result of the corneal neovascularization model selected that allows for the controlled release of vegf and does not entirely mimic the natural proangiogenic environment in which corneal neovascularization develops within a damaged cornea. additional studies utilizing other models such as the mechanical limbal injury - induced corneal neovascularization model, alkali - induced corneal neovascularization model [31, 32 ], and the corneal micropocket tumor implantation model should be considered in future experiments. secondly, the study was not designed to determine the most optimal dose of fce or the cause of the biphasic dose response. additional studies to determine the mechanism of inhibition and establish a complete dose - response curve are warranted. a third limitation of the current study is that long - term efficacy of fce was not assessed. further preclinical research would need to be completed prior to pursuing human trials into fce as a potential novel inhibitor of corneal neovascularization. fce is a novel antiangiogenic compound shown to significantly inhibit new vessel growth in a rabbit corneal neovascularization model. lower concentration fce 2 exhibited better inhibition than fce 20consistent with previous fce studies referencing a biphasic dose - response curve. the fce 2 concentration was found to be noninferior to bv in this vegf model. because of its known multitargeted, antiangiogenic properties, fce holds great promise for future clinical efficacy. further studies are necessary to elucidate the clinical potential and optimal dosing of this novel inhibitor of corneal neovascularization.	we assessed the antiangiogenic effects of subconjunctival injection of fc - endostatin (fce) using a human vascular endothelial growth factor - induced rabbit corneal neovascularization model. angiogenesis was induced in rabbit corneas through intrastromal implantations of vegf polymer implanted 2 mm from the limbus. nzw rabbits were separated into groups receiving twice weekly subconjunctival injections of either saline ; 25 mg / ml bevacizumab ; 2 mg / ml fce ; or 20 mg / ml fce. corneas were digitally imaged at 5 time points. an angiogenesis index (ai) was calculated (vessel length (mm) vessel number score) for each observation. all treatment groups showed a significant decrease in the vessel length and ai compared to saline on all observation days (p < 0.001). by day 15, fce 2 inhibited angiogenesis significantly better than fce 20 (p < 0.01). there was no significant difference between fce 2 and bv, although the values trended towards significantly increased inhibition by bv. bv was a significantly better inhibitor than fce 20 by day 8 (p < 0.01). fce was safe and significantly inhibited new vessel growth in a rabbit corneal neovascularization model. lower concentration fce 2 exhibited better inhibition than fce 20, consistent with previous fce studies referencing a biphasic dose - response curve. additional studies are necessary to further elucidate the efficacy and clinical potential of this novel angiogenesis inhibitor.
recently, the use of ni - cr base metal alloys in fixed prosthesis tends to increase because of the continued inflation of gold price. base metal alloy has various advantages such as higher yield and tensile strength and better resistance to creep, compared with noble alloys.1 - 3 however, base metal alloys also have several crucial disadvantages to be used. one of the critical disadvantages is the technique sensitivity in laboratory procedures, especially during casting and soldering. to assure the fit of metal frameworks on abutments, if any inadequacy was detected, sectioning and soldering of metal frameworks are required.4 soldering is a traditional method for joining components of fixed partial dentures using an intermediate metal.5 the longevity of a soldered prosthesis depends on the mechanical properties of its solder joints.6 - 9 el - ebrashi.10 reported that the stress was concentrated at the solder joint area and found to be tensile in nature. therefore, the solder joint should have sufficient strength to endure the functional forces directed on it.6,9 some previous studies suggested that the strength of base metal alloy in the solder joints is less predictable than that of gold alloy.11 - 13 other studies have investigated the factors affecting the strength of the solder joint. gap distance is one of the important factors affecting the strength of soldered joints.6,8,14,15 it has been reported that the optimal gap distance ranges from 0.15 mm16 to 0.76 mm.15 one study found that increasing the gap distance would increase the strength of the soldered connectors.15 however, according to stade.,15 the method of soldering was more important in connector strength than gap width. gas - oxygen torch is a traditional heat source, but there are some problems such as gas inclusions, voids and excessive oxide layer formation.1,11,16,17 as an alternative approach, infrared soldering is introduced. although several studies investigated the strength and quality of solder joints, the effectiveness of infrared soldering has not been widely investigated.6 several advantages of the infrared ray technique are reported such as lack of gas inclusions and limitation of heating area.6,17 - 19 in other studies, there were disagreements about its predictability compared with other techniques.18 - 21 the purpose of this study was to evaluate and compare the effects of different soldering techniques including infrared ray and gas torch under different gap distance conditions (0.3 mm and 0.5 mm) on the tensile strength and the surface porosity in ni - cr base metal alloy. thirty five wax patterns 18 mm in length, 3 mm in diameter and two 6 mm spheres on both ends were prepared for tensile testing (fig. the wax patterns were invested in a phosphate bonded investment and casting was performed with ni - cr based dental alloy (rexillium v, jeneric / pentron, san diego, usa) using a centrifugal casting machine and a propane gas - oxygen torch according to the manufacturer 's instructions. the composition, product name, manufacturer of the casting alloy and solder material used for this study are listed in table 1. after casting, the rings were bench cooled and then divested. the specimens were randomly assigned to five groups by soldering methods and gap distance (table 2). the specimens of the other groups were sectioned at the center, perpendicular to their long - axis, using a separating disk. both ends of specimens were invested with plaster in rectangular shape (1.5 1.5 1.5 cm) and the midpoint of the specimens was sectioned by the disk. then spacers were placed between two halves to allow precise gap distance (0.3 mm, 0.5 mm) and the sectioned specimens were united with pattern resin for stabilization during the investing procedure (fig. the assembled specimens were invested with soldering investment (deguvest l, degudent gmbh, rodenbacher, germany). for the gas - oxygen torch soldering, the investment blocks were preheated to 600 in a furnace and a flux (unitek, 3 m, monrovia, usa) was applied, then solder alloy (vera solder, aalbadent inc. the propane - oxygen gas torch was used and kept moving to prevent excessive oxide formation until the solder material flowed into the gap. for the infrared ray soldering, the invested specimens were placed on the refractory platform of the infrared soldering machine (quasar plus, zhermack s.p.a., badia polesine, italy) (fig. flux was applied and a piece of solder was placed to the joint area. then the specimen was soldered according to the manufacturer 's instructions. before testing, the solder joint area of each specimen was trimmed with carborundum stone rotary instrument to remove excess solder material. tensile testing was performed using a universal testing machine (instron 5582, instron co., ltd., canton, usa). each specimen was pulled until fracture occurred at a constant crosshead speed of 1.0 mm / min. the data for each sample was automatically calculated and recorded by the analyzing program (bluehill software, instron co., ltd., canton, usa). after tensile testing, the fractured surface of the specimens were analyzed with sem (hitachi s-3000h scanning electron microscope, hitachi inc., the percentage of the porous area to entire joint surface was measured with the image software (adobe acrobat 8 professional, adobe systems, san jose, usa) (fig. 4). the statistical analysis was carried out to find whether any significant difference of tensile strength or porosity among the groups. the data were analyzed at a confidence level of 95% with kruskal - wallis test using the statistical analysis software (spss version 12.0, spss inc., pearson 's correlation test was used to evaluate whether the presence of porosity may have influenced the tensile strength. in contrast, infra red groups showed higher tensile strength in smaller gap distance group. however, there were no significant differences among the test groups which were designed under different conditions (p = 0.174). g3 group shows the highest porosity presence on soldered joint and g5 group showed the smallest number of the percent. the value of the infrared soldering showed relatively smaller standard deviation than those of the gas torch soldering groups. however, comparing the joint porosity, there was also no significant difference among the groups (p =.230). according to pearson 's correlation test, correlation coefficient of tensile strength and porosity was -0.813 (p = 0.00) and showed negative correlation (fig. in this study, tensile strength and porosity formation were measured and compared when the two different soldering techniques, which were gas torch soldering and infrared ray soldering, were applied. the results of present study revealed that there was no significant difference in ultimate tensile strength between the two soldering techniques. this result coincides with the report of tehini.19 one investigation with noble alloy material showed no significant difference between the conventional torch and infrared heating techniques.20 however, cheng.22 suggested that the ultimate tensile strength of chromium - cobalt alloy connectors with the infrared soldering was significantly higher than those with a gas - oxygen technique. significant effect of gap distance on the joint 's strength was presented.6,8,15,23 also, it has been shown that increase of gap distance did not compromise the strength and the most unsatisfactory results occurred when there was an insufficient gap distance.8,15,23 ryge23 reported that a gap distance of less than 0.005 inch (0.123 mm) would cause greater porosity and the decreased strength of the soldered joints. in one similar study concerning infrared soldering, it has been observed that the 0.5 mm gap distance resulted in higher tensile strength than the 0.3 mm.6 the compromised flow of the solder and the adverse effect of the thermal expansion of the parent alloy in the narrow gaps was explained as the cause. porosities are caused by the flux, gas, foreign body inclusions or insufficient wetting of the parent metal by solder alloy. this is supported by the finding of other studies.12,17,24 the correlation between the porosity and the strength have been widely accepted.12,24 - 26 it is also clearly proved that there is a negative effect of porosity to the soldering material in the present study. some investigators suggested that soldering method27 and gap distance15,23 could be attributing factors to the porosity. another studies17 represented that infrared method was more advantageous than gas torch in porosity formation since less gas inclusions were found. however, in the current study, there were no significant differences between soldering methods and gap distance on the porosity. as fixed partial dentures are exposed to repetitive mechanical stresses during mastication, further studies should evaluate the long - term effectiveness of the soldering methods simulated under intraoral conditions. in addition, the effect of the gap should be closely examined to improve the quality of the prosthesis with joints to be soldered. this comparative study investigated the tensile strength and porosity formation of the joint by two soldering techniques (gas - torch soldering, infrared ray soldering) and evaluated the effect of the gap distance on the results. within the limitations of this study, infrared ray soldering may be an alternative method for the conventional gas - oxygen torch soldering. the gap distance between the soldered parts may give no effect to the tensile strength and porosity of the soldered joint within the range of 0.3 mm to 0.5 mm.	purposethe present study was intended to evaluate the effect of soldering techniques with infrared ray and gas torch under different gap distances (0.3 mm and 0.5 mm) on the tensile strength and surface porosity formation in ni - cr base metal alloy.materials and methodsthirty five dumbbell shaped ni - cr alloy specimens were prepared and assigned to 5 groups according to the soldering method and the gap distance. for the soldering methods, gas torch (g group) and infrared ray (ir group) were compared and each group was subdivided by corresponding gap distance (0.3 mm : g3 and ir3, 0.5 mm : g5, ir5). specimens of the experimental groups were sectioned in the middle with a diamond disk and embedded in solder blocks according to the predetermined distance. as a control group, 7 specimens were prepared without sectioning or soldering. after the soldering procedure, a tensile strength test was performed using universal testing machine at a crosshead speed 1 mm / min. the proportions of porosity on the fractured surface were calculated on the images acquired through the scanning electronic microscope.resultsevery specimen of g3, g5, ir3 and ir5 was fractured on the solder joint area. however, there was no significant difference between the test groups (p >.05). there was a negative correlation between porosity formation and tensile strength in all the specimens in the test groups (p <.05).conclusionthere was no significant difference in ultimate tensile strength of joints and porosity formations between the gas - oxygen torch soldering and infrared ray soldering technique or between the gap distance of 0.3 mm and 0.5 mm.
	the richest uranium ore bodies ever discovered (cigar lake and mcarthur river) are presently under development in northeastern saskatchewan. this subarctic region is also home to several operating uranium mines and aboriginal communities, partly dependent upon caribou for subsistence. because of concerns over mining impacts and the efficient transfer of airborne radionuclides through the lichen - caribou - human food chain, radionuclides were analyzed in tissues from 18 barren - ground caribou (rangifer tarandus groenlandicus). radionuclides included uranium (u), radium (226ra), lead (210pb), and polonium (210po) from the uranium decay series ; the fission product (137cs) from fallout ; and naturally occurring potassium (40k). natural background radiation doses average 2 - 4 msv / year from cosmic rays, external gamma rays, radon inhalation, and ingestion of food items. the ingestion of 210po and 137cs when caribou are consumed adds to these background doses. the dose increment was 0.85 msv / year for adults who consumed 100 g of caribou meat per day and up to 1.7 msv / year if one liver and 10 kidneys per year were also consumed. we discuss the cancer risk from these doses. concentration ratios (crs), relating caribou tissues to lichens or rumen (stomach) contents, were calculated to estimate food chain transfer. the crs for caribou muscle ranged from 1 to 16% for u, 6 to 25% for 226ra, 1 to 2% for 210pb, 6 to 26% for 210po, 260 to 370% for 137cs, and 76 to 130% for 40k, with 137cs biomagnifying by a factor of 3 - 4. these crs are useful in predicting caribou meat concentrations from the lichens, measured in monitoring programs, for the future evaluation of uranium mining impacts on this critical food chain.imagesfigure 1figure 2figure 3figure 4figure 5figure 6figure 7figure 8figure 9
primary cardiac tumors are rare, and hemangiomas are believed to represent 1 - 10% of benign forms. single casereports are described in literature depicting a heterogeneous pathology with significant clinical differences. due to the rarity and the possibility of a silent clinical course we hereby report a case of right ventricular silent hemangioma and review our previous experience and literature. from 1998 to 2014four cardiachemangiomas, 9.5% of benign primary cardiac tumors, imaging characteristics of hemangiomas on transthoracic and transesophageal echocardiography, cardiac magnetic resonance (cmr), computed tomography (ct), and angiographyare reviewed. a fixed plurilobulated mass originating from the right ventricular lateral wall was incidentally diagnosed [video 1 ]. echogenicity was the same as the myocardium, dimensions 35 28 cm [figure 1 panel a ], and neither outflow tract obstruction nor interference with tricuspid valve dynamic was present. on cmr ; the mass appeared homogeneous, with intermediate - to - high signal on t1-weighted [figure 1 panel b ] and diffuse hyperintensity on t2-weighted images [figure 1 panel c ]. no late gadolinium enhancement was present [figure 1 panel d ] ; first pass enhancement was late and heterogeneous [video 2 and figure 2 panel a ]. ct showed no extracardiac infiltration, the feeding artery was a branch of therightcoronary artery [figure 2 panel b ]. (panel a) transthoracic echocardiographic four - chamber view showing the ovalar isoechoic mass originating from the right ventricular lateral wall and occupying half of the rv cavity. (panel b) cardiac magnetic resonance t1-weighted sequence with fat suppression short axis view shows homogeneous, intermediate - to - high signal intensity. (panel c) cardiac magnetic resonance t2-weighted sequence four - chamber view shows a diffused hyperintensity. (panel d) cardiac magnetic resonance t1-weighted sequence short axis view shows absence of late gadolinium enhancement (panel a) cardiac magnetic resonance first pass perfusion imaging showing late and heterogeneous enhancement. (panel b) computed tomography modified four - chamber view shows no evidence of pericardial or extracardiac infiltration. (panel c) on gross examination, the mass appeared russet - colored, homogeneous, and noncapsulated. (panel d) histologic specimen, hematoxylin and eosin, original magnification, 40 : multiple large, thin - walled, dilated vascular spaces (arrow) can be seen within the ventricular wall differential diagnosis was between thrombosis and tumor. a thrombus was unlikely as no signs of right ventricular failure, deep venous thrombosis, or pulmonary embolism were present ; moreover, infiltration of the rv lateral wall was suspected. mri signal intensity was not typical of thrombosis and imaging characteristics could suggest a myxoma, which seemed the most probable diagnosis before surgical removal. an endomyocardial biopsy was taken into consideration, but would involve a high embolic and bleeding risk. although asymptomatic, surgical removal was decided in order to avoid embolic risk, hemodynamic consequences, and pericardial infiltration. on gross examination ; it appeared a solitary russet, homogeneous, noncapsulated mass with dimensions 2.5 2 1 cm ; and it was sessile, mildly polilobated, homogeneous soft in consistence [figure 2 panel c ]. the tumor was completely excised with transventricular approach taking care not to damage the right coronary artery branches. the postoperative course was uneventful and the patient discharged in good condition on postoperative day 4. histological examination demonstrated multiple endothelial - lined, large, thin - walled, and dilated vascular channels with interspersed fibrous septa and filled with blood or thrombosis : diagnosis of a cardiac heamngioma of the cavernous type was established. from 1998 to 2014, 46 consecutive primary cardiac tumors have been diagnosed in our department. four hemangiomas have been found, accounting for 8.7% of all primary cardiac tumors and 9.5% of benign forms. localization was mitral valve in two cases (one cavernous and one capillary), interatrial septum (arteriovenous type) in one, and right ventricle (cavernous type) in the present case (one). they were all asymptomatic, incidentally found on routine echocardiographic examination and have been operated on without complications. cavernous types, characterized by multiple dilated thin - walled vessels, are the most frequent. all ages may be affected and a female predominance is described. they can involve atria, ventricles, pericardium, and valves ; but no chamber predilection seems to be present. in a review of 56 cases of cardiac hemangiomas, the site of origin was : 36% in the right ventricle, 34% in the left ventricle, 23% in the right atrium, and the rest on the interatrial septum and in the left atrium. these tumors are slow growing, although a rapid growth has been reported in one case. transesophageal echocardiography may help in estimation of intra- and extracardiac extension, attachment, presence of intracavitary obstruction, or interference with valvular dynamics. ct and cmr provide more useful information about the invasiveness of the tumor and extracardiac extent. cmr demonstrates intermediate signal intensity on t1-weighted and hyperintense on t2-weighted images due to high water content ; on first pass perfusion imaging a rapid and strong fill - in is characteristic, mass disappearance in the intracavitary blood pool suggests highly vascular nature. late gadolinium enhancement is typically absent, although focal areas of fibrosis may be present. cardiac catheterization demonstrates the blood supply and a tumor blush due to the high vascularity, although sometimes dilated vascular channels cause slow flow and absence of first pass perfusion enhancement. cardiac hemangiomas are often asymptomatic, but may present with arrhythmias, complete heart block, sudden death, dyspnea, congestive heart failure, outflow tract obstruction, coronary insufficiency, pericardial effusion, and tamponade. the hemodynamic consequences of unoperated cardiac hemangiomas can not be predicted ; therefore, although spontaneous resolution has been reported, resection is always recommended.	a 74-year - old man underwent echocardiographic exam for hypertension screening. a fixed plurilobulated mass originating from the right ventricular lateral wall and occupying half of the cavity was incidentally diagnosed. on cardiac magnetic resonance (cmr) it appeared homogeneous, intermediate - to - high signal on t1-weighted, and diffusely hyperintense on t2-weighted images. first pass enhancement was late and heterogeneous and no late gadolinium enhancement was present. computed tomography (ct) showed no extracardiac infiltration, the feeding artery was a branch of therightcoronary artery. the tumor was excised and histological examination demonstrated a hemangioma of the cavernous type. the postoperative course was uneventful. from 1998 to 2014, four cardiac hemangiomas have been diagnosed in our department, accounting for 8.7% of all primary cardiac tumors and for 9.5% of all benign forms ; estimated population prevalence was 0.11/100.000 inhabitants / year. the hemodynamic consequences of unoperated cardiac hemangiomas can not be predicted and therefore, resection is recommended.
thromboxane and adp, which are among the mediators of platelet activation and aggregation, play a key role in initiating and propagating coronary thrombosis and are raised during myocardial infarction. simultaneous inhibition of both of these pathways with the combination of clopidogrel and aspirin produces greater antiplatelet effects than either agent alone [1, 2 ]. in recent reports, dual antiplatelet therapy with aspirin and clopidogrel showed significant improvements on prognosis in st - elevating myocardial infarction (stemi) [35 ]. moreover, this beneficial effect is not only limited to the acute phase, but also extended to a 1-year follow - up period. but substantial uncertainty remained regarding the net effects of adding clopidogrel to aspirin upon the reperfusion, acute inflammatory response, and ischemic events in this setting. in this study, we evaluated the effect of the addition of clopidogrel to standard reperfusion protocol on reperfusion and acute inflammatory response. from december 2006 to january 2008, consecutive patients were enrolled who presented with ischemic discomfort lasting > 20 minutes at rest within 12 hours, before randomization pain lasting > 20 minutes, st - segment elevation of at least 0.2 mv in at least two contiguous precordial leads. the study was limited to only anteriorly located myocardial infarction to homogenize the investigated population. the exclusion criteria were conduction or rhythm abnormalities (bundle branch block, idioventricular rhythm, etc.) ; any contraindication to thrombolytics ; early coronary angiography (within first 48 hours) due to recurrent ischemia or failed thrombolysis ; those patients under the treatment of aspirin or thienopyridines ; any contraindication to aspirin or clopidogrel ; past history of mi or coronary revascularization ; presence of clinically assessed heart failure (killip ii / iii) or cardiogenic shock ; hepatic failure ; renal failure (serum creatinine > 2.5 mg / dl) ; thrombocytopenia (.05). platelet activation and aggregation play a key role initiating and propagating coronary artery thrombosis, and antiplatelet therapy improves outcomes across the spectrum of acute coronary syndromes. beside this, it was thought that simultaneous inhibition of platelet activation and aggregation pathways with specific antiplatelet combinations might be more efficient in acute coronary syndromes [1, 2 ]. we observed improvements in both reperfusion and inflammatory response with the early addition of clopidogrel to standard reperfusion therapy in stemi patients in this study. moreover, these findings supported the hypothesis of dual antiplatelet inhibition with aspirin and clopidogrel might be more beneficial in acute coronary syndrome. currently, there are promising developments in the prevention of ischemic complications in sympthomatic atherothrombotic cases. the clarity - timi 28 study demonstrated that the addition of clopidogrel to aspirin in patients with stemi receiving fibrinolytic therapy improved the patency rate of the infarct - related artery after 48 hours and reduced ischemic complications. among the patients in this trial who underwent percutaneous coronary intervention (pci), described in the pci - clarty substudy, clopidogrel pretreatment significantly reduced the incidence of cardiac death or ischemic complications both before and after pci. in the commit trial, the routine addition of clopidogrel 75 mg / d to aspirin therapy for 4 weeks in patients with acute myocardial infarction resulted in a 9% proportional reduction in death, reinfarction, or stroke (p =.002) and a 7% proportional reduction in death (p =.03). even though no loading dose was used, the benefit of clopidogrel therapy was seen almost immediately by an 11% proportional reduction in mortality in the first 2 days after the initiation of therapy (p =.019). the results of both clarity - timi 28 and commit showed that adding clopidogrel to aspirin and other standard treatments safely reduced mortality and major vascular events in patients with acute myocardial infarction. (i) clopidogrel may facilitate initial fibrinolysis and thereby improve early reperfusion with a glycoprotein iib - iiia inhibitor -like effect. (ii) clopidogrel may exert its effects in myocardial infarction mainly by preventing reocclusion or by limiting microvascular effects of platelet activation rather than enhancing fibrinolysis. while most of the benefit of clopidogrel has been attributed to inhibition of platelet activation, blockage of the p2y12 receptor may also have pleotropic effects with respect to endothelial cell function, leukocyte activation, and inflammation. a reduction in the number of platelet - leukocyte interactions has been described [12, 13 ], and one study reported a special benefit of the drug in reducing the augmented risk of percutaneous interventions in patients with elevated levels of c - reactive protein. in another study, it was stated that clopidogrel pretreatment attenuated the periprocedural increase in crp by 65%. said that clopidogrel pretreatment reduces platelet inflammatory marker expression in patients undergoing pci, and they also concluded that it might be very important for clinical events. all these findings constituted an important clue for us to investigate the limiting effect of clopidogrel in increment of high - sensitive c - reactive protein in stemi and to verify this. activated platelets have been clearly implicated in the tendency for microembolization during acute coronary syndrome [17, 18 ] and play an important role in the inflammatory response. studies have shown that activated platelets express the cd40 ligand, a potent stimulus of vascular inflammation [19, 20 ]. the cd40 ligand promotes platelet - leukocyte interactions and induces tissue factor expression, thus providing a link among inflammation, platelet activation, embolization, and coagulation. the inhibition of subcellular platelet cd40 ligand by clopidogrel treatment may explain the mechanism of reduction in inflammation as expressed by an attenuation in c - reactive protein increase after acute stemi. by the way, we think that large extensive clinical trials are needed to exactly clarify the mechanisms of beneficial effects of clopidogrel on clinical results in previous ones and that is what we have determined in our study because the impressive improvement in clinical results with added clopidogrel on aspirin requires some other mechanisms except for a potent antiplatelet effect. the first and most important limitation is the small study population and the lack of a placebo control group. only the anteriorly located stemi patients were included to homogenize the study population, and a fibrinolytic agent only rt - pa was used and this condition was an important limiting factor for our study. clopidogrel loading dose (450 mg) may be a limitation. we think that different dosages (300600 mg) should be applied for both evaluations of safety and efficacy because there is a correlation between loading dose and time to reach maximal antiplatelet effect. another limiting factor of our study was the restriction of the study with 48 hours. a long follow - up period would be more useful to exactly realize all the efficiency and safety of clopidogrel (major and minor hemorrhages included) treatment. so that with long follow - up period, difference among the groups of medical treatment, pci and coronary artery bypass grefting in the direction of angiographic findings could be clearly understood. in conclusion, we found that addition of clopidogrel to medical reperfusion therapy in stemi had favorable effects on reperfusion and suppression of hs - crp. we think that these favorable clinical and laboratory effects of dual antiplatelet therapy with clopidogrel are not only limited to its antiplatelet effect, but also there may be some pleiotropic effects of clopidogrel ; those were not explained clearly. large extensive studies are needed to explain the complete effect of clopidogrel in acute stemi.	we investigated the effects of clopidogrel on reperfusion and inflammatory process in stemi. a total of 175 stemi patients with similar clinical characteristics were included to this study. one was the standard pharmacological reperfusion therapy group (group 1, n : 90), who received 300 mg aspirin, 70 u / kg bolus, and 12 u / kg / hr continuous infusion of unfractioned heparin and accelerated t - pa. clopidogrel 450 mg loading and 75 mg / d thereafter was added to standard reperfusion therapy in the other group (group 2, n : 85). the st - segment resolution, ck - mb, and high - sensitive crp (hs - crp) parameters were measured. complete st resolution was observed in 32 patients (36.8%) in group 1 and 53 patients (63.8%) in group 2 (p <.001). also in the first 24 hours, the ck - mb levels of patients in group 1 were significantly higher than those of group 2 (p =.001). the hs - crp values were greater in group 1 than group 2 at 48th hour (gruop 1 : 9.4 0.1 mg / l, group 2 : 3.7 1.4 mg / l ; p =.000). we concluded that adding clopidogrel to standard treatment in stemi patients provided early reperfusion and suppression of inflammatory response.
on approval from ethical committee of adhiparasakthi dental college and hospital, the study was started. photographs of five different subjects with matched teeth were made using the digital single - lens reflex camera under high resolution. using adobe photoshop, version 7 (adobe systems inc., san jose, ca, usa) color of one of the selected central incisor of one of the photographs (the other four were discarded) was modified in different the different dimensions of color that is, hue, value, chroma to predetermined levels (2%, 4%, 6%, 8%, and 10%). inclusion criteria being trainee dental surgeons of the selected institution and lay persons were people who visited the department of prosthodontics at adhiparasakthi dental college and hospital. person with a known history of color blindness, person above the age of 50 years, and person who were not willing were excluded from the study. the task was performed in a spacious room with multiple windows to avoid fatigue and allow for optimal lighting conditions. the study is multicentric since it was conducted in five different centers, double - blinded since both the operator and assessors were not aware of the changes done to the photos and the key was kept aside till the end of the survey, randomized since the crri and lay person were selected at random with only the inclusion and exclusion criteria as guide, control trial as un - modified contralateral central incisor served as control. the responses of crri and lay person were collected on a survey form and were recorded for statistical analysis. table 1 and figure 1 on values of perceptibility of change in hue, value and chroma shows that lay person were able to perceive the change in value more than 8%, hue more than 10% and chroma more than 10% and the trainee dental surgeons was able to perceive changes in value more than 2%, hue more than 8% and chroma more than 8%. this denotes that the trainee dental surgeons were able to perceive changes in value and chroma much more significantly than the lay person. dental cri were able to perceive hue, value and chroma better than lay person comparison of the perceptibility of various changes in dimensions of color by dental color rendering index and lay person table 2 and figure 2 on values of acceptability of change in hue, value and chroma shows that as far as acceptance of color change is concerned, trainee dental surgeons were more critical in acceptance of changes as they did not accept changes in value less than 4%, hue less 8% than and chroma less than 10%. comparatively lay person did not accept color changes value less than 6%, hue less 10% than and chroma less than 10%. lay person accepted color though it was different to a higher degree than dental cri comparison of the acceptability of changes in various dimensions of color by dental surgeons and lay person objective beauty is based on the consideration of the object itself based on preconceived notions. subjective beauty is a quality that is relative to the tastes of the person enjoying it. when we smile, our smile could often become the target of close scrutiny by the person you are smiling at. perception and acceptance of such color changes may or may not be an inherent or trained trait. studies of douglas. have proved that among professionals, the perception of color change was higher. studies have also proved that lay persons have a much higher tolerance level to variation in color. in a study by al - wahadni, they found that patients were more satisfied with the color matching of their porcelain - fused - to - metal crowns more than their prosthodontists. this leads us to speculate on whether the patient input is really necessary for shade selection. moreover, no study has been conducted to know as to how and when this ability of the dental surgeon blooms. a study by kijima., it was noted that color discrimination was made firstly in terms of hue, secondly in terms of value, and thirdly in terms of chroma. color perception defectiveness can not be overcome by any number of years of experience and color - defective dentists should obtain assistance when matching tooth shades. hence, the question as to how and when does this ability of the dental surgeon to perceive and discern this color difference develops. hence, a study was designed to test the perceptibility and acceptability of color variations between matched teeth among trainee dentist and the common man. one of the central incisors was modified using photoshop in the three dimensions of color viz. these modified photographs along with the unmodified picture were given to dental trainees and lay person and were asked to find out if they could discern the color change and what color they found acceptable. the study shows that the dental trainee was able to perceive the color differences much better than lay person to a significant degree similar to those of capa. it was also found that acceptance level of mismatched color was much lower in dental trainee than a lay person. this proves that color perception is an acquired skill that starts much earlier in a dental surgeons life and may be honed through years of experience. dental trainees were also more stringent on their acceptance of color variation to a significant level. this may be because of setting a higher standard for oneself to overcome any failure that could arise because of color difference. this learning is not about simple color perception but as put forth by kyle, it may instead result from how adaptation alters the relative salience of the target. this could also be because of perceptual grouping at a psychological level and, at the same time, outlines the mechanisms for grouping at the neurophysiological level as proposed by pieter. of the three - dimensions in color, both the dental surgeon and lay person were able to perceive changes in value more than hue. this is consistent with the findings of ratzmann. who perceived similar results but varied from the studies of kijima this could be due to increase in test subjects and the inclusion of lay person in the study group. though both subject groups were able to perceive color change, acceptability of color both the groups were able to accept change done to chroma and hue to a greater degree than to changes done to value in that order. with the limited results, it can be concluded that the perception of color difference seems to be a learned trait. whether it is enhanced by experience is concerned, dental surgeons are stricter and hence are a better judge. but still as beauty is in the eyes of the beholder, the final onus of color selection is on the subject themselves.	aim : the aim of this study was to find the difference in perceptibility and acceptability of changes done to various color coordinates of matched teeth, between trainee dental surgeons, and lay person.materials and methods : a photograph with a set of matched central incisor teeth was selected. in one of the central incisors, the color coordinates (hue, value, and chroma) were altered to a preset value. these pictures were presented to trainee dental surgeons and lay person and their level of perception of color change and acceptance of color change was registered and compared.results:it was found that trainee dental surgeons fared better in perceiving the color change and accepted less of the color changed specimens. the dimension of color that was more discerned both by lay person and trainee dental surgeons was value, hue, and last chroma.conclusion:when compared to a lay person, dental surgeons are more acute in perceiving color changes and do not accept the color difference between teeth to a higher degree.
poly(vinylidene fluoride) (pvdf) is a partially crystalline linear hydrofluorocarbon polymer exhibiting extraordinary electrical properties, ranging from those of a typical dielectric polymer to those of a versatile ferroelectric material, as a consequence of its crystalline structure and the abundance of polymorphic phases. four polymorphs,,, and, have been documented so far [1, 2 ], and the fifth form is strongly suggested to exist. a rather strong electric moment in the pvdf monomer unit arises because of a strong electronegativity of fluorine atoms as compared to those of hydrogen and carbon atoms. thus, each macromolecular chain possesses a dipole moment perpendicular to the polymer chain [4, 5 ]. if a polymer chain is packed in crystals to form parallel dipoles, the crystal possesses a net dipole moment as in polar,, and forms ; whereas, in antiparallel chain dipoles alignment, the net dipole moment vanishes as in nonpolar and phases. the most common polymorph of pvdf is the phase predominantly obtained during crystallization from the melt at moderate or high supercoolings [6, 7 ]. the phase is formed also during polymerization, and it is characterized by a trans - gauche - trans - gauche (tgtg) conformation of macromolecular chains. it is nonpolar and does not exhibit ferroelectricity ; however, when deformed, it displays a large flexoelectric effect, connected with the strain gradient. the phase can be transformed into three other polymorphic forms under an action of sufficient mechanical stress, heat, or electrical field. the phase, usually obtained during mechanical deformation of spherulites [916 ], is presently the most important polymorph of pvdf used extensively for piezoelectric and pyroelectric applications. an all - trans (tt) molecular conformation of pvdf is responsible for the ferroelectric properties. however, the fluorine atoms are too large to allow a simple all - trans conformation, and they are slightly offset to form a zigzag arrangement along the crystal c - axis. the presence of phase has been reported in pvdf films crystallized from the dimethyl sulfoxide, dimethyl acetamide, and dimethyl formamide solutions [18, 19 ] as well as in the samples crystallized at high pressures [20, 21 ], at high temperatures [6, 7, 22, 23 ], and after annealing of the phase crystals [7, 24 ]. the macromolecular chains of phase are in the tttgtttg conformation and can be considered, regarding the ferroelectric effect, as an intermediate between the and phases. when formed during melt crystallization above 160 c, the phase reaches the highest concentration close to 170 c. the polar phase can be formed by poling the antipolar phase at high electric fields [26, 27 ]. this form has the same unit cell dimension along c - axis and macromolecular chain conformation as the form, the difference lying in the interchain packing alone. a fifth crystallographic form is the phase containing the tttgtttg conformation of macromolecular chains similar to the phase but in an antipolar arrangement. mechanical deformation of the phase at most temperatures leads to an almost complete transformation to phase [13, 14 ], so for many years, oriented films containing phase had not been available. however, mackey. showed that isothermal recrystallization of pvdf nanolayers in multilayered psf / pvdf films at high temperatures causes the phase transition from to phase crystals. pvdf is used in a wide range of applications due to the ferroelectric properties of,, and crystals, which in turn is closely related to the alignment and orientation of those crystals. there are many means of enforcing pvdf crystal alignment and orientation ; most of them adopted from known processes designed for commodity polymers. the methods used to identify the polymorphic phases of pvdf and to determine the orientation of crystals in pure pvdf films or in blends with other polymers such as polyamide 11 (pa 11), poly(methyl methacrylate) (pmma), polyvinylpyrrolidone (pvp), polycarbonate (pc), and polysulfone (psf) include mainly x - ray diffraction [1, 9, 14, 2934 ], infrared spectroscopy (ftir) [6, 11, 12, 29, 31, 33, 3537 ], raman scattering [38, 39 ], and nuclear magnetic resonance (nmr). nevertheless, all methods mentioned above enabling identification of pvdf polymorphs, are insufficient to determine fully the preferred orientation of pvdf crystals and the texture of films. in the case of two - dimensional wide - angle x - ray diffraction (waxs-2d), the information is incomplete because the alignment and orientation of pvdf crystals in the direction along the incident x - ray beam path can not be elucidated. full texture determination can be achieved using x - ray pole figures technique. in the literature, there is practically no information about this technique used to examine the texture of pvdf. only wang and cakmak applied waxs pole figures of (020) plane to examine the orientation of pvdf phase crystals in injection - molded pvdf and pvdf / pmma blends. in this article, we concentrate on the full texture determination of pvdf nanolayers in multilayered psf / pvdf film systems utilizing x - ray pole figures of reflections from selected crystallographic planes. semicrystalline poly(vinylidene fluoride) (pvdf) homopolymer solef 6010 from solvay solexis crystallizing from the melt in the phase and amorphous polysulfone (psf), udel p-3703 obtained from solvay advanced polymers, were chosen as raw materials to produce 12-m thick psf / pvdf film systems by layer - multiplying coextrusion at conditions described in details by mackey.. the compositions of all film systems studied in the paper are collected in table 1. in each layered system, the pvdf nominal layer thickness was varied from 28 to 225 nm. the multilayered psf / pvdf films were isothermally recrystallized using two oil baths containing silicon oil at recrystallization temperatures of 145 c and 170 c, respectively.table 1the as - extruded and recrystallized multilayered psf / pvdf film systemssample codenumber of layerscomposition (v / v) psf / pvdfpvdf nominal layer thickness (nm)recrystallization temperature / time (c / h)#110/100#1a10/100145/5#1b10/100170/96#23270/30225#33270/30225145/5#425650/5047#525650/5047170/96#625670/3028#725670/3028170/96 the as - extruded and recrystallized multilayered psf / pvdf film systems the overall orientation of crystallographic planes of the samples was determined by means of computer - controlled waxs system equipped with a pole figure attachment associated with a wide - angle goniometer (dron 2.0) coupled to a sealed tube source of filtered cu k radiation (phillips), operating at 50 kv and 30 ma. the specimens in the form of sandwiched films (at least 1 1 cm) and approximately 0.15 mm thick were assembled with extrusion direction vertical. the waxs reflection scans of the samples were collected with the step of 0.05. the x - ray data for pole figure construction were collected for selected reflections. experimental x - ray diffraction data were corrected for background scattering, sample absorption, and defocusing of the beam. all pole figures were plotted with the pod program (los alamos national lab, nm). semicrystalline poly(vinylidene fluoride) (pvdf) homopolymer solef 6010 from solvay solexis crystallizing from the melt in the phase and amorphous polysulfone (psf), udel p-3703 obtained from solvay advanced polymers, were chosen as raw materials to produce 12-m thick psf / pvdf film systems by layer - multiplying coextrusion at conditions described in details by mackey.. the compositions of all film systems studied in the paper are collected in table 1. in each layered system, the pvdf nominal layer thickness was varied from 28 to 225 nm. the multilayered psf / pvdf films were isothermally recrystallized using two oil baths containing silicon oil at recrystallization temperatures of 145 c and 170 c, respectively.table 1the as - extruded and recrystallized multilayered psf / pvdf film systemssample codenumber of layerscomposition (v / v) psf / pvdfpvdf nominal layer thickness (nm)recrystallization temperature / time (c / h)#110/100#1a10/100145/5#1b10/100170/96#23270/30225#33270/30225145/5#425650/5047#525650/5047170/96#625670/3028#725670/3028170/96 the as - extruded and recrystallized multilayered psf / pvdf film systems the overall orientation of crystallographic planes of the samples was determined by means of computer - controlled waxs system equipped with a pole figure attachment associated with a wide - angle goniometer (dron 2.0) coupled to a sealed tube source of filtered cu k radiation (phillips), operating at 50 kv and 30 ma. the specimens in the form of sandwiched films (at least 1 1 cm) and approximately 0.15 mm thick were assembled with extrusion direction vertical. the waxs reflection scans of the samples were collected with the step of 0.05. the x - ray data for pole figure construction were collected for selected reflections. experimental x - ray diffraction data were corrected for background scattering, sample absorption, and defocusing of the beam. all pole figures were plotted with the pod program (los alamos national lab, nm). in order to identify and select the x - ray diffraction peaks for further detailed analysis of crystalline structure and texture of our multilayered psf / pvdf films, we summarized the current knowledge about predicted and observed x - ray reflections from the pvdf crystals. in tables 2, 3, 4, and 5, the most important known diffraction peaks are collected for the,,, and crystallographic forms of pvdf.table 2the data for crystallographic planes of form of pvdf and the observed wide - angle diffraction peaks d calc interplanar distance calculated from the unit cell of form pvdf crystals (orthorhombic, a = 0.496 nm, b = 0.964 nm, c = 0.462 nm) ; 2calc wide angle of diffraction maximum calculated from the bragg s law (n = 2dsin), where, wavelength of the incident x - ray beam has been assumed to 0.15418 nm ; d obs and 2obs interplanar distance and wide angle of diffraction maximum observed in the references [1, 33, 4350]table 3the data for crystallographic planes of form of pvdf and the observed wide - angle diffraction peaks d calc interplanar distance calculated from the unit cell of form pvdf crystals (orthorhombic, a = 0.858 nm, b = 0.491 nm, c = 0.256 nm) ; 2calc wide angle of diffraction maximum calculated from the bragg s law (n = 2dsin), where, wavelength of the incident x - ray beam, has been assumed to 0.15418 nm ; d obs and 2obs interplanar distance and wide angle of diffraction maximum observed in the references [43, 4547, 50, 51]table 4the data for crystallographic planes of form of pvdf and the observed wide - angle diffraction peaks d calc interplanar distance calculated from the unit cell of form pvdf crystals (monoclinic, a = 0.497 nm, b = 0.966 nm, c = 0.918 nm, -angle = 92.9) ; 2calc wide angle of diffraction maximum calculated from the bragg s law (n = 2dsin), where, wavelength of the incident x - ray beam, has been assumed to 0.15418 nm ; d obs and 2obs interplanar distance and wide angle of diffraction maximum observed in the references [1, 7, 33, 34, 43, 45, 51]table 5the data for crystallographic planes of form of pvdf and the observed wide - angle diffraction peaks d calc interplanar distance calculated from the unit cell of form pvdf crystals (orthorhombic, a = 0.496 nm, b = 0.964 nm, c = 0.462 nm) ; 2calc wide angle of diffraction maximum calculated from the bragg s law (n = 2dsin), where, wavelength of the incident x - ray beam, has been assumed to 0.15418 nm ; d obs and 2obs interplanar distance and wide angle of diffraction maximum observed in the reference the data for crystallographic planes of form of pvdf and the observed wide - angle diffraction peaks d calc interplanar distance calculated from the unit cell of form pvdf crystals (orthorhombic, a = 0.496 nm, b = 0.964 nm, c = 0.462 nm) ; 2calc wide angle of diffraction maximum calculated from the bragg s law (n = 2dsin), where, wavelength of the incident x - ray beam has been assumed to 0.15418 nm ; d obs and 2obs interplanar distance and wide angle of diffraction maximum observed in the references [1, 33, 4350 ] the data for crystallographic planes of form of pvdf and the observed wide - angle diffraction peaks d calc interplanar distance calculated from the unit cell of form pvdf crystals (orthorhombic, a = 0.858 nm, b = 0.491 nm, c = 0.256 nm) ; 2calc wide angle of diffraction maximum calculated from the bragg s law (n = 2dsin), where, wavelength of the incident x - ray beam, has been assumed to 0.15418 nm ; d obs and 2obs interplanar distance and wide angle of diffraction maximum observed in the references [43, 4547, 50, 51 ] the data for crystallographic planes of form of pvdf and the observed wide - angle diffraction peaks d calc interplanar distance calculated from the unit cell of form pvdf crystals (monoclinic, a = 0.497 nm, b = 0.966 nm, c = 0.918 nm, -angle = 92.9) ; 2calc wide angle of diffraction maximum calculated from the bragg s law (n = 2dsin), where, wavelength of the incident x - ray beam, has been assumed to 0.15418 nm ; d obs and 2obs interplanar distance and wide angle of diffraction maximum observed in the references [1, 7, 33, 34, 43, 45, 51 ] the data for crystallographic planes of form of pvdf and the observed wide - angle diffraction peaks d calc interplanar distance calculated from the unit cell of form pvdf crystals (orthorhombic, a = 0.496 nm, b = 0.964 nm, c = 0.462 nm) ; 2calc wide angle of diffraction maximum calculated from the bragg s law (n = 2dsin), where, wavelength of the incident x - ray beam, has been assumed to 0.15418 nm ; d obs and 2obs interplanar distance and wide angle of diffraction maximum observed in the reference figure 1 presents the waxs diffractograms of as - extruded pvdf control film, pvdf control film annealed at 145 c for 5 h, pvdf control film annealed at 170 c for 96 h, and psf / pvdf film systems.fig. 1the waxs diffractograms of as - extruded pvdf control film, pvdf control film annealed at 145 c for 5 h, pvdf control film annealed at 170 c for 96 h, and psf / pvdf multilayered films, obtained in the reflection mode. the curves have been shifted for better visualization the waxs diffractograms of as - extruded pvdf control film, pvdf control film annealed at 145 c for 5 h, pvdf control film annealed at 170 c for 96 h, and psf / pvdf multilayered films, obtained in the reflection mode. the curves have been shifted for better visualization for as - extruded 0.15-mm thick pvdf control film (sample # 1), five diffraction peaks with maxima at 17.75, 18.30, 19.85, 26.50, and 35.90 are observed in fig. 1. their positions imply that they are reflected from (100), (020), (110), (021), and (200) crystallographic planes of pvdf phase crystals. annealing of pvdf control film at 145 c for 5 h (sample # 1a) causes refining of crystals, note the intensification of (021) reflection at 26.50 and the appearance of (120), (111), and (002) reflections at 25.55, 27.80, and 35.80, respectively. annealing of the pvdf control film at 170 c for 96 h (sample # 1b) drastically changes the crystalline content. the reflections of (020), (110)/(101), and (004) crystallographic planes of pvdf phase crystals are observed at 18.55, 20.20, and 39.20, respectively. the film # 2 contains only 30 vol.% of pvdf in the form of 255-nm thick layers between 70 vol.% of psf layers. from the x - ray diffraction peaks, it is evident that the pvdf crystals are also of the phase although the diffraction is of rather low intensity due to lower concentration of pvdf in the film and probably due to a spatial orientation of crystals. after isothermal recrystallization at 145 c of the 225-nm thick pvdf layers in the psf / pvdf film (sample # 3), two diffraction peaks appeared, at 35.85 for (200) plane of phase and at 39.10. this last diffraction peak was identified as pvdf phase crystal (004) reflex [1, 34, 52 ]. other diffraction peaks with (hk0) indices are not well seen in reflection ; hence, the crystalline fraction of the sample # 3 consists of a combination of and phases, however, oriented. the film # 4 contains 50 vol.% of pvdf in the form of 47-nm layers between 50 vol.% of psf layers. from the x - ray diffraction peaks in the reflection mode, it is evident that the pvdf crystals are of the and phases, although the diffraction is again of rather low intensity due to a spatial orientation of and crystals. other diffraction peaks with (hk0) indices are not well seen in the reflection mode due to spatial orientation. after isothermal recrystallization at 170 c of the 47-nm thick pvdf layers in the psf / pvdf film (# 5), only one diffraction peak at 39.10 of (004) reflection of phase is seen. no sign of form can be noticed. in the film # 6 with 28-nm thick pvdf layers the diffraction peaks from the form with diffraction maxima from planes (020), (100), (110), and (200) are observed. no diffraction from (021) of form and no form reflections are noticed. after isothermal recrystallization at 170 c of the 28-nm thick pvdf layers in the psf / pvdf film (sample # 7), the diffraction peaks at 17.65, 35.95, and 39.10 are seen which are identified as the (100) of form overlapped with the (020) of form, the (200) of form, and the (004) of phase, respectively. hence, the coexistence of and forms can be noticed. in thinner pvdf layers, the phase crystals grow with structural defects and with orientation controlled by the psf / pvdf interface. in the cases of films # 2, # 4, and # 6 with pvdf nanolayers, the peak from (004) plane of phase becomes narrower and more intense when the samples were isothermally recrystallized at 145 or 170 c. this (004) peak is isolated from other diffraction peaks and we postulate that it can be used for clear and precise determination of c - axis orientation of crystals. similar role for the orientation of crystals can be served by (021) reflection which is also isolated from other diffraction peaks. this crystallographic plane is tilted by 46.22 with respect to c - axis of crystals. it is then postulated that the orientation of and crystals can be precisely determined from pole figures of (021) and (004) planes, respectively. the orientation of pvdf chains in the crystals was examined using x - ray pole figures. the pole figures of normals to the (004) plane for all multilayered psf / pvdf film systems are collected in fig. 2the pole figures of normals to the (004) planes of pvdf crystals : a as - extruded pvdf control film, b psf / pvdf film with nominal pvdf layer thickness of 225 nm, c psf / pvdf film with nominal pvdf layer thickness of 255 nm isothermally recrystallized at 145 c, d psf / pvdf film with nominal pvdf layer thickness of 47 nm, e psf / pvdf film with nominal pvdf layer thickness of 47 nm isothermally recrystallized at 170 c, f psf / pvdf film with nominal pvdf layer thickness of 28 nm, and g psf / pvdf film with nominal pvdf layer thickness of 28 nm isothermally recrystallized at 170 c. the normal direction is the center of pole figures the pole figures of normals to the (004) planes of pvdf crystals : a as - extruded pvdf control film, b psf / pvdf film with nominal pvdf layer thickness of 225 nm, c psf / pvdf film with nominal pvdf layer thickness of 255 nm isothermally recrystallized at 145 c, d psf / pvdf film with nominal pvdf layer thickness of 47 nm, e psf / pvdf film with nominal pvdf layer thickness of 47 nm isothermally recrystallized at 170 c, f psf / pvdf film with nominal pvdf layer thickness of 28 nm, and g psf / pvdf film with nominal pvdf layer thickness of 28 nm isothermally recrystallized at 170 c. the normal direction is the center of pole figures from the pole figure in fig. 2a, it is seen that there is no preferred orientation of that small amount of phase crystals present in the pvdf control film (sample # 1), except for a slight orientation due to the extrusion process. the non - annealed film # 2 with 255-nm thick pvdf layers also does not show any orientation of crystals (fig. a brief estimation on the basis of waxs 2 diffractogram indicated that the content of crystals is low in that sample (see fig. 1). annealing at 145 c of that film produced some small amount of crystals (sample # 3) ; however, they are only little oriented with c - axis (normal to (004) planes) perpendicular to the film surface, as it can be judged from fig. 2c. non - annealed film # 4 with 47-nm thick pvdf layers also contain only small amount of crystals, and they are unoriented as it can be deduced from the (004) pole figure in fig. in contrast, a strong texture of (004) planes is detected in fig. 2e for film # 5 with 47-nm thick pvdf layers after annealing at 170 c for 96 h. non - annealed film # 6 with 28-nm thick pvdf layers also contained very little amount of crystals (fig. after isothermal recrystallization of that film at 170 c for 96 h (sample # 7), most of crystals were transformed to crystals showing very strong texture with most of normals to the (004) planes being perpendicular to the film surface (fig. pvdf crystals are laying flat to the film plane exactly indicating the suggested alignment of phase crystals as showed by mackey.. at higher recrystallization temperature, i.e., at 170 c pvdf nanolayers recrystallized as in - plane phase crystals. the above data on the orientation of pvdf crystals in nanolayers, especially that crystals in thinner layers are more perfectly oriented with c - axes perpendicular to the film surface, led to the conclusion that the interface between psf and pvdf plays an important role in the orientation of crystals. however, it is not clear whether the martensitic transformation of to crystals occurs via macromolecular chains reorientation or the chains were already oriented perpendicular to the interfaces in crystals while the transformation relies on a conformation change from tgtgtgtg to tttgtttg. the answer can be found by investigating the crystal texture of non - annealed samples. the pole figures of normals to the (021) planes of crystals for non - annealed multilayered psf / pvdf films (samples # 2, # 4 and # 6) are presented in fig. 3the pole figures of normals to the (021) planes of crystals in non - annealed multilayered psf / pvdf films with pvdf nominal layer thickness of a 255 nm, b 47 nm, and c 28 nm. the normal direction is the center of the pole figure the pole figures of normals to the (021) planes of crystals in non - annealed multilayered psf / pvdf films with pvdf nominal layer thickness of a 255 nm, b 47 nm, and c 28 nm. the normal direction is the center of the pole figure it is evident that the (021) planes of crystals are preferentially oriented at 4045 with respect to the normal to psf / pvdf interfaces in all three multilayered psf / pvdf films. stronger clustering of the (021) normals is observed for thinner 28-nm pvdf layers. apparently, further refinement of chains orientation perpendicular to film surface occurs during isothermal recrystallization at 145 or 170 c facilitated by interaction of pvdf macromolecules with psf / pvdf interface. the pvdf nanolayers in all as - extruded psf / pvdf films crystallized into the phase structure. after isothermal recrystallization at 170 c, phase crystals in pvdf layers transformed into phase crystals. the x - ray diffraction in conjunction with pole figures was used to examine the texture of pvdf in multilayered psf / pvdf films. the (021) planes of crystals are well suited to use them for the determination of the pvdf crystal texture. there is some orientation of the (021) planes at 4045 to the psf / pvdf interface in all as - extruded multilayered films. for crystals, the (004) planes may be used for the determination of crystal orientation. since the normals to (004) planes are parallel to macromolecular chains, the pole figures enabled the determination of the overall orientation of pvdf crystals for thermally treated multilayered psf / pvdf film systems. most of those crystalline lamellae are in - plane position which resulted from initial similar orientation of crystals in as - extruded psf / pvdf films. further refinement of the texture occurs during isothermal recrystallization in conjunction with transformation of to crystals and due to the interaction of pvdf with psf / pvdf interface. the initial orientation of crystals and resulted crystal orientation after to transition are illustrated in fig. 4schematics of the orientation types of pvdf crystals : a mixed orientation of crystals in as - extruded multilayered psf / pvdf films and b in - plane orientation of crystals in recrystallized multilayered psf / pvdf films schematics of the orientation types of pvdf crystals : a mixed orientation of crystals in as - extruded multilayered psf / pvdf films and b in - plane orientation of crystals in recrystallized multilayered psf / pvdf films such in - plane orientation of polymer crystals with macromolecular chains perpendicular to the interface was reported previously by us for the system of nearly amorphous poly(ethylene - co - acrylic acid) (eaa) and crystalline polyethylene oxide (peo). such a possibility was also postulated by ma, hu, and reiter defining such system as crystals on sticky walls.	wide - angle x - ray scattering in conjunction with pole figure technique was used to study the texture of poly(vinylidene fluoride) (pvdf) and phase crystals in nanolayered polysulfone / poly(vinylidene fluoride) films (psf / pvdf) produced by layer - multiplying coextrusion. in all as - extruded psf / pvdf films, the pvdf nanolayers crystallized into the phase crystals. a large fraction of those crystals was oriented with macromolecular chains perpendicular to the psf / pvdf interface as evidenced from the (021) pole figures. further refinement of the texture occurs during isothermal recrystallization at 170 c in conjunction with transformation of to crystals. the crystals orientation was probed with the (004) pole figures showing the c - axis of pvdf crystals perpendicular to the psf / pvdf interface. the thinner the pvdf layers the stronger the orientation of crystals. it was proven that the x - ray reflections from the (021) planes of crystals and from the (004) planes of crystals are not overlapped with other reflections and can be effectively used for the texture determination of pvdf nanolayers in multilayered psf / pvdf films.
in 1963, rowell. described a distinctive subset of patients with lupus erythematosus (le) consisting of erythema multiforme - like skin lesions, anti - la (ss - b)/anti - ro (ss - a) antibodies, positive serum rheumatoid factor and a speckled pattern of antinuclear antibodies. though its progression to acute le has been documented, progression to anti - double - stranded dna (ds - dna) negative lupus nephritis has not been reported till date. an 18-year - old female presented with fever since 1 month and rash over face and forearms since 3 weeks. the patient was apparently all right prior to 1 month, when she developed high - grade continuous fever. three days later she developed blisters and red lesions over face and forearms and blackish lesions over forearms. she did not give any history of joint pains, decreased urine output and hematuria, chest pain, dyspnea, cough or no history of spontaneous bleeding tendencies. lesions over the face are in the form of palpable purpura, scars and targetoid lesions [figure 1a and b ]. purpuric and targetoid lesions were also seen over the arms [figure 2a ] and chest. non - tender erythematous macules and targetoid lesions were seen over palms [figure 2b ]. nail - fold capillaroscopy revealed proximal nail fold erythema, ragged cuticles, and capillary telangiectasia and nail - fold infarcts [figure 4a c ]. (a) clinical photograph showing scars and targetoid lesions over face and crusting over lower lip. (b) clinical photograph of face showing scars and targetoid lesions on closer view (a) clinical photograph showing scars and targetoid lesions and palpable purpura over arm. (b) clinical photograph showing non tender erythematous macules and targetoid lesions were seen over palms crusting erosions and edema were seen over lips (a) nail fold capillaroscopy showing erythema, telangiactasia, ragged cuticles and infarcts over proximal nail fold. (c) nail - fold capillaroscopy showing nail fold infact on higher magnification systemic examination was normal. complete hemogram and urine examination were normal except for a raised esr of 30 mm / hour. anti - nuclear antibody was positive with a titer of 1:160 and showed a speckled pattern. anti- ro antibody was found to be negative with a titer of 11 u / ml (titer of > 10 u / ml is considered positive by immunofluorescence method). histopathological examination of the biopsy specimen taken from targetoid lesion over the forearm revealed orthokeratosis, focal hypergranulosis, basal cell vacuolar degeneration, lymphohistiocyic infiltrate at the dermo epidermal junction with pigment incontinence [figure 5a and b ]. (a) section from targetoid lesion showing orthokeratosis, focal hypergranulosis, basal cell vacuolar degeneration, lymphohistiocyic infiltrate at the dermo epidermal junction with pigment incontinence (h and e 10x). (b) section from targetoid lesion showing basal cell vacuolar degeneration with lymphohistiocytic infiltrate at dermoepidermal junction (h and e 40x) a diagnosis of rowell 's syndrome was made on the basis of clinical and laboratory findings. the patient was duly started on tablet hydroxychloroquine 200 mg twice daily and tablet prednisolone at 30 mg which was gradually tapered was gradually tapered to 5 mg over a period of 6 months. four months later, she developed recurrence of lesions on face, chest, back, arms and ears. erythematous papules with dusky red hue were seen over the concha of ears and forearms. twenty - four hour urine protein examination revealed 472 grams of protein per 24 hours(normal range is less than 80 mg per day). complement c3 levels were low with a titer of 83.4 mg / dl.(normal range is 75 - 135 mg / dl). histopathology of the kidney revealed increased mesangial cellularity and increased cellular proliferation in few glomeruli with mild basement membrane thickening. there was no evidence of tubular casts, interstitial inflammation or blood vessel thickening [figure 6 ]. immunofluorescence showed moderate peripheral coarse granular igg, iga and c3 deposits with weak igm deposits. the patient was started on prednisolone 40 mg, tacrolimus 1.5 mg twice daily and ramipril10 mg for one month. with the above treatment 24 hour urine protein decreased to 744 mg of protein per 24 hours. histopathological section from kidney showing increased mesangial cellularity and increased cellular proliferation in few glomeruli with mild basement membrane thickening. interstitial inflammation and blood vessel thickening was seen. an association of erythema multiforme and le was first noted by scholtz in 1922. in 1963, during a study of 120 patients with discoid le, rowell. found four patients to have distinctive clinical and immunologic findings that included erythema multiforme - like lesions, chilblain - like lesions, speckled pattern of antinuclear antibodies, positive serum rheumatoid factor, and antibodies to saline extract of human tissues (anti sjt positivity). of the characteristic immunological abnormalities speckled pattern of ana was the anti - sjt positivity has been replaced by anti - ro and anti - la positivity. in 2000, zeitouni. redefined rowell 's syndrome with major and minor criteria. major criteria included i)le : acute, subacute or discoidii)erythema multiforme like lesions (with / without involvement of the mucous membranes),iii)speckled pattern of ana. le : acute, subacute or discoid erythema multiforme like lesions (with / without involvement of the mucous membranes), speckled pattern of ana. i)chilblains, ii)anti - ro antibody or anti - la antibody, iii)positive rf. anti - ro antibody or anti - la antibody, our patient satisfied all three major and one of the minor of the above criteria and also satisfied four of the acr criteria for sle. though originally described in cases of dle, there is now evidence to classify rowell 's syndrome as a type of subacute le rather than a separate entity. the early annular polycyclic lesions of scle may resemble erythema multiforme with similar histopathological and immunologic findings. rowell 's syndrome has been described with all subtypes of le (systemic, acute, subacute or discoid). unidentified hsv, ebv or other viral infections may cross - react with lupus autoantigens and they can initiate the immunologic response, hence triggering the em like lesions in sle. similarly, immunopathogenetic mechanisms described in both diseases may be responsible for the co - occurrence. anti - smith (sm) and anti - ds - dna antibodies are considered to be nephritogenic and their correlation with lupus nephritis (ln) has been well established. patients with drug - induced ln (hydralazine) have been described in the literature to have negative ds - dna and anti - sm antibodies on serological screening. only seven cases of non - drug - induced severe ln with negative ds - dna antibodies are reported. progression of rowell 's syndrome to ds - dna negative ln has not been reported in the literature. nail changes seen at presentation when the patient only had features of rowell 's syndrome have not been documented in previously reported cases. nail changes as seen in our case have not yet been described with rowell 's syndromeour case developed lupus nephritis and was ds - dna negative. ds - dna negativity has not been described in non - drug - induced lupus with cutaneous features. nail changes as seen in our case have not yet been described with rowell 's syndrome our case developed lupus nephritis and was ds - dna negative. ds - dna negativity has not been described in non - drug - induced lupus with cutaneous features.	rowell 's syndrome is now identified as a subtype of subacute lupus erythematosus (le) with erythema multiforme - like skin lesions, positive serum rheumatoid factor, anti - ro la positivity and speckled pattern of antinuclear antibodies. here we describe a case of rowell 's syndrome in an 18-year - old female who was found to be ds - dna negative, who later progressed to develop stage v lupus nephritis (ln) over a course of 4 months. although extremely rare, most cases of ln are drug induced. of only seven cases of non - drug induced ln with negative dsdna, none had cutaneous involvement. ours was a unique case of progression of rowells syndrome to ds - dna negative ln.
hepatitis a virus (hav) infects 212 million people each year, including 55 million symptomatic cases and 35,245 deaths (1). the virus (hav) is a member of the hepatovirus genus of picornaviridae family. hav is a non - enveloped, linear, single - stranded rna virus (2, 3). the lack of a lipid envelop allows the virus to be thermostable and acid resistant and resist bile lysis, which facilitates efficient fecal - oral transmission (4). thus, due to improvements in socioeconomic status, sanitation, accessibility to clean water, and the introduction of effective immunization programs, a dramatic decline in the endemicity of hav has occurred in many parts of the world over the past few decades (5, 6). a significant declining trend in age - specific seroprevalence has been found in italian people under 30 years of age (61% in 1988, 33% in 1995, and 8.9% in 2005 - 2008). other studies in taiwan and brazil have shown that the prevalence of anti - hav has decreased to a very low level in recent years (7, 8), although most developing countries have shown an increasing trend in the age groups of > or = 21 years old (9 - 11). further, some serious disease patients, for instance hemophilic patients, still need more intensive care. these patients require a long - life intravenous infusion of factor concentrates to treat bleeding. this could increase the risk of transmission of blood - borne infections through hav - contaminated blood along the fecal - oral route in hemophilic patients because blood products are inactivated by solvent such hav infection outbreaks that occurred among hemophilic patients between 1989 and 1997 worldwide have stimulated researchers to reconsider the safety of plasma derivatives because the non - enveloped viruses are neither easily inactivated by the heating technolog that has been used since 1980 nor by the solvent - detergent inactivation procedures being used today (12). therefore, both the american academy of pediatrics (aap) and the centers for disease control (cdc) strongly recommend an hav vaccine for persons with clotting - function disorders (10). although prevention programs have been performed in iran in recent years, therefore, a selective screening strategy in at - risk people, hemophilic patients as an example, with identifiable risk factors has been advocated, and neonates of known hav - positive patients have been demanded to possibly fill informational gaps in the disease prevalence (4) and, thus, to evaluate the effectiveness of prevention programs (8). the study s objective was to determine the seroprevalence of hepatitis a viral antibody in hemophilic patients and to document the transmito - epidemiological correlates of blood that are anti - hav positive. a cross - sectional descriptive study was conducted from april 2014 to april 2015 on all hemophilic patients in south khorasan province, iran. those who were willing and eligible to participate in the study, not having been vaccinated against hav, were interviewed and informed of the research aim. having given consent, 108 of the patients were recruited and formed the research subjects. they were evaluated with respect to viral safety, sex, blood group, and the origin of the clotting factor concentrates, categorized into three groups (10 - 17, 18 - 27, and 28), similar to the study of mauser - bunschoten (14). the study was performed under the supervision of birjand university of medical science and was approved by the local ethics committee of the university hospital. all 108 serum samples were tested with enzyme immunoassay (eia) kits (abbott - hepatitis a virus ab meta - axsym system, germany) for total anti - hav antibody. hepatitis b surface antigen (hbsag) (enzygenost hbs ag, usa), anti - hepatitis c virus antibodies (hcv - ab) (anti - hcv elisa, drg co., germany), anti - human immunodeficiency virus antibodies (hiv - ab) (genscreen hiv ; bio rad, france), and anti - human t - cell lymphotrophic virus- antibodies (htlv- ab) (gene labs diagnostics htlv-/, switzerland) were evaluated. all positive sera in hcvab were confirmed by a nested reverse transcriptase (rt - pcr) test (diasorine hcv - rna, spain). note that all blood products, in iran, have carefully been screened for hepatitis c virus since 1996 (15). fisher, x2 and t - test were performed with the confidence of 95% using sas program (version sas 9.1.3 service pack 4, copyright (c) 2002 - 2003 by sas institute inc., cary, nc, usa). all 108 serum samples were tested with enzyme immunoassay (eia) kits (abbott - hepatitis a virus ab meta - axsym system, germany) for total anti - hav antibody. hepatitis b surface antigen (hbsag) (enzygenost hbs ag, usa), anti - hepatitis c virus antibodies (hcv - ab) (anti - hcv elisa, drg co., germany), anti - human immunodeficiency virus antibodies (hiv - ab) (genscreen hiv ; bio rad, france), and anti - human t - cell lymphotrophic virus- antibodies (htlv- ab) (gene labs diagnostics htlv-/, switzerland) were evaluated. all positive sera in hcvab were confirmed by a nested reverse transcriptase (rt - pcr) test (diasorine hcv - rna, spain). note that all blood products, in iran, have carefully been screened for hepatitis c virus since 1996 (15). fisher, x2 and t - test were performed with the confidence of 95% using sas program (version sas 9.1.3 service pack 4, copyright (c) 2002 - 2003 by sas institute inc., cary, nc, usa). the mean age of participants was 27.7 16.4 years, with a minimum of 4 and maximum of 85 years old ; 0.93.5% (101 cases) of patients were males and 6.5% (7 cases) were females. in addition, 53% of our cases were single and 47% were married ; 86% of these patients had hemophilia type a (table 1). the severity level of hemophilia in 7.4% was mild (clotting factor level : 5% - 25% of normal), in 7.4% was moderate (clotting factor level : 1% - 5% of normal) and in 85.2% was severe (clotting factor level : less than 1% of normal) (16). further, the blood group in 38% of patients was b, in 28% was a, in 25% was o, and only 9% had blood group ab. moreover, 34% of our cases lived in urban areas, while 66% were from rural areas. in this study, 77.8% of the cases (84 out of 108) were anti - hav antibody seropositive. of the subjects who were under 20 years old, 59% were hav - positive were, while this percentage was 88.4% for those over 20 years old (p 0.05) was not significant. this clinical - based report presents the burden of hav and other blood - borne infections in a population of hemophiliacs, a high - risk population in south khorasan province, iran that had not been studied previously. we conducted a cross - sectional study of recent anti - hav seroprevalence to establish effective preventative measures for hav infection in hemophiliacs. the overall prevalence of hepatitis a infection in the hemophilic population was 77.8%, which is in contrast with previous observations reported in egypt (12). the rate of prevalence, however, varies widely in different parts of the world (12, 17). in a study on 133 hemophilic cases mauser - bunschoten in his study in the netherlands showed that the anti - hav prevalence in 197 hemophiliacs (treated with clotting factor concentrates produced from large plasma pools) was 20%, and in 144 patients (treated with small pool cryoprecipitate) it was 13% (19), while it was 22.4% in hayashi s study in japan (20). the level of hygiene in different communities could be one of the most important reasons for these variations. poor hygiene, poor water sanitation, and family crowding, which increase the chance of close contact with the virus, are several reasons for the increased prevalence of the infection. although in a cross - sectional study conducted among 1- to 15-year - old children, no difference in the seroprevalence of hepatitis a related to age groups, mean age, sex, and family size was observed (21), in most multivariate analyses, region, age group, marriage, referral date, and level of parental education were associated with hepatitis a virus seropositivity (17, 22 - 29). the outcome of the positivity rate for anti - hav concerning region (51.4% in urban areas and 91.5% in rural areas) is completely in favor of the findings of taghavi and his colleagues in shiraz showing the high frequency of hav - positive individuals living in rural areas (95.9% of rural people in comparison with 85.1% of the urban population) (28). in another study, the overall seroprevalence of hav in the general population of three provinces of iran (tehran, golestan and hormozgan) was 86%, with no variation between the two genders (22). the prevalence in younger subjects and in urban populations was under 70% (22), while in another province of iran (kashan) only 3.9% of children between 1 and 15 years there was a direct relationship between seroprevalence and age, as a rise in age caused an attendant increase in seroprevalence. the other point worth noting was the significant difference between the age groups (p < 0.001). the infection rate in subjects over 19 years old was 77.1%, while it was only 22.9% in those younger than 19. in hayashi s study, the infection incidence in the age range of 10 19 years was 21.4 %, and 30.8% of hemophilic patients were 40 - 49 years old (20). in chambost s investigation, 20% of people were 30 to 35 years old, and almost 49% of infected patients were over 50 years (28). some reports have indicated an increasing rate of acute hav infection in adults in iran in recent years (23). a serosurvey in tehran in the late 1970s found that more than 90% of 10 years old had immunity against hav (24). studies in the 2000s show a much lower seroprevalence in the majority of children and teenagers, while they still remain susceptible to hepatitis a infection (25), which can be one of causes of high seroprevalence. the other underlying cause is the high anti - hav seroprevalence rate in the middle east (26), which could increase the chance of exposure to the virus, leading to high seroprevalence in iran. hepatitis c and htlv-1 positivity were reported among 20.4 and 2.8% of our participants, respectively, similar to recent studies in iran and the united states, where blood transfusion was reported as a common factor of hcv (30 - 32). the prevalence of hepatitis c infection in hemophilia patients in a study in germany was 98.6% (33) ; it has also been reported to be 54.5% in india (34) and 96.97% (mzandaran province) (30) and 60.2% (tehran p rovince) (35) in iran. the seroprevalence of hcv and hbs - ag, as the zahedan hemophilia center reported, was 29.6% and 4.9%, respectively, in hemophilic patients (36), which is more prevalent than our study. however, as the results of this study indicate, there were no hiv- or hepatitis b - infected patients among the participants. the prevalence of hepatitis b infection in borhany s study conducted in karachi was reported to be 1.73% of hemophilic people (37) ; however, in another study in iran, no association between hbv infection and blood transfusion, as a main route of infection in hemophiliacs, was reported (38). one possible explanation for the inconsistency between the previous results and the present findings is that most of our hemophiliac patients were living in rural areas and did not have access to coagulation factors in these areas ; therefore, they have received cryoprecipitate instead of coagulation factors, which reduced the likelihood of blood - disease transmission. cryoprecipitate is prepared from the blood of local blood donors, and the prevalence of blood - borne diseases such as aids, hcv, and hbv infection is lower in these areas. therefore, the prevalence of infection with hepatitis c, hepatitis b, and hiv in our study was lower than previous studies. we attempted to determine whether vaccination against hepatitis a in hemophilic patients in south khorasan is necessary. the results show that more than 40% of the hemophilic patients in our study under 20 years of age have no immunity against hepatitis a, and 23% of hepatitis c patients have not had a hepatitis a co - infection yet. since hepatitis a can show a fulminant course in hepatitis c patients, vaccination against hepatitis a seems necessary in hemophilic patients in the region. moreover, further studies on hemophilic patients in other regions of iran seem necessary to determine their immunity status against hepatitis a.	backgroundhemophilic patients require long - life intravenous infusion of factor concentrates to treat bleedings. this could increase the risk of transmission of blood - borne infections like hepatitis c.objectivesthe current study was aimed at investigating the immunity status against hepatitis a in hemophilic patients in south khorasan and evaluating the necessity of hepatitis a vaccination for this population.patients and methodsa cross - sectional descriptive study was conducted between 2014 and 2015 on all hemophilic patients of south khorasan province, iran (n = 108) for anti - hav total, anti- hcv, hbs - ag, anti - hiv, and anti - htlv - i /ii. note that no one had already received a hepatitis a vaccine.resultsas our results show, 77.8% of the participants (59% under 20 and 88.4% above 20 years old) were seropositive for anti - hav total ; 20.4% and 2.8% (three patients) of the cases were anti - hcv positive and anti - htlv-1 positive, respectively, while none of the subjects were hbs - ag or hiv - ab positive. seventeen of the patients (15.75%) showed a co - infection of hav with hcv, and five hcv - infected patients (22.73%) had no immunity against hepatitis a. there was a significant relationship between age, rural life, and anti - hav positive state in our patients (p 0.05) was detected.conclusionsmore than 40% of the hemophilic patients under 20 years of age in the present study had no immunity against hepatitis a, and 23% of hepatitis c patients had not had a hepatitis a co - infection yet. since hepatitis a can show a fulminant course in hepatitis c patients, vaccination against hepatitis a seems necessary in hemophilic patients in the region.
porokeratosis is a genetic disease transmitted as an autosomal dominant trait featuring abnormal epidermal keratinization, which is histologically characterized by the presence of cornoid lamella. since then many variants of porokeratosis have been described, each with differing morphology, distribution, and clinical course. familial adenomatous polyposis (fap) is characterized by numerous adenomatous colorectal polyps that have an intrinsic tendency to progress to adenocarcinoma. fap with extra - intestinal lesions such as epidermoid cysts, osteomas, desmoid tumors, dental anomalies is called gardner 's syndrome. the association of porokeratosis of mibelli with gardner 's syndrome is extremely rare without any recorded cases in the literature, prompted us to report this case. an 18-year - old female of low socio - economic status presented to skin opd with complaints of multiple skin lesions all over the body and swellings on the face, scalp, and extremities of five years duration. lesions started to develop on the scalp insidiously, and later on left mandible, face, and extremities. clinical examination of the patient revealed multiple skin plaques present on the face, forearms, back and both lower extremities with elevated margin with a prominent deep furrow and central part showed normal skin [figure 1 ]. fluctuant skin swellings were observed on the scalp and back of trunk, with punctum [figure 2 ]. over the body of left ramus of mandible a clinical diagnosis of porokeratosis of mibelli, epidermoid cysts, and osteoma of mandible was made. family history of the index case revealed father had dysphagia, pain abdomen with episodes of bleeding per rectum, and ultimately died of us suspected gastrointestinal (git) origin malignancy. biopsy of the skin plaques, along with the excision biopsy of cystic swelling over scalp and bony hard swelling of left mandible was done. because of the family history and clinical presentation (sebaceous cysts and osteoma), a colonoscopy was done which revealed a solitary rectal polyp of 1 1.5 cm in size situated 7.0 cm from anal verge. porokeratosis of mibelli histopathological examination of the plaque lesions of skin revealed a keratin filled invagination of the epidermis, the center of which showed parakeratotic column (interpreted as cornoid lamella). bone lesion showed the histopathology of a benign osteoma showing mature osteocytes [figure 5 ]. histopathological examination of rectal polyp showed hyperplastic polyp of rectal mucosa with focal adenomatous change, mild nonspecific inflammation, cystic change, congested vessels with no evidence of malignancy [figure 6 ]. parakertotic column (cornoid lamella) in porokeratosis mibelli, (h and e, 100) osteoma with mature osteocytes (h and e, 200) hyperplastic polyp of rectal mucosa with focal adenomatous change (h and e, 100) the clinical picture, family history and multiple lesions diagnosed histologically in the index patient, we contemplated the possibility of porokeratosis of mibelli with an evolving gardner 's syndrome. gardner 's syndrome start with a few polyps in the 10 - 20 year age group and develop into its full blown clinical picture by the fourth decade of the patient, with an intrinsic tendency to progress to adenocarcinoma. it is caused by a germline mutation in the adenomatous polyposis coli (apc) gene located on the long arm of chromosome 5. the mandible is the most common location ; however, osteomas may occur in the skull and the long bone. osteomas precede the clinical and radiographic evidence of colonic polyposis, therefore, they may be sensitive markers for the disease. porokeratosis is a heterogeneous group of disorders characterized by distinct clinical findings of a keratotic ridge with a central groove that corresponds to the cornoid lamellae on histology. etiopathogenesis of porokeratosis is unknown but genetic inheritance as well as acquired form has been reported. heredity, immunosuppression, infection, and ultraviolet rays have been found to play a role in the causation of porokeratosis. no specific candidate gene has been found. however, genetic loci of disseminated superficial actinic porokeratosis have been detected in the region 12q23.2 - 24.1 (dsap 1) and 15q25.1 - 26.1 (dsap 2). recently, another loci has been found within an 8.2 cm or 11.9 mb region between markers d1s438 and d1s464 (dsap 3). larger lesions have higher malignant potentiality, particularly, the giant variety that is most frequently reported to show malignant transformation. malignancies reported in porokeratosis are squamous cell carcinoma, bowen 's disease, basal cell carcinoma, diffuse large b - cell lymphoma, etc. porokeratosis in association with lichen planus, diabetes mellitus, cap syndrome (craniosynostosis, anal anomalies, and porokeratosis), bloom 's syndrome, cystic fibrosis etc, have been reported.[711 ] to the best of our knowledge this is the first case reported of porokeratosis of mibelli with gardener 's syndrome.	porokeratosis represents a heterogeneous group of disorders characterized clinically by a distinctive ridge - like border and histologically by cornoid lamellae. gardner 's syndrome, a variant of familial adenomatous polyposis (fap), is an autosomal dominant disease characterized by colorectal polyps, osteomas, epidermoid cysts and soft tissue tumors. here we report a case of 18 yr old female who presented with porokeratosis of mibelli with osteoma, multiple epidermoid cytsts, and solitary rectal polyp.
medieval stained glass windows are part of our cultural heritage, but due to their permanent exposure to environmental conditions they have been damaged over centuries. to protect and conserve this valuable material, stained glass is made up of several components : network formers, stabilizers, modifiers, and coloring elements (rmich, 1999). in addition, several metals, such as cu, co, and mn, were used to color the glass (bamford, 1977 ; newton and davison, 1989). nevertheless, if we consider the main chemical elements, historic glass can be classified into two types : k - rich and na - rich glass (newton and fuchs, 1988 ; brill, 1999). most central european medieval stained glass produced between the 12th and 15th centuries was k - rich in composition. however, the coeval european mediterranean glass shows the continuation of a roman - like na - rich glassmaking tradition. a common feature of medieval stained glass is the presence of corrosion, patina development, and mineral crust growth over the glass, which has caused serious damage to many central european stained glass windows. most of these studies consider that glass corrosion and decay are related mainly to a physicochemical process (newton and davison, 1989 ; schreiner, 1991). nevertheless, since the beginning of the 20th century there has been evidence of biological induction in stained glass decay (krumbein., 1995). other important factors that enhance corrosion are environmental pollution (i.e., co2 and sox in urban areas, where most stained glass windows are located) and, in the case of biodeterioration, the presence of organic carbon on the glass. the result of glass decay is a sharp decrease of the flux and network modifiers on the surface and contiguous mass of glass (leaching). this leads to the genesis of a gel surface (or planar volume) of the glass depleted in practically all glass components except network formers (newton and davison, 1989 ; sterpenich and libourel, 2001 ; garcia - valles., the leached elements may combine with other (i.e., atmospheric) components to form complex salts. the most soluble salts are removed by moisture and rain, but the others remain on the glass surface as mineral products forming patinas and crusts, as sulfates (gypsum and syngenite), calcite, ca - oxalates, etc. in k ca - rich medieval glasses, when the surface ph might reach a level greater than 9, advanced corrosion of the outer level of silica - rich glass occurs (garcia - valles., 2003). as mentioned above, nowadays biological corrosion of glass glass biodeterioration is the result of metabolic activities of complex microbial communities composed mainly of fungi (nagamuttu, 1967 ; kaiser., 1996 ; schabereiter - gurtner., 2001b), bacteria (rlleke., 1999 ; marvasi., the organic residues present on historical glass, as dead microbial material, metabolites of autotrophic bacteria, animal faeces, and dust deposits, promote the microbial growth. the role of microorganisms in glass decay includes both chemical and mechanical destruction of glass. the mycelia of filamentous fungi and actinobacteria initiate both a mechanical destruction and the creation of a leaching environment by the adsorption of water, enhancing the chemical destruction of glasses. furthermore, the production of metabolic products, as organic and inorganic acids, can lead to ph changes, redox - reactions leaching and chelation of special glass components. in summary, microbial growth on glass surfaces produces several types of damage, such as bio - pitting corrosion, cracks, and patina formation (krumbein., 1991 ; drewello and weissmann, 1997). investigations of microbial colonization of historical glass have so far been based on culture - dependent methods (krumbein., 1991 ; drewello and weissmann, 1997), with only the exceptions using culture - independent techniques (rlleke., 1999 ; 2006). in determining the appropriate measures to take against microbial growth on historical glass, it is important to get an overview of the inhabiting microbial populations. however, the first problem found when working with samples taken from cultural assets is the small quantity of sample material available, which is in most cases not sufficient for reliable cultivation assays. furthermore, microbes are usually members of complex microbial communities and depend on special nutrients ; therefore only a minority of them can be cultivated under conventional laboratory conditions. by contrast, cultivation - independent methods enable the detection of slowly growing, fastidious, or uncultivable microorganisms, allowing a more complete picture of the inhabiting microbial communities than do traditional cultivation techniques (schabereiter - gurtner., 2001a). the objective of this study was the chemical and biological characterization of the stained window glasses showing signs of biodeterioration of two catalonian churches. to this end, glass surfaces were investigated using scanning electron microscopy (sem), energy dispersive spectrometry (eds), and x - ray diffraction (xrd). in addition, the chemical glass composition was investigated using wavelength - dispersive spectrometry (wds) microprobe analysis. the biodiversity of the micro - biota associated with the observed decay was investigated by the following molecular methods : dna extraction from glass samples, amplification by pcr targeting the16s rrna and its regions, and dna fingerprint analyses by denaturing gradient gel electrophoresis (dgge). in parallel clone libraries containing either pcr fragments of the 16s rdna or the its regions were screened by dgge and selected clone inserts were sequenced and compared with the embl database. glass samples were obtained from different restoration and conservation projects in two mediterranean coastal cities of northeastern spain, tarragona and barcelona. this area has a mediterranean climate with rainfalls mainly concentrated in spring and fall (around 580 mm yr) and is characterized by moderate weather, warm summers (2130 c), and mild sunny winters (614 c). they show evidence of damage and repair after the war of independence (18081812) as well. all stained glass windows show original black - fired draws (grisailles), but our present study is only concerned with the composition and corrosion of the main pieces of glass. 2) is a medieval building erected in the 14th century but the large rosette on the main faade was destroyed by the 1428 pyrenees earthquake and the stained glass window was rebuilt during the 15th century. over the centuries, damage and repairs have led to a mixture of old glass panels and new ones, with the most important modifications probably dating from the spanish war of independence and the spanish civil war (19361939) (ainaud de lasarte., 1985). all samples were obtained during restoration works and therefore consist of small pieces of broken glass (in general smaller than 0.5 g) that have no possibility of being remounted in the panels. the samples were first observed through a stereomicroscope to obtain morphological information, determine the structure and texture of the surface, determine the conservation state of grisaille, and observe the weathering products (patinas, crusts, pitting, loss of material, etc.). this was done to select the most suitable areas of the surface glass to be scraped with a diamond grindstone and to concentrate the neo - formed phase powder, which was mineralogically identified using a siemens d-500 x - ray diffractometer. diffraction patterns in the range 470 2 were obtained with a 0.05 2 step scan and 5 s counting time, using cu k radiation, tube conditions of 40 kv and 28 ma, and a graphite monochromator. one was used to study the fresh fracture, including the glass and neo - formed surface, by scanning electron microscopy (sem). the instruments used were a jeol j3m-840 and a leica 360, both served by a link microanalysis energy dispersive spectrometry eds system, including an energy - dispersive x - ray spectroscopy detector facility (linkan 10000 eds). the other section, perpendicular to the surface, was set in an epoxy resin block, and then by sem - eds. scanning electron microscopy was used to determine the structural changes in the surface, to evaluate the rate of corrosion within the glass, and to determine the composition. the chemical composition of the glass was obtained using wavelength - dispersive spectrometry (wds) microprobe analysis (cameca camebax sx-50). different natural and synthetic silicates and oxides of certified composition were used as standards (p&h developments and agar scientific commercial standard blocks). the analyzing crystals were provided by cameca (lif, tap, and pet ; and pc0 for instrumental determination of oxygen). this was achieved by random point microanalysis of the fresh glassy mesostase (in general n = 15 over each fragment). outside of the leached surfaces glasses are very homogeneous and analytical differences are within the range of (or much less than) expected instrumental error. zoned glasses (i.e., red glasses consisting of a deep red plate sandwiched between white glass) were also studied by acquisition of a profile of points orthogonal to the planar optical anisotropies. the analytical accuracy and precision was also controlled by means of internal standards (brill, 1999). extraction of dna was performed directly from the glass samples using the method previously described by sert and sterflinger (2010) with the following modifications : prior to lysis, a piece of glass (0.20.25 g) was triturated with a mortar and the obtained powder, together with 500 l lysing buffer, was added to the tubes of the lysing matrix e (mp biomedicals). the mixture was shaken in a cell disrupter (thermo savant fastprep, fp120, holbrook, usa) at full speed for 40 s, and incubated for 1 h at 65 c. afterward, the mixture was shaken again at full speed for 40 s and then centrifuged for 10 min at 10,000 g. the supernatant was transferred to a new eppendorf tube and an approximately equal volume of chloroform / isoamyl alcohol was added, mixed thoroughly, and centrifuged for 5 min in a microcentrifuge. the supernatant was transferred to a new eppendorf tube and further purified using the qiaamp viral rna mini kit (qiagen, hilden, germany) following the instructions of the manufacturer. the final elution step was repeated twice with 100 ml of 80 c preheated ddh2o (sigma aldrich, st. the purified dna was used directly for pcr amplification. for the analysis of fungal sequences, fragments of about 700 bp in size corresponding to the its1, the its2 region, and the adjacent 5.8s rrna gene, were amplified with the primer pair its1 and its4 (white., a nested pcr was performed with the pcr product of the first round as template dna using the primers its1gc with a 37-base gc clamp attached to the 5 end (muyzer., 1993) and its2. 200-bp fragments of the 16s rdna were amplified with a nested pcr using the eubacterial specific primer 341f - gc with a 40-bp gc clamp added to its 5 end (muyzer., 1993) and the universal consensus primer 518r (neefs., 1990). all pcr products were analyzed by electrophoresis in a 2% (w / v) agarose gel. 1993) using a d - code system (biorad) in 0.5 tae (20 mm tris, 10 mm acetate, 0.5 mm na2 edta ; ph7.8 with 8% (w / v) acrylamide). gels were run at a constant temperature of 60 c with a voltage of 200 v during 3.5 h and 6 h, respectively, for bacterial and fungal fingerprints. the linear chemical gradient of denaturants used in this study [100% denaturing solution contains 7 m urea and 40% (v / v) formamide ] are indicated in the figures. after completion of electrophoresis, gels were stained in a 1 g ml ethidium bromide solution (stock : 10 mg ml) for 20 min and afterward visualized by a uvp documentation system (biorad transilluminator, universal hood ; mitsubishi p93d - printer). to obtain a detailed phylogenetic identification of the microbial community members, clone libraries containing either its fungal regions (fungal community) or 16s rrna fragments (bacterial community) were carried out. for fungal clone libraries, the dna template was amplified using the primers its1/its4 as mentioned above. for bacterial clone libraries, the pcr products were purified using the qiaquick pcr purification kit protocol (qiagen, hilden, germany) and resuspended in ddh2o water. purified pcr products were ligated into the pgem - t easy vector system (promega, vienna, austria) following the instructions of the manufacturer. these cells allow the identification of recombinants (white colonies) on an indicator lb medium containing ampicillin (100 g ml), streptomycin (25 g ml), and x - gal (5-bromo-4-chloro-3-indolyl - -1-galactopyranoside ; 0.1 mm) (sambrook., 1989). clones were screened in a dgge gel and sequenced as described by schabereiter - gurtner. comparative sequence analysis was performed by comparing pair - wise insert sequences with those available in the public online database ncbi using the blast search program (altschul., 1997). the resulting sequences of the bacterial and fungal clones have been deposited at genbank : genetic sequence database at the national center for biotechnical information (ncib) (genbank i d : ba123456) (tables 3and 4). stereomicroscope observations showed different situations on each glass sample. all glass samples, except t-28 (cathedral of tarragona) and stm-13 (church of santa maria del mar), were covered by discontinuous orange and/or beige patina (figs. in addition, glasses presented traces of biological activity as bio - pitting (fig. 3a and b), isolate micro - cracks and some interconnected micro - cracks developed in glass, in patina, in old paints, or in grisaille (fig. 1c and 3a left) and also evidence of a gel with a silica composition, as determined by sem. the more external part of the patina showed to be orange and the bottom beige (fig. occasionally, the patina was formed in glass surfaces previously attacked by microorganisms (fig. 3a), producing a more or less penetrating pitting into the glass (fig. this destroyed surface can also be filled (constructive activity) with authigenic minerals (patina). sem observations of the glass corroborated the morphology and evolution of pits (fig. 3d shows initial development of curved - branched irregular pitting not directly related to cracking surface. each pit appears as an incipient nodule - like glass decay form overprinted on the curved branch of pit progression. these branches of pits tend to coalesce and provide a deeply penetrated upper film of the glass, sometimes associated with an external surface patina. we could also observe that in plaqu glass the bio - pitting stopped when the microorganisms arrived at the colored layers, which contain heavy metals the diameter of the pit holes decreases from the external (50 m) to the internal part (20 m, fig. this activity was also observed in the k - rich glass stm-16 (fig. 3e shows a macroscopic photograph with a bio - pitting arrangement made in the glass surface, and sem shows the detail of the pit hole section related to organic activity. the mineralogical composition of patinas, determined by xrd and corroborated by sem - edax analyses, revealed the presence of gypsum (caso42h2o), bixbyite (mn2o3), syngenite [k2ca (so4)2h2o ], thenardite [(-na2so4) ], calcite (caco3), and quartz (sio2), as well as the presence of clay minerals and ca - oxalate (weddellite, cac2o42h2o, and whewellite, cac2o4h2o), determined in orange patina. the chemical composition of the investigated samples obtained from the cathedral of tarragona and the church of santa maria del mar are showed in tables 1and 2, respectively. in all samples depending on the flushing compound type used, k2o or na2o, we distinguish two main compositional groups of glasses : na - rich and k - rich (or k ca - rich). the na - rich glasses typically show greater silica content (> 68%) than the k - rich or k ca - rich glasses (around 50%). the other network - forming, al2o3, has a uniform value 2% independently of the k- or na - rich character. the k - group glasses always contain another oxide, p2o5 (34%), which is absent in the na - group glasses. three (t-6, t-31, and t-35) out of six samples from the cathedral of tarragona corresponded to red plaqu glass, formed by red layer between 160 and 200 m thick and colorless 2.5 mm. the color exhibited can be due to the presence of cuo (comparing the results in table 1). two of the five samples from santa maria del mar were plaqu as well, stm-16 green and stm-19 blue. the first one was double plaqu in cross section, consisting of a 60-m - thick layer that was colorless, one layer green to 720 m, another colorless to 720 m, other green and colorless also to ca. the main chemical compounds are the same, but the green color is due to enriched cu, 3.7% cuo ; when this value is > 1% the color obtained is green. the blue plaqu was formed by blue glass of a 150-m - thick layer and other colorless to 2.8 mm. comparing the oxide constituents among the blue and colorless layers, differences were observed in mn and fe, showing higher values in the blue zones. for molecular analyses, pieces of glass (0.20.25 g) were used for direct dna extraction. the dna extracts were amplified by pcr with primers targeting the 16s rrna gene of bacteria, as well as the its regions of fungi. the bacterial and fungal amplified fragments were further analyzed by dgge analysis, revealing fingerprints for both bacterial and fungal communities. 4 shows the dgge profiles derived from the bacterial and fungal communities colonizing the samples obtained from the cathedral of tarragona and the church of santa maria del mar in barcelona. in general, bacterial dgge profiles showed a higher complexity in the community structure, with many dominant bands as well as some other faint bands (fig. the dgge profiles derived from the fungal communities showed fewer bands, indicating a lower biodiversity of fungi on the glass samples (fig. 4b). to obtain a phylogenetic identification of the individual members of the bacterial and fungal communities inhabiting the glasses of the two investigated locations, two k - rich glass samples (one from each location) were selected for the creation of clone libraries containing either the bacterial 16s rrna gene or the fungal its regions and the 5.8s rrna gene. the resulting bacterial and fungal clones were further screened by dgge and clones were selected for sequencing. the obtained sequences were compared with 16s rrna gene sequences and its regions of known bacteria and fungi, respectively, listed in the embl database. 5and 6 show the dgge profiles derived from bacterial (a) and fungal (b) clones selected for sequencing obtained from samples t-5 (cathedral of tarragona) and stm-16 (church of santa maria del mar), respectively. tables 3and 4 show the phylogenetic affiliations of the bacterial and fungal clones, respectively, obtained from both samples. table 3 shows the phylogenetic affiliations of all bacterial clones obtained in this study. a total of 19 and eight bacterial sequences were obtained from samples t-5 and stm-16, respectively. from sample t-5 (table 3a), nine sequences (47.3% of the bacterial sequences obtained from this sample) showed high score similarities, ranging from 90 to 100%, with members of the proteobacteria (alpha-, beta-, and gamma - proteobacteria) being related to species of the genera methylobacterium (k59), bradyrhizobium (k91), ralstonia (k15), delftia (k67), variovorax (k93), acinetobacter (k79), and thermomonas (k90), as well as to two uncultured bacterial clones (k95 and k83). three sequences of sample t-5 (15.8%) affiliated with members of the bacteroidetes phylum, namely with prevotella sp. (k61) and bacteroidetes bacteria (k76 and k78). five sequences (26.3%) affiliated with members of the actinobacteria phylum, with species of the genera kocuria (k24 and k58), micrococcus (k56), and cellulomonas (k63), as well as with an uncultured actinobacterium clone (k66). one single sequence (5.3% of bacterial sequences) showed itself to be related to the firmicutes phylum, namely with a marine bacterium (k68), and finally clone k33 (5.3%) was affiliated with a non - classified uncultured bacterium clone. two sequences (25% of the bacterial sequences obtained from this sample) showed high score similarities, ranging from 96 to 99%, with members of the beta - proteobacteria, namely with species of the genera delftia (k96 and k97). one single sequence of sample stm-16 (12.5%) affiliated with members of the bacteroidetes phylum, namely with an uncultured bacteroidetes bacterium clone (k1). five sequences (62.5%) affiliated with members of the actinobacteria phylum, with species of the genus arthobacter (k12, k13, k14, k66, and k71). table 4 shows the phylogenetic affiliations of all fungal clones obtained in this study. a total of seven and four fungal sequences were obtained from samples t-5 and stm-16, respectively. from sample t-5 (table 4a), four sequences (57.1% of the fungal sequences obtained from this sample) showed a high level of similarity (99100%) with cladosporium spp. one sequence (14.3%) showed the maximum score similarity (100%) with eurotium amstelodami (f11), and the remaining two sequences (28.6%) showed similarities with penidiella venezuelensis strains (clones f7 and f113). three out of the four obtained sequences (75% of the fungal sequences obtained from this sample) showed high score similarities (9899%) with phoma sp. (clones f1, f18, and f45) ; the remaining sequence affiliated with species of the genus cladosporium (clone f5). as reported in previous works (garcia - valles and vendrell, 2002 ; garcia - valles., 2003), the glasses made with potash flux (k - rich composition) are more easily decayed than those with a na - rich composition. the microscopic analyses revealed that the only visible deterioration phenomenon was related to microbial activity. indeed, there are several studies (callot., 1987 ; krumbein., 1991, 1995 ; drewello and weissmann, 1997) highlighting the relevance of microbial activity in the alteration of glasses. the biological attack observed in this study resulted in decreasing of transparency of the glasses, in combination with the appearance of orange patinas. in addition, the presence of bio - pitting more or less developed depending on the glass composition was observed. previous work (koestler., 1986) already reported that pitting occurred only on glass with a k - rich composition but not on na - glass. in some external areas of the analyzed glasses, it was possible to recognize a layer of new mineral phases. the thickness of this layer depends on both the glass composition and the environmental conditions (garcia - valles., 2003 ; the biogenic formation of calcite, weddellite, and gypsum has been shown to be influenced by the microorganisms inhabiting the surfaces (krumbein, 1986 ; garcia - valles., 1996, 1997). in mediterranean areas, significant changes in the ecological dynamics of microorganisms colonizing rock surfaces occur due to seasonal and environmental variations, and they contribute to mineral deposition (garcia - valles., 2010). the similar environmental conditions of the two investigated locations, including proximity to the sea (humidity, mist), pollution, and the chemical composition of the windows, result in the same leaching corrosion products on these glasses : the formation of a layer of silica gel and the leaching of potassium. potassium and calcium produce hydrated sulfates of k and ca [e.g., syngenite, k2ca(so4)2h2o and gypsum caso4h2o, and sodium generates thenardite (na2so4) ]. the results derived from molecular analyses showed the presence of complex bacterial communities colonising the decayed glasses of the cathedral of tarragona and the church of santa maria del mar. proteobacteria, bacteroidetes, and actinobacteria in both locations, as well as members of the firmicutes in the case of the cathedral of tarragona. comparing the bacterial communities detected on the glasses of both investigated locations, the diversity of sample t-5 from the cathedral of tarragona was higher than that observed in sample stm-16 from the church of santa maria furthermore, members of the proteobacteria dominated at the first location (47.3% of the bacterial sequences of this sample), while members of the actinobacteria were seen to be dominant at the church of santa maria del mar (62.5% of the bacterial sequences of this sample). interestingly, many of the detected bacteria were phylogenetically related to species well known for their ability to precipitate minerals, such as delftia sp., methylobacterium sp., variovorax sp., arthrobacter sp., kocuria sp., and micrococcus sp., as well as some bacteroidetes bacteria (jroundi., 2010 ; ettenauer., 2011), which could explain the presence of mineral precipitation on the glass surfaces. furthermore, some species of the detected genera are orange pink red pigmented bacteria, such as methylobacterium sp. these bacteria could be responsible of the appearance of the orange patinas on the glasses, together with the presence of the ca - oxalates (weddellite and whewellite) found in the patinas, which can be yellow, or yellowish - brown to brown. the fungal communities detected in both locations were shown to be less diverse than those of bacteria, but again, the biodiversity was higher in the sample obtained from the cathedral of tarragona, with a dominance of cladosporium sp. by contrast, species of the genus phoma dominated on sample stm-16 from the church of santa maria del mar. the bio - pitting observed with sem analyses could be directly related to the microorganisms able to produce mycelia, such as the actinobacteria and the filamentous fungi detected in this study. however, it should be emphasized that the detected fungi are ubiquitous airborne fungi that may be considered more as contaminant than as real glass - inhabiting fungi. the observed pitting could be interpreted as well as the result of fungal attack by other more specialized fungal species in the past and not detectable at the present. indirect evidence provided during recent restoration strongly suggests that the biodeterioration of the investigated catalonian glasses started before industrial and car - induced contamination occurred in these urban settlements (that is, prior biodegradation is now present in the opposite side of a fragment of glass accidentally inverted during historic restorations.). we could also observe that the microbial penetration in these glasses was related to their chemical composition. some elements, such as copper, play a role as inhibitors of the bio - activity. in 3e), the microbial development was stopped when the organisms reached the cu - rich colored layer and, thus, they stopped their destructive activity. in those samples showing ancient bio - activity, we observed a non - uniform spatial distribution of pitting on the surface of the glasses. in some cases, the bio - pitting formed a pattern of channels like those shown in fig. last but not least, our sequence results show high similarities with bacteria already found on deteriorated stone monuments (jroundi. 2011), building materials (schfer., 2010), caves (ikner., 2007), and prehistoric paintings (portillo., 2009), and associated with the corrosion of materials (forte - giacobone., 2011). many of the related microorganisms were previously isolated from stones and artworks in the mediterranean area (portillo., 2009 2011) which supports the idea that medieval stained glass biodeterioration in the mediterranean area shows patterns comparable to those developed on the stone (garcia - valles., 2003, 2010). this is logical if we think that, in historic buildings, both the rock and the glass have been exposed to the same atmospheric conditions, which makes for similar mechanisms of decay on both materials. furthermore, taking into consideration that tarragona and barcelona are cities located at the mediterranean seaside, it is not surprising to find sequences related to methylobacterium sp. able to tolerate chloride (hiraishi., 1995), kocuria aegyptia isolated from saline environments (li., 2006), oligotrophic species of the genus arthrobacter isolated from the mediterranean sea (grtner., 2011), as well as fungal species detected in marine air (see table 4). comparing our data with previous studies focusing on the biological deterioration of historical glass, we find a lack of studies that combine different methodologies, with very few exceptions (carmona., 2006). to date, published studies have focused on the microscopic and chemical (garcia - valles and vendrell, 2002, 2003) or on the microbial characterization of historical glass samples by culture - dependent techniques (marvasi., only a few published works have reported on the molecular characterization of historical glass samples (rlleke., 1999 ; schabereiter - gurtner., 2001b ; carmona., 2006). in the first two molecular studies mentioned above, the authors investigated glass samples derived from the historical window of the chapel in stockkmpen, germany. (1999) analyzed the bacterial community of this window via dgge and 16s rdna sequence analysis., as well as members of the ammonia - oxidizing genus nitrosospira and several members of the actinobacteria, such as arthrobacter, frankia, and geodermatophilus. schabereiter - gurtner. (2001b) analyzed the fungal communities inhabiting the same window by 18s rdna - based dgge fingerprinting, creation of clone libraries, and sequencing, and compared the detected community with the one obtained from other glass windows located at the church of st. even though authors found fungal communities consisting of five to eight different fungi on these two glass windows, the molecular strategy they followed was fastidious and very time - consuming, as it was necessary to use at least three different fungal primer combinations to screen 18s rdna clone libraries. (2006) investigated the microbial communities (bacteria and fungi) associated with the historical stained glasses of the cartuja de miraflores monastery (spain). the bacterial communities were analyzed by 16s rdna - based dgge fingerprinting, although no attempt at identification was made. nowadays it is well known that there is a lack of taxonomic resolution between fungal 18s rrna genes to closely related taxa and, therefore, this region is not so accurate for an accurate phylogenetic identification of fungi (anderson and cairney, 2004). in recent years, its regions have become the selected genetic marker for studies on fungal communities in environmental samples (white. for this reason, in previous studies we developed a protocol to obtain dgge fingerprints derived from fungal its regions of dna directly extracted from different materials of cultural heritage (michaelsen., 2006). to date, we have successfully applied this molecular strategy to analyze fungal communities colonizing paper (michaelsen., 2006, 2009, 2010), stone monuments (piar., 2009), parchment (piar., 2011), oil paintings on canvas (lopez - miras, personal communication), human remains (piar, unpublished data) and, in the present study, glass samples. this strategy has proven easier and more reliable than the one using dgge fingerprints derived from 18s rdna fragments. in addition, with the exception of some few works (rlleke., 1999 ; carmona., 2006 ; marvasi., 2009) bacteria were thought not to be dominant colonizers of glass surfaces and not to play a relevant role in the observed deterioration phenomena. the results obtained in the present study clearly show that bacterial communities were more diverse than those of fungi and that the detected bacteria are phylogenetically related to well - known bacteria possessing metabolic activities able to produce the observed biodeterioration of the investigated glasses. this fact highlights the relevance of bacteria, together with fungi, in the biodeterioration of historical glass.	we investigated the decayed historical church window glasses of two catalonian churches, both under mediterranean climate. glass surfaces were studied by scanning electron microscopy (sem), energy dispersive spectrometry (eds), and x - ray diffraction (xrd). their chemical composition was determined by wavelength - dispersive spectrometry (wds) microprobe analysis. the biodiversity was investigated by molecular methods : dna extraction from glass, amplification by pcr targeting the16s rrna and its regions, and fingerprint analyses by denaturing gradient gel electrophoresis (dgge). clone libraries containing either pcr fragments of the bacterial 16s rdna or the fungal its regions were screened by dgge. clone inserts were sequenced and compared with the embl database. similarity values ranged from 89 to 100% to known bacteria and fungi. biological activity in both sites was evidenced in the form of orange patinas, bio - pitting, and mineral precipitation. analyses revealed complex bacterial communities consisting of members of the phyla proteobacteria, bacteroidetes, firmicutes, and actinobacteria. fungi showed less diversity than bacteria, and species of the genera cladosporium and phoma were dominant. the detected actinobacteria and fungi may be responsible for the observed bio - pitting phenomenon. moreover, some of the detected bacteria are known for their mineral precipitation capabilities. sequence results also showed similarities with bacteria commonly found on deteriorated stone monuments, supporting the idea that medieval stained glass biodeterioration in the mediterranean area shows a pattern comparable to that on stone.
valproic acid (vpa) has a clinical use as an anticonvulsant and mood - stabilizing drug, primarily in the treatment of epilepsy, bipolar disorder, and, less commonly, major depression. hyperammonemia (ha) has been generally associated with liver failure or rare genetic mutations in enzymes participating in the urea cycle. however, in some patients treated with vpa, severe ha has been observed in the absence of liver failure and resulting in vomiting, ataxia, behavioral changes, lethargy, somnolence, or, in extreme cases, coma. numerous cases of severe and life - threatening ha related to the vpa treatment mostly in children, adolescents, and also adults have been previously reported in the medical literature (> 220 published reports in medline since 1980 by search using vpa and ha as keywords in august 2012). the exact mechanism of vpa - induced encephalopathy is unclear but relates to the accumulation of toxic vpa metabolites and elevated ammonia levels [2, 3 ]. the prior limited data from exclusively japanese cohort suggested that patients treated with vpa and who carry the t1405n (4217c > a, rs1047891) missense single nucleotide polymorphism (snp) in the carbamoyl phosphate synthetase 1 gene might be more likely to experience ha. the main goal of this project was to investigate, for the first time in caucasian cohort, if carbamoyl phosphate synthetase 1 (cps1) gene t1405n missense variant can be associated with increased occurrence of ha in subjects treated with vp. this prospective multicenter cohort study was performed between april 2011 and september 2012 using the study protocol which was approved by irb at psu hershey medical center, hershey, pa, usa, and institute of psychiatry and neurology in warsaw, poland. all subsequent caucasian adult patients treated with vpa (irrespective of age and gender) and satisfying the inclusion and exclusion criteria were enrolled into the study. inclusion criteria included adults (> 18 years of age) and treatment with vpa for the period of > 1 year. exclusion criteria included pregnancy, severe hepatic disease (as documented by both clinical diagnosis and grossly abnormal liver function tests), end - stage kidney disease, that is, requiring dialysis, and advance mental retardation that prevents signing of the informed consent. ha was defined as the plasma ammonia level > 65 mol / l (representing values larger than 95 percentile of the normal range by standard laboratory testing) at the time of enrollment. whole blood samples were collected into edta - tubes and frozen at 80c until analysis. genomic dna (gdna) was extracted from blood sample employing membrane ultrafiltration method using fuji minigene 80 semiautomatic extractor (fujifilm life sciences distributed by autogen, holliston, ma, usa), according to the manufacturer 's recommendations. the saliva samples were collected into oragene containers (dna genotek, canada) and extracted according to the manufacturer 's recommendations. gdna analysis of clinical samples was performed in triplicates using custom snp real - time pcr taqman genotyping assay (applied biosystems, foster city, ca, usa) and according to the manufacturer 's protocol. briefly, gdna was incubated with two custom designed flanking primers for amplifying the sequence of interest and two taqman mgb probes for detecting specific alleles containing a reporter dye (vic and fam) at the 5 end of each allele - specific probe and nonfluorescent quencher at the 3 end of the probe. the real - time pcr analysis was performed using taqman universal master mix, no amperase ung in 384-well optical plate using an applied biosystems prism 7900ht sequence detection system at pshmc genomic core facilities, hershey, pa, usa. following pcr amplification, endpoint fluorescence measurements from each well will be obtained, and the alleles present in each sample were identified. the primary analysis for the first specific aim utilized univariate logistic regression with a carrier status for minor allele as independent variable and a presence of ha (yes / no) phenotype as dependent variable. the logistic regression procedure enabled us to estimate the log of the odds ratio (or), a measure of the increase in odds of experiencing ha for subjects carrying the variant compared to the wild - type subjects. we obtained 95% confidence interval around this estimate and the p value for the or. the p value was compared with the predefined cutoff for statistical significance (alpha = 0.05). a significant association between carrying t1405n variant and increased risk of vpa - induced ha has been expected, therefore, the association was adjusted for the predefined covariates to determine whether the association between cps1 4217c > a and risk of vpa - induced ha remains significant after inclusion of factors. given the expected population incidence of vpa - induced ha of approximately 10%, expected frequency for minor allele of 0.35, alpha level = 0.05, and the power of 0.8, at least 140 patients were needed to detect or > 4 for experiencing ha in carriers of minor allele. in total, 142 subjects were enrolled in the study, from which 97 were enrolled in hershey, pa, usa, and 45 in warsaw, poland. in 95% of the enrolled patients, the observed plasma level of ammonia ranged between 9 and 181 mol / l (mean standard deviation 31.6 16.4 mol / l) in the investigated cohort of patients, and ha (defined as ammonia plasma level > 65 mol / l) was observed in total of 11 (7.7%) of patients treated with vpa. the distribution of cps1 genotypes for the polymorphism within overall study population fulfilled hardy - weinberg criteria (fisher 's exact test, p > 0.05). the observed genotype distribution (cc denotes homozygosity for the c - encoded thr1405 variant, aa homozygosity for the a - encoded asn1405 variant, and ac heterozygosity for polymorphism at position 1405) in investigated patients was cc : ca : aa = 69 : 61 : 13, n = 142). no significant differences among the two centers were observed in genotype distribution or clinical characteristics in patients enrolled in the study with exception of statistically significant more patients on multiple antiepileptic medications in pennsylvania cohort and higher level of ammonia in the warsaw cohort (table 1). the univariate analysis of the carriers and noncarriers of the thr1405 variant revealed a significant association with ha phenotype in the overall study group (p = 0.009, odds ratio 5.4 with 95% confidence interval of 1.5818.43). multifactorial logistic regression indicated that thr1405 carrier status is independently associated with ha after adjusting for study center, age, gender, total 24 hr vpa dose, vpa plasma concentrations, and the number of concomitant antiepileptic medications administered with vpa (not shown). no significant differences between medians of absolute blood concentrations of ammonia were observed in the three genotypes for the investigated variant (figure 1) or carrier versus noncarriers of the investigated minor allele. identifying early biomarkers for patients at risk for vpa - induced ha remains an elusive research goal. both heterozygous and homozygous carrier states of the t1405n polymorphism and concomitant administration of two or more anticonvulsants with vpa were shown previously to be independent risk factors for developing ha in the relatively small cohort of patients (n = 79) from japan and single case report from our laboratory [4, 5 ]. in the recent larger study, yamamoto. identified several other risk factors for ha in pwe, including vpa dose and use of hepatic enzyme inducers, although genetic polymorphism was not analyzed in this study. built on the previous reports, we hypothesized that in a caucasian population of patients without liver failure and treated with vpa, genetically determined variations in cps1 function would be associated with increased incidence of ha. our data confirms this hypothesis, because we did observe that the percentage of patients with ha was significantly higher in the carriers of the minor allele when compared with the carriers of two wild - type alleles for the investigated polymorphism (i.e., dominant model of inheritance). because the current study was not powered to investigate other factors involved in ha, we can not conclude with absolute certainty that other factors (e.g., vpa dose, concomitant use of other anticonvulsants) could be associated with increased occurrence of ha in the investigated cohort of patients during prolonged vpa treatment. the urea cycle is an essential process for the removal of ammonia from the body, and its initial step is the conversion of ammonia and bicarbonate into carbamoyl phosphate via hepatic mitochondrial cps1. the effects of vpa on urea metabolism are complex and occur in the liver mitochondria. inherited deficiency of cps1 with severe ha is a rare autosomal recessive disorder with a prevalence of 1 : 200,0001 : 800,000 (http://omim.org/entry/237300). at present, more than 60 severe deficiency - causing mutations in the cps1 gene have been identified (2012 human genome mutation database, http://www.hgmd.org/). less severe deficiency or reduced activity of cps1 is thought to be associated with vpa - induced ha. vpa preferentially inhibits cps1, which in turn may lead to a dose independent increase in the concentration of its substrate ammonia in the blood [7, 8 ]. vpa may also inhibit carnitine transportation into the mitochondria which is responsible for the shift in the balance of metabolism towards protein degradation with subsequent ha. t1405 polymorphism in the cps1 gene results in a threonine to asparagine amino acid substitution at an important cofactor (i.e., n - acetylglutamate) binding site in exon 36 of cps1. previous studies demonstrated the association of the cps1 t1405 polymorphism with neonatal pulmonary hypertension and necrotizing enterocolitis [1012 ]. several studies reported that asymptomatic ha patients had problems related to seizure control, developmental delay, and intellectual disability [13 ]. in addition, it was reported recently that the preexisting ha may be further exacerbated in stress - related situations (perioperative period for surgical procedures) which may increase the postoperative risk for these patients [13, 14 ]. it is important therefore to establish risk factors for an elevated ammonia level and to perform the measurement of ammonia irrespective of whether patients are asymptomatic or not, in particular in situations which may lead to further exacerbation of ha. in conclusion, the t1405n (4217c > a, rs1047891) missense was found to be a significant risk factor for the occurrence of ha in caucasian patients undergoing vpa therapy, even in subjects with normal plasma levels of vpa.	numerous cases of severe and life - threatening hyperammonemia (ha) related to the treatment of epileptic seizures with valproic acid (vpa) have been previously reported in the medical literature. the aim of this prospective, multicenter study was to verify the putative association between t1405 polymorphism and occurrence of vpa - induced ha in the cohort of 142 adult caucasian patients with epilepsy treated with vpa for at least 1 year and with normal liver functions. the nonsynonymous t1405n polymorphism genotyping was performed by real - time taqman pcr genotyping. in addition to plasma ammonia level, concentrations of liver enzymes and total vpa were measured in plasma with standard laboratory methods. ha (defined as ammonia plasma level > 65 mol / l) was observed in total of 11 (7.7%) of patients treated with vpa, and the carrier status for the investigated polymorphism was significantly (p = 0.009, odds ratio 5.4 with 95% confidence interval of 1.5818.43) associated with the occurrence of ha. the results of this study support a notion that in the caucasian patients with epilepsy undergoing vpa therapy, a t1405n (4217c > a, rs1047891) nonsynonymous variant was a significant risk factor for the occurrence of ha, even in patients with normal plasma levels of vpa.
central effect of carbohydrate (cho) on endurance performance (4, 6, 7, 12, 13, 16). this idea was first postulated when it was discovered that cho ingestion, during activity that is not limited by cho availability or oxidation rate, such as high intensity (e.g. > 70% vo2max) relatively short duration (up to 1 h) exercise, is associated with enhanced performance (1, 10). (5) that the intravenous infusion of glucose during a 1 h cycling time - trial did not improve performance, despite the previous work showing ingestion to improve performance. following this, carter. (4) were the first to provide evidence that cho (maltodextrin) mouth rinses improved performance compared to that of a control rinse of water. this led to the suggestion that cho sensing occurs in the mouth resulting in an ergogenic effect on performance via a central action, possibly by enhancing motor drive or motivation (or blunting their perturbation) during fatiguing exercise. a considerable body of research now exists showing that simply rinsing the mouth with a cho - containing solution can have an ergogenic effect on endurance exercise (4, 6, 7, 1113), although not all studies have observed benefits (2, 21). the work of chambers. (6) is particularly important as they have demonstrated that cho sensing in the mouth is associated with activation of reward centers in the brain and that this is independent of sweetness. (8) have provided evidence that the presence of a non - sweet carbohydrate (maltodextrin) in the mouth may enhance muscle function and facilitate corticomotor output. together, these findings provide mechanistic evidence that cho does have central, non - metabolic, ergogenic effects that can be induced simply by the presence of cho in the mouth, although there is a lack of evidence on the effect of different doses. the cho concentrations used in all of the previous mouth rinse studies are ~ 6% weight / volume (w / v), which seems to be somewhat arbitrarily based on the composition of commercially available sports drinks and previous work on cho ingestion. however, as the mechanisms for performance benefit with rinse are very different to those with ingestion there could be greater benefit with higher concentrations, but this has not yet been determined. evidence suggests that the mechanisms responsible for the ergogenic effects of cho mouth rinsing are related to cho - sensing in the oral cavity (6). however, it is unknown whether these oral receptors are sensitive to the concentration of cho in the solution and no dose - response studies have been conducted with cho mouth rinsing. in rodents allowed free access to different solutions, it has been demonstrated that, for glucose as well as cho polymer solutions, there is a concentration - dependent effect on affective behavior response. although animals ingested the solutions, knockout of the t1r2 and t1r3 proteins demonstrated that these behaviors were attributable, at least in part, to oral cho receptors (20). 20) showed a dose - response effect with 9% w / v being the optimal concentration for glucose in their wild - type mice. there was little difference, compared to water, for solutions with a concentration of 4.5% and lower, whereas there was a plateau at concentrations above 9%. equivalent evidence is lacking in humans and there are no dose - response studies with mouth rinsing rather than ingestion. however, smeets. (17) conducted an fmri study (to measure hypothalamic responses) with glucose ingestion at a variety of solution concentrations (0%, 8.3% and 25% w / v) and observed significant effects of the cho within minutes of ingestion. since these effects were observed immediately after ingestion (i.e. before any absorption or metabolic effects would manifest) this does suggest similar non - metabolic effects to those observed by chambers. (6). in this study, these observed effects were more marked with the higher concentration glucose solution (17). taken together, the evidence discussed above provides support for the notions that the optimal cho concentration to induce positive performance effects in humans could also be greater than the typical ~6% used in previous mouth rinse studies. furthermore, no studies have yet determined the effects of cho mouth rinsing on exercise of longer than 1 h in duration. therefore, the aims of this study were 1) to determine whether a carbohydrate mouth rinse enhances performance in a 90 minute treadmill performance trial ; and 2) to determine whether a higher concentration (12%) has a greater effect than a 6% solution. this study was conducted according to the guidelines laid down in the declaration of helsinki (2004). all procedures were approved by aberystwyth university research ethics committee for research involving human participants. written informed consent was obtained from all subjects. subjects also completed a pre - exercise screening questionnaire (physical activity readiness questionnaire) before participating in each test. seven male university students (age 21 1 years ; body mass 78 7 kg ; stature 1.81 0.12 m ; means standard deviation) participated in this study. all subjects were physically active and represented the university in a competitive sports team (e.g. football [soccer ], rugby, field hockey) but were not specifically endurance trained. all subjects took part in a familiarization trial and three main (experimental) trials : placebo (pla, 0% cho - electrolyte solution, cho - e, rinse solution), 6% cho - e rinse solution, and 12% cho - e rinse solution. all trials took place at the same time of day (start time within 1 hour) for each subject, and were separated by at least five days. participants first completed the familiarization trial, which was identical to the main trials except plain water was used as the mouth rinse solution. in this trial subjects the main trials were conducted in randomized order and solutions were administered double - blind. in addition they were required to keep a record of food and activity during the 24 hours before the first main trial and replicate this before any subsequent trials. all trials were conducted on a motorized treadmill (pps 55med, woodway gmbh, weil am rhein, germany). subjects were first asked to perform a 5 minute warm up at 6 km / h before beginning the performance trial. the test began with a rolling start (at a treadmill speed of 8 km / h) and subjects were allowed to freely control the treadmill speed using the manual controls located on the handrail. they were instructed to cover as much distance as possible during the 90 min test. subjects were not able to see the treadmill speed or distance covered, or heart rate, on the display panel but they were allowed to see the clock showing time elapsed. no encouragement was provided to the subjects during all of the tests. carbohydrate - containing solutions were made with a commercially available cho - electrolyte product (h5 ltd., derby, uk) supplied as a powder. the powder was mixed with concentrated, artificially sweetened (saccharin), cordial drink and plain water (1:3 ratio concentrate : water) to give final cho concentrations of 6% and 12% w / v, with approximately 418 mg and 836 mg of sodium per liter in the 6% and 12% solutions, respectively. the cho was comprised of maltodextrin (95%), dextrose (3%) and maltose (2%) and the pla solution did not have any of this powder added but contained additional sweeteners (saccharin) to help with blinding, in accordance with the methods of chambers. (6). for the rinse procedure subjects they were required to rinse the solution in their mouth for 5 seconds before expectorating back into the cup. the cups were marked with a graduation at 25 ml so that the volume of expectorate could be inspected to ensure that none of the liquid was swallowed. the first mouth rinse procedures occurred after the warm up and then at 15, 30 and 45 minutes of the performance trial. room temperature and atmospheric pressure were monitored and recorded, prior to each trial, with a temperature probe (rotronic hygromer pt100, grant instruments, cambridge, uk) connected to an electronic data logger (squirrel sq2020, grant instruments, cambridge, uk) and a mercury column direct reading barometer (cranlea, birmingham, uk), respectively. the distance and speed were recorded every 10 minutes during each trial and total distance was recorded at the completion of the 90-minute period. the distance covered at each 10 min split was used to calculate average speed over each segment. heart rate was measured using a telemetric device (polar s610i, kempele, finland). rating of perceived exertion (rpe), and subjective ratings of feeling and arousal were expressed using the borg scale (3), feeling scale (9), and arousal scale (19), respectively. these measures were recorded after the warm up and every 15 minutes during each trial. was collected at 15, 30 and 45 minutes during the trials using 150 l douglas bags. oxygen and carbon dioxide concentrations were determined using paramagnetic oxygen and infrared carbon dioxide analyzers (servomex 4100, crowborough, uk) and gas volume was measured with a dry gas meter (harvard apparatus ltd., edenbridge, uk) in order to determine oxygen consumption and carbon dioxide output. capillary blood samples were obtained from a fingertip pre- (5 min before warm - up) and post - exercise (immediately on completion of the 90 min run) using an automatic lancet device (soft clix pro, accu - check, mannheim, germany) and collected into lithium - heparin treated microtubes (microvette cb300, sarstedt, nmbrecht, germany) for the determination of blood glucose and lactate concentrations using an automated analyzer (ysi 2300 stat plus, yellow springs, oh, usa). data analyses were carried out using the software package spss (v17.00 ; spss inc., all data were normally distributed as determined by z - scores for skewness and kurtosis (within 2), with the exception of feeling scale data. oneway repeated measures anova tests (with holm - bonferroni corrected post hoc paired t - tests, where necessary) were used to compare performance (distance covered), and ambient conditions between trials. for normally distributed data, 2-way (trial time) repeated measures anova was used to compare variables with multiple measurement points during the trials (distance, speed, heart rate, rpe, arousal, blood [glucose ], blood [lactate ], and respiratory variables) between trials. if the sphericity assumption was violated the greenhouse - geisser correction was applied to anova p values (indicated by subscript gh after p values in the text), otherwise no correction was applied. for the feeling overall comparisons were made between trials and within trials (across time) with the friedman test. also, the discrepancy between the first and last times was compared between trials for equivalence with the trial time interaction comparisons in a 2-way anova. seven male university students (age 21 1 years ; body mass 78 7 kg ; stature 1.81 0.12 m ; means standard deviation) participated in this study. all subjects were physically active and represented the university in a competitive sports team (e.g. football [soccer ], rugby, field hockey) but were not specifically endurance trained. all subjects took part in a familiarization trial and three main (experimental) trials : placebo (pla, 0% cho - electrolyte solution, cho - e, rinse solution), 6% cho - e rinse solution, and 12% cho - e rinse solution. all trials took place at the same time of day (start time within 1 hour) for each subject, and were separated by at least five days. participants first completed the familiarization trial, which was identical to the main trials except plain water was used as the mouth rinse solution. in this trial subjects the main trials were conducted in randomized order and solutions were administered double - blind. in addition they were required to keep a record of food and activity during the 24 hours before the first main trial and replicate this before any subsequent trials. all trials were conducted on a motorized treadmill (pps 55med, woodway gmbh, weil am rhein, germany). subjects were first asked to perform a 5 minute warm up at 6 km / h before beginning the performance trial. the test began with a rolling start (at a treadmill speed of 8 km / h) and subjects were allowed to freely control the treadmill speed using the manual controls located on the handrail. they were instructed to cover as much distance as possible during the 90 min test. subjects were not able to see the treadmill speed or distance covered, or heart rate, on the display panel but they were allowed to see the clock showing time elapsed. carbohydrate - containing solutions were made with a commercially available cho - electrolyte product (h5 ltd., derby, uk) supplied as a powder. the powder was mixed with concentrated, artificially sweetened (saccharin), cordial drink and plain water (1:3 ratio concentrate : water) to give final cho concentrations of 6% and 12% w / v, with approximately 418 mg and 836 mg of sodium per liter in the 6% and 12% solutions, respectively. the cho was comprised of maltodextrin (95%), dextrose (3%) and maltose (2%) and the pla solution did not have any of this powder added but contained additional sweeteners (saccharin) to help with blinding, in accordance with the methods of chambers. they were required to rinse the solution in their mouth for 5 seconds before expectorating back into the cup. the cups were marked with a graduation at 25 ml so that the volume of expectorate could be inspected to ensure that none of the liquid was swallowed. the first mouth rinse procedures occurred after the warm up and then at 15, 30 and 45 minutes of the performance trial. room temperature and atmospheric pressure were monitored and recorded, prior to each trial, with a temperature probe (rotronic hygromer pt100, grant instruments, cambridge, uk) connected to an electronic data logger (squirrel sq2020, grant instruments, cambridge, uk) and a mercury column direct reading barometer (cranlea, birmingham, uk), respectively. the distance and speed were recorded every 10 minutes during each trial and total distance was recorded at the completion of the 90-minute period. the distance covered at each 10 min split was used to calculate average speed over each segment. heart rate was measured using a telemetric device (polar s610i, kempele, finland). rating of perceived exertion (rpe), and subjective ratings of feeling and arousal were expressed using the borg scale (3), feeling scale (9), and arousal scale (19), respectively. these measures were recorded after the warm up and every 15 minutes during each trial. expired respiratory gas was collected at 15, 30 and 45 minutes during the trials using 150 l douglas bags. oxygen and carbon dioxide concentrations were determined using paramagnetic oxygen and infrared carbon dioxide analyzers (servomex 4100, crowborough, uk) and gas volume was measured with a dry gas meter (harvard apparatus ltd., edenbridge, uk) in order to determine oxygen consumption and carbon dioxide output. capillary blood samples were obtained from a fingertip pre- (5 min before warm - up) and post - exercise (immediately on completion of the 90 min run) using an automatic lancet device (soft clix pro, accu - check, mannheim, germany) and collected into lithium - heparin treated microtubes (microvette cb300, sarstedt, nmbrecht, germany) for the determination of blood glucose and lactate concentrations using an automated analyzer (ysi 2300 stat plus, yellow springs, oh, usa). data analyses were carried out using the software package spss (v17.00 ; spss inc., all data were normally distributed as determined by z - scores for skewness and kurtosis (within 2), with the exception of feeling scale data. oneway repeated measures anova tests (with holm - bonferroni corrected post hoc paired t - tests, where necessary) were used to compare performance (distance covered), and ambient conditions between trials. for normally distributed data, 2-way (trial time) repeated measures anova was used to compare variables with multiple measurement points during the trials (distance, speed, heart rate, rpe, arousal, blood [glucose ], blood [lactate ], and respiratory variables) between trials. if the sphericity assumption was violated the greenhouse - geisser correction was applied to anova p values (indicated by subscript gh after p values in the text), otherwise no correction was applied. for the feeling overall comparisons were made between trials and within trials (across time) with the friedman test. also, the discrepancy between the first and last times was compared between trials for equivalence with the trial time interaction comparisons in a 2-way anova. room temperature (anova, p = 0.725) and barometric pressure (anova, p = 0.282) were relatively stable and similar between trials. mean temperature was 19.5 1.0 c, 19.7 1.2 c, and 19.2 1.6 c for the pla, 6% cho - e and 12% cho - e trials, respectively. mean barometric pressure was 743 6 mmhg, 752 11 mmhg, and 755 21 mmhg for the pla, 6% cho - e and 12% cho - e trials, respectively. there was a significant difference between trials in distance covered during the 90 minute performance run (anova, p = 0.001, see table 1a and table 1b). post hoc analyses revealed that there was a significant difference between the pla and 6% cho - e trials (p = 0.035) and between the pla and 12% cho - e trials (p = 0.003). there was no difference between the 6% cho - e and 12% cho - e trials (p = 0.196). two - way repeated measures anova revealed a significant main effect of trial (p = 0.001) for average speed over each 10-minute segment of the run (figure 1). there was also a trend for an effect of time (p = 0.053) but no significant trial time interaction (p = 0.436). due to the main effect of trial, the average speed for each 10 min segments were compared between trials with 1-way anova and post hoc paired t - tests (holm - bonferroni corrected) where necessary (see figure 1). there were no significant differences between trials in the first 60 min (1-way anova, p = 0.506, 0.213, 0.823, 0.359gh, 0.933, 0.373 for the first 6 segments, respectively). for the 7 and 8 segments there were significant differences (p = 0.001 and 0.010, respectively) but there were no differences for final segment (p = 0.141). post hoc comparisons revealed that the average segment speed, in the 7 segment, was significantly lower in the pla trial compared to the 6% cho - e (p = 0.014) and 12% cho - e (p = 0.003) trials with no difference between the 6% and 12% cho - e trials (p = 0.156). in the 8 segment average speed was lower in the pla trial compared to the 6% cho - e (p = 0.038) and 12% cho - e (p = 0.021) trials with no difference between the 6% and 12% cho - e trials (p = 0.889). for heart rate (table 2), 2-way repeated measures anova showed no significant main effect of trial (p = 0.131) or trial time interaction (p = 0.097) heart rate increased progressively during the trial with each point significantly higher than the previous one (all p < 0.05) with one exception, in that the heart rate at 75 minutes was not significantly different from 60 minutes (p = 0.573). for blood glucose concentration (table 2) the 2-way repeated measures anova showed no significant main effect of trial (p = 0.246) and trial time interaction (p = 0.511). there was a significant main effect of time (p = 0.018) with higher concentrations post - exercise. for blood lactate concentration (table 2) the 2-way repeated measures anova showed no significant main effect of trial (p = 0.761) and trial time interaction (p = 0.938). there was a significant main effect of time (p = 0.018) with higher concentrations post - exercise. for rating of perceived exertion 2-way repeated measures anova showed no significant main effect of trial (p = 0.258) and trial time interaction (p = 0.657). rpe increased progressively during the trial with each point significantly higher than the previous one (all p < 0.05, see table 2). for feeling scale ratings (figure 2), a friedman test revealed a significant effect of time (p < 0.001) in all trials (pla, 6% cho - e and 12% cho - e). there were no between trial differences at any of the time points although there was a trend at 90 min (friedman, p = 0.084). a 1-way anova on the discrepancy data (which were normally distributed) revealed a significant difference between trials (p = 0.030). post hoc analysis for the discrepancy data revealed no difference between the pla and 6% cho - e trials (p = 0.173), a significant difference between the pla and 12% cho - e trials (p = 0.030) and no difference between the 6% and 12% cho - e trials (p = 0.386). when analyzed in 30-minute segments feeling data were normally distributed and 2-way repeated measures anova revealed a significant main effect of time (p < 0.001gh). there was no significant main effect of trial (p = 0.593) and a trend for a trial time interaction (p = 0.071). post hoc analysis for the time effect showed that feeling ratings were significantly lower in the last 30-minute segment compared to the first 30-minute (p = 0.002) and second 30-minute (p = 0.003) segments. ratings were also significantly lower in the second compared to first 30-minute segment (p < 0.001). for arousal ratings (table 2), 2-way repeated measures anova showed no significant main effect of trial (p = 0.328), time (p = 0.125gh) and trial time interaction (p = 0.377). for oxygen consumption (table 3), 2-way repeated measures anova showed no significant effect of trial (p = 0.247), time (p = 0.082) or trial time interaction (p = 0.244). for carbon dioxide output (table 3), 2-way repeated measures anova showed no significant effect of trial (p = 0.066), time (p = 0.476gh), or trial time interaction (p = 0.151gh). for respiratory exchange ratio (table 3), 2-way repeated measures anova showed no significant main effect of trial (p = 0.886), time (p = 0.533) and trial time interaction (p = 0.477). the main findings of the present study are that rinsing the mouth with a carbohydrate - electrolyte (cho - e) solution, compared to a cho - e - free placebo, resulted in the accumulation of a greater distance in a 90-minute running performance trial on a motorized treadmill at a self - selected pace. however, a higher cho concentration solution (12% w / v) did not result in additional performance benefit compared to a standard cho concentration of 6% w / v. these findings agree with previous research showing enhanced endurance performance with cho and cho - e mouth rinses but this is the first study to show that there is no dose - response effect above concentrations of ~6%. significantly more distance was covered in the 6% cho - e (p = 0.035) and 12% cho - e (p = 0.003) trials compared to the placebo trial. however, there was no significant difference (p = 0.196) between the two cho - e containing solutions (table 1). it would appear that the performance differences were attributable to a better speed maintenance in the final 20 min of the cho - e trials (figure 1), despite the fact that the last solution was provided 45 min before the end of the trial. this suggests that the beneficial effects of cho - e mouth rinsing during prolonged exercise may persist for at least 20 45 minutes, which may have practical relevance in situations in which free access to drinks / solutions is restricted by the nature of the sport or activity (e.g. drinks stations in endurance races or breaks in match play). the speed profile in the present study suggests that the performance benefit is evident in the latter stages of the trial, at a time when fatigue becomes more apparent (i.e. speed or power output tends to decrease) rather than increasing speed in the earlier stages. (4) who observed differences in the first 3 quarters of a cycling time - trial (although differences could be related to differences between studies in trial duration and exercise mode). however, in the present study, no rinses were provided after 45 minutes meaning that the effects either persist for more than 20 minutes post - rinse or are caused by other mechanistic pathway(s). other potential mechanisms include : some cho from the rinse remaining adhered to receptors in mouth (i.e. not rinsed away) after expectoration ; or there is some cephalic phase hormonal response which exhibits a lag of effect duration, and/or has some effect on performance (or fatigue) in the latter stages. however, these mechanisms can not be confirmed or refuted by the present data and further research is now needed to determine the mechanisms responsible for this apparent persistent effect and the duration for which the effects remain after the final (or each) rinse. interestingly, smeets. (18) observed changes in fmri signal that persisted for at least 30 minutes after the ingestion of glucose and energy - free, artificially sweetened beverages. these data lead the present authors to suggest that the effects observed in our study were due to central effects persisting for this time period (i.e. at least 30 minutes post - rinse). although, the study of smeets. (18) was an ingestion study the fact that these effects persisted for at least 30 minutes in the energy - free drink condition suggest that some taste receptors, albeit for sweetness in this instance, may be able to stimulate brain responses that persist for this time period. although it is believed that the performance effects are due to different receptors (for cho, not sweetness) this data seems to support the notion that receptor - mediated mechanisms of action for cho rinsing (and hence oral detection) stimulates central effects that persist (or remain above control conditions, being beneficial) for at least 30 minutes, although this must be confirmed with similar studies on cho rinsing before this theory can be accepted. (13) used a 1 hour performance run, in which subjects were instructed to run as far as possible in the allowed time, and observed that greater distance was covered with a cho - e compared to pla mouth rinse. mean running speed was relatively stable throughout most of the trial with the exception of the first 5 minutes when it was slower (presumably whilst subjects were adjusting and settling in to their preferred pace), and the final 5 minutes when mean speed was increased significantly (the familiar sprint finish that is commonly observed in such performance trials, (15)). interestingly, mean running speed was significantly higher in the cho - e condition at two points in the middle of the run (5-minute average sections 2530 min and 3540 min) as well as in the final 5 minutes, which combined to produce better overall performance in the cho - e trial. a similar profile was evident in the present study in that mean running speed was relatively stable over the duration of the 90-minute run, with segmental analysis showing no differences between trials until the final 30 minutes, where mean running speed was significantly higher than pla in both choe trials. there were no significant differences in the present study between the two cho - e solutions (6% and 12 % cho). this suggests that cho - e rinsing in the current study had no impact on the early and middle stages of the trials, which differs from the findings of rollo. the present findings are in agreement, however, with whitham and mckinney (21), although they reported no significant difference between cho and pla mouth rinses for a 45-minute running performance trial, as the benefits in our study only become evident after 60 minutes or more. the rpe results showed significant differences across time (p < 0.001), which differs from the suggestions of carter (4) in that subjects did not select speeds that maintained a constant rpe. rather, average speed was relatively stable over the first two thirds of the trial whilst rpe progressively increased, culminating with near maximal ratings at the end (coinciding with the familiar sprint finish as mentioned above). however, this appears to be more typical of running rather than cycling protocols (13). nevertheless, the fact that rpe was not different between trials shows that more work was performed for the same relative subjective exertion, in agreement with previous studies in cycling (4), and running (13). a similar pattern was also evident for the feeling scale ratings, in that there was a significant decrease in ratings as the trial progressed but there were no differences between trials (figure 2a) showing that faster times and more work were achieved in the cho - e trials for the same (or less) relative decrease in feeling ratings. (6) that enhanced feeling ratings contributed to the enhanced performance with cho mouth rinsing. in the present study feelings ratings, when analyzed in 30 minute segments did show a trend (p = 0.071) for a trial time interaction. furthermore, analysis of the feeling rating discrepancy scores showed a smaller discrepancy with cho - e, although this only reached statistical significance (compared to pla) in the 12% cho - e mouth rinse trial (p = 0.030). it would seem, therefore, that the higher concentration mouth rinse may better limit the typical reduction in feeling ratings observed during prolonged exercise but this does not appear to be of sufficient magnitude to further enhance performance when compared to the 6% cho - e rinse solution, although this requires further research. it is possible that subjects could have ingested some of the solutions during the rinse procedure. however, clear instructions were provided to expectorate all of the solution and this was practiced in the familiarization trials. the expectorated solution was visually inspected to ensure a volume similar to that taken into the mouth was expelled (beakers were clearly marked to aid this). whilst it is possible that this could be confounded by saliva output, this volume is negligible (saliva flow rate is usually less than 0.5 ml) in the time allowed for rinsing. as the sample size was quite small it is conceivable that there was insufficient statistical power to detect differences between the 6% and 12% doses, which may be expected to be more subtle than the differences between pla and cho - containing solutions. however, post hoc power analysis on the present data revealed that a larger sample size would be unlikely to result in a finding of a significant difference between doses. nevertheless, we can not exclude the possibility that a much greater sample size (n = 30 or more) would have resulted in a significant difference between cho doses (6% and 12%) but further research is required to determine whether this would actually be the case. however, the solutions were taste matched and all drinks were flavored and strongly sweetened with artificial sweeteners. we believe that we were successful at blinding the subjects from trial order as when questioned after each trial (which were at least 1 week apart) subjects could not distinguish between the solutions. after all 3 trials had been completed subjects were also asked to reflect on all trails again and suggest which solution they received in each. only one subject guessed all trials correctly and 4 guessed 1 trial correctly. however, all 7 participants covered a greater distance in both cho - e trials compared to the pla. hence, whilst we can not rule out the possibility of a placebo effect in some subjects, because of the fact that all subjects performed better with cho - e (regardless of how they guessed) we are confident that the observed effects are due to cho - sensing in the mouth as suggested previously (4, 6, 13). it should also be noted that metabolic data (e.g. gas exchange variables) were only collected in the first 45 minutes yet the differences observed in the performance tests did not occur until after 60 minutes. whilst we are confident that the observed effects of cho rinsing were indeed non - metabolic (also supported by blood glucose and lactate measurements at the beginning and end of trials) it would be beneficial to also measure gas exchange throughout the whole exercise bout in future studies. in the study by rollo. (13) they used a customized automated treadmill to allow self - paced running whereas the current study used a traditional motorized treadmill with manual controls located on the handrail. according to whitham and mckinney, (21) studies in which runners manually change their running speed (e.g. using a traditional motorized treadmill) might not have the same degree of sensitivity to nutritional interventions as is the case when using an automated treadmill. this does not seem to have been true in the present study however, possibly due to the longer duration of the performance trial. therefore, it is possible that the use of longer duration running (e.g. 90 minutes) provides sufficient sensitivity to detect differences in self - paced treadmill running, even with a manual treadmill. in summary, we have demonstrated that rinsing the mouth with a cho - e solution, compared to placebo, enhances distance covered in a 90-minute running performance trial. this is the first study to show that a higher concentration solution (12% cho w / v) does not offer any additional benefit compared to a standard concentration of 6% w / v, thus there is no dose - response effect with cho concentration above ~6%. it is not known whether 6% is actually the optimal concentration for a cho - containing mouth rinse solution or whether similar effects can be achieved with lower concentrations. hence, the minimal concentration of cho that is required to elicit these ergogenic effects has not been determined and this requires further research. the cho - e mouth rinse seemed to have a positive effect on the subjects feelings in the later stages of the 90-minute running performance trial and the speed of the athletes in the final 1030 minutes were greater in the cho - e trials compared to the pla trials, despite the fact that the last rinse procedure occurred 45 minutes before the end of the trial. furthermore, there was no difference in rpe despite greater speeds being obtained in the cho - e trials. this supports previous work suggesting that cho mouth rinsing acts via a central action related to motivation, perceptions of effort and/or motor drive but shows, for the first time, that this effect is also capable of having ergogenic effects in more prolonged exercise. based on the current results it would seem that it is not the quantity of cho in the mouth rinse that enhances performance, it is the fact there is a presence of cho in the mouth. in addition, the benefits seem to last for at least 2045 minutes after the final mouth rinse, which could have practical relevance in situations when access to drinks / rinsing is limited or not readily available at all times.	there is a substantial body of recent evidence showing ergogenic effects of carbohydrate (cho) mouth rinsing on endurance performance. however, there is a lack of research on the dose - effect and the aim of this study was to investigate the effect of two different concentrations (6% and 12% weight / volume, w / v) on 90 minute treadmill running performance. seven active males took part in one familiarization trial and three experimental trials (90-minute self - paced performance trials). solutions (placebo, 6% or 12% cho - electrolyte solution, cho - e) were rinsed in the mouth at the beginning, and at 15, 30 and 45 minutes during the run. the total distance covered was greater during the cho - e trials (6%, 14.6 1.7 km ; 12%, 14.9 1.6 km) compared to the placebo trial (13.9 1.7 km, p 0.05). there were no between trial differences (p > 0.05) in ratings of perceived exertion (rpe) and feeling or arousal ratings suggesting that the same subjective ratings were associated with higher speeds in the cho - e trials. enhanced performance in the cho - e trials was due to higher speeds in the last 30 minutes even though rinses were not provided during the final 45 minutes, suggesting the effects persist for at least 2045 minutes after rinsing. in conclusion, mouth rinsing with a cho - e solution enhanced endurance running performance but there does not appear to be a dose - response effect with the higher concentration (12%) compared to a standard 6% solution.
increasingly, cardiac biomarkers have provided important information in predicting short - term and long - term risk profiles in patients with acute coronary syndromes (acs), particularly when they are used in combination. among the numerous biomarkers, high - sensitivity c - reactive protein (hscrp) has received widespread interest and a large database has been accumulated on their potential role as predictor of cardiovascular events [2, 3 ]. growth - differentiation factor-15 (gdf-15) is one of more than 40 members of the transforming growth factor- superfamily and it was originally identified in activated macrophages. accumulating evidence indicates that circulating levels of gdf-15 are associated with the risk of death and myocardial infarction, independent of clinical variables and other biomarkers, including hscrp and cardiac troponins [5, 6 ]. the inflammatory response triggered in the acs setting is the cumulative result of preexisting, low - grade inflammation in vulnerable atherosclerotic plaques and the ongoing myocardial ischemic damage during the progression of an acute coronary event. consistently, the magnitude of the inflammatory response as reflected by the peripheral levels of inflammatory markers is largely determined by the temporal interval between symptom onset and the time point of biochemical measurement. optimal interpretation of the elevated circulating levels of biomarkers would, therefore, require knowledge of their release curves and consideration of the time point of blood sampling [8, 9 ]. however, the long - term temporal changes of hscrp levels and the relation between the changes of gdf-15 levels have not been examined, after an episode of non - st - segment elevation acs (nste - acs). consequently, the aims of our study were todescribe changes of hscrp and gdf-15 levels over time after an episode of nste - acs, examine whether changes of hscrp and gdf-15 levels are associated with long - term major cardiovascular adverse events (mace). describe changes of hscrp and gdf-15 levels over time after an episode of nste - acs, examine whether changes of hscrp and gdf-15 levels are associated with long - term major cardiovascular adverse events (mace). three hundred and eighty consecutive acs patients were admitted to the coronary care unit of a university hospital. one hundred and twenty - five patients were excluded from analysis for the following reasons : patients with a history of systemic inflammatory diseases, such as infections or autoimmune disorders, neoplastic or haematological disease, administration of anti - inflammatory or immune - suppressive drugs, and surgical procedures or trauma in the preceding 3 months, patients with an equivocal or uninterpretable electrocardiogram, including left bundle branch block or persistent st - segment elevation due to a myocardial infarction and patients with significant changes in medical therapy during followup. patients were followed up for three years regarding the occurrence of mace (death, myocardial infarction, and unstable angina (class iiib)). therapeutic management during hospitalisation and in the outpatient clinic was left to the discretion of the attending cardiologist, according to the patients ' clinical course, standard institutional protocols, and current guidelines. the ethics committee of our institution approved the research protocol, and all patients gave written, informed consent for inclusion in the study. serial venous blood samples were obtained on admission from 8 am to 3 pm, to avoid the diurnal variation of inflammatory biomarkers reported by our group. blood samples were also obtained on a follow - up evaluation 36 months after admission. serum samples were obtained by centrifugation, after the formation of the clot of blood, and stored at 70c for subsequent analyses. concentrations of the serum hscrp were measured, by an ultrasensitive, enzyme - linked, immunosorbent assay kit (drg instruments gmbh, germany). in this enzyme - linked immunosorbent assay, serum gdf-15 concentrations were measured using a commercially, enzyme - linked immunosorbent assay (biovendor gmb, heidelberg, germany). in this assay, troponin i was determined immune enzymatically, using a technique based on sandwich elisa (boehringer mannheim, germany). all other biochemical measurements were performed in the biochemistry laboratory of our hospital from the samples obtained at baseline, using standard methods. personnel, blinded to patient 's baseline characteristics and clinical outcomes, carried out all measurements. results for normally distributed continuous variables are expressed as mean sd ; nonnormally distributed continuous variables are presented as median and interquartile range. analysis of normality of the continuous variables was performed with the kolmogorov - smirnov test. unpaired 2-tailed t - tests and the mann - whitney u - test assessed differences between the groups for continuous variables, as appropriate. categorical data and proportions were analysed by use of or fisher 's exact test when required. gdf-15 and hscrp levels had a nonnormal distribution and were, therefore, logarithmically transformed before regression analysis to fulfill the conditions required for this type of analysis. the information regarding the appearance of the endpoint, combined at a 36-month followup, was available for all patients included in the study. in patients who died during the 36-month followup period, the blood sample was not available, so we evaluated independent predictors of unstable angina (class iiib) and myocardial infarction (combined primary endpoint). we defined the value delta, as a value that represents the difference between the concentrations of inflammatory markers at admission and at 36-month followup. independent predictors of changes were identified by multiple linear regression analysis and multivariable regression analysis, as appropriate. tested covariates included sex, age, current smoking, diabetes mellitus, hypertension, dyslipidemia, coronary revascularisation, left ventricular ejection fraction, and troponin i. delta gdf-15 concentrations were introduced into the multivariate model as a binary variable, considering the median as the cut - off value. backward stepwise selection was used in multivariate analysis to derive the final model for which significance levels of 0.1 and 0.05 were chosen to exclude and include terms, respectively. differences were considered to be statistically significant if the null hypothesis could be rejected with > 95% confidence. the spss 15.0 statistical software package (spss inc. demographic and clinical data of patients with and without mace are presented in table 1. after 36 months of followup, the combined endpoint ((cardiac death (7 patients), myocardial infarction (3 patients), and unstable angina class iiib (35 patients)) appeared in 45 patients (17.6%). there were no significant differences in age, sex, cardiovascular risk factors, timi risk score, severity of coronary artery disease, treatment, and standard biochemical results between the two groups. regarding inflammatory biomarkers, we found no differences between both groups in levels of hscrp at admission and after a three - year followup (table 2). however, delta hscrp concentrations were higher in patients who developed mace compared to patients who did not (p = 0.01) (table 2). we found significant differences in the gdf15 levels after the three - year followup between both groups (p < 0.001) (table 2). moreover, delta gdf-15 concentrations were higher in patients who developed mace (p < 0.001) (table 2). multivariate analysis showed that delta gdf-15 (or = 52.3, ci 95% 7 - 388.5, p < 0.001) was the unique independent predictor of the combined endpoint (class iiib unstable angina and myocardial infarction) at 36-month followup. variables such as age (p = 0.15), sex (p = 0.23), smoking (p = 0.33), diabetes mellitus (p = 0.24), hypertension (p = 0.55), dyslipidemia (p = 0.57), revascularization (p = 0.70), left ventricular ejection fraction (p = 0.50), and troponin i (p = 0.15) were not independent predictors of mace. the results from our study demonstrate different patterns of release of the hscrp and gdf-15 with, over time, between patients with nste - acs. moreover, this is the first study to show that the changes in gdf-15, over time, are of prognostic relevance in nste - acs patients. the predictive value of gdf-15 measured on admission has been investigated in the two large nste - acs populations : the global utilisation of strategies to open occluded arteries iv (gusto - iv) and fast revascularisation during instability in coronary artery disease ii (frisc ii) cohorts [5, 12 ]. in another study, damman. have evaluated the long - term prognostic value of gdf-15, regarding death or myocardial infarction in nste - acs patients. they have shown that the kaplan - meier curves diverged early and continued to diverge up to five years. in a recent study, the circulating concentration of gdf-15 was measured at baseline (n = 1734) and at 12 months (n = 1517) in patients randomised in the valsartan heart failure trial (val - heft). they demonstrated increases in gdf-15 over 12 months, which were independently associated with the risks of future mortality and first morbid event also, after adjustment for clinical prognostic variables, b - type natriuretic peptide, hscrp, and high - sensitivity troponin t and their changes. in another study recent, eggers and colleagues analysed gdf-15 concentrations in participants from the prospective investigation of the vasculature in uppsala seniors (pivus) study. they demonstrated that the gdf-15 concentrations and their changes over time are powerful predictors of mortality in elderly community - dwelling individuals. in the results of our study, we found that nste - acs patients, who developed mace, displayed higher levels of gdf-15 at the 36-month followup than at admission. furthermore, we were able to show that delta gdf-15 is associated with adverse outcomes, independently of established clinical and biochemical risk markers. our results support the notion that gdf-15 integrates information on several relevant aspects and pathways in cardiovascular disease. the prominent antiapoptotic, antihypertrophic, and anti - inflammatory actions of gdf-15 in cardiovascular disease models indicate that this cytokine exerts protective effects in the context of acute cardiovascular injury. whether chronic increases in gdf-15 concentrations in nste - acs patients play an adaptive or maladaptive role remains to be investigated. in relation with hscrp in our study the delta value or rate of change of the hscrp was useful to differentiate the group of patients with worse clinical outcome during 36 months of followup. however, after adjusting by different confounders, we have not demonstrated that delta hscrp can predict mace in nste - acs patients. recently, in a study by karakas., they serially measured hscrp concentrations in up to 6 blood samples, taken at monthly intervals from 200 postmyocardial infarction patients, who participated in the airgene study. the implementation of hscrp measurement into clinical practice requires sound data on the reliability of such measurement. data is still scarce for the long - term analytical variation of hscrp measurement in patients with cardiovascular disease. the present study shows that the rate of change of hscrp measured at the 36-month followup was not predicting long - term mace in nste - acs patients. however, the delta gdf-15 at the 36-month followup seems to be a stronger predictor of mace than during an acute unstable phase.	among the numerous emerging biomarkers, high - sensitivity c - reactive protein (hscrp) and growth - differentiation factor-15 (gdf-15) have received widespread interest, with their potential role as predictors of cardiovascular risk. the concentrations of inflammatory biomarkers, however, are influenced, among others, by physiological variations, which are the natural, within - individual variation occurring over time. the aims of our study are : (a) to describe the changes in hscrp and gdf-15 levels over a period of time and after an episode of non - st - segment elevation acute coronary syndrome (nste - acs) and (b) to examine whether the rate of change in hscrp and gdf-15 after the acute event is associated with long - term major cardiovascular adverse events (mace). two hundred and fifty five nste - acs patients were included in the study. we measured hscrp and gdf-15 concentrations, at admission and again 36 months after admission (end of the follow - up period). the present study shows that the change of hscrp levels, measured after 36 months, does not predict mace in nsteacs - patients. however, the level of gdf-15 measured, after 36 months, was a stronger predictor of mace, in comparison to the acute unstable phase.
a 39-year - old woman (height : 158 cm, body weight : 45 kg) had taken nifedipine per oral from the department of the internal medicine for six months. for last one month the dose of nifedipine was increased due to uncontrolled spasmodic pain in her left toes while her face flushing and headache worsened and she was referred to the department of pain medicine. the blood test results showed nothing specific with the erythrocyte sedimentation rate (esr) 3 mm / hr and c - reactive protein (crp) below 1 mg / l. on physical examination, no lesions, such as skin ulcers or edema, on her hands and feet were found. after excluding the secondary causes such as connective tissue disease, arterial occlusive disease, artery disorder, the authors performed a sympathetic nerve block using 0.2% ropivacaine 8.0 ml at the level of upper third of the left l3 vertebral body and confirmed pain relief, but this symptom relief did not last for more than two days. in the operation room, the dorsum of the patient was draped with betadine in a prone position on the radiographic surgery table. non - invasive arterial blood pressure monitoring, an electrocardiogram, arterial oxygen saturation, and a skin temperature sensor (66s, hewlett - packard, usa) were attached to the insteps of both feet in order to observe the changes of temperature. after the local infiltration of 1% lidocaine 2.0 ml on the skin by the lateral approach used for traditional lumbar sympathectomy, 10 cm rfk (racz - finch kit, radionics, usa) cannula with a curved 10 mm active tip was inserted at the level of the lower third of the left 2 vertebral body and the second cannula was inserted at approximately 7 mm below with the same method. we confirmed there was no spread to the psoas muscle by injecting 2.0 ml of contrast material and checking the final location. a total of four cannulae were used in this procedure, and the procedure was sequentially performed from the lower third of the l2 vertebral body to the l2 - 3 intervertebral space with approximately 7 mm intervals (fig. 1). after inserting an electrode into the needle, we confirmed there was no back pain at 50 hz and 1 volt stimulation, and that there was no muscle contraction on the low back at 2 hz and 3 volts stimulation. next, the first cannula was removed and the third cannula was placed approximately 7 mm below the second cannula, and the second lesion was created with the same method. subsequently, the second cannula was removed and the fourth cannula was inserted approximately 7 mm below the third cannula, and the third lesion was created the same way. the skin temperature of the left and right insteps, as measured before the operation, was 26.4 and 26.6, respectively. five minutes after the creation of the lesions, the temperature of the left instep started to rise and the skin temperature of left and right insteps was measured as 26.8 and 26.6, respectively ; the visual analog scale (vas) decreased from 6 - 7 before the operation to 0 after the operation. the skin temperature of the left and right insteps, as measured after 30 minutes, showed a definite difference, as it was 34.8 and 28.6, respectively. the average gap of the skin temperature of both feet was confirmed as 7.3 when we performed infrared thermographic imaging (iti) the next day (fig. no particular side effects or complications appeared after the operation, so the patient left the hospital two days later. the patient showed continuous improvement on the follow - ups performed two months later and one year later. raynaud 's phenomenon induced by an excessive contraction of the peripheral blood vessels in fingers, toes, ears, and nose, is due to exposure to low temperature or stress ; the skin color of the influenced part turns white or blue accompanied by numbness, itchiness, and pain. more than 70% of the causes of this phenomenon are still obscure, and these are classified as primary raynaud 's phenomenon and separately called raynaud 's disease. in addition, raynaud 's phenomenon may be accompanied by other diseases, referred as secondary raynaud 's phenomenon or raynaud 's syndrome. the treatment for raynaud 's phenomenon is to decrease the frequency and the degree of spasm and to protect tissue from injury ; for these purposes, lifestyle modifiaction and vasodilators are first line of therapy. keeping warm temperatue especially hands and with the house is the beginning of life style modification. evading emotional stress, and ceasing cigarette are highly recommended. any dose of beta - blockers, contraceptives, or migraine drugs with vasoconstricting effect calcium channel blockers like nifedipine decrease the frequency and the degree of spasms in approximately two thirds of the patients and help to heal the skin ulcers of fingers and toes. however, in case the frequency and the degree of spasms worsen to the point of disturbing daily life, or in case continuous pain or a skin ulcer occurs in spite of the medication, a sympathetic nerve block, chemical nerve destruction, or operative sympathectomy should be considered. traditionally, a lumbar sympathetic block is performed between the lower third of the l2 vertebral body and the upper third of the l3 vertebral body under c - arm guidance or computed tomography (ct) ; umeda., also reported that lumbar sympathetic ganglia is most frequently found at the level of the lower third of the second lumbar vertebra, at the l2 - 3 interspace, and at the level of the upper third of the third lumbar vertebra on both the right and left sides. again in this case, the authors target the lumbar sympathetic ganglia between the lower third of the l2 vertebral body and the l2 - 3 intervertebral space. rf thermocoagulation, which has recently been applied in various pain treatments, is preferred to surgical removal or liquid neurolytic agent, since it makes selective nerve destruction easy by confirming the target nerve through the stimulation of sensory and motor nerves. haynsworth and noe reported that percutaneous sympathectomy using rf thermocoagulation is expected to bring a long duration of pain relief and lower the incidence of post - operative neuralgia, as compared to chemical nerve destruction. research document in korean also reported that lumbar sympathectomy using rf thermocoagulation decreases the risk of complications in comparison with chemical nerve destruction using absolute alcohol, and it has effective treatment results in hyperhidrosis of lower limbs, sympathetically maintained pain (smp), and vascular diseases. recently, many reports have focused on bipolar rf thermocoagulation that can create larger and more predictable lesions than monopolar rf thermocoagulation [9 - 11 ]. derby and lee reported that in their experiment model where they placed two rf electrodes at 6 mm intervals and heated them simultaneously, the temperature of the core between the two electrodes exceeded 66, so they might perform coagulation on a larger area, in case they used a bipolar electrode. pino., reported that the largest lesion in performing bipolar rf thermocoagulation was created at 90 for 120 - 150 seconds with 4 - 6 mm intervals of two electrodes. korean researchers reported that a 5 mm active tip needed more than 80 in temperature and 90 seconds in time within 6 mm intervals, and a 10 mm active tip 90 and 120 seconds within 8 mm intervals, in order to create strip lesion, through bipolar rf thermocoagulation, using egg white as a medium. in sacroiliac syndrome, it was reported that appropriate lesions were created over 90 and more than 90 seconds of rf thermocoagulation within 1 cm intervals of the two electrodes. in this case, the authors created lesions at 80 for 100 seconds with approximately 7 mm intervals between 10 mm active tips based on the above documentation ; in addition, we created three lesions sequentially, therefore, we expected that three sequential strip lesions would be created. in conclusion, the authors suggest that creating sequential lesions using bipolar rf thermocoagulation is capable of making larger lesions than the existing monopolar rf thermocoagulation, and this leads to a higher rate of successful operations while simultaneously avoiding the side effects and complications from chemical nerve destruction. these findings mean that bipolar rf thermocoagulation may be effectively used for hyperhidrosis, smp, and vascular diseases which need a long - term sympathetic nerve block.	a 39-year - old female was suffering from cold - induced raynaud 's attacks in both hands and feet, with symptoms being most severe in her left foot. the patient did not respond to medical treatments and was referred to our department of pain medicine. we performed sequential bipolar radiofrequency lumbar sympathectomy to the patient, which offered a long duration of symptom relief. sequential bipolar radiofrequency lesions could create continuous strip lesion, and thus, could achieve better results, while the potential risk of liquid neurolytic agents could be avoided.
latino immigrant women, particularly mexican women, are at increased risk for developing many preventable health conditions. this is due in part to limited access to healthcare and benefits, legal status, and limited income. while mexican women have traditionally migrated as a result of their families, their immigration is no longer restricted to family reunification. growing push factors for their migration include securing employment and ensuring the well - being of their children. mexican women comprise the largest female immigrant group in the united states, accounting for 5.4 million (47%) of the mexican immigrant population. in 2008 alone, more than 40% of the female immigrant population in 10 us states was from mexico. these women are more likely to lack legal status, with 59% of the us undocumented population born in mexico. they also have the lowest level of participation in the formal labor market, limiting them to low - paying jobs with limited access to employer - based health insurance. increased vulnerability of mexican immigrants has established a growing need to focus on the health of women because of the role, position, and influence they have in the hispanic family. the 2010 affordable care act (aca) is a crucial piece of health legislation that undoubtedly will increase access to quality healthcare services for mexican immigrant women who are without employer - sponsored or private health insurance. however, the aca excludes undocumented immigrants as well as legal immigrants with less than 5 years residence in the us. it thus places these groups at increased risk of developing chronic diseases that affect minority ethnic groups in particular. the purpose of this article is to review factors that are associated with the health status of mexican - born women living in the united states and review policy implications of the aca for this population (table). in this article, the term immigrant refers to mexican - born women or other immigrant women who are living in the united states, and the term nonimmigrant refers to us - born women of mexican origin or other us - born racial / ethnic groups. summary of main review articles with results systematic reviews identified through pubmed backward searches that were based on articles cited authors ' personal files abbreviation : aca, affordable care act. mexican - born women are disproportionately impacted by preventable health conditions as compared to other racial / ethnic groups in the united states. for instance, those of mexican birth are more likely to be overweight or obese (78.5%) compared to non - hispanic whites (nhws) (61.3%). physical inactivity is most prominent among mexican immigrant females (49%) compared to blacks (45%) and nhw women (28%). diabetes is more prevalent among mexican immigrant women with a longer length of stay in the united states (9.1%) compared to nhw women (5.7%). also important to note is that the prevalence of diabetes among recently arrived mexican immigrant women is only 4%. finally, mexican - born mothers are less likely to receive prenatal care beginning in the first trimester (62%) compared to other immigrant women (72%) and nhw women (76%). the immigrant paradox or epidemiologic paradox indicates that first - generation mexican immigrants experience higher poverty rates, lower education levels, and less access to healthcare than second - generation mexicans and nhws but have similar or better health outcomes. since the 1980s, the best substantiated findings supporting the immigrant paradox are the prevalence of low birth weight (lbw) infants and low infant mortality rates among mexican - born women. a recent study indicated that infant mortality rates among mexican - born women (5.1 per 1000 live births) were lower than that among nhw women (5.3 per 1000 live births). a likely explanation is that less acculturated women are more likely to consume more healthful foods and less alcohol and tobacco compared to more highly acculturated women, factors that may contribute to more positive birth outcomes. however, as length of stay in the united states increases, some of these behaviors (eg, consumption of an unhealthful diet and physical inactivity) are more likely to mirror the behaviors of nhw women. such behaviors also may contribute to the high prevalence of obesity and diabetes among mexican immigrant women. in contrast, high acculturation of latinos has been positively associated with a higher socioeconomic status and increased access to healthcare. acculturation risk factors are not limited to smoking, excessive body fat, and high blood sugar concentrations. in fact, acculturation stressors also include discrimination, legal status, and limited english proficiency. the pattern of worse health outcomes in relation to length of time in the united states further strengthens the immigrant paradox while simultaneously making it more complex. other factors to consider when analyzing the immigrant paradox include the social environment (eg, stress and legal barriers to resources) ; the physical and occupational environment (eg, pollution, overcrowding, crime, poor housing infrastructure) ; and the cultural environment (eg, more normative substance use behavior and access, poorer nutritional options). additional factors that are associated with poor health outcomes among mexican immigrant women include socioeconomic status. most mexican - born women are characterized by low educational attainment that negatively impacts their income, socioeconomic integration, and access to healthcare. although they tend to have completed more years in school than their male counterparts, the majority of mexican - born women (58%) have less than a high school degree, in comparison to other female immigrants (14%), balcks (12%), and nhws (6%). there is even a lower proportion of mexican - born women with a bachelor 's or higher degree (8%) compared to the substantially higher degrees achieved by other immigrants (46%), blacks (27%), and nhws (41%). the contemporary immigration context has made legal status a critical issue for the latino population in the united states. current estimates indicate that 8.3 million undocumented immigrants were in the labor force in 2008, a 5.4% share of the total labor force. however, these estimates may not reflect the participation rates of undocumented immigrants in the labor force because of underreporting in surveys and undercalculating in general. only 58% of working - age women who are undocumented immigrants are in the labor force, well below the percentage of women who are us - born (73%) or legal immigrants (66%). this may be due to the higher percentage of nonworking undocumented immigrant women who are raising children at home (29%) compared to other immigrants (16%) and us - born women (8%). with regard to occupation, only 10% of mexican - born immigrants work in management, professional, and related jobs, compared with 41% of immigrants from other countries. the types of employment that directly affect socioeconomic status and access to health - care for latinas are primarily concentrated in low - wage and informal markets. the great recession of 2008 may have impacted the types of low - wage industries that remained competitive, such as the construction industry. according to the pew hispanic center, the recession in the construction industry led to a rise in the unemployment rate for hispanics (6.5%) compared to non - hispanics (4.7%). mexican immigrant men have been concentrated in the construction industry, in comoparison to immigrant women, the unemployment rate among male spouses may have afforded some mexican immigrant women to be head - of - household during the great recession. moreover, the high unemployment rates among male spouses impact the entire immigrant household, putting even greater constraints on income for basic needs, including health services. as many mexican - born women are in low - wage jobs in the united states, it is very difficult for them to surpass poverty levels. research indicates that 30% of mexican - born women are below 100% of the us federal poverty level, compared to 10% of us - born nhw women. furthermore, about twice as many mexican - born women are living in poverty in comparison to other foreign - born immigrants (30% vs 14%). mexican - born women are even more likely to be under 150% of the us federal poverty level, and approximately 58% of them have children under the age of 18, whereas only 20% of us - born nhw women with children are below 150% of the us federal poverty line. finally, the challenges of mexican - born women increase when approximately 80% of those between 18 and 64 years of age are below the 150% of poverty line and are also single parents. with limited access to health services through public programs and with low levels of employer - based coverage, immigrant families traditionally have sought health coverage through community health centers, often with somewhat inadequate services. the aca was passed with the intention of expanding access to the uninsured, thus reducing costs and redirecting services toward prevention and primary care. currently, among women, mexican immigrants have the highest un - insurance rate (54.6%) as compared to other immigrants (26.2%), blacks (22.5%), and nhws (13.9%). therefore, a large majority of mexican - born women will have improved access to health services post - aca implementation. on the other hand, they also will face the greatest rate of exclusion from this generally positive set of health reforms, as undocumented immigrants as well as legal immigrants with less than 5 years ' residence in the united states are excluded from the health law. while the uninsured will undoubtedly have increased access to healthcare when the aca takes full effect in january 2014, the landscape of health insurance coverage will demand the efforts of many healthcare advocates to help millions of individuals to navigate a completely new system. latinos, particularly women of mexican birth, comprise the group that will need health coverage in the greatest proportion. given the nature of mexican immigrant families characterized by mixed - immigration status, low socioeconomic background, low enrollment in healthcare programs, and limited english proficiency there will be a need for culturally and linguistically appropriate health services and culturally sensitive healthcare providers. the aca has a number of funding provisions in place to address culturally and linguistically appropriate services : training of culturally competent healthcare providers;workforce development an increase in the number of healthcare providers in medically under - served areas and diversifying the workforce ; anda more streamlined process and the development of uniform categories for the collection and reporting of data on race / ethnicity and language training of culturally competent healthcare providers ; workforce development an increase in the number of healthcare providers in medically under - served areas and diversifying the workforce ; and a more streamlined process and the development of uniform categories for the collection and reporting of data on race / ethnicity and language these requirements will likely improve the ability for researchers, policymakers, healthcare providers, and advocates to address health disparities. though empirical research is still somewhat limited, culturally sensitive interventions have been shown to improve service provision and patient satisfaction. components of cultural competence include employment / retention of culturally competent personnel such as community health workers or promotoras and provision of interpreters / language services. some research has been conducted prior to implementation of the aca to investigate the needs of future consumers. a recent study among low - income racial/ ethnic diverse and limited english proficient (lep) adults in california indicated that participants prefer to have bilingual community health workers in order to provide assistance with the aca enrollment process.the study also identified other barriers such as educating hard - to - reach latino populations including migrant farmworker women about enrollment and mixed - status immigration families who fear deportation if they enroll an eligible family member. other core enrollment challenges include technology barriers and addressing literacy skills for low - income families. funding is available to address these issues and to help individuals enroll in a health insurance plan. current research among consumers of the aca also indicates that enrollment outreach information should include types of health insurance coverage and what services would be provided, qualification for coverage, costs, reviews about the program, and whether information on healthcare providers who will speak the primary language of the patient will be available. these results are likely to have important policy implications for states with large latino populations. although some immigrants will not qualify to purchase insurance through the health insurance marketplace, other options for healthcare include federally qualified community health centers (fqhcs). the aca requires funding increases for fqhcs to create new sites in medically underserved areas and expand preventive and primary healthcare services. approx imately 34% of healthcare patients are latino ; therefore, fqhcs will play a vital role in providing care to the newly insured. the largest female immigrant population in the united states is mexican. increased labor demands, better employment opportunities, and family reunification the vulnerability of mexican immigrant women has established a growing need to focus on their physical and mental health because of the role, position, and influence they hold in the hispanic family, as well as their impact on future generations. mexican - born women often are characterized by low educational attainment, which limits their employment opportunities and access to employment - based coverage, negatively impacting their health. other factors such as high acculturation also have contributed to poorer health outcomes among this group over time. the aca ideally will increase access to healthcare, thus reducing health disparities among mexican immigrant women. finally, research collaborations will be needed to develop binational initiatives so that researchers can better understand the cultural strengths of mexican women who immigrate to the united states. such knowledge also is needed to support the health and well - being of this population.	immigrant women of mexican birth face unique health challenges in the united states. they are at increased risk for developing many preventable health conditions due in part to limited access to healthcare and benefits, legal status, and inadequate income. increased vulnerability of women has established a growing need to focus on their healthcare needs because of their role, position, and influence in the family.the purpose of this article is to review factors that impact the health status of mexican - born women living in the united states and review policy implications of the affordable care act for this population.mexican-born women are the largest female immigrant group in the united states. therefore, they comprise the group that will need health coverage in the greatest proportion. as a result, there will be a need for culturally and linguistically appropriate healthcare services and culturally sensitive providers.
there are more than 9 million new cases of tuberculosis every year worldwide, and incidence is declining at a rate of less than 1% per year. nearly 2 million people die from tuberculosis every year, and the costs and social consequences of this disease are vast. this worldwide burden of tuberculosis has stimulated much interest in research for new approaches to the management of this disease. various organisations, individuals, and networks have tried to identify priorities to help guide and to stimulate appropriate funding. the explicit and rational setting of research priorities is integral to the research process : for allocation of resources into areas of strategic importance, to catalyse debate, and to strengthen the role of stakeholders in establishing the research agenda. ultimately, this strategy should help to improve the allocation and monitoring of funding and the progress towards targets in tuberculosis control. several approaches to facilitate setting of priorities for research have been described, which aim to increase transparency, objectivity, acceptability, and validity of the results. to judge the merits of competing priorities, information on expected cost, existing capacity, effect of the research, and effect on the population that is expected to benefit is also needed. several techniques have been used, including the delphi method (iterative broad consultation with a range of experts), trend analysis and modelling (forward extrapolation of historical data on the effect of certain research), scenario discussion (assessment of current priorities on the basis of a structured discussion of the potential outcomes), and matrix approaches (that use information on cost - effectiveness and other quantifiable data on the potential effect to direct the use of restricted resources). we aimed to systematically summarise priority topics for tuberculosis research from available publications and to describe how priorities were identified. this systematic review will help to inform new initiatives for identifying and setting research priorities, such as for the recently established research movement of the stop tb partnership, which aims to increase the scope, scale, and speed of tuberculosis research and to ensure that research priorities are identified and properly funded. we searched pubmed for studies published from 1998 to june 5, 2010, with the terms : (1) tuberculosis[tiab ] or mycobacter[ti ] or (tuberculosis / epidemiology / prevention and control) ; (2) (research[ti ] and agend[ti ]) or (research[ti ] and priorit[ti ]) or (research[ti ] and need[ti ]) or (resource allocation / organisation and administration) or (health services needs and demand) or (research support) ; and (3) # 1 and # 2. we also included publications cited in the documents when relevant. we contacted representatives of stop tb partnership and who to identify potentially relevant documents, especially for articles that might not have been indexed in pubmed ; we also accessed information from the tb research movement collection. the search results were screened by two authors (jr and pg) independently ; documents were included if there was reference to research prioritisation or research topics and specific mention of tuberculosis in the abstract. articles were classified into two types : consensus statements from a convened group or expert panel or reviews or commentaries on the state of tuberculosis research that mentioned priorities or agendas for future work. data extraction was done by jr and pg, and results were directly compared for verification and entered into microsoft access. we searched pubmed for studies published from 1998 to june 5, 2010, with the terms : (1) tuberculosis[tiab ] or mycobacter[ti ] or (tuberculosis / epidemiology / prevention and control) ; (2) (research[ti ] and agend[ti ]) or (research[ti ] and priorit[ti ]) or (research[ti ] and need[ti ]) or (resource allocation / organisation and administration) or (health services needs and demand) or (research support) ; and (3) # 1 and # 2. we also included publications cited in the documents when relevant. we contacted representatives of stop tb partnership and who to identify potentially relevant documents, especially for articles that might not have been indexed in pubmed ; we also accessed information from the tb research movement collection. the search results were screened by two authors (jr and pg) independently ; documents were included if there was reference to research prioritisation or research topics and specific mention of tuberculosis in the abstract. articles were classified into two types : consensus statements from a convened group or expert panel or reviews or commentaries on the state of tuberculosis research that mentioned priorities or agendas for future work. data extraction was done by jr and pg, and results were directly compared for verification and entered into microsoft access. 1004 articles were screened and 51 were shortlisted for full - text review (figure). 12 of 33 articles were consensus statements ; 11 of which were published in the past 5 years. who published three overviews of research priorities derived from expert consensus meetings held in 2005 with a wide range of questions. one focused on tuberculosis and hiv, one assessed tuberculosis more broadly, and the 2009 tuberculosis treatment guidelines contributed further suggestions for research arising from a series of systematic reviews. another multidisciplinary international working group (the international standards for tb care steering committee) produced standards for tuberculosis care directed at healthcare providers that are applicable worldwide. as part of this process, the authors derived a set of research priorities covering clinical case management, treatment and monitoring, and operational research. three consensus statements highlighted and proposed research priorities for multidrug - resistant (mdr) tuberculosis. a consensus statement on mdr tuberculosis was published by the stop tb partnership 's working group on mdr tuberculosis. the research subgroup of the working group on mdr tuberculosis produced a document in which they investigated the scale - up of programmatic management of mdr tuberculosis and related research priorities. a collaboration of european scientific academies made recommendations for work on mdr tuberculosis funded by the european union. a further three consensus statements came from funding agencies, one in the usa and two from europe. the us statement, from the national institute of allergy and infectious disease, described current and future plans for research on mdr tuberculosis funded through the national institutes of health. a group of authors of european commission - funded projects produced a prioritisation programme for research in neglected infectious diseases, which made recommendations for tuberculosis research, and another article described the current and european commission - funded tuberculosis research portfolio with recommendations for future direction of finances. lastly, a broadly drawn expert group published a paper on how to investigate the joint burden of diabetes mellitus and tuberculosis. the other 21 articles were reviews and commentaries ; six focused on tuberculosis in children, whereas the rest were not age specific. specific topics addressed were drug treatments, diagnostics, preventive therapy, health service limitations, funding, and design of clinical trials for tuberculosis drugs. table 1 provides a summary of the methods used to develop the research priorities in the studies. two groups seemed to collate data from primary research articles comprehensively, although they did not state their strategy. most articles (27 of 33) presented selected details from primary literature in conventional narrative review format, and gave no details of search terms, indexing databases, or inclusion and exclusion criteria. four of the 12 consensus statements used the opinion of expert subgroups or were derived from group discussion. in three consensus papers, systematic reviews were commissioned to inform an expert group, and the stop tb partnership working group on mdr tuberculosis used established who guidelines to critically appraise existing publications for gaps in knowledge. commentary articles identified knowledge gaps by systematic review in three cases, and three articles discussed selected results of existing systematic reviews. the rest of the commentary papers (13 of 21) did not specify the methods used and did not make use of systematic reviews. four of the consensus articles described some methods for ranking the priorities that they identified. two used meetings of experts subdivided into ad - hoc committees by research subject area ; in one, the number of questions was limited to five ; and in the other, participants ranked the questions they had generated by perceived importance, and refined the list by wider expert consultation. one article reported a seven - step analysis process that was used to compare research needs for the portfolio of diseases in the who special programme for research and training in tropical diseases. this paper used an analysis of current and projected burden of disease, current control limitations, research gaps, and opportunities. one article used internal and external advisers to estimate the relative potential of research areas to contribute substantially to a global public health response, although it did not show which criteria were used to assess these relative potentials. the number and type of research questions varied widely across the articles. some articles provided many questions (ten suggested more than 20, of which only one group had attempted relative prioritisation)277 question areas were identified. research was specifically suggested for hiv - infected persons (63 questions), mdr tuberculosis (49), malnutrition (nine), and diabetes (seven). consensus statements had more questions on average (mean of 21 questions) than did reviews and opinion pieces (mean of 15 questions). nine articles took into account the wide remit of tuberculosis research in general, of which three used expert subgroups within each area of interest. most other articles were more focused, including five articles on mdr tuberculosis and drug development, four on hiv co - infection, and two on laboratory diagnostics and vaccination. single articles focused individually on health system research, tuberculosis treatment guidelines, tuberculosis and diabetes mellitus, and design factors in drug trials. most articles identified treatment with drugs, drug development, and diagnostics as areas of research priority (table 2). 17 articles identified questions relating specifically to children. with regard to hiv - infected populations, the most commonly cited questions related to antituberculous drug treatment regimens (16 articles), diagnosis (15), and epidemiology (7). the pattern for mdr tuberculosis was similar, with drug treatment (ten), diagnosis (11), and epidemiology (ten) highlighted. the panel lists the most common research areas highlighted for hiv co - infection and mdr tuberculosis. systematic reviews were used more often for papers that had questions related to drug development, diagnostics, and epidemiology (five of nine articles that used these methods identified questions in these areas). by contrast, systematic reviews were only done in two articles that identified questions on basic science and vaccines. 14 of the 33 articles were by authors who originated from academic institutions, ten were by members of who or stop tb partnership (often jointly), and nine were by authors from non - governmental organisations (five), governmental or funding agencies (three), and a science advisory body (one). authors were most commonly affiliated with academic institutions, followed by who, and government staff (table 3). representatives of funding organisations did not commonly co - author the articles (two). 40 individuals were listed as authors on more than one of the included articles ; 12 contributed to more than two ; and five contributed to more than three. authorship of more than one article was most common for authors from universities (41%) and those affiliated with who and stop tb partnership (21%). the mean number of authors per article was nine (range 128) ; for consensus statements, the mean number of authors was 15 (range 228), and for reviews the mean was five (range 114). 20 of the articles included a statement of conflicts of interest. in three articles, the author 's affiliation indicated that publication would promote an organisation 's interests, but no conflict of interest statement was specifically published. there is, however, some evidence of a recent change in practice in articles published between 1998 and 2005, one of six articles included a statement ; from 2006 to 2010, 19 of 27 did so. we identified 33 research agendas for tuberculosis published between 1998 and 2010. two clear research priorities emerged from this systematic review : the development and testing of both new drugs and treatment regimens, and new diagnostic tests for tuberculosis. these areas also dominated when focusing on the research needs in specific populations such as patients co - infected with hiv or patients with mdr tuberculosis, who are particularly affected by the limitations of current drugs and diagnostics. this finding is indicative of the inefficiencies of the currently used sputum - smear - based diagnosis in many cases and of the observation that short - course chemotherapy, despite 95% efficacy in clinical trials, has not substantially contributed to decreasing the transmission of tuberculosis in areas with high hiv burden nor been effective for patients with drug - resistant tuberculosis. the use of epidemiology in these studies as a means to better understand the factors involved in the worldwide burden of disease and to assess the effect of case - finding was notable. the frequent inclusion of epidemiology emphasises the importance of doing studies at the population level to better target control interventions and possibly highlights a perception that accurately documenting the burden of disease might help to advocate allocation of resources for research. epidemiological and impact - assessment studies are also necessary for monitoring and evaluation and to check if the stop tb partnership strategy is actually effective in controlling tuberculosis. research into health services was also identified to be a common priority ; this emphasis on operational research might be indicative of the need to optimise the availability and cost - effectiveness of techniques for improved tuberculosis control at the programme level in resource - limited settings. investigation of basic science questions aimed at contributing to the research and development pipeline was less commonly identified as a priority. fundamental research on prominent fields, such as the biology of mycobacterium tuberculosis, the host - pathogen interactions, and the latency and persistence patterns, is essential for the development of new diagnostic tests and drugs. similarly, this research should support work on vaccine development, which was also relatively less prioritised than are other research areas. according to a treatment action group report on tuberculosis research and development funding, investments in tuberculosis research and development in 2007 were mostly in drug development (us$170 million, 35%), basic science ($ 121 million, 25%), and vaccine development ($ 71 million, 15%), compared with diagnostics ($ 41 million, 9%) and operational research ($ 36 million, 8%). one potential explanation for this apparent difference in allocation of funds is that, in the research topics reviewed here, the relative importance of drugs and diagnosis compared with basic and operation research is probably indicative of the difficulty of establishing clear research agendas in these areas rather than an absence of perception of priority. basic research is mostly driven by curiosity and might therefore not benefit from fitting into specific topic areas that could be perceived as restrictive or limited. because operational research is closely linked to programme implementation, this research falls comparatively short of funding and seems to be more difficult to prioritise in definite research agendas. systematic reviews might not always be necessary ; for example, because research in that area is recent. however, the use of systematic review has received growing attention in recent years and is increasingly being recognised as an important approach to the assessment of research by providing an inventory on what is known. although there are formal methods for prioritising research, few of the consensus groups used them. group discussion methods tended to provide large comprehensive lists of questions without prioritisation, such as the report by who and the special programme for research and training in tropical diseases report on tuberculosis. listing of questions might help in reaching a consensus in a large diverse group, but is less helpful in targeting strategic areas or in deciding on research funding allocation. this approach might be useful, however, for raising awareness and for funding in specific research domains. the consensus statement on short - course directly observed treatment for mdr tuberculosis, by contrast, was able to distil the list of identified topics into focused, prioritised research questions. the pool of academics and specialists involved in these articles was relatively small and many authors contributed to more than one document. although we do not know what effect they would have on priorities, involvement of patients is likely to help focus research on outcomes that interest those with disease. collaboration with patients is valuable to researchers, clinicians, and funding organisations, and is well documented in other areas. disclosure of conflicts of interest should be universally implemented, as has recently been adopted for expert meetings at who. although care was taken to include a comprehensive search of papers, some notable documents might have been overlooked. however, this study does not answer an important question for researchers : which of the research questions is supported by high - quality evidence ? we expect that by improving prioritisation methods, this question could be answered. to identify key research questions within specific areas, various people are involved to make decisions about need and scientific opportunities. this process needs a thorough understanding of existing work and a critical analysis of existing data through systematic review where appropriate. we believe that transparent and specific processes are important in setting research priorities. establishing these priorities would be enhanced by a structured synthesis of existing knowledge, such as that advocated by the grading of recommendations assessment, development and evaluation (grade) approach. consensus panels understandably tend to favour discussion and critical analysis to reach agreement, but generally fail to suggest priorities. formal methods to assess the relative merit of priority areas should be more widely adopted. this assessment would involve establishing clear criteria by which to judge the importance of the research questions, such as : the potential for progress, the public health need, and the potential effect on public health. criteria for establishing research priorities were the following : likelihood that the research question would be answerable in an ethical way ; likelihood that the resulting intervention would be effective in reducing disease burden ; deliverability, affordability, and sustainability of the resulting intervention ; maximum potential of the intervention to reduce disease burden ; and effect of disease burden reduction on equity in the population. in some approaches, a system of voting enables large groups of panel members to reach a consensus agreement. this system depends on participants being adequately informed of the existing knowledge base, such as by systematic review. additionally, panels need to engage representatives of patients and have transparent systems for expressing potential conflicts of interest. the identified research topics indicate the central role of who and the stop tb partnership in establishing guidelines and advocating for better control of tuberculosis worldwide. these organisations have recently jointly launched the tb research movement, which will engage many tuberculosis researchers in a collaborative strategic effort to increase the scope, scale, and speed of research to accelerate progress in worldwide control of tuberculosis. the research areas frequently identified and summarised here should help to provide a platform for explicit development of a transparent and widely approved system for the establishment of priorities for tuberculosis research, using specific criteria and systematic reviews combined with expert opinion. such an approach would identify knowledge gaps, inform funding organisations ' decisions, and ensure that research is harmonised and effective. pg is supported by a project funded by the uk department for international development for the benefit of developing countries. mp is supported by a new investigator award from the canadian institutes of health research.	summaryreliable and relevant research can help to improve tuberculosis control worldwide. in recent years, various organisations have assessed research needs and proposed priorities for tuberculosis. we summarise existing priority statements and assess the rigour of the methods used to generate them. we found 33 documents that specifically outline priorities in tuberculosis research. the top priority areas were drug development (28 articles), diagnosis and diagnostic tests (27), epidemiology (20), health services research (16), basic research (13), and vaccine development and use (13). the most focused questions were on the treatment and prevention of multidrug - resistant tuberculosis in people co - infected with hiv. methods used to identify these priorities were varied. improvements can be made to ensure the process is more rigorous and transparent, and to use existing research or systematic reviews more often. who, stop tb partnership, and other organisations could adopt an incremental process of priority development, building on the existing knowledge base.
ulcerative colitis (uc) and crohn 's disease (cd), the major forms of inflammatory bowel diseases (ibds) in humans, are chronic inflammatory disorders of the gastrointestinal tract. in uc, inflammation is restricted to the mucosa and extends proximally from the rectum to involve all or part of the colon. cd is typically a patchy, transmural, inflammatory disease that can affect the gastrointestinal tract anywhere from the mouth to the anus. both ibds are characterized by episodes of remission and exacerbations in which the patient experiences abdominal pain, diarrhea, blood in the stool, and systemic symptoms. patients with long - standing disease and severe inflammatory lesions involving the entire colon have increased risk of developing colorectal cancer (crc) [24 ]. a family history of crc, the presence of primary sclerosing cholangitis, backwash ileitis, and, in some studies, young age at onset of colitis increase further the risk of ibd - associated crc [58 ]. crc complicating the natural history of ibds accounts for only 1 - 2% of all cases of crc. nonetheless, chronic colitis is among the top high - risk conditions for crc, and ibd patients are 6 times more likely to develop crc than the general population. unlike sporadic crc in which the dysplastic precursor is usually the adenomatous polyp, ibd - associated dysplasia can be both polypoid and flat, localized or diffuse, and this probably reflects the fact that carcinogenesis in the inflamed colon follows a different sequence of genetic alterations than that observed in sporadic crc. the goal of crc screening and surveillance colonoscopy in ibd population is detection of premalignant changes early enough that intervention can prevent complications of invasive cancer. unfortunately, however, surveillance programs have not substantially prolonged survival in ibd patients, due to the technical limitations of recognizing dysplastic lesions in flat, normal - appearing mucosa., the advent of sophisticated techniques of molecular biology has contributed to the identification of key steps in the process of colon carcinogenesis, thereby facilitating the development of new drugs that efficiently target malignant cells. some of these compounds, such as nonsteroidal anti - inflammatory drugs (nsaids) and selective inhibitors of cyclooxygenase (cox)-2, are effective in attenuating the growth and diffusion of crc cells [13, 14 ]. however, their use in the chemopreventive programs of ibd - related crc is not justified because the administration of nsaids and cox2-inhibitors in ibd patients associates with high risk of disease flare - ups [15, 16 ]. mesalazine or 5-aminosalicylic acid (5-asa) is a drug widely used in ibds, mainly uc, for the treatment of mild relapses and maintenance of remission. mesalazine is structurally related to nsaids, but unlike these compounds, it is safe and free of serious adverse effects. epidemiological observations indicate that mesalazine can be also chemopreventive for ibd - associated crc [4, 17, 18 ], even though one study has documented no benefit. moreover studies conducted in experimental models of carcinogenesis have shown that the drug has many targets in cancer cells and modulates multiple biological pathways that sustain crc. in this paper we review the available experimental data that demonstrate the ability of mesalazine and its derivatives to interfere with intracellular signals involved in crc cell growth. the process of carcinogenesis is facilitated by a complex and dynamic interaction between genes and environmental factors that ultimately affects cell growth and survival. as a matter of fact, apoptosis progressively decreases and proliferation increases in the sequential steps from normal colonic mucosa to dysplasia and crc. therefore, compounds that inhibit cell proliferation and/or enhance cell apoptosis could find a place in the therapeutic armamentarium for crc. the initial demonstration that mesalazine can block the growth and promote apoptosis of crc cells comes from ex vivo studies in patients with colonic adenoma. showed that mesalazine administered orally to patients with sporadic polyps increased the apoptotic rate and decreased proliferation of cancer cells. demonstrated that rectal administration of mesalazine in patients with sporadic crc enhanced apoptosis of tumor cells. these observations were supported by studies in the mouse model of colitis - associated crc, induced by administration of azoxymethane (aom) followed by repeated oral administration of dextran sulfate sodium (dss), which showed that mesalazine reduced the number and size of neoplasms [23, 24 ]. it is conceivable that the anti - neoplastic properties of mesalazine are in part linked to the ability of the drug to target mucosal immune cells and inhibit expression and/or activity of various molecules involved in colon carcinogenesis (e.g., cox-2, inducible nitric oxide synthase, reactive oxygen species and nuclear factor - kb). indeed, it has been shown that mesalazine inhibits the growth and enhances the apoptosis of several crc cell lines in a time- and dose - dependent manner. the anti - mitogenic effect of mesalazine is also seen in cox-2-deficient cells raising the possibility that mesalazine inhibits crc cell growth via both cox-2-dependent and independent mechanisms. mesalazine - induced antiproliferative effect is associated with modulation of replication checkpoints in crc cells, which ultimately alter cell cycle progression. in this context, we have shown that increasing concentrations of mesalazine (i.e., 530 mm) cause a progressive accumulation of crc cells in s phase, thereby decreasing the percentage of cells in g2/m and g0/g1. mesalazine - treated cells exhibit a reduced expression of the phosphatase cdc25a, but not cdc25b or cdc25c, and inactivation of cdk2, a target of cdc25a. since cdk2 binds to either cyclin e or cyclin a and regulates the g1/s transition and s phase progression, respectively, mesalazine - induced cdk2 inactivation could be responsible for cell cycle block in s - phase. the exact mechanism by which mesalazine down - regulates cdc25a expression is not yet known. it is unlikely that chk1 and chk2, two upstream kinases that phosphorylate and promote degradation of cdc25a are involved in the negative regulation of cdc25a, because mesalazine downregulates cdc25a, expression in chk1- or chk2-deficient cells. by contrast, we showed that cells treated with mesalazine displayed enhanced ubiquitination and proteasome - dependent degradation of cdc25a. these findings together with the demonstration that mesalazine does not affect cdc25a rna expression strongly suggest that cdc25a is posttranscriptionally down - regulated in mesalazine - treated cells. these results are consistent with those published by luciani and colleagues, who show that exposure of crc cells to mesalazine causes a reversible accumulation of cells in s - phase. these authors showed that such an effect was p53 independent and related with the activation of proteins involved in the atm- and rad3-related kinase- (atr-) dependent s - phase checkpoint response (e.g., chk1, rad17). further work by other researchers has confirmed the ability of mesalazine to interfere with cell cycle progression [30, 31 ] and shown that crc cells can accumulate in various phases of the cell cycle in relation to the dose and time of exposure to the drug. both sporadic and ibd - related crc are characterized by a very similar frequency of the two major types of genomic instability, namely, chromosomal instability (cin) and microsatellite instability (min). cin is characterized by atypical segregation of chromosomes and abnormal dna content (aneuploidy), with consequent loss of whole (or part of) chromosomes and function of critical tumor suppressor genes (e.g., adenomatous polyposis coli, p53). min is characterized by an increased rate of point mutations and is dependent on defects in the mismatch repair system, a mechanism involved in repairing dna base - pair mismatches, which occur in the normal dna replication. during this process, however, when microsatellites are located in exonic gene regions, there can be a shift in the codon reading frame which results in a loss of protein function. studies performed by gasche and campregher demonstrated that mesalazine improves replication fidelity in cultured crc cells independently of the presence of mismatch repair system [34, 35 ]. the mechanism by which mesalazine inhibits the generation of frameshift mutations remains unknown, even though it could in part rely on the ability of the drug to slow down dna replication and cell division, because cell cycle regulation is one of the defense mechanisms that allow cells to either repair dna damage or eventually undergo apoptosis thus safeguarding the integrity of the genome. an intriguing possibility that emerges from the available experimental data is that the antitumoral properties of mesalazine reflect the ability of the drug to target several pathways that are both early and common in colorectal carcinogenesis. the wnt/-catenin pathway, which is constitutively activated in the majority of crc, is one of such targets. in this pathway, wnt binds to the transmembrane frizzled receptor, leading to the activation of the cytoplasmic disheveled (dsh) protein. dsh forms a complex with the -catenin degradation complex, which consists of the apc gene product, glycogen synthase kinase-3 (gsk-3), axin, and -catenin. in the absence of wnt, gsk-3 phosphorylates -catenin, thereby promoting its ubiquitination and degradation. in response to wnt signals, -catenin is no longer targeted for degradation, and it accumulates in the cytoplasm and subsequently translocates to the nucleus, where it associates with the transcriptional enhancers of the lymphoid enhancer - binding factor / tcf family and stimulates the expression of genes involved in tumor progression. bos and colleagues showed that mesalazine inhibits the wnt/-catenin pathway in apc - mutated crc cells with intact -catenin. mesalazine increases -catenin phosphorylation and consequently reduces nuclear accumulation of -catenin and expression of wnt/-catenin target genes (e.g., cyclin d1, c - met, and c - myc). the mechanism by which mesalazine promotes -catenin phosphorylation remains to be ascertained, but it is known that the drug inhibits the activity of the protein phosphatase (pp)2a, a known regulator of the -catenin phosphorylation status in crc cells. another important target of mesalazine in crc cells is epidermal growth factor receptor (egfr), the activation of which is followed by a range of intracellular events that eventually stimulate crc growth and survival. egfr is overexpressed not only in sporadic crc but also in the premalignant lesions of ibd - associated carcinogenesis [41, 42 ]. we showed that mesalazine suppresses egfr phosphorylation / activation in crc cells, as a result of its ability to enhance the activity of protein tyrosine phosphatases (ptps) that control egfr activation. in particular, mesalazine induces src homology (sh)-ptp2 to interact with and promote dephosphorylation of egfr. the peroxisome - proliferator - activated receptor gamma (ppar-), a transcription factor belonging to the nuclear hormone receptor superfamily, is highly expressed in the colon where it regulates cellular proliferation, differentiation, and apoptosis. ppar- activation inhibits formation of aberrant crypts foci and development of crc in mice [45, 46 ]. specifically, mesalazine enhances ppar- expression, promotes its translocation from the cytoplasm to the nucleus, and increases its interaction with vitamin d3 receptor - interacting protein-205 in crc cells. in competitive binding studies, mesalazine displaces rosiglitazone and the selective ppar- ligand gw1929 from their binding sites on the ppar- molecule. in immune - deficient mice engrafted with human crc cells, administration of mesalazine reduces the growth of xenografts, via a ppar--dependent mechanism. activation of ppar- by mesalazine is accompanied by induction of the tumor suppressor gene pten, activation of caspase-8 and caspase-3, and diminished expression of survivin and x - linked inhibitor of apoptosis protein. before generally considering mesalazine as an antitumor compound, it should be taken into consideration that the majority of preclinical studies investigating the role of this drug in crc growth and survival have been conducted in experimental models using very high doses which are not commonly reached within the gut tissue under standard oral treatment. therefore, the validation of novel mesalazine derivatives that exhibit similar safety profiles but enhanced anticancer activity is highly desirable. to this end, we have recently developed several mesalazine derivatives and focused our work on 2-methoxy-5-amino - n - hydroxybenzamide (we termed 214), since this compound displayed the more pronounced antimitogenic effect and was ten times more potent than mesalazine in blocking crc cell growth. interestingly, 214 did not affect the growth of normal colonic intraepithelial lymphocytes and fibroblasts. unlike mesalazine, 214 induced endoplasmic reticulum stress (ers) in crc cells thereby promoting downregulation of cyclin d1 and accumulation of cells in g0/g1 phase of the cell cycle. as expected, persistent block of 214-treated crc cells in g0/g1 phase of cell cycle was accompanied by a caspase - dependent cell death. to translate these observations in vivo, we assessed the anti - neoplastic effect of 214 in a syngeneic crc model, in which tumors were generated by injecting the murine crc cell line, ct26, into balb / c mice. mice treated with 214 showed a remarkable dose - dependent decrease in tumor volume compared to control mice. the anticancer effects of 214 was documented regardless of whether the drug was administered subcutaneously or systemically while in the same model mesalazine reduced the growth of tumors only when given subcutaneously. we further strengthened the in vivo anti - neoplastic effect of 214 by using the aom / dss - induced colitis - associated crc. mice given 214 developed fewer smaller tumors than control mice and 214 treatment was not associated with significant changes in the proliferation rate of normal colonic cells. more recently, we showed that 214 sensitized crc cells to tnf - related apoptosis - inducing - ligand- (trail-) driven death. trail - driven cancer cell apoptosis is mediated by ligand - dependent activation of two functional death receptors (drs) (i.e., dr4 and dr5). treatment of trail - resistant crc cells (i.e., ht-29 and dld-1) with 214 but not mesalazine upregulated dr5. moreover, 214 down - regulated the expression of survivin, an antiapoptotic protein that interferes with trail - induced cell death in cancer cells. these in vitro data were confirmed in a graft model generated by trail - resistant crc cells (i.e., ct26) in mice. in this model 214 synergized with trail in inhibiting the in vivo growth of ct26-derived tumors. in line with our results, honeder and coworkers have recently showed that mesalazine derivatives, including 214, inhibit crc cell growth. in the last decade extensive research has been performed to evaluate the anti - neoplastic action of mesalazine. although definitive conclusions from these studies can not be drawn, it seems that when used at very high doses the drug can interfere with critical steps in the process of colon carcinogenesis. even more promising seem to be the results obtained with mesalazine derivatives. among these, 214 is more potent than mesalazine in inhibiting crc cell growth and survival, maintains its anti - tumor activity when administered systemically, and does not affect the proliferation of normal gut cells. these observations and the fact that 214 is fully synthetic and has a fairly simple structure suggest that this drug could be helpful in designing novel crc chemoprevention programs. further experimentation is however needed to define the pharmacokinetic properties of the compound and evaluate the potential effects of 214 on vital functions of the host.	patients with inflammatory bowel disease (ibd) face an increased lifetime risk of developing colorectal cancer (crc). independent factors associated with increased risk include long disease duration, extensive colonic involvement, young age at onset of ibd, severity of inflammation, primary sclerosing cholangitis, backwash ileitis, and a family history of crc, thus emphasising the role of intestinal inflammation as an underlying mechanism. this notion is also supported by the demonstration that the use of certain drugs used to attenuate the ongoing mucosal inflammation, such as mesalazine, seems to associate with a reduced incidence of colitis - associated crc. in the last decade, work from many laboratories has contributed to delineate the mechanisms by which mesalazine alters crc cell behaviour. in this paper, we review the available experimental data supporting the ability of mesalazine and its derivatives to interfere with intracellular signals involved in crc cell growth.
a 42-year - old woman diagnosed with stage iv nsclc (adenocarcinoma) was admitted to our hospital in august 2013 and given an ap regimen (pemetrexed 500 mg / m on day 1, cisplatin 75 mg / m on days 1 to 3, repeated every 3 weeks) as initial chemotherapy on august 2nd, 2013. several days later, her egfr genetic test results demonstrated an exon 19 mutation (l747-t751>p) ; thus, she started taking gefitinib (250 mg once daily) on august 15th. on august 23th, which was 21 days after ap chemotherapy and 8 days after gefitinib treatment, the patient suddenly developed a widespread eruption including acne - like rash on the face, erythema papules on the trunk and limbs, oral ulcer, and conjunctivitis (figure 1a and 1b), followed by a fever of 39c. the rash gradually increased and aggravated, accompanied with blisters, pruritus, and ulceration. gefitinib was immediately stopped, and imipenem, amikacin, and fluconazole were administered intravenously as prophylaxis, and diphenhydramine and loratadine were given as an anti - allergy treatment. on the 13th day, the patient 's condition deteriorated further with a fever of 42c, fused mucocutaneous rash as well as diffuse vesicles and bullae (figure 1c and 1d), which coalesced and then sloughed, presenting a scalded appearance. a positive nikolsky sign was present on her back and feet (figure 1e and 1f). after consulting dermatology doctors, the patient was diagnosed with ten and transferred to the dermatology department at the second affiliated hospital of sun yat - sen university for further treatment. routine laboratory testing showed a white blood cell (wbc) count of 6.26 10/l [reference value : (3.69 - 9.16) 10/l ], neutrophil (neu) proportion of 73.1% (reference : 50%-70%), and c - reactive protein (crp) level of 16.36 mg / l (reference : 0 - 8.2 mg / l) ; both the mycoplasma pneumoniae igm antibody and mac strains were negative. no suspicious fungus was found in the oral swab examination, nor did bacteria grow in the skin secretion culture. immunosuppressive treatment was started with 100 mg methylprednisolone (daily injection) for 9 days and intravenous immunoglobulin (20 g / day) for 5 days, followed by 10 g / day for 5 days, accompanied with imipenem and teicoplanin for anti - infection and other supportive treatment. this treatment led to a recurrence of the rash and the mucosal lesions, reepithelization of the denuded skin (figure 2), and improvement of the patient 's general condition within 40 days. a chest computed tomography (ct) scan and brain magnetic resonance imaging (mri) showed partial remission after treatment. the combination of ap and gefitinib was suspended ; accordingly, the patient began treatment with icotinib (another egfr - tki made in china) after recovery, without exfoliative dermatitis or other similar toxicities. stable disease was later achieved. on the 8th day after gefitinib treatment, diffuse erythema papules were observed on the trunk (a) and palms (b) ; on the 13th day, fused skin rash and diffuse vesicles and bullae (c) as well as erosive lip mucosa (d) were observed ; on the 16th day, fused and sloughed systematic herpes (e) and plantar blister (f) were observed. the systematic rash gradually crusted and desquamated (a and b) ; reepithelization of the denuded skin and ultimate healing were observed (c - e). most ten cases result from hypersensitive reaction to drugs, and sulfonamides, pyrazolones, barbiturates, and antiepileptics are the most frequent triggers. ten usually occurs between 7 days to 8 weeks after drug administration. upon readministration of the implicated drugs ten is a t - cell mediated disease with cd8 t cells acting as the major mediator of keratinocyte death. drug - induced cd8 t - cell activation is highly specific for particular human leukocyte antigen (hla) allotypes, placing certain populations at a greater risk of developing ten. granulysin is the main mediator of apoptosis, and soluble fas ligand (sfasl), tumor necrosis factor - alpha (tnf-), and granzyme b / perforin are important in the pathogenesis of ten. put forward that the clinical features of ten include (1) constitutional symptoms such as fever, malaise, anorexia, and pharyngitis ; (2) erythematous, dusky, violaceous macules, morbilliform, or atypical targetoid macules starting on the trunk and spreading distally, confluence on the face, trunk, and elsewhere [the skin lesion area of ten is greater than that of stevens - johnson syndrome (sjs) ] ; (3) manifests in flaccid bullae, epidermal sloughing, and necrosis with gray hue ; (4) exfoliation of the epidermis involving 10% of body surface area for sjs, 10%-30% for sjs / ten overlap, and > 30% for ten ; (5) oral, genital, and ocular mucositis in nearly all patients ; (6) tender skin and painful mucosal erosions ; (7) positive nikolsky sign ; (8) positive asboe - hansen sign ; (9) systemic symptoms always present in sjs / ten overlap and ten ; and (10) respiratory tract epithelial involvement in 25% of patients with ten. histological features were described as follows : (1) full thickness epidermal necrosis ; (2) subepidermal split, lymphocytic infiltrate at the dermoepidermal junction, cd4 t cells in the dermis, and cd8 t cells in the epidermis ; and (3) endothelial apoptosis. for mild and early stage ten, the main differential diagnoses includes sjs, acute generalized exanthematous pustulosis (agep), erythema multiforme major (emm), staphylococcal scalded skin syndrome (ssss), drug - induced linear immunoglobulin a (iga) dermatosis, acute graft versus host disease (gvhd), and a generalized morbilliform drug eruption, among other conditions,. our patient 's clinical characteristics were consistent with the above criteria except items (8) and (10). because the patient 's exfoliation was almost systemic, sjs and emm were excluded ; ssss were excluded due to negative blood and rash cultures for bacteria and fungus as well as the presence of conjunctiva and oral mucosa damage. in addition, the patient 's rash mainly appeared as blisters and bullae due to erythema in the beginning stage, without pustules. therefore, the patient was diagnosed with ten according to typical clinical features. after treatment with glucocorticoids combined with immunoglobulin, her condition gradually improved, which verified the diagnosis of ten. however, there also exists some deficiency in the diagnosis of this case, primarily the lack of mucocutaneous biopsy and immunologic examination to aid in the diagnosis. an effec - tive treatment requires early diagnosis, immediate discontinuation of the causative drugs, and supportive and specific treatment. recently, the systematic application of glucocorticoids has been the major therapeutic regimen, and glucocorticoids combined with immunoglobulin can quickly control symptoms and shorten hospitalization time and is especially suitable for patients with concurrent infection. because this case of ten occurred after ap and gefitinib sequential combination treatment, it is difficult to determine which drug was responsible for this toxicity. thus far, there has been no report of ten induced by cisplatin, whereas there has only been one case of sjs related to bleomycin - cisplatin combination treatment and another case of exfoliative dermatitis associated with cyclophosphamide - cisplatin combination treatment. to the best of our knowledge, 4 cases of ten due to pemetrexed have been reported thus far : 1 due to pemetrexed alone, 1 related to pemetrexed plus carboplatin, and the other 2 related to pemetrexed plus cisplatin. the mucocutaneous disorder occurs between 2 days after the first cycle and 15 days after the second cycle of drug administration. although our patient received gefitinib after ap chemotherapy, ten occurred at the expected time and the patient did not develop mucocutaneous disorder after readministration of another egfr - tki, which supports pemetrexed as the initiator. although there is no report of egfr - tki - induced ten thus far, gefitinib could not be ruled out for the cause of this case as egfr - tkis alter keratinocyte proliferation, differentiation, migration, and attachment, and cutaneous toxicity occurs in more than 50% of patients. meanwhile, ten occurring after 8 days of gefitinib administration has also increased the suspicion of gefitinib as the initiator. another possible mechanism may be the synergistic effect on dermal toxicity for pemetrexed and gefitinib combination therapy. the basic skin toxicity of egfr - tkis may facilitate the occurrence of ten induced by pemetrexed. meanwhile, is there any possibility for the enhancement of egfr - tki - induced mucocutaneous disorder based on the alternation of folic acid metabolism of epithelial cells by pemetrexed ? it is still unknown. in summary, we report this case with the intent to further understand the potential rare mucocutaneous adverse effects of ap with gefitinib combination therapy. this case report also warns of the possibility of gefitinib as a potential initiator agent of ten.	toxic epidermal necrolysis (ten) is a rare acute life - threatening mucocutaneous disorder that is mostly drug - related (80%-95%). it is clinically characterized as a widespread sloughing of the skin and mucosa. ap regimen (pemetrexed plus cisplatin) has been the preferred first - line chemotherapy for metastatic non - squamous non - small cell lung cancer (nsclc). gefitinib, a small - molecule epidermal growth factor receptor (egfr) tyrosine kinase inhibitor (tki), has already been recommended as a first - line treatment in egfr - mutant metastatic nsclc. we report rare presentation of ten involving adverse effects of ap and gefitinib combination treatment in a 42-year - old woman diagnosed with metastatic nsclc harboring an egfr mutation. on the 21st day after administration of the first cycle of ap regimen and the 8th day after the initiation of gefitinib treatment, she developed an acne - like rash, oral ulcer, and conjunctivitis, which later became blisters and ultimately denuded. the characteristic clinical courses were decisive for the diagnosis of ten. treatment with systemic steroids and immunoglobulin as well as supportive treatment led to an improvement of her general condition and a remarkable recovery.
the incidence of gastric cancer varies widely depending on the geographic region analyzed ; it has been shown to be as high as 8082 per 100,000 inhabitants in some cities in japan ; has an intermediate incidence in costa rica, so paulo, brazil, and cali, colombia (50 100,000 inhabitants) ; and has a low incidence in kuwait, los angeles, ca, usa, and mexico (45 years.8 in a retrospective analysis of 72 cases of patients aged 35 years, found a greater incidence of invasion of adjacent organs (74% vs 29%) and distant metastasis (81% vs 50%) in patients younger than 35 years, as well as a reduced possibility of curative surgery (58% vs 17%) and greater postsurgical mortality (22% vs 2%).24 age as an adverse prognostic factor appears to be related to a greater degree with delay in diagnosis. lai, in a series of 6954 patients divided into three groups by age (with 12.7% of patients aged 65 years of age), concluded that patients < 40 years of age exhibited significantly better survival than those in group two ; multivariate analysis indicated that age was an independent prognostic factor.25 to date, the reason for the occurrence of gastric cancer in young people remains inexplicable. in our series, we did not find that women predominantly have gastric cancer in this age group, as has been reported in other series in the literature.26 conversely, in our study, 54% of the patients with gastric cancer were men. additionally, we found that despite aggressive surgical resection or neoadjuvancy, the outcomes from having gastric cancer continue to be invariably devastating. however, an attempt should be made to identify the subgroup of patients who can benefit from screening, and in whom early detection can be recommended. attempting to identify the environmental factors that favor the progression or development of gastric cancer would also be ideal. we also recommend searching for a tumor marker to detect this disease in its earliest stages, given that therapies used for standard management of gastric cancer to date have not substantially improved the disease s prognosis. prevention of the disease is optimal, as gastric cancer is truly difficult to control once it has been established. to date, there has been a trend toward late diagnosis of gastric cancer in younger patients who present with symptoms. physicians should account for the possibility of gastric cancer in patients with a familial history, or with symptoms of ulcer that do not improve under adequate medical management. with the diagnosis of an ulcer, panendoscopy should without exception be conducted to obtain a biopsy for early diagnosis, which can increase survival in young patients. the clinical and pathological characteristics of gastric cancer in a series of patients included the following : similar proportion in both genders. delay in diagnosis of young patients leads to presentation at advanced disease stages and to young patients being candidates for palliative care. despite the lack of demonstrating a statistically significant p the patients studied were found to have progressed to advanced disease stages, when treatment was oriented toward palliative care of the disease.	backgroundgastric cancer is an aggressive disease with nonspecific early symptoms. its incidence and prognosis in young patients has shown considerable variability.purpose of the studyour objective was to retrospectively study patients from our institution aged < 30 years with gastric carcinoma. the study was undertaken to describe the experience of gastric cancer in this population, and to demonstrate its specific clinical and pathological characteristics.materials and methodswe reviewed the cases of histologically confirmed gastric cancer between 1985 and 2006 at the instituto nacional de cancerologa of mexico (incan) ; emphasis in our review was placed on clinical presentation, diagnostic and therapeutic intervention, pathology, and the results.resultsthirty cases of gastric carcinoma were reviewed. the patients median age was 27 years (range, 1830 years) and the male : female ratio was 1:1.conclusiongastric cancer exhibits different behavior in patients aged, 30 years, but delay in diagnosis and the tumor s behavior appear to be the most important factors in prognosis of the disease.
spinal manipulative therapy was defined by world health organization as includes all procedures where the hands or mechanical devices are used to mobilize, adjust, manipulate, apply traction, massage, stimulate, or otherwise influence the spine and paraspinal tissues with the aim of influencing the patient 's health. cervical spine manipulation (csm) is one popular type of spinal manipulative therapies for the relief of cervical spine - related conditions worldwide, which is considered a high - level skill of manual therapy that demands bimanual coordinated rhythmical movements. currently, csm has emerged as one of the leading forms of alternative and complementary treatment for neck pain from cervical spinal disease. however, serious complications of csm continue to be reported. csm may carry the potential for serious neurovascular complications, primarily due to vertebral artery dissection (vad) and subsequent vertebrobasilar stroke. here, we reported a rare case of locked - in syndrome (lis) due to bilaterial vad after csm treated by arterial embolectomy. a 36-year - old right - handed man presented with numbness and weakness of limbs was transferred to emergency department in our hospital. one day before admission, the patient suffered from mild neck pain with no focal neurological deficits and 2 hours before he visited a chiropractor and underwent csm in a private clinic. however, during the period of csm, the patient 's pain deteriorated suddenly half an hour before admission. at that time, the patients complained numbness and hemiplegia in the right side of limbs. the 4 main vital signs routinely monitored as follows : temperature was 37 c, heart rate was 80 beats per minute, blood pressure was 132/88 mmhg, and respiratory rate was 26 breaths per minute. coagulation times, renal and liver function tests, and electrolytes were within normal limits. the cervical vertebra computed tomography (ct) showed mild intervertebral disc hemia of c3/c4, c4/c5, and brain ct scan was normal. gradually, although the patient remained conscious, he could not speak but could communicate with the surrounding by blinking or moving his eyes, and turned to complete quadriplegia, complete facial and bulbar palsy, dyspnea at 4 hours after admission. the repeated brain ct scan showed the hyperdense basilar artery sign and cervical vertebra ct scan showed no evident abnormorlity in cervical cord. brain ct angiography (cta) examination was performed at 8 hours after admission. the patient was transferred to the intensive care unit to prepare for the emergency embolectomy with intubated but without mechanical ventilation. the cervical vertebra and brain ct scan and mri scan. (a) the ct scan at 4 hours after syptoms onset showed the hyperdense basilar artery sign (the red arrow). (b) the ct scan at 4 hours after syptoms onset showed no evident abnormorlity in cervical cord. (d) the t2-weighted mri image at the 17th day showed the normal right verterbral artery (white arrow) and a high - signal fulfilling the left vertebral artery (red arrow). ct = computed tomography, mri = magnetic resonance imaging. the cta scan and dsa examination. (a) the cta scan showed stenosis of v3 segment and part of v4 segment of left vertebral artery, stenosis of v3 segment of right vertebral artery, thrombogenesis of v4 segment of left vertebral artery, mainly blocking of distal segment of basilar artery. (d) the dsa examination after emergency embolectomy showed the basilar artery recanalized, and bilateral superior cerebellar arteries and posterior cerebral artery developed. left vertebral aortocranial digital subtraction angiography (dsa) under general anesthesia was performed immediately and endovascular treatment was taken as well. a 6-fr introducer sheath was placed into the right femoral artery via a percutaneous route. aortocranial dsa shows vertebrobasilar thrombosis, blocking left vertebral artery, and stenosis of right vertebral artery (figure 2b, c). after emergency arterial embolectomy, the basilar artery recanalized, and bilateral superior cerebellar arteries and posterior cerebral artery developed, although the left cerebellar artery has poor developed and still blocking of distal segment of left vertebral artery (figure 2d). after the operation, he was returned to intensive care unit followed by antiplatelet therapy and supportive therapy. at 17 days after his admission, brain magnetic resonance imaging (mri) scan showed pontine infarction (figure 1c) and axial t2-weighted showed a high - signal fulfilling the left vertebral artery (figure 1d). twenty - seven days later, after the treatments in the intensive care unit and a general ward, the patient 's physical function gradually improved and discharged but still left neurological deficit with muscle strength grade 3/5 and hyperreflexia of limbs. the current best available evidence suggests that craniocervical arterial dissection may be of a low incidence but could be a serious complication of csm. in the present study, we added a rare case who was presented with lis caused by bilateral vad after csm. in 1934, a medical legal abstract 1st reported cerebrovascular accidents after csm. in 1947, the 1st case of vad after chiropractic manipulation was described. in particular, the force and extent of high velocity thrusts of the cervical spine, especially with rotational movement, can cause craniocervical arterial dissection in susceptible individuals. craniocervical arterial dissection is one of important causes of unpredictability of ischemic stroke in young and middle - aged people. although current biomechanical evidence is insufficient to establish the claim that causation between csm and craniocervical arterial dissection, clinical reports suggest that mechanical forces have a role in a considerable number of craniocervical arterial dissections and most population controlled studies have found an association between csm and vad stroke in young patients. uncommonly, it has been reported bilateral vad after csm, resulting in the left thalamus and posterior limb of the internal capsule and the right cerebellar hemisphere infarction. in the present study, bilateral vad after csm causes bilateral pons infraction characterized by lis. lis with a vascular etiology is a particularly severe type of lis for which the mortality is at 67% within the 1st 4 months. the imaging modalities are available to diagnose craniocervical arterial dissection and stroke, including duplex ultrasonography, ct, cta, mri, mra, and dsa. in the present study, the cervical vertebra and brain ct scan at 1.5 hours after syptoms onset showed no evident abnormorlity, whereas the ct scan at 4 hours after syptoms onset showed the hyperdense basilar artery sign. thus, cta is an easy available tool to choice, and dsa is the gold standard for luminal imaging. mri with diffusion - weighted imaging should be employed in acute infarcts and follow - up of vad and vertebrobasilar stroke. up to now, no specific treatment for lis has been established. the acute treatment and intervention of patients with lis is similar to that for patients with other acute ischemic stroke of brain stem insults. currently, thrombolysis with intravenous recombinant tissue - type plasminogen activator therapy remains the only proven effective pharmacological treatment for selected acute ischemic stroke patients within a relatively short therapeutic time window of 3 to 4.5 hours after the onset of stroke symptoms, although disappointments remain concerning modest recanalization rates and the devastating symptomatic intracranial hemorrhage. in 2015, the treatment protocols for acute ischemic stroke have been fundamentally altered because of the updated guidelines of american heart association / american stroke association for the early management of patients with acute ischemic stroke using endovascular techniques. this guideline concluded that certain endovascular procedures have been demonstrated to provide clinical benefit in selected patients with acute ischemic stroke. in the present study, the patient was gradually presented with lis due to bilaterial vad, which is associated with high mortality and serious complications. although treatment is initiated beyond 6 hours from symptom onset, we decided to proceed with a mechanical embolectomy. at result, the patient was treated by arterial embolectomy and gradually recovered to antigravity power when discharged. thus, arterial embolectomy is one of treatment choice for vertebrobasilar thrombosis due to bilateral vad after csm even in later time windows. we acknowledged that the increased risk after csm may be an artifact of patients seeking care for neck pain resulting from existing cvd rather than the result of treatment itself, suggesting that not all stroke cases temporally related to csm have preexisting craniocervical artery dissection.. the practitioner must be aware of this complication and should give the patient 's informed consent to csm. the specific radiological tests such as duplex ultrasonography and mri should be used before csm to evaluate the risk of adverse events and vascular vulnerability. in addition, csm is a high - level skill of manual therapy thus necessitating training to achieve proficiency. a well - trained practitioners may contribute to reduce the skill - related adverse events of inappropriate technique.	abstractcervical spine manipulation (csm) is a commonly spinal manipulative therapies for the relief of cervical spine - related conditions worldwide, but its use remains controversial. csm may carry the potential for serious neurovascular complications, primarily due to vertebral artery dissection (vad) and subsequent vertebrobasilar stroke. here, we reported a rare case of locked - in syndrome (lis) due to bilaterial vad after csm treated by arterial embolectomy.a 36-year - old right - handed man was admitted to our hospital with numbness and weakness of limbs after treating with csm for neck for half an hour. gradually, although the patient remained conscious, he could not speak but could communicate with the surrounding by blinking or moving his eyes, and turned to complete quadriplegia, complete facial and bulbar palsy, dyspnea at 4 hours after admission. he was diagnosed with lis. then, the patient was received cervical and brain computed tomography angiography that showed bilateral vad. aortocranial digital subtraction angiography showed vertebrobasilar thrombosis, blocking left vertebral artery, and stenosis of right vertebral artery. the patient was treated by using emergency arterial embolectomy and followed by antiplatelet therapy and supportive therapy in the intensive care unit and a general ward. twenty - seven days later, the patient 's physical function gradually improved and discharged but still left neurological deficit with muscle strength grade 3/5 and hyperreflexia of limbs.our findings suggested that csm might have potential severe side - effect like lis due to bilaterial vad, and arterial embolectomy is an important treatment choice. the practitioner must be aware of this complication and should give the patients informed consent to csm, although not all stroke cases temporally related to scm have pre - existing craniocervical artery dissection.
guajadials c - f (14), four sesquiterpenoid - based meroterpenoids with unprecedented skeletons were isolated from the leaves of psidium guajava. their structures and relative configurations were established by extensive spectroscopic analysis. a possible biosynthetic pathway for 14 was also proposed. supplementary material is available for this article at 10.1007/s13659 - 012 - 0102 - 4 and is accessible for authorized users.	abstractguajadials c - f (14), four sesquiterpenoid - based meroterpenoids with unprecedented skeletons were isolated from the leaves of psidium guajava. their structures and relative configurations were established by extensive spectroscopic analysis. a possible biosynthetic pathway for 14 was also proposed.graphical abstractelectronic supplementary materialsupplementary material is available for this article at 10.1007/s13659 - 012 - 0102 - 4 and is accessible for authorized users.
ashy dermatosis is a hypermelanotic disorder of the idiopathic variety characterized by bluish - grey macules in healthy individuals. it is a controversial entity and is sometimes considered as a variant of lichen planus. etiology of ashy dermatosis is mostly unknown and it usually affects the face, arms, neck, and trunk. ashy dermatosis usually has a symmetrical distribution but cases with unilateral presentation have also been observed. lichen planus pigmentosus, occupational dermatosis with hyperpigmentation, drug - related dermatoses, universal acquired melanosis, and familial progressive hyperpigmentation are the common entities confounding diagnosis. our case was a 20 year - old indian male who presented with slowly progressive, diffuse darkening of the face, arms, neck, and trunk seen over the last two years [figures 1 and 2 ]. he had no previous history of skin diseases and was not on any kind of medication during this two - year period. laboratory investigations suggested normal blood counts, blood glucose level, normal liver and kidney function test and normal acth stimulation (sensitive) test results. bluish black discoloration of face, chest, and upper extrimity bluish black discoloration of neck and back oral mucous membrane and palate are not involved it has been a controversial topic that has showed a tendency to appear mostly in dark colored individuals and also in asians. confusion also arises because the disease is also known by many different names like erythema dyschromicum perstans and lichen planus pigmentosus. others have suggested that ashy dermatosis presents clear clinical characteristics but that histopathological findings are not specific. our differential diagnoses revolved around lichen planus pigmentosus, occupational dermatosis with hyperpigmentation, drug - related dermatoses, universal acquired melanosis, allgrove 's syndrome, dermatomyositis, and familial progressive hyperpigmentation syndrome. absence of occupational exposure ruled out occupational dermatosis with hyperpigmentation ; dermatomyositis is a condition of muscle weakness, and allgrove syndrome is characterized by alacrima, achalasia, and acth insensitivity. but the patient did not show any of these symptoms and signs. a normal creatinine phosphokinase (cpk) level ruled out the chances of dermatomyositis, and a normal barium meal x - ray and acth sensitivity test ruled out allgrove syndrome. the patient had not taken any drugs in this period.so drug - related dermatosis was ruled out. the histopathological study was not conclusive enough to differentiate from lichen planus pigmentosus but the absence of pruritus, the lack of involvement of the oral mucosa, and the bluish - black discoloration in our patient, a dark colored indian in his second decade of life support our diagnosis in favor of ashy dermatosis of the idiopathic variety. the only treatment in this condition resulting in considerable improvement in pigmentation is clofazimine at a dose of 100 mg three times per week for three to five months.	we present here the case of a young indian male with slowly progressive, diffuse darkening of the face, arms, neck, and trunk. the patient was not taking any medication and there was no history of any previous skin disease and the mucous membrane was not involved. these findings are consistent with a diagnosis for ashy dermatosis of unknown etiology.
birt - hogg - dub syndrome (bhds) is an inherited autosominal dominant genodermatosis that predisposes individuals to the development of fibrofolliculomas (ff), trichodiscomas (td), and acrochordons of the face, neck, and upper trunk (1). there is also an increased risk for lung cysts, spontaneous pneumothorax, and renal carcinomas in affected people, and some patients may also develop colorectal polyps and cancers (2 - 4). the disease is caused by germline mutations in the bhd (also known as flcn) gene located in 17p11.2 encoding folliculin, a new protein with unknown function (5). we report a patient with bhds in which mutation analysis subsequently revealed a novel mutation. a 31-yr - old woman visited the department of dermatology for evaluation of long - standing mildly pruritic facial papules that she had had for 10 yr (fig. previously she had been treated with co2 laser and aldara ointment with the impression of verruca or syringoma but with little effect. physical examination revealed several firm, flesh - colored, dome - shaped, papular lesions ranging from 2 to 5 mm in diameter, distributed on the face and neck area. the patient had a history of pneumothorax ; otherwise, her medical history was not notable. one sample showed concentric layers of cellular fibrous tissue around hair follicles with an aritifactual cleft separating the fibroma from adjacent connective tissue (fig. also in another sample, a raised papule composed of connective tissue surrounded by a lateral collarette was seen (fig. staining with alcian blue and elastin stain revealed an unencapsulated loosely woven admixture of collagen and thin elastic fibers with mucin. periodic acid - schiff (pas) staining showed multiple thin and thick walled blood vessels with pas - positive basement membrane within the substane of the tumor.. computed tomographic scan of the chest, abdomen, and pelvis showed multiple cysts on both lower lung zone, with sizes ranging from 1.4 - 2.4 cm and a small amount of pneumothorax noted on the left anterior basal hemithorax. there was no family history of renal tumors, colon carcinoma, or other benign or malignant neoplasm. however, the patient reported that her two aunts died of ' lung disease ' (diagnosis unknown) and one of her older sisters was remembered to have had multiple tumorous lesions. both of her older sisters passed away at an early age but she did not know the cause of death. molecular analysis of the bhd gene was performed after informed consent from the patient. all the coding regions of the bhd gene (exons 4 - 14) were amplified using polymerase chain reaction (pcr) with oligonucleotide primers we designed (table 1). the amplified pcr products were sequenced using the abi 3100 genetic analyzer (applied biosystems / hitachi, foster city, ca, u.s.a.). sequencing analysis revealed a novel deletion mutation (p.f519lfsx17 [c.1557delt ]) in the bhd gene exon 14 of the patient (fig. this mutation results in producing the truncated protein folliculin, which is caused by frameshift of amino acid sequence in the bhd gene product. also, this deletion mutation has not yet been found in the normal populations, indicating that this mutation is the real cause of the syndrome in this case. bhds was recently found to be caused by heterozygous loss - of - function mutations in the bhd tumor suppressor gene on chromosome 17p11.2, which encodes the novel protein folliculin. fluorescent in situ hybridization has shown the expression of bhd mrna in many normal tissues including the skin and its appendages, the distal nephron of the kidney, stromal cells, and type 1 pneumocytes of the lung (6). the function of the bhd gene in tumorigenesis, however, has not yet been elucidated. the defective protein in patients with bhds may affect the cell 's cytoskeleton, disrupting the extracellular matrix and affecting the regulation of cellular proliferation (7). because patients with bhds have inactivating mutations in the bhd gene, and many bhds tumors exhibit loss of heterozygosity, the bhd gene is considered to be a tumor suppressor gene (7). fluorescent in situ hybridization showed that bhd mrna was strongly expressed in the proliferating epithelial strands of ffs but not expressed in the renal tumors of patients with bhds. genotype - phenotype correlation remains to be evaluated for bhds, but it was recently suggested that significantly fewer renal tumors were observed in patients with the c - deletion than those with the c - insertion mutation in the exon 11 hotspot (9). to date, several different bhd germline mutations have been identified with mutations affecting all translated exons (4 - 11) with the exception of exons 8 and 10. 4). clinical diagnosis of bhds requires a minimum of 10 skin lesions clinically compatible with ffs and at least one histologically proven ff (5, 9). ff and td present as asymptomatic single or multiple dome - shaped papules commonly located on the head, neck, back, and arms. however, many researchers now consider perifollicular fibroma in patients with bhds to actually represent ff (10). thus, based on clinical and histological findings, our patient could be diagnosed as bhds. since its description in 1977 bhds patients are 9.3 times more likely to develop a renal tumor than unaffected persons, and are 32.3 times more likely to develop a spontaneous pneumothorax (12). older age and male gender increase the risk for renal tumors, whereas the risk of spontaneous pneumothorax is inversely associated with age (12). between 15% and 30% of bhds - affected patients, patients develop renal tumors much earlier than unaffected persons, typically developing tumors in their 20s or 30s instead of in their 70s and often presenting with multiple, bilateral renal cancers. in the absence of strictly defined guidelines, it is recommended that patients with clinical manifestations of bhds undergo abdominal computed tomography and/or renal ultrasound at the time of diagnosis. siblings should have a complete physical examination with biopsy of lesions suspicious for ff / tds beginning in their 20s. routine screening for renal pathology may begin if they have ff or at age 40 yr. tumors less than 3 cm are observed, whereas tumors larger than 3 cm are treated with nephron - sparing procedures including partial nephrectomy (14). spontaneous pneumothorax was more likely to occur in younger patients with bhds (12). patients with bhds should be informed of the increased risk and educated on the signs and symptoms of pneumothorax. our patient was diagnosed with pneumothorax in her 20s but other concominant abnormalities were not found. however, as the risk of renal tumors increases with age we advised the patient to have regular screening. the risk for colon polyps and colon cancer was not increased in bhds (12), so screening for colon pathology may not be warranted. however, routine screening by colonoscopy is included in the currently recommended guideline for all patients aged > 50 yr. the decision to undergo examination at an earlier age should be discussed with the patient. the actual incidence of bhds is unknown, and the disease is most likely underdiagnosed. it is imperative that physicians recognize the skin lesions of bhds and institute proper screening to detect other manifestations of the disease, such as renal tumors and lung cysts. patients with numerous facial and truncal papules resembling ffs are candidates for biopsy. in summary, we report a case of bhds with a novel mutation, which is the first report in korea.	birt - hogg - dub syndrome (bhds) is an autosomal dominant genodermatosis characterized by cutaneous hair follicle tumors (fibrofolliculoma or trichodiscoma), pulmonary cysts, and increased risk of renal neoplasia. the genetic alteration for bhds has been mapped to chromosome 17p12q11, and the gene in this region has been cloned and believed to be responsible for the bhds. mutations in the bhd gene (also known as flcn) have been described in the patients with bhds. we present a case of a 30-yr - old korean woman with multiple mildly pruritic papules on her face and neck area. the patient had several firm, flesh - colored, dome - shaped, papular lesions measuring between 2 to 5 mm. except for a history of pneumothorax her medical records were not remarkable. mutation analysis of the bhd gene was performed, and a novel deletion mutation (p.f519lfsx17 [c.1557delt ]) causing truncation of the gene product, folliculin, was found in the exon 14. the actual incidence of bhds is unknown, but it is most likely underdiagnosed. so it is imperative that doctors recognize the skin lesions of bhds and institute proper screening to detect other manifestations of the disease. here, we report a case of bhds with a novel mutation, which is the first report in korea.
	research conducted since 1980 in relation to inheritance patterns and dna testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. mutations that increase ovulation rate have been discovered in the bmpr-1b, bmp15 and gdf9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. in the case of bmp15, four different mutations have been discovered but each produces the same phenotype. the modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (bmpr-1b ; lacaune), autosomal over - dominant genes with infertility in homozygous females (gdf9), x - linked over - dominant genes with infertility in homozygous females (bmp15), and x - linked maternally imprinted genes (fecx2). the size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the fecx2 mutation to an extra 1.5 ovulations per oestrus for the bmpr-1b mutation. a commercial dna testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection.
a 52-year - old woman was referred to our department with a growing calcified mass in the left shoulder. she had been previously diagnosed with interstitial lung disease and progressive systemic sclerosis eight and five years prior, respectively. four years before admission, chest computed tomography first revealed a small calcified lesion in the sub - scapular area (fig. the calcified lesion increased in size, eventually becoming a large tumor - like mass (fig. 1b). at presentation, the patient exhibited slightly limited motion in the affected joint and complained of mild pain and tenderness when leaning against a wall. the patient had no family history of tumoral calcinosis and no history of trauma, with the exception of a previous thoracoscopic lung biopsy of the right lower lobe. on physical examination, no skin lesions were noted on the body surface, but the mass was palpable on the neck and back. laboratory test results revealed that serum calcium, phosphorus, and vitamin d values were within normal limits. x - ray imaging of the chest revealed a large, lobulated, and trapezoidal calcific plaque extending from the tip of the left scapula to the lower neck (fig. when the patient was referred to us, she was being treated with a steroid (methylprednisolone, 2 mg) and an immunosuppressive drug (azathioprine, 100 mg) for interstitial lung disease. however, the patient received no specific therapy to control the progression of the calcification in the shoulder. although the pain and disability associated with the affected joint were not severe, we surgically excised the chest wall mass because the mass continued to grow for several years, showing a tendency for more rapid growth in the years immediately before the decision to perform a surgical excision. this was particularly problematic because the patient was completely dependent on a wheelchair due to polio - induced paralysis, and therefore, the preservation of arm function was essential for maintaining her quality of life. moreover, we were concerned that further growth of the tumor was likely to produce skin ulceration or compression of the brachial plexus and axillary vessels, which could potentially lead to psychological trauma to the patient and the ultimate loss of shoulder function. in the operating room, the patient was positioned in a semi - prone position, and a skin incision approximately 15 cm in length was made along the medial border of the left scapula. the mass was located between the rib cage and the scapula, and was tightly attached to the first and second intercostal muscles. the mass was carefully dissected without damaging the neurovascular structures and completely excised (fig. the patient was discharged on the sixth postoperative day without any complications. in outpatient follow - up appointments, she appeared well, and no recurrence was observed on a computed tomography scan 10 months after the surgery (fig. 2c). calcinosis, which refers to the deposition of calcium phosphate crystals in the soft tissues, is a reasonably frequent condition in patients with rheumatic disease or crest (calcinosis, raynaud s phenomenon, esophageal motility disorders, sclerodactyly, telangiectasia) syndrome. the hands and fingers are affected in approximately 80% of patients with systemic sclerosis who experience calcinosis. the superficial soft tissues overlying bony prominences are most commonly involved ; however, periarticular, intra - articular, or muscular involvement is also possible. the calcinosis in systemic sclerosis is typically small and limited, although less common cases involving generalized or tumor - like calcifications have recently been reported [35 ]. the term tumoral calcinosis was originally used to refer to a rare hereditary disease involving phosphate metabolic dysfunction with a pattern of autosomal recessive transmission. this disease is characterized by multilobulated, densely calcified masses that are generally located on the extensor surfaces of large joints. however, tumoral calcinosis gradually came to include huge mass - like calcifications that are secondary to various medical conditions such as renal failure, connective tissue disease, and hormonal imbalances. although chronic tissue inflammation and macrophage activation causing tissue devitalization seem to play an important role in the pathogenesis of calcinosis in rheumatic disease, the precise mechanism has not been fully elucidated. a few pharmacological agents such as warfarin, colchicine, diltiazem, and minocycline are occasionally beneficial in specific clinical circumstances ; however, their success rates are variable, and no large series of controlled studies have investigated the effects of these drugs. in general, surgical excision may be required when the lesion is large and causes severe nerve pain, deformity, disability, or ulceration of the affected joints. the present case has some limitations in terms of its ability to provide general guidance for the surgical treatment of tumoral calcinosis. first, attention was initially paid to the dominant pulmonary pathology, whereas the growing calcification in the shoulder was ignored as a typical epiphenomenon of systemic sclerosis. second, medical treatment was thus not utilized to treat the early stages of the calcified mass. finally, our patient was paraplegic, stemming from a prior polio infection, and preservation of the function of the affected arm was critical for the patient s quality of life. despite these limitations, moreover, no pharmacological agent to date has demonstrated proven efficacy in the reduction or elimination of very large calcified masses, such as the mass observed in the present case. in light of the specific details of our case, we determined that a delay in surgery to allow for a possible response to medical treatment was potentially more risky than immediate surgical excision. in a previously reported case, a patient who did not undergo surgery eventually lost the functionality of his hand and the ability to engage in his occupation. in another case, a patient presented with a huge ulcerated mass that had not been treated for several years ; the painful mass limited his daily life and even resulted in depression. when determining the optimal timing for surgery, it is important to consider the size of the calcified mass, the time lapse between the onset of calcification and the start of treatment, the patient s symptoms and general condition, and the presence of impending complications. although there is a risk of recurrence and further calcification due to surgical trauma, it may be beneficial to perform surgery before the condition progresses to become a very large, painful, disabling, and ulcerated mass.	extensive tumoral calcinosis affecting a large joint is uncommon in patients with systemic sclerosis. we report the case of a 52-year - old female patient referred for a growing calcified mass in the shoulder. she was diagnosed with interstitial lung disease and progressive systemic sclerosis. although the pain and disability associated with the affected joint was not severe, the patient underwent surgical excision because the mass continued to grow and was likely to produce shoulder dysfunction and skin ulceration. the patient appeared well 10 months after surgery with no signs of recurrence. this report highlights the timing and indication of surgical excision in similar cases.
pelvic radiation may be associated with an elevated risk of secondary bladder malignancies that may be seen as early as five years after exposure. intravesical bcg therapy is a standard treatment for high - risk nonmuscle - invasive bladder cancer (nmibc) (clinical stages ta, tis, and t1). we have previously shown that 50% of patients with nmibc who were previously exposed to prostate rt will have a durable response to intravesical bcg. we now report our experience with radical cystectomy after failed bcg immunotherapy for high - risk nmibc in men with and without a prior history of rt for pc. with institutional review board approval, we retrospectively identified all patients who underwent radical cystectomy for recurrent / persistent high - risk nmibc urothelial carcinoma and received intravesical bcg therapy from a dataset of nearly 1500 cystectomy patients at two academic medical centers from 1995 to 2008. we divided this cohort into three groups based on the history of pc and its associated treatment modality : (1) those with a history of pc treated with rt, (2) those who underwent prior radical prostatectomy (rp) alone, and (3) those without pc treatment prior to radical cystectomy. the three groups were compared focusing on perioperative complications, histopathologic findings, and clinical outcomes. all patients who received brachytherapy and/or external beam radiotherapy as primary treatment or as adjuvant treatment following rp or as salvage for locally - recurrent pc were included in group 1. statistical analyses were performed by means of fisher 's exact, chi square, t - test, anova, and kaplan - meier methods using spss version 16 (spss, chicago, il, usa). all statistical analyses were 2 sided, and p < 0.05 was considered statistically significant. we identified 53 patients who underwent radical cystectomy for nmibc after failed bcg therapy from two academic medical centers. twelve had previous prostate rt (group 1), 6 had a history of pc treated with rp alone (group 2), and 35 had no history of pc or rt exposure (group 3). patient age was significantly different between groups, with the irradiated group being older than the other groups (p = 0.01). clinical stages were not significantly different between groups. the differences in transfusion rate and estimated blood loss were not statistically significant. pathological upstaging (pt24 or pn13) was 58% in group 1, 29% in group 2, and 20% in group 3 (p = 0.01). extravesical extension (pt3) was also significantly higher in group 1 versus group 3 patients (p < 0.02). the incidence of carcinoma in situ in pathological specimens was highest in group 3 (p < 0.001). the number of positive margins was not statistically different between the three groups ; however, local recurrences (defined as pelvic soft tissue or urethra) were highest in group 1 (42%). residual prostate cancer was identified in two patients in group 1 and one patient in group 2. one patient from group 1 required androgen deprivation therapy due to recurrent prostate cancer after cystectomy. intraoperative complications included a rectal injury in group 1 and an obturator nerve injury in group 3. the rate of ureteroenteric obstruction requiring nephrostomy tube placement was also higher in group 1 with a total of 6 kidneys out of 24 requiring temporary drainage (p = 0.001). in group 1 nephrostomy tubes were placed in three patients for anastomotic strictures and one patient due to upper tract urothelial malignancy. in group 3, nephrostomy tube drainage was required for two patients, one with an anastomotic stricture and the other with an upper tract recurrence causing obstruction. of the patients that were initially managed with nephrostomy tube drainage, only one patient in group 3 required antegrade incision and dilation of an anastomotic stricture. in the remaining patients, the nephrostomies were removed without further sequelae, and no further intervention was required at the last follow - up. the majority of complications occurring in group 2 were related to urinary continence issues with patients requiring urethrotomy or artificial urinary sphincter placement. postoperative clavien major and minor complications were not significantly different, and there were no perioperative mortalities within 30 days of surgery. recurrence - free survival was significantly worse for the patients with previous prostate rt (42%) compared to the group with previous prostatectomy (100%) and those with no history of prostate cancer or rt (71%) (p < 0.01 ; figure 1). we previously reported that the efficacy of bcg may be diminished after pc rt with only 50% showing a durable response to intravesical therapy. as such, we sought to assess the outcomes of the patients with high - risk nmibc refractory to intravesical bcg that underwent radical cystectomy. to our knowledge, this is the first study to specifically analyze the outcomes of cystectomy for bcg - refractory nmibc in patients with prior prostate rt. in the present series, those patients with a history of prior prostate rt were significantly more likely to be clinically understaged and more importantly demonstrated a higher risk for disease recurrence following radical cystectomy than those without previous exposure to pelvic radiation. other studies have similarly shown that patients who undergo radical cystectomy after rt for pc have a high rate of nonorgan - confined disease, between 5060% [3, 6 ]. the prevalence of pathological upstaging seen in the cystectomy cohort with prior rt is concerning. in the present study, despite the shorter follow - up period, the majority of patients with prior rt who underwent cystectomy for failed bcg therapy recurred primarily within the pelvis. whether earlier consideration of radical cystectomy in the setting of nonmuscle - invasive bladder cancer and previous prostate radiotherapy would improve these outcomes remains to be determined. in addition, improvement in initial radiologic staging as well as subsequent imaging at the time of disease recurrence is of paramount importance. it is likely that the burden of disease in the patients who underwent cystectomy was significantly underestimated at the time of the initial diagnosis of urothelial carcinoma of the bladder. patients who undergo radical cystectomy after previous pc / rt have a higher rate of complications. eisenberg. reported a 21.1% rate of major urinary diversion - related complications in a cohort of salvage cystectomy patients. ramani. demonstrated a higher stricture rate in patients treated with primary radiotherapy for pelvic malignancy and then undergone salvage cystectomy. our higher rate of postoperative nephrostomy drainage in the rt group indicates that rt may be a risk factor for ureteroenteric anastomotic obstruction, likely a result of ischemia secondary to effects on the microcirculation of the distal ureter and/or bowel. resection of the ureter more proximally (above the common iliac bifurcation) in patients with previous pelvic radiotherapy may help prevent ureteroenteric strictures. it is a small retrospective study of patients treated at 2 academic medical centers over a 13-year period. both centers have tertiary referral practices, and thus the patients treated may be at higher risk than would be seen in the community setting. therefore, we may be overestimating the problem of clinical understaging at the time of cystectomy in the post - rt patients. furthermore, the utilization of newer modalities of radiotherapy, such as intensity modulated radiotherapy, has changed over the last decade which may impact our findings. although our sample size is small, it adds to the other prior small published series evaluating radical cystectomy outcomes of patients with prior prostate rt [11, 12 ]. intravesical bcg therapy may not be as effective for nonmuscle - invasive bladder cancer in the setting of prior prostate radiotherapy as evidenced by the high rate of pathologic upstaging. radiation - induced bladder cancer may represent a more aggressive phenotype for which early consideration for radical cystectomy should be given.	purpose. intravesical bacillus calmette - guerin (bcg) immunotherapy is indicated for high - grade nonmuscle - invasive bladder cancer (nmibc). the efficacy of bcg in patients with a history of previous pelvic radiotherapy (rt) may be diminished. we evaluated the outcomes of radical cystectomy for bcg - treated recurrent bladder cancer in patients with a history of rt for prostate cancer (pc). methods. a retrospective chart review was performed to identify patients with primary nmibc. we compared the outcomes of three groups of patients who underwent radical cystectomy for bcg - refractory nmibc : those with a history of rt for pc, those who previously underwent radical prostatectomy (rp), and a cohort without pc or rt exposure. results. from 1996 to 2008, 53 patients underwent radical cystectomy for recurrent nmibc despite bcg. those with previous pelvic rt were more likely to have a higher pathologic stage and decreased recurrence - free survival compared to the groups without prior rt exposure. conclusion. response rates for intravesical bcg therapy may be impaired in those with prior prostate radiotherapy. patients with a history of rt who undergo radical cystectomy after failed bcg are more likely to be pathologically upstaged and have decreased recurrence - free survival. earlier consideration of radical cystectomy may be warranted for those with nmibc who previously received rt for pc.
since 1983, as the leading cause of death, cancer has become a major public health concern in korea. annually, over 190,000 patients are newly diagnosed with cancer in korea, and one out of four deaths is due to cancer. although the cancer registration system in korea is very efficient and can provide nationwide cancer statistics within a relatively short time, at least a 2-year lag is still required for accurate data collection and compilation. to plan and apply a cancer control program, it is important to assess the number of new cases and deaths that are expected to occur during the current year. in this report, we provide the projected cancer incidence and mortality ratio based on the data up to 2009. the korean ministry of health and welfare initiated a nationwide, hospital - based cancer registry (the korea central cancer registry [kccr ]) in 1980. the details of the history, objectives, and activities of the kccr have been documented elsewhere. incidence data from 1999 to 2009 were obtained from the korea national cancer incidence database (knci db). cancer cases were classified according to the international classification of diseases for oncology, 3rd edition and converted according to the international classification of diseases, 10th edition (icd-10). the cancer sites included in this report are (i) all cancers combined and (ii) the 22 most common cancers : lip, month, and pharynx (c00-c14), esophagus (c15), stomach (c16), colon and rectum (c18-c20), liver and intrahepatic bile duct (liver) (c22), gallbladder and other parts of biliary tract (gallbladder) (c23-c24), pancreas (c25), lung and bronchus (lung) (c33-c34), breast (c50), uterine cervix (c53), uterine corpus (c54), ovary (c56), prostate (c61), testis (c62), kidney (c64), bladder (c67), brain and central nervous system (c70-c72), thyroid (c73), hodgkin lymphoma (c81), non - hodgkin lymphoma (c82-c85, c96), multiple myeloma (c90), leukemia (c91-c95), and all others. the mid - year population on july 1 of the respective year was applied when computing the incidence and deaths. due to the time required for data collection and analysis, incidence and mortality data are available is usually 2 - 3 years behind the current year. as such, we projected the expected number of new cancer cases and deaths in korea in the current year to provide an estimate of the current cancer burden. linear regression models were used to assess the time trend and the projection of rates. based on the observed cancer incidence data, a linear regression model was fitted to the age - specific rates by 5-year age group against observed years. from the projected age - specific rates in 2012, the estimated number of cancer cases was calculated by multiplying the rates by 2012 's projected age - specific population size. for thyroid and prostate cancer, which showed significant curvilinear trends, we used a square root transformation when fitting a linear regression model and converted the predicted values back to the original scale. to estimate the number of cancer deaths in 2012, we first ran a joinpoint regression model on the data for 1993 - 2010 to detect the year of significant changes in the trend of cancer mortality by sex and cancer site. a joinpoint regression describes changes in data trends by connecting several different line segments on a log scale at " joinpoints. " this analysis was performed using the joinpoint software (version 3.3, http://srab.cancer.gov/joinpoint) from the surveillance research program of the national cancer institute in the usa. after identifying the year of significant trend changes using joinpoint regression analysis, a simple linear regression model was fitted to the last line segment to estimate age - specific cancer mortality rates in 2012. similar to the method used for the projection of cancer incidence, the number of new deaths was then projected by multiplying the age - specific cancer mortality rates by 2012 's projected age - specific population. we summarized the results using the crude rates (crs) and age - standardized rates (asrs) of cancer incidence and mortality. the asrs were standardized using the world health organization (who) world standard population. table 1 presents the estimated number of new cancer cases and deaths during 2012 in korea by sex and cancer site. table 2 presents the estimated crs and asrs of cancer incidence in 2012 by sex and cancer site. the crs of all sites combined in males and females respectively in 2012 are projected to be 465.6 and 459.7 per 100,000, and the asrs of all sites combined are projected to be 345.1 and 300.9 per 100,000. in males, the five leading primary sites of cancer are expected to be the stomach (cr, 86.8 ; asr, 63.2), colon and rectum (cr, 77.4 ; asr, 56.7), lung (cr, 62.9 ; asr, 46.6), liver (cr, 49.5 ; asr, 35.6), and prostate (cr, 43.4 ; asr, 32.5), accounting for 68.7% of all newly diagnosed cancers in 2012. in females, the most common cancer sites are expected to be thyroid (cr, 153.4 ; asr, 109.4), breast (cr, 64.6 ; asr, 44.1), colon and rectum (cr, 49.5 ; asr, 29.5), stomach (cr, 41.1 ; asr, 24.7), lung (cr, 26.6 ; asr, 14.7), and liver (cr, 17.1 ; asr, 10.0), accounting for 76.7% of all newly diagnosed cancers (fig. thyroid cancer alone is projected to account for 33.4% (38,863 cases) of incident cases in females in 2012. table 3 presents the most common cancer sites expected in 2012 by sex and age group. leukemia and thyroid cancer are projected to be the most common forms of cancer in both sexes for the 0 - 14 and 15 - 34 age groups. gastric cancer is predicted to be the most common cancer in males 35 - 64 years of age, whereas lung cancer is predicted to be more frequent for malese 65 years of age. thyroid cancer is predicted to be the most common cancer for females 35 - 64 years of age, whereas colorectal cancer is predicted to be the most common cancer for females 65 years of age. 2 shows the age - specific incidence rates of the selected cancers for men and women in 2012. the projection indicates that the incidence of gastric, lung, liver, and colorectal cancers will increase gradually with age. in women, the age - specific incidence rates of breast and thyroid cancer will increase with age until the 5th and 6th decades of life, and then level off. it is estimated that 73,313 cancer deaths will occur in korea during 2012 (table 1). the crs of all sites combined in 2012 respectively for males and females are projected to be 178.5 and 110.4 per 100,000, and the asrs of all sites combined are expected to be 135.8 and 59.0 per 100,000 (table 4). in 2012, the five leading cancer sites causing mortality in males are predicted to be lung (cr, 46.5 ; asr, 34.4), liver (cr, 32.2 ; asr, 23.5), stomach (cr, 22.2 ; asr, 16.4), colon and rectum (cr, 18.3 ; asr, 13.7), and pancreas (cr, 9.6 ; asr, 7.1). during the same time period, in females, lung cancer (cr, 17.2 ; asr, 8.7) is projected to be the leading cancer site causing mortality, followed by cancers of the colon and rectum (cr, 14.0 ; asr, 7.1), stomach (cr, 12.1 ; asr, 6.1), liver (cr, 11.0 ; asr, 6.0), and pancreas (cr, 8.8 ; asr, 4.5). 3 shows the age - specific predicted mortality rates of the selected cancers for males and females in 2012. when examined by age, korean males > 60 years of age are expected to have the highest mortality rates from liver cancer, followed by lung cancer. in contrast, korean females > 55 years of age are expected to have the highest mortality rates from breast cancer, followed by lung cancer. table 1 presents the estimated number of new cancer cases and deaths during 2012 in korea by sex and cancer site. table 2 presents the estimated crs and asrs of cancer incidence in 2012 by sex and cancer site. the crs of all sites combined in males and females respectively in 2012 are projected to be 465.6 and 459.7 per 100,000, and the asrs of all sites combined are projected to be 345.1 and 300.9 per 100,000. in males, the five leading primary sites of cancer are expected to be the stomach (cr, 86.8 ; asr, 63.2), colon and rectum (cr, 77.4 ; asr, 56.7), lung (cr, 62.9 ; asr, 46.6), liver (cr, 49.5 ; asr, 35.6), and prostate (cr, 43.4 ; asr, 32.5), accounting for 68.7% of all newly diagnosed cancers in 2012. in females, the most common cancer sites are expected to be thyroid (cr, 153.4 ; asr, 109.4), breast (cr, 64.6 ; asr, 44.1), colon and rectum (cr, 49.5 ; asr, 29.5), stomach (cr, 41.1 ; asr, 24.7), lung (cr, 26.6 ; asr, 14.7), and liver (cr, 17.1 ; asr, 10.0), accounting for 76.7% of all newly diagnosed cancers (fig. thyroid cancer alone is projected to account for 33.4% (38,863 cases) of incident cases in females in 2012. table 3 presents the most common cancer sites expected in 2012 by sex and age group. leukemia and thyroid cancer are projected to be the most common forms of cancer in both sexes for the 0 - 14 and 15 - 34 age groups. gastric cancer is predicted to be the most common cancer in males 35 - 64 years of age, whereas lung cancer is predicted to be more frequent for malese 65 years of age. thyroid cancer is predicted to be the most common cancer for females 35 - 64 years of age, whereas colorectal cancer is predicted to be the most common cancer for females 65 years of age. 2 shows the age - specific incidence rates of the selected cancers for men and women in 2012. the projection indicates that the incidence of gastric, lung, liver, and colorectal cancers will increase gradually with age. in women, the age - specific incidence rates of breast and thyroid cancer will increase with age until the 5th and 6th decades of life, and then level off. it is estimated that 73,313 cancer deaths will occur in korea during 2012 (table 1). the crs of all sites combined in 2012 respectively for males and females are projected to be 178.5 and 110.4 per 100,000, and the asrs of all sites combined are expected to be 135.8 and 59.0 per 100,000 (table 4). in 2012, the five leading cancer sites causing mortality in males are predicted to be lung (cr, 46.5 ; asr, 34.4), liver (cr, 32.2 ; asr, 23.5), stomach (cr, 22.2 ; asr, 16.4), colon and rectum (cr, 18.3 ; asr, 13.7), and pancreas (cr, 9.6 ; asr, 7.1). during the same time period, in females, lung cancer (cr, 17.2 ; asr, 8.7) is projected to be the leading cancer site causing mortality, followed by cancers of the colon and rectum (cr, 14.0 ; asr, 7.1), stomach (cr, 12.1 ; asr, 6.1), liver (cr, 11.0 ; asr, 6.0), and pancreas (cr, 8.8 ; asr, 4.5). 3 shows the age - specific predicted mortality rates of the selected cancers for males and females in 2012. when examined by age, korean males > 60 years of age are expected to have the highest mortality rates from liver cancer, followed by lung cancer. in contrast, korean females > 55 years of age are expected to have the highest mortality rates from breast cancer, followed by lung cancer. this report provides the estimated nationwide cancer incidence and mortality in korea for the current year. a total of 234,727 new cancer cases and 73,313 cancer deaths are expected in korea during 2012. in korean males, gastric, colorectal, lung, liver, and prostate cancers are estimated to have the highest rates of incidence, while lung, liver, gastric, colorectal, and pancreatic cancers are estimated to be the most common causes of cancer - related deaths. in korean females, thyroid, breast, colorectal, gastric, and lung cancer are estimated to have the highest rates of incidence, while lung, colorectal, stomach, liver, and pancreas cancers are estimated to be the most common causes of cancer - related deaths. cancer has become an important public health concern in korea, and as the population continues to age, the cancer burden will continue to increase. the estimated cancer statistics of the current year given in this report represent an important resource to plan and evaluate cancer - control programs. the estimates in this report, however, are projected numbers based on statistical models and may vary from year to year ; hence, these estimates should be used with caution.	purposeto estimate the current cancer burden in korea, cancer incidence and mortality rates were projected for the year 2012.materials and methodsthe cancer incidence data from 1999 to 2009 were obtained from the korea national cancer incidence database, and the cancer mortality data from 1993 to 2010 were obtained from statistics korea. cancer incidence in 2012 was projected by fitting a linear regression model on observed age - specific cancer incidence rates against observed years, then multiplying the projected age - specific rates by the age - specific population. for cancer mortality, a similar procedure was applied, except that a joinpoint regression model was used to determine at which year the linear trend significantly changed.resultsa total of 234,727 new cancer cases and 73,313 cancer deaths are projected to occur in korea in 2012. for all sites combined, the crude incidence rates are projected to be 465.6 and 459.7, and the age - standardized incidences to be 345.1 and 300.9 per 100,000 respectively for males and females.conclusioncancer has become an important public health concern in korea, and as the korean population ages, the cancer burden will continue to increase.
although it can affect any one, it is more common in women, especially pregnant women and those who are taking contraceptives or hormone replacement therapy. melasma is thought to be the stimulation of melanocytes to produce more melanin pigments when there is sun exposure. melasma symptoms are dark, irregular well demarcated hyper pigmented macules to patches commonly found on the upper cheek, nose, lips and forehead. when the skin is exposed to the sun the hyperpigmentation becomes darker which shows the effect of sun exposure in melasma pathophysiology. it 's most common presentation is cirrhosis, hypopituitarism, cardiomyopathy, diabetes, arthritis or hyper pigmentation, which worsens by sun exposure. both melasma and hemochromatosis have hyperpigmentation all over the body, but melasma mostly involves places, which are exposed to the sun more frequently. melasma is the most common reason of skin hyperpigmentation, which its treatments are often ineffective as it comes back with continued exposure to the sun. iron, cobalt, magnesium and selenium, vitamin e and c are known to have effect on skin diseases progress, but little data about serum iron level and melasma. although iron overload affects skin pigmentation, effect of iron deficiency on skin is not clear. hence, we evaluated serum iron level, ferritin and total iron binding capacity (tibc) level among nonpregnant women with and without melasma. in a cross - sectional case - control study performed in 2012 in university referral dermatologic clinic of rasoul akram and razi hospitals. we included patients who have melisma as a case group. women with the history of cardiac or thyroid disease and usage of hormone therapy, phototoxic drugs or anti convulsant drugs or pregnancy were not included. nonpregnant women without melisma were considered as the control group. after declaring sufficient information, a written consent was taken from all participants. control and case groups were matched for demographic variables (age, marital status, body mass index and known related melasma disorder). the checklist included three parts to collect data regarding demographic information, medical history, and medical examination. we also checked serum iron level, tibc and ferritin level of blood in both groups. we considered serum iron level 55 - 160 g / dl, ferritin 11 - 306 ng / dl and tibc 228 - 428 g / dl as normal amounts among our patients. data were analyzed by statistical package for the social sciences (spss) for windows (version 16.0 ; chicago, il, usa). means were compared using independent t - test and proportions were compared using chi - square test. thirty - three nonpregnant women with melasma (case) and 33 nonpregnant women without melasm were evaluated during 1-year study. control and case groups were matched for demographic variables (age, marital status, body mass index and known related melasma disorder). demographic information compared between case and control groups mean (standard deviation) serum iron level, tibc and ferritin is shown in table 2. comparison of measured variables among case and control groups in case group, 27% had a lower level of serum iron, and 10% had upper serum iron level. in the control group, 15% were in the lower level and 10% upper level of serum iron (p > 0.05). about 23% of patients in the case group had low ferritin level compared with 12% in the control group, but not statistically significant. the mean serum iron level in the case group was a lower than the control group. however, ping. found higher amounts of iron, magnesium, copper, and zinc among 46 nonpregnant women with melasma. however jie. showed higher iron and copper in women with melisma comparing with women without melasma. study with larger sample size may be suggested. in our study, melasma was more observed in the age 25 - 35 years old. melasma is a common acquired disorder characterized by symmetric, hyperpigmented patches, which are most prevalent among young to middle - aged women. we did not find any significant difference between case and control groups in tibc and ferritin between two groups. the prevalence of low iron serum was more in case group (27%) compared with the control group (15%). in a research conducted in 2012, 14.3% of patients with melasma also had low serum iron level. there are different factors that have an effect on melasma. considering the common dermatologic symptoms of iron overload disease (hemochromatosis) and the relationship between iron deficiency and melisma. although the serum iron level was lower in nonpregnant women with mealsma, it was not significant compared with those without melasma. considering iron deficiency anemia as a prevalent problem among young women and as the fact that there are not definite treatments for melasma furthermore, there is a need for further evaluations with larger sample sizes regarding this issue. one limitation of our study was that we did not consider family history of melasma in our demographic data among our groups, which are an important predisposing factor. eb contributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work fb contributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work se contributed in the conception of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work kh contributed in the conception of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work ag contributed in the design of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work zacontributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work.	background : melasma is a common acquired disorder characterized by symmetric, hyperpigmented patches with an irregular outline, occurring most commonly on the face. it is most prevalent among young to middle - aged women. although iron overload affects skin pigmentation, effect of iron deficiency on skin is not clear. so, we evaluated serum iron level, ferritin and total iron binding capacity (tibc) level among nonpregnant women with and without melasma.materials and methods : a cross - sectional case study was conducted in 2012 at university dermatologic department on 33 nonpregnant women with melasma (case) and 33 nonpregnant women without melasma (control). serum iron level, tibc and ferritin in the two groups was measured and compared.results:serum iron level was lower in the case group (85 11) in comparison with control group (102 9), but the difference was not significant (p : 0.9). mean tibc and ferritin were higher in the case group (tibc : 329.4 29, ferritin : 6 18) than the control group (tibc : 329.3 29, ferritin : 33 6) without significant difference.conclusion:although the serum iron level was lower in nonpregnant women with mealsma, it was not significant compared with those without melasma.
in a medicolegal case where aman has injured his knee at work, a physician (an orthopaedic surgeon) provides the following testimony : given the mechanical symptoms of catching and lock, his failure to progress with rest, a home exercise program and anti - inflammatories it is medically indicated to proceed with right knee arthroscopy. at first glance, a statement such as this especially made by a specialised physician in the setting of a court case may seem persuasively objective and straight - forward. in this paper, however, we will argue that it may be neither of those two things. we want to point out that our aim is not to discredit this individual physician nor to further comment on that particular case, but rather to focus on the role that physicians private values may play in framing and understanding the concept of medical indication in a wide variety of clinical settings. health care is, by necessity, a value - laden enterprise. like any institution that purports to achieve something (in this case : improved health), it shows already by this intention that its actions are at least partly governed by values. in striving towards this also goes for those working within health care : a physician who does not value good health above bad health and benevolence above malevolence would seem badly suited for his / her job. one common view holds that the most important values in health care are autonomy, benevolence, non - maleficence and justice. although controversies regarding these four principles remain, these values have become so accepted that they now form part of some health care systems official regulation. in the following at least two of the above - mentioned values (benevolence and non - maleficence) are directly relevant to the concept of medical indication. judging that a procedure is medically indicated for a patient is in itself an evaluative process, as the physician balances the individual patient s health impairment versus the achievable health improvement and the possible side effects. if the achievable health improvement is sufficiently large and the possible side effects sufficiently small, the beneficence and non - maleficence principles would indeed support the physician s judgment of a specific medical treatment as medically indicated. however, since physicians are human beings it can not be taken for granted that they all fully share the official values. it is reasonable to expect that some of them hold certain private value convictions that may be in conflict with the official values. in the following official values which will be used for values conforming to the ethical principles mentioned above, regardless of whether these are shared by individual physicians or not. ethical problems may result if any physician s private values differ considerably from the official values. if physicians are allowed to act on such private values, predictability and transparency may be impaired, which, in turn, might undermine patients potential to make informed health care choices. to avoid this, many health care systems have checks and balances to limit the scope of physicians fancies. indeed, health care legislation and ethical codes of conduct are often based upon the official values mentioned above, striving to bar influence by physicians private values in the sense we have defined them. in sweden, there is a long positivist tradition where civil servants such as physicians are assumed to be neutral administrators of official guidelines and values. this is illustrated, for instance, by the fact that there is no room for conscientious objections in the swedish healthcare system. ideals and regulations such as these in themselves work to prevent physicians acting on the basis of their own whims. however, there is a body of empirical studies suggesting that despite all checks and balances physicians private values do sometimes enter clinical practice implicitly or through the back door. this expression refers to a cognitive process described by, among others, molewijk. who dubbed it describe how private values affect clinical practice by informing physicians impression of, and communication regarding, the factual basis of medical decisions. as the physicians private values are hidden in the presentation of factual aspects of the situation, they can effectually become the issue has been further investigated by juth and lynoe. who have instead used the term value impregnation of factual aspects. this term indicates that the factual aspects of a decision - making process may be more or less impregnated by a physician s private values. take, for instance, a physician who is privately in favour of physician - assisted suicide (pas), but works in a setting where pas is not permitted. when faced with a dying patient in pain, this physician may by route of conscious or unconscious value impregnation make a factual overestimation of the patient s pain, leading to the administration of possibly lethal doses of pain relief. conversely, a physician who does not support pas may in the same situation underestimate the pain, leading to possibly insufficient doses of pain relief. when physicians private values impregnate factual aspects of medical decisions, this can lead to several problems. first, it may compromise patients autonomy. obviously, the more biased the physician s information to the patient is, the harder it will be for the patient to reach a decision in the light of her own values and wishes. official values, but this is beyond the scope of the present study.) secondly, if physicians private values implicitly affect the clinical decision - making process, the choice of clinical examinations and treatments offered to the patient will be dependent upon these values. this may lead to arbitrariness, which is clearly in conflict with the so - called formal principle of justice (i.e. that relevantly equal cases should be treated equally), and by extension with the health care codex in several countries, for instance sweden. unlike physicians private values, it is commonly accepted that the patient s private values should be accounted for in the medical decision - making process. as individuals differ, so patients differ in attitudes to treatment as well as in their preferred levels of information and risk taking. such attitudes may, in line with the autonomy principle (an official value), legitimately affect how and which decisions are ultimately made. however, it is unclear whether such patient values are internal or external to the concept of medical indication. for instance, can a patient s strong desire for a treatment constitute or augment a medical indication for that treatment ? the merriam - webster medical dictionary simply defines medical indication as a symptom or particular circumstance that indicates the advisability or necessity of a specific medical treatment or procedure, giving no clue as to what these circumstances may be. in clinical practice, physicians sometimes speak of two kinds of indications : medical indications on the one hand and non - medical indications, extended indications, social indications or although the latter kind of indications may be invoked in any medical setting, they seem to be most often used in ethically complex medical situations such as beginning - of - life issues, life style questions or issues in palliative care. some examples are abortions, sterilisations, caesarean delivery on maternal request, sedation - therapy on request at the end of life and certain plastic - surgery operations (e.g. culturally motivated hymen restorations). the first is that in contrast to perceptions of the physician as an impartial administrator of official values the second is that the concept of medical indication is unclear and that different physicians may mean quite different things when they use the term. in the following, we will try to specify how the uses may differ and what implications these differences may have, especially in regards to value impregnation of medical indications associated with priority setting. we have previously conducted an experimental study among swedish physicians using a randomised controlled design. the results indicated that although most physicians stated that patients should not be held responsible for their conditions, a significantly larger proportion of physicians were inclined to offer a new and expensive treatment to a non - smoking lung - cancer patient than to a smoking lung - cancer patient. for the present paper, we used the same set of data to investigate whether the participating physicians estimate the medical indication for treatment differently depending upon the patient s smoking status, which would suggest that the concept of medical indication is open to value - impregnation. also, we wanted to examine how the physicians accounted for their judgments of medical indication, again with a special eye to possible value impregnation of this concept. respondents were randomised to receive one of two versions of a questionnaire containing a case description of a female 59-year - old lung - cancer patient. the two versions were identical but for one factor : in one version, the patient was a current smoker with a 40 pack - year smoking history, whereas in the other version, she had never smoked. by using this design, inspired by studies by joshua knobe, we aimed at capturing possible differences in response patterns attributable to the patients smoking status. in the case description, it was stated that the patient had incurable, disseminated lung cancer, but that a novel treatment could prolong her life approximately 10 weeks. the questionnaires then posed the questions whether or not there was a medical indication to offer the new treatment, and whether the respondents thought that the treatment should be offered (response options to both questions : yes / no). the respondents were further asked whether their own trust in health care would be affected if this kind of treatment was routinely offered (response options : decrease / not change / increase). those who claimed that their trust would increase or decrease were classified as value - influenced, and those who claimed their trust would not be affected were classified as value - neutral. the rationale for this dichotomisation was the assumption that those who said their trust would decrease or increase thereby expressed an evaluation of the act in question (i.e. to offer or not offer treatment). physicians who said their trust would decrease if the treatment were to be offered were thus interpreted to clearly oppose the routine offering of this treatment (and conversely). the group who, in contrast, reported their trust would not be changed if the treatment was to be routinely offered were interpreted to find this prospect neither good nor bad. the study group in the present analysis included a random sample of 1200 physicians (mainly oncologists, pulmonologists and gps) of which 646 responded, giving a response rate of 53.8%. the random samples were drawn from a commercial database (cegedim / stockholm) and came from all over sweden. the participants were 3078 years (mean : 56 years) and the sex balance was 52% male and 48% female respondents. the two versions of the questionnaire were randomly distributed to all participants by paper mail, including two reminders. the randomisation was executed by allotting each participant a list number, giving all even numbers the smoking patient version and all odd numbers the non - smoking patient version. the randomisation procedure resulted in two groups which was similar in all relevant aspects, results which have been presented elsewhere. in the introductory letter logistic regression analysis was performed in order to study associations between the dichotomous main outcome variable and the independent variables that might influence the outcome. we also included interactions in the logistic model to test for non - additivity of the independent variables. the data were registered and analysed using the epi - info software 6.04 as well as sas system 9.4, sas institute inc., cary, nc, usa. when analysing the comments, we used a modified version of content analysis focusing on the respondents stated reasons in support of their judgment of medical indication. we also tried to divide the reasons into factually based reasons and value - based reasons. all respondents were informed about the study s purpose and voluntary nature in a simple, comprehensible language. however, the joshua knobe - inspired method which effectively conceals the specific research aim from the respondents entails an ethical dilemma common to all partly deceptive research methods. in brief, the dilemma is that the respondents are asked to participate under auspices that do not exactly match the real purpose of the study. the study protocol was approved by the stockholm regional research ethics committee (dnr 2014/344 - 31/2). respondents were randomised to receive one of two versions of a questionnaire containing a case description of a female 59-year - old lung - cancer patient. the two versions were identical but for one factor : in one version, the patient was a current smoker with a 40 pack - year smoking history, whereas in the other version, she had never smoked. by using this design, inspired by studies by joshua knobe, we aimed at capturing possible differences in response patterns attributable to the patients smoking status. in the case description, it was stated that the patient had incurable, disseminated lung cancer, but that a novel treatment could prolong her life approximately 10 weeks. the questionnaires then posed the questions whether or not there was a medical indication to offer the new treatment, and whether the respondents thought that the treatment should be offered (response options to both questions : yes / no). the respondents were further asked whether their own trust in health care would be affected if this kind of treatment was routinely offered (response options : decrease / not change / increase). those who claimed that their trust would increase or decrease were classified as value - influenced, and those who claimed their trust would not be affected were classified as value - neutral. the rationale for this dichotomisation was the assumption that those who said their trust would decrease or increase thereby expressed an evaluation of the act in question (i.e. to offer or not offer treatment). physicians who said their trust would decrease if the treatment were to be offered were thus interpreted to clearly oppose the routine offering of this treatment (and conversely). the group who, in contrast, reported their trust would not be changed if the treatment was to be routinely offered were interpreted to find this prospect neither good nor bad. the study group in the present analysis included a random sample of 1200 physicians (mainly oncologists, pulmonologists and gps) of which 646 responded, giving a response rate of 53.8%. the random samples were drawn from a commercial database (cegedim / stockholm) and came from all over sweden. the participants were 3078 years (mean : 56 years) and the sex balance was 52% male and 48% female respondents. the two versions of the questionnaire were randomly distributed to all participants by paper mail, including two reminders. the randomisation was executed by allotting each participant a list number, giving all even numbers the smoking patient version and all odd numbers the non - smoking patient version. the randomisation procedure resulted in two groups which was similar in all relevant aspects, results which have been presented elsewhere. in the introductory letter, there was no mention of another version of the case presentation. logistic regression analysis was performed in order to study associations between the dichotomous main outcome variable and the independent variables that might influence the outcome. we also included interactions in the logistic model to test for non - additivity of the independent variables. the data were registered and analysed using the epi - info software 6.04 as well as sas system 9.4, sas institute inc., cary, nc, usa. when analysing the comments, we used a modified version of content analysis focusing on the respondents stated reasons in support of their judgment of medical indication. we also tried to divide the reasons into factually based reasons and value - based reasons. all respondents were informed about the study s purpose and voluntary nature in a simple, comprehensible language. however, the joshua knobe - inspired method which effectively conceals the specific research aim from the respondents entails an ethical dilemma common to all partly deceptive research methods. in brief, the dilemma is that the respondents are asked to participate under auspices that do not exactly match the real purpose of the study. the study protocol was approved by the stockholm regional research ethics committee (dnr 2014/344 - 31/2). when comparing the physicians who received the non - smoking patient version of the questionnaire and the physicians who received the smoking patient version, the first group tended to be more inclined to offer the proposed treatment than the second group (57.3% vs. 52%). this difference, however, was not significant (chi-2 = 1.78 ; df = 1, p = 0.18). in order to further analyse the data, we divided the physicians into the above - mentioned categories of value - influenced and value - neutral physicians. under this definition, 65% (n = 393) value - neutral and the remaining 35% (n = 207) were classified as value - influenced. there was no statistical difference in the relative proportions of the value - neutral to the value - influenced physicians among those who had received the smoking and non - smoking patient version of the questionnaire. among the value - influenced physicians, 67% (95% ci : 5876) stated that there was a medical indication for treating the non - smoking lung - cancer patient, while 50% (95% ci : 41 - 59) found a medical indication for treating the smoking patient (chi-2 = 5.8, df = 1 ; p = 0.016). among value - neutral physicians, the corresponding proportions were 53% in both groups (95% ci : 4660) (chi-2 = 0.003, df = 1 ; p = 0.96) see table 1. table 1.the proportions of physicians who found a medical indication for treating the non - smoking and the smoking lung - cancer patient, respectively.non-smoking patientsmoking patient there is a medical indication (yes) value - influenced (n = 102), (n = 115)67% (5876)50% (4159)value - neutral (n = 196), (n = 197)53% (4660)53% (4660) the treatment is offered (yes) value - influenced (n = 105), (n = 116)78% (7086)57% (4866)value - neutral (n = 197), (n = 198)70% (6476)67% (6074)note : the physicians have been classified as value - influenced or value - neutral. a similar comparison has been performed regarding the physicians inclination to offer the same treatment. numbers in brackets refer to respondents who received the non - smoking patient version and the smoking patient version of the questionnaire, respectively.an indicates that the difference was significant (p = 0.016) and that p = 0.001. in a logistic regression analysis considering possible interaction, the corresponding p - values were 0.06 and 0.02, respectively. the proportions of physicians who found a medical indication for treating the non - smoking and the smoking lung - cancer patient, respectively. note : the physicians have been classified as value - influenced or value - neutral. a similar comparison has been performed regarding the physicians inclination to offer the same treatment. numbers in brackets refer to respondents who received the non - smoking patient version and the smoking patient version of the questionnaire, respectively. an indicates that the difference was significant (p = 0.016) and that p = 0.001. in a logistic regression analysis considering possible interaction, we also used the dichotomy of value - influenced and value - neutral to compare the two groups inclinations to offer treatment. this analysis showed that 78% (95% ci : 7086) of the value - influenced physicians would offer treatment to the non - smoking patient as opposed to 57% (95% ci : 4866) in regards to the smoking patient (chi-2 = 11.19, df = 1 ; p = 0.001). among the value - neutral, the corresponding proportions were 70% (95% ci : 6476) versus 67% (95% ci : 6074) ; (chi-2 = 0.376, df = 1 ; p = 0.540). analysing the relationship between physicians estimation of medical indication and their inclination to treat the patient, we found that among those who found a medical indication for treatment, 92% (95% ci : 8995) were inclined to offer treatment, whereas among those who found no medical indication for treatment, 38% (95% ci : 3244) were inclined to offer treatment. we also analysed the comments to the question of whether there was a medical indication to offer treatment. a wide range of arguments / reasons were offered in support of the estimations of a medical indication for treatment. there were no systematic differences in arguments between respondents of the two versions of the questionnaire. table 2.categories of stated arguments for perceiving presence or absence of medical indication for treatment among respondents comments.topic of argumentrespondent judged there is a medical indication for treatment (n = 49)respondent judged there is no medical indication for treatment (n = 52)patient s expected survival timesurvival time is sufficient or survival time could be longer than stated (22)survival time is insufficient or survival time could be shorter than stated (19)the proposed treatment s efficacy and evidence basethe proposed treatment is effective or the proposed treatment has evidence (13) if there is medical evidence for treatment, there is a medical indication ; if it prolongs life there is a medical indicationthe proposed treatment is ineffective or the proposed treatment lacks evidence (4)patient s suitability for treatmentthe patient seems suitable (3) she seems healthypatient seems ill suited (5) she seems very illattitude towards life prolonging treatmentall treatment options should be tried (6)unethical to prolong a life of suffering (3)indications for treatment other than purely medical (narrowly conceived)yes (5) medically indicated so she can live past her grandchild s birthday ; it is medically indicated if the patient wants it ; medically indicated to show empathyyes (9) not medically indicated but there is a psychological gain ; not medically indicated but we have to show empathy ; medically indicated, but whether to offer treatment depends on what other financial interests compete.cost efficacy(no comments)too low (12) prioritizations are necessary ; resources should be put to better usenote : arguments are listed by main topic of argument.. categories of stated arguments for perceiving presence or absence of medical indication for treatment among respondents comments. in the whole group of physicians studied, there was no difference in the perception of medical indication for treatment depending upon the patient s smoking status. however, when the group was divided into those who seemed to hold an evaluative stance in regards to the proposed treatment (pro or contra) and those who seemed to be value neutral in regards to the proposed treatment, we found a significant difference. the 35% of the physicians who were classified as value - influenced, unlike their value - neutral counterparts, discriminated between the non - smoking and the smoking patient in their estimations of medical indication for treatment as well as their inclination to offer the treatment. the 65% who were classified as value - neutral, on the contrary, did not discriminate between the smoking and non - smoking patient on either account. in this, they acted in accordance with the swedish official values, which stress that patients previous behaviour should not influence access to treatment. claim that all physicians decisions are more or less influenced by official as well as private values. if the distinction between value - influenced and value - neutral physicians is plausible, it can be argued that at least in this setting the majority of the physicians seem not to let private values influence their estimation of the medical indication for the proposed treatment and their inclination to offer the treatment. whether this is because they discipline their potential subjectivity, or whether as a matter of fact they do not hold any strong private values regarding the proposed treatment, can not be assessed in the study. it should also be borne in mind that previous studies suggest that the relative proportions of value - neutral to value - influenced physicians might depend upon the level of controversy surrounding the issue in question. since the smoking patient questionnaire and the non - smoking patient questionnaire differed solely on the point of the patient s smoking status, which in turn was framed as being of no prognostic relevance, the results indicate that the value - influenced physicians incorporate medically irrelevant aspects in their assessment of medical indication for treatment. in this particular study, such aspects would be biases against smoking patients. we suggest that these physicians assessment of the factual aspects of medical indication could be value - impregnated. as nearly all participating physicians stated that patients responsibility should not count when deciding whether or not the patient should be offered a new and expensive treatment, it may be that some physicians private values were tacitly and unconsciously brought in through the back - door. we suggest that the back door metaphor might be interpreted as private values impregnating the estimations of factual aspects of medical indication. the impregnation procedure might be unconscious and invisible both for the participants themselves and others concerned. in this way, the physicians are seemingly not acting against the official values, but our applied experimental design makes it possible to reveal the procedure and the concealed agenda behind it. the empirical results provide some clues on how to analyse the concept of medical indication. as noted in the introduction, different people can mean different things when they say there is a medical indication for treatment. we propose that this is due to two different but related conceptual unclarities : firstly, the unclarity regarding the concept of medical indication itself, and secondly the unclarity regarding the conceptual relation between finding a medical indication for treatment and actually offering this treatment. at its analytical core, the concept of medical indication for a treatment seems to presuppose or establish only that there is evidence to show that the treatment is effective and reasonably safe. this is supported by the lexical merriam - webster definition of medical indication, which states that a treatment is medically indicated when advisable or necessary. thus, it is reasonable to expect that when physicians claim a treatment is medically indicated, they mean at least that medical evidence backs its usage. indeed, the comments in our data showed many physicians explaining their judgment of medical indication along these lines, e.g. if there is medical evidence for treatment, there is a medical indication. although consistent with the analytical core, many other comments showed that many respondents also included non - medical / extended considerations into the notion of medical indication itself, e.g. medically indicated so she can live past her grandchild s birthday. thus, it seems that whereas some physicians consider the above - mentioned reference to evidence of effect as a sufficient and necessary reason for judging that there is a medical indication for treatment, others see reference to evidence of effect as insufficient for medical indication. however, the absence of comments implying that the treatment was effective and reasonably safe, but still not medically indicated, seems to speak against this. all in all, the comments supported the hypothesis that there is great ambiguity regarding the interpretation of medical indication, and that some physicians have a much broader view of the concept. the second conceptual unclarity concerns the relationship between medical indication and the physician s inclination to treat. two of this paper s three authors are physicians, and our clinical experience is that when physicians speak of something being medically indicated, they are doing more than making a factual claim. this point can be analysed by reference to the concept of conversational implicature from the field of language philosophy. the conversational implicature of a statement is what the statement could be taken to mean, when the full context of the situation is accounted for. often, this amounts to much more than what is literally being said. if, for instance, i ask you if i can come around this afternoon and you answer i will be at home, i may be justified in thinking you did not merely offer me information about where you will be this afternoon, but rather that we have made a date of sorts. in much the same way, a physician saying there is a medical indication for treatment will often be interpreted, by conversational implicature, as meaning treatment should be offered or, at least, there is a reason to offer treatment. however, although related, these propositions are not necessarily synonymic or extensionally equivalent. conceptually, the correlation between what a physician means when s / he claims there is a medical indication to offer treatment and that s / he is inclined to offer treatment can be illustrated thus : indeed, the results of this study can be interpreted as showing support among physicians for all four views described above. returning again to those physicians who seem to equate medical indication with what we called the concept s minimal interpretation (reference to efficacy and safety), most displayed a correspondence between their judgment of the treatment s efficacy and their judgment of whether treatment should be given. thus, most of those who saw the treatment as efficient were inclined to offer treatment, and most who saw treatment as ineffective were disinclined to offer treatment. we propose that at least some of these efficacy - determined physicians adhere to position 1 above, making a strong link between medical indication and offering treatment. if the existence of position 1 physicians was only indirectly suggested by the results, there were very many comments that clearly expressed support for positions 2 or 4 (possibly also 3). in regards to the first unclarity mentioned above, these physicians seem to let humanitarian considerations remain external to the understanding of medical indication proper, but still influence the choice to offer treatment. one example of many such comments was : not medically indicated but we have to show empathy. the results also indicated that some physicians who judged there was a medical indication for treatment nevertheless opted not to offer treatment. in the scheme above, that would put them in position 4. all comments from that group regarding why they would not offer treatment concerned cost efficacy : prioritizations are necessary ; including in the sense that they lead to more patients being offered treatment than only those with a firm medical indication (under all interpretations of that concept). in contrast, position 4 is excluding as opposing reasons can subtract from the medical indication to lead to a situation where treatment is not offered despite there being a medical indication. as seen in the comments, the reasons for not giving the treatment may be prioritisation considerations in a situation of economy shortage. summing up so far, we have described two conceptually different ways by which physicians include other aspects than the purely medical ones (i.e. efficacy, safety, and evidence) in treatment decisions. the first way is to expand the notion of medical indication to encompass for instance humanitarian issues. the second way is to keep the notion of medical indication free from such issues, but base treatment decisions on a range of indications. we would like to point out that both of these practices may be in conflict with established systems for health care prioritisation. in sweden, for instance, the health care law stipulates that all priority setting decisions should conform to the principles of human dignity, needs and solidarity and cost efficacy. as can be seen, there is no officially sanctioned principle that regulates priority for patients with non - medical indications. in theory, it could be argued that extended / humanitarian aspects fall under the needs principle above, but this is not uncontested. thus, under the current swedish health law, humanitarian aspects have an unclear standing in priority setting situations, and any physician who frequently treats patients on a humanitarian indication may by opportunity cost decrease health access for patients managed by other physicians who do not base their treatment on this principle. thus, pending a philosophically sound work - up of the place of humanitarian indications within the hierarchy of prioritisation, it is probably wise to use this principle with moderation for instance, there was great variance in the responses to issues of prognosis and expected survival time. many physicians who found a medical indication for treatment pointed out that the patient seemed healthy and might live longer than the expected survival time on the proposed treatment. on the other hand, physicians who did not find a medical indication pointed out she seemed very ill and might live shorter. healthy she was, other than the fact that without treatment she would likely die within three weeks. as for the survival on treatment, deviations from the mean are of course possible in both directions. (however, one respondent actually provided a clear answer to this, commenting : one month is clinically significant time.) these findings give rise to the question : did the physician start with an inclination to treat and adjust his / her judgment of expected time accordingly, or did the judgment of time provide basis for the inclination to treat ? as our results can not answer this question, we do not claim that these response patterns prove that physicians value impregnate their perceptions of survival time. but the finding that some physicians used the patient s smoking status as basis for the medical indication indicates that there is a risk of value impregnation, and the judgment of expected survival time is a judgment that may easily be impregnated. on the same note, we found it interesting that some respondents who denied there being a medical indication for treatment claimed there was insufficient evidence for treatment. in fact, the questionnaire clearly stated that the proposed treatment had been thoroughly studied. obviously, this is an area where value impregnation can have far - reaching implications. to the critical - minded, it is almost always possible to claim there is insufficient evidence : most bodies of evidence contain contradictions and controversies. thus, whenever a physician does not want to offer treatment, s / he can offer lack of evidence or insufficient expected survival time as reasons for not offering treatment. if a physician s anti - smoker bias determines patients access to treatment by affecting how the physician estimates a patients medical indications for treatment as this study has indicated this is bad news for individual patients as well as for justice in health care priority setting. it is bad news because whether or not such a patient will receive treatment will depend on the private values of the decision - making physician. in other words, it becomes arbitrary whether or not such a patient will be offered the treatment. matters are further complicated by the fact that such value - impregnation may be partly unconscious. in a recent study of decision - making capacity evaluations in switzerland, hermann. found that a quarter of the studied physicians, when asked openly, stated that their own values influenced their evaluations, while equally many claimed that their own values had no effect at all. one way to raise awareness of this potential problem could be for clinicians to routinely question and discuss underlying evaluative forces in clinical decision making. this is probably most important when the issue at stake is controversial or value - laden, as when involving smoking patients. further empirical studies are needed to show how such awareness - raising activities may be arranged in the clinical setting. as indicated by our discussion above, there seems to be no agreement among physicians as to what is meant by medical indication. this ambiguity increases the risk of value - impregnation, and we therefore propose that the medical community should be more careful when using this concept. while there is no way to ensure a terminology free from value - impregnation, the ambiguity can be partly avoided if physicians reserve the moniker medical indication for treatment for what we have called its analytical core or minimal interpretation (the claim that evidence shows the treatment is effective and safe enough), and call other indications (social, humanitarian etc.) by another name. furthermore, we recommend that physicians reflect about how and when their own private values influence decision - making explicitly or implicitly, for instance through value impregnation of supposedly hard facts. the british ethicist martyn pickersgill writes of the essential entanglement of the moral and the factual and as we do not see any way to permanently disentangle the factual from the moral, we hope instead that this paper may be a starting - point for a discussion about that very entanglement. another practical implication of this study is the following : if there is disagreement between physicians (or physicians and patients) in a decision - making situation, it may be helpful to first examine whether the disagreement is based on the judgment of factual aspects and, if so, also examine whether this difference may depend on possible value - impregnations. this method yields robust data and in this setting allowed us to examine the effect played by the patient s smoking status on the estimation of medical indication. as the randomisation process resulted in comparable groups regarding relevant aspects, the design minimised the risk of bias. however, due to the relatively low response rate, we can not know to what degree the results are generalisable at least regarding the proportions of those who are value - neutral and value - influenced. comments made by the respondents indicate that some physicians found the case description over simplified, which could be a reason for the low response rate. the respondents answering patterns and comments raised a wealth of philosophical questions, pri marily concerning the notion of medical indication. therefore, we set out to investigate this topic in a long discussion section. by necessity in a mixed empirical / philosophical paper such as this, the philosophical analysis to some extent goes we thus wish to point out that the final interpretative result is our estimation of a best guess, and that we welcome alternative interpretations to the matter. in this paper, the group labelled value - influenced physicians were those whose trust in health care would be altered for better or worse if the proposed therapy was to become routinely used. the underlying assumption is that such an alteration of trust implies that the respondents feel that important health care values are truly at stake in this issue, in a way that the value - neutral physicians do not. thus, it is only in regards to the adoption of the proposed treatment as routine that value - neutral physicians are indicated to be value - neutral. outside of that, they may very well harbour for instance strong liberal and humanitarian values that are in accordance with the official values. what is of concern here is, then, a very limited interpretation of the term value - neutral. this interpretation is furthermore our own and its validity needs to be scrutinised further. finally, we wish to point out that in the qualitative analysis, the counting of comments is not intended to give an estimation of the relative frequency of certain opinions in the entire set of data. as only a minority of respondents commented on their responses, the comments can only give clues on how to interpret the rationales for understanding medical indication in the studied group. in the whole group of physicians studied, there was no difference in the perception of medical indication for treatment depending upon the patient s smoking status. however, when the group was divided into those who seemed to hold an evaluative stance in regards to the proposed treatment (pro or contra) and those who seemed to be value neutral in regards to the proposed treatment, we found a significant difference. the 35% of the physicians who were classified as value - influenced, unlike their value - neutral counterparts, discriminated between the non - smoking and the smoking patient in their estimations of medical indication for treatment as well as their inclination to offer the treatment. the 65% who were classified as value - neutral, on the contrary, did not discriminate between the smoking and non - smoking patient on either account. in this, they acted in accordance with the swedish official values, which stress that patients previous behaviour should not influence access to treatment. claim that all physicians decisions are more or less influenced by official as well as private values. if the distinction between value - influenced and value - neutral physicians is plausible, it can be argued that at least in this setting the majority of the physicians seem not to let private values influence their estimation of the medical indication for the proposed treatment and their inclination to offer the treatment. whether this is because they discipline their potential subjectivity, or whether as a matter of fact they do not hold any strong private values regarding the proposed treatment, can not be assessed in the study. it should also be borne in mind that previous studies suggest that the relative proportions of value - neutral to value - influenced physicians might depend upon the level of controversy surrounding the issue in question. since the smoking patient questionnaire and the non - smoking patient questionnaire differed solely on the point of the patient s smoking status, which in turn was framed as being of no prognostic relevance, the results indicate that the value - influenced physicians incorporate medically irrelevant aspects in their assessment of medical indication for treatment. in this particular study, such aspects would be biases against smoking patients. we suggest that these physicians assessment of the factual aspects of medical indication could be value - impregnated. as nearly all participating physicians stated that patients responsibility should not count when deciding whether or not the patient should be offered a new and expensive treatment, it may be that some physicians private values were tacitly and unconsciously brought in through the back - door. we suggest that the back door metaphor might be interpreted as private values impregnating the estimations of factual aspects of medical indication. the impregnation procedure might be unconscious and invisible both for the participants themselves and others concerned. in this way, the physicians are seemingly not acting against the official values, but our applied experimental design makes it possible to reveal the procedure and the concealed agenda behind it. the empirical results provide some clues on how to analyse the concept of medical indication. as noted in the introduction, different people can mean different things when they say there is a medical indication for treatment. we propose that this is due to two different but related conceptual unclarities : firstly, the unclarity regarding the concept of medical indication itself, and secondly the unclarity regarding the conceptual relation between finding a medical indication for treatment and actually offering this treatment. at its analytical core, the concept of medical indication for a treatment seems to presuppose or establish only that there is evidence to show that the treatment is effective and reasonably safe. this is supported by the lexical merriam - webster definition of medical indication, which states that a treatment is medically indicated when advisable or necessary. thus, it is reasonable to expect that when physicians claim a treatment is medically indicated, they mean at least that medical evidence backs its usage. indeed, the comments in our data showed many physicians explaining their judgment of medical indication along these lines, e.g. if there is medical evidence for treatment, there is a medical indication. although consistent with the analytical core, many other comments showed that many respondents also included non - medical / extended considerations into the notion of medical indication itself, e.g. medically indicated so she can live past her grandchild s birthday. thus, it seems that whereas some physicians consider the above - mentioned reference to evidence of effect as a sufficient and necessary reason for judging that there is a medical indication for treatment, others see reference to evidence of effect as insufficient for medical indication. however, the absence of comments implying that the treatment was effective and reasonably safe, but still not medically indicated, seems to speak against this. all in all, the comments supported the hypothesis that there is great ambiguity regarding the interpretation of medical indication, and that some physicians have a much broader view of the concept. the second conceptual unclarity concerns the relationship between medical indication and the physician s inclination to treat. two of this paper s three authors are physicians, and our clinical experience is that when physicians speak of something being medically indicated, they are doing more than making a factual claim. this point can be analysed by reference to the concept of conversational implicature from the field of language philosophy. the conversational implicature of a statement is what the statement could be taken to mean, when the full context of the situation is accounted for. often, this amounts to much more than what is literally being said. if, for instance, i ask you if i can come around this afternoon and you answer i will be at home, i may be justified in thinking you did not merely offer me information about where you will be this afternoon, but rather that we have made a date of sorts. in much the same way, a physician saying there is a medical indication for treatment will often be interpreted, by conversational implicature, as meaning treatment should be offered or, at least, there is a reason to offer treatment. however, although related, these propositions are not necessarily synonymic or extensionally equivalent. conceptually, the correlation between what a physician means when s / he claims there is a medical indication to offer treatment and that s / he is inclined to offer treatment can be illustrated thus : indeed, the results of this study can be interpreted as showing support among physicians for all four views described above. returning again to those physicians who seem to equate medical indication with what we called the concept s minimal interpretation (reference to efficacy and safety), most displayed a correspondence between their judgment of the treatment s efficacy and their judgment of whether treatment should be given. thus, most of those who saw the treatment as efficient were inclined to offer treatment, and most who saw treatment as ineffective were disinclined to offer treatment. we propose that at least some of these efficacy - determined physicians adhere to position 1 above, making a strong link between medical indication and offering treatment. if the existence of position 1 physicians was only indirectly suggested by the results, there were very many comments that clearly expressed support for positions 2 or 4 (possibly also 3). in regards to the first unclarity mentioned above, these physicians seem to let humanitarian considerations remain external to the understanding of medical indication proper, but still influence the choice to offer treatment. one example of many such comments was : not medically indicated but we have to show empathy. the results also indicated that some physicians who judged there was a medical indication for treatment nevertheless opted not to offer treatment. in the scheme above, that would put them in position 4. all comments from that group regarding why they would not offer treatment concerned cost efficacy : prioritizations are necessary ; including in the sense that they lead to more patients being offered treatment than only those with a firm medical indication (under all interpretations of that concept). in contrast, position 4 is excluding as opposing reasons can subtract from the medical indication to lead to a situation where treatment is not offered despite there being a medical indication. as seen in the comments, the reasons for not giving the treatment may be prioritisation considerations in a situation of economy shortage. summing up so far, we have described two conceptually different ways by which physicians include other aspects than the purely medical ones (i.e. efficacy, safety, and evidence) in treatment decisions. the first way is to expand the notion of medical indication to encompass for instance humanitarian issues. the second way is to keep the notion of medical indication free from such issues, but base treatment decisions on a range of indications. we would like to point out that both of these practices may be in conflict with established systems for health care prioritisation. in sweden, for instance, the health care law stipulates that all priority setting decisions should conform to the principles of human dignity, needs and solidarity and cost efficacy. as can be seen, there is no officially sanctioned principle that regulates priority for patients with non - medical indications. in theory, it could be argued that extended / humanitarian aspects fall under the needs principle above, but this is not uncontested. thus, under the current swedish health law, humanitarian aspects have an unclear standing in priority setting situations, and any physician who frequently treats patients on a humanitarian indication may by opportunity cost decrease health access for patients managed by other physicians who do not base their treatment on this principle. thus, pending a philosophically sound work - up of the place of humanitarian indications within the hierarchy of prioritisation, it is probably wise to use this principle with moderation. some apparent contradictions among the respondents comments also merit mention. for instance, there was great variance in the responses to issues of prognosis and expected survival time. many physicians who found a medical indication for treatment pointed out that the patient seemed healthy and might live longer than the expected survival time on the proposed treatment. on the other hand, physicians who did not find a medical indication pointed out she seemed very ill and might live shorter. healthy she was, other than the fact that without treatment she would likely die within three weeks. as for the survival on treatment, deviations from the mean are of course possible in both directions. (however, one respondent actually provided a clear answer to this, commenting : one month is clinically significant time.) these findings give rise to the question : did the physician start with an inclination to treat and adjust his / her judgment of expected time accordingly, or did the judgment of time provide basis for the inclination to treat ? as our results can not answer this question, we do not claim that these response patterns prove that physicians value impregnate their perceptions of survival time. but the finding that some physicians used the patient s smoking status as basis for the medical indication indicates that there is a risk of value impregnation, and the judgment of expected survival time is a judgment that may easily be impregnated. on the same note, we found it interesting that some respondents who denied there being a medical indication for treatment claimed there was insufficient evidence for treatment. in fact, the questionnaire clearly stated that the proposed treatment had been thoroughly studied. obviously, this is an area where value impregnation can have far - reaching implications. to the critical - minded, it is almost always possible to claim there is insufficient evidence : most bodies of evidence contain contradictions and controversies. thus, whenever a physician does not want to offer treatment, s / he can offer lack of evidence or insufficient expected survival time as reasons for not offering treatment. if a physician s anti - smoker bias determines patients access to treatment by affecting how the physician estimates a patients medical indications for treatment as this study has indicated this is bad news for individual patients as well as for justice in health care priority setting. it is bad news because whether or not such a patient will receive treatment will depend on the private values of the decision - making physician. in other words, it becomes arbitrary whether or not such a patient will be offered the treatment. matters are further complicated by the fact that such value - impregnation may be partly unconscious. in a recent study of decision - making capacity evaluations in switzerland, hermann. found that a quarter of the studied physicians, when asked openly, stated that their own values influenced their evaluations, while equally many claimed that their own values had no effect at all. one way to raise awareness of this potential problem could be for clinicians to routinely question and discuss underlying evaluative forces in clinical decision making. this is probably most important when the issue at stake is controversial or value - laden, as when involving smoking patients. further empirical studies are needed to show how such awareness - raising activities may be arranged in the clinical setting. as indicated by our discussion above, there seems to be no agreement among physicians as to what is meant by medical indication. this ambiguity increases the risk of value - impregnation, and we therefore propose that the medical community should be more careful when using this concept. while there is no way to ensure a terminology free from value - impregnation, the ambiguity can be partly avoided if physicians reserve the moniker medical indication for treatment for what we have called its analytical core or minimal interpretation (the claim that evidence shows the treatment is effective and safe enough), and call other indications (social, humanitarian etc.) by another name. furthermore, we recommend that physicians reflect about how and when their own private values influence decision - making explicitly or implicitly, for instance through value impregnation of supposedly the british ethicist martyn pickersgill writes of the essential entanglement of the moral and the factual and as we do not see any way to permanently disentangle the factual from the moral, we hope instead that this paper may be a starting - point for a discussion about that very entanglement. another practical implication of this study is the following : if there is disagreement between physicians (or physicians and patients) in a decision - making situation, it may be helpful to first examine whether the disagreement is based on the judgment of factual aspects and, if so, also examine whether this difference may depend on possible value - impregnations. this method yields robust data and in this setting allowed us to examine the effect played by the patient s smoking status on the estimation of medical indication. as the randomisation process resulted in comparable groups regarding relevant aspects, the design minimised the risk of bias. however, due to the relatively low response rate, we can not know to what degree the results are generalisable at least regarding the proportions of those who are value - neutral and value - influenced. comments made by the respondents indicate that some physicians found the case description over simplified, which could be a reason for the low response rate. the respondents answering patterns and comments raised a wealth of philosophical questions, pri marily concerning the notion of medical indication. therefore, we set out to investigate this topic in a long discussion section. by necessity in a mixed empirical / philosophical paper such as this, the philosophical analysis to some extent goes we thus wish to point out that the final interpretative result is our estimation of a best guess, and that we welcome alternative interpretations to the matter. in this paper, the group labelled value - influenced physicians were those whose trust in health care would be altered for better or worse if the proposed therapy was to become routinely used. the underlying assumption is that such an alteration of trust implies that the respondents feel that important health care values are truly at stake in this issue, in a way that the value - neutral physicians do not. thus, it is only in regards to the adoption of the proposed treatment as routine that value - neutral physicians are indicated to be value - neutral. outside of that, they may very well harbour for instance strong liberal and humanitarian values that are in accordance with the official values. what is of concern here is, then, a very limited interpretation of the term value - neutral. this interpretation is furthermore our own and its validity needs to be scrutinised further. finally, we wish to point out that in the qualitative analysis, the counting of comments is not intended to give an estimation of the relative frequency of certain opinions in the entire set of data. as only a minority of respondents commented on their responses, the comments can only give clues on how to interpret the rationales for understanding medical indication in the studied group. this study indicates that approximately a third of the studied physicians let their private values influence the judgement of whether or not to offer treatment to a smoking lung - cancer patient, and their estimation of the medical indication for such treatment. in contrast, the majority of the studied physicians either held no bias against smokers, or were able to keep such private values out of the medical decision - making process, and hence made more fair decisions or at least decisions that were in accordance with official swedish health care norms. first, that although physicians and patients may not realise this, stating that a treatment is medically indicated is by definition an evaluative endeavour. third, that physicians sometimes deleteriously seem to involve private values such as bias against smoking in estimations of medical indication for treatment. to ameliorate these problems, we suggest that physicians engage in discussions regarding the official and possible private value base of decisions, and that the term medical indication be reserved for statements about evidence of efficacy and safety of treatment only. the author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. the author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article : this study was made possible by a grant from the swedish foundation for humanities and social sciences (riksbankens jubileumsfond), (grant number p11 - 0510:1).	backgroundthe aim of this study was to investigate whether physicians who felt strongly for or against a treatment, in this case a moderately life prolonging non - curative cancer treatment, differed in their estimation of medical indication for this treatment as compared to physicians who had no such sentiment. a further aim was to investigate how the notion of medical indication was conceptualised.methodsa random sample of gps, oncologists and pulmonologists (n = 646) comprised the study group. respondents were randomised to receive either version of a case presentation ; in one version, the patient had smoked and in the other version she had never smoked. the physicians were labelled value - neutral (65%) and value - influenced (35%) on the basis of their attitude towards the treatment.resultsin the value - influenced group, there was a significant difference in the estimation of medical indication for treatment depending upon whether the patient had smoked (50% (95% ci : 4159) or never smoked (67% (95% ci : 5876) (chi-2 = 5.8, df = 1 ; p = 0.016)). there was no such difference in the value - neutral group.conclusionthis study shows that compared to value - neutral physicians, value - influenced physicians are more likely to base decisions of medical indication on medically irrelevant factors (in this case : the patient s smoking status). moreover, medical indication is used in an ambiguous manner. hence, we recommend that the usage of medical indication be disciplined.
fast acquisition is an important issue in magnetic resonance imaging (mri) for avoiding physiological effects and reducing scanning time on patients. unfortunately, accelerating acquisition by reducing k - space samples leads to noise amplification, blurred object edges, and aliasing artifacts in mr reconstructions. then improving reconstruction accuracy from highly undersampled k - space data becomes a complementary tool to alleviate the above side effects of reducing acquisition. to cope with the loss of image quality one process of introducing prior information in the reconstruction is known as regularization [211 ]. tikhonov regularization, a commonly used method that pursuits reconstructions by a l 2-norm minimization, leads to a closed - form solution that can be numerically implemented in an efficient way [68, 11 ]. moreover, with the advent of compressed sensing (cs) theory, sparsity - promoting regularization has gained popularity in mri (e.g., the l 1-based regularization) [13, 5, 10, 12 ]. the cs theory states that sparse, or more generally, compressible signals, incoherently acquired in an appropriate sense, can be recovered from a reduced set of measurements that are largely below the nyquist sampling rate. exact reconstruction can be achieved by nonlinear algorithms, using l 1 minimization or orthogonal matching pursuit (omp) [13, 5, 10, 12, 13 ]. eig((d) d) and x = shrink(g,) = (g max(\|g\|, 0))/(max(\|g\|, 0) +) is the solution of x = arg minx\|\|x\|\|1 + (1/2)\|\|xg\|\|2. line 10 is the frequency interpolation step for updating the image u. al scheme and adm applied to the constrained problem result in an efficient two - step iterative mechanism, which alternatively updates the solution u and image - patch related coefficients (, y, and d). for a more detailed description of the derivations, the interested readers can refer to. in (1) for example, some nonconvex relaxations such as l p quasi - norm \|\|\|\|p, 0 0 is a small parameter to prevent division by zeros. compared to the previous reweighted l 1 strategy, the only difference is that the reweighted l 2-approximation in (10) is employed to the second term : (17)li, m+1=argminl\|\|dilblyli\|\|22ista+2+1p\|\|l\|\|pprel2. then it attains the solution of l : (18)li, m+1=argminl \|\|l[li, m+(+)(di)tylm+1]\|\|22++\|\|wli, ml\|\|22. the minimizer of this least - square problem is given by (19)li, m+1=li, m+(+)(di)tylm+1/+(+)wli, m/, where w j, l = 1/(\| j, l \| +), j = 1,2,, j. similar to that in (14), > 0 is a small parameter to prevent numerical instabilities. now, we summarize our proposed method for mri reconstruction here, which we call weighted tbmdu. the detailed description of the proposed method is listed in algorithm 2. similar to tbmdu, the proposed wtbmdu method alternatively updates the target solution u, image patch related coefficients (, y, and d), and auxiliary variables. the difference between the plain tbmdu and the weighted tbmdu mainly lies on the weights used in updating the sparse coefficients. in wtbmdu, the weights are obtained by evaluating the function of variables at the solution of the previous step. specifically, whether the w j, l = 1/(\| j, l \| +) in (16) or w j, l = 1/(\| j, l \| +) in (19), the weighting scheme w j, l decreases as the absolute value of j, l increases, indicating that it penalizes more on the coefficients with small magnitude value. therefore, this operation strongly encourages the large coefficients to be nonzero and the small ones to be zero. in line 8 for reweighted l 1 and line 10 for reweighted l 2, the formulations denote operating every element in the matrix component - wise. in the following content of this paper, we denote the reweighted l 1 and reweighted l 2 in wtbmdu as wtbmdu - l1 and wtbmdu - l2, respectively. the strategy we used in wtbmdu is similar to that used in wnfcs, that is, combining the penalized proximal splitting strategy and reweighting strategy. the difference is that wnfcs focus on updating u in the simple cs domain and the proximal splitting strategy is employed to the fourier - related data - fidelity term, while our wtbmdu devotes to updating the coefficients in the adaptive dictionary and the proximal splitting strategy is employed to the dictionary - related sparse representation error term. the proposed method involves four parameters :,,, and. the setting of these parameters is similar to that in tbmdu. firstly, both parameters and are the bregman (or augmented lagrangian) positive parameters associated with the small image patches and the whole image itself, respectively. one is for the overlapping image patches and the other is for the image solution itself. it has been mathematically proven that the choice of the bregman parameter has little effect on the final reconstruction quality as long as it is sufficiently small [31, 44, 45 ]. in our work, the smaller the value of the bregman parameter is, the more iterations the bregman method need to reach the stopping condition. moreover, since and are with different orders of magnitude, we set n/m in the al formalism for the balance between various secondly, stands for the sparse level of the image patches and can be determined empirically. finally, the step size in the dictionary updating stage can be set to be a small positive number, for example, 0.01. in summary, there is only the parameter that should be carefully chosen in order to enable the efficiency of the algorithm. in our method, by taking advantage of the typical structure of the problem in this paper, we propose a similar rule to that used in. specifically, we set and so as to achieve condition numbers (1 + w l /t 0) and (ff p f p f + (/)fl r l r l f) that result in fast convergence of the algorithm. since t 0 = /(+) and, t 0. consequently (1 + w l /t 0) is a decreasing function of. choosing such that (1 + w l /t 0) 1 would require a large and accordingly, the influence of the weight w l diminishes and the solution of l trends to the least - square solution (q = 2). in our experiments, we observed that this phenomenon would result in an immature dictionary that is not learned enough. on the other hand, taking 0 would increase (1 + w l /t 0) which makes (1 + w l /t 0) numerically unstable. the same trend also applies to (ff p f p f + (/)fl r l r l f) as a function of /. we found that empirically choosing such that e((w l)) l (w l) /l additionally, we can estimate in a more practical way. specifically, since the number of data samples is huge, we can set e(w l) t 0, where e(w l) [0.2,1 ] is a robust estimate. together with the fact that 100, it leads to [1/500, 1/100 ]. as for the parameter, since (ff p f p f + (/)fl r l r l f) = (+)/, where = 64 when the patch overlapping is r = 1, it concludes that setting n/m such that (ff p f p f + (/)fl r l r l f) = 64 + 1 is a reasonable choice, under the assumption that the k - space data is significantly undersampled (e.g., [5%, 30% ]). as for the convergence, because of the unconvexity and nonlinearity of the problem in the case of updating dictionary, the global solution may not to be found easily like in tbmdu. nevertheless, our dictionary is updated by a gradient descent of the al scheme which leads to a monotonic decrease in the cost function. at the sparse coding stage, since wtbmdu merges the reweighted and penalization strategies, it still maintains the descent property of the latter and local minimum must be attained as demonstrated in. therefore, both the value of the objective function and the norm of the reconstruction difference between successive iterations can be chosen as the stopping criterion. in this section, we evaluate the performance of the proposed method using a variety of sampling schemes, with different undersampling factors. sampling schemes used in our experiments include 2d random sampling, cartesian approximation of multishot variable - density spiral sampling, cartesian sampling with random phase encodings (1d random) [1, 15 ], and pseudo radial sampling [15, 29 ]. reconstruction results on simulated mri data, a complex phantom, and real mri data were presented. the mr images tested in the synthetic experiments are from in vivo mr scans of size 512 512 (many of which are courtesy (2009, american radiology services [online ]. available : http://www3.americanradiology.com/pls/web1/wwimggal.vmg/) and used in), and the real mri data examples reported here are of size 256 256 (except in figures 6 and 7 where a phantom of size 512 512 was used). according to many prior work on cs - mri [1, 13, 29 ], the cs data acquisition was simulated by subsampling the 2d discrete fourier transform of the mr images (except in the second subsection where real acquired data was used). our proposed method wtbmdu was compared with the leading dlmri (the code is available in https://netfiles.uiuc.edu/ravisha3/www/dlmricode.zip) and tbmdu methods, which have been shown to substantially outperform other cs - mri methods such as ldp (matlab codes are available in http://www.stanford.edu/~mlustig/), and the zero - filling reconstruction. dlmri directly solves the l 0-minimization by omp while tbmdu is devoted to the l 1-induced sparse minimization. in each given example, the parameters for the dlmri method were set to be default values. in the experiments, the nominal values of various parameters were set as patch size m=6, the over - completeness of the dictionary k = 1 (correspondingly j = 36), and the patch overlap r = 1 ; thereby the number of data samples were l = 65536 for n=256 and =(m / r)2=36, = 0.0056, = n/m, = 0.01, = 12, and m = 3. to avoid dividing by zero, the parameter used in the weighted matrix w q, l decreased by 2% after each inner iteration with an initial value of 5. the setting of parameters m and is very similar to that in, [31, 32 ] and not discussed here due to the limit of paper space. real - valued dictionaries were used for the simulated experiments with real - valued images, where the over - complete discrete cosine transform (dct) was chosen as the initial dictionary. complex - valued dictionaries were used for real mr data, where both the real and imaginary parts were the same dct matrix. the quality of the reconstruction was quantified using the peak signal - to - noise ratio (psnr (the psnr is defined as psnr = 20 log10 255/rmse, where the rmse is the root mean error estimated between the ground truth and the reconstructed image)) and high - frequency error norm (hfen). all algorithms were implemented in matlab 7.1 on a pc equipped with amd 2.31 ghz cpu and 3 gbyte ram. figure 1 involves an axial t2-weighted reference image of the brain with pseudo radial sampling under 85% and 95% undersampling percentages, respectively (i.e., only acquiring 15% and 5% k - space data with corresponding acceleration factors of 6.67 and 20). the plots of psnr and hfen values as functions of iteration number under the undersampling percentage of 85% are presented in figures 1(d) and 1(e). it can be observed that the quantitative measures of both tbmdu and wtbmdu change quickly during the first few iterations. in other words, these measure values only need less iterations to reach the convergence zone and hence the iterative convergence property of our method is better than that of dlmri. the higher psnr values and lower hfen values after convergence also confirm the superiority of our method to dlmri and tbmdu. the reconstructed results shown in figures 1(f), 1(g), 1(h), and 1(i) reveal that the method wtbmdu - l1 with p = 0.5 provides a more accurate reconstruction on image contrast and sharper anatomical depiction. compared to dlmri, the magnitude images of the reconstruction error shown in figures 1(h) and 1(i) indicate that our method exhibits crisper reconstruction of object edges (the large anatomical structure in the middle region) and preserves finer texture information (the gray matter regions in the bottom - right of the reconstruction). in general, our proposed method provides better intensity fidelity to the fully sampled image. more obvious differences in visual quality can be observed in the case of 95% undersampling as shown in figures 1(j) and 1(k). the obtained psnrs of dlmri and wtbmdu - l1 with p = 0.5 are 26.30 db and 28.13 db, respectively. the dlmri reconstruction in figure 1(j) based on k - svd dictionary updating and greedy pursuit of coefficients shows a large number of spurious oscillations, although it gives much improvement than zero - filling and ldp (not shown in this paper). in contrast, wtbmdu shown in figure 1(k) results in much fewer spurious oscillations and better preservation of edges through iterative weighting of the coefficients under the data - adaptive dictionary. figure 2 compares the results generated by dlmri and wtbmdu using four sampling trajectories roughly under the same undersampling percentage : variable density random with 87% undersampling, cartesian approximation of multishot spiral with 86% undersampling, 1d cartesian trajectory, and pseudo radial sampling with 86% undersampling (i.e., 7.11-fold acceleration). the test image is the axial t2-weighted brain image shown in figure 1(a). as can be observed from the error images, wtbmdu - l1 performs better in reducing aliasing artifacts and maintaining fine details than dlmri with all verified sampling trajectories. table 1 lists the psnr values of the axial t2-weighted brain image at different sampling trajectories with the same undersampling percentage using dlmri, tbmdu, and wtbmdu. generally, the improvements gained by wtbmdu over other methods are different for four kinds of trajectories although under the same undersampling rate. the largest and smallest improvements were achieved with the 2d random and radial sampling, respectively, where roughly 5 db and 2 db were obtained. this indicates that the efficiency of dictionary learning methods may depend on the incoherence of the data acquisition. in the family of wtbmdu algorithms, the optimal p value is also different at various trajectories for both wtbmdu - l1 and wtbmdu - l2. to balance the numerical calculation and the selection of trajectories, p = 0.5 or p = 0.7 is a good option. figure 3 illustrates the performance of dlmri, tbmdu, and wtbmdu at a range of acceleration factors including 2.5, 4, 6, 8, 10, and 20, where zero - mean complex white gaussian noise with standard deviation = 10.2 was added to the 2d random sampled k - space. since the stopping rule for the outer loop of both tbmdu and wtbmdu is determined by \|\|f p u f\|\|2 <, the number of outer iterations k max of tbmdu and wtbmdu - l2 with p = 0.7 take the values of 3, 3, 6, 7, 7, 11 and 4, 8, 8, 10, 11, 11 for the above six acceleration factors, respectively. for the quantitative comparison, the values of psnr and hfen as functions of acceleration factor are shown in figures 3(b) and 3(c). it can be seen that wtbmdu performs best at all tested acceleration factors. the reconstruction results and the corresponding error images under 10-fold acceleration using three methods are displayed in figures 3(d), 3(e), and 3(f) and 3(g), 3(h), and 3(i), respectively. as shown in the error images, the brighter the error image appears, the larger the deviation between the reconstruction and the reference image will be. wtbmdu (figure 3(i)) presents less pixel errors and structure loss than that of dlmri in figure 3(g) and tbmdu in figure 3(h), especially in regions indicated by red arrows. in general, it can be concluded that both wtbmdu - l2 and tbmdu offer strong preservation of details compared with that of dlmri, while wtbmdu - l2 provides a crisper result of fine structures than that of tbmdu. figure 4 depicts the reconstruction results of a transverse slice of a noncontrast mr angiography (mra) of the circle of willis (cow) at the same experiment setting as in figure 3. the mra of the circle of willis has much textural information such as the vessels on the middle region and fine - scale details on the bottom region. as can be seen from figure 4(b), when the acceleration factor increased until 10-fold, the psnr gap between tbmdu and wtbmdu increases synchronously. the psnr improvement is also reflected in figures 4(e) and 4(f) where much less errors appeared in the wtbmdu error image, indicating wtbmdu performs better in maintaining fine details. on the other hand, similar as observed in figure 3, when the acceleration factor increased to as large as 20-fold, the advantage of the nonconvex optimization degraded and none of these methods can faithfully reconstruct the original image from such fewer k - space samples with additional noise. to investigate the sensitivity of various methods to different levels of complex white gaussian noise, dlmri, tbmdu, and wtbmdu were applied to reconstruct a t2-weighted sagittal view of the lumbar spine under pseudo radial sampling at 6.09-fold acceleration. figure 5(c) plots the psnr values of the recovered mr images by dlmri (blue curves), tbmdu (green curves), and wtbmdu (red curves) at a sequence of different standard deviations (= 2, 5, 8, 10, 14.2). in the case of = 2, the psnr of the image obtained by dlmri is only 38.22 db, tbmdu is 39.49 db, and wtbmdu - l2 with p = 0.7 reaches 40.52 db. the reconstructions and corresponding magnitudes of the error images with = 8 are shown in figures 5(d), 5(e), 5(f), 5(g), 5(h), and 5(i). it can be observed that the skeletons in the top half part of the tbmdu reconstruction appear less obscured than those in the dlmri results. meanwhile, the reconstruction by wtbmdu is clearer and sharper than that by dlmri and tbmdu and is relatively devoid of aliasing artifacts. this reveals that our method provides a more accurate reconstruction of image contrast and sharper anatomical depiction in noisy case. figure 6 shows the comparison between different methods on a physical phantom, which is often used to assess the resolution of mr reconstruction. figures 6(c), 6(d), 6(e), and 6(f) exhibit the results of dlmri, tbmdu, wtbmdu - l1, and wtbmdu - l2 with p = 0.7 at 80% undersampling ratio. the corresponding psnr values are 18.66 db, 26.82 db, 28.89 db, and 29.12 db, respectively. we can find that the wtbmdu reconstructions exhibit higher resolution than those with dlmri and tbmdu and are almost devoid of aliasing artifacts especially in zoomed - in regions. to investigate the noise sensitivity of proposed method on the complex k - space data, complex gaussian noise of = 30 was added to the k - space with 5-fold acceleration. in this case, the psnr values of dlmri, tbmdu, and wtbmdu - l2 with p = 0.7 methods are 17.93 db, 22.94 db, and 25.42 db, respectively. the enlargements of two region - of - interests (rois) are presented in figures 7(d) and 7(e). as can be observed, the dlmri reconstruction exhibits more oscillating artifacts than that of the other two methods. besides, the spot and circle in the bottom right of the wtbmdu reconstruction appear less obscured than those in the dlmri and tbmdu results. in figures 8 and 9, two real brain data sets containing more fine - detailed structures [44, 46 ] were used for comparison. the images in figures 8(a) and 9(a) are both the fully - sampled reconstruction of size 256 256 as references. a variable density cartesian sampling trajectory with 80% undersampling was employed as shown in figure 8(b). the reconstructions from two data sets using dlmri, tbmdu and wtbmdu - l2 with p = 0.7 are displayed in figures 8(b), 8(c), and 8(d) and figures 9(b), 9(c), and 9(d), respectively. the corresponding psnr values of three methods are 31.35 db, 32.04 db, and 32.69 db for reconstructions in figure 8 and 30.58 db, 31.59 db, and 31.82 db for those in figure 9. some regions of error in these subplots have been illustrated with red arrows, indicating that the reconstruction using wtbmdu shows better fidelity to the reference image than that of dlmri and tbmdu. the enlargements of the reconstruction results with these methods are shown in figures 8(f) and 9(e). it can be observed that visible aliasing artifacts along the phase encoding direction (horizontal in the image plane) in the dlmri reconstruction is more pronounced than those of tbmdu reconstruction, while there are almost no artifacts in that of wtbmdu with p = 0.7. close inspection of the zoomed - in images indicates that the weighted sparse regularization enhances the reconstruction quality. in summary, the results from our work clearly demonstrate the advantages of introducing iterative reweighting scheme and alternating direction method in nonconvex optimization over conventional methods, for constrained image reconstruction from undersampled k - space data. not only for the brain image containing large piecewise constant regions, as shown in figures 1, 2, and 3, but also for the circle of willis and lumbar spine composed of many texture features as shown in figures 4 and 5, the proposed method visually provides more pleasant results than existing methods. by means of the bregman iteration / al methodology, it is notable that the proposed method consistently supports superior results without any parameters tuned manually regardless of different sampling trajectories, varying sampling factors, and the existence of noise or not. we note that, in some circumstances, the psnr value started to decrease a little bit after achieving the highest value. the reason of this phenomenon is that the solution of problem (1) does not necessarily have higher psnr than the intermediate iterates. in real - time imaging applications where the acquisition and reconstruction speed is crucial, a numerical algorithm which converges fast at the beginning iterations this work presents a new regularizer combining the nonconvex l p pseudonorm and adaptive dictionary for mri reconstruction from undersampled k - space data. based on the potential success of tbmdu in the al framework for cs - mri, the proposed wtbmdu method extends the plain tbmdu to handle nonconvex l p regularization by weighting the sparse coding of the coefficients. l 2 technique results in the wtbmdu - l1 and wtbmdu - l2 algorithms, respectively. high - accuracy reconstructions are obtained from significantly undersampled k - space data by minimizing the adaptively sparsity - promoting regularization criterion subject to the data - consistency constraint. in particular, compared to the dlmri method that minimizes the l 0 regularization by the greedy algorithm of matching pursuit, the iteratively reweighted strategy combined with al framework yields much higher psnr values. on the other hand, compared to the plain tbmdu for l 1-norm minimization, the adaptively weighted method achieves 0.32.5 db psnr improvement and visually provides more pleasure results. various experimental results demonstrate the superior performance of the method under a variety of sampling trajectories and k - space acceleration factors. wtbmdu is very general since it represents an algorithmic framework that can be easily adapted to different reweighting strategies and nonconvex sparsity - inducing functions proposed in the previous literatures. some extensions will be studied in future as follows : (i) for the reweighted l 1 strategy, using different nonconvex objective functions as conducted in [38, 41 ] ; besides, the shrinkage can be generalized as in [47, 48 ] ; (ii) for the reweighted l 2 strategy, trying different nonconvex objective functions as in. additionally, the proposed scheme can be easily extended to incorporate other prior (e.g., spike and slab prior used in, where the regularization consists of the l 2-norm and l 0-norm terms). it may be better for stabling the numerical process ; (iii) the current iteratively reweighted strategies can be combined with the homotopic technique described in [1416 ], where the value of p slowly decreases from 1 to 0. another extension we will consider in future is to extend our proposed model to parallel mri reconstruction. we note that a very recently published paper, under the work of ramani and fessler, addressed the regularized sense - reconstruction using al methods. in order to effectively solve the unconstrained sense - reconstruction consisting of tv / wavelets regularization term and data - fidelity term using the al formalism, they split not only the regularization term, but also the fourier encoding and spatial components in the data - fidelity term, by introducing auxiliary variables to decouple the data - domain components, and the regularization component, respectively. we believe that the regularizer of the sparse representations of overlapping image patches in our work can be naturally incorporated into their work in a unified al framework.	nonconvex optimization has shown that it needs substantially fewer measurements than l 1 minimization for exact recovery under fixed transform / overcomplete dictionary. in this work, two efficient numerical algorithms which are unified by the method named weighted two - level bregman method with dictionary updating (wtbmdu) are proposed for solving lp optimization under the dictionary learning model and subjecting the fidelity to the partial measurements. by incorporating the iteratively reweighted norm into the two - level bregman iteration method with dictionary updating scheme (tbmdu), the modified alternating direction method (adm) solves the model of pursuing the approximated lp - norm penalty efficiently. specifically, the algorithms converge after a relatively small number of iterations, under the formulation of iteratively reweighted l 1 and l 2 minimization. experimental results on mr image simulations and real mr data, under a variety of sampling trajectories and acceleration factors, consistently demonstrate that the proposed method can efficiently reconstruct mr images from highly undersampled k - space data and presents advantages over the current state - of - the - art reconstruction approaches, in terms of higher psnr and lower hfen values.
the traditional technique for indirect esthetic restorations consists of taking an impression of the tooth immediately after preparation, followed by the luting of a provisional restoration. after the indirect restoration fabrication, the provisional material is removed and an adhesive system is applied to the tooth after which a resin luting agent is used for the adhesive luting procedure. some studies have shown that adhesive systems bond better to freshly prepared dentin than to dentin contaminated by provisionalization, which may lead to microleakage, hybridization failure, and sensitivity. to avoid these problems, the immediate dentin sealing (ids) technique this technique consists of the application of an adhesive system immediately after tooth preparation and before taking the impression. another technique was developed in which a sealing film is produced on the dentinal surface using an adhesive system and a low - viscosity composite resin immediately after tooth preparation. this layer of low - viscosity composite resin is thought to isolate the underlying hybrid layer, consequently aiding in the preservation of the dentinal seal. ids techniques have the clinical advantages of covering the prepared dentin with a resinous agent immediately after cavity preparation, thereby sealing and protecting the dentin pulp complex as well as preventing or decreasing sensitivity and bacterial leakage during the provisional stage. thus, ids has been suggested when a significant area of dentin has been exposed during tooth preparation for indirect restorations, such as inlays, onlays, veneers, and crowns. most studies on ids techniques have evaluated the efficacy of the bond strength between the resin cement and dentin, showing good bonding of the resin used in ids as well as an increased resin bond strength in ids with an adhesive system and an additional low - viscosity microfilled resin. restoration interface in the specimens coated with an adhesive system and a low - viscosity microfilled resin compared with non - coated specimens. due to the demand for tooth - colored restorations, ceramic biocompatibility and mechanical properties (e.g., high - elastic modulus and hardness) make them attractive for use as biomechanical prostheses. thus, ceramics are used widely for cusp replacement restorations as well as for esthetics. despite their many advantages, this weakness can be attributed to the presence and propagation of microflaws present on the surface of the material, making the ceramic susceptible to fracture during the luting procedure and under occlusal force. to increase retention, and fracture strength of the restored tooth, resin luting materials are commonly used to join ceramic crowns to the prepared hard tissue foundation. the cement layer may act as a cushion between the crown and dentin substrate, although the effect of this on the fracture strength of all - ceramic restorations is not well - established. molin., verified the influence of the film thickness of resin luting agents on the joint bond strength of the ceramic dentin interface and showed that the bond strength values were significantly lower with 20-m film than with 50-, 100- or 200-m films. scherrer., reported the effect of cement film thickness on the fracture resistance of glass ceramic plates loaded under compression using a spherical indenter. they found that the fracture resistance of glass ceramic cemented with zinc phosphate cement was not dependent on film thickness. when resin cement was used, a gradual decrease in the fracture strength was observed with increasing cement thickness. prakki., evaluated the fracture resistance of ceramic plates (1- and 2-mm thick) cemented to dentin as a function of the resin cement film thickness. these authors concluded that a higher cement film thickness resulted in increased fracture resistance only for 1-mm ceramic plates. the materials used in the ids can create a film thickness covering a vast range of values, depending on the type of resin material and the topography of the tooth preparation. however, no information exists regarding such film thickness in a full crown preparation and its influence on the fracture load of all - ceramic crowns. therefore, the aim of this in vitro study was to evaluate the thickness of an adhesive, a low - viscosity microfilled resin and a resin cement under full crown preparations as well as the influence on the compressive fracture load of a reinforced all - ceramic crown luted to human teeth. this study investigated the following hypotheses : (a) there are differences in the thickness of the resin materials at different positions under crowns and (b) the thickness of the resin materials does not influence the compressive fracture load of the all - ceramic crown. sixty sound maxillary premolars extracted for therapeutic indications were cleaned and disinfected by immersion in 10% thymol for 24 h. the premolars were then stored in distilled water at 4c for a maximum period of 6 months. these teeth had the following coronal dimensions : buccal - lingual distance of 9.0 - 9.6 mm ; mesiodistal distance of 7.0 - 7.4 mm ; and cervical - occlusal distance of 7.7 - 8.8 mm. a variation of 0.5 mm was associated with each measurement. the roots were mounted in acrylic resin approximately 2 mm below the cementoenamel junction of the tooth. tooth preparation was performed using a standardized preparation machine consisting of a high - speed hand piece (kavo, joinville, sc, brazil) coupled to a mobile base. the mobile base moved vertically and horizontally, in increments of 3 m, with the aid of a micrometer (mitutoyo, tokyo, japan). cusps were removed and the long axes of teeth were positioned vertically on the preparation machine. 3139 diamond wheel bur (sorensen, cotia, sp, brazil) was attached to a high - speed hand piece and all lateral convex surfaces were leveled. the dimensions of the preparations were as follows : 6 taper on each side, 1.2 0.2 mm shoulder margin and a 5 mm core height with rounded line angles. the prepared teeth were then randomly divided into the following 3 groups (n = 20) according to the materials used [table 1 ] : group 1 : control, without the ids techniquegroup 2 : ids with clearfil se bond. se primer was first applied to the cavity for 20 s and gently air dried. se bond was then applied ; mildly air - dried and light cured for 10 s using a conventional halogen light curing unit. polymerization of the adhesive was followed by the application of an air - blocking barrier (glycerine jelly) and light cured for a further 10 s to polymerize the oxygen inhibition layer. the glycerine jelly was rinsed under running tap watergroup 3 : ids with clearfil se bond and protect liner f. clearfil se bond was applied as described in group 2 but without the air - blocking barrier. after application of the adhesive, protect liner f was placed on the adhesive surface using a brush - on technique and light cured for 20 s. the surface of the cured low - viscosity microfilled resin was wiped with a cotton pellet soaked in alcohol for 10 s to remove the unpolymerized layer on the surface. group 1 : control, without the ids technique group 2 : ids with clearfil se bond. se primer was first applied to the cavity for 20 s and gently air dried. se bond was then applied ; mildly air - dried and light cured for 10 s using a conventional halogen light curing unit. polymerization of the adhesive was followed by the application of an air - blocking barrier (glycerine jelly) and light cured for a further 10 s to polymerize the oxygen inhibition layer. the glycerine jelly was rinsed under running tap water group 3 : ids with clearfil se bond and protect liner f. clearfil se bond was applied as described in group 2 but without the air - blocking barrier. after application of the adhesive, protect liner f was placed on the adhesive surface using a brush - on technique and light cured for 20 s. the surface of the cured low - viscosity microfilled resin was wiped with a cotton pellet soaked in alcohol for 10 s to remove the unpolymerized layer on the surface. materials used in the study an impression of each prepared tooth was taken using a polyvinyl siloxane impression material (express, 3m / espe, st. paul, mn, usa) and a custom - made impression tray fabricated with acrylic resin. the impressions were then cast in type iv stone (durone, dentsply, york, pa, usa) to produce dies. after the impression, the preparations were temporized with self - curing acrylic resin crowns cemented with non - eugenol provisional cement (tempbond ne, kerr, orange, ca, usa). tooth specimens were stored in distilled water at 37c for 2 months. for 10 specimens from each group, ips empress 2 restorations were fabricated in accordance with the manufacturer 's instructions in a dental laboratory. a 0.8-mm lithium disilicate core was made and ips empress veneer ceramic (dentin shade) was applied to the core to create a crown thickness of 1.5 mm. after storage, provisional restorations were removed and preparations were cleaned using pumice slurry until all provisional cement was removed. the intaglio surface of each crown was etched with 10% hydrofluoric acid for 20 s, rinsed and dried. a layer of silane (clearfil ceramic primer, kuraray medical inc., tokyo, japan) was applied, followed by gentle air drying for 5 s. the coated surfaces of the preparation (except in group 1) were then acid etched with 37% phosphoric acid for 10 s and rinsed and dried to remove any debris. a mixture of ed primer a and b was applied for 30 s and gently air - dried for 5 s. the base and catalyst of panavia f resin cement were mixed according to the manufacturer 's instructions. excess cement was removed with a microbrush and each surface (buccal, lingual, mesial, distal, and occlusal) was light cured for 40 s. the margins were finished with polishing discs and silicone tips (soft - lex, 3 m espe, st. after 2 months of storage in distilled water at 37c, each specimen was seated in a jig placed on the base of a universal testing machine. a compressive load was applied through a 3.2-mm diameter hardened steel sphere attached to the moving head of the testing machine (model 1123, instron corp., canton, ma, usa). the remnant ceramic on the prepared tooth was determined as type i (0%), type ii (less than 50%) or type iii (more than 50%). in the other 10 specimens for each group, after storage in 37c distilled water for 2 months, each crown was sectioned buccolingually through the center of the crown with a diamond blade in an isomet saw (buehler, lake bluff, il, usa), resulting in two portions. one portion of each specimen was placed under a measuring microscope (profile projector v-16d, nikon, tokyo, japan), with a measuring sensitivity of 1 m, under 100 magnification. the thickness of the adhesive system, low - viscosity microfilled resin and resin cement was measured at 10 positions as shown in figure 1. thickness of the resin materials was measured in a direction perpendicular to the dentin surface at each position. the thickness of the resin cement, adhesive and low - viscosity microfilled resin were measured at 10 different positions along the preparation the final thickness of the resin materials (adhesive, low - viscosity microfilled resin and resin cement) at the different positions in each group was compared using the friedman and wilcoxon signed - rank non - parametric tests. the kruskal - wallis and mann - whitney u non - parametric tests were also used to compare the final thickness values between the groups in each position. fracture loads were analyzed using the one - way analysis of variance, followed by tukey 's multiple comparison tests. the correlation between fracture load and the thickness of the resin materials was analyzed by the pearson correlation test. the mean film thickness of the adhesive, low - viscosity microfilled resin and resin cement in each position for the different groups is shown in table 2 and in figures 24. the thickness of the resin cement was higher in positions 5 and 6 than in other positions. the thickness of adhesive was higher in positions 2 and 9 and lower in positions 1 and 10. the thickness of the low - viscosity microfilled resin was higher in positions 5 and 6 and lower in positions 1 and 10. mean thickness (m) and standard deviation of the resin cement, adhesive and low - viscosity microfilled resin of the experimental groups in the different positions group 1 - mean thickness (m) of the resin cement group 2 - mean thickness (m) of the adhesive and resin cement group 3 - mean thickness (m) of adhesive, low - viscosity microfilled resin, and resin cement the sum of the resin materials in each position is presented in table 3. according to the friedmann non - parametric test, statistically significant differences were noted between the positions (p < 0.01). in group 1, a significantly higher resin cement thickness was obtained in positions 5 and 6. in group 2 (adhesive + resin cement) and group 3 (adhesive + low - viscosity microfilled resin + resin cement), significantly lower resin thickness values were obtained in positions 1 and 10. intermediate values were found in positions 2, 3, 7, and 8. although no statistically significant difference was observed between these positions and positions 5 and 6 in groups 2 and 3, a higher thickness of the resin material was observed at the occlusal surface (positions 5 and 6). sum of thickness of resin material (m) at different positions according to kruskal - wallis, the thickness of the resin material differed significantly between the groups in all positions (p < 0.01). the highest values were obtained in group 3, which were significantly different than those of group 2. the lowest values were obtained in group 1, which differed significantly from those of group 2 [table 3 ]. the fracture load of group 3 (1300 n) was statistically higher than of group 1 (1001 n) (p < 0.01). group 2 (1189 n) was not significantly different from groups 1 and 3 [table 4 ]. all fractures occurred through the veneer and the core materials. in group 1, 3 specimens presented with type i failure and 7 specimens with type ii failure. in group 2, 2 specimens presented with type i failure, 6 with type ii and 2 with type iii. in group 3, 4 specimens presented with type ii failure and 6 specimens with type iii failure [table 5 ]. mean fracture load (n) of the experimental groups remnant ceramic (%) on the crown after fracture pearson 's correlation coefficient indicated a regular positive correlation between the final thickness of the resin material and the fracture load (r = 0.549) [figure 5 ]. the first hypothesis was accepted because the film thickness values of the 3 resin materials (adhesive, low - viscosity microfilled resin, and resin cement) were different and appeared to be influenced by their positions under the crown. in groups 2 and 3, the clearfil se bond adhesive system was applied to seal the dentin immediately after tooth preparation. the film thickness of this material presented a vast range of values at different positions of the adhesive layer, which was in accordance with other studies. higher thickness was obtained in positions 2 and 9 (concave parts of the preparation), which is consistent with the tendency of the adhesive to pool at the inner angles of the preparation. the minimum thickness in both groups the thinner film of the adhesive at the borders is fortunate because a thicker film would expose more adhesive to the degradation process in the oral cavity. in group 2, the thickness of the adhesive could be measured in practically all positions, likely because the application of the glycerine gel allowed the polymerization of the outer layer. in some positions (positions 1, 4, and 10), the film thickness was less than 40 m [figure 3 ], which corresponds to the inhibition layer associated with oxygen inhibition of the radicals that initiate the polymerization reaction. without the glycerine gel layer, the adhesive would not have polymerized and would have been removed during the cleaning of the adhesive interface, resulting in many areas of exposed dentin. in fact, in group 2, the adhesive film could not be seen or measured at one of the borders of the preparation in 6 specimens. the film thickness was likely very thin and was removed during the cleaning procedure before luting with panavia f. when the adhesive film thickness was compared between groups 2 and 3, a trend toward higher thickness was observed in group 3, likely due to the application of the protect liner f over the adhesive, which protected the adhesive layer during the cleaning procedure. the cleaning of the adhesive interface was performed with pumice slurry to remove all remnants of the provisional cement. during this procedure, part of the adhesive layer was likely removed and the thickness of the adhesive reduced. the film thickness of the protect liner f (group 3) presented a more uniform range of values at different positions compared with the adhesive layer. this material has a higher percentage of filler compared with clearfil se bond as well as a decreased likelihood of pooling at the inner angles of the preparation. using a microbrush, the material was applied over the adhesive as thinly as possible from a visual perspective. at the borders, a clean microbrush was applied to remove a part of the material and to avoid a thicker layer, which could have considerably increased the amount of material exposed to the oral cavity. the minimum thickness was obtained in positions 1 and 10 (marginal areas of the preparation), which ranged from 19 m to 67 m. glycerine gel was not used, although the surface of the cured low - viscosity microfilled resin was wiped with a cotton pellet soaked in alcohol to remove the unpolymerized layer on the surface. without this procedure, in addition, the surface of the low - viscosity microfilled resin was cleaned with pumice slurry to remove the cement remnants, whereby some micrometers of the material may have also been removed. the thickness of the resin cement can be influenced by many factors, including margin geometry and the presence of the die spacer. in relation to the margin geometry, a shoulder bevel facilitates better seating than does a shoulder, although the preparation for a lithium disilicate ceramic requires a shoulder or a pronounced chamfer. the omission of a die spacer affects the proper seating of the restoration while an excessive layer can also enlarge the luting space. the best crown seating was found when 20 - 40 m of cement space was provided. in the present study, 2 coats of die spacer were applied, which corresponds to a thickness of approximately 30 m. however, the thickness of the resin cement was higher in positions 5 and 6 (the occlusal portions of the preparation). this finding corroborates previous reports regarding marginal fit and cement distribution under all - ceramic restorations, which showed the highest cement film thickness was usually located at the occlusal surface underneath the crown. ids with clearfil se bond and protect liner f (group 3) had the highest film thickness of the resin material in all positions compared with the other groups [table 3 ]. at the borders of the preparation (positions 1 and 10), the median thickness of the resin materials exposed to the oral environment corresponded to 120 m, 85 m, and 56 m for groups 3, 2, and 1, respectively. the marginal and internal fit of all - ceramic crowns is still very important for conventional and adhesive luted restorations. however, marginal fit is one of the most crucial criteria in the clinical decision involving the insertion of a restoration. most authors agree that discrepancies in the range of 100 m seem to be clinically acceptable with regard to the longevity of restorations. for other authors, however, marginal discrepancies up to 160 m might be tolerable. using the latter criteria, the results of the present study are within biologically acceptable standards for in all 3 groups. for the luting procedure with panavia f, ed primer was applied on the clearfil se bond adhesive (group 2) and on the low - viscosity microfilled resin (group 3). it is likely that this material contributed to the final thickness of the resin materials. however, it was not possible to visualize the layer of ed primer. in relation to the luting procedure, hence, it would have been more appropriate to apply a hydrophobic adhesive that did not contain water. nevertheless, according to the study of okuda., ed primer did not negatively influence the bond strength when it was applied on protect liner f for luting with panavia f while a higher bond strength was obtained in the study of udo. the reason for this finding is not clear, but it may be related to the polymerization of panavia f in the presence of ed primer. ed primer contains an aromatic sulfinate salt, which is believed to accelerate interfacial polymerization between the sealed dentin surface and the resin cement. the second study hypothesis was rejected because a significant upward trend was noted in the fracture load with increasing thickness of the resin material. this finding was not in accordance with other studies that observed a downward trend in the fracture load with increasing thickness of the resin cement. kim. observed that increased cement thickness can have an effect on reducing flexural failure load. in the study, the load to failure of silicon bonded to glass with variations in the thickness of the bonding epoxy layer indicated a 50% reduction in strength when this layer was increased from 20 m to 200 m. burke and watts, evaluated the resin cement thickness of 2-mm ceramic crowns that were submitted to compressive fracture load. the authors concluded that the film thickness did not influence the overall results because the mean film thickness of the best performing material tested was similar to that in a group that did not perform as well. however, such studies evaluated the influence of the thickness of the resin cement on ceramic strength without taking into consideration the film thickness formed by ids techniques. therefore, it is difficult to make direct comparisons between studies because of the different specimen dimensions, types of ceramic, and resin cement systems that were used, especially because numerous factors can affect ceramic fracture resistance behavior. in the present study, the load was applied on the occlusal regions of the crowns, corresponding to positions 5 and 6. it was at these positions that the highest final thickness of the resin material was recorded for all groups (approximately 130 m, 250 m, and 360 m for groups 1, 2, and 3, respectively). because, the resin cement thickness was similar for all groups in positions 5 and 6 (approximately 150 m), it is thought that the thickness of the clearfil se bond and protect liner f influenced the values of the compressive fracture load. during the curing process, the resin cement is transformed from a liquid to a solid state, thereby causing volume change and shrinkage of the material. the additional film thickness formed by the adhesive and the low - viscosity microfilled resin may have favored greater absorption of stresses generated by the shrinkage of the resin cement, contributing to greater stress relief at the interfaces. according to rees and jacobsen, high shrinkage stress, even over a small area of an interface, is sufficient to induce crack formation. this becomes an area of stress concentration and is liable to induce further failures under occlusal loading. the integrity of the ceramic - resin cement interface is predicted because of the great bond strength between the composite material and silanized ceramic. however, crack formation may have been possible at the dentin - resin cement interface during shrinkage of the resin cement, especially in the group that did not receive ids (group 1), which may explain its lower fracture load. another factor that could have contributed to the higher fracture load in group 3 was the fact that ids with the adhesive system and low - viscosity microfilled resin significantly improved the bond strength of indirect restorations bonded to dentin using the resin cement. increasing the bond strength of the luting material helps to increase the fracture strength of the restorative material. concluded that ids with another adhesive system, clearfil tri - s bond, increased the bonding durability of the resin cement to dentin against occlusal loading, which may reduce the possibility of fracture of all - ceramic crowns in clinical situations. in all specimens, crown fractures occurred through the veneer and core ceramics. the classification of fractures used in the present study was based on the remnant ceramic on the prepared tooth because this was the main difference observed between the groups. more than 50% of the ceramic crown remained bonded to the preparation after the compressive fracture load test in most specimens in group 3. this provides support for the idea that ids with clearfil se bond and protect liner f may promote a stronger bond between the ceramic crown and the dental preparation than does ids with clearfil se bond (group 2) or does uncoated specimens (group 1), in which less than 50% of the ceramic crown remained bonded to the preparation. one advantage of the ids technique is that the thickness of the resin materials is considered before the restoration is fabricated because it is captured in the impression. even so, the thickness of the resin materials can be a concern for crowns. a part of the tooth preparation was observed to be occupied by clearfil se bond and protect liner f. as a consequence, a part of the space designated for the ceramic core was occupied by clearfil se bond and protect liner f in group 3, especially at the concave part of the preparation (positions 2 and 9). despite this, this alteration in the geometry of the ceramic could be a concern for unreinforced ceramics such as ips empress leucite and feldspathic ceramics. ips empress 2 ceramic was used in the present study because reinforced ceramics tend to be used in clinical practice for full crowns on posterior teeth. recently, this ceramic has been replaced by ips e. max ceramic, which has a similar composition as ips empress 2. for this reason, the results of the present study may have been similar if ips e. max ceramic had been used. the ids technique should not be recommended with other reinforced dental ceramic systems such as glass infiltrated aluminum oxide, high - purity alumina, and zirconia ceramics. the main reason is that these reinforced ceramics resist the formation of microretentive surfaces after hydrofluoric acid etching and airborne particle abrasion, which are important surface treatments for adhesive luting. therefore, an interesting study could evaluate the influence of ids with feldspathic ceramic crowns, which have lower fracture resistance. despite the limitations of this in vitro study, the following conclusions can be drawn : the film thickness of clearfil se bond was higher at the concave and occlusal portions of the crown preparation and thinner at the bordersprotect liner f had a more uniform range of values at different positions except at the borders of the preparations, where the film thickness was thinnerthe film thickness of panavia f resin cement was higher at the occlusal portion of the crown preparationthe film thickness formed by clearfil se bond and protect liner f increased the fracture load of ips empress 2 ceramic crowns. the film thickness of clearfil se bond was higher at the concave and occlusal portions of the crown preparation and thinner at the borders protect liner f had a more uniform range of values at different positions except at the borders of the preparations, where the film thickness was thinner the film thickness of panavia f resin cement was higher at the occlusal portion of the crown preparation the film thickness formed by clearfil se bond and protect liner f increased the fracture load of ips empress 2 ceramic crowns.	objectives : the objective of this study is to evaluate, in vitro, the thickness of immediate dentin sealing (ids) materials on full crown preparations and its effect on the fracture load of a reinforced all - ceramic crown.materials and methods : sixty premolars received full crown preparation and were divided into the following groups according to the ids technique : g1-control ; g2-clearfil se bond ; and g3-clearfil se bond and protect liner f. after the impressions were taken, the preparations were temporized with acrylic resin crowns. ips empress 2 restorations were fabricated and later cemented on the preparations with panavia f. 10 specimens from each group were submitted to fracture load testing. the other 10 specimens were sectioned buccolingually before the thicknesses of panavia f, clearfil se bond and protect liner f were measured in 10 different positions using a microscope.results:according to analysis of variance and tukey 's test, the fracture load of group 3 (1300 n) was significantly higher than that of group 1 (1001 n) (p < 0.01). group 2 (1189 n) was not significantly different from groups 1 and 3. the higher thickness of clearfil se bond was obtained in the concave part of the preparation. protect liner f presented a more uniform range of values at different positions. the thickness of panavia f was higher in the occlusal portion of the preparation.conclusions:the film thickness formed by the ids materials is influenced by the position under the crown, suggesting its potential to increase the fracture load of the ips empress 2 ceramic crowns.
bioluminescence tomography (blt) is a rapidly growing field of research in optical molecular imaging, which allows for the visualization of normal and abnormal cellular processes in living subjects at the molecular or genetic level [14 ]. with blt, we seek to recover the spatial distribution of bioluminescent light source inside a small animal from external noninvasive measurements. generally speaking, the internal source intensity is closely related to the strength of the molecular / cellular activity, such as gene expression. thus, this imaging modality can provide in - depth information of the internal biological sources concerned in longitudinal monitoring and quantitative assessment changes and efficacy and thus further facilitates our understanding of bio - molecular processes as they occur in living animals. when using blt technique to measure efficiency of a genic therapy or to observe the growth or migration of cancer cells, accurate detection of different sources that differ greatly in density or power is instrumental ; for example, it may yield a great deal of information regarding tumor dissemination and burden in various sites before the development of gross disease [1, 7, 8 ]. therefore, the emphasis of this paper is multiple - source reconstruction that has not been sufficiently considered to date in blt. most reconstruction methods for blt can be classified to model - based reconstruction. in this case, given a light propagation model, the flux on the boundary can be predicted with numerical methods such as the finite element method (fem) by combing with the structural information and optical parameters regarding different organs. and then the blt is formulated as an optimization problem of minimizing the discrepancy between the boundary measurements and the predicted light intensities on the tissue surface. in the reconstruction procedure, the ill posedness of the blt problem does pose a challenge for determining a unique solution of the tomographic problem. different strategies have been proposed for coping with the ill posedness of blt inverse problems. these studies obtain stable reconstruction by increasing the amount of independent measurements with spectrally resolved approaches [1113 ], or by reducing the number of unknowns [10, 14 ], or with regularization techniques to incorporate some a priori information regarding the inverse source problem [1517 ]. in this paper, we focus our attention on the multiple - source reconstruction with monochromatic boundary measurements where regularization techniques are inevitable in the reconstruction process. the existing regularization - based reconstruction schemes in bioluminescent imaging to date can be loosely classified into three categories : l2 regularization, l1 regularization, and implicit regularization such as tsvd and lsqr [18, 19 ]. through regularization, some constraints are applied to reconstruction and yield an approximate solution of the blt problem. no matter which regularizer is used, source location and visualization are still needed for preclinical practice. most source location schemes are directly based on the reconstructed density vector and the larger the density, the more probable the source center. specifically, according to a priori knowledge of the number of sources, several nodes with larger density values are identified as the promising sources or set a global threshold by referring to the maximum density and only those nodes with a density value higher than the threshold will be displayed. in most applications of blt, for example, monitoring cancer metastasis, neither the sources number nor an appropriate global threshold is easy to determine. this is mainly due to the fact that bioluminescent lights are usually weak and diffuse, and consequently the number of potential sources is hard to estimate only by surface photon distributions. moreover, the global threshold strategy is unfeasible for distinguishing multiple sources with distinct difference in power. especially in l2 norm regularization cases, the obtained solution is usually oversmoothing, and thus a lower threshold will incur some artifacts in the final images whereas a higher one will discard some small potential sources. consequently, effective reconstruction scheme for multiple sources with different powers deserves further investigation. in this paper, we develop a finite element mesh aggregating approach for multiple - source reconstruction in blt. first, we propose a multiple - source detecting strategy. rather than assuming independence between mesh nodes, the proposed reconstruction strategy exploits spatial structure of the nodes and characteristic of energy decay to adaptively second, we integrate the proposed reconstruction strategy with regularization - based inverse algorithms to build a unified framework for solving blt inverse problem. numerical simulations and phantom experiments demonstrate the effectiveness of this framework. the paper is organized as follows. in section 2, we present a multiple - source reconstruction framework with the emphasis on the finite - element - mesh - aggregating - based source detection strategy. in section 3 section 4 presents a phantom experiment to further test the effectiveness of the proposed method. radiative transfer equation (rte) plays an important role in image reconstruction by predicting the bioluminescence light intensities on the tissue boundary, but solving rte remains an intractable task for biological tissue with spatially nonuniform optical properties and complex tissue geometries. instead, some approximations to rte have been established to overcome the difficulty of directly solving rte. among them, the diffusion approximation (da) model has been extensively used to describe the photon propagation in tissue where there is scattering dominant absorption [514 ]. here, we restrict our discussion to the da model for simplicity. the steady state diffusion equation complemented with the robin boundary condition can be expressed as follows : (1)(d(r)(r))+a(r)(r)=s(r), (r), (2)(r)+2a(r;n, n)d(r)(v(r)(r))=0, (r), where (r) is the photon power density at r, s(r) is an isotropic source distribution of gene expression, and d(r) and a(r) are the optical diffusion and absorption coefficient, respectively. in this work the term v(r) in (2) denotes the unit outer normal at boundary, a(r ; n, n) (1 + r(r))/(1 r(r)) is the boundary mismatch factor accounting for different refractive indices across the boundary. following the standard finite element analysis, support domain is discretized into t vertex nodes (n1, n2,, nt) and ne mesh elements, denoted as (l = 1,2,, ne) ; then (r) and source term s(r) can be approximately expressed as (3)(r)h(r)=k=1tkk(r), r,s(r)sh(r)=k=1tskk(r), r, where k is the approximate nodal value of (r) on the kth node nk, k(r) the nodal basis function with support over the elements, sk the discretized nodal values of s(r), and k(r) the interpolation basis functions, which is usually the same with k(r). based on (1)(3), a matrix equation of the linear relationship between source distribution and boundary measurements can be derived [10, section 2 ] : (4)as=, where a is a typical ill - conditioned matrix and represents measurable boundary nodal photon density. in real blt experiments, is computed from the surface flux image captured with a ccd camera. as mentioned in section 1, the flux density on the boundary can be predicted according to a forward model, thereby a natural choice for source reconstruction is to minimize the misfit between predicted data and measurements, that is, (5)s = arg mins\|\|as\|\|2. to deal with the ill posedness of blt inverse problem, permissible source region is usually incorporated into the reconstruction model by spatially constraining the reconstruction domain to the area of interest [10, 14, 16, 23 ]. a more effective approach to reconstruction is using regularization to act as an algebraic stabilizer in estimating solutions. using a general lp (0 0 provides a tradeoff between data fitting and constraints regarding solutions. obviously, tikhonov regularization method is a special case of (6) for p = 2, that is, using an l2-norm regularizer. for p = 1, l1-norm - based sparse regularization methods have recently attracted considerable amount of attention in blt [17, 2325 ] and the reconstructions results therein witnessed some improvements in image quality. based on the solution (a source density vector) obtained in section 2.2, source localization and imaging is then performed by combining with fem mesh information. facing the dilemma of threshold choice mentioned in section 1, we are hoping for an adaptive method that can avoid the difficulty of threshold selection while at the same time removing artifacts in the reconstructed images with relatively lower computational cost. consider that in most applications of blt, for example, detecting events that occur during the early stages of disease progression, the bioluminescent sources we want to recover are often localized in some small subregions of the domain. on the other hand, because light intensity is heavily attenuated in biological tissue and falls off exponentially from the illumination point, the diffusion range of a bioluminescent source is limited by the source strength. consequently, when taking the spatial structure of the mesh nodes into account, the source density vector should have a spatial aggregation on the mesh, which is also illustrated in the experiments in section 3 (figure 4). it is found that, in a very small local region, if a node in the mesh has a maximum density value, with a very high probability its adjacent nodes are also with larger density. it is found that in a very small local region, if a node in the mesh has a maximum density value, with a very high probability its adjacent nodes are also with a larger density. we also observe that there are some nodes with smaller density in the vicinity of nodes with the larger density. these observations are helpful for discriminating pseudosource from a cluster of mesh nodes and removing artifacts in images. on the basis of the above analysis, an iterative multiple - source detection strategy (msds) consequently, the preprocessing of solution with a small threshold of cmax (si) is helpful to remove pseudosources and reduce the data size to be processed in the subsequent steps. consequently, the preprocessing of solution with a small threshold of cmax (si) is helpful to remove pseudosources and reduce the data size to be processed in the subsequent steps. = { si \| i n, si > 0}. step 4initial the sources number k = 1 we can find out the other elements that directly adjoin the node j, if any, according to the mesh structure information. we can find out the other elements that directly adjoin the node j, if any, according to the mesh structure information. step 6if set o is null, stop ; otherwise k : = k + 1, and go to step 5. if set o is null, stop ; otherwise k : = k + 1, and go to step 5. with the steps defined above, we provide an automatic method to estimate the number of sources from the reconstruction results iteratively. the final results contain k sources. here, k is the number of subsets of the initial set o obtained at the end of the above iteration. when pi (i = 1, l, k) has more than one member, we call this situation overrepresentation, the nodes related to these elements will aggregate to represent a single source and the node with largest density value sj is regarded as the source center for simplicity. eventually, the cartesian coordinates of the reconstructed sources are obtained by their node index in the finite element mesh. based on the foregoing reconstruction scheme, we build a unified regularization framework for multiple - source reconstruction by integrating the msds with the general lp - norm regularization, as shown in figure 1. the msds is a relatively independent component of the framework, and hence different regularizer and different reconstruction algorithms can be utilized according to the practice of blt. in this section, we present some numerical experiments to demonstrate the utility and the effectiveness of the proposed method in multiple - source settings. comparison is performed between the proposed msds and the traditional global threshold strategy (gts). it should be pointed that the main theme of this paper is to evaluate the performance of this framework for multiple - source reconstruction in blt, rather than the comparison between specific reconstruction algorithms. as representatives of algorithms using l1 and l2 regularization, tikhonov regularization method and l1ls are, respectively, combined with the above two strategies to recover the interior source distribution from the synthetically boundary measurements. consequently, the reconstruction methods evaluated in the following experiments include tikhonov + msds, tikhonov + gts, l1ls + msds, and l1ls + gts. it is known that regularization parameter is crucial to yield a good solution for ill - posed problems, and the choice of regularization parameter is usually nontrivial. in this paper, the regularization parameter for tikhonov method was determined with the adaptive method proposed in. as for l1ls, the parameter was chosen as suggested in, that is, = 0.1\|\|2a\|\|. all the experiments were performed on a cylindrical mouse chest numerical phantom as shown in figure 2(a). the specific optical properties of different organs are listed in table 1. in the first study two sphere sources with radius of 0.5 mm were positioned in the left lung with the centers at s1 = (9, 3.5,15) and s2 = (9,3.5,15), respectively. they were uniform in size and shape. to illustrate the point of our discussion, we consider four cases of experiment settings : (i) both of the initial source densities were 1 nw / mm ; (ii) to (iv) the densities of s1 were still 1 nw / mm, but the densities of s2 were 0.5 nw / mm, 0.25 nw / mm, and 0.125 nw / mm, respectively, that is, the ratios of the power of source s2 to that of s1 were 2 : 1, 4 : 1, and 8 : 1. in the following experiments, the model was discretized into a fine tetrahedral element mesh and synthetic measurements were generated by solving the forward model with fem. to simulate the noise involved in real blt experiment, figures 2(b)2(e) show the forward mesh and the simulated photon distribution on the surface in the above four source settings. obviously, it is difficult to predict the source number only according to the photon distribution especially in case (iii) and case (iv). in the reconstruction process, a permissible source region strategy was also employed as a priori information to decrease the ill posedness of blt inverse problem, which was defined as { (x, y, z) \| 8 < (x + y) < 12,13.5 < z < 16.5 }. following the proposed reconstruction framework the reconstructions were carried out with the aforementioned four methods under different source settings. the first row and the third row of figure 3 show the final reconstruction results by tikhonov method and l1ls method combined with the proposed msds. for comparison, the second row and the fourth row of figure 3 present the corresponding reconstructed results rendered from gts, where a global threshold (35% of the maximum density value) was used. it is obvious that the two sources are accurately detected by the proposed msds combined with different regularization methods in all the cases considered. on the other hand, for case (iii) and case (iv), only the source with larger power is detected by tikhonov + gts and l1ls + gts, whereas the other weaker one is lost in the final reconstruction results. to quantitativly assess reconstruction results in different power settings, we summarize location errors and reconstructed powers by different reconstruction schemes in table 2, where the second column represents the actual initial power ratio of s1 to s2, and s1 and s2 denote the corresponding reconstructed sources., it is seen that l1-norm - based method l1ls generally performs better than l2-norm - based tikhonov method in terms of reconstructed powers and locations. figure 4 illustrates the mesh aggregating process of msds and compares the final reconstruction results of msds with those of gts in case (i). we can observe that there are some nodes with smaller density value in the vicinity of the two nodes with larger density, as shown in figures 4(a) and 4(b). apparently, retaining all of the nonzero components of the regularized solution will incur some artifacts in the final reconstruction image, in particular for l2 norm solution by tikhonov regularization method. the results in figures 4(c) and 4(d) show that the traditional gts directly discards those nodes with density value lower than the given threshold in the final results to improve the image quality. usually, a higher threshold is preferred in the literature, thus a threshold of 0.35max (si) was used in the experiments for gts method [16, 29 ]. as a result, those suspect targets with density lower than threshold will be omitted in this way. unlike traditional methods, the proposed msds considers not only density value of a node but also mesh structure used in reconstruction and thus it has an ability to remove pseudosources and retain weak suspect sources in the final reconstruction results, as shown in figures 4(e)-4(f) and 3. in the second experiment, we attempt to reconstruct sources with synthetic data generated from four scattered sources with different initial powers, which may be a common case in tumor metastasis. specifically, the power setup was according to ratio of 8 : 4 : 2 : 1 and the maximum power density was 1 nw / mm. figure 5 shows 3d views of the results of tikhonov regularization method and l1ls method, respectively, combined with gts and msds. obviously, it is hard for traditional gts method to detect multiple sources with lower power density in such experimental setting, whereas the proposed msds accurately distinguishes all of the sources. in view of the idea that the proposed multiple - source reconstruction approach utilizes underlying mesh structure information, it is necessary to assess the influence of different fem discretization on the proposed method. therefore, we conducted a set of double - source experiments under different discretization level. the results in figure 6 (where the number of nodes in reconstruction domain denotes different discretization level or mesh size) show the influence of finite element mesh on reconstruction. for tikhonov regularization method combined with msds, the location error increases slightly after a decrease along with the increasing of mesh size and the reconstructed power presents a similar variation trend. as for l1ls combined with msds, finite element discretization does affect reconstructed results in the sense that the location error and the reconstructed power vary with the change of mesh. however, for all of the discretization levels considered, the proposed method is able to accurately localize and quantify light source distribution. this set of blt experiments were conducted with a dual - modality blt / micro - ct system [17, 30 ]. a backthinned, backilluminated cooled ccd camera is used to measure the signal on the phantom surface from four directions at 90-degree intervals. the heterogeneous mouse chest phantom with 30 mm height and 15 mm diameter consists of four parts that represent muscle, lungs, heart, and bone, respectively. two small holes of diameter 2 mm were drilled in the phantom to place glass capillary with 1 mm inside diameter. luminescent solutions of height 2 mm were extracted from a red luminescent light stick (glow products, canada) and then injected to glass capillary to serve as one testing source. the real center positions of the two testing sources were (9,2, 16.6) and (9, 3,16.6). we collected 100 gray level images of the sources, which were taken by the ccd camera every one minute. figure 7 shows the fitted decay curve of light density. according to the decay curve, we can obtain sources with different intensities by controlling the injection time of luminescent solutions. three groups of experiments were conducted, and the ratios of the intensity of source s2 to that of s1 were 1 : 1, 2 : 1, and 4 : 1, respectively. figures 8(a)8(c) show the front views of the corresponding measured data on ccd under different intensity settings. subsequently, a permissible source region was roughly determined according to the surface flux density distribution, which is expressed as { (x, y, z) \| 8 < (x + y) < 13,15 < z < 18}. the phantom model was discretized into 4202 nodes and 21721 tetrahedra. after mapping the collected optical data on the three - dimensional phantom surface, we performed four rounds of reconstruction with tikhonov + gts, l1ls + gts, tikhonov + msds, and l1ls + msds under different source intensity settings. the normalized reconstruction results of tikhonov regularization method are similar to that of l1ls. to avoid interminable description, figure 9 only presents comparison results between tikhonov + gts and tikhonov + msds. for all of the testing cases considered in phantom experiments, tikhonov + msds and l1ls + msds can accurately detect two sources, and the maximum location error is 1.7 mm. even for the case of real intensity ratio 4 : 1, the reconstructed source strength ratios of them were 3.12 : 1 and 2.97 : 1. in stark contrast to the proposed methods, traditional global threshold methods failed to reconstruct the weaker of the two sources, as shown in figure 9(c). compared with the results of using gts (the top row of figure 9), the proposed msds methods produce fewer artifacts in the reconstructed images (the bottom row of figure 9) accurately reconstructing and distinguishing several sources with different intensities is a challenge problem in blt, which is also an essential ability for serial observation of disease progression or response to therapy in the same animal over time. in this work, we present a unified framework for multiple - source reconstruction by integrating a novel multiple - source detection strategy with regularization - based reconstruction process. the effectiveness of this regularization framework is validated with numerical simulations and further confirmed with phantom experiments. first, there is no need for a prior knowledge regarding source number, which is automatically estimated from the reconstruction results iteratively. second, the regularization framework is general since it can work with different regularizers and inverse algorithms. the proposed msds is also easily applied to other finite - element - based reconstruction schemes to improve the final reconstruction results or image quality. there are several limitations to the proposed method. as indicated in the experiment results, sparseness - inducing regularization method (l1ls) performs better than l2 norm method (tikhonov). this is mainly because l1 norm solution accords with the sparsity nature of bioluminescent source distribution in these applications. consequently, how to select appropriate regularizer and inverse algorithm for specific blt application is very important when using this framework. lp(0 < p < 1) norm regularized reconstruction has been tried for recovery of signals with weak sparsity in other image processing fields. so far, related researches have not yet been reported in blt. based on the proposed regularization framework, our future studies will investigate the effectiveness of other forms of regularizer for the ill - posed inverse problem of blt. although only the da model is considered for the sake of simplicity, the proposed blt reconstruction framework has no limitation on the forward model. the performance of our framework might be improved by using more accurate forward models, which is also the direction of our further work.	a finite element mesh aggregating approach is presented to reconstruct images of multiple internal bioluminescence sources. rather than assuming independence between mesh nodes, the proposed reconstruction strategy exploits spatial structure of nodes and aggregation feature of density distribution on the finite element mesh to adaptively determine the number of sources and to improve the quality of reconstructed images. with the proposed strategy integrated in the regularization - based reconstruction process, reconstruction algorithms need no a priori knowledge of source number ; even more importantly, they can automatically reconstruct multiple sources that differ greatly in density or power.
the advent of structural genomics initiatives has led to an increase in the number of protein 3d structures and hence there is a growing need for novel analysis tools (13). maintenance of the various analysis programs on changing computer platforms is becoming a problem for many users. the protein tools page at icgeb is a collection of locally developed methods designed to assist users in the analysis of 3d structures. therefore, they are particularly suited for online use and for large - scale data management. all the three servers described here were written as standard c programs with php front end and run on a beowulf type linux cluster. the servers accept the protein data bank (pdb) files (4), a description of the input / output options as well as the underlying theory is provided in the form of online help files. the cx server is a visualization tool designed to highlight protruding atoms within a protein structure. identification of protruding, or highly convex regions in proteins is relevant to the analysis of interfaces in protein protein complexes, in the prediction of limited proteolysis cleavage sites and in the identification of possible antigenic determinant regions. cx (13,5) calculates the ratio between the external volume and the volume occupied by the protein within a sphere centered at every protein atom. atoms in protruding regions will have a high ratio between the external and the internal volume, i.e. a high cx protrusion index. for protein structures only two independent parameters are used by cx : the average atomic volume and the sphere radius. the default value for the average atomic volume used by cx given the approximate nature of the method and its purposes, slight variations in the average atomic volume do not affect the results in a remarkable way. smaller values of r will make cx more sensitive to the local environment, whereas larger values will make it more sensitive to the global shape of the protein. the default radius used by cx (10) is a good compromise to highlight both backbone and side chain protruding atoms in most applications (figure 1a). the dpx server is designed to facilitate the analysis of buried atoms within the protein interior. parameters, such as the solvent accessible area (6) and the occluded surface, can not distinguish buried residues that are close to the protein surface from those that are deep inside the protein core. depth defined as the distance between a protein atom and the nearest water molecule surrounding the protein (7) was found to be a useful descriptor of the protein interior. depth correlates better than solvent accessibility not only with amide h / d exchange rates for several proteins, but also with the difference in the thermodynamic stability of proteins containing cavity - creating mutations and with the change in the free energy formation of protein protein complexes (8). we have developed the dpx index defined as the distance () of a non - hydrogen buried atom from its closest solvent accessible protein neighbor (9,10) where buried and accessible atoms are identified using the rolling sphere algorithm. although some information is lost for surface atoms (all solvent exposed atoms have dpx = 0 by default), the depth calculation is very fast because neither water molecules nor surface dots are explicitly considered. the only parameter that can be varied is the radius of the probe sphere, for which the default value is set to 1.4 (figure 1b). both cx and dpx read atom lines from a pdb file submitted by the user. non - standard residues, cofactors, metal ions and water molecules described in hetatm lines are not taken into account. each chain in the pdb file is treated as an independent molecule but the results are written into a single output file in the pdb format, in which the cx or dpx values are written in place of the atomic displacement parameters (b - factors). the output file can thus be displayed using molecular graphics programs [e.g. rasmol (11) and swiss - pdbviewer (12) ], and atoms colored according to their cx (or dpx) value. the pride server is designed to compare the fold (backbone conformation) of protein structures [for a review, see carugo and pongor (2) and the database issue 2005 of nucleic acids research for current references ]. pride is based on comparing distributions of intramolecular cc distances using a standard statistical process, contingency table analysis which gives a probability of identity or pride score (13). for the calculation, c(i + n) distance distributions (3 < n < 30) and the final pride score for two protein structures is the average calculated from the results of the 28 comparisons (0 pride 1). the calculation is extremely fast, so pairwise as well as multiple comparisons can be compared online. as pride is a metric, it can be used to cluster and classify protein 3d structures through standard cluster analysis methods. as the calculation is based only on the c atoms, the input files may contain only the c lines. its output contains not only the final pride score, but also the values it was derived from as well as a graphic representation of the underlying histograms. in case the pride cluster option is used to analyze n protein 3d structures (presented as concatenated pdb files), the server provides three, easily downloadable output files : (i) the n n square matrix where each i - thj - th element is the distance, defined as 1-pride, between the i - th and the j - th protein 3d structures ; (ii) the dendrogram that summarizes a cluster analysis performed using the neighbor program of the phylip software suite by applying the neighbor - joining criterion for cluster merging (figure 1) ; and (iii) a newick - format tree description that allows one to build its own dendrograms with the help of programs, such as njplot () and treeview (). in case the pride / scan option is used, the database search option of the server makes it possible to compare a 3d structure with the folds of the cath database (14). the search results are presented as a ranked list, and according to the statistical evaluation, in over 99.5 of the cases the most similar structure points to the correct topology group. the protein tools server. (a) title page [the sbase (15), fthom (16) and p450 (17) services have been described elsewhere ]. bottom : structure of the human histone lysine n - methyltransferase set7/9 complexed with a histone peptide and s - adenosyl - l - homocysteine (sah), pdb : 1o9s. the enzyme is shown as ribbons, the peptide as sticks and sah as a cpk model using ; the structure is colored according to the cx values, calculated using a sphere radius of 8. (d) output of the dpx server rendered with rasmol (5), the cpk model of the enzyme is shown in slab mode in the same orientation as in the left panel, and atoms colored according to their dpx values.	the www servers at are dedicated to the analysis of protein 3d structures submitted by the users as the protein data bank (pdb) files. cx computes an atomic protrusion index that makes it possible to highlight the protruding atoms within a protein 3d structure. dpx calculates a depth index for the buried atoms and makes it possible to analyze the distribution of buried residues. cx and dpx return pdb files containing the calculated indices that can then be visualized using standard programs, such as swiss - pdbviewer and rasmol. pride compares 3d structures using a fast algorithm based on the distribution of inter - atomic distances. the options include pairwise as well as multiple comparisons, and fold recognition based on searching the cath fold database.
for the last 30 years free flap reconstructive surgery has become routine, while basic principles of microsurgery have changed very little. the search for new techniques and modifications of already existing ones is gaining increasing attention. progress in flap designing and harvesting have improved the functional and aesthetic results, especially in head and neck reconstruction. surgical technique has shifted from simply obtaining flap survival and wound coverage, to better flap selection and more sophisticated reconstruction, due to the possibility of making the transfer of thinner flaps, flaps matching the recipient site s color and texture, and complex flaps for 3-dimmensional reconstructions. flap prefabrication is defined as implantation of separated vascular pedicle in a new territory, followed by a transfer of the flap neovascularized by this pedicle. these flaps are mainly used in head and neck reconstruction to achieve similar texture, shape, and color to those of recipient site ; however, prefabrication is usually reserved for individual cases in which conventional techniques are unreliable or unavailable. prefabrication is the process of making flaps to fulfill specific requirements by designing them with only required components in new vascular areas while minimizing donor site morbidity. instead of secondary corrections for a standard flap, vascular induction by implantation of a pedicle allows designing the flaps in discrete donor sites or in areas of skin excess. it is possible to establish new flaps with any desired components from anatomical regions that do not have defined axial vessels. prefabrication allows almost any tissue volume to be transferred to any specified recipient site, thus expanding the options of microsurgical reconstructions. autologous cartilage and bone are commonly used as a framework in reconstructive surgery. however, their disadvantages (e.g., limited availability and the morbidity and high risk of resorption) are quite serious. the advantages of microporous materials include decreased specific implantation weight and absence of capsular reaction. porous high - density polyethylene is an alloplastic material used by surgeons for over 50 years, and it has been shown to be well tolerated. it induces a minimal reaction when implanted into human tissues, and fibrovascular tissue not only anchors the implant but also imparts certain biological qualities to the implant, including the availability to support neoepithelialization and skin grafting. the main advantage of ptfe is the interweaving and ingrowth of loose connective tissue and vasculature. the inferior epigastric artery and vein were chosen as vascular carriers because of ease of dissection and sufficient diameter. in the first operation, after 8 weeks, each prefabricated complex was explored, resected, and macroscopically evaluated. the samples obtained for histopathologic study were fixed in 10% formaldehyde solution for 24 h. the tissues were routinely processed and embedded in paraffin blocks and 5-um - thick sections were obtained and evaluated microscopically (figure 3). the research protocol for this investigation all 20 prefabricated flaps survived and no serious surgical complications were observed. in 2 cases nearly 90% of the pores were invaded by soft tissue after 8 weeks. in some areas, the fibroneovascular tissue invading the pores had reached up to the outer surfaces of the implant. the inner parts of the implant were invaded with more mature and loose connective tissue compared with newly vascularized outer parts. inflammatory cells and active fibroblasts were present in some spots where the fibroneovascular tissue formation was taking place. flap prefabrication was used for the first time in 1971 by orticochea, who described vascular implantation in the retroauricular region for delayed nasal reconstruction. the introduction of a new blood supply into subcutaneous territory in an attempt to create new vascularized flaps was first described by washio, who implanted a section of pedicled dog intestine into the abdominal skin. those experimental studies were based on the theory that thin skin flaps can be created based on implanted vascular pedicles. voy reported an application of proplast ii for framework for prefabricated flaps, covering the implant with omentum and a skin graft. this pioneering research stimulated many investigators to consider the possibility of creating custom - designed donor sites by implantation of a nourishing vascular pedicle in the target tissues prior to harvest. this vascular carrier could be mesenteric vascular pedicle, vascular bundle, or musculovascular pedicle. based on the same concept, morrison prefabricated a thin axial - pattern skin flap in a rabbit model by implanting the femoral artery and vein directly into subdermal layers of skin. this research suggested that vascular implantation provokes an extensive outgrowth of new vessels from the implanted artery and vein, and that a neovascularization process begins within a few days of implantation and progresses rapidly by 8 to 12 weeks. without doubt, the ideal approach in reconstruction of the 3-dimensional structures of the face is the use of autogenous tissue. for this purpose, while providing inner lining with different tissues, a framework was usually formed by cartilage and bone to support these tissues. however, the difficulty of shaping autogenous tissues, the limited amount of donor - site tissues, and donor - site morbidity limit their use as a framework. for this reason, the use of alloplastic materials that can be shaped in detail 3-dimensionally and that are safer because they do not show resorption or deformation is becoming more popular. porous materials, like polytetrafluoroethylene, are invaded by a fibroneovascular tissue and become a single unit with vascular bed and tissues after they are implanted. because the instability and infection that are the most important risk factors for implant exposition are decreased, these materials are safer than nonporous ones. for reconstruction of 3-dimensional defects, in particular on the face, the most popular alloplastic material is high - density porous polyethylene. the most important factors that reduce the long - term biocompatibility of alloplastic materials are the presence of a chronic inflammation and the instability of the implant. even a subacute inflammation may cause detachment of the fibrovascular capsule from the implant surface and therefore trigger the chain of events that results in implant exposure and extrusion. prefabricated flaps are a useful tool for the reconstructive surgeon because of specific preferred tissue composite, regardless of their native vascular origin, can be transferred as free or pedicled flaps, donor - site morbidity is reduced, and the functional outcome for patients may by more satisfactory. based on the results of our study, we believe that the use of high - density porous polyethylene in flap prefabrication may be a good option for reconstruction of 3-dimensional defects, especially in patients with limited donor tissues.	backgroundthe search for new surgical flap techniques and modifications of already existing ones is gaining increasing popularity. progress in flap designing and harvesting have improved the functional and aesthetic results, especially in head and neck reconstruction.material/methodsten pigs were used in this study. in the first operation, high - density porous polyethylene prefabrication was performed bilaterally in all pigs. after 8 weeks, each prefabricated complex was explored, resected, and macroscopically evaluated.resultsall of 20 prefabricated flaps survived. no serious surgical complications were observed. in 2 cases there was chronic inflammation and in 4 cases there was instability of the implant.conclusionsafter this experimental study, we believe that the use of high - density porous polyethylene in flap prefabrication may be a good option for reconstruction of 3-dimensional defects, especially in patients with limited donor tissues.
in bisexual organisms with chromosomal sex determination, sex - linked genes occur in different dosages in the two sexes, and this dosage difference in genes not directly related to sex determination is compensated by a variety mechanisms, such as deactivation of one of x chromosomes in mammalian females (lyon 1988 ; straub and becker 2007) or higher expression of x - linked genes in drosophila males (baker. gene - specific data indicate that autosomal dosage compensation may be a common phenomenon in drosophila and that it is likely to occur on the transcriptional level (devlin. broader evidence that a broad spectrum of autosomal genes are under transcriptional regulation compensating for aneuploidy comes from transcriptome analysis of trisomies (fitzpatrick. 2002) and cancer - associated aneuploidies (tsafrir. 2006 ; williams. 2008) in human and mice and a variety of aneuploid genotypes in yeast (torres. although transcriptional level, as detected by microarrays, generally followed the dna dosage trend in these studies, two important trends became apparent : at least some genes in aneuploid regions are, in fact, transcribed at a nearly normal diploid level and many misregulated genes are not located in aneuploid regions (fitzpatrick. in contrast to mammalian and yeast data, two recent studies (gupta. 2009) indicated that autosomal dosage compensation is a rule rather than exception in drosophila (see below). if autosomal transcriptional dosage compensation is indeed common in at least some organisms, three important questions can be asked. first, do these mechanisms act on gene - specific level or on the level of larger chromosomal segments ? second, are these mechanisms capable of fine - tuned regulation of transcription level compensating for both deficiencies and duplications or do they operate on a more coarse scale, that is, assuring that genes with high - demand products are expressed at a sufficiently high level ? finally, can autosomal dosage compensation be the fundamental basis of dominance ? there are two aspects of dominance that require explanation : 1) why do most genes exhibit complete dominance of one of the alleles rather than additivity of the action of two alleles (i.e., why is codominance a relatively rare phenomenon), and 2) why is it the wild - type allele that is usually dominant. possible explanation of these factors has been the subject of perhaps the fiercest debate between the founding fathers of modern synthesis. fisher (1928) proposed that dominance of the wild - type alleles is the result of selection on modifier genes, which epistatically mask the action of the mutant allele in a heterozygote. by necessity such evolution this idea was met with criticism by cofounders of the modern synthesis (wright 1934 ; haldane 1939). instead, wright suggested that dominance is an inherent property of the physiological systems, perhaps evolved through selection to provide a safety margin in the action of a single functional copy of a gene, which would allow to accommodate for environmental fluctuations and for the lack of activity of the other gene. such selection would act on the entire population, not on heterozygotes only, and is therefore much more powerful. a variety of studies during last 30 years provided strong evidence in favor of the physiological theory of dominance. in particular, the metabolic control theory (kacser and burns 1981) implies that enzymes functioning in metabolic pathways are bound to exhibit a diminishing return relationship between activity of an individual enzyme and the flux of metabolites through the whole pathway, which ultimately determines the phenotype. thus, 2-fold change in protein titer (as in a heterozygote for a loss - of - function mutation) is usually negligible in terms of the resulting phenotype. this idea was supported by negative correlation between the strength of a mutant allele and its dominance (charlesworth 1979 ; crow 1979 ; crow and simmons 1983 ; phadnis and fry 2005). further support to the physiological dominance theory came from the observation that dominance is prevalent in organisms, which spend much of their life cycle in haploid phase, such as in chlamydomonas (orr 1991) or fission yeast (baek. finally, loss - of - function mutations are more likely to be fully recessive in enzyme - coding genes than in genes coding for structural or regulatory proteins (fisher and scambler 1994 ; veitia 2002 ; kondrashov and koonin 2004) and for proteins that are less likely to form protein complexes (papp. the physiological mechanisms behind dosage compensations are thought to be acting primarily on the protein level. on the other hand, dosage compensation may as well occur at the lever of transcription, resulting in a mechanism of dominance independent from the protein function. eukaryotic transcriptional machinery is equipped with a stunning variety of mechanisms enabling fine - tuned regulation of transcription (lee. such mechanisms often incorporate negative feedbacks allowing adjustment of transcription level to match the environmental fluctuations or tissue - specific developmental needs ; these feedbacks may as well provide compensation for a loss - of - function mutation in one of the alleles. on the other hand, one can hypothesize that, in many genes, the regulation of gene expression may be a lot less sophisticated and lacking fine - tuned gene - specific homeostasis mechanisms. in fact, the number of transcription factors present in the genome is constrained by the limits set by coding theory : unlimited increase of the number of transcription factors capable of recognizing specific nucleotide sequences would lead to the increase of misrecognition errors (itzkovitz., there may be genes coding for high demand proteins, which are constitutively transcribed at a high rate, and genes coding for low demand proteins, whose transcription is maintained at low level. if this is true, one would expect that transcriptional dosage compensation to be widespread and to correlate with the overall gene expression level. indeed, the pervasive nature of autosomal transcriptional compensation has been recently demonstrated in drosophila (gupta. 2009) report that the degree of compensation is different in genes with different degree of tissue specificity of expression : ubiquitously expressed genes are stronger compensated for deficiencies and less effectively for a duplication than tissue - specific ones. (2009) also suggest that there is no correlation between the degree of compensation and overall expression level. here, we test these results using three sets of drosophila genes. we measured the level of gene expression in two isogenic deletional lines using oligonucleotide microarrays and compared our results with published data on transcriptional compensation in heterozygotes for a duplication (gupta. two drosdel (ryder. 2007) drosophila melanogaster isogenic lines, df(3l)ed4475 and df(3l)ed4543, heterozygous for long deletions on 3l chromosomal branch both maintained against the tm6c balancer, were used for microarray experiment. twenty - five adult flies 25 days after eclosion were frozen in liquid nitrogen and used for rna extraction by trizol method (invitrogen) in 12 replicates from each line. samples were reverse transcribed, labeled, and hybridized to two - color 14k oligonucleotide microarrays by canadian drosophila microarray centre (missassauga, ontario, canada ; neal. the two lines, which serve as controls for each other, were alternated between cy3 and cy5 dyes to minimize possible channel bias. fluorescence intensity data (background intensity subtracted) were analyzed by jmp genomics 3.0 (sas institute 2007). the data are available at gene expression omnibus (geo) (edgar. data were anova - normalized to eliminate the effects of arrays and channels, mean intensity of fluorescence for hemizygous and diploid line calculated for each gene and the ratio of the intensity in the line with the deletion to that in the control line (r) analyzed. for a comparison with gupta. (2006), in which raw data are available and to avoid possible expression level - dependent bias in expression ratios, the correlation between expression ratio and mean expression level was also analyzed without any normalization ; the results are virtually identical. line ed4475 had slightly but statistically significantly higher fluorescence across the genome (ed4475 : ed4543 = 1.017 for diploid genes), and therefore, the ratio was adjusted by this factor. this adjustment had no effect on any of the findings reported. presence or absence of expression for each gene was evaluated by comparison of average fluorescence across all arrays with the internal blank (autoblank) intensities and genes with intensities significantly (p 0.69 ; f = 0.48, p > 0.87, and f = 1.06, p > 0.4034 for this study, gupta. there was, as predicted, a positive correlation between expression ratio (log2r) and overall expression level (log2 m). for heterozygotes, for deletions, 4a ; log2r = 0.77 + 0.077 log2 m ; p < 0.007 ; p < 0.02 with the uppermost outlier point removed) suggests that genes with barely detectable expression are nearly noncompensated (log2r = 1), whereas genes with highest observed expression level approach full compensation (log2r = 0). for heterozygotes, for a duplication versus diploid wild type, the regression (fig. 4b ; log2r = 0.77 + 0.14 log2 m ; p < 0.0001) suggests that there is a nearly complete compensation of low expression genes (log2r = 0), whereas highly expressed genes demonstrate little dosage compensation (log2r = log2(1.5) = 0.58). the regression of expression ratio in heterozygotes for a duplication to that is heterozygotes for a deletion (3-fold dosage difference) over overall expression level is also positive (fig. 4b ; log2r = 1.41 + 0.25 log2 m ; p < 0.0008). the corresponding regression for genes outside of the aberrations is nearly horizontal for both data sets, suggesting that the observed correlations are not a product of a bias in the expression data. it should be noted that this result is identical for both normalized and nonnormalized data. the observed correlations are also not artifacts of data fanning. for example, for deletions, expression ratios for genes with lower expression are expected tend to be located below the log2r = 0 line simply for the reason of being underexpressed in hemizygous state, whereas expression ratios for highly expressed genes, if not affected by mean expression, would be expected to cluster around log2r = 1, not log2r = 0 as are points corresponding to diploid genes. correlation between logarithm of mean expression level and logarithm of aberration : wild type expression ratio. (a) : this study (red circles : deletion : wild type). (2006) data (orange circles : duplication : wild type ; green circles : duplication : deletion). small circles are control (diploid) genes on both a and b. log2r = 0 corresponds to full dosage compensation. figure 5 shows the relationship between the degree of tissue specificity of expression and degree of compensation in two deletions in this study (a) and in a duplication (gupta. 2009), ubiquitously expressed genes are less strongly compensated than tissue - specific genes (p < 0.003), but in the other deletion, ed4542, the difference is not significant. likewise, for the duplication, transcriptional compensation of ubiquitously expressed genes is weaker than that of tissue - specific genes, in a reversal of the pattern observed on figure 3b in stenberg. strength of transcriptional compensation in tissue - specific and ubiquitously expressed genes in two deletions (a, this study) and in a duplication (b, gupta. 2006). our data confirm the recently observed phenomenon of widespread transcriptional compensation of genes located in haploid and triploid areas in drosophila lines with chromosomal aberrations, in a striking contrast to data recently reported in mammals (williams. this conclusion is based on the comparison of aberration : wild type expression ratios to diploid expression ratios and is, therefore, dependent on the assumption that chromosomal aberrations as such have no effect on the expression of diploid genes. with that caveat in mind, we also demonstrate that the degree of such compensation does not depend on the molecular function of the coded protein. (2009) reported that aberration : wild type expression ratios are distributed normally, indicating a universal (or at least chromosome wide or segment wide) rather than gene - specific compensatory mechanism. here we demonstrate that for in both deletions studied the distribution of deletion : wild type ratios was significantly deviant from normal, with a strong suggestion of a shoulder around log2r = 1, which suggest that some genes are stronger compensated than others, perhaps through the action of at least some gene - specific regulatory mechanisms. on the other hand, higher level of transcriptional compensation in tissue - specific genes than in ubiquitously expressed genes (see below) was observed for one deletion but not for the other, suggesting that some chromosomal segment - specific regulation may be taking place. (2009), we observe a correlation between the degree of compensation and the overall expression level of a gene. genes with higher expression level are more likely to be compensated for a deletion but less likely to be compensated for a duplication. a positive correlation between transcriptional compensation of a deletion and overall expression level (fig. 4a) can be explained by the existence of genes, which are constantly expressed at the highest possible level, limited by gene - unspecific factor such as the availability of rna polymerase complexes or individual transcription factors. however, this explanation is incompatible with the observed positive correlation between compensation for duplication and expression level (fig. 4b) : transcriptional limitation of highly expressed genes would result in this correlation having a negative not positive sign. we hypothesize that this finding indicates that highly expressed genes are equipped with a regulatory feedback mechanism more efficient in preventing underexpression than in preventing overexpression. in contrast, genes with low overall expression are more efficiently regulated to prevent overexpression in case of an overdose than to prevent underexpression in case of half the normal dosage. we hypothesize that the relationship between the degree of transcriptional dosage compensation and overall gene expression may be widespread. although stenberg. (2009) reported such relationship for only 1 comparison out of 4, a careful examination of their figure s4a, suggests that at least one other comparison may be approaching significance, demonstrating the same pattern we observed in this study : highly expressed genes are strongly compensated for the deficiency, perhaps with a hint of a nonmonotonic relationship (see also fig. (2009) did not observe this correlation, despite using very similar deletion lines, is that in this study we used a more stringent criterion to exclude genes with expression rate near or below detection level (and, therefore, meaningless expression ratios) by excluding genes with transcript signal not statistically different from the autoblank signal across arrays. (2009) study, an arbitrary cutoff was used, possibly leaving in some genes with low signal - to - noise ratio. this would account both for the lack of a significant correlation with the expression level and for the apparent nonmonotonic relationship between expression ratio in deficiencies and expression level (fig. 4a and c in stenberg. (2009) that ubiquitous genes are less effectively compensated for the dosage deficiency. the fact that this relationship is observed in one deletion but not the other, corroborates stenberg. (2009) idea that such compensatory mechanisms may be chromosome region specific or chromosomal region specific. observe that the correlation with gene expression level is not confounded with this result : ubiquitously expressed genes tend to have a higher expression level (simply due to the way they are defined for this analysis), so if the correlations with expression level were artifacts of confounding with the ubiquitousness of gene expression, it would have been expected to the opposite of what is actually observed. (2009) suggest that transcription of ubiquitously expressed genes tend to be limited by copy number. although consistent with the patterns observed for deletions in this study and by stenberg. (2009), this explanation is inconsistent with higher degree of compensation of ubiquitously expressed genes : if these genes were universally copy number limited, one would expect the transcription level to be directly proportional to the number of copies of the gene. rather, we hypothesize that the observed patterns can be explained by the existence of a continuum of genes with respect to most general types of regulatory mechanisms, genes on one end of the distribution being compensated more efficiently for underexpression than for overexpression and with the pattern reversed on the opposite end of the continuum. the former types of genes tend to : 1) have high overall expression or be expressed in a tissue - specific manner, 2) demonstrate a stronger dosage compensation for a deficiency, and 3) demonstrate little dosage compensation for duplication. genes of the second type tend to have low overall expression or be expressed ubiquitously, demonstrate little compensation for deficiency and greater compensation for duplication. at present it is impossible to differentiate between two possibilities : 1) highly expressed genes are equipped with a regulatory mechanism more efficiently preventing underexpression in order to maintain the required high level of expression and 2) a regulatory mechanism more efficient in preventing underexpression than overexpression causes the cognate gene to have a higher than average baseline expression level. one consideration speaks in favor of the former hypothesis : highly expressed genes are known to evolve slower (pl. 2001 ; drummond and wilke 2008), which indicates that essential or household genes are overrepresented among genes with high expression level. one might speculate that household genes are more likely than nonessential genes to evolve a regulatory mechanism maintaining a necessary minimal level of transcription but more permitting of overexpression. likewise, it remains unknown whether the observed compensation patterns are a manifestation of some generalregulatory mechanisms (whether gene - specific or chromosome - wide) capable of detecting copy number imbalance and predating the individual aberrations, or the result of a recent and fast adaptation to compensate for the aberration, which occurred in these particular lines since the introduction of the chromosomal abnormality. some of the lines used in these studies (such as df(2l)jh in gupta. 2006 ; stenberg. 2009) are fairly old and had an ample opportunity to evolve ; others, as drosdel lines in stenberg. (2009) and this study are younger but have also been maintained in a balanced hemizygous state for some time. one observation, namely the comparison of expression rate in heterozygotes for a duplication to that in heterozygotes for a deletion in gupta. if transcriptional compensation of genes in deletion df(2l)jh is characterized by the same patters observed deletions in our experiment, then the expected correlation between expression ratio duplication : deletion and overall gene expression should be negative. yet, this regression has a positive slope, in fact, higher than the regression of duplication : wild type ratios. either the pattern observed in our data is region or chromosome specific, or the deletion df(2l)jh (which contains only 59 genes) happens to be enriched with genes fully compensated despite their low expression level. high degree of transcriptional compensation in heterozygotes for a deletion suggests that recessivity of most loss - of - function mutations in drosophila can be explained by transcriptional compensation. this implies that relatively rare dominant mutant alleles either are not compensated at transcription or are gain - of - function mutations. there are only three genes with known dominant mutant alleles located within studied deletions (dichaete, frizzled, and breathless), and none of them show detectable expression, so we can not test the hypothesis that these genes are less likely to be compensated than genes with fully recessive mutations. it might be noted, however, that the line ed4543, which is hemizygous for dichaete, does not exhibit the dominant phenotype of classic dichaete alleles (extended and elevated wings), indicating that the classic alleles may be of gain - of - function type. we hypothesize that dominance of the wild - type allele caused by transcription - level compensation is a by - product of the regulatory mechanisms whose purpose is to maintain the expression level to meet changing environmental or developmental conditions rather than a direct result of selection to compensate for mutant alleles. this hypothesis is consistent with the theoretical prediction that selection to compensate for mutations is weak, whereas selection to maintain the optimal gene expression is strong (hurst and randerson 2000) and with the observation that mammalian genes possess abundant variation for such optimization (rockman and wray 2002). it is also consistent with the increased frequency of codominance of deleterious alleles observed in genes whose products are involved in protein protein interactions (papp. such interactions require a balance between expression levels of all genes in a group of interacting genes, which imposes constraints on the evolution of regulation of individual genes, resulting in lower opportunity for transcriptional compensation. because highly expressed genes demonstrate a more complete compensation for deletions, we predict that transcriptional compensation - based dominance of the wild - type alleles should be more common in highly expressed genes, whereas dominant mutations are more likely in genes with low overall expression. moreover, we can hypothesize that transcriptional - level dominance can be of two types : in genes with high expression loss - of - function mutations are compensated at transcription, whereas in genes with low expression high levels of gene products are simply not necessary, that is, haploinsufficiency is unlikely. we also found that, unlike compensation on the protein level, transcriptional compensation appears to be independent of protein function. we do not see any evidence of greater transcriptional compensation of enzyme - coding genes than regulatory genes coding for transcription factors and nucleic acid - binding proteins. it is hard to imagine that all genes for transcription factors are regulated at transcription, because it implies an endless pyramid of transcription factors for transcription factors and leads to low fidelity of regulation (itzkovitz. in addition, not every transcription regulation mechanism will automatically compensate for mutant alleles. for this to occur, the regulatory mechanism must be based on a negative feedback detecting abundance or activity or of the gene product. positive regulatory mechanisms, for example those, which detect a particular environmental variable, independent from the gene product will not result in transcriptional compensation of mutations. it should be therefore possible to test the hypothesis that transcriptional compensation is a by - product of evolution of negative feedback regulation of transcription by measuring transcription level in genes known to respond to environmental cues and in genes known to respond to abundance or activity of their own products. we predict that the first group will demonstrate lower transcriptional compensation of mutations than the second one.	little is known about dosage compensation in autosomal genes. transcription - level compensation of deletions and other loss - of - function mutations may be a mechanism of dominance of wild - type alleles, a ubiquitous phenomenon whose nature has been a subject of a long debate. we measured gene expression in two isogenic drosophila lines heterozygous for long deletions and compared our results with previously published gene expression data in a line heterozygous for a long duplication. we find that a majority of genes are at least partially compensated at transcription, both for -fold dosage (in heterozygotes for deletions) and for 1.5-fold dosage (in heterozygotes for a duplication). the degree of compensation does not vary among functional classes of genes. compensation for deletions is stronger for highly expressed genes. in contrast, the degree of compensation for duplications is stronger for weakly expressed genes. thus, partial transcriptional compensation appears to be based on regulatory mechanisms that insure high transcription levels of some genes and low transcription levels of other genes, instead of precise maintenance of a particular homeostatic expression level. given the ubiquity of transcriptional compensation, dominance of wild - type alleles may be at least partially caused by of the regulation at transcription level.
dendritic cells (dcs) have been found to be the pivotal antigen presenting cells (apcs) in regulation of immune response. activation through the t cell receptor in the absence of costimulation is proposed to render responder t cells anergic or tolerant. the costimulatory signal is delivered through interactions between the t cells and apcs and results from ligation of molecules such as cd28 and cd154 (cd40l), expressed on the t cells with their ligands cd80/cd86 and cd40 respectively, on apcs. co - stimulation blockade targeting cd80/cd86 on dcs efficiently prevents acute heart or kidney rejection in many mouse and rat models [37 ]. first clinical trial has been conducted to assess co - stimulation blockade strategy in renal transplantation. it may allow patients to avoid the adverse effects of calcineurin inhibitors, whilst providing equally effective immunosuppression. there are direct and indirect pathways of allorecognition, and both of which have been postulated to have roles in allograft immunity. direct alloantigen (ag) presentation, mediated by donor apcs, leads to vigorous t cell proliferation and is mainly involved in acute rejection. as then recipient dcs that can infiltrate to the graft become the predominant apcs, and they present alloag indirectly to t cells. however, more data showed that indirect recognition might play a more important role in whole allograft rejection [1214 ] and indirect recognition also can initiate rapid skin graft rejection. in addition, dcs can not be obtained from deceased donors ; so recipient dcs would potentially be taken into account in clinical transplantation. rna interference (rnai) is a recently identified phenomenon in which small interference rna (sirna) interacts with mrna containing homologous sequences, and ultimately this interaction results in degradation of the target mrna. hill. reported that transfection of dcs with sirna specific for il-12 p35 gene resulted in potent suppression of gene expression and blockade of bioactive il-12 p70 production. based on the attractive methodology of rnai for silencing a particular gene expression, we used lentivirus mediated rnai to suppress cd80 and cd86 expression on host dcs. endoplasmic reticulum is the organelle in which newly synthesized secretory and transmembrane proteins form their proper tertiary structure by posttranslational modification, folding, and oligomerization. however, many of these proteins are unfolded or misfolded by extracellular or intracellular stimuli. eukaryotic cells possess several mechanisms to adapt to endoplasmic reticulum stress (ers) and thereby survive. if the cells are exposed to prolonged or strong ers, the cells are destroyed by apoptosis. recent evidence indicates that ers signaling pathways play an important role in the pathogenesis of neurodegenerative disorders and diabetes. increasing evidences suggest ers is involved in allograft injury. at present, it is not known whether ers is involved in peripheral tolerance. in this study, we detected that these dcs - pulsed alloag could elicit lower proliferative responses and prolong heart allograft survival. for the first time, our study demonstrates that ers - mediated apoptosis signal pathway is involved in t cell apoptosis after indirect recognition pathway blockade. c3h / hej (c3h ; h-2k), c57bl/6 (b6 ; h-2k), and balb / c (h-2k) mice were purchased from shanghai laboratory animal center of chinese academy of sciences (shanghai, china) and were maintained in pathogen - free facility at fudan university (shanghai, china). animals were fed with standard chow ad libitum and were used at 79 weeks of age. briefly, the bm cells were removed from femurs and tibias of c3h mice and depleted of erythrocytes by hypotonic lysis. the cells were cultured in 24-well plates (110/well) in 1 ml rpmi 1640 (gibco, gaithersburg, md) supplemented with 10% v / v fetal bovine serum (fbs) and 10 ng / ml recombinant gm - csf (r&d systems, minneapolis, mn). after 6 days of culture, 1 g / ml lps (sigma, st. louis, mo) was added to the culture for 18 hours to allow for maturation. the purity of dc preparations was routinely monitored by flow cytometric analysis using anti - cd11c monoclonal antibody (mab) (ebioscience, san diego, ca). the recombinant lentivirus was constructed as previously described, with some modifications. in brief, short hairpin rna (shrna) fragments (table 1) were hybridized with synthesized sense and antisense oligonucleotides. the hybridized cd80 shrna fragment was cloned into the plasmid pgcl - gfp (figure 1). the 293 t cells were cotransduced with 20 g of pgcl - gfp, 15 g of phelper1.0, and 10 g of phelper2.0 by 100 l of lipofectamine 2000 (invitrogen, garlsbad, ca). the titers of cd80 lenti were determined with a green fluorescent protein (gfp) assay. nc lenti contained scrambled shrna fragment, an irrelevant shrna with random nucleotides, and a gc ratio close to above - mentioned shrna. lentivirus transduction was conducted when dcs were 30%50% confluent, lentivirus was added at different mois in serum - free medium at 37c in 5% humidified co2. after 4 hours, complete medium was added to the cells, and there was complete replacement of medium after 48 hours. then, 4 days post transduction, marker gene expression was examined using fluorescent microscopy. on day 6 of dcs culture, allogeneic splenocyte lysates were added to the culture at a dc : splenocyte equivalent ratio of 1 : 10 for 18 hours at 37c in 5% humidified co2. b6 splenocyte lysates were obtained by six cycles of freeze / thaw exposure in pbs. grafts were harvested, minced, and homogenized with 5% collagenase type ii (worthington, lakewood, nj) for 30 minutes at 37c. lymphocytes were purified by lymphocyte separation medium (mediatech, herndon, va) and then subjected to flow cytometry. expression of cell surface ag was detected on a facscan (bd biosciences, san jose, ca) and analyzed using cellquest software (bd biosciences). cells were stained with the following mab : pe - iak, pe - cd40, pe - cd80, pe - cd86 (ebioscience), and fitc - cd3 (bd biosciences). apoptosis was assessed by pe - annexin v staining (bd biosciences). for primary mlr, nylon wool - eluted spleen t cells (210) from c3h mice were used as responders. -irradiated (20 gy) isolated splenic t cells from dcs - injected c3h mice were responders and restimulated with -irradiated b6, c3h, balb / c ag - pulsed c3h - derived dcs. cultures were maintained in complete medium for 3 days at 37c in 5% humidified co2. [h]-tdr (0.5 ci / well) was added for the final 18 hours of culture. cells were harvested onto glass fiber disks using an automated system, and incorporation of [h]-tdr into dna was assessed by wallac 1450 liquid scintillation counter (perkinelmer, boston, ma). cervical vascularized heart transplantation was performed from b6 donors to size - matched c3h recipients using a cuff technique. rejection was defined as total cessation of cardiac contraction. to assess the effect of equipped dcs on allograft survival, animals received 210 cells administered intravenously through the lateral tail vein 7 days prior to heart transplantation in the absence of immunosuppression. total rna of splenic t cells was extracted using trizol reagent according to the manufacturer 's instructions (invitrogen). rna was then reverse - transcribed into cdna, using random primers and superscript ii reverse transcriptase (invitrogen). for semiquantitative rt - pcr statistical analysis was performed with stata 8.0 software (stata, college station, tx). statistical comparisons between groups were preformed using a one - way anova followed by a scheff 's test, as appropriate. graft survival between groups of transplanted animals was compared using the log - rank test for comparison of survival curves. to determine the lentiviral transduction efficiency in dcs, gfp expression was examined by microscopy and flow cytometry at different mois on day 4 after transduction. lentivirus demonstrated a high (79.8% 5.0%) transduction efficiency in dcs at moi of 20 (figure 2). the percentage of gfp - expressing cells remained minor changes when moi is > 20. therefore, in the following experiments all viral titers were at moi of 20. to blockade both cd80 and cd86 expression, dcs as measured by flow cytometry, we found that cd80 lenti and cd86 lenti together could enhance suppressive effect on cd80 and cd86 expression (figure 3(a)). but as to those transduced dcs lps failed to bring great changes of the cd80 and cd86 expression. on the other hand, cd80 lenti and cd86 lenti had no effect on expression of unrelated proteins (such as mhc - ii and cd40) (figure 3(b)). our study indicates that recombinant lentivirus can provide highly efficient and specific cd80 and cd86 knockdown in dcs. to explore the influence of these dcs on t cell response cd80 lenti and cd86 lenti - transduced dcs were poor stimulators of t cells compared to nc lenti - transduced dcs or no treated dcs (figure 4(a)). as shown in figure 4(b), t cells from c3h mice primed by injection of cd80 lenti and cd86 lenti - transduced dcs exhibited marked reduced responses to alloag (b6) versus to third party unrelated ag (balb / c) pulsed c3h - derived dcs. in contrast, t cells from c3h mice primed by injection of nc lenti - transduced or no treated dcs exhibited markedly increased proliferative responses to donor alloag and third party ag - pulsed c3h - derived dcs. however, t cells from c3h mice primed by injection of various dcs all exhibited significant low proliferative response to syngeneic ag (c3h) pulsed dcs. to investigate the therapeutic potential of these equipped dcs in murine cardiac transplant model, recipient mice (c3h) were pretreated with 210 dcs in nc lenti group, or cd80 lenti and cd86 lenti group, 7 days before heterotopic heart transplantation from b6 to c3h. median survival time (mst) in the control group was 9.3 days, while nc lenti - transduced dcs pretreatment accelerated heart allograft rejection (mst 6 days compared to control group). pretreatment with cd80 lenti and cd86 lenti - transduced dcs significantly prolonged the mst to 21.8 days but had no effect on pulsing third party ag (mst 7.5 days). these findings suggest that infusion of cd80 lenti and cd86 lenti - transduced dcs - pulsed alloag prior to transplantation prolongs heart allograft survival, and the prolongation is ag specific (figure 5). the most striking finding from the current study was the possible mechanism of equipped dcs prolonging graft survival. lymphocytes were isolated from spleens, mesenteric lymph nodes, and grafts and were assessed by annexin v staining. apoptotic cell in cd3 + t cell population from mice receiving cd80 lenti and cd86 lenti - transduced dcs was markedly higher than the t cells in nc lenti group (figure 6). to better characterize the mechanism of t cell apoptosis after costimulatory blockade, we used rt - pcr to analyze a number of apoptosis signaling pathway molecules in recipient spleens. as shown in figure 7, a striking upregulation of bax and grp78 was found in recipients treated with cd80 lenti and cd86 lenti - transduced dcs compared to nc lenti - transduced dcs or pbs. these changes in endoplasmic reticulum and mitochondrial pathway were enhanced by upregulation of chop and suppression of bcl - xl expression in these cells. the success of organ transplantation depends on the continuous administration of nonspecific immunosuppressive agents, immunosuppression therapies present risks for opportunistic infection, malignancy, and a variety of agent side effects. in particular, several dc - based therapies in blocking the costimulation pathways have achieved encouraging results [38 ]. however, antibodies or fusion proteins have a limited half - life and require multiple antibody treatments. our previous studies have indicated that chemically synthesized sirna can specifically and effectively knock down cd80 and cd86 gene expression in bm - derived dcs. then we choose recombinant lentiviruses that contain stem - loop constructs encoding that hairpin rnas lend to the intracellular generation of sirna - like species. lentivirus can infect noncycling and postmitotic cells ; reverse transcribed dna sequences can subsequently integrate into the genome of target cells and are stably expressed at high levels for extended times. our data clearly demonstrate that lentivirus transduced dcs induce t cell hyporesponsiveness and t cells primed by alloag - pulsed dcs later inhibit allogeneic responses, in an ag - specific manner. the findings are similar with taner. who showed that t cells cross - primed by alloag - pulsed, rapamycin treated dcs were hyporesponsive to subsequent challenge. recipient dcs can acquire intact mhc molecules from donor cells or tissues and stimulate direct antidonor alloimmune responses.. showed that mhc - ii/cd4 + recipients could reject cd80/cd86/ cardiac grafts as rapidly as wild - type grafts. the observed acute graft rejection may have been due to the direct activation of recipient t cells by recipient apcs after acquiring intact donor mhc molecules. the cd80/cd86-cd28 pathway is probably the most important and best characterized in t cell activation ; we have shown herein that blockade of cd80 and cd86 by lentivirus mediated rnai increases cardiac allograft survival but does not extend it indefinitely. since co - stimulation blockade is less effective in memory t cells than in naive t cells, memory t cells may also play an active role. several groups have addressed whether one or multiple injections will achieve a more significant effect. the mechanism by which lentivirus transduced dcs prolong heart allograft survival remains to be determined. the key requirement for long - term survival is that none of the activated effector t cells survives in a functional state. these include death receptor pathway, mitochondrial pathway and most recently described the endoplasmic reticulum pathway. the first pathway occurs in repetitively stimulated t cells and is largely mediated through fas and through related members of the tnf - receptor family. bcl-2 family proteins control the release of cytochrome c and apoptosis - inducing factor from mitochondria. sen 's group has found that alloreactive t cell apoptosis is induced via fas / fasl pathway in cardiac allograft [35, 36 ].. showed that the peripheral deletion of donor - reactive t cells in the early period after bm transplantation with costimulatory blockade using anti - cd154 and ctla4ig was mediated in part by fas and could be overcome by the constitutive expression of bcl - xl. under ers, unfolded proteins accumulate in the lumen of the endoplasmic reticulum, and then cells activate a self - protective mechanism by activation of genes encoding endoplasmic reticulum - resident chaperones such as bip / grp78 and grp94. if these adaptive responses are not sufficient to relieve cells from ers, cells undergo apoptosis associated with several molecules, including chop, caspase-12, and map kinase cascade. several investigators have reported that ers is involved in b cell differentiation and the innate immune response. ers response influences ischemia - reperfusion in human liver transplantation, while the endoplasmic reticulum pathway - mediated apoptosis in t cells of the immune system has not been studied. first we observed that, in recipient spleens, grp78 and chop were much higher in recombinant lentivirus group. phagocytosis of apoptotic cells by macrophages often leads to the production of il-10 and tgf and may promote tolerance. nevertheless, it is conceivable that apoptosis of activated t cells not only reduces the mass of t cells but also promotes active immune regulation that is essential for long - lasting tolerance. in summary, rnai - treated, alloag - pulsed host dcs can induce ag - specific t cell hyporesponsiveness and prolong heart allograft survival. ers - mediated apoptosis pathway may play a role in peripheral tolerance after heart transplantation with costimulatory blockade. a detailed understanding of activated t cells apoptosis in this process will undoubtedly lead to the design of more effective strategies to achieve tolerance in the clinic.	implementation of dendritic cell- (dc-) based therapies in organ transplantation can reduce dependency on nonspecific immunosuppression. despite extensive research, mechanisms of equipped dcs inducing transplant tolerance remain incomplete. here, we applied rna interference technique to inhibit cd80 and cd86 expression in host bone marrow - derived dcs. this approach could specifically and effectively knock down cd80 and cd86 expression. t cells primed by these dcs inhibited allogeneic responses. administration of recipient dcs loaded with alloantigen after cd80 and cd86 blockade prolonged cardiac allograft survival. we also found a higher percentage of apoptotic t cells in lymph tissues and grafts than that detected in control group. in addition, these t cells expressed high expression of grp78 than controls, indicating activation of unfolded protein responses. upregulation of chop expression among these cells suggested that the endoplasmic reticulum stress (ers) response switched to a proapoptotic response. our results indicated that ers - induced apoptosis may be involved in allogeneic t - cell apoptosis, and the ers - mediated apoptosis pathway may be a novel target in clinical prevention and therapy of allograft rejection.
	protein dynamics on the micro- to millisecond time scale is increasingly found to be critical for biological function, as demonstrated by numerous nmr relaxation dispersion studies. methyl groups are excellent probes of protein interactions and dynamics because of their favorable nmr relaxation properties, which lead to sharp signals in the 1h and 13c nmr spectra. out of the six different methyl - bearing amino acid residue types in proteins, methionine plays a special role because of its extensive side - chain flexibility and the high polarizability of the sulfur atom. methionine is over - represented in many protein protein recognition sites, making the methyl group of this residue type an important probe of the relationships among dynamics, interactions, and biological function. here we present a straightforward method to label methionine residues with specific 13chd2 methyl isotopomers against a deuterated background. the resulting protein samples yield nmr spectra with improved sensitivity due to the essentially 100% population of the desired 13chd2 methyl isotopomer, which is ideal for 1h and 13c spin relaxation experiments to investigate protein dynamics in general and conformational exchange in particular. we demonstrate the approach by measuring 1h and 13c cpmg relaxation dispersion for the nine methionines in calcium - free calmodulin (apo - cam). the results show that the c - terminal domain, but not the n - terminal domain, of apo - cam undergoes fast exchange between the ground state and a high - energy state. since target proteins are known to bind specifically to the c - terminal domain of apo - cam, we speculate that the high - energy state might be involved in target binding through conformational selection.
diffusion - weighted imaging (dwi) is increasingly regarded as a promising modality in breast lesion detection and characterization [14 ]. adc values were demonstrated to be reduced in breast cancers compared to normal tissue and benign lesions due to the increased cellularity. dwi is now regarded as a very useful adjunct method to dynamic contrast - enhanced (dce) mr imaging, which can improve the accuracy of diagnosis compared to dce mr imaging alone [57 ]. the histological difference between carcinomas and normal breast fibroglandular tissue lies not only in the increasing abnormal cell density, but also in the disordered organization and arrangement of fibroglandular tissues. the diffusion and adc changes detected by dwi are non - directional and can not demonstrate the 3-dimensional diffusion process resulting from the disordered structure. in normal breast tissue, the ducts, vessels, and other parenchyma around them are organized in approximately parallel patterns and have their main directions ; therefore, the water molecules within the extracellular space diffuse mainly along the axis of this space and they show anisotropy. dwi imaging can only detect the mean diffusion mobility without directional dependency, due to the limited number of gradients used in these sequences. on the other hand, the diffusion tensor imaging (dti) advanced from dwi can vividly exhibit the 3-dimensional diffusion process in healthy tissue and in lesions of the breast and other organs. because the number of diffusion gradients used in dti is much more than that used in dwi, a specific 3-dimensional ellipsoid tensor unit can be uniquely determined in each pixel, within which the diffusion ability in any direction can be accurately calculated. by measuring the anisotropic diffusion in different tissues, dti can provide more information about microstructure and pathophysiology than dwi, and could be helpful to describe and identify the characteristics of different kinds of tissue and even to discriminate different lesions. prior studies in anisotropy organs such as the brain, prostate, and kidney have shown its great potential [814 ]. similar to the brain, prostate, and kidney, the breast is also an anisotropy tissue, with parenchyma composed of ducts, vessels, and fibrous glandular tissue spreading radially from the nipple. the purpose of this study was to investigate whether the anisotropy parameters are helpful in the detection and discrimination of breast cancers, and to determine its value in predicting the risk of cancers. this study was approved by the local ethics committee, and all patients provided written informed consent before examination. between june 2012 and july 2014, 106 female patients with breast focal lesions underwent dynamic contrast - enhanced mri and dti. inclusion criteria were : (1) focal lesions found in contrast - enhanced mri were more than 10 mm in diameter ; (2) biopsy or surgery were performed after mri with a less than 7-day interval ; (3) benign or malignant histological result. we excluded anyone with previous surgery, radiation or chemotherapy of breast cancer, lesion in bilateral breast, or incomplete examination due to artifacts. a total of 56 patients were included, with age ranging from 37 to 68 years (median, 47 years). all patients were examined in prone position on the same 1.5 t mri system device (avanto, siemens healthcare, erlangen, germany) using a dedicated receiving bilateral breast matrix coil (breast matrix, siemens healthcare, erlangen, germany). a routine axial turbo - spin echo inversion recovery sequence of fat - suppressed t2wi (tr 5800 ms, te 56 ms, fov 275275 mm, matrix 314320, slice thickness 6 mm with no intersection gap, nex 2) was first performed after tomography, followed by a dti sequence. dti was performed using an axial 2-dimensional diffusion - weighted echo planer imaging sequence (tr 6900 ms, te 90 ms, slice thickness 5 mm with zero gap, nex 4, fov 380 mm285 mm, matrix 144192), and the diffusion gradients were applied in 6 directions with b=0 and 1 000 s / mm. finally, a dynamic contrast - enhanced sequence containing an axial t1-weighted 3d fast - spoiled gradient - recalled echo sequence (tr 20 ms, te 1.19 ms, fov 300300 mm, matrix 128128, slice thickness 2 mm) was performed. one precontrast acquisition and 5 postcontrast acquisitions were performed before and after the contrast of gd - dtpa (omniscan, ge) with a dose of 0.1 mmol / kg. diffusion tensor data were post - processed and analyzed by an experienced mri physician blinded to histopathological findings, on the mr syngo station (siemens healthcare) using the neuro3d toolbox (siemens healthcare, erlangen, germany). by browsing the contrast - enhanced subtraction images, the slice showing the lesion s maximum diameter was determined, and then the same slice was found in the axial adc map. by referring to the dce images, an roi in adc maps corresponding to the hyperintensity in dce images was drawn along the lesion margin, omitting hemorrhagic, cystic, and calcific areas. in the same patient, another roi was drawn in the contralateral healthy breast containing normal breast tissue only. then the anisotropy parameters, such as adc, fa, and eigenvalues (e1, e2, e3) were automatically calculated, where e1, e2, and e3 are the maximum, intermediate, and minimum diffusion tensor eigenvalues, respectively. every lesion and normal breast tissue was measured 3 times to produce the final averaged measurements. e2, e3, and the maximum anisotropy index e1e3 between breast cancers and normal breast tissue in the same patient were compared by 2-tailed paired t - test. dti - derived metrics between breast cancer and benign lesions were compared by non - parametric test. multi - variant logistic analysis was performed to determine if adc, fa, eigenvalues e1, e2, e3, and the maximum anisotropy index e1e3 are independent predictors in characterization of different breast lesions, and their predictive values were calculated. the full range of adc, fa, and e1 measurements were divided into equal quartiles and their values in predicting risk of breast cancer in every quartile were calculated. then, to compare diagnostic performance of adc, fa, e1, e2, e3, e1e3, and the multivariate model, receiver operating characteristic (roc) curve analysis was performed to calculate the area under the curve (auc) and 95% condence interval (ci). z - tests were used to compare the difference of auc in detecting and charactering different breast lesions using medcalc 11.0 software (medcalc software, mariakerke, belgium). we calculated the optimal critical value defined as the point with the maximum sum of sensitivity and specificity as well as the corresponding sensitivity and specificity. this study was approved by the local ethics committee, and all patients provided written informed consent before examination. between june 2012 and july 2014, 106 female patients with breast focal lesions underwent dynamic contrast - enhanced mri and dti. inclusion criteria were : (1) focal lesions found in contrast - enhanced mri were more than 10 mm in diameter ; (2) biopsy or surgery were performed after mri with a less than 7-day interval ; (3) benign or malignant histological result. we excluded anyone with previous surgery, radiation or chemotherapy of breast cancer, lesion in bilateral breast, or incomplete examination due to artifacts. a total of 56 patients were included, with age ranging from 37 to 68 years (median, 47 years). all patients were examined in prone position on the same 1.5 t mri system device (avanto, siemens healthcare, erlangen, germany) using a dedicated receiving bilateral breast matrix coil (breast matrix, siemens healthcare, erlangen, germany). a routine axial turbo - spin echo inversion recovery sequence of fat - suppressed t2wi (tr 5800 ms, te 56 ms, fov 275275 mm, matrix 314320, slice thickness 6 mm with no intersection gap, nex 2) was first performed after tomography, followed by a dti sequence. dti was performed using an axial 2-dimensional diffusion - weighted echo planer imaging sequence (tr 6900 ms, te 90 ms, slice thickness 5 mm with zero gap, nex 4, fov 380 mm285 mm, matrix 144192), and the diffusion gradients were applied in 6 directions with b=0 and 1 000 s / mm. finally, a dynamic contrast - enhanced sequence containing an axial t1-weighted 3d fast - spoiled gradient - recalled echo sequence (tr 20 ms, te 1.19 ms, fov 300300 mm, matrix 128128, slice thickness 2 mm) was performed. one precontrast acquisition and 5 postcontrast acquisitions were performed before and after the contrast of gd - dtpa (omniscan, ge) with a dose of 0.1 mmol / kg. diffusion tensor data were post - processed and analyzed by an experienced mri physician blinded to histopathological findings, on the mr syngo station (siemens healthcare) using the neuro3d toolbox (siemens healthcare, erlangen, germany). by browsing the contrast - enhanced subtraction images, the slice showing the lesion s maximum diameter was determined, and then the same slice was found in the axial adc map. by referring to the dce images, an roi in adc maps corresponding to the hyperintensity in dce images was drawn along the lesion margin, omitting hemorrhagic, cystic, and calcific areas. in the same patient, another roi was drawn in the contralateral healthy breast containing normal breast tissue only. then the anisotropy parameters, such as adc, fa, and eigenvalues (e1, e2, e3) were automatically calculated, where e1, e2, and e3 are the maximum, intermediate, and minimum diffusion tensor eigenvalues, respectively. every lesion and normal breast tissue was measured 3 times to produce the final averaged measurements. differences of adc, fa, eigenvalues e1, e2, e3, and the maximum anisotropy index e1e3 between breast cancers and normal breast tissue in the same patient were compared by 2-tailed paired t - test. dti - derived metrics between breast cancer and benign lesions were compared by non - parametric test. multi - variant logistic analysis was performed to determine if adc, fa, eigenvalues e1, e2, e3, and the maximum anisotropy index e1e3 are independent predictors in characterization of different breast lesions, and their predictive values were calculated. then the best - fitting regression model combining multiple predictors was created. the full range of adc, fa, and e1 measurements were divided into equal quartiles and their values in predicting risk of breast cancer in every quartile were calculated. then, to compare diagnostic performance of adc, fa, e1, e2, e3, e1e3, and the multivariate model, receiver operating characteristic (roc) curve analysis was performed to calculate the area under the curve (auc) and 95% condence interval (ci). z - tests were used to compare the difference of auc in detecting and charactering different breast lesions using medcalc 11.0 software (medcalc software, mariakerke, belgium). we calculated the optimal critical value defined as the point with the maximum sum of sensitivity and specificity as well as the corresponding sensitivity and specificity. in this study, 56 lesions were identified on dce - mri in 56 women and categorized as bi - rads 3, 4, or 5. adc, fa, e1, e2, and e3 were successfully measured in every lesion and the contralateral healthy breast tissue in carcinoma patients. adc, fa, e1, e2, e3, and e1e3 were all significantly lower in breast cancers than those in normal breast tissue (figure 2 and table 2). the averaged differences of adc, fa, e1, e2, e3, and e1e3 between breast cancer and normal tissue were (0.460.31)10 mm / s, 0.050.04, (0.570.38)10 mm / s, (0.450.31)10 mm / s, (0.360.26)10 mm / s, and (0.230.16)10 mm / s, respectively, and the averaged reducing ratios were (3217)%, (2413)%, (3319)%, (3217)%, (3118)%, and (3720)%, respectively. the subgroups of invasive ductal cancers (idc) and ductal carcinoma in situ (dcis) were also compared to the normal tissue, and all of these 6 parameters were obviously lower in idc and dcis than in normal tissue, with a statistically significant difference (p0.05). a further detailed analysis was performed for idc, dics, and benign lesions (table 3). there were no differences in adc, fa, e1, e2, e3, and e1e3 between idc and dcis (p>0.05). the adc, e1, e2, e3, and e1e3 were all significantly lower in invasive cancer (p0.05). because of the collinearity between adc, e1, e2, e3, and e1e3, these 5 parameters can not be combined in a single multivariate model, but 2-parameter models of adc, e1, e2, and e3 combined with fa all showed that adc (p0.05). multiple logistic regression showed e1e3 (p0.05). the coefficients, odds ratios, and the corresponding p valves of each dti parameter and the combining model are shown in table 5. the predicted risk of malignancy based on each dti parameters is shown in figure 4. adc, e1, e2, e3, and e1e3 produced aucs of 0.897, 0.898, 0.885, 0.892, and 0.882, respectively, and fa only produced 0.607. the multivariate model combining (e1e3) and fa produced an auc of 0.897, similar to adc (figure 5). e2, e3, and the combined model (p>0.05), and the difference between fa and other parameters was statistically significant (p0.05). a further detailed analysis was performed for idc, dics, and benign lesions (table 3). there were no differences in adc, fa, e1, e2, e3, and e1e3 between idc and dcis (p>0.05). the adc, e1, e2, e3, and e1e3 were all significantly lower in invasive cancer (p0.05). because of the collinearity between adc, e1, e2, e3, and e1e3, these 5 parameters can not be combined in a single multivariate model, but 2-parameter models of adc, e1, e2, and e3 combined with fa all showed that adc (p0.05). multiple logistic regression showed e1e3 (p0.05). the coefficients, odds ratios, and the corresponding p valves of each dti parameter and the combining model are shown in table 5. the predicted risk of malignancy based on each dti parameters is shown in figure 4. adc, e1, e2, e3, and e1e3 produced aucs of 0.897, 0.898, 0.885, 0.892, and 0.882, respectively, and fa only produced 0.607. the multivariate model combining (e1e3) and fa produced an auc of 0.897, similar to adc (figure 5). e2, e3, and the combined model (p>0.05), and the difference between fa and other parameters was statistically significant (p<0.01). dwi is now widely used in breast cancer detection and characterization. developed from dwi, dti not only provides traced weighted images and adc maps, but also other parameters maps such as fa and eigenvalues, which can show the microstructures and arrangements of tissues. studies have shown that adc and fa values are useful tools in breast carcinoma detection from normal breast tissue, and that adc is very useful in characterization and differentiation of malignant breast lesions from benign ones. adc values calculated from dti were shown to be highly consistent with those from dwi. in our study, the eigenvalues e1, e2, and e3, the maximum anisotropy index e1e3, and adc and fa were included, and their potential values in breast cancers detection and differentiation were investigated and evaluated with a 1.5 t mr scanner. our results showed that adc, e1, e2, e3, and e1e3 were significantly lower in cancer lesions compared to normal breast tissue. fa in breast cancers was also decreased by a lesser degree than adc, e1, and e1e3. in breast cancer differentiation, adc, e1, e2, and e3, as malignancy predictors, were highly associated with breast cancers risk, which had much more high - differentiation efficacy than other dti parameters used in our study. the fa alone did not provide any useful information in distinguish malignant from benign breast lesions. several studies have demonstrated that adc and fa are lower in breast cancers compared with normal breast tissue and benign lesions [1618 ], and this was supported by our results. we also found that eigenvalue e1, e2, e3, and the maximum anisotropy index e1e3 all were significantly lower in malignant lesions. to the best of our knowledge, no investigations have ever measured the decrease in those dti metrics. in our study, we first quantitatively investigated the decreasing degree of these parameters, and found they decreased by about 2437%. studies have examined the histologic changes of breast fibroglandular tissue in different phases of the menstrual cycle and found morphologic changes in epithelial and stromal components. as a result, breast morphology and density influenced by hormonal level have demonstrated regular fluctuation during the menstrual cycle. however, previous studies that examined these changes by using dti showed that adc and other anisotropy parameters, such as fa and e1, remained almost unchanged during the menstrual cycle and showed low mean within - subject variations, with coefficient of variance around 12% for adc and e1, and around 5% for fa and e1e3. besides the influence of hormonal level, the heterogeneous fibroglandular (especially the collagen) fibers may also result in the reduction of signal and mimic breast carcinomas, which may in turn produce the variations in the breast. reports have shown within - subject coefficient of variance is about 4.522% for adc, 11.4% for fa, and 17.6% for e1. however, our results suggest that the decrease in these dti parameters in breast cancer are far greater than the normal fluctuations in normal breast tissue, which means that the lower magnitude of these dti parameters in breast cancer result from the histologic difference between cancer lesions and normal tissue rather than from normal fluctuations. compared to normal breast glands, the cellularity density and microvessel density in breast cancer lesions increased significantly. although the relationship between dti anisotropy indices and breast cellularity density and microvessel density has not been reported, studies of other organs, such as the brain, lung, and prostate, have displayed a negative correlation between cellularity, microvessel density, and anisotropy parameters such as adc and fa values [2730 ], which may to some extent explain the reduction of adc and fa values in breast cancers. in the cancerous tissue, more disordered structure and increased necrotic material of gland cells may also play a role. the reduction in eigenvalues may also be due to do this, and further research on this topic is needed. our study found that the dti parameters adc, e1, e2, e3, and e1e3 were reduced much more than fa in breast cancer compared to normal tissue. changes in tumor cellular and microvessel density and the disorder of fibroglandular tissue may limit diffusion activity of water molecules, which, in turn, reduces e1, e2, and e3. especially interesting in our results is that the degrees of reduction of e1, e2, and e3 in breast cancer were very close, with a mean of around 3035%, which suggests that the 3 orthogonal eigenvectors of diffusion tensor ellipsoid unit was similarly scaled down. adc, as the average of the 3 eigenvectors, was significantly reduced, while fa was less reduced. this can also be confirmed by the different situation in breast cancers versus benign lesions, in which e1, e2, and e3 were significantly different between caners and benign lesions, while fa values had no significant difference, and the ratios of e1, e2, and e3 between both were also very close, at around 0.610.64. this suggests that the proliferation of cells in fibroglandular tissue, as well as the structural arrangement in tumors and normal tissue, have a relatively slighter influence on fa, perhaps because the diffusion distance of water molecular and the disordered microstructure is much smaller than a voxel in scale and the impact is significantly reduced in fa due to the arithmetic averages. while values of dti indices in breast cancers varied widely in previous studies (0.71.6 mm / s for adc, 2.260.24 for fa), the mean adc of breast cancers in our results (0.950.29 mm / s) are comparable with previous studies, and the indices of e1, e2, e3, and e1e3 in our study also agree with results in the literature. the fa in our study was 0.190.06, which is lower than in previous reports. no significant differences were found in anisotropy indices between dcis and invasive breast cancers in our study, which were all significantly lower than in normal tissue and benign lesions. partridge. reported that while the differences in fa values between dics and invasive breast cancers have no statistical significance, the adc value of invasive breast cancers were significantly lower than dcis, which is quite different from our results. the reasons for the difference in adc values between the 2 studies may lie in the variations among individual lesions. dcis has great variation in grade and cellularity, and some high - grade dcis has relatively higher cellularity, which may affect the measured dti parameters. the results of adc and fa in our study for dics and invasive cancer were all lower than the results of partridge, which, from another perspective, may confirm the reason mentioned early. comparisons between benign and malignant tumors showed no significant difference in fa values between the 2 different type of lesions, while adc, e1, e2, e3, and e1e3, as predictors for breast cancer, were significantly lower in breast cancer than in benign lesions, which is consistent with the findings of partridge and cakir, but opposite to the results of tsougos. our results suggest that adc, e1, e2, e3, and e1e3 all help to distinguish breast cancers from benign lesions. the roc curves show that adc and e1 have the highest discriminative values, with a slightly larger auc than e1e3, but no significant difference was found among the auc of those 5 parameters. although the regression model combining fa and e1e3 has similar diagnostic efficiency as adc, the computational complexity of the model restricts its use in clinical settings. for the discrimination between malignant and benign lesions, the sensitivity and specificity of adc was 82.4% and 90.9%, respectively, which are comparable to the results of baltzer. in addition, in our study the performance of e1 and e2 was very close to adc in sensitivity and specificity. in our study, the reduction of adc, as well as e1, e2, e3, and e1e3, our results show that the adc values of benign lesions, as well as e1, e2, e3 and e1e3, are mostly in the higher range, while the corresponding parameters for malignant lesions are mostly in the lower values. in fact, we did not observe a single malignant lesion when adc < 0.56 mm / s or e1 < 0.97 mm / s or e2 < 0.8 mm / s or e3 < 0.6 mm / s, and only 1 lesion with e1e3 less than 0.29 mm / s. with the reduction of adc, e1, e2, e3, and e1e3 from the values that most benign lesions are in, the risk of breast cancer increases rapidly. if the ranges in which most benign lesions are concentrated are regarded as reference groups, when the adc, e1, e2, or e3 is located in the lowest group (which strongly suggests breast cancer), the odds ratio reached about 97 or 67, which suggests that the risk of breast cancer was more than 90 or 70 times higher than in the reference group. due to the impact of cyclical changes in hormone levels, the dti indices of tissues may be affected, especially in the 2 week, which means the detection and differentiation of breast cancers by using adc, e1, e2, e3, and e1e3 may be influenced. fortunately, research shows that normal breast tissue has very slight fluctuations in adc, e1, e2, e3, and e1e3 values during the menstrual cycle, and no statistical significance was observed. therefore, the relatively stable mammary glands in dti parameters provide a reliable indication that these dti parameters have utility in breast lesions characterization. first, to ensure the accuracy of measurement, the smaller lesions were excluded because the margin of small lesions can not be accurately defined, which may have influenced the values of dti indices. therefore, the dti measurements in this study are not representative of all tumor lesions. fibroadenomas are relatively common in benign lesions ; therefore, the dti parameters in the benign group may reflect the characteristics of fibroadenomas to a relative larger degree, so further studies with expanded sample sizes are needed. we investigated the diffusion tensor indices of breast cancers, and found that adc, e1, e2, e3, and e1e3 were significantly lower in cancer lesions compared to normal breast tissue and benign lesions. adc, e1, e2, e3, and e1e3 of a breast mass were highly associated with the risk of breast cancer in a reverse relationship, while the fa is useless in breast cancer risk prediction. our results show the potential value of dti indices in breast cancer. in previous studies, dwi and adc were combined with contrast - enhanced mri to detect and differentiate breast cancers, so further studies are also required to assess the added value of dti indices in breast cancers as complementary tools to contrast - enhanced mri.	backgroundthe aim of this study was to investigate whether the anisotropy parameters are helpful in the detection and discrimination of breast cancers, and to determine its value in predicting the risk of cancers.material/methodsthere were 56 patients with 56 lesions (34 malignant, 22 benign) included in the study. dti was performed in every patient and apparent diffusion coefficient (adc), fractional anisotropy (fa), and eigenvalues e1, e2, and e3 were measured in every lesion and the normal breast tissue.resultsadc, fa, and eigenvalues of e1, e2, e3, and e1e3 in breast cancers were all significantly lower than in normal tissue (p0.05). adc, e1, e2, and e3 were very similar in discriminating breast cancers and benign lesions, with area under the curve (auc) 0.8850.898, sensitivity 73.585.3%, and specificity 90.9100%.conclusionsadc, e1, e2, e3, and e1e3 are much lower in breast cancers than in normal tissue and benign lesions. the reduction of adc, e1, e2, e3, and e1e3 of a mass in the breast is highly associated with the risk of breast cancer, but the fa has no utility in breast cancer risk prediction.
methicillin - resistant staphylococcus aureus (mrsa) infections are associated with significant mortality and health care costs.1 in nearly all hospitals, mrsa has become one of the gram - positive bacterial species associated with serious hospital - acquired infections.29 the population of patients most vulnerable to acquiring mrsa infections, including hospital - acquired pneumonia, is the elderly, whose immune systems are often affected by aging, underlying diseases, and medical interventions. in japan, senior citizens aged 75 years and older, termed elderly, constitute over 10.4% of the population and represent the largest and most frequent users of health care facilities, such as hospitals and long - term skilled nursing and residential homes. improving treatment outcomes for elderly patients with mrsa infections will therefore increase survival and quality of life, and reduce health care expenditure burdens.2 to date, mrsa hospital - acquired pneumonia has primarily been treated with intravenously administered vancomycin. in vitro and animal model studies investigating the pharmacodynamics of vancomycin indicate that the rate of mrsa killing depends primarily upon the duration of exposure to concentrations exceeding the minimum inhibitory concentration (mic) value of the target strain. although the area under the curve (auc)/mic ratio is the best predictor of efficacy in animal models,10,11 data characterizing the pharmacodynamic properties of vancomycin against mrsa in humans are limited. although a study that examined clearance of mrsa from sputum suggested that an auc / mic ratio > 400 may be effective,12 a study involving adult patients with mrsa pneumonia or sepsis failed to show an association between pharmacokinetic / pharmacodynamic parameters of vancomycin and treatment outcomes.13 in elderly individuals, renal clearance is significantly reduced. creatinine clearance decreases with age but serum creatinine concentration remains relatively stable because elderly persons typically lose muscle mass as they age, often leading to overestimation of renal function in the elderly.1417 because vancomycin is eliminated from the body mainly via the kidneys, overestimation of renal function leads to increased vancomycin trough concentrations, which may result in nephrotoxicity. however, it is uncertain whether targeting higher blood concentrations leads to increased efficacy of vancomycin and/or risk of nephrotoxicity in elderly patients. we performed a retrospective observational study to determine whether two pharmacokinetic indices for vancomycin, ie, serum trough concentrations and auc values, are associated with mortality from mrsa hospital - acquired pneumonia in elderly patients aged 75 years and older. the study was conducted at the national center for geriatrics and gerontology hospital, obu, japan. this 320-bed hospital comprises general (including emergency) services, except for pediatrics, and admits approximately 5,000 patients per year (more than 50% of whom are aged over 75 years). mrsa is endemic in this hospital, and the ratio of mrsa isolates per total s. aureus isolates is approximately 70%. during a 6-year period (from january 2006 through december 2012), all hospitalized patients aged 75 years or older with mrsa pneumonia microbiologically confirmed by sputum or blood cultures and treated with vancomycin therapy were identified using the clinical pharmacokinetics department computer database. we conducted a retrospective 6-year observational study with 28-day mortality as the primary outcome for 94 patients with mrsa pneumonia treated using vancomycin. we also assessed the relationship between the effect of pharmacokinetic indices of vancomycin, including serum trough concentrations and auc values, and the primary outcome. the clinical characteristics of the study patients were reviewed from hospital medical records. for patients with multiple episodes, only the first episode was counted. this study was approved by the ethics committee at the national center for geriatrics and gerontology hospital. the definition of hospital - acquired pneumonia was based on american thoracic society guidelines for the management of adults with hospital - acquired, ventilator - associated, and health care - associated pneumonia.2 here, hospital - acquired pneumonia was defined as pneumonia occurring 48 hours or more after hospitalization, with an acute lung infection characterized by cough, fever, purulent sputum, and an abnormal chest x - ray, that was not deemed to be incubating at the time of admission. among hospital - acquired pneumonia cases, those with mrsa isolated from blood culture or sputum which showed no sign of improvement after treatment with broad - spectrum antibiotics, such as carbapenem, for more than 3 days were defined as mrsa hospital - acquired pneumonia. the severity rating of pneumonia was defined according to the japanese respiratory society guidelines for management of hospital - acquired pneumonia18 and was used to divide the patients into severe, moderate, and mild groups. the severe group was defined as patients with three or more of the following risk factors or conditions : malignancy or immunocompromised status, impaired consciousness, requiring a fraction of inspired oxygen > 35% to maintain oxygen saturation > 90%, mean age 70 years or older (woman aged 75 years or older), and oliguria or dehydration. the moderate group was defined as patients with any two of the risk factors described above, and in addition, at least one of the following secondary risk factors : c - reactive protein 20.0 mg / l or extent of infiltration on chest x - ray covering at least two thirds of one lung. the mild group was defined as all other patients who were not compatible with severe or moderate criteria. immunosuppression was defined as need for corticosteroids or immunosuppressive agents.2 nephrotoxicity resulting from treatment with vancomycin was defined as an increase in serum creatinine of 0.5 mg / dl or a 50% increase from pretreatment levels.10 patients were divided into 28-day survivors and nonsurvivors from the time of vancomycin administration. our institutional microbiology laboratory performed antimicrobial susceptibility tests of clinical isolates using a broth microdilution method with the microscan pos series pc6.1j panel (siemens, sacramento, ca, usa) according to clinical laboratory and standards institute recommendations.19 to determine more accurately the susceptibility of mrsa to vancomycin, the most recent (january 2010 through december 2012) mrsa samples collected from patients (n = 21) were sent to mitsubishi chemical medience corporation (tokyo, japan) for determination of a vancomycin mic ranging from 0.5 to 2.0 g / ml. the initial treatment schedule for vancomycin was simulated to achieve a trough concentration of 1015 g / ml with tdm software, using patient characteristics, including age, body weight, and serum creatinine (vcm - tdm microsoft excel version 3.0, shionogi and co, ltd, osaka, japan). serum concentrations of vancomycin were determined from samples collected on the fifth day from the start of drug administration. blood samplings were performed twice, ie, once before vancomycin administration (trough), and once one hour after vancomycin administration (peak). the predicted 24-hour auc values for vancomycin were calculated using tdm software based on peak and trough concentrations. continuous variables were compared using the student s t - test for normally distributed variables and the mann - whitney u test for non - normally distributed variables. the multivariable model was used to establish risk factors for mortality after treatment with vancomycin for mrsa pneumonia. multivariable analysis were used for nephrotoxicity, the charlson comorbidity index, and nonoptimal auc.16 the predictive ability of the final model was quantified using hosmer a two - sided p - value of less than 0.05 was considered to be statistically significant. statistical package for the social sciences spss version 12.0 software (spss inc, chicago, il, usa) was used for the statistical analysis. the study was conducted at the national center for geriatrics and gerontology hospital, obu, japan. this 320-bed hospital comprises general (including emergency) services, except for pediatrics, and admits approximately 5,000 patients per year (more than 50% of whom are aged over 75 years). mrsa is endemic in this hospital, and the ratio of mrsa isolates per total s. aureus isolates is approximately 70%. during a 6-year period (from january 2006 through december 2012), all hospitalized patients aged 75 years or older with mrsa pneumonia microbiologically confirmed by sputum or blood cultures and treated with vancomycin therapy were identified using the clinical pharmacokinetics department computer database. we conducted a retrospective 6-year observational study with 28-day mortality as the primary outcome for 94 patients with mrsa pneumonia treated using vancomycin. we also assessed the relationship between the effect of pharmacokinetic indices of vancomycin, including serum trough concentrations and auc values, and the primary outcome. the clinical characteristics of the study patients were reviewed from hospital medical records. for patients with multiple episodes, this study was approved by the ethics committee at the national center for geriatrics and gerontology hospital. the definition of hospital - acquired pneumonia was based on american thoracic society guidelines for the management of adults with hospital - acquired, ventilator - associated, and health care - associated pneumonia.2 here, hospital - acquired pneumonia was defined as pneumonia occurring 48 hours or more after hospitalization, with an acute lung infection characterized by cough, fever, purulent sputum, and an abnormal chest x - ray, that was not deemed to be incubating at the time of admission. among hospital - acquired pneumonia cases, those with mrsa isolated from blood culture or sputum which showed no sign of improvement after treatment with broad - spectrum antibiotics, such as carbapenem, for more than 3 days were defined as mrsa hospital - acquired pneumonia. the severity rating of pneumonia was defined according to the japanese respiratory society guidelines for management of hospital - acquired pneumonia18 and was used to divide the patients into severe, moderate, and mild groups. the severe group was defined as patients with three or more of the following risk factors or conditions : malignancy or immunocompromised status, impaired consciousness, requiring a fraction of inspired oxygen > 35% to maintain oxygen saturation > 90%, mean age 70 years or older (woman aged 75 years or older), and oliguria or dehydration. the moderate group was defined as patients with any two of the risk factors described above, and in addition, at least one of the following secondary risk factors : c - reactive protein 20.0 mg / l or extent of infiltration on chest x - ray covering at least two thirds of one lung. the mild group was defined as all other patients who were not compatible with severe or moderate criteria. immunosuppression was defined as need for corticosteroids or immunosuppressive agents.2 nephrotoxicity resulting from treatment with vancomycin was defined as an increase in serum creatinine of 0.5 mg / dl or a 50% increase from pretreatment levels.10 patients were divided into 28-day survivors and nonsurvivors from the time of vancomycin administration. our institutional microbiology laboratory performed antimicrobial susceptibility tests of clinical isolates using a broth microdilution method with the microscan pos series pc6.1j panel (siemens, sacramento, ca, usa) according to clinical laboratory and standards institute recommendations.19 to determine more accurately the susceptibility of mrsa to vancomycin, the most recent (january 2010 through december 2012) mrsa samples collected from patients (n = 21) were sent to mitsubishi chemical medience corporation (tokyo, japan) for determination of a vancomycin mic ranging from 0.5 to 2.0 g / ml. the initial treatment schedule for vancomycin was simulated to achieve a trough concentration of 1015 g / ml with tdm software, using patient characteristics, including age, body weight, and serum creatinine (vcm - tdm microsoft excel version 3.0, shionogi and co, ltd, osaka, japan). serum concentrations of vancomycin were determined from samples collected on the fifth day from the start of drug administration. blood samplings were performed twice, ie, once before vancomycin administration (trough), and once one hour after vancomycin administration (peak). the predicted 24-hour auc values for vancomycin were calculated using tdm software based on peak and trough concentrations. continuous variables were compared using the student s t - test for normally distributed variables and the mann - whitney u test for non - normally distributed variables. the multivariable model was used to establish risk factors for mortality after treatment with vancomycin for mrsa pneumonia. multivariable analysis were used for nephrotoxicity, the charlson comorbidity index, and nonoptimal auc.16 the predictive ability of the final model was quantified using hosmer a two - sided p - value of less than 0.05 was considered to be statistically significant. statistical package for the social sciences spss version 12.0 software (spss inc, chicago, il, usa) was used for the statistical analysis. ninety - four elderly patients aged 75 years or older with mrsa pneumonia treated using vancomycin were eligible for the study. the median age of the study patients was 82 (range 7599) years, with more than half of the patients (71/94 [76% ]) residing in a nursing facility before hospital admission. of the 94 patients, 18 (19%) had mrsa pneumonia and sepsis, while the remaining 76 (81%) were diagnosed with mrsa pneumonia without sepsis. mrsa was coisolated with pseudomonas aeruginosa (n = 6) and/or klebsiella pneumoniae (n = 8) and/or acinetobacter species (n = 7) in 21 of 94 patients (22%). all patients had at least one comorbid disease, such as cardiovascular disease, dementia, or diabetes mellitus (data not shown). the demographic data of the 28-day survivors (n = 62) and nonsurvivors (n = 32) are summarized in table 1. the percentage of severe cases among survivors was 45% (28/62), whereas the rate was 78% (25/32) among nonsurvivors (p = 0.004). mean (standard deviation [range ]) serum creatinine levels in the survivor group was 0.7 0.4 (0.22.5) mg / dl while that in the nonsurvivor group was 0.8 0.4 (0.22.1) mg / dl (p = 0.145). survivors tended to have a lower mean charlson comorbidity index (2.4 1.8 [08 ]) than nonsurvivors (3.1 2.5 [110 ], p = 0.089). coexistence of mrsa bacteremia did not significantly differ between the two groups (23% versus 19%, respectively, p = 0.375). the pharmacokinetic and pharmacodynamic parameters of vancomycin in survivors and nonsurvivors are summarized in table 2. notably, the mean trough and peak concentrations, calculated auc values, and clearance of vancomycin did not differ significantly between the two groups (table 2). stratification of vancomycin trough concentrations revealed no statistically significant relationships with 28-day mortality at any of the breakpoints evaluated (p = 0.603, figure 1a). however, the auc values of 450 gh / ml were significantly associated with 28-day mortality (p 450 gh / ml, table 3). these risk factors were analyzed by multivariate analysis with multiple logical regression, finding the following as 28-day mortality : nephrotoxicity (p = 0.309, odds ratio [or ] 2.544 ; 95% confidence interval [ci ] 0.42115.371), charlson comorbidity index (p = 0.128, or 1.236 ; 95% ci 0.9411.625), nonoptimal auc (p 450 gh / ml was 73% (11 of 15 patients), and these 11 patients showed inferior renal clearance of vancomycin compared with the 83 patients with an auc 1 g / ml, optimal pharmacodynamic targets may not be achievable using standard vancomycin doses, even though these isolates are reported as susceptible by clinical laboratory and standards institute standards.26,27 therefore, the resulting auc / mic ratio would be significantly affected by only small variations in the mic. during the 6-year period of the present study, all mrsa isolates had a vancomycin mic 2 g / ml, as determined at our institute. further, in our most recent sampling survey of mrsa (n = 21), the 18 mrsa isolates had a vancomycin mic of 1 g / ml (86%), indicating that these isolates had an auc equal to auc / mic (the remaining three isolates showed a vancomycin mic of 0.5 g / ml [14% ]). although therapeutic guidelines for vancomycin recommend a target auc / mic for vancomycin of > 400 gh / ml,10 our present findings suggest that an auc of 250450 gh / ml is suitable for treatment of mrsa pneumonia with vancomycin in the elderly. as for the reason of this discrepancy, all isolates from study patients g / ml 1 g / ml, and those elderly patients aged 75 years older with potentially poor renal function had increased auc values and displayed poor prognosis. notably, all patients who had an auc < 250 gh / ml died, meaning that we have to consider alternative agents rather than vancomycin for elderly patients aged 75 years and older with poor renal function who have difficulty controlling the correct dosage of vancomycin. to the authors knowledge, this is the first study to examine the pharmacokinetics of vancomycin in elderly patients aged 75 years and older with mrsa pneumonia. our results suggest that an auc of 250450 gh / ml is a suitable target for initial empiric treatment of mrsa pneumonia in the elderly until the vancomycin mic is determined. in elderly patients with potentially poor renal function, administration of vancomycin may not be suitable and it may be necessary to consider alternative agents in such cases. we recommend that once the mic is determined, the dose should be adjusted according to the mic. we also consider that regular surveillance of the institutional antibiogram (such as vancomycin mic values) will contribute to optimal use of anti - mrsa agents, including vancomycin, resulting in more effective and safer treatment for elderly patients infected with mrsa.	backgroundmethicillin - resistant staphylococcus aureus (mrsa) infections are associated with significant mortality and health care costs. to improve treatment outcomes for mrsa, a better understanding of the pharmacokinetic / pharmacodynamic parameters of vancomycin is required to develop optimal dosing strategies, particularly in elderly patients (75 years of age) with limited renal function. the purpose of this study was to determine whether pharmacokinetic indices for vancomycin are associated with mortality from mrsa hospital - acquired pneumonia in elderly patients.methodswe conducted a retrospective observational study with 28-day mortality as the primary outcome for 94 patients with mrsa hospital - acquired pneumonia who had been treated with vancomycin from january 2006 through december 2012. our most recent sampling of mrsa isolates had a minimum inhibitory concentration (mic) for vancomycin of 1 g / ml (86%), indicating that the area under the curve (auc) was equal to the auc / mic in these isolates. the primary data from 28-day survivors and nonsurvivors were compared.resultsamong 94 elderly patients, the mean age was 82 (7599) years. multivariate analyses revealed that, among the factors examined, only the nonoptimal auc (450 gh / ml) was an independent predictor of 28-day mortality in elderly patients (odds ratio 23.156, 95% confidence interval 6.81478.687, p < 0.001). we detected a significant difference for increasing nephrotoxicity in nonsurvivors (nine of 32 patients [28% ]) compared with survivors (three of 62 patients [4.8% ], p = 0.003).conclusionthis finding indicates that patients with potentially poor renal function are likely to have increased auc values and a poor prognosis. consideration of the pharmacokinetics / pharmacodynamics of vancomycin and targeting an auc / mic value of 250450 gh / ml may result in improved treatment outcomes for elderly patients with mrsa hospital - acquired pneumonia.
according to the eau guidelines nephron - sparing surgery (nss) has a similar oncological outcome to that of radical surgery. however, nss is not suitable in some patients with localized renal cell carcinoma (rcc) because : 1) of locally advanced tumor growth, 2) partial resection is not technically feasible because the tumor is in an unfavorable location, 3) and/or significant deterioration of the patient 's general health. in these situations the gold standard curative therapy remains radical nephrectomy, which includes radical removal of the tumor - bearing kidney. acute pancreatitis has not yet been described in the published literature as a complication of radical nephrectomy. a 56-year - old patient was referred to the department of urology at the medical university of graz for right renal tumor (ct scan verified a 12 cm renal mass) to perform a radical nephrectomy. the preoperative anesthetic screening of our patient showed asa ii according to the american association of anesthesiology and well - controlled hypertension with normal laboratory blood tests. there were no co - existing infections the histological examination of the right kidney revealed a renal cell carcinoma (rcc). the operation was uneventful. however, one day later the patient complained of gradually increasing, serious abdominal and back pain, including jaundice and fever. on physical examination, the patient had neither a history of biliary lithiasis nor chronic alcohol consumption or infections. laboratory data (blood) demonstrated urea 61 mg / dl (n : 10 - 45), uric acid 8.5 mg / dl (n : 3.4 - 7), potassium 4.3 mmol/ (n : 3.5 - 5), calcium 1.99 mmol / l (n : 2.202.65), aspartate aminotransferase 216 iu / l (n : 0 - 35), alanine aminotransferase 134 iu / l (n:0 - 45), lactate dehydrogenase 404 iu / l (n:120 - 240) and amylase 989 iu / l (n : 13 - 53), lipase 2154 (0 - 60), and procalcitonin 3.45 (n:0 - 0.5). white blood cell count was also raised (13000), as well as crp 268 mg / l (n:0 - 8), bilirubin 1.43 (n:0.1 - 1.2 mg / dl), and creatinine 2.78 mg / dl (0.6 - 1.3). an abdominal ct scan was performed and demonstrated parenchymal edema of the pancreas (figs. 1 and 2). the patient was referred to the intensive care unit and treated conservatively for 15 days his medical condition improved and he was referred to the department of gastroenterology, where mr cholangiopancreatography showed no biliary stones, and a normal liver. the international symposium on acute pancreatitis in 1992 defined pancreatic necrosis as the presence of one or more diffuse or focal areas of non - viable pancreatic parenchyma. so, based on the patient 's clinical presentation and ct scan findings, the diagnosis of acute pancreatitis as a complication of radical nephrectomy was considered. the patient was referred to the intensive care unit (icu) and oral intake was prohibited. a nasogastric tube was inserted for decompression and parenteral nutrition was started from a central vein. ten days later, serum pancreatic enzyme levels and white blood cell count returned to normal ranges bowel movements became normal, and the patient passed stool. on the same day, the nasogastric tube was removed and restricted oral intake was permitted. on day 16 transperitoneal radical open nephrectomy is a generally accepted treatment for a renal mass greater than 10 cm in size. in the published literature according to burkey retroperitoneal dissection and ischemia could be risk factors for postoperative pancreatitis. however, this was not the case in our patient and trauma to the head of pancreas was avoided. according to milian the mortality rate of pancreatitis was 8.3% for conservative medical treatment versus 26.5% for surgical treatment. physicians should consider pancreatitis as a potentially life - threatening adverse event associated with propofol [6, 7 ], which may be due to failure of free fatty acid metabolism secondary to inhibition of free fatty acid entry into the mitochondria. we hypothesize that propofol could have played a role in the pathophysiology in this condition, because no biliary stone was demonstrated on preoperative or postoperative radiologic studies in the presented case. additionally, no other predisposing factors (e.g. alcohol, infection, addiction or hypercalcemia as well as history of chronic pancreatitis) for pancreatitis were present in our patient.	radical open nephrectomy is considered the standard treatment for kidney tumors or masses greater than 10 cm. we present a rare case of acute pancreatitis that occurred after right radical transperitoneal nephrectomy, which was treated by nonsurgical conservative interventions.the incidence of acute pancreatitis after renal surgery is not known in the literature.a 56-year - old man developed acute pancreatitis postoperatively after radical transperitoneal nephrectomy. an initial ct scan showed an enlarged pancreas with hypodense, heterogeneous consistency and with peripancreatic, perihepatic, mesenteric, and pelvic fluid collections. this complication was managed conservatively.
focal segmental glomerulosclerosis is the second most common cause of idiopathic nephrotic syndrome (ns) in adults. kidney transplantation in patients with fsgs has a recurrence rate of 2040% after first transplant and up to 5080% in subsequent transplants. plasmapheresis has been used as mainstay of therapy for recurrence ; however, most patients relapse after cessation of plasmapheresis., we report a case of posttransplant recurrent fsgs, who was successfully managed with addition of angiotensin receptor blockers (arbs) without plasmapheresis. a 52-year - old male with end - stage kidney disease (esrd) on maintenance hemodialysis since may 2011 presented to us in july 2011. his basic disease was unknown. on evaluation, he had bilaterally small kidneys with urine output of only 200300 ml / day. he underwent kidney transplantation on august 2, 2011, with triple immunosuppression consisting of tacrolimus (tac), mycophenolate mofetil, and prednisolone without antibody induction. initially, he had good urine output and creatinine decreased to 1.6 mg on day 4 ; however, on postoperative day 5, patient became oliguric. renal doppler was normal, so a kidney biopsy was done on day 6, and hemodialysis was initiated. biopsy revealed changes of acute cellular rejection (acr, banff ib) with acute tubular necrosis (atn). patient received three doses of intravenous methylprednisolone 500 mg, but his urine output and kidney function did not improve and he was continued on dialysis. a repeat kidney biopsy on day 16 revealed focal atn without inflammation and patient was continued on dialysis. a third kidney biopsy was done on day 30 in view of nonrecovering renal failure, which showed recovering atn and changes of calcineurin inhibitor toxicity. tac doses were reduced and subsequently his urine output increased and renal functions gradually improved. he achieved a minimum creatinine of 1.3 mg / dl at 2 months of transplant. in his next visit after 2 weeks, patient developed swelling over feet. a 24 h urine collection confirmed proteinuria of 11.8 g / day. at this time, his serum albumin was 1.7 mg / dl, and creatinine, 1.4 mg / dl. a repeat kidney biopsy was done at 3 months, which revealed segmental sclerosis in 3/22 glomeruli on light microscopy (lm). there was no interstitial inflammation or tubular atrophy / interstitial fibrosis (ifta) in biopsy [figure 1a ]. electron microscopy revealed diffuse foot process effacement confirming the diagnosis of recurrent fsgs [figure 1d ]. patient was explained about the need of pp ; however, he did not agree for the same. hence, his prednisolone dose was increased to 30 mg / day and tab telmisartan 40 mg / day was added, which was gradually increased to 120 mg / day. prednisolone was gradually tapered to 7.5 mg / day over next 6 months. with this treatment, there was a gradual improvement in proteinuria, which decreased to 600 mg / day at the end of 1 year and creatinine remained between 1.2 and 1.4 mg / dl. serum albumin also increased to 3.2 g. after 1 year, proteinuria again increased to 2 g / day on reducing telmisartan to 40 mg / day, as he had hypotension and dizziness. a repeat kidney biopsy revealed global sclerosis in 3/19 glomeruli, segmental sclerosis with hyalinosis in 6 glomeruli, synechia formation in 3 glomeruli, and ifta in 1015% of the cortical area [figure 1b and c ]. biopsy findings suggested that despite control of proteinuria and apparently normal serum creatinine, the histological changes continued to progress. at this time again, treatment with plasmapheresis and rituximab was discussed with patient, however he was not willing. subsequently, his prednisolone was increased to 20 mg / day and telmisartan to 120 mg / day. this resulted in gradual improvement in proteinuria to 500 mg / day over the next 1 year. now, after completion of 4 years of transplant, patient is doing well with serum creatinine of 1.41.5 mg / dl, and proteinuria between 250 and 500 mg / day. his current immunosuppression includes tab prednisolone 7.5 mg / day, mycophenolate sodium 360 mg twice daily, and tac 1 mg twice daily (level 45 ng / ml). (a) by light microscopy, the initial biopsy show focal segmental glomerulosclerosis ; however, no tubular atrophy or interstitial fibrosis was noted (b) by light microscopy, the following biopsy show focal segmental glomerulosclerosis, occasional globally sclerosed glomerulus along with mild patchy tubular atrophy occupying 1015% of the sampled cortex (c) higher magnification of the 5 allograft biopsy show lesion of segmental sclerosis with hyalinosis and synechiae formation (d) electron microscopy performed on 4 allograft biopsy show extensive foot process effacement the risk factors for recurrence are early age of presentation of ns, rapid progression to esrd, presence of mesangioproliferation in kidney biopsy, and retransplant, etc. early recurrence is more common, occurs within few days of transplant and is associated with massive proteinuria and delay in treatment may lead to rapid deterioration of renal function. kidney biopsy within few days after transplant is normal on lm, except the presence of diffuse foot process effacement in electron microscopy. another feature of recurrent fsgs found in some reports is higher chances of acute rejection and atn. our patient had delayed graft function and initial biopsies within 1 month revealed changes of acr and atn without any segmental sclerosis. however, as kidney function improved, patient was found to have heavy proteinuria with hypoalbuminemia and kidney biopsy at 3 months confirmed recurrence of fsgs [figure 1a and d ]. our patient did not have pretransplant biopsy, so there was a possibility of de novo fsgs ; however, de novo fsgs usually presents late. one series found that the mean time of diagnosis of de novo fsgs after transplantation was 57 months. most studies demonstrate remission rates between 50% and 60% with pp, but most patients relapse after stopping pp, suggesting that such treatment induces transient rather than sustained remission and graft survival is significantly inferior to patients without recurrence. it is possible that, despite initial remission of proteinuria, the histological changes continue to progress. our patient had progression of histological changes at 1 year, despite control of proteinuria and normal renal function. some reports have advocated intensifying immunosuppression, for example, replacement of azathioprine with cyclophosphamide or using high doses of cyclosporine. angiotensin - converting enzyme inhibitors (aceis) are shown to reduce proteinuria in one case report, but in this report aceis were used with pp. our patient responded to the slight increase in dose of corticosteroids, and use of arb without pp and is doing well after 4 years of transplant. savin. demonstrated that a circulating factor of 3050 ka protein is associated with increased permeability to albumin in rats. wei. demonstrated that soluble urokinase - type plasminogen activator receptor (supar) is most likely this factor ; however, more recent work has shown that supar is not correlated with proteinuria in recurrent fsgs and increased levels are found in other causes of proteinuria as well as other diseases. to summarize, this case report highlights two things : first and foremost is that some patients with post - transplant fsgs might respond to mild increase in steroid doses and optimal use of ace inhibitors / arb without pp and second despite the clinical response, the histological lesions may continue to progress.	recurrence of focal segmental glomerulosclerosis (fsgs) is common after kidney transplantation. plasmapheresis (pp) is considered to be the most effective treatment ; however, results are variable and relapse is common after stopping plasmapheresis. here, we report an unusual case of recurrent fsgs, who achieved complete remission with angiotensin receptor blocker therapy.

Subsets and Splits

No saved queries yet

Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.