article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
blow - out fracture of the inferior orbital wall is defined as fracture of an outer wall that supports the lower part of an orbit by the impact of blunt trauma, producing increased internal pressure. the importance of the diagnosis to treatment of the blow - out fracture is rising because of industrialization, increasing transportation speed, and increased violent accidents. for the diagnosis of orbital trauma, computed tomography (ct) is the most accurate radiologic imaging technique. although a fracture of the orbital inferior wall was in the past often difficult to detect by two - dimensional radiography, ct allows these injuries to be diagnosed much more readily. the coronal plane of ct is especially useful for the inferior wall fracture. while ct is more accurate, there are no obvious guidelines to predict prognosis or to decide surgical repair. evaluating the location and amount of fracture with altered volume and extents of orbit provides objective indicator of a blow - out fracture. this study assessed the association between eye symptoms (enophthalmos or diplopia) and site of damage, volume, deviated inferior rectus muscle (irm) and type of fracture with ct. the intent is to anticipate the prognosis of orbital trauma at the early stage and provide indications to decide surgical repair. from january 2009 to april 2014, 63 patients who came to pusan national university hospital with a chief complaint of orbital injury were diagnosed with orbital floor fracture. patients with fracture of both orbits were excluded because it was impossible to measure the relative value of fragment deviation. every patient underwent ct, and age, sex, cause of injury, location of fracture, and symptoms were documented in the medical record. of the patients who underwent surgery, the following were evaluated : operating method, material, change in symptom, diplopia, and the limit of eyeball movement. if the difference was more than 2 mm, it was judged that patient had enophthalmos. the boundary was sectioned into anterior border (50% of infraorbital rim using coronal plane image s boundary), posterior border (optic canal), and medial border (ethmoidomaxillary suture) (fig. the length of orbital floor (l), length between medial anatomic landmark to fragment s internal border (x) and external border (y), and each fragment of volume in the bone fragment s movement was measured. for each measured value, ct slice (3 mm) was multiple to estimate the area of bone fragment as well as the absolute value of malposition volume. relative value was calculated by dividing non - damaged side of orbital floor length and volume of orbit. v=(snn1an)v0 e = snn1(yxl) v = displaced tissue volume, s = slice (3 mm), n = total number of slices, v0=volume of opposite orbital side, e = area of fracture segment displacement of the irm increases the risk of eye symptoms. irm displacement was classified by the relative location of irm and an imaginary line between the medial and lateral boundary of the fracture site on the sagittal plane (fig. if the line is located just above the orbital floor, irm displacement is classified as grade 1, the line lying on the orbital floor but more than half located inside the orbit is grade 2, more than half of the line outside of the orbit is classified as grade 3, and completely outside of the orbit is grade 4. there are two broad types of inferior orbital wall fracture : trap - door (one side of bone fragment is attached to the orbital floor), and punched - out (both sides of bone fragment are unattached) (fig. the authors assessed the association between symptom status (enophthalmos or diplopia) and site of damage, volume, deviated irm and type of fracture with ct using the non - parametric mann - whitney test or kendall s tau as appropriate. kendall s tau (a type of rank correlation) provides a distribution - free test of independence and a measure of the strength of association between two variables. null hypotheses of no association were rejected if p - values were less than 0.05. data were analysed using the ibm spss statistics ver. 20.0 (ibm co., armonk, ny, usa). of 45 patients, 39 (86.7%) were male and 6 (13.3%) were female. the patients were sorted into two groups based on symptom status (enophthalmos or diplopia). the symptom - free group (group a) included 27 patients, of whom five underwent surgery. although these five patients had no symptoms, they underwent surgical reconstruction of the orbital floor because their displacement was large enough to predict delayed symptom occurrence. this group consisted of 18 people : 12 with diplopia, one with enophthalmos, and five with both. the association of the primary outcome, symptoms of diplopia or enophthalmos, was tested with three predictor variables : the extent of the damaged area by volume, the amount of irm deviation, and type of fracture. by ct measurement, the average fracture area was 242.0 mm (12.4737.0 mm) and average herniated volume of inferior wall was 10,88.2 mm (13.24,172.2 mm) (table 2). the group a mean area was 192.6 mm (12.4426.0 mm) and mean volume was 673.2 mm (13.22,343.0 mm). the group b area was 316.2 mm (95.7737.0 mm) and volume was 1,710.6 mm (275.44,172.2 mm). symptom status was associated with both affected area and herniated volume (p < 0.05). the comparative effect of volume and area on symptom status was analyzed by kendall s tau test. the association of volume with symptom status by kendall s tau was 0.07, smaller than the association of area with symptom status, 0.28. our interpretation is that volume is more influential in symptom status. whether symptom status included both diplopia and enophthalmos or just one symptom did not affect the associations with area and volume. irm displacement was categorized into four grades by the location of rectus muscle. in group a, 12 patients were grade 1, 11 were grade 2, four were grade 3, and none were grade 4. of group b patients, three were grade 1, two were grade 2, six were grade 3, and six were grade 4 (table 3). symptom status and higher grade were associated based on the correlation analysis in groups (p < 0.05). although correlation between the displacement of irm and the area of fracture site was low, the connection with displaced volume is statistically significant. also, both diplopia and enophthalmos occurred when irm displacement degree was high. there were 26 patients with trap - door fracture (one side - attached to the fracture) and 19 with punched - out (both sides detached). in group a, there were 19 trap - door type and eight punched - out type. in group the punched - out type is more strongly associated with symptom status and is statistically significantly associated with increase of area and volume (p < 0.05) (table 4). by ct measurement, the average fracture area was 242.0 mm (12.4737.0 mm) and average herniated volume of inferior wall was 10,88.2 mm (13.24,172.2 mm) (table 2). the group a mean area was 192.6 mm (12.4426.0 mm) and mean volume was 673.2 mm (13.22,343.0 mm). the group b area was 316.2 mm (95.7737.0 mm) and volume was 1,710.6 mm (275.44,172.2 mm). symptom status was associated with both affected area and herniated volume (p < 0.05). the comparative effect of volume and area on symptom status was analyzed by kendall s tau test. the association of volume with symptom status by kendall s tau was 0.07, smaller than the association of area with symptom status, 0.28. our interpretation is that volume is more influential in symptom status. whether symptom status included both diplopia and enophthalmos or just one symptom did not affect the associations with area and volume. irm displacement was categorized into four grades by the location of rectus muscle. in group a, 12 patients were grade 1, 11 were grade 2, four were grade 3, and none were grade 4. of group b patients, three were grade 1, two were grade 2, six were grade 3, and six were grade 4 (table 3). symptom status and higher grade were associated based on the correlation analysis in groups (p < 0.05). although correlation between the displacement of irm and the area of fracture site was low, the connection with displaced volume is statistically significant. also, both diplopia and enophthalmos occurred when irm displacement degree was high. there were 26 patients with trap - door fracture (one side - attached to the fracture) and 19 with punched - out (both sides detached). in group a, there were 19 trap - door type and eight punched - out type. in group the punched - out type is more strongly associated with symptom status and is statistically significantly associated with increase of area and volume (p < 0.05) (table 4). surgical reconstruction of orbit wall must be considered when traumatic diplopia and enophthalmos occur. however, because symptoms can occur not just immediately after the injury but after two or three weeks have passed, deciding whether to treat surgically is difficult. therefore, it is important to predict whether the orbit wall fracture will cause delayed eye symptoms like diplopia or enophthalmos. commonly used surgical indications for reconstructing the orbit wall are clinical diplopia, herniation of orbital tissue on ct image, enophthalmos more than 2 mm, and large fracture that passes over half of orbital bone[11 - 14 ]. in this study, criteria predictive of symptom status were examined using the most generalized medium for diagnosis, ct. manson. insisted that the degree of enophthalmos is directly proportional to the herniated volume of orbital tissue caused by a blow - out fracture that widens the fracture area. measuring the altered area and volume of orbital floor fracture using ct will be helpful to predict the degree of enophthalmos and to decide the feasibility of surgery. ploder. found area and volume of deviated orbital tissue by measuring the width and height of fracture on coronal plane. jin. assumed that the deviated fragment is an oval, and calculated the area and volume of tissue fallen off by measuring width, length and height. the volume of the injured orbit can nowadays be compared with the non - affected side using three - dimensional images. in this case, the error can occur up to 7% to 8% in volume difference of both orbits and error can be made by each observer who establishes the orbit area. in this study, area and volume of fragment were calculated by adding up the length and width of bone fragments in each coronal ct image. by using this method, relative accuracy can be secured by measurement reproducibility in definite anatomical structure. in this study, the association of eye symptoms with types of fracture, location of irm, and area and volume of bone fragment measured using ct was evaluated. the findings were interpreted to mean that as deviated bone fragment area and volume of herniated tissue increase, the more symptoms occur. also, of volume and area, therefore, malposition of irm by more than half of the orbital floor significantly affects the presence of symptoms. three of 13 (23.1%) patients who had one symptom were grade 4 while three of five (60%) patients who had both eye symptoms were grade 4 (irm with complete orbital floor herniation). insisted that surgery be considered when the grade was more than 2, and occurrence of symptoms was more frequent in grade 3 and 4. according to thaller - antlanger s research, type of fracture had a significant effect on prognosis, with punched - out fracture followed by orbital rim fracture predicting a poor prognosis. we found that punched - out type were less common (42%), and more related to occurrence of symptoms than trap - door type. in addition, four out of five patients who had enophthalmos and diplopia had punched - out fractures. a 57-year - old female patient presented with a punched - out type fracture by ct resulting from a pedestrian traffic accident. her symptoms were not serious, with no transition of bone fragment, and no enophthalmos and/or diplopia. after two weeks, she had delayed surgery because enophthalmos of 2 mm and slight diplopia developed. presumably, two bone fragments could not support the orbit structure due to gravity and the symptoms developed. such an unusual case helps support the hypothesis that punched - out type fractures have a stronger association with symptom occurrence. the sample size was small, and, especially, grade 3 and 4 of serious irm deviation were few. measurement reproducibility on ct, measuring area and volume of deviated bone fragment was difficult. to conclude from our results, area, volume, location of irm, and type of fracture measurement of fracture area and volume, evaluation of the deviated irm and classification of the fracture type by coronal ct are effective for predicting the prognosis and surgical indication. among these, the volume of deviated tissue is more strongly related to symptoms than the area of bone fragment. when the irm is more than half out of orbital floor, punched - out fractures have a higher risk of symptom occurrence and surgical treatment should be considered to reconstruct the structure. this study investigated and targeted 45 patients with orbital blow - out fracture visiting the department of oral and maxillofacial surgery of the dental clinic center in pusan national university hospital located at busan, including both outpatient and emergency room visits from january 2009 to april 2014. the purpose of this study is to review the association between the occurrence of enophthalmos or diplopia, and damaged area, volume, deviated irm and type of fracture by using the ct, to anticipate the prognosis of orbital trauma on the early stage, and to provide an indicator for the decision of surgical reconstruction of the orbital floor. the results of the investigation are shown below. the more deviated bone fragment area and volume of herniated tissue increase, the stronger the risk of symptom occurrence. also, between volume and area, volume is more related.deviation of irm more than half of orbital floor (grade 3 and 4) affects significantly the occurrence of symptoms.while punched - out fractures are less common, they are more associated with occurrence of symptoms than trap - door type and are more important in the increase of volume and area. the more deviated bone fragment area and volume of herniated tissue increase, the stronger the risk of symptom occurrence. also, between volume and area, volume is more related. deviation of irm more than half of orbital floor (grade 3 and 4) affects significantly the occurrence of symptoms. while punched - out fractures are less common, they are more associated with occurrence of symptoms than trap - door type and are more important in the increase of volume and area. injured orbital area, herniated volume, deviation of irm and type of fracture are all related to eye symptoms. in orbital trauma, measurement of fracture area and volume, evaluation of the deviated irm and classification of the fracture type by coronal ct are effective for the management of orbital trauma and predicting the prognosis. | purpose : this study assessed the association between eye symptoms (enophthalmos or diplopia) and site of damage, volume, deviated inferior rectus muscle (irm) and type of fracture with computed tomography (ct). the intent is to anticipate the prognosis of orbital trauma at initial diagnosis.methods:forty-five patients were diagnosed with fractures of the inferior wall of one orbit. fracture area, volume of displaced tissue, deviated irm, and type of fracture were evaluated from coronal ct by one investigator. the association of those variables with the occurrence of eye symptoms (diplopia and enophthalmos) was assessed.results:of 45 patients, 27 were symptom - free (group a) and 18 had symptoms (group b) of enophthalmos and/or diplopia. in group b, 12 had diplopia, one was enophthalmos, and five had both. by ct measurement, group a mean area was 192.6 mm2 and the mean volume was 673.2 mm3. group b area was 316.2 mm2 and volume was 1,710.6 mm3. the volume was more influential on symptom occurrence. each patient was categorized into four grades depending on the location of irm. symptom occurrence and higher grade were associated. twenty - six patients had trap - door fracture (one side, attached to the fracture), and 19 had punched - out fracture (both sides detached). the punched - out fracture was more strongly associated with symptoms and had statistically significantly higher area and volume.conclusion:in orbital trauma, measurement of fracture area and volume, evaluation of the deviated irm and classification of the fracture type by coronal ct can effectively predict prognosis and surgical indication. |
microbial ecologists have devoted considerable effort to understanding the nature of the viruses in seawater, because viruses have key roles in the evolution, ecology and mortality of marine plankton (rohwer and vega thurber, 2007 ; suttle, 2007). for at least the past two decades, researchers have assumed that the pool of viruses in the ocean is dominated by bacteriophages with dna genomes (steward., 1992 ; breitbart., 2002 ; weinbauer, 2004 ; comeau., 2010 ; sullivan., 2010). perhaps as a consequence, studies of the molecular diversity of marine viruses have most commonly (exclusively, before 2003) focused on dna viruses (edwards and rohwer, 2005 ; kristensen., however, evidence that rna viruses are important contributors to marine plankton ecology has been steadily accumulating (lang., 2009). the isolation of a positive - sense, single - stranded rna (ssrna) virus that infects the raphidophyte heterosigma akashiwo (harnav) was the first recorded instance of an rna virus infecting a marine protist (tai., 2003). this was followed by reports of similar picorna - like ssrna viruses infecting diatoms (nagasaki., 2004 ; shirai., 2008 ; tomaru., molecular surveys using degenerate primers to target the rna - dependent rna polymerase gene of picorna - like viruses have shown that, in addition to the handful of isolates, a very diverse pool of uncultivated picornavirads exist in seawater (culley., 2003 ; a double - stranded rna virus infecting the abundant marine prymnesiophyte micromonas pusilla represents a new genus in the family reoviridae (brussaard., 2004). a positive - sense, ssrna virus that infects the dinoflagellate heterocapsa circularisquama (tomaru., 2004) is only distantly related to existing viral families (nagasaki., 2005) and may represent a new family. metagenomic surveys of the rna viral fraction of seawater are consistent with the view provided by the limited number of isolates available so far, and suggest that the positive - sense, single - stranded picornavirads dominate the marine rna virus pool, but other diverse rna viruses, including some containing double - stranded rna, are present as well (culley., 2006). despite the emerging evidence that marine rna viruses are diverse and infect ecologically important members of the marine planktonic food web, there have been no reports that satisfactorily address the question of whether these viruses constitute a substantial fraction of the total virioplankton. this question is of considerable ecological interest, because, unlike the pool of dna viruses in seawater, which is composed predominantly of bacteriophage - like sequences (edwards and rohwer, 2005), marine rna viruses are almost exclusively comprised of those that infect eukaryotes (lang., 2009). directly quantifying the abundance of rna viruses in a mixed viral assemblage has proven difficult, because of technical limitations. differences in counts using a dna - specific stain vs a nonspecific nucleic acid stain have been reported (weinbauer and suttle, 1997 ; guixa - boixereu., 1999 ; bettarel., 2000), but the results are of uncertain significance, because the stains differ in their sensitivity (weinbauer, 2004). in particular, the small genomes of single - stranded dna and rna viruses make the individual virions difficult to detect even with appropriate stains (brussaard. 2012). given the difficulties of obtaining reliable direct counts of rna viruses, we took a different approach. in the work reported here, we measured the relative masses of rna and dna in natural assemblages of viruses purified from tropical coastal seawater and coupled this with estimates of the mass of nucleic acid per rna or dna virion to obtain the first estimates of the relative abundance of rna viruses in seawater. the samples for this study were collected from a pier in the southern portion of kne'ohe bay on the windward side of o'ahu, hawaii (21 25 46.80 n, 157 47 31.51 w). this tropical embayment is characterized by year - round warm temperatures (22 c to 28 c) and salinities ranging from 32 to 35, except during periods of heavy rain, when freshwater plumes from stream runoff can transiently suppress salinity to 2 s.d. from the mean length or had an average phred score of 2 s.d. from the mean length or had an average phred score of 0.5) by the dnase treatment that we applied to all of our samples before rna assay (figure 1). the majority of dna (8390%, depending on the sample) fell within a range of buoyant densities from 1.33 to 1.53 g ml with a peak around 1.45 g ml (figure 2). this buoyant density range and the peak location are similar to previous observations for dna - containing viruses from other marine environments (steward., 2000) and is well within the range for all known viruses (1.161.6 ; king., 2012). rna concentrations displayed a local peak at the same density with 3269% of the total in the same viral range. dna and rna were also found in higher density fractions nearer to, or at, the bottom of the gradient. as these fractions are outside the known range of viral buoyant densities, data from them were not included in subsequent analyses. for the metagenomic libraries prepared from rna within the viral density range (figure 2), the number of quality - controlled, de - replicated reads was 139 801 and 110 140 for the 2009 and 2010 samples, respectively (table 1). the majority of reads (6978%) in both libraries formed contigs with maximum lengths of 9378 bp for august and 9480 bp for june. we found that, after assembly and classification of the sequences in the rna viral metagenomes, roughly half (5057%) of the reads derived from the designated viral fractions were most similar to known eukaryote - infecting rna viruses, with the majority matching positive - sense, ssrna viruses in the order picornavirales (table 2). the percentage of sequences matching known double - stranded rna viruses was very small (0.021.2%). the calculated weighted average mass of rna per virion was 5.38 10 g in august and 5.25 10 g in june (table 2), which translate into weighted average genome sizes of 9528 nt and 9301 nt, respectively. the average of these (9414 nt) is very similar to the maximum contig lengths observed in each library and somewhat larger than the three complete rna virus genomes (ranging from 4449 to 9212 nt) assembled from a sample from coastal british columbia (culley., 2007). less than half of the reads (4143%) had no significant matches in genbank. we presume that most of these unidentified sequences are viral as well, because many otherwise unidentifiable sequences were found to assemble with virus - like sequences and the fraction of reads identified as cellular was small (table 2). estimates of cellular contamination in each library based on blastn comparisons with the silva database (6.1% and 0.7%) were nearly identical to those based on blastx comparisons with genbank nr database (6.7% and 0.8% of the sequences). the reads identified as cell derived by the former method were a subset of those identified by the latter. the identification of all of the putative ribosomal rna reads by blastx was somewhat surprising, but appears to be a result of mis - annotations of ribosomal rna genes as hypothetical proteins in genbank. as the blastx annotations used for megan were more comprehensive in the assignment of cell - derived reads, the larger percentages from that method were accepted as correct. after adjusting the rna mass estimates to discount the contribution from cellular rna, our estimates put the contribution of rna viruses to the total number of viruses at 3863% (table 3). by applying more conservative and more liberal assumptions, we calculated extreme high and low estimates that ranged from 15% to 77% (table 3). the absolute numbers for both types of viruses in our final samples are minimum estimates, because of losses during processing. assuming typical viral concentrations for these waters based on epifluorescence microscopy to be on the order of 0.5 to 1 10 per liter, this implies overall final yields of dna viruses on the order of 1733% (june) and 59% (august), but these estimates have considerable uncertainty. in the absence of data to the contrary, we assume these losses to be similar for rna and dna viruses. if dna viruses were preferentially lost, this would have led to overestimates of the contribution of rna viruses. some of the largest viruses (especially those > 0.2 m in diameter) will be lost by the initial 0.2 m filtration and all of the largest viruses known so far contain double - stranded dna (king., 2012), suggesting that the purification procedure will have some bias against dna viruses. however, the numerical contribution of viruses > 0.2 m to the total virioplankton appears to be low based on quantitative surveys using electron microscopy (bratbak., 1992 ; cochlan., 1993 ; wommack and colwell, 2000 ; auguet., 2006). the viral concentration method we used has not been tested specifically on rna viruses, but is reported to be exceptionally efficient for dna viruses (john., 2011). we were also more conservative in our assignment of rna as viral compared with dna. from the above considerations, we feel it is unlikely that we have grossly overestimated the contribution of rna viruses, but we can not conclusively rule out the possibility that our procedure is significantly biased against dna viruses. if rna viruses are as abundant as our data suggest, this would have important consequences for our understanding of marine viral ecology. the data imply, for example, that eukaryotic viruses can be just as abundant as bacteriophages in coastal ocean waters, despite the fact that the eukaryotic plankton concentrations are orders of magnitude lower than those of bacteria. it seems that the much larger burst sizes of eukaryotic rna viruses (thousands to tens - of - thousands ; lang., 2009) relative to those of bacteriophages (tens to hundreds ; wommack and colwell, 2000), compensates for the lower host abundances. this is consistent with earlier theoretical work based on mass transport calculations (murray and jackson, 1992). at the time of that report, only dna viruses with relatively small burst sizes were known to infect marine protists. as a consequence they point out, however, that small viruses having a large burst size (that is, those like the rna viruses that we now know exist), could have a large contribution to protistan mortality. as rna viruses and single - stranded dna viruses are not reliably detected with the current routine methods for viral direct counts, our data also suggest that many rate estimates that depend on fluorescence - based viral direct counts, such as viral turnover times, virus host contact rates and viral production rates, may be in need of revision. development of new methods to directly count even the smallest viruses would be helpful in better constraining the rates of these important processes. in the meantime, the approach we described here provides a means to estimate the relative contribution of rna viruses in natural aquatic habitats to determine whether our observations are more broadly representative of marine and freshwater habitats. | viruses are abundant in the ocean and a major driving force in plankton ecology and evolution. it has been assumed that most of the viruses in seawater contain dna and infect bacteria, but rna - containing viruses in the ocean, which almost exclusively infect eukaryotes, have never been quantified. we compared the total mass of rna and dna in the viral fraction harvested from seawater and using data on the mass of nucleic acid per rna- or dna - containing virion, estimated the abundances of each. our data suggest that the abundance of rna viruses rivaled or exceeded that of dna viruses in samples of coastal seawater. the dominant rna viruses in the samples were marine picorna - like viruses, which have small genomes and are at or below the detection limit of common fluorescence - based counting methods. if our results are typical, this means that counts of viruses and the rate measurements that depend on them, such as viral production, are significantly underestimated by current practices. as these rna viruses infect eukaryotes, our data imply that protists contribute more to marine viral dynamics than one might expect based on their relatively low abundance. this conclusion is a departure from the prevailing view of viruses in the ocean, but is consistent with earlier theoretical predictions. |
the national health insurance system in taiwan is compulsory and covers all citizens except prisoners. the taiwan national health insurance research database (nhird) was released for research purposes by the national health research institute (19) and is one of the largest and most comprehensive databases in the world. information included in the inpatient database incorporated sex, date of birth, encrypted patient identification numbers, residential or work area, dates of admission and discharge, medical institutions providing the services, the international classification of diseases (ninth revision) clinical modification (icd-9-cm) codes of diagnoses (up to five) and procedures (up to five), outcome at hospital discharge (recovered, died, or transferred out), order codes, and hospital charges. the approval from the human subjects institutional review board and informed consent from the patients were exempt for the use of the encrypted administrative database. the patients were described in a recent study on the epidemiology of first - attack ap in taiwan from 2000 through 2009 (1). we validated the diagnostic code previously, showing a positive predictive value of 90.0% (95% ci 79.296.2%) (1). severity criteria of ap were defined primarily according to the atlanta classification scheme (20), but were modified into the presence of intensive care unit (icu) admission (as a surrogate of acute physiology and chronic health evaluation [apache ] ii score 8), organ failure or dysfunction (supplementary table 1), gastrointestinal bleeding (supplementary table 1), or local complications (defined by physician - order codes for drainage of pancreatic abscesses or cysts) (1,3). between 2000 and 2009 (inclusive), we identified 106,458 patients (15 years) with first - attack ap from the nhird ; among them, 18,990 (17.8%) had diabetes (fig. diabetes was defined by icd-9-cm code 250.x, including those with (codes 250.4, 250.5, 250.6, 250.7) and without (250.0, 250.1, 250.2, 250.3, 250.8, 250.9) diabetes - related complications, in any position of the five diagnosis codes. because diabetic ap patients were older (median age 58 vs. 51 years) and had less male predominance (59.3 vs. 66.2%) than nondiabetic ones, we managed to achieve the comparability of the study groups by performing a frequency matching technique on sex, 5-year age strata, and year of admission without replacement. with a nondiabetes - to - diabetes ratio of 2, we randomly selected 37,980 nondiabetic ap patients. to better understand the effect of diabetes on outcomes of ap patients especially as relates to mortality, five levels of covariates first, patient demographics included age, sex, year of admission, and urbanization level (including urban, suburban, and rural areas) (1). second, hospital features included only hospital level (including medical center [> 500 beds ], regional [250500 beds ], and district hospitals [20249 beds ]). third, pancreatitis characteristics were prevalence of selected comorbid conditions, charlson comorbidity index (21,22), causes of ap (biliary or alcohol - related) (3), computed tomography, and severity criteria (including icu admission, organ failure, gastrointestinal bleeding, and local complications). fourth, inpatient stay features were related to processes of care, length of hospital stay, and various treatments, including endoscopic retrograde cholangiopancreatography (ercp), cholecystectomy, and life - supporting measures (including total parenteral nutrition, hemodialysis and use of vasopressors and mechanical ventilation) (3). the charlson comorbidity index is a weighted summary measure of clinically important concomitant diseases that has been adapted for use with icd-9-cm coded administrative databases (supplementary table 2) (21,22). because diabetes mellitus is a variable of primary interest in this study, diabetes with or without complications the severe criteria, including icu admission, organ failure, gastrointestinal bleeding, and local complication, were examined jointly and separately. continuous variables are presented as median (interquartile range) owing to a skewed distribution ; discrete ones are presented as count or percentage. in the univariate analysis, we used the mann - whitney u test (for continuous variables) or the test (for discrete ones) to compare differences between patients with and without diabetes. to account for hospital clustering, the effect of diabetes was analyzed using logistic regression model with generalized estimating equations methods (23), specifying an exchangeable structure of a working correlation matrix, to construct regression models. analyses were performed to yield the crude and adjusted risks. in the multivariable analysis for risk of severe ap, we adjusted only for patient demographics, hospital level, causes of ap (alcohol, biliary, both, and others) and charlson comorbidity index (0, 1, 2, 3 +). in the multivariable analysis for the risk of hospital mortality, we performed five sequential regression models adjusting for the five levels of covariates, consecutively and additively. to assess the effect of diabetes - related complications on hospital mortality, the above analyses were repeated by stratifying patients with diabetes according to the status of these complications. the multicollinearity among covariates was examined and found if a tolerance level was less than 0.1. (spss, chicago, il). a two - tailed p value of 500 beds ], regional [250500 beds ], and district hospitals [20249 beds ]). third, pancreatitis characteristics were prevalence of selected comorbid conditions, charlson comorbidity index (21,22), causes of ap (biliary or alcohol - related) (3), computed tomography, and severity criteria (including icu admission, organ failure, gastrointestinal bleeding, and local complications). fourth, inpatient stay features were related to processes of care, length of hospital stay, and various treatments, including endoscopic retrograde cholangiopancreatography (ercp), cholecystectomy, and life - supporting measures (including total parenteral nutrition, hemodialysis and use of vasopressors and mechanical ventilation) (3). the charlson comorbidity index is a weighted summary measure of clinically important concomitant diseases that has been adapted for use with icd-9-cm coded administrative databases (supplementary table 2) (21,22). because diabetes mellitus is a variable of primary interest in this study, diabetes with or without complications primary outcome was hospital mortality (1). secondary outcome was the development of severe ap the severe criteria, including icu admission, organ failure, gastrointestinal bleeding, and local complication, were examined jointly and separately. continuous variables are presented as median (interquartile range) owing to a skewed distribution ; discrete ones are presented as count or percentage. in the univariate analysis, we used the mann - whitney u test (for continuous variables) or the test (for discrete ones) to compare differences between patients with and without diabetes. to account for hospital clustering, the effect of diabetes was analyzed using logistic regression model with generalized estimating equations methods (23), specifying an exchangeable structure of a working correlation matrix, to construct regression models. analyses were performed to yield the crude and adjusted risks. in the multivariable analysis for risk of severe ap, we adjusted only for patient demographics, hospital level, causes of ap (alcohol, biliary, both, and others) and charlson comorbidity index (0, 1, 2, 3 +). in the multivariable analysis for the risk of hospital mortality, we performed five sequential regression models adjusting for the five levels of covariates, consecutively and additively. to assess the effect of diabetes - related complications on hospital mortality, the above analyses were repeated by stratifying patients with diabetes according to the status of these complications. the multicollinearity among covariates was examined and found if a tolerance level was less than 0.1. (spss, chicago, il). a two - tailed p value of < 0.05 was considered significant. when compared with nondiabetic ones, ap patients with diabetes were somewhat more likely to live in an urban area and to be admitted to regional hospitals. they also had fewer biliary and alcohol - related causes and had smaller charlson comorbidity index scores. however, the prevalence of certain comorbid conditions, including cerebrovascular, cardiovascular, and renal diseases, was higher in diabetic ap patients than in nondiabetic ones. hepatic disease and peptic ulcer were the most common comorbid conditions and were less prevalent in ap patients with diabetes. characteristics of the patients with ap according to the presence of diabetes additionally, diabetic ap patients received fewer invasive procedures of ercp and cholecystectomy but more computed tomography, insulin therapy, and life - supporting treatments, especially hemodialysis and mechanical ventilation, than nondiabetic ones. the length of hospital stay was slightly longer in diabetic ap patients than in nondiabetic ones. table 2 shows the effect of diabetes on the risks of a criteria - specific severe attack in patients with ap. after adjustment was made for patient demographics, hospital level, causes of ap, and charlson comorbidity index, diabetes was associated with a 21% increased risk of any severe attack. however, when these severity criteria were analyzed separately, the ap patients with diabetes suffered from a 58% higher risk of icu admission and a 30% higher risk of local complications, but experienced a 16% lower risk of gastrointestinal bleeding, than control subjects. the risk of organ failure (1 system) was similar between the two groups. however, the relative risk of failure in individual organ systems varied : diabetes was associated with a reduced risk of cardiovascular (odds ratio [or ] = 0.82), hepatic (or = 0.71), and hematologic (or = 0.47) failures but associated with an increased risk of renal (or = 1.20) and metabolic (or = 1.49) failures. the risks of neurologic and respiratory failures were similar in both groups. the effect of diabetes on the risk of severe attack in patients with ap hospital mortality was lower in diabetic ap patients than in nondiabetic ones (3.5% vs. 4.1%, p < 0.001). as shown in table 3, diabetes was associated with a lower risk of death in the five sequential models. the effect of diabetes was similar in model 1 and model 2 (or and 95% ci 0.83 [0.700.99 ] and 0.84 [0.720.98 ], respectively), slightly increased in model 3 (0.70 [0.620.79 ]), and then attenuated in model 4 (0.82 [0.720.95 ]). after all potential confounders (model 5) were controlled, diabetes was associated with a 23% lower risk of hospital mortality (0.77 [0.650.91 ]). no interaction was seen in stratified analysis by presence of diabetes - related complications (i.e., nephropathy, neuropathy, vasculopathy, or retinopathy). the effect of diabetes on the risk of hospital mortality in patients with ap when compared with nondiabetic ones, ap patients with diabetes were somewhat more likely to live in an urban area and to be admitted to regional hospitals. they also had fewer biliary and alcohol - related causes and had smaller charlson comorbidity index scores. however, the prevalence of certain comorbid conditions, including cerebrovascular, cardiovascular, and renal diseases, was higher in diabetic ap patients than in nondiabetic ones. hepatic disease and peptic ulcer were the most common comorbid conditions and were less prevalent in ap patients with diabetes. characteristics of the patients with ap according to the presence of diabetes additionally, diabetic ap patients received fewer invasive procedures of ercp and cholecystectomy but more computed tomography, insulin therapy, and life - supporting treatments, especially hemodialysis and mechanical ventilation, than nondiabetic ones. the length of hospital stay was slightly longer in diabetic ap patients than in nondiabetic ones. table 2 shows the effect of diabetes on the risks of a criteria - specific severe attack in patients with ap. after adjustment was made for patient demographics, hospital level, causes of ap, and charlson comorbidity index, diabetes was associated with a 21% increased risk of any severe attack. however, when these severity criteria were analyzed separately, the ap patients with diabetes suffered from a 58% higher risk of icu admission and a 30% higher risk of local complications, but experienced a 16% lower risk of gastrointestinal bleeding, than control subjects. the risk of organ failure (1 system) was similar between the two groups. however, the relative risk of failure in individual organ systems varied : diabetes was associated with a reduced risk of cardiovascular (odds ratio [or ] = 0.82), hepatic (or = 0.71), and hematologic (or = 0.47) failures but associated with an increased risk of renal (or = 1.20) and metabolic (or = 1.49) failures. the risks of neurologic and respiratory failures were similar in both groups. the effect of diabetes on the risk of severe attack in patients with ap hospital mortality was lower in diabetic ap patients than in nondiabetic ones (3.5% vs. 4.1%, p < 0.001). as shown in table 3, diabetes was associated with a lower risk of death in the five sequential models. the effect of diabetes was similar in model 1 and model 2 (or and 95% ci 0.83 [0.700.99 ] and 0.84 [0.720.98 ], respectively), slightly increased in model 3 (0.70 [0.620.79 ]), and then attenuated in model 4 (0.82 [0.720.95 ]). after all potential confounders (model 5) were controlled, diabetes was associated with a 23% lower risk of hospital mortality (0.77 [0.650.91 ]). no interaction was seen in stratified analysis by presence of diabetes - related complications (i.e., nephropathy, neuropathy, vasculopathy, or retinopathy). the effect of diabetes on the risk of hospital mortality in patients with ap in this study, we found that diabetes was associated with an increased risk of severe attacks in patients with ap, but the risk of individual severity criteria for ap associated with diabetes varied in magnitude and direction. ap patients with diabetes had more icu admissions and local complications, but had less frequent gastrointestinal bleeding. despite that the overall risk of organ failure was not affected by diabetes, and the risks of renal and metabolic failures although more severe attacks were seen in ap patients with diabetes, the risk of death was significantly lower in these patients, suggesting a protective effect on mortality by diabetes in first - attack ap patients. our finding of an increased risk of severe ap and a lower risk of death in diabetic ap patients is somewhat different from that found by frey and coworkers (13), who analyzed 84,713 patients with ap from the california patient discharge data in 19922002 to investigate the predictive value of comorbidity. they found that diabetes increased the risk of multiorgan (2 systems) failure (or 1.6, 95% ci 1.41.8), but was not associated with early (14 days) mortality (13). when individual severity criteria were analyzed, we did not find the association between overall organ failure and diabetes. instead, we found that diabetes was associated with increased risks of only icu admission and local complications. because of limited availability of medical order data and incomplete information on diabetes duration, we were unable to further assess the potential roles of incretin - based therapies and disease duration in causing the association of diabetes with severity in ap patients. our study also showed that the effect of diabetes on the risk of organ failure is different across systems. diabetes was found to associate with the increased risk of renal failures and the reduced risk of hematologic failure in ap patients with diabetes. similar results were also found in studies on sepsis and critical illnesses (24,25). a poorer metabolic reserve and a higher prevalence of chronic renal disease in diabetes may explain the higher risk of renal and metabolic failures in diabetic ap patients. on the other hand, the reduced risk of hepatic failure and gastrointestinal bleeding may probably reflect lower prevalence of hepatic disease and peptic ulcer in diabetic patients. although a survival effect might explain the lower prevalence of some comorbid conditions in diabetic patients (because those with multiple comorbidities would die earlier), these findings suggest that comorbidities in patients with ap have important implications in the disease process and call a need for further investigations. recent studies have shown that diabetes is usually associated with a greater severity and morbidity but not necessarily associated with a higher short - term mortality in patients undergoing cardiac surgery (26) or having trauma (27), acute myocardial infarction (28), or critical illnesses (18,29). in fact, a survival advantage of diabetes has been reported in patients with sepsis or critical illnesses including ap (18,24,30). although findings from the current analysis were not perfectly consistent with our research hypothesis, such seemingly beneficial survival effect of diabetes is not unique. it is not clear why diabetes may have such intriguingly protective effect on mortality in ap patients. some explanations addressed in sepsis and critical care studies (24,25,29,31) may be applicable to patients with ap since all these conditions can lead to a systemic inflammatory response syndrome and organ failure (32). the proposed biological mechanisms that favor diabetes during sepsis or critical illnesses include the anti - inflammatory effect of some antidiabetic agents (such as insulin (33) and troglitazone) (34), a less disturbed hemostatic balance (29), an adaptation to hyperglycemia (31), and a protective effect of a higher bmi in diabetic patients (35). however, contrary to the finding in critically ill patients (35), a higher bmi has been shown to predict a severe attack, local complication, and death in ap (36). the discrepant findings may be a result of an increased release of proinflammatory adipokine from peri - pancreatic fat necrosis that is present mainly in obese patients with ap (36). nonbiological explanations for the protective effect of diabetes may include differences in processes of care such as the intensity of acute services, the closeness of monitored care, and the degree of glycemic control. although information on glycemic control was not available in the database, some differences in processes of care might have existed, as reflected by the change of or after adjusting for inpatient stay features (adjusted or changed from 0.70 in model 3 to 0.82 in model 4). although hyperglycemia on admission is associated with an increased risk of organ failure and death in patients with ap (37), prior studies on critically ill patients suggested that the adverse effect of hyperglycemia may be modified by diabetes (30,38). in a retrospective cohort study on 4,946 critically ill patients, egi and coworkers showed that nondiabetic patients were 1.74 times more likely than diabetic ones (n = 728) to die in the icu in the same range of a time - weighted glucose concentration (between 8.0 and 10.0 mmol / l) (30). in addition, they found that hyperglycemia was associated with outcome only in nondiabetic patients but not in diabetic ones (30). these findings suggest that acute and chronic hyperglycemia are distinct pathophysiological entities and hence may have different clinical consequences (31). it would be interesting in future studies to find whether this phenomenon is also present in patients with ap. first, misclassification is likely because the diagnosis of diabetes relies on the coding and the values of blood glucose and glycated hemoglobin are not available in the database. because diabetes is more likely to be underdiagnosed, the misclassification would tend to underestimate the observed differences between patients with and without diabetes. besides, because differentiation between type 1 and type 2 diabetes can not be made in this study, specific interpretations of the study results are therefore limited. second, although it is uncommon that diabetes could have occurred during the period of hospitalization for ap, some patients might have newly diagnosed diabetes before admission for first - attack ap. if a longer duration of diabetes is favorably associated with the survival of ap patients, we believe that inclusion of these newly diagnosed patients with diabetes would tend to underestimate the seemingly protective effect of diabetes. third, the definition of severe ap in this study tended to include patients who had a more severe attack and received intensive and/or invasive treatments. for example, some patients might not be included if they had an apache ii score 8 but were cared for only outside an icu or if they had local complications but did not receive invasive procedures. besides, some patients with organ failures may also be missed or undercoded because of limited number of diagnostic codes. however, the selection of a more severe group of patients is nondifferential and tends to bias the observed effect toward the null. fourth, because first - attack ap was defined by the absence of ap - related hospitalization for at least 4 years before the inclusion, some patients with late relapses, albeit relatively uncommon, might have been enrolled in the study. because we are not aware the respective percentage of patients with late relapses in the two groups, it is hard to assess the potential influence of the inclusion of these patients on the risk estimates. for example, a limited number of spaces for diagnostic codes would reduce the available number of comorbid conditions, if existed, especially in people with diabetes, which might cause residual confounding and is more likely to bias the estimate toward the null. furthermore, the low yield in retrieving the causes would limit the adjustment, especially for biliary and alcohol - related ap. the diagnosis code for obesity (icd-9-cm code 278.0) was present in only 0.2% of the patients, which was apparently undercoded and hence not included in the analysis. besides, important clinical features such as bmi and apache ii score are not available. although the effect of the residual confounding is uncertain, we believe that it is not likely to oppositely change the conclusion. nevertheless, our study is strengthened by the large number of patients retrieved from a national population based database, which can provide an unbiased selection and enhance its generalizability. in conclusion, diabetes is relatively common in patients with ap and has significantly posed an adverse effect on the disease process and a favorable influence on patient mortality risk. future studies are needed to further illustrate the underlying mechanisms with which diabetes may reduce the risk of mortality and to find whether an interaction between hyperglycemia and diabetes is also present in patients with ap. more clinical attention should also be paid to the ap patients who also suffered from diabetes to further reduce the incidence of severe attacks in ap patients. | objectivediabetes may increase the risk of acute pancreatitis (ap). we aimed to further investigate whether diabetes may also adversely affect outcomes of patients with ap.research design and methodsin this retrospective cohort study, we compared 18,990 first - attack ap with diabetes to 37,980 matched control subjects from taiwan s national health insurance research database between 2000 and 2009. primary outcomes were development of severe ap, defined by a modified atlanta classification scheme, and hospital mortality. analyses were performed using univariable and multivariable logistic regression model with generalized estimating equations accounting for hospital clustering effect.resultsafter baseline characteristics were adjusted, ap patients with diabetes had a higher risk of a severe attack than their nondiabetic counterparts (adjusted odds ratio [or ] 1.21, 95% ci 1.161.26). when severity criteria were analyzed individually, diabetic ap patients had a 58% higher risk of intensive care unit admission and a 30% higher risk of local complications, but a 16% lower risk of gastrointestinal bleeding, than ap patients without diabetes. the risk of organ failure at least one system) was similar between the two groups. conversely, ap patients with diabetes were associated with a lower risk of hospital mortality (adjusted or 0.77, 95% ci 0.650.91).conclusionsalthough diabetes may adversely affect the disease process of ap, it seems to protect patients from ap - related mortality. |
iran is located in western asia, with over 77 million inhabitants and also more than two - thirds of the population is under the age of 30 with one - quarter being 15 years of age or younger. iran also exhibits one of the steepest urban growth rates in the world and approximately over 70 percent of iran 's population lives in urban areas. moreover, the indicators for health and education have improved dramatically during the recent years. on the other hand, iran is one of afghanistan 's neighbors and therefore has the most serious problems in asia. the latest rapid situation assessment of substance use in 2011 estimates the number of dependent substance users in iran at 1,200,000, corresponding to 2.2% of the adult population and a rise in injection drug use has a worrying ascending trend. a brief report of substance abuse policy in iran shows that government authorities and special services for treatment and harm reduction and prevention are being implemented on a patient - based approach. despite a significant increase in antisubstance trafficking efforts and establishment of several treatment centers in recent decades, the number of substance users has had an ascending trend and the age of onset has decreased. social policymakers have discovered a structural understanding of individual and social factors related to various levels of social health, providing an insight that can be used as the basis of public health policies. however, the application of evidence - based thinking in primary prevention is definitely hampered by the complexity of the causal chain. the knowledge about the first link is uncertain because of social and psychological factors. in addition, to identify effective strategies, evidence - based prevention programs and strategies adaptation need to be better understood as well as factors associated with institutionalization of effective prevention programs. thus, the main aim of this study is to investigate the most important social factors affecting substance use and other deviant behaviors in this country ; creating a structural discussion on the pathology of this phenomenon. this survey was implemented as a prospective study on 402 high risk abandoned substance users admitted to shafagh rehabilitation center : a clinical and psychological treatment center affiliated to the ministry of health, in collaboration with the police department and iran 's drug control headquarters in the year 2008 in tehran. a standard questionnaire was designed by researchers and experts to estimate baseline characteristics, sociodemographic variables, drug users ' experiences during rehabilitation treatment, imprisonment period, and substance use causes. narcotic replacement therapy at shafagh center was based on methadone therapy for 6 months. upon entrance to the rehabilitation center, the aim of the interview was explained to subjects and, after obtaining consent to participation, the questionnaire was completed for each individual via a face - to - face interviews, which were in - depth, semistructured interviews conducted by 3 social workers and 1 clinical psychologist [7, 8 ]. qualitative data that were collected through semistructured interviews including the subjects ' self - report reasons regarding substance use were extracted via the following questions : how did you get involved in substance addiction ? and what was your main reason of substance use ?. field notes were analyzed using a thematic analysis with inductive hand coding in order to derive themes by two researchers. this work was designed to construct the theories that are grounded in the data themselves. indeed, the process of coding occurred without trying to fit the data into a preexisting model or frame. this process mainly consisted of reading transcripts, generating initial codes, comparing and contrasting themes, and building theoretical models and thereafter developing a mixed methodology by entering qualitative information into a computer at the first opportunity. the rigor and trustworthiness of the data were ensured through immersion in the subject, peer checking, and data source triangulation using experts from different fields for collection. with the aim of conducting a peer review, each interview was first coded by the first author and then reviewed by the second author who modified the manuscript if necessary. moreover, the charts extracted by the first author were checked by the second author in the middle and late stages of the analysis and extracted ; the themes, subthemes, and related statements are provided. descriptive statistics such as number and percent for categorical and mean sd for continuous variables was used for descriptive tables. also, in the analytic statistics, univariate logistic regression was used to assess the associations between drug use and demographical and etiological variables. the data collected in the present study is a part of the data obtained for a research project approved by the health ministry of iran. the study participants submitted their informed consent forms after the study objectives were described to them and after confidentiality and anonymity of their information were assured. moreover, at interviews, all ethical principles and subjects ' rights to withdraw from the study at any stage were observed. after contrasting, the study themes of the theoretical framework were borrowed from the social ecological theory developed by berkowitz and perkins (1986) which explains the causes of substance abuse as being within the social environment and the social group in which individuals interact. it is hypothesized that, to change a particular behavior, the social context that shapes it must be changed and therefore, to change the behavior, the social institutions that shape it must undergo change. prevention efforts using this theory focus on changing the environment and mainly the socialization process rather than the person. in addition, this study is referred to as the social stress model of substance abuse and theorizes that the probability of engaging in drug use is assessed as a function of the stress level and to the extent of which it is triggered by stress moderators, social networks, social competencies, and resources of communities. moreover, in a sociological view, lpez and scott 's idea of the triple concept of social structure (2000) including institutional, relational, and embodied structures has provided a useful framework for understanding the impacts of combined social structure on deviant behaviors. drawing on the above theories, the fundamental variables of influencing deviant behaviors were defined in three structural levels and four categories in figure 1 and the following. etiologic variables of drug use variables (themes and codes) deviant social networks having a drug user in peers group.having a drug user in family.having an imprisonment history.joining a gang. having a drug user in peers group. having a drug user in family. having an imprisonment history. low social capital immigration.being away from family.divorce.family disputes and tensions.intragroup conflicts.loss of close relatives and friends. weak social sources joblessness.severe life conditions.economic hardship.adverse living conditions.unavailability of appropriate medical facilities.inappropriate welfare facilities.risky environment.easy access to drugs. statements i had never lived with the fear that i had no friends, so i did almost anything to keep the two good friends i still had. when i was 17, i started smoking cigarettes and alcohol because of my friends. at age 18 i started acting out like my peer drug addicts, stealing and sneaking out at night.both of my parents are active addicts, and they abused me physically and verbally, it was my father who got me into drugs.my parents were getting a divorce when i was 14. we moved to new city, i was isolated and they did not care for me. i started using alcohol and drugs with my new friends after school.i had many problems with my parents. it helps you fit in or make you cool.we had many problems in our life. i heard just try crack once and everything 's gon na be okay ; it will make everything go away.i struggled with depression and hopelessness for a long time. my friends used the substance ; they were enjoying themselves and bonding.i rarely had a friend and i was so alone in school and i thought to be worthlessness and boring for others. the fear of loneliness led me to smoke cigarette in the park as a common action that shows i am like you, then use alcohol in a party and step by step i found that i am a drug user and in addiction. i had never lived with the fear that i had no friends, so i did almost anything to keep the two good friends i still had. when i was 17, i started smoking cigarettes and alcohol because of my friends. at age 18 i started acting out like my peer drug addicts, stealing and sneaking out at night. both of my parents are active addicts, and they abused me physically and verbally, it was my father who got me into drugs. we moved to new city, i was isolated and they did not care for me. i heard just try crack once and everything 's gon na be okay ; it will make everything go away. i rarely had a friend and i was so alone in school and i thought to be worthlessness and boring for others. the fear of loneliness led me to smoke cigarette in the park as a common action that shows i am like you, then use alcohol in a party and step by step i found that i am a drug user and in addiction. as can be seen in table 1, among 402 reported drug users, 386 (96.5%) of them were men and 294 (73.4%) subjects were single or divorced. moreover, the majority of drug users were in the age range between 20 and 39 years, with a mean age of 28.78 years and minimum and maximum of 13 and 62 years, respectively. concerning the education level, majority of drug users, 339 (87.1%), had primary or secondary school education diplomas and also 15 (3.9%) subjects were illiterate. early onset of drug use in most participants (57.6%) was 20 years with an average age of 21.21 and also a minimum and maximum age of 17 and 53 years, respectively (sd = 6.363). in addition, 213 (57.1%) of participants had the minimum of a 5-year period of drug use. however, the majority of substance users had a history of addiction treatment and just 37% of them were treated by a physician. in addition, other risky behaviors including needle sharing, pre- or extramarital sex, and condomless sex were common among 21 (5.2%), 43 (10.7%), and 38 (19.5%) of drug users, respectively. on the other hand, the majority of substance users did not report a history of severe physical and mental illness before the onset of drug use (87.1% and 82.6%, resp.). the subjects also reported the following substance uses : cigarettes, 385 (95.8%) ; opium, 321 (79.9%) ; heroin, 259 (66.4%) ; crack, 227 (56.7%) ; cannabis, 174 (43.3%) ; alcohol, 164 (40.5%) ; and sedatives, 117 (29.1%). in addition, the reported major reasons were categorized into four main themes including deviant social networks (26.2%), low social capital (16.5%), weak social sources (15.2%), and stress (37.1%). according to the results of the univariate logistic regression test, in table 2, there are significant associations among the variables of age (or = 1.04 ; 95% ci : 1.011.07), divorce status (or = 2.07 ; 95% ci : 1.233.49), and the history of imprisonment (or = 2.12 ; 95% ci : 1.323.40) with presence of cannabis use. moreover, diploma or academic educational level (or = 0.26 ; 95% ci : 0.070.94) and history of imprisonment (or = 0.35 ; 95% ci : 0.210.58) have significant protective association with presence of alcohol consumption. also, there is a significant protective association between primary or secondary educational level (or = 0.29 ; 95% ci : 0.140.60) and history of imprisonment (or = 0.27 ; 95% ci : 0.170.44) and the presence of heroin consumption. diploma or academic educational level is identified as a protective factor (or = 0.29 ; 95% ci : 0.140.60) in comparison to lower education levels for presence of cocaine consumption. also, there is a significant protective association between history of imprisonment (or = 0.49 ; 95% ci : 0.280.84) and sedative drug consumption. moreover, in table 3, the findings provided are regarding the psychosomatic indicators that have been discovered after six months of methadone therapy and an education program for social - emotional skills. these results have shown that this program was approximately successful in decreasing drug users ' stress indicators. during recent years, there has been a considerable development in science - based prevention, providing new prevention models such as those based on risk and protective factors. in fact, the most important aspects of the models are their prognostic value and their influences on the success of treatment program [6, 12 ]. according to the study qualitative findings derived from the drug users ' self - reported statements, the most important reasons of substance use were prioritized as stress that could be associated with a comorbidity of other external stressors and the pressure of deviant social networks, low social capital, and weak social sources in the society. other studies confirm an increasing adolescents ' stress in iran 's contemporary society [13, 14 ]. furthermore, pleasure seeking and release of tension are discussed as the most common reasons for substance use among iranian high school students. on the other hand, the drug users ' psychotic symptoms assessment after a 6-month period of treatment and educational interventions confirmed a decline of some symptoms such as the feeling of tension, hopelessness, worthlessness, nervousness, and suicidal thoughts. these mental - social disorders may be interpreted as the weakness of emotional and social skills [6, 16 ]. other studies show how high school dropouts are two to three times more likely to begin and maintain injecting drug use, compared to high school graduates [17, 18 ]. it seems that the disruption and dysfunction of leading social institutions such as the family and school may have led to a major deprivation in individuals ' in both emotional and social skills and lead to fundamentally a weak embodied structure to cope with complex issues in the contemporary world. based on this study 's findings, most participants are single and without a high educational level (87.1% below high school diploma), indicating a high rate of school dropouts and the decline of intergroup social capital as a risk factor in the drug users ' socialization, particularly, because 57.6% of them have started drug abuse at the age below 20 years and, in sum, 16.5% of them are marked by low integration into a family and 57.3% of them suffered from a feeling of loneliness. in addition, the other studies show a low range of social capital within the drug users. indeed, bonds with friends and family are the strongest differentiating factors between substance users and nonusers. confirming the world health organization (2001) research findings on risk and protective factors from more than 50 countries, the most common risk factor for adolescent substance use in asia is the conflict within the family and friends who use substances. it is also concluded that a positive relationship with parents, parents who provide structure and boundaries, and a positive school environment are the most leading protective factors [21, 22 ]. social and emotional skills learning as a unifying theory with an increasing body of research demonstrates evidence - based interventions which are associated with healthy behaviors [2326 ]. on the other hand, the other extracted indictors of this study such as joblessness and severe life conditions, economic hardship, adverse living conditions, unavailability of appropriate medical facilities, and inappropriate welfare facilities can be demonstrated to a large extent as the weakness of social support sources. according to the findings, there is an addiction period of more than 5 years among 57% of the drug users and most of them have given up drugs several times, but approximately only 30% of them had been under treatment by a physician. these findings confirm previous studies regarding the high relapse rate and more common behavioral changes as an active and multidimensional process in which the clients experience a psychological status spectrum from recovery to the relapse complex : a process influenced by the treatment process and individual factors associated with the patients [27, 28 ]. it can be hypothesized that there exists a low coverage level of therapeutic services for substance in iran, since some participants stated running out of medicines or not being able to repurchase them as their main reasons for the noncommitment to the principles of the treatment program resulting in a relapse to addiction. there is a necessity for promoting the level of service utilization and continuation of medical and nonmedical treatment services in primary health care. in addition, low levels of social support system, such as joblessness, financial difficulties, and lack of social welfare in a society, are the significant indicators that can impact and shift social policies toward the improvement of wellbeing and social health [9, 10, 12 ]. the second explanation for the association between mental disorders and poor social circumstances is that individuals in socially disadvantaged situations are exposed to more psychosocial stressors (adverse life events) than those in more advantageous environments. these stressors act as triggers for the onset of symptoms and the loss of the individual psychological abilities necessary for social functions [29, 30 ]. according to the results of the regression analysis, being older and divorced and a history of imprisonment have an impact only on cannabis users as a risk factor and played a protective role on the other drug users. moreover, diploma or academic educational levels and history of imprisonment were protective factors associated with alcohol consumption. also, primary or secondary educational levels and a history of imprisonment were protective factors for heroin users. regarding the effectiveness of previous imprisonment on drug users, it is confirmed by findings of various studies. a relapse to drugs and alcohol abuse occurred in a context of poor social support, medical comorbidity, and inadequate economic resources. however, a strong systemic provision on the access to drugs and the prison - based residential drug and alcohol treatment programs has been suggested in prisons. the above findings confirm the combination of this study 's qualitative findings, especially for drug users who have a higher education level. however, substance use and addiction treatment is not widely available in prisons and studies support that most people with substance abuse issues who are released from prison relapse once back in the community. the prevention interventions after prison for drug users may include structured treatment with gradual transition to the community, improved protective factors, and reductions of environmental risk factors. according to the study findings, there is a comorbidity of various risk factors including the weakness of social capital, deviant social networks, and a low stock of social sources that overall have an impact on the risk factors of drug use. however, in the regression analysis, the results of some variables have not clarified the associations strongly because of the small sample size of this study that again alerted smaller subgroups through distributing them among the users of drug types. in sum, based on these findings, it can be concluded that a major part of drug users commonly use substances as a way to deal with difficulties in stressful situations. and, from a social point of view, substance use is acknowledged as a deviance behavior which stems from the functional weakness of institutional, relational, and embodied structures. thus, this study illuminated the need for a focus on the contributions of policymakers to developing strategies in improving social sources, social capital within the family unit and prosocial networks, and enhancing health services. | this study is a sociological analysis of the three dimensions of social structure including institutional, relational, and embodied structures that have an impact on the individuals ' deviant behaviors in the society. the authors used a mix method to analyze the qualitative and quantitative data of 402 high risk abandoned substance users in 2008 in tehran, capital city of iran. the leading reasons of substance use were categorized into four fundamental themes as follows : stress, deviant social networks, and low social capital and weak social support sources. in addition, the epidemiology model of regression analysis provides a brief explanation to assess the association between the demographical and etiological variables, and the drug users ' deviant behaviors. in sum, substance use is discussed as a deviant behavior pattern which stems from a comorbidity of weak social structures. |
a 2-year - old child was admitted to the department of pediatrics at the jawaharlal institute of postgraduate medical education and research (jipmer), puducherry, india, with a provisional diagnosis of cholera. before the child received antimicrobial therapy, a fecal specimen meanwhile, a strain of v. cholerae o1 el tor ogawa was isolated from the fecal specimen. this strain was biochemically identified (3) and confirmed by agglutination with specific antiserum (bd difco, becton dickinson, sparks, md, usa). antimicrobial drug susceptibility testing was conducted by kirby bauer method in accordance with the clinical and laboratory standards institute (4) against ampicillin (10 g), ceftriaxone (30 g), ciprofloxacin (5 g), furoxone (300 g), cotrimoxazole (25 g), and tetracycline (30 g). the mic for ceftriaxone was determined by the agar dilution method and etest for the el tor ogawa strain. for the agar dilution method, we doubled dilutions of ceftriaxone sodium (himedia, mumbai, india) from 0.5 g / ml to 128 g / ml, which included the recommended break points (5). american type culture collection escherichia coli 25922 was spread on each plate as growth control. the etest was performed according to the manufacturers instructions (ab biomrieux, solna, sweden). we performed the combination disk test using cefotaxime and ceftazidime, alone and in combination with clavulanic acid, to detect extended - spectrum -lactamase (esbl) in accordance with clinical and laboratory standards institute guidelines (4). the modified hodge test and imipenem - edta disk synergy test for the phenotypic detection of carbapenemase were performed as described (4,7). pcr was performed to detect esbl genes, i.e., blactx (8), blashv (8), and blatem (9) ; a multiplex pcr was used to detect the ampc group of genes, i.e., blamox, blacit, bladha, and blaacc (10). a multiplex pcr to detect carbapenemase genes, i.e., blakpc, blaimp, blavim, and blandm, was performed (11). the strain was resistant to ampicillin, ceftriaxone, cotrimoxazole, and furoxone and sensitive only to ciprofloxacin and tetracycline. because the strain was negative for the phenotypic and the genotypic tests for esbl production, in our attempt to determine the reason for the increased mic, we further tested for the ampc type of -lactamase production. the strain, an ampc -lactamase producer, was positive for the bladha gene (405 bp) by multiplex pcr. on sequencing, the bladha gene detected had 99% identity with klebsiella pneumoniae -lactamase bladha-1 gene (genbank accession no. ay635140.1). because carbapenems are considered the treatment of choice for ampc - producing organisms, we tested the strain for the production of carbapenemase and found it to be a carbapenemase producer by a positive modified hodge test and by the edta disk synergy test. the multiplex pcr for detection of carbapenemase genes yielded an amplicon of 660 bp, which was confirmed by sequencing to be an blandm-1 gene and had 100% identity with e. coli strain hk-01 plasmid pndm - hk (genbank accession no. to demonstrate the presence of a plasmid bearing the blandm-1 gene, we isolated a plasmid using the alkaline lysis method (12) from the v. cholerae strain. this plasmid was subjected to the multiplex pcr to detect the carbapenemase genes mentioned earlier (11), which yielded an amplicon of 660 bp matching that of the blandm-1 gene amplicon. (13) and used e. coli j53 as the recipient, which was isolated on meropenem (4 mg / l) containing luria - bertani agar and macconkey agar, meropenem (4 we also subjected the v. cholerae plasmid to the multiplex pcr to detect the ampc gene, as mentioned earlier, but none of the genes were amplified. we failed to transfer the ampc gene (bladha-1) by using the plasmid transfer experiment. (15). of the many ampc genes known are 2 types of bladha genes : bladha-1 and bladha-2 ; both are inducible plasmid - mediated genes. because the strain reported here was already resistant to a third - generation cephalosporin, i.e., ceftriaxone, we did not perform the inducible ampc test and proceeded to perform the ampc disk test. plasmid - mediated inducible -lactamases are extremely rare and are most often constitutive (15). the ampc disk test does not differentiate between chromosomal and plasmid - mediated ampc -lactamases. carbapenems are the treatment of choice for ampc - producing strains (6) and are hydrolyzed by carbapenemases, which have many families, including the metallo--lactamases (7). the most recently described blandm-1 (new delhi metallo--lactamase) is plasmid - mediated metallo--lactamase and has been isolated from the environment and from hospitals (14). we isolated a clinical strain of v. cholerae producing an ampc -lactamase and a carbapenemase. our findings, the critical role of all bacteriology laboratories needs to be emphasized for determining not only resistance patterns but also the mechanisms of resistance. health care associated networks need to be strengthened to ensure justified and appropriate use of antimicrobial agents that will result in safe drinking water and improved sanitation ; these can have remarkable effect in reducing the spread of many communicable diseases, such as cholera, and can go a long way in controlling the growing menace of antimicrobial drug resistance. in light of the above findings, the antimicrobial drug profile of organisms, such as v. cholerae, needs to be under constant surveillance in the community. | vibrio cholerae resistance to third - generation cephalosporins is rarely reported. we detected a strain that was negative for extended - spectrum -lactamase and positive for the ampc disk test, modified hodge test, and edta disk synergy test and harbored the bladha-1 and blandm-1 genes. the antimicrobial drug susceptibility profile of v. cholerae should be monitored. |
prostate cancer (pca) is the fastest growing cancer in korea. according to the statistical data of the national cancer information center, the incidence of pca, 8.5 per 100,000 population in 1999, the annual growth rate, 13.5%, is the fastest of all cancers in korea. radical prostatectomy (rp) is the standard treatment for patients with clinically localized pca (ct1-t2) and is associated with a life expectancy of > 10 years. whereas open radical retropubic prostatectomy (orp) has been considered the gold standard for surgical treatment, minimally invasive procedures have been introduced with the intention of minimizing peri- and postoperative morbidities. despite the widespread use of robot - assisted laparoscopic prostatectomy (ralp) over the past decade, there are ongoing debates regarding the benefits of ralp compared with orp. oncological controls in comparative studies have shown that ralp yields results similar to those of orp. one recent study suggested that ralp results in no significant improvement in urological complications such as incontinence and erectile dysfunction. however, not many studies have undertaken well - controlled, single - surgeon, direct comparisons of the outcomes of ralp and orp. there have in fact been some reports on the impact of prostate volume on surgical outcomes. in orp, a large - volume prostate is associated with longer operation time and increased complications. patients with a small - volume prostate, meanwhile, have higher rates of biochemical recurrence (bcr). in ralp, a small - volume prostate is correlated with early return of potency. however, there are few comparative reports on the impact of prostate volume on oncological and functional outcomes between the two types of surgery. the aim of the present study was to investigate differences in oncological and functional outcomes according to prostate volume in patients with localized pca who underwent orp or ralp. between september 2003 and april 2010, 408 consecutive patients underwent single - surgeon rp for biopsy - confirmed pca at seoul national university hospital. a total of 103 patients (25%) underwent ralp and 305 patients (75%) underwent orp. preliminarily, after approval from our institutional review board, a total of 253 patients were included in this study. we initially selected 176 consecutive orp and 77 ralp cases for clinically localized pca (ct1-t2). the first 100 patients who had undergone orp and the first 25 to undergo ralp were excluded from the analysis owing to the learning curve. postsurgery follow - up visits typically were scheduled at 3-month intervals for 1 year, and then semiannually for 1 year, and yearly thereafter. patients within each surgical group were divided into two subgroups according to their prostate volume as measured by preoperative transrectal ultrasound : less than 40 g and 40 g or larger. the oncological outcomes were assessed as positive surgical margin (psm) and 24 month bcr rates. bcr was defined as two consecutive prostate - specific antigen (psa) measurements 0.2 ng / ml. the functional outcomes were assessed as continence and potency. urinary continence was defined as the absence of any urinary leakage or the use of only one security pad. potency was defined as spontaneous erectile function satisfactory for intercourse or with the use of phosphodiesterase-5 inhibitors on demand. preoperative erectile function was assessed by use of a validated questionnaire, the international index of erectile function-5 (iief-5). we evaluated postoperative potency in all patients who had been potent before surgery, defined as an iief-5 score of 12, and who had undergone a bilateral or unilateral nerve - sparing procedure. postoperative potency was determined at each follow - up by means of a detailed surgeon - conducted interview. ralp was performed by the transperitoneal antegrade approach with the use of the da vinci robot system (intuitive surgical inc., the choice of surgical approach accorded with patient preference after discussion of the risks, benefits, and alternatives with the patient 's physician. in both groups, a uni- or bilateral nerve - sparing procedure was performed if clinically indicated by patient age, preoperative erectile function, and oncological parameters. the baseline characteristics of the patients were summarized as the mean standard deviation for continuous variables and frequencies or as percentages for categorical variables. the ralp and orp groups were compared by using the student 's t - test (continuous factors) and pearson chi - square test (categorical factors). kaplan - meier survival curves were compared across techniques by using the log - rank test for up to 24 months of follow - up. in all of the tests, a statistical analysis was performed with the spss ver. 13.0 (spss inc., the mean patient age was 67.06.76 years, and the median body mass index was 24.02.67 kg / m. the mean preoperative psa level was 7.417.74 ng / ml. the mean preoperative transrectal ultrasound prostate volume was 4217.92 ml. as for the patients ' clinical stages, 171 cases (68%) were stage i and 82 cases (32%) were stage ii. the preoperative baseline clinicopathological demographics of the orp and ralp groups were comparable (table 1). the mean operation time was significantly shorter in the orp group (151 minutes vs. 220 minutes, p<0.001), whereas the mean estimated blood loss was significantly less in the ralp group (917 ml vs. 642 ml, p<0.001). the number of patients who had undergone a nerve - sparing procedure (unilateral or bilateral) was significantly higher in the ralp group (63% vs. 83%, p=0.004). the pathological stages were very similar in each group, with 53% of patients with organ - confined disease in the orp group compared with 54% in the ralp group. however, there was a significant difference in the proportion of patients with a pathologic gleason score ; the proportion was more favorable in the ralp group (p=0.008). the most common location of a psm in the two groups was at the apex. psms were encountered less often with ralp than with orp, but without statistical significance (42% vs. 38%, p=0.394). the 2-year bcr - free survival rates were 88% (154 of 176) in orp and 94% (72 of 77) in ralp patients during the follow - up period. a log - rank test showed no statistical difference between the two groups (p=0.140) within 2 years of follow - up (fig., urinary continence had been regained in 55% of patients at 1 month, 80% at 3 months, 92% at 6 months, 95% at 9 months, 96% at 12 months, and 98% at 24 months. the corresponding ralp recovery rates were 38%, 71%, 84%, 88%, 94%, and 95% (fig. 2). after adjustment for age, operation type was not found to significantly affect postoperative urinary continence recovery (p=0.058). of the 177 patients who underwent orp, 55 (31%) were potent preoperatively, compared with 41 of the 77 patients (53%) who underwent ralp. in the orp group, nerve - sparing status was bilateral in 47 (85%) and unilateral in 8 patients (15%) ; the corresponding numbers in the ralp group were 33 (81%) and 8 (19%), respectively. in the subset of potent patients, 28 of 55 (51%) treated with orp and 23 of 41 (56%) treated with ralp were potent at the 2-year follow - up. the recovery rates after orp were 2% at 1 month, 6% at 3 months, 15% at 6 months, 22% at 9 months, 40% at 12 months, and 51% at 24 months ; after ralp, they were 0%, 17%, 29%, 29%, 54%, and 56%, respectively (fig. after adjustment for age and nerve - sparing status, the recovery of sexual function was comparable between the orp and ralp groups throughout the follow - up period (p=0.418). in the subgroup analysis for which patients were classified according to prostate volume into small (< 40 g) and large (40 g) volume groups, in the orp small - volume subgroup, the potency rates were 0% at 1 month, 0% at 3 months, 10% at 6 months, 21% at 9 months, 35% at 12 months, and 55% at 24 months. in the ralp small - volume subgroup, they were 0%, 24%, 36%, 36%, 56%, and 60%, respectively (fig. ralp was associated with quick potency recovery in the small - volume subgroup (p=0.020). between the two small - volume subgroups, there was no significant difference in the time to continence or oncological outcomes. within the large - volume subgroups, patients who had undergone ralp were less likely to become continent than were those who had undergone orp (p=0.048). in the orp large - volume subgroup, the continence rates were 57% at 1 month, 77% at 3 months, 91% at 6 months, 95% at 9 months, 95% at 12 months, and 97% at 24 months. in the ralp large - volume subgroup, they were 31%, 56%, 75%, 81%, 88%, and 91%, respectively (fig., there was no significant difference in the recovery of sexual function or oncological outcomes. in the present study we compared the surgical, oncological, and functional outcomes of orp and ralp. whereas the study was not randomized, its main strengths were the single - center and single - surgeon setting ; the use of a validated questionnaire to evaluate preoperative erectile function, specifically, the iief-5 ; and the inclusion of consecutive patients. the same protocols for preoperative diagnosis and staging evaluation of pca, perioperative treatment, pathological evaluation, and surgical approaches were adopted for both study groups, and the follow - up periods were sufficiently long for evaluation of functional outcomes. another strength of the methodology was the comparability of the baseline clinicopathologic characteristics between the two groups. bcr and psm are the two commonly used indexes for assessment of oncological outcomes following rp. in the present study, the psm rates were similar in the two groups, and consistent with other, prior series. the reported incidences of psm ranged from 11% to 37% after orp and from 9.6% to 26% after ralp. although more nerve - sparing procedures were performed in the ralp group, the technique did not significantly increase the incidence of adverse outcomes. the difference in the short - term bcr rates between the two groups was not statistically significant. also reported similar bcr rates for ralp and orp groups at short follow - ups of 1 and 3 years, respectively. sooriakumaran. recently reported that biochemical - free survival after ralp was 84.8% at a median follow - up of 6.3 years. long - term outcome data on psa progression are not yet available for ralp, owing to the relatively short history of their availability. further follow - up is required to determine long - term oncological outcomes such as disease - specific death and overall survival. in the present study, the recovery of erectile function was more rapid in ralp patients with small - volume prostates. we found a significant advantage of ralp over orp for those who had small - volume prostates at the 3- and 6-month follow - up, particularly for preoperatively potent patients (iief-512) undergoing unilateral or bilateral neurovascular bundle sparing. our postoperative potency rates were 24% after ralp and 0% after orp at the 3-month follow - up (p=0.007), and 36% and 10% at the 6-month (p=0.026), respectively. however, there was no difference in potency rates between the ralp and orp small - volume groups at 12 months (56% vs. 35%, p=0.095) or 24 months (60% vs. 55%, p=0.468) postoperatively. neither was there any statistical difference in recovery of erectile function between the two large - volume groups. tewari. reported that patients after ralp had a more rapid return of erection : 50% at a mean follow - up of 180 days versus 440 days after orp. rocco. reported a significant ralp advantage over orp for patients, particularly younger patients, who had undergone a nerve - sparing procedure at 3, 6, and 12 months postoperatively. however, krambeck. reported no significant difference in potency rate at the 1-year follow - up. this early return of erectile function could be attributed to preservation of potency with minimized damage to the neurovascular bundles, better magnified visualization, precise anatomical dissection, reduced blood loss, or improved anatomical - reconstruction ability by use of robotic assistance. it has been postulated that in larger prostates, the neurovascular bundles are displaced posteriorly, where they are possibly obscured by the prostate, making them prone to injury. also, a large prostate is less mobile in the pelvis, owing to the smaller available space. these factors could offset the advantage of ralp for potency preservation. in the present findings interestingly, patients with large - volume prostates seemed to recover continence more quickly after orp than after ralp. found that 84% of patients were continent at the 12 month follow - up after ralp. hu. reported that men undergoing ralp were more likely to be diagnosed as incontinent. malcolm. found no difference in health - related quality - of - life " bother scores " related to incontinence. reported no difference in continence after ralp or rrp at the 1-year follow - up. others, meanwhile, have reported 12 month urinary continence rates as high as 97% after ralp. our findings are interesting in light of the fact that ralp is thought to increase the precision of anastomosis and decrease the incidence of traumatic maneuvers on the urethrosphincteric complex. we suspect that these outcomes are related to a combination of extensive apical dissection and overzealous diathermy at the bladder neck with over - tight suturing, though we have no direct evidence for this. this difference might be attributable to the necessarily lengthy learning curve for making a running anastomosis compared with the interrupted anastomosis used for orp. or, it might also be due to the differences between the retrograde and antegrade approaches. in any case, there is no real explanation for such findings at the present time. the main limitation of this study, a retrospective review of our database, was the lack of randomized allocation of patients into one of the two treatment arms. the choice of surgical approach was based mainly on patient preferences and requests after they were fully informed about both procedures. still, given that these groups were relatively well matched regarding the comparability of the patients ' baseline characteristics, the substantial differences in functional outcomes shown in the present results can be attributed mainly to the two different surgical approaches. another concern is that because the patients underwent rp at a tertiary - care centre, the present study might not fully reflect epidemiological trends and, indeed, might have incorporated a certain degree of selection bias. the other limitations of this study were the relatively small number of patients and the short follow - up period. in this single - surgeon consecutive series, patients after ralp demonstrated early recovery of erectile function, especially those with small - volume prostates. ralp was also associated with lower blood loss but slightly longer operation times when compared with orp. a large - volume prostate was associated with lower rates of postoperative urinary continence recovery, particularly in ralp patients. long - term follow - up and well - designed randomized controlled trials are required before definitive conclusions on oncological and functional outcomes between orp and ralp can be drawn. | purposewe compared the impact of prostate volume on oncological and functional outcomes 2 years after robot - assisted laparoscopic prostatectomy (ralp) and open radical retropubic prostatectomy (orp).materials and methodsbetween 2003 and 2010, 253 consecutive patients who had undergone prostatectomy by a single surgeon were serially followed over 2 years postoperatively. ralp was performed on 77 patients and orp on 176. the patients were divided into two subgroups according to prostate volume as measured by transrectal ultrasound : less than 40 g and 40 g or larger. recoveries of potency and continence were checked serially by interview 1, 3, 6, 9, 12, and 24 months postoperatively.resultsralp was associated with less blood loss (orp vs. ralp : 910 ml vs. 640 ml, p<0.001) but a longer operation time (150 minutes vs. 220 minutes, p<0.001) than was orp. no statistically significant differences were found between the two groups for oncological outcomes, such as positive surgical margin (40% vs. 39%, p=0.911) or biochemical recurrence (12% vs. 7%, p=0.155). the overall functional outcomes showed no statistically significant differences at 2 years of follow - up (continence : 97% vs. 94%, p=0.103 ; potency : 51% vs. 56%, p=0.614). in the results of an inter - subgroup analysis, potency recovery was more rapid in patients who underwent ralp in a small - volume prostate than in those who underwent orp in a small - volume prostate (3 months : 24% vs. 0%, p=0.005 ; 6 months : 36% vs. 10%, p=0.024). however, patients who underwent ralp in a large - volume prostate were less likely to recover continence than were patients who underwent orp in a large - volume prostate (97% vs. 88%, p=0.025).conclusionspatients can be expected to recover erectile function more quickly after ralp than after orp, especially in cases of a small prostate volume. |
the ability of core shell nanowires to overcome existing limitations of heterostructures is one of the key ingredients for the design of next generation devices. this requires a detailed understanding of the mechanism for strain relaxation in these systems in order to eliminate strain - induced defect formation and thus to boost important electronic properties such as carrier mobility. here we demonstrate how the hole mobility of [110]-oriented ge si core shell nanowires can be substantially enhanced thanks to the realization of large band offset and coherent strain in the system, reaching values as high as 4200 cm2/(vs) at 4 k and 1600 cm2/(vs) at room temperature for high hole densities of 1019 cm3. we present a direct correlation of (i) mobility, (ii) crystal direction, (iii) diameter, and (iv) coherent strain, all of which are extracted in our work for individual nanowires. our results imply [110]-oriented ge si core shell nanowires as a promising candidate for future electronic and quantum transport devices. |
|
the -subdivision of proteobacteria includes gram - negative bacteria with diverse and contrasting lifestyles, ranging from free - living, symbiotic to pathogenic bacteria. despite this apparent heterogeneity, -proteobacteria share some unexpected common features such as an asymmetric cell division followed by a differentiation process. as the large nad - dependent glutamate dehydrogenases, to which gdhz belongs, are particularly well conserved among -proteobacteria, we postulated that the cell division control found in c. crescentus might be conserved as well. to address this question we created an in - frame deletion of gdhz homolog in the facultative intracellular pathogen brucella abortus 2308 (gdhzba). similarly to gdhz loss - of - function mutants in c. crescentus, the gdhzba strain had a strong growth defect when grown in complex medium (figure 2a). interestingly, gdhzba cells were slightly elongated and branched (figure 2b), which typically indicates a cell division defect in bacteria growing from one pole. furthermore growth and cell division defects were suppressed when glucose or xylose was added to the complex media or when xylose was used as the sole carbon source in a synthetic medium (figure 2a and data not shown). altogether these observations suggest that the role of gdhz in controlling cell division might be conserved in b. abortus, and likely in other -proteobacteria. (a) growth of b. abortus wild - type (black) and gdhzba (gray) cells in complex medium (2yt) or in synthetic medium with xylose as the only carbon source (plommet xylose), showing gdhz is required for optimal growth in complex mediium. (b) phase contrast imaging of b. abortus wild - type and gdhzba cells grown in complex medium (2yt) illustrating the morphological defects with elongated and branched cells (arrows) developed by gdhzba cells. (a) growth of b. abortus wild - type (black) and gdhzba (gray) cells in complex medium (2yt) or in synthetic medium with xylose as the only carbon source (plommet xylose), showing gdhz is required for optimal growth in complex mediium. (b) phase contrast imaging of b. abortus wild - type and gdhzba cells grown in complex medium (2yt) illustrating the morphological defects with elongated and branched cells (arrows) developed by gdhzba cells. as an intracellular pathogen, brucellae reside preferentially within trophoblasts and macrophages, in which it can survive and proliferate to produce chronic infections. intracellular brucellae hijack the intracellular vesicular trafficking to finally reach and replicate into the endoplasmic reticulum. althougth widely accepted to be a nutrient poor environment, the exact composition of the brucella containing vacuole (bcv) remains unclear. to test whether gdhz is important for intracellular replication, murine raw macrophages were infected with either wild - type or gdhzba strain, and the number of intracellular bacteria was determined at 2 hrs, 24 hrs and 48 hrs post - infection (pi). as gdhz constitutes a key entry point into the tricarboxylic acid (tca) cycle for several amino acids, the gdhzba mutant would be unable to efficiently replicate inside host cells if amino acids were a main carbon source during infection. as illustrated in figure 3a, the gdhzba mutant was already impaired 2 hrs pi and intracellular brucellae failed to replicate efficiently at 24 hrs and 48 hrs pi. during the first 68 hrs following entry into the cell, intracellular brucellae therefore, the difference in the number of intracellular bacteria between the strains at 2 hrs post - infection might be due to a defect in the internalization process. since bacteria were cultivated in complex media prior to infect, the proper entry of gdhzba cells inside macrophages might be affected by their morphological defect (figure 2). to circumvent this problem, b. abortus wild - type and gdhzba strains were grown in complex medium supplemented with glucose prior to infect murine macrophages. interestingly, when glucose was added to the preculture medium, both wild - type and gdhzba intracellular bacteria were present at similar levels at 2 hrs pi, indicating that the entry impairment observed with gdhzba cells was very likely a secondary effect (figure 3b). nevertheless, at 24 hrs and 48 hours pi, gdhzba cells failed to efficiently replicate compared to wild - type cells, whatever the medium used for cultivating brucella before infecting macrophages. altogether these results strongly suggest that gdhz is required for optimal intracellular replication of brucella, and emphasize the importance of amino acids as a main carbon source for brucellae inside host cells. internalization and intracellular replication of b. abortus wild - type and gdhzba cells into murine raw macrophages. raw 264.7 macrophages were cultured at 37 c (5 % co2 atmosphere) in dmem (invitrogen) supplemented with 10% fetal bovine serum (gibco), 4.5 g / l glucose, 1.5 g / l nahco3 and 4 mm glutamine. bacteria were centrifuged at 400 x g for 10 min at 4 c and then incubated for 1 hr at 37 c (5 % co2 atmosphere). cells were washed twice with fresh medium and then incubated in medium supplemented with 50 g / ml gentamicin to kill extracellular bacteria. prior to infections, bacteria were grown in (a) 2yt or (b) 2yt + 0.2 % glucose. the significant pairwise comparisons are indicated for p < 0.5 (), p < 0.01 () and p < 0.001 () in student t - tests. internalization and intracellular replication of b. abortus wild - type and gdhzba cells into murine raw macrophages. raw 264.7 macrophages were cultured at 37 c (5 % co2 atmosphere) in dmem (invitrogen) supplemented with 10% fetal bovine serum (gibco), 4.5 g / l glucose, 1.5 g / l nahco3 and 4 mm glutamine. cultures of brucella were prepared in dmem at a multiplicity of infection of 50. bacteria were centrifuged at 400 x g for 10 min at 4 c and then incubated for 1 hr at 37 c (5 % co2 atmosphere). cells were washed twice with fresh medium and then incubated in medium supplemented with 50 g / ml gentamicin to kill extracellular bacteria. prior to infections, bacteria were grown in (a) 2yt or (b) 2yt + 0.2 % glucose. the significant pairwise comparisons are indicated for p < 0.5 (), p < 0.01 () and p < 0.001 () in student t - tests. other metabolic regulators of cell division have been described in escherichia coli and bacillus subtilis. interestingly, all these regulators link glycolysis to cell division and both species use glucose and hexoses as major carbon sources. on the other hand, the deletion of gdha in e. coli, coding for an anabolic nadp - dependent glutamate dehydrogenase, did neither slow down growth in complex (lb) or synthetic (m9 g) media, nor interfere with cell division (data not shown). in contrast, c. crescentus and b. abortus use gdhz, catabolizing amino acids, to coordinate metabolism with cell division. based on these observations we postulate that bacteria have evolved by connecting the cell division machinery with the catabolic routes whose activity reflects nutrient fluctuations in the environment. in other words, such regulations would underline the main carbon sources used by bacteria, indicating that amino acids would constitute a favorite carbon source for c. crescentus, b. abortus, and likely other -proteobacteria. this hypothesis is further supported by the fact that amino acids transporters and catabolic enzymes are induced in bcv. it is noteworthy that, whatever the main carbon source is, metabolic enzymes constitute perfect candidates to fulfill additional regulatory functions. indeed, the conformational change induced upon substrate(s) binding or product(s) release, can serve as a proxy for the cell to monitor nutrient availability. this is thereby not surprising that most of the proteins in the glycolytic and the tca pathways are moonlighting enzymes, i.e. enzymes with secondary (regulatory) functions. in this perspective and knowing that a nad - dependent glutamate dehydrogenase connects the nitrogen cycle to the tca cycle, gdhz was very likely selected to coordinate growth with cell division in -proteobacteria. f.b. held a fria (fund for research training in industry and agriculture) fellowship from the national fund for scientific research (f.r.s.- fnrs). this work was supported by a research project (pdr t.0053.13) to x.d.b and a research credit (cdr 1.5067.12) to r.h from the f.r.s.- fnrs. | abstractprior to initiate energy - consuming processes, such as dna replication or cell division, cells need to evaluate their metabolic status. we have recently identified and characterized a new connection between metabolism and cell division in the -proteobacterium caulobacter crescentus. we showed that an nad - dependent glutamate dehydrogenase (gdhz) coordinates growth with cell division according to its enzymatic activity. here we report the conserved role of gdhz in controlling cell division in another -proteobacterium, the facultative intracellular pathogen brucella abortus. we also discuss the importance of amino acids as a main carbon source for -proteobacteria. |
solanaceae, the nightshade family, as a group represents the third most valuable crop family in the us, exceeded only by the grasses and legumes, and the most valuable family in terms of vegetable crops providing important dietary contributions to human health and nutrition. tomato (solanum lycopersicum until recently termed lycopersicon esculentum) is the centerpiece system for genetic and molecular research in this family, and has recently been targeted for genome sequencing by an international consortium currently funded and supported by ten contributing countries (1). tomato has long served as an important model system for fleshy fruit development and ripening, more general plant genetics, disease response and numerous aspects of physiology, resulting in the accumulation of substantial information regarding the biology of this economically important organism. recently, a large tomato est collection has been created which contains > 150 000 individual est sequences representing 30 000 unigenes from 27 different tissues / treatments (2). a public cdna microarray with 12 000 elements representing 8700 unigenes has been developed based on this est collection and is widely used by the solanaceae research community (). large amounts of gene expression data are being generated using the public array, and it is important to have a systematic approach to archive this information and make it publicly available to derive maximum benefit from the numerous research efforts employing this tool. our groups have also generated extensive time - course expression profiling data during fruit development and ripening in a normal tomato cultivar and well - defined ripening - related mutants (3). in addition, digital expression (est abundance) data from the analysis of the full tomato est collection has been created and is most effectively utilized through an interactive web - based data server (2). in order to (i) provide a central repository for all gene expression data derived from the tomato microarray, (ii) disseminate public expression profiling data during normal and mutant fruit development and ripening, and (iii) present digital expression data for all available tissues and treatments represented in public est collections, we have generated display, query and analysis tools to assist in development and testing of biological hypotheses based on tomato gene expression data. to this end, we have built an interactive online database tomato expression database (ted) which can be accessed at. ted is implemented as a 3-tier software architecture consisting of a web interface, a cgi middle tier which dynamically constructs and executes queries, and a relational database. it operates on a red hat linux system under an apache web server, and uses mysql as the database management system. cgi scripts connecting user queries to the database are implemented in perl, in conjunction with the dbi module that allows the scripts to connect to the back - end database. basic statistical calculations are implemented as r or in - house perl scripts, while some time - consuming calculations, such as clustering algorithms, are implemented in c or by wrapping existing third - party tools. ted includes the following three integrated components : the tomato microarray data warehouse, the tomato microarray expression database and the tomato digital expression database. these three components serve different purposes, however they are tightly linked to each other through key gene identifiers [e.g. clone identifier, tigr tentative consensus (tc) number ] and allow fluid passage among databases as required by the user. for example, a user querying the tomato microarray expression database for genes displaying a requested fruit development expression profile, can readily view digital expression data from a broader collection of tissues for any genes resulting from the initial query. similar to many other species - specific microarray databases, such as nascarrays (4), sgmd (5) and barleybase (6), the primary purpose of the tomato microarray data warehouse is to provide public storage / retrieval of raw microarray data and associated experiment information resulting from use of the publicly available tomato microarrays. the database follows miame (minimum information about microarray experiment) guidelines thus facilitating the interpretation of results of a given experiment unambiguously and further allows independent verification and reproduction of the experimental findings (7). to allow researchers to completely re - analyze published results and to facilitate further discovery, raw images and data files associated with each experiment are readily accessible in zipped format however, some datasets are password protected prior to publication or upon authors ' request. in addition to the data retrieval interface, a simple user - friendly, forms - based online data submission system was developed to facilitate the submission process. once the data is submitted, instead of uploading it directly into the database, our staff will examine its compliance with miame standards and obtain from the authors any missing or improperly formatted information prior to uploading it to the database. fruit is a major component of human nutrition contributing a significant portion of vitamins, minerals and fiber in a healthy diet. the ripening of fleshy fruit is a coordinated regulatory process involving genetic, hormonal and environmentally controlled interactions leading to complex gene expression patterns (8). in order to gain insights into the molecular basis of fruit development and dissect the regulatory network governing fruit ripening, we performed global expression profiling analysis during fruit development and ripening of tomato and various single mutant gene lines (3). currently, normalized and processed microarray data for ten time points with nine pair - wise comparisons during wild - type fruit development and ripening, and during development of an ethylene - insensitive, ripening impaired mutant (never - ripe ; nr) (9), is included in this database. in addition, dna sequence information of each est element on the tomato array is included as is corresponding annotation information that was developed for each array unigene sequence. a number of useful query interfaces and data mining, analysis and visualization tools have been developed. the annotation and sequence information in addition to the expression data can be retrieved for any specific est through the conventional gene identifier query or in batch using the corresponding data mining tools. sequence similarity searches against all est sequences on the tomato array are also available through the blast (10) search interface. in addition, data for a group of genes can be retrieved by using key word(s) to query est functional annotations. the said annotations are based on the annotations of sgn () (11) unigenes to which corresponding ests belong. ests that display simple or complex query patterns of interest can also be retrieved and the normalized ratios and p - values of each hybridization can be sorted. tools to find genes with similar or inverse expression patterns to a given est and to compare expression profiles during fruit development for genes of interest in normal and mutant genotypes were also developed (figure 1). both tools employ the pearson correlation coefficient to measure similarity of expression profiles. since the tomato microarray has occurrences of different ests corresponding to the same gene (i.e. pseudo - replicates), we developed a tool to display expression profiles of all the pseudo - replicates representing one particular gene (figure 2). while the majority of pseudo - replicates yield similar results and serve as a form of validation of the expression profiling results, infrequent instances where they do not yield the same expression profiles do occur and are discussed in alba. in order to identify functionally related genes based on their expression profiles, we adapted several commonly used clustering programs. linux version of cluster 3.0 (13) was wrapped for our hierarchical clustering algorithm. the applet version of java treeview (14) and slcview () were used to visualize the hierarchical clustering results in interactive and static mode, respectively. perl module algorithm::cluster was used to implement k - means and som (self - organizing maps) clustering algorithms, and in - house cgi scripts were developed to visualize k - means and som results. genes within each cluster generated from k - means and som can be further viewed in a heatmap (figure 3b) which is generated using matrix2png program (15) or in a table (figure 3c). it has been shown previously that est databases are a valid and reliable source of gene expression data (16). we analyzed a large tomato est dataset including > 150 000 ests derived from 27 different non - normalized cdna libraries to gain insights into differential expression among diverse plant tissues representing a range of developmental programs and biological responses (2). the resulting raw digital expression data for > 15 000 unigenes (tigr tcs) and normalized digital expression data for > 6000 tcs were included in this database (2). the raw and normalized digital expression data can be retrieved and visualized through gene identifier (tc number) queries. an example of the visualization of normalized digital expression data is shown in figure 4. the returned page provides a link to the expression profile data during fruit development and ripening for the queried tc so that the digital expression profile and microarray expression profile of the same gene can be compared. similar tools as those found in the tomato microarray expression database for blast searching against the whole unigene collection are included as are key word(s) search functions. in addition, we implemented online tools to (i) identify differentially expression genes between any two query tissues for which data is available (17), (ii) identify highly abundant genes in a specific tissue, and (iii) compare digital gene expression among tomato and arabidopsis homologues. furthermore, the raw and normalized digital gene expression data and corresponding analysis results (e.g. tables of differentially expressed and tissue - specific genes) from fei. (2) are publicly available through the database to all researchers for independent analysis. similar to many other species - specific microarray databases, such as nascarrays (4), sgmd (5) and barleybase (6), the primary purpose of the tomato microarray data warehouse is to provide public storage / retrieval of raw microarray data and associated experiment information resulting from use of the publicly available tomato microarrays. the database follows miame (minimum information about microarray experiment) guidelines thus facilitating the interpretation of results of a given experiment unambiguously and further allows independent verification and reproduction of the experimental findings (7). to allow researchers to completely re - analyze published results and to facilitate further discovery, raw images and data files associated with each experiment are readily accessible in zipped format however, some datasets are password protected prior to publication or upon authors ' request. in addition to the data retrieval interface, a simple user - friendly, forms - based online data submission system was developed to facilitate the submission process. once the data is submitted, instead of uploading it directly into the database, our staff will examine its compliance with miame standards and obtain from the authors any missing or improperly formatted information prior to uploading it to the database. fruit is a major component of human nutrition contributing a significant portion of vitamins, minerals and fiber in a healthy diet. the ripening of fleshy fruit is a coordinated regulatory process involving genetic, hormonal and environmentally controlled interactions leading to complex gene expression patterns (8). in order to gain insights into the molecular basis of fruit development and dissect the regulatory network governing fruit ripening, we performed global expression profiling analysis during fruit development and ripening of tomato and various single mutant gene lines (3). currently, normalized and processed microarray data for ten time points with nine pair - wise comparisons during wild - type fruit development and ripening, and during development of an ethylene - insensitive, ripening impaired mutant (never - ripe ; nr) (9), is included in this database. in addition, dna sequence information of each est element on the tomato array is included as is corresponding annotation information that was developed for each array unigene sequence. a number of useful query interfaces and data mining, analysis and visualization tools have been developed. the annotation and sequence information in addition to the expression data can be retrieved for any specific est through the conventional gene identifier query or in batch using the corresponding data mining tools. sequence similarity searches against all est sequences on the tomato array are also available through the blast (10) search interface. in addition, data for a group of genes can be retrieved by using key word(s) to query est functional annotations. the said annotations are based on the annotations of sgn () (11) unigenes to which corresponding ests belong. ests that display simple or complex query patterns of interest can also be retrieved and the normalized ratios and p - values of each hybridization can be sorted. tools to find genes with similar or inverse expression patterns to a given est and to compare expression profiles during fruit development for genes of interest in normal and mutant genotypes were also developed (figure 1). both tools employ the pearson correlation coefficient to measure similarity of expression profiles. since the tomato microarray has occurrences of different ests corresponding to the same gene (i.e. pseudo - replicates), we developed a tool to display expression profiles of all the pseudo - replicates representing one particular gene (figure 2). while the majority of pseudo - replicates yield similar results and serve as a form of validation of the expression profiling results, infrequent instances where they do not yield the same expression profiles do occur and are discussed in alba. in order to identify functionally related genes based on their expression profiles, we adapted several commonly used clustering programs. linux version of cluster 3.0 (13) was wrapped for our hierarchical clustering algorithm. the applet version of java treeview (14) and slcview () were used to visualize the hierarchical clustering results in interactive and static mode, respectively. perl module algorithm::cluster was used to implement k - means and som (self - organizing maps) clustering algorithms, and in - house cgi scripts were developed to visualize k - means and som results. genes within each cluster generated from k - means and som can be further viewed in a heatmap (figure 3b) which is generated using matrix2png program (15) or in a table (figure 3c). it has been shown previously that est databases are a valid and reliable source of gene expression data (16). we analyzed a large tomato est dataset including > 150 000 ests derived from 27 different non - normalized cdna libraries to gain insights into differential expression among diverse plant tissues representing a range of developmental programs and biological responses (2). the resulting raw digital expression data for > 15 000 unigenes (tigr tcs) and normalized digital expression data for > 6000 tcs were included in this database (2). the raw and normalized digital expression data can be retrieved and visualized through gene identifier (tc number) queries. an example of the visualization of normalized digital expression data is shown in figure 4. the returned page provides a link to the expression profile data during fruit development and ripening for the queried tc so that the digital expression profile and microarray expression profile of the same gene can be compared. similar tools as those found in the tomato microarray expression database for blast searching against the whole unigene collection are included as are key word(s) search functions. in addition, we implemented online tools to (i) identify differentially expression genes between any two query tissues for which data is available (17), (ii) identify highly abundant genes in a specific tissue, and (iii) compare digital gene expression among tomato and arabidopsis homologues. furthermore, the raw and normalized digital gene expression data and corresponding analysis results (e.g. tables of differentially expressed and tissue - specific genes) from fei. (2) are publicly available through the database to all researchers for independent analysis. we plan to add query interfaces (e.g. capability to search experiments according to authors) to the microarray data warehouse as more experiments are archived. we will also add support to output experimental data sets in mage - ml format (microarray gene expression - markup language) (18). we will continue to implement additional clustering and classification tools (e.g. principle component analysis additional analysis tools for expression profile comparison among multiple genotypes will be developed as more datasets are added to ted. cross genotype comparison tool. comparison of expression profiles of 1 - 1 - 3.4.10.21, a pto - like serine / threonine kinase, during normal tomato and nr mutant fruit development. expression profiles of pseudo - replicates from unigene sgn - u212746, a putative peptidyl - prolyl cis trans isomerase, during normal tomato fruit development and ripening. (b) heatmap view of expression profiles of genes in one cluster from (a) ; (c) table view of expression profiles of genes in one cluster from (a). | the tomato expression database (ted) includes three integrated components. the tomato microarray data warehouse serves as a central repository for raw gene expression data derived from the public tomato cdna microarray. in addition to expression data, ted stores experimental design and array information in compliance with the miame guidelines and provides web interfaces for researchers to retrieve data for their own analysis and use. the tomato microarray expression database contains normalized and processed microarray data for ten time points with nine pair - wise comparisons during fruit development and ripening in a normal tomato variety and nearly isogenic single gene mutants impacting fruit development and ripening. finally, the tomato digital expression database contains raw and normalized digital expression (est abundance) data derived from analysis of the complete public tomato est collection containing > 150 000 ests derived from 27 different non - normalized est libraries. this last component also includes tools for the comparison of tomato and arabidopsis digital expression data. a set of query interfaces and analysis, and visualization tools have been developed and incorporated into ted, which aid users in identifying and deciphering biologically important information from our datasets. ted can be accessed at. |
there is mounting evidence indicating that the static neck posture frequently assumed by computer workers using a computer is a risk factor for work - related neck and upper - limb disorders1, 2. during computer work, use of the cervical erector spinae (ces) muscles is important for efficient muscle activation and support for the task being performed, as well as for the upper trapezius1. a previous study reported that pain - related activation of the ces muscles could not be relaxed, even after an arm task2. recent findings indicated that the flexion - relaxation (fr) ratio in the ces muscles may be a significant criterion of neuromuscular impairment and function3. also, a previous study reported that the cervical extension and flexion angles could be a predictive factor for changes in head and neck posture after long - term visual display terminal work4. korean household internet and computer distribution rates have rapidly increased since 2000, and korea has now been identified as the country with the highest distribution of internet and computers in the world, with the rates exceeding 80%. a review of the rates of use of the internet using computers by age indicated that teenagers and people in their 20s use the internet the most frequently5. therefore, as of 2013, korean males and females in their 20s are thought to be exposed the most to diseases related to computers. therefore, this study compared the cervical range of motion and cervical frr between computer users in their early and late 20s in korea. eleven male and 7 female computer users in their early 20s (2024 years) and 10 male and 6 female computer users in their late 20s (2529 years) participated in this study. the early 20s group s average age, weight, and height were 21.6 1.5 (mean sd) years, 60.8 10.1 kg, and 168.3 8.5 cm, respectively. the late 20s group s average age, weight, and height were 27.8 2.1 years, 62.8 10.4 kg, and 169.5 6.8 cm, respectively. the subjects used computers for 5.01.5 hours / day (meansd) as full - time student workers in a university office. all subjects were right - dominant, and free of any neck or back pain for a minimum of 1 year prior to the study, and they did not have upper limb or cervical spine pathologies or rheumatological or neurological conditions. each subject provided informed consent before participating in the study. this study was approved by the inje university faculty of health sciences human ethics committee. all cervical rom measurements were taken with a cervical range of motion instrument (crom) (performance attainment associates, st. the intra - test reliability of the crom instrument was 0.89, and the inter - test reliability was 0.91. each participant began this phase by sitting on a standard folding chair and being fitted with the crom. after measuring the cervical active rom, electromyographic (emg) data were obtained for analyzing the fr ratio. surface electrodes were placed on the right sides of the ces muscles, 2 cm lateral to the c4 spinous process. the neck flexion and re - extension task comprised flexion, relaxation, and re - extension periods. the trunk flexion and re - extension task comprised relaxed standing, forward flexion, full flexion, and re - extension periods. each movement period lasted 3 seconds. the cervical flexion - relaxation ratio (frr) was calculated by dividing the maximal muscle activation during the 3-s re - extension period by the average activation during the 3-s relaxation period. the paired t - test was used for comparison of the cervical range of motion and cervical frr between the early and late 20s computer users in korea. the cervical extension, right and left lateral flexion, and right and left rotation (72.512.7, 39.66.5 and 42.66.6, 63.77.8 and 64.711.3) in the late 20s computer users were significantly lower compared with the cervical extension, right and left lateral flexion, and right and left rotation (83.513.7, 46.78.0 and 49.58.6, 72.58.5 and 73.57.2) in the early 20s computer users. cervical flexion showed no significant difference between the early 20s computer users (65.411.9) and late 20s computer users (598.3). the cervical frr in the late 20s computer users (1.24.8) was significantly lower compared with the cervical frr in the early 20s computer users (2.21.0). reduced crom can result from inactivity and structural changes in the tissues in the cervical spine, and the shortening of collagen tissue and muscle fibrosis results in an increased connective - tissue density6. there are many methods of evaluating the cervical region, including assessing crom, posture, muscle tenderness, pressure pain, neck - muscle power, and the subjective experience of pain. the results of the present study showed that the cervical extension, right and left lateral flexion, and right and left rotation in the computer users in their late 20s were significantly lower compared with the cervical motions in the computer users in their early 20s. the frr obtained by dividing the maximal muscle activation during the re - extension phase by activation during the relaxation phase was most highly associated with the cervical active rom, which was considered a major clinical feature of the anticipatory dysfunction and neck posture in previous studies4. this result showed that the cervical frr in the late 20s computer users (1.24.8) was significantly lower compared with the cervical frr in the early 20s computer users (2.21.0). in a previous study, the cervical frr values were relatively lower in the symptomatic population than in the controls3. the cervical frr, which is expressed as a numerical value, is a sensitive marker for measuring neuromuscular changes associated with even mild discomfort. in recent korea society, computer work is clearly the most threatening element that causes neck and shoulder pain for young computer users. although it is difficult to classify them as chronic patients given their ages, they may show tendencies of being chronic in terms of neck pain because they have been exposed to computers since childhood. this study was conducted to prepare for the possibility that young computer generations in korea could easily develop chronic neck pain, and the results of this study are thought to be very helpful clinically in determining neck pain in young computer users in their late 20s in korea, who could easily develop chronic neck and shoulder pain. | [purpose ] this study compared the cervical range of motion and cervical frr between computer users in their early and late 20s in korea. [subjects ] eleven male and 7 female computer users in their early 20s and 10 male and 6 female computer users in their late 20s participated in this study. [methods ] all cervical rom measurements were taken with a cervical range of motion instrument. electromyographic (emg) data were obtained for analyzing the fr ratio. [results ] cervical extension, right and left lateral flexion, and right and left rotation in the late 20s computer users were significantly lower compared with the cervical motions in the early 20s computer users. the cervical frr in the late 20s computer users was significantly lower compared with the cervical frr in the early 20s computer users. [conclusion ] this study was conducted to be prepared that the possibility for young computer generations in korea could easily develop chronic neck pain. |
(2009) address the production of il-9 by helper t cells, a finding that is of interest because of recent studies that found tgf- could induce the differentiation of th9 cells with a unique pattern of cytokine expression and a transcription factor profile that could not be pigeonholed into the framework of the th1, th2, th17, or t reg cell subsets (dardalhon. 2008). the role of tgf- in invoking il-9 production from t cells was originally reported by schmitt. (1994), who also noted that il-4 could potentiate and ifn- could inhibit the effect. tgf- regulates the differentiation of both t reg and th17 cells and, in this issue, nowak. (2009) demonstrate il-9 production by th cells primed in the appropriate manner and purified using reporters for foxp3 or il-17f (canonical signatures for t reg and th17 cells, respectively).this suggests that il-9 production tracks with priming or activation in the presence of tgf- rather than with a defined th subset. the authors go on to use knockout and chimeric mice to show that the il-9 made by th17 cells is proinflammatory in a standard myelin oligodendrocyte glycoprotein (mog) peptide - induced model of experimental autoimmune encephalomyelitis (eae). this result adds more complexity to the issue, as members of this group had previously implicated a role for il-9 produced by t reg cells in mediating graft tolerance by a mast cell dependent process (lu., 2006). thus, il-9 could be either inflammatory or regulatory, depending on the context and the source of the producing cells. in the hands of another group, il-9 produced by tgf-primed th17 cells enhanced the suppressive effects of t reg cells, resulting in an exacerbation of eae (although diseas was induced using a different dose of antigen) in the absence of il-9 (elyaman., 2009). everybody seems to agree that tgf- can induce il-9 production from helper t cells, but the biology beyond that will require further investigation to clarify the details. cells ? in the earlier studies, in vitro priming using anti - cd3 and irradiated apcs or anti - cd3 and anti - cd28 was used to generate foxp3-negative, il-9producing (and il-10producing) cells as assessed by intracellular cytokine detection after restimulation with pma and ionomycin ; conditions much like those used in the nowak. (2009) paper. but are the resulting cells truly a unique th subset ? studies in the mid-1990s demonstrated that cells primed once or twice were not stable when subsequently stimulated under different conditions, and they displayed much more plasticity than did cell lines restimulated multiple times under polarizing conditions (murphy., 1996). indeed, the original definition of th subsets was based on stable cytokine patterns produced by several mouse clones that were established from mice immunized in vivo and then cloned and maintained in vitro, and these cells provided the basis for the th1 and th2 designations (mosmann., 1986). the cell 's cytokine patterns remained stable whether assessed after stimulation with concanavalin a, antigen and apcs, or allogeneic apcs over periods up to 18 mo. no subsequently defined th subsets, including t reg and th17 cells, have stood up to such a rigorous examination. rather than discarding the concept of th subsets outside of the original th1 and th2 cells, however, it may be useful to consider the expansion of knowledge regarding intrinsic and extrinsic factors that come to bear on the ultimate elaboration of helper t cell cytokines. the identification of stable th cell lines enabled discovery of the molecular bases for the disparate patterns of cytokine expression and uncovered the epigenetic underpinnings of th cell differentiation. as recently reviewed (wilson., 2009), t cells integrate signals from dendritic cells and cytokines that together establish a network of dna - binding factors to initiate feed - forward systems that epigenetically modify chromatin such that patterns of gene expression come to be recapitulated in a heritable way. breaking the epigenetic code facilitated recognition of unique modifications associated not only with active or silenced genes, but also with poised genes that could be activated when signaled, as well as genes carrying bivalent marks that were capable of further modification (be it activation or silencing) upon subsequent exposure to the appropriate signals. in this way, differentiated cells become heritably restricted in their phenotypes, yet maintain some flexibility to tailor responses to changes in the environment, much as hematopoietic precursors traverse bistable states on their way to fixed cell lineages (laslo., (a) naive t cells have master regulators (top) in receptive poised states (yellow balls) and effector cytokines (bottom) in epigenetically silenced chromatin (red balls), although some cytokine genes are poised for rapid expression after tcr stimulation. (b) after one or two stimulations under polarizing conditions, daughter cells express similar cytokines from activated loci (green), whereas other cytokines become silenced (red) or maintain a poised state awaiting stimulation. some master regulators, however, remain bivalent (red and green), sustaining flexibility in the cells that allows redirection of cytokine expression if the inflammatory milieu changes. (c) with continued polarizing stimulations, master regulators become silenced (red) or activated (green), leaving cells with an essentially fixed repertoire of cytokine effectors (bottom) caused by the loss of genetic space. memory cells, which arise early after initial antigen stimulation, would be predicted to maintain more bivalent states at master regulators, thus leaving a more flexible cytokine repertoire in memory cells as compared with terminal effector cells. recent studies have interrogated cd4 and cd8 t cells by combining gene expression profiling with chip - seq and high - throughput sequencing technologies to investigate the chromatin state in resting and effector t cells, providing a first molecular look at the status of cytokine genes accompanying differentiation (araki. the surprising finding was the retention of bivalent marks at transcription factor genes previously identified as master regulators, thereby predicting a large degree of flexibility that could be revealed by subjecting cells to alternate conditions that activate the bivalent state. the presence of bivalent marks at tbx21 and gata3 in th17 cells, at gata3 in th1 cells, at tbx21 in th2 cells, and at tbx21, gata3, and rorc in t reg cells suggests the potential for substantial reversibility of function, which has now been confirmed experimentally (lee., 2009 ; wei., 2009) notably, however, these studies generally used two rounds of polarization in vitro, and are subject to the caveats noted above. such findings need to be extended to analyses of highly polarized cells generated in vivo and then cloned and sustained by the methods used to generate the initial th1 and th2 cells to assess whether further restrictions of lineage regulators occurs as cells are pushed into increasingly more confined genetic space. impinging upon this variegated nuclear architecture of the genome is the complex environment of cytokines and cell surface molecules that together constitute the system for modifying gene expression upon tcr ligation. it should not be surprising that some constellation of signals could activate the right network of transcription factors such that activation of unanticipated genes, potentially those carrying bivalent marks, will occur, thus achieving new states of cytokine expression. if some of those genes encode key regulators that can themselves affect chromatin architecture, reversibility in phenotype this is particularly true if coupled with signals that activate cell division, a process that favors the establishment of new marks on the daughter chromatin strands. after all, only four transcription factors are required (including c - myc to promote entrance into cell cycle) to convert fibroblasts into pluripotent stem cells, although a more thorough understanding of how to reprogram dna and histone modifications will be necessary to improve the efficiency of the process (for review see yamanaka, 2009). understanding the pathways that activate genes with bivalent marks will increase our understanding of the regulatory networks involved in t cells, and perhaps allow the strategic targeting of key pathways to redirect immunity in therapeutic ways. based on the reports of th9 cells, we might predict that the il-9 gene will carry a poised or bivalent mark in most activated t cells, but that this mark will increasingly tilt toward the activated state in the presence of tgf- and toward the silenced configuration in the presence of ifn-. similarly, il-10 can be induced from a wide variety of th subsets under different conditions, but il-27 might provide an entrance into the network that converts this cytokine gene to the fully activated state in certain subsets (stumhofer., 2007). a more complete analysis of the bivalency epigenetic map in th cells as they undergo successive rounds of division may reveal the critical paths that sequentially close down as cells terminally differentiate, as well as the key shortcuts that remain open to enable some cells to escape their terminal fates and reset their effector functions. such approaches may also help define important transition states, such as those that create t follicular helper cells, that have been related to th subsets through their cytokine expression status (king and mohrs, 2009 ; reinhardt. helper t cell differentiation can be compared with nested russian dolls, where each daughter represents a subset of the precursor from which it arose. although descended from the same genetic space, the environment will compress the accessible space sequentially, leaving each daughter less flexible than its predecessor (fig. thus far, descriptions of th subsets typically rely on once- or twice - primed cells, restimulation assays, whole population approaches (pcr, elisas, etc., that by necessity rely on the sum collected from many cells), or artificially in vitro activated cells all done for various technical and financial reasons. functional genomic analysis of more deeply nested dolls will be necessary before we can put the seminal observations of mosmann. (1986) into the proper molecular context to arrange the increasing array of putative th subsets into their proper hierarchical space. with single - cell genetic, sequence, and proteomic analysis getting closer and closer to reality, it will be only a matter of time until we find out whether truly differentiated th cells really have nine lives or nine cells have one. | the division of labor among two types of t helper (th) subsets, first described over 20 yr ago, has been buffeted by the discovery of new subsets and new cytokines that can be coaxed out of t cells with increasing disregard for the subset of origin. although th17 cells and regulatory t (t reg) cells are widely accepted subsets, and others are being proposed, their plasticity is difficult to reconcile with the definitions of th subsets as put forth in the initial description of th1 and th2 cells. a deeper molecular context will be required to reconcile the ever - increasing complexity of effector t cells. |
many us americans consume diets that are overly high in energy and in constituents associated with disease risk, particularly saturated fat (sfa), cholesterol and sodium and low in protective components such as fiber or -carotene. poorly balanced diets contribute to overweight, cardiovascular disease, type 2 diabetes and other conditions. in clinical research studies, individuals who adopt diets emphasizing vegetables, fruits, whole grains and legumes report significant reductions in the intake of fat and cholesterol and increases in fiber, -carotene, magnesium, potassium and vitamin k intake. plant - based diets are associated with improvements in body weight, plasma lipid concentrations, glycemic control and blood pressure and may assist in the management of prostate cancer. we tested a program designed to translate a plant - based dietary intervention from the research environment to the workplace. an initial controlled study at two corporate sites of the government employees insurance company, a large us insurer, showed that providing instruction in the use of plant - based diets tended to cause weight loss, improvements in plasma lipid concentrations and, for those with diabetes, improved blood glucose control. a subsequent trial at 10 corporate government employees insurance company sites in diverse regions of the united states showed similar results. as plant - based diets may alter a wide range of macronutrient and micronutrient intakes affecting health in many ways, we sought to assess the nutrient changes associated with the intervention diet in the latter study. we hypothesized that a plant - based dietary intervention would reduce the intake of energy, sfa and cholesterol and increase the intake of fiber, -carotene, vitamin c and potassium. the study design and major physiological results have been described elsewhere. briefly, the overall study tested the hypothesis that a program including a low - fat vegan diet taught through group sessions at worksites in widely divergent areas of the united states would elicit improvements in body weight and other health indicators. the study was intended to translate the findings of intervention trials into a simple program that could be implemented for large groups of individuals at work. it was designed not to test individual program components (for example, a diet or a group of classes) but rather to assess the effect of the intervention program as a whole, similar to the design of the diabetes prevention program, which tested the combined effects of diet and exercise interventions in individuals at risk for diabetes. individuals aged 18 years or above with a body mass index of 25 kg / m or a previous diagnosis of type 2 diabetes were recruited through employee notices at 10 government employees insurance company corporate offices in the united states : tucson, arizona ; san diego, california ; lakeland, florida ; macon, georgia ; chevy chase, maryland ; buffalo, new york ; woodbury, new york ; dallas, texas ; fredericksburg, virginia ; and virginia beach, virginia. exclusion criteria were current alcohol or drug abuse, pregnancy, history of severe mental illness, unstable medical status, current adherence to a low - fat vegetarian diet, participation in the previous government employees insurance company study and inability to attend weekly meetings. those who appeared to satisfy the participation criteria were scheduled for individual interviews to review the study procedures and confirm eligibility. the study was approved by an external institutional review board (independent review consulting, whose name was later changed to ethical and independent review services, corte madera, ca, usa.). each pair of sites represented a cluster, and, using a random - number table, the sites within each pair were randomly assigned to the intervention (fives sites) or control (five sites) groups. as the assignment was done by site rather than by individual, this method was used because of the likelihood that the intervention, which would be strongly apparent in the work environment, would tend to influence the behavior of individuals throughout the worksite, including those not assigned to the intervention group. at intervention sites, participants were asked to follow a low - fat vegan diet and attend weekly group meetings. individuals at control sites were given no dietary guidance and were not asked to make any dietary changes. they were given monetary compensation in the form of gift certificates to retail stores (whole foods market or target), totaling $ 50 for completion of all baseline and week-18 assessments. the rationale for compensation of control - group participants was that, unlike the intervention group, they received no other benefit from the study and had no contact with the investigators, aside from the assessments. all participants in both groups were asked to avoid changing exercise patterns during the study period. participants at intervention sites were asked to avoid animal products (that is, meat, poultry, fish, dairy products and eggs) and to base their diets on whole grains, vegetables, legumes and fruits. they were also encouraged to minimize added oils and to favor foods with a low glycemic index, such as beans, fruit, pasta, rye and pumpernickel bread (rather than typical wheat breads), and oatmeal or bran cereal (rather than typical cold cereals). intervention - group participants were also asked to take a daily supplement of vitamin b12, such as a multiple vitamin. at intervention sites with cafeterias, food service managers were asked to include low - fat plant - based menu options, such as oatmeal, minestrone or lentil soup, veggie burgers and portobello sandwiches, among the daily offerings. whether and how to implement such menu additions were left to their discretion, and their progress in doing so was not formally assessed. they were provided group support in the form of weekly lunch - hour classes at the worksite led by a registered dietitian, physician and/or a cooking instructor, following an established curriculum for the duration of the study. classes included sessions on replacements for animal products, healthful snacking, dining out, travel, shopping and cooking, as well as nutrition - related health topics such as weight loss, diabetes, heart disease and cancer. participants were offered additional support through an interactive online message board on which they could ask or respond to questions. all instructors received training in study procedures and best practices for facilitating group discussion and used identical instruction materials (a standardized curriculum, handouts, videos, instructions for cooking, and so on). the following measures were assessed at baseline and week 18 : a diet recall was used to assess nutrient intake over two 24-h periods at baseline and two 24-h periods at 18 weeks, using an online (automated self - administered 24-h recall, asa-24) program developed by the national cancer institute (bethesda, md, usa). the format and design of the asa-24 are based on the interviewer - administered automated multiple pass method 24-h recall developed by the us department of agriculture. the online program has the advantages of ease of use and scoring and face validity ; however, although the automated multiple pass method is a validated instrument, validation trials of asa-24 remained in progress at the time of this study. subjects were advised of vegan items that asa-24 does include, such as vegan burger, seitan and tofu, and of common vegan items that are not on asa-24, such as quinoa and tempeh. subjects were instructed not to skip any entries even if exact matches were not found in asa-24. instead, they were coached on how to find a suitable alterative, such as substituting brown rice for quinoa or vegetarian sub for vegan sandwich. registered dietitians cross - checked data on asa-24 by taking participant nutrient data and entering them into the usda nutrient database to make sure nutrient intake numbers were relevant to asa-24. numbers that appeared erroneous were excluded, such as an intake of 500 calories reported for an entire day. macronutrient intakes were reported as percentages of total energy intake, and fiber and micronutrients were reported as quantities per 1000 kcal. as animal products are the only significant source of dietary cholesterol, cholesterol intake reported at 18 weeks served as a rough gauge of adherence to the intervention diet. the numbers of group participants whose cholesterol intake was 50 mg / day (the amount of cholesterol in 2 ounces of typical meats or cheeses) and 75 mg / day (the amount of cholesterol found in 3 ounces of typical meats or cheeses) were calculated from 18-week diet recalls. the number of group participants whose fat intake was below 25 and 35% of the total calorie intake was also calculated. all participants were asked to continue their pre - existing medication regimens unless otherwise instructed by their personal physicians. student 's t - tests and -tests were used to assess whether any demographic or clinical measures between groups at baseline were unbalanced. nutrient data were examined for extreme values, and distributions of variables were examined for skewness using a normality plot and the shapiro wilk test. statistical analyses of nutrient intake were performed on an intention - to - treat basis, including all participants who completed an initial diet recall, with the post - intervention values for dropouts set to the pre - intervention values. a second analysis was limited to participants who completed diet recalls at baseline and 18 weeks. the significance of within - group changes in dietary variables was determined using paired t - tests. a general linear model univariate analysis (analysis of covariance) was used to estimate the treatment effect and determine whether the changes in nutrient intake of the intervention and control groups during the 18-week trial were significantly different from each other. diet group was included as a fixed factor in these models, with the baseline value of each nutrient as a covariate. in addition, the geographic site was added to the model as a random effect to account for within - site correlation in outcomes. as the number of sites was small, the significance of and confidence intervals for treatment effect were computed using the kenward participants at intervention sites were asked to avoid animal products (that is, meat, poultry, fish, dairy products and eggs) and to base their diets on whole grains, vegetables, legumes and fruits. they were also encouraged to minimize added oils and to favor foods with a low glycemic index, such as beans, fruit, pasta, rye and pumpernickel bread (rather than typical wheat breads), and oatmeal or bran cereal (rather than typical cold cereals). intervention - group participants were also asked to take a daily supplement of vitamin b12, such as a multiple vitamin. at intervention sites with cafeterias, food service managers were asked to include low - fat plant - based menu options, such as oatmeal, minestrone or lentil soup, veggie burgers and portobello sandwiches, among the daily offerings. whether and how to implement such menu additions were left to their discretion, and their progress in doing so was not formally assessed. they were provided group support in the form of weekly lunch - hour classes at the worksite led by a registered dietitian, physician and/or a cooking instructor, following an established curriculum for the duration of the study. classes included sessions on replacements for animal products, healthful snacking, dining out, travel, shopping and cooking, as well as nutrition - related health topics such as weight loss, diabetes, heart disease and cancer. participants were offered additional support through an interactive online message board on which they could ask or respond to questions. all instructors received training in study procedures and best practices for facilitating group discussion and used identical instruction materials (a standardized curriculum, handouts, videos, instructions for cooking, and so on). the following measures were assessed at baseline and week 18 : a diet recall was used to assess nutrient intake over two 24-h periods at baseline and two 24-h periods at 18 weeks, using an online (automated self - administered 24-h recall, asa-24) program developed by the national cancer institute (bethesda, md, usa). the format and design of the asa-24 are based on the interviewer - administered automated multiple pass method 24-h recall developed by the us department of agriculture. the online program has the advantages of ease of use and scoring and face validity ; however, although the automated multiple pass method is a validated instrument, validation trials of asa-24 remained in progress at the time of this study. subjects were advised of vegan items that asa-24 does include, such as vegan burger, seitan and tofu, and of common vegan items that are not on asa-24, such as quinoa and tempeh. subjects were instructed not to skip any entries even if exact matches were not found in asa-24. instead, they were coached on how to find a suitable alterative, such as substituting brown rice for quinoa or vegetarian sub for vegan sandwich. registered dietitians cross - checked data on asa-24 by taking participant nutrient data and entering them into the usda nutrient database to make sure nutrient intake numbers were relevant to asa-24. numbers that appeared erroneous were excluded, such as an intake of 500 calories reported for an entire day. macronutrient intakes were reported as percentages of total energy intake, and fiber and micronutrients were reported as quantities per 1000 kcal. as animal products are the only significant source of dietary cholesterol, cholesterol intake reported at 18 weeks served as a rough gauge of adherence to the intervention diet. the numbers of group participants whose cholesterol intake was 50 mg / day (the amount of cholesterol in 2 ounces of typical meats or cheeses) and 75 mg / day (the amount of cholesterol found in 3 ounces of typical meats or cheeses) were calculated from 18-week diet recalls. the number of group participants whose fat intake was below 25 and 35% of the total calorie intake was also calculated. all participants were asked to continue their pre - existing medication regimens unless otherwise instructed by their personal physicians. student 's t - tests and -tests were used to assess whether any demographic or clinical measures between groups at baseline were unbalanced. nutrient data were examined for extreme values, and distributions of variables were examined for skewness using a normality plot and the shapiro wilk test. statistical analyses of nutrient intake were performed on an intention - to - treat basis, including all participants who completed an initial diet recall, with the post - intervention values for dropouts set to the pre - intervention values. a second analysis was limited to participants who completed diet recalls at baseline and 18 weeks. the significance of within - group changes in dietary variables was determined using paired t - tests. a general linear model univariate analysis (analysis of covariance) was used to estimate the treatment effect and determine whether the changes in nutrient intake of the intervention and control groups during the 18-week trial were significantly different from each other. diet group was included as a fixed factor in these models, with the baseline value of each nutrient as a covariate. in addition, the geographic site was added to the model as a random effect to account for within - site correlation in outcomes. as the number of sites was small, the significance of and confidence intervals for treatment effect were computed using the kenward the intervention sites were in tucson, macon, chevy chase, buffalo and lakeland. the control sites were in san diego, fredericksburg, woodbury, dallas and virginia beach. of 319 volunteers screened for eligibility, 292 (142 at intervention sites and 150 at control sites) met the participation criteria and were enrolled in the overall clinical trial. of this group, 271 (130 at intervention sites and 141 at control sites) completed usable baseline diet recalls and constituted the baseline sample for the current inquiry. at 18 weeks, 183 (78 in the intervention group and 105 in the control group) completed diet recalls and were considered study completers for purposes of the nutrient analysis. there were no significant demographic differences between the intervention and control groups at baseline, except for a somewhat greater percentage of women at control sites (table 1). among completers, the intervention - group and control - group completers differed only with regard to gender (76% women in the intervention group, 88% women in the control group, p=0.04). compared with noncompleters, study completers were older (45.5 versus 41.6 years, p=0.008) and had a lower mean baseline body mass index (34.3 versus 37.3 kg / m, p=0.006). the median percentage of group sessions attended per participant (among the completers at intervention sites) ranged from 33% in macon to 75% in chevy chase, with an overall median of 50%. among study completers, cholesterol intake at 18 weeks was 75 mg / day for 85% (66/78) of intervention - group participants and 21% (22/105) of control - group participants (p<0.001). cholesterol intake was 50 mg / day for 74% (58/78) of intervention - group participants but only 13% (14/105) of control - group participants (p<0.001). total fat intake was 35% of the total calorie intake for 86% (67/78) of intervention - group participants compared with 40% (42/105) of the control - group participants (p<0.001). fat intake was 25% for 49% (38/78) of intervention - group participants and for 8% (8/105) of control - group participants (p<0.001). sfa intake was 10% of total calorie intake for 88% (69/78) of intervention - group participants and 38% (40/105) of control - group participants (p<0.001). sfa intake was 5% of total calorie intake for 51% (40/78) of intervention - group participants but only for 5% (5/105) of control - group participants (p<0.001). at baseline, there were significant differences between participants in the two study arms with respect to the percentage of energy from fat (p=0.04) and vitamin b12 per 1000 kcal (p=0.05). during the 18-week intervention, both groups reduced the reported energy intake but the between - group difference was not significant (table 2). comparing nutrient intake changes over time between the two groups in the intention - to - treat analysis, adjusting for baseline values and accounting for within - site correlations in outcome, the intervention group significantly reduced the mean reported intake of fat, particularly of sfa but also of monounsaturated fat (table 2). the intervention group also increased the reported intake of -carotene, vitamin c, magnesium and potassium. the calcium intakes of both groups were below the recommended levels at baseline, and calcium intake fell further in the intervention group. limiting the analysis to study completers, results were similar to those in the intention - to - treat analysis (table 3). overall reported energy intake fell in both groups. compared with changes in the control group, the intervention group reduced the reported intake of fat (total, monounsaturated fat and sfa), protein and cholesterol and increased carbohydrate and fiber intake. in addition, retinol intake fell, which was compensated for by an increase in -carotene. reported intakes of vitamin k, vitamin b6, folate, vitamin c, iron, magnesium and potassium increased, whereas calcium intake decreased. among study completers, cholesterol intake at 18 weeks was 75 mg / day for 85% (66/78) of intervention - group participants and 21% (22/105) of control - group participants (p<0.001). cholesterol intake was 50 mg / day for 74% (58/78) of intervention - group participants but only 13% (14/105) of control - group participants (p<0.001). total fat intake was 35% of the total calorie intake for 86% (67/78) of intervention - group participants compared with 40% (42/105) of the control - group participants (p<0.001). fat intake was 25% for 49% (38/78) of intervention - group participants and for 8% (8/105) of control - group participants (p<0.001). sfa intake was 10% of total calorie intake for 88% (69/78) of intervention - group participants and 38% (40/105) of control - group participants (p<0.001). sfa intake was 5% of total calorie intake for 51% (40/78) of intervention - group participants but only for 5% (5/105) of control - group participants (p<0.001). at baseline, there were significant differences between participants in the two study arms with respect to the percentage of energy from fat (p=0.04) and vitamin b12 per 1000 kcal (p=0.05). during the 18-week intervention, both groups reduced the reported energy intake but the between - group difference was not significant (table 2). comparing nutrient intake changes over time between the two groups in the intention - to - treat analysis, adjusting for baseline values and accounting for within - site correlations in outcome, the intervention group significantly reduced the mean reported intake of fat, particularly of sfa but also of monounsaturated fat (table 2). the intervention group also increased the reported intake of -carotene, vitamin c, magnesium and potassium. the calcium intakes of both groups were below the recommended levels at baseline, and calcium intake fell further in the intervention group. limiting the analysis to study completers, results were similar to those in the intention - to - treat analysis (table 3). overall reported energy intake fell in both groups. compared with changes in the control group, the intervention group reduced the reported intake of fat (total, monounsaturated fat and sfa), protein and cholesterol and increased carbohydrate and fiber intake. in addition, retinol intake fell, which was compensated for by an increase in -carotene. reported intakes of vitamin k, vitamin b6, folate, vitamin c, iron, magnesium and potassium increased, whereas calcium intake decreased. these changes were similar to those previously reported in clinical research settings, suggesting that these research findings effectively translated into an intervention implemented at worksites in widely divergent areas of the united states. part of this reduction may be because of underreporting, which is common in clinical trials of non - institutionalized participants. another possible explanation is that because asa-24 does not contain common vegan food items, subjects may have omitted these foods, resulting in lower energy intake reports. however, it is likely that the reduced energy intake of the intervention group is, at least in part, on account of increased fiber intake and reduced fat intake, both of which would tend to reduce the energy density of the diet. in turn, a reduction in energy intake favors weight loss, which has been observed in prior studies using low - fat, plant - based diets and was observed in the current study. reductions in reported energy intake and weight loss commonly occur with plant - based diets, even in the absence of specific limitations on energy intake or specific guidance regarding portion control. diets high in fiber may also facilitate removal of cholesterol, with favorable effects for individuals at risk of cardiovascular disease. in a 5-year study of patients with heart disease, a low - fat vegetarian diet as a part of a program of lifestyle changes has been shown to reverse atherosclerosis and reduce the risk of cardiac events. reported protein intake decreased in the intervention group, but the percentage of energy from protein remained within the range recommended by the institute of medicine. among micronutrients, the intervention group increased the reported intake of -carotene, vitamin c, magnesium and potassium. calcium intake was below the levels recommended by the institute of medicine at baseline and again at 18 weeks, and was dropped in the intervention group. in estimating calcium requirements, committees have used varying methods to calculate skeletal accretion and turnover rates, resulting in a considerable worldwide debate about whether currently recommended intakes of calcium are adequate to maximize peak bone mass and to minimize bone loss and fracture risk in later life. however, this may indicate the need for further instruction on plant - based sources of calcium, such as green leafy vegetables and legumes. reported iron intake increased in the intervention group, reflecting the increased intake of plant - based sources of iron. the 18-week nutrient intake data indicate that some intervention group participants continued to include some animal products in their diets and consumed more fat than had been recommended. nonetheless, the two groups diverged markedly in their reported dietary behavior, suggesting that the intervention elicits significant changes even for those participants who do not fully adhere to the prescribed guidelines. as previously reported, these nutrient changes are reflected in improvements in body weight, plasma lipid concentrations, and, for those with diabetes, improvements in glycemic control. the tendency of plant - based diets to favorably influence nutrient intake and clinical measures related to disease risk raises the question of their sustainability over the long term. a university of pittsburgh survey of young women who had tried both vegetarian and various calorie - restricted diets found that the mean duration of adherence to vegetarian diets was at least 2 years, compared with only 4 months for calorie - restricted diets. in the course of dietary intervention trials, adherence, attrition and eating behavior have been studied, and vegetarian and vegan regimens appear to be generally similar to other therapeutic diets within these parameters. strengths of the study include participation by individuals from divergent geographical areas, whose tastes and dietary habits and whose access to healthful foods likely varied as well ; the use of a dietary intervention that can be reproduced in other corporate locations ; and sufficient statistical power to demonstrate significant changes. its duration was limited to 18 weeks, primarily on account of the challenges of retaining untreated control - group participants over a longer period of time. had the study design included an active comparison program within the control group, it may have permitted sufficient engagement for a longer study, although such a design would have eliminated the possibility of comparisons with an untreated control. although there appeared to be a reasonable balance among those variables that were reported, we can not assume balance on other unreported or unmeasured variables. possible reasons for a failure to complete nutrient records include limited access to the internet and difficulties in navigating through the asa-24 online diet recall program. in summary, the present study demonstrated that a simple nutrition education program using modest group support at the place of employment yields significant improvements in nutrient intakes. the worksite is a potentially important venue for nutrition teaching and lifestyle modification and merits increased attention. in interventions using plant - based diets, planning for adequate intake of vitamin b12 and calcium future studies should focus on the longer - term nutrient changes associated with worksite dietary intervention programs. | background / objectives : to assess the effects on macro- and micronutrient intake of a nutrition intervention program in corporate settings across the united states.subjects/methods:two hundred and ninety - two individuals who were overweight or had type 2 diabetes were recruited from 10 sites of a us insurance company. two hundred and seventy - one participants completed baseline diet recalls, and 183 participants completed dietary recalls at 18 weeks. sites were randomly assigned to an intervention group (five sites) or to a control group (five sites) for 18 weeks. at intervention sites, participants were asked to follow a low - fat vegan diet and attend weekly group meetings. at control sites, participants continued their usual diets. at baseline and 18 weeks, participants completed 2-day diet recalls. between - group differences in changes in nutrient intake were assessed using an analysis of covariance.results:compared with those in the control group, intervention - group participants significantly reduced the reported intake of total fat (p=0.02), saturated (p=0.006) and monounsaturated fats (p=0.01), cholesterol (p=0.009), protein (p=0.03) and calcium (p=0.02), and increased the intake of carbohydrate (p=0.006), fiber (p=0.002), -carotene (p=0.01), vitamin c (p=0.003), magnesium (p=0.04) and potassium (p=0.002).conclusions : an 18-week intervention program in a corporate setting reduces intake of total fat, saturated fat and cholesterol and increases the intake of protective nutrients, particularly fiber, -carotene, vitamin c, magnesium and potassium. the reduction in calcium intake indicates the need for planning for this nutrient. |
methacrylate - based resin cements are popular for attaching indirect restoratives, appliances, and fiber posts to the prepared teeth due to their less technique sensitivity, good esthetics, high bond strength, and a potential for fluoride release.1 - 4 as luting agents for indirect restorations, resin cements are needed to keep the restoration in place and prevent dislodgement by forming a hard mass with sufficient strength to resist functional forces. in the oral cavity, however, shear forces that interact with the restoration inevitably induce dislodgement and retention loss. in addition, a low flexural strength, high shrinkage, water uptake, and expansion of the restorative materials also provoke debonding.5 - 7 among the resin cements, dual - cure resin cements have been adopted widely because of their dual cure nature by light and chemical agents. since restorative materials with opacity or dark shades are common, insufficient light transmission to the underlying cement and insufficient curing (degree of conversion) can occur. so any additional curing will be beneficial to compensate insufficient curing of resin cement because the curing conditions can be affected by the external light (light intensity, distance between the light - guide and resin cement, light - curing unit, etc.) and restoration thickness.8 - 11 in a dual - cure system, light - curing process is initiated by the light - activated photoinitiators and terminates the process mostly after the end of light irradiation. on the other hand, the self - curing process initiated by a chemical activator (benzoyl peroxide) lasts longer, even after the termination of light irradiation. therefore, in a situation of insufficient light transmission, the free radicals formed by the benzoyl peroxide / amine system compensate for the lack of monomer to polymer conversion.12 the dual - cure resin cements give higher hardness or better bond strength than those of the chemically - activated resin cements.13,14 the overall properties of resin cements using the dual - cure system seem to be superior when compared to the single - cure system. although the temperature in the oral cavity remains constant in most times, it can vary from 0 to 60 - 70 due to the foods served and smoking.15,16 such a variation in temperature may chill or heat the restorative materials and teeth and can change their mechanical properties. the short - term thermal effect on the resin cements can be understood indirectly by examining the effect of pre - heating on the resin cement. according to the limited studies, the results of preheating were inconsistent and product - dependent.17,18 thus long - term thermal effect on the dual - cure resin cements in conjunction with their mechanical properties was not widely studied. the present study investigated the effect of temperature on the light - cured resin cements that were immersed in water. the hypothesis was that the mechanical properties of dual - cure resin cements consistently depend on the temperature of immersion solution. for the study, five dual - cure resin cements (maxcem elite (mc), biscem (bc), calibra (ca), relyx arc (rx), and multilink automix (ma)) were selected, and their compositions are summarized in table 1. for light curing, a quartztungsten - halogen (qth) light - curing unit (hilux 601, first medica, greensboro, nc, usa) of 900 mw / cm was used. to evaluate the temperature effect on the specimens, the light - cured specimens were immersed in deionized water of three different temperatures (4, 37 and 60). the control specimens were aged only for 24 hours in a 37 dry and dark chamber. to measure the surface microhardness of the specimens, a metal mold (4 2 3 mm) was filled with the resin cement and light cured for 40 seconds. the cured specimens was removed from the mold and aged for 24 hours in a 37 dry and dark chamber. the specimens were then immersed in deionized water (4, 37 and 60) for 7 days. at this time, each specimen (n=10 for each temperature condition) was placed in a 1.5 ml tube, and the solution in the tube was replaced daily. after 7 days, specimens were removed from the tube and the solution on the surfaces was blotted away. the microhardness of the light cured top side (z=0) and bottom side (z=3 mm) surfaces was measured using a vickers hardness tester (mvk - h1, akashi, tokyo, japan) by making a microindentation (n=12 for each test condition) under a 200 gf load and 10 seconds dwell time. a three - point bending test was performed to determine the flexural properties [flexural strength (fs) and modulus (fm) ]. to make the specimens, a metal mold (25 2 2 mm) was filled with the resin cement according to the iso 4049.19 after filling the mold, both top and bottom surfaces were covered with slide glasses to make a flat surface. the specimen was irradiated for 40 seconds using a light - curing unit. since the specimen was much wider (25 mm) than the tip size (8 mm), five light exposures were performed on each side by overlapping the curing light. after light curing, one group of specimens was removed from the mold and aged for 24 hours in a 37 dry and dark chamber (control), the other groups of specimens were immersed in the three test solutions (4, 37 and 60) for 7 days. after aging or immersing in the test solutions, the specimens (n=10 for each test condition) were loaded to a universal testing machine (instron 3345, grove city, pa, usa) at a crosshead speed of 1 mm / min. the fs (f in mpa) was obtained using the following formula where d is the distance between the supports (20 mm), p is the maximum failure load (n), w is the width (2 mm), and h is the height (2 mm) of the tested specimen. the fm (e in gpa) was obtained using the following formula e = (p / d) (d / (4wh)) where p / d is the slope in the linear portion of the load - displacement curve. to measure the compressive properties [compressive strength (cs) and modulus (cm) ], a metal mold (3 mm in diameter, 6 mm in height) was filled with the resin cement. after filling the mold, both the top and bottom surfaces were covered with slide glasses to make the surface flat and then irradiated for 5 seconds (since light does not reach to the bottom surface, light curing would be better through the lateral surface after exposure). the opposite side was light cured for 40 seconds again after removing the other part. after light curing, one group of specimens was removed from the mold and aged for 24 hours in a 37 dry and dark chamber (control). the other group of specimens was immersed in the testing solutions (4, 37 and 60) for 7 days. after aging or immersing in the test solutions, compression tests were performed using a universal test machine at a crosshead speed of 1 mm / min. the cs (c in mpa) was obtained using the following formula where p is the maximum failure load (n) and a is the cross - sectional area of the specimen. the cm of the specimens is the slope of the linear portion of the load - displacement curve. the data acquired from the microhardness, three - point bending test, and compression test was analyzed by two way anova and post - hoc tukey tests at the 0.05 level of significance. table 2 shows the microhardness of the top and bottom surfaces before and after immersion in the solutions of different temperatures. before immersion, ma and mc showed the highest (50.9/47.6 hv) and lowest (33.1/30.1 hv) microhardness, respectively, among the specimens. after immersion for 7 days, the specimens showed a significant decrease in microhardness compared to the control case regardless of the solution temperatures (p<.001). on the top surface, ca and bc showed the lowest (4.8 - 15.9%) and highest (42.4 - 54.6%) microhardness difference between the control and immersed specimens, respectively. rx and ma showed a consistent microhardness decrease as the solution temperature increased. on the bottom surface, for the control case, the microhardness decreased approximately 3.3 - 12.2% compared to that of the top surface. the change of microhardness for solutions of different temperatures was not consistent both on the top and bottom surfaces. flexural properties (fs and fm) of the resin cements immersed in the solutions of different temperatures are shown in table 3. the highest and lowest fs, before (control) and after immersion, were achieved by ca (116.8 - 147.1 mpa) and bc (51.9 - 85.5 mpa), respectively. after immersion for 7 days, in most cases, fs decreased with increasing solution temperature. among the specimens, bc and ca showed the highest (39.3%) and lowest (20.6%) fs decrease, respectively. before immersion, ma and rx showed the highest (12.95 gpa) and lowest (10.72 gpa) fm, respectively. after immersion, most specimens (except ca) showed a significant decrease in modulus with increasing solution temperature (p<.001). among the specimens, ca and bc showed the highest (10.82 - 11.49 gpa) and lowest (6.62 - 6.81 gpa) fm, respectively. table 4 shows the compressive properties (cs and cm) of the resin cements immersed in the solutions of different temperatures. before immersion, rx and bc showed the highest (299.3 mpa) and lowest (211.7 mpa) cs, respectively. after immersion for 7 days, cs of the specimens decreased significantly (p<.001). among the specimens, ca and ma showed the highest (22.6%) and lowest (2.2%) cs decrease, respectively. for cm, before immersion, bc and rx showed the highest (4.19 gpa) and lowest (3.62 gpa) modulus, respectively. however, after immersion, specimens showed a significant decrease in modulus (p<.001). among the specimens, bc showed the lowest modulus (2.16 gpa) when immersed in the solution of 60. the present study evaluated the mechanical properties of dual - cure resin cements under different solution temperatures, which can minimally reflect the oral situation. the choice of solution temperature was arbitrary because the range of temperatures in the oral cavity is complicated and dynamic. in most situations, a constant temperature is maintained if there is no eating or drinking. however, the temperature can vary from 0 to 60 - 70 once cold or hot food is served.15,16 the range in this case can change depending on the dietary habits of each individual. in that sense, the choice of three different temperatures (4, 37 and 60) appears to be minimally appropriate for mimicking the oral situation. the microhardness test is a useful indirect assessment for evaluating the degree of cure of methacrylate - based specimens. the microhardness of the specimens is affected by many other factors which constitute the specimens. among the factors, the filler content, monomers types and ratios were found to be the determinant factors.20,21 regarding the filler content, in the present study, manufacturers released only the weight% data. according to the data, the resin cements have much lower filler content than many other composite resins. generally, in light - curing composite resins, the microhardness is positively correlated with the filler content. the degree of cure is basically the degree of monomer conversion to the polymer networks. most methacrylate - based dental restorative materials contain monomers, such as bis - gma, bis - ema, udma, and tegdma, with many different combinations and ratios. this means that the degree of cure (conversion) changes inconsistently depending on the commixtures and their combination ratios.22,23 in the present study, the filler content of the specimens showed a low correlation with the measured microhardness (r<0.4) regardless of the solution temperatures. such a low correlation may be due to the low filler content of the tested specimens. within the resin matrix, the distributed fillers are the source of light dissipation because fillers induce light scattering and absorption, so low filler content may result in less light loss within the specimen. actually, resin cements are not used for the restorations in which a direct mastication load is impressed, so the situation of low filler content would be tolerable both by itself and due to the dual - cure nature. the process of dual - cure is the curing of resin cements both by the external light and chemical agent. the dual - cure polymerization is beneficial in which light transmission is not sufficient. in this process, light - induced polymerization occurs first and then chemical agent - induced polymerization occurs later. the latter process compensates incomplete polymerization due to insufficient light transmission at the lower part of the specimen. on the control case (before immersion), minor microhardness difference (3.3 - 12.2% depend on resin brand) between the top and bottom surfaces would be due to the additional curing by chemical agent. such low microhardness difference is not common in the light - curing composite resins of 3-mm thick. after immersion in the test solutions for 7 days, the specimens showed a significant decrease in microhardness both on the top and bottom surfaces. such decrease in microhardness has also been observed in composite resins due to softening of the surface.24 once the specimens are immersed in the test solutions, water uptake and subsequent attacks at the interface between the inorganic fillers and resin matrix will occur. weakening of the bond between the filler and matrix and leaching of the surface by water make the specimen soft, which leads to a decrease in hardness. in the case of rx and ma, the microhardness decreased gradually with increasing solution temperature. on the other hand, in the case of bc, the microhardness increased gradually with increasing solution temperature even though the microhardness had significantly decreased after immersion at 4 solution. moreover, any additional curing by the external heat after the termination of light curing will depend on the residual monomers. in dual - cure resin cements, the residual monomers will be polymerized further by the subsequent chemical curing, so the remaining monomers will be reduced further with time (even though the situations can be different in each specimen). in the present study, hot water may enhance further polymerization, but, it may also enhance the softening and leaching of specimen through the specimen expansion and dissolution, so subsequent weakening is possible. on the other hand, if chemical curing after light curing is not complete and any monomers remain, external heat from the immersion solution may lead to some further polymerization, resulting in a subsequent increase in microhardness. fs and fm, the flexural properties, are determined using a three - point bending test. these flexural properties are related to the resistance to the mastication stress without fracture or permanent deformation. generally, fs depends on the internal defects or voids that were generated during manufacturing process.25 - 27 in the present study, fs and fm showed a significant decrease after immersion in the test solution, but the decrease was not consistent in the specimens. the fs of the resin cements tested ranged approximately 52 - 147 mpa depending on the conditions (control or immersion). these values meet the minimum fs requirement for dual - cure luting materials (50 mpa) set by iso 4049.19 as to the many methacrylate - based composite resins from more than 70 proprietary products (approximately 63 - 161 mpa), the tested resin cements showed a similar range of fs values.28 after immersion for 7 days, the initial (control) fm (10.72 - 12.95 gpa) decreased to 6.62 - 11.49 gpa depending on the solution temperature and brand. in the oral cavity, the preferred fm of the resin cements should be near the value of dentin and the restorative materials in order to have a similar deformation nature against the external load. according to the studies, the modulus of methacrylate - based restoratives and dentin was approximately 3 - 12 gpa and 17 - 25 gpa, respectively.28 - 30 a similar fm of the tested resin cements as to the many other restoratives is desirable for more durable cementation. otherwise, any resin cement may cause an adverse effect on the dentin - restorative structure due to the improper resistance at the interface. a compression test is an important in vitro test that evaluates the material 's sustained resistance against a heavy load during mastication. after immersion, the compressive properties (cs and cm) significantly decreased, but the correlation with solution temperature was not consistent. mc and ma showed minor cs change (2.2 - 4.4% decrease after immersion compared to that of the control case). on the other hand, the rest resin cements showed much greater cs change (15.8 - 22.6%) than mc and ma. generally, as the solution temperature increases, the immersed specimens expand and it results in the increase of water uptake through the filler - matrix interface. also, dissolution of fluoride from the contained fluoride - containing fillers will occur. as a result, weakening of the bond between the filler and matrix and the structure itself can lead to a decrease in cs. however, if there is any additional curing by the hot solution, such curing may compensate the weakening of the specimens by the absorbed water. the similar cs pattern in mc and ma may be due to a combination of these two effects. in the present study, cs after immersion for 7 days ranged approximately 178 - 299 mpa. this range matches with most methacrylate - based composite resins (approximately 100 - 290 mpa based on the study with more than 70 proprietary products).28 specimens showed much lower cm (2.2 - 4.2 gpa) than that of dentin (11.0 - 18.5 gpa) whether they were immersed or not.31,32 as a luting material, since resin cement forms a thin layer at the interface, such low cm may not make any serious mechanical problem after bonding. according to the evaluation, immersion in solution made the specimens to have significantly lower microhardness, flexural and compressive properties ; yet, the values inconsistently changed for varying solution temperature. the mechanical properties of the dual - cure resin cements were tested for different solution temperatures. the microhardness, flexural properties (fs and fm), and compressive properties (cs and cm) decreased significantly after immersion in the deionized water regardless of change in temperature. however, the effect of the solution temperature on the mechanical properties was not consistent and was rather brand - dependent. the flexural and compressive properties of the dual - cure resin cements were similar to those of the most methacrylate - based composite resins and dentin. | purposethis study was to evaluate the effect of the solution temperature on the mechanical properties of dualcure resin cements.materials and methodsfor the study, five dual - cure resin cements were chosen and light cured. to evaluate the effect of temperature on the specimens, the light - cured specimens were immersed in deionized water at three different temperatures (4, 37 and 60) for 7 days. the control specimens were aged in a 37 dry and dark chamber for 24 hours. the mechanical properties of the light - cured specimens were evaluated using the vickers hardness test, three - point bending test, and compression test, respectively. both flexural and compressive properties were evaluated using a universal testing machine. the data were analyzed using a two way anova with tukey test to perform multiple comparisons (=0.05).resultsafter immersion, the specimens showed significantly different microhardness, flexural, and compressive properties compared to the control case regardless of solution temperatures. depending on the resin brand, the microhardness difference between the top and bottom surfaces ranged approximately 3.3 - 12.2%. among the specimens, biscem and calibra showed the highest and lowest decrease of flexural strength, respectively. also, calibra and multilink automix showed the highest and lowest decrease of compressive strength, respectively compared to the control case.conclusionthe examined dual - cure resin cements had compatible flexural and compressive properties with most methacrylate - based composite resins and the underlying dentin regardless of solution temperature. however, the effect of the solution temperature on the mechanical properties was not consistent and depended more on the resin brand. |
obesity is an increasingly prevalent problem in the united states. seventeen percent of children and 32% of adults in the us meet the clinical definition of obesity. in adult men and in adolescents of both sexes, these numbers have been climbing over the past 6 years, and in women the rate of obesity seems to be leveling off. the obesity epidemic has been related to sedentary lifestyle, increased use of processed or high caloric foods, and other trends. a prospective study of three large cohorts found that compared to matched controls, obese patients were 1.44 (men) and 1.92 (women) times as likely to form stones. other studies have shown that obese patients have an increased excretion of stone - promoting substances. the newest trend in treatment of morbid obesity is roux - en - y gastric bypass or gastric banding. the rate at which these procedures are being performed has increased 600% from 1996 to 2001. in the 1970s, jejunoileal bypass led to significant complications, including nephrolithiasis, ranging from 11% at 1 to 5 years to as high as 39% after 15 years. in contrast, modern bariatric surgery procedures, which are touted to cause less malabsorption than jejunoileal bypass, have been postulated to have less impact on urinary stone risk. yet kidney stones were recently found to be one of the top 10 postoperative diagnoses in modern bariatric patients. a separate retrospective study found de novo stone formation in 3.2% of patients ; however, for patients with a history of nephrolithiasis, 31.4% were found to have recurrent stones after bypass surgery. in addition, hyperoxaluria was recently confirmed to be the most significant abnormality in urinary stone risk profile after modern bariatric surgery. furthermore, hyperoxaluria has been shown to increase as time from surgery increases. in both of these studies, the patients had low urinary volumes, and in neither study did the authors comment on the use of oral medications to modify stone risk. given what has been described as a pending epidemic in nephrolithiasis in patients undergoing modern bariatric surgery, we sought to evaluate the effects of medical management on urinary biochemical data between hyperoxaluric patients with and without a history of bariatric surgery. patients selected for the study had been referred to a urinary stone practice at a tertiary medical center for at least one episode of urolithiasis ; many patients had previously undergone 24-h urine collection and/or been placed on some form of medical therapy by the referring urologist. included patients had submitted at least two outpatient 24-h urine collections (within ~1 week s time) and a questionnaire to a commercial laboratory (litholink, chicago, ill). as in many practices, we recommend to all of our stone patients to decrease sodium, limit animal protein, and drink sufficient fluids so as to maintain a urine volume around 2 l / day. we also use the 24-h urine collection to make specific recommendations for dietary change and medical therapy. however, given the known tendency to chronic acidemia, hypocitraturia, and enteric hyperoxaluria in patients who have undergone bariatric surgery, we place all of these patients on 1,200 mg oral calcium divided up with meals as well as 20 meq potassium citrate three times daily. those patients with severe (> 75 mg / day) hyperoxaluria were identified. retrospective chart review was performed to determine their medical and surgical histories, especially regarding intestinal surgery and use of medications. an average value (over the two samples submitted by each patient) was determined for each urinary stone risk factor. calcium, magnesium, uric acid, creatinine, phosphorous, sodium, potassium, and ammonium were measured using a beckman autoanalyzer (beckman instruments, brea, ca). urine supersaturations of calcium oxalate, calcium phosphate, and uric acid were calculated by the iterative computer program, equil ii. in addition, the patient s self - reported information on 19 clinical parameters was included including family history, personal stone history, and use of stone risk modifying medications. comparison between groups was made using the student s t - test utilizing commercially available statistical analysis software (spss, chicago, il). we identified 39 patients who had severe hyperoxaluria (oxalate > 75 mg / day), 26 of whom had clinic charts available for review of medical and surgical histories. five of these 26 patients were found to have a history of roux - en - y gastric bypass surgery. in addition, none of the operations had taken place within the year prior to 24-h urine collection. all included non - bariatric patients had presumed dietary or idiopathic hyperoxaluria. the mean age, weight, and medication use seventy - six percent of the non - bariatric patients were men, although 80% of the bariatric patients were female. bariatric patients were heavier than non - bariatric patients (97 vs. 78 kg). non - bariatric and bariatric patients had a similar number of lifetime stone episodes (4.1 vs. 3.6). oral calcium supplement (80 vs. 28%) and potassium citrate (100 vs. 47%) use were more common in the bariatric than non - bariatric patients.table 1characteristics of hyperoxaluric patientsnon - bariatric (n = 21)bariatric (n = 5)mean age (years)5454males (%) 7620weight (kg)7897hctz (%) 1920calcium supp. (%) 4860allopurinol (%) 100 characteristics of hyperoxaluric patients tables 2, 3, and 4 provide a summary of the urinary biochemical data. those patients with a history of bariatric surgery had a significantly higher chloride (350 vs. 190 p < 0.01), a lower citrate (390 vs. 800 p = 0.04), higher oxalate (130 vs. 91 p < 0.01), and higher sodium (350 vs. 210 p < 0.01). urinary volume was 500 ml greater in the bariatric than non - bariatric group (2.9 vs. 2.4 l p = 0.36).table 2mean 24-h urine parameters by history of bariatric surgerynon - bariatricbariatricp - valueammonium41580.17calcium2401600.25chloride1903500.01citrate8003900.04creatinine1,9001,6000.36magnesium1301300.88oxalate911300.01ph6.36.10.58phosphorous1.21.20.75potassium931000.71sodium2103500.01sulfate51580.60urea nitrogen14130.77uric acid0.890.760.34volume2.52.90.39table 3mean 24-h urine concentrations by history of bariatric surgerynon - bariatricbariatricp - valueammonium19210.69calcium99540.13chloride851200.04citrate3901300.05creatinine8605900.11magnesium57490.48oxalate41470.48phosphorous0.540.420.38potassium42340.48sodium911200.08sulfate23190.57urea nitrogen6.34.80.32uric acid0.410.270.10table 4mean 24-h urine supersaturations by history of bariatric surgerynon - bariatricbariatricp - valuess ua0.820.670.76ss caox116.70.13ss caphos1.40.640.25 mean 24-h urine parameters by history of bariatric surgery mean 24-h urine concentrations by history of bariatric surgery mean 24-h urine supersaturations by history of bariatric surgery the concentration of each urinary solute also was calculated and compared between the two groups. the supersaturation of different stone constituents is determined more by solute concentration, rather than net amount excreted per day. these results can be found in table 3. only chloride (120 vs. 85 p = 0.04) and citrate (130 vs. 390 p = 0.05) showed a statistically significant difference. calcium concentration was almost 50% less in bariatric patients versus non - bariatric patients, although this did not reach statistical significance (54 vs. 99 p = 0.13). the supersaturation of calcium oxalate was 40% less in the bariatric patients versus the non - bariatric patients with hyperoxaluria (6.7 vs. 11 p = 0.13). oxalate excretion has been identified as a major risk factor for stone formation for decades. hyperoxaluria following bariatric surgery was definitively shown to be from increased intestinal oxalate absorption in the early 1980s. in this study, six patients were placed on an oxalate diet, a low - oxalate diet, and total parenteral nutrition. urinary oxalate on a low - oxalate diet decreased by half, while on total parenteral nutrition, a fourfold decrease in urinary oxalate was found. a complementary study revealed the importance of high oral calcium intake in binding luminal oxalate. the average urinary oxalate doubled when dietary calcium was reduced from 3,000 to 250 mg / day. these studies clearly show that dietary or medical intervention can mitigate some of the effects of bariatric surgery. in an attempt to further define the effects of aggressive medical management on urinary stone risk profile in patients undergoing roux - en - y gastric bypass, we retrospectively identified and compared hyperoxalurics with and without a history of bariatric surgery. the most notable finding of this study was that following bariatric surgery, patients had a surprisingly low supersaturation of calcium oxalate of 6.7. in fact, the supersaturation of calcium oxalate in our bariatric patients is similar to that found in a previous large cohort study of normal, overweight, and obese stone formers. the obese stone formers had a supersaturation of calcium oxalate (by the equil equation) of 6.14 (men) and 5.97 (women). therefore, by comparison, our obese patients after bariatric surgery had a supersaturation of calcium oxalate, which was only 10% higher. this finding is in contradiction to a study in the early 1980s that looked at 24-h urine collections in obese patients before and both 2 and 5 years after jejunoileal bypass surgery. following surgery, urinary calcium decreased from baseline, and oxalate excretion was threefold higher, despite calcium supplementation. however, in this study, the relative ss product (by robertson s equation) increased by a full 40% following surgery. however, the low supersaturation of calcium oxalate in our bariatric patients with hyperoxaluria is even more surprising given recent data published by asplin. this found a ss caox in gastric bypass and jejunoileal bypass patients that was nearly twice as high as our value of 6.7. although our patients had higher urinary oxalate (130 vs. 100 mg / day), higher urinary calcium (160 vs. 140 mg / day), and lower citrate (390 vs.~400 mg / day), our patients urinary volume was significantly greater (2.9 vs. 1.8 l). this may be the key difference between our bariatric stone formers and those of asplin. thus, many of the recommendations that are applicable to the stone - forming public in general, i.e., increased fluid intake, can have a significant impact on stone - forming risk even in this highly selected population. bariatric surgery can have profound effects on urinary citrate levels due to chronic metabolic acidosis. a study in jejunoileal bypass patients found a mean urinary citrate of 22 mg / day. these patients subsequently underwent bypass reversal with an increase in urinary citrate to 230 mg / day. citrate supplementation was initiated, and urinary levels rose further to 550 mg / day. in contrast, we did not see a significant degree of hypocitraturia in our studied bypass patients. this was likely influenced by the fact that all of the bariatric surgery patients were taking potassium citrate at the time of 24-h urine collection. however, urinary citrate levels were still significantly lower in the bariatric patients than non - bariatric patients, despite their higher rate of citrate supplementation. additionally, compliance is supported by the mean urinary potassium level (100 mg / day) since for every one meq of potassium intake ; approximately one meq of potassium appears in the urine. the influence of inhibitors of urinary stone formation also has been studied in weight reduction surgery patients. high oxalate levels in the intestine bind not only calcium, but also magnesium (a stone inhibitor). high calcium oxalate stone indices following jejunoileal bypass have been attributed to both to high urinary oxalate and low urinary magnesium, and 80% of our bariatric patients were on oral calcium, which likely lowered both oxalate absorption and oxalate available for magnesium binding. therefore, it is not surprising that our study found no difference in magnesium levels between hyperoxaluric patients with or without a history of bariatric surgery. our study included a large number of patients with hyperoxaluria, but was limited by its retrospective nature and small size of specific patients with a history of bariatric surgery. since most patients were seen after evaluation and treatment by an outside urologist, we were not able to examine an individual patient s response to any given therapy, i.e., a change in 24-h urine over time. furthermore, although we were able to determine from chart review that all of the bypass procedures had taken place over a year prior to 24-h urine collection, the exact dates of surgery could not be determined. additionally, the comparison groups differed in distribution of gender, as more of the bariatric patients were women. men in general have higher urine ss caox, which could have brought the results closer to the null hypothesis. while it is reassuring that none of our bariatric patients had renal insufficiency to suggest oxalate nephropathy, a recent study reported on two patients (8.7% of the study cohort) with renal failure presumed to be due to hyperoxaluria after roux - en - y gastric bypass. future studies could focus on 24-h urine collections in patients before and after bariatric surgery. this kind of internal control could factor in each patient s inherent stone - forming risk, with the additional risks of obesity and subsequent bariatric surgery and weight loss. this could be performed in a prospective fashion in coordination with a bariatric surgery center. these patients undergo extensive evaluations with sometimes multiple follow - up visits prior to surgery, and the opportunity likely exists for enrollment in a clinical trial. because of the dramatic increase in the numbers of these procedures, as well as the potential difficulties in performing stone operations in these patients, we need to know significantly more about the exact risk and nature of stone formation in these patients. despite the anticipated significantly higher oxalate levels, compared with other hyperoxaluric patients, modern bariatric surgery patients had a dramatically lower supersaturation of calcium oxalate, predominantly due to higher urinary volume and lower urinary calcium excretion. appropriate medical management, in particular oral calcium supplementation and aggressive fluid intake may mitigate some of the effects of enteric hyperoxaluria after modern bariatric surgery. | introductiontwo recent studies have shown that modern bariatric surgery leads to significant hyperoxaluria and risk of nephrolithiasis. however, neither report evaluates the use or effects of stone risk modifying agents in these patients. we sought to determine the impact of medical management on stone risk profile in patients who have undergone roux - en - y gastric bypass.materials and methodstwenty - four - hour urine collections of all patients referred to a tertiary clinic for nephrolithiasis in the past 4 years were reviewed. those patients with severe (> 75 mg / day) hyperoxaluria were identified. retrospective chart review was performed to identify those patients with a history of bariatric surgery. student s t - test was used to compare mean urinary parameters between bariatric and non - bariatric patients.resultsout of all stone formers within our 24-h urine collection database, 39 patients had severe hyperoxaluria (oxalate > 75 mg / day). twenty - six patients had complete information for review. five patients had a history of bariatric surgery. compared with non - bariatric patients, those with a history of bariatric surgery had increased use of oral calcium (80 vs. 28%) and citrate supplementation (100 vs. 47%), higher urinary oxalate (129 vs. 91 mg / day) and volume (2.9 vs. 2.4 l / day), lower urinary citrate (390 vs. 800 mg / day) and calcium (155 vs. 235 mg / day), and a decreased supersaturation of calcium oxalate (6.7 vs. 11).conclusionsappropriate medical management, in particular oral calcium and citrate supplementation, and perhaps most importantly aggressive fluid intake can mitigate some of the effects of enteric hyperoxaluria caused by fat malabsorption after modern bariatric surgery. |
pyogenic liver abscess (pla) is a crucial clinical disease that can be fatal without prompt recognition and treatment. an increasing number of studies have demonstrated that pla in western and asian countries differs in many aspects, including demographic characteristics, etiological factors, and clinical manifestations. for example, a significant proportion of pla in asia is associated with klebsiella pneumoniae infection, whereas escherichia coli is the predominant pathogen found in pla in western countries. moreover, pla in asia is typically associated with diabetes or a cryptogenic etiology, compared with the biliary etiology observed in western countries. colonic diverticular diseases are a relatively common health care problem and the most frequently reported pathology in routine colonoscopy. autopsy studies have estimated the diverticular - disease prevalence at 5% to 52% in western countries, and 1% to 19% in asia. approximately one - third of the population older than 45 years is estimated to have diverticular disease. diverticular diseases can lead to disruption of the colonic mucosal barrier and therefore major clinical morbidities, including inflammation, obstruction, infection, hemorrhage, fistula formation, perforation, and peritonitis. previous studies have demonstrated that the hematogenous spread of pathogens to the liver is a critical pathogenic factor for pla, and colonic mucosal defects might be a route for bacterial invasion into the portal system. in a relatively small cohort study, however, no study has been conducted in asia to investigate the epidemiologic association between diverticular diseases and pla by using a nationwide population - based dataset. we therefore hypothesized that patients with diverticular diseases may have a higher risk of pla than patients without diverticular diseases and conducted this study by analyzing data from taiwan 's national health insurance research database (nhird), which is composed of deidentified medical claims from 99% of the 23 million residents of taiwan. the national health insurance (nhi) program was implemented in taiwan on march 1, 1995, and provides insurance coverage for approximately 99% of the population of taiwan (ref1). the national health research institutes (nhri) maintains the nhird, comprising the administrative and health claims data of the nhi program, and makes it available for medical research. in this study, we used a subset of the nhird that includes files of inpatient claims from the registry of beneficiaries. the identification numbers of patients were scrambled before being released to users to protect the privacy of the insurant. diseases are coded according to the international classification of diseases, ninth revision, clinical modification (icd-9-cm). this study was approved to fulfill the condition for exemption by the institutional review board (irb) of china medical university (cmuh-104-rec2115). we identified patients with newly diagnosed diverticular diseases, including diverticulosis (icd-9-cm codes 562.10, 562.12) and diverticulitis (icd-9-cm codes 562.11, 562.13), from 2000 to 2011, from inpatient claims data. the initial date of hospitalization with a diagnosis of diverticular - disease was defined as the index date. patients with history of pla (icd-9-cm code 572.0) or amebic liver abscess (icd-9-cm code 006.3), missing data for sex or date of birth, or aged younger than 20 years were excluded from our study. nhi beneficiaries aged 20 years and older without diverticular were randomly selected for inclusion in a nondiverticulosis cohort and frequency matched with the patients in the diverticular cohort at a 4:1 ratio according to age (in 5-year bands), sex, history of diabetes mellitus (icd-9-cm code 250), and index year, and the same exclusion criteria were applied. person - years of follow - up were calculated for each patient until pla diagnosis or censoring because of loss to follow - up, death, withdrawal from the insurance program, or the end of 2011. the comorbidities comprised well - known risk factors for pla, namely, alcoholic liver disease (icd-9-cm codes 571.0, 571.1, 571.3), cholecystitis (icd-9-cm code 575), cancer (icd-9-cm codes 140 - 208), chronic obstructive pulmonary disease (copd) (icd-9-cm codes 491, 492, 496), choledocholithiasis (icd-9-cm code 574), cholangitis (icd-9-cm code 576.1), diabetes mellitus (icd-9-cm code 250), hyperlipidemia (icd-9-cm code 272), hypertension (icd-9-cm codes 401 - 405), heart failure (icd-9-cm code 428), liver cirrhosis (icd-9-cm codes 571.2, 571.5, 571.6), and pancreatic diseases (icd-9-cm code 577). student t - tests and chi - square tests were used to examine the differences in the demographic characteristics and comorbidities between the diverticular - disease and nondiverticular - disease cohorts. the incidence density rates (per 10,000 person - year) of pla were estimated for both cohorts according to sex, age, and comorbidities. univariate and multivariate cox proportional hazards regression analysis was used to assess the risk of developing pla associated with diverticular diseases, compared with the nondiverticular - disease cohort. the hazard ratios (hrs) and 95% confidence intervals (cis) were estimated in the cox model. the multivariate models were simultaneously adjusted for age, sex, and comorbidities of diabetes mellitus, hypertension, hyperlipidemia, cancer, copd, heart failure, choledocholithiasis, alcoholic liver disease, liver cirrhosis, cholangitis, cholecystitis, and pancreatic diseases. all data processing and statistical analyses were performed using sas version 9.4 (sas institute, inc., cary, nc) ; 2-tailed p <.05 was considered statistically significant. the national health insurance (nhi) program was implemented in taiwan on march 1, 1995, and provides insurance coverage for approximately 99% of the population of taiwan (ref1). the national health research institutes (nhri) maintains the nhird, comprising the administrative and health claims data of the nhi program, and makes it available for medical research. in this study, we used a subset of the nhird that includes files of inpatient claims from the registry of beneficiaries. the identification numbers of patients were scrambled before being released to users to protect the privacy of the insurant. diseases are coded according to the international classification of diseases, ninth revision, clinical modification (icd-9-cm). this study was approved to fulfill the condition for exemption by the institutional review board (irb) of china medical university (cmuh-104-rec2115). we identified patients with newly diagnosed diverticular diseases, including diverticulosis (icd-9-cm codes 562.10, 562.12) and diverticulitis (icd-9-cm codes 562.11, 562.13), from 2000 to 2011, from inpatient claims data. the initial date of hospitalization with a diagnosis of diverticular - disease was defined as the index date. patients with history of pla (icd-9-cm code 572.0) or amebic liver abscess (icd-9-cm code 006.3), missing data for sex or date of birth, or aged younger than 20 years were excluded from our study. nhi beneficiaries aged 20 years and older without diverticular were randomly selected for inclusion in a nondiverticulosis cohort and frequency matched with the patients in the diverticular cohort at a 4:1 ratio according to age (in 5-year bands), sex, history of diabetes mellitus (icd-9-cm code 250), and index year, and the same exclusion criteria were applied. person - years of follow - up were calculated for each patient until pla diagnosis or censoring because of loss to follow - up, death, withdrawal from the insurance program, or the end of 2011. the comorbidities comprised well - known risk factors for pla, namely, alcoholic liver disease (icd-9-cm codes 571.0, 571.1, 571.3), cholecystitis (icd-9-cm code 575), cancer (icd-9-cm codes 140 - 208), chronic obstructive pulmonary disease (copd) (icd-9-cm codes 491, 492, 496), choledocholithiasis (icd-9-cm code 574), cholangitis (icd-9-cm code 576.1), diabetes mellitus (icd-9-cm code 250), hyperlipidemia (icd-9-cm code 272), hypertension (icd-9-cm codes 401 - 405), heart failure (icd-9-cm code 428), liver cirrhosis (icd-9-cm codes 571.2, 571.5, 571.6), and pancreatic diseases (icd-9-cm code 577). student t - tests and chi - square tests were used to examine the differences in the demographic characteristics and comorbidities between the diverticular - disease and nondiverticular - disease cohorts. the incidence density rates (per 10,000 person - year) of pla were estimated for both cohorts according to sex, age, and comorbidities. univariate and multivariate cox proportional hazards regression analysis was used to assess the risk of developing pla associated with diverticular diseases, compared with the nondiverticular - disease cohort. the hazard ratios (hrs) and 95% confidence intervals (cis) were estimated in the cox model. the multivariate models were simultaneously adjusted for age, sex, and comorbidities of diabetes mellitus, hypertension, hyperlipidemia, cancer, copd, heart failure, choledocholithiasis, alcoholic liver disease, liver cirrhosis, cholangitis, cholecystitis, and pancreatic diseases. all data processing and statistical analyses were performed using sas version 9.4 (sas institute, inc., cary, nc) ; 2-tailed p <.05 was considered statistically significant. table 1 shows comparisons of the demographic characteristics and comorbidities of the diverticular - disease and nondiverticular - disease patients. the mean (standard deviation [sd ]) age of the diverticular - disease cohort was 57.7(18.1) years and that of the nondiverticular - disease cohort was 57.2(18.1) years, with 37.1% of the patients aged 49 years. women were predominant (55.8% vs 44.2%). the principal diseases including hypertension, hyperlipidemia, cancer, copd, heart failure, choledocholithiasis, alcoholic liver disease, liver cirrhosis, cholangitis, cholecystitis, pancreatic diseases, and percutaneous aspiration of the gallbladder and biliary tract in diverticular - disease patients were higher than those in the nondiverticular - disease cohort (table 1). the mean follow - up periods were 4.79 3.12 years for the diverticular cohort and 5.09 3.06 years for the nondiverticular cohort. characteristics of patients between patients with diverticular and patients without diverticular then, we determined the incidence of pla in both groups and found that diverticular diseases were associated with a significantly elevated risk of pla (table 2). the crude incidence of pla was 2.44-fold higher in the diverticular - disease cohort than in the nondiverticular - disease cohort (11.5 vs 4.65 per 10,000 person - year) (table 2). after adjustment for age, sex, and comorbidities, the adjusted hr (ahr) for developing pla during follow - up was 2.10 (95% ci, 1.812.44) for the diverticular - disease cohort, as compared with the nondiverticular - disease cohort. incidence and hazard ratio of pyogenic liver abscess between patients with diverticular and without diverticular stratification analyses were performed to evaluate the risk of pla in the subgroups stratified according to their sexes, ages, and comorbidities (table 2). our results showed that the elevated risk of pla in patients with diverticular diseases could be observed in every stratification analysis. the risk of pla in patients with diverticular diseases was significantly higher than in patients without diverticular disease, after stratification for sex (ahr, 1.83, 95% ci, 1.432.43 for women ; ahr, 2.27, 95% ci, 1.882.75 for men), age (ahr, 4.03, 95% ci, 2.775.85 for patients aged 49 years ; ahr, 2.17, 95% ci, 1.642.28 for patients aged 5064 years ; ahr, 1.65, 95% ci, 1.342.03 for the group aged 65 years), and comorbidities (ahr, 2.94, 95% ci, 2.323.73 for patients without comorbidities ; ahr, 1.65, 95% ci, 1.371.98 for patients with comorbidities). we then explored whether the inflammation of colonic diverticula was associated with pla risks. the incidence and relative risks of pla in patients with diverticulosis and diverticulitis compared with the nondiverticular - disease cohort, patients with diverticulosis had a significantly increased risk of pla (ahr, 2.26, 95% ci, 1.862.75), followed by patients with diverticulitis (ahr, 1.98, 95% ci, 1.652.38). incidence and hazard ratio of pyogenic liver abscess between different entities diverticular diseases finally, we would like to validate the accountability of our results by calculating the risk of pla in the patients with some known risk factors of pla. theoretically, we should be able to demonstrate that patients with pla risk factors, such as cholangitis, cholelithiasis, and diabetes mellitus, exhibited relatively high ahrs. on the other hand, patients with comorbidities not related to pla should have lower ahrs of pla. compared with the patients without diverticular diseases and comorbidities, those with only cholangitis had a higher risk of pla (ahr, 29.8, 95% ci, 7.39120.1) followed by those with only diabetes mellitus (ahr, 3.35, 95% ci, 2.494.51), those with only choledocholithiasis (ahr, 2.50, 95% ci, 1.185.31), and those with only copd (ahr, 2.33, 95% ci, 1.194.56) (table 4). moreover, compared with the diverticular - disease patients without these comorbidities, among the diverticular - disease patients, those with 5 or more comorbidities had a significantly increased risk of pla (ahr, 8.08, 95% ci, 4.3814.9), followed by those with 4 comorbidities (ahr, 5.30, 95% ci, 3.079.15), those with 3 comorbidities (ahr, 4.06, 95% ci, 2.696.14), those with any 2 comorbidities (ahr, 4.53, 95% ci, 3.366.60), and those with 1 comorbidity (ahr, 4.26, 95% ci, 3.325.47), regardless of comorbidity type. joint effects for acute coronary syndrome between diverticular and acute coronary syndrome - associated risk factor this study is the first to address the long - term risk of pla in asian patients with diverticular diseases through analysis of a nationwide database with widespread coverage and complete follow - up evaluation. this population - based cohort study demonstrates that the diverticular - disease cohort exhibited a significantly elevated risk of pla ; after mortality was accounted for as a competing cause of risk and multiple known confounding factors were adjusted for. additional clinical and basic studies are warranted for further investigation of the underlying causes of the observation in the present study. studies have reported that pla can occur secondary to asymptomatic sigmoid diverticulitis and colon cancer. the present study, in analyzing a 13-year longitudinal database, further established a link between pla and diverticular diseases. the large sample sizes collected in the present study enabled a highly reliable statistical analysis for assessing the pla risk in patients with diverticular diseases and therefore avoided selection and recall biases. over the past few decades, the mortality associated with pla has decreased gradually from more than 50% before the 1980s. however, recent studies have reported that pla has continued to have a significant in - hospital mortality rate since 2000, ranging from 2.5% to 10%. the presentation of pla is often nonspecific, and its diagnosis requires a high degree of clinical suspicion. the median symptomatic duration prior to the diagnosis of pla has been reported as approximately 1 week, whereas only 15% to 55% of pla patients present with localized right upper quadrant tenderness. therefore, identifying groups of patients who are at a risk of pla is imperative. based on the observations in this study, patients with diverticular diseases should undergo image screening for pla when there is any clinical suspicion. diverticular diseases are associated with old age and diabetes, which was also found in the present study. moreover, 10% to 25% of patients with diverticular diseases experience diverticulitis and its related complications, and therefore may undergo surgery at some point. therefore, these unfavorable factors may compromise a patient 's immunity and predispose the occurrence of pla. as mentioned, a substantial proportion of patients with diverticular diseases encounter colonic inflammation, bleeding, and even perforation. theoretically, mucosal disruption and underlying blood vessel exposure caused by diverticular inflammation may facilitate hematogenous spreading of colonic bacteria into portal circulation and the liver parenchyma. this hypothesis is further supported by a previous observation that nearly one - fourth of patients with cryptogenic pla had a colonic cause when they underwent colonoscopic investigation. in addition to translocation via the mucosal defects, some intestinal bacteria, including k. pneumoniae, could also enter the bloodstream directly without breaking the mucosal integrity. in - vitro and in - vivo studies suggested that k. pneumoniae could translocate across the colonic epithelium via rho gtpase - and phosphatidylinositol 3-kinase / akt - dependent mechanisms. other studies have reported that the expression of rho gtpase and phosphatidylinositol 3-kinase / akt activities were both enhanced within inflamed colonic segments. it will be of clinical interest to investigate whether direct bacterial translocation via intact intestinal mucosa contributes to the occurrence of pla in patients with diverticular diseases. one possible confounding factor in our observation is that the diverticular - disease cohort may have had a higher risk of colorectal cancer, which is known as a risk factor for pla. whether colonic diverticular diseases are associated with an increased risk of colorectal cancer remains controversial. diverticular diseases have been suggested to be a predisposing factor for left - side colorectal cancer. in a case control study, sigmoid diverticulitis was associated with a significantly higher risk of left - side colorectal cancer, with an odds ratio of 4.2. conversely, our previous study did not reveal any association between diverticular diseases and colorectal cancer. because we adjusted for cancer as comorbidity, there are some study limitations : the database has no detailed data about the smoking, alcohol, exercise, incomes, and diabetes mellitus control, which may the potentially confounding factors regarding the study biases ; no detailed data in eastern populations the to do further analyses about the prevalence and pattern of diverticular diseases, usually in the right - side colon. in addition, the pathogens of pla may be different based on the location ; we could not to confirm the diagnoses of pla and diverticular diseases by checking the individual patient 's medical record. however, these hospitalized patients whose diagnoses were strictly audited for reimbursement in this study ; these patients were included from the database of inpatient admission, which is the potential selection bias. all of the above these study limitations might cause underestimated or overestimated the association between diverticular diseases and the risk of pla. in summary, we determined that asian patients with diverticular diseases have a significantly increased risk of pla. based on our findings, further study on the rates of pla for patients with diverticular diseases | abstractwhether patients with diverticular diseases exhibit a higher risk of developing pyogenic liver abscess (pla) remains inconclusive.from the inpatient claims in taiwan 's national health insurance research database, we identified 54,147 patients diagnosed with diverticulosis in the 1998 to 2010 period and 216,588 controls without the disorder. the 2 cohorts were matched by age, sex, and admission year, and were followed up until the end of 2010 to estimate the risk of pla.overall, the incidence of pla was 2.44-fold higher in the diverticular - disease group than in the controls (11.5 vs 4.65 per 10,000 person - year). the adjusted hazard ratio (ahr) of pla was 2.11 (95% confidence interval [ci ], 1.812.44) for the diverticular - disease group, according to a multivariate cox proportional hazards regression model. the age - specific data showed that the ahr for the diverticular - disease group, compared with the controls, was the highest inpatients younger than 50 years old (ahr, 4.03 ; 95% ci, 2.775.85). further analysis showed that the diverticular - disease group exhibited an elevated risk of pla regardless of whether patients had diverticulitis.the patients with diverticular diseases exhibited a higher risk of pla. |
osteoarthritis (oa) of the knee is a common problem causing knee pain and physical disabilities in the elderly1. the prevalence of knee oa is known to increase with age not only in japan but also in various countries, meaning it is an important social issue around the world2, 3. recently, research on osteoarthritis against disability (road) studies in japan revealed an association between knee pain and joint space narrowing in men, while women tended to have knee pain even without radiographic knee oa. in general, a progression of radiographic change is thought to be a crucial indicator for assessing the severity of knee oa4, 5. however, there is a widespread belief of inconsistency between clinical symptoms and radiographic severity6, 7. for instance, sun. reported that the serum il-15 levels independently and positively correlated with pain severity but not kl grades in oa patients and, therefore, joint inflammation might play a key role, reflected by the severity of the symptoms8. the oa research society international (oarsi) guidelines for management of knee oa established by several orthopedic associations in each country9, recommend physical exercises as a core treatment method. indeed, some articles revealed that aerobic exercise and resistance training decreased serum levels of inflammatory mediators10. also, the multicenter osteoarthritis study recently reported a significant concordance between knee pain and radiographic knee oa by kellgren and lawrence grades11. oa, there is little evidence indicating the effectiveness of physical exercise in cases of severe radiographic knee oa. therefore, in this study, we tried to investigate the efficacy of supervised physical exercise for the symptoms in patients with knee oa by separating them into two groups : one group consisting of patients conducting supervised physical exercise ; and the other treated by conventional clinical methods. for our results, we used both the japanese knee osteoarthritis measure (jkom)12 and the pain disability assessment scale (pdas)13. the jkom has been established to assess the activity of daily life as well as pain and stiffness deriving from patients with knee oa in japan. furthermore, we also evaluated the pain related disabilities in patients with severe knee oa using the pdas because previous reports indicated that knee pain was subject to vary within months and weeks irrespective of radiographic severity14. this prospective study was conducted longitudinally for one year to confirm the mid - term efficacy of each treatment method. the study received ethical approval from the research ethics committee of the aichi medical university (no.12 - 101). patients with knee pain, confirmed with radiographic knee oa with a face of grade 3 or above according to the kellgren - lawrence (k - l) grading system were eligible for this study. eligibility criteria included patients older than 50 years and without total knee arthroplasty in either knee. we recruited participants who were interested in this study, which investigated knee - related health conditions using a specific questionnaire. we divided subjects into one of two different groups based on their knee care. we defined subjects in one group (n=26) as doing exercise for at least one year or more at a physical fitness center in aichi medical university regardless of whether they were receiving other forms of treatment or not (exercise group). we defined subjects in the other group (n=40) as treated at an orthopedic clinic in aichi medical university without using any physical fitness center (clinical group). accordingly, what treatment subjects received was already decided, and, therefore, it was hard to change the arm. as a result, this study was a non - randomized clinical trial. before investigating their status, each subject was fully informed by an investigator : 1) on the content of this study and 2) that all personal information of the subject would be kept confidential. after investigating their demographic backgrounds (age, gender), subjects received a radiographic examination of both knees by the posterior - anterior view at standing position to confirm radiographic severity. these radiographs were assessed by at least two orthopedic physicians according to the k - l grading system that uses the following grades : 0, normal ; 1, possible osteophytes only ; 2, definite osteophytes and possible joint space narrowing ; 3, moderate osteophytes and/or definite joint space narrowing ; and 4, large osteophytes, severe joint space narrowing, and/or bony sclerosis6. substantially, each radiographic score was decided according to the higher k - l grade of either side. participants also filled out two types of questionnaires, the japanese knee osteoarthritis measure (jkom)12 and the pain disability assessment scale (pdas) to assess their knee pain and pain - related disabilities13.the jkom consists of a pain rating based on a 100-mm visual analog scale (vas) and scores for a subscale of four symptoms based on a disease - specific questionnaire addressing four dimensions : pain / stiffness, condition in daily life, general conditions and health conditions, with 8, 10, 5 and 2 questions, respectively12. questions are rated on an ordinal scale of 04, with higher scores indicating a symptom or medical condition of higher severity. the four symptom subscales can be scored separately or combined to represent the aggregated total symptoms. on the other hand, the pdas is a scale for measuring lifestyle disabilities of patients with chronic pain. higher scores (on a scale of 0 to 60 points) indicate greater degrees of lifestyle disability13. after one - year follow - up, three patients in the exercise group and 17 patients in the clinical group were excluded as they had dropped out of the study. reasons for dropout were different for each participant and included receiving total knee arthroplasty (one subject), seeking other treatments, and unknown reasons. accordingly, we collected data for this research study from 43 patients in total, of which 20 patients were from the exercise group and 23 patients were from the clinical group voluntary - based supervised exercise consisted of a complex program such as land - based aerobic activities15 (e.g. cycling), stretching16, muscle strengthening (e.g. quadriceps and hamstrings strengthening)17 and aqua - based exercise (e.g. water walking)18 in our fitness center. we adjusted these exercise programs for each individual under the supervision of a physical therapist. for instance, subjects were instructed on knee stretching based on our stretching technique that could stretch the target muscle without decreasing muscle strength19. subjects used muscle strengthening exercises with some machines for both quadriceps and hamstrings, however when the subject complained of knee pain during the exercise, the magnitude of leg load was regulated according to the severity of the symptoms to prevent an aggravation of symptoms or subjects were instructed to only isometric quadriceps contraction20. moreover, when the subject had knee swelling, only water walking was advised as aerobic exercise by a therapist without cycling or treadmill walking. an exercise session was approximately 90 to 120 minutes divided by several breaks for each subject adjusted by endurance. although the frequency of exercise was different for each subject according to their convenience, everyone exercised one to three times in a week but at least once a week in our fitness center. seven participants in the exercise group regularly received intra - articular hyaluronic acid injections in other clinics once a month. by contrast, conventional treatment in the clinic included nonsteroidal anti - inflammatory drugs (nsaids) and intra - articular hyaluronic acid injections. patient consultations were usually conducted once or twice a month for each subject. at baseline, we compared demographic and morphological parameters among the groups, for age using the mann - whitney u test and for gender and k - l grades using the test. two - way repeated measures analysis of variance (anova) was performed to examine the effects over time and by group on the jkom score and pdas score with a scheff post - hoc comparison. subsequently, four symptom subscales of jkom were evaluated to examine separate effects of each treatment using the wilcoxon signed - rank test. we preformed all analyses with spss software (version 20.0 j ; spss inc., there was no significant difference in the epidemiological background (age p=0.57, gender ratio p=0.54) and radiographic severity of knees among the two groups, although there was a different trend in the severity of k - l grade (p=0.07) (table 1table 1.patients demographic backgroundexercise groupclinical groupage (years)72.06.173.96.9male / female5 / 154 / 19grade 3 / grade 415 / 511 / 12ages are reported as meansd. each category was compared among the groups, for age using the mann - whitney u test and for gender and k - l grades using test. both analyses showed no significant difference among the groups (p>0.05).). each category was compared among the groups, for age using the mann - whitney u test and for gender and k - l grades using test. two - way repeated measures anova did not show a significant time - course effect (f=0.04 p=0.83) or interaction (f=3.40 p=0.07) between time - course and group in jkom score. similarly, it did not show any significant time - course (f=0.27 p=0.61) or interaction (f=0.17 p=0.69) between time - course and group in the pdas score. however, there were significant group effects in both the jkom score (f=6.98 p=0.01) and pdas score (f=5.49 p=0.02). post hoc analysis revealed that only the patients in the exercise group showed significant improvement in their jkom score at one year after baseline (pgrade 4) was higher in the exercise group than in the clinical group. comparative analysis between the groups at baseline showed that this might affect the main results of this study. therefore, we believe further studies need to be conducted to confirm the effect of supervised exercise on severe knee oa by investigating both the survival rate of native knees and the life expectancy in such patients. | [purpose ] in this study, we investigated the efficacy of supervised physical exercise or conventional treatment on symptomatic knee osteoarthritis with severe morphological degeneration. [subjects ] sixty - six patients with severe radiographic knee osteoarthritis were enrolled. [methods ] participants were separated into two groups : in one group patients conducted physical exercise under supervision ; while in the other group they were treated by conventional clinical methods for one year. participants filled out two types of questionnaires ; the japanese knee osteoarthritis measure and the pain disability assessment scale at baseline and one year following enrollment in the study. two - way repeated measures analysis of variance was used to examine the effects over time and by group for a total of 43 participants ; consisting of an exercise group (n=20) and a clinical group (n=23) excluding 23 dropouts. [results ] analysis did not show a significant time - course effect or interaction between time - course and the groups in both questionnaires. on the other hand, there were significant group effects in both questionnaires with an advantage in the exercise group. [conclusion ] these results indicate that patients with knee osteoarthritis under supervised exercise conditions are more likely to maintain a better clinical outcome at one - year follow - up, despite the severe morphological degeneration in their knees. |
species of microsporidia are obligate intracellular protozoans that have been recognized among broad spectrum of invertebrate and vertebrate hosts (1, 2). almost 1200 species of microsporidia belong to more than 140 genera were described, so far (1, 3, 4). since the first human microsporidiosis was identified in 1959, reports of cases of immunocompromised patients who suffer from different form of microsporidia infection have been increased (5 - 7). chronic diarrhea is the most common clinical manifestation in hiv / aids patients with intestinal microsporidiosis, especially in individuals with less than 100 cd 4 + t cell per l of peripheral blood (8 - 10). prevalence of intestinal microsporidia infection has been reported from 2 to 50% and even higher depending on methods of diagnosis, geographical area or hygiene and immunity condition of study population (1, 11, 12). although the most prevalence of intestinal microsporidiosis could be seen in immunocompromised patients with chronic diarrhea but the infection have also been reported in immunodeficient or even immunecompetent individuals with or without diarrhea, frequently (13, 14). increasing the number of immunocompromised patients is the main reason that subtle diagnosis of opportunistic parasite such as encephalitozoon spp. and spores of human microsporidia are very small and the size of them is varying from 1m to 4m (8, 13). many staining and serological methods have been used for diagnosis of microsporidia infection, but molecular techniques based on rrna gene using polymerase chain reaction (pcr) and more recently real - time pcr have been showed 100% validity in detection and species identification of the parasite (15 - 19). to date, we did not have any precise information of intestinal microsporidia infection in immunocompromised patients in iran except rare studies that carried out by agholi. this study aimed to determine the intestinal microsporidia infection in hiv / aids patients in iran. this study were carried out on 81 stool samples which were collected from hiv / aids patients who referred to imam khomeini hospital during 2012 - 2013. hiv infection was confirmed by western blotting and aids phase also confirmed with cd 4 + t cell count less than 200 per l of peripheral blood and receiving anti - retroviral treatment (art). samples were collected actively from patients who referred to laboratory due to periodic checkup or intestinal disorders. based on appearance of stool, each of samples was considered in one of grades consisted : formed, diarrhea and watery diarrhea. from 81 stool specimens, all of stool samples suspended in pbs ph 7.5, and then the suspension filtered with sterile gases for debris exclusion. final suspension washed three times by sterile pbs and finally supernatant removed and remained pellet divided to 2 parts and each portion re - suspended in alcohol 80% and formalin thin slide for all of isolates was provided and staining was carried out using ryan blue method that described elsewhere (22), previously. screening carried out under oil immersion lens and small (1.2- 2m), ovoid, pinkish spores containing median belt considered as microsporidia. dna extraction performed on positive specimens that proved with light microscopic examination. for dna extraction 250 l from stool suspended in sterile pbs was transferred to 1.5 ml tube. after centrifuging in 5000 rpm for 10 minutes, supernatant was removed and then 400 l of lysis buffer (100 mm tric, 10 mm edta, 2% sds, (final ph = 8)), 20 g/l proteinase k and acide washed glass beads size 450 600 m were added to remained pellet. samples vortexing was repeated for 30 sec every 30 minutes. finally, after centrifuging in 3000 rpm for 5 min, supernatant transferred to bioneer stool dna extraction kit (bioneer corporation, daejeon, korea). pcr was performed using genus specific primers, which were designed, based on ssu rrna gene using online software (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). the first pair primers, pmicf (5- ggttgattctgcctgacg - 3) and pmicr (5 - cttgcgagc(g / a)tactatcc - 3), amplified 779 bp of ssu rrna gene of encephalitozoon spp and e. bieneusi. the second pcr employed primers enbf (5- ggtaatttggtctctgtgtg - 3) and enbr (5- ctacactccctatccgttc -3) to amplify 440 bp and also encepf (5- agtacgatgatttggttg- 3) and encepr (5- acaacactatatagtcccgtc- 3) to amplify 629 bp fragments for e. bieneusi and encephalitozoon spp. first pcr reaction was performed in final volume 25 l containing 2.5 l of 10x pcr buffer, 2 mm mgcl2, 200m dntp, 1.5 unit of taq polymerase (fermentase, thermo fisher scientific, lithuania) and 10 m of each primers. amplifications were carried out in peqlab thermocycler (peqlab biotechnologie gmbh, germany) under condition, 95 c for 5 min followed by 35 cycles of 94 c for 40 sec, 55 c for 45 sec and 72 c for 45 sec and final extension of 72 c for 4 min. the second pcr condition consisted 95 c for 5 min followed by 25 cycles of 94 c for 35 sec, 57c for 35 sec, 72 c for 40 sec and 72 c for 3 min as a final extension. 5l of pcr products were electrophoresed on 1.5% of agarose gel and were visualized after ethidium bromide staining. pcr products of positive samples were sequenced using abi 3130 (california, usa) and the results were compared using blast software in genbank database. data analyzing were performed by chi - square (x) test, using spss software (version 18, spss inc., this study were carried out on 81 stool samples which were collected from hiv / aids patients who referred to imam khomeini hospital during 2012 - 2013. hiv infection was confirmed by western blotting and aids phase also confirmed with cd 4 + t cell count less than 200 per l of peripheral blood and receiving anti - retroviral treatment (art). samples were collected actively from patients who referred to laboratory due to periodic checkup or intestinal disorders. based on appearance of stool, each of samples was considered in one of grades consisted : formed, diarrhea and watery diarrhea. from 81 stool specimens, all of stool samples suspended in pbs ph 7.5, and then the suspension filtered with sterile gases for debris exclusion. final suspension washed three times by sterile pbs and finally supernatant removed and remained pellet divided to 2 parts and each portion re - suspended in alcohol 80% and formalin thin slide for all of isolates was provided and staining was carried out using ryan blue method that described elsewhere (22), previously. screening carried out under oil immersion lens and small (1.2- 2m), ovoid, pinkish spores containing median belt considered as microsporidia. for dna extraction 250 l from stool suspended in sterile pbs was transferred to 1.5 ml tube. after centrifuging in 5000 rpm for 10 minutes, supernatant was removed and then 400 l of lysis buffer (100 mm tric, 10 mm edta, 2% sds, (final ph = 8)), 20 g/l proteinase k and acide washed glass beads size 450 600 m were added to remained pellet. samples vortexing was repeated for 30 sec every 30 minutes. finally, after centrifuging in 3000 rpm for 5 min, supernatant transferred to bioneer stool dna extraction kit (bioneer corporation, daejeon, korea). pcr was performed using genus specific primers, which were designed, based on ssu rrna gene using online software (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). the first pair primers, pmicf (5- ggttgattctgcctgacg - 3) and pmicr (5 - cttgcgagc(g / a)tactatcc - 3), amplified 779 bp of ssu rrna gene of encephalitozoon spp and e. bieneusi. the second pcr employed primers enbf (5- ggtaatttggtctctgtgtg - 3) and enbr (5- ctacactccctatccgttc -3) to amplify 440 bp and also encepf (5- agtacgatgatttggttg- 3) and encepr (5- acaacactatatagtcccgtc- 3) to amplify 629 bp fragments for e. bieneusi and encephalitozoon spp. first pcr reaction was performed in final volume 25 l containing 2.5 l of 10x pcr buffer, 2 mm mgcl2, 200m dntp, 1.5 unit of taq polymerase (fermentase, thermo fisher scientific, lithuania) and 10 m of each primers. amplifications were carried out in peqlab thermocycler (peqlab biotechnologie gmbh, germany) under condition, 95 c for 5 min followed by 35 cycles of 94 c for 40 sec, 55 c for 45 sec and 72 c for 45 sec and final extension of 72 c for 4 min. the second pcr condition consisted 95 c for 5 min followed by 25 cycles of 94 c for 35 sec, 57c for 35 sec, 72 c for 40 sec and 72 c for 3 min as a final extension. 5l of pcr products were electrophoresed on 1.5% of agarose gel and were visualized after ethidium bromide staining. pcr products of positive samples were sequenced using abi 3130 (california, usa) and the results were compared using blast software in genbank database. data analyzing were performed by chi - square (x) test, using spss software (version 18, spss inc., from eighty one stool samples which were collected from hiv+/aids patients, twenty five (30.86%) samples were positive for intestinal microsporidia infection, microscopically (fig. 1) and all of them confirmed with nested - pcr. positive cases were observed in 8 (34.8%) and 17(29.31%) of women and men, respectively. no statistically significant difference was found in the both groups (p = 0.631). chronic watery or moderate diarrhea were existed in 13 (52%) of positive cases. positive cases were also seen in 12 (48%) patients with history of diarrhea. no statistically significant difference was found in the both groups (p = 0.986). dna amplification of encephalitozoon spp. did not found by specific primers belonging to that. sequencing results of five cases, which were selected randomly from positive samples, were compared in genbank and consequently all of pcr results were proved. the accession numbers of sequenced samples including of kf875441, kf875442, kf875443, kf875444 and kf875445. results of study are summarized in table 1. the percent of infected patients in both genders was approximately equal and chronic sever or moderate diarrhea was seen in more than half of samples. although, more recently agholi. (21) described microsporidiosis in some hiv / aids patients (356/8) but there are not any precise information about microsporidia infection and also genus or species that are involve in transmission cycle of infection in those patients in iran. our findings clearly show that the microsporidiosis could be seen in more hiv / aids patients than that was mentioned in previous study (21). differentiation in findings likely related to manners of stool preparation or dna extraction. as most researchers have been declared spores have very small size, rigid double layer wall and also low counts in stool samples. as a result, stool preparation and strong dna extraction methods can impress the quality and quantity of molecular results (17, 23, 24). our results also show that e. bieneusi is the most important agent of intestinal microsporidia infection in hiv / aids patients in iran. it is interest to mentioned that e. bieneusi is one of most prevalent microsporidia parasites which were reported from immunocompromised individuals such as hiv / aids patients in most countries (11) and probably play an important role in intestinal involvement and subsequently chronic diarrhea in hiv / aids patients (21, 25 - 27). in our study e. bieneusi was detected in 12 (48%) of those patients who had not any severe or moderate diarrhea indication, at the sampling time. although no statistical relationship between diarrhea and microsporidiosis were seen in this study but it is interest to mention that according to recent research, intestinal microsporidiosis could be seen in individuals with intermittent diarrhea or rarely without history of acute or chronic diarrhea (13). however, all of hiv / aids patients in our study, received anti - retroviral treatment (art) and consequently their cd 4 + t cell count improved. on the other hand, some patients received different drug for signing treatment of diarrhea that probably both of reasons could be efficacious in diarrhea remission at the sampling time. so far, prevalence of different genus of microsporidia has not been known completely in iran and probably the cases of involvement with various forms of microsporidiosis are more than our expectancy. furthermore, it is need to assessment the infection get noticed in susceptible patients such as transplant recipients and cancer patients who are under immunosuppressing treatment and chemotherapy, respectively, or patients with other congenital or acquired immune system failures as at risk individuals. e. bieneusi is probably the most prevalent intestinal microsporidia genus particularly in hiv / aids in iran. strong stool preparation and molecular methods such as nested - pcr could be useful for detection of intestinal microsporidia infection. | backgroundspecies of microsporidia have been known as opportunistic obligate intracellular parasites particularly in immunocompromised patients. enterocytozoon bieneusi is one of most prevalent intestinal microsporida parasites in hiv+/aids patients. in this study, intestinal microsporidia infection was determined in hiv+/aids patients using microscopic and molecular methods.methodsstool samples were collected from hiv+/aids patients during 12 months. all of the stool specimens washed with pbs (ph : 7.5). slim slides were prepared from each sample and were examined using light microscope with 1000x magnification. dna extraction carried out in microscopic positive samples. dna amplification and genus / species identification also performed by nested - pcr and sequencing techniques.resultsfrom 81 stool samples, 25 were infected with microsporidia species and e. bieneusi were identified in all of positive samples. no encephalitozoon spp. was identified in 81 collected samples using specific primers.conclusion e. bieneusi is the most prevalent intestinal microsporidia in immunocompromised patients of iran. on the other hand, nested - pcr using specific primers for ssu rrna gene is an appropriate molecular method for identification of e. bieneusi. |
globally, solid waste management is one of the greatest environmental health challenges and continues to overwhelm local authorities and national governments as urban populations continue to rise and consumption patterns change [13 ]. cities generate about 1.3 billion tonnes of solid waste per year, a volume expected to rise to 2.2 billion tonnes by 2025, a more than double increase for developing countries. uganda, like many of such countries, is facing rapid urbanization of 5.1% per annum. this has led to overcrowding and the development of slums that are inadequately provided with basic infrastructure and services characterized by poor solid waste management. this leads to numerous environmental and health risks including contamination of surface and groundwater, ecosystem degradation, and soil pollution as well as greenhouse gas emissions by anaerobic decomposition of waste [6, 7 ]. in many of these communities, poor management of solid waste contributes to flooding, air pollution, and spreading of diseases and health conditions such as respiratory ailments and diarrhoea, giving rise to severe economic and social losses. the problems are particularly severe in slums in developing countries where the solid waste management systems are inadequate [3, 8 ]. municipal solid waste collection is currently one of the most critical lacking public services in slum areas in uganda and its low coverage has caused public outcry. factors that affect solid waste management in slums include inaccessibility, unaffordability where the service is expected to be paid for, and poor sanitation. the generation of solid waste is influenced by family size, education level, and income among other factors. the involvement of communities has a direct bearing on effective solid waste management and so do their awareness, attitudes, and practices. participation is influenced by social pressures, environmental motivation, attitudes, and economic incentives. kampala capital city authority (kcca) manages wastes generated in kampala while mukono municipal council manages those in mukono municipality. only 40% of the total wastes generated are collected and slums have less access to collection services. slums in kampala and mukono are characterized by poor access for collection vehicles, congestion, and land tenure systems that do not allow tenants to manage wastes appropriately. with increasing urbanization, population, and spatial growth of towns, solid waste collection is increasingly becoming difficult and approaches that reduce wastes need to be explored. in this study, we assessed the solid waste practices, concerns, and willingness to participate in key solid waste management initiatives in two urban slums in uganda. the study was conducted in two urban slums of kikulu (located in the outskirts of kampala, the capital city of uganda) and kikooza (located in mukono municipality, a major town approximately 27 kilometres east of kampala). kampala city with an area of 189 km is comprised of five divisions and has an approximate night and day population of 1.52 million and 3.15 million, respectively. mukono municipality has a population of 162,000 that grows at a rate of 10.4% annually and covers an area of 31.4 km. each slum is estimated to be 6 square kilometres and has a population of 5,000 people. open dumping of wastes and burning are main waste disposal methods used in these slum areas. the slums involved in the study were selected purposively as they were beneficiaries of a project aimed at improving water, sanitation, and hygiene in the areas. among other aims, the project promoted resource reuse and recovery from household wastes. these included waste separation at point of generation, composting for biodegradable wastes, and these slums are congested and unplanned, characterized by poor access to social amenities and poor solid waste management practices, and inhabited by people of low socioeconomic status. the study population comprised of all households in the two slums with household heads being the respondents. in situations where the household heads were not available, their spouse or another present consenting member of the household responded to the questionnaire. the study questionnaire was developed in english and translated to luganda, the local language mostly used in the study area. the questionnaire was used to collect data on social demographic characteristics such as age, education level, marital status and practices, concerns, and willingness of community members towards solid waste management initiatives. in particular, it assessed the residents ' waste storage, separations, and disposal practices and their concerns regarding poor solid waste management such as environmental pollution, increase in diseases, and vector populations. in addition, willingness to participate in solid waste composting, separation, and recycling was also assessed. depending on the size of the zones, a sampling interval was determined and systematic sampling was used to select households that participated in the study. a relative central point in each zone was established from which trained research assistants moved spirally outwards and administered the questionnaire to one respondent from each selected household. data was entered and cleaned in epi info 7.0 (cdc, atlanta, usa) statistical software. it was then transferred to stata 12.0 (statacorp, texas, usa) for analysis. multivariate analysis was also done to find out the factors associated with willingness to participate in solid waste management initiatives including composting and separation of waste. willingness to participate in each of the practices formed an outcome variable which was run against the independent variables including age, religion, education level, household size, and duration of stay in the area. all factors that were thought to affect willingness to participate in solid waste management activities were included for multivariate analysis. a step - wise multivariate logistic regression utilizing the backward elimination method was run to obtain the adjusted odds ratios. ethical approval was obtained from makerere university school of public health higher degrees, research and ethics committee. all respondents who participated in the study did so only after understanding its purpose and giving written informed consent. most respondents (59.8%) had attended secondary school education and 48.3% had lived in the study area for more than five years (table 1). the major categories of waste generated in households were food remains (38%) and plastics (37%). most households stored their wastes in polythene bags (59.1%) and sacks (20.2%) before disposal and 10.3% of the households did not have waste storage containers and kept their wastes outside the house in the open. most respondents (54.9%) reported carrying out some form of waste segregation at the household level. the majority (78.0%) did separate biodegradable wastes, especially food peelings which were mainly collected as animal feed. the most common frequencies of waste collection from households were weekly (28.8%) and biweekly (29.8%). the other households collected their wastes daily (19.6%), fortnightly (11.8%), monthly (5.3%), and rarely (4.8%). regarding waste disposal, 35.9% disposed of their waste at the dumping site, 24.8% burnt it in open pits, and 25.1% had it collected by trucks. in 76.3% of the households, women in other households, the responsibility of waste disposal was on male adults (11.2%), female children (3.0%), male children (4.4%), and housemaids and relatives (5.1%). the most commonly used plastics in households were clear light - duty polyethene (38.7%) and small black medium - duty polythene (35.3%) bags. the others were large coloured polythene bags (13.4%), heavy duty plastics (11%), and sacs (1.3%). among the households that regularly used plastics, the majority used them for carrying shopping items such as food stuffs (79%), for covering food when cooking (10%), to start fire during lighting of charcoal stoves (10%), and as containers for floral plants (0.2%). households used various methods to dispose of plastics and these included burning in open pits (27%), disposal at dumping site (25.3%), taking them by private waste collectors for a fee (22%), and plastics carried away by the municipal trucks (17%). the majority of households (74.7%) reported reuse of wastes and plastics were the most reused (45%). the other reused wastes were banana peelings (38%) and leftover food (9%) that were used for feeding animals. plastics were mainly reused for carrying purposes (79%), lighting charcoal stoves (10%), and covering food during cooking (10%). the majority (91.2%) of the households did not carry out composting and the reasons were as follows : not having a need for manure (60%), having little land on which to compost wastes (42.8%), and not having enough compostable wastes (5.3%) for those that could have use for it. most of the respondents were generally concerned about the solid waste management aspects assessed in the study. they mainly showed concern for presence of vectors such as mosquitoes (93.5%) and diseases related to improper use and disposal of waste (89.9%). they were less concerned about the reduction of natural resources (50.3%) and presence of wastes in their neighborhoods (65.8%) (figure 1). majority of respondents had a positive attitude towards improving solid waste practices in their communities. most (90.3%) said that, as community members, they played an important role in solid waste management in their areas (table 2). a high number of respondents were willing to participate in proposed solid waste management initiatives. sex, age of respondent, and education level did not influence respondents ' willingness to participate in composting and separation of wastes (table 3). at multivariate level, respondents who were married were 2 times more likely to be willing to participate in composting (aor = 1.84, 95% ci : 1.222.76) (table 4). biodegradable wastes such as leftover food formed the bulk of wastes generated in slums in this study. most of the biodegradable wastes were disposed of at open dumping sites which are likely to cause nuisances like foul smells and breeding insect vectors and vermin that endanger the health of slum dwellers and the environment [6, 7 ]. biodegradable wastes also contribute the largest portion of municipal waste that is collected by local authorities in uganda [15, 16 ]. the large proportion of biodegradable wastes provide an opportunity for waste recovery through separation and composting and provides an alternative to reduce waste volumes and stress on waste collection and disposal services. these alternatives, however, were minimally practiced in our study corresponding to findings from a previous study in nairobi in which only a few households carried out waste separation at a household level. waste reduction and other waste recovery options like waste for fuel that have been used in similar communities should be encouraged for biodegradable waste. although respondents frequently reused plastics, the majority finally disposed of them in open dumping sites or burnt them in open pits. slum residents reused plastics for carrying and covering food, which can increase exposure to phthalates which have been documented to affect the reproductive system, impacting fertility [19, 20 ]. burning of plastics also has potential to expose residents to chlorinated organic compounds such as dioxins which are carcinogenic and hence should be discouraged. plastics are nonbiodegradable and, when inappropriately dumped, result in clogging of drainage channels, creating water pools convenient for mosquito breeding and generating nuisance of smell. plastics collection and disposal practices observed among slum residents in this study create difficulty for recollection, recycling, and profitable reuse by recycling companies and individuals. similar to other studies conducted in urban settings [17, 22 ], solid waste management was primarily a responsibility of women and girls. initiatives targeting improving solid waste management should therefore consider the dominant role played by women and girls in the management of solid wastes. slum residents were more concerned with the effects of poor solid waste management than the causes. residents, for example, showed more concern for high vector populations and high burden of diseases related to poor solid waste management than that for presence of wastes in their neighbourhood. this could be an indication that community members lack sufficient knowledge on the casual relationships between poor solid waste management and its related consequences. there is thus need to create awareness among slum residents on the importance of proper solid waste management, while putting emphasis on aspects with most significant impacts on public health. attitudes towards social responsibility on solid waste management were also low among slum residents. whereas most respondents felt that they were doing enough to address solid waste management in their community, they did not think it was their responsibility to pick up wastes in their neighborhood. this clearly indicates that the most did not understand their roles as regards solid waste management at both household and community levels further indicating the need to raise awareness about solid waste management among slum dwellers. other studies done elsewhere have previously suggested that such awareness could increase participation in solid waste management initiatives [23, 24 ]. indeed, results from our study showed that most respondents believed that providing public education could improve the waste management situation. slum residents had high willingness to participate in solid waste management initiatives including separation of wastes and composting. willingness to participate however varied across different groups in the community ; for instance, single people had significantly lower willingness to participate in composting. knowing that there are groups with low willingness to participate in solid waste management improvement initiatives helps programmers in designing awareness campaigns particularly targeting them. marital status influenced the respondents ' willingness to participate in composting probably because the married have a higher sense of responsibility. a limitation of our study is that it relied on responses provided by household members and did not directly observe the waste management practices. secondly, a project focusing on improving water, sanitation, and hygiene was being implemented in the two slums. however, this was in its early stages of implementation. this study was carried out in urban slums and results might not be generalized for slums in smaller towns. however, the study provides useful insights into the solid waste management practices, concerns, and willingness to improve solid waste management in urban slums which could inform future studies. other studies should be conducted for slums in different contexts, particularly in developing countries. solid waste management practices such as storage and disposal practices in the slums were unsatisfactory, and separation and composting were minimally practiced. slum residents ' practices, concerns, and attitudes indicated lack of sufficient knowledge about good waste practices, their responsibilities, and consequencies of poor waste management. however, slum residents had high willingness to participate in waste separation and composting. therefore, there is a need for concerned authorities to engage residents of urban slums to improve their practices in solid waste management such as waste separation and disposal. | poor solid waste management is among the major challenges facing urban slums in developing countries including uganda. understanding community concerns and willingness towards involvement in solid waste management improvement initiatives is critical for informing interventions in slums. methods. we used a cross - sectional study to collect quantitative data from 435 residents in two urban slums in central uganda. a semistructured questionnaire was used which assessed waste collection practices, separation and disposal methods, concerns regarding solid wastes, and willingness to participate in waste separation and composting. data was analysed using stata 12. results. food remains (38%) and plastics (37%) formed the biggest proportion of wastes generated in households. most households (35.9%) disposed of general wastes by open dumping while 27% disposed of plastics by burning. only 8.8% of households conducted composting while 55% carried out separation for some decomposable wastes. separation was carried out for only banana peelings and leftover foods for feeding animals. respondents expressed high willingness to separate (76.6%) and compost (54.9%) solid wastes. conclusion. practices in waste disposal and separation were poor despite high willingness to participate in initiatives to improve waste management, highlighting a need for authorities to engage residents of slums to improve their practices. |
slow waves and sleep spindles are the essential elements in the definition of sleep stages. they recently received additional attention because of their hypothesized involvement in processes related to neuronal plasticity, learning, and memory [24 ]. furthermore, slow oscillations (< 1 hz) are considered as a central feature of sleep. these intracortically generated fluctuations consist at the cellular level of rhythmic depolarizing components (up states) separated by prolonged hyperpolarizations (down states). there is evidence that they are involved in the temporal organization of other sleep rhythms such as spindles and delta waves (for a review, see). also, it is hypothesized that the slow oscillation is involved in processes of learning and memory during sleep. tononi and cirelli proposed that slow oscillations were an indication of synaptic downscaling in the cortex occurring during nonrapid eye movement sleep in order to counteract synaptic potentiation resulting from learning processes occurring during wakefulness [6, 7 ]. evidence for this hypothesis comes from data of a motor learning task, arm immobilization, animal studies, and computational modeling. we shall address in this paper only one particular aspect in this context, which is, however, related to the interplay of sleep spindles and slow oscillations : i.e., the temporal organization of spindles. it was postulated that these thalamically generated sleep spindles are grouped by cortically generated slow oscillations and more generally that the slow oscillations also organize the occurrence of other sleep oscillations. this hypothesis is based on experimental and theoretical evidence : sleep spindles lost their coherence and their temporal however, there are also inconsistencies in relation to this hypothesis : first, the frequency of the slow oscillations was originally considered as being only slightly < 1 hz. achermann and borbly, for instance, reported a peak in the power spectrum at 0.7 hz. this would correspond to a shorter typical interevent interval between sleep spindles than 4 s. thus, only approximately every third slow oscillation would trigger a spindle. second, the rhythmic occurrence of spindles is most pronounced in sleep stage 2 (see fig. 4), but slow oscillations are most prominent in deep sleep. thus, one should also take alternative explanations into account. in the present paper, we investigated whether the periodicity in the occurrence of sleep spindles and other sleep oscillations might be a pure stochastic effect that occurs without assuming an additional slow process. to test this hypothesis, we compared interevent interval distributions of the events detected in the human sleep eeg with events detected in artificial data generated with stationary stochastic processes, which resemble to some extent the short - term properties of the eeg signal. the analysis is based on a recently proposed method to detect and analyze oscillatory events in the human sleep eeg. eeg data were modeled on short time scales (1s) by linear autoregressive (ar) models in a sliding window fashion. systems described by such linear models can be interpreted as a set of coupled stochastically driven harmonic oscillators with time - dependent frequencies and damping coefficients. in the case of the human sleep eeg, this frequency might represent resonances of the underlying thalamocortical networks. in, it was shown that the modulation of the frequency and the damping constant of the resonance of a simple excitatory inhibitory network can be detected from the mean activity of the network by applying this method. we analyzed 8-h sleep eeg data (single channel, derivation c3a2) of eight healthy young male subjects (mean age 24.1 0.6 years), each contributing four baseline nights [17, 19 ]. the sampling rate was 128 hz and sleep stages were visually scored according to standard criteria. oscillatory events were detected by fitting ar models of order 8 to subsegments of 1 s in length in a sliding window fashion resulting in a time dependence of the parameters of the ar model. the signal generated by an ar(p)-model can be interpreted as the superposition of the output of n oscillators and p 2n relaxators. the p parameters of the ar(p)-model are transformed into n frequencies and damping constants of the oscillators, and p 2n damping constants of the purely decaying nonoscillating modes. thus, time - dependent frequencies and damping constants result from the sliding window approach. figure 1 shows a 20-s segment of eeg (stage 2) and the time - dependent modules r and the corresponding frequencies \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$f\:$\end{document } of the poles. the damping constant is a function of r, = fs logr with fs denoting the sampling frequency. the case r = 1 corresponds to the limiting case of an undamped oscillation. the threshold for the event detection was set to r1 = 0.95 (fig. = 0.9 was applied : in order to account for statistical fluctuations, the event was not necessarily terminated whenever r became smaller than r1. it was considered as a single event if the corresponding r became larger than r1 again without falling below r2. the value r1 was chosen such that clearly visible sleep spindles were reliably detected by the algorithm, while r2 had to be low enough so that a single spindle was detected as a single event, but high enough so that subsequent spindles were recognized as distinct events. the time between the first and the final crossing of the threshold r1 plus 1 s (the length of the segment used to fit the ar model) was considered as the duration of the oscillatory event. the time when r was maximal was defined as the time of occurrence of the event and the corresponding frequency the interevent intervals were estimated as the difference of the time of occurrence of successive oscillatory events. 1detection of oscillatory events in a 20-s eeg segment of stage 2 non - rem sleep. the upper panel shows the eeg signal, the middle panel shows r, and the lower panel the corresponding frequencies f, with the colors indicating corresponding oscillatory modes. the detection threshold r1 = 0.95 is indicated in the middle panel (see section 2.2) detection of oscillatory events in a 20-s eeg segment of stage 2 non - rem sleep. the upper panel shows the eeg signal, the middle panel shows r, and the lower panel the corresponding frequencies f, with the colors indicating corresponding oscillatory modes. the detection threshold r1 = 0.95 is indicated in the middle panel (see section 2.2) for the analysis of the interevent intervals and the event durations, we assigned the events into different frequency bands. we are aware that this is not an optimal approach because of interindividual variation in mean event frequencies and their dependence on sleep stage and cycle. however, at the moment we have no method available to analyze the events on the basis of individually determined time - dependent frequency bands. therefore, we used the frequency bands employed previously, i.e., delta (: 0 f < 4.5 hz), alpha (: 8 f < 11.5 hz), and sigma (: 11.5 f < 16 hz ; sleep spindles) bands. figure 2 illustrates the detected events of a single night and the corresponding histogram of the event frequencies. 2detected oscillatory events in a single night (black dots represent single events), hypnogram (mt, movement time ; w, waking, rem, rapid eye movement sleep ; 1 to 4, nonrapid eye movement sleep stages 1 to 4), and corresponding histogram of the event frequencies. colors indicate the different frequency bands detected oscillatory events in a single night (black dots represent single events), hypnogram (mt, movement time ; w, waking, rem, rapid eye movement sleep ; 1 to 4, nonrapid eye movement sleep stages 1 to 4), and corresponding histogram of the event frequencies. colors indicate the different frequency bands artificial eeg data were generated using an ar(4) model with random inputs and parameters corresponding to a frequency in the spindle frequency band (f = 14 hz) and in the delta band (f = 3 hz), assuming a sampling frequency of 128 hz. we restricted the analysis to data from an ar(4) model because the two higher frequencies that can be seen in fig. we analyzed data sets with different values of r for the spindle frequency because the spindle oscillations are our main focus. for each set of parameter values, a time series of 6 10 data points (corresponding to approximately 13 h of eeg data) was generated. 3twenty - second simulated ar(4) data with time - dependent modules and frequencies derived by fitting an ar(4) model similar to fig. 1. the upper panel shows the signal, the middle panel shows r, and the lower panel the corresponding frequencies f, with the colors indicating corresponding oscillatory modes. the ar(4) model contained two oscillatory modes, one in the spindle frequency band, f = 14 hz, r = 0.94, and one in the delta frequency band, f = 3hz, r = 0.91 twenty - second simulated ar(4) data with time - dependent modules and frequencies derived by fitting an ar(4) model similar to fig. 1. the upper panel shows the signal, the middle panel shows r, and the lower panel the corresponding frequencies f, with the colors indicating corresponding oscillatory modes. the ar(4) model contained two oscillatory modes, one in the spindle frequency band, f = 14 hz, r = 0.94, and one in the delta frequency band, f = 3hz, r = 0.91 we analyzed 8-h sleep eeg data (single channel, derivation c3a2) of eight healthy young male subjects (mean age 24.1 0.6 years), each contributing four baseline nights [17, 19 ]. the sampling rate was 128 hz and sleep stages were visually scored according to standard criteria. oscillatory events were detected by fitting ar models of order 8 to subsegments of 1 s in length in a sliding window fashion resulting in a time dependence of the parameters of the ar model. the signal generated by an ar(p)-model can be interpreted as the superposition of the output of n oscillators and p 2n relaxators. the p parameters of the ar(p)-model are transformed into n frequencies and damping constants of the oscillators, and p 2n damping constants of the purely decaying nonoscillating modes. thus, time - dependent frequencies and damping constants result from the sliding window approach. figure 1 shows a 20-s segment of eeg (stage 2) and the time - dependent modules r and the corresponding frequencies \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$f\:$\end{document } of the poles. the damping constant is a function of r, = fs logr with fs denoting the sampling frequency. the case r = 1 corresponds to the limiting case of an undamped oscillation. the threshold for the event detection was set to r1 = 0.95 (fig. 1). to determine the event duration, a second threshold r2 = 0.9 was applied : in order to account for statistical fluctuations, the event was not necessarily terminated whenever r became smaller than r1. it was considered as a single event if the corresponding r became larger than r1 again without falling below r2. the value r1 was chosen such that clearly visible sleep spindles were reliably detected by the algorithm, while r2 had to be low enough so that a single spindle was detected as a single event, but high enough so that subsequent spindles were recognized as distinct events. the time between the first and the final crossing of the threshold r1 plus 1 s (the length of the segment used to fit the ar model) was considered as the duration of the oscillatory event. the time when r was maximal was defined as the time of occurrence of the event and the corresponding frequency the interevent intervals were estimated as the difference of the time of occurrence of successive oscillatory events. 1detection of oscillatory events in a 20-s eeg segment of stage 2 non - rem sleep. the upper panel shows the eeg signal, the middle panel shows r, and the lower panel the corresponding frequencies f, with the colors indicating corresponding oscillatory modes. the detection threshold r1 = 0.95 is indicated in the middle panel (see section 2.2) detection of oscillatory events in a 20-s eeg segment of stage 2 non - rem sleep. the upper panel shows the eeg signal, the middle panel shows r, and the lower panel the corresponding frequencies f, with the colors indicating corresponding oscillatory modes. the detection threshold r1 = 0.95 is indicated in the middle panel (see section 2.2) for the analysis of the interevent intervals and the event durations, we assigned the events into different frequency bands. we are aware that this is not an optimal approach because of interindividual variation in mean event frequencies and their dependence on sleep stage and cycle. however, at the moment we have no method available to analyze the events on the basis of individually determined time - dependent frequency bands. therefore, we used the frequency bands employed previously, i.e., delta (: 0 f < 4.5 hz), alpha (: 8 f < 11.5 hz), and sigma (: 11.5 f < 16 hz ; sleep spindles) bands. figure 2 illustrates the detected events of a single night and the corresponding histogram of the event frequencies. 2detected oscillatory events in a single night (black dots represent single events), hypnogram (mt, movement time ; w, waking, rem, rapid eye movement sleep ; 1 to 4, nonrapid eye movement sleep stages 1 to 4), and corresponding histogram of the event frequencies. colors indicate the different frequency bands detected oscillatory events in a single night (black dots represent single events), hypnogram (mt, movement time ; w, waking, rem, rapid eye movement sleep ; 1 to 4, nonrapid eye movement sleep stages 1 to 4), and corresponding histogram of the event frequencies. artificial eeg data were generated using an ar(4) model with random inputs and parameters corresponding to a frequency in the spindle frequency band (f = 14 hz) and in the delta band (f = 3 hz), assuming a sampling frequency of 128 hz. we restricted the analysis to data from an ar(4) model because the two higher frequencies that can be seen in fig. we analyzed data sets with different values of r for the spindle frequency because the spindle oscillations are our main focus. for each set of parameter values, a time series of 6 10 data points (corresponding to approximately 13 h of eeg data) was generated. 3twenty - second simulated ar(4) data with time - dependent modules and frequencies derived by fitting an ar(4) model similar to fig. 1. the upper panel shows the signal, the middle panel shows r, and the lower panel the corresponding frequencies f, with the colors indicating corresponding oscillatory modes. the ar(4) model contained two oscillatory modes, one in the spindle frequency band, f = 14 hz, r = 0.94, and one in the delta frequency band, f = 3hz, r = 0.91 twenty - second simulated ar(4) data with time - dependent modules and frequencies derived by fitting an ar(4) model similar to fig. 1. the upper panel shows the signal, the middle panel shows r, and the lower panel the corresponding frequencies f, with the colors indicating corresponding oscillatory modes. the ar(4) model contained two oscillatory modes, one in the spindle frequency band, f = 14 hz, r = 0.94, and one in the delta frequency band, f = 3hz, r = 0.91 figure 4 shows the interevent interval distributions of sleep spindles (11.516 hz). the histograms of the empirical data were estimated based on the four recordings of all subjects (pooled data). in sleep stage 2, the maximum is at t 4 s and is much more pronounced than in deep sleep [slow wave sleep (sws) ]. the distribution of the interevent intervals detected by our algorithm was similar to the distribution reported in for spindles identified by visual detection. figure 4 also contains the distributions of events detected from simulated data of stationary ar(4) models for two different values of the module r for the spindle frequency. events were detected with the same algorithm and parameters as for the eeg data. also, for the simulated data, the interevent interval distributions showed a peak around 4 s (2.5 s for r = 0.94 and between 2.5 and 4 for r = 0.89). the results of the simulated data indicate that stationary stochastic processes also exhibit a periodicity in the occurrence of events with a maximum similar to empirical data without the assumption of an additional slow process grouping the events. thus, in order to understand the character of the maxima in the empirical distributions, it is necessary to investigate these distributions in more detail. 4normalized histograms (pooled data) of interevent intervals (t) in the spindle frequency range (11.516 hz) in nonrapid eye movement sleep stage 2 (st2 ; top left) and slow wave sleep (sws, stages 3 and 4 ; top right) and of events in the spindle frequency range detected from data generated by stationary ar(4) models with r = 0.94 (bottom left) and r = 0.89 (bottom right) for the spindle frequency normalized histograms (pooled data) of interevent intervals (t) in the spindle frequency range (11.516 hz) in nonrapid eye movement sleep stage 2 (st2 ; top left) and slow wave sleep (sws, stages 3 and 4 ; top right) and of events in the spindle frequency range detected from data generated by stationary ar(4) models with r = 0.94 (bottom left) and r = 0.89 (bottom right) for the spindle frequency in fig. 5, an exponential decay for large interevent intervals was present in both the synthetic and the empirical data. for events occurring randomly with a certain constant rate (poisson process), one would expect that the interevent intervals are exponentially distributed, with the exponent being equal to the event rate (number of events per unit of time). in our situation, this can not be exactly the case because of the finite duration of the oscillatory events. however, for large interevent intervals compared to the event duration, this might be a reasonable assumption. the empirical distributions differ substantially from an exponential distribution not only for times below the maximum of the distribution but also for larger time intervals. thus, the region around the maximum can not be explained in the same way as the distributions for the ar processes. this is the first indication of an additional process contributing to the peak in the empirical interevent distributions. 5normalized histograms of interevent intervals as in fig. 4 but plotted on a semilogarithmic scale including additional values of r. the straight lines show fits to the exponential tails of these distributions normalized histograms of interevent intervals as in fig. 4 but plotted on a semilogarithmic scale including additional values of r. the straight lines show fits to the exponential tails of these distributions the systematic dependence of the exponential decay on r of the ar model and, therefore, on the damping of the spindle frequency pole, is illustrated in fig. 6a. for r 0.93, the exponent becomes smaller with smaller r. a similar relationship holds for the event rate (fig. the inverse relationship is observed only for large r, i.e., lower damping leads to a decrease in the event rate, which is overcompensated by an increased event duration. the relationship between the exponent of the exponential decay and the event rate is shown for r 0.93 in fig. systematic deviations for larger event rates might be explained by more events of longer duration as illustrated in fig 7 6a exponents from the fit of the exponential tails of the interevent interval distributions (fig. 5) of the simulated ar(4) data as a function of r of the spindle frequency pole. b event rate as a function of r. c exponent of the exponential decay (mean sd) as a function of the event rate shown only for 0.85 r 0.93. values for the empirical distributions (red) from sleep spindles shown separately for nonrapid eye movement sleep stages 2, 3, and 4. 7normalized histograms (pooled data) of the event duration (td) in the spindle frequency range (11.516 hz) in nonrapid eye movement sleep stage 2 (st2 ; top left) and slow wave sleep (sws, stages 3 and 4 ; top right) and events in the spindle frequency range from a stationary ar(4) process with different values of r for the spindle frequency a exponents from the fit of the exponential tails of the interevent interval distributions (fig. 5) of the simulated ar(4) data as a function of r of the spindle frequency pole. b event rate as a function of r. c exponent of the exponential decay (mean sd) as a function of the event rate shown only for 0.85 r 0.93. values for the empirical distributions (red) from sleep spindles shown separately for nonrapid eye movement sleep stages 2, 3, and 4. the straight line indicates the linear relationship as expected for a poisson process normalized histograms (pooled data) of the event duration (td) in the spindle frequency range (11.516 hz) in nonrapid eye movement sleep stage 2 (st2 ; top left) and slow wave sleep (sws, stages 3 and 4 ; top right) and events in the spindle frequency range from a stationary ar(4) process with different values of r for the spindle frequency the exponent of the empirical data of sleep spindles (fig. 6c) suggests an increased damping (corresponding to a smaller r) with increasing sleep depth from stage 2 through stage 3 to stage 4, which meets our expectations. the spindles exhibited, however, a larger exponent than expected from the resulting event rate. or, to put it the other way around, the event rate is smaller than one would expect from the exponent of the exponential decay. from the 4-s periodicity, one would have expected the contrary, i.e., a larger event rate, because an interevent interval of 4 s corresponds to an event rate of 15 events per minute. a possible explanation for this discrepancy might be the estimation of the event density of spindles : the number of detected spindles during a particular sleep stage was divided by the total time spent in this stage. this event rate is not equal to the inverse of the mean of the interevent interval distribution because only interevent intervals with no sleep stage transition between the events were included. the normalized distribution of the event duration (fig. 7) plotted on a logarithmic scale seems to be less specific for sleep spindles. first, the maximum around t = 4 s occurs in the simulated data for a wide range of values of r. second, there is no large difference between the distributions of the occurrence of spindles in sleep stage 2 and sws. there is a slightly larger probability to have longer spindles in sleep stage 2 compared to sws (fig. 7), which would correspond to a higher value of r if we assume that spindles were generated by a stationary ar process. note, however, that the probability of long spindles increased strongly in data generated by ar models of large r. this increase might be the reason for the slower exponential decrease in the interevent interval distribution for r = 0.95 compared to r = 0.93. we have demonstrated that important properties of the temporal organization of the occurrence of sleep spindles are already present for oscillatory events detected in data generated with stationary stochastic processes. such properties are the position of the maximum of the interevent interval distribution, i.e., the periodicity in the occurrence of events between 2 and 5 s and the maximum around 2 s in the distribution of event durations. a more detailed analysis, however, revealed that the exponential decay in the interevent distributions, which can be interpreted as reflecting the random occurrence of oscillatory events, starts in the case of the sleep spindles only at much longer interevent intervals compared to data from stationary ar processes. for interevent intervals around the maximum of 4 s, the empirical distributions of sleep spindles clearly differ from the distributions of the simulated events and show, in particular, no exponential decay. one could assume in a first approximation a gaussian distribution around 4 s, which would indicate that an additional process is responsible for the observed periodicity in the occurrence of spindles. including such a process in modeling the time series, i.e., modeling explicitly also the dynamics of the parameters of the ar model, would result in a nonlinear model. the extent to which such a process is related to cortical slow oscillations has to be the subject of further research. in particular, the present analysis could be extended by (1) also varying the delta frequency and/or its damping in the simulated data and (2) taking into account that single sleep stages are not dynamically homogeneous, i.e., not assuming that the spindles in a particular sleep stage were generated by a single stationary process but rather by a suitable ensemble of such processes. moreover, it is known that there are strong interindividual differences in the event rates of sleep spindles (e.g.,). thus, one should also investigate to which extent interindividual differences in the interevent interval distributions are present. our analysis demonstrated, nonetheless, how phenomenological modeling of the short - term dynamics of the eeg using linear models can be used to detect and to analyze oscillatory events and to test hypotheses about the origin of some of their properties. | the sleep electroencephalogram (eeg) is characterized by typical oscillatory patterns such as sleep spindles and slow waves. recently, we proposed a method to detect and analyze these patterns using linear autoregressive models for short (1 s) data segments. we analyzed the temporal organization of sleep spindles and discuss to what extent the observed interevent intervals correspond to properties of stationary stochastic processes and whether additional slow processes, such as slow oscillations, have to be assumed. we have found evidence for such an additional slow process, most pronounced in sleep stage 2. |
despite the declining incidence of gastric cancer in western countries, gastric cancer is the most frequently diagnosed cancer worldwide, and is one of the main causes of cancer deaths. in patients with advanced gastric cancer with distant metastasis or recurrence, systemic chemotherapy has been recommended as standard treatment, and the prolongation of survival or increase in the quality of life is well - established. however, patients with advanced gastric cancer with distant metastasis or recurrence remain incurable, and these patients have a median survival of only 7 - 13 months, despite receiving chemotherapy. also, first - line standard chemotherapy regimens have not been defined for patients with advanced gastric cancer. cisplatin - based regimens have demonstrated superior efficacy compared to platinum - free regiments, although cisplatin - based regimens have significant toxicity. oxaliplatin is a third generation platinum compound with a lack of cross - drug resistance with cisplatin, a synergistic effect with 5-fluorouracil (5-fu), and a satisfactory safety profile compared to cisplatin [6 - 9 ]. moreover, many adducts of oxaliplatin appear to be more effective in inhibiting dna synthesis than adducts of cisplatin [10 - 12 ]. two phase iii trials have directly compared oxaliplatin - based versus cisplatin - based regimens, both of which have concluded that oxaliplatin is at least as effective as cisplatin, and has a lower toxicity profile, except neurotoxicity, in combination regimens for patients with advanced gastric cancer. in several phase ii studies involving the treatment of advanced gastric cancer, various combinations of oxaliplatin, 5-fu, and folinic acid (fa), as first- or second - line treatments, however, the optimal dose and schedule of combination oxaliplatin, 5-fu, and fa were not established. the aim of this retrospective study was to report the efficacy and toxicity of a biweekly protocol of oxaliplatin (100 mg / m) combined with 5-fu (2,400 mg / m ; 46-hour continuous infusion), and fa (200 mg / m) as first - line treatment on response, survival, and toxicity rates of metastatic and recurrent gastric cancer in korean patients. the eligibility criteria were as follows : 1) histologically - confirmed metastatic or recurrent adenocarcinoma of the stomach and 18 years of age ; 2) no previous chemotherapy, except post - operative adjuvant chemotherapy or chemoradiation that was received > 6 months previously ; 3) an eastern cooperative oncology group (ecog) performance status of 0 - 2 ; 4) no serious or uncontrolled concurrent medical illness ; 5) at least one measurable lesion ; and 6) adequate baseline hematologic function (absolute neutrophil count [anc]1.510/l, platelet count10010/l), adequate hepatic function (serum bilirubin1.25upper normal limit [unl ], serum aspartate aminotransferase, alanine aminotransferase2.5unl, serum alkaline phosphatase5.0unl), and adequate renal function (serum creatinine1.5 mg / dl). the exclusion criteria were as follows : 1) preexisting peripheral neuropathy ; 2) concurrent or prior malignancy, except curative resection of cervical carcinoma in situ or squamous cell carcinoma of the skin ; 3) active infection ; and 4) concurrent treatments that interfered with the evaluation of the study. oxaliplatin (100 mg / m) and fa (200 mg / m) were given as a 2-hour intravenous infusion followed by 5-fu (2,400 mg / m) as a 46-hour continuous infusion every 2 weeks. treatment was continued until disease progression, unacceptable toxicity, patient refusal, or at the discretion of the physician. each cycle was started if the anc and platelet count on the day of treatment were > 1.510/l and > 10010/l, respectively. in the case of toxicity grade 3, except alopecia, chemotherapy was delayed 1 week, then restarted after full recovery. a reduction of 25% in all drug doses was applied to grade 3/4 thrombocytopenia or febrile neutropenia, grade 4 neutropenia, and grade 3/4 non - hematologic toxicity in the previous cycle of chemotherapy. the response to treatment was assessed according to the response evaluation criteria in solid tumors (recist) criteria (ver. computed tomography (ct) scans of the measurable lesions were performed within 2 weeks prior to treatment. after every 4th cycle of chemotherapy, ct scans were performed to determine the response of the disease, or sooner if there was evidence of any clinical deterioration. complete blood cell counts with differentials and serum biochemistries were repeated prior to the start of each chemotherapy cycle, and the toxicity was graded according to the national cancer institute common toxicity criteria (nci - ctc, ver.3.0). overall survival (os) was calculated from the first day of chemotherapy to the date of death. time - to - progression (ttp) was calculated from the first day of chemotherapy to the date of disease progression. the kaplan - meier method was used to analyze the ttp and os, and the 95% confidence interval (ci) for the median time - to - event was computed. the eligibility criteria were as follows : 1) histologically - confirmed metastatic or recurrent adenocarcinoma of the stomach and 18 years of age ; 2) no previous chemotherapy, except post - operative adjuvant chemotherapy or chemoradiation that was received > 6 months previously ; 3) an eastern cooperative oncology group (ecog) performance status of 0 - 2 ; 4) no serious or uncontrolled concurrent medical illness ; 5) at least one measurable lesion ; and 6) adequate baseline hematologic function (absolute neutrophil count [anc]1.510/l, platelet count10010/l), adequate hepatic function (serum bilirubin1.25upper normal limit [unl ], serum aspartate aminotransferase, alanine aminotransferase2.5unl, serum alkaline phosphatase5.0unl), and adequate renal function (serum creatinine1.5 mg / dl). the exclusion criteria were as follows : 1) preexisting peripheral neuropathy ; 2) concurrent or prior malignancy, except curative resection of cervical carcinoma in situ or squamous cell carcinoma of the skin ; 3) active infection ; and 4) concurrent treatments that interfered with the evaluation of the study. oxaliplatin (100 mg / m) and fa (200 mg / m) were given as a 2-hour intravenous infusion followed by 5-fu (2,400 mg / m) as a 46-hour continuous infusion every 2 weeks. treatment was continued until disease progression, unacceptable toxicity, patient refusal, or at the discretion of the physician. each cycle was started if the anc and platelet count on the day of treatment were > 1.510/l and > 10010/l, respectively. in the case of toxicity grade 3, except alopecia, chemotherapy was delayed 1 week, then restarted after full recovery. a reduction of 25% in all drug doses was applied to grade 3/4 thrombocytopenia or febrile neutropenia, grade 4 neutropenia, and grade 3/4 non - hematologic toxicity in the previous cycle of chemotherapy. oxaliplatin (100 mg / m) and fa (200 mg / m) were given as a 2-hour intravenous infusion followed by 5-fu (2,400 mg / m) as a 46-hour continuous infusion every 2 weeks. treatment was continued until disease progression, unacceptable toxicity, patient refusal, or at the discretion of the physician. each cycle was started if the anc and platelet count on the day of treatment were > 1.510/l and > 10010/l, respectively. in the case of toxicity grade 3, except alopecia, chemotherapy was delayed 1 week, then restarted after full recovery. a reduction of 25% in all drug doses was applied to grade 3/4 thrombocytopenia or febrile neutropenia, grade 4 neutropenia, and grade 3/4 non - hematologic toxicity in the previous cycle of chemotherapy. the response to treatment was assessed according to the response evaluation criteria in solid tumors (recist) criteria (ver. computed tomography (ct) scans of the measurable lesions were performed within 2 weeks prior to treatment. after every 4th cycle of chemotherapy, ct scans were performed to determine the response of the disease, or sooner if there was evidence of any clinical deterioration. complete blood cell counts with differentials and serum biochemistries were repeated prior to the start of each chemotherapy cycle, and the toxicity was graded according to the national cancer institute common toxicity criteria (nci - ctc, ver.3.0). overall survival (os) was calculated from the first day of chemotherapy to the date of death. time - to - progression (ttp) was calculated from the first day of chemotherapy to the date of disease progression. the kaplan - meier method was used to analyze the ttp and os, and the 95% confidence interval (ci) for the median time - to - event was computed. between january 2006 and august 2009, 39 patients with a median age of 62 years (range, 38 to 78 years) were retrospectively studied in seoul, bucheon, and cheonan soonchunhyang university hospitals. there were 22 men and 17 women, and 2 patients (5.1%) had an ecog performance status of 2. thirty - one patients (79.5%) had primary metastatic disease and 8 patients (20.5%) had recurrent disease. the metastasis involved two organs in 11 patients (28.2%) and > 3 organs in 11 patients (28.2%). the majority of the patients (71.8%) had 1 or 2 involved regions, and the common target lesion was a lymph node or the liver. thirty - two of the 39 patients were evaluable for response according to the recist criteria (ver. the response was not assessable in 7 patients who were lost to follow - up (n=3), voluntary refusal for further treatment after 1 or 2 cycles (n=2), and death before the 4 cycles of chemotherapy (n=2). eleven patients (28.2%) achieved a partial response, 14 patients (35.9%) had stable disease, and 7 patients (17.9%) had progressed during the course of treatment (table 2). treat analysis, the overall response rate (orr) and disease control rates were 28.2% (95% ci, 11.7 to 44.7%) and 64.1% (95% ci, 49.9 to 78.3%), respectively. the median duration of follow - up was 20.1 months (range, 2.1 to 63.0 months). the ttp and os were 4.3 months (95% ci, 2.0 to 6.5 months) (fig. 1) and 9.8 months (95% ci, 3.5 to 16.0 months) (fig. then, age (0 - 64 years vs.>65 years), gender, a history of surgery or chemotherapy, ecog performance status (0 - 1 vs. 2), disease status before chemotherapy (newly diagnosed vs. recurrent), and the number of metastases (0 - 2 vs.>3) were compared between the two groups. based on univariate analysis, the ecog performance status (p=0.004) and the number of metastases (p=0.033) only the ecog performance status was a significant factor affecting survival based on multivariate analysis (hazard ratio, 0.134 ; p=0.043). table 3 shows the summaries of the incidence of main toxicities. the major grade 3 or 4 hematologic toxicities per cycle were neutropenia (15.2%) and thrombocytopenia (7.6%). the major non - hematologic toxicities per cycle were constipation (46.2%) and nausea (41.9%). peripheral neuropathy per cycle occurred in 33.8% of the patients and all cases were grade 1 - 2 ; there were no treatment interruptions or discontinuations due to neuropathy. one patient (2.6%) had acute renal failure after 1 treatment cycle, which required transient hemodialysis. the relative dose intensities of oxaliplatin and 5-fu were 87.4% and 86.2% of the planned doses, respectively. between january 2006 and august 2009, 39 patients with a median age of 62 years (range, 38 to 78 years) were retrospectively studied in seoul, bucheon, and cheonan soonchunhyang university hospitals. there were 22 men and 17 women, and 2 patients (5.1%) had an ecog performance status of 2. thirty - one patients (79.5%) had primary metastatic disease and 8 patients (20.5%) had recurrent disease. the metastasis involved two organs in 11 patients (28.2%) and > 3 organs in 11 patients (28.2%). the majority of the patients (71.8%) had 1 or 2 involved regions, and the common target lesion was a lymph node or the liver. thirty - two of the 39 patients were evaluable for response according to the recist criteria (ver. the response was not assessable in 7 patients who were lost to follow - up (n=3), voluntary refusal for further treatment after 1 or 2 cycles (n=2), and death before the 4 cycles of chemotherapy (n=2). eleven patients (28.2%) achieved a partial response, 14 patients (35.9%) had stable disease, and 7 patients (17.9%) had progressed during the course of treatment (table 2). treat analysis, the overall response rate (orr) and disease control rates were 28.2% (95% ci, 11.7 to 44.7%) and 64.1% (95% ci, 49.9 to 78.3%), respectively. the median duration of follow - up was 20.1 months (range, 2.1 to 63.0 months). the ttp and os were 4.3 months (95% ci, 2.0 to 6.5 months) (fig. 1) and 9.8 months (95% ci, 3.5 to 16.0 months) (fig. then, age (0 - 64 years vs.>65 years), gender, a history of surgery or chemotherapy, ecog performance status (0 - 1 vs. 2), disease status before chemotherapy (newly diagnosed vs. recurrent), and the number of metastases (0 - 2 vs.>3) were compared between the two groups. based on univariate analysis, the ecog performance status (p=0.004) and the number of metastases (p=0.033) were significantly different between the two groups. only the ecog performance status was a significant factor affecting survival based on multivariate analysis (hazard ratio, 0.134 ; p=0.043). table 3 shows the summaries of the incidence of main toxicities. the major grade 3 or 4 hematologic toxicities per cycle were neutropenia (15.2%) and thrombocytopenia (7.6%). the major non - hematologic toxicities per cycle were constipation (46.2%) and nausea (41.9%). peripheral neuropathy per cycle occurred in 33.8% of the patients and all cases were grade 1 - 2 ; there were no treatment interruptions or discontinuations due to neuropathy. one patient (2.6%) had acute renal failure after 1 treatment cycle, which required transient hemodialysis. the relative dose intensities of oxaliplatin and 5-fu were 87.4% and 86.2% of the planned doses, respectively. despite a large number of randomized trials, the best agent or optimal regimen for the first - line treatment of advanced gastric cancer has not been determined. a variety of different oxaliplatin combination regimens have been studied (oxaliplatin plus 5-fu, epirubicin, or capecitabine) in phase ii trials. also, several studies involving various combinations of oxaliplatin/5-fu / fa for treating advanced gastric cancer have been published ; these studies have shown consistent results regarding the activity of oxaliplatin combinations [15 - 19 ]. the range of ttp, median os, and orr of these trials were 4.3 - 6.2 and 7.3 - 9.6 months, and 26 - 45%, respectively. although data from randomized controlled phase iii trials have not been published, in practice various combinations of oxaliplatin/5-fu / fa are used for the treatment of advanced gastric cancer in korea. however, one prospective study involving oxaliplatin/5-fu / fa as first - line chemotherapy in korean patients with advanced gastric cancer has been conducted. in that study, all 37 patients were elderly (> 65 years of age). the objective of our study was to assess the efficacy and toxicity of a biweekly combination of oxaliplatin (100 mg / m in a 2-hour infusion), fa (200 mg / m in a 2-hour infusion), and 5-fu (2,400 mg / m in a 46-hour continuous infusion) as first - line treatment for treating younger patients with advanced gastric cancer in korea. although our study was retrospective, the results showed that the chemotherapy regimen was an effective and safe combination for advanced gastric cancer as first - line treatment in korea, as well as western countries. the os of 9.8 months was within the range of previous trials (7 - 12 months) using platinum - containing and taxane- or irinotecan - based regimens. although survival is not a reliable point for evaluation of efficacy in a retrospective study, the median survival of 9.8 months in the current study compared favorably with previous studies. the treatment compliance for this regimen was good, with a dose adherence to both oxaliplatin and 5-fu of > 85%. owing to the patient selection bias, a comparison of the toxicity profiles in this study with other phase ii studies that used various oxaliplatin and 5-fu administration schedules is not relevant. compared with previous biweekly regimens [15 - 17 ], the biweekly protocol in the current study used higher levels of oxaliplatin (100 mg / m vs. 85 - 100 mg / m), and lower levels of fa (200 mg / m vs. 400 - 500 mg / m) and 5-fu (2.4 g / m vs. 2.4 - 3.0 g / m). in the current study, major grade 3/4 hematologic toxicity, including neutropenia (30.8%) and thrombocytopenia (20.0%), was encountered. although we infused 5-fu continuously without bolus to reduce hematologic toxicity, the rates of grade 3/4 neutropenia and thrombocytopenia were relatively high compared with other studies. it is possible that the rate of hematologic toxicity reflected the relatively high dose of oxaliplatin ; however, to make such an assumption, more evidence should be provided, such as 85 mg / m vs. 100 mg / m of oxaliplatin in caucasian and asian populations. nevertheless, the toxicities were manageable. neurotoxicity is the most common side effect in an oxaliplatin - containing protocol, but there was no grade 3/4 neurotoxicity encountered during the current study, which may have been due to the relatively low cumulative dose of oxaliplatin (median, 521 mg / m) used in this setting ; indeed, neuropathy is particularly prevalent for cumulative doses > 540 mg / m. one female patient had acute renal failure after one treatment cycle requiring transient hemodialysis ; she had normal renal function before treatment and did not receive medications with renal toxicity. further, she declined continuation of treatment for voluntary withdrawal after one cycle. therefore, the investigator considered renal toxicity a possible untoward effect related to oxaliplatin. in the current study, diarrhea occurred in 6.7% of the cycles, but 46.2% of the cycles had associated constipation (grade 1 or 2). compared with the other oxaliplatin/5-fu / lv regimens studied in gastric cancer, the rate of constipation was high. it would be worthwhile to determine whether or not oxaliplatin would slow the intestinal transit time in asians. although our study was retrospective, biweekly combination chemotherapy with oxaliplatin, 5-fu, and fa was well - tolerated and active as first - line treatment in patients with metastatic or recurrent gastric cancer. | purposewe retrospectively determined the efficacy and safety of the combination of oxaliplatin, 5-fluorouracil (5-fu), and folinic acid (fa) as first - line chemotherapy for patients with metastatic or recurrent gastric cancer.materials and methodsbetween january 2006 and august 2009, 39 patients with histologically - confirmed, metastatic or recurrent gastric cancer underwent chemotherapy, and the results were retrospectively investigated. the chemotherapy regimen consisted of oxaliplatin (100 mg / m2) and fa (200 mg / m2 ; 2-hour infusion), then 5-fu (2,400 mg / m2 ; 46-hour continuous infusion) every 2 weeks.resultsthirty-nine patients received a total of 210 treatment cycles. the median number of cycles was 6 (range, 1 to 16). of the 32 evaluable patients, zero patients achieved a complete response and 11 patients achieved a partial response (response rate, 28.2%). the median time - to - progression and overall survival were 4.3 months (95% confidence interval [ci ], 2.0 to 6.5 months) and 9.8 months (95% ci, 3.5 to 16.0 months), respectively. the main hematologic toxicity was anemia, which was observed in 119 cycles (56.7%). grade 3/4 neutropenia was observed in 32 cycles (15.2%). the main non - hematologic toxicity was constipation, which was observed in 91 cycles (46.2%). peripheral neuropathy occurred in 71 cycles (33.8%) ; all cases were grade 1 or 2. no treatment - related deaths were reported.conclusionthis study showed that combination chemotherapy with oxaliplatin, 5-fu, and fa is an active and well - tolerated regimen as first - line treatment in patients with metastatic or recurrent gastric cancer. |
fabry disease (fd) is a rare x - linked disorder resulting from a deficient activity of the lysosomal enzyme -glycosidase a (-gal a) that leads to progressive accumulation of glycosphingolipids in several tissues and organs. in the classical form of the disease, renal involvement commonly ensues in the second to third decades of life with overt proteinuria (> 300 mg / day) rapidly leading to chronic kidney disease (ckd) and end - stage renal disease (esrd). cardiac and renal atypical variants of the disease with different degrees of organ impairment and the pattern of disease have been described in males. in females, the disease presentation may range from a completely asymptomatic status to the classic form of fd. nonetheless, to the best of our knowledge, isolated proteinuria as the first sign of the disease is rare and has been described only in males. enzyme replacement therapy (ert) with agalsidase has been demonstrated to be safe and effective in the improvement of several signs and symptoms of fd in both genders, and it is accepted that the early establishment of ert might prevent organ damage. thus, ert is recommended in the presence of symptoms or organ involvement. however, due to the variable presentation and the slower progression of the disease in female patients, the questions of how to detect organ involvement and when to start therapy remain open. vv, a 20-year - old female was referred to our clinic in 2006 for a family screening programme due to one uncle, the mother and sister being diagnosed with fd [point mutation i354k (c1061t > a) of the exon 7 ]. at that time, vv was completely asymptomatic for fabry disease ; leucocyte -gal a activity was 19.5 nmol / mg prot / h (normal values 1850 nmol / mg prot / h), while molecular analysis showed the presence of the pathologic genotype, confirming the heterozygous status of the patient. at this time, clinical evaluation and periodic laboratory tests were unremarkable and no sign of fd could be detected. two years later in the first evaluation, urine analysis showed evidence of isolated persistent microalbuminuria (303 mg / l ; normal value < 30 mg / l) without overt proteinuria or abnormalities in the urinary electrolytes. all laboratory tests were in the normal range including serum creatinine and creatinine clearance (0.7 mg / dl and 92 ml / min, respectively). similarly, a thorough physical examination of the patient could not elicit any sign of fd or any other disease. specifically, body mass index, blood pressure and heart rate were 20.5 kg / m, 120/70 mmhg and 68 bpm, respectively. audiometric evaluation did not show any evidence of hearing loss. magnetic resonance imaging (mri) of the brain was negative for infarctual encephalopathy. finally, both sweat test and electromyography were normal, with no evidence of sensitive - motor abnormalities. due to the presence of isolated and persistent microalbuminuria light microscopy revealed numerous vacuolated cells in both glomerular tuft and tubular cells ; myelin osmiophilic bodies were also present in glomeruli or between tubules (figure 1a). direct immunofluorescent study showed negative staining for iga, igm, igg, c1q, c3 and c4. zebra bodies in podocytes, epithelial and endothelial cells of the glomerular tuft (figure 1b). thus, the renal biopsy confirmed that the patient presented fd with the sole involvement of the kidney. considering the aggressive course of the disease in the family, the optimal blood pressure control and what was suggested by the international guidelines for fd diagnosis and treatment, we started ert with agalsidase beta (fabrazyme - genzyme corp.) at a standard dose of 1 mg / kg every 2 weeks, in the hope to provide vv with an aetiological rather than antiproteinuric treatment. after 6 months of treatment, the microalbuminuria returned to the normal range (27 mg / l), while no other signs or symptoms of fd could be detected. renal biopsy of an asymptomatic fabry female patient presenting with isolated microalbuminuria (303 g / l, 24 h urine collection). light microscopy (panel a, left) shows numerous vacuolated cells in glomerular tufts (upper panel) and tubuli (lower panel). tem (panel b, right) shows osmiophilic zebra bodies in podocytes and epithelial cells (upper panel) and endothelial cells (lower panel). several studies have demonstrated that heterozygous patients, due to the lyon phenomenon, may present different phenotypes ranging from the complete absence of symptoms of the classical form of fabry disease. to the best of our knowledge, this is the first case reported of an adult heterozygous female in whom isolated microalbuminuria is the first and only presenting sign of both fd and renal involvement. the presentation of fd with a prevalent renal impairment (so - called renal variant) is rare and documented in male patients only. nonetheless, microalbuminuria has been recently described as a preliminary sign of renal impairment in symptomatic young female patients. it is the authors opinion that the present case report should question the watch and wait approach and pose several questions on what should be looked at as early signs of fd and when to start ert. indeed, the early detection of renal damage appears of paramount importance since the presence of proteinuria and/or ckd at the time of the start of ert are independent predictors of poor outcome. however, our case should suggest that microalbuminuria might be regarded as an early sign of fd nephropathy. furthermore, the disappearance of microalbuminuria after 6 months of ert without antiproteinuric agents [such as angiotensin - converting enzyme inhibitors (ace - i) or angiotensin receptor blockers (arbs) ] should deserve attention since it might suggest that early intervention might also reverse fd nephropathy. this finding might be of importance if we consider data from the fabry registry that seem to corroborate the notion that females with fd are undertreated, as only 33.8% of females currently included in the fabry registry are on ert. in summary, this case suggests that the kidney may be the first, and sometimes only, organ damaged by fd in heterozygous female patients and that isolated and persistent microalbuminuria instead of proteinuria should be regarded as an early marker of fd nephropathy and an indication for ert. renal variant, as well as how to detect organ damage and when to start an early treatment in female fd patients. | fabry disease (fd) is a rare x - linked disorder characterized by low or absent activity of the lysosomal enzyme -glycosidase - a that leads to progressive accumulation of glycosphingolipids in different organs and tissues. clinical manifestations vary from classic to atypical forms characterized by one prevalent organ involvement, and a renal variant has been described in men but not in women. however, little is known about renal manifestation in females affected by fd. we herein report a case of a 22-year - old female with isolated and persistent microalbuminuria as the only sign of fd. in light of the importance of early recognition and treatment of fd organ damage, this case should call for future studies to determine how to assess organ damage, investigate the existence of a renal variant in fd female patients and determine when best to start enzyme replacement therapy (ert). |
embryonic pancreata were harvested from time - mated cd1 strain mouse intercrosses of ngn3 females and males and stored individually in rnalater (ambion) at 4c until genotyping by pcr (30 cycles ; ngn3 forward, 5-cctcttctggctttcactac-3 and reverse, 5-ggagcgagagtttgatgtgg-3 ; neomycin forward, 5-gtcttgtcgatcaggatgatctc-3 and reverse, 5-caatatcacgggtagccaacgc-3). pancreatic islets were prepared from 6-month - old female cd1 mice by collagenase digestion and isolated by ficoll / histopaque gradients and handpicking (each preparation : six mice/1,000 islets). tc1 - 6, tc3, min6-, and mpac - tumor cell lines (10) were grown to 60% confluency in rpmi medium. total rna was extracted from tissues with trizol reagent (invitrogen, carlsbad, ca), purified by rneasy columns (qiagen, valencia, ca). biotin - labeled crna was synthesized by the affymetrix protocol (affymetrix, santa clara, ca) and hybridized to mgu74av2 and/or moe 430 2.0 microarrays. data were analyzed with genespring 7.2 (silicon genetics, redwood city, ca) and gc robust multi - array average (gc rma) used for normalization. anova was applied to cell line data, and p values were corrected by benjamini and hochberg 's procedure. netaffx (affymetrix, santa clara, ca ; http://www.affymetrix.com/analysis/index.affx) was used to extract a common probe set between moe430 2.0 and mgu74av2 platforms. gene classification was performed with fatigo (http://fatigo.bioinfo.cipf.es). quantitative rt - pcr (qrt - pcr) was performed on cdna (5 ng) derived from total rna by iscript cdna synthesis kits (bio - rad laboratories, hercules, ca). assays used fam dye labeled taqman mgb probes and an abi 7000 pcr instrument (applied biosystems, foster city, ca) and were normalized to glyceraldehyde-3-phosphate dehydrogenase. mouse pancreata were fixed in 4% paraformaldehyde and embedded in optimal cutting temperature compound (tissue tek ; sakura finetek, torrance, ca) for immunofluorescence microscopy. sections (6 m) were blocked in tyramide signal amplification blocking solution (zymed, carlsbad, ca) incubated overnight with guinea pig anti - insulin, mouse anti - glucagon (sigma, st louis, mo), rat anti - somatostatin (abcam, cambridge, ma), or rabbit anti - znt8 aa268 - 369 (9). secondary antibodies conjugated to alexa 488, 1-amino-1-methyl-3(4)-aminomethylcyclohexane, cyanine 5, and cyanine 3 fluorophores (jackson immunoresearch laboratories, west grove, pa) were applied for 60 min and sections mounted in glycerol - based media. images were acquired with an olympus 1x70 microscope equipped with a photometrics quantix cooled monochromatic ccd camera (kodak chip kaf1400). pancreatic microarray analyses were performed on wild - type and ngn3 mice at e12.5, e15.5, and e18.5. the majority of the endocrine fate allocations occur between e13.5 and e15.5, when ngn3 is maximally expressed (11,12) ; endocrine markers (insulin and glucagon) subsequently appear along with neuroendocrine markers, e.g., prohormone convertases and chromogranins. thus, comparison of e12.5 with e15.5 identifies transcripts that characterize precursor cells, responses to the activation of ngn3 expression, and the transition to the differentiated endocrine fate. at e12.5, 203 gene transcripts were downregulated > threefold in ngn3 versus wild - type littermates and, at e15.5, 54 (table 1 and supplementary tables 2 and 3, available in an online appendix at http://dx.doi.org/10.2337/db07-1126). fewer genes were upregulated : 53 at > threefold in e12.5 and 17 in e15.5 (data not shown). at e18.5, 645 transcripts were downregulated > 3-fold in ngn3 versus wild - type animals (supplementary table 4), 290 > 4-fold, and 35 > 10-fold. validation of select transcripts by qrtpcr demonstrated that glucagon (down 1,400-fold), insulin (down 400-fold), and znt8 (down 18-fold) were readily detectable in wild - type but not ngn3 animals with 40 cycles of pcr (data not shown). of the transcripts that were downregulated > fourfold, 46 mapped to transcripts highly expressed in adult islets (raw value > 2,000 including znt8) and 28 to transcripts moderately expressed (5002,000) (table 2). comparison of tc1.6- and tc3-cell transcripts identified 1,554 transcripts that were > 2-fold enriched in tc3 versus tc1.6 and 403 that were > 10-fold enriched (supplementary table 5). conversely, 1,202 transcripts were > 2-fold enriched in tc1.6- versus tc3-cell lines and 212 > 10-fold (supplementary table 6). of the genes downregulated > fivefold in the ngn3 mice, 74 were enriched in tc - cells and 108 in tc - cell lines (supplementary tables 7 and 8). another 1,396 transcripts were expressed in both tc- and tc - cell lines and 774 not detected. f) showed that insulin transcripts were enriched in adult islets versus tc- and not expressed in tc- or mpac - cell lines (fig. 1d). by microarray analysis, insulin expression in islets and -cell lines did not differ since signals were saturated (> 25,000 arbitrary units). glucagon transcript levels by qrtpcr were higher in islets than in tc - cells and present at a low level in tc3- and min6-cells but absent in mpac - cells (fig. 1e). by microarray analysis, the glucagon signals saturated in islets and tc - cells but otherwise showed the same trend of expression. znt8 transcript levels by qrtpcr were 4- to 5-fold higher in -cell lines than in tc1.6-cells and 50- to 100-fold higher than in ductal cells (fig. microarray analysis showed znt8 expression in islets and - and -cell lines but not in ductal cells. immunohistochemical localization of znt8 in wild - type adult pancreas showed its expression in the majority of islet cells and absence in acinar and ductal tissue. it was principally colocalized with insulin and also found in a subpopulation of somatostatin - positive cells. e18.5 ngn3 pancreas tissue did not show any znt8, insulin, glucagon, or somatostatin expression (data not shown). the loss of expression of genes in the pancreas of ngn3 mice provides a model to define the transcriptome of the endocrine pancreas and offers insight into the transcriptional and morphogenetic factors responsible for the patterning and differentiation of the endocrine lineage. genes responsive to paracrine signaling from endocrine cells adjacent to exocrine or ductal cells might also have been revealed, although there was little evidence of this. as previously observed (5), expression of the pancreatic islet hormones (insulin, glucagon, somatostatin, pancreatic polypeptide, and ghrelin) were markedly diminished alongside genes known to be expressed in islets but not in acinar tissue (iapp, chgra, chgrb, npy, pyy, pcsk1, pcsk2, and igrp / g6pc2). several candidate transcriptional regulators of islet cell lineage development were likewise absent (neurod, mafb, insm1, myt1, pax6, and isl1). at e12.5, there are a few endocrine cells that are immunoreactive to glucagon and occasional insulin and glucagon double - positive cells. during this phase, robo1 (dutt1 protein, orthologous to the drosophila roundabout) and an expressed sequence tag 9430047l24rik encoding unc5c homolog are the two most endocrine - enriched transcripts. robo1 encodes a molecule of the neural - cell adhesion molecule family that interacts with the extracellular ligand slit (1315) that has been implicated in migration of axons, myoblasts, and leukocytes in vertebrates and in lung development (16). at e15.5, four transcripts notably absent in ngn3 pancreas were myt1, crystallin 2, secretogogin ef - hand, and 4930568n03rik (genbank accession no. microarray data defining the pancreatic development kinetics from e12.5 to e18.5 (k. juhl, s. sarkar, j. jensen, j. hutton, unpublished data) suggest that myt1 is downstream of ngn3, as previously documented (3,17). the av323033 est cluster is a component of the unigene identification mm.209896, which represents nucleolar protein four (nol4), which is expressed in libraries from brain, eye, thymus, pancreas, endocrine, spinal cord, and male genitalia. at e18.5, genes notably absent in ngn3 pancreas included mafb, nkx6.1, wbscr14, nnat, syt13, and pcsk1n genes that function in mature islet cells as transcription factors (mafb, nkx6.1, and wbscr14) (18) or in stimulus secretion coupling. some transcripts downregulated at this point, however, are expressed at earlier times in wild - type and ngn3 pancreas, notably pitx2, ramp2, hmgn3, and gtpbp4-pending, indicating that their cell specification is changing. ramp2, for example, is a chaperone for the calcitonin receptor - like receptor that mediates adrenomedullin action on growth and differentiation where strong mesenchymal - epithelial interactions take place (19). comparison of tc and tc expression data with the list of 2,352 genes that were downregulated at any age in ngn3 mice revealed 74 -cell candidates including glucagon, arx, brn4, spp1, irx2, rbp4, mafb, car2, tfpi, vegfc, and fev - pending and 108 -cell candidates including ins1&2, iapp, neuronatin, pdx1, g6pcrs, npy, prcad, sepp1, sytl4, hpca, and atp2a3. genes that were expressed in both cell types included genes classifed as neuroendocrine (chgra and -b, scgn2 and -3, scgn, cpe, and pcsk1 and -2) and transcription factors active in multiple pancreatic endocrine cells (pax6, isl1, neurod1, and nkx2.2). in all, the ngn3 model did a remarkably good job of predicting endocrine - specific and neuroendocrine genes, especially given that it reports on 5% of the pancreatic tissue. at the time of the secondary transition, ngn3-downregulated transcripts are likely to reflect specific transcripts of the immediate precursors of endocrine cells and thus overlap with profiles derived from fluorescence - activated cell sorter sorted ngn3enhanced green fluorescent protein cells (supplementary tables 9 and 10) (3,20,21). twenty - nine of the 190 transcripts of the mgu74av2 dataset of gu. (3) showed overlap including low - copy number transcription factors (mafb, arx, brn4, ngn3, neurod1, pax6, myt1, and zfp288). of the remaining 161 transcripts, 112 were expressed at e12.5 and e15.5 irrespective of ngn3 gene status, and four (gnao, gip, sgne1, and nkx2.2) were not found. the above microarray datasets can be downloaded from an open access web site : http://www.cbil.upenn.edu/rad/php/displaystudy.php?study_id=1330. while the current study focuses on embryological development of the pancreas, these datasets can potentially be analyzed in other ways to provide an understanding of islet function in health and disease. given the current interest in identifying biomarkers that could be used to isolate -cells and their precursors or to image islet mass, it was of interest to review how effective the selection criteria used here to ascertain -cell specificity would be in identifying a -cell marker of lower abundance. the example is the insulin granule zinc transporter znt8 (slc30a8), a type 1a diabetes autoantigen (9) and a gene associated with type 2 diabetes susceptibility (8). znt8 transcripts were decreased 18-fold in ngn3 mice pancreas at e18.5 (table 2), in tc3- and min6-cells, and to a lesser extent in tc - cells (fig. 1a and f) but not in a mouse pancreatic ductal cell line (mpac). immunofluorescence microscopy showed colocalization with insulin and with a minor islet cell population that coincides with the -cell. a lower level of expression in the -cell was indicated by qrtpcr and other studies (22) but could not be confirmed by immunohistochemistry. a similar strategy could apply the current datasets for the discovery of novel regulatory processes involved in islet metabolism, stimulus secretion coupling, gene transcription, and intracellular and intracellular signaling. | objective to document the transcriptome of the pancreatic islet during the early and late development of the mouse pancreas and highlight the qualitative and quantitative features of gene expression that contribute to the specification, growth, and differentiation of the major endocrine cell types. a further objective was to identify endocrine cell biomarkers, targets of diabetic autoimmunity, and regulatory pathways underlying islet responses to physiological and pathological stimuli.research design and methods mrna expression profiling was performed by microarray analysis of e12.518.5 embryonic pancreas from neurogenin 3 (ngn3)-null mice, a background that abrogates endocrine pancreatic differentiation. the intersection of this data with mrna expression in isolated adult pancreatic islets and pancreatic endocrine tumor cell lines was determined to compile lists of genes that are specifically expressed in endocrine cells.resultsthe data provided insight into the transcriptional and morphogenetic factors that may play major roles in patterning and differentiation of the endocrine lineage before and during the secondary transition of endocrine development, as well as genes that control the glucose responsiveness of the -cells and candidate diabetes autoantigens, such as insulin, ia-2 and slc30a8 (znt8). the results are presented as downloadable gene lists, available at https://www.cbil.upenn.edu/radquerier/php/displaystudy.php?study_id=1330, stratified by predictive scores of relative cell - type specificity.conclusionsthe deposited data provide a rich resource that can be used to address diverse questions related to islet developmental and cell biology and the pathogenesis of type 1 and 2 diabetes. |
cow s milk allergy is the most common food allergy in children. symptoms usually involve the skin and the gastrointestinal and respiratory tracts. gastrointestinal tract manifestations of cow s milk allergy are nonspecific, and are the only type that can be diagnosed in all age groups. here, we report a rare case of cow 's milk allergy in an infant with hypoalbuminemia and malnutrition. sami ulus maternity and children s health and diseases training and research hospital, ankara, turkey, in september 2013, for weakness and swelling of the legs that had endured for two days. laboratory data revealed albumin at 1.7 g / dl ; serum na, k, urea, creatinin, and alanine - aspartate aminotransferase levels were normal. anti - gliadin, anti - endomysium, and anti - tissue transglutaminase antibodies were negative. cow s milk allergy was diagnosed due to cow s milk - specific ige and skin prick test results. on rare occasions, cow s milk allergy presents with hypoalbuminemia. when diagnosis is delayed, this allergy may impair the growth and quality of life and may even be life - threatening. cow s milk allergy (cma) is the most common food allergy in infants and young children, with a prevalence of 2% - 3% in the general population. allergic reactions to cow s milk may be categorized as ige - mediated, non - ige - mediated, and mixed types (1, 2). in infancy, there is no definitive means of differentiating ige- and non - ige - mediated cma, owing to significantly overlapping presentations ; however, quick onset symptoms are almost always ige - mediated (1). symptoms and signs of cma usually involve the skin and the gastrointestinal and respiratory tracts. gastrointestinal tract manifestations of cma are nonspecific and the only type that can be diagnosed in all age groups (1). when diagnosis is delayed, the allergy may impair the growth and quality of life and even be life - threatening (3). rarely, cma may also present with hypoalbuminemia (4, 5). here, we report a rare case of cma in an infant with hypoalbuminemia and malnutrition. sami ulus maternity and children s health and diseases training and research hospital, ankara, turkey, in september 2013, after having suffered weakness and swelling of the legs for two days. she had diarrhea four times, and was vomiting three times daily, for two months. her stool was non - bloody and watery ; however, these complaints were resolved one week before hospital admission. milk formula and complementary feeding was started at six months of age, but the patient usually avoided this combination and ultimately vomited. the interval between intake of cow s milk and onset of symptoms could not be determined by her mother, whose prenatal, natal, and postnatal history was not significant ; neither was her family history. the patient was agitated and pale, with bilateral pretibial pitting (+ 2) edema. her weight was 7 kg (3% - 10% percentile) and her height was 66 cm (3% percentile). laboratory data revealed a white blood cell count of 10.000/mm, hemoglobin at 7.5 g / dl, mcv at 102 fl, platelets at 405 10/mm, and albumin at 1.7 g / dl. serum na, k, urea, creatinin, and alanine - aspartate aminotransferase levels were normal. her serum vitamin b12 level was < 45 pg / ml (200 - 1510 pg / ml), indicating severe vitamin b12 deficiency. the maternal hemoglobin level was 11 g / dl, mcv was 100 fl, and the maternal serum vitamin b12 level was 167 pg / ml. the patient s serum folic acid and ferritin levels were normal ; anti - gliadin, anti - endomysium, and anti - tissue transglutaminase antibodies were negative. serum iga, igm, and igg were normal, but ige concentration was 250 iu / ml (normal level is 0 - 15 iu / ml). there was no peripheral eosinophilia. ku / l (normal level : < 0.35 ku / l) and caseine - specific ige level was 0.35 the skin prick test for cow s milk protein was 4 5 mm (negative control 0 mm, positive control 6 7 mm) and positive (table 1). albumin was administered as an infusion twice and stopped when her serum albumin level reached 2.4 g / dl. treatment with intramuscular vitamin b12 was commenced, and normalization of her vitamin b12 (1320 pg / ml) was seen. she had difficulty in oral feeding, so a nasogastric tube was inserted for feeding and an amino - acid - based infant formula was started. the latter showed significant clinical improvement as her appetite and activity improved ; she gained 1500 grams of body weight over the following 20 days. after one month, the serum albumin reached a normal level (3.6 g / dl) spontaneously. an oral cow s milk challenge test was planned, but the patient did not attend the follow - up. gastrointestinal symptoms and signs of cma may be caused by inflammation, dysmotility, or a combination of both. the signs include dysphagia, vomiting, regurgitation, dyspepsia, early satiety, anorexia, diarrhea (with or without malabsorption or protein loss due to enteropathy), rectal bleeding, failure to thrive, abdominal pain, severe colic, and persistent constipation that is often accompanied by perianal abnormalities (1, 3). the state of inflammation may result in reduced bioavailability or an excessive loss of nutrients due to the increased intestinal permeability that causes poor growth in children with food allergies. serum hypoalbuminemia on admission and a rapid decrease in serum albumin levels during follow - up are important clinical presentations of cma. hwang. (4) described a number of children with enterocolitis caused by cow s milk, and reported that a failure to gain weight (< 10 g / day) and serum hypoalbuminemia (< 3.5 g / dl) upon admission are the highest indices of suspicion for cma. in addition, rapid reduction in the serum albumin level to < 3 g / dl, during follow - up or after admission, may be regarded as an important diagnostic clue (4). reported that 4 of their 29 cma patients had serum albumin of less than 2.5 g / dl. the nutritional status was normal in 38%, while first and second degrees of protein energy malnutrition were observed in 27.6% and 34.4% of patients, respectively (5). upon admission, our patient presented a mild degree of protein energy malnutrition and severe hypoalbuminemia caused by the clinical manifestation of edema. the most common causes of edema and hypoalbuminemia were ruled out as she had no loss of protein in urine and stool. any diagnosis of cma must be either confirmed or excluded through an allergen elimination and challenge procedure. specific ige and skin prick testing alone, although helpful in identifying patients who are more likely to have an immediate reaction to cow s milk protein, and those with a delayed reaction who are more likely to remain intolerant for a longer period, can not diagnose all cases of cma. the cutoff values for positivity of skin prick test results and sige determinations, as reported in most studies in the literature, are a wheal diameter greater than 3 mm and a ku / l sige level greater than 0.35, respectively (1). our patient was diagnosed with ige - mediated cma from her sige and skin prick test results. an oral cow s milk challenge test was planned, but the patient did not attend the follow - up. as soon as the diagnosis was made, she started being fed with amino - acid - based infant formula and breast milk was not stopped, as the mother s diet was reconfigured as a cow s milk proteins - free diet. there was a significant clinical improvement in the patient after a period of one month, and an encouraging decrease in hypoalbuminemia was seen. as mentioned above, an oral cow s milk challenge test was planned, but the patient did not attend. in our country, b12 deficiency has been found in nearly 50% - 70% of pregnant women and 40% of newborn babies (7). the long - term prognosis for the majority of affected infants is generally good, with 80% - 90% naturally acquiring tolerance to cow milk proteins by the age of five. however, recent studies suggest that the natural history of cma is changing, with an increasing persistence until later in life and increasing severity of illness (2). a multidisciplinary follow - up was recommended to our patient at pediatric allergy and pediatric nutrition units for three - month periods. cma should be kept in mind as a cause, although it is unclear whether in this case hypoalbuminemia is the result of persistent vomiting or a diet with low protein content. | introductioncow s milk allergy is the most common food allergy in children. symptoms usually involve the skin and the gastrointestinal and respiratory tracts. gastrointestinal tract manifestations of cow s milk allergy are nonspecific, and are the only type that can be diagnosed in all age groups. here, we report a rare case of cow 's milk allergy in an infant with hypoalbuminemia and malnutrition.case presentationa nine - month - old girl was admitted to dr. sami ulus maternity and children s health and diseases training and research hospital, ankara, turkey, in september 2013, for weakness and swelling of the legs that had endured for two days. she had bilateral pretibial pitting (+ 2) edema. laboratory data revealed albumin at 1.7 g / dl ; serum na, k, urea, creatinin, and alanine - aspartate aminotransferase levels were normal. her urinary analysis did not reveal proteinuria. stool samples were normal, and stool steatocrite was negative. anti - gliadin, anti - endomysium, and anti - tissue transglutaminase antibodies were negative. cow s milk allergy was diagnosed due to cow s milk - specific ige and skin prick test results.conclusionson rare occasions, cow s milk allergy presents with hypoalbuminemia. when diagnosis is delayed, this allergy may impair the growth and quality of life and may even be life - threatening. |
unsaturated amine borane complexes have been known for many years to be isolable molecules that easily survive exposure to the air at room temperature.(1) this stability can be attributed to the strength of the bond between nitrogen and boron in the lewis acidlewis base complex and is consistent with prior reports that demonstrate conversion of alkenylamine boranes into isomeric hydroboration products upon heating (eq).(1b) like other simple hydroborations,(2) this process likely involves reversible dissociation to borane and the free lewis base ligand (i.e., the amine), followed by a conventional intermolecular hydroboration and subsequent internal nb bond formation to afford the cyclic borane complex 1. in related studies, thermally induced borane transfer has been demonstrated from a saturated amine borane to an unsaturated amine, as shown in eq using trimethylamine borane as the source of borane.(1c) formation of 2 requires cleavage of the nb bond at some stage prior to hydroboration and is most easily understood if this occurs by a simple dissociative event. also consistent is the well - known dissociation of amine boranes at similar temperatures in the absence of alkenes.(3) we could find no cases in the prior literature to suggest that unsaturated amine boranes are capable of hydroboration by an intramolecular mechanism that might occur below the temperature for nb dissociation. similar conclusions have been reached for the comparably stable unsaturated phosphines boranes.(4) these issues are relevant to the prospects for heteroatom - directed intramolecular hydroboration,(5) a problem in hydroboration chemistry that was recognized long ago.(6) prior to our work, the only well - defined examples of heteroatom direction via bonding interactions involving lewis basic electron pairs are in the transition metal catalyzed hydroborations.(7) these reactions are believed to take place via an om bonding interaction, and not an ob interaction. as part of a program designed to develop new methods for heteroatom - directed hydroboration, we have initiated a study of amine borane activation. a preliminary account of this work has appeared,(8) as well as a report describing the analogous activation of phosphine boranes.(9) we now describe the activation of unsaturated amine boranes in detail. according to the classical dissociative mechanism, hydroboration (hb) requires a trivalent borane to access the 4-center transition state. however, initial formation of an olefin borane -complex via sn2-like alkene bonding at the backside of the amine borane nb bond might also be considered, by analogy to the mechanism suggested for borane etherate hydroborations based on computational studies.(10) if such a pathway were to operate for unsaturated amine boranes 3, then a slow reaction would be expected for two reasons. first, the inherent stability of the nb bond works against any mechanism that requires nb bond cleavage, including an sn2-like pathway. second, and more important, the orbital requirements for internal nucleophilic attack are not satisfied in the case of 3 or related homoallylic and bis - homoallylic amine boranes because the potential nitrogen leaving group bond would be endocyclic with respect to the hypothetical cyclic transition state.(11) this means that there should be no rate advantage for hb via an internal sn2-like displacement process involving the c = c subunit of an unsaturated amine borane acting in the role of the nucleophile, as long as the amine nitrogen acts as the leaving group. the above analysis implies that 3 would have to react via a dissociative pathway, presumably via -complexes such as 4 or 5. these intermediates may well undergo further reaction with a preference for one of the two regioisomeric 4-center transition states due to electronic factors associated with the amine or amine borane subunits, but such effects are poorly understood and their role is difficult to anticipate. the goal of the present study was to determine whether a more predictable version of regiocontrolled hydroboration is feasible via amine borane intermediates where the nb bond remains intact. we began with the premise that an internal hydroboration may be possible starting from a stable amine borane of general structure 3 if a good exocyclic leaving group is introduced at boron, as in the iodoborane complex 6 (scheme 1). we could imagine a dissociative sn1-like mechanism via an ion pair 7, or an sn2-like internal nucleophilic substitution process via the bonding interactions shown for 8. in either event, the initial result would be the formation of a tethered olefin -complex ion pair 9. bond reorganization via the fused bicyclic 4-center transition state 10 with subsequent ion pair recombination would then afford 11. competition by a bridged bicyclic transition state 12 to give the regioisomeric product 13 is also conceivable, but this was expected to be the minor pathway. to test the above premise, a series of homoallylic amines were prepared, usually from the alcohols 14 by aminolysis of the tosylates 15 (scheme 2). amines 16, 18, and 20 were then easily converted into the isolable amine boranes 17, 19, and 21 by treatment with thfbh3. similar conventional methods were used to prepare homologous alkenylamine boranes 25, 27, and 31, 33. after a preliminary survey of common electrophiles iodination of amine boranes is fast, easy to do, and has a long history.(12) according to the stoichiometry, molecular iodine is fully utilized in conversion of 3 to 6. apparently, the initially formed byproduct hi reacts with 3 to generate a second equivalent of the iodoborane complex 6, together with hydrogen gas. when the iodine activation method was applied to homoallylic amine boranes, hb occurred at room temperature on a time scale of hours according to product assay after standard oxidative workup with alkaline hydrogen peroxide. however, initial attempts to characterize the presumed intermediates 6 or the initial products 11 and 13 using nmr methods were not informative. numerous signals were observed in the crude h nmr spectrum prior to oxidative workup, as would be expected from the presence of diastereomers involving stereogenic boron as well as regioisomers, but the sheer complexity of the spectrum suggested the presence of additional unknown species. thus, structures 6, 11, and 13 were tentatively drawn based on stoichiometry and product assay after oxidative workup. as shown in table 1, activation with 50 mol% i2 in ch2cl2 converts a broad range of unsaturated amines into amino alcohols. good to excellent regiocontrol was observed in the representative case of e-19b (entry 5 ; 13:1 36b:37b) as well as a number of other examples (entries 2, 6, 8, 12, 15, 18), leaving little doubt that an internally directed hb had been achieved. somewhat improved 18:1 selectivity for 36b:37b was obtained in the iodine experiments when e-19b was recrystallized prior to activation (entry 6), but the 13:1 ratio using e-19b partially purified by simple plug filtration over silica gel (entry 5) has been retained in table 1 to allow better comparisons with other entries where the amine borane substrate could not be crystallized. conditions, 50 mol% i2/dcm, rt ; yields refer to aminoalcohols isolated by chromatogaphy as a mixture of regioisomers after workup with naooh. the iodine activation of crystallized e-19b was conducted at two different concentrations. however, the ratio of regioisomeric aminoalcohols obtained with 0.1 or 1.0 m solutions of the purified substrate was identical (18:1 36b:37b), suggesting an intramolecular pathway. additional evidence was provided by a control experiment where e-19b was treated with excess borane in thf (2 equiv). this gave a much lower ratio of 36b:37b (2.4:1) as expected for conventional intermolecular hb. finally, e-19b was activated in the usual way, but in the presence of added -methylstyrene (2 equiv) as a potential trap for dissociated borane species or other species capable of intermolecular hb. after oxidative workup, this experiment gave conversion of e-19b to 36b:37b as usual, along with recovered -methylstyrene. only traces of the alcohol products derived from -methylstyrene were detected (20:1 36b:37b selectivity for the iodine - induced hydroboration of z-19b. the role of olefin geometry was more pronounced for the bis - homoallylic amine boranes, especially for the n - benzyl derivatives (entries 18 vs 17). however, the relatively modest selectivities for some, but not all of the e - alkenylamine boranes indicate that the directing effect arises from a combination of factors. in this light, it was no surprise to find that the directing effect is not sufficient to overwhelm other factors that contribute to hb regioselectivity. for example, terminal alkenes reacted with low selectivity (entries 1, 4, 13, 16), as did a phenyl - substituted substrate (entry 10). in the latter example, the result can be understood by comparing the product ratio with that expected from the standard (intermolecular) hb selectivity for -methyl - styrene, 86:14 in favor of the benzylic alcohol after oxidative workup.(14) for the amine - directed hb reaction (entry 11), the benzylic alcohol is the minor product (1:3 ratio). the alkenyl pyrrolidine borane z-21c was relatively well behaved, and conversion of the alkene occurred within 5 h at rt, although the amino alcohol 38c was not recovered cleanly due to competing formation of the n - oxide during oxidative workup. in contrast, the dibenzylated analog of amine borane e-19b (r, r = bn) gave low conversion under the standard conditions, and unreacted amine was recovered together with the regioisomeric amino alcohols (1.0:3.5:1.5 ratio). deuterium labeling experiments were utilized to probe the amine - directed hydroborations in greater detail. labeled e-19d(d3) was prepared by the addition of the parent amine to thfbd3 (generated in situ from nabd4 + iodine).(15) an equivalent of e-19b was then added to e-19d(d3) and the mixture was activated with iodine as usual. after oxidative workup, the resulting amino alcohol products were analyzed for the presence of deuterium. within limits of detection by esms and h nmr, neither 36b nor 37b contained deuterium that might be traced to intermolecular crossover or disproportionation events involving e-19d(d3). furthermore, h nmr integration revealed the presence of 36d(d1) and 37d(d1), the expected products of intramolecular deuteroboration. the control experiment using e-19d(d3) as the only substrate in the iodine activation gave identical spectral data for the signals assigned to 36d(d1) and 37d(d1). these results rule out a significant (> 5%) role for retro - hydroboration and deuteroboration pathways that would be expected to produce 36d(d2) and 37d(d2) by h / d scrambling. therefore, the reaction of e-19d(d3) with iodine involves a kinetically controlled, intramolecular hydroboration. an experiment was carried out with substrate e-17b to learn whether a catalytic amount of iodine would be sufficient for conversion of the amine borane (table 1, entry 3) to hydroboration products (scheme 3). treatment with 10 mol% iodine resulted in a somewhat slower conversion of the substrate compared to the experiment using 50 mol% iodine (2 h vs 0.3 h at rt), but oxidative workup gave the amino alcohol 34b as the dominant product with nearly the same yield and excellent selectivity (table 1, entry 4 vs entry 3). this observation indicates that the initially formed hydroboration product 49 can react with the substrate e-17b by reversible hydride - iodide exchange, a process that would regenerate the activated 48 as well as the cyclic amine borane 50. the experiment was therefore repeated without oxidative workup, and formation of 50 was confirmed by isolation after chromatography (41% yield). initial attempts to oxidize the reaction mixture from hydroboration led to variable product recovery and a 7:1 ratio of amino alcohols 36b and 37b. the problem was traced to lower reactivity in the oxidative cleavage step for the presumed cyclic amine borane intermediates 53 and 54, structures that are relatively stable compared to the precursor iodoboranes 51 and 52 that accumulate under conditions of stoichiometric activation. improved reactivity in the oxidative cleavage was achieved by the addition of 40 mol% of iodine to the product mixture obtained from catalytic hydroboration to force the conversion of 53 and 54 back to 51 and 52. this gave a 10:1 ratio of amino alcohol products e-36b : e-37b (79% yield). of course, reactivation by adding iodine negates any practical advantage for catalytic activation in the hydroboration step for this case. no further attempt was made to characterize the mixture of regioisomers and epimers 53 and 54 or to identify the factors responsible for the diminished 10:1 regioselectivity compared to the stoichiometric activation method. iodine activation was explored in substrates 55 and 56, structures where complications due to regioisomer or epimer formation were not expected (scheme 4). stoichiometric activation of 55 gave no hydroboration products at rt, consistent with the pattern of slower reactions for the tertiary amine boranes as noted earlier. however, the analogous primary amine borane 56 behaved normally using either 50 mol% or 10 mol% iodine at rt. in the stoichiometric reaction, oxidative workup afforded the amino alcohol 60, but purification was easier after benzoylation to give the bis - benzoyl derivative 61. the latter structure provided an opportunity to determine whether the stereochemistry corresponds to the typical syn delivery of boron and hydride to the olefin via a 4-center hydroboration pathway. this was confirmed by the diaxial trans relationship for ha and hb in 61, assigned from the vicinal coupling constant (j = 9.5 hz). the catalytic activation method using 10 mol% iodine at rt also worked well with 56. complete consumption of olefin required less than two hours and cyclic amine borane 59 was isolated from the mixture in 46% yield after chromatography. under these reaction conditions, propagation of the catalytic cycle likely occurs by reversible transfer of iodine from 58 to 56 to regenerate the activated iodoborane complex 57. the catalytic hydroboration could also be initiated by the addition of 10 mol% of et3n bh2i to 56, as expected according to the proposed catalytic cycle via reversible h / i exchange. the cyclic amine borane 59 could be oxidized with naooh to the amino alcohol 60 in 87% yield without further activation, provided that the oxidation was allowed to proceed for > 8 h at rt. the stereochemistry of 60 obtained using the catalytic iodine method was confirmed by conversion to 61. as an additional probe of the stereochemical consequences of internal hydroboration, the bis - homoallylic amine borane 62 (obtained as a mixture of inseparable n - epimers) hydroboration was sluggish compared to the substrates of table 1 (24 h for complete alkene consumption), but warming to 45 c gave conversion within 45 h. oxidation with naooh then afforded 1,3- and 1,4-amino alcohols 63 and 65 as major products in a 10:3 ratio. the syn stereochemistry obtained for each of these compounds is consistent with an internal mechanism. none of the 1,3-trans isomer 64 was found and only a small amount of 66 was detected, presumably resulting from some form of intermolecular hydroboration due to the higher temperature. the major product 63 was identified by comparison with the mixture of isomers 63 + 64 obtained by lah reduction from ketone 67.(16) in contrast to the iodine - promoted reaction, intermolecular hydroboration of 62 using excess thfbh3 gave a nearly equal mixture of all four possible isomers 6366 by nmr assay. having shown that homoallylic and bis - homoallylic amine boranes undergo intramolecular hydroboration upon treatment with iodine, we turned to the allylic amine analogues to learn whether an amine - directed hb pathway would be possible with the shorter tether (scheme 6). the expected amino alcohol products did form in some examples using iodine activation and oxidative workup, but reproducibility was poor. this was surprising because the iodine activation of homoallylic amine boranes had consistently afforded hb products even though minimal precautions were taken to exclude air or moisture. by comparison, the allylic amine borane activations required carefully optimized inert atmosphere conditions to achieve substantial conversion. despite these precautions, iodine activation of crotylamine borane 68a rarely gave better than 50% yield of amino alcohols 69a and 70a (57:1 ratio), and some experiments gave no amino alcohol products at all. furthermore, several tries with the secondary n - benzylcrotylamine borane 68b afforded no hydroboration products upon treatment with 50 mol% of iodine at rt. heating the reaction mixture at 45 c did give partial conversion on a time scale of hours (6:1 ratio of 69b:70b along with ca. 20% recovered n - benzylcrotylamine), but iodine activation of the tertiary substrate 68 (r = r = bn) gave no hydroboration regardless of temperature. thus, treatment of 68a or 68b with excess thfbh3 followed by naooh gave improved ratios of 69:70 after 2 h at 0 c (a, 9:1 ; b, 1013:1) compared to the iodine activation experiments. further tests were conducted using the cyclic allylic amine boranes 71a, b to determine whether the stereochemistry of hb products would correspond to an internal hydroboration pathway (scheme 7). however, 71a gave 1,2-trans amino alcohol 72a as the major product (3:1 72:73 ; iodine activation at rt over 45 h, followed by oxidative workup) while 71b gave no amino alcohols at room temperature. formation of the trans isomer 72 suggests competition by an intermolecular mechanism, so the experiment was repeated in the presence of 1 equiv of -methylstyrene in an attempt to shut down intermolecular pathways. this experiment should favor 73, the presumed product of the nitrogen - directed intramolecular pathway, but the major amino alcohol was the same trans - isomer 72 (2:1 72:73) although the product ratio was lower. alcohols 74 and 75 were also obtained from this experiment, providing clear evidence for competing intermolecular hb. when iodine activation of 71a was performed in the presence of 3 equiv of -methylstyrene, alcohols 74 and 75 were the exclusive products (6.5:1 ratio). this ratio is similar to the result from reaction of -methylstyrene with thfbh3 (74:75 = 5.7:1). the above experiments show that intermolecular hb pathways are not only accessible, but potentially dominant in the reaction of 71a under the conditions of iodine activation, in contrast to the behavior of homoallylic amine boranes. similar reactivity trends were found in a comparison of amine boranes 76a and 76b, although conversion to hydroboration products was slower (scheme 8). hb did occur if the resulting mixture was heated at 4550 c (2 h), resulting in the amino alcohol 78a (74%) after oxidative workup along with ca. the corresponding sequence starting with 76b gave at most 10% of 78b, and ca. 90% of the material was recovered as the unreacted n - benzylcyclohexenylmethylamine. in an attempt to understand the puzzling reactivity and reproducibility trends, the crude product after iodine activation of 76a was examined at rt using h nmr spectroscopy. the olefinic signal of the starting complex 76a (ca. 5.65 ppm) was replaced by two new signals at ca. 5.85 ppm and 6.0 ppm together with several minor maxima. the major signal at 6.0 ppm, along with a broad absorption at ca. 7.57.8 ppm and a broad singlet at 3.6 ppm, were identified by comparison with the corresponding signals of cyclohexenylmethylammonium iodide 79. evidence regarding the new signal at 5.85 ppm is less conclusive, but this absorption was enhanced by addition of free cyclohexenylmethylamine to freshly activated 76a, presumably containing 77a. this suggests a boronium salt structure 80 as the species responsible for the 5.85 ppm signal, but 80 could not be isolated to confirm this assignment. furthermore, the presence of 77a after iodine addition could not be established due to the complexity of the b nmr spectrum. the most important observation from the above study is that formation of the ammonium salt 79 is a major pathway resulting from iodine activation of 76a. we do not have detailed evidence regarding how 79 is formed, although the hi generated in the first stage of iodine activation would have to be the principal suspect. direct protonation of the nb bond via a three - center two - electron interaction is one possibility, and another is dissociation of the amine - bh2i complex followed by protonation at nitrogen. in either case, the results would indicate a weaker nb bond for the allylic amine boranes compared to the homoallylic or bis - homoallylic amine complexes. this is consistent with the electron - withdrawing inductive effect of the olefinic sp carbon, a factor that is responsible for the lower pka (by ca. 1 pka unit) of ammonium salts derived from allylic amines compared to their saturated amine analogues.(17) the same inductive effect should lower the stability of allylic amine boranes, and could be the reason why allylic amine nitrogen becomes partially protonated during iodine activation. in any case, n - protonation requires that one or more trivalent boron species (presumably, bh3 or bh2i) would have to be released as the nb bond is cleaved. this would explain why the allylic amine borane reactions are highly sensitive to experimental variables, why the products are mostly those expected from an intermolecular hydroboration, and why some of our experiments with the allylic amines gave no hydroboration products even though the reactions were conducted under nitrogen. dichloromethane is not an ideal solvent for hydroborations because the borane - solvent complex is labile, at least compared to thfbh3, and is easily destroyed by contaminants. given the insights obtained from the study of 76a, we reexamined the reactions of the crotylamine borane 68a. immediately upon addition of iodine (ca. 5 mol%) to 68a, a broad singlet appeared at 7.35 ppm that shifted to 7.55 ppm as more iodine (50 mol% total) was added. over the same time scale, the broad signal due to the complexed nh2 protons shifted from ca. new olefinic signals also appeared, and basic oxidative workup returned unreacted crotylamine, as would be expected assuming that crotylammonium iodide is formed during activation. if sufficient care was taken to maintain inert conditions, the amino alcohols 69a and 70a were also recovered after oxidative workup (69% yield). however, we could not extract meaningful structural evidence regarding the hydroboration products prior to oxidative workup from the complex h or b nmr spectra. in response to reviewer comments, one more series of nmr experiments was initiated in an attempt to obtain more evidence regarding the activated borane intermediates using simple model amine boranes as well as the well - behaved, primary homoallylic amine - derived borane e-17b. the latter substrate affords the best overall combination of regioselectivity (43:1) and product yield (> 80%) in amine - directed hb, and has the simplest structure. nevertheless, the h nmr spectrum after activation using 50 mol% iodine (0 c to rt, 40 min) could not be interpreted beyond noting a broad signal at 7.45 ppm (ca. 0.10.15 h) suggesting minor formation of ammonium salts, as well as six maxima between 3.1 to 3.6 ppm with extensive splitting and overlap in the expected ch2nh region. the b nmr spectrum showed several maxima between 6 and 25 ppm. in striking contrast, when the same substrate e-17b was treated with 5 mol% iodine (catalytic conditions), the b nmr spectrum was relatively clean and consisted of the signals for unreacted e-17b together with the cyclized product amine borane 50. evidently, the nmr complexity using 50 mol% iodine is due at least in part to the formation of nbi species, but control experiments with simple models (see below) suggest that the presence of nh bonds in the substrate e-17b is the main problem. as already reported in the early literature, amine boranes lacking nh bonds react cleanly with iodine. for example, treatment of the tertiary amine borane me3nbh3 with iodine affords the iodoborane complex me3nbh2i as a single species.(18a) we also observe a single well - resolved nmr signal with the expected triplet coupling (b = 9.3 ppm, t, j = 131 hz). on the other hand, reaction of the known primary amine borane nbunh2bh3(18b) with 50 mol% iodine in chloroform produces multiple b maxima. minor signals observed at 18.1 ppm (diborane by chemical shift comparisons)(19) and 23 ppm (nbh2x, br t, jbh = ca. 135 hz) were relatively sharp, but accounted for less than 4% of total signal intensity. two major peaks (7 and 17 ppm) were also observed, but these resonances were broad and featureless, and could not be assigned with certainty, although the chemical shifts are near the range reported for dimeric hydrogen bridged amine boranes (4 to 11 ppm) that might be formed via elimination of hi from nbunh2bh2i, followed by 2 + 2 combination of the transient monomer [nbunhbh2].(20) although definitive structural evidence was not obtained despite considerable effort, the nmr studies do show that complexity is inherent in the iodine activation of amine boranes that contain nh bonds, such as the primary amine borane e-17b. despite this complexity, the amine - directed hydroborations proceed with good to excellent regioselectivity and conversion in a number of cases. because multiple species are present in solutions containing the iodine - activated intermediates, the isolation of internal hydroboration products in good yields supports the notion that the unidentified activated intermediates are formed reversibly. according to this interpretation, the byproducts of iodine activation undergo interconversion with iodoborane complexes such as 6, and internal hb eventually drives the equilibrium to cyclic amine boranes. | iodine activation induces intramolecular hydroboration of homoallylic and bis - homoallylic amine boranes with good to excellent control of regiochemistry compared to control experiments using excess thfbh3. deuterium labeling and other evidence confirm that the iodine - induced hydroboration reaction of homoallylic amine boranes occurs via an intramolecular mechanism equivalent to the classical 4-center process and without competing retro - hydroboration. longer carbon chain tethers result in lower regioselectivity, whereas the shorter tether in allylic amines results in a switch to dominant intermolecular hydroboration. regioselectivity in thfbh3 control experiments is higher for the allylic amine boranes compared to the iodine activation experiments, whereas the reverse is true for homoallylic amine borane activation. |
boletus griseipurpureus (boletaceae) is a wild edible ectomycorrhizal mushroom, rich in protein and low in fat (1). an analysis of the internal transcribed spacer (its) region for b. griseipurpureus from the south of thailand revealed a monophylogenetic clade (1). however, only its sequences can not indicate the differences among its populations at the subspecies level. the second largest subunit of rna polymerase ii (rpb2) is more variable and more informative than the its region (3) and has been used to constitute phylogenetic trees of genera, such as cortinarius and to resolve the species concepts in strobilomyces (4). therefore, this marker has the potential to discriminate the subspecies (3) and thus it was chosen in this study. mushroom extracts are generally used in dietary supplements and in combination with herbs (5) for their potential health benefits. ethanolic extracts of pleurotus and russula inhibited both the gram - positive and the gram - negative bacteria (7). for this reason, this study aimed to identify the genetic variation of b. griseipurpureus and also to evaluate any antibacterial activities. basidiomes were collected under acacia magium in surat thani and songkhla provinces and under eucalypts in roi et and ubon ratchathani provinces, in thailand. basidiomes were assigned to the b. griseipurpureus corner taxon on the basis of the morphological features (2). similar to another study (1), amplification was performed in a 50 l reaction mixture, frpb2 - 5f (fungal rpb2 - 5forward) and brpb2 7.1r (basidiomycete rpb2 7.1 reward) (biodesign, thailand) used as primers. sequences were then edited using bioedit and mega (molecular evolutionary genetics analysis) (version 5.05) was applied to analyze the aligned sequences carried out by the clustal w analysis. bootstrapping was performed with 1000 replicates of the neighbor - joining (nj) analyses using 1000 replicates. basidiomes were dried at 40c for 16 hours before 70 g was blended and soaked in 500 ml of either methanol or ethyl acetate at room temperature for 1 week. the residue was re - extracted twice with 500 ml of the solvent, reduced to dryness, dissolved in the respective solvent to a concentration of 200 mg / ml and stored at 4c. the antibacterial activity against escherichia coli atcc 25922, staphylococcus aureus atcc 29523 and methicillin - resistant staphylococcus aureus (mrsa 189) inoculated as compared with mcfarland standard no. 0.5, was evaluated using the agar well diffusion method on mueller hinton agar (becton dickinson and company, france). the extracts (80 l) were placed in 6 mm wells ; the plates in triplicate were incubated at 37 + 2c for 24 hours and the diameter of inhibition zones was determined. the best extract was determined by the minimal inhibition concentration (mic) (9). similar to another study (1), amplification was performed in a 50 l reaction mixture, frpb2 - 5f (fungal rpb2 - 5forward) and brpb2 7.1r (basidiomycete rpb2 7.1 reward) (biodesign, thailand) used as primers. sequences were then edited using bioedit and mega (molecular evolutionary genetics analysis) (version 5.05) was applied to analyze the aligned sequences carried out by the clustal w analysis. bootstrapping was performed with 1000 replicates of the neighbor - joining (nj) analyses using 1000 replicates. basidiomes were dried at 40c for 16 hours before 70 g was blended and soaked in 500 ml of either methanol or ethyl acetate at room temperature for 1 week. the residue was re - extracted twice with 500 ml of the solvent, reduced to dryness, dissolved in the respective solvent to a concentration of 200 mg / ml and stored at 4c. the antibacterial activity against escherichia coli atcc 25922, staphylococcus aureus atcc 29523 and methicillin - resistant staphylococcus aureus (mrsa 189) inoculated as compared with mcfarland standard no. 0.5, was evaluated using the agar well diffusion method on mueller hinton agar (becton dickinson and company, france). the extracts (80 l) were placed in 6 mm wells ; the plates in triplicate were incubated at 37 + 2c for 24 hours and the diameter of inhibition zones was determined. the best extract was determined by the minimal inhibition concentration (mic) (9). the polymerase chain reaction (pcr) products from the amplified rdna were 1,100 bp in size on 1.5% agarose gels. the rdna rpb2 regions were cloned and the nucleotide sequences were used to constitute a phylogenetic tree (figure 1) together with 13 genbank sequences. b. griseipurpureus from ubon ratchathani and roi et had a greater sequence identity than that from the southern provinces of thailand (surat thani and songkhla). overall, the b. griseipurpureus sequences were closely related to the b. edulis and b. satanus sequence data in genbank. the basidiome crude extracts showed a significant antagonistic effect against the growth of the gram - positive and gram - negative bacteria (p < 0.05) and the crude methanol extract exhibited a stronger antibacterial activity than the crude ethyl acetate extract (p < 0.01, table 1). the mic of the crude methanol extract was 31 b. griseipurpureus corner from ubon ratchathani = bg ubon ratchathani (kc887325), b. griseipurpureus from roi et = bg roi et (kc887326), b. griseipurpureus from surat thani = bg surat thani (kc887327), b. griseipurpureus from songkhla = bg songkhla (kc887328). data are presented as mean sd. values are not different by duncan s multiple range test (p < 0.05). the sequences which contained the rpb2 region suggest a monophylogenetic clade among basidiomes of b. griseipurpureus and the phylogenetic tree suggests that b. griseipurpureus has affinity in the boletus group. these findings are in contrast with the its results that showed b. griseipurpureus was more closely related to tylopilus than the boletus group (1). in the future, the rpb2 region should be analyzed in parallel with other molecular markers for the phylogenetic study such as lsu, atp6, rpb1, nuc - lsu and mtssu sequences in order to better define the taxa boundaries (3, 4, 10, 11). this will require a more extensive collection of b. griseipurpureus in the region than what was possible in this study. lastly, the antimicrobial activities of the basidiome extracts suggest that this edible species may have attributes other than food nutrients. as for the extracts of daedalea elegans, the methanol extracts had a greater biological activity (5). a crude methanol extract from auricularia polytrica was able to inhibit both s. aureus and e. coli (9). the crude methanol extracts of tylopilus neofelleus basidiomes were active against the gram - positive but were inactive for the gram - negative bacteria (12). however, a crude ethanol extract of russula delica was more effective in inhibiting the growth of the gram - positive than the gram - negative bacteria (13). the higher activities of the crude methanol extracts are in concordance with a previous study with strobilomyces (14). for this study, the crude methanol extract of b. griseipurpureus displayed a stronger antibacterial activity than the crude ethyl acetate extract. the minimal inhibition concentration of the crude methanolic extract from the basidiocarp of this species (31 g / l) was high, compared to the extracts from tricholoma lobayensis (9). moreover, the basidocarp extracts also available in some plant extracts, such as the crude ethanolic extract of zataria multiflora was able to inhibit 75 strains of mrsa at the concentration 2 - 16 mg / l. the replacement of antibacterial agents with extracts of medicinal mushrooms and herbs may overcome bacterial activities (5, 9, 12 - 16). b. griseipurpureus might be applied in dietary supplements in combination with herbs (5) and bioactive compounds for potential health benefits. a further study of this species will help enhance its values and widen its cultivation opportunities. | background : boletus griseipurpureus corner, an edible mushroom, is a putative ectomycorrhizal fungus. currently, the taxonomic boundary of this mushroom is unclear and its bitter taste makes it interesting for evaluating its antibacterial properties.objectives:the purpose of this study was to identify the genetic variation of this mushroom and also to evaluate any antibacterial activities.materials and methods : basidiocarps were collected from 2 north - eastern provinces, roi et and ubon ratchathani, and from 2 southern provinces, songkhla and surat thani, in thailand. genomic dna was extracted and molecular structure was examined using the rna polymerase ii (rpb2) analysis. antibacterial activities of basidiocarp extracts were conducted with escherichia coli atcc 25922, staphylococcus aureus atcc 29523 and methicillin - resistant staphylococcus aureus (mrsa) 189 using the agar - well diffusion method.results:all the samples collected for this study constituted a monophyletic clade, which was closely related with the boletus group of polypore fungi. for the antibacterial study, it was found that the crude methanol extract of basidiomes inhibited the growth of all bacteria in vitro more than the crude ethyl acetate extract.conclusions:basidomes collected from four locations in thailand had low genetic variation and their extracts inhibited the growth of all tested bacteria. the health benefits of this edible species should be evaluated further. |
implantable cardioverter defibrillator (icd) implantation is performed at many centers in korea,1)2) however, icd lead extraction has not yet been reported. we report our experience of icd lead extraction using locking stylet and polypropylene dilator sheath in a patient with recurrent inappropriate shocks due to lead fracture. a 46-year - old man presented to our institution for evaluation of repeated, inappropriate, icd shocks. icd (single chamber, dual coils, vitruso dr d164awg, medtronic inc., minneapolis, mn, usa) was implanted for sustained monomorphic ventricular tachycardia associated with unstable hemodynamics and underlying systolic left ventricular dysfunction. the ejection fraction of 30% was recorded two years ago at another hospital. during icd implantation, ventricular fibrillation was induced by t - shock and successfully terminated by biphasic shock at 10 j. icd interrogation revealed 33 episodes of shock delivery due to noise sensing. however, a definite break point of icd lead was not detected on chest x - ray. icd therapy was switched off based on a clinical diagnosis of icd lead fracture, and the patient was transferred to our hospital. the icd lead (sprint quattro 6944, medtronic inc.) was tined, and the diameter of lead tip and shaft (comprising shock coil) was 2.7 mm. icd lead extraction was performed with support from the cardiac surgery team. following routine preparation for generator removal, the disconnected lead was tested again to exclude connection problem between icd lead and the generator, which showed high impedance over 2,500 ohms. lead extraction was performed after confirming icd lead fracture. a locking stylet (liberator locking stylet 016 - 032, cook vascular inc., vandergrift, pn, usa) was inserted into the central core of the icd lead to prevent lead disruption. a 12 fr (4 mm) polypropylene dilator sheath (byrd dilator sheath sets, cook vascular inc.) mild traction force was applied to the locking stylet to straighten the alignment of the icd lead and the dilating sheath. the dilator sheath was advanced with bidirectional (clockwise and counter - clockwise) rotation to dissect adhesive fibrous bands formed around the icd lead. when the dilator sheath was placed 1 - 2 cm below the tip of right ventricular (rv)-lead, the locking stylet was pulled gently with gradually increasing traction forces. the icd lead and dilator sheath were successfully removed without evidence of lead fragments remaining in the right ventricle (fig. there was no evidence of major complications, such as hemopericardium, hemothorax, and myocardial inversion. after confirming successful icd lead extraction, a new icd lead was inserted into right ventricle followed by skin closure. pacemaker or icd rv - lead extraction is a high risk procedure with a morbidity of 1.4 - 2.5%.3)4) fibrous tissues encapsulate implanted leads and cause adhesion to major veins, the right atrial or the ventricular wall.5) major complications such as hemopericardium, hemothorax and death occur during fibrous tissues dissection around the implanted leads.6) incomplete lead removal or procedure failure is another clinical problem that occurs in 7 - 13.2% of cases.3)4) if an infected lead is retained, the risk of treatment failure with antibiotics will be very high.7) even non - infected lead fragment may cause embolic complications.8)9) therefore, various extraction techniques have been tried to improve the success rate of complete lead removal. they include direct traction with rotational forces,10) traction with locking stylet,11) counter - traction with dilating sheath,3)4) femoral workstation,12) laser sheath,13) and electrosurgical sheath.14) traction and counter - traction using locking stylet and dilating sheath is a conventional technique for pacemaker and icd lead extraction. it has been proven to be effective and safe in clinical trials.3)4) although newly developed techniques such as electrosurgical or laser sheath are in clinical use, they have not been introduced in korea, and the conventional technique using locking stylet and dilator sheath is still useful if performed by experienced operators.14) the authors tried 25 pacemaker and one icd lead extractions associated with lead malfunction or infection since 2004. of the 26 cases, 24 cases were successfully managed with the conventional traction and counter - traction technique using locking stylet and dilator sheath. in the two failed attempts, the operators could not advance the dilator sheath to the icd lead tip due to severe fibrous adhesion at the subclavian vein and in the superior vena cava. of the 24 successful cases, open heart surgery was performed in one case due to cardiac tamponade following complete pacemaker ventricular lead extraction. icd lead extraction is known to have higher complication rate than pacemaker lead extraction.6) however, it can be removed successfully with the same techniques. to our knowledge, this is the first icd lead extraction case reported in korea. | a 46-year - old man presented to our institution with inappropriate implantable cardioverter - defibrillator (icd) shock delivery. the icd (single chamber, dual shock coils) was implanted for sustained monomorphic ventricular tachycardia with unstable hemodynamics and underlying systolic left ventricular dysfunction. icd interrogation revealed recurrent episodes of icd shock due to noise sensing and increased impedance of right ventricular - lead. with the impression of lead fracture, icd lead extraction was performed. the fractured icd lead was completely removed by traction of locking stylet and counter - traction of polypropylene dilator sheath. a new lead was inserted and the patient was discharged without complications after 2 days. to our knowledge, this is the first report on icd lead extraction by conventional traction and counter - traction technique in korea. |
project budburst (budburst.org) is a citizen - science program in which ordinary people including kids ten years old and up observe and upload information about bloom times and other life stages of plants (called phenophases) to a national database online. this site has been actively storing phenological information since 2007 and continues to be a source of information for scientists studying climate change. project budburst is an excellent project for students who want to do something positive for the environment, and it supports life - science performance expectations outlined in the next generation science standards (ngss). college students can benefit from the opportunity to practice scientific inquiry, do authentic research, reflect on efficacy, and contribute to a larger research project that has global implications. education students will be introduced to a program that supports the kind of hands - on investigations encouraged by the ngss. biology and science education professors are already introducing students to project budburst and its application to their course of study some examples can be found under the site s education tab, on the undergraduates page. there are many ways to apply this citizen - science project to a school curriculum. becoming a project budburst citizen scientist can help research scientists predict and manage environmental problems such as the spread of diseases, wildfire risk, invasive species, migration patterns, and other conditions that affect the environment. scientists do not have extensive data on phenological events and therefore need help gathering this information so that they can make more reliable predictions about natural events and potential catastrophes. in fact, the success of research on how plants are changing over a vast area and over a long time depends on the efforts of citizen scientists, who can cover more territory as a group than any individual scientist could. this is especially critical for understanding how interspecies relationships are being affected by large and small changes in their environments (2). data from project budburst are actually contributing to scientific research on the effects of climate change on living organisms. they have been used in peer - reviewed, published research including a study of predicting the timing of cherry tree blooming in washington, dc (1). there is no charge to become a member, and the site contains useful information about the plants, the project, why it is important, and how the data are being used. the observing plants tab at the top has a drop - down menu with plants to observe, where browsers will find an extensive list of plants to study. it includes flowering herbaceous plants like sunflower (helianthus annuus), virginia bluebell (mertensia virginica), and butterfly milkweed (asclepias tuberosa), as well as common trees like apple (malus pumila), red maple (acer rubrum), and eastern white pine (pinus strobus). recently, the common dandelion (taraxacum officinale) was added to the list of plants, making the program even simpler for younger students and other novices wanting to participate. watching dandelion is an excellent place to begin because dandelions are everywhere, they are easy to find, there is only one species so students will not confuse it with the wrong plant, and the phenophases are easier to confidently identify than many of the other plants on the list. the project budburst website defines a phenophase as a distinct event in the annual life cycle of a plant or animal in relation to changes in seasons and climate. phenophases for all wildflowers, including dandelions, are first flower, full flower, first fruit, full fruit, and all leaves withered. these phases can be easily distinguished on a dandelion because the plant produces a flower bud that turns from bud into fully opened, yellow blossom overnight. students who are watching the plant will have a definite date for first flower on their plant. there is no guess work in determining the date of the first ripe fruit, either this is when the fluffy white ball of seeds opens for the first time on the plant. when there are three or more fluff balls, the plant is in full fruiting stage. dandelions continue to flower and fruit into the fall, but their show is much less dramatic as the season progresses. it may be difficult to establish the all leaves withered date, but this date is less critical than those of the flowering and fruiting stages. it is worth noting that many students, even those of high school age, do not make the connection between the yellow dandelion flower and its white, wind - dispersed fruits, which contain the seeds. this citizen - science project makes students realize that these two plant events they have seen all their lives belong to the same plant and that all flowers make seeds. there are two kinds of reports that a citizen scientist may contribute : a single report for a one - time observation and a regular report for watching the plant over time. while observing a plant growing and changing over multiple seasons gives students a complete picture of the plant s life cycle, the single report is a good way to get started without being overwhelmed by the need to keep track of this plant for several months. these forms can be found under the observing plants tab at the top of the web page. for a dandelion, use the wildflower report. after gaining an understanding of what is required to do project budburst, the next step is to select a dandelion or other plant to study, preferably one growing in a protected area that is not likely to be mowed down or treated with weed killers. it is best to do this early in the spring before the plant has bloomed, but students can observe their plant any time during the year. student should take a gps reading of its location using a gps device or a cell phone with gps app. if they plan to watch the plant over the spring and summer, they should mark it with a stake or flag to ensure they return to the same individual plant each time. it has been observed that some students associate the word site with websites in cyberspace rather than a physical space. the form asks participants to give the area a site name, and so educators should be prepared to explain the meaning of the word in its physical sense and suggest that students call the site something like green family backyard or smart elementary school playground. this project presents an opportunity to explain how to read the numbers and symbols using the words the class can discuss why accurately identifying the location of the plant is important for this project. means, and they may need help determining the distance of their plant from paved areas. students can follow the directions on the website to learn more about their plant and how to record observations. after completing a single report, or at the end of the season, they can login to the website, upload their data, make a valuable contribution to science and climate change research, and call themselves bona fide citizen scientists. watching dandelions grow through their life cycle supports understanding of plant life cycles, which can be compared to life cycles of other organisms for a deeper understanding of life science. students of all ages and levels will find an extensive list of plants to study so that there is great potential to use the site for more sophisticated science projects while contributing to real research on global climate change. | project budburst is a national citizen - science project that tracks bloom times and other phenological data for plants across the country. data from project budburst are being used to measure the effects of climate change. students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. journal of microbiology & biology education |
a broad and heterogeneous group of syndromes may result from this process, since any type, size, and location of blood vessel may be involved. vasculitis and its consequences may be the primary or sole manifestation of a disease ; alternatively, vasculitis may be a secondary component of another primary disease like infection, malignancy and rheumatic disease. beside systemic vasculitis, non bacterial thrombotic endocarditis (nbte) could be a paraneoplastic manifestation of malignancy too. the cardiac conditions most commonly resulting in nbte are mitral regurgitation, aortic stenosis, aortic regurgitation, ventricular septal defects, and complex congenital heart disease. nbte also arises as a result of a hypercoagulable state ; this phenomenon gives rise to the clinical entity of marantic endocarditis (uninfected vegetations seen in patients with malignancy and chronic diseases) and to bland vegetations complicating systemic lupus erythematosus and the antiphospholipid antibody syndrome. the patient is 34 y / o man presented with episodic painless purple discoloration and linear ungual hemorrhage of fingers and toes, associated with paresthesia since a month ago. he also complained of 10 - 15 mins morning stiffness and 4 kg weight loss during previous month. he had a few episodes of vertigo and because of the following symptoms he went to neurologist. brain mri which was done (figure 1) and the patient was referred to rheumatologist for more evaluation. mri findings were : multiple hyper signal lesions in periventricular and subcortical with involvement of subcortical mfibers in parietal lobe, preserving basal gangelia, thalamus and corpus callosum, the possibility of demyelinating disease should be considered he had history of left eye amblyopia since childhood, lumbar disc herniation 10 years ago and unilateral varicocele surgery last year. he took no medications and he did not smoke or use illicit drugs. he was married and worked as a salesman. on examination, bp : 115/70, pr : 76/min, t : 37.2 oral, rr : 16/min. subungual hemorrhage was seen in nearly all fingers plus a purple patch on the left sole. tte was done before admission and was normal. a complete blood count and results of liver function tests serum creatinin level was 1.6mg / dl and urine analysis revealed proteinuria and hematuria (table 1). under the clinical suspicion of systemic vasculitis, methylprednisolone and cyclophosphamide chest ct scan was done and right sided pleural effusion with multiple small nodules in right lung parenchyma was seen (figure 2). pleural fluid analysis was exudative (table 2), so imipenem and ciprofloxacin were started and because of the possibility of underlying malignancy, cytologic analysis of pleural fluid was requested. chest computed tomography showed right side pleural effusion pleural fluid analysis on the fourth day of admission, he suddenly experiences a very severe right flank pain. u / a and cbc revealed hematuria and leukocytosis (wbc=17500) and abdominopelvic ct scan findings were infracted zones in both kidneys, suggestive for systemic vasculitis or embolic process (figure 3). abdominopelvic computed tomography showed hypo dense areas suggestive for kidney infarction transthorasic echocardiography was repeated and this time a large size mass (12 5 mm) was seen on aortic valve that was suggestive for vegetation, so antibiotics were changed to cefazoline, ampicillin and gentamycin. during the next days hemoglobin level dropped to 11.3gr / dl and due to thrombocytopenia and abnormal coagulation tests and fragmented rbcs in peripheral blood smear, subclinical dic was suggested and ffp and packed cell were transfused and renal biopsy was canceled. two days later right hemi paresis was evolved and on examination right hemiparesia without any sphinctral dysfunction or sensory abnormality was detected. this time brain mri revealed evidence of one hyper signal lesion in left hemisphere of cerebellum (figure 4). brain mri showed a hyper signal lesion in left hemisphere of cerebellum transesophageal echocardiography confirmed aortic vegetation on rcc (7 5 mm). on suspicion of underlying malignancy, whole body bone scan was done and findings were increased uptake in posterior ribs and spine, suggestive for metastasis. result of cytologic examination on pleural fluid revealed severe mesothelial hyperplasia with cytologic atypia and ihc report was suggestive for adenocarcinoma with suspected origin of upper gi, pancreas or testis and lung and colon were low likely (negative for ttf 1 and positive for ck 7). at first, patient was candidate for vats (video assisted thoracic surgery) but due to ihc report and patient unwillingness, vats was canceled and searching for other sources of metastasis was started. during the admission, because of worsened dyspnea and orthopnea and exudative pleural fluid, chest tube was inserted. the results of serum tumor markers were bhcg < 1 u / l (normal<10), afp=3.5iu / ml (normal=0 - 10), psa=0.2ng / ml (normal = upto4), ca19 - 9=66.9u / ml (normal=0 - 36), cea=5.8ng / ml (normal = non smoker < 3.4). ultrasound of both testicles was normal and abdominopelvic ct was unremarkable for malignancy. finally under the diagnosis of metastatis of unknown primary, patient had been feeling better after starting therapy and after a few sessions of physiotherapy, he was able to walk. the patient was presented with multi organ involvement such as skin, brain and kidney that was suggestive of systemic disease. as we discussed below, the main possible diagnosis was overlapping of systemic vasculitis and endocarditis and it 's embolic complications, as manifestations of underlying malignancy. systemic vasculitis is in two categories ; primary or secondary, but in our patient, due to negative results of rheumatologic panel, secondary vasculitis associated with primary diseases like malignancy or infection was more compatible with the patient. leukocytoclastic venulitis confined to the skin is the most common finding ; however, widespread systemic vasculitis may occur but it is an uncommon presentation. exudative pleural effusion with positive cytology made this hypothesis more prominent and led us searching for the most common sites of metastatic pleural effusion such as lung carcinoma, breast carcinoma and lymphoma. bma / bmb (bone marrow aspiration and biopsy) and absence of organomegaly or lymphadenopathy, lymphoma was not an appropriate possibility. as ihc report was low likely for lung, being the origin of metastasis, we tried to find other origins such as pancreas, testis and upper gi, but all results were unremarkable for malignancy. endocarditis : our patient suffered from skin lesions that were compatible with janeway and subungual hemorrhage and led us to endocarditis, either bacterial or nonbacterial thrombotic endocarditis (nbte). cardioembolism is responsible for 20% of ischemic stroke and among the causes of cardioembolism, endocarditis was considered in this patient, responsible for the acute cerebellar stroke and kidney infarctions and due to the size and location of vegetation, nbte was more compatible with the patient. finally due to elevated ca 19 - 9 and nodularity in right lung, chemotherapy drugs were selected in a way that they could cover pancreas and lung. | secondary systemic vasculitis and nonbacterial endocarditis are rare events. we report a case presented with different manifestations of underlying malignancy such as systemic vasculitis, non bacterial endocarditis and dic (disseminated intravascular coagulopathy). efforts to find the source of malignancy was unsuccessful and due to patient 's unwillingness for further evaluation, finally under the diagnosis of metastatic disease of unknown primary, patient is receiving cyclic chemotherapy. |
nebivolol is a third - generation 1 - selectiveblocker that is indicated for the treatment of hypertension and heart failure. it has vasodilatory properties mediated by direct stimulation of the endothelial nitric oxide synthase (enos). nebivolol is a racemic mixture of two enantiomers in a 1:1 ratio, namely a d - and an l - isomer. the d - isomer selectively blocks the 1 receptor and has mild vasodilatory properties, while the l - isomer stimulates enos, thereby resulting in vasodilatation. the hemodynamic changes induced by nebivolol may lead to a negative chronotropic effect, inhibition of sympathetic outflow from cerebral vasomotor centers, inhibition of peripheral 1-adrenoceptors, suppression of renin activity, and decreased peripheral vascular resistance. the very high selectivity of the nebivolol d - isomer for 1 - versus 2-adrenergic receptors involves the limited effects on airway reactivity, insulin sensitivity and the lesser negative inotropic effect of nebivolol in patients with heart failure. although nebivolol has no intrinsic sympathomimetic activity, it exerts an agonistic effect on 3-receptors, which may partially explain its effects on the endothelium. the most frequently occurring adverse events (aes) associated with nebivolol reported in clinical trials are fatigue (4 - 79%), headache (2 - 24%), paresthesia (7 - 13%), bradycardia (6 - 11%), rhinitis (1 - 7%), and dizziness (2 - 5%). other commonly reported (> 1%) nebivolol - associated aes are diarrhea (2 - 3%) and nausea (1 - 3%), both of which are consistent with aes reported for other -blockers. adverse events reported in < 1% of patients are insomnia, asthenia, hypercholesterolemia, and hyperuricemia. the following aes were communicated to the manufacturer after nebivolol became commercially available : abnormal hepatic function, acute pulmonary edema, acute renal failure, atrioventricular block, bronchospasm, erectile dysfunction, hypersensitivity, myocardial infarction, pruritus, psoriasis, raynaud 's phenomenon, intermittent claudication, somnolence, syncope, and thrombocytopenia. nebivolol is contraindicated in patients with severe bradycardia, atroventricular nodal block greater than first degree, cardiogenic shock, decompensated heart failure, and severe liver disease. like the use of other -blockers, abrupt cessation of nebivolol therapy is not recommended because it may lead to a rebound effect and to the precipitation of severe angina, myocardial infarction, and ventricular arrhythmias. like most antihypertensive agents used in pregnancy, nebivolol is designated a pregnancy category c medication (no human data supporting safety or toxicity during pregnancy). category c includes drugs for which human studies are lacking but animal studies showing a fetal risk. category c drugs should be administrated only if the potential benefits outweigh the potential risks to the fetus. this category is difficult to interpret because there is no evidence of risk and it is so broad to be preclude usefulness in practice. here we report the case of an infant who was admitted to the pediatrics and neonatology unit of the moscati hospital (aversa, italy) about 24 hours after birth. the reason for hospitalization was persistent severe hypoglycemia (blood glucose = 30 mg / dl) and jaundice (total bilirubin = 12.5 mg / dl, indirect bilirubin 11.75 mgl / dl). the mother reported taking nebivolol 5 mg / day for unspecified tachycardia in the last 4 months of pregnancy. because of jaundice and hypoglycemia, the infant immediately underwent phototherapy and intravenous administration of 10% glucose solution. the laboratory tests carried out at admission revealed polycythemia with hematocrit 63.7%, red blood cells count of 6,230,000/mm, mild hyponatremia (132 meq / l) and mild thrombocytopenia (platelets = 99,000/mm) with prolongation of prothrombin time and activated partial thromboplastin time. tests during hospitalization showed blood glucose level within normal limits, despite treatment with intravenous glucose solution, and coagulation remained deranged without overt clinical manifestations, and hyponatremia became more pronounced. urinary electrolytes were below normal, hence it was decided to reduce fluid intake and increase the administration of sodium chloride. abdominal ultrasonography, cardiology consultation, electrocardiography, echocardiography, and brain ct scan were unremarkable. serial c - reactive protein, urinalysis, urine cultures and blood cultures were also unremarkable. the clinical condition of the newborn gradually improved and coagulation test and the levels of blood glucose, bilirubin and serum sodium normalized. consequently, the patient was discharged on the 10 day, in a good clinical condition and with normalization of clinical and laboratory parameters. the detection of adverse drug events (ades) is crucial to improving the quality of health care system both in adults and, especially in pediatrics. to date, pharmacovigilance studies on vaccine and drug safety are still not enough in pediatric population. moreover, pregnant women are often excluded from clinical studies, and this could induce an inadequate pharmacological treatment which could compromise both fetal and maternal well - being. in this scenario, we report the first case, to our knowledge, of nebivolol induced a hypoglycemia, polycythemia and hyponatremia in a newborn after a spontaneous at - term delivery. during pregnancy, some studies found an association between -blocker treatment and small for - gestational - age (sga) newborns and preterm births, but not others. a study conducted in a cohort of all births in denmark between 1995 and 2008 revealed an association between exposure to -blockers and preterm birth and perinatal mortality. when the analysis was adjusted for maternal comorbidity, co - medication and smoking, only labetalol was found to be associated with perinatal mortality. however, other studies show that labetalol is safer than other -blockers during pregnancy, thus this drug is becoming the first - line choice for hypertension and other chronic conditions during pregnancy. in any event, the risk of sga, preterm birth and perinatal mortality following exposure to -blockers could be a class effect. our patient was affected by hypoglycemia, polycythemia and hyponatremia after being exposed to nebivolol during the last 4 months of pregnancy. there are numerous reports of hypotension, bradycardia and hypoglycemia in infants after administration of -blockers, particularly labetalol, during pregnancy. in particular, a cohort study showed that exposure to -blockers in the last trimester of pregnancy is associated with an increased risk of hypoglycemia in infants. in fact, -blockers spread through the placenta, and can increase insulin levels and decrease glucagon levels in the fetus, thereby resulting in hypoglycemia in the newborn. however, hypoglycemia is common in neonates and usually occurs in the first 48 hours after birth. the risk of hypoglycemia in newborns is increased by prematurity, perinatal stress or asphyxia, small size for gestational age and being born to diabetic mothers. the persistent form may be due to metabolic diseases, such as hyperinsulinism and hypopituitarism, or hereditary hepatic enzyme deficiencies. instead, the transient hypoglycemia could represent a metabolic mechanism of adaptation to extrauterine life and is commonly observed in at - risk infants. moreover, transient low blood glucose concentrations are frequently observed in healthy newborns and, unlike in our case, it is a transient phenomenon. therefore, it is conceivable that exposure to nebivolol has favored the onset and persistence of hypoglycemia in our patient. there are no reports of hyponatremia or polycythemia consequent to exposure to nebivolol. in our case it has been suggested that -blockers without intrinsic sympathomimetic activity cause selective vasoconstriction of placental vessels. placental insufficiency can lead to chronic or acute fetal hypoxia with birth asphyxia and hypothermia, neonatal hypoglycemia, polycythemia and coagulopathy. hyponatremia could be the consequence of increased blood viscosity resulting from polycythemia and thus it would be a pseudohypontremia. to our knowledge, this is the first case of hypoglycemia, polycythemia and hyponatremia in a newborn exposed to nebivolol during the last 4 months of pregnancy. the safety profile of beta blockers (-blockers) used in pregnancy is still unclear and controversial. there is a lack of studies on the tolerability and safety of nebivolol during pregnancy. however, it appears that the risk profile of nebivolol for pregnancies is the same as that of other -blockers. therefore, there is a need for studies designed to assess the tolerability profile of this class of drugs when used in pregnancy in order to minimize risks both for the unborn that for pregnant women. for this reason pharmacovigilance post - marketing studies are key elements to monitor the safety and effectiveness of approved drugs, especially when used in special conditions such as pregnancy. | nebivolol is a third - generation beta blocker that exerts selective antagonistic activity on 1 receptors. it has vasodilating properties that result from direct stimulation of endothelial nitric oxide synthase. nebivolol is indicated for the treatment of hypertension and heart failure, and is generally well tolerated. in this article, we report a case of an infant who was admitted to the pediatrics and neonatology unit of the moscati hospital (aversa, italy) about 24 hours after birth. the reason for hospitalization was persistent severe hypoglycemia (blood glucose = 30 mg / dl) and jaundice (total bilirubin = 12.5 mg / dl, indirect bilirubin 11.75 mg / dl). he was born by spontaneous delivery after a normal term pregnancy. birth weight was 3040 g and the apgar score was 6 - 9. the mother reported taking nebivolol 5 mg / day for unspecified tachycardia in the last 4 months of pregnancy. clinical and instrumental investigations carried out during hospitalization did not reveal any congenital or perinatal abnormalities. after treatment for metabolic and electrolyte imbalance, he was discharged on the 10th day of hospitalization, in good clinical condition and with normalization of clinical and laboratory parameters. currently, there are no specific studies on nebivolol tolerability during pregnancy. our data suggest that the risk profile of nebivolol during pregnancy is the same as that of other -blockers. therefore, further studies are required to determine the safety of -blockers during pregnancy and the risks to the unborn child. |
clinically, calcineurin inhibitors (e.g., cyclosporine a, csa) have been used to reduce proteinuria in focal segmental glomerulosclerosis (fsgs), minimal change disease (mcd), and other proteinuric kidney diseases. t - cell dysfunction is associated with some forms of proteinuria, including a subset of mcd in children. this concept originally stemmed from the so called shalhoub hypothesis that lipoid nephrosis is produced by a systemic abnormality of t - cell function. for decades, fsgs was thought to be an immunologic disease resulting from the noxious effect of a lymphokine on the podocyte. this was the primary reason for using csa as an immunosuppressive drug, to continue to endorse this mechanism of action despite studies demonstrating that calcineurin inhibition reduced proteinuria in nonimmunologic glomerulopathies. actually, csa can also reduce proteinuria in human and experimental alport 's syndrome, a nonimmunological disease, raising doubts of this hypothesis [4, 5 ]. moreover, although csa effectively lowered the level of proteinuria in human membranous nephropathy, the study of ambalavanan. showed a more numerous and lager electron - dense immune deposits than before csa 's therapy, indicating that whilst csa exerts an antiproteinuric effect, the drug does not modify the histologic aggravation of the glomerular lesions. a recent study showed that csa has a direct antiproteinuric effect on podocytes.csa blocked calcineurin - mediated dephosphorylation of the actin - organizing protein synaptopodin, a podocyte foot process cytoskeletal component, facilitating its degradation by cathespin l. mechanistically, this study thus identified a new calcineurin signaling pathway in kidney podocytes and attributed the antiproteinuric effect of csa to its inhibition of calcineurin - mediated degradation of synaptopodin. thus, this antiproteinuric effect was shown to be independent of t cells, at least partially. although arguing against an antiproteinuric role of csa through the suppression of t cells, this study did not rule out the involvement of nfat proteins downstream of calcineurin in kidney podocytes. our results, along with those from wang. and nijenhuis., suggested that conditional nfatc1 activation in podocytes per se is sufficient to induce proteinuria in mice. thus, both studies provided in vivo evidence that nfat activation in podocytes may be a critical pathogenic molecular event leading to proteinuria or fsgs. altogether, these advances in podocyte research indicate that calcineurin - nfat signal or calcineurin - synaptopodin axis has a direct proteinuric effect on podocytes, and these observations raise the possibility of developing specific antiproteinuric drugs that lack the unwanted effects of calcineurin or nfat inhibition. proteinuria, a cardinal sign and a prognostic marker of kidney disease, affects several hundred million people worldwide. podocytes, endothelial cells, and the glomerular basement membrane (gbm) constitute the glomerular filtration barrier, a highly specialized structure for selective ultrafiltration. the common denominator in a variety of kidney diseases, including mcd and fsgs, is podocyte injury involving a massive loss of protein in the urine (proteinuria) [13, 14 ]. several studies showed that the podocyte has a central role in the development of proteinuria and idiopathic nephrotic syndrome. several pathogenic pathways involved in effacement of the podocyte foot processes and the development of proteinuria have been discovered. studies in hereditaryproteinuric syndromeshaveuncovered that mutations of podocyte proteins, including -actinin-4, cd2ap [16, 17 ], nephrin, plce1, podocin, trpc 6 [21, 22 ], formin protein inf2, and myo1e lead to proteinuria, podocyte foot processes effacement and podocyte actin cytoskeleton disruption [14, 25 ]. other proteins regulate the podocyte actin cytoskeleton and are important for the glomerular filtration barrier. these proteins include rho gdialpha [26, 27 ], podocalyxin, fat1, nck1/2, and synaptopodin. trpc6 is a member of the large transient receptor potential superfamily of nonselective cation channels [32, 33 ]. mutations in the gene that encodes trpc6 have been identified in families with autosomal - dominant fsgs [3436 ]. many calcium - dependent signals, including calcineurin, may be potential targets of trpc6 activation in podocytes since trpc6 are involved in the regulation of intracellular calcium concentration in response to the activation of g - protein - coupled receptors and receptor tyrosine kinases. meanwhile, some trpc6 mutations found in human beings with fsgs result in increased amplitude and duration of calcium influx into hek293 cells [21, 22 ]. trpc6-deficient mice do not show any obvious renal phenotype. however, transient induction of trpc6 overexpression by in vivo gene delivery results in proteinuria. the actin - binding protein synaptopodin, which is highly expressed in podocytes, is a key regulator of podocyte function since bigenic heterozygosity for synaptopodin and cd2-associated protein results in proteinuria and fsgs. synaptopodin induces stress fibers by stabilizing the gtpase rhoa and suppresses filopodia by disrupting cell - division cycle-42-insulin receptor substrate p53-mena signaling complexes. recently, urokinase receptor (upar) and its soluble form (supar) have been shown to be involved in the pathogenesis of proteinuria and fsgs [39, 40 ]. upar is a glycosylphosphatidylinositol - anchored protein that has been shown to be a proteinase receptor for urokinase but has also been involved in nonproteolytic pathways, mainly through interactions with other plasma membrane proteins such as integrins. upar and 3 integrin colocalize in podocytes and thus form a complex with 3 integrin, thereby causing the activation of 3 integrin. in vivo gene delivery of constitutively active 3 integrin is sufficient to induce proteinuria in mice ; conversely, inhibition of upar expression and 3 integrin activation has an antiproteinuric effect. interestingly, supar, a soluble form of upar has been identified as a circulating fsgs factor that is elevated in the serum of approximately two - thirds of primary fsgs patients. supar - mediated activation of 3 integrin on podocyte foot processes may be the mechanism of injury caused by high supar blood concentrations. the calcineurin is ubiquitously expressed in all mammalian tissues and is a ca - dependent serine / threonine phosphatase composed of a catalytic subunit, cna, and a regulatory subunit, cnb [43, 44 ]. calcineurin has a wide range of roles in organ development and cellular functions [45, 46 ], including the regulation of transcription in various renal cells [43, 44 ]. clinically, csa is used to reduce proteinuria in kidney diseases, such as idiopathic nephrotic syndrome (especially fsgs). the immunosuppressive effect of csa results from inhibition of signaling by the transcription factor nfat in t cells, and this action has also been believed to mediate csa 's antiproteinuric effect. although the efficacy of csa was thought to derive from its suppression of nfat activation in t cells through the inhibition of calcineurin, not all drugs suppressing t - cell activation have protective effects on glomeruli. the study of faul. suggested a novel role for csa in inhibiting the dephosphorylation of synaptopodin by calcineurin.. found that activation of calcineurin in the podocyte is sufficient to cause proteinuria via the degradation of synaptopodin and that csa blocks the calcineurin - mediated dephosphorylation of synaptopodin, thereby preserving the phosphorylation - dependent synaptopodin-14 - 3 - 3b interaction. csa and e64 ameliorate lps - induced proteinuria by blocking the catl - mediated degradation of synaptopodin [4851 ]. these data unveiled a calcineurin signaling pathway, which is operative in podocytes and contributes to the maintenance of kidney filter function. although faul. argued against an antiproteinuric role of csa through the suppression of t cells, it is possible for the involvement of nfat proteins downstream of calcineurin in podocyte injury, since the nfat transcription factors are the most extensively studied calcineurin substrates and the major regulators of transcription in response to ca / calcineurin signals [47, 52 ]. ca signaling through ion channels has recently emerged as a potential modulator of podocyte function, and several ca - permeable channels have been identified inpodocytes [53, 54 ]. generally, upon activation by increased intracellular ca, calcineurin dephosphorylates the nfat proteins that reside in the cytoplasm in resting cells. this dephosphorylation exposes the concealed nuclear localization signals of the nfat proteins, leading to the cytoplasm to nucleus translocation of these proteins. in the nucleus, the nfatc proteins form nfat transcription complex with their nuclear partners to control the transcription of target genes. trpc6 mutations were found in families with hereditary fsgs, and trpc5 and trpc6 channels are now known as the ca influx pathways for the nonselective, cationic current in podocytes. mutations in one of these channels, trpc6, lead to aberrant ca signaling, podocyte dysfunction [21, 22 ], and nephrin and neph1 have been shown to interact with several ca channels, including trpc6 [11, 56 ]. inhibition of calcium channels and chelation of extracellular calcium reduced protamine sulfate - induced damage, suggesting that calcium signaling plays a critical role in the initial stages of glomerular injury. calcineurin inhibitors (fk506 and csa) inhibited protamine sulfate - mediated barrier changes, indicating that calcium signaling acts, in part, through calcineurin - dependent cleavage of synaptopodin. meanwhile, mutations in trpc6 enhance the amplitude and duration of the ca channel current which cause nfat activation, indicating the activation of the calcineurin - nfat pathway as a potential mediator of fsgs. importantly, the study of wang. demonstrated that, in parallel to synaptopodin regulation, there may be an additional pathway from calcineurin to podocyte injury and proteinuria that involves nfat - mediated regulation of known and novel factors important for podocyte function. to study the role of nfat signaling in glomerular podocytes, wang. created a system for inducible activation of nfat signaling in podocytes, in which a podocin - cre transgene was used to induce the removal of the transcriptional stop cassette in a rosa26-rtta allele only in podocytes [59, 60 ]. and when the cassette is deleted, the rosa26 promoter drives the production of reverse tetracycline - controlled transactivator (rtta) in podocytes. when treated with doxycycline, the doxycycline - rtta complex binds to the teto sequence of the teto - nfatc1 transgene. the mice carrying three alleles (podocin - cre, ro - sa26-rtta, and teto - nfatc1) were referred as mutants. thus, results from wang. provided in vivo evidence that nfat activation, either in utero or postdevelopmentally, can lead to podocyte injury and proteinuria, which suggest that activation of nfat signaling may be a key pathogenic molecular change in podocyte injury and the development of proteinuria. using a similar model for conditional nfat activation in podocytes, nijenhuis. demonstrated that podocyte - specific inducible expression of a constitutively active nfat mutant increased trpc6 expression and induced severe proteinuria, and that calcineurin inhibition by csa downregulated trpc6 expression and reduced proteinuria. importantly, this study showed that a deleterious feed - forward mechanism, in which trpc6-mediated ca influx stimulates nfat - dependent trpc6 expression, is involved in angiotensin ii (ang ii)-associated podocyte injury. in vitro and in vivo models, ang ii, a key contributor to the pathogenesis of glomerular disease, increases trpc6 expression in podocytes. the regulation of trpc6 expression by angii is dependent on trpc6-mediated ca influx and the activation of the ca - dependent calcineurin / nfat signaling. tian. showed that ang ii resulted in significant reduction in the abundance of synaptopodin, and gene silencing of trpc6 resulted in loss of synaptopodin in podocytes in contrast, gene silencing of trpc5 did not affect synaptopodin abundance. trpc6-depleted cells treated with csa restored synaptopodin abundance, suggesting an association between ca influx through trpc5 and trpc6 channels and synaptopodin signaling in podocytes.. showed that that all three trpc6 mutations (p112q, r895c, and e897k) to enhance channel activity lead to enhanced basal nfat - mediated transcription in cultured podocytes, which are dependent on channel activity and are dominant when mutants are coexpressed with wild - type trpc6. activation of nfat by trpc6 mutants is blocked by inhibitors of calcineurin, calmodulin - dependent kinase ii, and phosphatidylinositol 3-kinase. in addition, another study showed that calcineurin induces podocyte apoptosis in a genetic model of type 1 diabetes mellitus (akita mice). in cultured podocytes, activated nfat promotes podocyte apoptosis in a calcineurin - dependent fashion, and induction of apoptosis by either angiotensin ii or endothelin-1 in other cell populations, nfatc1 activation leads to distinctive changes in transcription and cellular behavior [6365 ]. interestingly, rcan1, wnt6, and fzd9 were shown to be upregulated in glomeruli isolated from nfatc1 nuc transgenic mice, making them potentially direct targets of nfatc1. the upregulation of rcan1, a known target of nfat [66, 67 ], may reflect a potential regulation axis of calcineurin, nfat, and rcan1 in podocyte. moreover, upregulation of wnt signaling was found to be detrimental to podocytes, and wnt signaling was also shown to be upregulated in nfatc1 nuc transgenic mice, indicating that the upregulation of wnt signaling seems to be the pathogenesis of nfat activation - induced podocyte injury and fsgs. however, recently published researches showed that the effect of csa on proteinuria is not dependent on nfat inhibition in t cells, but rather results from its effects on kidney podocytes, including the stabilization of synaptopodin. moreover, in vivo evidence from nfatc1 nuc transgenic mice and akita mice showed nfat activation - induced podocyte apoptosis and injury, and nfat - dependent trpc6 expression, the mutations of which have been shown to be associated with proteinuria and glomerulosclerosis in human patients. in summary, recently, there is the possibility that csa might have a coupled nonimmunological antiproteinuric effect : one as demonstrated by faul. on synaptopodin and the podocyte cytoskeleton, another separate one through the inhibition of nfat as nfat induces proteinuria and podocyte apoptosis (figure 1). | the antiproteinuric effect of cyclosporine a(csa) has been believed to result from its immunosuppressive effect on the transcription factor nfat in t cells. however, current evidences supporting this hypothesis are missing. a recent study showed that csa has a direct antiproteinuric effect on podocytes, suggesting a novel non - immunosuppressive mechanism for csa 's antiproteinuric effect. conditional nfatc1 activation in podoyctes per se is sufficient to induce proteinuria in mice, indicating that nfat activation in podocytes is a critical pathogenic molecular event leading to podocyte injury and proteinuria. meanwhile, evidence showed that trpc6-mediated ca2 + influx stimulates nfat - dependent trpc6 expression. altogether, these advances in podocyte research indicate that calcineurin - nfat signal or calcineurin - synaptopodin axis has a direct proteinuric effect on podocytes which raises the possibility of developing specific antiproteinuric drugs that lack the unwanted effects of calcineurin or nfat inhibition. |
reactions in leprosy are acute inflammatory episodes occurring in an otherwise chronic course of the infection. histopathology of type 1 lepra reaction shows edema within granuloma separating inflammatory cells with density of lymphocytes in the dermis. to distinguish between upgrading and downgrading reaction histopathologicaly, serial examination of biopsies histopathology of skin lesions of type 2 lepra reaction (erythema nodosum leprosum, enl) shows dermal edema, neutrophilic infiltration and vasculitis on a background of macrophage granuloma. wide variations in clinical presentation of leprosy in reaction, make histopathology an important tool for supporting clinical diagnosis. while leprosy is histopathologicaly relatively easy to diagnose, lepra reactions are not always diagnosable under the microscope. although our study included clinical features, we decided to focus on histopathologic features and their clinicopathologic co - relation. a retrospective clinicopathological analysis of 64 skin biopsies of patients with lepra reaction visiting a tertiary care centre during year 20052008 was done. we included skin biopsy specimens of patients of all ages, diagnosed as lepra reaction (type 1 and type 2) after clinico - pathological correlation. those with doubtful diagnosis were clinically reviewed and if needed, excluded from the study. histopathological reevaluation of the skin biopsies stained with hematoxylin and eosin stain was done and findings were recorded. afb staining was not done routinely, as it was not useful for diagnosis of lepra reactions. clinical review was not possible for 4 patients (1 of type 1 reaction and 3 of type 2 reaction) for logistic reasons. the age of the patients included in study ranged from 6 years to 68 years (mean age 35.55 years) for type 1 reaction, while it was 11 to 65 years (mean age 40.10 years) for type 2 reaction. the leprosy spectrum (based on clinicopathologic co - relation) and type of reaction observed in our patients is mentioned in table 1, while table 2 details their clinical features. type of lepra reaction and clinical spectrum of hansen 's disease clinical profile of patients histopathological observations in type 1 reaction are illustrated in table 3. the most consistent finding in type 1 reaction was higher than expected accumulation of lymphocytes within granuloma which was seen in all specimens, followed by occurrence of edema in papillary dermis, pyknosis of lymphocytes, and edema in the granuloma followed by folliculotropism [figure 1 ] and lymphocytic panniculitis [figure 2 ]. histopathological observations in type 1 reaction lymphocytic infiltratation of follicle (folliculotropism) lymphocytic panniculitis histopathological observations in type 2 reaction have been depicted in table 4. we observed that, the presence of neutrophils in the granuloma was a uniform feature seen in all lesions of enl [figure 3 ]. other common findings were leukocytoclasia and papillary dermal edema (81% each) and lobular [figure 4 ] and septal neutrophilic panniculitis (66%). prior studies on histopathologic features of lepra reactions are prospective clinicopathological evaluations. due to the sheer amount of data e.g., vasculitis is mentioned as a finding but individual histopathologic features of vasculitis like fibrin in vessel wall or fibrin thrombi or leukocytoclasia are not described. dermal edema, loosening of granuloma, and predominance or increase in number of lymphocytes are described as a feature of type 1 reaction in prior studies. interpretation of pyknosis of lymphocytes can be difficult at times as it can be influenced by inter - observer variations. we observed that, lymphocytes in granuloma associated with dermal edema and/or edema within the granuloma is highly suggestive type 1 reaction. epidermotropism has classically been described with mycosis fungoides but here we observed it in few lesions of type 1 lepra reaction. lazaro - medina. have described some new markers for type 1 reaction which include spongiosis of the epidermal and follicular epithelium with exocytosis of mononuclear cells, parakeratosis, focal interface changes with occasional individual cell necrosis of keratinocytes, and follicular mucinosis. some of these findings like epidermal and follicular epithelium spongiosis, interface change were also observed by us. occurrence of giant cells in the granuloma is one of the finding which helps in classifying histopathologically the features of upgrading and downgrading type1 lepra reactions. lockwood dn and co - workers in a prospective study compared skin lesions with type 1 reaction with non - reactional controls ; in addition to intra dermal and intra granuloma edema they noted increase in giant cell size and giant cell numbers in type 1 reaction. as in our study such comparison with non - reactional control was not done, we are unable to make any comments on the findings they described. neutrophils are not seen in ordinary lesions of leprosy. in type 2 lepra reactions, because of the immune complex deposition, neutrophils are attracted in these lesions. neutrophils were present either within the granulomatous infiltrate or / and in the interstitium with or without leukocytoclasia. in a few sections more severe and recent onset lesions of lepra reactions showed much denser infiltrate as compared less severe and subsiding lesions. we noted neutrophilic spongiosis as more common than intraepidermal pustule formation. the dense collection of neutrophils in the epidermis and dermis is probably responsible for the clinical finding of pustules in enl lesions. infiltration of sweat duct and sweat gland by neutrophils was found in a few cases without any evidence of damage or necrosis of the sweat duct or sweat glands. the histopathologic spectrum of vasculitis range from endothelial swelling, neutrophilic infiltration of the vessel wall with destruction of the walls and leucocytoclasia. a variable degree of vascular involvement in type 2 reaction was noted in our study and majority of the lesions with type 2 reaction did not have all classical features of vasculitis. this finding was in slight disagreement with previous literature where vasculitis affecting arterioles and venules was observed in 50% cases of type 2 reaction by job. in 1964 and fibrin in vessel wall was the commonest sign observed followed by fibrin thrombi and neutrophils in vessel wall in few cases. the histological features of vasculitis depend upon the stage at which a lesion has been biopsied. an older lesion will have sparse neutrophilic infiltrate and predominance of mononuclear cells whereas an early lesion show predominantly neutophilic infiltrate with fibrin deposition. occlusion of the vascular lumina with extensive involvement where vessels in lower part of the dermis and subcutaneous tissue are involved leads to necrosis or ulceration of the lesion. the vascular changes we noted were more prevalent in the upper and mid dermis than subcutaneous tissue. necrosis and ulceration is fairly uncommon in enl in contrast to lucio reaction where ulceration and necrosis is almost always seen. in lucio reaction endothelial proliferation along with thrombosis of dermal and subcutaneous vessels leads to ischemic necrosis and ulceration. as we observed, occlusion of vessel lumen was seen in a few lesions and was limited to upper and mid dermis and that may be the reason why none of the lesion in our study showed ulceration and necrosis. similar to the observation of lymphocytic involvement of follicle in type 1 reaction, a few cases (5%) of type 2 reaction showed lymphocytic infiltration of sebaceous lobules. involvement of subcutaneous tissue by granulomatous infiltrate can be seen in cases of lepromatous leprosy though the lesion is not in reaction. but the presence of neutrophils in subcutaneous tissue is an important clue to the type 2 reaction. papillary dermal edema and lymphocytic infiltration within granulomas were the most consistent signs of type 1 lepra reaction followed by edema in granuloma and pyknosis of lymphocytes. infiltration of granulomas by neutrophils was the most reliable sign in cases of type 2 reaction. a few new findings were folliculotropism, epidermotropism, and lymphocytic panniculitis in type 1 reaction and neutrophils in sweat ducts and lymphocytes in sebaceous lobules in type 2 reaction, which needs validation. | background : lepra reactions are not always diagnosable under the microscope. we analyzed skin histopathology in 64 cases of lepra reaction.aim:to make detailed observations on histopathologic features of type 1 and type 2 lepra reaction (erythema nodosum leprosum, enl).materials and methods : in this retrospective study, we included 64 patients diagnosed during a 3-year period as lepra reaction based on clinico - pathological co-relation.results:out of the 64 patients, 22 were of type 1 reaction and 42 of enl. the most consistent finding in type 1 reaction was papillary dermal edema (86%) followed by pyknosis of lymphocytes (77%) and intercellular edema within granuloma (73%). surprisingly, folliculotropism of lymphocytes was seen in 55% and subcutaneous infiltration in 36%. in enl, the most common finding was presence of neutrophils within the granuloma (100%), followed by leukocytoclasia (81%), papillary dermal edema (81%), and neutrophilic panniculitis (69%). fibrin in the vessel wall or / and granulomas was noted in only 38% while fibrin thrombi in the vessel walls were seen in only 12% of cases.conclusion:infiltration of macrophage granulomas by neutrophils is a reliable sign of enl. classical signs of vasculitis are not always present in enl. folliculotropism and lymphocytic panniculitis were frequent in type 1 reactions while neutrophilic panniculitis was common with enl. |
in addition to the progresses made in the areas of surgical techniques and surgical tools, efforts are being made to take surgical measures for the patient in such a manner so that they are economical and with less side effects and least hospitalization period in addition to maximum benefits for the patient regarding the elimination of the disease. cholecystectomy is not an exception and since the time philippe moure invented laparoscopic cholecystectomy (lc) technique in 1987, in france, and noticeable advancements have occurred in the relevant techniques and instruments. the common lc method is an american method with four ports that leads to lesser scars and pain, shorter hospitalization duration, and quicker recovery in comparison with the open surgery. of course, the lc method has a 1.3 - 9% chances of wound infection and 0.77 - 3% chances of port - site hernia. they have therefore tried to obtain better results in comparison with the lc method in the recent year regarding the matters of beauty, pain after the surgery, and being economical through using fewer ports or decreasing the port sizes. the belief is that these methods are more economical considering the number of hospitalization days, the duration of the surgical procedure, and the surgery expenses. the efforts made in the field of improving lc results led to the invention of single - incision lc (silc) method in 1990. the benefits of the silc method include reduced risk of wound infection, quicker recovery period, lesser postsurgical pain, and better aesthetic results compared to the results of the four - port lc method. this method also suffers disadvantages in comparison to the common methods, which are as follows : increased surgical - procedure period, difficult to learn for the surgeons, and more compromised vision during the surgery that increased risk of damage to the bile duct and the common bile duct (cbd) and increased chances of port - site hernia. therefore, some surgeons held the belief that this surgery with four ports had lesser chances of unexpected occurrences during surgery, and as a result this technique was easier and quicker. it seemed like the surgery was done in a shorter time since the surgeon saw better while operating using this method and it seemed like this method had lesser side effects compared to the silc method. also, since the cut on the skin is smaller, the postsurgical pain is expected to be lesser and the skin is expected to look better. many studies have been dedicated to comparing the silc method and the common method so far but the silc method has not been considered a good replacement for the four - port method in these research works with regard to the fact that the surgery duration was longer in most of these studies when using the silc method and there were more side effects in some cases. very few research works have been conducted on comparing the silc method and the mlc method while it seems like the mlc method takes lesser time since the surgeon has a clearer vision during the surgery that leads to lesser side effects in comparison with the silc method. also, since the cut on the skin is smaller, the postsurgical pain is expected to be lesser and the skin is expected to look better. therefore, this study aims at comparing these two methods (mlc and silc methods) logically in order to examine whether the surgery could be performed in a shorter time period and result in lesser side effects since the vision is better during the surgery when smaller ports are used in comparison with when fewer ports are used. the study also tries to find answer to the following questions : do the postsurgical pain and the beauty results make this a more confident and less dangerous surgery ? is this surgery beneficial to the patient and the health system in general ? this study is a randomized clinical trial conducted on the patients admitted to shariati hospital, tehran who were diagnosed with cholecystitis, and those with symptomatic cholelithiasis had indications for lc. the study protocol was approved in the institutional review board and informed consent was obtained from the patients. all the operations were performed by the same surgeon, who had experience of performing mlc and silc procedures. postoperatively, the levels of pain was recorded using the visual analog scale (vas) scores (ranged from 0 to 10) as well as the parameters such as dosage of intravenous analgesics, wound length, hospitalization period, and postsurgical side effects (including wound infection, nausea and vomiting, and reoperation and readmissions). the study population included the patients (aged 18 years and above) who were admitted to shariati hospital, tehran, between 2013 and 2014 and were candidates of lc. the exclusion criteria included : age > 50 years, signs of concurrent cbd stone, morbid obesity (bmi 40), severe acute cholecystitis, the american society of anesthesiologists (asa) score of 3 or 4, and previous surgeries in the upper abdominal areas. the umbilicus was cautiously cleaned and the abdominal surface was prepared and draped for surgery. a 10-mm port was placed in the lower part of the umbilicus, a 2.7-mm port was placed in the epigastric region, a 2.7-mm port was placed 2 cm below the right costal margin in the midclavicular line, and another 2.7-mm port was placed in the lower right side of the anterior axillary line. a 10 mm 30 camera was sent in from the 10-mm port, and the grasper holding the fundus of the gallbladder (gb) was sent in through the right lower port. the gb was then taken out using the 10-mm port. using conventional instruments and equipment after the insertion of a veress needle, co2 pneumoperitoneum was created and preserved at a pressure of 14 mmhg. a 10-mm port was used in the most inferior portion of the incision and two 5-mm ports were used in the upper left and right corners through the medial portion of the rectus sheets. we started the procedure with the insertion of a 0 10-mm camera through the 10-mm port and changed it to a 30 camera when required. when the gb was completely separated, we temporarily removed the camera and entered the bag using the 10-mm port with the distal part of the connected thread (tail of purse string in the opening of the bag) still outside. using the connected thread, we took out the bag containing gb by pulling the bag to the 10-mm opening. at the end of the procedure, the 10-mm port site was closed using 1.0 vicryl for the fascia. after the lc, the patients underwent the recovery period of the operating room and were transferred to the ward. acetaminophen was used for the baseline pain relief (1 gm every 6 h pro re nata (prn)) and in case of severe pain, 25 mg of pethidine was used. the information of each patient was collected in the information form by the concerned nurse who was blinded to the surgery. the patients pain was registered within the ward based on vas score (0, completely painless, to 10, unbearable pain) in specific time intervals after the surgery (every 8 h before receiving the baseline pain reliever and then 1 week after the surgery in the first visit). during a 1- and a 3-month telephone survey, they were asked to evaluate their overall satisfaction with the procedure and cosmetic results using a 10-point likert scale and report it themselves (1 : the least degree of satisfaction and 10 : the maximum satisfaction degree). data were analyzed using the statistical package for the social sciences (spss) version 19 (chicago, inc). based on the smirnov - kolmogorov test, operative time, vas scores, total pethidine dosage, and postoperative hospital stay were all compared among the 2 groups by using the nonparametric kruskal - wallis test. intraoperative and postoperative adverse events were compared among groups by using the chi - square test. although the data for nonparametric continuous / quantitative variables are usually presented in terms of median and interquartile percentage, we thought that the mean standard deviation (sd) representation would aid in the comparison with the results of other studies. hence, quantitative variables have been presented in terms of mean sd values, and the values have been considered statistically significant at p - value 100 cc), and stone spillage ; damage to the bile duct did not occur in any of the groups. postoperative complications such as chest pain, heart and lung effects, hernia or port - site seroma, and wound infection did not occur in any of the groups. also in terms of postoperative nausea and vomiting, pain (at 8 h, 16 h, 24 h, and 1 week after the operation), pethidine intake, and hospitalization period there was no difference between two groups. there were no readmission, reoperation, and mortality in this cohort of patients. in terms of patients self - evaluated outcomes either in 1-month or 3-month follow - ups, no statistically significant difference was observed in cosmesis [table 3 ]. the surgery duration had a normal distribution in both groups and the comparison between them showed that the average surgery time was 45.1 6.88 min in the mlc group and it was equal to 63.75 7.57 min in the silc group, this difference was significant (p - value 100 cc), and stone spillage ; damage to the bile duct did not occur in any of the groups. postoperative complications such as chest pain, heart and lung effects, hernia or port - site seroma, and wound infection did not occur in any of the groups. also in terms of postoperative nausea and vomiting, pain (at 8 h, 16 h, 24 h, and 1 week after the operation), pethidine intake, and hospitalization period there was no difference between two groups. there were no readmission, reoperation, and mortality in this cohort of patients. in terms of patients self - evaluated outcomes either in 1-month or 3-month follow - ups, no statistically significant difference was observed in cosmesis [table 3 ]. there were 20 patients in the mlc group and 20 patients in the silc group and since the p - value was not significant in the two groups regarding the age and gender, we could conclude that both the groups were homogeneous regarding the age and gender factors. as previously mentioned, the duration of the surgery was significantly and noticeably shorter in the mlc group in comparison with single incision group (approximately 18.65 min). it is worth mentioning that only one comparison has been made between the surgery duration of the mlc and silc procedures. many other research works compared the surgery duration of silc with that of the common four - port lc. mlc was compared with the common method in a few studies, which indicated that the mlc method did not take a longer time period than the common method. also, the mlc and silc methods have been separately compared with the common method in two studies. the silc method was longer than the common method only in hosogi 's study, and both the silc and mlc methods took longer time than the common four - port method in saad 's research. the significant difference between the two methods in terms of operation time could be because the silc method is more difficult to perform and that most of the surgeons are not familiar with this method. our study made it clear that the postsurgical pain was almost the same in the two groups at 8 h, 16 h, 24 h, and also 1 week after the operation. of course, the silc group received more pain relievers (a mean of 48 mg in the - silc group against 32 mg pethidine in the mlc group) ; however, this amount was not significantly different. the postsurgical pain was similar in both the groups in the only study that compared the mlc and silc methods. another study compared the severe postsurgical pain in the mlc and common lc methods, and it was found that the pain was less in the mlc method, and the silc method was more painful than the common lc in some of the research works. and, of course, some articles have stated that both groups experienced the same amount of pain. these differences between the results could stem from the surgeon 's technique in cutting the skin and the elasticity of the tissue. the results could also be more valid if the comparison was made among a larger sample. nausea and vomiting are common after the lc surgery, which was not different in two groups in the present study. we divided the surgery effects into two groups intraoperative events and postoperative complications. with regard to the previous studies, it seems like gb bursting during the operation occurs in the mlc group since the ports are small and the damage to the bile duct occurs in the silc group since the surgeon can not easily see while operating. however, no significant difference was found between the two groups in the case of the surgery complications during the operation such as the gb bursting. significant bleeding in gb bed, damage to bile duct, and damage to diaphragm did not occur in any of the patients in the two groups. the complications during and after the surgery (cholelitiasis, damage to diaphragm, wound infection, and hernia in the port site) were more in the silc group. in saad 's study, the effects were also more in silc method in comparison with the common method in kasara 's study. however, the effects of the bile duct were the same in the common lc and the silc method in the study of philip., although the effects related to the wound and the postsurgical pain were more in the silc method. the bile duct may be more damaged in the silc group since the surgeon 's vision is more compromised in this method in comparison with the port surgery. the postsurgical complications (such as chest pain, heart and lung problems, hernia, and wound infections) had no significant difference between two groups. in some researches, the postsurgical effects such as port - site hernia and wound infection were more in the silc group. this difference between the research works may be due to the fact that there might be other reasons other than the port size affecting this matter. although we did not have sufficient time to follow up the patients conditions for long in this study, yet at the short - term follow - up that continued for 1 and 3 months after the surgery, both groups were similarly satisfied with their surgery scar and there was no significant difference between the groups regarding this matter (based on the vas system). the mlc method was superior to the common lc method in different studies regarding the surgery scar. on the other hand, the scars of the silc group looked better in mlc in lee 's study, silc method was preferred in most of the studies such as the works of hosogi, sasaki, and sharma in comparison to the common lc regarding the matter of the surgery scar. the reason behind these statistical differences could be the manner in which the surgeon stiches the skin and not so much the cut length or the port size. three groups were defined regarding the findings, the first group included uninflamed gb, the second group included acute cholelithiasis, and the third group included severe cholelithiasis with adhesion and no significant difference was observed between the two groups. the hospitalization period was the same for both mlc and silc groups and there was no significant difference between them. in conclusion, the findings show that except the operating time that was shorter in mlc group, in other aspects mlc compared to silc had no superiority. complications, such as postoperative pain, length of hospital stay, and short - term cosmetic outcomes, were similar in the two groups. nd contributed in the conception and design of the work, conducting the study, acquisition, analysis, and interpretation of data for the work, drafting and revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. as contributed in the conception and design of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. zk contributed in the design of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. as : contributed in the design of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. mj : contributed in the design of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. ag : contributed in the design of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. hm : contributed in the design of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. | background : surgical technique using small - diameter instruments and single - incision laparoscopy are two new options for less invasive laparoscopic cholecystectomy (lc). in this study, we have compared mini - lc (mlc) with single - incision lc (silc).materials and methods : this study is a randomized clinical trial conducted on the patients diagnosed with symptomatic cholelithiasis who underwent lc. forty patients were randomized to two equal groups of mlc and silc. they were compared in terms of demographic data, operation time, and surgical complications.results:baseline characteristics were similar in two groups. operation time in mlc was significantly shorter than that in silc (45.1 69 min vs 63.75 7.57 min, p - value < 0.001). also, the total length of the wound in silc group was shorter than that in mlc group (p - value < 0.003). postoperative pain scores were similar in two groups. hospital stay was shorter in mlc (1.2 0.6 days vs 1.6 0.8 days, p < 0.021). there was no difference in postoperative complications in two groups.conclusion:mlc because of less operation time is preferred than silc. also, by subjective measures, it was a more comfortable method compared to silc. |
the patient is a 58 years old iraqi male that referred to our center three months after an unsuccessful operation for removing a subhepatic mass, probably adrenal mass. he experienced general weakness, fatigue, and weight loss in the last several months. a scar of previous surgery in the right subcostal area (subcostal incision) with near 15 cm length was noted. in hematological examination, hb was 11 g / dl. in serum biochemistry, renal function tests, electrolytes, and serum levels of cortisole and aldosterone were normal. in ct scan that was done with intravenous and oral contrast (figure 1), a large mass located in the subhepatic area and intervening with the upper pole of the right kidney was noted. in the report of previous operation that was done in iraq, tumorectomy was failed due to severe adhesions of the mass to the peripheral tissues. the patient scheduled for right adrenalectomy with the midline laparotomy incision. after opening the layers, the mass was located in the lodge of upper pole of the right kidney. it was severely adherent to the peripheral tissues, due to severe adhesion of the mass to the subhepatic area, its differentiation from the kidney or adrenal was difficult. due to severe bleeding from the subhepatic bed subcapsular resection of the mass with the adherent kidney performed. its total size was 14 cm 10 cm and it weighted 2250 grams. the final histopathological examination of the mass revealed, renal cell carcinoma, clear cell type, fuhrman nuclear grading 2 (figure 2) with invasion to gerotas fascia and involvement of ipsilateral adrenal which originated from the upper pole of the kidney as exophytic growth pattern (t3n0m0). the postoperative course was uneventful and the patient discharged home at fourth postoperative day uneventfully. certain anatomical structures and extra - adrenal pathological conditions may produce ct images suggesting adrenal pathology where none actually exists. disorders of the adrenal gland result in classic endocrine syndromes such as cushing syndrome, hyperaldosteronism, and pheochromocytoma. in addition, tumors of the adrenals may present with abdominal pain or as an abdominal mass. the diagnosis of these disorders requires careful endocrine evaluation, and in many patients adrenal imaging studies are required to define adrenal anatomy. in our patient, pulse, blood pressure, renal function tests, serum cortisole, electrolytes, and urinary catecholamines were all normal. however, the tumor located below the right adrenal gland during operation and the diagnosis of renal cell carcinoma (rcc) depended on the histopathological examination. a mass arising in the upper pole of the kidney may be difficult to differentiate from an adrenal mass [1, 2 ]. additional examinations are usually necessary to confirm the nature of the lesion and to exclude the presence of life - threatening malignant disease. only 21 of 1000 specimens submitted for frozen section diagnosis were of genitourinary origin, which reflects the relatively low incidence of kidney lesions that necessitate surgery and the limited role of frozen section in the surgical management of these lesions. with the advancements in the diagnosis and treatment of renal tumors, f - fluro-2-deoxy - d - glucose positron emission tomography (fdg - pet) has proved to be valuable in the diagnosis and management of a variety of malignancies, but is still limited in providing detailed anatomical information. according to the literature, an adrenal incidentaloma with high fdg uptake usually indicates malignancy and requires further investigation. however, accurate localization of the adrenal gland in fdg - pet is difficult without the presence of surrounding well - visualized organs, such as the kidney or liver. if these organs have a congenital anomaly or are altered due to a previous operation, misdiagnosis can occur. a rare diagnosis when faced with a renal mass is that of an ectopic adrenal adenoma. distinguishing this entity from renal cell carcinoma has proven to be extremely difficult due to similarities in clinical presentation and radiologic findings typically, the diagnosis of an ectopic adrenal adenoma is only reached after surgical excision and careful pathologic examination. an ipsilateral adrenal mass in a patient with rcc is not uncommon and usually is a primary adrenal lesion rather than metastatic rcc. on the basis of takeda. study, i-131 cholesterol adrenocortical scintigrapgy is useful in the differentiation of adrenal and renal tumors when a large tumor occupies the upper pole of the kidney or adrenal gland. in fdg - pet, a normal right adrenal gland is barely visualized, whereas an adrenal lesion with intense fdg uptake usually represents malignancy [810 ]. finally, possible causes of the adrenal pseudotumors are as follows ; exophytic upper pole renal mass, abundant suprarenal fat, retroperitoneal tumor localized in the area of adrenal gland, prominent lobation of the hepatic lobe, or hepatic tumor, gastric diverticulum and redundant gastric fundus, fluid filled duodenum / colon, splenic lobulation, tortuous or dilated splenic arteries and veins, pancreatic tail in an unusual location or pancreatic tail mass, and focal thickening of adjacent diaphragmatic crus. although some of the imaging modalities like meticulous ct technique, mri (with emphasis on the usefulness of three - dimensional reconstructions) or intraoperative frozen section can help in the differentiation between large masses of adrenal and/or renal tumors, but the final diagnosis depends on the histopathological examination by skilled pathologists. in these instances, diagnostic pitfalls did not affect patient care, because these cases generally are candidates for adrenalectomy or radical nephrectomy. | there are a variety of causes of adrenal pseudotumors on computerized tomography (ct) scan, including upper - pole renal mass, gastric diverticulum, prominent splenic lobulation, pancreatic mass, hepatic mass, and periadrenal varices. we present a case of a large subhepatic mass that discrimination of its origin from neighborhood organs was difficult preoperatively. our patient was a 58 years old man, that three months after an unsuccessful operation in another center for a pseudoadrenal mass underwent a very difficult subcapsular tumorectomy in our center. |
avian influenza is a highly contagious viral disease of major concern to both the poultry industry and human health ; the currently ongoing outbreaks of h5n1 since 1997 have been unprecedented with over 500 million birds destroyed and over 303 humans dead. this development has ignited a global fear of imminent influenza pandemic. even though, adoption of vaccination policy as a targeted control or prevention measures has been generally discouraged by the scientific community. however, the need to boost eradication efforts in order to limit the spread of infections and ensure safety against international trade embargoes and avoid economic losses couple with the recent advances in dna technology has prompted a re - evaluation of both vaccine strategies and restrategising of diagnostic tool as an additional effort in the battling against highly pathogenic avian influenza control programme [13 ]. recent advances in molecular dna biotechnology of protein expression and production of recombinant viral protein using various expression systems are becoming popular, more acceptable, and efficient. the ease with which genes are manipulated to yield recombinant protein both for vaccines and diagnostics is fast revolutionalizing the industry. yeast has been endowed with the capacity for easy posttranslational modification of expressed polypeptides with ease. the use of methylotrophic yeast system for foreign protein expression is increasing dramatically, since the advent of the first world licensed genetically engineered vaccine antigen for hepatitis b for human in 1986 was prepared using yeast recombinant. in this study, we described the expression of aiv ns1 in pichia pastoris as an easy tool for generating efficient expression system that could have potential for serological diagnostics of aiv without compromising surveillance. inactivated influenza a / chicken/5858/malaysian 2004 (h5n1) was kindly provided by veterinary research institute, ipoh, perak, malaysia. trizol rna extraction method was employed in the extraction of the viral rna, under bls-3 condition. plasmid dna extraction and gel purification were employed in accordance with kits manufacturer 's instructions. the following primers were employed for rt - pcr : the sense primer p 1 and antisense primer f 5ctc ggc tcg agt atg gat tcc aac act gtg 3 and f 5gac tgc ggc cgc gct ctt atc tct tgc tcc 3. rt - pcr was performed under the following conditions : the reaction mixture contained in a final concentration of 1x of reaction buffer, 5 mm of mgcl2, 0.8 m of each primer (ns1 f & ns1 r), 0.1 mm of dntp, 2 u of amv reverse transcriptase, and 5 u of recombinant rnasin ribonuclease inhibitor and 100 ng of extracted rna template. the mixture was initially incubated as follows : briefly, at 45c for 50 min, reverse transcriptase denature at 94c for 5 min, chilled at 4c, the full denaturation at 94c for 2 min, at 94c for 1 min, 1 mins at 53c, 2 min at 68c for 40 circles of amplification, and 10 min at 68c for an additional extension. the pcr products of the full length of aiv a / chicken/5858/malaysian / h5n1 strain ns1 generated was purified using geneall gel sv kit (general biosystem, korea) and subsequently cloned into pcr 2.1 topo vector from topo ta cloning kit (invitrogen, usa) according to manufacturer 's instructions. the amplified products of the gene encoding ns1 and ppicza expression vector were digested and subcloned according to standard procedures. the sequence used for comparison or analysis in this study was a / chicken / malaysia/5858/2004 (h5n1) (dq321197.1) obtained from the genbank database. the nucleotides of the ns1 gene were compared with the published sequences from around the world. a 100% homology was obtained with a / chicken / malaysia/5858/2004 (h5n1) on ncbi blast (as shown below). the full length of influenza a / chicken / malaysia/5858/2004/(h5n1) ns1 gene of 801 bp in size was amplified by rt - pcr, sequenced, and cloned into pcr2.0 topo ta cloning vector (figure 1). purified dna clone of amplified full - length ns1 gene was inserted into the expression vector ppicza to generate a recombinant plasmid ppicza - ns1 (figure 2). after comparing the nucleotide sequence of ns1 gene derived from the recombinant plasmid ppicza - ns1, its deduced amino acid sequence was found to be ns1 of h5n1 strain with 100% homology, and the nucleotide sequence was found to be similar to that influenza a / chicken / malaysia/5858/2004 (h5n1) strain with 100% homology, as shown in (figure 4). immunoblotting results revealed the antigenic band of ~28 kda ns1 of hpai using polyclonal antibody against the 28 kda ns1 protein. these findings strongly suggested that this protein might be useful as potential antigen for diagnostics against natural / experimental hpai infections. this result also indicated successful expression of ns1 gene of avian influenza subtype h5n1 designated as gs115/ppicza / ns1, an approximately ~28 kda protein confirmed via western blot using ns1 polyclonal antibody (figure 3) and indirect elisa using purified recombinant ns1 protein as coating antigen (table 1). while avian influenza (ai) continues to remind us of one of the most fearful diseases threatening the poultry industry and human population, it has an economic burden and international trade impacts with serious embargoes ; it causes loss of production and productivity both on individual and the society [7, 8 ]. ns1 of the influenza virus is a highly conserved gene when compared with other encoded proteins, though it has poor antigenicity. previous study showed that within the influenza virion there was no ns1 protein, but it could be highly expressed by cells infected with influenza virus. therefore, birds vaccinated with inactivated vaccines did not produce nonstructural protein - specific antibodies, so ns1 antibodies are only presented in naturally infected birds ; therefore, this could provide a window opportunity for the differentiation between the vaccinated and the naturally infected birds, a major challenge to serological surveillance. in this study, we amplified and cloned the ns1 gene of an ai strain a / chicken / malaysia/5858/2004 (h5n1), into the ppicza eukaryotic expression system. the recombinant plasmid designated as gs115-ppicza - ns1 immunodetection using ns1 polyclonal in antibody in western blot (figure 3) further confirmed the antigenicity and correct folding of the recombinant protein. restriction enzyme digestion has been a method of choice when screening a lot of transformants. however, high zeocin concentration were used for screening of high copy no of positive pichia transformants. in conclusion, the ns1 gene of h5n1 subtype influenza a virus was successfully cloned and expressed via shake flask following methanol inductions. these results laid foundation as a preliminaries finding for developing an effective diagnostics marker for influenza a (h5n1) using recombinant dna technology. the inability to differentiate antibody due to either natural infection or vaccination has been a serious setback hindering the progress of surveillance programme by interfering with accuracy of diagnosis, and by extension this can affect the free market flow of poultry and poultry product at the international market, resulting in a trade embargoes enforcement. in the present study, it has been demonstrated that the ability to clone and express ns1 recombinant protein in a shake flask fermentation condition will offer an armful opportunity for the production of this ns1 recombinant protein that was shown to specifically bind ns1 polyclonal antibodies on western blot ; it has also shown a potentially promising result in an indirect elisa (table 1) using putative recombinant as coating antigen. it could differentiate between infected and vaccinated birds, in that ns1 antibodies could only be detected in natural / experimental infections. based on the above results, it has been clearly demonstrated that the difference between the positive and negative purified cell lysate samples is more than threefold difference ; therefore, it is envisage that this may have a good potential for diagnosis in the case of clinical or experimental infections or natural outbreaks, even though this might require further assay using field samples. previous studies had shown that a difference equal to or greater than threefold is enough to demonstrate the establishment of an infection, while the indirect elisa is ongoing trials and validation have been projected that this could be useful at quarantine stations, where only a single convalescent serum sample is obtained. this technology would offer a simple and less expensive diagnostic antigen with less hazardous contact with a whole viral particle commonly encountered in the conventional method. | avian influenza (ai) is a highly contagious and rapidly evolving pathogen of major concern to the poultry industry and human health. rapid and accurate detection of avian influenza virus is a necessary tool for control of outbreaks and surveillance. the ai virus a / chicken / malaysia/5858/2004 (h5n1) was used as a template to produce dna clones of the full - length ns1 genes via reverse transcriptase synthesis of cdna by pcr amplification of the ns1 region. products were cloned into pcr2.0 topo ta plasmid and subsequently subcloned into ppicza vector to construct a recombinant plasmid. recombinant plasmid designated as ppicza - ns1 gene was confirmed by pcr colony screening, restriction enzyme digestion, and nucleotide sequence analysis. the recombinant plasmid was transformed into pichia pastoris gs115 strain by electroporation, and expressed protein was identified by sds - page and western blotting. a recombinant protein of approximately ~28 kda was produced. the expressed protein was able to bind a rabbit polyclonal antibody of nonstructural protein (ns1) avian influenza virus h5n1. the result of the western blotting and solid - phase elisa assay using h5n1 antibody indicated that the recombinant protein produced retained its antigenicity. this further indicates that pichia pastoris could be an efficient expression system for a avian influenza virus nonstructural (ns1). |
invasive cervical cancer (icc) is the leading cause of cancer - related deaths among women in developing countries. it is the second most common cancer among women worldwide with an estimate of over 500,000 new cases and about 275,000 deaths in 2008. about 86% of these cases occur in developing countries representing approximately 15% of female cancers [2, 3 ]. however, the true incidence in many african countries is unknown as there is gross underreporting. many of the figures in literature are hospital - based, and these represent a small fraction of women dying from cervical cancer, as most women can not access hospital care and oftentimes die at home. mortality rates in developed countries with successful screening programs hardly exceed 5 per 100,000 women. in sub - saharan africa in 2002, survival rate was 21% compared with 70% and 66% in usa and western europe, respectively. in nigeria, the known primary underlying cause is the humanpapillomavirus (hpv), which is the most common sexually transmitted infection worldwide, and it is estimated that 50% to 80% of sexually active women are infected at least once in their lifetime. prevention of cancer of the cervix is achievable by preventing hpv infection and ensuring early detection and treatment which significantly reduces its morbidity and mortality. pap smear test is one of the most reliable and effective cancer screening tests available. about 75% of women in industrialized countries have been screened for cervical cancer in the previous five years, compared to less than 5% in developing countries. in sub - saharan africa, few women are ever screened for cervical cancer. screening coverage in developing countries is low ranging from 2.0% to 20.2% in urban areas and 0.4% to 14.0% in rural areas. low levels of awareness and poor knowledge of cervical cancer coupled with unavailability and inaccessibility of cervical cancer screening services are responsible for the very small number of women being screened in developing countries. lagos state has two tertiary and about 22 government owned secondary health care facilities where follow - up and treatment may be accessed for cases of positive pap smear results. this survey was undertaken to assess community perception and preventive practices on cervical cancer amongst residents of an urban neighborhood of lagos, nigeria. lagos state is located in southwestern nigeria and lies on longitude 3 24 e and latitude 6 27 n. lagos state has an estimated population of 15 million people. it is made up of 20 local government areas, and 37 local council development areas (lcda). olusosun is located in onigbongbo lcda of lagos and is an area known widely on account of the presence of the largest landfill in lagos state. a descriptive cross - sectional study design was used and the study population was selected among the residents of olusosun area. sample size was established such that an accuracy of 5% could be reached around an observed probability of 25%. a nonresponse rate of 10% (+ 29) was anticipated ; therefore, a total sample size of 317 was obtained. a medical outreach (consisting of free medical consultation and basic services) was conducted in june 2013 at olusosun community by resident doctors undergoing medical specialist (postgraduate) training at a tertiary health institution in lagos as part of the activities for the annual general week of the resident doctors involving elections, medical mission, and other programs. residents of the community had been sensitized about the program prior to the outreach to promote community participation in the event. the inclusion criterion is the condition that the respondents must be 18 years of age or above. a structured interviewer - administered questionnaire developed by the researchers (based on literature search) was used for data collection. this instrument was pretested in a different community close to the tertiary health institution to exclude ambiguities and administered by research assistants who had a day training to ensure lexical coherence as well as efficient and effective discharge of duties. the questionnaire sought information on sociodemographic details, perception, and preventive practices on cervical cancer. tests of significance were performed using a 95% confidence interval, and the level of significance was set at p < 0.05. outcome measures include perception of cervical cancer, knowledge of preventive practices, and proportion of respondents who had engaged in preventive practices. ethical clearance was obtained from the research and ethics committee and informed consent was obtained from each participant at the point of data collection. lagos state is divided into 20 local government areas (lgas) with a breakdown of 16 urban and 4 rural lgas. the findings might not be representative of the entire state (rural and urban combined), but it is fairly representative of the urban communities of lagos. see tables 1, 2, 3, 4, 5, 6, 7, and 8. the results from this study show that just over a third of respondents (37.2%) had heard about cervical cancer, with television (39%) being the commonest source of the information. this is quite low when compared to a cross - sectional survey of 650 women conducted in london, which showed that 76.2% of the participants perceived cervical cancer to be a common disease and were also aware of the risk factors for the disease. similarly, a yemeni study revealed that most respondents (80.6%) had heard about cervical cancer with a quarter of the respondents (26.4%) accessing this information from television. in africa, a study in kenya, to assess knowledge and practices about cervical cancer and pap smear testing among cervical cancer and noncancer patients, found that 51% of the respondents were aware of cervical cancer which is also higher than that obtained in the present study. sub - saharan africa which appears to be one of the most affected regions also has the lowest awareness rates about cervical cancer, as even lower rates were reported in cameroon where a study to assess the knowledge of cervical cancer showed that only 28% had prior knowledge of cervical cancer and another study in ibadan among women aged 20 to 65 years attending the general outpatient unit of a department in a tertiary hospital found that only 15% of the respondents had heard of cervical cancer [4, 16 ]. among rural women in a study conducted in osun state of nigeria, about 39.2% of the women had heard about cervical cancer which is also very similar to the findings in the present study. suboptimal awareness of cervical cancer is further demonstrated in the present study by the fact that only 5.1% of respondents who had heard of cervical cancer understood that hpv infection has been strongly implicated in its causality. correspondingly, none of the respondents in a study conducted in malaysia had heard of the hpv. the low awareness in these countries that have a greater share of cervical cancer deaths than high income countries is worrisome. in the midst of this, however, a favorable finding is that 84.5% of respondents are willing to attend a cervical cancer heath education program. this gives an indication that the population is willing to learn about cervical cancer and its prevention in at - risk groups. based on the minimal proportion of cervical cancer, informed respondents, it is not surprising that over 90% of the study participants were uninformed on ways of preventing cervical cancer with only 6% of all respondents having heard of the hpv vaccine. these are similar to the finding in a cross - sectional survey among college women in a university in ghana which showed that only 7.9% were aware of the link between humanpapillomavirus and cervical cancer. findings from the present study are also similar to those reported from an intervention study conducted among market women in lagos to evaluate the effect of health education on awareness and uptake of cervical cancer screening where only 6.9% and 12.0% of respondents in the study and control groups had heard about pap smears at baseline. these figures are quite low when compared with findings from the study conducted in yemen where a great majority (70%) of respondents were correctly informed that cervical cancer is preventable. proportions of 59% and 18% of participants in that study knew that routine screening by pap smear and vaccination against hpv infection are some methods for the prevention and control of cervical cancer. knowledge generally does not necessarily translate to practice in numerous cases as has been observed on certain occasions. for instance, despite the better awareness observed about cervical cancer prevention in the yemen study, preventive practices were low with only 19 (7%) of all those knowledgeable about cervical cancer reported having received cervical cytology testing (pap smear test). this is comparable to findings in the present study where among the respondents, who had heard of cervical cancer, only 8.5% had undergone a pap smear test and 6.8% had received the hpv vaccine. some limiting factors may include cost, availability of vaccines, and screening services as well as accessibility. contrarily, findings in developed countries such as uk showed that 80.5% of women in a study in london had undergone at least one pap smear test with 71.5% reporting regular smear tests (every 35 years). furthermore, screening practices were reported to be poor in a south african survey where in spite of good knowledge on cervical screening and readily accessible facilities with available screening services, the majority of women (87%) from higher social and educational backgrounds did not undergo cervical screening. in nnewi, nigeria it is interesting to observe that, among female health care workers who are expected to uptake innovative promotive and preventive health practices, the findings in the present study indicate that although awareness of cervical cancer and its prevention appear poor, there was a willingness to learn about this preventable cancer by all respondents. this can form the basis for improving awareness of at - risk groups and other stakeholders including the menfolk particularly in the light of the immense benefit of male involvement in reproductive health matters in lagos, nigeria, and africa as a whole. it is therefore very important to develop ways of ensuring that the message about cervical cancer and its prevention spreads to the grassroots across nigeria and sub - saharan africa to reduce the avoidable morbidity and mortality. in addition, primary and secondary prevention need to be emphasized in terms of health education, hpv vaccination, and cervical screening services which should also be made readily available and accessible in both rural and urban areas. | background. cervical cancer prevention in developing countries is suboptimal compared with the developed world where there are fewer deaths and improved survival rates. this study describes the perception and preventive practices on cervical cancer by residents of an urban neighborhood of lagos, nigeria. methods. a descriptive cross - sectional study was conducted on 317 consecutively recruited consenting participants at a medical outreach using a pretested, interviewer - administered, semistructured questionnaire. data analysis was done using statistical package for social sciences version 19. tests of significance were performed using 95% confidence interval with level of significance set at p < 0.05. results. the majority of respondents were within 3049 years of age (46.7%) and female (62.1%) and 70.3% had secondary level education and above. about 37.2% of respondents had heard about cervical cancer with 84.5% of the participants willing to attend a cervical cancer health education program. among the female respondents, 4.1% had received the hpv vaccine, while 5.1% had undergone a pap test. awareness about cervical cancer was significantly higher with increasing age in the total population (p < 0.05). conclusion. there is a need to improve awareness of at - risk groups and the menfolk about cervical cancer based on the immense benefit of male involvement in reproductive health matters. |
there currently is considerable interest in developing therapeutic strategies to enhance plasticity of the adult central nervous system (cns). physical exercise, diet, and various forms of environmental / cognitive enrichment have all been proposed to facilitate plasticity [14 ]. for example, the maturation and strength of gabaergic signaling act as a critical regulator of plasticity in cortical networks, with increasing inhibitory tone during postnatal development generally limiting plasticity [59 ]. consequently, manipulations aimed at reducing the strength of gabaergic transmission are thought to constitute promising candidate strategies to enhance plasticity of mature, less plastic cortical circuits [7, 8 ]. interestingly, recent reports have provided evidence for the notion that chronic treatment with the antidepressant and selective serotonin reuptake inhibitor (ssri) fluoxetine can reduce the strength of gabaergic inhibition and promote plasticity of forebrain synapses. for example, chronic (4 weeks) fluoxetine administration restored ocular dominance shifts in the primary visual cortex (v1) of adult rats, a form of developmentally regulated plasticity that is significantly reduced in the mature brain. in addition, fluoxetine treatment allowed v1 synapses to express greater long - term potentiation (ltp), an electrophysiological index of the ability of synapses to undergo an upregulation of synaptic strength. these plasticity - promoting effects of chronic fluoxetine administration appeared to be mediated by a decrease in intracortical inhibition and translated into significant behavioral effects, as assessed by the restoration of visual functions in a rat model of adult amblyopia. thus, chronic ssri treatment may offer significant, therapeutic potential for the restoration of plasticity to levels normally present only during the earlier stages of postnatal brain development. the notion that chronic ssri treatment can exert a prominent, facilitating effect on plasticity has also been supported by investigations employing structural and neuroanatomical measures. noted that, in rats, 14-day treatment with fluoxetine resulted in an increase in immediate early gene (c - fos) expression in the somatosensory cortex, together with an increased spine density of cortical pyramidal cells ; similar results have also been obtained in hippocampal pyramidal cells. finally, it is now well established that fluoxetine administration enhances neurogenesis in the hippocampal formation of adult animals [1416 ], an effect that appears to be a critical mediator of some of the behavioral effects seen with ssri treatment. the evidence summarized above indicates the potential of fluoxetine to affect plasticity of forebrain synapses. it is important to note, however, that some investigations have failed to detect beneficial effects (or noted adverse outcomes) of chronic fluoxetine treatment on plasticity or in animal models of several neurological diseases, some of which clearly involve deficient plasticity mechanisms (down syndrome, fetal alcohol syndrome, and neurotoxic brain damage) [1720 ]. consequently, there is a need for further, detailed investigations of the effects of ssri treatment on plasticity mechanisms across various forebrain networks. in the present study, we assessed the effect of chronic fluoxetine treatment on ltp in the thalamocortical auditory system between the medial geniculate nucleus (mgn) and primary auditory cortex (a1) of adult rats. ltp in this projection system shows a sharp, age - dependent decline over postnatal life, with high levels of ltp present during the first 5 - 6 weeks of postnatal life, but only modest levels after postnatal day (pd) 100. here, we tested whether chronic fluoxetine treatment of adult rats would restore ltp to levels normally seen only in juveniles, similar to the effects reported for plasticity in v1 of adult rodents. experiments were conducted on adult, male long - evans rats (obtained from charles river laboratories inc., saint - constant, qubec, canada ; 200250 g body weight or about 5055 days old at the arrival in the animal colony ; at least 9095 days old at the time of the electrophysiological procedures). rats were individually housed (cage dimensions 40 20 20 cm) with ad libitum access to food and water. the colony room was maintained under a reversed 12 /12 hour dark / light cycle (lights on at 7 pm). experimental procedures were performed in accordance with the published guidelines of the canadian council on animal care and approved by the queen 's university animal care committee. all efforts were made in order to minimize animal suffering and the number of animals employed for these experiments. all animals were allowed at least 1 week of acclimatization to the animal colony prior to the onset of fluoxetine treatment. the fluoxetine treatment regimen was the same as that described by vetencourt.. fluoxetine (capsules containing 10 mg fluoxetine hydrochloride, obtained from the kingston general hospital pharmacy, kingston, on, canada) was dissolved in the drinking water at 0.2 mg / ml and was available ad libitum ; control animals received drinking water without drug. drinking bottles were covered with cardboard or tinfoil to prevent photodecomposition of fluoxetine and were refilled every 48 hours. treatment continued for 4 - 5 weeks (mperiod = 4.5 and 4.7 weeks for fluoxetine and water rats, resp.), with fluid intake (every 48 hours) and body weight (every 7 days) recorded throughout the treatment period. electrophysiological assessments were carried out at the end of the treatment period (rat age of about 9095 days) and followed previously established procedures [21, 22 ]. rats were anesthetized using urethane (sigma - aldrich, oakville, on, canada ; 1.5 g / kg, given as three intraperitoneal (i.p.) injections of 0.5 g / kg each, every 20 min, further supplements as required to reach deep, surgical anesthesia). in addition, the local anesthetic marcaine (0.2 - 0.3 ml) was administered subcutaneously under the skin covering the skull. throughout the experiment after anesthesia induction, rats were placed in a stereotaxic apparatus, the skull was exposed, and small holes were drilled over the mgn (ap 5.5, l + 4.0, v 5.4 to 6.4) and the ipsilateral a1 (ap 4.5, l + 7.0, v 3.2 to 5.4, all measurements from bregma). additional holes over the cerebellum and frontal cortex were used to secure reference and ground connections (jewelry screws), respectively. a stimulation electrode (concentric bipolar electrode, sne-100, rhodes medical instruments, david kopf, tujunga, ca) was lowered into the mgn, and a recoding electrode (125 m diameter teflon - insulated stainless steel wire) was placed in a1. the final, ventral placement of both electrodes was optimized to yield the maximum amplitude of field postsynaptic potentials (fpsps) in a1 in response to single pulse stimulation of the mgn. signals were amplified (model 1800, a - m systems inc., carlsborg, wa, half - amplitude filter settings at 0.3 hz to 1 khz), digitized (at 10 khz using a powerlab/4s system, running scope software v.4.0.2, ad instruments, toronto, on, canada), and stored for subsequent offline analysis. stimulation (0.2 ms pulse duration) of the mgn was delivered by means of a stimulus isolation unit (ml 180 stimulus isolator, ad instruments). for each rat, a 30 min period following the final electrode adjustments was given to allow for stabilization prior to the onset of data collection. following stabilization, an input - output curve was generated by stimulating the mgn at successively increasing intensities (0.11.0 ma, in 0.1 ma increments). the intensity that elicited fpsps of 5060% of the maximal fpsp amplitude was chosen for the formal data collection. baseline fpsps were recorded every 30 s until a 30 min period of stable baseline recordings was established. subsequently, theta - burst stimulation (tbs) of the mgn was applied as trains of 10 bursts (delivered at 5 hz), with each burst consisting of five pulses at 100 hz. stimulation trains were repeated every 10 s for a total of four trains. this induction protocol has previously been shown to elicit reliable ltp in the thalamocortical auditory system in vivo [21, 22 ]. after the tbs delivery, fpsps were recorded for 60 min (every 30 s), followed by a second tbs episode (same as above) and a final 60 min of fpsp recordings. immediately after the experiment, rats were perfused through the heart with 0.9% saline, followed by 10% formalin. brains were extracted and immersed in formalin prior to sectioning (40 m) using a cryostat. the locations of all electrodes were examined using standard histological techniques and only animals with accurate placements were included in the analysis of the electrophysiology data. the fpsp amplitude was computed offline by scope software (v.4.1.1, ad instruments). values for each rat were averaged over 10 min intervals and these averages were normalized by dividing them by the averaged baseline (pre - tbs) amplitude of that animal. data were statistically evaluated by repeated measures analysis of variance (anova) and, if statistically appropriate, simple effects tests using the clr anova software package (v.1.1, clear lake research inc., houston, tx). note that the results of all statistical analyses are reported in the appropriate figure captions. for a 4-week period, rats were given access to drinking water (n = 18) or drinking water containing fluoxetine (0.2 mg / ml ; n = 20). during this period, weight gain was significantly reduced in rats given access to fluoxetine relative to control (water) animals (figure 1(a)). the total weight gain from week 0 (before treatment onset) to week 4 was 37 3% and 54 + 3% for fluoxetine and water animals, respectively, findings that are consistent with the substantial literature demonstrating appetite - suppressant effects of fluoxetine treatment [19, 20, 23 ]. fluoxetine also reduced water intake (figure 1(b)), with fluid consumption over 48 h averaging 31 1 ml and 51 3 ml in fluoxetine and water animals, respectively. after 4 - 5 treatment weeks (4.5 and 4.7 weeks for fluoxetine and water animals, resp.), each rat was anesthetized with urethane to allow for the placement of a stimulating and recording electrode in the mgn and a1, respectively (figure 2(a)). consistent with previous wok [21, 22 ], extracellular recordings in the middle layers (iii / iv) of a1 revealed that single pulse stimulation of the mgn elicited fpsps consisting of two negative - going components with peak latencies of about 68 and 1416 ms, respectively (figure 2(b)). previous work using current - source density analysis and pharmacological approaches has revealed that these two negative peaks correspond to current sinks associated with the sequential activation of direct, thalamocortical synapses (layer iv ; first fpsp peak) and subsequent, intracortical synapses (layers ii / iii ; second fpsp peak) [22, 24 ]. it is important to note that the urethane dose required for deep, surgical anesthesia did not differ significantly between the two groups of animals, with water and fluoxetine rats receiving a final dose of 2.12 0.09 and 2.07 0.06 g / kg of urethane, respectively (figure 2(c)). thus, chronic fluoxetine treatment did not appear to alter the response to urethane anesthesia. initially, fpsps elicited by single - pulse mgn stimulation were recorded for 30 min in order to establish a measure of baseline synaptic strength prior to ltp induction. stimulation intensities used for the two groups of animals did not differ significantly, with mgn stimulation pulses of 0.48 0.04 ma and 0.5 0.02 ma for water (n = 11) and fluoxetine (n = 14) animals, respectively (figure 2(d)). further, the amplitude of baseline fpsps did not differ between the treatment groups, with the amplitude of the first peak at 1.05 0.15 mv and 1.0 0.15 mv in water and fluoxetine animals, respectively (figure 2(e)). the amplitude of the second fpsp peak was 0.48 0.07 mv and 0.59 0.08 mv in the water and fluoxetine group, respectively (figure 2(f)). it is noteworthy that the amplitude difference between the two groups amounts to 23%, even though the statistical analysis did not indicate this effect to approach significance (p = 0.3). following the completion of baseline recordings (30 min), two episodes of tbs were delivered to the mgn, each followed by 60 min of fpsp recordings. in water animals, tbs resulted in successful ltp induction, with the first tbs episode resulting in a potentiation of the first and second fpsp peak to 115% and 123% of baseline, respectively (figure 3 ; all values reported here are mean values for recordings taken between 3160 min after tbs delivery). the second tbs episodes resulted in further potentiation in water animals, with the two peaks reaching 120% and 135% of baseline (figure 3). in fluoxetine animals, tbs also resulted in ltp, but the amplitude of the first and second fpsp peak reached only 111% and 110% of baseline, respectively, following the first tbs episode (figure 3). further, after the second tbs, both peaks reached only 113% of baseline (figure 3). thus, fluoxetine animals showed less potentiation than that seen in the water group, an effect that was significant for the second fpsp peak representing intracortical synapses (see caption for figure 3). as mentioned, the second fpsp peak in fluoxetine rats exhibits a baseline amplitude 23% higher than that seen in water animals. even though this effect did not reach statistical significance, it might nevertheless indicate a minor enhancement of intracortical synaptic strength following chronic fluoxetine exposure. such an enhancement may act to limit (occlude) further ltp induction by tbs delivery. in order to assess this possibility, we performed additional analysis by plotting and correlating baseline fpsp amplitude against levels of ltp for the second fpsp peak in all fluoxetine animals (figure 4). however, correlations using either raw or rank - ordered data (figure 4) both failed to indicate a significant relation between baseline fpsp amplitude and subsequent potentiation induced by tbs in fluoxetine rats. with the present experiments, we examined whether chronic fluoxetine treatment alters ltp of synapses in the mature a1 of adult rats. several recent reports have provided support for the notion that chronic fluoxetine treatment leads to an enhancement of plasticity in the adult cns [7, 10, 1214, 25 ]. in contrast to these findings, we found no evidence of an upregulation of plasticity at a1 synapses. in fact, there was a clear suppression of ltp in fluoxetine - treated rats, in particular for the second peak of the cortical fpsp, thought to reflect synaptic currents originating at intracortical synapses in a1 (see below). previous work has shown that, in rats, fpsps elicited by mgn stimulation in vivo typically consist of two distinct, negative peaks that correspond to current sinks associated with the successive activation of thalamocortical and intracortical a1 synapses, respectively [22, 24, 26 ]. for both sets of synapses, ltp induced by thalamic stimulation shows a clear, age - related decline, with significant potentiation present up to pd 50, modest ltp around pd 100 (about the time ltp was assessed in the present study), and very little or no ltp after pd 200 [21, 24 ]. as such, ltp in the rat thalamocortical auditory system provides an appropriate model to study the developmental decline of plasticity in a central sensory system. the present data confirm that adult rats show modest levels of plasticity under the present experimental conditions, with thalamocortical and intracortical synapses expressing ltp of about 120% and 135% of baseline, respectively. surprisingly, rats given chronic fluoxetine showed less ltp, with both thalamocortical and intracortical synapses expressing potentiation of only 113% of baseline, respectively, observations that are indicative of an inhibition of ltp induction mechanisms, especially for intracortical synapses in a1. the results summarized above regarding ltp in control animals are consistent with previous work, which has also shown that intracortical synapses in the adult a1 show higher ltp levels relative to thalamocortical synapses [21, 22, 24 ]. interestingly, receptive field plasticity of a1 neurons (i.e., shifts in the optimal response to different sound frequencies) also occurs by a potentiation of intracortical but not thalamocortical synapses, suggesting that the ltp measured here plays a direct role in receptive field plasticity and associated changes of the tonotopic map present in a1. consequently, it is possible that chronic fluoxetine exposure may also impair a1 receptive field shifts in rodents, a hypothesis that clearly requires examination. we employed the same fluoxetine dosing regimen (0.2 mg of fluoxetine in 1 ml of drinking water) as that used in previous work showing a restoration of ocular dominance plasticity and enhancement of ltp in v1 slice preparations obtained from adult rats. in the present investigation, rats in the fluoxetine condition consumed an average of about 15.5 ml of fluid every 24 hours, equaling an intake of about 3.1 mg of fluoxetine. this drug amount corresponds to a daily dosage of about 10.7 mg / kg and 7.9 mg / kg of body weight at the beginning (body weight of about 290 g) and the end (390 g) of the treatment period, respectively. these dosages are very similar to those used in previous chronic administration studies demonstrating behavioral and/or neurochemical effects following fluoxetine treatment [10, 17, 19, 28 ]. in our experiments, fluoxetine reduced body weight gain during the treatment period, a classic effect of ssri treatment [17, 19, 20, 23 ]. in addition, we also noted a suppression of water intake, also consistent with the results of previous work. together, these results confirm the bioavailability and bioactivity of fluoxetine, as administered in the present investigation. while fluoxetine has been suggested to enhance plasticity of the mature cns, empirical evidence assessing this contention has been inconsistent. stewart and reid noted that 15-day treatment with fluoxetine reduced levels of ltp in the dentate gyrus of anesthetized rats, and inhibitory effects on hippocampal (area ca1) ltp in rats have also been reported for acute (single - dose) fluoxetine treatment. an elegant, recent investigation revealed that a chronic (4 week) fluoxetine regimen resulted in deficits in the induction of ltp in the hippocampal ca1 field of adult rats, while dentate gyrus ltp was intact. interestingly, the same authors also noted a disruption of ltd, which again was specific for the ca1 field. the ltd impairment is of significance since it suggests that any observed reduction in ltp is unlikely to be related exclusively to an upregulation of synaptic strength following long - term fluoxetine exposure (see). typically, such an effect reduces ltp but yields greater ltd, due to the fact that enhanced synaptic connectivity represents a potentiated state, which limits further potentiation but leaves greater room for synaptic weakening [3133 ]. it will be important for future work to assess whether chronic fluoxetine impairs or facilitates ltd induction in areas other than the hippocampal formation. the present experiments did not provide reliable evidence for an upregulation of a1 synaptic strength following chronic fluoxetine, with baseline fpsp amplitudes showing no significant differences between the two treatment groups. previous work has found evidence for an enhancement of field potential strength in rats after fluoxetine administration in both the dentate gyrus and ca1 field [17, 30 ], even though a lack of fpsp facilitation in the rat dentate gyrus has also been reported. it is noteworthy, however, that the second fpsp peak was 23% larger in fluoxetine rats relative to water animals, in particular since this value is very similar to the reduction of ltp for the second fpsp peak in the fluoxetine group (135% and 113% potentiation in water and fluoxetine rats, resp., we carried out additional analyses to assess whether greater baseline fpsp amplitude was related to lower levels of tbs - induced ltp, suggestive of an occlusion - like effect of chronic fluoxetine in ltp. however, these analyses did not provide any suggestion of an association between baseline fpsp amplitude and subsequent ltp magnitude. we can not rule out that such a relation, or a significant difference in baseline synaptic strength, may emerge with larger sample sizes or alternative methodologies to study synaptic connectivity and plasticity in a1 (e.g., optical imaging or in vitro approaches). it is also possible that some cns regions (e.g., hippocampal formation) exhibit greater sensitivity to the potential, neurotrophic effects elicited by fluoxetine than areas such as the primary sensory fields of the neocortical mantle. previous work has shown that local application of an nmda receptor antagonist directly in a1 of rats blocks the induction of ltp elicited by mgn stimulation in vivo [22, 34 ]. it is well documented that the precise subunit composition of the nmda receptor exerts profound effects on ltp induction by altering the level of calcium influx across the postsynaptic membrane. receptors containing the nr2b subunit exhibit prolonged channel opening duration and greater calcium influx relative to nr2a - expressing receptors, effects that lead to enhanced ltp induction [21, 22, 3537 ]. interestingly, in rats, chronic fluoxetine exposure can alter nmda subunit composition by increasing the relative expression of nr2a subunits, raising the possibility that this effect contributes to the reduction of ltp noted here and in previous work [17, 30 ]. future work is required to examine this hypothesis and delineate the precise mechanisms that mediate the effects (facilitating and inhibitory) of long - term fluoxetine exposure on the induction of different forms (e.g., structural and physiological) of cns plasticity. in recent years, there has been considerable excitement regarding the potential of various ssris to enhance cns plasticity [7, 8, 10, 14, 39 ]. not only have the plasticity - promoting actions been suggested to mediate mood - enhancing effects [1416, 39 ], but ssris may also facilitate plasticity and functional recovery in neurological conditions unrelated to mood disorders (e.g., [7, 10, 1820 ]). while some evidence is clearly supportive of this notion [10, 12, 13, 25 ], the present study confirms and extends previous investigations that have failed to detect an enhancement of plasticity following chronic fluoxetine treatment [17, 30 ]. in fact, both electrophysiological (ltp) and structural investigations are compatible with the view that fluoxetine exposure can result in a strengthening and stabilization of synaptic connectivity, which reduces the ability of neurons to express further plasticity [12, 13, 30, 38 ]. thus, the effects of fluoxetine on plasticity appear to be complex and bidirectional, findings that clearly require consideration when discussing the use of fluoxetine and other ssris for the modulation of plasticity of the mammalian forebrain. | several recent studies have provided evidence that chronic treatment with the selective serotonin reuptake inhibitor (ssri) fluoxetine can facilitate synaptic plasticity (e.g., ocular dominance shifts) in the adult central nervous system. here, we assessed whether fluoxetine enhances long - term potentiation (ltp) in the thalamocortical auditory system of mature rats, a developmentally regulated form of plasticity that shows a characteristic decline during postnatal life. adult rats were chronically treated with fluoxetine (administered in the drinking water, 0.2 mg / ml, four weeks of treatment). electrophysiological assessments were conducted using an anesthetized (urethane) in vivo preparation, with ltp of field potentials in the primary auditory cortex (a1) induced by theta - burst stimulation of the medial geniculate nucleus. we find that, compared to water - treated control animals, fluoxetine - treated rats did not express higher levels of ltp and, in fact, exhibited reduced levels of potentiation at presumed intracortical a1 synapses. bioactivity of fluoxetine was confirmed by a reduction of weight gain and fluid intake during the four - week treatment period. we conclude that chronic fluoxetine treatment fails to enhance ltp in the mature rodent thalamocortical auditory system, results that bring into question the notion that ssris act as general facilitators of synaptic plasticity in the mammalian forebrain. |
glycogen storage diseases (gsd) are a group of disorders caused by alteration of the enzymes involved in glycogen metabolism, producing an accumulation of glycogen in several tissues. the most frequent type of glycogen storage disease is gsd ix, which incidence is 1:100,000 births and is responsible for 25% of all gsd cases. gsd ix is caused by defects in the activity of the phosphorylase kinase complex (phk, e.c. 2.7.1.38), which plays a critical role in regulating glucose release from glycogen, causing an excess of glycogen storage. patients with gsd ix generally present hepatomegaly, short stature, raised transaminases and triglycerides and sometimes ketotic hypoglycemia in early childhood. phk is a decahexameric enzyme composed by four subunits :,, and. subunits and have regulatory functions, the -subunit has catalytic function and -subunit is identical to calmodulin. subunit has two isoforms encoded by two different genes : phka1 and phka2, which encode the muscular and liver isoforms, respectively. subunits, and are encoded by phkb, phkg2 and calm1, respectively. phka1 and phka2 deficiencies are x - linked, while phkb and phkg2 deficiencies are inherited according to an autosomal recessive pattern. the most common gsd ix subtype is the subtype ixa, caused by mutations in phka2, accounting for approximately 75% of cases. gsd ixa has been split biochemically in two further types : ixa1 (gsd9a1) with loss of phk enzyme activity in peripheral blood cells and liver tissue, and ixa2 (gsd9a2) with normal phk activity in blood cells., patients with gsd ixa, can develop growth retardation, hepatomegaly, and ketosis with or without hypoglycemia, increases in triglycerides, cholesterol and transaminases. therefore, gsd ixa has been described as a benign form since often does not need treatment. however, genetic variants in phka2 are associated with a broad phenotypic spectrum and even cases of cirrhosis have been described. the first reported case was a white 18 months old boy who had micronodular liver cirrhosis and presented the mutation p.arg298pro. later reviews have described more patients with hepatic fibrosis at diagnosis who presented mutations in phka2. other uncommon phenotypes have been reported in the literature, such as kidney dysfunctions due to renal tubular acidosis and cns affectation with delayed cognitive and speech abilities as a result of phka2 pathogenic variants. to date the human gene mutation database (hgmd) has reported over 80 mutations in phka2 associated with gsd ixa, including missense, splicing, small deletions, small insertions and gross deletions variants. in this paper the patient of spanish origin was born after 40 weeks and 5 days of gestation by normal vaginal delivery. the paternal great - grandmother, two brothers of the great - grandmother and one sister of the grandmother had transaminase elevation. his birth weight was 3.450 kg and birth length 50 cm. from 8 months onwards failure to thrive was noted and at age one year a routine laboratory analysis revealed an increase in liver enzymes. subsequent analysis showed : alt 113(1049 u / l) and ast 134(037 u / l). he showed hepatomegaly and, slight hyperechogenicity. a complete biochemical profile done at 2 years 5 months, revealed the following results : glucose 52 mg / dl (60100), total cholesterol (tc) 228 mg / dl (40), ldl - c 166 (a, p.(glu655lys) in phka2 exon 18. 1). in silico analysis showed two possible consequences of this change : first, a missense change in the amino acid glutamate to lysine in position 655 of the protein p.(glu655lys). two out of five predictors of pathogenicity classified this variant as damaging or possible damaging (fasthmm 2.68 (s 2.45 conserved), phastcons (placenta) 0.96 (range 01), phastcons (vertebrate) 1 (range 01), phylop (placenta) 2.5620 (score 2) and phylop (vertebrate) 3.3290 (score 2).second, since the mutation affects the last coding nucleotide of phka2 exon 18 ; the splicing predictors maxentscan, nnsplice, genesplicer, human splicing finder - like revealed that this variant may disrupt canonical splice donor site of exon 18, probably resulting in an aberrant protein. splicing predictions at nearest natural junction predicted a decreased splicing efficiency at the canonical donor site by 68,9%. the variant was absent in the mother, thus, it is likely to have arisen as de novo event. first, a missense change in the amino acid glutamate to lysine in position 655 of the protein p.(glu655lys). two out of five predictors of pathogenicity classified this variant as damaging or possible damaging (fasthmm 2.68 (s 2.45 conserved), phastcons (placenta) 0.96 (range 01), phastcons (vertebrate) 1 (range 01), phylop (placenta) 2.5620 (score 2) and phylop (vertebrate) 3.3290 (score 2). second, since the mutation affects the last coding nucleotide of phka2 exon 18 ; the splicing predictors maxentscan, nnsplice, genesplicer, human splicing finder - like revealed that this variant may disrupt canonical splice donor site of exon 18, probably resulting in an aberrant protein. splicing predictions at nearest natural junction predicted a decreased splicing efficiency at the canonical donor site by 68,9%. the variant was absent in the mother, thus, it is likely to have arisen as de novo event. gsd ix is considered as a benign condition, due to the fact that the patients may become asymptomatic when they grow up and frequently the treatment is not necessary. however, recent studies have shown that untreated children may develop undesirable effects such as morning sickness, which could affect their school performance, and growth delay, which may result in psychological distress. in adult patients the risk of bone fracture may be higher due to the reduced bone density secondary to delayed puberty. in this study we identified a novel phka2 variant in in a patient with clinical suspicious of gsd. the patient showed a wide range of associated clinical features : hepatomegaly, growth delay, muscle weakness, fasting ketosis and high levels of liver enzymes and total cholesterol.. genetic analysis of phka2 identified a hemizygous missense variant nm_000292.2(phka2):c.1963 g > a, p.(glu655lys) in exon 18, which could explain this phenotype. in silico analysis revealed the possible pathogenicity of this variant. bionformatics tools for predicting splicing effects showed that this variant disrupts exon 18 canonical splice donor site, probably resulting in an aberrant protein. according to the acmg criteria for variant classification we classify this variant as pathogenic. gsd ix is a significant subgroup of gsds, however its biochemical and genetic diagnosis has been complicated due to its genetic heterogeneity and phenotypic overlapping with others gsds. normoglycemic ketonemia is a usual biochemical feature in patients with gsd types vi and ix, and ketonemia can occur with hypoglycemia in all gsd types. therefore, gsd vi and gsd ix must be incorporated into the differential diagnosis of ketotic normoglycemia, and kb (kb is the sum of blood acetoacetate and -hydroxybutyrate concentrations) must be regularly measured in ketotic gsd patients. also the clinical manifestations of gsd ix practically overlap with those of gsd vi except for the inheritance pattern. as a result of this, the novel phka2 variant identified in this study confirms the diagnosis of gsd ix allowing the differential diagnosis with regard to other types of gsd. phka2 missense mutations can affect the n - terminal glucoamylase domain or the c - terminal calcineurin b - like domain. variants associated with n - terminal domain principally lead to gsdixa2 and are clustered into the predicted active site of the phk. they might have a direct impact on the predicted hydrolytic activity of the subunit. the variants at the c - terminal domain lead to gsdixa1 and are clustered in the region predicted to interact with the regulatory domain of the catalytic subunit in a region covering this interaction site leading to unstable phk complex or less regulated holoenzyme. in our patient, it was not possible to distinguish between gsdixa1 and gsd1xa2 since the enzymatic assays was not available. moreover, we can not predict whether the variant c.1963 g > a, p.glu655lys is affecting n - terminus or c - terminus domain. we can conclude that all in silico tools predict a deleterious impact on protein function and genetic test helps avoiding the use of much more invasive techniques such as quantification of glycogen content and pkh activity in liver biopsy samples. | glucogenosis type ix is caused by pathogenic variants of the phka2 gene. herein, we report a patient with clinical symptoms compatible with glycogen storage disease type ixa. pygl, phka1, phka2, phkb and phkg2 genes were analyzed by next generation sequencing (ngs). we identified the previously undescribed hemizygous missense variant nm_000292.2(phka2):c.1963 g > a, p.(glu655lys) in phka2 exon 18. in silico analyses showed two possible pathogenic consequences : it affects a highly conserved amino acid and disrupts the exon 18 canonical splice donor site. the variant was found as a de novo event. |
thus, vision loss is a major medical, economic, safety, and social issue affecting millions of persons worldwide. neurodegenerative diseases of the retina involve progressive and irreversible loss of retinal neurons, their connections and supporting glia, thereby leading to impaired visual function. major neurodegenerative eye diseases include glaucoma and age - related macular degeneration. despite being major causes of disability, limited effective therapeutic methods for treating these neurodegenerative eye diseases exist which, at best, slow down the neurodegenerative progression. until now, no therapeutic option has been proven to successfully reverse or cure vision loss from these neurodegenerative eye diseases, especially glaucoma. although glaucoma is a group of aetiologically heterogeneous optic neuropathies, all glaucomas are associated with dysfunction and the eventual death of retinal ganglion cells (rgcs), resulting in degeneration of optic nerve and ultimately loss of vision. therefore, preserving the rgcs and the optic nerve, both structurally and functionally, is vital for the treatment and possible cure of glaucoma and other neurodegenerative eye diseases. however, similar to other central nervous system (cns) tracts in mammals, the injured optic nerve has very limited regenerative capacity due to the weak intrinsic capacity of adult neurons to reactivate a growth program after injury and the presence of an inhibitory neuronal tissue environment in the adult cns. in order to slow the progressive decline in visual function caused by neurodegenerative eye diseases or even restore vision function, a lot of effort has been devoted toward three major avenues of engagement : cell based therapy, neuro - regeneration and neuro - rejuvenation, which will be discussed in detail later. a better understanding of these approaches will provide insight into the cure of neurodegenerative eye diseases and bring hope to those patients who suffer from vision loss. three general approaches have been commonly suggested to overcome the barrier of neuronal repair in the ocular system (figure 1). one approach involves introducing stem cells into the degenerating retina to replace dead neuronal cells. alternatively, the retinal neuronal growth program might be stimulated in adult neurons, allowing them to overcome the inhibitory environment and grow new dendrites and axon often termed neuro - regeneration. and last, we propose what we believe to be the most promising and practical approach : enhancing the function of existing rgcs with established visual neuropathways which we term neuro - rejuvenation stem cell therapies function as paracrine - mediated treatments with trophic factors (black symbols) secreted from transplanted cells (blue cells) protecting injured retinal ganglion cells (rgc, red cells). however, most of injected cells remain in the vitreous cavity and do not or poorly integrate into existing neuronal circuits. neuro - regeneration involves stimulating intrinsic growth programs in adult neurons to overcome inhibitory environmental cues in the cns. the injured optic nerve can be stimulated to produce new axonal fibers which migrate incorrectly toward the retina and toward wrong targets. the green newly formed axon ends in an ipsilateral tract which is supposed to join the contralateral tract (solid green dots). neuro - rejuvenation enhances the function of existing rgcs with established neuropathways by stimulating the creation of super rgcs. increased neuronal activity and communication among the existing rgcs can enhance signal to noise ratios and retinal ganglion cell function and neuronal survival. most current ocular cell transplantation treatments function as paracrine - mediated therapies in which retinal cell - derived trophic factors protect injured endogenous retinal neurons (i.e., retinal pigmented epithelium cell transplantation ; figure 1). however, a successful stem cell treatment for neurodegenerative eye diseases must include not only the replacement of degenerated neurons, but also the correct restoration of neural circuits in a one - to - one correspondence. one major hindrance to successful retinal stem cell transplantation is that differentiation of stem cells into retinal neurons from transplanted stem cells has not been widely achieved in vivo, much less restoring a correct neural circuity. for example, rgc cell death protection and neurite growth, induced by bone mesenchymal stem cells (bmscs), were reported to be mediated by platelet - derived growth factor (pdgf), nerve growth factor (ngf), brain - derived neurotrophic factor (bdnf) and neurotrophin-3 (nt-3) (mead. transplantation of bmscs into the vitreous cavity after optic nerve transection demonstrated no evidence of their differentiation into mature retinal neurons and bmscs remained static in the vitreous instead of integrating into the rgc layer. transplanted cells that do not integrate into the retina can not communicate with existing neural circuits and have only relatively short lifespans without cell to cell contact or cellular adherence. thus, the beneficial effect of transplanted stem cells is unlikely to be long lasting, if any. embryonic stem cells (escs), which can successfully express mature rgc markers after intravitreal injection into n - methyl - d - aspartic acid (nmda) damaged retinas (aoki., 2008), are also potential candidates for stem cell therapy. however, only a small percentage of transplanted escs appear to integrate into the rgc layer. most escs appear to form abnormal structures, including teratomas and multi - rgc layers, and no visual evoked potentials (veps) were detected in nmda - exposed animals after escs transplantation treatment suggesting transplanted escs are few or unable to produce any electrical signals upon intravitreal injection. in addition, transplanting escs are not equivalent to transplanting differentiated adult retinal cells for cellular transplantation and replacement. aside from the physical barriers of transplanting retinal cells, a major and critical challenge that needs to be addressed with stem cell therapy is the altered retinal system caused by the degenerative neuronal disease (cuenca., changes to the resting state of the damaged retina may exist, which would affect the function of transplanted cells and the existing cells. for example, the ocular system has immune privilege which can be compromised in disease states. an important aspect of cellular transplantation into the eye that needs to be taken into serious consideration is the possibility of immune rejection and the development of sight threatening uveitis. transplanted stem cells may also differentiate into unpredictable phenotypes under disease states, unlike phenotypes characterized in vitro, and may express abnormal cytokine profiles when surrounded by different retinal cell types unlike the uniform cell types observed in vitro under laboratory and non - physiological conditions. also, uncontrolled cell growth and migration within the cns neuropil and possible oncogenesis (due to the loss of normal growth and regulatory pathways in stem cells) possible challenges for stem cell therapy the protection and/or restoration of vision loss in neurodegenerative eye diseases. the injured optic nerve, in glaucoma patients for example, can not intrinsically regenerate (quigley, 1999). the lack of adequate stimulation and growth responses by adult neurons to overcome inhibitory molecules in the cns tissue are the important impediments to axonal regrowth. overstimulating the retinal growth program may overcome this barrier and alleviate the decline toward retinal cell death signals. two key pathways have been identified to be able to promote significant axonal growth in vivo. upregulation of ciliary neurotrophic factor (cntf) or activation of downstream signal transducer and activator of transcription 3 (stat3) in adult rgcs after injury was sufficient to promote robust axonal regeneration in vivo (muller., 2007 ; pernet., 2013b). both molecular approaches elicited long - distance growth of injured optic nerves, near or up to the optic chiasm. the effect of upregulated cntf can be further enhanced by the elevation of cyclic amp (camp) (cui., 2003). deletion of the suppressor of cytokine signaling (socs)3, which is involved in the negative feedback loop of stat3 activation, was also able to achieve comparable extent of axonal growth (smith. mammalian target of rapamycin (mtor) is a central regulator of growth in all cell types. deletion of two upstream repressors - phosphatase and tensin homolog (pten) and tuberous sclerosis (tsc)1/2 - selectively in retinal ganglion cells after optic nerve crush strongly stimulated axonal regeneration up to 4 mm (park. synergistic treatment that inducing controlled inflammatory response in the eye, when combined with elevation of intracellular camp and deletion of the gene encoding pten enabled rgcs to regenerate axons to the full length of the optic nerve in mature mice ; even a rare subset of axons managed to enter the brain (kurimoto. however, under such high level of local growth stimulation, massive axonal sprouts formed and grew randomly in a dense plexus that covered the inner surface of the retina and blood vessels (pernet., 2013a). unfortunately, an unexpected regeneration pattern was also observed in the injured optic nerve : the return of many new fibers toward the retina and pronounced axonal misrouting at the optic chiasm (figure 1). in the stat3 group, 40% of axons showed u - turns, and this was also observed in co - activation of mtor and stat3 (pernet. more than half of all fibers joined the ipsilateral tract in the pten and socs3 double - knock out mice, whereas the percentage should be lower than 5% in normal mice (luo., 2013). vision function recovery requires re - innervation of the correct corresponding region in the occipital cortex by the appropriate types of retinal axons. even if some of the few regenerated fibers extended beyond the chiasm and terminated in the vicinity of the closest target, it is still doubtful that they will reach the correct target (luo., 2013) (figure 1). vision would be much worse if connections are made to a wrong target and present a false image similar to cell phones with the wrong ip addresses communicating with the wrong cell towers. compared to the other two approaches for restoring vision, neuro - rejuvenation is the most practical and most accessible approach to preserve and enhance vision by taking advantage of existing neuronal connections to produce an enhanced true image, protect retinal ganglion cells through elevated intrinsic activity which enhances signal to noise ratios, and enhance retinal ganglion cell function (figure 1). instead of focusing on rescuing dying retinal neurons or replacing them with transplanted neurons, the existing dysfunctional and healthy neurons and neuronal networks are the main therapeutic target. one major technical barrier to neuronal transplantation is the lack of the correct neuronal circuitry through each of the relays (i.e., superior colliculus, lateral geniculate nucleus, occipital cortex), to produce a real image versus many bright spots that do not correspond to an image, but only to the location of the transplanted cells assuming they can even make connections as far as the optic chiasm. neuro - rejuvenation is based upon the concept that electrical activity is essential for neuronal survival and axonal growth. trans - corneal electrical stimulation (tes) promotes both axonal regeneration and survival of rgcs after optic nerve crush (tagami., 2009). axon regeneration mediated by insulin - like growth factor (igf-1) receptors can be blocked by igf-1 receptor antagonists. furthermore, visual evoked potential (vep) amplitudes impaired by optic nerve crush can be increased by tes stimulation, indicating functional visual recovery (miyake., 2007). however, compared to traditional electrical stimulation which causes unintended side effects or even may be detrimental to neighboring cells, optogenetic stimulation has significant advantages, such as cell - specific targeting and excellent spatiotemporal resolution reaching millisecond - timescales of activation. optogenetics combines the use of genetic and optical techniques to modulate activity in targeted cells or tissues. by genetically introducing wavelength - specific modular light - gated ion channels and pumps to targeted neurons, optogenetics offers a noninvasive method of excitation and suppression in existing correctly neuronally linked excitable cells and tissues in vivo. recently, different groups have achieved neuronal protection and axonal regeneration by optogenetic stimulation under various conditions, which offers a promising and practical approach to protect vision loss in neurodegenerative eye diseases, not through cell replacement, but by enhancing the function of existing neuronal cells. subcellular calcium release by ryanodine receptor (ryr) is required for neuronal regeneration in c. elegans and this can be enhanced by optogenetic stimulation (sun., 2014). damaged neurons were depolarized by the activation of channelrhodopsin-2 (chr2), resulting in calcium influx via l - type voltage gated calcium channels (vgccs). the increased calcium flux triggered additional calcium concentration elevation from the endoplasmic reticulum via ryr channels, effectively amplifying the innate calcium signal to enhance axonal regeneration. optogenetic stimulation has also been shown to successfully promote nerve growth in dorsal root ganglion (drg) cell cultures, which is attributed to the increased secretion of ngf and bdnf (park., 2015). this was verified by the directional bias in the outgrowth of wild - type drgs in the presence of stimulated chr2-drgs. recently, optically - induced neuronal activity has been demonstrated to sufficiently promote functional motor axon regeneration in vivo. thy1-chr2-yfp transgenic mice, in which a subset of motor neurons expresses chr2, received blue light stimulation immediately prior to transection and surgical repair of the sciatic nerve. compared to animals without blue light stimulation, mice that received optogenetic stimulation had significantly more chr2 + axons successfully re - innervated, more reformation of neuromuscular junctions, more moto - neurons that can be retrograde labeled by cholera toxin subunit b, and restored evoked muscle electromyography (emg) activity (m responses) one month after injury to the gastrocnemius muscle (ward., 2016). novel therapeutic approaches to neurodegenerative eye diseases, which cause serious medical, economic and social issues, are very much needed. thus, far, the three treatment strategies are stem cell transplantation, neuro - regeneration and neuro - rejuvenation, which have all attracted much attention. compared to stem cell therapy, in which transplanted cells have uncertain cell fates and a challenging integration into neuronal circuits, and neuro - regeneration, which faces challenges of reaching the correct neuronal destinations, neuro - rejuvenation provides us with a more promising and practical approach by taking advantage of existing rgcs and neuronal networks. instead of introducing new cells into the retina or stimulating those dying retinal neurons, neuro - rejuvenation focuses on existing cells, by enhancing their intrinsic functional capacity, allowing existing neuronal cells to aid their sick partners, and strengthening existing connections to increase existing signal - to - noise ratios. a deeper understanding of neuro - rejuvenation will shed light on the treatment of neurodegenerative eye diseases and bring hope to those patients who suffer from vision loss. | neurodegenerative eye diseases, such as glaucoma, cause irreversible vision loss in millions of patients worldwide, creating serious medical, economic and social issues. like other mammalian central nervous system tracts, optic nerve intrinsically lacks the capacity for axonal growth and its surrounding environment is also non - permissive to regeneration. any axonal damage also triggers a vicious cycle of retinal ganglion cell (rgc) death. exploring methods that can enhance rgcs survival and promote axonal regeneration will not only enable vision restoration for millions of patients, but also shed light on the treatment of other neurodegenerative diseases. in this review article, we will go through three current approaches to cure neurodegenerative eye diseases, including cell based therapy, neuro - regeneration and neuro - rejuvenation. |
panthothenate kinase - associated neurodegeneration (pkan), formerly termed as hallervorden - spatz disease is a rare chromosomal disorder first described by hallervorden and spatz in 1922. the characteristic features in patients with pkan include dystonia, muscle spasm, cognitive dysfunction, and seizure disorder. the anaesthetic concerns include difficult airway management, increased risk of gastric aspiration, dehydration, and post - operative respiratory and renal insufficiency. here, we report a case of successful anaesthetic management of a 9-year - old intellectually disabled male child with pkan, posted for ophthalmic surgery under general anaesthesia (ga). a 9-year - old boy weighing 20 kg, diagnosed case of pkan, admitted at our institute with a history of right eye lid oedema with maggots for debridement. he had a history of fall 7 days back and sustained injury over the right eyeball from a wooden stick. the child also had a history of intermittent abnormal flexor posturing and spasm of both the upper limbs for last 7 years, which became persistent and fixed during last 2 years. he also reported of frequent falls due to progressively worsening spasm and was unable to perform any definitive motor function. he had a history of generalised tonic - clonic seizures for the past 3 years and was on syrups of sodium valproate and lorazepam. since admission to our institute physical examination revealed cognitive dysfunction, facial dysmorphism, rigidity and involuntary movements of upper limbs. airway examination showed microstomia, micrognathia, retrognathia, modified mallampatti class ii, with normal thyromental distance and neck movements [figure 1 ]. magnetic resonance imaging (mri) brain revealed specific pattern of hyperintensity within hypointensity of anteromedial globus pallidus with eye - of - the - tiger child with panthothenate kinase associated neurodegeneration presenting with right eyelid oedema and maggots high - risk consent was obtained from the child 's parents and a bed was arranged in the paediatric intensive care for post - operative ventilation if required. on the day of surgery, oral antiepileptics and iv ranitidine 20 mg and routine antibiotics were administered as iv cannula was in situ. a difficult airway cart including supraglottic devices, video - laryngoscope, and fibreoptic bronchoscope (fob) were kept ready to manage the anticipated difficult airway. the child 's father was allowed to stay in the operating room (or) till induction. standard monitoring including electrocardiogram, pulse oximetry (spo2), and non - invasive blood pressure (nibp) were attached. before induction, his vital signs recorded were a heart rate of 116 beats / min, nibp 86/38 mm hg, respiratory rate 26/min and spo298%. iv fentanyl 2 mcg / kg was administered, and the child was pre - oxygenated with 100% oxygen (6 l / min) for 3 minutes. for induction, iv propofol was administered in titrated doses (total of 35 mg) and anaesthesia was then gradually deepened with halothane (1to 3% in 100% o2). after ensuring adequate depth of anaesthesia (loss of eyelash reflex and relaxed jaw), check video - laryngoscopy proseal laryngeal mask airway (plma) of size 2.0 was inserted in the first attempt and suction catheter was passed through the gastric channel. as adequate tidal volume was achieved with manual ventilation, assisted pressure support ventilation (pressure support ventilation with apnoea backup ventilation using the drager primus anaesthesia machine) was started and anaesthesia was maintained with isoflurane (1.0 to-1.2 mac) in o2 : air (fio20.5). topical procaine anaesthetic drops (0.5%) were instilled in the operating eye and 200 mg iv paracetamol were administered for intra - operative analgesia. antiemetic prophylaxis (2 mg of ondansetron) was given 10 min before the end of surgery. on the completion of surgery, isoflurane was turned off and 100% o2 was administered. when adequate tidal volume and regular respiration were achieved, the plma was removed after gastric and oropharyngeal suctioning. child was turned left lateral and was observed in or for next 10 minutes, before shifting to post - anaesthesia care unit (pacu). there was no episode of seizure, muscle spasm, vomiting or airway obstruction noticed postoperatively. panthothenate kinase associated neurodegeneration is a rare, autosomal recessive, neurodegenerative disorder characterised by the accumulation of iron in the basal ganglia of the human brain. the responsible gene (pank 2) for the disease has been localised in the short arm of chromosome no. 20, which is required for the phosphorylation of pantothenic acid in the formation of coenzyme a. defective phosphorylation results in under - utilisation of cystine in the body. this excessive cystine causes chelation of iron resulting in excessive free radical generation, lipid peroxidation, axonal dystrophy, and apoptotic cell death resulting in neuraxonal degeneration. the onset of disease is usually in the first or second decade of life ; however, it can occur at any age. it may be familial or sporadic, and the average survival time after the diagnosis is about 10 to-15 years. characteristic neurological features include progressive rigidity (oromandibular rigidity, trismus, dysphagia), involuntary movements (chorea, athetosis), seizures, cognitive dysfunctions, visual impairment (optic atrophy, retinitis pigmentosa), and difficulties in articulation, swallowing, and chewing. these signs and symptoms influence the pre - anaesthetic preparation of the patient, as well as intra - operative and post - operative anaesthesia management. reviewed the case reports concerning the anaesthetic management of patients with pkan and found successful and safe use of anaesthetic drugs like opioids (fentanyl, remifentanil), inhalational agents (nitrous oxide, halothane, sevoflurane, isoflurane), induction agents (propofol, thiopentone), and muscle relaxants (succinylcholine, vecuronium, pancuronium). there are several reports of autopsies revealing muscle wasting secondary to poor nutrition and diffuse axonal changes in the brain which may involve upper motor neuron lesions to an unpredictable extent, thereby increasing the possibility of hyperkalaemic cardiac arrest. intrathecal baclofen to relieve spasticity and dexmedetomidine during mri were also used in these patients. presence of involuntary movements (chorea, athetosis), rigidity and seizures interfere with the placement of iv cannula, arterial line, positioning for regional anaesthesia and awake intubation. involuntary movements may not completely disappear with the induction of anaesthesia and reappear on emergence from anaesthesia. attempts for awake intubation techniques like fob and tracheostomy under local anaesthesia can intensify these involuntary movements. the child reported here was mentally disabled, uncooperative, and had signs of difficult airway with a progressive neurological disorder. although awake fob is the gold standard for difficult airway management, it is unsuitable for such patient. this child was also having risk of aspiration and endotracheal intubation is considered to be a gold standard for securing the airway in these patients. however, successful airway management using plma in a patient with difficult airway and at increased risk of gastric aspiration has been reported in the literature. supraglottic airway devices have advantages in ophthalmic surgery as they cause minimal changes in haemodynamics, intraocular pressure, minimal trauma to the airway and decrease intubation and extubation response. we chose plma as it allows the passage of suction catheter through the gastric tube and protects against gastric aspiration. video - laryngoscopy was done to assess cl grading to be prepared for intubation in the emergent situation. keegan. reported reintubation and mechanical ventilation in the post - operative period due to the dynamic upper airway obstruction and acute respiratory failure in an 11-year - old girl with pkan for stereotactic thalamotomy. emergency tracheostomy during induction and re - intubation in the post - operative period may be needed. hence, all the necessary preparations should be done and made available to secure the airway in such scenarios. we avoided neuromuscular blockade as ophthalmic surgery did not need muscular paralysis, and lungs were ventilated with assisted pressure support ventilation with etco2 monitoring. sevoflurane was also avoided during induction as seizure - like movements of the extremities have been observed during induction of anaesthesia with sevoflurane. there are several case reports of sevoflurane provoking seizure like activity, particularly in children and in conjunction with high concentrations and hypocapnia. therefore, propofol was used for induction of anaesthesia using its antiepileptic properties to our benefit. we could successfully manage the child with pkan and difficult airway using plma without muscle relaxants for ophthalmic surgery. no case has been reported in the literature using proseal lma for airway management in a child with pkan. | panthothenate kinase - associated neurodegeneration (pkan) (hallervorden - spatz disease) is a rare autosomal recessive chromosomal disorder characterised by progressive neuroaxonal dystrophy. the characteristic features include involuntary movements, rigidity, mental retardation, seizures, emaciation. the anaesthetic concerns include difficult airway, aspiration pneumonia, dehydration, and post - operative respiratory, and renal insufficiency. we report successful anaesthetic management of a 9-year - old intellectually disabled male child with pkan, scheduled for ophthalmic surgery under general anaesthesia. |
a 42-year - old female patient was admitted to the department of dentomaxillofacial radiology, faculty of dentistry, ankara university with a complaint of bleeding on the gums. the patient 's medical history included having undergone treatment for pernicious anemia and a gastric ulcer two years earlier. on intraoral examination, the patient was asymptomatic except for a few restored and missing teeth. a lesion was found incidentally on routine periapical radiographs taken for the restored teeth and edentulous areas (fig. radiopaque masses were coincidentally observed in the periapical radiographs but the exact boundaries of the masses could not be seen. for further and more detailed examination, cone - beam computed tomography the panoramic radiograph and cbct revealed maxillary bilateral and symmetrical, well - defined, round, radiopaque masses in contact with the root of the maxillary right second molar and left first molar teeth. lobular, irregularly shaped radiopacities with clear radiolucent demarcation were also present in the right edentulous mandibular molar area (figs. 2 and 3). the bucco - lingual aspects of the lesions were best visualized on the axial cbct image (fig. cbct added valuable radiographic information regarding the relationships of the lesions with significant anatomical structures, cortical plates, and tooth roots. dirty yellow, bone - hard tissues of 1 cm1 cm0.6 cm dimensions were analyzed in this examination. on the basis of the histopathologic findings, the tumor was diagnosed as fod (fig. the patient was advised to have routine follow - up examinations at six - month intervals. the case has been followed up over the last 14 months and has remained asymptomatic. osseous dysplasias (periapical, focal, florid osseous dysplasias, and familial gigantiform cementoma) are a group of disorders that involve the same pathological processes.10 the clinical and radiological features of osseous dysplasia help to distinguish these lesions from others. pod is mostly confined to the anterior mandible, within the space between the canines.8 fod is a widespread form of pod and is a single lesion.1,5 the differential diagnosis of fod includes paget 's disease, chronic osteomyelitis, and gardner 's syndrome.1,10 paget 's disease is often polyostotic and shows changes in the level of serum calcium, phosphorous, and alkaline phosphatase.1,2,10 gardner 's syndrome may involve jaw bone changes similar to those with fod, but fod does not show any of the other skeletal changes that are seen in gardner 's syndrome.10 chronic osteomyelitis is a primary infection of the mandible presenting with unilateral pain, soft tissue swelling, fever, and lymphadenopathy.8,10 the secondarily infected lesion of fod has a wider radiolucent border than chronic osteomyelitis.1 steven reported a case that was diagnosed as chronic osteomyelitis with underlying infected fod.8 macdonald - jankowski published a systematic review on fod in 20036 that reviewed 158 cases, the mean age of which was 49 years. half of these cases had pain, swelling, and pus discharge / fistula with the frequencies of 52%, 31%, and 18%, respectively. fods can affect several areas of the jaws : posterior mandible area (99%), posterior maxilla (73%), anterior mandible (64%), and anterior maxilla (36%). the fod features observed in the present case report were in accordance with the results of that study. ong and siar provided their patient with surgical treatment to reduce the mass of the swellings.2 in rare cases, fod can be a hereditary condition with an autosomal dominant familial heredity.4 in our case, no familial aspect was observed. gndz reported a case of fod in which the lesion was seen throughout the alveolar processes of all quadrants of the maxilla and the mandible. the lesion was identified in three quadrants of the jaws in our case. while some reports have described diagnosing fod by clinical and radiological evaluation,5,7,10,13 others performed a biopsy.4,8,12 in the present case, a biopsy was also taken to confirm the diagnosis. in line with the various other reported cases, our patient was asymptomatic and the lesion was noticed incidentally on periapical radiographs taken for other purposes.4,5,7,10,13 up to now, two cases diagnosed by ct have been reported in the literature7,13 cbct images are useful diagnostic tools for identifying the location and extent of the lesion. cbct can be utilized to discriminate fod from lesions that display a similar sclerotic appearance on panoramic and periapical radiography.7 unlike the previous reports, in the diagnosis of the present case, not only clinical and radiological methods but also histological methods were used. clinicians should know the properties of such lesions and should be aware of their radiographic appearance. periapical radiographs may be insufficient to determine multifocal localization and the limits of the lesion. therefore, panoramic radiographs and ct images are preferable for a broader and more detailed examination. however, when infection of the lesion, resulting from trauma occurs, it requires surgical debridement and enucleation since antibiotics may not be effective due to the avascular nature of the lesion. | florid osseous dysplasia (fod) is an uncommon, benign, cemento - osseous lesion of the jaws. the etiology of fod is still unknown. it is often asymptomatic and may be identified on routine dental radiographs. the classic radiographic appearance of fod is amorphous, lobulated, mixed radiolucent / radiopaque masses of cotton - wool appearance with a sclerotic border in the jaws. in our case the lesion was found incidentally on routine periapical radiographs taken for restored teeth and edentulous areas. for further and detailed examination, a panoramic radiograph and cone - beam computed tomograph (cbct) were taken. the panoramic radiograph and cbct revealed maxillary bilateral and symmetrical, non - expansile, well - defined, round, radiopaque masses in contact with the root of the maxillary right second molar and left first molar teeth. our aim in presenting this case report was to highlight the importance of imaging in diagnosis of fod. |
patients with collagen vascular disease (cvd) such as rheumatoid arthritis, systemic lupus erythematosus, scleroderma, polymyositis, and dermatomyositis, are known to be sensitive to ionizing radiation 19. irradiation to the lung in patients with interstitial pneumonia (ip) is also considered a relative contraindication because ip is a risk for severe radiation - induced pneumonitis 10. meanwhile, in general, irradiation of extrapulmonary sites in ip patients is not contraindicated. here, we report a patient with bladder cancer and mild ip who received pelvic irradiation and showed unexpectedly severe adverse effects that followed by the onset of polymyositis and fatal exacerbation of ip. a 70-year - old japanese man with bladder cancer (ct1n0m0) presented to the radiation oncology department in march 2014. he had ip, which had been controlled stable with prednisolone (10 mg / day) since 2010. a chest computed tomography (ct) revealed ground - glass opacity in the subpleural region (figs.1 and 2). spirometry test results showed a restrictive pattern (vital capacity, 55% ; forced expiratory volume 1.0, 76%). although he was diagnosed as being tolerable for surgery under general anesthesia, he refused surgery and selected radiotherapy for his bladder cancer. he had a previous history of spinal canal stenosis and cataract in the left eye, however, he did not have a medical history indicative of a risk for severe radiation toxicity including diabetes mellitus. radiotherapy targeting the bladder and pelvic lymph node regions was initiated, with a daily fraction of 2 gy. however, he developed urinary tract pain and erythema in the radiation field much earlier than expected (i.e., within the first week). alpha - blockers, loxoprofen, intravesical infusion of lidocaine, and betamethasone valerate ointment were ineffective. in the third week, he showed grade 3 urinary tract pain, grade 3 radiation dermatitis (assessed using the common terminology criteria for adverse events, version 4.0), and needed to urinate every 5 to 10 min. thus, radiotherapy was terminated at 34 gy, much less than the target bladder dose of 60 gy., he was admitted to our hospital with proximal muscle weakness, which had worsened over the previous 2 weeks. iu / l) and c - reactive protein (3.66 mg / dl) levels, myogenic changes in the left deltoid and biceps brachii on electromyography, a high signal in the proximal muscles on magnetic resonance imaging (short - ti inversion recovery), and the presence of autoantibodies against aminoacyl - trna synthetase (anti - ars antibodies) led to a diagnosis of polymyositis. meanwhile, ct (chest through pelvis) showed no signs of infection or progression of cancer. an increased dose of prednisolone (60 mg / day) over 1 month improved the muscle weakness and ck levels (639 chest ct showed extensive areas of ground - glass opacity and consolidation, suggesting an acute exacerbation of ip (fig.3). despite maximum medical therapy, including prednisolone pulse (1 g / day) and cyclophosphamide, he died 1 week later. we conducted radiotherapy to this patient because he had not presented with any symptoms suggestive of cvd. although we could not identify the specific reason of the severe adverse effects during radiotherapy, the following onset of polymyositis suggested that the patients had vulnerability to ionizing radiation. to the best of our knowledge, this is the first case reported in the literature of unexpectedly severe adverse reactions to radiotherapy followed by the onset of cvd. the current case suggests that unexpectedly severe adverse effects after radiotherapy can be an alarm of cvd onset, which enables the prediction and early intervention of the cvd. notably, cvd - associated ip can precede the appearance of systemic cvd symptoms by many years ; sometimes by more than 5 years 12,13. these findings are consistence with our case which had a 4-year history of ip before the onset of polymyositis. in such cases, it is impossible to distinguish cvd - associated ip from other types of ip (e.g., drug - induced ip or idiopathic ip) because the clinicopathological findings of cvd - associated ip show wide variation 1113. at the time of radiotherapy however, there may be a considerable number of patients with ip - preceding cvd who are at risk of unexpectedly severe toxicity after radiotherapy. anti - ars antibody - positive polymyositis and dermatomyositis are strongly associated with ip 15. of note, 2950% of anti - ars antibody - positive ip - associated cases polymyositis and dermatomyositis are ip - preceding type 15. taken together, these findings suggest that measurement of anti - ars antibody levels in ip patients prior to radiotherapy may help predict severe radiation toxicity associated with the late onset of polymyositis or dermatomyositis. cvd markers such as antinuclear antibody were not evaluated in the stable ip period. in summary, careful observation for the alarm adverse effects of radiotherapy, especially in ip patients, may lead to the prediction and early intervention of the cvd. written informed consent was obtained from the patient s next of kin for publication of this case report and accompanying images. | key clinical messageinterstitial pneumonia (ip) sometimes precedes collagen vascular disease (cvd) onset. a patient with bladder cancer and mild ip received pelvic irradiation and experienced unexpectedly severe urinary toxicity followed by polymyositis onset and fatal ip exacerbation. careful observation for alarm adverse effects of radiotherapy in ip patients may help predicting cvd onset. |
infection with the hepatitis b and c viruses (hbv and hcv) causes significant morbidity and mortality. even though hbv infection can be prevented through vaccination, the world health organization (who) has estimated that globally around 240 million people are chronically infected [1, 2 ] with between 500 000 and 700 000 deaths each year [1, 3 ]. who estimates also indicate that 23% of the world 's population are hcv - infected, equating to 120170 million people. about 10 million people die annually (27% of all deaths) from causes related to viral hepatitis, most commonly liver disease, including liver cancer. an estimated 57% of liver cirrhosis cases and 78% of primary liver cancers result from hbv or hcv infection. co - infections with hiv are an increasing problem in countries with hiv epidemics in people who inject drugs (pwid), and in those treated with hiv anti - retrovirals, and underlying viral hepatitis is becoming a major cause of death. globally there are geographical variations in the extent of both hbv and hcv infection including within europe. in the european union (eu) and european free trade association (efta) area, prevalence in the general population varies from 04% to 52% for anti - hcv and from 01% to 56% for hbsag. hepatitis prevalence in the rest of the who european region, mainly eastern europe and central asia countries, has not been assessed even though this part of the region has recently experienced an accelerating hiv epidemic and an increase in the population of pwid. hbv and hcv are bloodborne viruses that are easily transmitted through blood - to - blood contact [2, 911 ]. parenteral routes, particularly injecting drug use or poor hygiene in clinical settings, are major sources of transmission [2, 912 ]. hbv can also be transmitted sexually, and this route has also been reported for hcv in certain circumstances [10, 13 ]. perinatal transmission of both hbv and hcv can also occur [2, 9, 10 ]. the majority of adults infected with hbv spontaneously resolve their infection and develop protective immunity. less commonly chronic infection results and, in rare cases, causes potentially fatal acute liver failure. in contrast to hbv, the majority of hcv - infected adults develop chronic disease. those with chronic infections remain infectious to others and are at risk of developing serious liver disease such as cirrhosis or hepatocellular cancer [15, 16 ]. the available antiviral treatments for both hbv and hcv infections have increased and become more effective [17, 18 ]. treatment may also have a role in prevention through reducing the pool of infectious people. as chronic hbv and hcv infections are largely asymptomatic, many patients who might benefit from treatment remain undetected. efforts are needed to detect those infected and who would benefit from treatment, so that the costly sequelae of infection can be reduced [21, 22 ]. to target case - finding it is necessary to know which population groups are most affected ; and information on the likely numbers infected is needed for healthcare planning, for example, to assess the cost of providing treatment. examination of these at a regional level allows comparison of the burden between countries as well as informing international responses. the aims of this study were to : (a) assess the prevalence of hbv and hcv infection in the who european region countries outside the eu / efta through a literature review ; (b) generate simple estimates of the numbers living with hbv and hcv infection in these countries, and (c) to compare this burden with that in the rest of the who european region obtained from published data. studies that had measured hbv and hcv seroprevalence since 2000 were identified through a literature review. to be included, studies had to : (a) have tested a biological sample (self - reports were excluded) to measure prevalence of hbsag or anti - hcv in a who european region country outside the eu / efta area (n = 20, table 1) ; (b) do so in one or more of these adult population groups : general population, blood donors, pregnant women, pwid, men who have sex with men (msm), and sex workers ; and (c) have been published from 2000 to 2010 inclusive. table 1.number and geographical coverage of studies that had measured the prevalence of hepatitis b surface antigen (hbsag) or antibodies to the hepatitis c virus (anti - hcv) in each population group by country : countries in the who european region outside eu / efta(a) general population and blood donorscountrygeneral populationblood donorshbsaganti - hcvhbsaganti - hcvno. of studiescoverage of studiesno. of studiescoverage of studiesno. of studiescoverage of studiesno. of studiescoverage of studiesalbania3national (x2), 1 city / area11 city / area21 city / area, n.s.21 city / area, n.s.armenia0000azerbaijan0000belarus0000bosnia & herzegovina001national2national, 1 city / areacroatia001national1nationalgeorgia011 city / area00israel001national1nationalkazakhstan11 city / area2national, 1 city / area1national0kyrgyzstan012 cities / areas00montenegro001national1nationalrepublic of moldova0000russian federation2?national, 1 city / area2?national, 1 city / area11 city / area11 city / areaserbia (incl. kosovo)11 city / area11 city / area11 city / area11 city / areatajikistan01multi - site1national1nationalthe former yugoslav republic of macedonia0011 city / area11 city / areaturkey9multi - site (x2), 1 city / area (x7)7multi - site, 1 city / area (x6)3national, 1 city / area (x2)3national, 1 city / area (x2)turkmenistan0000ukraine4unclear3unclear3unclear2unclearuzbekistan1multisite1multisite1multisite2multisite total 21 20 18 18 (b) people who injecting drugs (pwid)pwidhbsaganti - hcvno. / area21 city / areaarmenia00azerbaijan1multi - site2multi - site, 2 cities / areasbelarus1multi - site2multi - site, 1 city / areabosnia & herzegovina2multi - site2multi - sitecroatia3national multi - site, 1 city / area3national, multi - site, 1 city / areageorgia31 city / area4multi - site, 1 city / area (x3)israel1national1nationalkazakhstan12 cities / areas2national, 2 cities / areaskyrgyzstan02multi - site, 2 cities / areasmontenegro1unclear21 city / area, unclearrepublic of moldova1national1nationalrussian federation22 cities / areas, 1 city / area16multi - site (x2), 1 city / area (x12), unclear (x2)serbia (incl. kosovo)11 city / area3multi - site, 1 city / area (x2)tajikistan02multi - site, 1 city / areathe former yugoslav republic of macedonia00turkey1multi - site11 city / areaturkmenistan00ukraine31 city / area (x1), unclear (x2)61 city / area (x4), unclear (x2)uzbekistan02national multi - sitetotal2253(c) men who have sex with men (msm) and sex workersmsmsex workershbsaganti - hcvhbsaganti - hcvno. of studiescoverage of studiesalbania11 city / area000armenia0000azerbaijan11 city / area11 city / area1multi - site1multi - sitebelarus0000bosnia & herzegovina1national1national1national1nationalcroatia11 city / area21 city / area, national01nationalgeorgia11 city / area11 city / area00israel0000kazakhstan01national01nationalkyrgyzstan01national03national multi - site, 1 city / areamontenegro0000republic of moldova011 city / area011 city / arearussian federation012 cities / areas03multi - site, 1 city / area (x2)serbia (incl. kosovo)11 city / area11 city / area11 city / area11 city / areatajikistan0001nationalthe former yugoslav republic of macedonia0000turkey1multi - site02multi - site, 1 city / area11 city / areaturkmenistan0000ukraine1unclear1unclear1unclear1unclearuzbekistan0002multi - site, 1 city / areatotal811617eu / efta, european union and european free trade association area ; n.s., not stated. ; ?, preceding a detail indicates that the information available on this item in the source was limited.according to united nations security council resolution 1244 (1999). number and geographical coverage of studies that had measured the prevalence of hepatitis b surface antigen (hbsag) or antibodies to the hepatitis c virus (anti - hcv) in each population group by country : countries in the who european region outside eu / efta eu / efta, european union and european free trade association area ; n.s., not stated. ; ?, preceding a detail indicates that the information available on this item in the source was limited. according to united nations security council resolution 1244 (1999). medline and embase were searched for studies on the prevalence of hbv and hcv (see supplementary online material for search terms). the grey literature were indentified through searches of documents held by the who regional office for europe, the european monitoring centre for drugs and drug addition (emcdda) website, and the sources identified in a systematic review on hiv in the who european region which had systematically collected data on seroprevalence studies (including those with a focus on viral hepatitis). the titles and abstracts were first reviewed to identify relevant publication (in english or russian), the full text was then assessed for inclusion and data extracted (including secondary reports). data relating to screening of first - time blood donors was obtained from the council of europe report. the prevalences in pregnant women were combined with the general population data. the nature of this population, women of child - bearing age, could mean that the prevalence might not reflect that overall in the general population, particularly if prevalence differs by gender or age, or if fertility rates are higher in migrant groups with higher prevalences ; however, we have assumed that such differences are likely to be small overall. prevalence in first - time blood donors was not combined with the general population data, as blood donors are a highly select group. in most countries those who may have been at risk of infection with bloodborne viruses are excluded from giving blood, thus blood donors are usually likely to be at lower risk overall than the general population. a selected prevalence estimate in the general population was obtained for each country using the algorithm in table 2. table 2.algorithm used to select a national prevalenceprevalences were selected using the following hierarchy:(1) national studies.(2) studies with multiple sites across the country.(3) regional / city levels studies.if more there was than one study (for example several multi - site studies) then the weight mean was used (or mean if this could not be calculated) to obtain the selected prevalence. algorithm used to select a national prevalence the total number of adults currently infected with hbv and hcv was estimated by applying the hbsag and anti - hcv prevalences to the 2008 national adult (aged 15 years) population estimates. in countries that had a selected prevalence in blood donors only, the prevalence in the general population was simply imputed from the blood - donor data. this was done by using the median ratio of the blood - donor estimates to the general population estimates for those countries with selected estimates for both of these groups. for countries with no general population and no blood - donor estimate medians were used as the distributions were skewed, with a small number of countries having a much higher prevalence than the rest ; the median thus gives a more conservative estimate than would be obtained using the mean. for hcv, 74% of those anti - hcv positive were assumed to have current infection. to obtain comparable simple estimates of the numbers living with these infections in the eu / efta countries the same method was applied to published data (n = 30, excluding four with populations < 100 000). prevalence in first time blood donors was taken from the council of europe report, with additional data from an european centre for disease prevention and control (ecdc) review (hbsag prevalence for 27 countries, anti - hcv for 26). general population prevalences were obtained from the ecdc review, this had obtained selected prevalences for the eu / efta countries using a similar method (13 countries hbsag, 12 anti - hcv). the numbers of current pwid infected with hbv and hcv were obtained by applying the selected pwid hbsag and anti - hcv prevalences to published national estimates of the number of current injectors [26, 27 ]. where national estimates of the current injecting population were not available the median of the national prevalences of injecting drug use was used to impute the number of pwid from the adult population data. for countries with no hbsag or anti - hcv prevalence estimate for pwid the median of the selected national prevalences was used. medians were again used as the distributions were skewed. as with the general population for hcv, 74% of those anti - hcv positive were assumed to have current infection. to obtain comparable simple estimates of the number of pwid living with these infections in the eu / efta countries prevalence data from studies undertaken since 1999 was downloaded from the emcdda website (all eu states and norway report hbv and hcv seroprevalences for pwid to emcdda) and literature searches for switzerland and iceland (not members of emcdda). numbers were then estimated using the same approach, including imputations for missing data, as for the countries outside eu / efta. after accounting for studies reported by more than one publication, a total 86 sources were identified (supplementary fig. twenty - one studies, undertaken in seven countries (35% of total), had measured hbsag prevalence in a group representing the general population (table 1) : 11 recruited from the general population, five pregnant women, and five other groups (supplementary table s1). half of these studies had recruited from one city / area (table 1). thirteen countries (65%) had measured hbsag prevalence in blood donors (18 studies, 39% had national coverage, table 1). the study hbsag prevalences ranged from 01% (blood donors, bosnia & herzegovina) to 13% (general population, uzbekistan, supplementary table s1). 1) ranged from 13% to 13% for the general population (median 34%, mean 50%) and from 01% to 84% for blood donors (median 11%, mean 22%). the selected general population prevalence was higher than the selected blood - donor prevalence in five of the seven countries with both (table 3), the median of the ratio between these was 14 (range 05726, mean 16). 1.prevalence of antibodies to hepatitis c virus (anti - hcv) and hepatitis b surface antigen (hbsag) in (a) the general adult population ; (b) people who inject drugs (pwid) in the who european region, by country.. table 3.simple estimates of the number of adults with hepatitis b surface antigen (hbsag) and hepatitis c virus (hcv) in who european regioncountrypopulation aged 15 yr in 2008prevalence in first time blood donorsprevalence in studies representing general populationprevalence in general population imputed from blood donorsprevalence estimate usedestimated numbers with infection (rounded to nearest 100)aged 15 yrhbsaganti - hcvhbsaganti - hcvhbsaganti - hcvhbsaganti - hcvhbsaganti - hcvchronic hcv those outside eu / efta albania2 389 00070%07%90%30%11%25%measuredmeasured215 00071 70053 000armenia2 431 000azerbaijan6 549 000belarus8 228 000bosnia & herzegovina3 170 00001%003%01%01%imputed from bdimputed from bd470019001400croatia3 760 00002%01%03%02%imputed from bdimputed from bd10 20076005600georgia3 575 00067%measured239 500177 200israel5 077 00001%01%02%02%imputed from bdimputed from bd830010 4007700kazakhstan11 796 00018%38%10%24%measuredmeasured448 200118 00087 300kyrgyzstan3 790 00016%measured60 60044 900montenegro498 00007%06%10%12%imputed from bdimputed from bd500059004400republic of moldova3 016 000russian federation120 185 00011%21%15%36%15%43%measuredmeasured1 802 8004 326 7003 201 700serbia8 068 00042%03%24%05%57%06%measuredmeasured193 60040 30029 900tajikistan4 239 00030%29%05%41%59%imputed from bdmeasured171 80021 20015 700fyr macedonia1 674 00010%02%14%05%imputed from bdimputed from bd22 80075005600turkey53 958 00021%03%34%07%29%07%measuredmeasured1 834 600377 700279 500turkmenistan3 531 000ukraine39 554 00010%13%13%12%13%27%measuredmeasured514 2004 746 5003 512 400uzbekistan19 034 00052%64%133%131%71%13%measuredmeasured2 531 5002 493 5001 845 200countries without hbsag31 120 00034%estimated from median prevalence1 058 100anti - hcv15 527 00023%estimated from median prevalence357 100264 300total (rounded to nearest 1000)8 821 00012 886 00095 360 000 those in eu / efta austria7 087 00001%01%03%05%imputed from bdimputed from bd24 30037 90028 000belgium8 790 00001%003%07%06%04%03%measuredmeasured61 50052 70039 000bulgaria6 606 00018%04%13%79%45%imputed from bdmeasured520 80085 90063 500cyprus707 00001%002%09%04%02%measuredimputed from bd640014001 000czech republic8 875 000004%013%06%02%13%measuredimputed from bd53 300118 00087 300denmark4 476 000003%003%01%03%imputed from bdimputed from bd610012 4009200estonia1 140 00003%07%12%70%imputed from bdimputed from bd13 60079 60058 900finland4 403 000003%004%02%01%04%measuredimputed from bd880017 90013 200france50 870 000003%002%13%01%02%imputed from bdmeasured61 400661 300489 400germany70 748 00001%01%06%04%06%08%measuredmeasured424 500283 000209 400greece9 578 00020%03%21%10%84%33%measuredmeasured201 10095 80070 900hungary8 511 00000%03%00%31%imputed from bdimputed from bd2600267 400197 900iceland249 000ireland3 506 000001%001%01%01%01%measuredimputed from bd350031002300italy51 260 00004%14%52%17%measuredmeasured717 6002 665 5001 972 500latvia1 943 000lithuania2 823 00006%10%26%103%imputed from bdimputed from bd73 900289 800214 500luxembourg395 00001%01%04%06%imputed from bdimputed from bd170025001800malta342 000netherlands13 553 00001%002%01%04%03%02%measuredmeasured13 60054 20040 100norway3 862 000003%003%01%04%imputed from bdimputed from bd440013 60010 000poland32 389 00005%02%19%20%19%imputed from bdmeasured659 800615 400455 400portugal9 076 00001%02%04%17%imputed from bdimputed from bd36 900157 000116 100romania18 157 00037%09%56%35%158%92%measuredmeasured1 016 800635 500470 300slovakia4 536 00001%01%06%06%05%measuredimputed from bd27 20024 00017 700slovenia1 733 00001%003%04%04%imputed from bdimputed from bd750061004500spain37 814 00002%01%10%20%07%14%measuredmeasured378 100756 300559 600sweden7 641 000005%01%02%04%02%06%measuredmeasured15 30030 60022 600switzerland6 335 00002%01%07%06%imputed from bdimputed from bd44 80040 60030 000united kingdom50 210 000004%004%07%02%04%imputed from bdmeasured86 400351 500260 100countries without hbsag2 534 00006%estimated from median prevalence15 200anti - hcv2 534 00012%estimated from median prevalence29 10021 600total (rounded to nearest 1000)4 487 0007 387 9005 467 000total europe 732 137 00013 308 00020 274 00015 003 00018%28%20%bd, blood donors ; fyr macedonia, former yugoslav republic of macedonia ; anti - hcv, antibodies to the hpatitis c virus ; eu / efta, european union and european free trade association area.estimated using median of the national ratios of the general population prevalence to prevalence in blood donors. prevalence of antibodies to hepatitis c virus (anti - hcv) and hepatitis b surface antigen (hbsag) in (a) the general adult population ; (b) people who inject drugs (pwid) in the who european region, by country. hatched areas on maps indicate countries outside the who european region. simple estimates of the number of adults with hepatitis b surface antigen (hbsag) and hepatitis c virus (hcv) in who european region bd, blood donors ; fyr macedonia, former yugoslav republic of macedonia ; anti - hcv, antibodies to the hpatitis c virus ; eu / efta, european union and european free trade association area. estimated using median of the national ratios of the general population prevalence to prevalence in blood donors. ten countries (50%) had measured the anti - hcv prevalence in groups representing the general population (20 studies : nine recruited from the general population, six pregnant women, five other groups), with two - thirds of these studies covering one city / area (table 1). twelve countries (60%) had measured anti - hcv prevalence in blood donors (18 studies, 39% recruited from one city / area, table 1). the study anti - hcv prevalences ranged from 003% (blood donors, bosnia & herzegovina) to 13% (general population, uzbekistan, supplementary table s1). the selected country estimates (table 3, fig. 1) ranged from 05% to 13% for the general population (median 23%, mean 43%) and from 003% to 64% for blood donors (median 046%, mean 13%). the selected general population prevalence was higher than the selected blood - donor prevalence in six of the seven countries with measures of both (table 3), the median of the ratio between these was 21 (range 01792, mean 30). fourteen (70%) countries had measured hbsag prevalence and 17 (85%) anti - hcv prevalence in pwid (table 1). in total 54 studies were identified, including 30 that had recruited from community settings ; eight from needle and syringe programmes, low - threshold facilities, harm reduction, or outreach services ; three from addiction treatment settings ; four through other service types ; and five through mixed settings (setting was unclear in four, see supplementary table s2). twenty - two studies had measured hbsag (38% recruited in one city / area, table 1) and 53 studies anti - hcv prevalence (53% recruited in one city / area, table 1). the study hbsag prevalences ranged from 0% to 34%, and the anti - hcv prevalences from 53% to 95% (supplementary table s2). (median 68%, mean 92%) and from 53% to 73% for anti - hcv (median 46%, mean 46%). table 4.estimates of number of current hepatitis b and c infections in the who european region : eu / efta and non - eu / efta comparisonsadult population(%)current hbv(%)current hcv(%)eu / efta427 615 000(58)4 487 000(34)5 467 000(36)non eu / efta304 522 000(42)8 821 000(66)9 536 000(64)who european region732 137 000(100)13 308 000(100)15 003 000(100)eu / efta, european union and european free trade association area.twenty - seven eu member states : austria, belgium, bulgaria, cyprus, czech republic, denmark, estonia, finland, france, germany, greece, hungary, ireland, italy, latvia, lithuania, luxembourg, malta, the netherlands, poland, portugal, romania, slovakia, slovenia, spain, sweden, united kingdom.four eea / efta countries : norway, iceland, liechtenstein, switzerland.albania, armenia, azerbaijan, belarus, bosnia & herzegovina, croatia, georgia, israel, kazakhstan, kyrgyzstan, montenegro, republic of moldova, russian federation, serbia (incl. kosovo), tajikistan, the former yugoslav republic of macedonia, turkey, turkmenistan, ukraine. estimates of number of current hepatitis b and c infections in the who european region : eu / efta and non - eu / efta comparisons eu / efta, european union and european free trade association area. twenty - seven eu member states : austria, belgium, bulgaria, cyprus, czech republic, denmark, estonia, finland, france, germany, greece, hungary, ireland, italy, latvia, lithuania, luxembourg, malta, the netherlands, poland, portugal, romania, slovakia, slovenia, spain, sweden, united kingdom. albania, armenia, azerbaijan, belarus, bosnia & herzegovina, croatia, georgia, israel, kazakhstan, kyrgyzstan, montenegro, republic of moldova, russian federation, serbia (incl. kosovo), tajikistan, the former yugoslav republic of macedonia, turkey, turkmenistan, ukraine. thirteen studies were found that had measured the prevalence of either hbsag or anti - hcv in msm (supplementary table s3). the samples sizes ranged from 61741 (mean 235, median 157), and the majority had recruited msm from community settings (11, 85%). eight (40%) countries had undertaken a single study that had measured the hbsag prevalence in msm (five recruited from one city / area, table 1). the prevalences ranged from 0% to 18% (supplementary table s3) with a median of 64% (mean 69%). eleven studies (from 10 countries, 50%) reported anti - hcv prevalence in msm (five recruited from one city / area, table 1). the median of study anti - hcv prevalence was 42% (mean 78%, range 016%, supplementary table s3). seventeen studies (supplementary table s4) had measured the prevalence of either hbsag or anti - hcv in sex workers : samples sizes ranged from 1382249 (mean 591, median 315). almost half of the studies (eight, 47%) recruited sex workers from community settings, with four recruiting through services (23%) and two (12%) from both community settings and services (setting unclear for three, supplementary table s4). six studies, from five countries (25%), reported an hbsag prevalence in sex workers (two recruited from one city / area, table 1) ; prevalence ranged from 2% to 18% (supplementary table s4), the median was 29% (mean 61%). seventeen studies from 12 countries (60%), reported an anti - hcv prevalence in sex workers (seven recruited from one city / area, table 1) ; prevalences ranged from 24% to 40% (median 11%, mean 14%). general population prevalence estimates were imputed from the blood - donor prevalence using the median ratio of the general population to the blood - donor prevalence derived from those countries with both (table 3). applying this ratio to the blood - donor prevalence in those countries from which it was derived, gave a median difference between the countries measured and the imputed general population prevalence of 0004% for hbsag (range 33% to 62%, mean 06%) and 002% for anti - hcv (range 54% to 93%, mean 07%). this variability indicates that a country prevalence imputed this way should be treated with caution. the selected and imputed prevalences obtained here were applied to population data to produce simple estimates of the numbers infected. these estimates indicate that of the 3045 million adults living outside the eu / efta area 88 million (29%) have hbsag and 95 million (31%) have hcv rna (table 3). comparable estimates for the eu / efta countries obtained by applying the same method to published data (table 3, fig. 1 ; the median ratio between the selected general population and the selected blood - donor prevalence used in the imputations was 43 for hbsag and 11 for anti - hcv). these indicated that of the 4276 million adults in the eu / efta countries 45 million (10%) have hbsag and 55 million (13%) have hcv rna (table 3). these levels are respectively around one - third and one half of the levels estimated for the area outside the eu / efta. combining these simple estimates indicates that of the 7321 million adults in the who european region 133 million (18%) have hbsag and 150 million (20%) have hcv rna ; with two - thirds of those living with each infection outside the eu / efta area (table 4). the selected and imputed estimates of prevalence in pwid were used to derive simple estimates of the number of current pwid living with hbv and hcv infection outside the eu / efta. considering the wide range in the estimated prevalences of injecting drug use (007736%) and in the prevalences of the two infections in pwid (see above) the imputed data should be viewed with great caution. these estimates indicate that of the estimated 32 million current pwid outside the eu / efta 07 million (21%) have hbsag and 15 milion (47%) have hcv rna (table 5). table 5.simple estimates of the number of people who inject drugs with hepatitis b surface antigen (hbsag) and hepatitis c virus (hcv) in who european regioncountrypopulation aged 15 yr in 2008estimated number of current pwidprevalenceestimated numbers with infection (rounded to nearest 100)numberprevalenceimputed from median prevalencehbsaganti - hcvhbsaganti - hcvchronic hcv those outside eu / efta albania2 389 00010 00015%13%15001300900armenia2 431 0002000008%azerbaijan6 549 000300 000458%59%54%17 700162 700120 400belarus8 228 0006308008%13%39%80025001800bosnia and herzegovina3 170 0005500017%27%38%10021001500croatia3 760 00016 740045%08%46%10077005700georgia3 575 000127 833358%29%67%370085 60063 400israel5 077 00021 00043%62%90013 0009600kazakhstan11 796 000100 000085%79%60%790060 00044 400kyrgyzstan3 790 00025 000066%54%13 60010 000montenegro498 000200038%800600republic of moldova3 016 0003810013%68%43%30016001200russian federation120 185 0001 825 000152%31%73%565 8001 332 300985 900serbia8 068 00018 000022%15%52%260094006900tajikistan4 239 00017 000040%33%55004100fyr macedonia1 674 0002691016%turkey53 958 000226 00029%53%660012 0008900turkmenistan3 531 00014 000ukraine39 554 000375 000095%12%71%44 000266 300197 000uzbekistan19 034 00080 000042%36%28 80021 300median prevalence of injecting drug use04%countries without hbsag estimated using median prevalence142 69168%9700countries without anti - hcv estimated using median prevalence18 69146%86006400total (rounded to nearest 1000)662 0002 014 0001 490 000 those in ue / efta austria7 087 00017 500025%53%93006900belgium8 790 00025 800029%37%74%100019 10014 100bulgaria6 606 00020 250031%55%58%110011 7008700cyprus707 000446006%35%36%20200100czech republic8 875 00031 200035%12%37002700denmark4 476 00012 754028%53%67005000estonia1 140 00013 801121%90%12 4009200finland4 403 00015 650036%42%66004900france50 870 000122 000024%45%54 90040 600germany70 748 00094 250013%20%75%190070 70052 300greece9 578 0008148009%25%50%20041003000hungary8 511 0003941005%05%23%20900700iceland249 000600ireland3 506 0006289018%04%72%3045003400italy51 260 000326 000064%59%193 000142 800latvia1 943 000550074%41003000lithuania2 823 0005123018%59%73%30037002800luxembourg395 0001482038%39%81%1001200900malta342 00090033%300200netherlands13 553 0003115002%30%77%10024001800norway3 862 00010 032026%12%74%10074005500poland32 389 00088 00046%59%400051 90038 400portugal9 076 00016 425018%50%46%80076005600romania18 157 00049 00010%64%500031 40023 200slovakia4 536 00018 841042%50%94007000slovenia1 733 0007310042%34%22%20016001200spain37 814 00083 972022%73%61 60045 500sweden7 641 00029 513039%88%26 00019 300switzerland6 335 00031 653050%78%24 70018 300united kingdom50 210 000142 650028%46%65 60048 600median prevalence of injecting drug use03%countries without hbsag estimated using median prevalence852 53435%29 800countries without anti - hcv estimated using median prevalence60059%400300total (rounded to nearest 1000)45 000697 000516 000total europe (rounded to nearest 1000)706 0002 711 0002 006 000fyr, the former yugoslav republic of macedonia ; anti - hcv, antibodies to the hepatitis c virus ; eu / efta, european union and european free trade association area ; eu / efta hbsag and anti - hcv data from emcdda website plus a literature search for switzerland and iceland (national study ; weighted mean of national studies ; multi - city ; weighted mean from city / sub - region studies ; one city / region.)mathers., plus data for bosnia & herzegovina, croatia, czech republic, cyprus, estonia, greece, luxembourg, macedonia, portugal, sweden, and united kingdom from emcdda website ; and data for serbia from the republic of serbia ungass country progress report on aids 2010. simple estimates of the number of people who inject drugs with hepatitis b surface antigen (hbsag) and hepatitis c virus (hcv) in who european region fyr, the former yugoslav republic of macedonia ; anti - hcv, antibodies to the hepatitis c virus ; eu / efta, european union and european free trade association area ; eu / efta hbsag and anti - hcv data from emcdda website plus a literature search for switzerland and iceland (national study ; weighted mean of national studies ; multi - city ; weighted mean from city / sub - region studies ; one city / region.) mathers., plus data for bosnia & herzegovina, croatia, czech republic, cyprus, estonia, greece, luxembourg, macedonia, portugal, sweden, and united kingdom from emcdda website ; and data for serbia from the republic of serbia ungass country progress report on aids 2010. comparable estimates for current pwid living in eu / efta countries were derived from published data by applying the same method (table 5, fig. these estimates for eu / efta should be viewed cautiously, as due to the substantial variability in the prevalences (injecting drug use : 00612%, median 028%, mean 031% ; hbsag : 0310%, median 35%, mean 37% ; anti - hcv : 1288%, median 59%, mean 58%) the imputed data used here are likely to be subject to much uncertainty. the estimation process indicates that of the estimated 12 million current pwid in the eu / efta area 45000 (37%) have hbsag and 05 million (43%) have hcv rna (table 5). the proportion with anti - hcv is comparable with the level outside of the eu / efta ; however, the proportion with hbsag is much lower (table 4). combining these estimates indicates that in current pwid (estimated 45 million) across the who european region 07 million (15%) have hbsag and 20 million (44%) have hcv rna (table 5). our simple estimates suggest that almost 1/50 adults in the who european region have hbv infection and a similar proportion chronic hcv. outside of the eu / efta area prevalence was around three times higher for hbsag and over twice as high for hcv rna. prevalence of these infections was highest in pwid (15% and 44%, respectively). although the estimates here need to be viewed with caution, they do suggest a sizable burden due to these two viral infections in the region, particularly outside the eu / efta area. the prevalence data on hbsag and anti - hcv were obtained from literature searches, while grey literature was included, it is possible studies will still have been missed particularly if they have recently been undertaken, reported in languages other than russian or english, or unpublished. second, measures of the prevalence of hbsag and anti - hcv were not identified in all populations or in all countries. in many countries no national studies had been undertaken, thus local and regional data were assumed to be reflective of the whole country. small studies (n < 100) and those where population was not specifically or clearly defined were excluded ; however, we did not asses the methodological quality of the studies, in part because data available was often limited. the studies used a range of designs and thus the robustness of the resulting data is likely to be variable. where no measure of prevalence was found, simple imputation approaches were applied. even so, the extensive nature of searches undertaken in this assessment mean that it is likely to provide as robust an estimation as is currently practical at the regional level. in the who european region outside the eu / efta, the measured hbsag and anti - hcv prevalences were highest in pwid, but infection was also common in the general population (38% and 23%, respectively), msm (87% and 42%, respectively), and in sex workers (33% and 11%, respectively). there was substantial variation between countries, while prevalence of these infections in pwid was high in most countries ; uzbekistan had a prevalence of 13% for both infections in the general population. the general population hcv prevalence estimate was also elevated in the ukraine and georgia, and in albania the general population hbsag prevalence estimate was elevated. while these differences might be related to the methodologies used in the studies, they warrant further investigation. for the general population, pwid and msm prevalences were higher than in the eu / efta area, although comparable data for eu / efta was very limited for msm. the ecdc review found only two studies from the eu / efta countries that had measured hbsag in msm [4% sweden 19931997, and < 1% uk (scotland) 19932003 ] and one study that had measured anti - hcv [13% amsterdam (the netherlands) 2003 ], indicating a need for further studies of prevalence for msm and other transmission risk populations. for sex workers data on the prevalence of these infections has not been reviewed for the eu / efta area, but considering the elevated prevalence found here this is needed. in the countries outside the eu / efta, msm have a higher prevalence of both hbsag and anti - hcv than the general population, and sex workers had higher anti - hcv prevalence. the high anti - hcv prevalence in msm and sex workers the higher prevalences of both infections in msm is a concern considering the evolving epidemic of hiv in this group in parts of central and eastern europe. the ratios between the general population estimates and the blood - donor estimates were higher for the eu / efta area compared to outside (almost three times higher for hbsag and about five times higher for anti - hcv). the reasons for this difference are unclear, but it could for example, be due to more success in excluding those who have been at risk of infection from blood donation in the eu / efta countries, or be a reflection of the higher prevalence of these infections in the general population outside the eu / efta area. the estimates of the numbers infected simply applied prevalence to population data ; with the prevalences derived from studies using a range of methodologies and imputed for countries with no data (the majority lacked a general population hbsag estimate). there is some corroboration for the estimates obtained from comparison with published national estimates for hcv. in italy a modelling approach estimated 21 million people chronically infected with hcv in 2000 and 19 million in 2005 compared to the 20 million estimated here. in the uk, modelling approaches suggest that around 200 000 people are living with chronic hcv infection [30, 31 ], while the simple uk estimate here (n = 260 100) is higher it is within the confidence range. for the pwid estimates there is some corroboration from the uk, where 66 000 current pwid were estimated as hcv - infected in england and wales compared to the simple uk estimate here of 48 600 though the study had estimated a larger injecting population than the one used here. the estimates of the number of infected pwid obtained here will be particularly uncertain, as estimates of infection prevalence are being simply applied to estimates of the number of current pwid. both of these are difficult to measure due to the illicit and marginalized nature of injecting drug use, and are thus are likely to be subject to much uncertainty. the estimated number of pwid should thus be used very cautiously. in the uk almost as many former pwid were estimated to have hcv as current pwid. the estimates obtained here relate to number of infected current pwid, but there will also be many former pwid that will have been infected. it is thus likely that many of the infections in the region not in current pwid will be in former pwid. a previous estimate had suggested that 14 million people were living with chronic hbv in the who european region, although the method used for this estimate is not given, it provides some corroboration for the 133 million estimated here. in the 1990s, it was estimated from national prevalence data, that there were 89 million people living with hcv in the who european region (prevalence 10%), our estimate suggest that hcv infection might have increased over time to 15 million (prevalence 20%). if so, this might reflect transmission in pwid, particularly in the east of the region, where there has been a recent and accelerating epidemic of hiv in pwid. viral hepatitis has been recognized as a global public health problem and a world health assembly resolution has called on member states to take action to strengthen preventive and control measures. our findings indicate a large pool of individuals infected with hbv and hcv in the who european region, and so the potential for further transmission. the who 's recent framework for global action to prevent and control viral hepatitis describes the work needed. interventions to prevent transmission [2, 9, 35 ], including information on safer sex, condom distribution, needle and syringe programmes, and strict infection control practices in healthcare and other settings, need to be maintained and expanded as appropriate. hbv can be prevented through vaccination, national policies should be reviewed regularly, and in those countries with universal vaccination programmes targeted vaccination of high - risk groups should be considered, as recommended by who. easy access to diagnostic testing is an important entry point for accessing both prevention and treatment programmes, and in higher prevalence countries targeted screening programmes should be considered for those at greatest risk. other measures can also reduce the transmission of viral hepatitis, such as, ensuring a safe blood supply. this study provides useful data for policy makers on the scale of hbv and hcv infection in the region. policy makers need consider the extent of these diseases when planning health services in order to ensure that appropriate interventions [3537 ] are provided on a sufficient scale to reduce the burden arising from these two preventable infections. these findings indicate that there may be over 13 million adults living with hbv and 15 million with hcv in the who european region indicating a large burden for treatment and care. the prevalence of these infections appears to be higher outside the eu / efta, with these countries (mainly in eastern europe and central asia) accounting for 66% of those with hbsag and 64% of those with hcv rna, yet only 42% of the european region 's adult population (table 4). efforts to prevent, diagnose and treat these infections need to be maintained and improved. surveillance of the seroprevalence of these infections and related risk behaviours in the affected populations is needed to monitor trends and allow assessment of the impact of interventions. | summaryknowledge of hepatitis b and c prevalence, and numbers infected, are important for planning responses. published hbsag and anti - hcv prevalences for the 20 who european region countries outside the eu / efta were extracted, to complement published data for the eu / efta. the general population prevalence of hbsag (median 38%, mean 50%, seven countries) ranged from 13% (ukraine) to 13% (uzbekistan), and anti - hcv (median 23%, mean 38%, 10 countries) from 05% (serbia, tajikistan) to 13% (uzbekistan). people who inject drugs had the highest prevalence of both infections (hbsag : median 68%, mean 82%, 13 countries ; anti - hcv : median 46%, mean 46%, 17 countries), and prevalence was also elevated in men who have sex with men and sex workers. simple estimates indicated 133 million (18%) adults have hbsag and 150 million (20%) hcv rna in the who european region ; prevalences were higher outside the eu / efta countries. efforts to prevent, diagnose, and treat these infections need to be maintained and improved.this article may not be reprinted or reused in any way in order to promote any commercial products or services. |
in february 1997, rotavirus infection was diagnosed (by page analysis) in a 2-year - old child hospitalized with severe acute diarrhea at the g. di cristina the virus, pa260/97, exhibited a long e - type and was recognized by an sg - specific monoclonal antibody (mab) and by a vp7-specific mab as sgi and g3 (6). accordingly, strain pa260/97 displayed a genetic / antigenic constellation that is usually observed in animal - like viruses. for confirmation of the initial antigenic characterization and information about the vp4 (p) genotype, strain pa260/97 was characterized at the molecular level. by pcr genotyping of the vp7 and vp4 genes with panels of primers specific for various human g and p types (3,7,8), the vp7 was characterized as g3 and the vp4 was untypeable. to characterize strain pa260/97 in more detail, we determined the sequence of the vp7, vp4 (vp8), vp6, and nsp4 genes. we also determined the vp7, nsp4, and vp6 sequences of human strain pah101/97 (g3p, sgii, long e - type), detected in palermo in the same year, as well as the sequences of the vp8, vp6, and nsp4 genes of 2 g3p, sgi, long e - type strains, rv198/95, and rv52/96, isolated from dogs in italy in 1995 and 1996, respectively (9). the sequences of human strains pa260/97 and pah101/97 and of canine strains rv198/95 and rv52/96 have been deposited in genbank. the accession numbers are as follows : ef442738 (vp6), ef442733 (vp7), ef442735 (vp8), and ef442741 (nsp4) for strain pa260/97 ; ef534715 (vp6), ef442734 (vp7), and ef534716 (nsp4) for strain pah101/97 ; ef442737 (vp6), ef442736 (vp8), and ef442739 (nsp4) for strain rv198/95 ; ef442742 (vp6), ef442740 (vp8), and ef442743 (nsp4) for strain rv52/96. the vp8 of strain pa260/97 displayed the highest amino acid (aa) identity (98%) to the canine strain rv52/96, g3p, isolated in italy in 1996 (figure 1). similar, the vp7 of strain pa260/97 displayed the highest identity to g3 rotaviruses, with the best match (99% nt and aa) to the canine strain rv52/96 ; identity to reference human g3 strains (yo, au-1, ma09004, tk28) and to the human g3 strain pah101/97, isolated in palermo in 1997, ranged from 77% to 78% nt and from 88% to 90% aa. in the phylogenetic vp7-based analysis (figure 2), human strain pa260/97 clustered with animal g3 strains. species - specific patterns have been demonstrated in the vp7 gene of g3 human and animal rotaviruses (9). these patterns are suggestive of mechanisms of host - species restriction and are useful for tracing the origin of unusual rotavirus strains. phylogenetic analysis of the deduced amino acid sequence derived from vp4 gene of the pa260/97 human rotavirus strain and other p rotavirus strains. the tree was generated by the neighbor - joining method using the clustalw program (http://dambe.bio.uottawa.ca/dambe.asp). phylogenetic analysis of deduced amino acid sequence derived from vp7 gene of the pa260/97 human rotavirus strain and other g3 rotavirus genotypes. the tree was generated by the neighbor - joining method using the clustalw program (http://dambe.bio.uottawa.ca/dambe.asp). scale bar indicates nucleotide substitutions (100). a close genetic relationship between human strain pa260/97 and canine strain rv52/96 was also observed by comparing the genes that encode vp6 and nsp4. on the basis of mab reactivity, sequencing of an informative fragment of the vp6 gene (10) showed a close genetic relationship (97% aa) between strain pa260/97 and canine strain rv52/96 and only 86% aa identity with strain pah101/97. sequence analyses of nsp4 enabled characterization of strains pa260/97, rv198/95, and rv52/96 into the nsp4 genotype c ; strain pah101/97 (g3p) was characterized as nsp4 b genotype. the highest identity was observed between strains pa260/97 and rv52/96 (98% nt and 99% aa). rotavirus strains with a g3p combination are usually detected in cats and dogs. despite only a few reports of rotavirus isolation from dogs with gastroenteritis, all canine strains identified thus far in the united states, japan, and europe (cu-1, a79 - 10, lsu79c-36, rs15, rv198/95, and rv52/96) display g3 and p specificities (9). more recently, g3p rotaviruses have also been identified in monkeys and goats (1,11). in contrast, detection of g3p in humans is uncommon ; only 4 g3p strains hcr3a, hcr3b (4,12), ro1845 (5), and cmh222 (13)have been reported. by sequence analysis and by rna - rna hybridization, strains hcr3a and ro1845 were found to be related to canine and feline rotaviruses rather than to human g3 rotaviruses ; strain cmh222 appeared to be genetically related to both simian and caprine g3p rotaviruses (13). the mexican rotavirus strain 7177 - 1042 bears a common human vp4 gene, p, in conjunction with a canine - like vp7 gene, closely related to the vp7 of canine strain rv198/95 (14). canine rotavirus infection is considered a minor disease in young dogs (pups) because it is usually mild or unapparent ; however, serologic investigations have shown a high prevalence of antibodies to rotavirus in adult dogs (15). previous documented examples of infections in humans by canine - like rotavirus strains have been associated with either asymptomatic (strains hcr3a and hcr3b) or symptomatic (strain ro1845) clinical forms of disease (4,5,12). strain pa260/97 in the 2-year - old child was associated with enteritis severe enough to require hospitalization. therefore, the results of this study reinforce the hypothesis that canine - like rotaviruses may be able to not only cross the species barriers but also to induce severe disease forms in children. the lack of systematic surveillance of rotavirus infection in small animals (e.g., dogs and cats) and the fact that most rotavirus infections in such animals may go undetected hinder the ability to establish firm epidemiologic connections. in conclusion, complementing the human rotavirus surveillance programs with surveillance in animals is paramount to understanding the global ecology of rotaviruses and to identifying and characterizing interspecies transmission events and virus evolution | infection by an animal - like strain of rotavirus (pa260/97) was diagnosed in a child with gastroenteritis in palermo, italy, in 1997. sequence analysis of vp7, vp4, vp6, and nsp4 genes showed resemblance to a g3p[3 ] canine strain identified in italy in 1996. dogs are a potential source of human viral pathogens. |
human sparganosis is a zoonosis caused by plerocercoid larvae (= spargana) of pseudophyllidean (now classified as diphyllobothriidean) tapeworms. in asia, s. erinaceieuropaei is responsible for this disease, whereas spirometra mansonoides is important in the americas. this parasite can be found anywhere in the body including the central nervous system. in rare cases, a sparganum involves the spinal cord, usually at the thoracic to lumbar levels [7 - 15 ]. to our knowledge, here, we describe a case of cauda equina syndrome with molecular evidence for identification of the causative agent and review the literature of sparganosis involving the spinal cord. the patient was a 52-year - old female sugarcane farmer who lived in a rural community of suphan buri province, central thailand. she presented to our hospital complaining of lumbodorsal pain for the previous month, progressive symmetrical paraparesis with sensory impairment and radiculopathy for 2 weeks, and bowel / bladder dysfunction for 3 days. she had no history of ingesting inadequately cooked frogs, snakes, or birds. on examination, motor strength of the left lower extremity decreased from grade v (normal) to grade iii in the hamstrings, iliopsoas, and quadriceps muscles ; grade i - ii in the ankle and toe plantar flexor muscles ; and grade 0 in the ankle dorsiflexors muscles and the extensor hallucis longus muscle. for the right lower extremity, sensations were decreased below the l2 dermatome on both sides with peri - anal anesthesia, and the knee and ankle jerk were absent on both sides. routine biochemical and hematological investigations were within normal limits except for an increase of absolute eosinophil count in the peripheral blood (0.4610/l). mri of the whole spine showed multiple intradural extramedullary serpiginous - mass lesions in the subarachnoid space continuously from the prepontine to the anterior part of the medulla oblongata levels, c7, t2-t8, and t12 vertebral levels distally until the end of the thecal sac, and filling - in of the right s1 neural foramen (fig. attempts of spinal tapping to obtain a cerebrospinal fluid (csf) sample were unsuccessful. laminectomy at l1 and l2 level was performed to obtain a tissue sample for histopathological examinations. during the operation, we noticed a matted mass involving nerve roots with remarkable inflammation and multiple cystic lesions containing pus ; no csf was seen due to obstruction by the mass. a small piece of tissue from the matted mass was removed and fixed in formalin and processed for paraffin embedding. histological examinations demonstrated a degenerated solid section of a folded cestode larva having irregular folding tegument which was homogenously eosinophilic in color. 2b arrows), which is a characteristic feature of a cestode larva, were seen. there were mild inflammatory cell infiltrations including eosinophils, lymphocytes, a few plasma cells, and neutrophils in the larval section (fig. after the histopathological confirmation, serological tests for detection of specific antibodies in the serum was performed. using elisa, we detected a high titer of specific igg antibodies against s. erinaceieuropaei sparganum partially purified antigen. the serum was negative for cysticercosis by elisa and also negative for gnathostomiasis, paragonimiasis, fascioliasis, and angiostrongyliasis by immunoblotting. for molecular identification of the causative parasite species, dna was extracted from 10 m unstained serial sections (cut from the formalin - fixed paraffin - embedded specimen) attached to glass slides using a dexpat kit (takara bio inc., amplification of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene by pcr was performed in a 25 l reaction mixture. a fragment of cox1 gene was amplified using the primers se658-f (5'-ttt gat cct ttg ggt ggt gg-3 ') and se1124-r (5'-acc aca aac cac gtg tca tg-3 '), which were designed from the cox1 gene of s. erinaceieuropaei (genbank accession no. ab369250). pcr was carried out using a geneamp pcr system 9700 (applied biosystems, singapore). the reaction was carried out in a 25 l volume containing 2.5 l of 10x faststart high fidelity reaction buffer with 18 mm mgcl2 (roche, mannheim, germany), 200 m of each deoxyribonucleotide triphosphate, 0.2 m of each primer (invitrogen, carlsbad, california, usa), and 0.625 units of faststart high fidelity enzyme blend (roche). the amplification procedure consisted of 35 cycles at 95 for 30 sec (denaturation), 59 for 30 sec (annealing), and 72 for 45 sec (extension), with a final extension at 72 for 10 min. amplified product was run on a 1% agarose gel ; a 467 bp fragment was cut and sequenced using the megabace 1000 dna analysis system (ge healthcare, piscataway, new jersy, usa). the cox1 gene sequence of s. erinaceieuropaei obtained from the patient was analyzed by blast - n search via ncbi. the partial cox1 sequence of s. erinaceieuropaei from the patient, which was deposited in the genbank database (no. kc551943), was almost completely (97 - 99% identity) identical with those of s. erinaceieuropaei from various geographical localities. from these results, after laminectomy at l1 and l2 level, the patient received corticosteroid and praziquantel therapy, and her lumbosacral pain moderately improved. however, she persistently complained of a dull, uncomfortable sensation on both buttocks. at follow - up after 1 month, paraparesis with sensory impairment, urination, and defecation difficulties still persisted. this study protocol was approved by siriraj institutional review board certificate of approval (coa no. it is caused by the larvae of the tapeworm genus spirometra, whose definitive hosts are domestic and wild cats and dogs. human infections usually occur in the following 3 ways ; drinking untreated water containing infected copepods ; ingesting raw or inadequately cooked flesh of snakes, frogs, or birds infected with spargana ; and applying the flesh of an infected frog as a poultice to a wound. the disease usually involves the subcutaneous tissue or muscles of the chest, abdominal wall, or limbs. central nervous system involvement is relatively rare, involvement of the spinal cord, in particular, is extremely rare. in the literature [7 - 10,12 - 16 ], including the present study, 10 cases of spinal sparganosis have been reported. these were 6 males and 4 females whose ages ranged from 10 to 59 years (mean age ; 38.9 years). the sparganum more commonly involved intradural (70%) than extradural sites, usually at the thoracic level [7 - 10,12,13 ], followed by the cervical level. including the present case, our patient demonstrated long and multiple intradural extramedullary lesions extending from the prepontine to the anterior part of medulla oblongata levels, c7, t2-t8, and t12 vertebral levels distally until s1 level. clinical manifestations included sensory disturbances (70%), weakness of the limbs (60%), pain (60%), and voiding difficulty (50%). the mean duration of symptoms before diagnosis was 9.4 months (range ; 3 days to 3 years). the prognosis was good or fair. in nearly all of the spinal sparganosis patients, our patient was unique in that the lesions were at multiple levels from the prepontine down to the end of the thecal sac. the patient presented with severe lumbodorsal pain due to a mass compressing the adjacent spinal cord and resulting spinal cord edema. pain in the nerve root may occur long before the signs of spinal cord compression have developed. in our patient, lumbodorsal pain developed before paraparesis and bowel / bladder involvement. the route of the entry of worms into the spinal cord remains unclear, but hematogenous spread seems likely. it is hard to diagnose sparganosis clinically and to differentiate it from neoplastic and inflammatory disorders or other parasitic visceral larva migrans because it is rare and has non - specific manifestations. we could not find any specific features for diagnosis in neuroradiological imaging of these cases. elisa for detecting anti - sparganum igg antibody is highly sensitive (85.7 - 100%) and specific (95.7%). however, the elisa technique can not identify the causative worm at the species level. pcr - based molecular techniques should be used for identification of the causative pathogens of infectious diseases. recent development of pcr / sequencing technique for dnas from formalin - fixed paraffin - embedded (ffpe) tissues kept for many years enabled us to perform the retrospective re - appraisal of individual cases and also epidemiological studies. in conclusion, we report here a rare case of sparganosis presented as cauda equina syndrome. pcr - based identification of the causative agent using ffpe tissues led us to the accurate and definite diagnosis. | a 52-year - old woman presented with lower back pain, progressive symmetrical paraparesis with sensory impairment, and sphincter disturbance. magnetic resonance imaging (mri) of the whole spine revealed multiple intradural extramedullary serpiginous - mass lesions in the subarachnoid space continuously from the prepontine to the anterior part of the medulla oblongata levels, c7, t2-t8, and t12 vertebral levels distally until the end of the theca sac and filling - in the right s1 neural foramen. sparganosis was diagnosed by demonstration of the sparganum in histopathological sections of surgically resected tissues and also by the presence of serum igg antibodies by elisa. dna was extracted from unstained tissue sections, and a partial fragment of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using a primer set specific for spirometra spp. cox1. after sequencing of the pcr - amplicon and alignment of the nucleotide sequence data, the causative agent was identified as the larva of spirometra erinaceieuropaei. |
megalocornea is a nonprogressive bilateral congenital enlargement of the anterior segment in the absence of raised intraocular pressure.1 it can occur in three forms simple megalocornea unassociated with other ocular abnormalities ; anterior megalophthalmos with megalocornea ; and iris and angle abnormalities as well as buphthalmos in infantile glaucoma. anterior megalophthalmos is a rare hereditary disorder characterized by presence of megalocornea (horizontal corneal diameter more than 13 mm) in association with enlarged lens iris diaphragm and ciliary ring.2 secondary complications include presence of iridodonesis, miosis, atrophy of iris stroma, and cataractous lens. marfan 's syndrome, apert syndrome, down syndrome, and mucolipidosis type 2 are some systemic associations seen with this condition. premature development of cataract is the most common cause for visual impairment in this condition. cataract extraction in these patients is prone to complications due to presence of weak zonules and ciliary ring enlargement. one of the major challenges in the management of cataract is placing the correct size of intraocular lens (iol) in the capsular bag to prevent iol decentration. possible options would include use of a large custom - made posterior chamber (pc) iol or use of anterior chamber iris sutured iol.34 this case report describes the use of standard posterior chamber iol of larger diameter in the management of cataract in anterior megalophthalmos. a 40-year - old healthy woman presented with gradual progressive painless diminution of vision in both eyes for 1 year duration her best corrected visual acuity (bcva) od was 6/18 and light perception with projection, os. anterior segment examination in both eyes revealed presence of megalocornea [figure 1 ] and clear cornea with mild pigment on endothelium. anterior chamber were deep bilaterally. there was grade i nuclear sclerosis (by lens opacity classification system ii) od and total cortical cataract with phacodonesis os. gonioscopy showed open angles with broad pigmented trabecular meshwork and anterior embryotoxon [figure 2 ]. the central corneal thickness (cct) using ultrasound pachymetry was 0.445 mm od and 0.465 mm os. horizontal corneal diameter measured by using a castroviejo calipers biometric data of a patient with anterior megalophthalmos gonioscopy photograph showing presence of broad pigmented portion of trabecular meshwork manual small incision cataract surgery with use of capsular tension ring (ctr) with peribulbar block was planned for the left eye. a single piece rigid poly methyl methaacrylate posterior chamber iol of + 15.00 d power, with 6.5 mm diameter optic and an overall diameter of 13.5 mm (aurolab, tamil nadu, india) was implanted [figure 3 ]. follow up was performed at 1, 3, 4, 6, 12 weeks postoperatively. at 3 months postoperatively, bcva in the left eye was 6/9 with + 2.00 d sphere and + 1.0 d cylinder at 90 and the pciol was well centered. per operative photograph anterior megalophthalmos is a rare inherited condition that is characterized by the presence of megalocornea, ciliary ring enlargement and secondary effects of iridodonesis, miosis, atrophy of iris stroma, and occurrence of cataract.5 x - linked genetic transmission is found in 50% of cases of anterior megalophthalmos (possibly located on xq21.3-q22), autosomal transmission in 40%, and sporadic transmission in the remaining 10%. it is commonly seen in males (90%) because x - linked inheritance is common. our case being a female, with a negative family history probably suggests a sporadic occurrence. she had megalocornea, deep anterior chamber, hypoplasia of iris stroma as pupils failed to fully dilate pharmacologically as well as anterior embryotoxon with presenile cataract fitting into the diagnosis of anterior megalophthalmos. the lens in anterior megalophthalmos is of normal size,6 but the ciliary ring is enlarged, which is responsible for weakened zonules and subluxation of lens. one of the major challenges in the management of cataract in patients with anterior megalophthalmos is prevention of iol decentration. various techniques have been recommended including placement of iris clip iol in the posterior chamber7 and custom iol.8 javadi.9 have reported safe implantation of standard iol (13.4 mm in length with 7 mm optic) in six eyes without complications. tsai.10 have also reported the use of standard iols (13 mm in length and 6 mm optic) in a case of anterior megalophthalmos who underwent phacoemulsification. in our case we were able to implant a standard iol (13.5 mm overall length with 6.5 mm optic) successfully. introduced in 1991, ctrs have become indispensable in stabilizing the capsular bag in the presence of generalized weakness or dehiscence of less than 150.11 hence, placement of conventional ctrs are not limited to only zonular dialysis and can be used in generalized weakness of zonules. even though there was phacodonesis, zonular dialysis was not evident and iol implantation was possible in our case without the use of ctr. zare.12 have suggested preoperative use of ultrasound biomicroscopy (ubm) in anterior megalophthalmos to measure the actual size of the capsular bag. zare.12 were able to implant a standard foldable iol as the capsular bag diameter in their case was found to be normal by ultrasound biomicroscopy. the hyperopic shift could be explained with greater posterior shift of the iol due to long zonules. in our case it was not possible to assess the capsular bag diameter, we assume that it would have been of normal size as there was no iol decentration for the entire follow - up period. however, there is relative paucity of female cases (such as the current case) in the literature. however, good visual rehabilitation can be achieved with standard iol in these anatomically challenged eyes, even in centers with limited or no access to investigative techniques such as ubm. | we report a case of 40-year - old female who presented with diminution of vision in both eyes. ocular evaluation showed presence of bilateral megalocornea with deep anterior chamber, iridodonesis, cataract, and anterior embryotoxon. she was diagnosed with bilateral anterior megalophthalmos. she underwent an uneventful cataract extraction with standard posterior chamber intraocular lens implantation of overall large diameter in the left eye. zonular dialysis was not evident intraoperatively despite the presence of iridodonesis. postoperatively the intraocular lens was well centered throughout follow up. this case report reviews this rare disorder and highlights successful visual rehabilitation. |
this is an investigator - initiated phase iii double - blind, randomized, placebo - controlled, two - arm crossover clinical study. the study adhered to the guidelines of the declaration of helsinki, and the protocol and consent form were approved by the local investigational review board, the national ethics committee, and the ministry of health. patients (aged > 18 years) with type 1 or type 2 diabetes and dme resulting in best corrected visual acuity (bcva) of 0.4 were eligible if they had at least two previous sessions of laser photocoagulation > 6 months before enrollment or if they had leaking microaneurysms within the foveal avascular zone, making laser photocoagulation unsafe for the central vision. in addition to standard inclusion and exclusion criteria for phase iii studies of infliximab, patients were excluded if they had 1) vitreoretinal traction, 2) retinal detachment, 3) proliferative diabetic retinopathy requiring immediate panretinal photocoagulation, 4) any previous eye surgery 6 months before the study, including any intravitreal infusions, 5) macular edema of the ischemic type or caused by retinal conditions other than diabetes, 6) cataract or media opacities of a degree that precluded accurate retinal photographs or optical coherence tomography (oct) measurement, 7) hard exudates under the fovea, or 8) uncontrolled arterial hypertension (blood pressure > 180/110 mmhg), a major change in glycemic control (e.g., 2% change in a1c) within the last 6 months, or a change in daily number of insulin injections. consenting patients were screened for the study within 2 weeks before random assignment with a medical history, physical examination, electrocardiogram, purified protein derivative test, chest x - ray, and laboratory tests including hemoglobin, a1c, platelet count, white blood cell count and differential, aspartate aminotransferase, alanine aminotransferase, -glutamyl transferase, alkaline phosphatase, total and conjugated bilirubin, lactate dehydrogenase, plasma lipids (total cholesterol, hdl cholesterol, and triglycerides), creatinine phosphokinase, renal function (urea and creatinine), sodium, potassium, calcium, phosphate, and serological tests for hepatitis and hiv infection. in addition, an experienced examiner obtained ophthalmic / dme history and performed, in both eyes, measurements of bcva, oct, stereoscopic fundus photographs (seven fields), applanation tonometry, and fluorescein angiography. patients were randomly allocated 1:1 to receive placebo or infliximab in a two - armed crossover, double - blind design according to the permuted block randomization list generated in sas. patients received placebo at weeks 0, 2, 6, and 14, followed by infliximab at weeks 16, 18, 22, and 30 (group a), or vice versa (group b) in addition to standard therapy for diabetes, hypertension, and dyslipidemia, which remained unchanged during the study. all study drugs were administered via a 2-h intravenous infusion at a dose of 5 mg / kg body wt on the scheduled visits at weeks 0, 2, 6, 14, 16, 18, 22, and 30. blinding was maintained to week 32, when the final clinical, laboratory, and ophthalmic evaluation was performed in all patients. finally, adverse event reporting and a complete physical examination were performed at week 56 (long - term follow - up visit). physical examination and bcva measurements of the number of letters a patient was able to read from the early treatment diabetic retinopathy study (etdrs) charts with correction for individual refractive errors were performed at every visit. foveal thickness measurements by third - generation oct (stratus oct iii), using the fast macular thickness scan, stereoscopic fundus photographs (seven fields), and intraocular pressure measurements using a goldman applanation tonometer were performed at weeks 8, 16, 24, and 32. study physicians were blinded to the subject 's treatment (infliximab or placebo) as well as to the subject 's previous visual acuity assessments. the primary end point of the study was to assess the efficacy and safety of four infusions of infliximab on bcva, evaluated by a mixed - models approach for imbalanced crossover design using the percent difference between infliximab and placebo groups as an outcome variable. the secondary end points were 1) the effect of infliximab on the anatomic change of dme, assessed by oct and 2) the effect of infliximab on diabetic retinopathy, assessed by fundus photographs and fluoroangiographic studies. the treatment effect of infliximab versus placebo in macular thickness and fundus photographs results was also evaluated by a mixed - models approach for imbalanced crossover design using the percent difference as an outcome variable. the planned sample size of 26 patients was based on the expected reduction of bcva after treatment with infliximab (16). it was estimated that 22 evaluable eyes (11 per study arm) would provide 90% power to detect a mean difference in log minimum angle of resolution (logmar) bcva of 0.67 (equivalent to 22 letters read in the edtrs chart) at a 0.001 level of statistical significance. under the assumption of a 15% dropout rate, however, the study was terminated after enrollment of the first 12 patients because of inability to recruit additional patients who had not any intravitreal infusion within the prior 6 months (exclusion criterion 4, as described above). patients (aged > 18 years) with type 1 or type 2 diabetes and dme resulting in best corrected visual acuity (bcva) of 0.4 were eligible if they had at least two previous sessions of laser photocoagulation > 6 months before enrollment or if they had leaking microaneurysms within the foveal avascular zone, making laser photocoagulation unsafe for the central vision. in addition to standard inclusion and exclusion criteria for phase iii studies of infliximab, patients were excluded if they had 1) vitreoretinal traction, 2) retinal detachment, 3) proliferative diabetic retinopathy requiring immediate panretinal photocoagulation, 4) any previous eye surgery 6 months before the study, including any intravitreal infusions, 5) macular edema of the ischemic type or caused by retinal conditions other than diabetes, 6) cataract or media opacities of a degree that precluded accurate retinal photographs or optical coherence tomography (oct) measurement, 7) hard exudates under the fovea, or 8) uncontrolled arterial hypertension (blood pressure > 180/110 mmhg), a major change in glycemic control (e.g., 2% change in a1c) within the last 6 months, or a change in daily number of insulin injections. consenting patients were screened for the study within 2 weeks before random assignment with a medical history, physical examination, electrocardiogram, purified protein derivative test, chest x - ray, and laboratory tests including hemoglobin, a1c, platelet count, white blood cell count and differential, aspartate aminotransferase, alanine aminotransferase, -glutamyl transferase, alkaline phosphatase, total and conjugated bilirubin, lactate dehydrogenase, plasma lipids (total cholesterol, hdl cholesterol, and triglycerides), creatinine phosphokinase, renal function (urea and creatinine), sodium, potassium, calcium, phosphate, and serological tests for hepatitis and hiv infection. in addition, an experienced examiner obtained ophthalmic / dme history and performed, in both eyes, measurements of bcva, oct, stereoscopic fundus photographs (seven fields), applanation tonometry, and fluorescein angiography. patients were randomly allocated 1:1 to receive placebo or infliximab in a two - armed crossover, double - blind design according to the permuted block randomization list generated in sas. patients received placebo at weeks 0, 2, 6, and 14, followed by infliximab at weeks 16, 18, 22, and 30 (group a), or vice versa (group b) in addition to standard therapy for diabetes, hypertension, and dyslipidemia, which remained unchanged during the study. all study drugs were administered via a 2-h intravenous infusion at a dose of 5 mg / kg body wt on the scheduled visits at weeks 0, 2, 6, 14, 16, 18, 22, and 30. blinding was maintained to week 32, when the final clinical, laboratory, and ophthalmic evaluation was performed in all patients. finally, adverse event reporting and a complete physical examination were performed at week 56 (long - term follow - up visit). physical examination and bcva measurements of the number of letters a patient was able to read from the early treatment diabetic retinopathy study (etdrs) charts with correction for individual refractive errors were performed at every visit. foveal thickness measurements by third - generation oct (stratus oct iii), using the fast macular thickness scan, stereoscopic fundus photographs (seven fields), and intraocular pressure measurements using a goldman applanation tonometer were performed at weeks 8, 16, 24, and 32. study physicians were blinded to the subject 's treatment (infliximab or placebo) as well as to the subject 's previous visual acuity assessments. the primary end point of the study was to assess the efficacy and safety of four infusions of infliximab on bcva, evaluated by a mixed - models approach for imbalanced crossover design using the percent difference between infliximab and placebo groups as an outcome variable. the secondary end points were 1) the effect of infliximab on the anatomic change of dme, assessed by oct and 2) the effect of infliximab on diabetic retinopathy, assessed by fundus photographs and fluoroangiographic studies. the treatment effect of infliximab versus placebo in macular thickness and fundus photographs results was also evaluated by a mixed - models approach for imbalanced crossover design using the percent difference as an outcome variable. the planned sample size of 26 patients was based on the expected reduction of bcva after treatment with infliximab (16). it was estimated that 22 evaluable eyes (11 per study arm) would provide 90% power to detect a mean difference in log minimum angle of resolution (logmar) bcva of 0.67 (equivalent to 22 letters read in the edtrs chart) at a 0.001 level of statistical significance. under the assumption of a 15% dropout rate, however, the study was terminated after enrollment of the first 12 patients because of inability to recruit additional patients who had not any intravitreal infusion within the prior 6 months (exclusion criterion 4, as described above). there were three women and eight men, aged between 40 and 73 years, with diabetes duration ranging between 3 and 20 years (1 patient with type 1 diabetes and 10 patients with type 2 diabetes). the additional enrolled patient, aged 72, was randomly assigned to initially receive placebo (group a), but had an acute myocardial infarction 2 days before the first scheduled injection and withdrew from the study. one patient from group a withdrew consent at week 18 after receiving four placebo injections and the first infliximab injection. in total 14 eyes were eligible for analysis (6 eyes in group a, including this patient 's response to placebo treatment, and 8 eyes in group b) (table 1). demographic and disease characteristics of patients with dme and individual bcva values of eligible eyes at baseline (week 2), end of study treatment 1 (week 16), and end of study treatment 2 (week 32) a denotes placebo ; b denotes infliximab. study treatment 1 : from baseline to week 16 ; study treatment 2 : from week 16 to week 32. individual values of bcva at baseline, week 16 (end of the first study treatment), and week 32 (final evaluation after the second study treatment) are shown in table 1. baseline bcva was not different between groups (31.6 5.1 vs. 23.5 10.3 letters read ; t = 1.7 ; p = 0.10). 1a, bcva decreased from 31.6 5.1 at baseline to 28.8 11.6 letters read at week 16 in eyes treated initially with placebo and subsequently increased to 35.4 11.2 letters read at completion of infliximab treatment (week 32). on the other hand, bcva increased from 23.5 10.3 at baseline to 30.4 13.4 letters read at week 16 in eyes treated initially with infliximab and remained essentially unchanged at completion of placebo treatment (31.4 12.1 letters read, week 32). changes in visual acuity (va) measured by the number of letters that a patient was able to read from the etdrs chart from baseline to study end. eyes of group a and group b were treated initially with placebo followed by infliximab or vice versa, respectively (a). the improvement of visual acuity in infliximab - treated eyes is significantly greater by 24.3% compared with that of placebo - treated eyes, as evaluated by a mixed - models approach for imbalanced crossover design (b). collectively, four infusions of infliximab resulted in an increase in bcva, from mean sd 25.5 10.7 (range 640) to 32.3 12.4 (range 947) letters read (n = 13). in contrast, bcva remained essentially unchanged in placebo - treated eyes (n = 14), from 31.5 10.5 (range 945) to 31.1 11.3 (range 1043) letters read. least squares means indicated that infliximab administration resulted in 28.6% and placebo resulted in 4.3% improvement in visual acuity. a possible carryover effect of infliximab in the second part of the study was tested in this model and was found to be nonsignificant. overall, the improvement in visual acuity in the infliximab - treated eyes was significantly greater by 24.3% compared with that in placebo - treated eyes (95% ci 4.843.7 ; p = 0.0167) (fig. 1b). a similar analysis failed to reveal a significant effect of infliximab over placebo in the secondary end points of the study. least squares means indicated that central macular thickness assessed by oct decreased by 3.7% with infliximab and increased by 1.3% with placebo (p > 0.5). moreover, no significant difference between infliximab and placebo could be demonstrated in the scores of fundus photographs graded according to the etdrs protocol. as shown in table 2, the following changes from baseline (2 week) to the end of the study (32 weeks) were evident in our 10 patients (13 eyes) who, either in the first or second part of the study, received four infliximab infusions : bcva improved by at least one line (5 letters in the edtrs chart) in 10 of 14 eyes (77%), whereas 5 eyes (38%) gained two or more lines, 2 eyes remained stable, and 1 eye worsened by 5 letters. foveal thickness decreased by > 10% in 5 eyes (38%), remained stable in 5 eyes, and increased by > 10% in 3 eyes. finally, as documented by both fundus photographs and fluoroangiography, the status of diabetic retinopathy improved in 3 eyes, remained stable in 5 eyes, and deteriorated in 1 eye. changes from baseline to 32 weeks in bcva, dme, and retinopathy status after infliximab, given either during study treatment 1 (eyes 0105) or study treatment 2 (eyes 0714) grading according to the etdrs protocol : 20 : macular edema only ; 35, 43, 47, and 53 : mild, moderate, moderately severe, and severe nonproliferative diabetic retinopathy, respectively. infliximab was well tolerated and no safety issues emerged from hematologic monitoring, urinalysis, or ophthalmic assessments, including intraocular pressure or cataract formation during the study. moreover, no significant impact of placebo or infliximab on glycemic control was noted. one male patient (aged 64, with diabetes type 2 for 4 years ; table 1) had a diagnosis of breast cancer 5 months after the baseline evaluation. this condition was considered to be unrelated to infliximab treatment, because a slightly palpable mass leading to the final diagnosis was revealed in a physical examination at week 18, only 14 days after the first infliximab injection. another male patient (aged 73, with diabetes type 2 for 18 years ; table 1) developed an upper respiratory tract infection that was treated successfully with antibiotics at week 29 while receiving placebo. finally, one male patient (aged 71, with diabetes type 2 for 11 years ; table 1) developed a neuro - ischemic foot ulcer at week 51 (18 weeks after receiving the eighth study injection of placebo). individual values of bcva at baseline, week 16 (end of the first study treatment), and week 32 (final evaluation after the second study treatment) are shown in table 1. baseline bcva was not different between groups (31.6 5.1 vs. 23.5 10.3 letters read ; t = 1.7 ; p = 0.10). as shown in fig. 1a, bcva decreased from 31.6 5.1 at baseline to 28.8 11.6 letters read at week 16 in eyes treated initially with placebo and subsequently increased to 35.4 11.2 letters read at completion of infliximab treatment (week 32). on the other hand, bcva increased from 23.5 10.3 at baseline to 30.4 13.4 letters read at week 16 in eyes treated initially with infliximab and remained essentially unchanged at completion of placebo treatment (31.4 12.1 letters read, week 32). changes in visual acuity (va) measured by the number of letters that a patient was able to read from the etdrs chart from baseline to study end. eyes of group a and group b were treated initially with placebo followed by infliximab or vice versa, respectively (a). the improvement of visual acuity in infliximab - treated eyes is significantly greater by 24.3% compared with that of placebo - treated eyes, as evaluated by a mixed - models approach for imbalanced crossover design (b). collectively, four infusions of infliximab resulted in an increase in bcva, from mean sd 25.5 10.7 (range 640) to 32.3 12.4 (range 947) letters read (n = 13). in contrast, bcva remained essentially unchanged in placebo - treated eyes (n = 14), from 31.5 10.5 (range 945) to 31.1 11.3 (range 1043) letters read. least squares means indicated that infliximab administration resulted in 28.6% and placebo resulted in 4.3% improvement in visual acuity. a possible carryover effect of infliximab in the second part of the study was tested in this model and was found to be nonsignificant. overall, the improvement in visual acuity in the infliximab - treated eyes was significantly greater by 24.3% compared with that in placebo - treated eyes (95% ci 4.843.7 ; p = 0.0167) (fig. a similar analysis failed to reveal a significant effect of infliximab over placebo in the secondary end points of the study. least squares means indicated that central macular thickness assessed by oct decreased by 3.7% with infliximab and increased by 1.3% with placebo (p > 0.5). moreover, no significant difference between infliximab and placebo could be demonstrated in the scores of fundus photographs graded according to the etdrs protocol. as shown in table 2, the following changes from baseline (2 week) to the end of the study (32 weeks) were evident in our 10 patients (13 eyes) who, either in the first or second part of the study, received four infliximab infusions : bcva improved by at least one line (5 letters in the edtrs chart) in 10 of 14 eyes (77%), whereas 5 eyes (38%) gained two or more lines, 2 eyes remained stable, and 1 eye worsened by 5 letters. foveal thickness decreased by > 10% in 5 eyes (38%), remained stable in 5 eyes, and increased by > 10% in 3 eyes. finally, as documented by both fundus photographs and fluoroangiography, the status of diabetic retinopathy improved in 3 eyes, remained stable in 5 eyes, and deteriorated in 1 eye. changes from baseline to 32 weeks in bcva, dme, and retinopathy status after infliximab, given either during study treatment 1 (eyes 0105) or study treatment 2 (eyes 0714) grading according to the etdrs protocol : 20 : macular edema only ; 35, 43, 47, and 53 : mild, moderate, moderately severe, and severe nonproliferative diabetic retinopathy, respectively. infliximab was well tolerated and no safety issues emerged from hematologic monitoring, urinalysis, or ophthalmic assessments, including intraocular pressure or cataract formation during the study. moreover, no significant impact of placebo or infliximab on glycemic control was noted. one male patient (aged 64, with diabetes type 2 for 4 years ; table 1) had a diagnosis of breast cancer 5 months after the baseline evaluation. this condition was considered to be unrelated to infliximab treatment, because a slightly palpable mass leading to the final diagnosis was revealed in a physical examination at week 18, only 14 days after the first infliximab injection. another male patient (aged 73, with diabetes type 2 for 18 years ; table 1) developed an upper respiratory tract infection that was treated successfully with antibiotics at week 29 while receiving placebo. finally, one male patient (aged 71, with diabetes type 2 for 11 years ; table 1) developed a neuro - ischemic foot ulcer at week 51 (18 weeks after receiving the eighth study injection of placebo). evidence suggests that altered local expression of tnf may play an important role in the pathogenesis of dme (17,18) and that low - grade subclinical inflammation is responsible for many of the signature vascular lesions of diabetic retinopathy (9). moreover, studies in patients with arthritis have shown that anti - tnf therapy negatively affects vascular permeability and angiogenesis by decreasing vegf (19), which has been implicated directly in the pathogenesis of dme and diabetic retinopathy (2,9,11). although studies have shown the possible benefits of intravitreal corticosteroids and anti - vegf antibodies in the treatment of dme, focal / grid laser photocoagulation continues to be the only proven safe and effective treatment (2). it is noteworthy that there are no previous randomized placebo - controlled phase iii studies for any treatment option in dme. the present study included patients with sight - threatening dme that was unmanageable by laser photocoagulation. of the 14 evaluable eyes, 12 had previously received at least two laser sessions (maximum eight sessions, eye 12) (table 1). the two remaining eyes had leaking microaneurysms within the foveal avascular zone, making laser photocoagulation unsafe for the central vision. in view of our previously published encouraging preliminary results with infliximab (15), the crossover design of this phase iii study was chosen to allow all participants with sight - threatening dme to receive infliximab and to enhance the statistical power of the study. because of the strict study exclusion criteria and because intravitreal administration of anti - vegf agents has been increasingly used over the past 2 years in greece, we were able to recruit only 12 patients. thus, the main limitation of the present study is the small sample size, limiting statistical analysis and not ensuring that randomization balanced all known and unknown risk factors between groups. however, the mean duration of diabetes, as well as the mean number of previous laser treatments and length of time since the last session were similar (table 1), whereas baseline bcva was also not different between groups. despite the small sample size, our short crossover trial of a conventional dose of infliximab demonstrated a significant improvement over placebo on the severely impaired visual acuity of these patients. infliximab, either as a first or second agent resulted in almost similar increases in bcva (6.9 and 6.6 mean letters read, respectively). thus, this infliximab - induced mean observed improvement of almost 7 letters read in the edtrs chart is comparable to the mean gain in bcva at 6 months in patients with dme treated with four intravitreal injections of the anti - vegf agent ranibizumab (11). moreover, at the end of the study bcva improved by at least one line in 77% and by at least two lines in 38% of infliximab - treated eyes. these results are considered clinically important, given the fact that patients included in this study were unsuitable for all available approved treatment options. it seems that improvement of bcva was not correlated with the secondary anatomic and vision - related end points, because neither an anatomic improvement of dme by oct nor a decrease in fundus photographs grading by the etdrs protocol could be demonstrated. a recent study of 323 eyes from a randomized clinical trial of two methods of laser photocoagulation for dme found that the oct - based assessment of the extensiveness of dme neither explains additional variation in baseline visual acuity above that explained by other known important variables nor predicts changes in macular thickness or visual acuity after laser photocoagulation (20). for example, local tnf neutralization by infliximab could have exerted a beneficial effect on photoreceptor function, explaining in part the improvement in bcva despite the persistence of macular edema in patients throughout our study. 2, the photoreceptor inner / outer segment line, which was invisible at baseline or after the placebo treatment, partially reappeared after infliximab treatment. whether such changes underlie the infliximab - induced bcva improvement remains to be seen, because the photoreceptor inner / outer segment junction line was not identifiable by oct at any time in all other patients. sequential oct images at baseline (a), at completion of placebo treatment (b), and at completion of infliximab treatment (c). the photoreceptor inner / outer segment junction line at the foveola is highly disrupted at week 2 (a, arrow), becomes almost absent at week 16 (b, arrow), and appears partially restored at week 32 (c, arrow). the key safety considerations that emerged during the first years of clinical use of infliximab included infections, autoimmune disease, demyelinating disease, malignancies, and congestive heart failure (8). overall rates of these conditions in randomized controlled trials were not significantly increased during treatment compared with placebo. postmarketing surveillance data in thousands of patients have clearly shown that the safety profile of infliximab is excellent, provided that it is not used to treat patients with active infection, malignancy, preexisting demyelinating conditions, and heart failure and that precautions are taken for reactivation of latent tuberculosis. no other particular safety signals in patients with diabetes have emerged (8). overall, infliximab was well tolerated in our study. to summarize, a short - term treatment with infliximab significantly improved bcva in eyes with advanced - stage sight - threatening dme refractory to standard treatment, further suggesting an important role for tnf - mediated pathogenetic mechanisms in this condition. this positive result also suggests that larger and longer term placebo - controlled trials are warranted to assess the efficacy and safety of systemic tnf blockade and/or of local delivery of anti - tnf antibodies by intravitreal injection (2124) for the primary treatment of dme. | objectivebecause many patients with diabetic macular edema (dme) do not respond to focal / grid laser photocoagulation, the only currently approved treatment, alternatives are needed. based on encouraging preliminary findings, we aimed to assess efficacy and safety of the anti tumor necrosis factor (tnf) monoclonal antibody infliximab in this condition.research design and methodsthis was a single - center, double - blind, randomized, placebo - controlled, crossover study. eleven patients with sight - threatening dme persisting after two sessions of laser photocoagulation received infliximab (5 mg / kg) intravenously at weeks 0, 2, 6, and 14, followed by placebo at weeks 16, 18, 22, and 30, or vice versa. blinding was maintained to week 32, when the final assessments were performed. best corrected visual acuity evaluated by a mixed - models approach for imbalanced crossover design using the percentage difference as the outcome variable was the primary study end point. data were analyzed on an intention - to - treat basis.resultsearly treatment of diabetic retinopathy study (etdrs) scores dropped from 31.6 5.1 (mean sd) letters read at baseline to 28.8 11.6 letters read at week 16 in six placebo - treated eyes and improved to 35.4 11.2 letters read after infliximab. in contrast, visual acuity improved from 23.5 10.3 at baseline to 30.4 13.4 letters read at week 16 in eight infliximab - treated eyes and was sustained at completion of placebo treatment (31.4 12.1 letters read). the excess visual acuity in infliximab - treated eyes was greater by 24.3% compared with that in placebo - treated eyes (95% ci 4.843.7 ; p = 0.017). infliximab treatment was well tolerated.conclusionsthe positive results of this small phase iii study suggest that larger and longer term trials should be conducted to assess the efficacy of systemic or intravitreal anti - tnf agent administration for primary treatment of dme. |
trimethyltin (tmt), a short - chain trialkyltin, is used as a stabilizing agent for certain plastics and is a neurotoxin that induces neuronal damage in both humans and experimental animals [1 - 3 ]. tmt causes a selective degeneration of pyramidal neurons in the hippocampus and the cortical areas connected to the hippocampus [4, 5 ]. proposals have been made that tmt produces excess generation of cellular oxidative species, which leads to apoptotic cell death. therefore, oxidative stress and apoptosis resulting in cognitive dysfunction may be a hallmark feature of neurodegeneration. in this case, drugs, including herbal - based drugs, that can inhibit tmt - induced oxidative damage may represent a new generation of therapeutics for neurological diseases. administration of saffron extract and crocin improved spatial cognitive abilities following chronic cerebral hypoperfusion in rats in part through their antioxidant activities. additionally, treatment with rosmarinus officinalis aerial parts essential oil was found, through performance on the morris water maze task, to enhance both the memory function in the intact memory and the scopolamine - induced learning deficits in rats. lipophilic extracts of the gum resin of boswellia species have been used in herbal medicine since ancient times for various indications in folk medicine to treat inflammatory and infectious diseases. a rich unique group of pentacyclic triterpenes, termed boswellic acids (bas), accounts for the active substances in the extract. some of the chemical compounds present in frankincense are acid resin (56%), gum, which is similar to gum arabic (30% - 36%), 3-acetyl - beta- boswellic acid (boswellia sacra), alpha - boswellic acid (boswellia sacra), 4-o - methyl - glucuronic acid (boswellia sacra), incensole acetate and phellandrene. olibanum gum resin, as a medicinal plant, is traditionally used in india to treat various diseases, including inflammatory ailments, arthritis, cardiac disorders and pain [7, 14 ]. several studies have shown that bas are the major constituents in olibanum gum resin and that they have anti - inflammatory, anti - cancerous and anti - ulcerous activities [8 - 11 ]. moreover, in in vivo and in vitro studies, bas have been found to inhibit the synthesis of pro - inflammatory enzymes and 5-lipoxygenase such as leukotrine b4 (ltb4), which cause inflammatory reactions, bronchoconstriction, and increased vascular permeability [12, 13, 15 ]. also, the administration of ethyl acetate (0.1 mg/ kg) and n - butanol (0.1 mg / kg) fractions obtained from gum resin of boswellia carterii (b. carterii) has been reported to improve memory function in intact rats and in animals with hyoscine - induced memory impairment. several studies have demonstrated that excessive production of reactive oxygen species (ros), which occurs in tmt - induced neurotoxicity, leads to oxidative damage in the brain ; therefore, pursuing antioxidant therapies to reduce that damage could be supportive [16 - 19 ]. the present study was designed to evaluate the possible neuroprotective or ameliorative effects of ba on tmt - induced learning and memory deficits and oxidative stress. for this purpose furthermore, acetylcholinesterase (ache) activity, glutathione (gsh) content and malondialdehyde (mda) level in the cerebral cortex were measured. because of the important role of the cerebral cortex in memory function and easy separation of total brain, this part of brain has often been used for biochemical analysis. tmt chloride, mda tetrabutylammonium, reduced gsh and dtnb [5,5-dithiobis-(2-nitrobenzoic acid) ] were obtained from sigma - aldrich, and ba was purchased from shanghai research institute of the chemical industry testing center. male wistar rats weighting 230 - 260 g were purchased from the animal facilities of the pharmaceutical research center, bu - ali research institute, mashhad university of medical sciences. all animal experiments were approved and were carried out in accordance with the ethical committee acts of mashhad university of medical sciences. the animals were housed in standard cages under hygienic conditions and were provided standard animal feed and water ad libitum throughout the treatment period. for acclimatization, the rats were kept in the animal houses for one week prior to the beginning of the study. forty rats were randomly divided into five groups (n = 8 per group) : the control group and four tmt - treated groups. the rats with tmt - induced lesions were treated with saline [(tmt - lesioned + saline group, 1.6 ml / kg) which means rats received saline instead of ba ], ba at 40 mg / kg (b40 group), ba at 80 mg / kg (b80 group), or ba at 160 mg / kg (b160 group). the rats were injected intraperitoneally (i.p.) with tmt (8.0 mg / kg body weight) dissolved in 0.9% saline. the morris water maze task was used to determine spatial memory impairment induced by tmt administration. the apparatus was a circular pool of 136 cm in diameter and 60 cm in depth. the pool was filled with water to a depth of 25 cm, and the water temperature remained between 20 - 22c. several visual cues were placed on the walls of the experiment room. the experiment consisted of five days of training. on the training days, the rats were subjected to 4 sessions (on days 1 - 5) with 10-seconds intervals for each of 2 trials to find a hidden, transparent platform submerged 1 cm below the water s surface. in every trial, the rat was placed in the water facing the wall of the pool in one of the four possible starting locations. the rat was allowed to search for the platform for 60 seconds and was gently guided if it could not reach it. rats were allowed to remain on the platform for 15 seconds to learn extra maze cues. two days after the last training day, each rat was subjected to a probe trial, in which the platform was removed from the pool, and the animals were tested in a 60-second spatial probe trial. the time spent in the quadrant where the platform had been located during the training days was measured, and the amount of time spent in that quadrant was calculated. this parameter was taken as an indicator of spatial memory. at the end of the experiment, the samples were snap - frozen in liquid nitrogen and stored at - 80c until use. the evaluation of lipid peroxidation was done by determining the (mda) level, as a marker of lipid peroxidation, in the cerebral cortex. mda reacts with thiobarbituric acid (tba) as a tba reactive substance (tbars) to produce a pink - colored complex, which has a maximum absorbance at 532 nm. in this method, 3 ml of phosphoric acid (1%) and 1 ml of tba (0.6%) were added to brain tissue homogenate (10%) in kcl, after which the mixtures were heated for 45 minutes in boiling water. after the mixture had been cooled, 4 ml of n - butanol was added and vortex - mixed for 1 minutes, followed by centrifugation at 3,000 g for 10 minutes. then, the organic layers were separated and transferred to a fresh tube, and the absorbance was recorded at 532 nm. mda levels were expressed as nmol / g tissue. the gsh level in rat brain tissue the nitromercaptobenzoic acid anion released has an intense yellow color and can be used to determine the presence of -sh groups. the absorbance of this yellow component was measured at 412 nm and compared with the standard curve to determine the gsh concentration. the ache assay was performed according to the colorimetric method of ellman by using acetylthiocholine iodide as a substrate.the reaction of the thiol compound with dtnb forms a complex with absorbance at 405 nm. for this test, 20 l of sample serum and 100 l of 5% (w / v) acetylthiocholine iodide solution were added to 3 ml of elman reagent (0.02% dtnb in 0.1-m sodium dihydrogen phosphate buffer solution, ph = 7.4). the cholinesterase activity was calculated as follows : cholinesterase (mu/ ml, at 25c) = change in absorbance in 30 s 23400. statistical differences were evaluated by using the one - way analysis of variance (anova), followed by the tukey post - hoc test. additionally, for the morris water maze test, statistical analyses were performed using the two - way anova, followed by the bonferroni test. a p - value < 0.05 was considered as significant. to evaluate spatial memory impairment induced by tmt administration, we used the morris water maze task. animals were treated with different doses of ba (40, 80 and 160 mg/ kg) after treatment with tmt at 8 mg / kg. as shown in (fig. 1)a, the escape latency time (elt), the time spent to find the platform during five days was measured. administration of tmt at 8 mg / kg significantly increased the elt in five days compared with the control group, and the administration of ba at 160 mg / kg to the tmt - treated rats significantly decreased the elt on days 4 and 5 (p < 0.01 and p < 0.001). the results for the swimming paths indicated that rats in the tmt - treated group and the ba treatment groups often searched for the platform in a wrong way. thus, the rats took a longer time to locate the platform and had fewer excursions into the target region, thereby making the elt longer. a statistically significant decrease in the mean elt administration of tmt at 8 mg / kg significantly decreased the distance compared with the control group (p < 0.01), and the administration of ba at 160 mg / kg significantly increased the distance as compared with the tmt - lesioned + saline group (p < 0.05). during the test trial, the percentage of distance traveled in quadrant 1 (q1) in the control group was higher than it was in the tmt - treated groups. moreover, the percentage of distance traveled in q1 for the b160 group was increased significantly. 1c shows the spent time in the target area (probe) (s). administration of tmt at 8 mg / kg decreased the time the rats spent in the target area compared with the control group (p < 0.01), and the treatment of rats with ba at 160 mg / kg significantly increased that time compared with the tmt - lesioned + saline group (p < 0.01). in the final test trials, the swimming time spent in q1 (the target quadrant) was used to estimate retention. in this case, the tmt - lesioned + saline group spent more time swimming in the target quadrant compared with the control group. moreover, the rats in the b160 group spent more time swimming in the target quadrant than (fig. 1)e show the rats in the tmt - lesioned + saline group. finally, (fig. 1)d and (fig. 1)e shows the measured swimming speeds of the test (cm / s) on the probe day and during the 5 days of the test respectively. as fig. 2 shows, exposure to tmt increased the level of mda in the cortex of brain tissue compared with the control group (p < 0.01). remarkably, in the b80 (p < 0.05) and the b160 (p < 0.01) groups, the levels of mda in brain tissue were significantly decreased in comparison with that in the tmt - lesioned + saline group. however, the mda levels in the rats in the b40 groups were not significantly different from those in the tmt - lesioned + saline group. as fig. 3 shows, a significant decrease in the level of gsh was observed in tmt - lesioned + saline group compared with the control group (p < 0.01). furthermore, the gsh levels for the rats in the b40 and b80 groups were not significantly different from the gsh levels in the tmt - lesioned + saline group. however, the rats in the b160 group showed significantly increased gsh levels compared with the gsh levels in the rats in the tmt - lesioned + saline group (p < 0.01). the activity of ache was significantly increased in the rats in the tmt - lesioned + saline group compared to the control group (p < 0.01) (fig. 4) whereas all groups treated with ba at any of the three doses used in this study exhibited a significant inhibitory effect against ache. thus, treatments with any of the three different doses of ba (40, 80 and 160 mg / kg) used in this research led to significant reductions in ache activity compared to that in the tmt - lesioned + saline group. to evaluate spatial memory impairment induced by tmt administration, we used the morris water maze task. animals were treated with different doses of ba (40, 80 and 160 mg/ kg) after treatment with tmt at 8 mg / kg. as shown in (fig. 1)a, the escape latency time (elt), the time spent to find the platform during five days was measured. administration of tmt at 8 mg / kg significantly increased the elt in five days compared with the control group, and the administration of ba at 160 mg / kg to the tmt - treated rats significantly decreased the elt on days 4 and 5 (p < 0.01 and p < 0.001). the results for the swimming paths indicated that rats in the tmt - treated group and the ba treatment groups often searched for the platform in a wrong way. thus, the rats took a longer time to locate the platform and had fewer excursions into the target region, thereby making the elt longer. a statistically significant decrease in the mean elt administration of tmt at 8 mg / kg significantly decreased the distance compared with the control group (p < 0.01), and the administration of ba at 160 mg / kg significantly increased the distance as compared with the tmt - lesioned + saline group (p < 0.05). during the test trial, the percentage of distance traveled in quadrant 1 (q1) in the control group was higher than it was in the tmt - treated groups. moreover, the percentage of distance traveled in q1 for the b160 group was increased significantly. 1c shows the spent time in the target area (probe) (s). administration of tmt at 8 mg / kg decreased the time the rats spent in the target area compared with the control group (p < 0.01), and the treatment of rats with ba at 160 mg / kg significantly increased that time compared with the tmt - lesioned + saline group (p < 0.01). in the final test trials, the swimming time spent in q1 (the target quadrant) was used to estimate retention. in this case, the tmt - lesioned + saline group spent more time swimming in the target quadrant compared with the control group. moreover, the rats in the b160 group spent more time swimming in the target quadrant than (fig. 1)e show the rats in the tmt - lesioned + saline group. finally, (fig. 1)d and (fig. 1)e shows the measured swimming speeds of the test (cm / s) on the probe day and during the 5 days of the test respectively. as fig. 2 shows, exposure to tmt increased the level of mda in the cortex of brain tissue compared with the control group (p < 0.01). remarkably, in the b80 (p < 0.05) and the b160 (p < 0.01) groups, the levels of mda in brain tissue were significantly decreased in comparison with that in the tmt - lesioned + saline group. however, the mda levels in the rats in the b40 groups were not significantly different from those in the tmt - lesioned + saline group. as fig. 3 shows, a significant decrease in the level of gsh was observed in tmt - lesioned + saline group compared with the control group (p < 0.01). furthermore, the gsh levels for the rats in the b40 and b80 groups were not significantly different from the gsh levels in the tmt - lesioned + saline group. however, the rats in the b160 group showed significantly increased gsh levels compared with the gsh levels in the rats in the tmt - lesioned + saline group (p < 0.01). the activity of ache was significantly increased in the rats in the tmt - lesioned + saline group compared to the control group (p < 0.01) (fig. 4) whereas all groups treated with ba at any of the three doses used in this study exhibited a significant inhibitory effect against ache. thus, treatments with any of the three different doses of ba (40, 80 and 160 mg / kg) used in this research led to significant reductions in ache activity compared to that in the tmt - lesioned + saline group. treatment with tmt induced learning and memory impairment in wistar rats, and treatment with ba at a dose of 160 mg / kg markedly improved learning and memory abilities on the water maze tasks. additionally, the activity of ache was significantly elevated following exposure to tmt whereas all groups treated with ba presented a significant inhibitory effect against ache. administration of tmt reduced gsh content and increased the level of mda in the cerebral cortex while treatment with ba at 160 mg / kg increased the gsh content and decreased the tmt - induced lipid peroxidation in rat brain tissue. the pathogenesis of tmt neurotoxicity is a complex event ; it contains multiple processes such as glutamate excitotoxicity and impairment of neurotransmission with oxidative stress [24, 25 ]. a suggestion has been made that tmt causes neuronal oxidative stress and increases the free radical production, which is a potential contributor in apoptotic cell death. several studies have shown that lipid peroxidation and oxidative stress are increased in tmt - induced neurotoxicity [7, 27 ]. moreover, free radial scavengers have an important role in protection against tmt - induced neurotoxicity in experimental animals. the possibility of ba being an antioxidant and memory enhancer makes this agent an ideal choice as a neuroprotective agent. for manifestation of oxidative damage, mda, the end product of lipid peroxidation generated in tissues by free radical injury, is considered to be a sensitive biomarker. in the present experiment, many researchers have found lipid peroxidation changes in brain tissue after treatment with tmt [7, 27 ]. as mentioned in the results, lipid peroxidation returned to near control levels in the b80 and the b160 groups. on the other hand, a major antioxidant, which protects cells against oxidative stress, exposure to tmt induces oxidative stress, which decreases the gsh levels and reflects the degree of oxidative insult. in this study, gsh was measured in all groups, and a significant depletion of gsh was observed in the rats treated only with tmt. several reports have indicated that gsh depletion is a critical factor in the induction of oxidative stress [5, 6, 29, 30 ]. therefore, depletion of endogenous gsh invariably sensitizes an animal to tmt - induced neuronal damage. in the present study, rats treated with 160 mg / kg of ba showed increased gsh levels, which is evidence for a compromised antioxidant defense. an elevated level of gsh may be part of a protective mechanism to reduce neuronal damage. previous studies have reported that ba has an efficient antioxidant activity [16, 17, 19 ]. hartmann evaluate the antioxidant effect of an extract of the plant boswellia serrata (b. serrata), which consists of ba, in an experimental model of acute ulcerative colitis induced by administration of acetic acid in rats. assimopoulou reported that b. serrata resin could additionally be used as a natural antioxidant in cosmetics and pharmaceutical preparations. in the research of sabina treatment with ba normalized the levels of lipid peroxidation and antioxidant status in mice with inflammation induced by using monosodium - urate crystals. they suggested that the effect of ba was similar to that of other pentacyclic triterpenes, such as ursolic acid and lutein. moreover, several researchers have reported the efficacy of agents with antioxidant activity in reducing tmt - induced neurotoxicity. kuar suggested that a prophylactic treatment with ginkgo biloba extract protected against tmt - induced neurodegeneration because of its antioxidant effects. the findings of qu showed that the anti - apoptotic effect of lycopene against tmt - induced neurotoxicity was due to its potential antioxidant activity. in the investigations of shin, ascorbate treatment significantly attenuated the early oxidative stress induced by tmt, leading to a persistent deficiency in gsh status. choi reported that quercetin, with its high antioxidant activity, could possess a wide range of beneficial activities for treating neurodegenerative disorders, notably alzheimer 's disease (ad). another possible mechanism underlying the beneficial effects of ba in our study is its ache inhibitory effects. additionally, neuronal damage in the cholinergic systems of animal models has been reported following exposure to tmt. in our experiment, exposure to tmt led to increased ache activity whereas ba treatment effectively reduced the activity of ache in the serum samples. therefore, another protective mechanism of ba in tmt - induced memory dysfunction may be mediated through inhibition of ache activity. in another study, the ethyl acetate fraction from onion (allium cepa l.) flesh and peel significantly reduced tmt - induced learning and memory impairment in mice due to ache inhibition. obviously, tmt is a neurotoxin that induces neural damage, which leads to behavioral and learning deficits and disrupts memory [35, 36 ]. many researchers have proven that tmt causes a degeneration of the pyramidal neurons in the rat hippocampus and the cortical areas (pyriform cortex, entorhinal cortex and subiculum) connected to the hippocampus, as well as neuronal loss in associated areas [2, 4, 37 ]. the best way to evaluate the deficits in hippocampal - dependent memory is to use the morris water maze test. the present study showed impairment in spatial learning in the group treated only with tmt, which agrees with the results in previous reports on spatial learning impairments [35, 39 ]. moreover, the results of the current study indicated that the spatial memory improved during the training days when the dose of ba in the treatment groups was increased. this finding is in agreement with the results reported by researcher that high antioxidant agents enhance the learning and memory abilities of rats [7, 32, 33 ]. in conclusion, ba effectively ameliorated tmt - induced neurotoxicity through ache inhibition and antioxidant activity. therefore, ba may be used as a potential natural resource for mitigating learning and memory dysfunction caused by aging and neurodegenerative diseases. ba, boswellic acid ; tmt, trimethyltin ; sd, standard deviation ; b, boswellic acid. ba, boswellic acid ; gsh, glutathione ; tmt, trimethyltin ; sd, standard deviation. ba, boswellic acid ; ache, acetylcholinesterase ; tmt, trimethyltin ; sd, standard deviation. | objectives : boswellic acid (ba), a compound isolated from the gum - resin of boswellia carterii, is a pentacyclic terpenoid that is active against many inflammatory diseases, including cancer, arthritis, chronic colitis, ulcerative colitis, crohn 's disease, and memory impairment, but the mechanism is poorly understood. this study investigated the effects of boswellic acid on spatial learning and memory impairment induced by trimethyltin (tmt) in wistar rats.methods:forty male wistar rats were randomly divided into 5 groups : normal group, tmt - administrated rats (8.0 mg / kg, intraperitoneally, i.p.) and tmt + ba (40, 80 and 160 mg / kg, i.p.)-administrated rats. ba was used daily for 21 days. to evaluate the cognitive improving of ba, we performed the morris water maze test. moreover, to investigate the neuroprotective effect of ba, we determined the acetylcholinesterase (ache) activity, the malondialdehyde (mda) level as a marker of lipid peroxidation, and the glutathione (gsh) content in the cerebral cortex.results:treatment with tmt impaired learning and memory, and treatment with ba at a dose of 160 mg / kg produced a significant improvement in learning and memory abilities in the water maze tasks. consistent with behavioral data, the activity of ache was significantly increased in the tmt - injected rats compared to the control group (p < 0.01) whereas all groups treated with ba presented a more significant inhibitory effect against ache than the tmt - injected animals. in addition, tmt reduced the gsh content and increased the mda level in the cerebral cortex as compared to the control group) p < 0.01). on the other hand, treatment with ba at 160 mg / kg slightly increased the gsh content and reduced the mda level in comparison to the tmt - administered group (p < 0.01).conclusion : the above results suggest that the effect of ba in improving the cognitive function may be mediated through its antioxidant activity. |
1a). four trials used tid dosing, three used bid dosing, and all but one trial (pregabalin 300 mg / day vs. placebo) used escalation to assigned fixed dosing over a period of 1 to 2 weeks. patients were randomized to placebo or fixed - dosage pregabalin at 150, 300, or 600 mg / day. one trial included a 75-mg / day dosage arm (8) ; results for this dosage are not presented here, as 75 mg / day is considered to be a nontherapeutic dosage of pregabalin in painful dpn. one trial (10) studied both dpn and postherpetic neuralgia patients administered flexible - dosage pregabalin (150600 mg / day), fixed - dosage pregabalin (600 mg / day), or placebo. to ensure consistency for the purposes of this analysis, only the dpn patients who received fixed - dosage pregabalin (28% of the total cohort) each of the studies shared fundamental inclusion criteria, including 18 years of age, an average pain score 4 (on an 11-point, likert - like numeric rating scale [nrs ] : 0 = no pain to 10 = worst possible pain) over a 7-day baseline period, and a score 40 mm on the 0- to 100-mm visual analog scale of the short - form mcgill pain questionnaire at screening and randomization (baseline and randomization in one study). prior therapeutic failure of gabapentin was an exclusion criterion in three studies (68). all patients provided informed consent before participation, and all studies were conducted in compliance with the ethics principles originating in or derived from the declaration of helsinki, internal review board requirements, or good clinical practices guidelines. the primary efficacy measure in each study was end point mean pain score (on the 11-point nrs) derived from entries in patients daily pain diaries. a supplemental responder analysis using two definitions of response patients with 50% and with 30% reductions in mean pain scores from baseline was also performed. end point mean sleep - interference score was derived from daily sleep diaries in which patients rated daily how much their pain had interfered with their sleep (also done using an 11-point nrs, with 0 = pain does not interfere with sleep to 10 = pain completely interferes with sleep). each study included the patient global impression of change, in which patients rate their improvement on a 7-point scale ranging from very much worse to very much improved these measures were also analyzed to determine whether there were significant differences versus placebo between bid and tid dosing regimens. finally, time to onset of sustained and clinically meaningful pain relief was investigated across the seven studies. this was defined as the first day on which patients demonstrated a 1-point reduction in mean pain score in patients with a 30 and 50% reduction in mean pain score at end point. these two criteria were imposed to ensure clinically meaningful and durable pain relief based on evidence that in studies with a similar design, a 30% improvement from baseline corresponds to a patient global impression of change of much improved or very much improved at study end point (13). baseline pain scores in a typical clinical trial with painful dpn patients are between 6 and 6.5 on the 0- to 10-point scale ; therefore, a 30% improvement is 2 points. we defined the event of interest in this time - to - event analysis as the time to the first 1-point reduction in the daily pain score, recognizing that any such criterion could be considered arbitrary. time to onset of sustained pain relief was evaluated by applying the kaplan - meier procedure, and comparisons with placebo were made using the log rank test. safety measures included incidence of adverse events, physical and neurologic examinations, 12-lead electrocardiogram, vital signs, weight change, and clinical laboratory testing including a1c. for the pooled analysis, all statistical testing of efficacy measures was performed on the intent - to - treat (itt) population. end point mean pain scores using last observation carried forward and sleep interference were analyzed with ancova (with a term for baseline values and a term for treatment), whereas other secondary efficacy measures (responders) were analyzed using a logistic regression model (with a term for baseline values and a term for treatment). a total of 1,510 patients represented the itt population in the seven studies : 557 received placebo, and 953 received pregabalin. ninety percent of patients were white, and 58% were male. mean age was 59 years, mean weight was 93 kg, and mean baseline pain score was 6.5 (fig. significant reductions in end point least - squares mean pain scores were observed for all three dosages investigated (p = 0.007 for 150 mg / day and p < 0.0001 for 300 and 600 mg / day vs. placebo) (fig. 2a and b). pain reductions associated with pregabalin appear to be positively correlated with dosage, with the greatest effect observed in patients treated with 600 mg / day. the proportions of patients experiencing 50 or 30% reductions in pain levels (responders) were significantly greater in the pregabalin groups than in the placebo group (fig. 2c) and were dose related. the number needed to treat for these data are as follows : pregabalin 600 mg / day 4.04 (95% ci 3.35.3), pregabalin 300 mg / day 5.99 (4.210.4), and pregabalin 150 mg / day 19.06 (ci for the absolute risk reduction contains 0, rendering the ci for the number needed to treat difficult to interpret). more patients treated with pregabalin reported global health status improvements than patients treated with placebo, as measured by the patient global impression of change. eighty percent of pregabalin 600 mg / day patients, 74% of 300 mg / day patients, and 65% of 150 mg / day patients were improved, compared with 54% of placebo patients (300 and 600 mg / day, p < 0.0001). in each of the above analyses, both bid and tid regimens of 600 mg / day pregabalin were significantly superior to placebo (p < 0.0001 for all comparisons of bid dosing to placebo and tid dosing to placebo). for 300 mg / day, only the tid dosing regimen was significantly superior to placebo (p < 0.0001 for all comparisons) ; however, the 300 mg / day bid dosage group was included in only one of the seven studies. kaplan - meier analysis revealed that the median time to onset of sustained (30% improvement from baseline) pain relief was 4 days in patients treated with pregabalin at 600 mg / day, 5 days in patients treated with pregabalin at 300 mg / day, 13 days in patients treated with pregabalin at 150 mg / day, and 60 days in patients receiving placebo (fig. comparison of the pregabalin treatment groups with placebo by log rank test confirmed that time to onset of clinically meaningful pain relief was statistically significantly more rapid than with placebo (p < 0.0001 for pregabalin doses of 300 and 600 mg / day and p = 0.01 for 150 mg / day). the median time to onset of sustained (50% improvement from baseline) pain relief was 6 days in patients treated with pregabalin at 600 mg / day and 12 days in patients treated with pregabalin at 300 mg / day. comparison of the pregabalin treatment groups with placebo by log rank test confirmed that time to onset of clinically meaningful pain relief was statistically significantly more rapid than with placebo (p < 0.0001 for pregabalin doses of 300 and 600 mg / day and p = ns for 150 mg / day). mean sleep interference scores at end point were also significantly improved in all three pregabalin groups, with 150, 300, and 600 mg / day showing reductions of 1.92, 2.32, and 2.62, respectively, compared with 1.32 for placebo (p = 0.003 for 150 mg / day and p < 0.0001 for 300 and 600 mg / day vs. placebo). as with change in mean pain score, improvement in sleep interference appeared to be positively correlated with dosage. incidence of treatment - emergent adverse events (teaes) appeared to be related to dosage, with most of the common teaes having the greatest incidence among patients receiving 600 mg / day (table 1). there was no consistent pattern in teae incidence rates by dosing regimen, with some teaes, such as peripheral edema and weight gain, having greater incidence in the bid dosing groups relative to the tid dosing groups, while other teaes, such as dizziness and somnolence, occurred with greater frequency in the tid than the bid groups. the discontinuation rate due to adverse events was greatest in the 600 mg / day group (fig. serious teaes occurred in 3.4, 2.3, and 4.9% of patients receiving 150, 300, and 600 mg / day pregabalin and in 3.4% of patients receiving placebo. the most common serious teaes reported by both pregabalin and placebo patients were of cardiovascular nature and were not considered associated with treatment. over the course of 5 to 13 weeks of treatment, the incidence of clinically meaningful weight gain (defined using a food and drug administration guided criterion of 7% weight increase from baseline to end point) for pregabalin versus placebo was dose related : 2.01% for pregabalin at 150 mg / day (p = 0.14 [95% ci 0.47 to 3.03% ]), 2.12% for pregabalin at 300 mg / day (p = 0.04 [0.09 to 2.86% ]), and 3.88% for pregabalin at 600 mg / day (p < 0.0001 [1.764.54% ]) groups, compared with 0.73% for the placebo group. the odds of weight gain compared with placebo are 2.3-fold for pregabalin at 150 mg / day (p = 0.14 [0.776.60% ]), 2.8-fold for pregabalin at 300 mg / day (p = 0.04 [1.067.47% ]), and 6.2-fold for pregabalin at 600 mg / day (p < 0.0001 [2.8213.67% ]). mean changes in weight from baseline to end point for pregabalin - treated patients versus placebo control subjects were 0.76 kg for pregabalin at 150 mg / day (p = 0.02 [0.081.11 kg ]), 1.86 kg for pregabalin at 300 mg / day (p < 0.0001 [1.262.14 kg ]), and 2.04 kg for pregabalin at 600 mg / day (p < 0.0001 [1.542.22 kg ]) ; the mean change was 0.16 kg for placebo. the incidence of 7% weight gain by study duration across all pregabalin doses is as follows : 5 weeks, 2.8% ; 8 weeks, 6.8% ; and 1213 weeks, 7.9%. there was a dose - related increase in edema and peripheral edema (table 1). the presence of edema across doses and by severity is as follows : pregabalin at 150 mg / day, mild 64.3%, moderate 28.6%, and severe 7.1% ; pregabalin at 300 mg / day, mild 56.4%, moderate 41%, and severe 2.6% ; pregabalin at 600 mg / day, mild 63.4%, moderate 33%, and severe 1.1% ; and placebo, mild 81%, moderate 19%, and severe 0%. in all pregabalin - treated groups, 15.2% had edema or peripheral edema, 6.0% had a 7% weight increase, and 2.3% had both weight increase and edema. in comparison, in the placebo - administered group, 7.3% had edema or peripheral edema, 1.5% had a 7% weight increase, and 0.2% had both. there were no clinically meaningful changes in laboratory values from baseline to end point reported in the studies. there were neither statistically significant nor clinically meaningful changes from baseline to end point in a1c values (% of total hb) in pregabalin - treated patients and in control subjects over 5 to 13 weeks of treatment : pregabalin at 150 mg / day, 0.07% (95% ci 0.07 to 0.24) ; pregabalin at 300 mg / day, 0.01% (0.01 to 0.26) ; pregabalin at 600 mg / day, 0.08% (0.09 to 0.13) ; and placebo, 0.03% (0.05 to 0.11). significant reductions in end point least - squares mean pain scores were observed for all three dosages investigated (p = 0.007 for 150 mg / day and p < 0.0001 for 300 and 600 mg / day vs. placebo) (fig. pain reductions associated with pregabalin appear to be positively correlated with dosage, with the greatest effect observed in patients treated with 600 mg / day. the proportions of patients experiencing 50 or 30% reductions in pain levels (responders) were significantly greater in the pregabalin groups than in the placebo group (fig. 2c) and were dose related. the number needed to treat for these data are as follows : pregabalin 600 mg / day 4.04 (95% ci 3.35.3), pregabalin 300 mg / day 5.99 (4.210.4), and pregabalin 150 mg / day 19.06 (ci for the absolute risk reduction contains 0, rendering the ci for the number needed to treat difficult to interpret). more patients treated with pregabalin reported global health status improvements than patients treated with placebo, as measured by the patient global impression of change. eighty percent of pregabalin 600 mg / day patients, 74% of 300 mg / day patients, and 65% of 150 mg / day patients were improved, compared with 54% of placebo patients (300 and 600 mg / day, p < 0.0001). in each of the above analyses, both bid and tid regimens of 600 mg / day pregabalin were significantly superior to placebo (p < 0.0001 for all comparisons of bid dosing to placebo and tid dosing to placebo). for 300 mg / day, only the tid dosing regimen was significantly superior to placebo (p < 0.0001 for all comparisons) ; however, the 300 mg / day bid dosage group was included in only one of the seven studies. kaplan - meier analysis revealed that the median time to onset of sustained (30% improvement from baseline) pain relief was 4 days in patients treated with pregabalin at 600 mg / day, 5 days in patients treated with pregabalin at 300 mg / day, 13 days in patients treated with pregabalin at 150 mg / day, and 60 days in patients receiving placebo (fig. comparison of the pregabalin treatment groups with placebo by log rank test confirmed that time to onset of clinically meaningful pain relief was statistically significantly more rapid than with placebo (p < 0.0001 for pregabalin doses of 300 and 600 mg / day and p = 0.01 for 150 mg / day). the median time to onset of sustained (50% improvement from baseline) pain relief was 6 days in patients treated with pregabalin at 600 mg / day and 12 days in patients treated with pregabalin at 300 mg / day. comparison of the pregabalin treatment groups with placebo by log rank test confirmed that time to onset of clinically meaningful pain relief was statistically significantly more rapid than with placebo (p < 0.0001 for pregabalin doses of 300 and 600 mg / day and p = ns for 150 mg / day). mean sleep interference scores at end point were also significantly improved in all three pregabalin groups, with 150, 300, and 600 mg / day showing reductions of 1.92, 2.32, and 2.62, respectively, compared with 1.32 for placebo (p = 0.003 for 150 mg / day and p < 0.0001 for 300 and 600 mg / day vs. placebo). as with change in mean pain score, improvement in sleep interference appeared to be positively correlated with dosage. incidence of treatment - emergent adverse events (teaes) appeared to be related to dosage, with most of the common teaes having the greatest incidence among patients receiving 600 mg / day (table 1). there was no consistent pattern in teae incidence rates by dosing regimen, with some teaes, such as peripheral edema and weight gain, having greater incidence in the bid dosing groups relative to the tid dosing groups, while other teaes, such as dizziness and somnolence, occurred with greater frequency in the tid than the bid groups. the discontinuation rate due to adverse events was greatest in the 600 mg / day group (fig. serious teaes occurred in 3.4, 2.3, and 4.9% of patients receiving 150, 300, and 600 mg / day pregabalin and in 3.4% of patients receiving placebo. the most common serious teaes reported by both pregabalin and placebo patients were of cardiovascular nature and were not considered associated with treatment. over the course of 5 to 13 weeks of treatment, the incidence of clinically meaningful weight gain (defined using a food and drug administration guided criterion of 7% weight increase from baseline to end point) for pregabalin versus placebo was dose related : 2.01% for pregabalin at 150 mg / day (p = 0.14 [95% ci 0.47 to 3.03% ]), 2.12% for pregabalin at 300 mg / day (p = 0.04 [0.09 to 2.86% ]), and 3.88% for pregabalin at 600 mg / day (p < 0.0001 [1.764.54% ]) groups, compared with 0.73% for the placebo group. the odds of weight gain compared with placebo are 2.3-fold for pregabalin at 150 mg / day (p = 0.14 [0.776.60% ]), 2.8-fold for pregabalin at 300 mg / day (p = 0.04 [1.067.47% ]), and 6.2-fold for pregabalin at 600 mg / day (p < 0.0001 [2.8213.67% ]). mean changes in weight from baseline to end point for pregabalin - treated patients versus placebo control subjects were 0.76 kg for pregabalin at 150 mg / day (p = 0.02 [0.081.11 kg ]), 1.86 kg for pregabalin at 300 mg / day (p < 0.0001 [1.262.14 kg ]), and 2.04 kg for pregabalin at 600 mg / day (p < 0.0001 [1.542.22 kg ]) ; the mean change was 0.16 kg for placebo. the incidence of 7% weight gain by study duration across all pregabalin doses is as follows : 5 weeks, 2.8% ; 8 weeks, 6.8% ; and 1213 weeks, 7.9%. there was a dose - related increase in edema and peripheral edema (table 1). the presence of edema across doses and by severity is as follows : pregabalin at 150 mg / day, mild 64.3%, moderate 28.6%, and severe 7.1% ; pregabalin at 300 mg / day, mild 56.4%, moderate 41%, and severe 2.6% ; pregabalin at 600 mg / day, mild 63.4%, moderate 33%, and severe 1.1% ; and placebo, mild 81%, moderate 19%, and severe 0%. in all pregabalin - treated groups, 15.2% had edema or peripheral edema, 6.0% had a 7% weight increase, and 2.3% had both weight increase and edema. in comparison, in the placebo - administered group, 7.3% had edema or peripheral edema, 1.5% had a 7% weight increase, and 0.2% had both. there were no clinically meaningful changes in laboratory values from baseline to end point reported in the studies. there were neither statistically significant nor clinically meaningful changes from baseline to end point in a1c values (% of total hb) in pregabalin - treated patients and in control subjects over 5 to 13 weeks of treatment : pregabalin at 150 mg / day, 0.07% (95% ci 0.07 to 0.24) ; pregabalin at 300 mg / day, 0.01% (0.01 to 0.26) ; pregabalin at 600 mg / day, 0.08% (0.09 to 0.13) ; and placebo, 0.03% (0.05 to 0.11). in this pooled analysis of patients with painful dpn from seven randomized, controlled trials spanning the effective dose range, pregabalin was shown to significantly reduce pain associated with dpn. the pooled analysis, in contrast to individual reports, revealed efficacy of the 150-mg dose ; however, efficacy with bid dosing was only present with the 600-mg dose. in addition, time to event analysis revealed that pregabalin was associated with a dose - related, rapid onset of sustained pain relief. several anticonvulsants with diverse mechanisms of action have been subjected to large - scale randomized controlled trials assessing therapeutic efficacy in the treatment of painful dpn. these agents, which include topiramate (1416), lamotrigine (17), oxcarbazepine (18,19), and gabapentin (2022) have shown varying efficacy in clinical trials. in contrast, pregabalin has shown efficacy in six of seven clinical trials. among the seven trials, one included 150-, 300-, and 600-mg / day treatment arms, two included two of these dosages, and four included only one of these dosages (fig. pooling data from all treatment arms in this analysis adds to our knowledge of the efficacy, safety, and tolerability of pregabalin for treatment of painful dpn. in terms of efficacy, there was an evident dose response, with the greatest efficacy observed among patients treated with 600 mg / day. equally evident from this pooled analysis but not from examination of the trials individually, as 150 mg / day was not significantly efficacious in any individual study was the observation that patients treated with pregabalin at its lowest effective dosage for chronic neuropathic pain, 150 mg / day, experienced statistically significant improvements in their pain and pain - related sleep interference and responded to pregabalin (30% improvement) in proportions significantly greater than placebo. time to onset analysis of the pooled data revealed dose - related, rapid onset of durable pain relief. by day 4, 50% of the subjects taking 600 mg / day had a sustained (30% at end point) 1-point improvement in pain score, while a response of this magnitude was achieved by day 5 in the 300 mg / day group. all seven studies showed statistically significant differences between pregabalin and placebo by week 1 (610,12) or week 2 (11) ; however, these analyses do not necessarily imply that the response is clinically meaningful. this approach also does not provide insight into the durability of the response in individual patients. although not frequently used in pain therapeutic trials (23), the time to onset analysis used here provides numerical and graphic (fig. 2d) information that is clinically relevant for patient and clinician, specifically the likelihood of a predetermined clinical response (the hazard ratio) and the time to this response. the analysis in this report was complicated by the different dose escalation schedules of the individual studies. since time to onset was determined from the start of dose escalation and not the time point when an effective therapeutic dose was attained, the analysis may have overestimated the time to sustained efficacy. the present analyses revealed that dosing schedule (bid vs. tid) apparently made no meaningful difference for patients treated with 600 mg / day, as both regimens were highly statistically significant versus placebo. this finding is in contrast to studies of postherpetic neuralgia in which bid efficacy was demonstrated across a range of doses from 150 to 600 mg / day (24). the basis for this difference in efficacy between disease states is not known, although it may be related, in part, to the permitted use of concomitant pain medication in all postherpetic neuralgia pregabalin clinical trials (2426). however, the 150- and 300-mg / day doses were used bid in only one study in this pooled analysis (15), and further studies are required to definitively address this question. the dose - related increase in efficacy was accompanied by a dose - related increase in incidence of most adverse events. while there was a consistent increase in the incidence of dizziness across doses, the incidence of somnolence was similar in the 300- and 600-mg / day doses. examination of adverse events by dosing regimen, i.e., bid versus tid, for each pregabalin daily dosage did not reveal any consistent patterns favoring one regimen over the other. edema was not an exclusion criterion in any study ; however, clinical judgment is warranted when pregabalin is used in patients with preexisting edema. pregabalin was not associated with cardiovascular complications, rarely led to discontinuations, and was not associated with laboratory changes suggestive of renal or hepatic failure. the incidence of reported weight gain was not only dose related but also dependent on duration of exposure. the underlying cause of the weight gain is not known and does not appear to be related to the presence of peripheral edema. there was no evidence that the weight increase compromised glycemic control ; the pooled analysis showed no clinically meaningful changes in a1c values in any dose cohort in studies with treatment durations of 5 to 13 weeks. long - term studies are warranted to address this question. in conclusion, the current pooled analysis of seven randomized, controlled clinical trials in patients with painful dpn showed that over the effective dose range, pregabalin not only significantly reduced pain associated with dpn but was also associated with rapid onset of sustained pain relief. the improvement in pain relief was accompanied by a dose - related incidence of adverse events. | objective to evaluate the efficacy, safety, and tolerability of pregabalin across the effective dosing range, to determine differences in the efficacy of three times daily (tid) versus twice daily (bid) dosage schedules, and to use time - to - event analysis to determine the time to onset of a sustained therapeutic effect using data from seven trials of pregabalin in painful diabetic peripheral neuropathy (dpn).research design and methods data were pooled across seven double - blind, randomized, placebo - controlled trials using pregabalin to treat painful dpn with dosages of 150, 300, and 600 mg / day administered tid or bid. only one trial included all three of these dosages, and tid dosing was used in four. all studies shared fundamental selection criteria, and treatment durations ranged from 5 to 13 weeks.resultspooled analysis showed that pregabalin significantly reduced pain and pain - related sleep interference associated with dpn (150, 300, and 600 mg / day administered tid vs. placebo, all p 0.007). only the 600 mg / day dosage showed efficacy when administered bid (p 0.001). pain and sleep interference reductions associated with pregabalin appear to be positively correlated with dosage ; the greatest effect was observed in patients treated with 600 mg / day. kaplan - meier analysis revealed that the median time to onset of a sustained (30% at end point) 1-point improvement was 4 days in patients treated with pregabalin at 600 mg / day, 5 days in patients treated with pregabalin at 300 mg / day, 13 days in patients treated with pregabalin at 150 mg / day, and 60 days in patients receiving placebo. the most common treatment - emergent adverse events were dizziness, somnolence, and peripheral edema.conclusionstreatment with pregabalin across its effective dosing range is associated with significant, dose - related improvement in pain in patients with dpn. |
focal segmental glomerulosclerosis (fsgs) causes scarring or sclerosis of glomeruli that act as tiny filters in the kidneys, damage to which results in diminished ability to properly filter blood, resulting in the urinary loss of plasma proteins and subsequent proteinuria. a 60-year - old, white female with a history of intermittent proteinuria was referred by her primary care physician for renal dysfunction. she also had rheumatoid arthritis (ra) but no active synovitis and was maintained on prednisone 5 mg / d. she also complained of worsening vision in her right eye and was diagnosed with optic neuritis (on). she remained stable for about 8 months when examination indicated fsgs relapse, and she reported painful ra flares. she was treated with acthar gel (40 mg biweekly) for 6 months, after which proteinuria and urine protein - to - creatinine ratio decreased to about half. her on improved, and she reported that she had fewer ra flares and pain improved by 50%. this case of confirmed fsgs showed an improved response to treatment with acthar gel for fsgs with concomitant ra and on. this referral case is relevant to primary care practitioners who treat disorders that may be responsive to corticosteroid therapy. the antiproteinuric effects and ancillary improvement in ra and on symptoms during treatment with acthar gel are not entirely explained by its steroidogenic actions. acth is a bioactive peptide that, together with -melanocyte - stimulating hormone, exhibits biologic efficacy by modulating proinflammatory cytokines and subsequent leukocyte extravasation and may have autocrine / paracrine effects in joints. while acthar gel was primarily administered in this case to treat proteinuria, it also showed ancillary benefits in patients with concomitant inflammatory disease states. focal segmental glomerulosclerosis (fsgs) is named for the characteristic scarring or sclerosis of glomeruli that act as tiny filters in the kidneys. focal relates to the fact that only some of the filters are damaged, whereas damage to the glomeruli results in a diminished ability to properly filter blood, resulting in the urinary loss of plasma proteins (ie, proteinuria), which is a hallmark of nephrotic syndrome (ns). the etiology of fsgs is often unknown, but known risk factors include infection, drug toxicity, and systemic diseases such as diabetes, hypertension, and obesity.1 fsgs is a relatively common form of kidney disease in the united states and is now one of the most common patterns of glomerular injury encountered in human kidney biopsies, as well as the most common cause of proteinuria in the african american and us hispanic populations.1 in 2012, a clinical practice guideline from the organization kidney disease : improving global outcomes (kdigo) was published based on a systematic literature review conducted in january 2011, and supplemented by additional evidence through november 2011.1 the recommended initial treatment of idiopathic fsgs associated with clinical features of the ns is immunosuppressive therapy that usually begins with prednisone given at high dose for a minimum of 4 weeks to a maximum of 16 weeks as tolerated, to achieve remission, with subsequent tapering over 6 months.1 kdigo recommends consideration of calcineurin inhibitor as first - line therapy for patients with a relative contraindication to high - dose corticosteroids (cs).1 rheumatoid arthritis (ra) is classified according to the 2010 american college of rheumatology and european league against rheumatism classification criteria. the current classification focuses on features at earlier stages that are associated with persistent / erosive disease.2 historically, treatment for most patients started with cs or nonsteroidal anti - inflammatory drugs. however, emerging evidence indicates that early and aggressive targeted - treatment strategies that provide consistent suppression of ra disease activity is linked to better long - term outcomes.3,4 optic neuritis (on) is an inflammatory, demyelinating condition that is highly associated with multiple sclerosis (ms), and it may be the presenting feature in 15% to 20% of patients with ms.5 on typically affects young adults, and women are affected more often than men. on is second only to glaucoma as the most common acquired optic nerve disorder in persons younger than age 50.6 on usually improves on its own and although intravenous cs may speed recovery, it does not appear to provide long - term benefit and undergoing no treatment for acute on is an option.6,7 a meta - analysis of randomized controlled clinical trials using cs or adrenocorticotropic hormone (acth) showed that either modality produced significant improvement of visual disability and is therefore effective in accelerating short - term recovery.8 the author is not aware of a previous case that highlights an improved response to treatment with acthar gel (repository corticotropin injection) in a patient having these multiple disorders that are usually treated with cs therapy. a 60-year - old, white, obese woman was referred by her primary care physician for renal dysfunction. the patient, who has a history of intermittent proteinuria, had normal renal biopsy findings 14 years ago, and would likely benefit from another biopsy. she also has a history of hypertension, hyperlipidemia, hypothyroidism, peptic ulcer, chronic obstructive pulmonary disease, ra, and type 2 diabetes mellitus. proteinuria was 2.5 g at presentation, serum creatinine was at a normal level, and c - reactive protein level was elevated. glomerular immunofluorescence was uniformly negative for immunoglobulins igg, iga, complement c3, c1q, and light chains. the quality of glomerular tissue preservation was adequate, with no evident cellular or proliferative changes or entrapment of immune complexes at any capillary or mesangial foci. foot processes of the visceral epithelial cells and capillary basement membranes were intact and free of defects. the patient was treated with an angiotensin - converting enzyme (ace) inhibitor for fsgs and was maintained on her current dosage of prednisone for ra. she also complained of worsening vision in her right eye and of seeing water bubbles. an exam with an ophthalmologist showed that the patient had orbital inflammation and on hyperemia and she was diagnosed with on. the patient s fsgs remained stable for approximately 8 months after presentation when examination showed worsening edema and highly probable fsgs relapse. serum creatinine concentration was 1.54 mg / dl, and she had 4 + proteinuria (319 mg / dl) and a urine protein - to - creatinine ratio (upcr) of 9.3 g / g. the patient also experienced painful ra flares during ongoing treatment with 5 mg of prednisone once daily. she began treatment with a 6-month regimen of acthar gel (40 u twice weekly) in april 2013 for fsgs. at her initial follow - up visit in september 2013, proteinuria and upcr had decreased to about one - half (159 mg / dl and 4.3 g / g, respectively) and serum albumin was 3.4 g / dl. at a follow - up visit later in september, spot urine upcr was 1.78 g / g and serum albumin was 3.7 g / dl. in addition, ophthalmic follow - up showed a decrease in orbital inflammation and reduction in swelling and thickness of the optic nerve in both eyes. although approved by the food and drug administration (fda) for treatment of on, there are limited data demonstrating the efficacy of acthar gel (a highly purified preparation of acth) for this condition. the patient reported that after starting treatment with acthar gel, she experienced fewer ra flares and pain had decreased by about 50%. she was also instructed to call in the case of worsening symptoms or adverse effects to medications. the patient did experience an elevation of her blood pressure and vitreous seeding was observed. this patient had a confirmed diagnosis of fsgs of unknown etiology but had a history of risk factors associated with fsgs. although less responsive than minimal - change ns, fsgs appears to respond to cs and treatment with cs is specifically recommended in kdigo guidelines.1 although not specifically studied in primary or secondary fsgs, ace inhibitors or angiotensin - receptor blockers (arbs) also reduce proteinuria and slow progression in proteinuric kidney disease, and patients with fsgs should receive renin - angiotensin system blockade and instructions to restrict dietary sodium.9 this patient was initially treated with the ace inhibitor lisinopril 20 mg and later switched to the arb telmisartan 80 mg. the empirical results shown in the patient in this case appear to support further consideration of acthar gel for treatment of fsgs. the role of acthar gel has not been adequately studied in ra, and it is fda - approved in ra only for short - term use. however, acth stimulates the adrenal cortex to produce cortisol in response to stress and also is an important physiologic agonist of the melanocortin (mc) system.10 the rationale for its use in ra is related to a study showing increased levels of -melanocyte - stimulating hormone (-msh) in the synovial fluid of patients with ra or juvenile ra, and it also has been shown to reduce joint pathology in rats with adjuvant - induced arthritis.11 acthar gel is a highly purified preparation of acth (acth139). acth139 is a bioactive peptide derived from a large precursor protein named pro - opiomelanocortin. acth is biochemically cleaved in vivo into another bioactive peptide, -msh, that corresponds to the first 13 amino acids of acth139 12 and exhibits biologic efficacy by modulating proinflammatory cytokines and subsequent leukocyte extravasation.13 investigations into the biologic distribution and function of mc receptors show that acth139 has anti - inflammatory or immunomodulatory functions related to the activation of mc1r, mc3r, and mc5r and is the only known mc peptide that will activate mc2r in the adrenal cortex.12 mechanisms of action now being considered for acthar gel hypothesize effects beyond steroidogenesis. the precise role of mcs in ra is uncertain, but evidence suggesting that mcs exert anti - inflammatory properties in ra is drawn from clinical studies that showed acth139 decreased joint pain, swelling, and rheumatic symptoms.13 mc peptides modulate inflammation through mc receptors and the activation of mcs initially reduce inflammatory cytokines and chemokines, later followed by the induction of anti - inflammatory mediators that facilitate the resolution of inflammatory response.13 in ra, the inflamed joint is characterized by infiltrating leukocytes as well as activated bone / cartilage cells, and studies suggest that mc peptides could act locally in an autocrine / paracrine manner.13 evidence for this is supported by an experimental murine model that mimics the flare of ra, in which the administration of an mc-3 agonist attenuated disease in incidence and severity in wild - type mice but not in mc-3 deficient mice, with sustained nf-b signaling in the osteoclasts of mc-3 deficient mice.14 this experimental model suggests that endogenous mc-3 controls the arthritic response in a model of passive serum - transfer arthritis.14 the mechanism of action of acthar gel comprises multiple components, including five mc receptors, each having varying biological activities.10 receptor - binding studies have revealed that all five mc receptors show a strong affinity for acth, which is one of four mc peptides, thereby establishing the potential for this hormone to activate these receptors.10 acth has shown efficacy as primary and secondary therapy for ns. two recent studies have prospectively examined the use of acthar gel in patients with fsgs.15,16 one was a prospective open - label trial of 15 subjects with resistant glomerular disease treated with acthar gel (80 u, subcutaneously, twice weekly).15 five subjects had resistant fsgs or minimal - change disease (mcd) and preserved renal function at baseline (serum creatinine 0.61.2 mg / dl) and had failed a traditional course of cs.15 all subjects with fsgs / mcd failed to achieve sustained remission with cs therapy and at least one other immunosuppressive therapy.15 among the five subjects, two subjects (one with fsgs, one with mcd) showed sustained improvement in upcr from baseline to 24 weeks (3.160.78, mcd ; 1.940.43, fsgs).15 of the remaining three subjects, two showed an increase in upcr from baseline to week 24, and one showed no appreciable change.15 these results should be interpreted in the context of a population of treatment - resistant patients in whom the failure of first - line treatment increases the likelihood for the failure of second - line therapy, and so forth.15 given the small sample size, the study provides evidence to warrant further investigation in controlled trials. another study was a retrospective case series that evaluated the use of acthar gel in 21 adult patients with idiopathic ns, including one patient with fsgs.17 three patients received acthar gel as primary therapy, 18 patients had failed prior immunosuppressive therapy, nine of whom had failed at least three therapies. acthar gel was administered subcutaneously in varying regimens ranging between 80 iu and 160 iu per week.17 the patient with fsgs was a 63-year - old hispanic female who had been previously treated with cs, mycophenolate mofetil, and a calcineurin inhibitor and had proteinuria of 10,275 mg / d.17 the patient was treated with acthar gel, 80 u biweekly, for 6 months and achieved partial remission, with a decrease in proteinuria from 10,275 mg / d before treatment to 2,970 mg / d.17 in the largest retrospective case series to date, 44 patients with ns were treated with acthar gel, including 15 patients with fsgs.18 eligible cases underwent an assessment of 24-hour proteinuria level or spot upcr prior to and following 6 months of acthar gel therapy. complete remission was defined as proteinuria 500 mg / g and partial remission as proteinuria > 500 mg / g to 3,500 mg / g and with 50% reduction in proteinuria from baseline. clinical response was defined as 25% reduction in proteinuria level from baseline and the reduction in final proteinuria did not meet the definitions for complete or partial remission. twelve of the 15 patients with fsgs showed partial remission (n=8) or a clinical response (n=4) of approximately 30% reduction in proteinuria. fifteen of 44 patients had treatment - related side effects, mainly steroid - like such as hypertension, weight gain, and hyperglycemia. seven patients had early termination of treatment due to increased edema, fatigue, weight gain, hypertension, and seizures. therefore, all the adverse effects known to occur with elevated cortisol may occur with acthar gel administration as well.19 according to the existing experience of clinical use of acth as well as ongoing clinical trials of other mc analogs, the side effects of mc - based therapy seem mild, tolerable, and reversible.20 acth therapy through the cortisol effect might also induce mild hypertension. as an endogenous glucocorticoid, cortisol may directly elevate blood pressure by enhancing vascular tone or, because it has a fair amount of activity on the mineralocorticoid receptor, may cause sodium and water retention and volume expansion.20 for nonsteroidogenic mcs or analogs, mildly elevated blood pressure has been reported during phase ii or iii clinical trials, possibly attributable to central stimulation of sympathetic outflow mediated by the interaction of -msh with mc4r.2022 another recent study examined 24 subjects and the data for analysis were available for 23 patients.16 six subjects had steroid - dependent fsgs, 15 had steroid - resistant fsgs, and two additional subjects were treated with acthar gel as first - line therapy between january 2009 and april 2012.16 the trial included 16 subjects in a prospective investigator - initiated pilot study (nct01155141) ; four had been described previously with shorter - term results and the remaining four were evaluated retrospectively in chart review.16 the classification of steroid - dependent or steroid - resistant fsgs was based on kdigo guidelines.1 treatment regimens were not entirely uniform : 12 subjects received 40 u of acthar gel subcutaneously, weekly for 2 weeks, 80 u, subcutaneously, weekly for 2 weeks, followed by 80 u, subcutaneously, twice weekly for 16 weeks of treatment. seven subjects received 40 u of acthar gel, subcutaneously, twice weekly for 2 weeks, followed by 80 u, subcutaneously, twice weekly for 6 months of treatment. the remaining five subjects received acthar gel with heterogeneous dosing as determined by the treating physician. the duration of therapy ranged from 12 to 56 weeks, with a mean follow - up time of 48 weeks.16 at the end of therapy, seven of 24 (29%) patients had experienced remission (two complete and five partial).16 in subjects achieving remission of proteinuria, median time to reduced proteinuria was 5 weeks and median time to remission of proteinuria was 16 weeks.16 although only 29% of the subjects experienced remission in this series, improved outcomes may encourage physicians to consider acthar gel in idiopathic fsgs cases that are refractory to previous cs therapy., we recommend that acth be discontinued for patients with fsgs who have not demonstrated any significant decline in proteinuria by 1216 weeks. the pathological basis of fsgs and mcd appears to essentially be podocyte - related, as evidenced by podocyte foot processes effacement, microvillus transformation, and podocytopenia.23 knockout and transgenic models have provided proof of concept that mutations in specific podocyte proteins mediate genetic forms of fsgs.24 a study was conducted in rats with subtotal nephrectomy to examine the capability of acthar gel for providing podocyte protection.25 compared with the control group, acthar gel preserved kidney function as measured by increased renal plasma flow and glomerular filtration rate and lower serum creatinine levels. these data suggest that acthar gel reduces proteinuria and renal injury in a preclinical model of progressive glomerulosclerosis. lindskog investigated the expression of mc in human kidneys to test the hypothesis that synthetic acth directly exerts its antiproteinuric effects via mc receptors.26 gene expression of the mc receptor mc1r (but no other mc receptor) was identified in podocytes, glomerular endothelial cells, mesangial cells, and tubular epithelial cells, and analysis showed that podocytes expressed most of the mc1r protein.26 a specific mc1r agonist (ms05) demonstrated that mc1r agonism reduced proteinuria, improved podocyte morphology, and reduced oxidative stress in rats with passive heymann nephritis (phn).26 the nonspecific mc receptor agonist -msh (n=8) also significantly reduced proteinuria by 52% compared with untreated phn (n=8 ; p<0.05). within the -msh group, this corresponds to a 55% decrease in proteinuria after 4 weeks of treatment compared with proteinuria at the start of treatment. acthar gel (acth) has antiproteinuric and immunomodulatory effects that are not entirely explained by its steroidogenic activity. acth is the parent molecule of -msh, and exhibits biologic efficacy by modulating proinflammatory cytokines and subsequent leukocyte extravasation, and evidence suggests that mcs also may have autocrine / paracrine effects in joints. acthar gel was primarily administered in this case to induce the remission of proteinuria in a patient with a history of intermittent proteinuria and a confirmed diagnosis of fsgs treated with ace inhibitor therapy, but who experienced worsening edema and serum creatinine with 4 + proteinuria. this case is interesting not only because of its effect in improving proteinuria, but also because it showed clinically beneficial ancillary effects on the patient s inflammatory disease states. the role of acth in the treatment of ra or on has not been adequately studied, but improvement in this patient s flares and pain in ra as well as orbital inflammation and reduction in the swelling of the optic nerve and thickness is noteworthy and may be related to its agonist effects on multiple mc receptors. | backgroundfocal segmental glomerulosclerosis (fsgs) causes scarring or sclerosis of glomeruli that act as tiny filters in the kidneys, damage to which results in diminished ability to properly filter blood, resulting in the urinary loss of plasma proteins and subsequent proteinuria.case presentationa 60-year - old, white female with a history of intermittent proteinuria was referred by her primary care physician for renal dysfunction. biopsy confirmed fsgs and she was treated with an angiotensin - converting enzyme inhibitor. she also had rheumatoid arthritis (ra) but no active synovitis and was maintained on prednisone 5 mg / d. she also complained of worsening vision in her right eye and was diagnosed with optic neuritis (on). she remained stable for about 8 months when examination indicated fsgs relapse, and she reported painful ra flares. she was treated with acthar gel (40 mg biweekly) for 6 months, after which proteinuria and urine protein - to - creatinine ratio decreased to about half. her on improved, and she reported that she had fewer ra flares and pain improved by 50%. this case of confirmed fsgs showed an improved response to treatment with acthar gel for fsgs with concomitant ra and on.conclusionthis referral case is relevant to primary care practitioners who treat disorders that may be responsive to corticosteroid therapy. the antiproteinuric effects and ancillary improvement in ra and on symptoms during treatment with acthar gel are not entirely explained by its steroidogenic actions. acth is a bioactive peptide that, together with -melanocyte - stimulating hormone, exhibits biologic efficacy by modulating proinflammatory cytokines and subsequent leukocyte extravasation and may have autocrine / paracrine effects in joints. while acthar gel was primarily administered in this case to treat proteinuria, it also showed ancillary benefits in patients with concomitant inflammatory disease states. |
materials from renewable resources have the potential to be more environmentally friendly than polymer materials of petrochemical origin.1 the annual production of chitin in nature is estimated to be in the range of 10100 trillion tones, and the seafood industry generates large amount of chitin waste.2 the disposal of this bioresource is an environmental problem and this resource is simply underutilized. chitin is a nanocomponent embedded in the shells of crustaceans such as lobsters, crabs, shrimps in the form of mechanically functional chitin microfibrils (nanofibers). chitin microfibrils share many characteristics with cellulose microfibrils, including high stiffness, low density, high surface area, and high aspect ratio, making chitin interesting also for nanotechnology applications. the literature on chitinbased nanocomponents is dominated by chitosan, regenerated chitin, and chitin nanocrystals.3 chitosan polymers are deacetylated derivatives of chitin.4 a recent development is electrospun chitin nanofibers or microfibers produced from dissolved chitin or derivatives including chitosan.5 electrospun nanofibers form randomly interwoven networks and are attractive as biomedical textiles for wound dressings. however, toxic chemicals such as dmac (n, ndimethylacetamide)6 or naoh / urea7 are used during processing. although chitosan nanofibers can be prepared through green routes,8 the resulting fiber diameter is much larger than the desired in the presented work. environmental challenges are also present in chitin nanocrystal preparation due to the use of strong acid hydrolysis, strong base9 or (2,2,6,6tetramethylpiperidin1yl)oxyl (tempo)mediated oxidation.10 chitin nanocrystals have mainly been used as reinforcement in polymer nanocomposites.11 it has also been added to bacterial cellulose films to provide bactericidal activity.12 an interesting application of chitin is as a component in hydrogels. for example, as chitin nanocrystals were combined with a polymer hydrogel, the storage modulus (a measure for the stiffness of a hydrogel network structure) increased from 34 to 1700 pa on addition of 0.5 % chitin nanocrystals.13 the polymer hydrogel itself was a mixture of cyclodextrin and a triblock copolymer of poly(ethylene oxide)poly(propylene oxide)poly(ethylene oxide) in water.13 a limitation of acidhydrolyzed chitin nanocrystals is often the short aspect ratio (length / diameter ratio). recent advances in disintegration of cellulose nanofibers from wood pulp fibers have inspired isolation of highaspectratio chitin nanofibers.9c,9d, 14 such chitin nanofibers have particularly small diameters (ca. 4 nm).15 they were used to prepare nanopaper structures with novel characteristics such as high optical transparency and high specific nanofiber surface area. critical factors included good stability of the chitin water hydrocolloid as well as the nanoscale dimensions of the chitin nanofiber crosssections. apart from providing excellent mechanical properties,14, 16 chitin nanofiber materials also have advantages such as gasbarrier properties, optical transparency, and low thermal expansion. colloidal suspensions of chitin or cellulose nanofibers will form gels after mechanical homogenization at relatively low concentrations. one gelation mechanism is simply formation of physical entanglements between nanofibers due to the high surface area and high aspect ratio. chitin hydrogels are particularly interesting for applications in water purification, tissue scaffolds, drug delivery, and 3d printing.17 for hydrogels prepared using chitosan or regenerated chitin, chemical modification or mechanical reinforcement are necessary to achieve favorable mechanical properties. organic frameworks to form aerogel microspheres.19 in another example, chitin nanocrystals were combined with chitosan, with the storage modulus reaching 169 kpa at 13 % chitin content.11a it is also possible to prepare regenerated chitin hydrogels from chitin solutions in naoh / urea7 or chitosan hydrogels through baseinduced precipitation.19 gel properties are developed by chitin precipitation in organic solvent and a freezing thawing approach.4 however, such regenerated chitin hydrogels had lower mechanical properties compared to crosslinked hydrogels from chitin or cellulose nanofibers. by crosslinking with epichlorohydrin, mechanical properties were improved. the storage modulus was roughly 70 pa at 1 % chitin content.7 chemically crosslinked hydrogels based on chitin nanocrystals were also prepared by heating in an autoclave but no mechanical properties were reported.20 recently, chitin hydrogels in the form of nanofiber networks were also prepared from regenerated chitin nanofibers. the procedure involved conversion of thin chitin nanofibers (34 nm in width and length in micrometers) isolated from squid21 to chitin nanofibers through treatment in naoh / urea followed by quenching in ethanol;22 thus, chitin nanofibers could be converted to chitin and then trapped before dissolution. hydrogel properties were mechanically enhanced due to the mixture of dangling polymer chains and partially dissolved nanofibers. tensile properties were reported.22 the chitin nanofibers used in the present study were analyzed previously.14, 15 chitin powder was treated with 2 m hcl, 20 % naoh, and ethanol to remove calcium carbonate particles, protein matrix, and pigments, respectively ; subsequent mechanical treatment was performed at ph 3 to facilitate nanofiber liberation through electrostatic repulsion. the obtained chitin nanofibers show some structural analogies to tempooxidized cellulose nanofibers in terms of charged surfaces, high aspect ratio, and uniform nanofiber width. the aspect ratio of the chitin nanofibers presented herein was in the range of 25250, with diameters of 34 nm and lengths reaching several micrometers.14 positively charged nanofiber surfaces improve colloidal stability due to electrostatic repulsion between fibrils. this serves to counteract nanofiber agglomeration. in a previous study, a freestanding hydrogel with a water content of 99.9 % was successfully produced from a colloidal water suspension of tempooxidized cellulose nanofibers.23 this was accomplished by careful adjustment of the ph value and evaporation of water to increase concentration.23 herein, we develop a green process for the preparation of hydrogels from water suspensions of chitin nanofibers. the novelty of the hydrogel is the unique properties of the chitin nanofibers developed in our lab14, 16c and the preparation procedure, which results in a substantial fraction of nanoscale pores. the procedure involves suspending chitin nanofibers in water, where stability is achieved through electrostatic repulsion effects. then gelation is induced by neutralization of the suspension so that electrostatic repulsion effects are removed. the unique structural, rheological, and mechanical properties of the chitin nanofiber hydrogels are discussed. moduli and strengths of the chitin nanofiber hydrogels are much higher than for regenerated chitinbased hydrogels or hydrogels based on short rodlike chitin nanocrystals. chitin nanofibers (chnfs) have positively charged surfaces in acidic solution due to the protonation of amino groups obtained from partial deacetylation of chitin molecules present on the fibril surface during the extraction procedures. for this reason, chnfs can be electrostatically stabilized at low ph values in acetic acid. the charge density depends on the degree of acetylation (da) and ph value, which is therefore important for gel formation. the positively charged chnf surfaces were neutralized either by dialysis or by addition of naoh solution to the chnf suspension to produce freestanding hydrogels (scheme 1). hydrogels with a chnf content in the range of 0.43.0 wt % were produced through dialysis method. in addition, naoh neutralization was used to prepare chnf hydrogels with chnf contents from 0.4 to 2.0 wt %. for the dialysis method dialysis removes acetic acid as well as hydronium ions, leading to deprotonation of amino groups, with the ph value increasing to neutral. the gel formation mechanism involves gradual buildup of stronger fibril fibril interactions with secondary bonding of individual nanofibers to each other on the nanoscale, as was described for cellulose nanofibers of similar geometry.24 at much higher chnf concentrations, mechanical entanglement and even capillary condensation take place between chnfs, leading to the formation of a giant supramolecular agglomerate the resulting hydrogels were soaked in deionized water at ph 7 and ph 3 for several days ; in both cases their physical properties were retained. this is an important achievement as neither crosslinking nor chemical modification was required for hydrogel formation. the total charge of chnfs was roughly 315 mol g as measured by titration using a particle charger analyzer (stabino), which is much lower than the carboxylate content in tempooxidized cellulose nanofibers (1500 mol g).25 in addition to the aspect ratio, it seems reasonable to assume that the gelation concentration may be also related to the nanofiber surface charge, which is essential for the stabilization of nanofiber colloids to prevent agglomeration. a similar phenomenon was reported for colloidal suspensions based on tempooxidized cellulose nanofibrils, in which gelation was possible at much lower concentrations (i.e., 0.1 %).23 hydrogel preparation from water suspension of chitin nanofibers : (a) dialysis neutralization and (b) naoh neutralization. dynamic storage modulus (g) is a measure of the stiffness of the hydrogel networks. chnf hydrogels of 1 wt % solid content produced through dialysis were much stiffer (g=2.6 kpa) compared to hydrogels prepared by naoh neutralization (g=2.0 kpa), see figure 1 a and b. there is a linear relationship between frequency or shear rate and storage modulus in the frequency range of 1100 hz at 10 % min strain rate, although the dependence is not so strong for naohneutralized hydrogels. g increased steadily with frequency at all concentrations for dialyzed hydrogels. a steady increase in g against chnf concentration the loss modulus (g) is related to the energy dissipated due to permanent deformation of polymer hydrogel, a viscoelastic material. for the naohneutralized hydrogel samples with concentrations of 0.40.8 wt %, g was higher than g, which may relate to a lack of gelation in local regions caused by incomplete neutralization. as the nanofiber geometry is the same, the reason may be a more efficient bonding mechanism between the nanofibers. storage modulus (g) and loss modulus (g) as a function of frequency for chnf hydrogels prepared from aqueous suspensions with various chnf contents by (a) dialysis and (b) neutralizing with naoh. (d) rheological behavior of chnf suspension with 0.8 wt % solid content at ph 3. the effect of aspect ratio is important for nanofiber hydrogels.24a it influences the concentration at which gelation occurs and also the storage modulus. g l solid content for gelation to occur.24a herein, gelation occurred already at a chnf concentration of 0.4 wt % for both preparation routes. the highest value of storage modulus was achieved at 3.0 wt % for the dialyzed chnf hydrogel (g=13 kpa). for tempooxidized cellulose nanofibers, saito. 20 kpa at 0.8 wt %).23 feinduced cellulose hydrogels prepared from tempooxidized cellulose nanofibers had an even higher value (g=31 kpa at 1.27 wt % cellulose content).26 reasons for property differences include nanofiber network structure (i.e., extent of dispersion), intrinsic nanofiber properties and dimensions, extent of defects in nanofibers, and nature of nanofiber the amount of charge in tempooxidized cellulose nanofibers is about 1500 mol g 25 whereas that of the chnfs discussed herein is 315 mol g. in carboxymethyl cellulose nanofibers obtained from disintegrated wood pulp fibers, the charge is 600 mol g.24a in tempooxidized cellulose and chnfs, the total charge is critical for the strong gelforming characteristics. figure 1 c shows the changes in g as a function of chnf concentration. both dialyzed and naoh hydrogels show a linear increase with chnf concentration (the scale for xaxis is logarithmic). as the nanofiber geometry is the same, the reason may be more efficient bonding mechanisms between the nanofibers, which increases network stiffness. the measurements shown in figure 1 c was done based on study for tempooxidized cellulose hydrogel which was adopted from the properties of semiflexible filaments such as actin.27 the dialyzed hydrogels show some similarities to the behavior of tempooxidized cellulose nanofiber hydrogels with respect to the correlation of storage modulus versus concentration.23 the g value of tempooxidized cellulose hydrogels can be described by an empirical exponential expression, g=ac, where a is a constant related to the aspect ratio of an individual nanofiber and the intrinsic stiffness of material (polymer chain or fiber) and the power, n, relates to the nanofiber network structures and indicates the dependence on the nanofiber concentration, c.23 the chnf hydrogels discussed herein had a lower a value than tempooxidized cellulose nanofibers hydrogel. figure 1 d shows the rheological behavior of a chnf hydrogel (0.8 wt %) at ph 3 as a control. a nonlinear curve analogous to pseudoplastic behavior was observed, indicating liquidlike properties over the range of tested shear rates and strains. freezedrying was carried out after changing the solvent to tertbutanol : freezedrying in water tends to disturb the original network structure as the growth of ice crystals often creates a different pore structure than was present in the hydrogel.23, 28 the sem micrographs shown in figure 2 reveal the nanofiber network structures of chnf hydrogels with different chnf concentrations. chnfs are present as long swirled nanofibers, many of them with diameters around 10 nm. chnfs with larger diameters (20100 nm) are aggregates formed due to incomplete fibrillation or agglomeration during freezedrying. the images show a gradual increase in pore size with decreasing chnf concentration. according to the micrographs many chitin scaffolds in the literature obtained through freezedrying from water have a characteristic pore size much larger than 1 m. gelatin scaffolds showed pore sizes of 139166 m.29 sem micrographs of the longitudinal crosssectional view of chnf aerogels prepared from hydrogels with (a) 0.6, (b) 0.8, (c) 1.0, and (d) 2.0 wt % chnfs (scale bars correspond to 1 m). autoporosimetry measures pore sizes by recording changes in pressure obtained when liquid is pushed out from pores with different sizes during adsorption desorption cycles. the volume of the liquid adsorbed per gram of chitin (chnf) was assumed to correspond to the total volume of pores. for the pore size distribution, reference is made from the fact that samples with many large pores adsorb more liquid compared to those with many small pores per gram of chitin (chnf). figure 3 a shows the cumulative pore volume against pore size obtained from the first cycle of an autoporosimetry measurement. the cutoff pore size specified for the autoporosimetry membrane allowed pore size measurements between 5 and 500 m. however, we were interested in the volume of pores below 5 m to be able to compare pore size distributions. the volume of pores below 5 m in size was estimated from the volume of hexadecane retained after the first cycle. hexadecane was first adsorbed in small pores below 5 m to equilibrate the sample during the adsorption cycle and was not desorbed in the subsequent measurements. in figure 3 a, the pore volume of pores smaller than 5 m is indicated by box a and is roughly 60 % of the total pore volume at 2.0 wt % chnfs. data shown in figure 3 b present the volume of hexadecane retained per milligram of chitin (chnf) after desorption during the first cycle. a large fraction of small pores is observed for aerogels with high chnf concentrations. the liquid adsorbed in large pores was desorbed in the next desorption cycle. however, the large volume of liquid retained in small pores at high chnf concentrations makes it tempting to speculate that a large fraction of the pores were below 5 m. the highresolution micrographs of the nanofiber gel structure shown in figure 2 confirm the submicrometer scale of the nanofiber network structure in the material. this study is a first report of the importance of nanofiber and network characteristics of chitin hydrogel properties, but future work should include more detailed characterization of the pore size distribution below 5 m using brunauer teller (bet) gas adsorption measurements. in a previous study, the pore sizes in aerogels prepared from cellulose nanofibers after solvent exchange to tertbutanol ranged was on the nanometer scale (1016 nm).28 however, the small pore size was achieved by centrifugation, a more tedious preparation procedure than our method. data from autoporosimetry measurements as a function of chnf concentration for adsorption desorption cycles of chnf aerogels : (a) cumulative pore volume (%) as a function of pore size and (b) volume of hexadecane (mm mg of chitin (chnf)) adsorbed in pores with a characteristic size below 5 m. the stress strain curve typically consists of an initial linear region followed by a steep increase in slope above 40 % compressive strain. the chnf network collapses to some extent and, therefore, becomes more resistant to compression because collapsing nanofibers begin to touch and interact. the hydrogels deformed to a maximum compressive strain of around 80 % at which point the compressive stress was maximum. at the origin of discontinuities in the compression curve at 2 wt % is not entirely clear (figure 4 a), perhaps it can be assigned to artifacts during testing or a hydromechanical modification of the hydrogel at high compressive stress. compressive strength and modulus increase with chnf concentration (figure 4 b). uniaxial compression data are summarized in table 1, together with data for other hydrogels reported previously in literature.7, 30 with the exception of hydrogels obtained from cellulose nanofibrils prepared by tempomediated oxidation, the hydrogel presented herein shows better mechanical properties than most soft waterbased bionanofiber hydrogels. compressive mechanical properties of chnf hydrogels (strain at highest compressive stress was 80 %). chitin nanofibers (chnfs) have positively charged surfaces in acidic solution due to the protonation of amino groups obtained from partial deacetylation of chitin molecules present on the fibril surface during the extraction procedures. for this reason, chnfs can be electrostatically stabilized at low ph values in acetic acid. the charge density depends on the degree of acetylation (da) and ph value, which is therefore important for gel formation. the positively charged chnf surfaces were neutralized either by dialysis or by addition of naoh solution to the chnf suspension to produce freestanding hydrogels (scheme 1). hydrogels with a chnf content in the range of 0.43.0 wt % were produced through dialysis method. in addition, naoh neutralization was used to prepare chnf hydrogels with chnf contents from 0.4 to 2.0 wt %. for the dialysis method dialysis removes acetic acid as well as hydronium ions, leading to deprotonation of amino groups, with the ph value increasing to neutral. the gel formation mechanism involves gradual buildup of stronger fibril fibril interactions with secondary bonding of individual nanofibers to each other on the nanoscale, as was described for cellulose nanofibers of similar geometry.24 at much higher chnf concentrations, mechanical entanglement and even capillary condensation take place between chnfs, leading to the formation of a giant supramolecular agglomerate the resulting hydrogels were soaked in deionized water at ph 7 and ph 3 for several days ; in both cases their physical properties were retained. this is an important achievement as neither crosslinking nor chemical modification was required for hydrogel formation. the total charge of chnfs was roughly 315 mol g as measured by titration using a particle charger analyzer (stabino), which is much lower than the carboxylate content in tempooxidized cellulose nanofibers (1500 mol g).25 in addition to the aspect ratio, it seems reasonable to assume that the gelation concentration may be also related to the nanofiber surface charge, which is essential for the stabilization of nanofiber colloids to prevent agglomeration. a similar phenomenon was reported for colloidal suspensions based on tempooxidized cellulose nanofibrils, in which gelation was possible at much lower concentrations (i.e., 0.1 %).23 hydrogel preparation from water suspension of chitin nanofibers : (a) dialysis neutralization and (b) naoh neutralization. dynamic storage modulus (g) is a measure of the stiffness of the hydrogel networks. chnf hydrogels of 1 wt % solid content produced through dialysis were much stiffer (g=2.6 kpa) compared to hydrogels prepared by naoh neutralization (g=2.0 kpa), see figure 1 a and b. there is a linear relationship between frequency or shear rate and storage modulus in the frequency range of 1100 hz at 10 % min strain rate, although the dependence is not so strong for naohneutralized hydrogels. g increased steadily with frequency at all concentrations for dialyzed hydrogels. a steady increase in g against chnf concentration the loss modulus (g) is related to the energy dissipated due to permanent deformation of polymer hydrogel, a viscoelastic material. for the naohneutralized hydrogel samples with concentrations of 0.40.8 wt %, g was higher than g, which may relate to a lack of gelation in local regions caused by incomplete neutralization. as the nanofiber geometry is the same, the reason may be a more efficient bonding mechanism between the nanofibers. storage modulus (g) and loss modulus (g) as a function of frequency for chnf hydrogels prepared from aqueous suspensions with various chnf contents by (a) dialysis and (b) neutralizing with naoh. (d) rheological behavior of chnf suspension with 0.8 wt % solid content at ph 3. the effect of aspect ratio is important for nanofiber hydrogels.24a it influences the concentration at which gelation occurs and also the storage modulus. g l solid content for gelation to occur.24a herein, gelation occurred already at a chnf concentration of 0.4 wt % for both preparation routes. the highest value of storage modulus was achieved at 3.0 wt % for the dialyzed chnf hydrogel (g=13 kpa). for tempooxidized cellulose nanofibers, saito. 20 kpa at 0.8 wt %).23 feinduced cellulose hydrogels prepared from tempooxidized cellulose nanofibers had an even higher value (g=31 kpa at 1.27 wt % cellulose content).26 reasons for property differences include nanofiber network structure (i.e., extent of dispersion), intrinsic nanofiber properties and dimensions, extent of defects in nanofibers, and nature of nanofiber the amount of charge in tempooxidized cellulose nanofibers is about 1500 mol g 25 whereas that of the chnfs discussed herein is 315 mol g. in carboxymethyl cellulose nanofibers obtained from disintegrated wood pulp fibers, the charge is 600 mol g.24a in tempooxidized cellulose and chnfs, the total charge is critical for the strong gelforming characteristics. figure 1 c shows the changes in g as a function of chnf concentration. both dialyzed and naoh hydrogels show a linear increase with chnf concentration (the scale for xaxis is logarithmic). as the nanofiber geometry is the same, the reason may be more efficient bonding mechanisms between the nanofibers, which increases network stiffness. the measurements shown in figure 1 c was done based on study for tempooxidized cellulose hydrogel which was adopted from the properties of semiflexible filaments such as actin.27 the dialyzed hydrogels show some similarities to the behavior of tempooxidized cellulose nanofiber hydrogels with respect to the correlation of storage modulus versus concentration.23 the g value of tempooxidized cellulose hydrogels can be described by an empirical exponential expression, g=ac, where a is a constant related to the aspect ratio of an individual nanofiber and the intrinsic stiffness of material (polymer chain or fiber) and the power, n, relates to the nanofiber network structures and indicates the dependence on the nanofiber concentration, c.23 the chnf hydrogels discussed herein had a lower a value than tempooxidized cellulose nanofibers hydrogel. figure 1 d shows the rheological behavior of a chnf hydrogel (0.8 wt %) at ph 3 as a control. a nonlinear curve analogous to pseudoplastic behavior was observed, indicating liquidlike properties over the range of tested shear rates and strains. freezedrying was carried out after changing the solvent to tertbutanol : freezedrying in water tends to disturb the original network structure as the growth of ice crystals often creates a different pore structure than was present in the hydrogel.23, 28 the sem micrographs shown in figure 2 reveal the nanofiber network structures of chnf hydrogels with different chnf concentrations. chnfs are present as long swirled nanofibers, many of them with diameters around 10 nm. chnfs with larger diameters (20100 nm) are aggregates formed due to incomplete fibrillation or agglomeration during freezedrying. the images show a gradual increase in pore size with decreasing chnf concentration. according to the micrographs many chitin scaffolds in the literature obtained through freezedrying from water have a characteristic pore size much larger than 1 m. chitinwhisker hyaluronan gelatin scaffolds showed pore sizes of 139166 m.29 sem micrographs of the longitudinal crosssectional view of chnf aerogels prepared from hydrogels with (a) 0.6, (b) 0.8, (c) 1.0, and (d) 2.0 wt % chnfs (scale bars correspond to 1 m). autoporosimetry measures pore sizes by recording changes in pressure obtained when liquid is pushed out from pores with different sizes during adsorption desorption cycles. the volume of the liquid adsorbed per gram of chitin (chnf) was assumed to correspond to the total volume of pores. for the pore size distribution, reference is made from the fact that samples with many large pores adsorb more liquid compared to those with many small pores per gram of chitin (chnf). figure 3 a shows the cumulative pore volume against pore size obtained from the first cycle of an autoporosimetry measurement. the cutoff pore size specified for the autoporosimetry membrane allowed pore size measurements between 5 and 500 m. however, we were interested in the volume of pores below 5 m to be able to compare pore size distributions. the volume of pores below 5 m in size was estimated from the volume of hexadecane retained after the first cycle. hexadecane was first adsorbed in small pores below 5 m to equilibrate the sample during the adsorption cycle and was not desorbed in the subsequent measurements. in figure 3 a, the pore volume of pores smaller than 5 m is indicated by box a and is roughly 60 % of the total pore volume at 2.0 wt % chnfs. data shown in figure 3 b present the volume of hexadecane retained per milligram of chitin (chnf) after desorption during the first cycle. the liquid adsorbed in large pores was desorbed in the next desorption cycle. however, the large volume of liquid retained in small pores at high chnf concentrations makes it tempting to speculate that a large fraction of the pores were below 5 m. the highresolution micrographs of the nanofiber gel structure shown in figure 2 confirm the submicrometer scale of the nanofiber network structure in the material. this study is a first report of the importance of nanofiber and network characteristics of chitin hydrogel properties, but future work should include more detailed characterization of the pore size distribution below 5 m using brunauer the pore sizes in aerogels prepared from cellulose nanofibers after solvent exchange to tertbutanol ranged was on the nanometer scale (1016 nm).28 however, the small pore size was achieved by centrifugation, a more tedious preparation procedure than our method. data from autoporosimetry measurements as a function of chnf concentration for adsorption desorption cycles of chnf aerogels : (a) cumulative pore volume (%) as a function of pore size and (b) volume of hexadecane (mm mg of chitin (chnf)) adsorbed in pores with a characteristic size below 5 m. figure 4 shows the compressive stress strain curves for chnf hydrogels. the stress strain curve typically consists of an initial linear region followed by a steep increase in slope above 40 % compressive strain. the chnf network collapses to some extent and, therefore, becomes more resistant to compression because collapsing nanofibers begin to touch and interact. the hydrogels deformed to a maximum compressive strain of around 80 % at which point the compressive stress was maximum. at the origin of discontinuities in the compression curve at 2 wt % is not entirely clear (figure 4 a), perhaps it can be assigned to artifacts during testing or a hydromechanical modification of the hydrogel at high compressive stress. compressive strength and modulus increase with chnf concentration (figure 4 b). uniaxial compression data are summarized in table 1, together with data for other hydrogels reported previously in literature.7, 30 with the exception of hydrogels obtained from cellulose nanofibrils prepared by tempomediated oxidation, the hydrogel presented herein shows better mechanical properties than most soft waterbased bionanofiber hydrogels. (a) compression stress strain curves of chnf hydrogels prepared by naoh neutralization. compressive mechanical properties of chnf hydrogels (strain at highest compressive stress was 80 %). a new solventfree procedure was developed for the preparation of strong and stiff hydrogels based on native chitin nanofibers (chnfs). these chnfs are unique in terms of preserved native structure, high aspect ratio (length / diameter ratio of ca. 25250), small diameter, high purity, and high molar mass. despite the high aspect ratio, colloidal suspensions of chnfs are stable liquids at low ph values (ph 3) and low concentrations due to electrostatic repulsion between cationic chitin nanofibers. hydrogel formation is then simply induced by neutralization so that repulsion is removed and individual smooth nanoscale chnf form strong physical bonds by secondary forces. moduli and strengths are much higher than for regenerated chitinbased hydrogels or hydrogels based on short rodlike chitin nanocrystals. the reasons are the excellent intrinsic strength and stiffness of the unique chnfs, the dense physical crosslinking in the threedimensional nanofiber network, and physical entanglements due to the very high chnf aspect ratios. furthermore, the prepared chnf hydrogels, especially at high chnf contents, can have more than 60 % of the pore volume in pores below 5 m in size (submicrometer scale). this is due to the preparation scheme, where first electrostatic repulsion (before gelation), then (after gelation) strong physical chnf it may be concluded that the nanostructure control mechanisms ensure that the hydrogel is dominated by a large fraction of individual but strongly connected chitin nanofibers rather than chnf agglomerates, and that there is a strong influence on the macroscopic mechanical properties although structural organization on the submicrometer scale is likely random. the strong improvements in mechanical properties of chnf hydrogels reported here may facilitate chnf use in applications such as tissue engineering, water purification, 3d printing, drug delivery, or wound healing devices. native lowprotein chitin nanofibers (chnfs) from lobster homarus americanus of northwest atlantic were prepared as described in our previous publication.15 the concentration of chnfs in its colloidal suspension was 1.0 wt %. degree of acetylation (da) was in the range of 8687 % as determined by solidstate crosspolarization magic angle spinning c nuclear magnetic resonance (cp / mas c nmr) spectroscopy. the dependence of gelling behavior of chnfs in water as effect of ph and concentration on chnf agglomeration was studied. hydrogels of different chnf concentrations were prepared by neutralizing acetic acid present in the water suspension of chnfs. the colloidal suspension was dialyzed in deionized water under ambient conditions using a regenerated cellulose dialysis membrane with a molecular weight cutoff of 12 kda until neutrality was reached. the concentration of chnfs in the hydrogel was varied from 0.4 to 3.0 wt %. to prepare hydrogels with 3.0 wt % chnfs, the hydrogel in the dialysis membrane was dehydrated in ethanol and then rehydrated in deionized water. through dialysis, chnf neutralization, dehydration, or rehydration was achieved through osmosis. for the preparation of naohneutralized hydrogels, typically 2 ml 20 % naoh solution colloidal suspensions with low concentrations were prepared by diluting a 1.0 wt % suspension whereas higher concentration such as 2.0 wt % were obtained slow evaporation of water in air from the 1.0 wt % suspension. rheological tests of chnf hydrogels were performed using a flat parallel plate configuration with a diameter of 25 mm and a gap thickness of 1 mm on a rheometer (mcr 501, anton paar, austria). dynamic rheological properties were measured in frequencysweep mode over the range of 1100 rad s at a strain rate of 10 % and ambient temperature (25 c). storage modulus and tan delta were recorded for hydrogels with chnfs concentration of 0.4, 0.6, 0.8, 1.0, 2.0, and 3.0 wt %. for each concentration, rheological characterization of chnf hydrogel sample with 0.8 wt % chnfs content at ph 3 was performed as control in parallel plate configuration using a malvern rheometer (kinexus, malvern instruments ltd, uk). aqueous chnf hydrogel was solvent exchanged with tertbutanol and then freezedried to produce chnf aerogels. solvent exchange was first performed in 50 % tertbutanol in water twice at an interval of 2 h and then in 100 % tertbutanol overnight. pore size and size distribution of the aerogel was measured using a tri / autoporosimeter version 200812 (tri / princeton, usa). the aerogel sample was placed in a chamber and then equilibrated in liquid hexadecane after the chamber was vacuumed. pore size measurement specification was according to the membrane cutoff pore size of 1.2 m. the morphology of chnf aerogels was characterized by using fieldemission scanning electron microscopy (fesem, hitachi s4800 japan). the samples (chnf aerogels) were conditioned in a desiccator overnight to remove moisture and then sputtered with a 5 nm thick layer of platinum / palladium using an agar hr sputter coater. fesem images were recorded at 1.0 kv from secondary electrons. compression test. mechanical properties of the chnf hydrogel were measured under compression mode using a universal testing machine (instron model 5944) equipped with a 50 n load cell. circular specimens were prepared with diameter 25 mm and thickness was measured. the stress strain curves of the hydrogels were recorded at room temperature at a strain rate of 10 % min. yield stress was calculated as stress value corresponding to the intersection of the tangent between the elastic region and the initial plastic deformation region. | abstractchitin nanofibers of unique structure and properties can be obtained from crustacean and fishery waste. these chitin nanofibers have roughly 4 nm diameters, aspect ratios between 25250, a high degree of acetylation and preserved crystallinity, and can be potentially applied in hydrogels. hydrogels with a chitin nanofiber content of 0.4, 0.6, 0.8, 1.0, 2.0, and 3.0 wt % were successfully prepared. the methodology for preparation is new, environmentally friendly, and simple as gelation is induced by neutralization of the charged colloidal mixture, inducing precipitation and secondary bond interaction between nanofibers. pore structure and pore size distributions of corresponding aerogels are characterized using autoporosimetry, revealing a substantial fraction of nanoscale pores. to the best of our knowledge, the values for storage (13 kpa at 3 wt %) and compression modulus (309 kpa at 2 wt %) are the highest reported for chitin nanofibers hydrogels. |
nine patients with type 2 diabetes and eight healthy control subjects gave informed consent to the approved protocol. patients with poor metabolic control were intentionally chosen. lipid profile and inflammatory proteins (fibrinogen, von clauss method ; haptoglobin and immunoglobin g, immunonephelometric method ; and c - reactive protein, latex agglutination technique) were determined for each participant. six patients were on oral antidiabetic and aspirin medications, three were on insulin, five were on cholesterol - lowering therapy, and four were treated for hypertension. those on insulin had a history of coronary artery disease, and two of them had suffered from myocardial infarction. mean sd age of patients was 58.3 8.8 years (range 4170). healthy subjects were age matched (51.1 8.7 years [range 4164 ]), did not take regular medications, and had no history of cardiovascular disease. a couette instrument made of two concentric cylinders and installed in an incubator at 37c generated homogeneous shear rates via a rotating outer cylinder. the 32-mhz polyvinylidine flouride ultrasound transducer (visualsonics, toronto, canada) had a 6 db bandwidth of 1545 mhz. avb2-ta - c - crima ; avtech, ottawa, canada). received radio frequency (rf) echoes (model no. au-3a-0120 ; miteq, hauppauge, ny) were amplified by 54 db, filtered between 10 and 50 mhz (model no. 5900 pr ; panametrics, waltham, ma), and digitized at 250 mhz (model no. the protocol consisted of imposing a 500 s shear rate for 120 s to disrupt aggregates. then, aggregation kinetics were recorded for 380 s at randomly applied reduced shear rates of 0, 1, 2, 10, 50, 100, and 200 s. one hundred rf echoes were acquired every 2 s. for each blood sample, the protocol was repeated three times for averaging. rf signals were adjusted to compensate for blood attenuation at each shear rate and integrated backscatter coefficient (ibsc) was determined as previously described (6). nine patients with type 2 diabetes and eight healthy control subjects gave informed consent to the approved protocol. patients with poor metabolic control were intentionally chosen. lipid profile and inflammatory proteins (fibrinogen, von clauss method ; haptoglobin and immunoglobin g, immunonephelometric method ; and c - reactive protein, latex agglutination technique) were determined for each participant. six patients were on oral antidiabetic and aspirin medications, three were on insulin, five were on cholesterol - lowering therapy, and four were treated for hypertension. those on insulin had a history of coronary artery disease, and two of them had suffered from myocardial infarction. mean sd age of patients was 58.3 8.8 years (range 4170). healthy subjects were age matched (51.1 8.7 years [range 4164 ]), did not take regular medications, and had no history of cardiovascular disease. a couette instrument made of two concentric cylinders and installed in an incubator at 37c generated homogeneous shear rates via a rotating outer cylinder. the 32-mhz polyvinylidine flouride ultrasound transducer (visualsonics, toronto, canada) had a 6 db bandwidth of 1545 mhz. avb2-ta - c - crima ; avtech, ottawa, canada). received radio frequency (rf) echoes (model no. au-3a-0120 ; miteq, hauppauge, ny) were amplified by 54 db, filtered between 10 and 50 mhz (model no. 5900 pr ; panametrics, waltham, ma), and digitized at 250 mhz (model no. the protocol consisted of imposing a 500 s shear rate for 120 s to disrupt aggregates. then, aggregation kinetics were recorded for 380 s at randomly applied reduced shear rates of 0, 1, 2, 10, 50, 100, and 200 s. one hundred rf echoes were acquired every 2 s. for each blood sample, the protocol was repeated three times for averaging. rf signals were adjusted to compensate for blood attenuation at each shear rate and integrated backscatter coefficient (ibsc) was determined as previously described (6). bmi, blood pressure, triglycerides, total cholesterol, hdl and ldl cholesterol, fibrinogen, and c - reactive protein were not different between groups (p > 0.05 ; unpaired t tests), whereas immunoglobin g (8.4 1.0 vs. 11.3 1.8 g / l, p 0.89), whereas in diabetic patients, maximum slope of ibsc occurring at 2 s was similar to that at 1 s (p = 1.0). except for that at 200 s (p = 0.11), kinetic slopes were always faster in diabetic patients, which is indicative of higher rates of neighboring rbc clustering. ibsc at plateaus averaged between 180 and 380 s after shear rate reductions as presented in fig. maximum ibsc at 2 s was similar to those at 0 and 1 s (p > 0.95). similarly, ibscs at 1 and 2 s were similar in diabetic patients (p > 0.95). ibscs were statistically higher in diabetic patients between 2 and 100 s, which reflects stronger adhesions and bigger steady - state aggregate sizes in diabetes. statistically significant differences in fig. 1 were noted for shears between 2 and 100 s, which correspond to normal flow at center streams and pathological flow stasis in recirculation zones of large systemic veins and arteries. accordingly, ea in diabetes can be related to lower - limb artery ischemic events, microangiopathy in foot extremities, and retinopathy. inflammation is involved in pathogenesis of type 2 diabetes and rbc aggregation, which agrees with our results (legend of fig. 1). subacute inflammatory state promoting rbc aggregation is also associated with obesity (8) and metabolic syndrome (9). thus, reducing inflammation (and indirectly aggregation) with statins and a1c with antidiabetic medication and/or diet are indicated because both have known benefits to cardiovascular consequences of diabetes. we reported measurements from a laboratory instrument, but a short - term objective is sizing rbc aggregates in vivo with ultrasound (10). at 32 mhz, the proposed noninvasive method should be investigated further because it may have potential benefit for diagnosis and follow - up of diabetic foot complications and for monitoring therapy. | objective to measure with ultrasound the increased erythrocyte aggregation (ea) kinetics and adhesion energy between erythrocytes in patients with type 2 diabetes and poor metabolic control.research design and methods blood samples were analyzed in a couette rheometer at 32 mhz following shear rate reductions from 500 s1 to residual shears of 0 (stasis), 1, 2, 10, 50, 100, and 200 s1. the increase in ea was determined with the integrated backscatter coefficient as a function of time and shear rate.resultsthe time required to form aggregates was shorter in diabetic patients at shear rates below 200 s1 (p < 0.01). erythrocytes formed larger aggregates in diabetic patients than in control subjects (p < 0.05 at 2 to 100 s1).conclusions ultrasound can potentially noninvasively demonstrate, in vivo and in situ, the impact of local abnormal ea on arteriovenous flow disorders in diabetes. |
neuromyelitis optica (nmo) has been traditionally considered a predominantly opticospinal disorder, but recent studies have shown that clinical spectrum of nmo includes cerebral and brainstem syndromes as well [13 ]. brain lesions on magnetic resonance imaging (mri) are found in the majority of nmo patients with long - standing disease [1, 2, 46 ], which makes it sometimes difficult to differentiate this disorder from multiple sclerosis (ms). ultrahigh - field mri (4 tesla or above) affords an unprecedented view of brain structures and pathology in vivo on a submillimeter scale due to high signal - to - noise ratio [7, 8 ]. the largely enhanced susceptibility of ultrahigh - field mr effect provides unique contrast between lesions and veins. this feature makes ultrahigh - field mr a valuable tool for differentiating plaques of ms, which frequently contain a venule, from lesions of other etiologies that rarely do. our aim in this work is to characterize brain lesions in patients with neuromyelitis optica spectrum disorders (nmosd) using 7 t mr and to discuss the findings in the context of the growing literature on ultrahigh - field imaging in ms [919 ]. inclusion criteria in the study were the diagnosis of nmo - spectrum disorders (nmosd) defined either as nmo by 2006 wingerchuk. criteria, or recurrent longitudinally extensive transverse myelitis (letm) with nmo igg seropositivity, or recurrent optic neuritis (on) with nmo igg seropositivity. nmo igg was measured at the mayo clinic laboratory (rochester, mn) by either immunohistochemical or enzyme - linked immunosorbent assay. all nonbedbound nmosd patients followed by the neurologists of the nyu - ms center (i. k. and j. h.) were invited to participate in the study. for each patient, we collected the following information : gender, ethnicity, country of birth, age at symptom onset, disease duration at mri, index event, number of optic neuritis and of transverse myelitis relapses, visual acuity and ambulatory status at last followup, nmosd therapy, and presence and number of vascular risk factors (defined as history of smoking, hypertension, hypercholesterolemia, or cardiovascular disease). ultrahigh - field imaging was carried out on a 7-tesla whole - body human mr system (magnetom, siemens medical solution, erlangen, germany) at the center for biomedical imaging / radiology at nyu langone medical center, which uses gradients of 45 mt / m with maximum gradient strength of 72 mt / m effective and a slew rate of 200 t / m / s (346 t / m / s effective). the head coil was used with a birdcage - like circularly polarized transmit coil and a 24-element phased array coil located on a close - fitting helmet - like device (nova medical, inc., ma). the imaging protocol consisted of high - resolution axial 2d high - resolution t2 -weighted gradient echo (gre), t2-weighted turbo spin - echo (tse), fluid - attenuated inversion recovery (flair), and sagittal t1-weighted 3d magnetization - prepared rapid acquisition of gradient - echo (mprage) imaging. the parameters of t2 -weighted gradient echo (gre) include tr / te / flip angle = 580 ms/25 ms/35 and slice thickness = 2 mm, with slice gap of 2.6 mm with pixel of 0.23 0.23 mm, which were optimized for better signal - to - noise and contrast between lesions and venous structures. for axial t2-weighted tse, the acquisition parameters were tr / te / flip angle = 14300/73 ms/144 ; slice thickness = 2 mm ; fov = 200 187 mm ; matrix = 384 384 mm. for axial space flair imaging, the acquisition parameters were tr / te / ti = 8000/380/2100 ms ; voxel size = 1 1 1 mm isotropic. for sagittal t1-weighted 3d mprage, the acquisition parameters were tr / te / ti = 2250/2.37/1100 ms, section thickness = 1 mm ; fov = 256 256 mm, matrix = 384 384. infratentorial volume could not be reliably evaluated because our 7 t receive coil yielded poor signal - to - noise ratio in this region, and the examination was therefore limited to supratentorial region. two experienced observers (y. g. and i. k.) examined t2-weighted and 2d gradient echo (t2) imaging sequences for presence of lesions. to reduce the possibility of misidentification, only the lesions that were present on both sequences were counted. for each lesion, we recorded lesion size, configuration, location, and presence or absence of central venule and of hypointense peripheral ring on t2 sequence. lesion localization was defined as periventricular (2 mm from cortex or ventricle, excluding corpus callosum), corpus callosum, cortex, and deep grey matter nuclei. lesions were described as perivenous if they were seen to be traversed by a vein on t2 sequence. data collection was carried out according to protocol approved by the institutional review boards of nyu - langone medical center, and all patients gave informed consent in writing before participation. ten patients agreed to participate in the study, six of whom were diagnosed with nmo and four with limited forms of nmo. demographic, disease - related, and radiologic characteristics of our nmosd cohort are shown in table 1. the total number of lesions was 92 (mean number was 9.2 8.8 ; median : 6 ; range : 230). seventy - six lesions (83%) were subcortical, 8 (9%) were juxtacortical, 3 lesions (3%) were found in corpus callosum, and 5 (5%) were periventricular (4 of which were adjacent to frontal horns of the lateral ventricles). all but three of the 92 lesions were 3 mm in diameter, while nearly all lesions in our series were 3 mm in diameter. absent histopathological correlation, it is impossible to be certain that brain lesions seen in our cohort are due to an nmo - specific pathogenic process. some of the lesions could theoretically represent stigmata of small vessel disease (svd), in itself a pathologically heterogeneous entity. for a number of reasons, svd origin of observed lesions seems to us to be less likely explanation. first, the finding of juxtacortical and corpus callosum lesions and the absence of basal ganglia lesions militate against svd etiology. secondly, thread - like lesions (figures 2(a)2(d)) have not been described in svd. third, we could find no correlation between vascular risk factors and the number of brain lesions (table 1) and observed small lesions in patients in their 20s and 30s with no vascular risk factors. lastly, in at least three of our patients, a lesion on 7 t mri was seen to enhance with gadolinium previously on a conventional mri study (unpublished data). whatever the pathogenesis of small subcortical lesions nmo may be, these non - specific lesions represent the most consistent feature of nmo on brain mri. our data is broadly consistent with recently published findings of 7 t mri of the brain in 10 german nmosd patients. the german nmosd cohort was somewhat older than ours (46 years versus 42 in our group) but had a slightly shorter disease duration (7 years versus 9 years). both groups were exclusively female, and all but one patient were nmo igg seropositive. in neither ours nor the german nmosd cohort were any cortical lesions observed, and the lesions that were present were predominantly small and subcortical the proportion of perivenous lesions among the german nmosd patients was higher than in our group (35% versus 9%), which may be related to the higher average number of lesions in their cohort (14 lesions versus 9 lesions in our group). importantly, in both cohorts, the number of perivenous lesions was significantly smaller than what is typically reported in ms (> 80%). finally, although hypointense ring, which is indicative of iron or hemosiderin deposition, is found in a significant minority of ms lesions [17, 28 ], it was only observed in one out of ten nmosd patients in the german nmo cohort and none of our ten patients. this further supports differential brain lesion pathogenesis in ms and nmo. our work and that of sinnecker. demonstrate that small round subcortical lesion without a central venule or hypointense ring is the most characteristic feature on nmosd on ultrahigh - field mri. in contrast, the signature lesion of ms is oblong, periventricular, and traversed centrally by a venule [9, 10, 15, 16 ], corresponding to dawson 's fingers, described pathologically almost a hundred years ago. dawson 's fingers and cortical lesions on 7 t mri in a patient with multiple, > 9, t2 hyperintense lesions should alert the radiologist that diagnosis of ms is unlikely. ultrahigh - field imaging of brain in nmosd provides strong supportive evidence that ms and nmo constitute two distinct nosological entities despite their predilection for the same organs. | background. brain lesions are common in neuromyelitis optica spectrum disorder (nmosd) and may resemble lesions of multiple sclerosis (ms). objectives. to describe the imaging characteristics of supratentorial lesions in nmosd on ultrahigh - field (7 t) mri with special attention to vessel - lesion relationship. methods. ten nmosd patients, all women and all seropositive for nmo igg, with mean age of 51.3 15.4 years and disease duration of 9.2 6.4 years, were scanned at a 7 t whole - body human mr system with high - resolution 2d gradient echo sequence optimized to best visualize lesions and venous structures, t2- and t1-weighted imaging. results. in 10 patients with nmosd, a total of 92 lesions were observed (mean : 9.2 8.8 ; range : 230), but only 8 lesions (9%) were traversed by a central venule. all lesions were < 5 mm in diameter, and 83% were located in subcortical white matter. there were no lesions in the cortex or basal ganglia. two patients exhibited diffuse periependymal abnormalities on flair. conclusions. small, subcortical lesions without a central venule are the most consistent finding of nmosd on 7 t mri of the brain. ultrahigh - field imaging may be useful for differentiating between nmosd and ms. |
nanoparticles are a special group of materials with unique features and extensive applications in diverse fields.1 metal nanoparticles, such as those containing gold and silver have recognized importance in chemistry, physics, and biology because of their unique optical, electrical, and photothermal properties.2 the ease of synthesizing gold and silver nanoparticles and their affinity for binding many biological molecules makes them attractive candidates for study. various physical and chemical methods have been reported over the last two decades for the synthesis of gold and silver nanoparticles, of which chemical approaches, such as chemical reduction, electrochemical techniques, and photochemical reduction, are most widely used. the green method of nanoparticle synthesis employing plant extracts is a simple and viable alternative to chemical procedures and physical methods.3 chemical and physical methods are harmful because the chemicals used are toxic, flammable, and are not disposed easily of in the environment.4 in recent years, biosynthesis of nanoparticles has received considerable attention due to the growing need to develop clean and nontoxic chemicals, environmentally friendly solvents, and renewable materials.5 utilization of biological systems such as plant extracts for the synthesis of nanoparticles has advantages over chemical and physical methods, because these systems are cost - effective, environment friendly, single - step in nature, and easily scaled up for large - scale synthesis.6 studies have shown that the size, morphology, stability, and physicochemical properties of metal nanoparticles are strongly influenced by the experimental conditions,79 and play pivotal roles in controlling the physical, chemical, optical, and electronic properties of these nanoscopic materials. this is particularly important for noble metals, such as gold and silver, which have strong surface plasmon resonance oscillations.10 several researchers have reported the use of natural products, inactivated plant biomass, and as living plants such as aloe vera,11 carica papaya,12 magnolia kobus, diospyros kaki,13 medicago sativa,14,15 azadirachta indica,16 pelargonium graveolens,17 chilopsis linearis,18 and tamarindus indica19 for the production of silver and gold nanoparticles (table 1). large amounts of nanoparticles can be easily synthesized from plants, and the majority of these are nontoxic. they have been used in pharmaceutical drug - based industries for treating lymphocytic leukemia, detecting dna, inhibiting bacteria and fungi, and preventing burns and open wound infections.20,21 trianthema decandra, a prostrate, glabrous, succulent annual belonging to the aizoaceae family, is found as a weed throughout most of india.22 the plant has various medicinal properties and has been reported to have antioxidant and antimicrobial properties.23 in the present study, we describe the biosynthesis of gold and silver nanoparticles from aqueous root extract of t. decandra for the first time. chloroauric acid and silver nitrate were reduced to metallic gold and metallic silver respectively, on reaction with root extract of t. decandra, resulting in synthesis of gold and silver nanoparticles. the gold and silver nanoparticles formed were characterized using ultraviolet - visible, scanning electron microscopy, energy dispersive x - ray, and fourier transform infrared spectroscopy. t. decandra l was collected from salem district, tamil nadu, india, during june 2011. the plant was taxonomically identified and authenticated by the botanical survey of india, coimbatore, and voucher specimen bsi / src/5/23/10 - 11/tech 975 was deposited at the plant biotechnology laboratory, sri ramaswamy memorial university, for future reference. gold (iii) chloride trihydrate (haucl4) and silver nitrate (agno3) were purchased from sigma - aldrich, st louis, mo. next, 20 g of coarsely powdered material was extracted with 100 ml of double - distilled water. the extract was stored at 4c until further use. for the synthesis of gold and silver nanoparticles, 10 ml of 1 mm aqueous haucl4 and agno3 solutions were separately added to 5 ml, 10 ml, and 15 ml of aqueous root extract and incubated in the dark. the resulting colloidal solutions of gold and silver were then analyzed using ultraviolet - visible spectroscopy. the colloidal solutions of gold and silver were diluted by adding 2.9 ml of deionized water to 0.1 ml of sample. bioreduction of haucl4 and agno3 was recorded as a function of time using water as a reference at 3-hour intervals from zero hour up to 24 hours using an ultraviolet - visible spectrophotometer (perkin - elmer, boston, ma) in a scanning range of 200 nm to 800 nm. to remove excess gold and silver ions, the gold and silver colloids were centrifuged at 10,000 rpm for 15 minutes and washed at least three times with deionized water. a dried powder of the gold and silver nanoparticles was obtained by freeze - drying. the air - dried powder form of the synthesized gold and silver nanoparticles was ground with kbr pellets and subjected to fourier transform infrared spectroscopy. the gold and silver nanoparticles formed were characterized using high resolution field emission scanning electron microscopy (fe - sem). the samples were prepared by simple drop coating of the suspension of gold and silver nanoparticles separately on a carbon - coated copper grid, by simply dropping a very small amount of the sample on the grid, with excess solution removed using blotting paper. the film on the scanning electron microscopy grid was then allowed to dry under a mercury lamp for 5 minutes. energy dispersive x - ray spectroscopy was then performed using the hitachi s-3400 n fe - sem instrument equipped with a thermo energy dispersive x - ray spectroscopy attachment. the antimicrobial activity of the gold and silver nanoparticles formed was assayed using the standard kirby - bauer disc diffusion method.24 bacterial suspensions of staphylococcus aureus (mtcc 29213), streptococcus faecalis (mtcc 0459), enterococcus faecalis (mtcc 2729), escherichia coli (mtcc 443), pseudomonas aeruginosa (mtcc 1035), proteus vulgaris (mtcc 1771), bacillus subtilis (mtcc 121), yersinia enterocolitica (mtcc 840), and the fungus, candida albicans (mtcc 183), grown overnight were swabbed on separate nutrient agar plates using l - rods. whatman filter paper (no 1) discs 6 mm in diameter were separately impregnated with 20 l of a 10 mg / ml solution of gold and silver nanoparticles in dimethylsulfoxide. chloramphenicol and nystatin were used as positive controls for bacteria and the fungus respectively, while dimethylsulfoxide served as a negative control. diameters of the zones of inhibition were measured using a meter ruler, and the mean value for each organism was recorded and expressed in millimeters. the data were analyzed by one - way analysis of variance followed by the duncan s multiple range test. t. decandra l was collected from salem district, tamil nadu, india, during june 2011. the plant was taxonomically identified and authenticated by the botanical survey of india, coimbatore, and voucher specimen bsi / src/5/23/10 - 11/tech 975 was deposited at the plant biotechnology laboratory, sri ramaswamy memorial university, for future reference. gold (iii) chloride trihydrate (haucl4) and silver nitrate (agno3) were purchased from sigma - aldrich, st louis, mo. the shade - dried materials were powdered and passed through a 40-mesh sieve. next, 20 g of coarsely powdered material was extracted with 100 ml of double - distilled water. for the synthesis of gold and silver nanoparticles, 10 ml of 1 mm aqueous haucl4 and agno3 solutions were separately added to 5 ml, 10 ml, and 15 ml of aqueous root extract and incubated in the dark. the resulting colloidal solutions of gold and silver were then analyzed using ultraviolet - visible spectroscopy. the colloidal solutions of gold and silver were diluted by adding 2.9 ml of deionized water to 0.1 ml of sample. bioreduction of haucl4 and agno3 was recorded as a function of time using water as a reference at 3-hour intervals from zero hour up to 24 hours using an ultraviolet - visible spectrophotometer (perkin - elmer, boston, ma) in a scanning range of 200 nm to 800 nm. to remove excess gold and silver ions, the gold and silver colloids were centrifuged at 10,000 rpm for 15 minutes and washed at least three times with deionized water. a dried powder of the gold and silver nanoparticles was obtained by freeze - drying. the air - dried powder form of the synthesized gold and silver nanoparticles was ground with kbr pellets and subjected to fourier transform infrared spectroscopy. the gold and silver nanoparticles formed were characterized using high resolution field emission scanning electron microscopy (fe - sem). the samples were prepared by simple drop coating of the suspension of gold and silver nanoparticles separately on a carbon - coated copper grid, by simply dropping a very small amount of the sample on the grid, with excess solution removed using blotting paper. the film on the scanning electron microscopy grid was then allowed to dry under a mercury lamp for 5 minutes. energy dispersive x - ray spectroscopy was then performed using the hitachi s-3400 n fe - sem instrument equipped with a thermo energy dispersive x - ray spectroscopy attachment. the antimicrobial activity of the gold and silver nanoparticles formed was assayed using the standard kirby - bauer disc diffusion method.24 bacterial suspensions of staphylococcus aureus (mtcc 29213), streptococcus faecalis (mtcc 0459), enterococcus faecalis (mtcc 2729), escherichia coli (mtcc 443), pseudomonas aeruginosa (mtcc 1035), proteus vulgaris (mtcc 1771), bacillus subtilis (mtcc 121), yersinia enterocolitica (mtcc 840), and the fungus, candida albicans (mtcc 183), grown overnight were swabbed on separate nutrient agar plates using l - rods. whatman filter paper (no 1) discs 6 mm in diameter were separately impregnated with 20 l of a 10 mg / ml solution of gold and silver nanoparticles in dimethylsulfoxide. chloramphenicol and nystatin were used as positive controls for bacteria and the fungus respectively, while dimethylsulfoxide served as a negative control. diameters of the zones of inhibition were measured using a meter ruler, and the mean value for each organism was recorded and expressed in millimeters. the data were analyzed by one - way analysis of variance followed by the duncan s multiple range test. nanoparticles of noble metals are characterized by the presence of bright colors produced by oscillations of the surface electron cloud of these particles. the formation of gold and silver nanoparticles was observed by monitoring the change in color, ie, a light yellow solution turning to ruby pink when haucl4 was used and a pale yellow solution turning to dark grey when agno3 was used. the collective oscillations of electrons in a nanoparticle upon interaction with light of suitable energy causes the nanoparticles to attain the color specific to a particular metal. particle size, shape, and aggregation depend strongly on the frequency of oscillations.25 the reduction kinetics of aqueous chloroaurate ions and silver ions leading to synthesis of gold and silver nanoparticles was compared using different amounts, ie, 5 ml, 10 ml, and 15 ml of root extract of t. decandra (figures 1 and 2). gold nanoparticles were synthesized within 3 hours of reaction with the root extract and the components thereof, while more than a 6-hour reaction period was required for synthesis of the silver counterpart. preliminary phytochemical screening of aqueous extracts of t. decandra showed the presence of various secondary metabolites.26 the bioreduction achieved in the present study is attributed to the metabolites present in the plant. synthesis of gold nanoparticles was pronounced when 15 ml of root extract was used for bioreduction, while 10 ml of the same root extract was sufficient for production of silver nanoparticles. the colloidal gold solution showed strong (0.15 au), weak (0.04 au), and moderate (0.08 au) absorption peaks with 15 ml, 5 ml, and 10 ml of extract respectively, at 575 nm (figure 3). the colloidal silver solution showed strong (0.81 au), weak (0.23 au), and moderate (0.31 au) absorbance peaks with 10 ml, 5 ml, and 15 ml of extract respectively at 340 nm (figure 4). nanoparticles may grow in a process involving rapid bioreduction and strongly influence surface plasmon resonance in the water extract.27 the results of the present study are in accordance with previous reports, including that by vijayakumar on artemisia nilagirica, indicating occurrence of a silver band at 340400 nm. further characterization using fourier transform infrared, scanning electron, and energy dispersive x - ray spectroscopy was carried out for gold nanoparticles formed with 15 ml and silver nanoparticles formed with 10 ml of t. decandra root extract. the functional groups present in gold nanoparticles detected using fourier transform infrared spectroscopy had absorption peaks located at 1649.33 cm and 1020.12 cm in the region of 10001800 cm characteristic of gold atoms (figure 5). two absorption peaks located at 1649.33 cm and 1020 cm are indicative of c = c stretch and aromatic cc bonds, respectively. distinct peaks in the range of 2344.87 cm and 2364.35 cm correspond to cn stretch, while peaks at 2925.92 cm and 3422.38 cm correspond to ch and oh stretching vibration, respectively. fourier transform infrared spectroscopy analysis of the silver nanoparticles showed absorption peaks of reduced silver at 1653.96 cm and 1027.44 cm in the region of 10001800 cm (figure 6). two absorption peaks located at 1653 cm are associated with the stretch vibration of c = c, and the single absorbance peak located at 1027 cm is assigned to cn stretching vibrations of amine. further distinct peaks in the region of 2343.972362.27 cm correspond to cn stretch for nitrile groups, while 3447.86 cm corresponds to oh stretching vibration. scanning electron micrographs (figure 7) for the gold nanoparticles reveal numerous spherical, triangular, hexagonal, and cubic structures produced by reduction of goldions with sizes ranging between 33.7 nm and 99.3 nm. an individual gold nanohexagon with an average edge length of 737 nm is also seen in figure 7b. very recently, rai have demonstrated that the presence of halide ions and modulation of temperature can control the morphology of biologically synthesized gold triangles using lemongrass leaf extract.28 in the present study, nanoparticles resembling triangles with sizes ranging between 33.7 nm and 99.3 nm were produced during bioreduction of haucl4, which could be attributed to the chloride ions present in it (figure 7d). spherical silver nanoparticles with diameters of 3694 nm are depicted in the scanning electron micrographs (figure 8). the variation in particle sizes, such as 36, 47, 60, and 94 nm, is possibly due to the fact that the nanoparticles are being formed at different times. water - soluble heterocyclic compounds, including saponin, were mainly responsible for the reduction of silver ions or chloroaurate ions to metallic silver and metallic gold, respectively. further, it has been shown that the presence of chloride ions during nanosynthesis promotes the growth of nanotriangles. in the present study, reduction of chloroaurate ions produced nanotriangles. the presence of gold atoms in the gold nanoparticles was further confirmed by energy dispersive x - ray spectroscopy. the optical absorption peak was observed at approximately 2.2 kev, which is typical of gold nanocrystallite absorption due to surface plasmon resonance. the current energy dispersive x - ray spectroscopic profile of gold nanoparticles of t. decandra (figure 9) showed strong gold atom signals around 0.30, 2, 2.2, 2.4, and 9.7 kev. similarly, the presence of silver atoms in the silver nanoparticles was confirmed using energy dispersive x - ray spectroscopy (figure 10). the optical absorption peak was observed at 3 kev, which is typical for silver nanocrystallite absorption due to surface plasmon resonance. in an earlier study, individual spherical silver nanoparticles synthesized using alfalfa showed absorption peaks in the range of 2.54 kev.29 the current profile of energy dispersive x - ray spectroscopy for silver nanoparticles of t. decandra indicate strong silver atom signals around 0.20, 3, 3.2, and 3.4 kev. antimicrobial activity of the synthesized gold and silver nanoparticles was studied using eight different bacteria, namely s. aureus, s. faecalis, e. faecalis, e. coli, p. aeruginosa, p. vulgaris, b. subtilis, y. enterocolitica, and a fungus, c. albicans. both gold and silver nanoparticles exhibited excellent activity against y. enterocolitica, p. vulgaris, e. coli, s. aureus, and s. faecalis. zones of inhibition measuring 13.515.5 mm were recorded for the gold nanoparticles, while their silver counterparts recorded zones of 15.520.5 mm. moderate activity was recorded against the other three bacteria tested (table 2, figures 11 and 12). the growth inhibition of c. albicans was double in silver nanoparticles when compared with gold nanoparticles. the antibacterial effect was more pronounced in gram - negative bacteria than gram - positive ones. the antimicrobial activity of colloidal silver particles is influenced by the particle dimensions.30 silver has long been recognized as having an inhibitory effect on microbes present in medical and industrial processes. the most important application of silver and silver nanoparticles is in medical industry, such as in topical ointments to prevent infection against burns and open wounds.31 gold nanoparticles are harmful to bacteria and fungi. they bind closely to the surface of microorganisms, causing visible damage to cells, with complete destruction of flagella, stimulated production of biofilm, and aggregation within the biofilm.32 comparison of gold and silver nanoparticle sizes indicates the latter to be smaller than the former. the smaller particles have greater antimicrobial effects.33 further, the antimicrobial activity in the present study was much higher when compared with previous reports. silver nanoparticles from polyalthia longifolia, balsamodendron mukul, melia azadirachta, berberis aristata, acorus calamus, embelia ribes, psoralea corylifolia, smilax china, glycyrrhiza glabra, and andropogon muricatus showed activity against e. coli, p. aeruginosa, s. aureus, and c. albicans, with zones of inhibition measuring less than 8 mm in diameter.30,33 the results of the present study are indicative of pronounced antibacterial effects. they provide an important basis for use of gold and silver nanoparticles synthesized from the root extract of t. decandra in the treatment of human infections associated with the microorganisms used in this study. nanoparticles of noble metals are characterized by the presence of bright colors produced by oscillations of the surface electron cloud of these particles. the formation of gold and silver nanoparticles was observed by monitoring the change in color, ie, a light yellow solution turning to ruby pink when haucl4 was used and a pale yellow solution turning to dark grey when agno3 was used. the collective oscillations of electrons in a nanoparticle upon interaction with light of suitable energy causes the nanoparticles to attain the color specific to a particular metal. particle size, shape, and aggregation depend strongly on the frequency of oscillations.25 the reduction kinetics of aqueous chloroaurate ions and silver ions leading to synthesis of gold and silver nanoparticles was compared using different amounts, ie, 5 ml, 10 ml, and 15 ml of root extract of t. decandra (figures 1 and 2). gold nanoparticles were synthesized within 3 hours of reaction with the root extract and the components thereof, while more than a 6-hour reaction period was required for synthesis of the silver counterpart. preliminary phytochemical screening of aqueous extracts of t. decandra showed the presence of various secondary metabolites.26 the bioreduction achieved in the present study is attributed to the metabolites present in the plant. synthesis of gold nanoparticles was pronounced when 15 ml of root extract was used for bioreduction, while 10 ml of the same root extract was sufficient for production of silver nanoparticles. the colloidal gold solution showed strong (0.15 au), weak (0.04 au), and moderate (0.08 au) absorption peaks with 15 ml, 5 ml, and 10 ml of extract respectively, at 575 nm (figure 3). the colloidal silver solution showed strong (0.81 au), weak (0.23 au), and moderate (0.31 au) absorbance peaks with 10 ml, 5 ml, and 15 ml of extract respectively at 340 nm (figure 4). nanoparticles may grow in a process involving rapid bioreduction and strongly influence surface plasmon resonance in the water extract.27 the results of the present study are in accordance with previous reports, including that by vijayakumar on artemisia nilagirica, indicating occurrence of a silver band at 340400 nm. further characterization using fourier transform infrared, scanning electron, and energy dispersive x - ray spectroscopy was carried out for gold nanoparticles formed with 15 ml and silver nanoparticles formed with 10 ml of t. decandra root extract. the functional groups present in gold nanoparticles detected using fourier transform infrared spectroscopy had absorption peaks located at 1649.33 cm and 1020.12 cm in the region of 10001800 cm characteristic of gold atoms (figure 5). two absorption peaks located at 1649.33 cm and 1020 cm are indicative of c = c stretch and aromatic cc bonds, respectively. distinct peaks in the range of 2344.87 cm and 2364.35 cm correspond to cn stretch, while peaks at 2925.92 cm and 3422.38 cm correspond to ch and oh stretching vibration, respectively. fourier transform infrared spectroscopy analysis of the silver nanoparticles showed absorption peaks of reduced silver at 1653.96 cm and 1027.44 cm in the region of 10001800 cm (figure 6). two absorption peaks located at 1653 cm are associated with the stretch vibration of c = c, and the single absorbance peak located at 1027 cm is assigned to cn stretching vibrations of amine. further distinct peaks in the region of 2343.972362.27 cm correspond to cn stretch for nitrile groups, while 3447.86 cm corresponds to oh stretching vibration. scanning electron micrographs (figure 7) for the gold nanoparticles reveal numerous spherical, triangular, hexagonal, and cubic structures produced by reduction of goldions with sizes ranging between 33.7 nm and 99.3 nm. an individual gold nanohexagon with an average edge length of 737 nm is also seen in figure 7b. very recently, rai have demonstrated that the presence of halide ions and modulation of temperature can control the morphology of biologically synthesized gold triangles using lemongrass leaf extract.28 in the present study, nanoparticles resembling triangles with sizes ranging between 33.7 nm and 99.3 nm were produced during bioreduction of haucl4, which could be attributed to the chloride ions present in it (figure 7d). spherical silver nanoparticles with diameters of 3694 nm are depicted in the scanning electron micrographs (figure 8). the variation in particle sizes, such as 36, 47, 60, and 94 nm, is possibly due to the fact that the nanoparticles are being formed at different times. water - soluble heterocyclic compounds, including saponin, were mainly responsible for the reduction of silver ions or chloroaurate ions to metallic silver and metallic gold, respectively. further, it has been shown that the presence of chloride ions during nanosynthesis promotes the growth of nanotriangles. in the present study, reduction of chloroaurate ions produced nanotriangles. the presence of gold atoms in the gold nanoparticles was further confirmed by energy dispersive x - ray spectroscopy. the optical absorption peak was observed at approximately 2.2 kev, which is typical of gold nanocrystallite absorption due to surface plasmon resonance. the current energy dispersive x - ray spectroscopic profile of gold nanoparticles of t. decandra (figure 9) showed strong gold atom signals around 0.30, 2, 2.2, 2.4, and 9.7 kev. similarly, the presence of silver atoms in the silver nanoparticles was confirmed using energy dispersive x - ray spectroscopy (figure 10). the optical absorption peak was observed at 3 kev, which is typical for silver nanocrystallite absorption due to surface plasmon resonance. in an earlier study, individual spherical silver nanoparticles synthesized using alfalfa showed absorption peaks in the range of 2.54 kev.29 the current profile of energy dispersive x - ray spectroscopy for silver nanoparticles of t. decandra indicate strong silver atom signals around 0.20, 3, 3.2, and 3.4 kev. antimicrobial activity of the synthesized gold and silver nanoparticles was studied using eight different bacteria, namely s. aureus, s. faecalis, e. faecalis, e. coli, p. aeruginosa, p. vulgaris, b. subtilis, y. enterocolitica, and a fungus, c. albicans. both gold and silver nanoparticles exhibited excellent activity against y. enterocolitica, p. vulgaris, e. coli, s. aureus, and s. faecalis. zones of inhibition measuring 13.515.5 mm were recorded for the gold nanoparticles, while their silver counterparts recorded zones of 15.520.5 mm. moderate activity was recorded against the other three bacteria tested (table 2, figures 11 and 12). the growth inhibition of c. albicans was double in silver nanoparticles when compared with gold nanoparticles. the antibacterial effect was more pronounced in gram - negative bacteria than gram - positive ones. the antimicrobial activity of colloidal silver particles is influenced by the particle dimensions.30 silver has long been recognized as having an inhibitory effect on microbes present in medical and industrial processes. the most important application of silver and silver nanoparticles is in medical industry, such as in topical ointments to prevent infection against burns and open wounds.31 gold nanoparticles are harmful to bacteria and fungi. they bind closely to the surface of microorganisms, causing visible damage to cells, with complete destruction of flagella, stimulated production of biofilm, and aggregation within the biofilm.32 comparison of gold and silver nanoparticle sizes indicates the latter to be smaller than the former. the smaller particles have greater antimicrobial effects.33 further, the antimicrobial activity in the present study was much higher when compared with previous reports. silver nanoparticles from polyalthia longifolia, balsamodendron mukul, melia azadirachta, berberis aristata, acorus calamus, embelia ribes, psoralea corylifolia, smilax china, glycyrrhiza glabra, and andropogon muricatus showed activity against e. coli, p. aeruginosa, s. aureus, and c. albicans, with zones of inhibition measuring less than 8 mm in diameter.30,33 the results of the present study are indicative of pronounced antibacterial effects. they provide an important basis for use of gold and silver nanoparticles synthesized from the root extract of t. decandra in the treatment of human infections associated with the microorganisms used in this study. to summarize, we achieved successful green synthesis of gold and silver nanoparticles using t. decandra root extract. silver and gold nanoparticles were synthesized under ambient conditions, and characterization of synthesized nanoparticles was carried out by ultraviolet - visible, fourier transform infrared, scanning electron and energy dispersive x - ray spectroscopy. it is believed that phytochemicals present in t. decandra extract reduce the silver and gold ions into metallic nanoparticles. | backgroundthere is an increasing commercial demand for nanoparticles due to their wide applicability in various markets, including medicine, catalysis, electronics, chemistry, and energy. in this report, a simple and ecofriendly chemical reaction for the synthesis of gold and silver nanoparticles from trianthema decandra (aizoaceae) has been developed.methods and resultson treatment of aqueous solutions containing chloroauric acid or silver nitrate with root extract of t. decandra, stable gold or silver nanoparticles were rapidly formed. the kinetics of reduction of gold and silver ions during the reaction was analyzed by ultraviolet - visible spectroscopy. field emission - scanning electron microscopy showed formation of gold nanoparticles in various shapes, including spherical, cubical, triangular, and hexagonal, while silver nanoparticles were spherical. the size of the gold nanoparticles was 3365 nm and that of the silver nanoparticles was 3674 nm. energy dispersive x - ray and fourier transform infrared spectroscopy confirmed the presence of metallic gold and metallic silver in the respective nanoparticles. the antimicrobial properties of the synthesized nanoparticles were analyzed using the kirby - bauer method. the results show varied susceptibility of microorganisms to the gold and silver nanoparticles.conclusionit is believed that phytochemicals present in t. decandra extract reduce the silver and gold ions into metallic nanoparticles. this strategy reduces the cost of production and the environmental impact. the silver and gold nanoparticles formed showed strong activity against all microorganisms tested. |
each year, more than forty million abortions are occurred whole of the world (1). most of the inducible abortions are performed by surgical methods as the gold choice procedure however may lead patients dissatisfaction and postoperative serious complications (2). by advancing medical services as alternative methods for performing abortion, this modality has replaced previous surgical methods especially for abortions occurring within first trimester (3). in the early 1970s, a first generations of pregnancy terminating medications consisting prostaglandins was introduced that followed by developing drugs consisting anti - progesterone in 1980 (4). by developing these alternatives particularly drugs including prostaglandins, some large trials could demonstrate their efficacies with high successfulness for inducing abortions during first trimesters (5). this drug has a wide clinical applications including prevention of peptic ulcer induced by non - steroidal anti - inflammatory drugs and also of its serious complications such as gastric bleeding (7). this drug is now widely used for inducing pregnancy terminations that its complete abortion rate has been reported between 61% and 93% (8). the effectiveness of this drug is dependent to the dose of usage, following its repeated dose as well as it using in combination with other drugs such as methotrexate that led to a complete abortion rate of 98% (9, 10). despite misoprostol can be used with different roots including oral, sublingual and vaginal, however a few evidences are available in drug effectiveness as well as its related side effects when use in different roots. hence, the present study aimed to compare the efficacy of misoprostol in first trimester abortion through two sublingual and vaginal routes of administration. this randomized clinical trial was conducted from april 2014 to november 2014 on 52 consecutive women in first trimester admitted to amiralmomenin hospital in zabol city that were candidate for pregnancy termination because of fetal iufd or missed abortion in sonography reports. those women with previous scar on uterine patients with external and internal opening of the cervix is open to both symptoms of abortion is spontaneous start of the study were excluded. all patients were hospitalized and then randomly assigned to receive sublingual misoprostol (400 g, n = 27) or vaginal misoprostol (400 g placed in posterior fornix, n = 25). because of small sample size, block randomization was performed according to the time of admission. single blind allocation and intervention were conducted by a nurse working in the midwifery unit. one of women in first group had history of thyroid nodule that was treated with levothyroxine. the study was approved by institutional ethics committee, the patients and the attendants were explained about the procedure and informed consent was obtained. on admission, a complete medical history was obtained from all subjects and all were physically examined and vital sign were checked and monitored every 4 hours. the presence or absence of vaginal bleeding presence or absence of uterine contractions that indicate the pain was identified in all patients. the external opening of the cervix, both domestic as well as those that were open were signs of spontaneous abortion is excluded. the initial dose repeated every 4 hours t0 termination of pregnancy or maximum dose of 2000 microgram. the abortion was then induced in all women. the main criterion for effective medical abortion complete abortion was defined as complete expulsion of the pregnancy products or endometrial diameter less than 10 mm and absence of residue in sonographic report, otherwise it was considered as incomplete abortion. the study end points were completeness of abortion and also tolerability and complications of the used regimens. frequencies of different clinical and demographic variables between patients receiving two treatment methods were compared by chi square and fisher exact tests (for categorical variables) and mann whitney test (for continues variables). association between these methods and experiencing complete abortion was assessed using multivariate cox regression models. in sublingual group, one of the subjects did not respond to medical abortion that underwent curettage surgery and was thus excluded. thus, 27 women in vaginal group and 25 women in sublingual group were included in further assessment. the overall mean age was 30.48 6.07 years (29.48 6.21 years in vaginal group and 31.56 5.85 years in sublingual group, p = 0.221). mean time of follow - up for women prescribed with sublingual and vaginal inducers were 570 217 min and 514 208 min respectively with no difference between the groups (p = 0.6). as illustrated in table 1, none of the pregnant in the sublingual group developed complete abortion at the end of follow - up time, while 36% of women inducted with vaginal misoprostol experienced complete abortion indicating a intergroup significant difference (p = 0.001). compared with vaginal group, those women in sublingual group experienced more complications including diarrhea (22.2% versus 20.0%), nausea and vomiting (22.2% versus 0.0%), and abdominal pain (3.7% versus 0.0%). according to the patient to increase the frequency of bowel movements, diarrhea, loose stool consistency have been reported. some previous reports comparing efficacy of different roots of misoprostol on abortion completeness showed similar drug efficacy when administrated vaginally or sublingually, however some others confirmed the superiority of one prescribing protocol compared with another. in a similar study by parveen in 2011, the average time for cervical ripening was significantly less in sublingual administration as compared to the vaginal rout. also, although the intra - operative pain severity of the sublingual group was lower in comparison to the vaginal route, loose motions and nausea / vomiting were more prevalent in sublingual group than in vaginal group. vimala (11) indicated that the duration of the procedure and the amount of blood loss were similar in the two groups prescribed vaginal and sublingual misoprostol whereas those women in the sublingual group experienced significantly more shivering and preoperative vaginal bleeding. interestingly, tanha (12) and colleagues found that although the effectiveness was high in the sublingual group than in vaginal group, the sublingual group experienced more prevalence rate of bleeding, pain severity, diarrhea and fever. also, ganguly (13) showed that the rate of complete abortion was higher in sublingual group in comparison to vaginal route, surgical evacuation was required in less number of cases in sublingual group, induction - abortion interval was least with the sublingual route, however gastro - intestinal side - effects more prevalent in sublingual rout. in another study by saxena (14), sublingual group had a higher dilatation and lower time duration of surgery as compared to vaginal routes. furthermore, pain severity in the sublingual group was significantly lower and patient acceptability was higher for sublingual as compared to vaginal route. as shown in various reports, contradictory results have been revealed regarding more efficacy, tolerability, as well as complications of the different administration routs including sublingual and vaginal routes. although we could show lower efficacy as well as higher complications of sublingual versus vaginal prescription of misoprostol, some pointed studies obtained higher efficacy and lower rate of complications by administrating misoprostol as sublingually when compared with its using orally. in all reviewed studies, the doses of administrating drugs were similar and thus different dosages could not be a potential confounder explaining these heterogeneities. however, some other factors such as differences in exclusion criteria, study sample sizes, or main characteristics of clinical trials such as method of randomization may affect the results and thus power of the studies. it can be suggested that although use of sublingual misoprostol is prefer for women candidates for terminating pregnancy because of the ease of use, but it s probable lower efficacy and also higher gastrointestinal side effects should not be also ignored. in contrast, vaginal use of drug may result in some specific complications such as vaginal bleeding as shown in some studies and also may cause high patients dissatisfaction. it seems that the selection of the route of administration should be considered based on the physician discretion and patient clinical condition. however, due to higher rate of abortion incompleteness and higher complication rates in sublingual group shown in our study, higher caution should be considered in the use of sublingual route. fateen showed the use of sublingual misoprostol to induce cervical priming in first trimester abortion was efficient and as effective as vaginal misoprostol with more convenience to the patient and avoided the need of the doctor to insert it (15). shah demonstrated sublingual and vaginal misoprostol are both equally effective for the medical management of missed miscarriage although their overall effectiveness is low within the first 24 hours. sublingual misoprostol is associated with more side effects especially an unpleasant taste (6). sublingual and vaginal misoprostol are both equally effective for the medical management of missed miscarriage although their overall effectiveness is low within the first 24 hours. parveen. concluded that sublingual misoprostol is an effective and favorable cervical ripening agent for first trimester abortion as compared to vaginal and oral dosage forms (17). some limitations included in this research ; lack of willingness of patients to choose medical approach of treatment os it is very slow in comparison with the surgery. if the dose of treatment was less, it might include them in this study. the third limitation was indexing patients with diarrhea only based on their report and we did not measure the volume of stool as a factor. therefore this may include error because patients may reported based on number of times going to toilet and loose stool consistency. in conclusion, according to our findings, the use of misoprostol in vaginal route is more abortion completeness as well as lower complication rate as compared to sublingual prescription of the dru / g. in this regard, the use of misoprostol vaginally should be more scheduled because may lead higher patients satisfaction. | background : each year, more than forty million abortions are occurred whole of the world. misoprostol is a prostaglandin analogue with a strong uterotonic effect. the present study aimed to compare the efficacy of misoprostol in first trimester abortion through two sublingual and vaginal routes of administration.methods:this randomized clinical trial was conducted on 52 consecutive women in first trimester candidate for pregnancy termination because of fetal iufd or missed abortion in sonography reports. the patients were hospitalized and then randomly assigned to receive sublingual misoprostol (400 g, n 27) or vaginal misoprostol (400 g placed in posterior fornix, n = 25).findings : none of the pregnant in the sublingual group developed complete abortion at the end of follow - up time, while 36% of women inducted with vaginal misoprostol experienced complete abortion indicating a intergroup significant difference (p = 0.001). compared with vaginal group, those women in sublingual group experienced more complications including diarrhea (22.2% versus 20.0%), nausea and vomiting (22.2% versus 0.0%), and abdominal pain (3.7% versus 0.0%).conclusion : the use of misoprostol in vaginal route results in more abortion completeness as well as lower complication rate as compared to sublingual prescription of the drug. |
new psychoactive substances (npss) are continuously emerging on the recreational and illicit drug market. they are often referred to as legal highs, designer drugs, or they are mainly synthetic derivatives and analogues of existing controlled drugs, analogues of pharmaceutical products, herbs, fungi, and their extracts that show psychoactive actions. some npss are controlled, while others are legally sourced and can either be sold directly on the drug market or be used as precursors for the synthesis of other designer drugs that mimic the psychoactive effects of controlled substances [4, 5 ] ; thus, due to the chemical alterations of the parent compounds, nps derivatives can avoid drug legislation. furthermore, for most npss, pharmacological and analytical data are limited or unavailable, which makes detection, monitoring, and control more difficult. ah-7921 is a new, structurally atypical synthetic opioid analgesic that appears to be sold as a research chemical or it was synthesized in the 1970s by allen and hanburys ltd. as a potential analgesic medicine ; however, its development was abandoned due to its addictive properties. it has never been marketed as a medicine, nor used as pharmaceutical or medicinal product ; it has also no industrial use. there are very few references available on this compound. in vivo studies in animals indicated its -opioid receptor agonistic activities, although no studies have evaluated its pharmacological and toxicological properties in humans. its activities are similar to those of morphine and include analgesia, hypothermia, respiratory depression, and addictive behavior [79 ]. the abuse of ah-7921 has been reported in eight member states of the european union as well as in norway, leading to severe toxicity (non - fatal) cases and 16 reported deaths within a limited period of time (december 2012september 2013). thus, ah-7921 is controlled in six european countries (sweden, poland, romania, finland, netherlands, and norway) since 2013. the aim of this review is to summarize the current knowledge about ah-7921 concerning its chemistry, pharmacology, and toxicology, as well as its legal status. the limited existing analytical methodologies for determination of ah-7921 in biological samples are also presented. published or reported ah-7921-related cases, fatalities, intoxications, and self reports from drug users are reviewed. ah-7921 is an n - substituted cyclohexylmethylbenzamide, where the benzamide moiety is dichlorinated at positions 3 and 4 of the benzyl ring, and the aminocyclohexane moiety is n, n - dimethylated. ah refers to allen and hanburys, the company that patented the drug. its systematic (international union of pure and applied chemistry) name is 3,4-dichloro - n-{[1-(dimethylamino)cyclohexyl]methyl}benzamide, but it can also be found as 1-(3,4-dichlorobenzamidomethyl)cyclohexyldimethylamine [6, 10 ]. common names like doxylam, doxylan, and cn 2924 29 98 (cas number) are also used. 1chemical structures of ah-7921, fentanyl, doxylamine, and phencyclidine chemical structures of ah-7921, fentanyl, doxylamine, and phencyclidine ah-7921 is an off - white solid with the molecular formula c16h22cl2n2o. its molecular weight is 329.26 g / mol, and the melting point of its hydrochloride salt is 215216 c. it is soluble in ethanol (11 mg / ml), dimethylsulfoxide (3 mg / ml) and dimethylformamide (10 mg / ml) ah-7921 appeared on the european drug market in 2012. however, in july 2012 it was formally brought to the attention of the european union early warning system for the first time by norway and sweden, and later, in august 2012, by the united kingdom. in 2013, it was identified as a co - ingredient in synthetic cannabinoid- and cathinone - derivative products sold in japan. ah-7921 is sold via the internet on various websites where it is sometimes referred to as is also used in internet drug forums, legal high websites, and head shops. this name may be confused with doxylamine, the international nonproprietary name of a widely used (non - prescription) antihistaminic medicine with sedative - hypnotic properties that is chemically completely different from ah-7921 (fig. 1). thus, intake of ah-7921 mislabeled as doxylamine could lead to unintentional toxicity or overdoses with the drug. ah-7921 has no established or acknowledged industrial, agrochemical, cosmetic, human, or veterinary medical value or use, and thus there is neither marketing authorization for this nps in the european union nor in the 28 member states, norway, and iceland. ah-7921 is legitimately used as an analytical reference standard and in scientific research [6, 12, 13 ], and can be ordered online from suppliers of chemicals. relative labeling (analytical reference standard, laboratory reagent only, or not for human consumption) appears on some of the dubious products that are sold through the internet on different websites to conform to law. according to the emcdda, ah-7921 collected from street samples or drug seizures was in powder form ; however, it is not known whether the salt or free base forms were present. internet licit retailers offer ah-7921 for sale in the form of free base or as its hydrochloride salt. ah-7921 was first detected in the united kingdom in july 2012 in a collected sample of 250 mg of a white powder purchased for 10 gbp via the internet. various quantities of powder ranging from 0.02 (sweden) to 500 g (france) were seized between july 2012 and october 2013. by march 2014, europol received reports related to the detection of ah-7921 in seized or collected materials at the scene of death or in biological fluids from austria, belgium, denmark, finland, france, germany, norway, and sweden [6, 14, 15 ]. information about the dosage of ah-7921, the route of administration, its purity when purchased (mainly online) from drug retailers, and its concomitant use with other substance(s), such as medicine(s) or alcohol, can be extracted from self - reported experiences in drug forums or other related websites. the drug is consumed by nasal insufflation, sublingual application, intravenous injection, a combination of insufflation and oral consumption, or rectal administration (in the form of powder, tablet, or capsule) at doses ranging from 10 to 150 mg [10, 1518 ]. an ah-7921 user reports that the threshold dose for me was around 0.05 g. i explored doses up to 0.512 g. i also experimented with immediate tolerance using multiple doses. i found that re - dosing between 1 a.m. and 3 a.m. produced the smoothest increase in effects and duration. many users take ah-7921 in combination with other psychoactive substances and/or controlled drugs, especially cannabis [16, 17 ]. in some fatal or intoxication cases reported by the member states and norway, medicines, controlled drugs, and/or other npss were also detected in biological samples along with ah-7921. ah-7921 was designed, synthesized, developed, and patented in the mid 1970s by researchers from the university of aston (birmingham) and the pharmaceutical company allen and hanburys ltd. it was synthesized among other n - substituted cyclohexylmethylbenzamide derivatives as a potential analgesic agent due to its structural similarity to fentanyl and phencyclidine (fig. 1). ah-7921 proved to be the most active compound of the designed series in animal models tested possessing significant analgesic properties (ed50 = 0.55 mg / kg). especially in mouse, ah-7921 showed an analgesic action equal to morphine (ed50 = 0.45 mg / kg) when inhibiting phenylquinone - induced writhing. after subcutaneous administration in mice, the drug proved to be an antinociceptive agent during hot - plate test. because early in vivo animal studies of ah-7921 revealed its potent analgesic activity, it was selected among the series of n - substituted cyclohexylmethylbenzamides for further investigation and detailed studies in higher species. particularly, orally administered doses of ah-7921 in conscious dogs led to suppression of pain response (to electrical stimulation of the dental pulp) to an extent similar to that of morphine with a minimal effective antinociceptive oral dose of 1.25 mg / kg. in rhesus monkeys, the minimal oral antinociceptive (for similarly induced pain) doses of ah-7921, codeine, and morphine were 13.8, 11.3, and 5.0 mg / kg, respectively. these doses caused no overt behavioral effects in the above examined animal models, although higher oral doses of 50 mg / kg caused slight central nervous system depression. further studies by the same scientific group of allen and hanburys ltd. revealed the addictive liability of ah-7921 ; administration of naloxone to rats that were orally treated with 5 mg ah-7921/kg three times daily that increased to 20 mg ah-7921/kg three times daily over 5 days caused an withdrawal syndrome similar to that produced in animals that had received morphine on a similar dosage schedule. in addition, on terminating ah-7921 treatment, withdrawal signs appeared over a period of 2448 h, which indicates that the physical dependence produced is similar to that of opioids. sewell and spencer in their study showed that the antinociceptive effects of subcutaneously injected morphine or ah-7921 were prolonged in both cases by intracerebroventricularly injecting serotonin in mice, while noradrenaline attenuated the antinociceptive effects of these two analgesics. thus, it was assumed that ah-7921 interacts in vivo with brain - penetrating serotonergic and adrenergic drugs. more recent studies in rodents indicated that ah-7921 was a -opioid receptor agonist, while -opioid receptors were also involved to its analgesic effect against chemically induced pain. this moderate selectivity towards - over -opioid receptors was also confirmed in vitro using opioid receptor preparations from guinea pig brains. hayes and tyers studied the antinociceptive effects, as well as the adverse effects produced by ah-7921 and other selected opioid receptor agonists, after subcutaneous administration in mice. these adverse effects included miosis, straub tail response, hypothermia, sedation, respiratory depression (ed50 = 2.5 mg / kg), and inhibition of gastrointestinal propulsion. in general, these effects of ah-7921 were similar to those of morphine, indicating a shared mode of action at the receptor level, while they were significantly reduced by simultaneous subcutaneous administration of naloxone. these results demonstrated that the doses that produced side effects were close to those responsible for its analgesic action. in the same study, morphine was found to have a twofold greater safety margin than ah-7921, which suggests easier appearance of toxic effects after ah-7921 use. there are no published studies concerning the pharmacological or toxicological action of ah-7921 in humans and the clinical features of its acute toxicity. thus, the only available information related to the use and the effects of this drug is scarce and originates from internet drug forums and a limited number of recently published poisoning cases. ah-7921 as a -opioid receptor agonist produces relaxation, euphoria, respiratory depression, nausea, hypertension, and hypothermia, as users of this drug have mentioned [6, 10 ]. however, it is difficult to estimate the role of -opioid receptor agonism in the overall physiological and psychological effects of ah-7921 in humans. drug users reported that the desired (positive) effects of ah-7921 after oral intake include physical anesthetic effect, euphoria, mental relaxation, and pleasant mood lift, while nausea and vertigo induced by movement appeared as adverse (negative) effects that could be minimized by having a meal 24 h prior to ingestion. according to a user who had been in search of a substance that would provide pain management and tried ah-7921 orally, the effects of ah-7921 seem to be highly predictable and repeatable. i found the intensity of the effects to correspond in a linear relationship to the dosage amount. an ah-7921 user mentioned that the inhalation of vapors in an amount of 40 mg as free base led to a very relaxing and pleasant experience, euphoria, and pain relief similar to those produced by doses of morphine as low as 10 mg. the peak - effects lasted for 1.5 h. no other effects except warmness of body, extreme relaxation, analgesic effects, medium euphoria, and miosis (occurring with the use of other opioids) were noticed. two ah-7921 users experienced similar effects as well as an addition opiate glow, alertness, occasional itching, nausea, and tremors after sublingual administration and re - dosing of a solution of powder ah-7921 in lemon juice and warm water. no serious adverse effects were observed by these users. a user who consumed orally in total 2 g of ah-7921 in 3 weeks experienced feelings of depression and mild insomnia after withdrawal from the drug, while his second experience resulted in a visit to hospital with numbness, spasms, and twitches. other users have confirmed that ah-7921 can lead to withdrawal symptoms worse than morphine due to its much longer half - life. the growing recreational use of npss has led to an increasing number of confirmed cases of severe intoxications and fatalities associated with their consumption in europe and worldwide. according to the emcdda report of 2014, the swedish poison information centre reported eight non - fatal intoxications associated with ah-7921 use between december 2012 and april 2013. the presence of ah-7921 was analytically confirmed in seven of these cases, but no information on ah-7921 quantification was given. the clinical symptoms described in the above cases included seizures, hypertension, and tachycardia [6, 14, 15 ]. the first death associated with ah-7921 was reported by norway in december 2012. since then, a total of 16 deaths in which ah-7921 was detected have been reported from sweden, the united kingdom, and norway [6, 14, 15 ]. three fatal cases, in which the use of ah-7921 was involved, occurred in norway between december 2012 and august 2013. in the first case of the three, ah-7921 was not analytically confirmed in biological samples, but its use was suspected due to the detection of ah-7921 in the small amounts of a white powder found in a bag and in a syringe with dried blood at the location close to the deceased during the investigation at the scene of death. etizolam and phenazepam were also found in the bag and the syringe. in the second case, ah-7921 was detected in his peripheral blood at a concentration of 0.428 g / ml. 2-fluoromethamphetamine, 3-methylmethcathinone, codeine, and paracetamol were also detected. in the third case, the death was associated with ah-7921 in norway, but the drug was analyzed in sweden. ah-7921 was quantified in femoral blood at a concentration of 0.34 g / ml. etizolam was also detected [6, 14, 15 ]. three deaths associated with ah-7921 were also reported in the united kingdom between february 2013 and august 2013. the involvement of this nps was analytically confirmed. in the first case (february 2013), ah-7921 was detected in postmortem femoral blood at a concentration of 0.58 g / ml. in addition to ah-7921, etizolam, etaqualone, mephedrone, pentedone, diphenylpropinol, and 4-methylmethcathinone were detected in postmortem urine. ah-7921 was also detected in a packet of labeled powder found at the scene of death. in the second case (july 2013), ah-7921 was determined at a concentration of 0.05 g / ml in the femoral blood of a man found dead with a bag containing chloroform over his head. the victim of the third case was found unresponsive at home and died later after being transferred to a hospital. in postmortem femoral blood, ah-7921 (4.46 g / ml), mirtazapine, and doxylamine were detected. their presence was also confirmed in urine along with clobazam and a codeine metabolite [6, 14, 15 ]. ten lethal cases were reported in sweden between january and september 2013, and all cases were analytically confirmed. in nine of them, ah-7921 was determined in femoral blood at concentrations ranging from 0.03 to 0.99 g / ml, while in the tenth case it was detected postmortem in hair although not quantified. in all cases, these substances included amphetamine (two cases), 3-methylmethcathinone (two cases), a metabolite of ketamine, alcohol, buprenorphine, and drugs such as benzodiazepines (alprazolam, diazepam, nordazepam, pyrazolam), pregabalin, gabapentin, zopiclone, mirtazapine, paroxetine, bupropion, and aripiprazole. in three cases, the death was attributed to toxic effect of ah-7921 or overdose of ah-7921, while in four cases, the causes of death were given as unintentional overdose, overdose of benzodiazepines and opiates, intoxication with opioids among others, and pneumonia caused by aspiration. in two cases, the cause of death was reported as unclear, and in the last case, no further information was provided [6, 9, 14, 15 ]. reported a death in the usa associated with ah-7921 of a 19-year - old male found dead in bed by his friend. the latter indicated that the deceased had purchased two vials of an unknown drug and used them for two consecutive nights. pulmonary congestion, edema of the lungs, and enlargement of the liver and spleen were revealed during autopsy. the analysis of the content of the two vials found at the scene identified ah-7921 in one vial and 4-methyl--pyrrolidinohexanophenone (mphp) in another vial. in the postmortem blood, only ah-7921 was detected and quantified, while dextromethorphan and mphp were found in the postmortem urine along with ah-7921. because of the chemically basic nature and structure of ah-7921, its extraction from biological samples and analysis are simple, easy, and thus amenable to a number of techniques. soh and elliot reported the development of high - performance liquid chromatography diode array (hplc dad) detection, liquid chromatography tandem mass spectrometry (lc ms - ms), and ultra high - performance liquid chromatography quadrupole time - of - flight - mass spectrometry methods for determination of ah-7921 and its metabolites simultaneously with other npss and their metabolites in blood and plasma samples. the developed methods were applied for forensic purposes and were also used to study the stability of these emerging substances and their metabolites in the biological fluids. detected and identified ah-7921 in an illegal product in japan based on previously published gas chromatography mass spectrometry (gc ms) and ultra performance liquid chromatography electronspray ionization mass spectrometry techniques after extraction with methanol from herbal - type products crushed to powder. the isolation of ah-7921 from postmortem blood was succeeded by liquid liquid extraction with n - butyl chloride from alkalinized samples. the analyses were based on the use of gc ms using selected ion monitoring mode ; the electron impact (ei) mass spectrum of the underivatized ah-7921 showed characteristic fragments at m / z 126 (base peak), 145, and 173. their characteristic fragments were m / z 112 (base peak), 145, and 173, and m / z 98 (base peak), 145, 173, respectively. they were suggested to be the ah-7921 metabolites, n - desmethyl - ah-7921 and n, n - didesmethyl - ah-7921, produced by the demethylation and di - demethylation of the n, n - dimethylcyclohexanamine group, respectively. however, the absence of metabolic studies and certified reference standards precluded the verification of the other detected substances as metabolites. the possibility also exists that these substances could be contaminants or byproducts found in the material. nuclear magnetic resonance and fourier transform infrared spectra of ah-7921 are available at european information system and database on new drugs and could be used for the identification of the drug in seized materials [10, 2931 ]. ah-7921 is currently controlled in six european countries (sweden, poland, romania, finland, netherlands, and norway). particularly, in sweden it is controlled under the narcotic drugs control act (sfs 1992 - 860) and the narcotic drugs control ordinance (sfs 1994 - 1554) complying with the obligations of the 1971 united nations convention on psychotropic substances. in poland, ah-7921 fell under the definition of a substitution drug under the act amending the act on state sanitary inspection (2010), and thus its production and marketing are penalized with administrative sanctions (i.e. fine). in romania it is controlled under law 194/2011 as a substance with psychoactive potential until proven harmless. netherlands and finland reported that ah-7921 is a controlled substance and must comply with medicine legislation (in finland since 15 march 2013medicines act 395/87). in norway there is no information regarding the control status of ah-7921 in spain. the remaining 22 member states (austria, belgium, bulgaria, croatia, cyprus, the czech republic, denmark, estonia, france, germany, greece, hungary, ireland, italy, latvia, lithuania, luxembourg, malta, portugal, slovakia, slovenia, and the united kingdom) and turkey reported that ah-7921 is not controlled at the national level, although germany intended to introduce national measures for this nps [6, 14, 15, 29, 32 ]. in june 2014, the european commission proposed to member states to take the necessary measures to subject ah-7921, along with other npss, to control to prevent its further spread. following this proposal, a decision on scheduling ah-7921 in the member states was taken in september 2014. the distribution of ah-7921 has been considered to be illegal in israel since 12 september 2013. in australia, ah-7921 was scheduled as a prohibited substance (subjected to schedule 9 of the standard for the uniform scheduling of medicines and poisons) in may 2014, although this amendment has been repealed as of 2 june 2014 ; but its import is still banned. it is expected that ah-7921 will be a controlled substance in most countries worldwide by the end of 2015. ah-7921 is an nps available online and constitutes a public health danger in many countries worldwide. it is a potential analgesic drug with addictive properties and has been synthesized to mimic the effects of morphine, fentanyl, and phencyclidine due to structural similarity to the latter two, and at the same time, it outsmarts the drug laws. ah-7921 was first synthesized in the mid-1970s, but it only recently (in 2012) appeared on the drug market and gained the attention of authorities due to the intoxications and fatalities it caused. it is considered a synthetic opioid, and its pharmacological properties are similar to morphine. potential side effects include miosis, hypothermia, sedation, respiratory depression, and inhibition of gastrointestinal propulsion, as well as, in severe cases, death. the drug is available online in the powder form, and is often used concomitantly with other recreational drugs. in 2012 and 2013, a number of reported deaths associated with the intake of ah-7921 led to control of this substance in six european countries, israel, and australia. in september 2014, the european commission published a decision calling upon its member states to take the necessary measures to subject ah-7921, along with other npss, to control to prevent its further spread. | ah-7921 is a structurally unique synthetic opioid analgesic that has recently entered the drug arena in europe, the usa, and japan. although it was synthesized and patented in the mid-1970s, it was first identified in a seized sample purchased via the internet in july 2012 and formally brought to the attention of the european union early warning system in august 2012 by the united kingdom. several in vitro experiments and animal model studies established the morphine - like analgesic action of ah-7921 as a -opioid receptor agonist that has been found to be several times more potent than codeine and at least as potent as morphine. this novel psychoactive substance has already led to eight non - fatal intoxications and 16 deaths in sweden, the united kingdom, norway, and the usa. thus, ah-7921 is a current public health risk, and better international collaboration, effective legislation and continuous community alertness are needed to tackle this current growing problem. the aim of this review is to summarize the current knowledge about this drug concerning its chemistry, pharmacology, and toxicology, as well as its international legal status. the limited existing analytical methodologies for the determination of ah-7921 in biological samples are also presented. published or reported ah-7921-related cases, fatalities, or intoxications, and self reports from drug users are reviewed. |
the university medical center groningen is a tertiary referral center in the northern part of the netherlands. we perform routine diagnostic real - time pcr for all patients evaluated for respiratory disease by laboratory developed tests for 17 targets, including adenovirus, bocavirus, coronavirus, enterovirus, metapneumovirus, influenza, parainfluenzavirus, rhinovirus, and respiratory syncytial virus (5). from all enterovirus detections with a cycle threshold (ct) value 48 hours after admission ; the source of possible nosocomial infection was not identified. we obtained 20 sequences of part of the ev - d68 viral protein gene and aligned them with the sequences from the 2014 epidemic. clades were assigned as described previously (7) by the neighbor - joining method by using bionumerics software 6.6 (applied maths / biomrieux, sint - martens - latem, belgium). sequence analysis (figure 2) showed that the 2016 strains were closely related to sequences of the recently described subclade b3 (8), represented in figure 2 by 4 sequences from china. the nucleotide divergence was 2.1% within b3, 5.5% between b1 and b3, and 7.3% between b2 and b3. we submitted our 20 sequences from 2016 to genbank (accession nos. kx685066kx685084 and kx710328). maximum - parsimony tree of partial viral protein 1 sequences of enterovirus d68 (ev - d68). included are the strains obtained in the laboratory of the university medical center groningen (groningen, the netherlands) in 2014 (light gray, n = 23) and 2016 (black, n = 20) and worldwide isolates from 2014 (dark gray, n = 73). recent strains cluster in the recently described clade b3, with a nucleotide divergence of 2.1% within clade b3, 5.5% to clade b1, and 7.3% to clade b2. chn, china ; dnk, denmark ; esp, spain ; fin, finland ; fra, france ; ger, germany ; irl, ireland ; ita, italy ; nld, the netherlands ; svn, slovenia ; usa, united states. after the upsurge of ev - d68 in our region during 2009 and 2010, we set up routine genotypic characterization for several viral pathogens, including enterovirus and rhinovirus, which is also offered to regional referring hospitals and healthcare institutions. sequencing results are available within 1 week, which provides clinically relevant and epidemiologic information. this so - called regiotype strategy contributed to timely detection of ev - d68 in our hospital in 2014, as well as in 2016. we recognized a sudden reappearance of ev - d68 with a sharp increase of cases that could not be explained by a change in surveillance strategy. in line with previous outbreaks, mostly children were affected, and those with underlying pulmonary conditions seemed at higher risk for icu admission (9). the number of children who needed icu admission was higher in 2016 than in our 2010 and 2014 reports (3,4). although dynamics of viral disease and shedding are not known for ev - d68, we assume a role for ev - d68 in the symptoms of patients 12 and 23, as, in line with rhinovirus infections, higher viral load might indicate symptomatic disease (10). evidence that ev - d68 might cause afm is increasing after recent epidemiologic investigations (1,11,12). in patient 16, atypical guillain - barr syndrome initially was diagnosed ; however, this diagnosis was later discarded because the electromyography results indicated motoric axon or anterior horn cell disease, and the clinical picture and mri results were in favor of afm (13). mri findings were subtle, and radiologic diagnosis was made only after further review and discussion of the case with the neurologists. the absence of ev - d68 in csf is consistent with previous reports (1,12). sequencing results showed that the strains in our study cluster in the recently described clade b3 (8). during the 2014 outbreak, most ev - d68 sequences belonged to clades b1 and b2, although a1 and a2 were also represented (2,14). larger epidemiologic and genotyping studies are needed to evaluate whether the distinction within clade b is tenable and whether our clinical findings are typical for subclade b3. this upsurge could indicate an active ev - d68 season, as highlighted by the epidemiologic curve, with a potential increase in afm cases. clinicians should be alert for ev - d68, its clinical implications, and the need for appropriate diagnostics, particularly in children who are admitted with respiratory failure to the icu or with possible symptoms of afm. | in june and july 2016, we identified 8 adults and 17 children with respiratory enterovirus d68 infections. thirteen children required intensive care unit admission because of respiratory insufficiency, and 1 had concomitant acute flaccid myelitis. phylogenetic analysis showed that all of 20 sequences obtained belong to the recently described clade b3. |
the fundamental manifestation of the aging process is a progressive decline in the functional maintenance of tissue homeostasis and an increasing propensity to degenerative diseases and death. it has attracted significant interest to study the underlying mechanisms of aging, and many theories have been put forward to explain the phenomenon of aging. there is an emerging consensus that aging is a multifactorial process, which is genetically determined and influenced epigenetically by environment. most aging theories postulate a single physiological cause of aging, and likely these theories are correct to a certain degree and in certain aspects of aging. reactive oxygen species (ros) are highly reactive molecules that consist of a number of diverse chemical species including superoxide anion (o2), hydroxyl radical (oh), and hydrogen peroxide (h2o2). because of their potential to cause oxidative deterioration of dna, protein, and lipid, ros have been implicated as one of the causative factors of aging. as ros are generated mainly as by - products of mitochondrial respiration, mitochondria are thought to be the primary target of oxidative damage and play an important role in aging. emerging evidence has linked mitochondrial dysfunction to a variety of age - related diseases, including neurodegenerative diseases and cancer. details of the precise relationship between ros - induced damage, mitochondrial dysfunction, and aging remain to be elucidated. ros are generated as by - products of aerobic respiration and various other catabolic and anabolic processes. mitochondria are the major producer of ros in cells, and the bulk of mitochondrial ros is generated at the electron transport chain [5, 6 ]. electrons leak from the electron transport chain directly to oxygen, producing short - lived free radicals such as superoxide anion (o2) [7, 8 ]. o2 can be converted to nonradical derivatives such as hydrogen peroxide (h2o2) either spontaneously or catalyzed by superoxide dismutase (sod) [913 ]. it can be diffused within the cell and be removed by cytosolic antioxidant systems such as catalase, glutathione peroxidase, and thioredoxin peroxidase [14, 15 ]. in addition to being generated during cellular metabolism in mitochondria, ros can be produced in response to different environmental stimuli such as growth factors, inflammatory cytokines, ionizing radiation, uv, chemical oxidants, chemotherapeutics, hyperoxia, toxins, and transition metals [1626 ]. other than mitochondrial respiration, a number of cytosolic enzymes are able to generate ros. the nicotinamide adenine dinucleotide phosphate (nadph) oxidases are a group of plasma membrane - associated enzymes found in a variety of cell types. the function of nadph oxidases is to produce superoxide from oxygen using electrons from nadph. once they are produced, ros react with lipids, proteins, and nucleic acids causing oxidative damage to these macromolecules [3034 ]. ros readily attack dna and generate a variety of dna lesions, such as oxidized dna bases, abasic sites, and dna strand breaks, which ultimately lead to genomic instability. 7,8-dihydro-8-oxo - deoxyguanosine (8-oxo - dg) is one of the most abundant and well - characterized dna lesions caused by ros. it is a highly mutagenic lesion that results in g : c to t : a transversions. to limit the cellular damage caused by ros, ros - generated dna lesions are repaired mainly by base excision repair as well as other dna repair pathways including nucleotide excision repair, double - strand break repair, and mismatch repair [3840 ]. in addition, the damaging effects of ros can be neutralized via elevated antioxidant defense, which includes superoxide dismutase, catalase, and glutathione peroxidase to scavenge ros to nontoxic forms. intracellular ros are normally maintained at low but measurable level within a narrow range, which is regulated by the balance between the rate of production and the rate of scavenging by various antioxidants. ros, at low level under normal conditions, is found to act as signaling molecules in many physiological processes, including redox homeostasis and cellular signal transduction. by activating proteins such as tyrosine kinases, mitogen - activated protein kinases, or ras proteins, dependent on cell types, ros have been found to function as signaling molecules in cell proliferation, cellular senescence, or cell death [45, 46 ]. the divergent effects of ros on many cellular processes suggest that ros are not merely detrimental byproducts, but also generated purposefully to mediate a variety of signaling pathways. the free radical theory of aging proposed by denham harman more than fifty years ago postulates that aging results from the accumulation of deleterious effects caused by free radicals, and the ability of an organism to cope with cellular damage induced by ros plays an important role in determining organismal lifespan. in agreement with this theory, increased ros production by mitochondria and increased 8-oxo - dg content in the mtdna are frequently detected in aged tissues [40, 4750 ], suggesting that progressive accumulation of oxidative dna damage is a contributory factor to the aging process. consistently, many studies have found that increased oxidative damage in cells is associated with aging [5153 ]. furthermore, genetic studies in worm, fly, and mouse have linked enhanced stress resistance or reduced free radical production with increased lifespan. mutant strains of c. elegans that are resistant to oxidative stress have extended lifespan, whereas those more susceptible to free radicals have shortened lifespan [54, 55 ]. mice lacking the antioxidant enzyme superoxide dismutase 1 (sod1) exhibit a 30% decrease in life expectancy. small synthetic mimetics of sod / catalase increase lifespan in c. elegans, while treatment of antioxidant drugs in mice increases the median lifespan up to 25% [59, 60 ]. further supporting this hypothesis, mice lacking ogg1 and myh, two enzymes of the base excision repair pathway that repairs oxidative dna damage, show a 50% reduction in life expectancy. collectively, these studies demonstrate that interplay between ros and protective antioxidant responses is an important factor in determining aging and lifespan. despite a large body of evidence supporting the role of ros in aging, the free radical theory of aging faces some challenges. mice heterozygous for superoxide dismutase 2 (sod2) have reduced manganese sod (mnsod) activity, increased oxidative damage, but normal lifespan. overexpression of antioxidant enzymes in mice, such as sod1 or catalase, does not extend lifespan [64, 65 ]. the median lifespan of mice heterozygous of glutathione peroxidase 4 (gpx4), an antioxidant defense enzyme that plays an important role in detoxification of oxidative damage to membrane lipids, is significantly longer than that of wild - type mice, even though gpx4 mice show increased sensitivity to oxidative stress - induced apoptosis. studies of long - lived rodents also do not find a convincing correlation between level of oxidative damage and aging. furthermore, pharmacologic intervention with antioxidants in humans and mice has little effect on prolonging lifespan [6870 ]. more investigations are clearly needed to clarify the discrepancy in the role of ros and antioxidant enzymes in aging among different species and to understand the precise role that free radicals play in aging. senescence, a process in which normal somatic cells enter an irreversible growth arrest after a finite number of cell divisions, is thought to contribute to organismal aging [7274 ]. senescent cells are associated with high level of intracellular ros and accumulated oxidative damage to dna and protein [7577 ]. in contrast, immortal cells suffer less oxidative damage and are more resistant to the deleterious effects of h2o2 than primary cells. increasing intracellular oxidants by altering ambient oxygen concentrations or lowering antioxidant levels accelerates the onset of senescence, while lowering ambient oxygen or increasing ros scavenging delays senescence [76, 7881 ]. telomere shortening is considered as the major cause of replicative senescence [82, 83 ]. it has been reported that the rate of telomere shortening is directly related to the cellular level of oxidative stress. telomere shortening is significantly increased under mild oxidative stress as compared to that observed under normal conditions, whereas overexpression of the extracellular sod in human fibroblasts decreases the peroxide content and the rate of telomere shortening. the presence of 8-oxoguanine (8-oxog), an oxidative derivative of guanine, in telomeric repeat - containing dna oligonucleotides has been shown to impair the formation of intramolecular g quadruplexes and reduces the affinity of telomeric dna for telomerase, thereby interfering with telomerase - mediated extension of single - stranded telomeric dna. ros also affect telomeres indirectly through their interaction with the catalytic subunit of telomerase, telomerase reverse transcriptase (tert). increased intracellular ros lead to loss of tert activity, whereas ros scavengers such as n - acetylcysteine (nac) block ros - mediated reduction of tert activity and delay the onset of cellular senescence. furthermore, the presence of 8-oxog in the telomeric sequence reduces the binding affinity of trf1 and trf2 to telomeres. trf1 and trf2 are components of the telomere - capping shelterin complex that protects the integrity of telomeres. in addition, ros - induced dna damage elicits a dna damage response, leading to the activation of p53, a critical regulator of senescence. it has been shown that p53 transactivates e3 ubiquitin ligase siah1, which in turn mediates ubiquitination and degradation of trf2. consequently, knockdown of siah1 expression stabilizes trf2 and delays the onset of replicative senescence. the p53-siah1-trf2 regulatory axis places p53 both downstream and upstream of dna damage signaling initiated by telomere dysfunction. by regulating telomere maintenance or integrity directly or indirectly tissue - specific or adult stem cells, which are capable of self - renewal and differentiation, are essential for the normal homeostatic maintenance and regenerative repair of tissues throughout the lifetime of an organism. the self - renewal ability of stem cells is known to decline with advancing age [9194 ], suggesting that decline in stem cell function plays a central role in aging. increasing evidence suggests that dysregulated formation of ros may drive stem and progenitor cells into premature senescence and therefore impede normal tissue homeostasis. genetic studies of mice deficient in genes implicated in ros regulation indicate that elevated level of ros within the stem cell compartments leads to a rapid decline in stem cell self - renewal [9598 ]. deletion of ataxia telangiectasia mutated (atm) kinase results in increased ros level in hematopoietic stem cell (hsc) population in aged mice, which correlates with a rapid decline in hsc number and function. when atm mice are treated with antioxidants, the defect in stem cell self - renewal is rescued, suggesting that high level of ros causes the decline in stem cell function. furthermore, deficiency in telomerase reverse transcriptase (tert) accelerates the progression of aging, resulting in an even shorter lifespan in atm mice accompanied by increased senescence in hematopoietic tissues and decreased stem cell activity. these tert - deficient hscs are also sensitive to ros - induced apoptosis, suggesting another possible cause of stem cell impairment during aging. similarly, defect in hsc number and activity accompanied by increased accumulation of ros is observed in mice lacking three members of forkhead box o - class (foxo) [9698 ]. increased level of ros in foxo3-null myeloid progenitors leads to hyperproliferation through activation of the akt / mtor signaling pathway, and ultimately premature exhaustion of progenitors. mice carrying a mutation in inner mitochondrial membrane peptidase 2-like (immp2l) gene, which is required to process signal peptide of mitochondrial cytochrome c1 and glycerol phosphate dehydrogenase 2, exhibit an early onset of aging phenotypes, including premature loss of fat. elevated mitochondrial ros level in the immp2l mutant mice leads to impaired self - renewal of adipose progenitor cells, suggesting that ros - induced damage to adult stem cells is the driving force of accelerated aging in these mice. further supporting this notion, intracellular level of ros is found to correlate with the long - term self - renewal ability of hscs in mouse. hscs with high level of ros show a decreased ability of long - term self - renewal, and treatment of antioxidant nac is able to restore the functional activity of hscs with high level of ros. taken together, these studies suggest that ros play an important role in stem cell aging. ros - generated dna lesions are repaired by several dna repair pathways including base excision repair, nucleotide excision repair, double - strand break repair, and mismatch repair [3840 ]. hscs in mice deficient in dna repair pathways, including nucleotide excision repair, telomere maintenance, and nonhomologous end - joining, exhibit increased sensitivity to the detrimental effect of ros, diminished self - renewal and functional exhaustion with age. these data support the notion that accumulated dna damage is one of the principal mechanisms underlying age - dependent stem cell decline. because mitochondria are the major producer of ros in mammalian cells, the close proximity to ros places mitochondrial dna (mtdna) prone to oxidative damage. consistently, many studies have shown that 8-oxo - dg, one of the common oxidative lesions, is detected at higher level in mtdna than nuclear dna, suggesting that mtdna is more susceptible to oxidative damage [52, 105113 ]. as both the major producer and primary target of ros, mitochondria are thought to play an important role in aging. the mitochondrial theory of aging, extended from the free radical theory, proposes that oxidative damage generated during oxidative phosphorylation of mitochondrial macromolecules such as mtdna, proteins, or lipids is responsible for aging. as mtdna encodes essential components of oxidative phosphorylation and protein synthesis machinery, oxidative damage - induced mtdna mutations that impair either the assembly or the function of the respiratory chain will in turn trigger further accumulation of ros, which results in a vicious cycle leading to energy depletion in the cell and ultimately cell death [104, 114, 116118 ]. as mitochondria play a critical role in regulation of apoptosis, which is implicated in the aging process, age - related mitochondrial oxidative stress may contribute to apoptosis upon aging. the activation of the permeability transition pore in mitochondria, which is believed to play a critical role in cell necrosis and apoptosis, is enhanced in spleen, brain, and liver of aged mice [120, 121 ]. moreover, mitochondrial adenine nucleotide translocase, a component of the permeability transition pore, exhibits an age - associated increase of oxidative modification in male houseflies. thus, mitochondria appear to influence the aging process via modifying the regulatory machinery of apoptosis. mice expressing proof reading - deficient mitochondrial dna polymerase show a consistent increase in mtdna mutations, premature onset of the aging phenotypes and reduced lifespan [124, 125 ], suggesting a critical link between mitochondria and aging. interestingly, ros production in these mice is not increased [124, 125 ]. similarly, mice expressing proof reading - deficient mitochondrial dna polymerase specifically in heart show accumulation of mutations in mtdna and develop cardiomyopathy, but oxidative stress in the transgenic heart is not increased, indicating that oxidative stress is not an obligate mediator of diseases provoked by mtdna mutations. more studies are required to further clarify the consequence of oxidative stress and mitochondrial dysfunction in aging. mitochondrial genome encodes proteins required for oxidative phosphorylation and atp synthesis, and rnas needed for mitochondrial protein translation. the mtdna is densely packed with genes and only contains one noncoding region called the displacement loop (d - loop). the d - loop is important for mtdna replication and transcription and has been extensively studied for the presence of age - related mutations. age - dependent accumulation of point mutations within the d - loop has been reported in various types of cells and tissues, including skin and muscle [128132 ]. in addition to point mutations, deletions of mtdna are detected at higher frequency in aged human and animal tissues [133145 ]. replication is thought to be the likely mechanism leading to the formation of mtdna deletions [146148 ], but recent studies suggest that mtdna deletions may be generated during repair of damaged mtdna rather than during replication. it is thought that repair of oxidative damage to mtdna accumulated during aging leads to generation of double - strand breaks, with single - strand regions free to anneal with microhomologous sequences on other single - stranded mtdna or within the noncoding region. subsequent repair, ligation and degradation of the remaining exposed single strands would result in the formation of an intact mitochondrial genome harboring a deletion. whether and how exactly mutations and deletions of mtdna cause the aging phenotypes are not clear. among mtdna deletions during aging, especially in postmitotic tissues like muscle and brain, the frequency of this deletion increases in brain, heart, and skeletal muscle with age, although the increase varies in different tissues of the same individual, or even in different regions of the same tissue [134, 136, 137 ]. this deletion occurs in a region encoding subunits of the nadh dehydrogenase, cytochrome c oxidase, and atp synthase. whether deletion of these genes plays a causative role in the development of aging phenotypes remains to be determined. in addition to age - associated increase of mtdna mutations and deletions, the abundance of mtdna also declines with age in various tissues of human and rodent [156158 ]. for instance, in a large group of healthy men and women aged from 18 to 89 years, mtdna and mrna abundance is found to decline with advancing age in the vastus lateralis muscle. furthermore, abundance of mtdna correlates with the rate of mitochondrial atp production, suggesting that age - related mitochondrial dysfunction in muscle is related to reduced mtdna abundance. however, age - associated change in mtdna abundance seems to be tissue specific, as several studies have reported no change in mtdna abundance with age in other tissues in human and mouse [159161 ]. it is possible that tissue - specific effect of aging on mtdna abundance is related to the status of aerobic activity [156, 158 ], as aerobic exercise has been shown to enhance muscle mtdna abundance in both human and mouse [162164 ]. increased prevalence of mtdna mutations / deletions and decreased mtdna abundance offer attractive underlying causes of mitochondrial dysfunction in aging, which warrants further investigation. a heterogeneous class of disorders with a broad spectrum of complex clinical phenotypes has been linked to mitochondrial defect and oxidative stress [165, 166 ]. particularly, mitochondria are thought to play an important role in the pathogenesis of age - associated neurodegenerative diseases, such as alzheimer 's disease, parkinson 's disease, and huntington 's disease. this is not surprising as neurons are especially sensitive and vulnerable to any abnormality in mitochondrial function because of their high energy demand. alzheimer 's disease (ad) is the most common form of dementia and often diagnosed in people over 65 years of age. ad is characterized by severe neurodegenerative changes, such as cerebral atrophy, loss of neurons and synapses, and selective depletion of neurotransmitter systems in cerebral cortex and certain subcortical region. mitochondria are significantly reduced in various types of cells obtained from patients with ad [168170 ]. dysfunction of mitochondrial electron transport chain has also been associated with the pathophysiology of ad. the most consistent defect in mitochondrial electron transport enzymes in ad is a deficiency in cytochrome c oxidase [171, 172 ], which leads to an increase in ros production, a reduction in energy stores, and disturbance in energy metabolism. parkinson 's disease (pd) is the second most common progressive disorder of the central nervous system, which is characterized prominently by loss of dopaminergic neurons in the substantia nigra and formation of intraneuronal protein aggregates. the finding that exposure to environmental toxins, which inhibit mitochondrial respiration and increase production of ros, causes loss of dopaminergic neurons in human and animal models leads to a hypothesis that oxidative stress and mitochondrial dysfunction are involved in pd pathogenesis. consistent with this notion, a significant decrease in the activity of complex i of the electron transport chain is observed in the substantia nigra from pd patients. furthermore, neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, which acts as an inhibitor of complex i, can induce parkinsonism in human, monkey, and rodent [177, 178 ]. genetic studies of pink1 and parkin further support the role of mitochondrial dysfunction in pathogenesis of pd [179, 180 ]. autosomal recessive mutations in pink1 and parkin are associated with juvenile parkinsonism [181183 ]. studies in drosophila have provided strong evidence that pink1 and parkin act in the same genetic pathway to control mitochondrial morphology in tissues with high energy demand and requirement of proper mitochondrial function, such as indirect flight muscle and dopaminergic neurons [184186 ]. consistent with the finding in drosophila, primary fibroblasts derived from patients with pink1 mutations show similar abnormalities in mitochondrial morphology. the morphologic changes of mitochondria can be rescued by expression of wild - type parkin but not pathogenic parkin mutants, suggesting that mitochondrial dynamics plays an important role in pd pathogenesis. huntington 's disease (hd) is another hereditary neurodegenerative disorder that affects muscle coordination and leads to cognitive decline and dementia. hd is caused by an autosomal dominant mutation in the huntingtin (htt) gene. morphologic defects of mitochondria, such as reduced mitochondrial movement and alterations in mitochondrial ultrastructures, have been observed in patients with hd or transgenic hd mouse models [189, 190 ]. in addition, expression of mutant htt leads to impaired energy metabolism, abnormal ca signaling and mitochondrial membrane potential, and drastic changes in mitochondrial ultrastructures [191, 192 ]. although the underlying molecular mechanism remains to be determined, it is recently proposed that mutant htt conveys its neurotoxicity by evoking defects in mitochondrial dynamics, mitochondrial fission and fusion, and organelle trafficking, which in turn result in bioenergetic failure and hd - associated neuronal dysfunction. mitochondrial dysfunction and increased oxidative damage are often associated with ad, pd, and hd, suggesting that oxidative stress may play an important role in the pathophysiology of these diseases. increased production of cellular ros and oxidative stress have been reported to induce autophagy, a homeostatic process that enables cells to degrade cytoplasmic proteins and organelles [194197 ]. the observation of increased autophagy in the brains of patients with ad, pd, and hd suggests that autophagy contributes to the pathogenesis of these neurodegenerative diseases, possibly by causing cell death [170, 198202 ]. consistently, oxidative stress - induced autophagy of accumulated amyloid -protein in ad causes permeabilization of lysosomal membrane and leads to neuronal cell death. mitochondria damaged by significantly increased oxidative stress in pyramidal neurons of ad are subjected to autophagic degradation, ultimately leading to neurodegeneration. furthermore, overexpression of wild - type pink1 increases mitochondrial interconnectivity and suppresses toxin - induced autophagy, whereas knockdown of pink1 expression potentiates mitochondrial fragmentation and induces autophagy, suggesting that induced autophagy as a consequence of loss of function of pink1 may contribute to the pathogenesis of pd. interestingly, autophagy also serves as a protective mechanism in age - related neurodegenerative diseases. several studies demonstrate that basal level of autophagy clears the deleterious protein aggregates that are associated with ad, pd, and hd [205207 ], therefore playing a protective role in the maintenance of neural cells. administration of rapamycin induces autophagy and enhances the clearance of mutant htt, improving cell viability and ameliorating hd phenotypes in cell and animal models. furthermore, parkin, whose loss of function mutation causes early onset pd, has been found to promote autophagy of depolarized mitochondria, suggesting that a failure to eliminate damaged mitochondria by mutant parkin is responsible for the pathogenesis of pd. it is not entirely clear why autophagy can exert protective or deleterious effects on pathogenesis of these neurodegenerative diseases. a better understanding of autophagy, mitochondrial dysfunction, and oxidative stress is necessary in order to dissect the pathogenesis of ad, pd, and hd. cancer is considered an age - associated disease, as the incidence of cancer increases exponentially with age. warburg first discovered that cancer cells constitutively metabolize glucose and produce excessive lactic acid even in the presence of abundant oxygen, a phenomenon named aerobic glycolysis. in contrast, normal cells generate energy mainly from oxidative breakdown of pyruvate, which is an end product of glycolysis and is oxidized in mitochondria. conversion of glucose to lactate only takes place in the absence of oxygen (termed pasteur effect) in normal cells. he hypothesized that defect in mitochondrial respiration in tumor cells is the cause of cancer, and cancer should be interpreted as mitochondrial dysfunction. a growing body of evidence has demonstrated the presence of both somatic and germline mutations in mtdna in various types of human cancers [211213 ]. the most direct evidence that mtdna mutations may play an important role in neoplastic transformation comes from the study by introducing a known pathogenic mtdna mutation t8993 the t8993 g mutation derived from a mitochondrial disease patient causes a 70% reduction in atp synthase activity and a significant increase in mitochondrial ros production. tumor growth in the t8993 g mutant cybrids is much faster than that in the wild - type control cybrids. moreover, staining of tumor sections confirms a dramatic increase in ros production in t8993 g mutant tumors, suggesting that mitochondrial dysfunction and ros elevation contribute to tumor progression. consistent with this notion, the sod2 mice exhibit increased oxidative damage and enhanced susceptibility to cancer as compared to wild - type mice. collectively, these studies suggest that mtdna mutations could contribute to cancer progression by increasing mitochondrial oxidative damage and changing cellular energy capacities. genetically engineered mouse models provide great systems to directly dissect the complex relationship between oxidative damage, mitochondrial dysfunction, and aging. although it is difficult to manipulate mitochondrial genome, genetic engineering of nuclear genes that are involved in oxidative stress response and mitochondrial function has been utilized to study mitochondrial biology and aging. mammalian cells scavenge ros to nontoxic forms through a sophisticated antioxidant defense that includes superoxide dismutase (sod), catalase, and glutathione peroxidase. genetic ablation of sod2, which encodes a mitochondrial manganese sod (mnsod), leads to early postnatal death in mice accompanied by a dilated cardiomyopathy, metabolic acidosis, accumulation of lipid in liver and skeletal muscle, increased oxidative damage, and enzymatic abnormalities in mitochondria [216, 217 ]. treatment of sod2 mice with a synthetic sod mimetic not only rescues their mitochondrial defects in the liver, but also dramatically prolongs their survival. furthermore, heterozygous sod2 mice show evidence of decreased membrane potential, inhibition of respiration, and rapid accumulation of mitochondrial oxidative damage. mitochondrial oxidative stress induced by partial loss of sod2 leads to an increase in proton leak, sensitization of the mitochondrial permeability transition pore and premature induction of apoptosis. these studies clearly demonstrate that ros generated in mitochondria play an important role in cell homeostasis and aging. conflicting results of the effect of increased sod2 expression on aging are obtained using different sod2 transgenic mouse strains [220222 ]. a transgenic line carrying a human sod2 transgene under the control of a human -actin promoter shows protection against hyperoxic lung injury, reduction in mitochondrial superoxide in hippocampal neurons, and extended lifespan as the result of increased activity of mnsod. another transgenic line carrying a 13-kb mouse genomic fragment containing sod2 such level of sod2 overexpression does not alter either lifespan or age - related pathology, even though these mice exhibit decreased lipid peroxidation, increased resistance against paraquat - induced oxidative stress, and decreased age - related decline in mitochondrial atp production. the reason behind the different outcomes of these two sod2 transgenic mice on lifespan is not clear, but may be related to different levels of sod2 expression. the precise role of sod2 in aging needs further investigation. an important function of mitochondria is to produce atp. targeting genes involved in atp production offers a great opportunity to study the role of mitochondrial function in aging. an example is a mouse model with targeted inactivation of adenine nucleotide translocator (ant), a transporter protein that imports adp and exports atp from the mitochondria. ant1 mice exhibit classical physiological features of mitochondrial myopathy and hypertrophic cardiomyopathy in human, as evident of cardiac hypertrophy, an increase in succinate dehydrogenase and cytochrome c oxidase activities, a degeneration of the contractile muscle fibers, and a massive proliferation of abnormal mitochondria in skeletal muscle. the increase in mitochondrial abundance and volume in muscle of ant1 mice is accompanied by upregulation of genes that are known to be involved in oxidative phosphorylation. the ant1-deficient mouse model provides strong evidence that a defect in mitochondrial energy metabolism can result in pathological disease. immp2l protein is a subunit of a heterodimer complex of inner mitochondrial membrane peptidase that cleaves signal peptide from precursor or intermediate polypeptides after they reach the inner membrane of mitochondria [227, 228 ]. mammalian immp2l has two known substrates, cytochrome c1 and glycerol phosphate dehydrogenase 2, both of which are involved in superoxide generation. the immp2l mutant mice have impaired processing of signal peptide of cytochrome c1 and glycerol phosphate dehydrogenase 2, and consequently show elevated level of superoxide ion, hyperpolarization of mitochondria, and increased oxidative stress in multiple organs. furthermore, these immp2l mutant mice exhibit multiple aging - related phenotypes, including wasting, sarcopenia, loss of subcutaneous fat, kyphosis, and ataxia. these data provide a strong evidence that mitochondrial dysfunction is a driving force of accelerated aging. many studies have demonstrated that oxidative stress and mitochondrial dysfunction are two important factors contributing to the aging process. the importance of mitochondrial dynamics in aging is illustrated by its association with a growing number of age - associated pathogenesis. a better understanding of response to oxidative stress and mitochondrial dynamics will lead to new therapeutic approaches for the prevention or amelioration of age - associated degenerative diseases. | aging is an intricate phenomenon characterized by progressive decline in physiological functions and increase in mortality that is often accompanied by many pathological diseases. although aging is almost universally conserved among all organisms, the underlying molecular mechanisms of aging remain largely elusive. many theories of aging have been proposed, including the free - radical and mitochondrial theories of aging. both theories speculate that cumulative damage to mitochondria and mitochondrial dna (mtdna) caused by reactive oxygen species (ros) is one of the causes of aging. oxidative damage affects replication and transcription of mtdna and results in a decline in mitochondrial function which in turn leads to enhanced ros production and further damage to mtdna. in this paper, we will present the current understanding of the interplay between ros and mitochondria and will discuss their potential impact on aging and age - related diseases. |
staphylococcus aureus is an important bacterial pathogen that may cause a variety of diseases, ranging from common skin and soft tissue infections to very serious and lethal diseases such as septic shock, toxic shock syndrome or pneumonia (1, 2). although antibiotic therapy is currently used to treat s. aureus infections, the emergence of antibiotic - resistant strains is rapidly exhausting available treatment options (1, 2). to date, resistance of s. aureus strains to methicillin is categorized as one the main causes of hospital infections. furthermore, treatment of methicillin - resistant s. aureus (mrsa) infections often requires longer hospital stays and imposes a tremendous financial burden (3). severe mrsa infections therapy is complicated by the fact that these strains are susceptible to only a few antimicrobials such as vancomycin. unfortunately, in the past decade, vancomycin resistant s. aureus is isolated, highlighting the ability of the bacteria to adapt to the new antibiotics (4, 5). the main resistance mechanism of s. aureus to methicillin is the acquisition of the meca gene and encoding a new transpeptidase enzyme (pbp) that has a reduced tendency to beta lactam antibiotics. since meca gene has high homology among mrsa strains and coagulase negative staphylococcus resistant to methicillin, it is considered as a proper molecular marker to determine methicillin resistance in all staphylococcal species (6, 7). these differences appear to be due to various distribution of this gene at different geographical regions or their identification method. increased spread of meca is the common issue among all these studies, indicating a potential threat that make staphylococcal infections resistant to methicillin and other globally used antibiotics (9). nowadays, phenotypic methods such as disk diffusion and minimum inhibitory concentration (mic), as well as genotypic methods such as pcr are used to diagnose mrsa strains. these methods have some limitations and there is no perfect method to diagnose these strains (10). as mentioned above, since mrsa strains are among the important human pathogens, it is necessary to find a reliable and simple method as an alternative or complementary method to diagnose mrsa strains especially during the prevalence of the strains or performance of a health plan. for instance, sucrose is used by almost 98% of s. aureus strains, producing acid during its fermentation process. the current study assayed the turanose metabolism at different dilutions as a new rapid phenotypic method to identify mrsa isolates. the obtained results indicated a considerable difference between the fermentation of turanose in mrsa and methicillin - sensitive s. aureus (mssa) isolates at 0.7% dilution. therefore, a simple phenotypic test based on the turanose fermentation is suggested as a useful method to diagnose mrsa strains. due to the importance of methicillin - resistant s. aureus (mrsa) infections, the current study aimed to assay the turanose metabolism at different dilutions as a rapid phenotypic method to identify mrsa isolates. samples were collected from tehran medical centers, within three months (october - december 2011). isolation of s. aureus was performed according to the standard microbial and biochemical tests, such as fermentation of mannitol, coagulase test and dnase (merck, kgaa, darmstadt, germany). the disk diffusion method was performed using a disk containing 1 g oxacillin (bbl, sensi disk, usa) to diagnose mrsa isolates (12). this method was performed according to the clinical and laboratory standards institute (clsi) guidelines (13). for this purpose, bacterial suspensions equal to 0.5 mcfarland standard were scattered on agar mueller - hinton medium (merck, kgaa, darmstadt, germany). then, the oxacillin disk was put on the incubated plates and after 24 hours the inhibition zone diameter around the disk was measured. dna extraction of s. aureus isolates was conducted by dna extraction kit (qiagen gmbh, hilden, germany) to identify the presence or absence of meca gene in the s. aureus isolates, the following pairs of primers were used for the amplification (14) : meca f : 5'-tagaaatgactgaacgtccgataa-3 ' meca r : 5'-ccaattccatgtttcggtctaa-3 ' pcr reactions were carried out in a final volume of 50 l containing 2 l of dna template, 5 l of 10x reaction buffer, 2 l of dntps (10 mm), 2 l of mgcl2 (50 mm), 2 l of each primer (10 pmol), and 1u of taq dna polymerase (fermentas ; vilnius, lithuania). the pcr conditions were as follow : an initial denaturation for 5 minutes at 94c, followed by 30 cycles, each consisting of 60 seconds at 94c, 60 seconds at 55c, and 60 seconds at 72c with a final extension step at 72c for 5 minutes. after amplification of meca gene, 10 l of the samples were subjected to electrophoresis on a 1% agarose gel to confirm the presence of the amplified products. five grams of turanose was dissolved in 100 ml of distilled water and sugar with 5% dilution was prepared. to complete tantalization process of the turanose, the mixture was placed in a boiling water bath (80c) for sterilization, for an hour per day on three consecutive days. the prepared 5% dilution of turanose was used to provide 1%, 0.7% and 0.5% dilutions. preparation of microbial suspensions of each s. aureus strain was performed in sterile glass vials and their turbidity was adjusted to 0.5 mcfarland. in triplicate, 150 l of nutrient broth (sugar free) medium containing different turanose dilutions (0.5%, 0.7% and 1%) were inoculated to each well in microplates (greiner, germany) and 150 l of each microbial suspension was added to the microplates. furthermore, medium as well as turanose without microbial suspension were used as a negative control and blank, respectively. the growth of susceptible and resistant isolates to methicillin was assayed in the presence of different dilutions of turanose by measurement of their light absorption with enzyme - linked immunosorbent assay (elisa) reader (awareness technology inc.) at 610 nm. to calculate the average, one - way anova, students t - test and tukey hsd test were used to compare the differences between the mean values of the groups using spss software. samples were collected from tehran medical centers, within three months (october - december 2011). isolation of s. aureus was performed according to the standard microbial and biochemical tests, such as fermentation of mannitol, coagulase test and dnase (merck, kgaa, darmstadt, germany). the disk diffusion method was performed using a disk containing 1 g oxacillin (bbl, sensi disk, usa) to diagnose mrsa isolates (12). this method was performed according to the clinical and laboratory standards institute (clsi) guidelines (13). for this purpose, bacterial suspensions equal to 0.5 mcfarland standard were scattered on agar mueller - hinton medium (merck, kgaa, darmstadt, germany). then, the oxacillin disk was put on the incubated plates and after 24 hours the inhibition zone diameter around the disk was measured. dna extraction of s. aureus isolates was conducted by dna extraction kit (qiagen gmbh, hilden, germany) to identify the presence or absence of meca gene in the s. aureus isolates, the following pairs of primers were used for the amplification (14) : meca f : 5'-tagaaatgactgaacgtccgataa-3 ' meca r : 5'-ccaattccatgtttcggtctaa-3 ' pcr reactions were carried out in a final volume of 50 l containing 2 l of dna template, 5 l of 10x reaction buffer, 2 l of dntps (10 mm), 2 l of mgcl2 (50 mm), 2 l of each primer (10 pmol), and 1u of taq dna polymerase (fermentas ; vilnius, lithuania). the pcr conditions were as follow : an initial denaturation for 5 minutes at 94c, followed by 30 cycles, each consisting of 60 seconds at 94c, 60 seconds at 55c, and 60 seconds at 72c with a final extension step at 72c for 5 minutes. after amplification of meca gene, 10 l of the samples were subjected to electrophoresis on a 1% agarose gel to confirm the presence of the amplified products. five grams of turanose was dissolved in 100 ml of distilled water and sugar with 5% dilution was prepared. to complete tantalization process of the turanose, the mixture was placed in a boiling water bath (80c) for sterilization, for an hour per day on three consecutive days. the prepared 5% dilution of turanose was used to provide 1%, 0.7% and 0.5% dilutions. preparation of microbial suspensions of each s. aureus strain was performed in sterile glass vials and their turbidity was adjusted to 0.5 mcfarland. in triplicate, 150 l of nutrient broth (sugar free) medium containing different turanose dilutions (0.5%, 0.7% and 1%) were inoculated to each well in microplates (greiner, germany) and 150 l of each microbial suspension was added to the microplates. furthermore, medium as well as turanose without microbial suspension were used as a negative control and blank, respectively. the growth of susceptible and resistant isolates to methicillin was assayed in the presence of different dilutions of turanose by measurement of their light absorption with enzyme - linked immunosorbent assay (elisa) reader (awareness technology inc.) at 610 nm. to calculate the average, one - way anova, students t - test and tukey hsd test were used to compare the differences between the mean values of the groups using spss software. out of the 150 staphylococcus isolates, 80 were identified as s. aureus. according to the disk diffusion results, 40 s. aureus isolates electrophoresis of pcr products showed that the length of pcr fragment of the meca gene was approximately 310 bp (figure 1). the growth of mrsa and mssa strains was evaluated in the presence of turanose with 0.5%, 0.7% and 1% dilutions to find significant differences in metabolism of turanose among the strains. the result of turanose metabolism at the dilutions showed significant difference among mrsa and mssa isolates in 0.7% dilution of turanose (p 0.05) (figure 2). the metabolism of turanose was evaluated at (a) 0.7% dilution for mrsa and (b) mssa, (c) 1% dilution for mrsa and (d) mssa, and (e) 0.5% dilution for mrsa and (f) mssa strains. numbers 1 - 40 : the mrsa or mssa strains and number 41 : the negative control. out of the 150 staphylococcus isolates, 80 were identified as s. aureus. according to the disk diffusion results, 40 s. aureus isolates electrophoresis of pcr products showed that the length of pcr fragment of the meca gene was approximately 310 bp (figure 1). the growth of mrsa and mssa strains was evaluated in the presence of turanose with 0.5%, 0.7% and 1% dilutions to find significant differences in metabolism of turanose among the strains. the result of turanose metabolism at the dilutions showed significant difference among mrsa and mssa isolates in 0.7% dilution of turanose (p 0.05) (figure 2). the metabolism of turanose was evaluated at (a) 0.7% dilution for mrsa and (b) mssa, (c) 1% dilution for mrsa and (d) mssa, and (e) 0.5% dilution for mrsa and (f) mssa strains. numbers 1 - 40 : the mrsa or mssa strains and number 41 : the negative control. staphylococcus aureus is one of the major causes of nosocomial and community - acquired infections that results in substantial morbidity and mortality (1, 2). furthermore, due to multi - drug resistance and the ability to acquire resistance to new antibiotics quickly, it is more and more difficult to treat s. aureus infection, especially with the emergence of vancomycin resistant s. aureus (15, 16). after the growth of mrsa at hospitals, these infections gradually go out of hospitals, which worsen their treatment complexity (4). for example, the prevalence of mrsa was reported 2% in switzerland and the netherlands or 80% in china (17). similarly, high prevalence of mrsa was reported in different parts of iran (18, 19). the differences in prevalence of the mrsa strains may be due to long - term antibiotic treatment of patients suffering from severe infections, with long hospitalization and increased selective pressure (20)., meca gene is detected by pcr in most studies to confirm phenotypic tests in mrsa diagnosis (20). in the current study, rodriguez reported that all mrsa strains contain the meca gene, similar to the current study. however, there are reports on the absence of this gene in mrsa strains. in a study, it was shown that 2.25% of mrsa strains lack meca gene (12). this discrepancy may be due to bad quality of the pcr test or genetic mutation. although, genotypic methods such as pcr are in the category of rapid methods to diagnose resistant strains, they are not perfect enough to diagnose resistance. for example, whereas detection of the meca gene is the gold standard of identification of mrsa strains, the required facilities and high costs do not let many laboratories use the method to identify mrsa (21). furthermore, it is documented that some resistant strains have different genetic sequences and the designed primers fail to identify the mrsa strains in pcr reaction. this difference in genetic sequence indicates that the necessary precaution should be noted in the application of genotypic methods to detect mrsa. in addition to being time - consuming and expensive, phenotypic methods such as disk diffusion have difficulties to diagnose resistant strains (22). despite extensive efforts, a diagnostic method identifying all mrsa is currently missing and there is a need to make future diagnostic test evaluations to develop a sensitive, specific and practical method to detect the strains (22). phenotypic diagnostic methods of bacteria are on the basis of quantitative assessment of products obtained from biochemical reactions or metabolism of initial substrates. since biochemical and phenotypic methods completely depend on responsible genes on the bacterial dna, these methods are a kind of indirect assessment of bacterial genetics. although, phenotypic methods are usually simpler than genotypic methods, genotypic methods appear to be necessary in some cases in order to confirm phenotypic findings (9, 10). the current study was designed based on the kinetic assessment of biochemical reactions. some studies showed that genes are responsible for resistance to methicillin make some changes in the walls of gram - positive bacteria and there is a relationship between the wall changes made by resistance genes and metabolism of turanose in mrsa strains (23). thus, the relationship between metabolism of turanose and resistance to methicillin in s. aureus strains was evaluated in the current study. the results showed a significant relationship between the metabolism of turanose at 0.7% dilution and resistance to methicillin in s. aureus strains. by turanose metabolism as a phenotypic test, it was found that a simple diagnosis method can be achieved to identify these strains. therefore, such studies that can lead to find a rapid way to diagnose antibiotic resistance is highly valuable. it is likely to introduce rapid diagnostic kits of these bacteria by analyzing bigger populations of the strains. in conclusion, the current study suggests a new method for rapid and simple diagnosis of mrsa strains at laboratories by measuring the metabolism of turanose. | background : methicillin - resistant staphylococcus aureus (mrsa) is a major pathogen in the hospital and community settings. rapid methods to diagnose s. aureus infections are sought by many researchers worldwide. the current study aimed to utilize a phenotypic method of turanose fermentation to identify methicillin - susceptible and resistant s. aureus.objectives:the current study aimed to assay the turanose metabolism at different dilutions as a rapid phenotypic method to identify mrsa isolates.materials and methods : a total of 150 staphylococcus isolates were collected from tehran health centers. staphylococcus aureus isolates were identified based on cultural characteristics, biochemical reactions and positive tube coagulase test. methicillin resistance was determined by the disk diffusion method. the polymerase chain reaction amplification was used to detect the meca gene in mrsa isolates. all the methicillin - resistant and susceptible isolates were evaluated for turanose metabolism with 1%, 0.7% and 0.5% dilutions using the microplate method.results:out of the 150 staphylococcal isolates, 80 were identified as s. aureus. among which 40 (50%) of the isolates were mrsa. the meca gene was present in all s. aureus isolates resistant to methicillin. a considerable difference was also observed between susceptible and resistant isolates of s. aureus at a 0.7% dilution of turanose.conclusions:since it is highly important to rapidly detect mrsa isolates, especially in nosocomial infections, phenotypic methods may certainly be useful for this purpose. resistance to methicillin in s. aureus shows a substantially increased ability in turanose metabolism. it is concluded that fermentation of turanose at 0.7% dilution could be a rapid detection method for primary screening of mrsa isolates. |
publication ethics is a multidimensional concern that affects numerous groups such as authors, editors, reviewers, researchers, scholars, learned societies and organizations, policy makers, practitioners, clinicians, funders, and many other stakeholders. what is generally expected of scholarly publications is, first and foremost, the provision of a detailed and valid record of research ; and ideally, all editors are required to meet universal standards to achieve the maximum effect within the research community. taking into consideration the principles of the different dimensions of research ethics is, therefore, one of the most important requirements of medical research. one of these dimensions is publication ethics, which has been granted special attention by the iranian ministry of health and medical education in recent years. on preparing scientific manuscripts, ethical aspects of publishing such as authorship criteria, conflict of interest, and internationally accepted ethical principles for research on humans and animals must be taken into account. in addition to the global agreements for publication ethics criteria such as uniform requirements for manuscripts, established by the international committee of medical journal editors, journals need to consider some special criteria in their instructions to authors with respect to their internal rules. to this end, the commission for accreditation and improvement of iranian medical journals and medical journals editors society has spared no effort to enhance the quality of submissions to medical journals in recent years. the aim of the present study was to evaluate the quality of ethical considerations in the instructions to the authors of iranian journals of medical sciences. this study was conducted on all the journals listed in the ranking file of the commission for accreditation and improvement of iranian medical journals (http://www.hbi.ir/nsite/service/special/?level=21) in october 2011. checklist items (n=15) were extracted from the national manual of ethics in medical research publications, which was published by the iranian ministry of health and medical education and its content validity was assessed by a panel of experts. additionally, all the questions were checked for relevancy, clarity, and simplicity. the study focused on the instructions to the authors of iranian journals of medical sciences. journals were excluded if their instructions to authors were not available online or if they contained no instructions to authors. editorial leadership was assessed on the basis of the most current instructions to authors and editorial policy statements. fifteen parameters were scored as mentioned or not mentioned : aim and scope ; editorial freedom ; authorship criteria ; cover letter ; redundant publication ; double submission ; author s responsibility for data accuracy, principles of medical ethics in the use of human samples, principles of medical ethics in the use of animal samples ; conflict of interest ; respect of the privacy policy ; principles of advertising ; integrity in reporting clinical trial results ; copyright ; and review process. in addition, the impact factors, indexing level, and rating of the journals were assessed to determine their quality. all the accredited iranian research scientific journals of medical sciences listed in the ranking file downloaded from the website of the commission for accreditation and improvement of iranian medical journals in october 2011 (n=198) were entered into the study. the anova,, mann - whitney u, kendall correlation coefficient were used to analyze the data. of the 160 journals, 76 (47.5%) were in english and 84 (52.5%) were in farsi. the meanstandard deviation (sd) and the maximum and minimum of the overall score of the publication ethics in the above - mentioned cases were 8.92.88, 14, and 0, respectively. the highest impact factor (1.199), the most frequently mentioned publication ethics items were comprised of redundant publication and double submission (85%, 83.8%), aim and scope (81.9%), principles of medical ethics in the use of human samples principles of advertising (1.2%), authorship criteria (15%), and integrity in reporting clinical trial results (30.6%) accounted for the least mentioned items. distribution of publication ethics items mentioned in the iranian research scientific journals of medical sciences the test was used ; significant difference between english and persian journals (p value<0.05) the items of authorship criteria, cover letter, redundant publication, principles of medical ethics in the use of animal samples, copyright were significantly more frequent in the english language journals, while editorial freedom was an item that was significantly more frequent in the farsi language journals. according to table 2, the overall scores of publication ethics, impact factor, and indexing level in the english language journals were significantly higher than those in the farsi language ones, but their ranking was identical. comparison of the overall scores of publication ethics, ranking, impact factor, and indexing level between the english and farsi journals the mann - whitney u test or the test was used, as appropriate ; significant deference between the english and farsi journals (p value<0.05) there was a significant positive correlation between the overall score of the publication ethics of the journals and their ranking (p<0.001) and impact factor according to the kendall correlation (p=0.02). furthermore, there was a significant difference between the overall score of publication ethics in different levels of indexing using the anova (p<0.001). in this study, we evaluated the quality of publication ethics in the instructions to the authors of iranian journals of medical sciences. as was demonstrated, the most frequently mentioned principles of publication ethics in the instructions to authors were redundant publication (85%), author s responsibility for data accuracy (83.8%), aim and scope (81.9%), principles of medical ethics in the use of human samples (74.4%), review process (74.4%), and copyright (71.2%). the iranian journals of medical sciences, included in the present study, were of high quality in terms of editorial leadership vis - - vis the aforementioned ethical considerations as expressed in their instructions to authors. nevertheless, the editors need to upgrade their instructions to authors regarding principles of advertising (1.2%), authorship criteria (15%), integrity in reporting clinical trial results (30.6%), conflict of interest (53.8%), and principles of medical ethics in the use of animal samples (65.6%). one of the most frequently mentioned ethical considerations was redundant publication, which was significantly of a higher frequency in the english language journals than in their farsi language counterparts (p<0.01). kim. in korea, showed that 5.93% of the index articles were associated with 29 duplicate articles, which exceeded expectations. one way to overcome such a problem is to augment instructions to authors of journals. in a similar vein, a study by kitagawa, in japan suggested that raising awareness about duplication publication among researchers requires the understanding of publication ethics. conflict of interest was another item of publication ethics assessed in the present study. about half (53.8%) of the iranian journals demanded that authors declare conflict of interest in their research. the item was more frequently mentioned in the english language journals than in the farsi language ones (p<0.001). alfonso. in spain, reported that less than half of the journals included in their assessment had a specific policy on conflict of interest as one of the principles of publication ethics. in the present study, one of the principles of publication ethics least mentioned in the instructions to authors was authorship criteria (15%) ; the english language journals were, however, significantly more directive on this item than were the farsi language ones (p<0.001). our findings were consistent with those of the study by sakaran. in india, indicating that editors must upgrade their instructions to authors through the inclusion of ethical requirements, particularly a study in iran on the views of the editors of iranian medical journals reported that most of the editors were not familiar with the standard be that as it may, journals still need to urge consideration of authorship criteria further. accordingly, the aim and scope of most of our journals tend to be general and the editors are liable to draw upon national standards for publication ethics, whereas most journals in developed countries work on specific fields professionally and follow international guidelines such as those specified by the committee on publication ethics (cope, www.publicationethics.org.uk) and international committee of medical journal editors (icmje, www.icmje.org). to obtain more information about publication ethics in journals, further studies based on the cope guidelines are required to check the publications against the international standards such as the icmje. in the present study, there was a correlation between the rankings of the journals and publication ethics specified in the instructions to authors. as a result, adherence to publication ethics in journals seems to be of vital importance if the quality of the journals is to be enhanced. quality improvement requires editors to be familiar with the international guidelines of publication ethics (cope and icmje). | providing a perfect instruction to authors can prevent most potential publication ethics errors. this study was conducted to determine the quality of ethical considerations in the instructions to the authors of iranian research scientific journals of medical sciences (accredited by the commission for accreditation and improvement of iranian medical journals) in october 2011. checklist items (n=15) were extracted from the national manual of ethics in medical research publications, and the validity of the manual of ethics was assessed. all the accredited iranian journals of medical sciences (n=198) were entered into the study. the instructions to the authors of 160 accredited iranian journals were available online and were reviewed. the anova and kendall correlation coefficient were performed to analyze the results. a total of 76 (47.5%) of the 160 journals were in english and 84 (52.5%) were in farsi. the most frequently mentioned items related to publication ethics comprised commitment not to send manuscripts to other journals and re - publish manuscripts (85%, 83.8%), aim and scope of the journal (81.9%), principles of medical ethics in the use of human samples (74.4%), and review process (74.4%). on the other hand, the items of principles of advertising (1.2%), authorship criteria (15%), and integrity in publication of clinical trial results (30.6%) were the least frequently mentioned ones. based on the study findings, the quality of publication ethics, as instructed to the authors, can improve the quality of the journals. |
we conducted a single - center, open - label, randomized clinical trial to evaluate the progression of -cell dysfunction over 3.5 years in patients with treatment - nave newly diagnosed type 2 diabetes. all patients were treated for 3 months with insulin and metformin and then randomly assigned to treatment with either insulin plus metformin (ins group) or triple oral therapy (tot group) with metformin, pioglitazone, and glyburide. the results of the first 3-month run - in period were published previously (14) as were results of the glycemic control, adverse effects, and quality of life up to 36 months (15). patients aged 2170 years with treatment - nave type 2 diabetes diagnosed within the previous 2 months were recruited from parkland hospital and the clinical diabetes research center at the university of texas southwestern medical center at dallas (utsw). exclusion criteria included type 1 diabetes related antibodies, baseline hba1c level 1.5 mg / dl in male and > 1.4 mg / dl in female subjects), liver enzymes higher than two times the upper limit of normal, severe coronary artery disease (myocardial infarction within the past 6 months or active angina), heart failure stages iii iv, pregnancy or lack of approved contraception, untreated proliferative diabetic retinopathy, any life - threatening conditions, use of more than two alcoholic drinks per day, or illicit drug use within the 6 months before enrollment. the study was approved by the institutional review board at utsw, and written informed consent was obtained from all subjects preceding the start of the study. following enrollment, insulin and metformin were initiated in all patients for a 3-month lead - in treatment period to enable everyone to attain similar glycemic control prior to randomization. this also removed any preexisting glucotoxicity and associated temporary -cell stunning that might have been present in different degrees at the time of diagnosis. novolog mix 70/30 by flexpen and metformin were initiated and titrated based on a previously published algorithm (14). all patients received diabetes education and nutritional and lifestyle counseling at enrollment with reinforcement throughout the study. after 3 months of treatment, patients were randomly assigned to either continue insulin and metformin or begin triple oral therapy. randomization strata were race (african american or non african american) and bmi (cutoff 35 kg / m), chosen to minimize possible baseline characteristic confounders on -cell function. the participants were enrolled and assigned (by i.l.) to interventions according to the randomization schema generated by the study statistician (b.a.- h.). patients randomly assigned to the tot group discontinued insulin, continued metformin 1 g twice daily (or maximum tolerated dose), and started 1.25 mg glyburide twice daily and 15 mg daily pioglitazone. titration of insulin and glyburide (up to the highest clinically effective dose of 10 mg daily) was performed by the study physician throughout the study, based on home blood glucose monitoring logs to attain a fasting blood glucose level of 70110 mg / dl and postprandial blood glucose level of 8% confirmed by a second reading and occurring after maximization of the glyburide dose or adequate insulin dose titration. volunteers randomly assigned to the tot group who reached this end point were transitioned to insulin and metformin treatment, whereas those randomly assigned to insulin continued with the same treatment. evaluation of -cell response was performed at 0, 6, 12, 18, 30, and 42 months postrandomization. patients fasted the evening before, and antidiabetes treatment was withheld for 24 h prior to testing. a mixed - meal challenge test (mmct) was performed using high - protein boost 1 g / kg carbohydrate equivalent (or maximum of 90 g, equivalent to 480 cc) ingested over 5 min. glucose and c - peptide were collected at 0, 15, 30, 60, 90, 120, 150, and 180 min from the time of ingestion. -cell function was assessed using calculated c - peptide area under the curve (aucc) and glucose auc (aucg). initial insulin release was calculated as c030 and c030/g030, and maximal insulin production was calculated as c0-max and c0-max / g0-max. the incremental aucc (iaucc) and incremental aucg (iaucg) were calculated as the auc above baseline (fasting) values. c - peptide was measured using radioimmunoassay (millipore), hba1c by high - performance liquid chromatography, and glucose with yellow springs instrument in the clinical diabetes laboratory at utsw. the laboratory is accredited by the national glycohemoglobin standardization program. patients were instructed to return their unused medications at every visit for inventory and estimation of patient compliance. mild hypoglycemic episodes were defined as symptoms indicative of low blood glucose accompanied by a documented capillary blood glucose value of 1.5 mg / dl in male and > 1.4 mg / dl in female subjects), liver enzymes higher than two times the upper limit of normal, severe coronary artery disease (myocardial infarction within the past 6 months or active angina), heart failure stages iii iv, pregnancy or lack of approved contraception, untreated proliferative diabetic retinopathy, any life - threatening conditions, use of more than two alcoholic drinks per day, or illicit drug use within the 6 months before enrollment. the study was approved by the institutional review board at utsw, and written informed consent was obtained from all subjects preceding the start of the study. following enrollment, insulin and metformin were initiated in all patients for a 3-month lead - in treatment period to enable everyone to attain similar glycemic control prior to randomization. this also removed any preexisting glucotoxicity and associated temporary -cell stunning that might have been present in different degrees at the time of diagnosis. novolog mix 70/30 by flexpen and metformin were initiated and titrated based on a previously published algorithm (14). all patients received diabetes education and nutritional and lifestyle counseling at enrollment with reinforcement throughout the study. after 3 months of treatment, patients were randomly assigned to either continue insulin and metformin or begin triple oral therapy. randomization strata were race (african american or non african american) and bmi (cutoff 35 kg / m), chosen to minimize possible baseline characteristic confounders on -cell function. the participants were enrolled and assigned (by i.l.) to interventions according to the randomization schema generated by the study statistician (b.a.- h.). patients randomly assigned to the tot group discontinued insulin, continued metformin 1 g twice daily (or maximum tolerated dose), and started 1.25 mg glyburide twice daily and 15 mg daily pioglitazone. titration of insulin and glyburide (up to the highest clinically effective dose of 10 mg daily) was performed by the study physician throughout the study, based on home blood glucose monitoring logs to attain a fasting blood glucose level of 70110 mg / dl and postprandial blood glucose level of 8% confirmed by a second reading and occurring after maximization of the glyburide dose or adequate insulin dose titration. volunteers randomly assigned to the tot group who reached this end point were transitioned to insulin and metformin treatment, whereas those randomly assigned to insulin continued with the same treatment. evaluation of -cell response was performed at 0, 6, 12, 18, 30, and 42 months postrandomization. patients fasted the evening before, and antidiabetes treatment was withheld for 24 h prior to testing. a mixed - meal challenge test (mmct) was performed using high - protein boost 1 g / kg carbohydrate equivalent (or maximum of 90 g, equivalent to 480 cc) ingested over 5 min. glucose and c - peptide were collected at 0, 15, 30, 60, 90, 120, 150, and 180 min from the time of ingestion. -cell function was assessed using calculated c - peptide area under the curve (aucc) and glucose auc (aucg). initial insulin release was calculated as c030 and c030/g030, and maximal insulin production was calculated as c0-max and c0-max / g0-max. the incremental aucc (iaucc) and incremental aucg (iaucg) were calculated as the auc above baseline (fasting) values. c - peptide was measured using radioimmunoassay (millipore), hba1c by high - performance liquid chromatography, and glucose with yellow springs instrument in the clinical diabetes laboratory at utsw. the laboratory is accredited by the national glycohemoglobin standardization program. patients were instructed to return their unused medications at every visit for inventory and estimation of patient compliance. mild hypoglycemic episodes were defined as symptoms indicative of low blood glucose accompanied by a documented capillary blood glucose value of < 70 mg / dl. severe hypoglycemia was defined as symptoms of hypoglycemia that required assistance from another individual for treatment, regardless of capillary blood glucose level. the sample size was estimated to detect differences between the ins and tot groups in aucc of 240 ng / ml / min, with an estimated sd of 225 ng / ml / min (16). to detect this effect size, completion of 20 patients in each group was needed for power of 90% at = 0.05. the intention - to - treat analysis is reported (unless otherwise stated), which included all subjects according to their randomization treatment assignment, including those who reached the predefined treatment failure end point and were switched from the tot to ins group. biochemical measurements and auc responses were assessed with mixed - model repeated - measures analysis. the repeated - measures models consisted of a treatment group factor, study time (month) factor, and interaction between group and time, with subject modeled as a random effect. auc responses and hypoglycemic event rates were log or rank transformed, respectively, prior to analysis. statistical analysis was performed with sas version 9.2 (sas institute, cary, nc). sixty - three patients were recruited from november 2003 to june 2005, and 58 completed the 3-month run - in period (29 were randomly assigned to continue insulin plus metformin and 29 were changed to triple oral therapy (fig. completion rates at 3.5 years in the study were 24 of 29 (83%) in the ins group and 21 of 29 (72%) in the tot group. treatment failure occurred in three (10.3%) patients in the ins group and five (17.2%) patients in the tot group (p = 0.33). baseline and end of study (42-month) data results of all the calculated -cell function indices are shown in table 1. there was no significant change over time in -cell function between or within groups, as calculated by aucg, aucc, and aucc / aucg (fig. there also was no significant change over time or between groups in the following : iaucc, iaucc / iaucg (fig. 2d and f), baseline - maximum or baseline30 min c - peptide or c - peptide/glucose. there was a significant over - time decrease in iaucg (p < 0.001) in the tot group when compared with the ins group, which had no significant change (p = 0.009 group - by - time interaction) (fig. likewise, the baseline30 min and baseline - maximum glucose (p = 0.004) were significantly reduced over time in the tot but not the ins group (p = 0.002 and p = 0.03, respectively, group - by - time interaction). these findings suggest an overall postprandial glycemic benefit of triple oral therapy, yet the two groups had very similar glycemic control and -cell function. hba1c was substantially improved in both groups during the 3-month lead - in period (from 10.8 2.6% to 5.9 0.5%) (14). at 3.5 years after randomization hba1c was 6.35 0.84% ins versus 6.59 1.94% tot (p = 0.54 group by time interaction), and 19/24 (79%) in ins and 17/21 (81%) in tot met ada guidelines of hba1c < 7%. the average insulin dose at the time of randomization was 0.63 0.29 units / kg / day while after 42 months it increased to 0.82 weight increased in both groups over time (from 102.2 24.9 to 106.2 31.7 kg in the ins group and from 100.9 23.0 to 110.5 31.8 kg in the tot group), with no significant difference between groups (p = 0.35) (fig. b : mild hypoglycemic episodes, defined as any symptoms associated with a capillary glucose level of < 70 mg / dl. there was a low rate of mild hypoglycemia overall, defined conservatively as any symptoms with a glucose reading < 70 mg / dl. mild hypoglycemia decreased significantly over time (p = 0.01) but did not differ significantly between groups (p = 0.5). both groups had on average 1.3 1.5 events in the month after randomization, but this fell rapidly and leveled off by month 9. at the end of the study, there were 0.5 0.8 events per month in the ins group and 0.4 0.5 events per month in the tot group (fig. the proportion of patients having any hypoglycemic events remained stable throughout the study (48.5% in the ins group and 52.9% in the tot group), but the number of events per person decreased over time. two participants in the ins group had three events of severe hypoglycemia (all within the first month postrandomization), whereas four participants in the tot group had six such events (four in the first 2 months postrandomization). compliance with all medications at 3.5 years was 87 20% in the ins group and 90 15% in the tot group. there was no significant change over time in -cell function between or within groups, as calculated by aucg, aucc, and aucc / aucg (fig. there also was no significant change over time or between groups in the following : iaucc, iaucc / iaucg (fig. 2d and f), baseline - maximum or baseline30 min c - peptide or c - peptide/glucose. there was a significant over - time decrease in iaucg (p < 0.001) in the tot group when compared with the ins group, which had no significant change (p = 0.009 group - by - time interaction) (fig. likewise, the baseline30 min and baseline - maximum glucose (p = 0.004) were significantly reduced over time in the tot but not the ins group (p = 0.002 and p = 0.03, respectively, group - by - time interaction). these findings suggest an overall postprandial glycemic benefit of triple oral therapy, yet the two groups had very similar glycemic control and -cell function. hba1c was substantially improved in both groups during the 3-month lead - in period (from 10.8 2.6% to 5.9 0.5%) (14). at 3.5 years after randomization hba1c was 6.35 0.84% ins versus 6.59 1.94% tot (p = 0.54 group by time interaction), and 19/24 (79%) in ins and 17/21 (81%) in tot met ada guidelines of hba1c < 7%. the average insulin dose at the time of randomization was 0.63 0.29 units / kg / day while after 42 months it increased to 0.82 weight increased in both groups over time (from 102.2 24.9 to 106.2 31.7 kg in the ins group and from 100.9 23.0 to 110.5 31.8 kg in the tot group), with no significant difference between groups (p = 0.35) (fig. b : mild hypoglycemic episodes, defined as any symptoms associated with a capillary glucose level of < 70 mg / dl. there was a low rate of mild hypoglycemia overall, defined conservatively as any symptoms with a glucose reading < 70 mg / dl. mild hypoglycemia decreased significantly over time (p = 0.01) but did not differ significantly between groups (p = 0.5). both groups had on average 1.3 1.5 events in the month after randomization, but this fell rapidly and leveled off by month 9. at the end of the study, there were 0.5 0.8 events per month in the ins group and 0.4 0.5 events per month in the tot group (fig. 3b). of interest, the proportion of patients having any hypoglycemic events remained stable throughout the study (48.5% in the ins group and 52.9% in the tot group), but the number of events per person decreased over time. two participants in the ins group had three events of severe hypoglycemia (all within the first month postrandomization), whereas four participants in the tot group had six such events (four in the first 2 months postrandomization). compliance with all medications at 3.5 years was 87 20% in the ins group and 90 15% in the tot group. our data show that -cell function can be preserved for at least 3.5 years after diagnosis of type 2 diabetes when intensive therapy is initiated early in the disease process. this was true regardless of the method used to attain intensive control (insulin - based regimen or a triple combination of oral agents, both after an initial 3-month insulin treatment period). both treatments led to excellent glycemic control, were well tolerated, safe, and had good compliance. this confirms previous studies that showed -cell preservation with short - term intensive insulin therapy or oral monotherapy, but most importantly our study shows that an insulin - based regimen or a combination of oral hypoglycemic agents has the potential to change the course of the disease for a more meaningful period of time. chen. (12) performed a similar study in which 50 patients with newly diagnosed type 2 diabetes were treated in - house with intensive insulin therapy for 1014 days and then randomly assigned to continue insulin therapy (nph only) or change to a single oral medication (metformin or a sulfonylurea based on bmi) for 6 months. the oral drugs were titrated up at clinic visits (every 24 weeks), and after maximum titration the other drug was added. the study showed that hba1c was significantly higher in the oral treatment group at 6 months postrandomization (7.5 1.5 vs. 6.33 0.70%). both groups had improved -cell function using oral glucose tolerance testing, but significantly more improvement was seen in the insulin therapy group. unfortunately, the study only analyzed -cell function in patients with hba1c < 7% (~90% of the insulin group and 45% of the oral group), which likely excluded patients in whom -cell function actually declined below baseline, especially in the oral group. our study showed comparable improvement in glycemic control and -cell function in both treatment groups. this difference in results could be attributed to initial shorter treatment with insulin at diagnosis (1014 days vs. 3 months), possibly inducing less recovery of stunned -cells (17), or the stepwise treatment strategy used in the oral group. nph insulin was titrated up every 3 days based on fasting blood glucose readings, whereas the oral agent was only titrated up or an additional pill added at office visits. this approach illustrates the pitfalls of the currently advocated stepwise titration strategy of oral medications leading to less and slower improvement in hyperglycemia and -cell recovery. the adopt trial randomly assigned recently diagnosed (<3 years) treatment - nave patients with diabetes (baseline hba1c 7.36 0.93%) to monotherapy with either metformin, glyburide, or rosiglitazone for a median of 4 years (13). although glycemic control improved within the first 6 months, hba1c increased over the next 3.5 years, and at 4 years only 40% of rosiglitazone, 36% of metformin, and 26% of glyburide groups had hba1c < 7%. this correlated with -cell function (assessed by homeostasis model assessment), which also increased in all groups at 6 months but then declined steadily over the remainder of the study, with a greater fall in the group with the highest failure rate (6.1% annual decline in glyburide) and lowest in the group with the lowest failure rate (2% annual decline in rosiglitazone). these results further demonstrate the lack of durability (conferred by -cell function stabilization or improvement) of single - drug therapy even when initial glycemic control is not far from goal. of note, rosiglitazone, a peroxisome proliferator thiazolidinediones confer a protective effect on -cells through multiple mechanisms, as they 1) improve insulin sensitivity, leading to reduced glucotoxicity ; 2) increase insulin - sensitive adipocytes promoting fatty acid uptake and storage, leading to reduced lipotoxicity (18) ; and 3) directly prevent -cell apoptosis and increase proliferation in animal models (19). they have been shown to improve -cell function in several clinical trials (2022) and may have been a pivotal component in the tot group in our study. yet it is clear that not even thiazolidinedione monotherapy is sufficient to alter the natural course of the disease, and a multidrug approach is most appropriate. our study was 42 months but involved frequent clinic visits (every 3 months) with intensive medication titration, plenty of encouragement, and regular compliance checks. this should not hinder applicability to outpatient clinical treatment as it is well known that type 2 diabetes is a progressive disease and does require frequent medication titration and a multidisciplinary approach with frequent visits. we also acknowledge that the 3.5 year follow - up in this study, although a lot longer than any previous intervention that achieved -cell stabilization, is still short when the life - long burden of diabetes is considered. we are continuing to follow - up our study volunteers to assess whether these results persist. we assessed -cell function using oral mixed - meal testing, which gives a more comprehensive assessment of -cell function, taking into account intestinal incretin hormone interactions. in addition, we measured c - peptide to avoid the drawbacks of using insulin concentration : 1) insulin measurement is not simply a function of pancreatic secretion but also depends on clearance, 2) insulin antibodies can develop and interfere with measurement, and 3) the insulin assays can cross - react with the exogenous insulin patients were receiving. given the design of the study, we are unable to differentiate whether the -cell preservation effect was attributed to the initial insulin - based therapy that all patients received in the run - in phase or attributed to ongoing therapy received after randomization. several studies have shown that short - term insulin treatment in patients with newly diagnosed type 2 diabetes can lead to rapid improvement in -cell function (811) and even -cell preservation up to 1 year (10,11). although we have certainly noted a very rapid and impressive improvement in glycemia with this initial insulin treatment (14), we believe that in the absence of continuous intensive therapy this would not have been sustained. conversely, we believe that the results of the study might have been quite different in the absence of the run - in period, where all patients were treated with an insulin - based regimen. this study was designed to compare the progression of -cell dysfunction in patients treated with intensive insulin - based therapy versus intensive oral therapy and had no control group receiving stepwise initiation of either therapy. however, we believe there is well - established evidence that there is progressive loss of -cell function in patients with type 2 diabetes treated in this manner this certainly limited our power to detect a between - group as well as an over - time difference in the primary outcome. nevertheless aucc seems to have slightly increased overtime, especially in the ins group (fig. 2c) ; therefore, our conclusions are conservative and well supported by the data. the population in our trial is representative of minorities (43% african american and 38% hispanic), mostly recruited from the county hospital system. this lends additional strength to these findings, as these therapeutic interventions were successfully administered and results attained in a patient population most challenging to treat. our study shows that it is possible to preserve -cell function long after the initial diagnosis of type 2 diabetes if therapy is initiated in a timely and intensive manner. instead of starting with diet and/or monotherapy followed by stepwise treatment escalation when failure is achieved, patients should be treated with an initial period of intensive insulin therapy to maximize -cell recovery and then either continued on an insulin - based regimen or switched to multiple hypoglycemic medications with complementary mechanisms of action. either of these strategies will stabilize -cell function and maintain excellent long - term glucose control, a desirable disease - modifying effect. in addition, this can be achieved safely, and we have previously shown (15) that both treatment strategies have high patient satisfaction ratings with improved quality of life. in conclusion, intensive insulin therapy at the time of diagnosis of type 2 diabetes followed by either an insulin - based regimen or multiple oral hypoglycemic agents preserves both glycemic control and -cell function for at least 3.5 years with no significant difference in the adverse - effect profile. | objectiveto assess -cell function preservation after 3.5 years of intensive therapy with insulin plus metformin (ins group) versus triple oral therapy (tot group) with metformin, glyburide, and pioglitazone.research design and methodsthis was a randomized trial of 58 patients with treatment - nave newly diagnosed type 2 diabetes. all patients were treated with insulin and metformin for a 3-month lead - in period followed by random assignment to the ins or tot group. -cell function was assessed using a mixed - meal challenge test at randomization and 6, 12, 18, 30, and 42 months. analyses were intention to treat and performed with repeated - measures models.resultscompletion rates at 3.5 years were 83% in the insulin group and 72% in the tot group, with good compliance in both groups (87 20% in the ins group vs. 90 15% in the tot group). -cell function was preserved at 3.5 years after diagnosis, with no significant change from baseline or difference between the two groups as measured by area under the curve (auc) of c - peptide (p = 0.14) or the ratio of c - peptide to glucose auc (p = 0.7). excellent glycemic control was maintained in both groups (end - of - study hba1c 6.35 0.84% in the ins group vs. 6.59 1.94% in the tot group). weight increased in both groups over time (from 102.2 24.9 kg to 106.2 31.7 kg in the ins group and from 100.9 23.0 kg to 110.5 31.8 kg in the tot group), with no significant difference between groups (p = 0.35). hypoglycemic events decreased significantly over time (p = 0.01) but did not differ between groups (p = 0.83).conclusions-cell function can be preserved for at least 3.5 years with early and intensive therapy for type 2 diabetes with either insulin plus metformin or triple oral therapy after an initial 3-month insulin - based treatment period. |
fusion and gemination are the terms used to describe joint and double formation of teeth. fusion is generally regarded as a union of two or more hard tissues of two or more teeth, and the number of teeth in the affected arch is usually less than one. however, definitive diagnosis is difficult, because a normal tooth can fuse with a supernumerary tooth or a tooth may be congenitally missing. if it occurs early enough in embryonic development, the result may be a tooth of normal or slightly larger than normal size. if it occurs late in the development, the result is the more classic example seen clinically, resulting in hypodontia of that dental arch and the presence of a large tooth, anomalous in form. dejonge proposed the term synodontia to describe adjacent teeth that combine during development. however, its distribution according to gender, race, and location are conflicting in literature. gemination, according to mcdonald is the attempted division of single tooth germ by invagination during the growth cycle. there is usually a normal number of teeth in the arch and a radiograph shows one root and one pulp space with two partially or totally separated crowns. kelly suggested that in gemination the two halves of the joined crowns are usually mirror images, in contrast to fusion, which manifests with a distinct difference in the two halves of the crown. some believe that this alteration occurs as a result of physical forces that put developing teeth in contact, thus producing necrosis of the epithelial tissue that separates them, leading to fusion. thalidomide embryopathy may include dental fusion and knudsen has produced the anomaly in animals treated with trypan blue and high doses of vitamin a. the incidence of dental developmental disorders is variable. kelly statistics, bilateral fusion is less common in permanent dentition than in the primary dentition. also bilateral fusion in permanent dentition is found more frequently in the maxilla than in the mandible. furthermore, 100% of the permanent bilateral fusion cases seen in the maxilla involve central incisors and 83% of them involve supernumerary teeth. the prevalence of connated teeth in permanent dentition is 0.2% and in primary it ranges from 0.4 to 0.9%. the prevalence of unilateral double teeth is 0.5% in the primary dentition and 0.1% in the permanent dentition. the meta - statistic for the prevalence of bilateral double teeth is 0.02% in both primary and permanent dentition. talon cusp is also an uncommon dental anomaly in which an accessory cusp - like structure projects from the cingulum area or cementoenamel junction of the maxillary or mandibular anterior teeth into both primary and permanent dentitions. this anomalous structure is composed of normal enamel and dentin and either has varying extensions of pulp tissue inside it or is devoid of a pulp horn. talon cusp is a rare dental anomaly, especially when it occurs on mandibular teeth. the permanent dentition is more often affected than the primary dentition ; the maxillary incisors being the most frequently involved teeth. the etiology of the talon cusp remains unknown, but it seems to have both genetic and environmental components. it is believed that the talon cusp originates during the morphodifferentiation stage of tooth development, where it may occur as a result of the outward folding of the inner enamel epithelial cells, and transient focal hyperplasia of the peripheral cells of the mesenchymal dental papilla. talon cusp on a fused tooth is a very rare occurrence and only few cases have been reported to date. in recent times, jeevarathan., in 2005, presented a rare case of a facial and palatal talon cusp on the primary maxillary right lateral incisor of a five - year - old girl with bilateral cleft lip. danesh., in 2007, also reported a case of fused maxillary central incisor with dens evaginatus as a talon cusp in which orthodontic treatment involving cusp reduction was done because of forced bite. ekambaram., in 2008, also described a rare case report of fusion of the mandibular permanent incisors with labial and lingual talon cusp. this case report presents a rare combination of two different developmental anomalies, with different mechanisms of formation occurring in one dentition, that is, bilateral mandibular fusion accompanied by talon cusp in the permanent dentition. the main aim is to widen the arena of knowledge of the readers and make them aware that such a combination is a possibility. moreover, these cases may pose treatment problems whenever they interfere with occlusion, speech, or cause trauma to the tongue or become carious, which needs wise judgment and management by the clinician. a 9-year - old boy reported to the department of pedodontics and preventive dentistry, bapuji dental college and hospital, for routine dental check up. there was no reported history of orofacial trauma or disturbances during the teething period. informed consent was procured from the parents of the patient before any findings were reported. on examination complete fusion of the right mandibular central and lateral incisors and incomplete fusion of the left mandibular central and lateral incisors was seen [figure 1 ]. also, a talon 's cusp was noted on the lingual side of the incompletely fused teeth [figure 2 ]. the diagnosis of fusion rather than gemination, on the right side, was based on the fact that there were two teeth lesser than the normal complement when the double teeth were counted as one. radiographic examination [figures 3 and 4 ] revealed that the completely fused tooth had two pulp chambers, but a single root canal. the incompletely fused teeth (joined by enamel and dentin) had two separate roots with one root having a normal pulp chamber and a canal, while the other root was devoid of the pulp chamber as well as root canal. all other treatment was completed including extraction of the grossly decayed second primary molar followed by placement of a space maintainer. complete fusion of right and incomplete fusion of the left side mandibular central and lateral incisors panoramic radiograph showing a full set of permanent teeth except for the apparent absence of two mandibular incisors intraoral periapical and occlusal radiographs. note, completely fused teeth have two pulp chambers, but a single root canal, and incompletely fused teeth have two separate roots with one root having a normal pulp chamber and canal, while the other root is devoid of a pulp chamber as well as a root canal although literature on gemination and fusion is extensive, there is still much debate on the nomenclature. some authors have tried to differentiate them by counting the number of teeth or by observing the root morphology. while some use fusion and gemination as synonyms. some authors call it as double teeth or connated teeth to avoid the confusion. the case presented could be considered as showing typical clinical characteristics of fusion between each central and lateral incisor because there were less number of teeth in the lower arch. bilateral agenesis of central / lateral incisors with fusion / gemination of each incisor to a supernumerary contiguous tooth could be a confounding factor leading to the diagnosis of gemination. clinical and radiographic examination showed the right side fused tooth had a complete developmental groove between two halves, while the left side tooth showed a complete fusion of the crowns, but had two separate roots, one with the pulp chamber and root canal and the other one devoid of both the pulp chamber and the root canal. this evidence indicates that fusion in the left side occurred later than the fusion on the right tooth. another uniqueness of this case report is the presence of talon 's cusp on the lingual side of the incompletely fused (left) tooth. there are no specific criteria describing the talon cusp, which is a type of developmental dental anomaly. the tubercle that has a different shape and dimension is often named as cingulum hypertrophy. mader suggests that the term talon cusp should only be used to describe anomalous cusps of permanent incisors that project prominently from the lingual surface of the tooth, are morphologically well - delineated, and extend at least half - way from the cementoenamel junction to the incisal edge. however, davis reported that when the tubercle is deviated, it is not always necessary to reach the midline, because the tubercle makes a slope to the mesial. although the lateral incisors are the most frequently affected teeth in the permanent dentition, in the present case, the tubercle localized on the lingual surface of the mandibular left fused tooth, which was considered as a talon cusp, according to mader 's classification. even though mesiodens, microdontia, dens evaginatus on posterior teeth, shovel - shaped incisors, dens invaginatus, or carabelli tubercule overgrowth have been reported with talon 's cusp, cases of talon 's cusp associated with fusion are very rare. the developmental concerns relating to bilateral fusion are the same as those of unilateral occurrences. double teeth may lead to serious problems relating to esthetics and malocclusion, especially when involving supernumerary elements or with the presence of carious lesions along the grooves dividing each crown. therefore, the dental treatment involved only measures intending to prevent dental plaque accumulation in the risk areas, along with topical fluoride application (with apf gel) and regular follow - up of the patient, every three months. if a clinician faces any problems like malocclusion, esthetics, speech problems, or caries, associated with the fused teeth, a proper endodontic treatment should be given with obturation of the involved teeth followed by their separation and shaping out in required forms. if any occlusal interferences are encountered the teeth can be ground in two to three appointments, with an appropriate time period of around six to eight weeks between the two visits. | whenever nature diverts from the normal or usual it gives rise to something called abnormal or unusual, which we call a disorder. fusion of two teeth is a common developmental disorder that is seen by a clinician. however, bilateral fusion along with talon 's cusp is very rarely seen and reported in literature. this article describes a rare case of the bilateral fusion of permanent mandibular central and lateral incisors, along with presence of talon 's cusp on the left fused teeth. |
hemorrhage and perforation are the most common complications after colonoscopy occurring in less than 1% of patients and often associated with biopsy or polypectomy. splenic injury or rupture is also an infrequent complication that is often forgotten and may require urgent surgical intervention. the first case of splenic trauma after colonoscopy was described by wherry and zehner in 1974, but the true incidence of this dreadful complication is probably underestimated. there are 39 case reports in the english literature and at least 9 more in foreign publications (table 1). we report a similar case of splenic rupture diagnosed 18 hours after colonoscopy, which required emergent splenectomy. presentation, diagnosis, treatment, and potential risk factors are evaluated herein, as is a thorough review of the literature. summary of 42 cases of splenic injury after colonoscopy details were not provided in some cases. ct = computed tomography ; us = ultrasound ; acls = advanced cardiac life support. an 82-year - old woman was admitted to the hospital for mild congestive heart failure and pneumonia. her past history was significant for myocardial infarction and a left nephrectomy for transitional cell carcinoma via a left flank incision. after a week of intravenous antibiotics for left lower lobe pneumonia and bacteremia, she began having diarrhea. tests for clostridium difficile were negative, and the patient was diagnosed with antibiotic - associated diarrhea. during this period, her diarrhea became blood tinged, and her hemoglobin dropped by 3 g / dl. no acute origin of bleeding was identified, and findings included severe diverticulosis in the left colon and internal hemorrhoids. the postprocedure period was complicated by the onset of left upper quadrant abdominal pain accompanied by hypotension. laboratory tests revealed an acute drop in hemoglobin from 9.6 g / dl to 6.8 g / dl. the patient was transfused appropriately, and a computed tomographic scan (ct) of the abdomen and pelvis was ordered. the ct confirmed a large left upper quadrant hematoma, consistent with a splenic rupture and associated hemoperitoneum. the patient had persistent hypotension and acute anemia and therefore was taken to surgery for exploration. a midline laparotomy was performed, and a large amount of intraabdominal blood was encountered from the left upper quadrant. a moderate number of adhesions were present at the splenic flexure associated with a large splenic capsular tear. splenic injury after colonoscopy is a serious complication, yet its true incidence is unknown. numerous large series over the last 3 decades have demonstrated splenic trauma as a rare entity. reluctance to publish morbidity information, the absence of complication codes for splenic injury after colonoscopy, and the fact that the procedure is infrequently followed by routine surgical exploration all contribute to its unknown incidence. despite this uncommon complication, knowledge of this serious consequence is the best aide to early diagnosis because outcomes can be fatal. the cause of splenic complications after colonoscopy have not definitively been established, yet many risk factors have been proposed (table 2). the most common theory involves tension of the splenocolic ligament from either excessive manipulative traction or decreased mobility of the spleen or colon from adhesions. specific maneuvers like the slide by advancement, alpha maneuver, hooking the flexure, and straightening the sigmoid loop have all been implicated in excessive traction and splenic capsule avulsion. any prior surgery, inflammation, or intraabdominal infection may lead to adhesions and decreased mobility leaving the left upper quadrant susceptible to splenic insult during colonoscopy. it has been suggested that positioning the patient and minimizing external pressure may prevent splenic complications in higher risk cases. the left lateral position may allow the spleen and flexure to fall left and lax, preventing the tension of the spleen that occurs when it falls back in the supine position. despite precautions age does not appear to be a risk factor, because the age range for reported cases was 33 years to 90 years with a median age of 63 years. however, a higher risk of splenic complications does appear to exist in women. in reported cases that included gender, 72% (29/40) of cases occurred in women. it is unclear why there is a predominance of this complication in the female population (table 3). proposed risk factors for splenic injury during colonoscopy case characteristics of splenic injury after colonoscopy us = ultrasound ; ct = computed tomography ; acls = advanced cardiac life support. often early symptoms are attributed to postpolypectomy serositis, colonic distension, analgesia, sedation, old age, or impaired mental status. the differential diagnosis for significant pain within 24 hours after colonoscopy includes retained gas, perforation, and splenic injury. rare complications causing abdominal pain include mesenteric tears, volvulus and gas explosions. pain less than 12 hours postprocedure will warrant observation in most cases. in 39 patients with recorded symptoms, 31 (79%) presented with the onset of symptoms in less than 24 hours. most patients present with abdominal pain, often in the left upper quadrant, that may radiate to the left shoulder. historically, kehr 's sign is pain at the tip of the left shoulder after bimanual palpation of the left upper quadrant with the patient in the trendelenburg position. it is not a reliable sign, and a positive kehr 's sign or left shoulder pain was only recorded in 55% (16/29) of patients. hypotension, anemia, or an elevated white blood cell count can also suggest a splenic injury. any patients with peritoneal signs or hemo - dynamic instability should be treated with a high index of suspicion for surgical perforation or splenic injury. although early onset of symptoms is common, delayed diagnosis even up to 10 days has been described as has a patient with serious splenic injury who was entirely asymptomatic. the diagnosis of a surgical abdomen should be made on clinical grounds, yet the advancement of imaging technology can elucidate the equivocal or suspicious case. a ct scan provides a definitive diagnosis and delineates the degree of injury that can often determine operative versus nonoperative management. ct was included in the diagnostic algorithm in 62% (25/42) of cases, and 11 of these scanned patients avoided a laparotomy and improved with nonoperative management. the use of ultrasound has been described in 5 cases, but 2 of these cases also included ct scans. ct remains the best diagnostic tool to aid in management, because all patients (11/11) treated nonoperatively were scanned in their evaluation. the goal of management in splenic injury after colonoscopy is nonoperative ; however, splenectomy may be difficult to avoid. thirty cases (70%) required splenectomy, including half diagnosed by ct, but these numbers benefit from publication bias and the pre - ct era. janes suggested that predictors of failed conservative treatment include hemodynamic instability, underlying splenic disease, a grade iii traumatized spleen by ct, old age, and hemoperotineum. one case of splenic artery embolization has been reported, but the definitive interventional treatment remains splenectomy. two cases were diagnosed during emergent laparotomy, and one case was found during autopsy after the patient underwent severe shock. splenic injury and rupture are rare complications of colonoscopy that must not be forgotten in the differential for postprocedural pain. not using excessive maneuvers in high risk patients and having a high index of suspicion postprocedure will optimize outcomes. | colonoscopy is a familiar and well - tolerated procedure and is widely used as a diagnostic and therapeutic modality by both gastroenterologists and surgeons. although perforation and hemorrhage are the most common complications, splenic injury or rupture is a rare but potentially lethal complication. we report a case of splenic rupture diagnosed 18 hours after colonoscopy, which required emergent splenectomy. we also reviewed over 39 other cases of splenic rupture or injury after colonoscopy reported in the english literature. despite being an infrequent complication, splenic rupture warrants a high degree of clinical suspicion critical to prompt diagnosis. most patients present with symptoms within 24 hours after colonoscopy, although delayed presentation days later has been described. ct scan of the abdomen is the radiological study of choice to evaluate colonoscopic complications. splenic injury can be managed conservatively or with arterial embolization depending on the extent of trauma, but splenectomy remains definitive management. clinical criteria are the primary determinants in choosing operative therapy over observation. herein, possible risk factors for splenic trauma during colonoscopy are identified, and clinical outcomes are evaluated. |
medical devices, which have a physical mode of action, are widely employed to control head louse infestation in europe and, more recently, in australia. however, in most countries, competent authorities and national prescribing schemes still generally favor insecticide - based medicinal products over medical devices for patient reimbursement schemes. this is despite the fact that the efficacy of many of the insecticide products is now reduced because the lice have acquired resistance to the active chemicals.14 the efficacy of several class i medical devices compared with insecticides has already been demonstrated in randomized, controlled, comparative studies.58 nevertheless, most competent authorities have been reluctant to include devices in their prescribing formularies, so that parents using these products to eliminate infestation from their children can obtain reimbursement of costs. therefore, many general health practitioners continue to prescribe less efficient and potentially more toxic insecticide - based preparations. this has only served to increase levels of insecticide resistance in countries such as the uk and the irish republic. the class i medical device investigated in this study has been available for use in germany since 2001, and its efficacy has previously been evaluated in preliminary uncontrolled tests. the aim of this study was to demonstrate that the soya oil - based shampoo is effective when used in a community setting. the manufacturers also wished to generate evidence for efficacy, in comparison with the leading medicinal product marketed in germany, so they could make an application to the authorities for approval for inclusion on the reimbursable listing. the first stage would allow us to show that the soya oil - based shampoo demonstrated noninferiority to 0.43% w / v permethrin lotion. the design was sufficiently powered that a second - stage analysis could then be performed to detect if either product showed superior activity. we recruited participants into the study in essentially the same way as for previous studies, by advertising on local radio, in newspapers, and by contact with previous study participants. potential participants were supplied with an information booklet prior to recruitment, and an enrolment visit was arranged a minimum of 24 hours later. all prospective participants signed consent forms before being screened for the presence of at least five live head lice, found within a maximum screening time of 5 minutes, by using a plastic detection comb (ksl consulting, helsinge, denmark, figure 1). each infested household member could be enrolled if : older than 2 years ; they had not been treated with head louse products during the previous 2 weeks ; and that had not been treated with trimethoprim - sulfamethoxazole or permanent waves or hair colors during the previous 4 weeks. we asked all prospective participants to confirm that they were unaware of allergy or sensitivity to pyrethroid insecticides, soya, nuts, or any other ingredient of the test products. adult females also confirmed that they were not breast feeding or pregnant, and using adequate contraception. we excluded people with asthma or similar respiratory conditions and those with long - term scalp conditions other than pediculosis, earlier participants in this trial, and anyone who had participated in another clinical study within one month before entry. we collected baseline demographic data on gender, age, hair characteristics, and previous pediculicide use. any ineligible people with lice were offered a standard of care treatment (4% dimeticone liquid gel) to prevent reinfestation of study participants. ethical approval for the study was granted by the oxfordshire research ethics committee a. the study was conducted in conformity with the principles of the declaration of helsinki, of the european union directive 2001/20/ec, and the ich topic e11 guideline. all participants stated before giving consent that they had read the participation information booklet and understood the purpose and requirements of the study. children also provided written or verbal assent, according to age, witnessed by the parent or guardian. a total sample size of 96 participants (48 in each of the treatment groups) was considered sufficient to detect a difference of 35% between groups for success rate at 14 days, with 90% power and 95% confidence intervals (ci). this 35% difference represented the difference between a 35% success rate in one product group and a 70% rate in the other group. the actual sample size required was 45 per group, so a planned recruitment of 48 per group made allowance for dropout. treatment allocation was derived from an online computer - generated list.9 allocation at the point of delivery was made from instruction sheets enclosed in opaque, sealed, sequentially numbered envelopes distributed to investigators in balanced blocks of eight. a copy of the listing was prepared in case an emergency code break was required. randomization was by individual, so different family members could receive different treatments. not only were the products physically different, the method of application was completely different also, so blinding at delivery was impossible. this study was single - blinded, with post - treatment assessments performed by different investigators, unaware of which treatment products had been used (assessor - blinded). in order to ensure a correct treatment, application was made in conformity with the instructions for use supplied with each product. the soya oil shampoo (mosquito luseshampoo ; wepa apothekenbedarf gmbh and co kg, hillscheid, germany) was supplied in 100 ml bottles.. a greater quantity of shampoo (about three times the quantity required to wash the hair) was then applied and massaged to produce a stable foam, with more added if the foam broke too quickly. we left the shampoo on the hair for 30 minutes, covered with a shower cap to prevent drips. at the end of this time it was rinsed off, towel - dried, and reapplied in the same manner. after a further 30 minutes, the shampoo was rinsed out. we applied the permethrin lotion (infectopedicul lotion ; infectopharm arzneimittel und consilium gmbh, heppenheim, germany), which was supplied in 150 ml bottles, after washing the hair with a nonmedicated shampoo followed by towel - drying. the lotion was applied a few drops at a time and massaged through the hair until the hair was soaked to the point of runoff. parents or guardians performed the rinsing, in some cases while the investigator was still present. we asked those people treated with permethrin lotion not to shampoo their hair for 3 days. for both products, participants were reminded not to use nit combs or other pediculicide preparations during the course of the study. the primary outcome measure for the study was elimination of lice after two applications of product. assessments were made by dry detection combing on day 2, on day 9 immediately before the second treatment, then day 11, and a more thorough examination was performed on day 14. any lice found were collected in the case record and examined by microscope to determine the development stage. if no lice were found on days 11 and 14, after the second application of treatment, it was considered a success. differences in success rates were measured by the 95% ci calculated using a normal approximation of the binomial distribution. we conducted analyses using oxstat ii (version 1.1 ; oxstat ltd, london, uk), epi info (version 6 ; centers for disease control and prevention, atlanta, ga), and purpose - built calculators for normal approximation and kruskal wallis / mann whitney tests. the first stage would allow us to show that the soya oil - based shampoo demonstrated noninferiority to 0.43% w / v permethrin lotion. the design was sufficiently powered that a second - stage analysis could then be performed to detect if either product showed superior activity. we recruited participants into the study in essentially the same way as for previous studies, by advertising on local radio, in newspapers, and by contact with previous study participants. potential participants were supplied with an information booklet prior to recruitment, and an enrolment visit was arranged a minimum of 24 hours later. all prospective participants signed consent forms before being screened for the presence of at least five live head lice, found within a maximum screening time of 5 minutes, by using a plastic detection comb (ksl consulting, helsinge, denmark, figure 1). each infested household member could be enrolled if : older than 2 years ; they had not been treated with head louse products during the previous 2 weeks ; and that had not been treated with trimethoprim - sulfamethoxazole or permanent waves or hair colors during the previous 4 weeks. we asked all prospective participants to confirm that they were unaware of allergy or sensitivity to pyrethroid insecticides, soya, nuts, or any other ingredient of the test products. adult females also confirmed that they were not breast feeding or pregnant, and using adequate contraception. we excluded people with asthma or similar respiratory conditions and those with long - term scalp conditions other than pediculosis, earlier participants in this trial, and anyone who had participated in another clinical study within one month before entry. we collected baseline demographic data on gender, age, hair characteristics, and previous pediculicide use. any ineligible people with lice were offered a standard of care treatment (4% dimeticone liquid gel) to prevent reinfestation of study participants. ethical approval for the study was granted by the oxfordshire research ethics committee a. the study was conducted in conformity with the principles of the declaration of helsinki, of the european union directive 2001/20/ec, and the ich topic e11 guideline. all participants stated before giving consent that they had read the participation information booklet and understood the purpose and requirements of the study. children also provided written or verbal assent, according to age, witnessed by the parent or guardian. a total sample size of 96 participants (48 in each of the treatment groups) was considered sufficient to detect a difference of 35% between groups for success rate at 14 days, with 90% power and 95% confidence intervals (ci). this 35% difference represented the difference between a 35% success rate in one product group and a 70% rate in the other group. the actual sample size required was 45 per group, so a planned recruitment of 48 per group made allowance for dropout. treatment allocation was derived from an online computer - generated list.9 allocation at the point of delivery was made from instruction sheets enclosed in opaque, sealed, sequentially numbered envelopes distributed to investigators in balanced blocks of eight. a copy of the listing was prepared in case an emergency code break was required. not only were the products physically different, the method of application was completely different also, so blinding at delivery was impossible. this study was single - blinded, with post - treatment assessments performed by different investigators, unaware of which treatment products had been used (assessor - blinded). in order to ensure a correct treatment, application was made in conformity with the instructions for use supplied with each product. the soya oil shampoo (mosquito luseshampoo ; wepa apothekenbedarf gmbh and co kg, hillscheid, germany) was supplied in 100 ml bottles.. a greater quantity of shampoo (about three times the quantity required to wash the hair) was then applied and massaged to produce a stable foam, with more added if the foam broke too quickly. we left the shampoo on the hair for 30 minutes, covered with a shower cap to prevent drips. at the end of this time it was rinsed off, towel - dried, and reapplied in the same manner. we applied the permethrin lotion (infectopedicul lotion ; infectopharm arzneimittel und consilium gmbh, heppenheim, germany), which was supplied in 150 ml bottles, after washing the hair with a nonmedicated shampoo followed by towel - drying. the lotion was applied a few drops at a time and massaged through the hair until the hair was soaked to the point of runoff. parents or guardians performed the rinsing, in some cases while the investigator was still present. we asked those people treated with permethrin lotion not to shampoo their hair for 3 days. for both products, participants were reminded not to use nit combs or other pediculicide preparations during the course of the study. the primary outcome measure for the study was elimination of lice after two applications of product. assessments were made by dry detection combing on day 2, on day 9 immediately before the second treatment, then day 11, and a more thorough examination was performed on day 14. any lice found were collected in the case record and examined by microscope to determine the development stage. if no lice were found on days 11 and 14, after the second application of treatment, it was considered a success. differences in success rates were measured by the 95% ci calculated using a normal approximation of the binomial distribution. we conducted analyses using oxstat ii (version 1.1 ; oxstat ltd, london, uk), epi info (version 6 ; centers for disease control and prevention, atlanta, ga), and purpose - built calculators for normal approximation and kruskal wallis / mann whitney tests. the study was a two - center investigation, with sites about 150 miles apart in cambridge and leeds, uk. between june 21, 2010 and december 31, 2010, consent was obtained from 134 people to be screened for head lice, and 91 participants (59 cambridge, 32 leeds) in 48 households were enrolled in the study. a further 121 household members either declined screening, were ineligible, or were unavailable. enrolled people comprised 78 children and 13 adults aged 247 (median 10) years. most demographic characteristics of the study population showed no significant differences when compared with populations enrolled in previous studies.5,6,8 however, the proportion of participants with heavier infestations at enrolment (ie, more than one louse found with the first stroke of a detection comb) was significantly (p < 0.001) higher in leeds than in cambridge, although this did not appear to influence the outcome of treatment. more than one family member in 24 households participated, 14 families having two participants in the study, seven families had three participants, and three families had four. the most common household sizes were five (15 houses), three (10 houses), and four (10 houses). it was planned that equal numbers of people would receive each treatment (48 per group), with a final enrolment of 45 receiving shampoo and 46 receiving lotion in the time allocated by the sponsor. eighty - six participants were assessed on day 14, and were considered to have completed the study (figure 2). one child refused a second application of permethrin lotion and two refused a second application of shampoo, because the treatments were too irritating. six participants dropped out, and five parents combed lice from their child s hair between treatments (two on permethrin lotion and three on soya oil shampoo), and the remainder missed one or more other assessments. all other participants had complete data sets, with two treatments nine days apart, and follow - up checks on days 2, 9, 11, and 14. the main endpoint analysis was the comparison of rate of cure for the 91 participants in the intention to treat population. according to this criterion, success was achieved by 16/46 (34.8%) of the participants in the permethrin lotion group and by 28/45 (62.2%) of the participants in the soya oil shampoo group. the difference in rate of success between the two treatments was estimated as 27.4% (95% ci : 7%, 48%) which meant that the soya oil shampoo was significantly (p < 0.01) more effective than permethrin lotion in the population tested. elimination of protocol violators from the analysis gave per - protocol success rates of 36.8% for the permethrin lotion group and 74.3% for the soya oil shampoo group, a difference of 37.5% (95% ci : 15%, 60%), which was also significant (p < 0.001). comparison of outcomes for the two sites found a difference in success rates for both intention to treat and perprotocol analyses. in cambridge, lice were eliminated in 21/29 (72.4%) of the intention to treat population treated with shampoo compared with 7/16 (43.8%) in leeds, and 11/30 (36.7%) had no lice after treatment with permethrin lotion in cambridge compared with 5/16 (31.3%) in leeds. similar differences in outcomes were found in the per - protocol population, with success in 21/26 (80.8%) for shampoo and 10/25 (40.0%) for lotion in cambridge compared with 5/9 (55.6%) success for shampoo and 4/13 (30.8%) for lotion in leeds. analysis of lice collected post - treatment showed that there were significantly more louse nymphs present at days 9 and 11 following the lotion treatment than after using shampoo (table 1). we found that 10 participants treated with soya oil shampoo had no lice at any checkup after the first application of product compared with five people treated with permethrin lotion. however, most participants in both groups, irrespective of whether lice were found at the day 2 assessment, were found to have adult lice present by the time of the day 9 assessment (24 shampoo and 25 lotion), all but seven of whom had female lice containing fully developed eggs, demonstrating the absolute necessity of a second application of product. the mean quantity of shampoo applied (65.2 g) per treatment was similar to the quantity of lotion (60.5 g) given. all other adverse events were some form of hot, itching, or stinging sensation during one or both treatments (12 people [26.6% ] with the shampoo and 11 [23.9% ] with the lotion). five of the participants experienced two treatment - related adverse events each, two treated with the shampoo and three with the lotion (table 2). the most severe adverse events were in children treated with the lotion, in which the high concentration of alcohol caused intense stinging of excoriations on the scalp, such that at least three children found it so distressing they tried to wipe the lotion off, and one refused a second treatment. at least two participants found that removing the shower cap supplied with the shampoo reduced irritation during treatment with that product. the study was a two - center investigation, with sites about 150 miles apart in cambridge and leeds, uk. between june 21, 2010 and december 31, 2010, consent was obtained from 134 people to be screened for head lice, and 91 participants (59 cambridge, 32 leeds) in 48 households were enrolled in the study. a further 121 household members either declined screening, were ineligible, or were unavailable. enrolled people comprised 78 children and 13 adults aged 247 (median 10) years. most demographic characteristics of the study population showed no significant differences when compared with populations enrolled in previous studies.5,6,8 however, the proportion of participants with heavier infestations at enrolment (ie, more than one louse found with the first stroke of a detection comb) was significantly (p < 0.001) higher in leeds than in cambridge, although this did not appear to influence the outcome of treatment. more than one family member in 24 households participated, 14 families having two participants in the study, seven families had three participants, and three families had four. the most common household sizes were five (15 houses), three (10 houses), and four (10 houses). it was planned that equal numbers of people would receive each treatment (48 per group), with a final enrolment of 45 receiving shampoo and 46 receiving lotion in the time allocated by the sponsor. eighty - six participants were assessed on day 14, and were considered to have completed the study (figure 2). one child refused a second application of permethrin lotion and two refused a second application of shampoo, because the treatments were too irritating. six participants dropped out, and five parents combed lice from their child s hair between treatments (two on permethrin lotion and three on soya oil shampoo), and the remainder missed one or more other assessments. all other participants had complete data sets, with two treatments nine days apart, and follow - up checks on days 2, 9, 11, and 14. the main endpoint analysis was the comparison of rate of cure for the 91 participants in the intention to treat population. according to this criterion, success was achieved by 16/46 (34.8%) of the participants in the permethrin lotion group and by 28/45 (62.2%) of the participants in the soya oil shampoo group. the difference in rate of success between the two treatments was estimated as 27.4% (95% ci : 7%, 48%) which meant that the soya oil shampoo was significantly (p < 0.01) more effective than permethrin lotion in the population tested. elimination of protocol violators from the analysis gave per - protocol success rates of 36.8% for the permethrin lotion group and 74.3% for the soya oil shampoo group, a difference of 37.5% (95% ci : 15%, 60%), which was also significant (p < 0.001). comparison of outcomes for the two sites found a difference in success rates for both intention to treat and perprotocol analyses. in cambridge, lice were eliminated in 21/29 (72.4%) of the intention to treat population treated with shampoo compared with 7/16 (43.8%) in leeds, and 11/30 (36.7%) had no lice after treatment with permethrin lotion in cambridge compared with 5/16 (31.3%) in leeds. similar differences in outcomes were found in the per - protocol population, with success in 21/26 (80.8%) for shampoo and 10/25 (40.0%) for lotion in cambridge compared with 5/9 (55.6%) success for shampoo and 4/13 (30.8%) for lotion in leeds. analysis of lice collected post - treatment showed that there were significantly more louse nymphs present at days 9 and 11 following the lotion treatment than after using shampoo (table 1). we found that 10 participants treated with soya oil shampoo had no lice at any checkup after the first application of product compared with five people treated with permethrin lotion. however, most participants in both groups, irrespective of whether lice were found at the day 2 assessment, were found to have adult lice present by the time of the day 9 assessment (24 shampoo and 25 lotion), all but seven of whom had female lice containing fully developed eggs, demonstrating the absolute necessity of a second application of product. the mean quantity of shampoo applied (65.2 g) per treatment was similar to the quantity of lotion (60.5 g) given. all other adverse events were some form of hot, itching, or stinging sensation during one or both treatments (12 people [26.6% ] with the shampoo and 11 [23.9% ] with the lotion). five of the participants experienced two treatment - related adverse events each, two treated with the shampoo and three with the lotion (table 2). the most severe adverse events were in children treated with the lotion, in which the high concentration of alcohol caused intense stinging of excoriations on the scalp, such that at least three children found it so distressing they tried to wipe the lotion off, and one refused a second treatment. at least two participants found that removing the shower cap supplied with the shampoo reduced irritation during treatment with that product. in this comparison of a medical device (soya oil - based shampoo) and a medicinal product (permethrin alcoholic lotion), we have found that the physically acting shampoo was significantly more effective than the insecticide. indications from other studies conducted in the uk suggest that lack of efficacy for the lotion is because permethrin currently has limited effectiveness due to physiological degradation mechanisms rather than gene mutations such as kdr (knockdown resistance).2,8,10 in this study, we followed the instructions for use of the products as supplied by the manufacturers, with reapplication after nine days (the product leaflets11,12 suggest reapplication after 810 days). evidence obtained from lice collected during the assessments not only suggested that neither product exerts a complete ovicidal effect, but also that the interval between treatments is too long, because nymphs emerging after the first treatment had, in many cases, developed into fully matured adults by the time of the second treatment. adult female lice collected on day 9 mostly contained fully developed eggs and, in one case, eggs appeared to have already been laid by these lice, because new first - stage nymphs were found at the day 14 assessment. there are no published data on the time required for head louse eggs to hatch on the head (all published studies have been either of body louse eggs or of head louse eggs maintained in the laboratory or in containers on other parts of the body). what studies exist suggest is that maturation of lice can occur in around 8 days.13 therefore, it has been agreed by several investigators around the world that a 7-day interval is more likely to provide the best outcome (barker, unpublished data). any difference in efficacy of permethrin lotion could be attributed to differences in resistance of lice in each locality, but this could not explain differences in the efficacy of the soya oil shampoo. we can only suggest that any difference may have been due to individual variation in application technique within the instructions by different investigators. one factor we found critical was the quantity of water remaining on the hair and, in cambridge, this was reduced to an absolute minimum by rigorous towel drying prior to the therapeutic application of product by one of us (ifb). other investigators may have been less rigorous, which could have resulted in greater dilution of the product. physically acting medical device products have increased in number, availability, and variety of dosage form. all essentially act either by occlusion of the louse respiratory tract or by disruption of the surface lipids of the insects.14,15 as a result, this type of product is popular with consumers in most countries because they do not contain conventional insecticides, and mostly do not contain harsh solvents, such as alcohol. the disadvantages of alcohol were clear in this study because a high proportion (31%) of those treated with the permethrin lotion reported mild to intense stinging when the fluid was applied to louse bites and excoriations on the scalp. however, even the shampoo was not without some side effects resulting from relatively prolonged contact with surfactant components. such effects were exacerbated by use of the shower cap, which probably does not help the therapeutic activity in any way. nevertheless, in comparison with the insecticide - based lotion, the soya oil shampoo was not only more acceptable than the lotion but was also significantly more effective, with a success level similar to several other widely used medical devices.58 the mosquito luseshampoo contains soya oil, which is made up from several medium chain, mostly unsaturated, lipids (c16:0, c18:0, c18:1, c18:2, c18:3). soya oil has a similar profile to other fixed vegetable oils, such as neem oil and olive oil, that are reputed to have a pediculicidal occluding effect.16 the mechanism of action of such oils on head lice is unknown, although it has been speculated in the popular press that they have some form of asphyxiation effect. because insects have a waxy protective layer on their cuticle that contains lipids of similar carbon chain lengths,17 what is more probable is that the lipids in the shampoo, combined with surfactant, cause disruption to the surface lipids of the lice, leading to water loss and dehydration. in this randomized, controlled, assessor - blinded, clinical investigation we have shown that a soya oil - based shampoo (mosquito luseshampoo) was significantly more effective than a permethrin lotion with an alcohol vehicle. however, the recommended retreatment time should be adjusted from 810 days to 7 days in order to avoid the risk that louse nymphs hatching from eggs surviving the first treatment may develop into adulthood and lay viable eggs themselves before the second application of product. | backgroundthis was a randomized, assessor - blind, controlled comparison of a soya oil- based medical device shampoo with a medicinal permethrin lotion in an alcohol vehicle for treatment of head louse infestation to generate data suitable for a regulatory submission to achieve reimbursable status for the shampoo product.methodswe treated 91 children and adults, divided between two sites, on two occasions 9 days apart. participants washed their hair and towel - dried it before treatment. the shampoo was used twice for 30 minutes each time. the lotion was used for 30 minutes followed by rinsing. assessments were made by dry detection combing on days 2, 9, 11, and 14 after the first treatment. according to present knowledge, this combing technique does not influence the overall head louse populations or outcome of treatment.resultsthe soya oil shampoo was significantly (p < 0.01) more effective than the lotion for both intention to treat (62.2% versus 34.8% successful treatment) and per - protocol (74.3% versus 36.8% success) groups. post - treatment assessments showed the necessity for repeat treatment, but that a 9-day interval was too long because if eggs hatched after the first treatment, the lice could grow old enough to lay eggs before the second treatment.conclusionthe soya oil - based shampoo was more effective than the permethrin lotion, more cosmetically acceptable, and less irritant. |
pleural mesothelioma is a rare condition associated with exposure to asbestos in around 70% of the cases. other risk factors include sv40 virus, genetic alterations, and exposure to radiotherapy generally for cancer treatment. the relationship between exposure to radiotherapy and pleural mesothelioma has been documented in the literature. also, metastatic skeletal involvement is common in carcinoma breast. follow - up tc- methylene diphosphonate (mdp) bone scintigraphy (bs) helps in early detection of skeletal metastases especially in high - risk patients. here, we present the case of 50-year - old female of carcinoma left breast treated with modified radical mastectomy, followed by radiotherapy who underwent bs on follow - up which was negative for the skeletal metastases but showed abnormally increased left rib cage uptake that led to the incidental detection of malignant pleural mesothelioma. a 50-year - old female patient of carcinoma left breast underwent modified radical mastectomy, followed by radiotherapy 12 years back. suspecting the pain to be of musculoskeletal origin, the treating oncologist referred the patient for tc - mdp bs to rule out skeletal metastases. bs was done 3 h, following intravenous injection of 20 mci of tc - mdp. it revealed diffusely increased radiotracer uptake involving all the left - sided ribs thus giving the appearance of asymmetrically increased left rib cage uptake [figure 1a and b ; arrows ]. the remaining skeleton showed normal radiotracer distribution. because this pattern was atypical for rib metastasis, single photon emission computed tomography / computed tomography (spect / ct) of the thorax was done in the same setting. transaxial spect and spect / ct images [figure 1c and e ; arrows ] revealed diffusely increased radiotracer uptake in all the left - sided ribs. using bone window on ct [figure 1d ], all the left - sided ribs showed regular cortical outlines with no apparent abnormality. transaxial ct in soft tissue window revealed circumferential nodular left - sided pleural thickening [figure 1f ; arrow, arrow head ]. the increased uptake of tracer in the ribs was likely secondary to the increased vascularity in underlying pleural pathology and was interpreted as reactive in nature. biopsy from the pleural - based nodular lesion was suggestive of pleural mesothelioma [figure 2a - d ]. 99mtc - methylene diphosphonate bone scintigraphy showing diffusely increased left rib cage uptake (anterior a, posterior b ; arrows). transaxial single photon emission computed tomography (spect) and spect / ct images (c, e ; arrows) show diffusely increased radiotracer uptake involving the left - sided ribs. transaxial ct (bone window, d) shows normal left - sided ribs with regular cortical outlines. transaxial ct (soft tissue window, f) shows a pleural - based soft tissue density lesion in the left lung lower lobe (f, arrow head) with diffuse circumferential pleural thickening (f, arrow) histological evaluation (4, a ; 10, b ; 20, c) shows hematoxylin - and eosin - stained sections showing round to oval cell with moderate amount of cytoplasm with mild nuclear pleomorphism. during the course of their disease, about one third of patients with breast cancer are at risk of developing recurrence. therefore, early diagnosis and treatment of recurrent breast cancer is important to define therapeutic strategies to enhance the duration of survival. metastatic skeletal involvement is common in patients with breast cancer and has been demonstrated by postmortem studies in up to 70% of the patients. detection of these lesions has a prognostic as well as therapeutic significance as the mean survival in patients with bony metastases is only 2 years. rib involvement is common in patients with multiple metastases but an uncommon site for solitary metastases. malignant pulmonary and pleural disease usually heralds poor prognosis, the manifestation of which can be either solid disease or a malignant pleural effusion, or a combination of both. ct is the workhorse of pleural imaging, able to achieve specificity of close to 100%. the latency period for developing pleural mesotheliomas may vary depending upon the type of etiology. our extensive literature search revealed few cases of carcinoma breast who later on developed pleural mesothelioma attributed to radiotherapy given for the treatment of breast cancer. in patients of carcinoma breast treated with radiotherapy, the time interval between the radiation and the appearance of the mesothelioma ranges from 10 to 30 years. this is in contrast to asbestos - related mesotheliomas, where there is a greater time interval (usually 30 - 40 years) and patients are also much older (usually > 60 years). in the present study, therefore, we hypothesized that radiotherapy given for the treatment of primary breast cancer could have played a role in the development of pleural mesothelioma. although there was no evidence of skeletal metastasis, the demonstration of pleural pathology by spect / ct played an important role in the patient management as timely treatment increases the survival of the patients. therefore, this pattern of asymmetrical hemithoracic rib cage uptake on bs should be kept in mind as an indirect indicator of underlying pleural involvement warranting further investigation for documenting the same. | follow - up bone scintigraphy (bs) in a patient of carcinoma left breast, who was treated with surgery followed by radiotherapy 12 years back, revealed asymmetrically increased radiotracer uptake in left - sided ribs. since, this pattern was atypical for metastatic rib involvement, single photon emission computed tomography / computed tomography (spect / ct) of thorax was done in the same setting which revealed circumferential nodular left - sided pleural thickening. biopsy confirmed it to be pleural mesothelioma. left - sided ribs showed no abnormality on ct, thus suggesting the rib uptake as reactive in nature. this pattern of asymmetric rib uptake on bs should be kept in mind and warrants further investigation for determining underlying pathology. |
dental caries is the most common chronic disease of childhood and significantly impacts children 's well - being. among us children aged from 2 to 5 years of age, more than 25% have caries, a prevalence which appears to be on the rise. yet, young children, particularly those who are low - income, encounter substantial barriers accessing dental care for prevention or treatment of dental caries. meanwhile, primary care physicians (pcp) who care for children in the us, specifically pediatricians and family physicians (and in some settings, nurse practitioners and physician assistants), have unique opportunities to deliver oral health anticipatory guidance and implement dental caries primary prevention at frequent well - child - care visits early in a child 's life. infants, young children, and their parents will likely see their pcp as many as 13 times before they have ever visited a dentist, and more children have ready access to primary medical care than to dental care, particularly if they are publicly insured. studies indicate that, with training, physicians can effectively deliver preventive oral health services [4, 5 ]. in an effort to encourage pcps to further their involvement in oral health as a means to diminish oral health disparities among children, 44 out of 50 us states now reimburse pcps to provide preventive oral health care services to medicaid - enrolled children. however, until recently, most pediatricians have lacked formal training in oral health [6, 7 ] that would allow them to effectively deliver these services and bill for them. acknowledging the impact of dental disease on children 's health and the unique role that pediatricians can play in addressing oral health beginning in infancy, the american academy of pediatrics (aap) added oral health promotion to its strategic plan in 2006 and set about developing plans to educate us pediatricians about oral health using a train - the - trainer model. funding for these efforts was provided by a grant from the american dental association foundation. the result was the chapter oral health advocate (coha) program, in which 1 - 2 representative pediatricians were recruited from each aap chapter to become peer - to - peer educators called cohas for fellow pediatricians in their state or aap chapter (larger states have multiple chapters). cohas were trained at the chapter advocacy training on oral health (catooh), a 1.5-day course held 3 times (2008, 2009, and 2010) at aap headquarters in elk grove, illinois, usa. following the catooh, cohas implemented (or refined) an oral health preventive program within their own practices and then disseminated the model to their fellow pediatricians and other pediatric providers using strategies and techniques they had learned during the catooh and, subsequently, within their own practices. this study describes participants ' experiences during the catooh and subsequent implementation during activities as cohas. we were specifically interested in roles that cohas assumed and the opportunities and challenges that cohas faced in their efforts to disseminate oral health knowledge and skills to other pediatricians. we intend that findings from this project will (1) allow refinement, expansion, and replication of the coha program ; (2) increase awareness of pediatric oral health issues that arise in primary care practice ; (3) describe factors that influence pediatricians ' willingness and abilities to adopt oral health into their routine and practice ; (4) inform future models of physician peer training and advocacy that could be applied in other countries and to other areas within health care. fifteen more cohas were trained in 2009 and 36 in 2010. at the time of the interviews (during march 2011february 2012), there were 64 cohas from 50 states and us territories. the coha program is ongoing and cohas remain active in their roles and continue to expand their knowledge around oral health and increase their level of advocacy for children. cohas are not paid and do not receive any funding from the aap for their activities. a steering committee of pediatricians, dentists, and staff from the aap and the american dental association (ada) planned the catooh, which included didactic, interactive small group and hands - on sessions. design of the catooh was based on principles of adult learning and evidence that a combination of didactic and interactive cme activities is substantially more effective than didactic sessions alone in promoting behavior change. the 2008 catooh covered basic oral health science, fluoride, oral health risk assessment, prevention and anticipatory guidance, oral health reimbursement, and hands - on practice in oral examination and fluoride varnish application. in 2009 and 2010, the agenda was supplemented with presentations from previously trained cohas about lessons learned and best practices and with a session on billing (see table 1 for 2010 catooh agenda). in addition to attending the catooh, cohas completed an online oral health training program, called protecting all children 's teeth, which was developed by pediatricians and dentists working together with the aap (pact is available at : http://www2.aap.org/oralhealth/pact/index-cme.cfm). they also received directed readings, supply lists, resources for peer and patient education, and a list of state dental contacts. at the end of each catooh, participants completed a commitment - to - change contract that specified at least 4 training sessions per year would be done by each coha. additionally, individual coha goals included working with state medicaid programs around pcp oral health reimbursement, educating residents and other trainees about oral health, link with oral health coalitions, and improving medical / dental relationships. after each catooh, the aap offered technical assistance and organized an electronic listserv for cohas to share ideas, strategies, and support and for research updates and announcements. the aap and the university of washington institutional review boards (irb) approved this project. a semistructured script was used with questions in the following categories : motivation to become a coha, previous oral health experience, perceptions about the catooh, activities undertaken as a coha, facilitators and barriers encountered by cohas, and recommendations for the future. the first 8 interviews were conducted in person during a coha advisory council meeting and the remainder by telephone. each audiotape was reviewed, the content wase categorized into themes, and representative quotes was selected. to reduce bias, the interviewer (cwl) was not involved with planning or implementation of the catooh or the coha program. findings, including themes and representative quotes, were presented, and feedback about accuracy and completeness was elicited from the catooh steering committee and coha advisory council. forty cohas responded and were scheduled for an interview (62% responses after 3 emails). participants had graduated from medical school an average of 17 years prior to the interview (range 4 to 44). approximately one - quarter of subjects were in private practice, one - quarter practiced at a community health center or federally qualified health center, and one - half were academic pediatricians. most cohas practiced in suburban or urban locales while approximately 10% worked in rural settings. approximately two - thirds of interviewees had previous oral health involvement prior to becoming a coha. these individuals volunteered to be cohas because of their interest in oral health, which usually was motivated by their patients ' oral health problems and difficulties accessing dental care. the other third of cohas had no previous oral health experience, but most were involved with their local aap chapter and/or other advocacy activities such as reach out and read. some of those interviewed confessed an initial lack of interest in oral health prior to attending the catooh, as this participant stated, i really was n't that interested (in oral health) but when they asked for volunteers to be a coha, no one volunteered so i figured, ok, i 'll go. however, the coha training proved influential and this same individual went on to say, i came out of the 2008 catooh and was really excited about (oral health) and i was on fire about how we could do this with pediatricians. towards the goal of optimizing children 's oral health, cohas advocated pediatricians ' role to be that of providing preventive oral health anticipatory guidance, screening for caries risk and dental disease, applying fluoride varnish to children at high risk for dental caries, and facilitating access to a dental home. almost all of the interviewees met their goal of conducting at least 4 oral health training sessions per year and most did more. in general, cohas felt the on - site training that they provided to other pediatricians and their staff was well received. as fellow pediatricians, cohas were uniquely able to relate to those that they were training but cohas also acknowledged that each pediatric practice is different, and thus, an individualized approach to training was necessary. for example, in some practices, the pediatrician applies the fluoride varnish whereas, in other practices, fluoride varnish application is delegated to another health care provider, such as the medical assistant. in addition to academic detailing and on - site training, cohas used other ways to reach out to pediatricians in their state / chapter to provide education, usually by email or presenting grand rounds at their hospital or area medical schools. some cohas were able to make a greater impact by focusing time and energy at a state government level, for example, meeting with state medicaid directors to advocate for pcps ' reimbursement for oral health services and for expanded access to dental care for poor and low - income children. academic cohas, meaning those who work at universities and their affiliated medical centers and who typically have both clinical and educator roles, explained that their positions allowed them more time to spend on oral health activities than clinicians in private practice since it was expected that they would be involved in community projects, outreach, and trainee education. most academic cohas provide pediatric medical care for a disproportionate share of children with special health care needs, publicly insured and uninsured children. there were common lessons that academic cohas sought to impart to trainees : (1) oral health is part of well - child - care ; (2) oral health prevention is easy to do ; (3) it is important for pediatricians to partner with dentists in their community. additionally, academic cohas gave resident noon lectures about oral health, developed a continuity clinic oral health curriculum, and incorporated an oral health module into the residents ' community and/or advocacy rotation. these cohas reported that residents had little difficulty incorporating oral health into their visits with patients. interviewees attributed residents ' ease with oral health to a few factors including that residents have additional time to spend with patients and that residents are still in the process of developing their routine. referring to oral health, one coha said, residents just do it if you tell them to. although there was variation in the infrastructure in place to support cohas, most cohas listed 5 factors that enabled their success as cohas : (1) the catooh ; (2) support from the aap, fellow cohas, and others ; (3) personal experience implementing oral health into their practice ; (4) relationships with dentists ; (5) reimbursement for oral health services. in addition to knowledge gained at the catooh, cohas learned from other cohas ' successes and failures, were given valuable resources like flip charts to use when educating fellow pediatricians, and developed strategies for developing collaborative relationships with dentists, expanding pediatrician involvement in oral health and optimizing billing for these services. furthermore, the lectures and discussions with dentists at the catooh helped cohas appreciate the expertise of their dental colleagues and made dentists in general seem more approachable. the most valued aspects of the catooh was the hands - on aspect of the training, meaning that cohas were able to examine and apply fluoride varnish to actual children. cohas found their experience at the catooh to be empowering as this coha said, all of a sudden it hit me. cohas, whether they were new to oral health or previously involved, came away from the catooh highly motivated to promote oral health involvement among fellow pediatricians and to improve the oral health of children. it was important, cohas expressed, to maintain this momentum upon return to the coha 's home states and to have a forum for ongoing collaboration and exchange of ideas. to that end, after each catooh, the aap national office maintained regular contact with the cohas. cohas also worked with their local aap chapter and stayed in touch with fellow cohas via the listserv. through these interactions, cohas could avail themselves of expert assistance when problems or questions arose and were able to share resources and ideas. most cohas commented positively on the support they received from their local aap chapter and its executive director who often helped with outreach and legislative contacts, as one coha explained, (the executive director) did a lot so that i could focus on outreach rather than organizing. some cohas worked in communities and states where there was a preexisting oral health coalition with whom they could work and rely on for additional support. in settings with limited resources, a few cohas applied for small grants, usually from foundations, to offset the costs of some of their oral health activities. one coha used americorp volunteers, who helped in developing and maintaining detailed online and printed lists of local dentists ' contact information, accepted insurance plans, and wait times for new appointments. after returning from the catooh, cohas focused their initial efforts on incorporating oral health into their own practice and, in the process, learned a variety of lessons, as this comment reflects : once you have done about 20 to 30, it becomes part of your routine. you are not clumsy anymore (you need to) do it whether you are running behind or not. once you have done about 20 to 30, it becomes part of your routine. you are not clumsy anymore (you need to) do it whether you are running behind or not. cohas believed that their insider perspective provided them with ease and credibility in talking to fellow pediatricians and helped them be more positive about the process of integrating oral health into primary care as these quotes reveal : on paper it looks complicated. you need a pediatrician who has done it to make it doable. at first it takes you 3 - 4 minutes, but if you incorporate oral health into the history and the oral screening exam into your physical and then put the fluoride varnish on while you 're examining the child 's mouth, then you 're done and it takes 60 seconds once you are used to it. on paper it looks complicated. it takes you 3 - 4 minutes, but if you incorporate oral health into the history and the oral screening exam into your physical and then put the fluoride varnish on while you 're examining the child 's mouth, then you 're done and it takes 60 seconds once you are used to it. cohas without prior oral health experience seemed to have a better sense about how the average pediatrician might be resistant to undergoing oral health training and adopting oral health into his / her practice. for example, one coha remarked if you do n't know anything about (oral health), then you do n't understand the magnitude of the problem and you do n't know how easy it is, so you just think you ca n't add one more thing to your plate. when cohas had overcome such barriers personally, they felt they were more effective in encouraging other pediatricians to become involved. some cohas practiced in areas where dentists were already involved in training physicians about oral health, giving the opportunity for cohas to participate and provide the pediatrician perspective. for example, one coha who partnered with a dentist for such presentations noted : the dentist knows the science but he does not really know how a pediatric office works and what are going to be the barriers for pediatricians. when our state medicaid program tried to roll this out without pediatrician involvement, none of the pediatricians was really sure they wanted to do it because, (after the dentist 's presentation), the pediatricians did not know what would be involved, could n't see how easy it was (because there was no hands - on demonstration), and that billing would be easy for the (pediatrician 's) billing staff. the dentist knows the science but he does not really know how a pediatric office works and what are going to be the barriers for pediatricians. when our state medicaid program tried to roll this out without pediatrician involvement, none of the pediatricians was really sure they wanted to do it because, (after the dentist 's presentation), the pediatricians did not know what would be involved, could n't see how easy it was (because there was no hands - on demonstration), and that billing would be easy for the (pediatrician 's) billing staff. additionally, most cohas met with local dentists to discuss their role as a coha and, in doing so, were also able to explicitly address fears that pcps were going to be practicing dentistry. cohas found that dentists were more supportive than expected once they found out that the pediatricians were focused on caries primary prevention in infants and young children (whom general dentists are often uncomfortable seeing, cohas said). meeting with dentists as a coha allowed the pediatrician - dentist relationship to expand into a more collaborative one in which cohas felt greater ease referring patients to and consulting dentists about specific cases. positive experiences with dentists gave cohas greater confidence in educating fellow pediatricians about the importance of children having a dental home. even in settings in which access to regular dental care was limited, almost all of the cohas had developed and shared strategies with fellow pediatricians for obtaining urgent dental care for their patients with acute dental problems. to that end, cohas each knew a few dentists whom they could call upon for dental emergencies or more urgent treatment needs, as this coha described : when i see rotten teeth, i call the dentist and make the appointment for the family. when i see rotten teeth, i call the dentist and make the appointment for the family. (when i ask them personally), they will never turn me down. in most states, cohas could rely on the fact that the hook is that it is a procedure that pediatricians can do and get paid for. the reimbursement was particularly attractive in states such as washington and north carolina, where medicaid payment to pcps for delivering oral health services ranges from $ 50 to $ 70 per encounter. however, the average payment is $ 15$25 and most state medicaid programs only reimburse for fluoride varnish application. oral screening, risk assessment, and family education are expected but in most states not paid separately. cohas encountered 3 levels of barriers related to oral health dissemination to fellow pediatricians : (1) personal professional barriers that interfered with achievement of goals they had set for themselves ; (2) policy and colleague - level barriers, in the form of pediatrician reluctance to undergo training about oral health ; (3) community-/patient - level barriers, which affected pediatricians ' abilities to optimally address their patients ' oral health needs. the most often cited personal barrier faced by interviewees was lack of time to accomplish the activities they envisioned for themselves as cohas. the economic climate may have worsened this situation for some cohas who had acquired more clinical duties or lost administrative time as their respective institutions dealt with budget shortfalls. the majority of cohas had little or no funding and few resources. when asked what would help them do more, cohas typically replied, in one form or another, more time, more money, and more help. fellow pediatricians would sometimes decline cohas offer to conduct an office - based training, citing limited time and being overwhelmed with other demands. as one coha put it, they worry about the 1500 other things we have to do for bright futures (guidelines for health supervision). there were other concerns among pediatricians, including some of the cohas themselves, surrounding reimbursement for oral health activities and fluoride varnish application being only available for medicaid - insured children. although low - income children are considered at higher risk for dental disease, some cohas stated that they wanted delivery of oral health services to be based on individual need, regardless of a child 's insurance and were uncomfortable doing it for one population and not another. logistically, it was often challenging to identify and direct services only to medicaid - insured children in offices that served a mix of privately and publicly insured children (which is the norm for pediatricians in private practice in the us). there were also unique, state - specific barriers that made incorporating oral health into pediatricians ' practices more challenging. for example, some states required that pcps undergo oral health training in person with a dentist in order to qualify for medicaid reimbursement. this requirement imposed burdens of time away from practice, need to travel, and lack of physician perspective. cohas and their fellow pediatricians encountered barriers to educating families about oral health. in some communities, there was limited oral health literacy, which hindered families seeking regular professional dental care and practicing home oral hygiene. however, the main barrier to optimizing their patients ' oral health was limited access to quality professional dental care, as this coha described : part of the (coha) program is to encourage (pediatrician) referral to dentists and the standard question (from the pediatrician) is, to whom do i refer ? and you do not always have an answer. part of the (coha) program is to encourage (pediatrician) referral to dentists and the standard question (from the pediatrician) is, to whom do i refer ? and you do not always have an answer. most cohas described that, within their communities, privately insured children typically went to pediatric dentists in private practice, but such care was unavailable to lower - income children because these dentists did not accept medicaid. more often than not, low - income children received dental care at community health centers or increasingly, at for - profit dental clinic chains that were geared exclusively towards medicaid - insured children. cohas expressed concerns, which were based upon comments made by their patients ' parents, about what seemed to be lower quality of dental care delivered at some of these chain clinics. this is the first paper to describe a national program of peer - to - peer physician education and advocacy about oral health. the previous literature reported that pediatricians perceive preventive oral health as within their purview and that pcps are capable of delivering preventive oral health services, described state 's efforts at oral health integration into primary care [4, 11, 12 ], and demonstrated that pcp efforts result in improved oral health among their patients. however, past efforts to train pediatricians about oral health have been limited to single states and have not always included pediatricians in the planning and delivery of educational programs. in this project, cohas from every chapter were recruited for a national training program with the expectation that they would return to their home state and educate / train fellow pediatricians to deliver preventive oral health services, thus allowing for more widespread, standardized, and rapid dissemination. furthermore, pediatricians were involved in developing and revising the catooh, and cohas learned from one another 's experiences. utilizing pediatricians to train other pediatricians was considered essential because cohas uniquely understood how pediatric practices function and how pediatricians could incorporate oral health into their routines. cohas provided at least 4, and sometimes substantially more, oral health training sessions per year to fellow pediatricians, as well as at grand rounds and local conferences. cohas ' original goals expanded and evolved once they returned to their home state and better understood the needs of their fellow pediatricians and children within their state. for some cohas, this meant focusing more on their efforts on state - level advocacy or on promoting collaborative relationships with dentists. because of this, cohas sometimes had to rely on strategies other than traditional academic detailing to reach fellow pediatricians (e.g., emailing pediatricians about web - based oral health training opportunities). yet, cohas then lost the advantage of a personal visit during which they could facilitate hands - on training. resources that could allow cohas to expand their efforts might include funding for administrative support and outreach efforts and assistance in developing alternative training strategies to accommodate pcps ' limited time. these cohas formed the eyes and ears for the status of children 's oral health within their communities. collectively, cohas could bring attention to these issues, but they need to know how to quantify and direct their concerns. furthermore, a number of cohas had access to preexisting data, such as medicaid claims and other reports, which, with additional technical assistance, would allow for tracking of oral health outcomes. pediatric residents ' adoption of oral health was viewed as successful by the cohas who supervised them. ideally, having an established oral health routine when one finishes residency means that such routines will be sustained. family medicine is farther along in this process than any other medical specialty ; their residents complete formal, standardized education in oral health as a required part of their training. finally, cohas made important inroads in developing collaborative relationships with dentists in their communities, a process that was encouraged by positive interactions with dentists during the catooh. such interdisciplinary relationships enhance professional learning, improve patient care, and ideally, promote improved access to dental care for children. when it was difficult for pediatricians ' patients to access dental care, it was more challenging for pediatricians to fully implement preventive oral health into their practices. this was because pediatricians lacked any place to refer patients for ongoing dental care or when oral health problems were identified on screening examination. partnering with programs such as washington 's abcd (access to baby and child dentistry), which trains dentists to care for young children and provides enhanced medicaid reimbursement to do so, would satisfy the critical link of a professional dental care referral source that pcps need to be truly effective in promoting oral health for all children. it is important to acknowledge the limitations of this work. while employing qualitative methods allowed themes to emerge that otherwise might not have been considered in a traditional survey, the time - consuming nature of the interview may have discouraged some cohas from responding. a response rate of 62% is reasonable for surveys of physicians but those who did not respond may have had different experiences or perspectives that are not reflected in this paper. this paper describes a novel nationwide effort to train pediatricians to be oral health peer educators and advocates. it also provides insight into the varying roles cohas played and the opportunities and challenges that cohas and their fellow pediatricians encountered integrating oral health into well - child - care visits. some barriers identified in these interviews are modifiable, such as by streamlining training requirements for pcps to bill medicaid for oral health services, whereas other barriers are more difficult to overcome, for example, time constraints among pcps. nevertheless, cohas and their fellow pediatricians found that, once initiated, providing oral health services takes less time than anticipated and delivers a valuable service to their patients. difficulty finding a dental home for patients who lack private dental insurance or cash to pay out - of - pocket is a known barrier to promoting preventive oral health within pediatric practice. however, results from this study point to the potential for national- and local - level collaboration between dentists and physicians as a means to expand interdisciplinary education and collegiality, as well as to expand access to professional dental care for all children. though cohas largely felt their efforts in reaching out to and training their peers had been successful, the increasing time pressure in pediatric practice creates a need for the most efficient training strategies ; these could include use of social media, web - based resources, oral health prompts in the electronic medical record, and incentivizing training by pairing maintenance of certification with oral health quality improvement efforts. the relative ease with which pediatric residents adapted to implementing oral health services highlights the need for focused efforts in medical school and residency to ensure that new physicians receive sufficient didactic and clinical training in oral health. this paper, focused on training and implementation, is the first in a series looking at the impact of the coha program. results provide insight into factors that bear consideration when asking physicians to incorporate preventive oral health care into medical practice. these include the importance of (1) pediatrician involvement in designing and delivering oral health educational programs ; (2) beginning oral health education early in medical training ; (3) individualizing the approach for each physician practice ; (4) expanding oral health surveillance and advocacy capacities ; (5) incorporating dental partnerships into every level of implementation. applying the lessons learned in this study along with ongoing technical and financial support, the coha program holds promise to further improve access to preventive oral health services in pediatric medical practices, diminish oral health disparities, inform oral health policy, coordinate state - level oral health surveillance and quality improvement initiatives, and enhance referrals and collaboration with dental professionals. | objective. (1) to describe an innovative program training us pediatricians to be chapter oral health advocates (cohas). (2) to provide insight into cohas ' experiences disseminating oral health knowledge to fellow pediatricians. patients and methods. interviews with 40 cohas who responded to an email request, from a total of 64 (62% response). transcripts were analyzed for common themes about coha activities, facilitators, and barriers. results. cohas reported positive experiences at the aap oral health training program. a subset of academic cohas focused on legislative activity and another on resident education about oral health. residents had an easier time adopting oral health activities while practicing pediatricians cited time constraints. cohas provided insights into policy, barriers, and facilitators for incorporating oral health into practice. conclusions. this report identifies factors influencing pediatricians ' adoption of oral health care into practice. cohas reported successes in training peers on integrating oral health into pediatric practice, identified opportunities and challenges to oral health implementation in primary care, and reported issues about the state of children 's oral health in their communities. with ongoing support, the coha program has a potential to improve access to preventive oral health services in the medical home and to increase referrals to a dental home. |
we selected eight genes known to be involved in the ras pathway, namely cdk5, hras, mapk1, mapk3, map2k1, map2k2, ngfr and raf1. core genes due to their relevance in the ras pathway and their consequential importance in colorectal cancer. the knock - down experiments were performed on the eight core genes using short hairpin rna (shrna) in two colorectal cancer cell lines sw480 and sw620. for each knock - down there are six replicates (except cdk5 in sw620 with five replicates) with three different types of controls (empty vector, nontarget and non transduced), totaling 125 samples. we used the affymetrix genechip hg - u133plus2 platform to profile the gene expression of each sample. we used the simpleaffy bioconductor package to check the quality of each individual cel file. 1 shows that a majority of files contains a sufficiently large percentage of present calls (> 40%, except for biological replicates one and two and hras biological replicate three with 39.58%) and all scale factors lie within a 3-fold range which complies with the good quality guidelines from affymetrix. in more detail, we can observe that those cel files that were generated in the early stages of the data generation are of lower quality than the rest of the files, namely the biological replicates one and two (fig. 2 and table 1). the raw and normalized data are available from ncbi gene expression omnibus repository with accession number gse53091. a successful knock - down experiment should result in significantly lower expression compared to the unperturbed samples. here, we assess the quality of a knock - down experiments by testing the difference between matched knock - down samples versus nontarget control samples using a wilcoxon signed rank test. in fig. 3, we show the difference between knock - down and control sample expression for each of the eight knock - downs for both cell - lines together. in each plot, the knocked - down gene is highlighted in blue and the obtained p - values are represented by symbols in the bottom of each plot. the significance levels are represented as follows : for p 40%, except for biological replicates one and two and hras biological replicate three with 39.58%) and all scale factors lie within a 3-fold range which complies with the good quality guidelines from affymetrix. in more detail, we can observe that those cel files that were generated in the early stages of the data generation are of lower quality than the rest of the files, namely the biological replicates one and two (fig. 2 and table 1). the raw and normalized data are available from ncbi gene expression omnibus repository with accession number gse53091. a successful knock - down experiment should result in significantly lower expression compared to the unperturbed samples. here, we assess the quality of a knock - down experiments by testing the difference between matched knock - down samples versus nontarget control samples using a wilcoxon signed rank test. in fig. 3, we show the difference between knock - down and control sample expression for each of the eight knock - downs for both cell - lines together. in each plot, the knocked - down gene is highlighted in blue and the obtained p - values are represented by symbols in the bottom of each plot. the significance levels are represented as follows : for p < 0.001, for p < 0.01, for p < 0.05 and - for p < 0.1. from the eight plots in fig. 3, we can observe that the difference in expression between knock - down and control samples is significant for all of the eight knock - downs (the differential expression of the blue boxes is significantly lower than zero). in our study, we determined the set of significantly affected genes for each of the eight knock - downs. for example, the knock - down of raf1 significantly changes the expression of map2k2 and ngfr with p - values < 0.001 (only considering the eight core genes). we then used the set of significantly affected genes to quantitatively validate inferred gene regulatory interactions. in this article we described a unique data set containing ras pathway - related gene knock - down experiments in two different colon cancer cell - lines. it contains the expression values from the knock - down of eight genes as well as three different controls in six biological replicates. the genome - wide gene expression was measured using the human genome u133 plus 2.0 array. this data was recently used in a published study on the validation of regulatory gene networks. r code enabling to programmatically access the data and to fully reproduce the results presented in the paper. r code enabling to programmatically access the data and to fully reproduce the results presented in the paper. | quantitative validation of gene regulatory networks (grns) inferred from observational expression data is a difficult task usually involving time intensive and costly laboratory experiments. we were able to show that gene knock - down experiments can be used to quantitatively assess the quality of large - scale grns via a purely data - driven approach (olsen. 2014). our new validation framework also enables the statistical comparison of multiple network inference techniques, which was a long - standing challenge in the field.in this data in brief we detail the contents and quality controls for the gene expression data (available from ncbi gene expression omnibus repository with accession number gse53091) associated with our study published in genomics (olsen. 2014). we also provide r code to access the data and reproduce the analysis presented in this article. |
other concomitant symptoms should be considered for diagnostic approach in a child with pleuritic chest pain. in this report we discuss chest pain in a 6-year - old child with regard to other signs and symptoms. this six - year old boy was presented to the emergency department of children 's medical center, tehran, with dyspnea and pleuritic chest pain. the symptoms had begun two months ago and gradually aggravated for the past two weeks. some of the differential diagnoses of chest pain in the pediatric patient are pneumonia, pleurisy, pneumothorax, pericarditis, endocarditis, costochondritis (tietze syndrome), herpes zoster (cutaneous), angina (familial hypercholesterolemia, anomalous coronary artery), epidemic pleurodynia, trauma and rib fracture, lesions of the dorsal root ganglia, tumors of the spinal cord, and gallbladder disease. gastro - intestinal diseases like peptic ulcer, esophagitis (gastroesophageal reflux, infectious, pill), cholecystitis, perihepatitis (fitz - hugh - curtis syndrome), esophageal foreign body and spasm are less common causes of chest pain in children. the chronicity of the symptom indicates that a systemic chronic problem could be the main cause. cardiac diseases like pericarditis, endocarditis, mitral valve prolapse, and arrhythmias are among the''must not miss '' diagnoses and should be ruled out. heart beat was 110/min, respiratory rate 38/min, blood pressure 110/70, temperature 39c, body weight 15 kg and height 107 cm. the medical history was notable for 25 days of hospitalization at 4 years of age, because of a history of 3 months fever and bad appetite. the medical files were not available, but his mother had been told that her son was treated for typhoid. six months after getting discharged from the hospital, the patient again developed fever and general asthenia, and his mother noted that since then he continuously felt weak, had low growth rate, and developed fever occasionally. he also had an intermittent fever which according to his mother lasts for a few years. as his mother told, he has not received vaccination since four years of age. however, we had to check for typhoid, but it should be considered that another underlying chronic febrile disease involvement was probable. now in physical examination we searched for signs and symptoms of a chronic disease and specific organ involvement. at admission, the patient was in apparent respiratory distress, which worsened on supine position and he preferred to remain in semi - sitting position. conjunctivae were pale and auscultation of heart and lung was normal. on abdominal examination, a generalized tenderness interfered with the examination process. the mother reported of a generalized bone pain, weight loss, nocturnal sweating and fever during the last three months. his father also had a three years history of night - fever and cough without any medical evaluation. the symptoms of pale conjunctivae, weight loss, night sweating and fever, indicate the chronic pattern of the illness. iran is an endemic area for tuberculosis, so it also had to be considered, especially with the positive suspicious family history. cardiopulmonary causes had to be ruled out, because of pleuritic chest pain and orthopnea. infectious, rheumatologic and maybe malignant causes of serositis are among the possible diagnoses, which could be the reason for other signs and symptoms of the patient. the first blood - work tests showed the following results (normal values in parentheses) : complete blood count : wbc 8130/l (neutr 59%, lymph 34%, mono 6%, eosin 0%), rbc 3.600,000/l, hb 8.1 g / dl, mcv 75.7 fl, mch 22.5 pg, plt 377000 /l, blood glucose 102 mg / dl, creatinine 0.6 mg / dl (0.3 - 0.7), blood urea nitrogen 10 mg / dl (5 - 20), c - reactive protein 24 mg / l (1.2) ]. amylase, lipase, uric acid, cholesterol, triglycerides, calcium, phosphorous, liver function tests, lactate dehydrogenase, total protein and albumin were normal. the presence of serositic arthritis and a positive ana made the rheumatologic diseases, especially sle to be the first in the list of the differential diagnosis. systemic - onset juvenile rheumatoid arthritis could also be a possible cause. some more tests, especially anti - dsdna, and rf were needed. antinuclear antibodies (anas) can be positive in systemic lupus erythematosus, drug - induced lupus, juvenile arthritis, juvenile dermatomyositis, vasculitis syndromes, scleraderma, infectious mononucleosis, chronic active hepatitis and hyperextensibility. the latest cbc : wbc 3180 (neut 58%, lymph 36%, mono 14.6%, eos 0, baso 0.3%), rbc 3.18, hb 7 g / dl, mcv 69.2, mch 21.6, platelets 293000. results of the new tests are as follow : anticcp 1.7/ml (within normal range, neg 100), rf + + + +, aso 100 todd units (up to 200 todd units). on the criteria for lupus, diagnosis of sle was made (table 1) and treatment with prednisolone tablets (2mg / kg / day) and hydroxychloroquine (5mg / kg / day) initiated. a few days later, the patient 's condition improved gradually and the fever subsided. criteria for systemic lupus erythematosus the diagnosis of lupus is established by combination of clinical and laboratory manifestations. the company of 4 (serositis, arthritis, abnormal titer of anti - dna antibody, antinuclear antibody) of 11 criteria serially or simultaneously strongly suggests the diagnosis. patients who are suspect to have lupus, but show fewer than 4 criteria should receive proper medical treatment. a positive ana test is not necessary for diagnosis ; absence of ana in lupus is very rare. hypocomplementemia is not diagnostic, and very low levels or absence of total hemolytic complement suggests the likelihood of complement component insufficiency. having different pictures, lupus must be among the differential diagnoses of many problems, from fevers of unknown origin to arthralgias, anemia, and nephritis. the differential diagnosis depends on the presenting manifestation and affected organ and includes systemic - onset juvenile rheumatoid arthritis, acute poststreptococcal glomerulonephritis, acute rheumatic fever, infective endocarditis, leukemia, immune thrombocytopenic purpura, and idiopathic hemolytic anemia. sometimes the early presentation is atypical such as parotitis, abdominal pain, transverse myelitis, ordizziness. lupus should also be considered in patients with multiorgan involvement, especially in the presence of hematologic or urinalysis problems. clinical manifestations of sle include constitutional symptoms (fatigue, prolonged fever, anorexia, lymphadenopathy, weight loss), musculoskeletal (arthralgias, arthritis) cardiovas - cular, pulmonary (pulmonary hemorrhage, pleuritic pain), skin, renal, hematologic, neurologic (seizures, psychosis, stroke, cerebral venous thrombosis, pseudotumor cerebri, aseptic meningitis, chorea, global cognitive deficits, mood disorders, transverse myelitis, and peripheral neuritis (mononeuritis multiplex). on the sixth day of treatment our patient 's condition suddenly deteriorated. he was found in apparent respiratory distress, high fever, dyspnea and having an enlarged liver span. he was then transferred to picu, and cotrimoxazole, ceftazidim, and stress dose of hydrocortisone was initiated. other blood work test results in picu were as follow : trend of cbc tests in the patient in picu ferritin 8654 ng / ml (7 - 140), fibrinogen 1300 mg / dl (172 - 539), cholesterol 199 mg / dl (120 - 200), triglycerides 398 mg / dl (60 - 165), adenosine deaminase 18 u / l (0 - 15), calcium 8 mg / dl, na 127 meq / l (135 - 145), ast 57 u / l (up to 40), alt 24 u / l (up to 40), c - reactive protein 48 mg / dl (neg 500pg / ml suggests heart problems, < 100pg / ml suggests lung disease. the level of esr, creatine phosphokinase, lactate dehydrogenase, and bnp may be elevated in acute or chronic myocarditis. we expect that treatment with immunosuppressives along with antibiotics and supportive care, may cause the presenting critical condition to subside and also improve heart condition involved in the process of background disease. receiving medication for opportunistic infections, mas and supportive care, the patient 's respiratory distress and general condition improved gradually and he was transferred to rheumatology ward and after 2 weeks he was discharged with an appropriate regimen for sle. in long time follow up the disease went into reemission and treatment was reduced gradually. a flare up of the disease after 1.5 years forced to increase the drugs which could be decreased again after remission. after 3 years follow up, the disease is in remission and he is on low dose prednisolone (5 mg / daily) and hydroxychlroquine (100 mg / daily). the patient initially came to the emergency room with mild respiratory distress, pleuritic chest pain and other signs and symptoms that indicate a chronic disease. the initial evaluation revealed diminished growth pattern, bone pain, night sweating and fever, pleuritic dyspnea, high esr and serositis, which have a long list of differential diagnosis (cardiopulmonary, infectious, rheumato - logic and malignancies), but the chronic pattern of the illness made the malignancies less probable. the infectious causes were ruled out by laboratory tests, and soon after, the rheumatologic causes were taken into consideration. mas is a potentially fatal complication of childhood systemic inflammatory diseases [2, 3 ]. it can be one of the causes of secondary hemophagocytic lymphohistiocytosis (hlh) [3, 6 ]. this syndrome is characterized by excessive activation of t lymphocytes and macrophages and massive production of cytokines. the clinical presentation of mas includes persistent high fever, pancytopenia, hepatosplenomegaly, hepatic dysfunction, ence - phalopathy and coagulation abnormalities[2, 5 ]. mas can occur as a complication of rheumatic diseases or triggered by an infection or by a change in treatment regimen [2, 7, 8 ]. there are few case reports, that describe mas as the first manifestation of rheumatic and also kawasaki disease. abnormal immune system reaction and regulation that leads to the lack of control of an exaggerated immune response is one of the mechanisms suggested for mas. the diagnostic criteria for mas that complicates systemic juvenile idiopathic arthritis (s - jia), include decreased platelet count, elevated aspartate aminotransferase, decreased white blood cells, hypofibrinogenemia, central nervous system impairment, hemorrhages, hepatomegaly and histologic evidence of macrophage hemophagocytosis in bone marrow aspirates. it is also diagnosed in systemic lupus erythematous [11, 13 ]. in our patient, mas happened during the treatment of sle, and it should always be kept in mind, if the condition of a rheumatologic patient deteriorates acutely without any obvious reason rapid initiation of the treatment is very important and critical. | pleuritic pain is not an unusual problem in children. other concomitant symptoms should be considered for diagnostic approach in a child with pleuritic chest pain. in this report we discuss chest pain in a 6-year - old child with regard to other signs and symptoms. finally, we found a rare life - threatening complication of juvenile systemic lupus erythematosus (jsle) in our patient. |
a 24 y / o single, educated, mother is hesitant to have her 12 mo daughter vaccinated for measles, mumps and rubella (mmr) due to concerns of her developing autism. student objectives : to discuss the actual risks and benefits of the mmr vaccine and to debunk the link the between the mmr vaccine and autism by describing recent medical literature on the topic. a 7 y / o boy has been having more frequent asthma exacerbations and his divorced parents are arguing in the office over the situation and both are potentially at fault. student objectives : to manage the interview effectively keeping the patient s interest and not the parental issues at the center of the discussion. a 16 y / o healthy female (or male), from a middle - class background, comes to the office for a sports physical. the patient s social history is significant for increasing marijuana use, occasional sexual intercourse, and brief periods of depression in her past. student objectives : to gain the trust of the patient and to complete a thorough psychosocial history with interventional guidance as appropriate. | as medical students enter the role of physician, clinical outcomes not only rely on their mastery of clinical knowledge, but also on the effectiveness in which they can communicate with patients and family members. while students typically have numerous opportunities to practice clinical communication with adult patients, such practice in pediatric settings is limited. this study examines if simulated patient (sp) encounters strengthen third - year medical students communication skills during the pediatrics clerkship. during 2011 - 2013, three sp encounters (comprising 3 pediatric scenarios) were incorporated into a pediatrics clerkship at one united states medical school to give students a safe venue to practice advanced communication with observation and direct feedback. third - year medical students engaged in the scenarios and received both written and oral feedback from an evaluator observing the encounter. with irb approval, students self - perceived confidence and abilities at performing the advanced communication skills were measured using an eightitem, likert scale questionnaire administered pre and post the sp encounter. pre- and post - questionnaires (n=215 ; response rate, 96%) analyzed using a wilcoxon - matched pairs signed - rank test demonstrated statistically significant increases in students perception of their confidence and abilities regarding their performance (p<0.05 ; bonferroni correction, p<0.006). there was an increases in student confidence and self - perceived ability in : first, communicating with children and family members of young patients ; second, managing confrontational situations involving parents ; third, performing a thorough psychosocial history with an adolescent ; and fourth, using evidence based medicine to motivate parents. |
(1) patients may report dysuria, intermittency, haematuria, frequency, hesitancy, nocturia or sudden termination of voiding. a 62 year old lady presented to the hospital with a swelling in her right thigh. she had a past history of myelomeningocele spina bifida which had been closed at birth. she suffered from urinary incontinence and had been managed with long term suprapubic catheters for 20 years. she had required a vesicolithotomy via a midline incision and a vaginal hysterectomy 13 years previously. initial examination revealed a swollen right thigh and a calcified mass protruding through the skin in the right groin. a strong smell of urine was noted although it was thought that this was secondary to a leakage from around the site of her supra pubic catheter. laboratory data demonstrated normal renal function, a raised c - reactive protein and normal white cell count. due to her swollen right leg a deep vein thrombosis was excluded with an ultrasound scan and negative d dimer and plain radiographs of her right hip and pelvis were requested. a urology opinion was sought, initially, with regard to management of the suprapubic catheter. on closer examination, urine was noted to be leaking not from the suprapubic site but around the calcified mass in the right groin and a diagnosis of vesicocutaneous fistula was made. her radiographs demonstrated two urinary calculi (fig 1) and she went on to have an abdominal computed topography scan (fig 2) which confirmed the diagnosis of a vesicocutaneous fistula. plain radiographs demonstrating two bladder calculi ct demonstrating the two bladder calculi pointing towards the right groin vesicolithotomy was performed removing the calculi by enlarging the fistulous opening. (fig 3) two calculi measuring 40 mm 43 mm 30 mm and 43 mm 50 mm 33 mm were extracted. 4) the suprapubic catheter was changed and the fistula was left open and urine leakage continued to decrease in quantity until the fistula tract closed. intraoperative view of the bladder calculi emerging through the vesicocutaneous fistula into the right groin the two bladder calculi following extraction urological complications are often a major source of morbidity for these patients. (5) abnormal bladder sensation and function combined with sphincter dysnergia predispose the spina bifida patient to urinary stasis, recurrent urinary tract infections, stone formation and renal function impairment. (5) management of the problem can be difficult and may include the use of anti - cholinergics, intermittent self catheterisation (isc), supra pubic catheterisation or surgical intervention to allow urinary diversion. (6) increased fluid intake, weekly changes of indwelling catheters if isc is not possible and regular ultrasonic screening, to pick up stone formation at an early stage, may help reduce the burden of these problems. (2 - 4) predisposing factors to bladder stone formation include urinary stasis, bladder outflow obstruction urinary stasis, recurrent urinary tract infections and foreign bodies within the bladder (1), all of which can be seen in spina bifida patients. in our case the added sensory abnormalities secondary to spina bifida left the bladder calculus undiagnosed until it had formed the vesicocutaneous fistula. good control of the predisposing factors can dramatically reduce the risk of developing bladder calculi, but especially in cases where this is difficult, a high index of suspicion, regular urological review and timely uss can prevent the development of both the bladder calculus and its complications. | we present a rare case of a vesicocutaneous fistula secondary to two large bladder calculi in a patient with spina bifida. a 62 year old lady presented with swelling of her right thigh and a calcified mass protruding through the subcutaneous tissues of her right groin. urine was seen to be draining from around the area and plain radiographs and a computed topography (ct) scan confirmed the presence of two bladder calculi with a vesicocutaneous fistula. vesicolithotomy was performed and the fistula tract left to close spontaneously. worldwide this is only the fourth case of a bladder calculus causing a vesicocutaneous fistula. |
the plasma membrane serves as a highly dynamic platform for binding of peripheral membrane proteins and their complexes, a phenomenon that is involved in the regulation of a wide range of cellular and physiological processes, e.g., intercellular signaling, membrane trafficking, and coagulation. as the association of peripheral membrane proteins is often intended to be transient, these proteins have evolved specialized domains, termed membrane anchoring domains, which are responsible for reversibly binding to the membrane. these membrane - anchoring domains take advantage of different molecular strategies (various types of specific lipid protein interactions) in achieving membrane affinities tuned to the function of the proteins, although the binding can be broadly viewed as a combination of electrostatic interactions with (often anionic) lipids and hydrophobic interactions with the apolar core of the membrane. in many cases, membrane binding constitutes a step in the activation of the protein, a process which is chiefly controlled through modulation of the lipid composition of the membrane in specific areas. developing a molecular view of how membrane - anchoring domains interact with the membrane is therefore crucial to our understanding of peripheral proteins function. despite the high relevance of the phenomenon, due to technical challenges involved in obtaining high - resolution information on the process of membrane insertion / binding, there have been relatively few studies achieving atomistic details on the membrane - bound forms of peripheral proteins.(9) furthermore, different experimental approaches have often resulted in different membrane - bound models for the same anchoring domain, adding to the uncertainty of the problem. for instance, a variety of experimental techniques, including epr, fluorescent labeling,(12) and nmr,(14) have been utilized to characterize the membrane - bound forms of the c2 domain, a common anchoring domain in signal transduction and membrane trafficking of proteins. these experiments, however, have resulted in membrane - bound models ranging from 5.2 insertion and making an angle of 77 with the membrane normal to the domain being inserted 10 and making an angle of 52 with the membrane normal. the roles of the three ca - binding loops (cbl) and the -groove in membrane binding are also disputed.(16) similar discrepancies are found in the studies of the gla domains, the anchoring domain of vitamin k - dependent coagulation factors, where the relative orientation and depth of penetration into the membrane are largely disputed, and the fyve domain, where the membrane binding motif has not even been characterized. (clarification : gla refers to -carboxyglutamic acid ; gla refers to a gla - rich anchoring domain.) computational studies on membrane anchoring domains have proven equally difficult. in contrast to integral membrane proteins, whose membrane binding mode is fairly well understood, and for which even semiautomated insertion protocols exist, there are currently no robust methods to determine how deep and in what orientation a peripheral membrane protein will insert into a biological membrane, or even in some cases which residues comprise the membrane anchor. these anchors usually comprise a small portion of the anchoring domain and could be as small as a few amino acids, making the prediction of the anchors rather difficult. compounded further by the need of describing the protein s structural changes that are induced / accompanied by insertion into the membrane, especially with regard to the side chains in and around the anchor region, and the slow diffusion of lipid molecules around the insertion point, describing the process of membrane insertion has proven extremely challenging in simulation studies. of the small number of computational studies conducted on peripheral proteins, a majority have focused on only a handful of anchoring domains, namely, the bar, c2,(31) gla,(21) fyve,(32) px, and membrane binding domain of prostaglandin h2 synthase. naturally, most of these studies had to rely on initial embedding (partially or fully) of the anchoring domain into the lipid bilayer. while these studies have provided important information on how the anchoring domains might be stabilized within the membrane, they give little detail on the extremely dynamic process of insertion. modeling the membrane - bound form in these studies also requires a priori knowledge of the anchoring region (the anchor). in addition, manually embedding the protein in the membrane introduces biased sampling and might restrict the states available to the protein. however, in order to observe membrane insertion within the time scales accessible to molecular dynamics (md) simulations, these studies had to make use of methods such as implicit membranes, steered molecular dynamics (smd)(21) or relaxing the anchoring domain into a vacuum created by removal of lipids. furthermore, and most importantly, most of the computational studies investigating membrane binding of the anchoring domain at atomic resolutions are extremely costly, requiring at least 100s of nanoseconds of simulation time to observe relevant phenomena. thus, these (md) simulations are often too expensive to conduct multiple trials, collect sufficient statistics, and ensure the validity of the models proposed. in this study we have utilized the gla domain of human protein c (hprc) as a representative membrane anchoring domain to test the effectiveness and efficiency of a simple biphasic solvent, membrane - mimetic model in characterizing the nature of the membrane anchoring domain and in capturing and describing the process of hydrophobic insertion of membrane anchoring domains. during the coagulation cascade, activated protein c (apc) acts as an anticoagulant(40) helping to stop clot formation. hprc has a similar overall structure to other vitamin k - dependent coagulation proteins (figure 1a) containing a serine protease (sp) catalytic domain, two egf - like domains and the membrane - anchoring gla domain.(41) the structure of the hprc gla domain is very similar to the gla domains of other vitamin k - dependent hemostatic proteins such as factor viia (fviia) and prothrombin,(42) containing seven bound ca ions coordinated by nine gla residues (figure 1b). binding of these ca ions is necessary for the formation of an active tertiary structure, as this causes the conformational change necessary to expose the 11-residue hydrophobic -loop and prepare the anchoring domain for insertion into the plasma membrane. recent studies have also demonstrated that membrane insertion involves mainly the -loop and the bound ca ions, with the hydrophobic triad known as the keel forming the penetrating surface. structure of human protein c. (a) a general representation of hprc showing the relative positions of the gla anchoring domain, the two egf - like domains, and the catalytic serine protease (sp) domain. (b) the gla domain of hprc. the backbone is shown in gray while the seven bound ca ions are shown as yellow spheres and numbered according to the crystal structure of the gla domain of fviia.(69) the nine gla residues of hprc - gla are colored in cyan, and the hydrophobic residues of the keel are shown in red. the arrow represents the vector connecting ca-4 and the c of phe40 which was used to represent the gla domain s axis in subsequent angle calculations. this structure is the starting point for all the simulations in the biphasic solvent system. this report proposes a conceptually simple, but very efficient md - based method for characterizing the depth of hydrophobic penetration and obtaining initial membrane - bound models of anchoring domains in peripheral membrane proteins. after construction of a water / dcle (1,1-dichloroethane) biphasic system, multiple short simulation trials were performed to ensure the fidelity of the calculated properties of the organic phase to true experimental values.(49) the viability of this model as a membrane mimetic was then tested by placing the gla domain of hprc into the equilibrated biphasic system in multiple initial orientations with respect to the interface and performing unconstrained, equilibrium md simulations. these simulations consistently resulted in spontaneous penetration of the gla domain into the dcle phase with exactly the same anchor (the keel), and achieving the same final height and angle of membrane insertion in a few nanoseconds. it is apparent from these simulations that the keel plays a pivotal role in the insertion dynamics of this anchoring domain much as it does in fviia. it appears that dcle provides an optimal organic phase for the devised simplified membrane model, as employing several other organic solvents, including dimethyl sulfide (dms), ethyl propyl ether (epe), or heptane did not successfully capture the process of membrane insertion of the anchoring domain. to our knowledge, this study represents the first use of a biphasic solvent system to investigate the atomistic details of membrane insertion of the anchoring domains. the gla domain of hprc was placed into the aqueous phase of organic / water biphasic solvent systems in different initial configurations and simulated with all - atom md, in order to describe the process of its hydrophobic insertion and to determine the depth of its penetration into this membrane - mimetic model. in this section the details of the modeling steps and the protocols used for the md simulations while several different organic solvents were tested, dcle turned out to be the most effective solvent in terms of capturing the process of membrane binding and insertion of the studied anchoring domain. therefore, we will describe the modeling steps in detail only for the dcle / water biphasic model in the following, noting that similar protocols and procedures were employed when using other organic solvents. a single dcle molecule was constructed by exchanging two hydrogen (h) atoms for two chlorine (cl) atoms in an ethane molecule. the resulting structure was then relaxed in vacuo for 100 ps. a 60 60 60 box of dcle was then generated using the packmol program(50) replicating the relaxed dcle structure 1,578 times, in order to produce the correct density of this organic solvent. a similar 60 60 60 box containing 6,845 waters was generated and placed on top of the dcle box using the solvate plugin in vmd(51) to create a biphasic solvent system with final dimensions of 60 60 120 containing 34,000 atoms and with the interface normal aligned along the z - axis. this structure was then energy minimized and equilibrated for 2 ns using an npt ensemble with a target pressure and temperature of 1.0 atm and 310 k, respectively. similar procedures were employed when constructing biphasic solvent boxes composed of water and either dms, heptane, or epe. the resulting biphasic solvent boxes were used for all subsequent simulations. a partial structure of the gla domain of hprc(52) was taken from the rcsb protein data bank (pdb)(53) (pdb entry 1lqv) containing residues 133 of the protein segment and the seven bound ca ions. the missing eleven residues of hprc gla domain, comprising the c - terminal helix, were modeled using the bovine factor x gla domain(48) (pdb entry 1iod) and making the following mutations using the psfgen plugin of vmd:(51) a34v, 35d, q36d, d38l, 39a, and y44h (where stands for gla). the complete 44-amino acid hprc gla domain was then solvated in 10,263 water molecules and neutralized with 3 na ions using the solvate and autoionize plugins of vmd(51) to give the system final dimensions of 56 48 45 containing 11,000 atoms. the system was energy minimized and simulated for 50 ps under npt conditions (p = 1.0 atm, t = 310 k) during which all c atoms were harmonically constrained (k = 5.0 kcal mol). the resulting structure of hprc - gla was used as the initial structure for all insertion simulations. the equilibrated hprc gla domain was added to the aqueous phase of the equilibrated biphasic solvent system. the gla domain of hprc was then rotated and/or translated to produce a total of six different initial configurations for the dcle / water system. these initial configurations were chosen to represent a wide variety of height from the aqueous organic interface in addition to different orientations ranging from parallel with the aqueous organic interface to perpendicular to the aqueous organic interface. overlapping solvent molecules were then removed, and the resulting systems were simulated using the protocol below. for dms, epe, and heptane biphasic systems, only one initial configuration of the protein was used, namely, with the keel positioned 10 from the interface and the protein s axis (figure 1b) aligned with the interface normal. all simulations were performed using the namd2 molecular dynamics software,(54) utilizing both the charmm27 force field with / cross term map (cmap) corrections(55) and charmm36(56) (cgenff) set of force field parameters. all simulations were run under npt conditions with 1.0 atm as the target pressure, 310 k as the temperature, and the time step of 2 fs. constant temperature was maintained by langevin dynamics using a damping coefficient,, of 1 ps applied to all atoms. nonbonded interactions were cut off after 12 with a smoothing function applied after 10. the particle mesh ewald (pme) method(60) was used for long - range electrostatic calculations with a grid density greater than 1. an important aspect of all subsequent calculations was the determination of the water / dcle interface. this was done by first selecting a volume which is 5 on either side of the plane separating the aqueous and organic phases. the average z - coordinate for all dcle molecules within 2.5 of a water molecule was calculated and represented the interface. to calculate the depth of penetration of hprc - gla, the center of mass of the keel the depth of penetration of hprc - gla is defined as the z - coordinate difference between the center of mass of the keel and that of the interface. aqueous solubility was calculated by counting the number of dcle molecules that were both within 2.5 of water and farther than 2.5 from other dcle molecules in every frame. this was then averaged over the number of frames and divided by the equilibrated volume of water to give the number solubility, which was converted to g / ml of water to give the aqueous solubility. to determine the mobility of the various organic phases used, the self - diffusion constant, d, of each organic phase was calculated as the asymptotic value of the einstein relation : where r(t0) is the position of a molecule at time t0 and r(t0 + t) is the position of the molecule after time t. although, in actuality, t is limited by the length of the simulation, the value of d converged quickly (t < 10 ns). because the diffusion coefficient is calculated as a function of the time difference, t, the number of sample points decreases as t increases, thus making the final points in the diffusion calculation prone to error. therefore, the asymptotic value was calculated as the mean of the final 10 ns of the trajectory, excluding the last 5 ns. below the results obtained from modeling and simulation of various biphasic solvent models will be first presented. then, we turn our attention to the simulations in which insertion of an anchoring domain into the biphasic membrane was studied. as the dcle / water biphasic system was found to be the most effective model with regard to capturing the phenomenon of protein insertion, we will primarily discuss this model in the following section. the results obtained with other biphasic models and their performance will be discussed only briefly and using the dcle / water biphasic model as a reference. the main drive behind the design of a highly mobile membrane - mimetic model originates from a long - standing problem that we and others have been facing when studying protein insertion into lipid bilayers in simulation studies employing all - atom representations ; lipid molecules exhibit slow lateral diffusion, and respond very slowly to an inserting protein, resulting often in their insufficient relaxation within the time scales accessible to md simulations. one of the major factors contributing to the slow diffusion of lipid molecules within a bilayer environment is the long tails of the lipid molecules in a biological membrane, which tend to form highly disordered and entangled structures within the core of a bilayer. because organic solvent molecules are generally much smaller than lipid tails, they diffuse much faster, having a diffusion coefficient on the order of 10 cm s compared to 10 cm s for most lipids. faster diffusion will allow the organic phase to better accommodate the protein upon disruption of the interface, decreasing the time needed to simulate we therefore based our choice of a molecular representation of the hydrophobic core in our model on the criteria of size, aqueous solubility, phase at the desired simulation temperature (room or body temperature), and availability of force field parameters. with the release of the charmm general force field, cgenff,(56) most of the organic solvents available in cgenff, however, are either volatile at 310 k (e.g., acetone, methylene chloride, and ether) or are lengthy molecules which would not be optimal for constructing a highly mobile membrane - mimetic model. to determine the optimum solvent to be used in the biphasic solvent system, we tested four different organic species : dcle, dms, epe, and heptane. heptane was chosen due to its obvious similarity to the true membrane core and the fact that it is the smallest alkane which is liquid at the simulation temperature. additionally, the parameters were readily created by extending the existing cgenff parameters for pentane. dcle, dms, and epe were chosen due to their small size (between 8 and 16 atoms), their nonpolar nature (each with permanent dipole moments less than 1.83 d),(49) and the availability of parameters of easily adaptable analogues. since the fluidity of the solvent phase is a critical factor in determining the relaxation of the organic solvent in response to protein insertion, the self - diffusion constant (d) of the organic species was calculated (figure 2). out of the species tested, dcle clearly has the largest self - diffusion coefficient (d = (1.35 0.02) 10 cm s) with dms diffusing almost as rapidly (d = (1.24 0.01) 10 cm s). the larger species, epe and heptane, had much smaller self - diffusion constants (on the order of 10 cm s). the calculated diffusion constants suggest that the larger species will be less accommodating for the inserting protein. (left) plot of the self - diffusion coefficients d calculated for each species as a function of the time interval t ; asymptotic values were taken as the value of d. in the plot, the d at a specific time interval is given in green for dcle, orange for dms, purple for epe, and red for heptane. (right) molecular images of the organic species tested ; the outline of each molecule corresponds to the same color line on the plot. in fact, membrane insertion simulations clearly established the superiority of dcle over the other three tested organic solvents as the organic solvent in our biphasic membrane model. the anchoring domain was found to have difficulty inserting and/or staying inserted in these particular organic phases composed of heptane and epe, possibly due to the large size of the solvent molecules. for the case of the biphasic solvent system composed of dms, the protein only partially inserted into the dms phase ; full insertion and formation of a stable membrane - bound form was only observed in the case of dcle. we attribute this to the slight amphipathic nature of dcle, which includes both hydrophobic (methyl) and weak polar (dichloromethyl) groups in its structure, rendering it with the ability to establish either mode of interaction with various groups in a protein, thus representing a membrane more effectively in such a simplified model as the one used here. although, among the tested solvents, heptane is chemically the closest species to the core of a biological membrane, it completely lacks the ability of establishing partial polar interactions with the incoming protein, a factor that might have contributed to the inability of the biphasic heptane / water model in capturing membrane insertion of the anchoring domain. the distinct advantage that dcle has over a strictly nonpolar species is its permanent dipole moment that allows for charge dipole interactions between the solvent and the submerged portions of the protein backbone (figure 3). moreover, the methyl groups of dcle are able to surround the hydrophobic moieties of the keel (i.e., side chains of phe and leu in hprc gla domain), providing a locally hydrophobic environment (figure 3). the dipole moment together with the large diffusion coefficient allows dcle to adapt optimally and quickly to the insertion of protein. radial distribution functions g(r) are shown for chloride (purple) and methyl (black) groups for (a) phe4 side chain, (b) leu5 side chain, (c) leu8 side chain, (d) backbone oxygen of phe4, (e) backbone oxygen of leu5, and (f) backbone oxygen of leu8. arrows depict the position of the first peak for each distribution. after simulating the dcle / water biphasic solvent system for 2 ns, the density of the system was calculated to be 1.14 0.05 g / ml, which shows good agreement with the accepted value of 1.2 g / ml (table 1).(49) for a consistent interface to be maintained, the aqueous solubility of dcle needed to be modeled very well by this system, and indeed, it was. the accepted value for the solubility of dcle in water is 8.6 10 g / ml.(49) over the 2 ns trajectory, we obtained an aqueous solubility of (9.89 2.9) 10 g / ml, which agrees with the accepted value reported in table 1.(49) in addition, figure 4 shows how well the interface is maintained ; the steep density gradients on either side clearly indicate the separation of dcle and water at the interface. thus, the physical properties of dcle vital to this study were reproduced in the simulations. during the equilibration, the dcle solvent box did experience a small amount of shrinkage, but equilibrated to 86% of its original size within 89 ps. the z - dimension shrank 5 and fluctuated 0.5 around its equilibrated value. the freedom of the organic phase in modulating its dimension will be an added advantage of the biphasic system when used for integral proteins / peptides, as it will ensure an optimal match of the thickness of the hydrophobic layer to the inserted protein. calculated every 2 ps for the duration of the trajectory with the arithmetic mean and standard deviation displayed. experimental value found in lide.(49) the density of dcle (solid curve) and water (dashed curve) phases averaged over the simulation period of 2 ns. the dotted line at x = 0 represents the approximate location of the dcle / water interface. a common problem encountered when studying the membrane - bound forms of anchoring domains is the multitude of atomic models proposed, which seem to depend heavily on the initial orientation and position of the anchoring domain with respect to the membrane. thus, we wished to test the ability of the reduced membrane model (dcle / water biphasic model) to consistently reproduce a single equilibrium structure by simulating a variety of initial orientations. the six initial configurations chosen to test the viability of the biphasic solvent system as a model for membrane insertion are shown in figure 5. these particular initial configurations display a variety of heights from the aqueous organic interface, as well as a spectrum of angles ranging from parallel with the interface normal to perpendicular to the normal. the green surface represents the dcle volume while the water is implied in the empty space. the labels found in each box will be adopted throughout the text to simplify discussion of these systems. the time evolution of the height of the gla domain from the interface over the entire 30 ns course of the simulations is displayed in figure 6. it is clear from the plot that each initial configuration converges to a height of 2.20 1.04 (table 2) within a few nanoseconds and fluctuates slightly around this equilibrium point for the remainder of the simulation (figure 6). the angle with respect to the interface normal also converges at approximately the same rate to 23.37 12.48 (figure 6) ; figure 7 displays the converged structure of hprc gla domain (snapshot taken at t = 29 ns). as expected, the 60 and 90 trials were the slowest to insert, since they needed more time in solution to explore and find an optimal orientation toward the interface. this rate of insertion corresponds to at least 1 order of magnitude increase in the speed of insertion over previous studies, making this method more accessible to md simulations. in the simulation study of fviia anchoring,(21) the gla domain fluctuates 5 around its equilibrium height ; in this study, we see a similar degree of fluctuation around the equilibrium height. the plot of the domain s angle to the interface normal, however, shows a greater variability which is likely due to the absence of headgroup specific interactions with the anchoring domain. ohkubo and tajkhorshid(21) have demonstrated that the seven bound ca ions of the hfvii gla domain interact significantly with the phosphate groups of the lipid headgroups resulting in the stabilization of the membrane - bound complex. this effect is clearly missing from our model, resulting in a larger degree of fluctuation of the domain at the interface. we note that specific contacts between the lipid headgroups and peripheral proteins are of utmost importance in interaction of proteins such as the ras family and ferm domain(66) with the membrane. these interactions are not represented by the simple model used in our simulations, and while the model appears to be very efficient in determining mostly hydrophobic interactions, it is not able to describe specific lipid protein interactions. (top) the height of the keel c atoms above the dcle / water interface, which was assumed to be the average position of the first layer of dcle molecules in contact with water. (bottom) the angle between the gla domain s axis, determined by the vector traced from the ca-4 and the c of phe40 (see figure 1), and the interface normal (z - axis). the colors used in these plots correspond to the outline around each orientation found in figure 5. height was determined by taking difference of the center of mass of keel residue backbone atoms and instantaneous interface z - coordinate. interface normal was taken to be z - axis ; gla domain axis was chosen to be the vector from ca-4 to the c of phe40 (figures 1b and 7b). depiction of the hprc gla domain at t = 29 ns. in this figure, the green represents dcle, the white represents water, the protein backbone is depicted in gray, and the keel residues are shown in red. (a) figure shows a side view of the gla domain with its average height above the interface of 2.20 1.04. (b) figure shows a front view of the gla domain together with the interface normal and the defined protein axis ; the equilibrium angle of the protein was found to be 23.37 12.48. (c) a front view of the fully inserted hfviia gla domain.(21) (b) and (c) demonstrate that the equilibrium structure of the inserted gla domain using the biphasic solvent system is comparable to the structure obtained using an all - atom representation of the membrane. in close agreement with previous simulations of the fvii gla domain,(21) we observed a similar mechanism by which both fviia and hprc gla domains insert into the hydrophobic layer. no matter what angle the anchoring domain initially makes with the interface normal, it has an apparent grab - and - pull motion. the keel approaches the interface at an angle until phe4 inserts itself into the hydrophobic volume ; this is followed by a domino - like falling of the other two keel residues into the organic phase which coincides with the domain standing up and the angle between the domain and the interface normal decreasing. capturing the insertion dynamics is important to the study of anchoring domains, and the observed dynamics of hprc - gla provides further qualitative support for the ability of the model to capture similar phenomena to those obtained from full membrane simulations. energetic analysis of the interaction between the gla domain and the organic phase of the membrane mimetic model clearly indicates that nonpolar interactions are the main driving force for association and insertion of the gla domain into the organic phase. using the last 5 ns of each of the six membrane insertion simulation of the gla domain into the dcle / water biphasic system, an average electrostatic interaction of only 11 kcal / mol between the gla domain and the organic phase is calculated, whereas the van der waals component of the interaction energy amounts to more than 47 kcal / mol. membrane binding of peripheral proteins is a key step in regulating their activity in physiological processes as diverse as endosomal trafficking and hemostasis. these proteins have evolved specialized anchoring domains, which play a pivotal role in recognition of specific membrane regions and the proteins subsequent binding and insertion. however, given the fluid nature of the membrane and the reversible nature of the binding process, current experimental techniques have not been able to conclusively determine the relative depth and orientation of the membrane - bound forms of these anchoring domains. there still remains an ongoing debate on depth of penetration, equilibrium angle, and even the identity of the domains involved in anchoring these proteins. limitations to the time scales accessible by md simulations have also made computational studies of membrane anchoring domains very challenging. in this paper, we present, to our knowledge, the first use of a biphasic solvent model as a simple representation of a membrane to identify the membrane - interacting portion and to investigate the membrane - bound orientations of anchoring domains. the developed biphasic solvent model is demonstrated to be an efficient method to probe a protein and to determine the specific moieties involved in membrane penetration. the model is computationally very efficient, owing to purposefully keeping the size of the molecular species composing the hydrophobic core (organic phase) small, an aspect which is in contrast to previously reported models used to represent simplified membranes, e.g., octanol / water phases. at the same time, since the model remains atomistic, one does not have to be concerned with the potential complications of coarse - grained and/or multiscale representations, or shortcomings arising from implicit representations of membrane and water. throughout our multiple trials sampling a variety of initial orientations and positions of a gla domain (the anchoring domain of vitamin k - dependent coagulation proteins), the keel residues of the domain, known to be the membrane penetrating residues, were consistently found to be the only residues which spontaneously inserted into the organic solvent within a few nanoseconds, demonstrating their unique affinity for the hydrophobic core. in addition to identifying the anchor, this model also allows for rapid analysis of the depth of penetration of the anchoring domain and equilibrium angle relative to the interface normal. a clear advantage of the method over static analysis of hydrophobic surfaces of proteins is related to the dynamical description of the process during which conformational changes of the protein can be induced due to interaction with the hydrophobic phase. in addition to hydrophobic insertion, which constitutes an important and necessary mode of interaction for membrane - anchoring domains, it is well - known that specific interactions with lipid head groups form another critical set of interactions for these proteins. lipid head groups are very important in the process of reversible membrane binding by membrane anchors, and in many cases they control whether or not a peripheral protein should bind the membrane. such specific protein we note, however, that the final structures obtained from the biphasic solvent model simulations can be used to construct models of membrane - bound proteins with accurate full membrane representations. the biphasic system can be used to efficiently identify how deep the protein penetrates into the membrane s hydrophobic core, thereby providing a guide for placement and modeling of the protein in a full membrane system. by aligning the interfacial region of the full lipid bilayer to the aqueous organic interface in the biphasic model, one can maximize the overlap between the hydrophobic regions of the two representations, thus ensuring an optimal initial insertion of the protein into the hydrophobic core of the full membrane. work is in progress to add specific representations of the lipid headgroup to our biphasic solvent model while keeping the simulation times necessary to capture spontaneous membrane binding still on the nanosecond time scale.(67) once completed, the model will provide a platform for more detailed computational studies on the variety of molecular mechanisms used by anchoring domains to bind to the membrane. | membrane binding of peripheral proteins, mediated by specialized anchoring domains, is a crucial step for their biological function. computational studies of membrane insertion, however, have proven challenging and largely inaccessible, due to the time scales required for the complete description of the process, mainly caused by the slow diffusion of the lipid molecules composing the membrane. furthermore, in many cases, the nature of the membrane anchor, i.e., the part of the protein that inserts into the membrane, is also unknown. here, we address some of these issues by developing and employing a simplified representation of the membrane by a biphasic solvent model which we demonstrate can be used efficiently to capture and describe the process of hydrophobic insertion of membrane anchoring domains in all - atom molecular dynamics simulations. applying the model, we have studied the insertion of the anchoring domain of a coagulation protein (the gla domain of human protein c), starting from multiple initial configurations varying with regard to the initial orientation and height of the protein with respect to the membrane. in addition to efficiently and consistently identifying the keel region as the hydrophobic membrane anchor, within a few nanoseconds each configuration simulated showed a convergent height (2.20 1.04) and angle with respect to the interface normal (23.37 12.48). we demonstrate that the model can produce the same results as those obtained from a full representation of a membrane, in terms of both the depth of penetration and the orientation of the protein in the final membrane - bound form with an order of magnitude decrease in the required computational time compared to previous models, allowing for a more exhaustive search for the correct membrane - bound configuration. |
inversion traction (it) is a form of spinal traction in which the body is maintained in an inverted position so that back problems can be prevented and cured1. specifically, it provides the spinal column with traction force using the body s weight. the force of the body s weight in the it position is usually calculated as approximately 40% of the body s overall weight2 ; this depends on the user s body weight and the traction angle. unlike automated mechanical traction, it is difficult in the case of it to adjust the traction force because the traction angle is set by the users themselves. thus, it places excessive traction force on the spinal column. in the it process the muscle spindles arranged parallel to the muscle fibers are then stretched, and -motor neurons are stimulated by the stretch stimulus signal from the muscle spindles through the ia and ii sensory nerves. although muscle tension works as a muscle guard to protect the muscles, persistent muscle guarding restricts blood flow and causes muscle fatigue3. recently, wang.5 reported that it causes muscle fatigue in the lumbar erector spinae. it can be deduced from this finding that it prevents the lumbar erector spinae from relaxing. however, the study of wang.5 did not provide any information on it in the case of inversion above 30, mainly because it was performed at an inverted angle below 30 in the study. moreover, previous studies insisting that it helps to relax the lumbar erector spinae are controversial6, 7. however, there is no doubt that it can prevent relaxation of the lumbar erector spinae. in a study by vernon.6 on it, 19 subjects showed increased paraspinal electromyographic activity. accordingly, the current study analyzed the electromyographic activities of the lumbar erector spinae resulting from the application of an it traction angle of over 30. based on the results, we investigated whether it can help in the relaxation of the lumbar erector spinae. in this study, the subjects comprised 60 healthy male adults with no history of musculoskeletal or neurological system disorders. the mean age, weight, and height of the subjects were 23.022.10 years old, 70.7710.14 kg, and 174.285.95 cm, respectively. all subjects were equally and randomly assigned to a 3030 group, a 3060 group, and a 6060 group depending on the angle of it applied. all the subjects listened to a detailed explanation about the study s methodology, safety matters concerning the progression of the study, and bio - information protection before voluntarily consenting to participate in the study. this study was approved by the bioethics committee of the catholic university of pusan (cupirb-2015 - 027). the subjects were positioned horizontally on a table - form it device (tb2015-h1, the ban, namyangju, republic of korea) and remained resting in a supine position for 10 minutes. after resting, for example, in the case of the 3060 group, it was first performed at 30 of inversion for three minutes, followed by a further three minutes at 60of inversion. inversion was performed on the 3030 group and the 6060 group in the same way. to evaluate the muscle activities of the lumbar erector spinae, electromyographic signals were collected at a sampling rate of 1,000 hz using an electromyography system (lxm3204, laxtha inc. the root mean square (rms) values were calculated using the telescan software (laxtha inc., daejeon, republic of korea) after being processed with a 60 hz notch filter and a 50500 hz band - pass filter. the muscles were the lumbar erector spinae on both sides of the lumbar spine (l2, l4)8. the paired t - test was used to compare the significance of the differences in rms values between the pre - it and post - it values. one - way anova and scheff s post hoc test were used to compare the significance of the differences in rms values between the groups. the rms at the l2 and l4 levels on both sides were statistically significantly higher after it compared with before it (p<0.01). after it, the rms values at the l2 and l4 levels on both sides in the 3060 group and 6060 group were significantly higher than those in the 3030 group (p<0.01). before it, there were no significant differences between the groups in terms of rms values at the l2 and l4 levels on both sides (table 1table 1.changes in rms values after itgroupbefore itafter itl2 left (v)30305.312.087.853.5030605.651.8412.704.1560605.502.0212.175.79l2 right (v)30306.873.058.993.6630606.441.2113.053.6360606.611.7112.464.73l4 left (v)30304.181.667.043.5930604.380.7811.783.8560605.062.4211.495.44l4 right (v)30306.132.158.363.5330605.951.1012.143.5360606.201.7011.243.80p<0.01, values with different letters in a column are significantly different by scheffe s test). p<0.01, values with different letters in a column are significantly different by scheffe s test inversion traction is a widely used conservative treatment for low back pain conditions (e.g., degenerative or herniated discs, spinal stenosis, or other spinal conditions). it provides pain relief, muscle relaxation, and distraction of vertebral column1, 6. however, the paraspinal muscles generally provided resistance against spinal traction. a traction force of at least 25% of the body s weight is necessary to achieve distraction of the lumbar vertebrae against muscular resistance9. the force of it applied is usually approximately 40% of the overall body weight2. the applied traction force places a direct stretching load on the paraspinal muscles, and this load elicits increasing muscle tension. our study also produced a similar result, and we verified increased muscle activities of the lumbar erector spinae after it. these results concur with those of a study by wang.5 showing that it causes muscle fatigue. although the study by wang.5 only examined an it angle of less than 30, it was clear from our study that it can not help to achieve relaxation of the lumbar erector spinae in our study. however, previous studies have clearly stated that it can help with relaxation of the lumbar erector spinae6, 7. in addition, these studies noted that it decreases electromyographic activities of the lumbar erector spinae, but this was not found in our study. moreover, the previous studies measured electromyographic activities during it, and this was the reason why the electromyographic activities were considered to have decreased. during the process of it, the induced accommodation, in turn, affects the response of the stretching load, and electromyographic activities decrease as time passes. for these reasons, we compared the rms values after it with the rms values before it in order to examine changes in muscle tension. this method was used in a study by acedo.11, and like that study, we were able to obtain results showing changes in muscle tension. after it, the rms values of the lumbar erector spinae in the 3060 group and 6060 group were higher than those in the 3030 group, and there was no difference between the 3060 group and the 6060 group. in other words, muscle tension increased by it was affected by the size of the traction angle rather than the process of traction angle application. in a study by cholewicki.12, there was no difference between the electromyographic activities of the lumbar erector spinae during several types of traction, when the same peak torque was applied by spinal traction. in the case of it, the traction force depended on the user s body weight and on the traction angle. accordingly, it was affected by the size of the traction angle rather than the process of traction angle application. therefore, the size of the traction angle should be fully taken into account and applied very carefully in prescribing it. in this study, the subject was comprised of healthy male adults, so the results of this study were limited to a healthy population. however, muscle tension will be increased by it in any other population, as it also lengthens paraspinal muscles in any other population. the aspects of the change in muscle tension will be different depending on the pathological symptoms or conditions of the subject. therefore, we suggest that it need not be applied if it does not aid in the relaxation of the lumbar elector spinae. | [purpose ] the purpose of this study was to analyze changes in the electromyographic activities of the lumbar erector spinae caused by inversion traction in order to verify the relaxation effect. [subjects and methods ] the subjects included 60 healthy male adults who were equally and randomly assigned to a 3030 group, a 3060 group, and a 6060 group. inversion traction was performed for six minutes, and the electromyographic activities of the lumbar erector spinae (l2, l4) were measured before and after inversion traction. [results ] the root mean square values at the l2 and l4 levels on both sides were statistically significantly higher after inversion traction compared with before inversion traction. before inversion traction, the root mean square values at the l2 and l4 levels on both sides in the 3060 group and 6060 group were significantly higher than those in the 3030 group, while the root mean square values at the l2 and l4 levels on both sides showed no significant differences between the groups before inversion traction. [conclusion ] the findings of this study indicated that it is more likely to elicits an increase in muscle tension and prevent relaxation of the lumbar erector spinae. |
patients or individuals may not respond in similar ways when administered with the same drug in a standard dose. both genetic and non - genetic factors including age, gender, nutrition, concomitant medications, organ function however, to a great extent the inter - individual variability in drug response is attributable to the presence of single nucleotide polymorphisms (snps) in the sequence of the genes encoding proteins that are involved in the absorption, distribution, metabolism and excretion (adme) of many therapeutic agents, toxins and various pollutants23. the pharmacogenetics and pharmacogenomics (pgx) predicts disease risk, selection of proper medication with regard to response and toxicity, and appropriate drug dosage guidance based on an individual 's genetic make - up4. genetic variations in genes encoding adme proteins have been associated with marked inter - individual variability in drug response, toxicity as well as disease susceptibility. the variation can occur at various levels of adme as well as in drug action. presence of snps in genes encoding drug metabolizing enzymes (dme) can cause the alteration of the enzyme leading to normal, reduced, increased or absence of activity. based on this level of enzyme activity, patients can be divided into four phenotypes : (i) poor metabolizer (pm) - no activity ; (ii) intermediate metabolizer (i m) - reduced activity ; (iii) extensive metabolizer (em) - normal activity ; and (iv) ultra - extensive or ultrarapid metabolizer (um) increased activity24. polymorphisms exhibited by these dmes and transporters are well known and their prevalence varies among different ethnic populations4. therefore, the knowledge of genetic variations is essential to understand the ethnic differences in disease occurrence, development, prognosis, therapeutic response and toxicity. before unraveling the genotype - phenotype associations in a particular population, it is of paramount importance to establish the normative frequency of these genes. in recent years we have performed pharmacogenetic studies on clinically important genes and established their normative frequencies in south indian populations567891011121314. since the indian populations are highly heterogeneous in nature, our results could not be extrapolated to the entire indian population. india is the world 's second most populous country and inhabited by more than 1.21 billion humans comprising 4,693 communities, 325 languages and 25 scripts1516. there is extreme diversity in terms of culture, biological, social characteristics, language and religion in indians and genetically they are unique from other races. based on their ethnic origin, the caucasoid and protoaustraloid are the most predominant populations, mostly confined to northern and southern india. the mangoloids live along the himalayan fringe of jammu and kashmir and north - eastern region of the country, whereas the negritos limited to andaman islands alone. in the same way, on the basis of their linguistic lineages the languages spoken in india belong to four major families : austro - asiatic (central & east india), dravidian (south india), indo - european (north india) and tibeto - burman (north - east india)1617. the indian populations have been characterized as ancestral north indians (ani) and ancestral south indians (asi) on the basis of their ancestry components17. the authors have also shown that unlike the ani, the asi are not genetically close to any of the contemporary population outside india17. a recent indian genome variation consortium (igvc) study of genetic markers in 55 diverse indian populations revealed high heterogeneity among the dravidian populations and showed dissimilarity with hapmap populations16. the indian population comprised multiple ethnic groups but there have been no published data available on the allele frequencies of these genes for indians. hence, we compiled the frequency distribution of the variants of genes encoding drug metabolizing enzymes and drug transporters, with indian perspective. we compiled the normative frequency data of dme and transporters in various geographical regions of india reported from different studies and pooled them as north indians (ni), south indians (si) and north east indians (nei) based on their ancestral ethnicity. furthermore, we also compared the pooled mean allele frequency of indian populations with the data from previous reports in africans, asians and caucasians. a keyword literature search of the articles published (up to june 2012) on genes encoding drug metabolizing enzymes and drug transporters in indian populations was done from databases such as pubmed, medline and google scholar. the following search terms were used : cyp450, cyp1a1, cyp1a2, cyp2a6, cyp2c8, cyp2c9, cyp2c19, cyp2d6, cyp2e1, cyp3a, cyp3a4, cyp3a5, gsts, gstm1, gstt1, gstp1, ugts, sult1a1, sult1a2, comt, nat1, nat2, mdr1 or abcb1, oct1 or slc22a1, slco1b1 or oatp1b1 transporters, dme and adme in combinations with words polymorphism or variation, pharmacogenetics, pharmacogenomics, india, south indian, studies with the following inclusion criteria were included (i) original papers carried out in native indians, (ii) studies containing data on unrelated healthy individuals, (iii) with information on normative genotype or allele frequency distribution, and (iv) well defined ethnicity. the reasons for exclusion of studies, were (i) overlapping data, (ii) family - based studies, (iii) meta - analysis, (iv) studies on non - residential indians, and (v) studies that did not report genotype or allele frequency. ethnicities were categorized as ni, si, and nei based on their geographical origin. when more than one publication was available for a gene snp frequency for the same population from the same group, only the study with highest total number of subjects was included to avoid bias and overlapping data. enzymes involved in phase i drug metabolism largely belong to the cytochrome p450 (cyp) super family of drug metabolizing enzymes which catalyze the reactions such as hydrolysis, oxidation and reduction in which the functional groups of a substrate are added or deleted. this cyp450 system is divided into 18 families and 44 subfamilies consisting of 57 genes and 58 pseudo genes. among them, the oxidative metabolism of 90 per cent drugs has been controlled by cyp1, cyp2 and cyp3 subfamilies18. the allele frequency distribution of phase i enzymes in various indian populations is described in table i7891113192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263. allele frequencies (%) of genes encoding phase i drug metabolizing enzymes (dme) in various indian populations cyp1a (cyp1a1 & cyp1a2) : human cyp1a belongs to the group of phase i dme cyp450 isoforms. these are the key enzymes in the biotransformation of estrogens, polycyclic aromatic hydrocarbons and aromatic amines. in addition, cyp1a2 is also involved in the metabolism of a number of therapeutic drugs including caffeine, clozapine, olanzapine, amitriptyline, r - warfarin, veramapil, theophylline, propranolol, clomipramine, imipramine, haloperidol and acetaminophen. the gene encoding cyp1a1 is located at 15q22-q24, spanning 5,810 bp with seven exons and six introns. while the gene encoding cyp1a2 is located at 15q22, extending 7.8 kb with six exons and so far, polymorphisms in these genes lead to variability in the enzyme activity and is shown to be associated with various cancers such as colon, ovarian, breast, lung, oral and acute lymphoblastic leukaemia (all). the most common being cyp1a1 2a or m1 (3798t > c), also known as msp1, cyp1a1 2c or m2 (2455a > g), cyp1a1 3 or m3 (3204t > c) and cyp1a1 4 or m4 (2452c > a) polymorphisms for cyp1a1. for cyp1a2, the frequency of the mutant alleles cyp1a1 2a and cyp1a1 2c were significantly (p a, leu160his), 4a (gene deletion), and 5 (1436g > t and 6582g > t, gly479val) have been well known. the frequency data of cyp2a6 1b polymorphisms are available only for ni43 and similarly cyp2a6 2 and 5 are available only in si populations13. among the cyp2a6 variants, 1b is the most prevalent allele followed by 4, whereas 2 and 5 were found to be rare (table i). the comparison of cyp2a6 1b between ni (32.7%) and other populations indicates similarity with caucasians (27.6%) and significant difference with africans 11.2 per cent and asians 42.8 per cent (p t, i269f), cyp2c8 3 in exons 3 and 8 (416g > a/1196a > g, r139k / k399r), cyp2c8 4 in exon 5 (792c > g, i264 m) and cyp2c8 5 (475dela). the enzymes encoded by these variant alleles impair the metabolism of several drug substrates of cyp2c8. subjects who are homozygous (2/2 or 3/3) have lower intrinsic clearance of cyp2c8 substrates than those who are heterozygous (further, the polymorphisms of cyp2c8 have been associated with diseases such as myocardial infarction (mi)80. the only study which determined the frequency distribution of cyp2c8 alleles in any of the indian population was carried out in si tamilians11 with a frequency of about 0.8 per cent (95% ci 0.2 - 2.1) and 2.9 per cent (95% ci 1.6 - 4.7) for cyp2c8 2 and 3, respectively (table i). population studies from around the world in different populations indicate that cyp2c8 2 variant is rare in si and caucasians, whereas it is a common variant among africans. allele cyp2c8 3 is a common variant in caucasians while it occurs either at small frequency or not present in si and africans. with regard to asians subjects, the cyp2c8 polymorphism was monomorphic for cyp2c8 cyp2c9 : drugs undergoing oxidative metabolism such as s - warfarin, rosiglitazone, tolbutamide, phenytoin, glyburide, glibenclamide, glimepiride, glipizide, losartan, irbesartan, torsemide, tamoxifen, fluvastatin, fluoxetine, amitriptyline and other commonly used anti - inflammatory drugs (diclofenac, ibuprofen, naproxen, piroxicam, aceclofenac, celecoxib) have been described to be principally metabolized by cyp2c9848586. it is encoded by the gene cyp2c9, which is located on chr10q24.2. among the cyp2c isoforms, cyp2c9 is the most abundant one and constitutes about 20 per cent of total cyp450 hepatic content85. the gene cyp2c9 is known to be polymorphic and inter - individual differences in the enzyme activity of cyp2c9 categorize subjects into ems, ims and pms. among the many variants, cyp2c9 2 (430c > t, arg144cys) in exon 3 and cyp2c9 3 (1075a > c, ile359leu) in exon 7 are the most characterized alleles and individuals with these variant alleles are reported to have decreased cyp2c9 activity. these variants are reported to be associated with acute mi, hypertension, colorectal cancer and major depressive disorders ; also with certain adverse drug reactions including gingival hyperplasia, hypoglycaemia and gastrointestinal bleeding. in addition, a number of other alleles such as cyp2c9 5 (1080c > g, d360e), 6 (818adel), 9 (752a > g, h251r), 11 (1003c > t, r335w) and 12 (1465c > t, p489s) may cause impaired metabolism, which may give rise to life threatening drug toxicity and may have impact on drug metabolism and disease susceptibility646684. the prevalence of cyp2c9 2 was significantly different between ni and si (9% vs. 3.6%, p a) and cyp2c19 3 in exon 4 (636g > a) have diminished ability to metabolize therapeutic agents that are substrates of cyp2c196684. the cyp2c19 2 allele notably occurred at a higher frequency among the indian populations (ni 33.1% and si 36.8%) than africans 16 per cent, caucasians 13.3 per cent and slightly higher than asians 28.4 per cent (p t, -340c > t) increases the activity of cyp2c19 protein resulting in ultrarapid metabolism of cyp2c19 substrates66. the ultrarapid metabolizer cyp2c19 17 was studied only in si tamilians14 with a frequency of about 19.2 per cent (table i). the comparison of si subjects with asian individuals indicates significant difference in um allele, p t;4180g > c) in exon 2 and 6, 3 (2549dela) in exon 5, 4 (1846g > a in intron 3 - exon 4 junction), 5 (whole gene deletion), 10 in exon 1(188c > t, p34s), 14 (1758g > a), 17 (1023c > t ; 2850c > t) in exon 2 and 41 (2988g > a) variants were the most characterized alleles of cyp2d666. the frequencies of the defective alleles in different races vary widely. apart from pms, ims individuals also had been classified as ums of cyp2d6 substrates depending upon the presence of cyp2d6 allele combinations. pms are those who carry two defective alleles (inactive enzyme), resulting in increased concentrations of the parent drug in plasma, whereas in the case of ums, as a result of gene duplication individuals carry more than two copies of the functional gene leading to increased enzyme activity, resulting in decreased parent drug concentration in blood96. the dosage recommendation is based upon the cyp2d6 genotype for drugs that are substrates of cyp2d6 in order to avoid both treatment failure and adverse drug reaction. of the five variants which contribute to the loss of cyp2d6 activity (3,4, 5, 6 and 14), only 14 was not detected in indian populations. similarly, the other variants (9, 17 and 29) leading to diminished enzyme activity were also not found in indians. the functional allele cyp2d6 2 was most prevalent in indians which was found at comparable frequencies between ni (29.3%) and si (34.8%). both the indian populations showed significant difference compared with asians and caucasians (p a) is the only defining variant of cyp3a4 reported at present. subjects carrying the defective alleles of cyp3a4 have been implicated in disease predisposition to prostate cancer, estrogen receptor negative breast cancer and type 2 diabetes mellitus106. the frequency of cyp3a4 1b was available in ni (1.2%) only and the comparison between ni and other populations indicates significant variations (p 50 per cent of currently used drugs. it shares about 85 per cent of amino acid sequence identity with cyp3a4 but it has different degrees of catalytic activity and regioselectivity towards substrates105. kuehl have demonstrated that at least one cyp3a5 1 allele is needed for expressing cyp3a5 protein. they have identified cyp3a5 3 (a to g at 6986) in intron 3 and cyp3a5 6 (g to a at 14690) in exon 7, which led to the absence of cyp3a5 protein 6986a allele (cyp3a5 1) was before correlated with high expression107. further, two more variants in the coding regions viz.,2 (27289c > a, thr398asn) in exon 12 and 4 (14665a > g, gln200arg) in exon 8 were identified. cyp3a5 may represent upto 50 per cent of the total hepatic cyp3a content in people expressing cyp3a5105106. this gene may be an important contributor to individual and inter - racial variation in cyp3a mediated metabolism of drugs including antipsychotics (olanzapine), antiestrogen (tamoxifen), anticancer (irinotecan, docetaxel, vincristine), antimalarial (mefloquine, artemether, lumefantrine), immunomodulators (tacrolimus, cyclosporine), antihistamines (chlorpheniramine, terfenadine, astemizole), antiplatelets (clopidogrel), antihypertensives (nifedipine, amlodipine, felodipine, verapamil), antivirals (indinavir, nelfinavir, ritonavir, saquinavir), hmg - coa reductase inhibitors (atorvastatin, cerivastatin, lovastatin) antibiotics (clarithromycin) and steroids (testosterone, estradiol, progesterone and androstenedione). the presence of non - functional polymorphic alleles of cyp3a5 has been associated with blood pressure, mi, breast cancer and acute myeloid leukemia (aml) or all106. in indians, none of the other variants 2, 4 and 6 were identified in indians (table i). the frequency of cyp3a5 3 in si 56 per cent (95% ci 53.5 - 58.5) was significantly different (p g was observed only in ni45 34.7 per cent which was higher than caucasians 9.2 per cent (p 7 (ugt1a1 28) polymorphism in the tata element of the 5promoter region. it is characterized by (ta) 7 repeats instead of more common (ta) 6 repeats, resulting in lower promoter activity. it is the genetic basis for several clinical conditions such as, mild unconjugated hyperbilirubinemia associated with reduced hepatic bilirubin glucuronidation (gilbert syndrome) and irinotecan mediated toxicity142143. irinotecan, an inhibitor of intracellular topoisomerase - i is metabolized to form active sn-38, which is further conjugated and detoxified by ugt1a1 enzyme143. the only study which determined the frequency of ugt1a1 28 in native indians was carried out in si12 namely, andhra pradesh 32.2 per cent, karnataka 29 per cent, kerala 46.5 per cent and tamil nadu 52.8 per cent (table iii). significant differences in the frequencies of this variant were observed in si 39.7 per cent, as compared to africans 55.3 per cent, asians 13.1 per cent and caucasians 29.6 per cent, p c),3a (460g > a and 719a > g),3b (460g > a) and 3c (719a > g) are the four major variant alleles that cause 80 - 95 per cent intermediate and low enzyme activity. carriers of theses alleles have been shown to have clinical implications with respect to metabolism, toxicity and therapeutic efficacy of thiopurine drugs. tpmt2, 3a and 3b were rare, while tpmt3c appears to be the most common variant in indians. another variant allele, the african specific tpmt8 (644g > a) in exon 9 which is responsible for intermediate activity, was absent in indians12. the mutant allele tpmt3a which causes the largest decrease in tpmt activity was detected only in ni (0.4%) but it was absent in si, similarly tpmt2 and tpmt3b was present only in si (0.1% and 0.1%) but not in ni (table iii). with regard to tpmt3a, the ni were different from caucasians (p a, arg213his) and sult1a1 3 (667a > g, met223val). individuals carrying the variant allele sult1a1 2 will have diminished capacity to sulphate the substrates of sult1a1 due to shorter protein life and more susceptible to cancer risk as well. gene duplication and deletion was more common in sult1a1 gene and a correlation between the enzymatic activity and sult1a1 gene copy numbers has been observed by hebbring in an in vitro study. the frequency of sult1a1 2 in indian populations was established in si13033 (22.6%) and nei36 (27.2%) but not in ni (table iii). it was significantly higher than those reported in asians 8.7 per cent and lower than caucasians 41.5 per cent (p a) in exon 4, where the nucleotide change a to g results in the replacement of valine with methionine at codon 158 in mb - comt and 108 in s - comt leading to 3 - 4 fold decrease in methylation activity. except the snp rs4680, the frequency of the other reported alleles such as rs3788319, rs737865, rs6269, rs4818, rs4633, rs165599 were available only in si133 (table iii). the frequency of rs4680 was significantly different between ni and si (49 vs. 41.6%), p a (arg64gln), 282c > t (tyr94tyr), 481c > t (leu161leu), 341t > c (ile114thr), 590g > a (arg197gln), 803a > g (arg268lys) and 857g > a (gly286glu)161. among these, the most studied alleles were nat2 5, nat2 6 and nat2 7 at positions 341, 590 and 857, respectively. the variant nat2 6 corresponding to inactive enzyme was detected with a frequency of 37 per cent in si134 which was similar to 31.5 per cent in ni and different from nei35 26 per cent, (p t / a / c in exon 21, 3435c > t in exon 26 and 1236c > t in exon 12 are the most studied alleles of mdr1 gene171., the indians have at least one variant allele of mdr1. among the indian populations, the lowest 42.4 per cent and the highest 60 per cent frequency of 2677t / a allele similarly, the frequency distribution of the synonymous snp 3435c > t was found to be 53.6 per cent in ni and 59.5 per cent in si (table iv). a significant inter- and intra - ethnic difference was observed when these two alleles were compared among indians and with other major populations (table ii)172173174. on the other hand, the frequency of 1236c > t was available only in ni populations (51.9%) and it was different from other populations, p t), rs628031 in exon 7 (met408val, 1222a > g) and rs622342 (1386c > a) located in an intron between exon 8 and exon 9 were described in tamilian healthy subjects10. genetic variants of oct1 were common in si tamilians with a frequency of 8.9 per cent (95% ci 5.6 - 13.5), 80.3 per cent (95% ci 75.2 - 85.6) and 24.5 per cent (95% ci 18.9 - 30.2) for the alleles rs2282143 (t), rs628031 (g) and rs622342 (c), respectively10. with regard to rs2282143, similarity was observed for africans but not with asians (p g), slco1b1 4 (463c > a) and slco1b1 5 in exon 6 (521t > c). the prevalence of these variants were available only in ni169 population and its frequency was reported to be 45, 2.6 and 1.4 per cent for 1b, 4 and 5, respectively (table iv). the comparison of 1b allele frequency showed significant difference with being higher in africans 87 and asians 64 per cent but lower in caucasians 37 per cent (p c), also known as msp1, cyp1a1 2c or m2 (2455a > g), cyp1a1 3 or m3 (3204t > c) and cyp1a1 4 or m4 (2452c > a) polymorphisms for cyp1a1. for cyp1a2, the frequency of the mutant alleles cyp1a1 2a and cyp1a1 2c were significantly (p a, leu160his), 4a (gene deletion), and 5 (1436g > t and 6582g > t, gly479val) have been well known. the frequency data of cyp2a6 1b polymorphisms are available only for ni43 and similarly cyp2a6 2 and 5 are available only in si populations13. among the cyp2a6 variants, 1b is the most prevalent allele followed by 4, whereas 2 and 5 were found to be rare (table i). the comparison of cyp2a6 1b between ni (32.7%) and other populations indicates similarity with caucasians (27.6%) and significant difference with africans 11.2 per cent and asians 42.8 per cent (p t, i269f), cyp2c8 3 in exons 3 and 8 (416g > a/1196a > g, r139k / k399r), cyp2c8 4 in exon 5 (792c > g, i264 m) and cyp2c8 5 (475dela). the enzymes encoded by these variant alleles impair the metabolism of several drug substrates of cyp2c8. subjects who are homozygous (2/2 or 3/3) have lower intrinsic clearance of cyp2c8 substrates than those who are heterozygous (further, the polymorphisms of cyp2c8 have been associated with diseases such as myocardial infarction (mi)80. the only study which determined the frequency distribution of cyp2c8 alleles in any of the indian population was carried out in si tamilians11 with a frequency of about 0.8 per cent (95% ci 0.2 - 2.1) and 2.9 per cent (95% ci 1.6 - 4.7) for cyp2c8 2 and 3, respectively (table i). population studies from around the world in different populations indicate that cyp2c8 2 variant is rare in si and caucasians, whereas it is a common variant among africans. allele cyp2c8 3 is a common variant in caucasians while it occurs either at small frequency or not present in si and africans. with regard to asians subjects, the cyp2c8 polymorphism was monomorphic for cyp2c8 cyp2c9 : drugs undergoing oxidative metabolism such as s - warfarin, rosiglitazone, tolbutamide, phenytoin, glyburide, glibenclamide, glimepiride, glipizide, losartan, irbesartan, torsemide, tamoxifen, fluvastatin, fluoxetine, amitriptyline and other commonly used anti - inflammatory drugs (diclofenac, ibuprofen, naproxen, piroxicam, aceclofenac, celecoxib) have been described to be principally metabolized by cyp2c9848586. it is encoded by the gene cyp2c9, which is located on chr10q24.2. among the cyp2c isoforms, cyp2c9 is the most abundant one and constitutes about 20 per cent of total cyp450 hepatic content85. the gene cyp2c9 is known to be polymorphic and inter - individual differences in the enzyme activity of cyp2c9 categorize subjects into ems, ims and pms. among the many variants, cyp2c9 2 (430c > t, arg144cys) in exon 3 and cyp2c9 3 (1075a > c, ile359leu) in exon 7 are the most characterized alleles and individuals with these variant alleles are reported to have decreased cyp2c9 activity. these variants are reported to be associated with acute mi, hypertension, colorectal cancer and major depressive disorders ; also with certain adverse drug reactions including gingival hyperplasia, hypoglycaemia and gastrointestinal bleeding. in addition, a number of other alleles such as cyp2c9 5 (1080c > g, d360e), 6 (818adel), 9 (752a > g, h251r), 11 (1003c > t, r335w) and 12 (1465c > t, p489s) may cause impaired metabolism, which may give rise to life threatening drug toxicity and may have impact on drug metabolism and disease susceptibility646684. the prevalence of cyp2c9 2 was significantly different between ni and si (9% vs. 3.6%, p a) and cyp2c19 3 in exon 4 (636g > a) have diminished ability to metabolize therapeutic agents that are substrates of cyp2c196684. the cyp2c19 2 allele notably occurred at a higher frequency among the indian populations (ni 33.1% and si 36.8%) than africans 16 per cent, caucasians 13.3 per cent and slightly higher than asians 28.4 per cent (p t, -340c > t) increases the activity of cyp2c19 protein resulting in ultrarapid metabolism of cyp2c19 substrates66. the ultrarapid metabolizer cyp2c19 17 was studied only in si tamilians14 with a frequency of about 19.2 per cent (table i). the comparison of si subjects with asian individuals indicates significant difference in um allele, p t;4180g > c) in exon 2 and 6, 3 (2549dela) in exon 5, 4 (1846g > a in intron 3 - exon 4 junction), 5 (whole gene deletion), 10 in exon 1(188c > t, p34s), 14 (1758g > a), 17 (1023c > t ; 2850c > t) in exon 2 and 41 (2988g > a) variants were the most characterized alleles of cyp2d666. the frequencies of the defective alleles in different races vary widely. apart from pms, ims individuals also had been classified as ums of cyp2d6 substrates depending upon the presence of cyp2d6 allele combinations. pms are those who carry two defective alleles (inactive enzyme), resulting in increased concentrations of the parent drug in plasma, whereas in the case of ums, as a result of gene duplication individuals carry more than two copies of the functional gene leading to increased enzyme activity, resulting in decreased parent drug concentration in blood96. the dosage recommendation is based upon the cyp2d6 genotype for drugs that are substrates of cyp2d6 in order to avoid both treatment failure and adverse drug reaction. of the five variants which contribute to the loss of cyp2d6 activity (3,4, 5, 6 and 14), only 14 was not detected in indian populations. similarly, the other variants (9, 17 and 29) leading to diminished enzyme activity were also not found in indians. the functional allele cyp2d6 2 was most prevalent in indians which was found at comparable frequencies between ni (29.3%) and si (34.8%). both the indian populations showed significant difference compared with asians and caucasians (p a) is the only defining variant of cyp3a4 reported at present. subjects carrying the defective alleles of cyp3a4 have been implicated in disease predisposition to prostate cancer, estrogen receptor negative breast cancer and type 2 diabetes mellitus106. the frequency of cyp3a4 1b was available in ni (1.2%) only and the comparison between ni and other populations indicates significant variations (p 50 per cent of currently used drugs. it shares about 85 per cent of amino acid sequence identity with cyp3a4 but it has different degrees of catalytic activity and regioselectivity towards substrates105. kuehl have demonstrated that at least one cyp3a5 1 allele is needed for expressing cyp3a5 protein. they have identified cyp3a5 3 (a to g at 6986) in intron 3 and cyp3a5 6 (g to a at 14690) in exon 7, which led to the absence of cyp3a5 protein 6986a allele (cyp3a5 1) was before correlated with high expression107. further, two more variants in the coding regions viz.,2 (27289c > a, thr398asn) in exon 12 and 4 (14665a > g, gln200arg) in exon 8 were identified. cyp3a5 may represent upto 50 per cent of the total hepatic cyp3a content in people expressing cyp3a5105106. this gene may be an important contributor to individual and inter - racial variation in cyp3a mediated metabolism of drugs including antipsychotics (olanzapine), antiestrogen (tamoxifen), anticancer (irinotecan, docetaxel, vincristine), antimalarial (mefloquine, artemether, lumefantrine), immunomodulators (tacrolimus, cyclosporine), antihistamines (chlorpheniramine, terfenadine, astemizole), antiplatelets (clopidogrel), antihypertensives (nifedipine, amlodipine, felodipine, verapamil), antivirals (indinavir, nelfinavir, ritonavir, saquinavir), hmg - coa reductase inhibitors (atorvastatin, cerivastatin, lovastatin) antibiotics (clarithromycin) and steroids (testosterone, estradiol, progesterone and androstenedione). the presence of non - functional polymorphic alleles of cyp3a5 has been associated with blood pressure, mi, breast cancer and acute myeloid leukemia (aml) or all106. in indians, none of the other variants 2, 4 and 6 were identified in indians (table i). the frequency of cyp3a5 3 in si 56 per cent (95% ci 53.5 - 58.5) was significantly different (p g was observed only in ni45 34.7 per cent which was higher than caucasians 9.2 per cent (p 7 (ugt1a1 28) polymorphism in the tata element of the 5promoter region. it is characterized by (ta) 7 repeats instead of more common (ta) 6 repeats, resulting in lower promoter activity. it is the genetic basis for several clinical conditions such as, mild unconjugated hyperbilirubinemia associated with reduced hepatic bilirubin glucuronidation (gilbert syndrome) and irinotecan mediated toxicity142143. irinotecan, an inhibitor of intracellular topoisomerase - i is metabolized to form active sn-38, which is further conjugated and detoxified by ugt1a1 enzyme143. the only study which determined the frequency of ugt1a1 28 in native indians was carried out in si12 namely, andhra pradesh 32.2 per cent, karnataka 29 per cent, kerala 46.5 per cent and tamil nadu 52.8 per cent (table iii). significant differences in the frequencies of this variant were observed in si 39.7 per cent, as compared to africans 55.3 per cent, asians 13.1 per cent and caucasians 29.6 per cent, p c),3a (460g > a and 719a > g),3b (460g > a) and 3c (719a > g) are the four major variant alleles that cause 80 - 95 per cent intermediate and low enzyme activity. carriers of theses alleles have been shown to have clinical implications with respect to metabolism, toxicity and therapeutic efficacy of thiopurine drugs. tpmt2, 3a and 3b were rare, while tpmt3c appears to be the most common variant in indians. another variant allele, the african specific tpmt8 (644g > a) in exon 9 which is responsible for intermediate activity, was absent in indians12. the mutant allele tpmt3a which causes the largest decrease in tpmt activity was detected only in ni (0.4%) but it was absent in si, similarly tpmt2 and tpmt3b was present only in si (0.1% and 0.1%) but not in ni (table iii). with regard to tpmt3a, the ni were different from caucasians (p a, arg213his) and sult1a1 3 (667a > g, met223val). individuals carrying the variant allele sult1a1 2 will have diminished capacity to sulphate the substrates of sult1a1 due to shorter protein life and more susceptible to cancer risk as well. gene duplication and deletion was more common in sult1a1 gene and a correlation between the enzymatic activity and sult1a1 gene copy numbers has been observed by hebbring in an in vitro study. the frequency of sult1a1 2 in indian populations was established in si13033 (22.6%) and nei36 (27.2%) but not in ni (table iii). it was significantly higher than those reported in asians 8.7 per cent and lower than caucasians 41.5 per cent (p a) in exon 4, where the nucleotide change a to g results in the replacement of valine with methionine at codon 158 in mb - comt and 108 in s - comt leading to 3 - 4 fold decrease in methylation activity. except the snp rs4680, the frequency of the other reported alleles such as rs3788319, rs737865, rs6269, rs4818, rs4633, rs165599 were available only in si133 (table iii). the frequency of rs4680 was significantly different between ni and si (49 vs. 41.6%), p a (arg64gln), 282c > t (tyr94tyr), 481c > t (leu161leu), 341t > c (ile114thr), 590g > a (arg197gln), 803a > g (arg268lys) and 857g > a (gly286glu)161. among these, the most studied alleles were nat2 5, nat2 6 and nat2 7 at positions 341, 590 and 857, respectively. the variant nat2 6 corresponding to inactive enzyme was detected with a frequency of 37 per cent in si134 which was similar to 31.5 per cent in ni and different from nei35 26 per cent, (p t / a / c in exon 21, 3435c > t in exon 26 and 1236c > t in exon 12 are the most studied alleles of mdr1 gene171., the indians have at least one variant allele of mdr1. among the indian populations, the lowest 42.4 per cent and the highest 60 per cent frequency of 2677t / a allele similarly, the frequency distribution of the synonymous snp 3435c > t was found to be 53.6 per cent in ni and 59.5 per cent in si (table iv). a significant inter- and intra - ethnic difference was observed when these two alleles were compared among indians and with other major populations (table ii)172173174. on the other hand, the frequency of 1236c > t was available only in ni populations (51.9%) and it was different from other populations, p t), rs628031 in exon 7 (met408val, 1222a > g) and rs622342 (1386c > a) located in an intron between exon 8 and exon 9 were described in tamilian healthy subjects10. genetic variants of oct1 were common in si tamilians with a frequency of 8.9 per cent (95% ci 5.6 - 13.5), 80.3 per cent (95% ci 75.2 - 85.6) and 24.5 per cent (95% ci 18.9 - 30.2) for the alleles rs2282143 (t), rs628031 (g) and rs622342 (c), respectively10. with regard to rs2282143, similarity was observed for africans but not with asians (p g), slco1b1 4 (463c > a) and slco1b1 5 in exon 6 (521t > c). the prevalence of these variants were available only in ni169 population and its frequency was reported to be 45, 2.6 and 1.4 per cent for 1b, 4 and 5, respectively (table iv). the comparison of 1b allele frequency showed significant difference with being higher in africans 87 and asians 64 per cent but lower in caucasians 37 per cent (p c), also known as msp1, cyp1a1 2c or m2 (2455a > g), cyp1a1 3 or m3 (3204t > c) and cyp1a1 4 or m4 (2452c > a) polymorphisms for cyp1a1. for cyp1a2, the frequency of the mutant alleles cyp1a1 2a and cyp1a1 2c were significantly (p a, leu160his), 4a (gene deletion), and 5 (1436g > t and 6582g > t, gly479val) have been well known. the frequency data of cyp2a6 1b polymorphisms are available only for ni43 and similarly cyp2a6 2 and 5 are available only in si populations13. among the cyp2a6 variants, 1b is the most prevalent allele followed by 4, whereas 2 and 5 were found to be rare (table i). the comparison of cyp2a6 1b between ni (32.7%) and other populations indicates similarity with caucasians (27.6%) and significant difference with africans 11.2 per cent and asians 42.8 per cent (p t, i269f), cyp2c8 3 in exons 3 and 8 (416g > a/1196a > g, r139k / k399r), cyp2c8 4 in exon 5 (792c > g, i264 m) and cyp2c8 5 (475dela). the enzymes encoded by these variant alleles impair the metabolism of several drug substrates of cyp2c8. subjects who are homozygous (2/2 or 3/3) have lower intrinsic clearance of cyp2c8 substrates than those who are heterozygous (further, the polymorphisms of cyp2c8 have been associated with diseases such as myocardial infarction (mi)80. the only study which determined the frequency distribution of cyp2c8 alleles in any of the indian population was carried out in si tamilians11 with a frequency of about 0.8 per cent (95% ci 0.2 - 2.1) and 2.9 per cent (95% ci 1.6 - 4.7) for cyp2c8 2 and 3, respectively (table i). population studies from around the world in different populations indicate that cyp2c8 2 variant is rare in si and caucasians, whereas it is a common variant among africans. allele cyp2c8 3 is a common variant in caucasians while it occurs either at small frequency or not present in si and africans. with regard to asians subjects, the cyp2c8 polymorphism was monomorphic for cyp2c8 cyp2c9 : drugs undergoing oxidative metabolism such as s - warfarin, rosiglitazone, tolbutamide, phenytoin, glyburide, glibenclamide, glimepiride, glipizide, losartan, irbesartan, torsemide, tamoxifen, fluvastatin, fluoxetine, amitriptyline and other commonly used anti - inflammatory drugs (diclofenac, ibuprofen, naproxen, piroxicam, aceclofenac, celecoxib) have been described to be principally metabolized by cyp2c9848586. it is encoded by the gene cyp2c9, which is located on chr10q24.2. among the cyp2c isoforms, cyp2c9 is the most abundant one and constitutes about 20 per cent of total cyp450 hepatic content85. the gene cyp2c9 is known to be polymorphic and inter - individual differences in the enzyme activity of cyp2c9 categorize subjects into ems, ims and pms. among the many variants, cyp2c9 2 (430c > t, arg144cys) in exon 3 and cyp2c9 3 (1075a > c, ile359leu) in exon 7 are the most characterized alleles and individuals with these variant alleles are reported to have decreased cyp2c9 activity. these variants are reported to be associated with acute mi, hypertension, colorectal cancer and major depressive disorders ; also with certain adverse drug reactions including gingival hyperplasia, hypoglycaemia and gastrointestinal bleeding. in addition, a number of other alleles such as cyp2c9 5 (1080c > g, d360e), 6 (818adel), 9 (752a > g, h251r), 11 (1003c > t, r335w) and 12 (1465c > t, p489s) may cause impaired metabolism, which may give rise to life threatening drug toxicity and may have impact on drug metabolism and disease susceptibility646684. the prevalence of cyp2c9 2 was significantly different between ni and si (9% vs. 3.6%, p a) and cyp2c19 3 in exon 4 (636g > a) have diminished ability to metabolize therapeutic agents that are substrates of cyp2c196684. the cyp2c19 2 allele notably occurred at a higher frequency among the indian populations (ni 33.1% and si 36.8%) than africans 16 per cent, caucasians 13.3 per cent and slightly higher than asians 28.4 per cent (p t, -340c > t) increases the activity of cyp2c19 protein resulting in ultrarapid metabolism of cyp2c19 substrates66. the ultrarapid metabolizer cyp2c19 17 was studied only in si tamilians14 with a frequency of about 19.2 per cent (table i). the comparison of si subjects with asian individuals indicates significant difference in um allele, p t;4180g > c) in exon 2 and 6, 3 (2549dela) in exon 5, 4 (1846g > a in intron 3 - exon 4 junction), 5 (whole gene deletion), 10 in exon 1(188c > t, p34s), 14 (1758g > a), 17 (1023c > t ; 2850c > t) in exon 2 and 41 (2988g > a) variants were the most characterized alleles of cyp2d666. the frequencies of the defective alleles in different races vary widely. apart from pms, ims individuals also had been classified as ums of cyp2d6 substrates depending upon the presence of cyp2d6 allele combinations. pms are those who carry two defective alleles (inactive enzyme), resulting in increased concentrations of the parent drug in plasma, whereas in the case of ums, as a result of gene duplication individuals carry more than two copies of the functional gene leading to increased enzyme activity, resulting in decreased parent drug concentration in blood96. the dosage recommendation is based upon the cyp2d6 genotype for drugs that are substrates of cyp2d6 in order to avoid both treatment failure and adverse drug reaction. of the five variants which contribute to the loss of cyp2d6 activity (3,4, 5, 6 and 14), only 14 was not detected in indian populations. similarly, the other variants (9, 17 and 29) leading to diminished enzyme activity were also not found in indians. the functional allele cyp2d6 2 was most prevalent in indians which was found at comparable frequencies between ni (29.3%) and si (34.8%). both the indian populations showed significant difference compared with asians and caucasians (p a) is the only defining variant of cyp3a4 reported at present. subjects carrying the defective alleles of cyp3a4 have been implicated in disease predisposition to prostate cancer, estrogen receptor negative breast cancer and type 2 diabetes mellitus106. the frequency of cyp3a4 1b was available in ni (1.2%) only and the comparison between ni and other populations indicates significant variations (p 50 per cent of currently used drugs. it shares about 85 per cent of amino acid sequence identity with cyp3a4 but it has different degrees of catalytic activity and regioselectivity towards substrates105. kuehl have demonstrated that at least one cyp3a5 1 allele is needed for expressing cyp3a5 protein. they have identified cyp3a5 3 (a to g at 6986) in intron 3 and cyp3a5 6 (g to a at 14690) in exon 7, which led to the absence of cyp3a5 protein 6986a allele (cyp3a5 1) was before correlated with high expression107. further, two more variants in the coding regions viz.,2 (27289c > a, thr398asn) in exon 12 and 4 (14665a > g, gln200arg) in exon 8 were identified. cyp3a5 may represent upto 50 per cent of the total hepatic cyp3a content in people expressing cyp3a5105106. this gene may be an important contributor to individual and inter - racial variation in cyp3a mediated metabolism of drugs including antipsychotics (olanzapine), antiestrogen (tamoxifen), anticancer (irinotecan, docetaxel, vincristine), antimalarial (mefloquine, artemether, lumefantrine), immunomodulators (tacrolimus, cyclosporine), antihistamines (chlorpheniramine, terfenadine, astemizole), antiplatelets (clopidogrel), antihypertensives (nifedipine, amlodipine, felodipine, verapamil), antivirals (indinavir, nelfinavir, ritonavir, saquinavir), hmg - coa reductase inhibitors (atorvastatin, cerivastatin, lovastatin) antibiotics (clarithromycin) and steroids (testosterone, estradiol, progesterone and androstenedione). the presence of non - functional polymorphic alleles of cyp3a5 has been associated with blood pressure, mi, breast cancer and acute myeloid leukemia (aml) or all106. in indians, none of the other variants 2, 4 and 6 were identified in indians (table i). the frequency of cyp3a5 3 in si 56 per cent (95% ci 53.5 - 58.5) was significantly different (p g was observed only in ni45 34.7 per cent which was higher than caucasians 9.2 per cent (p 7 (ugt1a1 28) polymorphism in the tata element of the 5promoter region. it is characterized by (ta) 7 repeats instead of more common (ta) 6 repeats, resulting in lower promoter activity. it is the genetic basis for several clinical conditions such as, mild unconjugated hyperbilirubinemia associated with reduced hepatic bilirubin glucuronidation (gilbert syndrome) and irinotecan mediated toxicity142143. irinotecan, an inhibitor of intracellular topoisomerase - i is metabolized to form active sn-38, which is further conjugated and detoxified by ugt1a1 enzyme143. the only study which determined the frequency of ugt1a1 28 in native indians was carried out in si12 namely, andhra pradesh 32.2 per cent, karnataka 29 per cent, kerala 46.5 per cent and tamil nadu 52.8 per cent (table iii). significant differences in the frequencies of this variant were observed in si 39.7 per cent, as compared to africans 55.3 per cent, asians 13.1 per cent and caucasians 29.6 per cent, p c),3a (460g > a and 719a > g),3b (460g > a) and 3c (719a > g) are the four major variant alleles that cause 80 - 95 per cent intermediate and low enzyme activity. carriers of theses alleles have been shown to have clinical implications with respect to metabolism, toxicity and therapeutic efficacy of thiopurine drugs. tpmt2, 3a and 3b were rare, while tpmt3c appears to be the most common variant in indians. another variant allele, the african specific tpmt8 (644g > a) in exon 9 which is responsible for intermediate activity, was absent in indians12. the mutant allele tpmt3a which causes the largest decrease in tpmt activity was detected only in ni (0.4%) but it was absent in si, similarly tpmt2 and tpmt3b was present only in si (0.1% and 0.1%) but not in ni (table iii). with regard to tpmt3a, the ni were different from caucasians (p a, arg213his) and sult1a1 3 (667a > g, met223val). individuals carrying the variant allele sult1a1 2 will have diminished capacity to sulphate the substrates of sult1a1 due to shorter protein life and more susceptible to cancer risk as well. gene duplication and deletion was more common in sult1a1 gene and a correlation between the enzymatic activity and sult1a1 gene copy numbers has been observed by hebbring in an in vitro study. the frequency of sult1a1 2 in indian populations was established in si13033 (22.6%) and nei36 (27.2%) but not in ni (table iii). it was significantly higher than those reported in asians 8.7 per cent and lower than caucasians 41.5 per cent (p a) in exon 4, where the nucleotide change a to g results in the replacement of valine with methionine at codon 158 in mb - comt and 108 in s - comt leading to 3 - 4 fold decrease in methylation activity. except the snp rs4680, the frequency of the other reported alleles such as rs3788319, rs737865, rs6269, rs4818, rs4633, rs165599 were available only in si133 (table iii). the frequency of rs4680 was significantly different between ni and si (49 vs. 41.6%), p a (arg64gln), 282c > t (tyr94tyr), 481c > t (leu161leu), 341t > c (ile114thr), 590g > a (arg197gln), 803a > g (arg268lys) and 857g > a (gly286glu)161. among these, the most studied alleles were nat2 5, nat2 6 and nat2 7 at positions 341, 590 and 857, respectively. the variant nat2 6 corresponding to inactive enzyme was detected with a frequency of 37 per cent in si134 which was similar to 31.5 per cent in ni and different from nei35 26 per cent, (p t / a / c in exon 21, 3435c > t in exon 26 and 1236c > t in exon 12 are the most studied alleles of mdr1 gene171. in general, the indians have at least one variant allele of mdr1. among the indian populations, the lowest 42.4 per cent and the highest 60 per cent frequency of 2677t / a allele similarly, the frequency distribution of the synonymous snp 3435c > t was found to be 53.6 per cent in ni and 59.5 per cent in si (table iv). a significant inter- and intra - ethnic difference was observed when these two alleles were compared among indians and with other major populations (table ii)172173174. on the other hand, the frequency of 1236c > t was available only in ni populations (51.9%) and it was different from other populations, p t), rs628031 in exon 7 (met408val, 1222a > g) and rs622342 (1386c > a) located in an intron between exon 8 and exon 9 were described in tamilian healthy subjects10. genetic variants of oct1 were common in si tamilians with a frequency of 8.9 per cent (95% ci 5.6 - 13.5), 80.3 per cent (95% ci 75.2 - 85.6) and 24.5 per cent (95% ci 18.9 - 30.2) for the alleles rs2282143 (t), rs628031 (g) and rs622342 (c), respectively10. with regard to rs2282143, similarity was observed for africans but not with asians (p g), slco1b1 4 (463c > a) and slco1b1 5 in exon 6 (521t > c). the prevalence of these variants were available only in ni169 population and its frequency was reported to be 45, 2.6 and 1.4 per cent for 1b, 4 and 5, respectively (table iv). the comparison of 1b allele frequency showed significant difference with being higher in africans 87 and asians 64 per cent but lower in caucasians 37 per cent (p < 0.001)169181. similarly, the other variants (4 and 5) were higher in other populations but asians showed similarity with ni with regard to slco1b1 4 (table ii)181. currently, there are studies in india which established the normative frequency of clinically important genes, but most of these analyzed a limited number of individuals from south and north indian populations. as indian populations are highly heterogeneous in nature, these results may not be applied to the entire country population. further, the frequency and impact of these gene polymorphisms on the enzyme activity are available for other major populations of the world (celera, dbsnp, hapmap, hgvbase, jsnp and refargen), but there are no such data for indians. the indian genome variation consortium (igvc) has generated a database igvbrowser which harbours allele and genotype frequency for 4,229 snps from over 900 genes in distinct indian populations, but it focused largely on disease predisposition biomarkers and lacks information on adme genes16. considering this along with the endogamous and polygenetic nature of indian populations and being deficient in functional studies of these polymorphisms in indians, there is a need for the systematic study to identify and functionally characterize clinically important adme gene polymorphisms. in doing so, eventually we will have an opportunity to create an indian database, perhaps an indmap with the establishment of a nation - wide network among the indian pgx researchers. this would provide information which would aid the researchers as well as the health care professionals for understanding the ethnic genetic diversity of the indian population and its impact on drug pharmacokinetics and pharmacodynamics. additionally, the ultimate benefit of pgx studies is the usage of personalized medicine in clinical practice. one of the major problems in india is the non - availability of a cost - effective pgx testing method which is specific for indian populations. henceforth, it becomes imperative to develop a pgx chip in india and multicentre studies are required to validate the utility and clinical benefit of such chip. finally, it can be concluded that understanding the role of genetics in influencing the pharmacodynamics and pharmacokinetics of clinically used drugs might help in tailoring pharmacotherapy. therefore, information regarding the frequency distribution of the defective alleles of genes encoding enzymes concerned with adme within particular populations is essential in adapting pgx. | phase i and ii drug metabolizing enzymes (dme) and drug transporters are involved in the absorption, distribution, metabolism as well as elimination of many therapeutic agents, toxins and various pollutants. presence of genetic polymorphisms in genes encoding these proteins has been associated with marked inter - individual variability in their activity that could result in variation in drug response, toxicity as well as in disease predisposition. the emergent field pharmacogenetics and pharmacogenomics (pgx) is a promising discipline, as it predicts disease risk, selection of proper medication with regard to response and toxicity, and appropriate drug dosage guidance based on an individual 's genetic make - up. consequently, genetic variations are essential to understand the ethnic differences in disease occurrence, development, prognosis, therapeutic response and toxicity. for that reason, it is necessary to establish the normative frequency of these genes in a particular population before unraveling the genotype - phenotype associations. although a fair amount of allele frequency data are available in indian populations, the existing pharmacogenetic data have not been compiled into a database. this review was intended to compile the normative frequency distribution of the variants of genes encoding dmes (cyp450s, tpmt, gsts, comt, sult1a1, nat2 and ugts) and transporter proteins (mdr1, oct1 and slco1b1) with indian perspective. |
a computed tomography (ct) incidentaloma is an incidentally detected and previously unsuspected finding or abnormality that is not related to the indication for obtaining the ct examination. chest ct incidentalomas are pandemic in modern health care due to many factors, including the explosion in the use of chest ct scanning, particularly in the emergency department, in oncology centers, and in screening for coronary artery disease (cad) and lung cancer. multidetector ct results in huge numbers of thin ct sections with excellent spatial resolution, leading to the detection of many incidental findings. incidentalomas on chest ct scans may represent normal findings, normal variants, or abnormal findings. abnormal findings may be of little or no clinical significance (e.g. a calcified lung granuloma), requiring no further evaluation, or they may be highly significant, requiring immediate treatment (e.g. a large, central pulmonary embolus). commonly, however, incidentalomas are of questionable clinical significance (e.g. a thyroid nodule), necessitating further evaluation via clinical correlation, follow - up and/or additional testing. a systematic review of 11 chest ct studies performed for cad and lung cancer screening revealed that the proportion of patients with at least one incidental imaging abnormality requiring follow - up varied from 3% to 41.5% ; the wide variation was largely due to considerable differences in follow - up recommendations for incidental findings across studies. overall, 7.7% and 14.2% of participants in cad or lung cancer screening studies, respectively, had further investigations of incidental findings. other individual cad screening studies found major extracardiac incidentalomas in 516% of patients. a lung cancer screening study involving 5200 participants discovered incidental findings in 3%, leading to 12 invasive procedures ; however, only 8 of these were clinically relevant. the nelson lung cancer screening trial found that 129/1929 (7%) ct examinations revealed clinically relevant incidental findings, resulting in 118 additional imaging tests ; furthermore, 8 of these showed new incidental findings. eleven patients underwent more than one additional imaging study, and ultimately, only 15 patients needed clinical treatment or further follow - up of their incidental findings. only one incidental cancer was detected (pancreatic cancer), which was incurable due to the presence of metastatic disease. based on these results, the authors advised against systematically searching for and reporting of incidental findings on lung cancer screening studies, as this practice may lead to additional costs, patient anxiety, and risk of iatrogenic injury. despite the conclusions of the authors of the nelson study, most radiologists feel obligated to report incidental findings and give suggestions regarding the clinical significance and appropriate work - up of such findings. for some findings, there are well established clinical guidelines, whereas, for others, no specific guidelines exist. the following sections give suggested guidelines for reporting incidental findings, based on the best evidence that is currently available in the medical literature. thyroid abnormalities, such as nodules (solitary or multiple), cystic lesions, calcifications and diffuse glandular enlargement, are often detected on chest ct examinations (fig. thyroid nodules are found in approximately 16% of chest ct scans, more commonly in women. most incidentally found thyroid lesions are benign, with an approximately 911% prevalence of malignant lesions. the differential diagnosis for an incidental thyroid abnormality in euthyroid individuals includes nontoxic multinodular goiter, follicular adenoma, thyroiditis, simple cyst, and carcinoma (primary or secondary). clinical features that correlate with malignancy include : age (younger than 35 years or older than 70 years) ; size (> 2.5 cm) ; presence of dysphagia or hoarseness ; history of external neck radiation in childhood or adolescence ; firm, irregular and/or fixed nodule at physical examination ; presence of cervical lymph node enlargement ; multiple endocrine neoplastic syndromes ; personal or family history of thyroid malignancy ; and possibly male gender. figure 1incidental nodule in the left lobe of the thyroid gland (arrow). furthermore, it has been reported that ct is unreliable in distinguishing simple cysts, complex cysts, and solid nodules. ct underestimates the number of nodules relative to sonography, suggesting that sonography is a useful adjunctive test after the incidental detection of a thyroid abnormality on ct ; furthermore, current management guidelines for thyroid nodules are based on morphologic sonographic characteristics. although sonography is sensitive in detecting thyroid nodules, it is not accurate in diagnosing malignancy ; its major usefulness is in guiding thyroid biopsies. once an incidental thyroid nodule is found, referral to a thyroid specialist may be the most cost - effective option for further evaluation, although ultrasonography may also be suggested. according to the guidelines of the american thyroid association, generally, only nodules > 1 cm need further evaluation, because they have a greater potential to represent clinically significant cancers compared with lesions 10 mm, a 3-month follow - up examination may be optimal ; persistence suggests the presence of adenocarcinoma in situ or invasive adenocarcinoma. these nodules can be followed to assess for long - term stability, although a more aggressive approach, including biopsy or resection, may be chosen. features that correlate with malignancy include increase in nodule size, increase in overall attenuation, and development of a solid component (figs. 8 and 9). figure 7small, incidental ground glass nodule (arrow) that likely represents a focus of aah. figure 9incidental ground glass nodule (a, arrow) grew into a mixed solid and ground glass nodule 4 years later (b, arrow). small, incidental ground glass nodule (arrow) that likely represents a focus of aah incidental ground glass nodule (a, arrow) grew into a mixed solid and ground glass nodule 4 years later (b, arrow). incidental findings are frequently found on chest ct examinations. although most of these findings are not clinically significant, some may represent incidentally discovered malignancies. detection of incidentalomas may lead to a large number of expensive follow - up examinations, extra radiation in healthy people, unnecessary invasive procedures and patient anxiety. when reporting an incidental finding, the radiologist should indicate the probability of the importance of the finding, and should offer evidence - based guidelines for further work - up or follow - up when necessary. | abstracta computed tomography (ct) incidentaloma is an incidentally detected and previously unsuspected finding or abnormality that is not related to the indication for obtaining the ct examination. the aim of this article is to review the frequency of incidentalomas on chest ct scans, discuss the potential clinical significance of the findings, and suggest guidelines for reporting, further evaluation, and follow - up, with particular focus on thyroid lesions, enlarged mediastinal lymph nodes and lung nodules. |
acrodermatitis enteropathica (ae) is an autosomal recessive condition resulting in severe zinc deficiency. the deficiency is caused by a defect of dietary zinc absorption in the duodenum and jejunum. zinc is an essential co - enzyme in metal enzymes (like alkaline phosphatase) ; it is an important structural component of gene regulatory proteins (required, for example, for the intracellular binding of tyrosine kinase to t - cell receptors) and it has also a function in regulation (has the ability to regulate gene expression). consequently, there are multiple signs and symptoms in severe deficiency : growth retardation, impaired immune function, and multiple skin or gastrointestinal lesions. signs and symptoms in infancy can include diarrhea, mood changes, anorexia, and neurological disturbance. in schoolchildren and toddlers, zinc deficiency is characterized by growth retardation, alopecia, weight loss, and recurrent infections. laboratory diagnosis is hazardous, zinc levels in serum, urine, or hair are used (although they are not specific, neither sensitive), zinc absorption tests are cumbersome, genetic testing is definite (defect in 8q24, gene slc39a4) though not routinely available. most clinicians therefore depend on immediate results of a therapeutic zinc regimen (330 mol / kg body weight). in denmark another study reported also an incidence of 1 per 500,000 children without predilection for race or sex. we present the case of a caucasian 14-month - old boy, admitted for skin lesions that occurred from the first months of life. the boy was born prematurely, weighing 1800 g, without any perinatal medical history. he had been breastfed for 1 month and then formula - fed up to 5 months, followed by diversified nourishment. his family history revealed an apparently healthy 5-year - old sister and another sister who died at the age of 5 months with similar superinfected skin lesions. his parents stated that the skin lesions started at the age of 2 months, about 1 month after the infant was weaned from breastfeeding ; initially, lesions were discrete and partially ameliorated with local treatment. at the age of 10 months, the boy had bacterial skin superinfections with staphylococcus aureus, including suprapubic and right thigh abscesses, which required surgical incisions followed by antibiotic treatment with clindamycin, intravenous, for 10 days, according to sensitivity testing. the antibiotic treatment for s aureus determined the disappearance of the pus, but the lesions of ae persisted. he was born weighing 1800 g, so he had shown no evidence of delay in his growth. at admission to our clinic, skin examination revealed erythematous and micro pustular lesions predominantly on the buttocks, thighs, and perioral region (figure 1). antibiotic treatment with piperacillin - tazobactam, intravenous, was conducted under sensitivity testing with slight improvement in skin lesions. the dermatologist suspected napkin psoriasis, and a local treatment with fluticasone propionate was started. skin biopsy was performed, and then, the patient was discharged to continue local treatment until the arrival of the skin biopsy result. histopathological examination of left thigh skin biopsy revealed epidermal hyperplasia with acanthosis, clustered necrotic keratinocytes and parakeratosis, crusts, and intraepidermal vacuolization (figure 2). skin lesions in the diaper area, thighs (a), and face (b). epidermal hyperplasia with acanthosis, hyper and parakeratosis, crusts, he 40 (a) and intraepidermally vacuolization, he 100 (b). one month later, he was readmitted with more extensive erythematous, scaly and pustular lesions located in the inguinal and perianal regions, on the thighs, on the scalp, and periorificial on the face. the hair was thin, with areas of alopecia, the eyebrows and the eyelashes were fallen, perionychia was present (figure 3). an abscess was developed on the right thigh, which required surgical incision, followed by antibiotic treatment with clindamycin, according to sensitivity testing for s aureus isolated from pus. erythematous, scaly, and pustular lesions located in the inguinal and perianal regions, on the thighs (a), periorificial on the face, perionychia (b), and on the scalp with alopecia areas (c). the patient 's serum and urinary zinc levels were low : 23 g / dl (normal value = 65118 g / dl), respectively, 11.4 mg in the urine of 24 hours (normal value = 1501200 mg/24 h), thereby confirming the diagnosis. serum alkaline phosphatases, a zinc - dependent enzyme, was also to the lower limit of normal (50 u / l, normal = 40600 u / l). his immune function revealed iga and igg deficiency (iga = 10.87 mg / dl, igg = 426.29 mg / dl). other causes of malabsorption were excluded : antitissue transglutaminase antibodies (iga and igg) for celiac disease and -lactoglobulin for cow 's milk protein intolerance were negative. also, iontophoresis was negative (chloride concentration was 34 zinc therapy was instituted at a dosage of 3 mg / kg daily of elemental zinc, with rapidly favorable evolution : the lesions became smaller and paler after 2 to 3 days of treatment. the infant was discharged to continue daily zinc treatment ; the doses were to be adapted to the evolution and weight. on 2 months check - up, the skin lesions and alopecia were almost completely remitted (figure 4), the agitation episodes disappeared, and the child had a normal behavior. he is currently continuing his zinc treatment, and he will be undergoing regular check - ups. cutaneous aspects after 2 months of treatment, with remission of periorificial lesions and alopecia. zinc is an essential trace element required for the proper functioning of all cells, and plays an important role in the metabolism of protein, carbohydrate, and vitamin a. it is a cofactor of numerous metal enzymes such as alkaline phosphatases, alcohol dehydrogenase, rna polymerase, and numerous digestive enzymes. there are many causes of acquired zinc deficiency : premature infants, low birth weight, zinc deficiency in maternal milk, exclusive parenteral nutrition, malabsorption syndromes such as crohn disease and celiac disease, alcoholism, low calcium and phytate diet, and kwashiorkor. it is caused by an autosomal recessive mutation of slc39a4 (solute carrier family 39 member 4) gene on chromosome 8q24.3, which determines a congenital partial or total deficiency of the zinc transporter protein zinc - ligand binding protein 4 (zip 4). the clinical manifestations of acquired zinc deficiency and ae are similar and consist of 3 essential symptoms : periorificial dermatitis, alopecia, and diarrhea. the disease begins with symmetrical erythematous, squamous or eczematous lesions, sometimes vesiculobullous or pustular lesions, located around perioral, anogenital, and acral areas. skin damage becomes erosive and spreads to other periorificial areas of the face (eyes, nose, and ears), neck, lower abdomen, back, inguinal area, and thighs. in some instances other mucous and cutaneous signs consist of diffuse alopecia, loss of eyelashes and eyebrows, glossitis, gingivitis, stomatitis, onychodystrophy, onycholysis, and pachyonychia. unfortunately, it is also the most variable, and it can be intermittent or totally absent. in children with watery diarrhea, general symptoms and neuropsychological disorders are common (irritability, lethargy, depression, anorexia), and also growth retardation, weight loss, anemia, and ophthalmic involvement (photophobia, blepharitis, conjunctivitis). secondary bacterial infections (with gram - positive and sometimes gram - negative) or candidiasis (candida albicans) are common and they can modify the clinical picture. so, clinical findings in ae described in the literature encompass a broad spectrum, making the diagnosis challenging. in our patient, repetitive bacterial skin superinfections with e coli and s aureus modified the symptomatology, also requiring surgery, which leaded to a diagnosis delay. the diagnosis is based on clinical symptoms and is confirmed by low plasma zinc levels and rapid clinical response to zinc supplementation. in our case, in the absence of certainty diagnostic and with periorificial lesions that seemed to be typical for ae, we performed zinc test. low serum alkaline phosphatase value, a zinc - dependent metal protease, has an indirect role in establishing the diagnosis. histopathologic findings have a less significant contribution at establishing the diagnosis, because microscopic aspects are not specific, but, in our case, we performed biopsies in the absence of certainty diagnostic. histopathology of cutaneous lesions reveals a psoriasiform necrolysis, most often pale, by cytoplasmic vacuolization, subsequent focal, or confluent necrosis of keratinocytes in the superficial part of the epidermis and parakeratosis more or less confluent. in resolving or chronic ae lesions, acrodermatitis enteropathica has been described in breast - fed infants related to low zinc levels in the mothers. in our case, the skin lesions started at the age of 2 months, about 1 month after the infant was weaned from breastfeeding. serum alkaline phosphatase levels, in our child, were to the lower limit of normal (50 u / l). in another study also, the authors reported a low value (18 u / l) at the time of diagnosis. the differential diagnoses to consider are psoriasis, atopic dermatitis, seborrheic dermatitis, contact dermatitis, skin infections with candida, langerhans cell histiocytosis, and cystic fibrosis. once the disease has been diagnosed, the treatment consists of oral zinc supplementation given daily, which leads to a dramatic disappearance of the symptoms within a few days. with treatment, the survival rate is 100%. the limitation of our case report is the fact that on presentation to a genetic consult, dna samples were taken to carry out specific genetic tests for both the patient and his parents, but we still could not perform them, because these techniques are currently unavailable in romania. acrodermatitis enteropathica is a rare condition ; early recognition of cutaneous manifestation being necessary, particularly because of immunodeficiency and infection concerns in these patients. patients with repetitive bacterial skin superinfections may be misdiagnosed for months after initial presentation, as in the case of our patient. in the presented case, the diagnosis was delayed because of change in clinical symptoms, through the absence of the diarrhea and through the recurrent bacterial superinfection. | abstractacrodermatitis enteropathica is a rare genetic autosomal recessive disorder, characterized by periorificial dermatitis, alopecia, and diarrhea. it is caused by mutations in the gene that encodes a membrane protein that binds zinc. we report a 14-month - old boy, admitted for erythematous, scaly and pustular lesions, initially located in the inguinal and perianal regions and on thighs, and very few erythematous lesions on the face. due to the numerous bacterial skin superinfections with staphylococcus aureus, including abscesses that required surgical incision, the clinical picture was modified, leading to a delayed establishment of the diagnosis. later, the symptoms became suggestive for this disease, the diagnostic having been confirmed by low plasma zinc values. under zinc therapy, skin lesions improved significantly in a few days, with favorable outcome. two months later, the skin lesions almost disappeared.abscesses due to bacterial skin superinfections may lead to initially misdiagnosed acrodermatitis enteropathica. |
diffusion tensor imaging (dti) is a noninvasive magnetic resonance imaging (mri)-based technique that is increasingly used to characterize microstructural brain changes in parkinson 's disease (pd). mean diffusivity (md) and fractional anisotropy (fa) are common dti measures extracted from the diffusion tensor which measure the magnitude of water diffusion and directional dependence of diffusivity respectively. many dti studies on pd are based on a cross - sectional design at 1 time point. although longitudinal nuclear imaging studies have been conducted in pd, radiation risk, cost, and infrastructural support limit their clinical utility. we hypothesize that change in dti parameters in nigrostriatal structures may be useful correlates with motor progression. to address current gaps in the literature, we conducted a prospective dti mri brain study of a cohort of 46 pd patients over a 6-year period to determine if the change in dti md and fa for specific brain regions correlates with disease progression. the study received approval from the institutional ethics committee (year of approval 2011, grant number 2002/009/d / c) and all patients gave written informed consent. the patients were diagnosed with mild to moderate pd at recruitment by movement disorders neurologists based on the united kingdom brain bank criteria and were part of an earlier dti study. they were evaluated using the united parkinson disease rating scale (updrs) motor scores over a 6-year period. they underwent brain imaging twice (at baseline and 6 years later) on a 1.5 t mr scanner (siemens avanto, erlangen, germany), using a standardized imaging protocol. briefly, the diffusion data was obtained using an echo planar imaging sequence with 12 directions, b - values of 0 and 800 s / mm, te / tr = 90/4300 ms, 1.2 1.2 4 mm voxel size and 4 averages. for both mri, patients were scanned during their on stage to reduce motion, with the scan tilt parallel to the anterior - posterior commissural (ac - pc) lines. fa and md values were obtained using the dti taskcard on the leonardo workstation (siemens, erlangen, germany). two raters, blinded to the clinical severity and disease progression, independently placed regions of interest (rois) using standardized techniques and atlas - based reference maps on the brain structures (figure 1). rois (40.2 mm) were drawn in the substantia nigra on the slice below which the red nucleus was most prominently as seen on the b0 image. rois were also placed in the caudate (44.2 mm), anterior putamen (106 mm), posterior putamen (106 mm), and ventrolateral thalamus (106 mm) on the slice immediately above the ac - pc line. for the frontal white matter, rois (350 mm) were placed on the slice where the lateral ventricles are no longer seen. ab colour fa maps (left) and corresponding b0 images (right), depicting placement of regions of interest (rois) in the (a) caudate, anterior, and posterior putamen, ventrolateral thalamus, (b) frontal white matter and c, (c) substantia nigra. all statistical analyses were done using r 3.0.2 (www.r-project.org) with a 2-sided significance level of 0.05. intraclass correlation coefficient values comparing the dti parameters obtained by the 2 raters were calculated. the wilcoxon signed - rank sum test was performed to evaluate the change in md and fa. linear regression analysis was carried out to evaluate the relationship of the change in md and fa and change in the updrs motor score between baseline and year 6 scan with adjustments for age and gender. the study received approval from the institutional ethics committee (year of approval 2011, grant number 2002/009/d / c) and all patients gave written informed consent. the patients were diagnosed with mild to moderate pd at recruitment by movement disorders neurologists based on the united kingdom brain bank criteria and were part of an earlier dti study. they were evaluated using the united parkinson disease rating scale (updrs) motor scores over a 6-year period. they underwent brain imaging twice (at baseline and 6 years later) on a 1.5 t mr scanner (siemens avanto, erlangen, germany), using a standardized imaging protocol. briefly, the diffusion data was obtained using an echo planar imaging sequence with 12 directions, b - values of 0 and 800 s / mm, te / tr = 90/4300 ms, 1.2 1.2 4 mm voxel size and 4 averages. for both mri, patients were scanned during their on stage to reduce motion, with the scan tilt parallel to the anterior - posterior commissural (ac - pc) lines. fa and md values were obtained using the dti taskcard on the leonardo workstation (siemens, erlangen, germany). two raters, blinded to the clinical severity and disease progression, independently placed regions of interest (rois) using standardized techniques and atlas - based reference maps on the brain structures (figure 1). rois (40.2 mm) were drawn in the substantia nigra on the slice below which the red nucleus was most prominently as seen on the b0 image. rois were also placed in the caudate (44.2 mm), anterior putamen (106 mm), posterior putamen (106 mm), and ventrolateral thalamus (106 mm) on the slice immediately above the ac - pc line. for the frontal white matter, rois (350 mm) were placed on the slice where the lateral ventricles are no longer seen. ab colour fa maps (left) and corresponding b0 images (right), depicting placement of regions of interest (rois) in the (a) caudate, anterior, and posterior putamen, ventrolateral thalamus, (b) frontal white matter and c, (c) substantia nigra. all statistical analyses were done using r 3.0.2 (www.r-project.org) with a 2-sided significance level of 0.05. intraclass correlation coefficient values comparing the dti parameters obtained by the 2 raters were calculated. the wilcoxon signed - rank sum test was performed to evaluate the change in md and fa. linear regression analysis was carried out to evaluate the relationship of the change in md and fa and change in the updrs motor score between baseline and year 6 scan with adjustments for age and gender. the mean age of the pd patients was 70.1 years 9.3 and 47.8% were men. the median duration of pd at presentation was 3 years, inter quarter range (1.25, 5). the inter - rater agreement was excellent with intraclass correlation coefficients > 0.8 for all roi dti parameters. changes in md and fa in all brain regions from the baseline to the year 6 scan were shown in table 1. compared to the baseline scan, md increased in all brain regions (p 6 years in the sn in our cohort. fa also increased in other subcortical nuclei : the caudate, putamen, and thalamus. ferritin - bound iron has been found to affect dti parameters, with fa increasing as iron concentrations increase, whereas md was insensitive to these changes. iron deposition in sn and basal ganglia of pd patients may explain the fa increase in part. differential patterns of mineralization of the deep gray nuclei add to the complexity and may account for the subnuclear regional fa differences. the lack of association in the posterior putamen compared to the anterior putamen in our study could be explained by the potential confounder from more iron deposition in the posterolateral putamen compared to anteromedial putamen. a study in 14 pd patients showed increased iron in caudal putamen but not in anterior putamen over a 3-year period. besides iron, selective elimination of myelinated fibers traversing gray nuclei, targeted loss of specific dendritic connections, gliosis and tissue compaction are other postulated mechanisms explaining increases in fa. clearly, fa changes are complex and multifactorial, susceptible to iron effects and other complex striatal microstructural reorganization induced by dopaminergic denervation. in contrast, the frontal white matter, which is remote from the nigrostriatal circuitry and contains little iron, showed a distinctly different pattern of fa decrease and md increase over time. in cross - section studies, zhan demonstrated decreased fa in frontal white matter in pd compared with health controls. the decreased fa decrease in the frontal white matter in pd patients in our longitudinal study corroborates this hypothesis. however, as the main objective of the study was to identify dti parameters that can correlate with clinical disease progression in pd, the patients were used as their own controls. furthermore, for long - term longitudinal studies, it will be difficult to find 1 for 1 matching since no individual will be alike for the potential confounding variables over time. as this is an observation study, 1 can not prove a cause effect association. our regression analysis showed a correlation between anterior putamen diffusivity and progression of motor scores over a 6-year period. this suggests that mean diffusivity in anterior putamen may be a noninvasive imaging marker for disease progression. nuclear imaging (18f fluoro - l - dopa) studies over 5 years have shown that the disease process in pd first affects posterior putamen, followed by the anterior putamen and the caudate nucleus. in conclusion, our longitudinal 6-year study involving a large cohort of pd patients demonstrated that increase in anterior putaminal diffusivity correlated with disease progression. our findings also suggest that serial diffusivity changes are more consistent than anisotropy changes and may be useful as an additional objective in vivo biomarker for evaluating disease progression in pd. further longitudinal multimodal mri studies to evaluate the utility of both diffusion and brain - iron changes in pd in monitoring disease progression and response to therapy will be useful. | abstractdiffusion tensor imaging (dti) is an increasingly used noninvasive imaging tool. however its long - term clinical utility is unclear. parkinson 's disease (pd) is a common neurodegenerative disease.we prospectively examined a cohort of 46 parkinson 's disease (pd) patients who underwent diffusion tensor imaging (dti) of the brain at baseline and 6 years later on a 1.5 tesla scanner using a standardized protocol. dti parameters of mean diffusivity (md) and fractional anisotrophy (fa) were extracted using regions - of - interest (rois) analysis from various brain regions.compared to the baseline scan, md increased in all brain regions (p < 0.0001). fa increased in the substantia nigra and posterior putamen, but decreased in the frontal white matter (p < 0.0001). linear regression analysis demonstrated that the md in the anterior putamen increased 11.6 units (95% ci = [4.71, 18.43 ]) (p = 0.0003) for every unit increase of united pd rating scale (updrs).our 6-year prospective longitudinal study demonstrated increased diffusivity in all brain regions and that in the anterior putamen correlated with disease progression. serial diffusion data may be useful as an additional objective in vivo biomarker for motor progression in pd. |
ins-1 cells (passage 545) were cultured in rpmi1640 medium (sigma) containing 11.1 mmol / l d - glucose supplemented with 10% heat - inactivated fbs, 10 mmol / l hepes, 100 units / ml penicillin, 100 mg / ml streptomycin, 1 mmol / l sodium pyruvate, and 50 mol / l -mercaptoethanol at 37c in a humidified incubator containing 5% co2. cells were grown in 12-well plates at a density of 5 10 per well for electrophysiology and on 12-mm poly - l - lysine coated coverslips for immunocytochemistry. pancreatic -cells were isolated from the islets of langerhans of sprague - dawley rats weighing 200300 g. animals were anesthetized with pentobarbital sodium (50 mg / kg, i.p.). all procedures were approved by the institute of laboratory animal resources at seoul national university. islets were isolated after digesting the pancreas by injecting 1 mg / ml collagenase dissolved in hank 's balanced salt saline (hbss, sigma) solution into pancreatic ducts. collected islets were dispersed mechanically into single cells in ca - free krebs - ringer bicarbonate buffer (krbb, sigma) and then plated onto poly - l - lysine coated coverslips and cultured for 45 days in rpmi1640 medium containing 11.1 mmol / l d - glucose, 100 units / ml penicillin, and 100 mg / ml streptomycin. we confirmed by poly(adp - ribose) polymerase cleavage assay that cell viability was not affected after glucose deprivation for 2 h. katp channel currents were monitored at room temperature using a standard whole - cell or inside - out patch - clamp technique with an epc-10 amplifier and pulse software (version 8.67 ; heka electronik) and analyzed using igor software. the cell - attached patch technique was used to measure unitary katp currents with an axopatch 200b amplifier and analyzed with pclamp software (axon instruments). patch electrodes were pulled from borosilicate glass capillaries to obtain a resistance between 2 and 5 mol / l. the internal solution for whole - cell experiments contained (in millimoles per liter) 30 kcl, 110 k - aspartate, 2.6 cacl2, 10 hepes (ph 7.2 with koh), 0.5 egta, and 5 edta. the bath solution for whole - cell and cell - attached patch recordings contained (in millimoles per liter) 137 nacl, 5.6 kcl, 10 hepes (ph 7.4 with naoh), 0.5 mgcl2, and 1.8 cacl2. compound c (calbiochem) and 5-aminoimidazole-4-carboxamide ribonucleoside (aicar, calbiochem) were added during pretreatment as indicated in the text and included during current recordings. for inside - out and cell - attached patch recordings, pipettes were filled with a solution containing (in millimoles per liter) 140 kcl, 2.6 cacl2, 1 mgcl2, and 10 hepes (ph 7.2 with koh) ; upon patch excision in inside - out experiments, bath solutions were changed to a solution containing (in millimoles per liter) 107 kcl, 1 cacl2, 2 mgcl2, 10 hepes, and 11 egta (ph 7.2 with koh). cells were fixed with 4% paraformaldehyde in pbs for 15 min. for katp channel staining, cells were permeabilized with 0.25% triton x-100 in pbs for 10 min, blocked with 2% donkey serum in pbs for 30 min at room temperature, and incubated with rabbit anti - kir6.2 (1:50, santa cruz biotechnology) and goat anti - sur1 (1:50, santa cruz biotechnology) and rabbit anti kir2.1 (1:50, santa cruz biotechnology) antibodies overnight at 4c. the subcellular localizations of kir6.2 were assessed using alexa488-conjugated anti - rabbit igg antibody (488-nm excitation, 1:100, invitrogen) and cy5-conjugated anti - goat igg (633-nm excitation, 1:100, jackson immunoresearch) antibodies, respectively. images were acquired by confocal microscopy (leica, germany ; fluoview 1000, olympus) using a 63 oil - immersion objective. the same instrument settings were used for each experiment, and all experiments were repeated at least three times. because we did not identify -cells using insulin antibody, we could not entirely exclude the possibility that -cells or -cells were included in our observation. the surface and total expression levels of kir6.2 were determined by western blot analysis using an antibody to kir6.2 (1:1,000, santa cruz biotechnology). the surface protein fractions of ins-1 cells were assessed using surface biotinylation ez - link sulfo - nhs - ss - biotin kits (pierce). to verify consistent amounts of surface proteins, the membrane probed by kir6.2 primary antibody was washed for 2 h and examined by immunoblot using an antibody to kir2.1 (1:1,000, santa cruz biotechnology). total protein was prepared by incubating cells with ripa buffer, and proteins were resolved by 12% sds - page. insulin secretion from rat pancreatic islets was measured by enzyme immunoassay (elisa kits, mercodia). changes in insulin secretion in response to glucose deprivation were monitored using the batch incubation method by collecting samples at 30-min intervals. all statistical analyses were performed using anova, and p < 0.05 was considered to be significant. ins-1 cells (passage 545) were cultured in rpmi1640 medium (sigma) containing 11.1 mmol / l d - glucose supplemented with 10% heat - inactivated fbs, 10 mmol / l hepes, 100 units / ml penicillin, 100 mg / ml streptomycin, 1 mmol / l sodium pyruvate, and 50 mol / l -mercaptoethanol at 37c in a humidified incubator containing 5% co2. cells were grown in 12-well plates at a density of 5 10 per well for electrophysiology and on 12-mm poly - l - lysine coated coverslips for immunocytochemistry. pancreatic -cells were isolated from the islets of langerhans of sprague - dawley rats weighing 200300 g. animals were anesthetized with pentobarbital sodium (50 mg / kg, i.p.). all procedures were approved by the institute of laboratory animal resources at seoul national university. islets were isolated after digesting the pancreas by injecting 1 mg / ml collagenase dissolved in hank 's balanced salt saline (hbss, sigma) solution into pancreatic ducts. collected islets were dispersed mechanically into single cells in ca - free krebs - ringer bicarbonate buffer (krbb, sigma) and then plated onto poly - l - lysine coated coverslips and cultured for 45 days in rpmi1640 medium containing 11.1 mmol / l d - glucose, 100 units / ml penicillin, and 100 mg / ml streptomycin. we confirmed by poly(adp - ribose) polymerase cleavage assay that cell viability was not affected after glucose deprivation for 2 h. katp channel currents were monitored at room temperature using a standard whole - cell or inside - out patch - clamp technique with an epc-10 amplifier and pulse software (version 8.67 ; heka electronik) and analyzed using igor software. the cell - attached patch technique was used to measure unitary katp currents with an axopatch 200b amplifier and analyzed with pclamp software (axon instruments). patch electrodes were pulled from borosilicate glass capillaries to obtain a resistance between 2 and 5 mol / l. the internal solution for whole - cell experiments contained (in millimoles per liter) 30 kcl, 110 k - aspartate, 2.6 cacl2, 10 hepes (ph 7.2 with koh), 0.5 egta, and 5 edta. the bath solution for whole - cell and cell - attached patch recordings contained (in millimoles per liter) 137 nacl, 5.6 kcl, 10 hepes (ph 7.4 with naoh), 0.5 mgcl2, and 1.8 cacl2. compound c (calbiochem) and 5-aminoimidazole-4-carboxamide ribonucleoside (aicar, calbiochem) were added during pretreatment as indicated in the text and included during current recordings. for inside - out and cell - attached patch recordings, pipettes were filled with a solution containing (in millimoles per liter) 140 kcl, 2.6 cacl2, 1 mgcl2, and 10 hepes (ph 7.2 with koh) ; upon patch excision in inside - out experiments, bath solutions were changed to a solution containing (in millimoles per liter) 107 kcl, 1 cacl2, 2 mgcl2, 10 hepes, and 11 egta (ph 7.2 with koh). cells were fixed with 4% paraformaldehyde in pbs for 15 min. for katp channel staining, cells were permeabilized with 0.25% triton x-100 in pbs for 10 min, blocked with 2% donkey serum in pbs for 30 min at room temperature, and incubated with rabbit anti - kir6.2 (1:50, santa cruz biotechnology) and goat anti - sur1 (1:50, santa cruz biotechnology) and rabbit anti kir2.1 (1:50, santa cruz biotechnology) antibodies overnight at 4c. the subcellular localizations of kir6.2 were assessed using alexa488-conjugated anti - rabbit igg antibody (488-nm excitation, 1:100, invitrogen) and cy5-conjugated anti - goat igg (633-nm excitation, 1:100, jackson immunoresearch) antibodies, respectively. images were acquired by confocal microscopy (leica, germany ; fluoview 1000, olympus) using a 63 oil - immersion objective. the same instrument settings were used for each experiment, and all experiments were repeated at least three times. because we did not identify -cells using insulin antibody, we could not entirely exclude the possibility that -cells or -cells were included in our observation. the surface and total expression levels of kir6.2 were determined by western blot analysis using an antibody to kir6.2 (1:1,000, santa cruz biotechnology). the surface protein fractions of ins-1 cells were assessed using surface biotinylation ez - link sulfo - nhs - ss - biotin kits (pierce). to verify consistent amounts of surface proteins, the membrane probed by kir6.2 primary antibody was washed for 2 h and examined by immunoblot using an antibody to kir2.1 (1:1,000, santa cruz biotechnology). total protein was prepared by incubating cells with ripa buffer, and proteins were resolved by 12% sds - page. insulin secretion from rat pancreatic islets was measured by enzyme immunoassay (elisa kits, mercodia). changes in insulin secretion in response to glucose deprivation were monitored using the batch incubation method by collecting samples at 30-min intervals. all statistical analyses were performed using anova, and p < 0.05 was considered to be significant. to investigate the roles of energy - dependent signaling mechanisms in katp channel regulation, we pretreated ins-1 cells with different concentrations of glucose (0 mmol / l for glucose - deprived [gd ], 3 mmol / l for low glucose [3 g ], 11.1 mmol / l for control [11 g ]) for 2 h at room temperature before katp currents were recorded. 1a. to induce the maximal activation of katp channels, we dialyzed the cells with atp - free internal solutions and monitored changes in cell conductance in response to the washout of intracellular atp by applying hyperpolarizing pulses to 130 mv, from a holding potential of 70 mv every 10 s (fig. we confirmed that the increases in currents under these conditions were because of katp channel activation by testing the effect of glibenclamide, a selective katp channel blocker (data not shown). for reliable measurements of maximum current amplitude, the katp current rundown was minimized by adding 5 mmol / l edta to the internal solutions (19). upon patch break - in, several minutes passed until the whole - cell conductance increased rapidly and reached the maximum level. this delay was longer in cells pretreated with 11 g than that in cells pretreated with 3 g or the gd solution. this observation was expected because the initial atp concentrations would be higher in 11g - treated cells, so that atp washout would take longer. however, it was surprising to find that the amplitudes of katp currents at their maximum activation were much smaller in 11g - treated cells than in 3g- or gd - treated cells (fig. the maximum katp conductance (gmax), calculated by measuring the difference in current amplitudes between 130 and 70 mv, was normalized to the cell capacitance (cm). ns / pf) was similar to that in 3g - treated cells (2.28 0.12 ns / pf), whereas that in 11g - treated cells (0.33 0.05 ns / pf) was significantly less than that in gd- or 3g - treated cells (p no significant difference in cm was observed among 11 g, 3 g, and gd - treated cells (12.01 0.28 pf ; n = 130).. a : schematic diagram of the experimental protocols used for treating cells before current recording. 11 g, 3 g, and gd represent 11.1 mmol / l, 3 mmol / l, and 0 mmol / l glucose, respectively. b : representative recordings of katp whole - cell currents in 11g-, 3g-, and gd - treated ins-1 cells. whole - cell current traces were obtained by hyperpolarizing pulses to 130 mv (500 ms) from a holding potential of 70 mv every 10 s. c : mean conductance normalized to cell capacitance (ns / pf) measured at peak activation from 11g-, 3g-, and gd - treated cells (n = 8, 11, and 12, respectively). d : single katp channel currents recorded at 60 mv from an inside - out patch obtained from 11g- (upper panel) and gd - treated ins-1 cells (lower panel) exposed to 0.25 mmol / l diazoxide in the presence of 1 mol / l mgatp. e : upper panel : mean katp channel activity (npo) in 11g- and gd - treated cells. mean values for npo ; 0.16 0.04 (n = 28) in 11 g and 0.86 0.12 (n = 28) in gd, 0.05 0.02 (n = 16) in 11 g and 0.25 0.06 (n = 28) in gd, 0.04 0.01 (n = 8) in 11 g and 0.15 0.04 (n = 10) in gd when the cells were exposed to 0.25 mmol / l diazoxide in the presence of 1 mol / l, 10 mol / l, and 100 mol / l mgatp, respectively. lower panel : maximum number of channels opened at the same time (n ') within the excised patch pipette. statistical significance was evaluated by an unpaired t test and one - way anova. p < 0.001. it may be argued whether the lower gmax in 11g - treated cells was because of insufficient washout of cellular factors that could suppress katp channels. to exclude this possibility, we used inside - out excised patch recordings, yet significant differences in katp channel activities were still observed between 11g- and gd - treated cells. the mean value for npo obtained in the presence of diazoxide (0.25 mmol / l) and atp in gd - treated cells was about five times larger than that in 11g - treated cells (fig. furthermore, the maximum number of channels opened at the same time in a patch membrane (n ') was significantly more in gd - treated cells compared with 11g - treated cells. the differences between 11g- and gd - treated cells were unaffected by varying atp concentrations (fig these results support the hypothesis that some energy - dependent signaling mechanism(s) activated during the pretreatment in 3 g or gd was required to activate katp conductance to its full capacity. there was no evidence that the atp sensitivity and gating kinetics (mean open time) of the katp channels were affected by glucose deprivation (supplementary figs. s1 and s2). we next investigated which signaling mechanism is responsible for the gd - induced increases in katp channels. the activation of ampk by glucose deprivation has been reported in insulin - secreting cell lines (18). to confirm that ampk was activated in ins-1 cells by glucose deprivation or low glucose (3 mmol / l), western blot analysis was performed using a phosphorylation - specific antibody. the levels of the phosphorylated ampk (pthr) increased similarly for cells in 0 or 3 mmol / l glucose solutions, reaching maximum levels after 2 h at room temperature and 30 min at 37c, whereas the total ampk levels were unaffected (fig. we tested the involvement of ampk in gd - induced increases in katp channel activities using compound c (an ampk inhibitor) (20), ampk sirna transfection, and aicar (an ampk activator) (21). mol / l) for 30 min before current recording in glucose - free solution (gd + cc ; fig. 2b, upper panel), and gmax (0.22 0.04 ns / pf ; n = 11) became similar to the background conductance measured in the presence of glibenclamide (0.12 0.03 ns / pf). we confirmed that the katp channel activity recorded by inside - out patches was not affected by compound c applied to the internal side of the membrane (supplementary fig. s3b), but katp current activation in gd - treated cells in whole - cell recordings was abolished by adding compound c to internal solutions (supplementary fig. these results indicated that compound c inhibited katp channels not directly but by inhibiting intracellular mechanisms and that this inhibitory effect appeared in a relatively short period. furthermore, katp current activation in 11g - treated cells increased significantly when aicar (0.5 mmol / l) was added 20 min before current recording (fig. 2b, middle panel), the application of aicar to gd - treated cells did not induce further increases in gmax. the effects of compound c and aicar on katp channel activities observed in inside - out recordings (fig. the finding that the effect of glucose deprivation on katp channels was inhibited by compound c and mimicked by aicar indicated that ampk was responsible for the gd - induced increases in katp conductance. we confirmed that the effects of gd, compound c, and aicar on katp conductance were similarly observed in pancreatic -cells (supplementary fig. a : the levels of phosphorylated ampk (upper panel) and total ampk (lower panel) measured by western blot assay from cell lysates of ins-1 cells pretreated with 3 g or gd solution for the times indicated at room temperature (25c, left panel) and 37c (right panel). b : katp whole - cell currents recorded in cells pretreated with compound c (10 mol / l) in glucose - free solution (gd + cc, upper panel) and in cells pretreated with aicar (0.5 mmol / l) in 11.1 mmol / l glucose solution (11 g + aicar, middle panel). lower panel : normalized mean conductance (ns / pf) obtained in gd + cc (0.22 0.04 ; n = 11), 11 g + aicar (2.10 0.43 ; n = 6), and gd + aicar (2.44 0.40 ; n = 6) are compared with those of gd and 11 g shown in fig. 1c. c : single katp channel currents recorded at 60 mv in an inside - out patch obtained from gd + cc (upper panel) and 11 g + aicar treated ins-1 cells (middle panel). mean values for npo obtained in gd + cc (0.06 0.02 ; n = 13) and 11 g + aicar (0.20 0.06 ; n = 7) are compared with those of gd and 11 g shown in fig. d : whole - cell current traces obtained from ins-1 cells transfected with scr or siampk and pretreated in zero glucose for 2 h. normalized gmax (in ns / pf) ; 0.39 0.17 (n = 7) in siampk - transfected gd cells and 3.26 0.52 (n = 7) in scr - transfected gd cells. the gmax values in two gd + siampk cells that display exceptionally large currents are indicated separately by open circles above the bar. statistical significance was evaluated by unpaired t test and one - way anova. p < 0.05, p < 0.01, p < 0.001. the involvement of ampk in katp channel regulation was further confirmed in ins-1 cells transfected with both 1- and 2-ampk sirna (siampk) (research design and methods are described in the online appendix). the total expression of the -subunit of ampk in cells transfected with siampk was significantly lower than that in cells transfected with an equal concentration of scrambled sirna (scr ; supplementary fig. green fluorescence protein was cotransfected, and green fluorescence protein - positive cells were selected for current recordings. transfection of scr did not appear to affect the katp current in gd - treated cells (fig. 2d, lower panel), and the normalized gmax was similar to that in untransfected cells (fig. 1). in contrast, the katp current activation in cells transfected with siampk was negligible in seven of nine cells (fig. 2d, upper panel). in two cells, katp current activation was well observed, probably because of the variation in ampk knockdown levels among cells. the gmax values in these cells were not included in the calculation of the mean value and are shown separately with open circles above the bar (fig., higher katp channel activity can be caused by increasing the number of functional channels (n) or by increasing the open probability (po). because the measurement of gmax or npo can not distinguish these two possibilities (further discussion in the online appendix), we examined changes in the surface expression levels of kir6.2 using surface biotinylation / streptavidin purification and subsequent western blot analysis in ins-1 cells. for the loading control, we probed the same blots with an antibody to kir2.1, another inward - rectifying k channel. we found that the kir6.2 surface levels were low in 11g- or 6g - treated cells (supplementary fig. s5b) but increased similarly in 3g- and gd - treated cells (duration of pretreatment : 2 h ; fig. the increase in kir6.2 surface level was dependent on the duration of glucose deprivation up to 2 h (fig. 3a), which was consistent with the effect of glucose deprivation on ampk activation (fig. in contrast, the increase in surface kir6.2 by glucose deprivation was abolished by compound c (duration of compound c application : 20 min in fig. s5b). increased kir6.2 surface expression was not induced by inducing hyperpolarization using a katp channel opener (diazoxide ; supplementary fig. s5b) but induced by the addition of aicar to 11 g solution (fig. kir2.1 surface levels remained unchanged by these treatments, indicating that the above effects were specific to kir6.2. we also verified that the total kir6.2 levels detected by directly immunoblotting the cell lysates did not change under these conditions, indicating that the ampk - induced signaling activated during 3 g or gd treatments regulated kir6.2 trafficking to increase the kir6.2 surface levels without changes in gene expression. a : ins-1 cells were incubated with gd medium for the times indicated before surface labeling with a biotin probe. the surface (s) or total (t) expression level of kir6.2 was assessed by western blot analysis as described in the online appendix. kir2.1, a surface channel that does not react on glucose deprivation, was used as a negative control. b : the cells were maintained with 11 g, 3 g, or gd medium in the presence or absence of 40 mol / l compound c for 2 h before surface labeling with a biotin probe. the surface expression level of kir6.2 was quantified by densitometry and expressed as an arbitrary value to that of the cells incubated with gd medium, which was set to 1. c : the cells were treated with 0.5 mmol / l aicar - containing 11 g medium for the times indicated before surface labeling with a biotin probe. the surface expression level of kir6.2 was quantified by using the same method in b. statistical significance was determined by anova.. to observe changes in channel protein distributions, we used confocal microscopy with fluorescent - labeled antibodies to kir6.2 (green) in pancreatic -cells. the nucleus and plasma membrane were located using dii (red) and dapi (blue), respectively. in 11g - treated cells, punctuate structures were observed scattered in the cytosol (fig. 4a), whereas in gd - treated cells, dominant fluorescence signals were observed at the cell periphery (fig. the fluorescence intensity profiles measured along a line drawn across the cell membrane excluding the nucleus also confirmed that the areas of high intensity were scattered randomly in 11g - treated cells and at the cell periphery in gd - treated cells. the kir6.2 signals at the cell periphery exhibited broader signal intensity than the red fluorescence signals emitted by plasma membrane marker dii, suggesting that the amount kir6.2 subunits underneath the membrane, as well as integrated at the surface membrane, were higher in gd - treated cells. when compound c was added to the glucose - deprived medium, the effects of glucose deprivation on the distribution of kir6.2 subunits were abolished (fig. when aicar was added to the 11 g solution, the distribution pattern and intensity profile of kir6.2 subunits were similar to those of gd - treated cells (fig. these results indicate that ampk activation increases katp channel surface expression by regulating the trafficking of katp channel proteins. we confirmed that sur1 distribution was changed by each treatment similarly to those observed for kir6.2 subunits (supplementary fig. d : confocal fluorescent images obtained from pancreatic -cells immunolabeled with kir6.2 antibody (green, second panel) in 11 g (a), gd (b), gd + cc (c), and 11 g + aicar (d). both compound c (10 mol / l) and aicar (0.5 mmol / l) were pretreated for 1 h before fixation. nucleus was stained with dapi (blue, first panel), and plasma membrane was stained with dii (red, third panel). cells were incubated with these dyes (dapi, 405-nm excitation, 1:5,000, molecular probes ; dii, 543-nm excitation, 1:1,000, sigma) for 5 min immediately before mounting. overlay of the fluorescence images showing kir6.2, dapi, and dii (fourth panel). the intensity profiles of kir6.2 (green) and dii (red) fluorescence measured along a yellow line drawn across the cell membrane excluding the nucleus (fifth panel). (a high - quality color digital representation of this figure is available in the online issue.) to test the functional significance of the ampk - dependent modulation of katp channels, we examined whether compound c and aicar cause decreases in insulin secretion in response to glucose deprivation (fig. the insulin secretion measured at 11.1 mmol / l glucose was higher in the presence of compound c, but lower in the presence of aicar when compared with the control. after glucose deprivation, the release of insulin decreased gradually to the minimum level within 1 h for the control ; this response was inhibited significantly by compound c, whereas pretreatment with aicar facilitated the decrease in insulin secretion in response to glucose deprivation. effects of compound c and aicar on decreased insulin secretion because of glucose deprivation. a : experimental protocol showing of how islets were incubated in 11.1 mmol / l glucose for 1 h before removing the glucose (time set as 0 min). the samples for insulin measurements were taken from each independent batch at 30, 0, 30, 60, 90, and 120 min (arrows) in the krb buffer. b : time - dependent changes in the percentage of islet insulin content secreted during acute glucose deprivation. insulin secretion as a percentage of total insulin content (secreted / total) was calculated. control (circles) ; in the presence of compound c (triangles) ; in the presence of aicar (squares). for each data point p < 0.05, p < 0.01, p < 0.001 compared with the control. to investigate the roles of energy - dependent signaling mechanisms in katp channel regulation, we pretreated ins-1 cells with different concentrations of glucose (0 mmol / l for glucose - deprived [gd ], 3 mmol / l for low glucose [3 g ], 11.1 mmol / l for control [11 g ]) for 2 h at room temperature before katp currents were recorded. 1a. to induce the maximal activation of katp channels, we dialyzed the cells with atp - free internal solutions and monitored changes in cell conductance in response to the washout of intracellular atp by applying hyperpolarizing pulses to 130 mv, from a holding potential of 70 mv every 10 s (fig. we confirmed that the increases in currents under these conditions were because of katp channel activation by testing the effect of glibenclamide, a selective katp channel blocker (data not shown). for reliable measurements of maximum current amplitude, the katp current rundown was minimized by adding 5 mmol / l edta to the internal solutions (19). upon patch break - in, several minutes passed until the whole - cell conductance increased rapidly and reached the maximum level. this delay was longer in cells pretreated with 11 g than that in cells pretreated with 3 g or the gd solution. this observation was expected because the initial atp concentrations would be higher in 11g - treated cells, so that atp washout would take longer. however, it was surprising to find that the amplitudes of katp currents at their maximum activation were much smaller in 11g - treated cells than in 3g- or gd - treated cells (fig. the maximum katp conductance (gmax), calculated by measuring the difference in current amplitudes between 130 and 70 mv, was normalized to the cell capacitance (cm). ns / pf) was similar to that in 3g - treated cells (2.28 0.12 ns / pf), whereas that in 11g - treated cells (0.33 0.05 ns / pf) was significantly less than that in gd- or 3g - treated cells (p no significant difference in cm was observed among 11 g, 3 g, and gd - treated cells (12.01 0.28 pf ; n = 130).. a : schematic diagram of the experimental protocols used for treating cells before current recording. 11 g, 3 g, and gd represent 11.1 mmol / l, 3 mmol / l, and 0 mmol / l glucose, respectively. b : representative recordings of katp whole - cell currents in 11g-, 3g-, and gd - treated ins-1 cells. whole - cell current traces were obtained by hyperpolarizing pulses to 130 mv (500 ms) from a holding potential of 70 mv every 10 s. c : mean conductance normalized to cell capacitance (ns / pf) measured at peak activation from 11g-, 3g-, and gd - treated cells (n = 8, 11, and 12, respectively). d : single katp channel currents recorded at 60 mv from an inside - out patch obtained from 11g- (upper panel) and gd - treated ins-1 cells (lower panel) exposed to 0.25 mmol / l diazoxide in the presence of 1 mol / l mgatp. e : upper panel : mean katp channel activity (npo) in 11g- and gd - treated cells. mean values for npo ; 0.16 0.04 (n = 28) in 11 g and 0.86 0.12 (n = 28) in gd, 0.05 0.02 (n = 16) in 11 g and 0.25 0.06 (n = 28) in gd, 0.04 0.01 (n = 8) in 11 g and 0.15 0.04 (n = 10) in gd when the cells were exposed to 0.25 mmol / l diazoxide in the presence of 1 mol / l, 10 mol / l, and 100 mol / l mgatp, respectively. lower panel : maximum number of channels opened at the same time (n ') within the excised patch pipette. statistical significance was evaluated by an unpaired t test and one - way anova. p < 0.001. it may be argued whether the lower gmax in 11g - treated cells was because of insufficient washout of cellular factors that could suppress katp channels. to exclude this possibility, we used inside - out excised patch recordings, yet significant differences in katp channel activities were still observed between 11g- and gd - treated cells. the mean value for npo obtained in the presence of diazoxide (0.25 mmol / l) and atp in gd - treated cells was about five times larger than that in 11g - treated cells (fig. furthermore, the maximum number of channels opened at the same time in a patch membrane (n ') was significantly more in gd - treated cells compared with 11g - treated cells. the differences between 11g- and gd - treated cells were unaffected by varying atp concentrations (fig these results support the hypothesis that some energy - dependent signaling mechanism(s) activated during the pretreatment in 3 g or gd was required to activate katp conductance to its full capacity. there was no evidence that the atp sensitivity and gating kinetics (mean open time) of the katp channels were affected by glucose deprivation (supplementary figs. s1 and s2). we next investigated which signaling mechanism is responsible for the gd - induced increases in katp channels. the activation of ampk by glucose deprivation has been reported in insulin - secreting cell lines (18). to confirm that ampk was activated in ins-1 cells by glucose deprivation or low glucose (3 mmol / l), western blot analysis the levels of the phosphorylated ampk (pthr) increased similarly for cells in 0 or 3 mmol / l glucose solutions, reaching maximum levels after 2 h at room temperature and 30 min at 37c, whereas the total ampk levels were unaffected (fig. we tested the involvement of ampk in gd - induced increases in katp channel activities using compound c (an ampk inhibitor) (20), ampk sirna transfection, and aicar (an ampk activator) (21). mol / l) for 30 min before current recording in glucose - free solution (gd + cc ; fig. 2b, upper panel), and gmax (0.22 0.04 ns / pf ; n = 11) became similar to the background conductance measured in the presence of glibenclamide (0.12 0.03 ns / pf). we confirmed that the katp channel activity recorded by inside - out patches was not affected by compound c applied to the internal side of the membrane (supplementary fig. s3b), but katp current activation in gd - treated cells in whole - cell recordings was abolished by adding compound c to internal solutions (supplementary fig. these results indicated that compound c inhibited katp channels not directly but by inhibiting intracellular mechanisms and that this inhibitory effect appeared in a relatively short period. furthermore, katp current activation in 11g - treated cells increased significantly when aicar (0.5 mmol / l) was added 20 min before current recording (fig. 2b, middle panel), becoming indistinguishable from katp current activation of gd - treated cells. the application of aicar to gd - treated cells did not induce further increases in gmax. the effects of compound c and aicar on katp channel activities observed in inside - out recordings (fig. the finding that the effect of glucose deprivation on katp channels was inhibited by compound c and mimicked by aicar indicated that ampk was responsible for the gd - induced increases in katp conductance. we confirmed that the effects of gd, compound c, and aicar on katp conductance were similarly observed in pancreatic -cells (supplementary fig. a : the levels of phosphorylated ampk (upper panel) and total ampk (lower panel) measured by western blot assay from cell lysates of ins-1 cells pretreated with 3 g or gd solution for the times indicated at room temperature (25c, left panel) and 37c (right panel). b : katp whole - cell currents recorded in cells pretreated with compound c (10 mol / l) in glucose - free solution (gd + cc, upper panel) and in cells pretreated with aicar (0.5 mmol / l) in 11.1 mmol / l glucose solution (11 g + aicar, middle panel). lower panel : normalized mean conductance (ns / pf) obtained in gd + cc (0.22 0.04 ; n = 11), 11 g + aicar (2.10 0.43 ; n = 6), and gd + aicar (2.44 0.40 ; n = 6) are compared with those of gd and 11 g shown in fig. c : single katp channel currents recorded at 60 mv in an inside - out patch obtained from gd + cc (upper panel) and 11 g + aicar treated ins-1 cells (middle panel). mean values for npo obtained in gd + cc (0.06 0.02 ; n = 13) and 11 g + aicar (0.20 0.06 ; n = 7) are compared with those of gd and 11 g shown in fig. d : whole - cell current traces obtained from ins-1 cells transfected with scr or siampk and pretreated in zero glucose for 2 h. normalized gmax (in ns / pf) ; 0.39 0.17 (n = 7) in siampk - transfected gd cells and 3.26 0.52 (n = 7) in scr - transfected gd cells. the gmax values in two gd + siampk cells that display exceptionally large currents are indicated separately by open circles above the bar. statistical significance was evaluated by unpaired t test and one - way anova. p < 0.05, p < 0.01, p < 0.001. the involvement of ampk in katp channel regulation was further confirmed in ins-1 cells transfected with both 1- and 2-ampk sirna (siampk) (research design and methods are described in the online appendix). the total expression of the -subunit of ampk in cells transfected with siampk was significantly lower than that in cells transfected with an equal concentration of scrambled sirna (scr ; supplementary fig., green fluorescence protein was cotransfected, and green fluorescence protein - positive cells were selected for current recordings. transfection of scr did not appear to affect the katp current in gd - treated cells (fig. 2d, lower panel), and the normalized gmax was similar to that in untransfected cells (fig. 1). in contrast, the katp current activation in cells transfected with siampk was negligible in seven of nine cells (fig. 2d, upper panel). in two cells, katp current activation was well observed, probably because of the variation in ampk knockdown levels among cells. the gmax values in these cells were not included in the calculation of the mean value and are shown separately with open circles above the bar (fig. in principle, higher katp channel activity can be caused by increasing the number of functional channels (n) or by increasing the open probability (po). because the measurement of gmax or npo can not distinguish these two possibilities (further discussion in the online appendix), we examined changes in the surface expression levels of kir6.2 using surface biotinylation / streptavidin purification and subsequent western blot analysis in ins-1 cells. for the loading control, we probed the same blots with an antibody to kir2.1, another inward - rectifying k channel. we found that the kir6.2 surface levels were low in 11g- or 6g - treated cells (supplementary fig. s5b) but increased similarly in 3g- and gd - treated cells (duration of pretreatment : 2 h ; fig. the increase in kir6.2 surface level was dependent on the duration of glucose deprivation up to 2 h (fig. 3a), which was consistent with the effect of glucose deprivation on ampk activation (fig. in contrast, the increase in surface kir6.2 by glucose deprivation was abolished by compound c (duration of compound c application : 20 min in fig. s5b). increased kir6.2 surface expression was not induced by inducing hyperpolarization using a katp channel opener (diazoxide ; supplementary fig. s5b) but induced by the addition of aicar to 11 g solution (fig. kir2.1 surface levels remained unchanged by these treatments, indicating that the above effects were specific to kir6.2. we also verified that the total kir6.2 levels detected by directly immunoblotting the cell lysates did not change under these conditions, indicating that the ampk - induced signaling activated during 3 g or gd treatments regulated kir6.2 trafficking to increase the kir6.2 surface levels without changes in gene expression. a : ins-1 cells were incubated with gd medium for the times indicated before surface labeling with a biotin probe. the surface (s) or total (t) expression level of kir6.2 was assessed by western blot analysis as described in the online appendix. kir2.1, a surface channel that does not react on glucose deprivation, was used as a negative control. b : the cells were maintained with 11 g, 3 g, or gd medium in the presence or absence of 40 mol / l compound c for 2 h before surface labeling with a biotin probe. the surface expression level of kir6.2 was quantified by densitometry and expressed as an arbitrary value to that of the cells incubated with gd medium, which was set to 1. c : the cells were treated with 0.5 mmol / l aicar - containing 11 g medium for the times indicated before surface labeling with a biotin probe. the surface expression level of kir6.2 was quantified by using the same method in b. statistical significance was determined by anova.. to observe changes in channel protein distributions, we used confocal microscopy with fluorescent - labeled antibodies to kir6.2 (green) in pancreatic -cells. the nucleus and plasma membrane were located using dii (red) and dapi (blue), respectively. in 11g - treated cells, punctuate structures were observed scattered in the cytosol (fig. 4a), whereas in gd - treated cells, dominant fluorescence signals were observed at the cell periphery (fig. the fluorescence intensity profiles measured along a line drawn across the cell membrane excluding the nucleus also confirmed that the areas of high intensity were scattered randomly in 11g - treated cells and at the cell periphery in gd - treated cells. the kir6.2 signals at the cell periphery exhibited broader signal intensity than the red fluorescence signals emitted by plasma membrane marker dii, suggesting that the amount kir6.2 subunits underneath the membrane, as well as integrated at the surface membrane, were higher in gd - treated cells. s6). when compound c was added to the glucose - deprived medium, the effects of glucose deprivation on the distribution of kir6.2 subunits when aicar was added to the 11 g solution, the distribution pattern and intensity profile of kir6.2 subunits were similar to those of gd - treated cells (fig. these results indicate that ampk activation increases katp channel surface expression by regulating the trafficking of katp channel proteins. we confirmed that sur1 distribution was changed by each treatment similarly to those observed for kir6.2 subunits (supplementary fig. d : confocal fluorescent images obtained from pancreatic -cells immunolabeled with kir6.2 antibody (green, second panel) in 11 g (a), gd (b), gd + cc (c), and 11 g + aicar (d). both compound c (10 mol / l) and aicar (0.5 mmol / l) were pretreated for 1 h before fixation. nucleus was stained with dapi (blue, first panel), and plasma membrane was stained with dii (red, third panel). cells were incubated with these dyes (dapi, 405-nm excitation, 1:5,000, molecular probes ; dii, 543-nm excitation, 1:1,000, sigma) for 5 min immediately before mounting. overlay of the fluorescence images showing kir6.2, dapi, and dii (fourth panel). the intensity profiles of kir6.2 (green) and dii (red) fluorescence measured along a yellow line drawn across the cell membrane excluding the nucleus (fifth panel). (a high - quality color digital representation of this figure is available in the online issue.) to test the functional significance of the ampk - dependent modulation of katp channels, we examined whether compound c and aicar cause decreases in insulin secretion in response to glucose deprivation (fig. the insulin secretion measured at 11.1 mmol / l glucose was higher in the presence of compound c, but lower in the presence of aicar when compared with the control. after glucose deprivation, the release of insulin decreased gradually to the minimum level within 1 h for the control ; this response was inhibited significantly by compound c, whereas pretreatment with aicar facilitated the decrease in insulin secretion in response to glucose deprivation. effects of compound c and aicar on decreased insulin secretion because of glucose deprivation. a : experimental protocol showing of how islets were incubated in 11.1 mmol / l glucose for 1 h before removing the glucose (time set as 0 min). the samples for insulin measurements were taken from each independent batch at 30, 0, 30, 60, 90, and 120 min (arrows) in the krb buffer. b : time - dependent changes in the percentage of islet insulin content secreted during acute glucose deprivation. insulin secretion as a percentage of total insulin content (secreted / total) was calculated. control (circles) ; in the presence of compound c (triangles) ; in the presence of aicar (squares). for each data point p < 0.05, p < 0.01, p < 0.001 compared with the control. activity - dependent and cell signal - dependent trafficking has been reported for many cell surface channels (e.g., trpc5) (22), transporters (e.g., glut4) (23), and receptors (e.g., ampa receptors) (24), and these mechanisms play important roles in regulating their activities. the regulatory mechanisms for katp channels have been investigated intensely for many years. most studies have focused on direct regulation, such as changes in the open probability or the atp sensitivity of the channels (25,26), but little is known about how channel numbers at the surface membrane are regulated. to investigate this aspect, we applied current recording, immunocytochemistry, and surface biotinylation techniques. our results demonstrate that in pancreatic -cells, the surface level of katp channels is dynamically regulated by energy deprivation, resulting in higher katp conductance. thus, we propose that the activation of katp channels by energy depletion occurs in two steps : ampk - dependent trafficking followed by channel opening via a decrease in atp (supplementary fig. the effects of glucose concentration on katp channels in pancreatic -cells have been investigated previously (8,27), but the results between studies are not entirely consistent. (27) reported that an acute reduction of glucose levels induced a rapid increase in the expression of both kir6.2 and sur1, and this effect was mimicked by the pharmacological activation of ampk. these findings are consistent with ours, but they interpreted the results to indicate that glucose deprivation upregulates the translation of existing mrnas because they observed no changes in channel distributions or mrnas levels. (8) reported that the incubation of -cells in high - glucose solution (17 mmol / l) for 1 h resulted in increased kir6.2 recruitment to the plasma membrane and increased katp currents, and they claimed that pka and ca - dependent signaling is involved in high - glucose we do not know the exact reason for this discrepancy, but several important differences exist between experimental conditions (summarized in supplementary table s1). differences in the cell model (mouse vs. rat ; rinm5f vs. ins-1 ; different passage), pretreatment protocols (incubation time and temperature), and internal solution composition may account for such discrepancy (see further details in the online appendix). the seemingly contradictory results may imply that the regulation of the surface density of katp channels involves a complex signaling network and should be considered as a major factor in the regulation of katp channel activities. although the present study primarily addresses the trafficking regulation of katp channels by ampk, it does not exclude the possibility that ampk - dependent signaling contributes to the regulation of katp gating. we showed that the effect of ampk signaling on npo measured from excised patches was similar to that on surface kir6.2 levels (figs. 2 and 3), implying that the changes in npo are mainly attributable to the changes in channel density. however, ampk inhibition reduced the whole - cell katp conductance more profoundly (fig. this difference may imply that ampk signaling in intact cells contributes not only to katp channel trafficking but also to facilitating katp channel gating. the underlying mechanisms remain to be investigated, but several possibilities can be postulated : ampk may phosphorylate katp channels to increase channel gating or regulate intracellular factors that can facilitate katp channel opening, such as mgadp (2830), phosphoinositides (26), and long - chain acyl - coas (31). in fact, the inhibition of insulin secretion in a low energy state is a key mechanism in preventing hypoglycemia. katp channel opening in low atp is generally believed to mediate these responses, but the ic50 for atp blocking measured in excised patches (20 mol / l) is too low to explain katp channel opening at zero or low glucose, in which [atp]i is at least 0.8 mmol / l (30). because the amp : atp ratio varies more sensitively than the adp : atp ratio (32), we postulate that the ampk - dependent modulation of katp channels demonstrated in the present study ought to serve as a more sensitive and efficient means of regulating pancreatic -cell excitability and insulin secretion under low - glucose conditions. to test this possibility, we monitored the changes in insulin secretion in response to glucose deprivation and tested the effects of pretreatment with compound c or aicar (fig. the results indicated that the reduced insulin secretion by glucose deprivation is significantly attenuated by compound c and facilitated by aicar. our results appeared to be consistent with the previous studies showing that forced activation of ampk inhibited, whereas compound c increased, glucose- stimulated insulin secretions (3335). in those studies, however, metabolic effects of ampk were considered to be primarily responsible for regulating insulin secretion. it has not been studied whether the effects of ampk on katp channel trafficking are involved in this inhibition, but it was shown that ampk decreased the number of docked vesicles containing insulin (36,37). this and the present study indicate that ampk regulates the trafficking of insulin vesicles and kir6.2 in opposing directions, so as to optimize the -cell functions in a low energy state. a similar pattern of concerted action of ampk was reported in epithelia for glut4 and cftr trafficking (11). in conclusion, katp channel trafficking is regulated by cellular energy status via ampk, and this process may play a key role in inhibiting insulin secretion under low energy status. although the underlying molecular mechanisms involved in ampk - dependent katp channel trafficking remain to be elucidated, this study provides new insights into the regulation of katp channels in pancreatic -cells. | objectiveamp - activated protein kinase (ampk) and the atp - sensitive k+ (katp) channel are metabolic sensors that become activated during metabolic stress. ampk is an important regulator of metabolism, whereas the katp channel is a regulator of cellular excitability. cross talk between these systems is poorly understood.research design and methodsrat pancreatic -cells or ins-1 cells were pretreated for 2 h at various concentrations of glucose. maximum katp conductance (gmax) was monitored by whole - cell measurements after intracellular atp washout using atp - free internal solutions. katp channel activity (npo) was monitored by inside - out patch recordings in the presence of diazoxide. distributions of katp channel proteins (kir6.2 and sur1) were examined using immunofluorescence imaging and surface biotinylation studies. insulin secretion from rat pancreatic islets was measured using an enzyme immunoassay.resultsgmax and npo in cells pretreated with glucose - free or 3 mmol / l glucose solutions were significantly higher than in cells pretreated in 11.1 mmol / l glucose solutions. immunofluorescence imaging and biotinylation studies revealed that glucose deprivation induced an increase in the surface level of kir6.2 without affecting the total cellular amount. increases in gmax and the surface level of kir6.2 were inhibited by compound c, an ampk inhibitor, and siampk transfection. the effects of glucose deprivation on katp channels were mimicked by an ampk activator. glucose deprivation reduced insulin secretion, but this response was attenuated by compound c.conclusionskatp channel trafficking is regulated by energy status via ampk, and this mechanism may play a key role in inhibiting insulin secretion under low energy status. |
anxiety among patients is present in the operation theatre set up with a reported incidence of 60%80%. lengthy surgical procedures, anaesthesia, unfamiliar surroundings and unexpected delays typically increase patient anxiety. approximately, one - third of patients having surgery under regional anaesthesia are highly anxious before surgery. anxiety stimulates the activity of the sympathetic nervous system and may increase the incidence of intraoperative tachycardia, hypertension, arrhythmias, increased pain perception and requirement of anaesthetic drugs. this may decrease the overall patient satisfaction with perioperative care and may affect the process of giving informed consent. during the pre - anaesthetic check - up (pac), the anaesthesiologist counsels the patient regarding the procedure and associated anaesthetic risks. however, this transfer of knowledge is usually limited and may not be entirely retained. many methods to deliver this information have been tried in the form of written pamphlets and questionnaires. in india, not all patients are literate enough to read, understand and retain this information. multimedia information to allay we developed a short visual clip of 206 s duration depicting the procedure of spinal anaesthesia (sab). we aimed to compare the effect of this pre - operative multimedia video information on perioperative anxiety and haemodynamic parameters in patients undergoing procedures under sab versus patients who were not provided with the video information. our primary objectives were to measure baseline anxiety and anxiety 1 h before induction of anaesthesia using a self - reported psychological instrument, the spielberger state - trait anxiety inventory (stai) and secondary objectives were to study haemodynamic parameters such as heart rate (hr) and mean arterial pressure (map) perioperatively. this was a prospective randomised controlled, single - blind study of 200 patients in groups of 100 each posted for surgery under sab over a period of 2 years. all patients between 18 and 60 years of age of either sex undergoing elective surgery under sab were included. all participants were literate, and only those patients who could read and fill in the questionnaire on their own in english, hindi or the local language (marathi) were included. patients refusing to give consent for the study, having significant cardiovascular or neurological disease, on medications such as beta blockers, antidepressants, cardiac or psychiatric drugs, pregnant patients and those who had undergone procedures under sab in the past were excluded from the study., patients were allotted into nonvideo group (group nv) and video group (group v). according to this randomisation, group allocations were sealed in opaque envelopes prepared by an anaesthesiologist not involved in the study. at no point of time was the principal investigator aware of the group allotment. in all patients, baseline anxiety was assessed during the pac by the principal investigator using the stai - trait (stai - t) (twenty questions), the stai - state (stai - s) (twenty questions). all patients then proceeded to another room where the envelopes were opened by the second investigator and group allotment was revealed. in group nv, the procedure of sab was explained verbally to the patients by the second investigator following which the patient was allowed to ask questions. patients in group v were taken to the audio - visual room where they were shown a short visual clip on the method of sab using a laptop computer by an anaesthesiologist involved in the study. verbal explanation of the anaesthetic procedure was provided to the patients in the language they understood. if they wanted to watch the visual clip again, they were allowed to do so. patients in both groups were informed about the procedure, its effects, side effects and risk of complications. all patients were also informed that the anaesthesiologist would be with them throughout the surgery monitoring their vital parameters. on the day of surgery, stai - s was repeated 1 h before induction by the principal investigator in both groups in the pre - operative waiting room. the anaesthesiologist conducting the case along with the surgeon then accompanied the patients into the operation theatre. standard monitoring devices such as pulse oximeter, noninvasive blood pressure and cardioscope were attached. participant was placed in the sitting position and under all aseptic precautions ; sab was administered with 0.5% bupivacaine using appropriate size spinal needle and appropriate drug volume by an anaesthesiologist not involved in the study. haemodynamic parameters such as hr and map were noted during the pac (baseline) and before administration of sab (pre - sab). a 206 s visual clip was specially prepared for this study and was shown to patients in group v. it begins with the patient entering the operation theatre with the anaesthesiologist and surgeon. it then shows the positioning of the patient followed by painting the site with antiseptic solution. the draping is done and the anaesthesiologist feels for landmarks on the patient 's back, and then administers sab. the patient is then made to lie supine, and spinal level is checked with solvent ether. the onset of motor blockade by inability to raise the feet was also depicted. the film ended with the start of surgery. this visual clip was accompanied by auditory information to the patient in one of the three languages. sample size of 200 was estimated from a similar study in which the prevalence of anxiety of patients by stai - s in low anxiety group (stai < 37) was 58% in the pre - operative film group and 38% in the control group. with type i error at 5% level of significance and 80% power of study sample size of 98 was estimated in each group. two patients were added to each group to compensate for the possible loss of data. data were statistically described in terms of mean standard deviation (sd) and percentages when appropriate. comparison of quantitative variables between the study groups was done using student 's t - test for independent samples if normally distributed. whitney u - test was used for nonnormally distributed quantitative and ordinal data. for comparing categorical data, all statistical calculations were done using microsoft excel 2007 and spss version 15 (spss inc., chicago, il, usa). the study population in both groups were similar with respect to age, sex and american society of anesthesiologists physical status [table 1 ]. patient characteristics, spielberger state - trait anxiety inventory scores and haemodynamic parameters there was no significant difference between the two groups in terms of a - trait and a - state scores at enrolment during the pac. group nv had significantly higher a - state scores compared to group v pre - sab [table 2 and figure 1 ]. prevalence of state anxiety for spinal anaesthesia in the two groups comparison of mean values of stai scores in group nv and group v. group nv - nonvideo group, group v - video group, stai - t - spielberger state - trait anxiety inventory - trait, stai - s - spielberger state - trait anxiety inventory - state, sab - spinal anaesthesia both groups were comparable with respect to baseline hr. the mean hr pre - sab in group nv increased 24% from baseline whereas in group v there was a 4.87% increase from baseline. the difference in hr pre - sab between two groups was statistically significant (p < 0.001). the pre - sab map in group nv increased by 19.79% from baseline whereas in group v it decreased by 1.96% from baseline. the difference in map pre - sab between two groups was statistically significant (p < 0.001) [figures 2 and 3 ]. changes in heart rate at various time intervals in group nv and group v. group nv - nonvideo group, group v - video group changes in mean arterial pressure at various time intervals in group nv and group v. group nv - nonvideo group, group v - video group the prevalence of anxiety among patients having surgery under sab in the pac was 82% in group nv and 80% in group v. immediately before surgery ; this increased to 96% in group nv and decreased to 66% in group v [table 2 ]. the mean a - trait scores and a - state scores for females was significantly higher than males. females also had significantly higher levels of state anxiety scores compared to males pre - sab [table 3 ]. this study revealed that those patients who were not shown the multimedia information film on sab experienced a significant increase in state anxiety score from baseline to immediately before surgery (59.31 8.12 ; mean sd) whereas those who were shown the video showed a significant decrease in state anxiety score pre - sab (50.46 10.37 ; mean sd) (p < 0.001). patients who were not shown the film also showed a significant increase in haemodynamic parameters compared to baseline before surgery (hr, map pre - sab, p < 0.001). this proves that our intervention in the form of multimedia information was successful in allaying anxiety related to sab in the perioperative period. this was in accordance with a study conducted in 2010 to determine the effect of pre - operative multimedia information on perioperative anxiety in patients undergoing procedures under regional anaesthesia. the authors demonstrated that viewing a short information film before operation reduced the anxiety of patients undergoing elective surgery under regional anaesthesia and the effect was sustained into the post - operative period. although there are many international studies validating the effect of audiovisual information on perioperative anxiety, there are no such studies in the indian context. this is further important because in our country not all patients may be literate and hence may be unable to read information brochures or search for information relating to anaesthesia and surgery which is frequently available to patients abroad. it comprises separate self - report scales for measuring two distinct anxiety concepts ; state anxiety and trait anxiety. reliability and validity of the stai are well reported (cronbach 's alpha = 0.896). the stai - t scale consists of twenty statements that ask people to describe how they generally feel. the stai - s scale also consists of twenty statements, but the instructions require subjects to indicate how they feel at a particular moment in time. stai - s scale can be used to determine the actual levels of anxiety intensity induced by stressful procedures. the validity of the stai rests upon the assumption that the examinee has a clear understanding of the state and trait instructions. each question is rated on a four - point scale (not at all, somewhat, moderately so, very much so). the range of possible scores for form y of the stai varies from a minimum score of 20 to a maximum score of 80 on both the stai - t and stai - s subscales. stai scores are commonly classified as no or low anxiety (2037), moderate anxiety (3844) and high anxiety (4580). we used the form y of stai in english and had it translated in hindi and marathi by an expert in the respective languages. the retranslated sentences which most closely resembled the original english stai form y sentences were used for that language. there are studies abroad for the use of stai in evaluating anaesthesia - related anxiety. this may be the limiting factor for its use in the indian set up, and hence most published indian studies have used the visual analogue scale for measurement of perioperative anxiety. this simple intervention was effective in avoiding hr and map variations perioperatively by reducing catecholamine surge. this is because of decreased anxiety which inhibits the hypothalamic pituitary adrenal axis release of adrenocorticotrophic hormone and cortisol into the blood stream and decreased activation of sympathetic nervous system. in this study, women had higher baseline anxiety scores as well as higher scores pre - sab compared to men (p < 0.001). hence, we need to focus more attention on this section of the population. this can be easily done with the help of multimedia video information along with other relaxation and behavioural techniques. this shows that perioperative anxiety in the indian context is high compared to data from the british study which showed a 17% prevalence of this may highlight certain lacunae in our current system of providing perioperative information to our patients and may suggest that we need to put in more efforts to reduce this high anxiety prevalence. as we used stai for assessment of anxiety, we could only assess scores in literate patients. hence, a large section of patients who were illiterate could not be included in the study. this could have been the section that would actually benefit the most from the multimedia information. furthermore, as anxiety relating to surgery and/or anaesthesia may not be exclusive, we did not aim to separate the two entities in this study. hence, the high prevalence of anxiety in our study population may have been attributed to anxiety for surgery. long - term follow - up and evaluation of patients for any impact of post - anaesthesia stress disorder reduction and change in psychological behaviour was not done. multimedia information in the form of a short audiovisual clip during the pac is an effective and feasible method to reduce perioperative anxiety. we encourage anaesthesiologists to focus their attention on this mode of educating patients about the anaesthesia experience. | background and aims : a high incidence of anxiety has been reported in patients in the operation theatre set up. we developed a short visual clip of 206 s duration depicting the procedure of spinal anaesthesia (sab) and aimed to compare the effect of this video on perioperative anxiety in patients undergoing procedures under sab.methods:a prospective randomised study of 200 patients undergoing surgery under sab was conducted. patients were allotted to either the nonvideo group (group nv - those who were not shown the video) or the video group (group v - those who were shown the video). anxiety was assessed using the spielberger state - trait anxiety inventory during the pre - anaesthetic check - up and before surgery. haemodynamic parameters such as heart rate (hr) and mean arterial pressure (map) were also noted. student 's t - test was used for normally distributed and mann whitney u - test for nonnormally distributed quantitative data. chi - square test was used for categorical data.results:both groups were comparable with respect to baseline anxiety scores and haemodynamic parameters. the nonvideo group showed a significant increase in state anxiety scores before administration of sab (p < 0.001). patients in the video group had significantly lower hr and map preoperatively (p < 0.001). the prevalence of high anxiety for sab was 81% in our study which decreased to 66% in the video group before surgery.conclusion:multimedia information in the form of a short audiovisual clip is an effective and feasible method to reduce perioperative anxiety related to sab. |
hypoxia is suggested to play an important role in the pathogenesis of endocrine and metabolic dysregulation in obesity and the metabolic syndrome. we could previously demonstrate, based on an experimental human in vivo design established in our group, that 30 minutes of oxygen desaturation to 75% are sufficient to induce features of the metabolic syndrome such as glucose intolerance [2, 3 ] and respective changes in sympathetic activation [2, 3 ], resting energy expenditure [2, 3 ], and vascular endothelial growth factor (vegf) levels, a hormone which has been assumed to play a role in the pathogenesis of the metabolic syndrome. another hormone centrally involved in body weight regulation and thereby the development of the metabolic syndrome is leptin. leptin is synthesized mainly, but not exclusively, by white adipose tissue sending a feedback signal to the brain about the amount of peripheral fat storages. recent literature indicates that circulating leptin concentrations are possibly increased by hypoxic conditions in humans, suggesting a link to the obstructive sleep apnea syndrome (osas), a disease characterized by recurrent night apneic periods, which is strongly associated with obesity. indeed, as compared to healthy controls, osas patients show elevated leptin concentrations which return to normal after elimination of night apneas by continuous positive airway pressure (cpap) therapy. however, it remains unclear if high leptin levels in these patients are related to hypoxia, to hormonal interactions, or to the frequently increased body mass in osas. at high altitude (30004000 m), that is, under constant hypoxic conditions, increased [9, 10 ] as well as decreased leptin concentrations have been reported in humans as compared to sea level. potential confounders of leptin secretion in this setting are physical strain, nutritional differences, or physical stress upon ascension. previous studies using cell cultures [1214 ] and animal models have provided a contradicting evidence for an impact of hypoxia on leptin concentrations. in order to clarify if hypoxia affects circulating leptin concentrations in humans, we experimentally induced a short hypoxic period as compared to normoxic condition in healthy normal weight participants according to our established study design which has been demonstrated to induce clinically relevant changes in energy and hormone metabolism [2, 3 ]. oxygen saturation of 75%, as applied in our study, corresponds to a physiological state at approximately an altitude of 35004000 m. to control for common biases known to influence leptin metabolism, we performed our study at rest. moreover, our group has previously shown that the glucose metabolism is a main determinant of leptin secretion [16, 17 ]. each subject, therefore, underwent an euglycemic glucose clamp procedure to ensure stable circulating glucose and insulin concentrations throughout the experiments to control for these influencing factors on plasma leptin levels. additionally, sympathetic activation as evaluated by circulating epinephrine and norepinephrine concentrations was monitored. exclusion criteria were overweight (body mass index (bmi) > 25 kg / m), chronic or acute illness (particularly respiratory diseases), alcohol or drug abuse, smoking, competitive sports, exceptional physical or mental stress, and current medication of any kind. each participant gave a written informed consent, and the study was approved by the local ethics committee. subjects participated in a hypoxic and a normoxic session separated by an interval of at least 4 weeks. on the days of experimental testing, subjects reported to the medical research unit at 11:00 h after an overnight fast of at least 12 hours. after 3 hours of clamping, hypoxia was induced for 30 minutes by decreasing oxygen saturation to 75%. on the normoxic control condition, we assessed the course of leptin concentrations at baseline and repeatedly 3 hours after induction of hypoxia according to leptin 's half life in normal weight men of about 3 hours by punctional determination. during induction of hypoxia and also during the normoxic control period, participants breathed at normobaric conditions through a tightly fitting face mask connected to a trajan 808 fresh gas supply (draeger medical technology, luebeck, germany), using a valveless high - flow system between 14 and 17 l / min. inspired oxygen fraction (fio2) was varied by adjusting oxygen and nitrogen. oxygen saturation was continuously measured by pulse oxymeter and was decreased to 75% within approximately 5 minutes. catecholamine levels were monitored at baseline and every 7.5 minutes during hypoxia (versus control). all blood samples were immediately centrifuged and the supernatants stored at 24c until assay. leptin concentrations were measured by elisa (diagnostic systems laboratories, sinsheim, germany ; interassay coefficient of variation (cv) 4.4%, intra - assay cv 3.8%). serum insulin was measured by radioimmunoassay (pharmacia insulin ria 100, pharmacia diagnostics, uppsala, sweden ; inter - assay coefficient of variation (cv) < 5.8%, intra - assay cv < 5.4%). blood glucose concentrations were monitored at 5-minute intervals throughout the experiment (glucose analyser, beckman coulter, inc. high pressure liquid chromatography was applied to measure plasma epinephrine (intra - assay cv < 2.9% ; inter - assay cv < 4.2%) and norepinephrine levels (intra - assay cv < 2.6% ; inter - assay cv < 3.9%, chromosystems, munich, germany). analyses of variance (anova) for repeated measurements, including the factors session (time points of data collection) were implemented and corrected according to the greenhouse - geisser procedure. the area under the curve (auc) was calculated from 6 hours leptin short - profiles to determine overall differences in leptin secretion between the two sessions. in addition, student 's paired t - tests were performed to compare hormone concentrations at single time points. upon induction of hypoxia, oxygen saturation decreased over a period of about 5 minutes and was held stable at a plateau of 74 2%. oxygen saturation (corresponding to 3541 mmhg pao2) during the corresponding period under the normoxic condition remained at a mean level of 98 2%. determination of plasma glucose concentrations and serum insulin confirmed that respective blood levels remained constant after having reached the equilibrium and did not differ between hypoxic and normoxic conditions throughout the study (figure 1). also, as already published, norepinephrine concentrations did not differ significantly between the two sessions (p =.3) whereas epinephrine levels were significantly higher under the hypoxic condition as compared with the control session (p <.01). the glucose infusion rates were significantly lower during the hypoxic as compared to the normoxic period. figure 2 shows the course of leptin concentrations during normoxic and hypoxic conditions under euglycemia. overall, leptin levels increased significantly during hypoxia (p <.001) and normoxia (p <.001) in the overall time course of 6 hours of measurements. there were no statistical differences in leptin levels between hypoxic and normoxic conditions as revealed by anova for repeated measurements for the session effect (p =.269) and the interaction effect (p =.638). analyses of the aucs of leptin concentrations confirmed that there was no difference between the two conditions (p =.180). paired t - test comparison revealed that there were no differences between the groups at baseline (p =.446). similarly, after having reached the euglycemic equilibrium, plasma leptin concentrations showed no significant differences between conditions directly before the induction of hypoxia, during the hypoxic period, and during the 2.5 hours period after hypoxia in t - test comparison of single time points (p =.137 for all). our results show that plasma leptin concentrations are not affected by acute hypoxia as compared to normoxic control in healthy subjects at rest. in contrast, previous studies showed an inverse correlation of serum leptin levels to altitude [11, 19, 20 ], that is, when altitude increase serum leptin levels drop. however the effects of hypoxia on circulating leptin concentrations are contradicting as recently discussed in detail by sierra - johnson. [the underlying cause why our results do not confirm previous data indicating an increasing effect of hypoxia on leptin levels deserves to be explained. norepinephrine and epinephrine have been shown to inhibit leptin secretion [2426 ], whereas glucocorticoids, for example, dexamethasone, stimulate leptin secretion in humans [27, 28 ]. so it may be speculated that in our study a potential increase in leptin concentrations upon hypoxia may be masked by suppressing effects of the risen epinephrine levels under this condition. this mechanism, however, can only remain speculation within the scope of an in vivo approach as applied here and requires some confirmation in further studies. our second finding was a significant increase in leptin concentrations in the course of the six hours of the experimental procedure. this is in line with the finding that circulating leptin concentrations display ultradian and circadian rhythmicity with a nadir about noon and the early afternoon, and peak levels during the night [29, 30 ]. the increase in leptin concentrations starting prenoon and the following 6 hours as reported here may reflect this diurnal variation. moreover, the increased leptin concentrations may also be due to the standardized insulin infusion during the clamp [16, 17, 31 ]. since insulin has been shown to elevate leptin concentrations [17, 32 ], we intended to exclude this biasing factor by applying the hyperinsulinemic - euglycemic clamp technique which adjusts constant insulin concentrations during the experiments. notwithstanding, this method may have contributed to the overall rise in leptin levels even though in all conditions equally. one central question we intended to focus by our study was if alterations in leptin concentrations in osas patients could be assigned either to recurrent hypoxia or to the known high bmi which is a frequently found feature in this disease. generally, leptin is produced by white adipose tissue and downregulates food intake by inhibiting neuropeptide y synthesis and elevating alpha - melanocyte stimulating hormone synthesis in the hypothalamus, a feedback mechanism signalling increased peripheral fat reserves to cerebral appetite centers. indeed, it has been shown that serum leptin levels are positively correlated with the bmi [33, 34 ]. remarkably, some studies could demonstrate that osas patients, however, display higher leptin levels than bmi - matched obese and normal weight subjects [34, 35 ]. since leptin is a physiological feedback signal to reduce appetite and thereby should prevent the development of obesity, the occurrence of overweight and elevated circulating leptin concentrations, as seen in osas patients, deserves an explanation. one possible explanation is a congenital leptin deficiency, although this is a rarely seen defect. the second avowal could be a relative leptin resistance, due to the fact that leptin seems to downregulate its own receptors, so high leptin levels could possibly reduce the number of leptin receptors and generate a relative leptin resistance which in turn causes obesity. on the other hand, it was demonstrated that the apnea - hypopnea index (ahi) correlates positively with serum leptin concentrations in patients with osas but not in the bmi - matched control group and there was a significant decrease of serum leptin levels in osas patients upon treatment with cpap therapy over six months despite of stable bmi values [34, 38 ]. therefore, we can speculate that recurrent oxygen desaturations in osas patients may play a major role in the regulation of leptin concentrations disregarding the influence of obesity. notwithstanding, our data do not confirm the hypothesis that elevated leptin concentrations in osas patients are caused by hypoxia either. this negative result, however, may be based on our study protocol which fundamentally differs from the approach of other investigations. this hypoxic pattern differs from previous studies according to length, frequency, and degree of oxygen desaturation [8, 9, 11, 12 ]. zaccaria., for example, studied male subjects at high altitude with an observation period of 20 days. therefore, it remains to be carefully considered to what extent our findings can be assigned to the hypoxic conditions as present in osas where severe hypoxic periods, displaying distinctly lower oxygen saturation values than 75%, can be observed. so eventually our negative findings may simply reflect an insufficient duration and the extent of hypoxia to affect leptin secretion. notwithstanding, our study design has been established to induce clinically relevant changes in other features of the metabolic syndrome [2, 3 ] and is therefore an adequate approach to gain first insight into the effects of acute hypoxia in this context in humans. in addition, this is the first study investigating the effects of acute hypoxia on leptin concentrations controlling for fundamental influencing factors in healthy men. according to our data, plasma leptin levels seem to be unaffected by short hypoxic episodes of moderate degree. future studies are desirable to further clarify the relationship between hypoxia and leptin regulation in physiological and pathophysiological states. | leptin is involved in the endocrine control of energy expenditure and body weight regulation. previous studies emphasize a relationship between hypoxic states and leptin concentrations. the aim of this study was to investigate the effects of acute hypoxia on leptin concentrations in healthy subjects. we examined 14 healthy men. hypoxic conditions were induced by decreasing oxygen saturation to 75% for 30 minutes. plasma leptin concentrations were determined at baseline, after 3 hours of euglycemic clamping, during hypoxia, and repeatedly the following 2.5 hours thereafter. our results show an increase of plasma leptin concentrations in the course of 6 hours of hyperinsulinemic - euglycemic clamping which may reflect diurnal rhythmicity. notwithstanding, there was no difference between levels of leptin in the hypoxic and the normoxic condition (p =.2). since we did not find any significant changes in leptin responses upon hypoxia, plasma leptin levels do not seem to be affected by short hypoxic episodes of moderate degree. |
lymph edema is the accumulation of a high - protein edema fluid in the interstitial tissue as a result of the functional overload of the lymphatic system in which lymph volume exceeds transport capabilities and the lymphatic system becomes overwhelmed, causing lymphatic insufficiency or failure1. secondary lymph edema may occur as a result of obstruction or interruption of the lymph system due to surgery. the most common cause of secondary lymph edema in the upper extremity is breast cancer treatment, especially with the combination of axillary surgery and radiation and lower extremity lymph edema mostly occurs as a consequence of gynecological cancer (cervical, endometrial, vulvar, head and neck cancers)2. the prevalence of post breast cancer surgery upper limb lymph edema is between 8% and 65% as described in the literature3, 8. the main reasons for this wide reported range of prevalence of the upper extremity lymph edema are : the follow - up time, the number of patients included in the studies, the classification and criteria used for its definition, the use of different measuring methods, and the time elapsed after surgery. the factors that contribute to the development of upper extremity lymph edema after breast cancer surgery are classified in terms of extent of axillary surgery and mastectomy, axillary lymph node dissection (alnd), the number of nodes removed, the presence of a metastatic lymph node, use of axillary radiation therapy, chemotherapy, younger age at diagnosis, older age (> 55), weight, body mass index (bmi), injury or infection in the ipsilateral arm, and trauma3,4,5,6,7,8,9,10,11,12. except for lymph edema the other complications after breast cancer surgery are as follows : pain in the affected shoulder and arm, restrictions of shoulder motions, decrease in the muscle strength and functional capacity of the upper extremity, and difficulty with activities of daily living12,13,14,15,16. development of lymph edema after breast cancer surgery increases the upper extremity symptoms of pain, numbness, stiffness, loss of strength and function5, 17. together with physical and functional inabilities, lymph edema is also associated with psychological morbidity13. psychological impacts of lymph edema include anxiety, depression, loss of body self confidence, social isolation and sexual dysfunction18. moreover lymph edema and impaired upper extremity functions lead to deterioration in the activities of daily living16. it is reported that the functions of the arm decrease as the severity of lymph edema increases and the levels of depression and anxiety increase as the symptoms of the upper extremity increase19, 20. the severity and localization of lymph edema and pain are the factors that aggravate psychological distress and anxiety13. there are several methods of treatment for breast cancer - related lymph edema including physiotherapy, exercises, medical treatment with benzopyrones and a variety of microsurgical techniques. complex decongestive physiotherapy (cdp) is a multimodality approach that consists of manual lymphatic drainage (mld), skin care, compression bandages, and exercise, and it is a promising form of treatment recently. cdp is used to activate lymphatic vessels and move protein rich fluid from edematous to non edematous areas. although cdp was developed several decades ago, there are many studies that show cdp can greatly reduce the volume and percentage volume of breast cancer - related lymph edema. however, there are few studies about the effects of cdp on other physical aspects such as pain, restriction of movements, and functions of the upper extremity or its effects on psychological factors. therefore the aim of this study was to investigate the effects of phase i cdp on physical functions and depression levels of subjects with breast cancer - related upper extremity lymph edema. this interventional clinical study was carried out at pamukkale university school of physical therapy and rehabilitation. approval for this study was granted by the non - invasive clinical research ethics committee of pamukkale university and the study was conducted in accordance with the principles of the declaration of helsinki. all the subjects provided their informed consent. among the 96 subjects having lymph edema and referred for physical therapy, 77 subjects with secondary lymph edema after modified radical mastectomy were chosen. the subjects who had metastasis, severe orthopedical or neurological deformity, acute infection, uncontrolled hypertension, severe venous or arterial insufficiency, severe psychiatric symptoms or any other contraindications to manual lymphatic drainage and compression were excluded. sixty - three subjects met the inclusion criteria of this study, but five of the subjects did not attend to the decongestive physical therapy programme regularly and they were excluded from the assessments. circumference, range of motion (rom) measurements of both upper extremities, muscle strength of the ipsilateral extremity and depression level were assessed before and after the phase i cdp treatment. the circumferences of both extremities were measured at the metacarpophalengeal joints of the hand, and styloid process of radius and 5, 10, and 15 cm above the styloid process of radius of the forearm, the lateral epycondile and 5, 10, and 15 cm above the lateral epycondile of the upper arm by using a standard one inch, retractable, fiber glass tape measure. the shoulder range of motion was measured using standard techniques of goniometry as active and passive measurements of shoulder flexion, extension, abduction and adduction, internal and external rotation21, 22. muscle strength of the ipsilateral extremity was measured by lovett s manual muscle testing23. depression levels of the subjects were evaluated using the beck depression inventory (bdi) which was first developed by beck. in 196124. participants were asked to choose the suitable option that expressed their emotional status in the last 1-week period. the maximum score is 63, and the cutoff value for the turkish version is 17 which indicates a need for help25. phase i complex decongestive physiotherapy consisting of mld, multi layer compression bandaging, remedial exercises in combination with respiratory exercises were performed by all subjects five times in a week for four weeks (20 sessions in total) by a certified lymph edema physiotherapist21, 26,27,28. at the end of the phase i cdp treatment the subjects wore compression garments. self massage, home exercises for lymph edema and skin care were prescribed for the subjects by the therapist for the phase ii cdp. differences in measurements circumference, shoulder range of motion and the beck depression inventory were assessed using the paired samples t test. pearson s correlation coefficient method was used to assess the influence of changes in measurement of circumference and shoulder range of motion on beck depression inventory scores. the physical characteristics and demographic data of subjects are presented in table 1table 1.physical properties and demographic data of the subjectsphysical propertiesx sdage (years)43.5 5.3height (cm)161.3 6.7weight (kg)78.4 7.8bmi (kg / m)26.3 1.2demographic datan (%) education levelilliterate15 (25.8)8 years16 (27.5)occupationhousewife35 (60,34)teacher13 (22.4)retired10 (17.2). fifty - one of the subjects had been given chemical therapy (ct), 43 of subjects had been given radiotherapy (rt) and 38 of subjects had received endochirine therapy (table 2table 2.other therapies that subjects received after mrmother therapiesn (%) chemical therapyyes51 (87.9)no7 (12.0)radio therapyyes43 (74.1)no15 (25.8)endocrine therapyyes38 (65.5)no20 (34.4)). the average duration of lymph edema was 32.05.5 months and the average time since the operation was 38.52.1 months. after modified radical mastectomy, the subjects were given on averagely 5.3 1.1 treatments of ct and 10.2 4.0 sessions of rt. a significant difference in the circumference measurement was found when compared before and after complex decongestive physiotherapy (cdp) at all levels of measurement (table 3table 3.comparison of upper extremity circumference measurementscircumference measurementb.cdp (cm)a.cdp (cm)mcp joint21.30.820.01.2styloideus radius22.54.320.90.95 cm 26.44.723.62.510 cm 27.05.124.77.315 cm 29.24.726.75.3lateral epicondyles30.93.929.23.65 cm 36.76.332.36.810 cm 37.07.733.95.415 cm 38.83.334.02.9 p < 0.05, mcp : metacarpophalengeal. we found that the muscle strength of the subjects was good (average 4.60.2 according to manual muscle testing) and decrease in muscle strength was not found before cdp. the shoulder range of motions before and after cdp are shown in table 4table 4.comparison of upper extremity range of motionsromb.cdp ()a.cdp ()shoulder jointflexion136.69.6171.38.2extension54.65.758.66.2abduction128.316.4164.92.3adduction0.00.00.00.1internal rotation78.84.685.51.0external rotation76.42.484.23.6elbow jointflexion142.6 8.9146.09.6extension0.0 0.00.00.0wrist jointflexion85.5 2.585.9 3.4extension84.80.885.3 3.8ulnar deviation19.60.321.0 2.6radial deviation14.41.915.6 2.3p<0.05, rom : range of motion. according to this table, a significant difference was found in all shoulder range of movements except from adduction. although active shoulder range of movement did not reach to normal levels, there was a significant increase after cdp. when we assessed the average depression scores of the subjects before cdp a moderate level of depression was found. the depression score improved to mild depression levels after cdp and there was a significant difference in the scores of before and after treatment as shown in table 5table 5.comparison of depression scoresdepression scoreb.cdpa.cdpbdi24.55.419.48.3 p<0.05, b.cdp : before complex decongestive physiotherapy. there was a significant positive correlation between the changes in circumference measurement of the affected arm and the depression level (table 6table 6.relation between average change in depression measurement and average change in circumference measurements of the affected armthe average change in depression scores (x sd)the average change in circum ference measurements of the affected arm (x sd) (cm)r bdi score (5.6 1.4) mcp joint (1.0 0.8)0.4 styloideus radius (2.2 0.7)0.7 5 cm (3.4 0.9)0.6 10 cm (3.1 1.1)0.7 15 cm (3.4 1.2)0.4 lateral epicondyles (1.00.5)0.3 5 cm (4.2 1.2)0.6 10 cm (2.9 0.2)0.6 15 cm (4.0 1.2)0.7p<0.05, mcp : metacarpophalengeal). the depression levels decreased as the circumference measurement decreased. p < 0.05, mcp : metacarpophalengeal. a.cdp : after complex decongestive physiotherapy p<0.05, b.cdp : before complex decongestive physiotherapy. psychological and psychosocial factors such as anxiety, depression, distress, altered emotional reactions, sleep disturbances and social isolation are common in breast cancer29. increased prevalence of depression among breast cancer patients has been shown in several studies30,31,32,33. fann. reported that the risk of major depression is 25% in women with breast cancer, and within one year of diagnosis up to 30% of women with breast cancer may develop either anxiety or depression, which may persist for more than 5 years after diagnosis and initial treatment34. in one interesting study it was found that those cases of mastectomy and hysterectomy had depressive symptoms and problems regarding body image, spouse relationships and sexual satisfaction. when the depressive state was compared between the cases with mastectomy and hysterectomy, it was found that patients with mastectomy were more depressive than patients with hysterectomy35. the factors which are related to psychological distress include being diagnosed as having a life - threatening illness, treatments and their side - effects, uncertainty of outcomes, role changes as a result of activity limitation and restrictive participation, and issues related to body image, especially unsatisfactory cosmetic results and lymph edema36, 37. there are studies which report that psychological distress such as depression, anxiety ; hopelessness and helplessness are more common in breast cancer survivors with lymph edema31,32,33, 38. they found that lymph edema was associated with a higher impact score on the perceived impact problem profile39. in another study, pyszel. reported that breast cancer survivors with lymph edema had statistically significantly worse psychological distress scores than survivors without lymph edema40. in our study we assessed the depression levels of women with lymph edema after modified radical mastectomy with bdi. in common with the previous studies, we found that women with post mastectomy lymph edema had moderate levels of depression (average bdi score=24.55.4). the most common symptoms associated with lymph edema are swelling, heaviness, tightness, firmness, pain, numbness, stiffness, decreased mobility, and the physical disfigurement of the condition. women with post mastectomy lymph edema are unable to complete household responsibilities, in severe cases they even need assistance with daily care activities, and have difficulty in performing their jobs which leads to significant role changes in social life. as a result untreated or occurance of lymph edema is a cause of serious psychological disturbances, e.g. depression. another reason for the occurance of depression is difficulty with coping and adjusting to a chronic disease, which is for some of the subjects a surprise because of inadequate information. many of the subjects in our study had the idea that lymph edema was an untreatable condition before complex decongestive therapy, which also might have been a reason for their high levels of depression. aesthetic concerns, which might prevent women from wearing their usual clothing, might also be an important cause of depression. the shoulder rom of women with post mastectomy lymph edema was significantly reduced in our study. there are many studies which indicate that following breast cancer treatment, women with lymph edema present with upper extremity impairments3, 4, 13, 17, 27, 28. women with lymph edema more frequently demonstrate bilateral impairments in shoulder rom and upper extremity strength than women without lymph edema. besides swelling of the arm, rom limitation can lead to reduced physical activity which may also be related to depression41, 42. complex physical therapy has been recommended as a primary treatment by consensus panels and is an effective therapy for lymph edema43,44,45,46,47. complex physical therapy resulted in some volume reduction of the affected extremity in 95% of 399 patients (50% reduction in 56% of patients, 2549% reduction in 31%, and 124% reduction in 8%), 54% of whom maintained the therapeutic result after 3 years48. in agreement with the literature, the results of our study showed that after cdp, the shoulder rom of the subjects increased and the circumference measurement of the affected arm significantly decreased. several studies have shown the effects of cdp on physical functions and the quality of life of lymph edema patients14, 15, 26,27,28, 47,48,49. in one of the literature reviews, researchers concluded that among the therapeutic modalities used for lymph edema treatment, cdp undoubtedly had the strongest scientific support50. cdp applied lymph edema patients effectively improved the quality of lymph edema patients through the reduction in the volume and circumference of the affected limb, a decrease in fear of movement, and increase in physical function49. as we discussed above, psychological distress such as depression and anxiety, is also associated with lymph edema. many studies have demonstrated the effectiveness of cdp, however, not many studies have investigated the effects of cdp on depression and other psychological issues. in present study we assessed the depression levels of subjects before and after cdp. we found a significant decrease in the depression score to mild - minimum levels. there was a positive correlation between circumference reduction and depression levels and also a negative correlation between rom and depression levels. we think arm swelling and rom limitation as a result of lymph edema after mastectomy aggravate depression which is usually found in breast cancer survivors. cdp which is one effective way of treating arm swelling and decrease in physical function can also contribute treatments for psychological distress such as depression. reduction in limb volume and increase in range of motion reduces the fear of movement and increase the physical function. the volume decrease in the affected extremity and increase in rom may lead to improvements in the social roles of subjects through increase of physical function. the improvement in social participation may also be a factor that helps to alleviate depression. also, a decrease in aesthetic anxiety and becoming aware of that lymph edema is treatable, are the other factors that may contribute to the alleviation of depression. our study is important as there are not many studies of the psychological distress in breast cancer and/or lymph edema related to breast cancer, especially secondary lymph edema after mastectomy, and there are very few studies about the effects of cdp and other treatment choices on the psychological distress such as depression51, 52. the lack of a control group was the most important limitation of this study. | [purpose ] breast cancer - related upper extremity lymph edema is known to cause physical, functional and psychological impairments in women after modified radical mastectomy. the aim of this study was to investigate the effects of phase i complex decongestive physiotherapy (cdp) on physical functions and depression levels in women with breast cancer - related upper extremity lymph edema. [subjects and methods ] fifty - eight subjects with breast cancer - related upper extremity lymph edema were the subjects of this study. the arm circumference, shoulder range of motion (rom), muscle strength and depression levels of the subjects were assessed before and after phase i cdp treatment. [results ] after phase i cdp, there was a statistically significant reduction in circumference measurements at all levels of the affected arm. there was not any statistically significant difference in muscle strength after cdp. the shoulder rom improved after treatment. there was a significant reduction in the beck depression inventory score. a significant positive correlation was found between depression levels and circumference measurement. [conclusion ] based on the results we suggest that by reducing limb volume, beside improving physical functions, phase i cdp can affect psychological status, especially depression which is very common in women with breast cancer - related upper extremity lymph edema. |
due to the stringency of cellular quality control (qc), protein production and assembly are often inefficient in the cell. about 30% of newly synthesized proteins in mammalian cells are subject to rapid degradation by proteasomes. however, experimental efforts to rationalize the interplay between the physiochemical properties of polypeptide chains and their interactions with qc networks have thus far been limited to a handful of soluble proteins. far less is known about integral membrane protein folding and assembly, a process that is intimately linked to the molecular basis of numerous diseases. many of the proteins that carry out the qc of nascent integral membrane proteins in the endoplasmic reticulum (er) have been identified in recent years. however, the structural properties subjected to surveillance by qc, potentially triggering disposal by the er - associated degradation (erad) pathway, are largely unexplored. here we test the hypothesis that the conformational stability of integral membrane proteins plays a central role in their interactions with cellular qc and the efficiency with which they traffic to their intended cellular compartments. to test this hypothesis, we interrogate a series of pathogenic variants of human peripheral myelin protein 22 (pmp22), the cellular misfolding and misassembly of which causes a spectrum of peripheral neuropathies associated with charcot pmp22 is expressed in myelinating schwann cells of the peripheral nervous system (pns) and is highly abundant in the membranes of compact myelin. strikingly, only 20% of wild - type (wt) pmp22 reaches its intended destination at the plasma membrane under physiological conditions ; the majority of the nascent protein is retained in the er and/or targeted for degradation. furthermore, most pathogenic variants further reduce the trafficking efficiency of pmp22, which suggests that pathogenic mutations promote misfolding within the secretory pathway. we recently reported quantitative thermodynamic measurements of the conformational stability of purified wt pmp22, the first such measurement to be made for any multispan eukaryotic membrane protein. surprisingly, we found that wt pmp22 exhibits marginal conformational stability in vitro, which parallels its rapid degradation and inefficient trafficking in the cell. to elucidate the nature of the interplay between the folding and cellular trafficking of integral membrane proteins, we here quantitatively survey the conformational stability and cellular trafficking of a series of misfolding - prone pathogenic pmp22 variants. remarkably, the results not only appear to confirm a mechanistic linkage between conformational stability and cellular trafficking but also strongly suggest that the degree of mutagenic destabilization is directly related to the severity of peripheral neuropathy in humans carrying the associated mutations in the pmp22 gene. structural distribution of pathogenic mutations in pmp22. a topology diagram and a structural model depict the positions of the mutated residues and the position of the myc epitope tag that was inserted for immunological detection of pmp22 in mammalian cells. (a) a cartoon depicts the topology of the sequence of pmp22 with respect to the membrane. the position of the myc epitope tag inserted into the constructs used for cellular trafficking studies is indicated with dashed lines. the lowest - energy conformation of a recently published structural model of the apo - form of pmp22 is viewed parallel to the position of the membrane (b) and from its extracellular face (c), with the positions of the pathogenically mutated side - chains characterized in this work being highlighted for reference. mutated side chains associated with dss (severe neuropathy), which include h12q, l16p, m69k, s76i, and g150d, are shown in red. mutated side chains associated with cmt disease (cmt1, moderate neuropathy), which include g107v and t118 m, are shown in purple. mutated side chains associated with hnpp (mild neuropathy), which include s22f and a67 t, are shown in blue. finally, the position of the side chain for the nonpathogenic i137v mutation site is shown in black. several of the known pathogenic mutations in the pmp22 gene have been found to enhance the misfolding and mistrafficking of pmp22 in the cell. therefore, characterization of the effects of these mutations provides an opportunity to elucidate a potential relationship between conformational stability and cellular trafficking. from the 44 known pathogenic missense mutations in pmp22 associated with peripheral neuropathies (human gene mutation database, http://www.hgmd.cf.ac.uk/ac/index.php), we selected 10 pathogenic variants and 1 nonpathogenic isoform that are dispersed throughout the 4 transmembrane (tm) helices of pmp22 (figure 1a). these mutations cause a spectrum of clinical phenotypes ranging from hereditary neuropathy with liability to pressure palsies (hnpp, mild neuropathy), cmt type 1 (cmt1, moderate neuropathy), and dejerine sottas syndrome (dss, severe neuropathy) (table 1). previously reported motor nerve conduction velocities of patients harboring these mutations confirm that the degree of dysmyelination caused by these mutations is highly variable (supplementary table 1), which suggests that this set of mutations is likely to manifest a range of effects on the conformational equilibrium of pmp22. additionally, we recently found that none of these mutations are predicted to cause topogenic defects, which suggests that conformational defects are manifested after pmp22 is cotranslationally inserted into the membrane. we recently characterized the conformational equilibrium of purified wt pmp22 in n - dodecylphosphocholine (dpc) micelles and found that only 50% of the protein is folded at equilibrium. because the free energy difference between the folded and unfolded ensembles is minimal under this condition (gf u 0 kcal / mol), even small perturbations of the conformational equilibrium caused by mutations should cause measurable differences in the fraction of folded protein. therefore, to determine the effects of pathogenic mutations on the conformational stability, we assessed the tertiary folding of pathogenic pmp22 variants in dpc micelles at equilibrium using near - uv circular dichroism (cd) spectroscopy, which is sensitive to the tertiary ordering of aromatic side chains. the shapes of the near - uv cd spectra of these variants are similar to that of the wt protein (figure 2 and supplementary figure 1), suggesting that the mutations do not significantly alter the tertiary structure of the folded protein. however, significant differences are apparent in the magnitude of the tryptophan peak at 299 nm ([]299), which reflects the fraction of folded pmp22 (ffold). with the exception of g107v and t118 m pmp22, []299 is diminished in the spectra of the mutant proteins (figure 2 and supplementary figure 1), which confirms that these mutations reduce ffold. based on the signal of the folded protein and the signal of the unfolded protein (see experimental section), we determined ffold for each mutant variant in dpc micelles directly from the near - uv cd spectra (table 1). moreover, because pmp22 achieves conformational equilibrium under these conditions, ffold values can be used to directly determine the free energy of folding (gf u) and to calculate the effect of a mutation on the free energy of folding (gf u). the energetic effects of four of the pathogenic mutations (h12q, s22f, g107v, and t118 m) appear to be modest (|gf u | 2.0 kcal / mol, table 1). furthermore, three of the four highly destabilizing mutations (l16p, m69k, and s76i) are associated with severe pathogenic phenotypes (dss). together, these data demonstrate that the majority of the pathogenic mutations studied herein decrease the conformational stability of pmp22. nevertheless, the fact that the nonpathogenic i137v variant decreases the conformational stability while the severely pathogenic h12q variant has a negligible effect on the conformational equilibrium of the apoprotein is puzzling. these observations suggest that additional factors, such as the presence of an endogenous ligand, may influence the conformational equilibrium of pmp22 in vivo. the fraction of folded protein (ffold) was assessed for wt and mutant pmp22 using near - uv cd spectroscopy. the average cd signal from three replicate near - uv cd measurements of wt (black) and four representative mutant variants including s22f (cyan), m69k (red), g107v (green), and i137v (purple) pmp22 under nondenaturing conditions is plotted against the wavelength. the magnitude of the tryptophan peak, which serves as a reliable probe for the fraction of folded pmp22, is indicated for each variant with dashed lines. the magnitude of the signal of the fully folded proteins determined from equilibrium unfolding of wt protein in the presence of stabilizing osmolytes (see experimental section) is indicated with a dotted line for reference. the energetics of protein folding and misfolding in the cell depend on the physiochemical properties of the cellular compartments in which qc occurs. one decisive factor is the concentration of ligands or cofactors, which can bind to and stabilize native conformations relative to misfolded conformations. pmp22 is known to have an avid affinity for zn(ii) and cu(ii) and features two divalent cation binding sites, which likely employ the five histidine residues in its extracellular loops (figure 1a). given that myelin is rich in both zn(ii) and cu(ii), it is highly probable that the binding of metal ion cofactors influences pmp22 folding and assembly within the cell. we therefore sought to compare the influence of metal binding on the conformational equilibrium of wt and mutant pmp22 variants. we first compared the propensity of the destabilized g150d and l16p variants to bind zn(ii) relative to wt using fluorescence spectroscopy, as previously detailed. a gain in the intrinsic tryptophan fluorescence intensity is coincident with consecutive zn(ii) binding events for each of these variants (figure 3a), which suggests that binding is coupled to the formation of tertiary structure. importantly, this aspect of the titration data highlights the fact that these proteins are not fully folded in the absence of metal ions (table 1). nevertheless, comparison of the apparent binding affinities provides insight into whether mutations influence zn(ii) binding. fitting of the titration data with a two - site binding model reveals that these mutations significantly increase both of the apparent equilibrium dissociation constants (kd, app) relative to those of wt (figure 3a, table 1). to assess the nature of the structural changes that occur upon binding, we used near - uv cd to probe the tertiary structure of the bound forms of g150d pmp22, which is mostly unfolded in dpc micelles at equilibrium in the absence of zn(ii) (figures 3b and supplementary figure 1). the addition of a two - fold excess of zn(ii) relative to the first apparent equilibrium dissociation constant (kd1,app) of g150d pmp22 is coincident with an increase in the near - uv cd signal at 299 nm (figure 3b). however, despite the fact that 67% of the protein is saturated with a single zn(ii) ion under this condition, only about 37% of the native cd signal is recovered. this result demonstrates that the saturation of the first binding site is coupled to a partial folding reaction. a second folding reaction occurs upon saturation of the second binding site. in the presence of a two - fold excess of zn(ii) relative to the second apparent equilibrium dissociation constant (kd2,app) (a condition under which 67% of the protein is bound to two zn(ii) ions), the similarity between the fraction of doubly bound protein and the apparent fraction of folded protein under this condition suggests that saturation of both binding sites is thermodynamically coupled to global folding. though we previously found no evidence for the accumulation of partially folded equilibrium intermediates in the absence of metal ions, these results clearly show that at least three conformational states accumulate during coupled zn(ii) binding and folding (figure 3c). together, these findings confirm that metal ion binding is thermodynamically coupled to pmp22 folding. the fraction of folded protein (ffold) was determined from near - uv cd spectra as detailed in the experimental section. u values were determined as described in the experimental section, with the associated error values reflecting propagated standard deviations. kd, app values represent the globally fit values from three replicate titrations of the protein with zncl2 at ph 5.5, with the errors reflecting the standard error of the fitted value. gapp values were determined as described in the experimental section, with the associated error values reflecting propagated standard errors elucidation of the effects of pathogenic mutations on the energetics of coupled binding and folding reactions may provide insight into the mechanism by which mutations in pmp22 prompt cellular misfolding. unambiguous delineation of the effects of mutations on binding and folding would require equilibrium unfolding measurements in the presence of metal ions. however, such measurements can not be achieved because the negatively charged detergents utilized as denaturing agents for -helical membrane proteins form insoluble complexes with divalent metal ions. nevertheless, because binding is thermodynamically coupled to refolding, changes in the apparent equilibrium dissociation constants (kd, app) quantitatively reflect the effects of mutations on the energetics of the overall binding and folding reaction. the effect of a mutation on the apparent free energy difference associated with this cooperative binding and folding reaction (gapp) can therefore be expressed as follows:1,where r is the gas constant, t is the temperature, kd, app wt is the apparent equilibrium dissociation constant of the wild - type protein, and kd, app mut is the apparent equilibrium dissociation constant of the mutant protein. summing gapp values for the two sequential binding and folding reactions therefore yields the effect of a mutation on the free energy difference between the apoprotein ensemble and the globally folded zn(ii)-bound form of pmp22 (gapp, total) as follows:2,which reflects the energetic effects of mutations on the formation of the fully folded zn(ii)-bound form of pmp22. the energetic effects of the g150d (gapp, total = 1.8 0.6 kcal / mol) and l16p (gapp, total = 3.3 0.5 kcal / mol) mutations on the formation of zn(ii)-bound pmp22 are consistent with the magnitude by which these mutations destabilize the apoprotein (gf u = 1.5 0.2 and > 2.0 kcal / mol for the g150d and l16p, respectively) (table 1), indicating that these mutations likely disrupt similar contacts present in both the apoprotein and in the zn(ii)-bound forms. we surveyed the additional nine mutations studied herein for their energetic effects on the formation of zn(ii)-bound pmp22. with the exception of s22f, which exhibits a unique decrease in intrinsic tryptophan fluorescence upon saturation of its second binding site (supplementary figure 2), a similar increase in the intrinsic tryptophan fluorescence coincided with binding and folding for each variant, which suggests similar structural rearrangements interestingly, the degree to which these mutations influence the energetics of binding and folding (gapp, total) is in several cases distinct from the degree to which they destabilize the apoprotein (gf u) (table 1). for instance, despite the fact that the apoprotein form of the nonpathogenic i137v variant is destabilized relative to the wt protein (gf u = 1.0 0.1 kcal / mol), the energetics of binding and folding for i137v pmp22 are indistinguishable from that of wt pmp22 (gapp, total = 0.1 0.9 kcal / mol). in contrast, the severely pathogenic h12q mutation has minimal influence on the conformational stability of the apoprotein (gf u = 0.37 0.07 kcal / mol) but significantly destabilizes the zn(ii)-bound form of pmp22 (gapp, total = 2.4 0.6 kcal / mol). overall nine of the ten pathogenic mutations surveyed disrupt the formation of zn(ii)-bound pmp22 to a significant extent (gapp, total > 1.0 kcal / mol), with all four of the mutations responsible for severe disease (dss) exhibiting the largest energetic effects on the formation of zn(ii)-bound pmp22. these results demonstrate that pathogenic mutations exhibit differential effects on the apoprotein and zn(ii)-bound forms of pmp22 and suggest the effects of the mutations on the bound form may be more closely related to the pathogenic misfolding mechanism. zn(ii) binding was monitored for wt and mutant pmp22 variants in dpc micelles at ph 5.5 using near - uv cd and tryptophan fluorescence. (a) wt (black), g150d (cyan), and l16p (red) pmp22 were titrated with zncl2, and binding was monitored by the change in the intensity of the tryptophan fluorescence emission at 345 nm. the relative fluorescence intensity at 345 nm from representative replicate experiments is plotted against the concentration of zncl2, and the global fit of each data set to a two - site binding model is shown. (b) g150d pmp22 was equilibrated in the presence of 0 mm (dotted line), 720 m (2 kd1,app, dashed line), and 14 mm (2 kd2,app, solid line) zncl2 prior to measurement of the near - uv cd spectra, and the mean residue ellipticity ([]) is plotted against the wavelength. (c) a cartoon depicts a hypothetical reaction coordinate for the coupled binding and folding of the g150d pmp22 variant. to assess the linkage between the destabilization imparted by these mutations and the mechanisms of pathogenic cellular misfolding, we sought to relate in vitro folding measurements to the degree with which these variants are retained by cellular qc. recognition of misfolded pmp22 by cellular qc machinery is a key factor leading to the retention of pathogenic variants in the secretory pathway and the decrease in the concentration of mature pmp22 at the plasma membrane. we therefore devised a means to quantitatively assess the efficiency with which these variants escape qc and traffic to the plasma membrane. pmp22 variants were transiently expressed in madin darby canine kidney (mdck) cells, and pmp22 at the plasma membrane was then labeled with a pe - conjugated primary antibody. to detect retained intracellular pmp22, the cells were then fixed, permeabilized, and again immunostained with an alexa fluor 647-conjugated primary antibody. flow cytometry was then employed to quantify the immunostaining of pmp22 at the plasma membrane (folded) and in the intracellular compartments (misfolded) for each cell. cells expressing wt pmp22 consistently exhibited significant trafficking of the protein to the plasma membrane (figure 4a), though its trafficking efficiency varied considerably across the cellular population (figure 4b). the population average for wt pmp22 (17 3%) is consistent with previously reported estimates of the wt pmp22 trafficking efficiency in schwann cells (20%). furthermore, the relative trafficking efficiencies of pathogenic variants (table 2) are generally consistent with previous qualitative observations in other cell lines. the trafficking efficiencies of the nonpathogenic i137v pmp22 and those of the s22f and a67 t variants associated with mild disease phenotypes are quite similar to that of the wt protein (table 2). however, the other eight pathogenic variants exhibit markedly decreased trafficking efficiencies (figure 4, table 2). considering that total cellular pmp22 expression levels were comparable for all variants tested (table 2), these differences likely reflect the degree of cellular misfolding and the resulting intracellular retention by the cellular qc machinery. importantly, five of the six variants with the highest degree of intracellular retention are highly destabilized and are associated with severe disease phenotypes. these observations quantitatively affirm the notion that a reduction in cellular trafficking is a common effect of pathogenic mutations and suggests that the intracellular retention of pathogenic pmp22 variants is related to their reduced conformational stability. wt and mutant pmp22 variants were transiently expressed in mdck cells, and the cellular trafficking of these proteins was quantitatively assessed using flow cytometry. (a) contour plots depict the distribution of 2500 gfp - positive cells from a representative flow cytometry experimental replicate expressing wt (black), t118 m (cyan), or l16p (red) pmp22 according to their relative immunostaining of pmp22 at the plasma membrane (stained with a pe - conjugated monoclonal antibody) and intracellular pmp22 (stained with an alexa fluor 647-conjugated monoclonal antibody). (b) a histogram depicts the fraction of the cellular population with the indicated ratio of the staining of pmp22 at the plasma membrane to that of the total pmp22 staining for cells expressing wt (black), t118 m (cyan), or l16p (red) pmp22. calculated ratios account for both the effect of nonspecific binding of the antibodies as well as the intrinsic difference in the intensities of the signal of the two fluorescently labeled antibodies (see experimental section). the heights of the bars reflect the average fractional population from three replicate experiments (7500 cells total per variant) and the error bars reflect the standard deviations of these values. to our knowledge, the relationship between the conformational stability of an -helical membrane protein and its cellular trafficking in mammalian cells has not been previously explored. notably, most highly destabilized proteins exhibit reduced trafficking (tables 1 and 2). however, there are two exceptions. the s22f mutant pmp22 exhibits a unique increase in its cellular trafficking efficiency, which may be related to the distinct structural properties of the zn(ii)-bound form of s22f pmp22 (supplementary figure 2). also, the g107v variant appears to have comparable conformational stability to that of wt pmp22 (table 1), yet exhibits impaired cellular trafficking (table 2). however, we noticed that the intrinsic tryptophan fluorescence intensity of g107v pmp22 is similar to that of wt pmp22 under our experimental conditions, which has been optimized for biophysical studies, but greatly diminished at physiological ph (supplementary figure 3). this finding suggests the structural defects caused by this particular mutation may not be manifested under the conditions used for our folding reactions. for these reasons, we have excluded the s22f and g107v variants from our analysis of the relationship between the conformational stability and cellular trafficking of pmp22 variants. in order to assess the mechanism of pathogenic cellular misfolding, we compared the conformational stability and cellular trafficking measurements. u values for the folding of the pmp22 apoprotein against relative degree of plasma membrane trafficking but found no apparent relationship (supplementary figure 4). in contrast, a linear relationship is apparent between the energetic effects of mutations on zn(ii)-mediated pmp22 folding (gapp, total) and the degree of plasma membrane trafficking (r = 0.73, figure 5a). a key feature of this correlation is the differentiation of pathogenic phenotypes that arises from these combined measurements : mutations that cause severe disease phenotypes (dss) exhibit the highest degree of destabilization and the largest reduction in cellular trafficking, while mutations that cause moderate to mild phenotypes (cmt1 and hnpp) have more subtle effects. this correlation has critical implications for the role of metal ions as pmp22 cofactors. to further examine the relationship between binding, folding, and trafficking, we corrected the apparent zn(ii) binding constants for differences in the stabilities of the variants (supplemental theory). simulations based on corrected thermodynamic parameters confirm zn(ii) binding represents a key mediator of the folding equilibrium constant and cellular trafficking of pmp22 (supplemental theory). together these findings strongly suggest that pathogenic misfolding arises as a result of the impact of mutations on the zn(ii)-binding - linked conformational stability of pmp22. values represent the average of three replicate population - averaged values (2,500 gfp - positive cells per replicate), and errors reflect the standard deviation of the population - averaged values. we next sought to determine whether these observations are also consistent with the degree of dysmyelination arising from these mutations. because myelin principally provides insulation for nerve axons to enhance conductance, pathogenic dysmyelination in cmt1 and related disorders reduce motor nerve conduction velocities (ncv). ncv values for patients who are heterozygous for the mutations studied in this work therefore represent a favorable metric for the severity of the disease phenotype. a striking linear correlation (r = 0.88) is apparent between ncv values and the relative concentrations pmp22 variants at the plasma membrane (figure 5b), which strongly supports the notion that the mistrafficking of pmp22 variants represents a key pathogenic mechanism leading to dysmyelination. furthermore, ncv values are also correlated with the energetic effects of these mutations on zn(ii)-mediated pmp22 folding (r = 0.64, figure 5c), suggesting that the compromised stability of the zn(ii)-bound forms of these variants is responsible for their aberrant trafficking in vivo and, ultimately, for dysmyelination. together, these findings indicate that the conformational instability of pmp22 underlies most neuropathies arising from pathogenic missense mutations in the pmp22 gene. collectively, our results suggest that metal ion - mediated folding is a limiting reaction within the pmp22 biosynthetic pathway. these findings strongly suggest that conformational stability is a critical variable in the proper production and cellular trafficking of integral membrane proteins in the cell ; a finding with broad relevance to the molecular basis of a number of diseases. furthermore, we believe these results serve to unify a number of observations involving pathogenic pmp22 variants and have implications for the rational design of novel therapeutics for this class of hereditary peripheral neuropathies. we recently found that the positions of pathogenically mutated side chains associated with severe disease phenotypes almost all fall within the protein core of a structural model of the pmp22 apoprotein (figure 1b, c), suggesting that pathogenic misfolding may principally arise as a result of the disruption of tertiary contacts within the native structure. while the findings of this paper are generally consistent with this notion, the results also highlight metal ion binding as a factor that likely contributes to the net conformational stability of pmp22 under physiological conditions (figure 5a, c). the conformational stability of pmp22 in vivo should therefore depend both on the intrinsic conformational stability of the apoprotein and the metal ion binding affinity. inspection of the folding data and binding data reveals that pathogenic mutations can destabilize the protein by interfering with helical packing, metal ion binding, or both (table 1). regardless of the destabilization mechanisms, the net energetic effect of these mutations on the formation of the fully folded, zn(ii)-bound pmp22 is clearly important for its cellular trafficking (figure 5a) and the degree of dysmyelination (figure 5c). the notion that metal ions play a critical role in pmp22 biogenesis is quite reasonable considering the essential roles metal ions play in the nervous system. zinc and copper are plentiful in myelin, and depletion of either results in peripheral neuropathy. moreover, compaction of pns myelin has been shown to be mediated by zn(ii) and other zn(ii)/cu(ii) binding proteins expressed in myelin such as the myelin basic protein. based on our results, we hypothesize that the binding of metal ions likely constitutes one of the decisive interactions in the biosynthetic pathway of pmp22. such a role for metal ions in pmp22 biogenesis is fully consistent with emerging perspectives on the influence of metabolites and cofactors on the rate and efficiency of protein folding in the cell. correlation of zn(ii) binding energetics and cellular trafficking of pmp22 variants to clinical phenotypes. correlations between the quantitative effects of mutations on the apparent free energy of zn(ii) binding (gapp, total), the quantitative effects of mutations on the cellular trafficking of pmp22, and the motor nerve conduction velocities of patients with the corresponding mutations are shown. (a) the surface - immunostaining of mdck cells expressing pmp22 variants were normalized relative to that of the wt protein (table 2) and plotted against the corresponding gapp, total values (table 1). a linear fit of the data weighted according to the experimental errors (r = 0.73) is shown (dashed line). (b) motor nerve conduction velocities (ncv) of patients harboring pathogenic mutations (supplementary table 1) were plotted against the relative surface immunostaining of mdck cells expressing the corresponding pmp22 variant (table 2). an unweighted linear fit of the data (r = 0.88) is shown (dashed line). (c) ncvs from patients harboring pathogenic mutations in pmp22 (supplementary table 1) were plotted against the gapp, total values of the corresponding pmp22 variant (table 1). an unweighted linear fit of the data (r = 0.64) is shown (dashed line). this work confirms the long - held suspicion that the conformational stability of pmp22 is intimately linked to its cellular fate. considering that passage through qc involves a large number of diverse protein nevertheless, it should be noted that a similar empirical linear relationship has previously been documented between the conformational stabilities of mutant forms of a water - soluble protein (bovine pancreatic trypsin inhibitor) and their secretion efficiencies. such relationships suggest that the structural defects detected by qc are closely linked to conformational stability. differences in the folding and/or unfolding kinetics, for example, may underlie differential recognition unstable variants. in this regard, it should be noted that pmp22 folding, which requires hours to reach equilibrium in vitro, is accelerated roughly 30-fold in the presence of zn(ii) (supplementary table 2). the increase of the folding rate of binding - competent variants by metal ions may, in turn, prevent the formation of interactions of between pmp22 and various folding sensors such as calnexin, which is known to form long - lived interactions with destabilized pmp22 variants. further studies are needed to gain mechanistic insight into the key interactions that limit the folding and trafficking of pmp22 in cells. the apparent relationships between folding, trafficking, and ncv values in patients harboring these mutations suggest the decreased yield of folded pmp22 at the plasma membrane constitutes the key driver of dysmyelination in the afflicted patients (figure 5b, c). however, the etiology of cmt1 and related peripheral neuropathies is believed to stem from a variety of biochemical effects of pathogenic pmp22 mutations including the enhanced retention of pathogenic variants in the early secretory pathway, wild - type / mutant heterodimerization, the formation of intracellular aggregates, and a diminished capacity of the cellular proteostasis network. for instance, the enhanced retention of pathogenic variants in the secretory pathway and the concomitant decrease in the yield of pmp22 at the plasma membrane likely arise as a result of enhanced interactions between misfolded variants and er chaperones / folding sensors. formation of non - native dimers, in turn, may form as a consequence of the buildup of misfolded variants in the endoplasmic reticulum. polyubiquitination and extrusion of misfolded variants from the er eventually result in the buildup of large, insoluble aggresomes in the cytosol that are engaged by proteasomal and lysosomal machinery. the association of chaperones, proteasomes, and lysosomes with aggresomes coincides with decreases in the buffering capacity of the cellular proteostasis network, which may in turn facilitate the secondary aggregation of unrelated proteins that rely on common chaperones. thus, pharmacological strategies aimed at suppressing the misfolding of pathogenic pmp22 variants could potentially abrogate the chain of events collectively responsible for dysmyelination. this perspective provides a source of optimism regarding the potential utility of small molecule pharmacological chaperones that suppress misfolding by specifically binding the native fold relative to misfolded conformations. such pharmacological chaperones have been reported for a number of other disease - linked membrane proteins including the cystic fibrosis transmembrane conductance regulator (cftr) and various g protein - coupled receptors. indeed, the coupling of zn(ii) binding and folding observed for pmp22 in this work demonstrates the feasibility of ligand - mediated pmp22 stabilization. collectively, these findings indicate that pmp22 represents a promising candidate for the development of pharmacological chaperones. studies of the biophysical basis of membrane protein misfolding are in an early stage of development. our findings suggest that the intrinsic thermodynamic preference for the native conformation over a competing ensemble of disordered conformations represents a decisive factor in pmp22 biogenesis. a long line of evidence suggests these principles may extend to a number of other membrane proteins implicated in disease. first, as is true for pmp22 and various other membrane proteins known to undergo misfolding including rhodopsin, cftr, and the vasopressin v2 receptor, pathogenic mutations generally appear to be evenly distributed throughout the primary sequence. this suggests that pathogenic loss of function most often occurs as a result of misfolding rather than disruption of specific functional elements. additionally, many of these mutations involve nonconservative substitutions that would be expected to perturb native conformations. for example, pathogenic mutations often involve the introduction of helix - breaking residues, polar residues, or charged residues within tm helices. the putative destabilization imparted by such pathogenic substitutions has been previously suggested based on various computational studies and from biophysical studies of isolated tm helices. this work represents the first definitive evidence directly linking conformational destabilization of a human membrane protein to pathogenic cellular misfolding, which opens the door for additional mechanistic investigations of this phenomenon in other related disease - linked integral membrane proteins. despite growing appreciation of protein misfolding as the molecular basis of for numerous diseases, we are just beginning to understand the critical factors that prompt the misassembly of nascent membrane proteins. the linkage documented herein between the conformational stability of an -helical membrane protein and its passage through cellular qc is likely to be generally applicable to many other membrane proteins implicated in disease and provides fundamental insight into the logic of membrane protein qc in the er. our results also strongly suggest a critical role for divalent metal ions in pmp22 biogenesis. finally, pmp22 appears to be a suitable target for the development of pharmacological chaperones to treat certain forms of cmt1 and related neuropathies. quickchange mutagenesis was used to create mutants of pmp22 within the pah13 construct, which has been previously described for the expression of pmp22 in escherichia coli. for transient expression of pmp22 in mammalian cells, this construct expresses pmp22 and egfp off of the same transcript, which enables facile identification of transformed cells expressing pmp22. due to the lack of high - quality monoclonal antibodies for pmp22, we used quickchange mutagenesis to insert a myc epitope into the second extracellular loop of pmp22 within the pires2 constructs to enable immunological detection. it has previously been shown that this modification does not impact the trafficking or turnover of the protein. quickchange mutagenesis was also used to introduce point mutations into the pires2 vectors prior to purification of each vector using a perfectprep endofree plasmid maxi kit (5prime, gaithersburg, md). expression and purification of mutant proteins were also performed as previously described for the wt protein, except that the mutant proteins were separated from the cleaved expression tag and protein aggregates by cation exchange chromatography using a 1 ml hitrap sp sepharose column and/or size exclusion chromatography using a 24 ml superpose 6 column on an kta fplc (ge healthcare, piscataway, nj) when necessary. we previously demonstrated that wt pmp22 is only 50% folded (gf u 0 kcal / mol) at equilibrium in dpc micelles, which implies the fraction of folded protein (ffold) should be sensitive to the effects of mutations on the conformational stability under these conditions. therefore, we directly assessed the ffold of each variant in dpc micelles using near - uv cd spectroscopy in order to determine the corresponding free energy of folding (gf u). to measure the ffold for each variant, we assessed the mean residue ellipticity at 299 nm ([]299), which serves as a reliable probe for the degree of tertiary structure formation, of each variant in nondenaturing dpc micelles and subtracted the signal of the denatured protein in mixed micelles containing dpc and a high mole fraction of the denaturing detergent n - lauroyl sarcosine (ls) (xls) and then divided this quantity by the signal of the fully folded protein as described below. each purified variant protein was equilibrated at room temperature in 25 mm sodium acetate (ph 5.5) containing 150 mm nacl, 1.0 mm tcep, and 28 mm dpc (0.00 xls) prior to acquisition of the near - uv cd spectrum of the protein under nondenaturing conditions using a jasco j-810 spectropolarimeter (jasco, easton, md). purified variants were also equilibrated at room temperature in 25 mm sodium acetate (ph 5.5) containing 150 mm nacl, 1.0 mm tcep, 28 mm dpc, and 28 mm ls (0.50 xls), a condition under which the tertiary structure of the wt protein is known to be denatured. cd spectra for both the folded protein and the denatured protein were corrected by subtracting the spectra of 25 mm sodium acetate (ph 5.5) containing 150 mm nacl, 1.0 mm tcep, and 28 mm dpc (0.00 xls) (nondenaturing conditions) or of 25 mm sodium acetate (ph 5.5) containing 150 mm nacl, 1.0 mm tcep, 28 mm dpc, and 28 mm ls (0.50 xls) (denaturing conditions), respectively. to minimize the influence of slight deviations in the spectral baselines, all spectra were empirically normalized based on the average signal between 320 and 330 nm, which was observed to be close to zero in all cases. to determine the signal of the folded variant protein from these spectra, the average []299 value from three replicate cd spectra of the denatured protein (at 0.50 xls), which represents the baseline signal of the fully unfolded protein, was subtracted from the average []299 value of the protein under nondenaturing conditions (0.00 xls). to determine the ffold value of the variant, this corrected signal was then divided by 105 2 deg cm dmol res, which is the average signal of the fully folded protein as determined from the fitting of three replicate wt pmp22 equilibrium unfolding transitions measured in the presence of 15% glycerol using a two - state equilibrium model ; see ref (21). the ffold values were then used to calculate equilibrium constants and the free energy of folding (gf u) assuming a two - state equilibrium, which was previously shown to adequately describe the behavior of the wt protein under these conditions at equilibrium. briefly, purified pmp22 variants were equilibrated at a protein concentration of 1 m at room temperature in 25 mm sodium acetate (ph5.5) containing 150 mm nacl and 28 mm dpc for at least 1 h prior to binding measurements. the solution was then equilibrated in a quartz cuvette containing a stir bar at 25 c for at least 15 min prior to serial titration with a stock zn(ii) solution containing 25 mm sodium acetate (ph 5.5), 150 mm nacl, and 550 mm zncl2 using a hamilton syringe (reno, nv). final concentrations ranging from 40 to 80 mm zncl2 were achieved, depending on the variant, in order to ensure saturation of both binding pockets. the binding reaction was allowed to proceed for 5 min after each addition, which was judged to be sufficient for the binding kinetics of wt and mutant pmp22 (supplementary table 2). the extent of binding was then monitored with a 20 s average of the fluorescence emission intensity at 345 nm with a jobin yvonne fluoromax spex-3 (horiba scientific, edison new jersey, nj). the signal was then corrected according to the dilution factor, and the gain in the fluorescence intensity was normalized relative to the fluorescence intensity of pmp22 in the absence of zncl2. the background fluorescence was judged to be negligible according to titrations performed in the absence of pmp22. binding isotherms were best described by a two - site binding model as judged by the residuals of the fits of the data to single- and two - site binding models. to reduce the influence of random errors on the fitted kd values, three replicate binding isotherms were globally fitted to determine the two kd values. mdck cells, which have proven to be robust in previous studies of the cellular trafficking of integral membrane proteins, were grown at 37 c and 5% co2 in f-12 dmem containing 10% fetal bovine serum (fbs), penicillin, and streptomycin (life technologies, grand island, ny) to 2050% confluency in 6 cm culture dishes. the cells were then transfected in optimem media (life technologies, grand island, ny) for 24 h with 1 g of plasmid per dish using effectine transfection reagent (qiagen, venlo, nl). the transfection media was then removed, and the cells were allowed to grow in f-12 dmem containing 10% fbs, penicillin, and streptomycin for an additional 24 h. transfected cells were trypsinized and prepared for facs analysis using the fix & perm kit in accordance with the manufacturer s instructions (life technologies, grand island, ny). briefly, half of the cells from a confluent 6 cm culture dish (ca. 1.6 10 cells) were suspended in 100 l of culture media, and a pe - labeled monoclonal anti - myc antibody (clone 9e10) (cell signaling technology, danvers, ma) was added to the solution to a final concentration of 0.75 g / ml to immunostain pmp22 on the surface of the cell. the cells were then incubated in the dark at room temperature for 30 min. 100 l of the fixation solution was then added to the media, and the cells were incubated for 15 min in the dark at room temperature. the cells were then rinsed and pelleted by centrifugation twice with 3 ml of pbs containing 5% fbs and 0.1% nan3 (rinse solution). the cells were then suspended in 100 l of the permeabilization solution, and an alexa fluor 647-labeled monoclonal anti - myc antibody (clone 9e10) (cell signaling technology, danvers, ma) was added to the solution to a final concentration of 0.75 g / ml to label intracellular pmp22. after a 30 min incubation in the dark at room temperature, the cells were again rinsed and pelleted by centrifugation twice using rinse solution then resuspended in 300 l of the rinse solution prior to facs analysis. immunostained cells were analyzed with a facs canto ii flow cytometer (bd bioscience, san jose, ca). 2500 transfected cells expressing pmp22 were analyzed from each sample by gating on gfp - positive cells (excited with a 488 nm laser, detected with 515545 nm emission filter). the single - cell pe intensity (surface pmp22, excited with a 488 nm laser, detected with 564606 nm emission filter) and alexa fluor 647 intensity (internal pmp22, excited with a 633 nm laser, detected with 650670 nm emission filter) signals were corrected for nonspecific binding by subtracting the average intensities of untransfected, gfp - negative cells within each sample. to correct for the difference in the fluorescence intensity of the two antibodies, cells expressing wt pmp22 were stained with either the pe - labeled antibody or the alexa fluor 647-labeled antibody prior to facs analysis, and the ratio of the average intensities of these cells was used to normalize the two signals. single - cell trafficking efficiency values were then calculated from the ratio of the corrected pe signal of a given cell over the sum of its corrected alexa fluor 647 and pe signals. average trafficking efficiency values calculated in this fashion were found to be similar to those determined by a comparison of the population - averaged intensities of intact (surface pmp22) and permeabilized (total pmp22) cells stained with the same concentration of the same fluorescently labeled antibody. single - cell fluorescence intensity values below the background intensity were assigned an intensity of 0. cells for which this correction or for which extremely low intensity values resulted in a nonreal or artificially inflated efficiency ratio (> 50% efficiency, typically less than 1% of the population) were discarded from the analysis. results were analyzed and visualized using flowjo x software (treestar inc., ashland, or). from titrations of both intact and permeable cells expressing wt pmp22 with fluorescently labeled antibodies, we found the average fluorescence intensity to be linearly dependent upon the antibody concentration. this confirms that fluorescence intensity values fall within the linear range of the detectors. moreover, this ensures that the observed trafficking efficiency values are independent of the chosen antibody concentration. compensation for spillover of the fluorescence signals between the channels utilized for the analysis as well as the gates for the selection of single cells, gfp - positive cells, and gfp - negative cells was initially set manually but was kept consistent for the collection of all data sets obtained thereafter. | despite broad biochemical relevance, our understanding of the physiochemical reactions that limit the assembly and cellular trafficking of integral membrane proteins remains superficial. in this work, we report the first experimental assessment of the relationship between the conformational stability of a eukaryotic membrane protein and the degree to which it is retained by cellular quality control in the secretory pathway. we quantitatively assessed both the conformational equilibrium and cellular trafficking of 12 variants of the -helical membrane protein peripheral myelin protein 22 (pmp22), the intracellular misfolding of which is known to cause peripheral neuropathies associated with charcot marie tooth disease (cmt). we show that the extent to which these mutations influence the energetics of zn(ii)-mediated pmp22 folding is proportional to the observed reduction in cellular trafficking efficiency. strikingly, quantitative analyses also reveal that the reduction of motor nerve conduction velocities in affected patients is proportional to the extent of the mutagenic destabilization. this finding provides compelling evidence that the effects of these mutations on the energetics of pmp22 folding lie at the heart of the molecular basis of cmt. these findings highlight conformational stability as a key factor governing membrane protein biogenesis and suggest novel therapeutic strategies for cmt. |
tamoxifen is an effective treatment in reducing recurrence and mortality rates for estrogen receptor (er) positive breast cancer patients 1. on the other hand, an undesirable side effect of increasing risk of endometrial cancer has been suspected for decades 2 - 6. a number of case - control studies showed that the risk of endometrial cancer increased after long - term tamoxifen treatment for breast cancer patients 2 - 6. a vast majority of these case - control studies were conducted in the western world with a small sample size (from a total of a few hundred to a few thousand cases in each study 2 - 6. a previous study of 674 consecutive breast patients in japan reported that tamoxifen use for longer than 5 years correlated with increasing risk of developing endometrial cancer, while the small sample size prevented to detect statistical significance 7. a more recent study analyzing pooled studies from the cochrane central register of controlled trials and national library of medicine for published data from january 1970 to december 2010, however, reported that the risk of endometrial cancer, deep vein thrombosis and pulmonary embolism is low in women < 50 years who take tamoxifen for breast cancer prevention. in addition, although levonorgestrel intrauterine system (lng - ius) has been used in patients with breast patients taking tamoxifen (tam) to prevent endometrial proliferation, the benefits, the side effects, and the patients suitable for this treatment are still elusive 9. the above facts clearly indicate the needs for further clarification of the potential link between tamoxifen use and the risk for endometrial cancer. since the incidences of breast and endometrial cancer have been increasing (figure 1), according to the taiwan cancer registration system (https://cris.bhp.doh.gov.tw/pagepub/home.aspx), our study aimed to assess the endometrial cancer risk after tamoxifen adjuvant treatment for female breast cancer patients in taiwan using a significantly large and population - based database. a retrospective cohort study was conducted to evaluate tamoxifen use on endometrial cancer risk for breast cancer patients in taiwan. in our study, the data included details of inpatient orders files, inpatient expenditures by admissions files, details of ambulatory care orders files and ambulatory care expenditures files. the above data were obtained from the national health insurance research database (nhird) (http://www.nhri.org.tw/nhird/en/index.htm) provided by the bureau of national health insurance, department of health, and managed by national health research institutes. all identifiers of all patients were completely removed before the release of the documentation and the encrypted data used in our study can not link to any of the specific individual. a total of 74,280 patients treated for breast cancer between january 1, 1997 and december 31, 2004 were included in the study. the cases were identified according to the coding of ninth revision international classification of diseases (icd-9) 1740 - 1749 (malignant neoplasm of female breast). of the 74,280 patients, 39,411 (53.1%) received tamoxifen treatment, and 34,869 (46.9 %) did not. the duration of tamoxifen treatment was timed from the first to the last prescription for tamoxifen. tamoxifen - associated endometrial cancer was defined as endometrial cancer that occurred in patients at least 6-month after the diagnosis of breast cancer, who underwent tamoxifen treatment. logistic regression analysis was performed to assess the potential association between the development of endometrial cancer with tamoxifene treatment, prior hormone exposure, hypertension, diabetes and age. of the 222 endometrial cancer cases, 153 (69 %) were seen in patients with tamoxifen treatment, and 69 (31%) were seen in patients without the use of tamoxifen. the incidence of endometrial cancer was 0.388% (153/39,411) in patients with tamoxifen treatment, while was 0.198% (69/34,869) in patients without tamoxifen treatment (p < 0.001). among patients with tamoxifen treatment, the average duration of tamoxifen use was 2.91 years in patients developed endometrial cancer, and was 1.67 years in patients did not develop endometrial cancer (table 2). logistic regression of endometrial cancer risk for breast cancer patients on prior hormone exposure, hypertension, diabetes, age and tamoxifene treatment are shown in table 3. tamoxifen use and age over 35 years were significantly correlated with the development of endometrial cancer (p<0.001 and p=0.002, respectively). patients treated with tamoxifen had a significantly higher risk of endometrial cancer than those who did not take tamoxifen (or 1.86 ; 95%ci, 1.40 - 2.47 ; p < 0.001). however, there were no significant differences in prior hormone exposure, hypertension and diabetes. logistic regression of endometrial cancer risk for breast cancer patients with tamoxifen use on duration of tamoxifen treatment, prior hormone exposure, hypertension, diabetes and age are shown in table 4. a link between long - term tamoxifen use and increasing endometrial cancer risk by odds ratio was 2.94 (95%ci, 2.13 - 4.06) for 3 years or longer ; the odds ratio was 4.08 (95%ci, 1.67 - 9.93) for women aged older than 35 years compared to those aged 35 or younger than 35 years for breast cancer patients with tamoxifen use. to the best of our knowledge, our study is the largest population based study to further assess the potential association between tamoxifen use for breast cancer treatment and the risk for endometrial cancer. our study reveals that tamoxifen use and age over 35 years were significantly correlated with the development of endometrial cancer for breast cancer patients. furthermore, for breast cancer patients undergoing tamoxifen treatment, a link between long - term tamoxifen use and increasing endometrial cancer risk by odds ratio was 2.94 (95%ci, 2.13 - 4.06) for 3 years or longer ; the odds ratio was 4.08 (95%ci, 1.67 - 9.93) for women aged older than 35 years compared to those aged 35 or younger than 35 years. a case - control study revealed a significantly increasing endometrial cancer risk by or 3.6 (95% ci ; 2.6 to 4.8) for breast cancer women with tamoxifen treatment beyond five years compared those women with no treatment 4. the comprehensive cancer centres ' alert group detected an increasing endometrial cancer risk for longer duration of tamoxifen use, relative risk 6.9 (95%ci, 2.4 - 19.4) for at least 5 years and 2.0 (95%ci, 1.2 - 3.2) for 2 - 5 years compared with non - users in breast cancer women 6. our study has also obtained several unique findings that are not sufficiently addressed in previous studies, such the duration of tamoxifen use and patients ' age. previous studies showed an increasing endometrial cancer risk after 5-year tamoxifen use 4, 6, while our study reveals the risk impact can occur fewer than 3-years. our study has suggested that age is an important factor for the development of endometrial cancer in breast cancer patients. in our study, an increasing endometrial cancer risk by or 4.16 (95% ci = 1.71 to 10.14) was observed in the breast cancer women aged older than 35 years compared with the younger breast cancer patients (table 3). our study has also detected an increasing endometrial cancer risk by or 4.08 (95% ci = 1.67 to 9.93) in breast cancer patients with tamoxifen treatment for women older than 35 years compared with the younger ones (table 4). it is very important to prevent endometrial cancer developing or diagnose at early stage as tamoxifen is commonly used for all stages of hormone receptor positive breast cancer patients. a previous study reported that the endometrium thickness cumulatively increased during the tamoxifen treatment and the thicker endometrium remained years after the end of treatment, which results in increasing endometrial cancer development 10. another study showed that breast cancer patients with tamoxifen use have early stage endometrial cancer and good prognoses 11. the incidence of subsequent endometrial carcinoma does not increase for primary breast cancer patients with tamoxifen usage if the patients underwent annual screening for gynecologic malignancies, including a pelvic examination, cervix and endometrium examination 12. regular follow - up of the endometrium thickness in breast cancer women taking tamoxifen may play an important role for endometrial carcinoma early diagnosis 10. the risk of endometrial cancer has been traditionally reported for postmenopausal women receiving long term tamoxifen therapy. however, more than half of patients in this study appear to have developed cancer within 3 years, almost a third within 18 months. the incidence peak of taiwanese female breast cancer is also different form the western countries 13. the clinical implications need more studies for evaluating the pathogenesis, environmental genetics and other factors. our study shows that tamoxifen use and age over 35 years significantly correlated with breast cancer patients with endometrial cancer. regular gynecologic follow - up may be mandatory for those women with three years or above of tamoxifen use and age over 35 years. | background : our study aimed to assess the endometrial cancer risk after tamoxifen adjuvant treatment for female breast cancer patients in taiwan.materials and methods : a total of 74,280 breast cancer patients between january 1997 and december 2004 were included in the study ; 39,411 received tamoxifen treatment and 34,869 did not. tamoxifen - associated endometrial cancer was defined as endometrial cancer that occurred in patients at least 6-month after the diagnosis of breast cancer, who underwent tamoxifen treatment.results : a total of 222 patients developed endometrial cancer, and of these,153 (69 %) were seen in patients with tamoxifen treatment, and 69 (31%) were seen in patients without the use of tamoxifen. the incidence of endometrial cancer was 0.388% (153/39,411) in patients with tamoxifen treatment, while was 0.198% (69/34,869) in patients without tamoxifen treatment. logistic regression analysis demonstrated that tamoxifen use and age over 35 years were significantly correlated with development of endometrial cancer (p<0.001 and p=0.002, respectively). the odds ratio was 2.94 (95%ci, 2.13 - 4.06) for 3 years or longer tamoxifen use. the odds ratio was 4.08 (95%ci, 1.67 - 9.93) for women older than 35 years compared to those 35 or younger than 35 years. there were no significant differences in prior hormone exposure, hypertension and diabetes.conclusions : to the best of our knowledge, this is the largest population based study that shows in patients with breast cancer, tamoxifen use for more than three years or patients older than 35 years was associated with a significantly increased risk for developing endometrial cancer. |
metzincin matrix - metalloproteases (mmps) comprise a large family of endopeptidases of which today, 24 distinct genes have been identified in man (only 23 have been identified in mouse). the prefix metallo- refers to the reliance of these endopeptidases on zinc ions to perform hydrolysis of their respective protein substrates. mmps are best known for their actions in remodeling of extracellular matrix (ecm) proteins and typical classification of the mmps is based on their ecm substrate, their primary structure, and their subcellular localization. groups of mmps thus include the collagenases (mmp-1, mmp-8, and mmp-13), stromelysins (mmp-3 and mmp-10), stromelysin - like mmps (mmp-11 and mmp-12), matrilysins (mmp-7 and mmp-26), membrane - type mmps (mt - mmp-1 to mt - mmp-6), gpi - type mmps (mmp-17 and mmp-25), and, probably the best known, gelatinases (mmp-2 and mmp-9) [24 ]. research dedicated to identifying mmp targets has however uncovered that in fact the prefix matrix is far from complete as the mmp substrate repertoire is much more diverse and also includes growth factors, hormones, cytokines, and chemokines. even more, mmps are now known to also cleave intracellular targets (see later) [2, 3 ]. this multitude of target proteins grants mmps involvement in a wide array of cellular functions. as such, they contribute to cellular differentiation and migration, regulation of growth factor activity, and cell survival as well as apoptosis, angiogenesis, and inflammation. mmp activity is controlled at three levels : (i) transcription ; (ii) proenzyme activation, and (iii) inhibition by endogenous proteins, most notably the tissue inhibitors of metalloproteases (timps ; timp-1 to timp-4). mmps are synthesized as zymogens that are activated while being located intracellularly (see further), bound to the plasma membrane, or after secretion in the extracellular environment, most commonly by removal of their propeptide domain. a cysteine residue in the propeptide domain interacts with the catalytic zinc ion, thereby preventing protease activity until the propeptide domain is removed. the dissociation of this cysteine - zn interaction (cysteine switch) is a critical step in the activation of all mmps. the third and fourth mmp protein domains are a linker region of variable length and a hemopexin domain that confers substrate specificity [2, 5 ]. timps bind to the catalytic subunit of mmps and inhibit them with a 1 : 1 stoichiometry (note though that there are just four timps for over twenty mmps) and the protease - antiprotease paradigm states that the net mmp proteolytic activity is the difference of total active mmps minus the total timp activity. internalization, protease activity, posttranslational modifications (s - nitrosylation, glycosylation, oxidation, and alkylation), compartmentalization, and availability of substrates add additional levels of mmp activity control [1, 3 ]. mmps are implicated in many physiological as well as pathological conditions, but we here focus on their role in inflammation. the inflammatory response is characterized by a cascade of molecular events including the secretion of cytokines, chemokines, and proteases by the damaged tissue as well as by infiltrating mast cells and neutrophils which are the sentinels responsible for detecting tissue damage or infection. this acute response subsequently promotes invasion of leukocytes from the blood side into the inflamed tissue, giving rise to a more chronic inflammatory state. in nearly every organ or tissue system, for instance, efficient migration and extravasation of leukocytes along chemotactic gradients to sites of infection are important for establishing effective immunity and mmps have been shown to contribute to these functions. mmps aid in establishing a chemotactic signal for recruitment of leukocytes and at the same time degrade ecm and junctional proteins, promoting leukocyte infiltration. chemokines are immobilized mostly on the ecm or cell surface by binding to glycosaminoglycans and mmps might contribute to the liberation of these molecules, delivering soluble effectors in the extracellular environment. paracellular movement of leukocytes is impeded by tight junctions and adherens junctions that occlude the intercellular cleft. occludin and zonula occludens-1 (zo-1), important components of the intercellular tight junctional complex, have been identified as substrates of mmps [911 ]. in addition, vascular endothelium- (ve-) cadherin and e - cadherin, major components of the adherens junction, are known to be cleaved by mmp-7 and mmp-9 [1214 ]. importantly, mmps are derived from the injured tissue as well as from the infiltrating immune cells. macrophages are on the other hand important in attenuating the acute immune response. here, mmps contribute by removing the chemotaxis of neutrophils and by inhibiting t - cell proliferation and function [4, 5 ]. at a second level, mmps regulate the availability and activity of inflammatory mediators, including cytokines and chemokines. whereas the proinflammatory tumor necrosis factor - alpha (tnf) is generally activated by mmps, a dual role has been proposed with respect to interleukin-1-beta (il1) activity [15, 16 ]. as such, tnf, il1, and transforming growth factor - beta (tgf) are implicated in the upregulation of mmp-1, mmp-3, and mmp-9 via the nuclear factor kappa - b (nfb) transcription factor, thereby creating a positive feedback loop [1719 ]. finally, mmps can trigger a specialized form of programmed cell death termed anoikis that is induced by cells detaching from the surrounding ecm by interrupting cell - cell and cell - matrix interactions. a thorough discussion of isolated mmps ' contribution to inflammation falls beyond the scope of this review but is excellently reviewed by others [4, 21, 22 ]. a first and very relevant aspect of mmps in view of this review is the activation kinetics of mmps. some mmps, for example, mt - mmps and the downstream mmp-2, are believed to be constitutively active, although their activity can still be enhanced in inflammatory conditions. oppositely, other mmps such as mmp-9 are only induced and activated under conditions of immune activation and are normally associated with activated leukocytes, macrophages, and endothelium. being dependent on the presence of proinflammatory cytokines and a cascade of cleavage events by upstream proteases (other mmps, plasmin), activation of mmps is considered to be a slightly delayed (nevertheless acute) event in the inflammatory response [1, 23 ]. however, as we will discuss later, removal of the prodomain is not always required and mmps may be acting at a faster time scale in such conditions. being dependent on membrane - bound mt1- and mt3-mmps for its activation, mmp-2, for example, is generally considered to be spatially constrained, whereas other mmps like mmp-9 are released in the extracellular space and diffuse to more remote sites. therefore, secreted mmps are presumed to cause more widespread damage. in addition, as outlined below, mmps are now also known to cleave intracellular substrates, unlocking a new level of complexity with respect to their role in inflammation. in the following sections we will discuss their action on connexin (cx) channel function. these channels too have been identified as important contributors to the inflammatory process (see later) ; however, only a small number of papers suggested a link between cxs and mmps. their interaction at the functional level therefore remains poorly understood. here, we try to explain how an mmp - cx interaction may mechanistically alter channel function and contribute to acute inflammation. cxs are a family of transmembrane proteins with molecular weights (mw) varying from 26 to 60 kda on which the current nomenclature is based (e.g., cx43 has a mw of ~43 kda). cxs form two kinds of channels, namely, gap junctions (gjs) and hemichannels (hcs). gjs mediate the direct diffusion of ions and molecules with mws up to 1.52 kda, including inositol 1,4,5 trisphosphate, cyclic nucleotides, and energy molecules such as glucose and atp, thereby contributing to the coordination of cell function in several organs and tissues. gj channel - mediated intercellular communication (gjic) is, for instance, implicated in the communication of electrical signals between cardiomyocytes, coordinating cardiac pump function. gjic between smooth muscle cells coordinates, for example, bladder and uterus function [25, 26 ]. gjs also pass signaling molecules to mediate the propagation of intercellular ca waves in various tissues and organs, they provide metabolic coupling between liver cells or astrocytes [2830 ] and contribute to the exchange of bone modulating molecules. however, on the downside, gjs also spread cell death signals to neighboring cells, thereby contributing to tissue / organ damage in pathology. half gj channels that arise from the hexameric assembly of different cx subunits can be present in the plasma membrane both as gj precursors, called connexons, or as nonjunctional, functional channels, known as hcs. for a long time, it was thought that the only reason for a hc to open was related to their incorporation into a gj channel. uncontrolled hc opening was presumed to lead to membrane depolarization and depletion of essential molecules from the cytoplasm, ultimately resulting in cell dysfunction and possibly cell death. the first evidence of functional hcs arose from in vitro work using cx46 expression in xenopus laevis oocytes, indicating that hc opening resulted not only in dye uptake, but also in cell depolarization and cell death. research over the past decades has however identified numerous scenarios in which hcs are activated to open, thereby contributing to paracrine signaling through the release of atp, glutamate, glutathione, nad, and prostaglandins [38, 39 ]. hc - mediated atp release, for instance, functions as a paracrine signal in the propagation of intercellular ca waves [27, 40 ]. evidence is accruing that hcs may contribute to physiological functions such as center - surround antagonism in the retina [37, 41 ], osteogenesis [31, 42 ], regulation of vascular permeability, central chemoreception, and atherosclerotic plaque formation. however, hcs also have an established role in pathological conditions associated with inflammation which has been particularly well - documented in the brain [4654 ]. finally, both hcs and gjs are important in the induction as well as the propagation of cell death. in this review we will focus on the actions of mmps on gjs and hcs formed by cx43, which is ubiquitously present in a large array of cells and tissues in the human body. furthermore, cx43 is the isoform that has been characterized in great detail in terms of intramolecular gating mechanisms as well as its role in inflammation at the functional level. the only paper thus far indicating that cx43 is a target for mmps, more specifically mmp-7, has documented cleavage of the intracellularly located c - terminal domain. indeed, as outlined above, mmp activity is not confined to the extracellular space and substrates are much more diverse than just matrix proteins. at present, intracellular targets such as intracellular matrix proteins, enzymes, and molecular chaperones regulating transcription and translation are well known to be part of the mmp substrate repertoire. multiple mmps, including mmp-1, mmp-2, mmp-3, mmp-7, mmp-8, mmp-9, mmp-13, mmp-26, and mt1,3-mmp, have been shown to process intracellular proteins, indicating that intracellular activity of mmps is not confined to one particular class of mmps. mmp-3 is, for example, activated in dopaminergic neurons by the apoptosis inducer bh4 and acts upstream of caspase-3, indirectly contributing to the cleavage and activation of this apoptotic mediator. high throughput degradomics has furthermore identified a myriad of intracellular matrix proteins as substrates of mmp-9, many of which are linked to different autoimmune diseases. such data indicate that mmp-9 may have an immune - regulatory function, removing toxic molecules that are released upon cell death, but also generating substrates for autoantigens. finally, intracellular activity of mmp-2 has been confirmed in fast twitch type ii muscle fibers with protease activity being dependent on physical exercise ; mmp-2 's specific role is however unknown in these cells. in platelets, intracellular activation of mmps may be achieved by intracellular proteases that separate the prodomain from the catalytic domain. the golgi - associated prohormone convertase furin, for instance, activates mmp-11 by cleavage at the arg - x - arg - x - lys - arg sequence. this recognition motif has also been identified in mt1-, mt2-, mt3-, mt4-, and mt5-mmps and in mmp-23, while the similar arg - x - x - arg and lys - x - x - arg sequences have been found in all mmps, except mmp-7 and mmp-12 [2, 3 ]. other candidate mechanisms for intracellular proteolytic processing of mmps include serine proteases, caspases, upstream intracellular mmps, and autolytic cleavage [2, 3 ]. trypsin-2 has, for instance, been shown to activate mmp-9 inside intracellular vesicles of epithelial cancer cells, thereby determining the aggressive and invasive character of these cells. reactive oxygen (ros, e.g., peroxynitrite) and nitrogen (rns) species that reassociated with oxidative stress may interact with the cys - thiol group and disrupt the interaction with zn, leading to autocatalytic activation while the full - length pro - mmp remains intact. s - nitrosylation and s - glutathionylation have been shown to activate mmp-1, mmp-2, mmp-8, and mmp-9 [2, 3, 63 ]. mmp-2, mmp-7, mmp-8, and mmp-9 activity have been furthermore shown to be dependent on ros levels with low levels activating the proteases and high levels preventing protease activity. at the same time, ros may also alter the structure and binding affinity of timps, resulting in lower affinity and dissociation from the mmps. alternatively, oxidative stress has been shown to promote activation of an alternate promoter located within the first intron of the mmp-2 gene, rendering an intracellularly active n - terminal truncated mmp-2 isoform that lacks the secretory sequence and the inhibitory prodomain region. intracellular activity of mmps may be further facilitated by alternative splicing that renders mmp proteins lacking the secretory signal peptide [2, 3, 66, 67 ]. finally, it has been proposed that intracellular activation of mmps can be achieved by proteins belonging to the sibling (small integrin - binding ligand n - linked glycoprotein) family. bsp (bone sialoprotein), osp (osteopontin), and dsp1 (dentin matrix protein 1), all upregulated in different types of cancer, may, respectively, bind and activate mmp-2, mmp-9, and mmp-3 without removing the prodomain, but by inducing conformational changes in the protease. evidence for the proteolytic processing of cx proteins by mmps is mostly derived from the heart where cx40, cx43, and cx45 are expressed in a site - specific manner with cx43 present in atrial tissue and being most prevalent in the ventricles. cx40 and cx45 are present in sa and av nodes and in atrial and ventricular tissue, respectively [69, 70 ]. in the heart, gjs mediate electrical coupling and direct cell - to - cell transfer of chemical and metabolic signals. consequently, changes of gj properties are collectively known to contribute to myocardial infarction injury and arrhythmogenesis. intravenous injection of the proinflammatory cytokine tnf increased mmp-2 levels in mouse atrial tissue which was correlated with a decrease in cx40 expression. in canine ventricular tissue, cx43 expression became progressively weaker and disordered with the duration of ventricular fibrillation. at the same time, a decline in timp-2 levels and increase in mmp-2/timp-2 ratio were observed. cardiac pressure overload in timp-2 knockout mice was associated with increased levels of mmp-9 and mmp-14, leading to a decreased expression of the endocardial cx37 as well as cx43, thereby exacerbating cardiac dysfunction. in cardiac fibroblasts, expression of both mmp-2 and mmp-9 was increased and associated with a concomitant decrease in cx43 expression after activation of endothelin receptors. finally, elevated levels of homocysteine, a sulfur - containing nonprotein amino acid and a strong inducer of oxidative stress, activated mmp-9 in mouse ventricular myocytes which led to cx43 mitochondrial translocation and degradation. a link between cx expression and mmp activation has also been described in extracardiac tissues, for example, in the retinal endothelial cells, where hyperglycemia increased mitochondrial mmp-2 activity, leading to a downregulation of cx43 as well as the induction of apoptotic cell death. treatment with mmp-2 small interfering rnas prevented the decrease in cx43 and protected against apoptosis. oppositely, in hyperglycemic kidneys, ros activated mmp-9 which was accompanied by an upregulation of cx40 and cx43. despite correlation between increased mmp expression and decreased cx expression levels, none of the papers referred to above unequivocally demonstrated a direct role of mmp proteolytic activity in regulating cx expression. have recently indicated that, in rat h9c2 cardiomyocytes, hypoxia decreased the total cx43 protein level by ~3050% in a mek / erk mapk - dependent and mmp-9-dependent manner. doxycycline is best known as a broad - spectrum antibiotic tetracycline but also acts as a broad - spectrum mmp inhibitor at subantimicrobial doses. furthermore, the most straightforward evidence for the proteolytic processing of cx43 by mmps was provided by lindsey.. in postmyocardial infarction heart sections, cx43 staining was decreased while cardiomyocyte mmp-7 levels were significantly increased. accordingly further evaluation by surface plasmon resonance (spr) protein binding studies demonstrated a direct and specific interaction between cx43 and mmp-7. importantly, decreased cx43 detection levels were observed when using an antibody targeting the last 10 c - terminal amino acids (373382), but not when using an antibody targeting amino acids (252270) that are located more upstream in the c - terminal domain. this argued in favor for the proteolytic cleavage of cx43 c - terminal amino acids, rather than an overall decrease in cx43 expression levels. in silico analysis indeed revealed two sites with sequence homology to known mmp-7 cleavage sequences within the cx43 c - terminal domain : nqnakkvaaghelqplaivd shows similarity with the mmp-7 cleavage sequence gpqaiagq ; prpddlei shows similarity with the mmp-7 cleavage sequence ppeelkfq (figure 1). we performed further in silico analysis of possible mmp cleavage sites in the human cx43 c - terminal domain using prosper (http://lightning.med.monash.edu.au/prosper/) and siteprediction (http://www.dmbr.ugent.be/prx/bioit2-public/siteprediction/). siteprediction uses known datasets available in literature to identify possible cleavage sites in a given amino acid sequence. it combines similarity scores of the candidate sequence with known cleavage sites, with frequency scores that indicate whether amino acids of the candidate sequence are likely to occur at the cleavage domain recognized by a specific protease. siteprediction allows predicting of cleavage sites of numerous proteases, including mmp-1, mmp-2, mmp-3, mmp-7, mmp-8, mmp-9, mmp-12, and mmp-13. of these, only mmp-2, mmp-7, and mmp-9 have been described in the context of altered cx43 expression / function and we therefore chose to focus only on these three mmps. siteprediction identifies numerous potential cleavage sites in the cx43 c - terminal domain that have 95% specificity (the chance that the identified site is an actual cleavage site) (table 1). analysis using prosper seems more stringent as compared to siteprediction as only one cleavage domain is identified for mmp-2 and no candidate sites for mmp-7 are recognized (table 2). like siteprediction, prosper identifies protease substrates and their cleavage sites, using info available in the peptidase database merops. it furthermore combines a number of complementary sequence and structural features, including local amino acid sequence profile, predicted secondary structure, solvent accessibility, and natively disordered region, as well as some global sequence features, for predicting cleavage sites of protease substrates. the resulting probability score (that describes the quantitative cleavage probability for each cleavage site) contains a confidence in the prediction and only cleavage sites with a predicted cleavage probability score greater than 0.8. only mmp-2, mmp-7, mmp-9, and mmp-3 are available in prosper and we again focused on mmp-2, mmp-7, and mmp-9 for identifying potential cleavage sites in the cx43 protein. figure 1 summarizes the potential target sites of mmp-2, mmp-7, and mmp-9 in the cx43 c - terminal domain as identified by prosper and siteprediction. we stress, however, that in silico analysis is predictive and requires further experimental validation. for instance, although an interaction between cx43 and mmp-7 has been confirmed by spr, prosper did not identify mmp-7 as a protease that cleaves cx43. siteprediction does, but the identified domains do not correspond with those described by lindsey.. in addition, one of the sites identified in (figure 1, indicated by) has an average score of 0.005 and a specificity far below 95% in siteprediction. oppositely, both prosper and siteprediction identified mmp-2 as a potential candidate, but mmp-2 failed to bind cx43 in spr studies. based on the data presented by lindsey. and those obtained with in silico analysis demonstrating cleavage of the c - terminal domain, a careful reevaluation of previous studies reporting cx43 downregulation should perhaps be considered. indeed, most commercially available antibodies against cx43 target the c - terminal domain, but unfortunately, epitopes are not always mentioned in studies claiming cx43 downregulation. cx43 is by far best characterized in terms of the role of its c - terminal domain in modulating channel function. this domain comprises amino acids 232382 and is the primary interaction domain of cx - associated partner proteins like zo-1, tubulin, microtubules, and caveolins that may regulate protein trafficking and function [8183 ]. additionally, it is the prime target for posttranslational modifications such as s - nitrosylation and phosphorylation. under both basal and stimulated conditions, cx channel activity appears to be regulated by ongoing phosphorylation - dephosphorylation events. however, much of the details on how cx phosphorylation can determine the activity state of hcs and gjs still remains to be resolved. interestingly, certain kinases, including ph - dependent kinases, act on the cx43 c - terminal domain, a molecular hotspot for the control of gj and hc activity. phosphorylation of the ct tail may add negative charges at this site, potentiating an interaction between the ct and the second half of the cytoplasmic loop (cl), termed the l2 region (aas 119144). as such, the l2 region, which contains a stretch of positively charged aas, serves as a receptor domain for the ct [87, 88 ]. this intramolecular ct - cl interaction has been proposed to act as a ball - and - chain mechanism mediating the closure of gj channels, for instance, during voltage gating and chemical gating of gj channels by intracellular acidification [8995 ] (figure 2(a)). the ct - cl interaction is expected to induce a change in channel conformation that brings the gjs in a closed state. strikingly, for cx43hcs, such ct - cl interaction is essential for hc opening. this was suggested for the first time in studies investigating the bimodal response of cx43hcs to an increase in [ca]i. a moderate increase in [ca]i up to 500 nm strongly promotes cx43hc opening while this effect disappears with larger [ca]i elevations to the micromolar level that tend to close the hcs [9799 ]. mechanistically, ca - activation of cx43hcs is mediated by calmodulin - dependent signaling and is dependent on a ct - cl interaction that brings the hcs in the available to open state (figure 2(b)). importantly, ct - cl interaction is a necessary condition for hc opening, but the actual opening is triggered by membrane depolarization or moderate (< 500 nm) elevation of [ca]i. hc closure at above 500 nm [ca]i is mediated by cytoskeletal contractions that pull the c - terminal domain away from the cl [96, 101 ] (figure 2(b)). the latter system acts as a brake on hc opening and is operational under physiological conditions presumably to prevent the detrimental effect of uncontrolled opening of this large conductance channel. the dependence of cx43hc opening on a ct - cl interaction stands in stark contrast to the fact that such interaction results in closure of gjs. at the molecular level, it is still uncertain why and how gjs and hcs are differentially modulated by a ct - cl interaction. nonjunctional hcs (closed) may adopt different conformations as compared to those incorporated into gjs (open). interactions between subunits during docking of two hcs may indeed result in conformational changes of the cx protein, thereby altering gating properties. another element that may contribute is the fact that hcs and gj channels are differentially located in different plasma membrane domains with different properties such as lipid rafts. like most transmembrane proteins, cxs are cotranslationally integrated into the rough endoplasmic reticulum (er) membrane where they adopt their native transmembrane configuration [103, 104 ]. the subsequent oligomerization of cx proteins into hcs starts in the er, progressing to the trans - golgi network [103, 104 ]. after leaving the er - golgi intermediate compartment, cxs then transit through the cis- and trans - golgi network before being shuttled to the pm [56, 105 ]. some data indicate that cx43 is transiently phosphorylated early in the secretory pathway, suggesting that the ct is exposed and available for interaction with modifying proteins during transit from the er to the golgi network and plasma membrane. thus, in principle, intracellular cleavage of the cx43 c - terminal domain may not only occur in plasma membrane cx43 channels, but also in channels that are en route to the plasma membrane. work with ct - truncated cx43 mutants has repetitively shown that ct - truncated proteins are present at the plasma membrane of mammalian cells [93, 107109 ]. consequently, also following mmp cleavage, channels harboring truncated cx43 will be present at the plasma membrane. note though that in vivo data describing the trafficking behavior of disease - associated cx43 mutations giving rise to preliminary ct - truncated cx43 indicates that these truncated proteins are not inserted in the plasma membrane [110113 ]. this has been confirmed by dye coupling studies for cx43 and cx43 mutants. dual patch clamp studies have revealed similar results at the macroscopic level for cx43 and cx43. yet, single channel analysis of the latter revealed that mean open time was prolonged and transitions to intermediate, residual open states were lost. gjs formed by truncated cx43 were furthermore found to be resistant to closure upon intracellular acidosis. opposite to gjs, hcs containing ct - truncated cx43 become refractive to activation in response to membrane depolarization and increased [ca]i (cx43) or by omission of extracellular ca form the culture medium (cx43), most likely because the ct - cl interaction that is necessary for hc opening is lost. opposite results exist for hcs formed of truncated cx43 (cx43) that still open in zero ca conditions. as the mechanism of cx43hc opening by depletion of extracellular ca conditions remains to be fully elucidated, it is uncertain whether the short, remaining ct stretch in the cx43 versus the cx43 can be responsible for this differential outcome. c - terminal cx43 cleavage by mmps not only results in a truncated protein with compromised ct - cl interaction capabilities but also renders small, free endogenous c - terminal peptides that have potential to alter channel function in their own right. this is exemplified by application of exogenous peptides that mimic the last 9 amino acids of the cx43 protein (rprpddlei). act1, developed by gourdie and coworkers, is an example of such a peptide that is n - terminally linked to an antennapedia cell - penetrating peptide. act1 interferes with the binding of zo-1 to the c - terminal domain, thereby sequestering undocked cx43 connexons into gjs, enhancing gj aggregation and potentiating gjic, without stimulating cx43 expression [118, 119 ]. act1 is currently under investigation as a novel therapeutic in wound healing [120123 ] and may also be applicable as an antiarrhythmogenic compound as well as a tumor suppressor. the act1 peptide was only found effective as a hc inhibitor in confluent cell monolayers, but not in semiconfluent cells. it was therefore hypothesized that act1 inhibits hcs only because more hcs are incorporated into gj channels. in this collaborative work, we used the very same c - terminal peptide (rprpddlei) but linked to the tat translocation sequence (derived from the hiv-1 virus), to investigate hc gating by [ca]i changes in subconfluent cell cultures. here, addition of the tat - ct peptide prevented hc closure at high [ca]i by binding to the cl, thereby mimicking the endogenous ct - cl interaction. exogenously added tat - ct peptide is thus able to substitute for the endogenous ct sequence. in line with this, tat - ct restored hc activity of c - terminally truncated cx43 (cx43), while not affecting hc activation by modest (< 500 nm) [ca]i. the lack of tat - ct effect on closed cx43hc in resting conditions points to a scenario whereby ct - cl interaction is a necessary condition for hc opening triggered by stimuli such as strong membrane depolarization or moderate (< 500 nm) [ca]i elevation. some additional activation steps may be necessary that first expose the cl domain for subsequent binding of the ct. in this context, zo-1 did not seem to play a role in the modulation of hc function by tat - ct since a tat - ct version lacking the last isoleucine residue, essential for interaction with zo-1, was fully capable of alleviating closure by high [ca]i and of restoring the activity of cx43 hcs. this was later confirmed in cx43 adult hearts where cx43 and zo-1 still normally colocalized at the intercalated disk despite the absence of the 5 last c - terminal amino acids. as a consequence of these considerations, the peptide resulting from cleavage of the cx43 c - terminal domain at prpddlei as has been described for mmp-7 and suggested for mmp-9 (figure 1), may thus prevent pathological closure of gjs while promoting hc opening at high [ca]i. on a longer time scale (hours / days), hc opening may be dampened as suggested by the work with act1 peptide. finally, forced expression of cx43 c - terminal fragments has additionally revealed their translocation to the nucleus where they act to inhibit cell growth and abrogate differentiation [126129 ]. intriguingly, endogenous, cytoplasmic c - terminal fragments of cx43, about 20 kda in size have been observed in cultured murine and hamster cells and tumor cells and in cardiac cells subjected to ischemia [130134 ]. these naturally occurring fragments have been suggested to result from internal translation of the gja1 gene transcript since their occurrence could not be prevented by the mmp protease inhibitor egta - complete(r) and the serine protease inhibitor phenylmethylsulfonyl fluoride (pmsf). however, it looks less convincing that addition of protease inhibitors in the lysis buffer would prevent the occurrence of previously mmp - cleaved fragments in the lysate. in another paper, cleavage was excluded as a possible source of these fragments because detection with an n - terminal cx43 antibody could only reveal full - length protein but not truncated cx43. obviously, posttranscriptional control of cx43 expression at the mrna level may explain some of these results but we propose to carefully consider the alternative option of cleavage by proteases. indeed, in most cases, these c - terminal 20 kda fragments mainly remain at the observational level and their origin is not discussed. particularly in conditions known to induce mmp activity such as ischemia some evidence comes from the cardiac system [48, 135, 136 ] but most evidence derives from the central nervous system where increased cx43 expression has been observed following stroke, epilepsy, optic nerve damage, spinal cord injury, amyloid plaque formation, and ms and where cx43hc opening leads to increased damage via the inflammatory response [47, 52, 137144 ]. cx43hc opening in inflammatory conditions is known to be mediated by advanced glycation end - products (ages), oxidative stress [84, 145 ], and proinflammatory cytokines [146, 147 ]. were the first to show that exposure of cultured astrocytes to (microglia - derived) proinflammatory cytokines such as il1 and tnf stimulated cx43hc opening. this was mediated by the activation of p38 mapk and increase in nos activity and no production. acute opening of astroglial cx43hcs by il1/ was later confirmed using live brain slices from mice harboring s. aureus induced abscesses. upon opening, cx43hcs form a well - known pathway for the release of atp which is driven by a large concentration gradient between the intra- and extracellular compartment [34, 149, 150 ]. this purinergic messenger is a crucial factor in establishing a chemotactic signal for infiltrating polymorphonuclear neutrophils [151154 ]. modulation of cx43hcs and inhibition of atp release indeed correlate with reduced tissue invasion of neutrophils. neutrophils on their part also release atp by means of cx43hcs, further contributing to the progression of the inflammatory response [156, 157 ]. in addition, cx43hc - mediated atp release can actively contribute to the activation of the nlrp3 inflammasome, a protein complex that serves to sense pathogen- and danger - associated molecular patterns and is involved in il1 and il18 processing. using the endothelial cell line b.end5, robertson and coworkers have furthermore indicated that atp release induces the expression of toll - like receptor-2 (tlr2) and production of il6 upon infection with s. epidermidis. in turn, tlr2 activation gave rise to a further upregulation of cx43 expression, albeit it had no impact on actual cx43hc opening. not only atp but also other active compounds released by hcs might contribute to progression of inflammation. for instance, inhibition of glutamate release from activated microglia has proven beneficial in the outcome of spinal cord injury, reducing glial scar formation and increasing expression of growth factors., cx43 expression was upregulated in spinal cord astrocytes following chronic constriction injury and subsequent cx43hc opening led to the release of the chemokine cxcl1. in short intriguingly, all of the above - mentioned pathological conditions (stroke, epilepsy, bacterial infection, etc.) in which cx43hcs contribute to inflammation are also associated with increased mmp activity [23, 161166 ]. in the following paragraphs we set out a hypothesis of how proteolytic cleavage of mmps can contribute to inflammation. interestingly, knockout of the mmps that have been associated with reduced cx43 expression / function (i.e., mmp-2, mmp-7, and mmp-9) leads to altered chemotaxis, attenuated leukocyte influx, and reduced cell death [8, 167173 ]. however, an equal amount of papers describes impaired repair, increased leukocyte load, and an aggravated inflammatory response upon knockout of these mmps [13, 174176 ]. as described above, an important feature of the mmps is their minor latency of activation, with oxidative stress and/or expression of proinflammatory cytokines generally preceding mmp activity. interestingly, activation of cx43hcs by the proinflammatory cytokines tnf, il1, and ifn requires exposure times in the order of 9 h, 24 h, and 48 h. these very slow actions may well reflect the involvement of mmps. additionally, mmp expression and activity depend on an increase of [ca]i triggered by proinflammatory cytokines. this [ca]i increase will also activate cx43hc opening when hcs are in the available to open state. subsequent mmp - cleavage in the ct will generate a c - terminal peptide that is bound to the cl (figure 2(b)). the consequent effect of proteolytic cleavage on hc function may depend on the position of the mmp cleavage site relative to the yet unidentified cx43-actomyosin interaction domain(s) in the cx43 c - terminal tail that mediates high [ca]i - induced hc closure (high [ca]i brake). when cleavage occurs at a site that is situated c - terminally from the cx43-actomyosin interaction domain, it is expected that the c - terminal peptide can not be removed from the cl by cytoskeletal / actomyosin contractions (see section 3.3). thus, hcs remain in the available to open state (with effective opening triggered by membrane depolarization or [ca]i increase), but the high [ca]i brake disappears, thereby promoting hc opening in cells with pathologically high [ca]i (figure 2(b)). alternatively, when cleavage takes place at a site that lies upstream at the n - terminal side of the actomyosin linkage domain, the outcome is less clear. theoretically, it is possible that cytoskeletal contractions remove the c - terminal peptide from the cl ; however, multiple amino acid domains in the ct may participate in the ct - cl interaction. indeed, cx43 c - terminal amino acid domains 281295, 299304, 341327, 342348, and 360382 have all been shown to engage in the intramolecular interactions necessary for ball - and - chain gj channel gating [180, 181 ]. for cx43hcs, at present, only the last 10 amino acids have been described to contribute to the ct - cl interaction necessary for promoting hc opening. however, as for gjs, it is to be expected that more upstream domains also participate in this intramolecular interaction. identification of the actomyosin interaction site in the cx43 c - terminal domain will allow us to further define the effects of mmp cleavage upstream (n - terminally) of the actomyosin linkage domain on hc function. for gj channels, various proteins have been suggested to function as a linker between the cytoskeleton and the cx43 c - terminal tail, including drebrin, cortactin, ezrin, src, cip85, ccn3, and zo-1 [100, 188, 189 ]. for hcs, the latter can be excluded as the intermediate between the cytoskeleton and the cx43 c - terminal domain ; however, whether the other candidate proteins, mentioned in the context of gjs, also interact with cx43hcs remains to be confirmed. oxidative stress, that is tightly linked to the intracellular ca household and to fast, intracellular mmp activation, has also been shown to promote cx43hc opening within a time frame of several minutes [84, 191 ]. as described above, mmp cleavage may in this case further promote hc opening mediated by a loss of their high [ca]i brake. interestingly, cx43hcs themselves may subsequently act as an entry channel for ros that may further activate mmps and hc through a positive feedback loop. increased opening of cx43hcs following proteolytic processing by mmps would give rise to exaggerated atp release and leukocyte infiltration, altogether aggravating the inflammatory response. additionally, persistent loss of atp and nutrients would also result in cellular energy deprivation and ultimately cell death. furthermore, in the brain, elevated levels of glutamate in the cerebral interstitial fluid are known to be excitotoxic and so hc glutamate release by microglial cells would give rise to neurodegeneration. although hc opening in inflammatory conditions is generally considered deleterious for the cell, a few reports indicate that hc opening may act protective, for example, by releasing signaling molecules that activate src and erk - mediated survival signals or by releasing prostaglandin e2 that protects against apoptosis [192194 ]. opposite to hcs, generally taken, gjic is reduced in inflammatory conditions, as shown for proinflammatory cytokines, atp, and oxidative stress [146, 195200 ]. such uncoupling has dual effects on the inflamed tissue ; on the one hand, it may act as a protective mechanism that encapsulates the injured cells and functionally separates them from the surrounding healthy tissue. however, at the same time, uncoupling also impedes the supply of energy and nutrients that are necessary for tissue repair processes. notably, contrasting reports that describe persisting functional gjic in inflammation are available as well [159, 201, 202 ]. gjs have, for instance, been shown to propagate oxidative stress and bystander cell death [32, 203 ]. additionally, coupled cells are able to share antigens with and trigger a response in cytotoxic t - lymphocytes. finally, gjs have been suggested to mediate the propagation of nfb and mapk activation from infected to noninfected cells, leading to il8 production, also by the latter. have indicated that the degree of gjic inhibition is dependent on the distance to the lesion site and that coupling gradually increases with expanding distance from the lesion site. despite the upregulation of cx43 expression, uncoupling was observed at the third day after infection and persisted up to the 7th day, indicating a long lasting effect. the mechanisms that mediate such persistent block of gjic without affecting expression levels are currently unknown. given the double role of gjic, the differential outcome of uncoupling in inflammation, and uncertainties regarding the detailed mechanisms of uncoupling, it is very difficult to speculate on the functional outcome of proteolytic cleavage mediated by mmps in terms of gjic and its impact on inflammation. finally, ct truncation not only should be considered relevant in view of intramolecular gating mechanisms and single channel function but is also of utmost importance at the level of protein - protein interactions. as mentioned above, the cx43 c - terminal domain contains interaction sites for, for example, zo-1, occludin, claudin, tubulin, and the protooncogene src [205, 206 ]. deletion of the last 5 amino acids has no functional effects of the level of gjic but nevertheless induces arrhythmogenesis due to aberrant, channel independent interactions of cx43 with sodium and potassium channels. the purinergic receptor p2y1 is another example protein believed to interact with the c - terminal domain of cx43 and its expression is reduced in cx43 knockout animals [207, 208 ]. via their interaction with proteins that contribute to tight and adherens junctions (e.g., zo-1 and occludin), cxs stabilize the junctional complex that is situated between epithelial and endothelial cells and impedes paracellular diffusion [209212 ]. a reduction in cx43 expression is often accompanied by a downregulation of the junctional proteins leading to compromised intercellular junctions. importantly, destabilization of the junctions abrogates the barrier function of epithelial and endothelial cells and therefore facilitates the paracellular movement of leukocytes into the inflamed tissue. on the other hand, exposure of astrocytes to il1 leads to a concomitant downregulation of cx43 and upregulation of the tight junctional protein claudin-1. it is believed that the latter brings astrocytes closer together, reducing the extracellular space volume and forcing inflammatory molecules to move in a particular direction. notably, connexin protein interactions with junctional proteins also stabilize the gj plaques [213, 214 ]. in addition, many of the cx43 interaction partners, including zo-1 and occludin, are also mmp substrates and their proteolytic cleavage is expected to induce gj uncoupling. yet, such matter is ought to be addressed in future studies. via their remodeling of ecm and intercellular junctions as well as by their proteolytic processing of cytokines, chemokines, and growth factors, mmps importantly contribute to inflammation, a process in which they are known to have beneficial as well as detrimental functions. in this paper we specifically describe the regulation of cx43 expression and channel function by the intracellular action of mmps. cx43 is the most prevalent building block of gjs and hcs, two types of channels intricately involved in tissue homeostasis as well as in acute inflammation. a handful of reports describe a link between altered expression of cx43 on the one hand and elevated levels of mmp activation on the other. in silico analysis additionally demonstrates that mmps are capable of mediating cleavage of the cx43 c - terminal domain which is an important determinant of hc and gj channel function. such cleavage has also been directly demonstrated in cardiac tissue where it contributes to tissue damage following myocardial infarction. unfortunately, until now, no studies have been performed that unequivocally demonstrate the direct impact of mmps on channel function at the mechanistic level. we here explain the possible effects of c - terminal cleavage on cx43 channel function, using available information that comes from work with cx43 truncated mutants and studies with exogenous c - terminal peptides as a basis. however, in inflammatory conditions where the oligomerized cx43 protein is cleaved in the plasma membrane instead of being exogenously expressed as a truncated mutant, the underlying mechanisms may be very different. in addition, much like mmps, the contribution of gjs and hcs to the inflammatory process seems very diverse with inhibition of the channels resulting in a positive as well as a negative outcome, depending on the tissue, the trigger, and the timing. therefore, future challenges will be to better understand the role of mmps and cx43 channels in inflammation and to gain detailed insight in the nature of mmp - cx interactions as well as in the effects on channel function before gearing up to the therapeutic level. | the coordination of tissue function is mediated by gap junctions (gjs) that enable direct cell - cell transfer of metabolic and electric signals. gjs are formed by connexin (cx) proteins of which cx43 is most widespread in the human body. beyond its role in direct intercellular communication, cx43 also forms nonjunctional hemichannels (hcs) in the plasma membrane that mediate the release of paracrine signaling molecules in the extracellular environment. both hc and gj channel function are regulated by protein - protein interactions and posttranslational modifications that predominantly take place in the c - terminal domain of cx43. matrix metalloproteases (mmps) are a major group of zinc - dependent proteases, known to regulate not only extracellular matrix remodeling, but also processing of intracellular proteins. together with cx43 channels, both gjs and hcs, mmps contribute to acute inflammation and a small number of studies reports on an mmp - cx43 link. here, we build further on these reports and present a novel hypothesis that describes proteolytic cleavage of the cx43 c - terminal domain by mmps and explores possibilities of how such cleavage events may affect cx43 channel function. finally, we set out how aberrant channel function resulting from cleavage can contribute to the acute inflammatory response during tissue injury. |
neuroimmune interactions are increasingly appreciated as both an important regulator of normal brain development and function and a potential contributor to the pathophysiology of a range of neuropsychiatric illnesses. in particular, there is accumulating evidence that immune dysregulation can contribute to obsessive - compulsive disorder (ocd) and tourette syndrome, at least in a subset of cases [1, 2 ]. ocd is characterized by unreasonable or excessive thoughts and fears (obsessions) and/or repetitive behaviors (compulsions). tourette syndrome, which is frequently comorbid with ocd, is characterized by tics : repetitive, stereotyped, involuntary movements and vocalizations [4, 5 ]. both ocd and tourette syndrome are accompanied by pathological changes in the corticobasal ganglia circuitry, especially in the striatum [6, 7 ]. a role for dysregulated immune function is particularly clear in the syndrome known as pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections, or pandas. pandas is characterized by the sudden onset of ocd and/or tic symptoms in childhood, following a streptococcal infection [9, 10 ]. the symptoms are usually dramatic and can include motor and vocal tics, obsessions, and compulsions. it has been hypothesized that pandas arises from the development of brain - reactive autoantibodies after infection with group a streptococcus. here we review the evidence for an immunological etiology for ocd, tourette syndrome, and related conditions. we focus on one particular component of the immune system : microglia, the brain - resident immune cells. these enigmatic cells have recently emerged as potential key players in the pathophysiology of neuropsychiatric disorders. their activation in neurological disease has classically been associated with inflammation, neuronal damage, and neurodegeneration. however, over the past decade, novel roles for microglia in brain development, homeostasis, and plasticity have emerged. a groundbreaking study demonstrated that microglia can engulf synapsis during normal postnatal development in mice. synaptic pruning by microglia is necessary for the formation of brain circuitry and normal connectivity. disruption of neuron - microglia interactions, through disruption of the fractalkine / fractalkine receptor signaling pathway, results in a range of neural and behavioral abnormalities. microglia cells are also necessary for adult neurogenesis and provide support for neuronal survival. more recently, in keeping with our growing understanding of their roles in modulation of normal brain function, research has focused on neuropsychiatric conditions that are not characterized by frank neuronal death. microglial contributions to pathophysiology in these disorders may be subtle and may relate to their noninflammatory functions. as new functions of microglia in normal brain development and function are discovered, and disruption of these functions in disease is characterized, new therapeutic strategies will emerge. a number of animal models have been described in recent years in which the primary behavioral pathology is a maladaptive excess of repetitive behaviors, most commonly grooming. these have often been interpreted as modeling ocd [1921 ], but repetitive grooming has also been described in models of tourette syndrome, autism, rett syndrome, trichotillomania, and other conditions. we first review several models in which the precise disease correlate is less firmly established but the association between microglial abnormalities in the corticostriatal circuitry is particularly striking. animal studies with clearer etiopathogenic links to particular diseases are reviewed subsequently, together with the relevant clinical literature. an early study reported that knockout of the hoxb8 gene produces compulsive grooming, progressing to hair removal and ultimately to skin lesions. hoxb8 expression in the brain is restricted to microglia (identified in these experiments by their expression of the cell - surface marker cd11b). strikingly, abnormal behavior in hoxb8 knockouts (kos) is rescued by transplantation of normal bone marrow, which repopulates the brain with wild - type microglia. conversely, excessive grooming is produced by transplantation of bone marrow from hoxb8 ko mice into wild - type animals. interestingly, not all cd11b cells in the brain express hoxb8, which suggests that hoxb8 cells might be a subpopulation of microglia, constituting approximately 40% of total microglial cells. however, the total number of microglia cells in the brain of hoxb8 mutant mice is reduced by only 15%. first, the hoxb8 subpopulation may be necessary for maintaining normal brain function, and loss of these cells in the ko animals may produce pathological grooming. second, the population of hoxb8-negative microglia may expand in the knockout animals, which may lead to functional abnormalities. in progranulin deficient (grn) mice, microglial activation leads to both excessive grooming and neurodegeneration. this led to the suggestion that their repetitive behavior could be more related to classic inflammatory microglial activation and neuronal damage, rather than the loss of a neuroprotective or neuromodulatory function. notably, autosomal dominant mutations in the human grn gene contribute to a common form of familial frontotemporal lobar degeneration [27, 28 ]. no association of grn mutations with ocd, tourette syndrome, or related conditions has been described. cd11b cells in the brain are all of monocyte lineage, but they can be either resident brain microglia or peripherally derived monocytes. although both resident microglia and peripherally derived monocytes express the cx3cr1 [29, 30 ], only the latter express ccr2, providing a powerful marker to discriminate between resident microglia and infiltrating monocyte in the brain. cx3cr1 microglia are widely distributed through the brain parenchyma, while ccr2 monocytes are rarely seen in the healthy brain. interestingly, microglia and monocytes play differential roles in neurodegeneration and brain injury [3133 ]. distinguishing between these two populations may therefore prove to be quite important in understanding how microglial abnormalities can lead to repetitive behavioral pathology. in hoxb8 ko mice, the fact that abnormal behavior is rescued by transplanting in wild - type bone marrow indicates that hoxb8 cells derived from circulating monocytes can enter the brain and have behavioral effects. this is consistent with evidence indicating that hoxb8 regulates monocyte / macrophage differentiation from hematopoietic precursors [3436 ]. on the other hand, another recent paper showed that mice lacking cx3cr1, which is expressed by brain - resident microglia, show excessive grooming, along with other behavioral abnormalities that were interpreted as representing an autism - spectrum disorder - like phenotype. considerable evidence suggests that immune dysregulation may contribute to the pathophysiology tourette syndrome [37, 38 ]. however, two recent studies, using different methodologies, have suggested abnormalities in microglial activation in patients with tourette syndrome. both studies focused on the basal ganglia. in a recent postmortem analysis of brains from tourette syndrome cases, lennington. described increased number of cd45 microglial cells in the striatum. these cells had morphological changes consistent with neurotoxic activation, concomitant with enriched expression of inflammatory genes [39, 40 ]. importantly, the brain samples were obtained from refractory adult patients ; no comparable postmortem data exist for more typical pediatric and/or fluctuating disease. a second recent study used in vivo positron emission tomography (pet) imaging with () c-[r]-pk11195 (pk), a ligand that binds to the transporter protein (tspo), which is expressed by activated microglia. increased pk binding, indicative of inflammatory microglial activation, was observed in the caudate nuclei bilaterally in children with tourette syndrome. an important caveat is that children with tourette syndrome were compared to adult healthy controls (mean age 11.4 years versus mean age 28.7 years). nevertheless, as the first study to image microglial activation in vivo in tourette syndrome, this is an important advance. work in animal models of tic disorders may help to elucidate the role of microglia in their pathophysiology. until recently, there have been no animal models of tourette syndrome with clear links to its etiopathophysiology in which to do such work. recent work has identified a hypomorphic mutation in l - histidine decarboxylase (hdc), which encodes the rate - limiting enzyme in the biosynthesis of histamine, as a rare but high - penetrance genetic cause of tourette syndrome. knockout of the hdc gene, which recapitulates this molecular abnormality, thus produces an animal model with strong etiologic validity. these mice exhibit behavioral and neurochemical abnormalities seen in patients with tourette syndrome, further confirming the validity of the model [44, 45 ]. we found that microglia cells are not activated in basal conditions in the striatum in hdc - ko mice ; rather, microglia from this mice exhibit reduced arborization and normal expression of inflammatory markers. a similar effect is seen when neuronally derived histamine is specifically disrupted, through targeted virus - mediated ablation of histaminergic neurons in the posterior hypothalamus. the total number of microglia is unchanged in ko animals, but the number of microglia expressing insulin - like growth factor 1 (igf-1) is reduced. igf-1 expressing microglia are necessary for neuronal survival and promote neurogenesis in nonpathological conditions [16, 17 ] ; a specific reduction of these cells suggests impairment in these functions. inflammatory challenge with bacterial lipopolysaccharide (lps) dramatically changed this pattern : microglia activation in the striatum was enhanced in hdc - ko mice, compared with wild - type controls. this was accompanied by enhanced induction of the proinflammatory cytokines il-1 and tnf-. taken together, these findings suggest that in this mouse model of tourette syndrome there is a deficit in microglia - mediated neuroprotection, accompanied by overreactivity to environmental challenge. such complex mechanisms can not be appreciated in human studies and reinforce the importance of work in animal models to clarify the mechanisms of microglial dysregulation in neuropsychiatric disease. the normal number of microglia in the hdc - ko model and their reduced arborization at baseline contrast with the more numerous and activated microglia seen postmortem. it is possible that the activation of microglia observed in patients with tourette syndrome emerges only after challenge by environmental factors, such as infection, or over the course of aging. our studies in mice [44, 46 ] are performed in a pathogen - free environment, in young adult mice. after lps challenge, microglia activation in the animal model much more closely resembles that seen postmortem in humans. regardless of this consideration, all the studies point to activation of microglia in the basal ganglia in tourette syndrome [39, 41, 46 ], irrespective of the complexity of the underlying mechanisms., however, this evidence is much weaker than in the case of tourette syndrome, except in the case of pandas, to which we return below. more particularly, the role of microglia cells in ocd has not been clearly elucidated. the hoxb8 knockout mouse, described above [19, 25 ], has been described as a mouse model of ocd and may thus implicate microglial dysregulation in the disorder ; however, clear clinical data linking abnormalities in the hoxb8 gene, or the consequences of its disruption, to ocd has yet to emerge. to date, there are no imaging or postmortem studies describing microglia abnormalities in patients with ocd. obsessive - compulsive disorder (ocd) and tourette syndrome often strike in childhood. in a subset of cases, acute onset temporally coincides with a bout of infectious disease, particularly with streptococcus ; this clinical syndrome is known as pandas, or more generally pediatric acute - onset neuropsychiatric syndrome (pans). by analogy with the better - understood pathophysiology of rheumatic fever and sydenham 's chorea, ocd and tourette syndrome symptoms in these cases have been hypothesized to arise from the development of autoantibodies that cross - react with proteins normally expressed in the brain ; this mechanism is known as molecular mimicry. while many details of pandas as a clinical entity remain unclear, and some are controversial, the association of immune dysregulation with ocd and tourette syndrome symptoms in this subset of pediatric patients is increasingly clear. the tspo / pk pet imaging study of microglial activation described above examined both noninfectious tourette syndrome and pandas. children with pandas had increased pk binding in the striatum with respect to adult healthy controls ; this corresponds with increased striatal volumes previously described during acute illness in pandas patients [48, 49 ]. inflammation was higher and more broadly spread through the bilateral caudate and lentiform nucleus in pandas than in non - pandas tourette syndrome. importantly, this comparison with age - matched patients avoids the interpretive difficulties created by comparison to an adult healthy control group ; the observed differences support the notion that pandas is etiologically distinct from non - pandas tourette syndrome. a recent study in mice examined the effects of intranasal group a streptococcal (gas) infection and may begin to shed light on the role of microglia in pandas. repeated intranasal gas inoculations result in increasing the number of cd68/iba1 activated microglia in the glomerular layer of the olfactory bulb. abnormal synaptic pruning, probably mediated by microglia, was also observed (see below). the majority of activated microglia were found in close proximity to cd4 t cells, suggesting that gas antigens could be presented to th17 cells by local microglia. the role of microglia in neurodegenerative diseases has been understood in terms of classic, inflammatory activation, which may be both a consequence and a cause of neuronal damage. in ocd and tourette syndrome, which are not characterized by frank neural degeneration, the nature of any contribution of microglial dysregulation to pathophysiology is much less clear. nave hdc - ko mice display morphological abnormalities in striatal microglia that suggest quiescence, normal expression of inflammatory markers, but a reduced number of igf-1 expressing microglia. igf-1 expression by microglia is induced by th2 cytokines such as il-4, which induce a neuroprotective phenotype, at least in organotypic hippocampal cultures. in vivo, igf-1 expressing microglia support cortical neurons during development and promote neurogenesis in the adulthood [16, 17, 52 ]. igf-1 thus, deficiency of igf-1 microglia in this animal model of tourette syndrome might lead to impaired neuroprotection and, consequently, to enhanced susceptibility to neuroinflammation after an environmental challenge (figure 1). consistent with this, lps challenge triggers an exaggerated response in hdc - ko mice, both at the level of morphological activation and the production of the inflammatory cytokine il-1 (figure 1). more generally, these results suggest that, in some neuropsychiatric disorders in which no marked neurodegeneration occurs, microglial dysregulation may constitute a failure of neuroprotective functions, which may create a vulnerability to neuroinflammation. this mechanism may explain observations in other animal studies, in which loss of microglia - specific genes triggers abnormal grooming behavior [15, 25 ]. for example, cx3cr1 is a key molecule for neuron - glia communication and has a role in neuroprotection [5557 ], which supports the interpretation that knocking it out disrupts neuroprotective or regulatory functions of microglia (figure 1). in postmortem tourette 's samples, loss of certain types of interneurons has been reported in the basal ganglia [39, 58, 59 ]. we have found reduced igf-1 expressing microglia in the striatum in the hdc - ko model of tourette syndrome pathophysiology. these igf-1 microglial cells are required for neuronal support during postnatal development, at least in the cortex [16, 17, 52 ]. although these phenomena have not been linked, it is plausible that impaired igf-1 microglial function in the maintenance of striatal neurons might be causative of neuronal loss observed in tourette syndrome (figure 2). hdc - ko mice have not been reported to develop spontaneous reduction of striatal interneurons ; however, this might happen in aging mice or young mice subjected to immune challenge. in fact, hdc - ko microglia are more susceptible to lps - induced activation than wild - type microglia. recent studies have described a key role for microglia in synaptic pruning during development, with long lasting consequences in adulthood [13, 14 ]. cx3cr1 knockout mice exhibit deficient synaptic pruning, excessive grooming, and social deficits. whether this function is altered in ocd, progranulin ko mice, on the other hand, have abnormal microglial activation and increased synaptic pruning, which results in elimination of inhibitory synapses in the ventral thalamus (figure 2), hyperexcitability in the thalamocortical circuits, and repetitive behavioral pathology. as mentioned above, there is limited but promising evidence from animal studies that synaptic pruning might be altered in pandas. using an animal model of intranasal gas infection, dileepan and coworkers observed microglial activation and loss of vglut2, a marker of excitatory synapses. these results raise the possibility that synaptic pruning of excitatory connections may be increased in pandas (figure 2). their contact instances with neuronal synapses are reduced in frequency by reductions in neuronal activity [61, 62 ]. in the aging retina, for example this may lead to impairments in their surveillance ability [63, 64 ]. in the hdc - ko mouse, it is possible that microglial abnormalities in this animal model lead to alterations of synaptic pruning. preliminary results suggest that hdc - ko animals may have cx3cr1 deficiencies (frick. cx3cr1 deficiency produces altered microglial morphology, similar to what is seen in hdc - ko mice. investigation of synaptic pruning in hdc - ko mice, and other mouse models of tourette syndrome, is warranted. such interactions have, however, been described in rett syndrome, an autism - spectrum disorder characterized by mutation of the methyl - cpg - binding protein-2 gene (mecp2). mecp - null microglia release dramatically higher levels of glutamate, and microglia - derived glutamate has neurotoxic effects on dendrites and synapses. it is plausible that microglia - derived glutamate might similarly contribute to the pathophysiology of ocd (figure 2). whether microglial abnormalities in ocd and tourette syndrome, or in any of the animal models described above, are associated with glutamate dysregulation is an important area for future study. while evidence for microglial dysregulation in ocd, tourette syndrome, and pandas is growing, much remains unclear. the case for microglial dysregulation is strongest in the case of tourette syndrome ; recent postmortem and pet imaging studies have produced convergent evidence for increased microglial activation in the striatum in patients [4042 ]. this is complemented by our studies in the hdc - ko mouse model of tourette syndrome. we have proposed that these mice capture a pathophysiologically important gene x environment interaction, in which deficiency in microglia - mediated neuroprotection produces a susceptibility to inflammatory changes upon environmental challenge. this hypothesis needs to be explored in other well - validated models and in clinical contexts to test its generality. mechanisms by which microglial abnormalities contribute to disease are likely to be shared across distinct etiologies and traditional diagnoses. for instance, abnormal synaptic pruning was observed both in animals inoculated with gas (which may capture key elements of the pathophysiology of pandas) and in mice that develop excessive grooming after inactivation of the progranulin gene. in both cases, increased synaptic pruning cooccurs with microglia activation. in cx3cr1 knockout mice, deficient synaptic pruning accompanies alterations in neuron - microglial communication. this is accompanied by social deficits, which has been interpreted as an autism - like phenotype. results from these models must be interpreted cautiously, as neither progranulin nor cx3cr1 has been clearly associated with any of these conditions in humans. abnormal synaptic pruning by microglia in the more pathophysiologically grounded hdc - ko model of tourette syndrome is warranted. these studies in animal models are intriguing and allow detailed mechanistic analysis, but their relevance for the understanding of clinical disease remains to be firmly established. information about microglial abnormalities in patients with ocd, tourette syndrome, and pandas remains very limited. this is a recently opened frontier in our understanding of the pathophysiology of these disorders. it is, however, one of great promise, which may lead to the identification of novel therapeutic targets. | there is accumulating evidence that immune dysregulation contributes to the pathophysiology of obsessive - compulsive disorder (ocd), tourette syndrome, and pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (pandas). the mechanistic details of this pathophysiology, however, remain unclear. here we focus on one particular component of the immune system : microglia, the brain 's resident immune cells. the role of microglia in neurodegenerative diseases has been understood in terms of classic, inflammatory activation, which may be both a consequence and a cause of neuronal damage. in ocd and tourette syndrome, which are not characterized by frank neural degeneration, the potential role of microglial dysregulation is much less clear. here we review the evidence for a neuroinflammatory etiology and microglial dysregulation in ocd, tourette syndrome, and pandas. we also explore new hypotheses as to the potential contributions of microglial abnormalities to pathophysiology, beyond neuroinflammation, including failures in neuroprotection, lack of support for neuronal survival, and abnormalities in synaptic pruning. recent advances in neuroimaging and animal model work are creating new opportunities to elucidate these issues. |
sarcoidosis is a very rare disease in korea with an incidence of 59 cases in 1998 (0.125 cases/100000 people)11). hydrocephalus is a rare clinical feature with a prevalence of 6% among patients with neurosarcoidosis, as reported by a prospective study2). secondary hydrocephalus following meningitis, ventriculitis, or hemorrhage may be complicated by septum formation in the ventricular system2). benzagmout.14) reported that after the treatment of ventricular shunt and corticosteroid therapy, acute hydrocephalus by neurosarcoidosis was resolved. we report the case of a 31-year - old man who developed multi - septated hydrocephalus from neurosarcoidosis and was treated with multiple shunt placements. a 31-year - old man complained of a mild headache in the frontal area without nausea or vomiting for 7 days. on admission, he was confused and disoriented with time and space. the patient had no fever, and his complete blood count, serum biochemistry profiles and autoimmune antibody screening results were normal. cerebrospinal fluid (csf) analysis revealed leukocytosis (53 leukocytes / mm) with a mononuclear preponderance and markedly increased protein to 2.64 chest radiograph and chest ct scan showed bilateral symmetric hilar and mediastinal lymphadenopathy suggesting sarcoidosis. gadolinium - enhanced magnetic resonance image (mri) of brain revealed hydrocephalus and enhanced lesions in septum pellucidum, infundibulum, aqueduct, corpus callosum, and leptomeninges (fig. we performed neuroendoscopic biopsy of the enhanced lesions in the septum pellucidum through the standard right precoronal approach. histopathological results showed non - caseating granuloma and biopsy specimens were all negative for bacteria, fungi and acid - fast bacilli, which were consistent with neurosarcoidosis (fig. ventriculo - peritoneal shunting (strata valve ; medtronic, ca, usa) through the right parieto - occipital approach was performed, and intravenous methyl prednisolone was then started at 20 mg / kg / day for 3 consecutive days ; this was followed by prednisolone (1 mg / kg / day) for 4 weeks. on post - operative day 5, the patient showed progressive improvement of confusion and disorientation, and at 3 weeks post - operation, he was discharged without any neurological deficit. four months after discharge, the patient was re - admitted due to headache, and gait disturbance. brain ct revealed an enlarged left lateral ventricle with periventricular edema and a collapsed right ventricle, at which a ventricular catheter was inserted (fig. gait disturbance including headache improved gradually, and in post - operative week 4, he was discharged without any neurological deficit. six months after second shunt operation, he complained of upward gaze palsy, and gait disturbance. brain ct showed an increased fourth ventricle with periventricular edema and both lateral ventricles were well - collapsed with ventricular catheter in situ (fig. gadolinium - enhanced mri of the brain revealed an enlarged fourth ventricle with other enhanced lesions in the left occipital lobe, left cerebellar peduncle (fig. therefore, we planned ventriculo - peritoneal shunting for the isolated fourth ventricle by neuronavigation with intravenous methyl prednisolone. neuronavigator - guided fourth ventriculo - peritoneal shunting was performed via the left lateral transcerebellar approach with neuronavigation (in2vision ; cybermed, seoul, korea). the csf profile collected at the operative field revealed severe leukocytosis (121 leukocytes / mm) and an increase in the level of protein to 2.03 g / l. after 2 weeks of steroid treatment, csf collected at the valve dome was normalized (6 leukocytes / mm and 0.62 g / l protein). on post - operative day 10, upward gaze palsy and gait disturbance gradually disappeared, and the patient was discharged 4 weeks post - operatively with mild neurological deficit. four months later, the patient 's previous upward gaze palsy and gait disturbance was resolved and ct at follow - up showed a reduction in the size of the fourth ventricle compared to the previous pre - operative ct scan (fig. sarcoidosis is a very rare granulomatous disease in korea, and its cause remains unknown. neurosarcoidosis most often presents with cranial nerve palsies, predominantly affecting the optic and facial nerves, reflecting its predilection for the base of the brain. the diagnosis of neurosarcoidosis is confirmed by biopsy showing noncaseating granulomas in the absence of organisms or other potential causes. in patients with hydrocephalus, the treatment depends upon the clinical status. in the case of asymptomatic hydrocephalus, treatment is not required4). secondary hydrocephalus following meningitis may be complicated by septum formation in the ventricular system, resulting in complex manifestation of csf circulation disturbance7). even though the prognosis for neurosarcoidosis itself is good, hydrocephalus associated with neurosarcoidosis has poor long - term prognosis with a mortality rate of 75%1). benzagmout.3) reported that after the treatment with ventricular shunt and corticosteroid therapy, acute hydrocephalus associated with neurosarcoidosis was resolved. in the present case, we first performed ventriculo - peritoneal shunt in the right lateral ventricle for hydrocephalus in neurosarcoidosis, and observed the slit - like right lateral ventricle 4 months after discharge. hamada.8) reported that endoscopic treatment was effective for the treatment of obstructive ventricles in neurosarcoidosis. further, they suggested that loculated hydrocephalus, which was often treated by placement of an additional shunt, can be better treated with neuroendoscopy since multiple shunt placement was complicated and often results in shunt malfunction8). it was necessary to perform endoscopic plasty of the occluded right foramen of monro and fenestration of the septum pellucidum for the treatment of hydrocephalus during endoscopic biopsy. isolated fourth ventricle requires neurosurgical intervention, because impairment of brain stem functions may lead to sudden death12,13). shin.14) reported that in the presence of a functioning shunt in the lateral ventricle, treatment options for the isolated fourth ventricle include the placement of an additional fourth ventricular catheter, via a variety of trajectories or endoscopic approaches to open the cerebral aqueduct. an endoscopic approach can only be performed if a membranous occlusion of the aqueduct is present on preoperative mri. further, the standard precoronal approach can be used only in cases with a dilated supratentorial ventricular system5). in the present case, because the supratentorial ventricular system was markedly collapsed and both the inlet and the outlet of the fourth ventricle were obstructed by enhanced lesions, the endoscopic procedure was not considered as an appropriate treatment option. therefore, to minimize the complications related to fourth ventricular shunt insertion, we performed ventriculo - peritoneal shunting via the left lateral transcerebellar approach using a neuronavigator. the risks of this procedure included brain stem penetration by the ventricular catheter, with focal neurological deficit because of the compressed cerebellum and brain stem expansion by decompressing the isolated fourth ventricle following ventriculo - peritoneal shunting9). however, in the present case, there were no complications caused by the catheter during follow - up. we report a case of hydrocephalus associated with neurosarcoidosis treated by multiple shunt placement with clinical features and a review of literature. | a 31-year - old man was admitted to our hospital due to hydrocephalus with neurosarcoidosis. ventriculo - peritoneal shunting was performed in the right lateral ventricle with intravenous methylprednisolone. subsequently, after 4 months, additional ventriculo - peritoneal shunting in the left lateral ventricle was performed due to the enlarged left lateral ventricle and slit - like right lateral ventricle. after 6 months, he was re - admitted due to upward gaze palsy, and magnetic resonance image showed an isolated fourth ventricle with both the inlet and outlet of fourth ventricle obstructed by recurrent neurosarcoidosis. owing to the difficulty of using an endoscope, we performed neuronavigator - guided ventriculo - peritoneal shunting via the left lateral transcerebellar approach for the treatment of the isolated fourth ventricle with intravenous methyl prednisolone. the patient was discharged with improved neurological status. |
estudio retrospectivo de la implantacin del myoring en un bolsillo corneal en los casos de queratocono. el espesor de la crnea en el punto ms fino no reflej cambios, mejorando los valores de sim k, esfera y cilindro manifiesto durante el seguimiento a los 9 meses de la intervencin y permaneciendo entonces estables hasta el ltimo seguimiento a los 5 aos de la misma. la agudeza visual no corregida y corregida (udva, cdva) mejor considerablemente a los 9 meses de la intervencin, y continuaron mejorando significativamente hasta el ltimo seguimiento a los 5 aos de la misma. el tratamiento result seguro y efectivo, con mejora continua de la agudeza visual durante los 5 aos posteriores a la ciruga. keratoconus is a rare disease which is characterized by progressive steepening and thinning of the cornea, thus resulting in progressive vision loss. corneal intrastromal implantation surgery (cisis) with myoring implantation has demonstrated to be an effective and safe treatment for visual rehabilitation in myopia and keratoconus.2, 3 this paper presents 5 years follow - up data of myoring treatment for keratoconus of a central european population, discusses the related treatment principles and provides a guideline for evaluating treatment success. as described elsewhere,2, 3 cisis starts with the creation of an intrastromal corneal pocket of 9 mm in diameter at a depth of 300 microns by means of the pocketmaker ultrakeratome (dioptex gmbh, austria), followed by the implantation of the myoring (dioptex gmbh, austria) via a small lamellar tunnel of less than 5.5 mm using a particular implantation forceps. the myoring finally has to be centered by using the real postoperative optical axis as a reference. the procedure is minimally invasive, causes no pre- or postoperative pain and will take only 10 min when performed by a trained and experienced surgeon. the patient is advised to apply a combination of steroid and antibiotic eye drops hourly until undergoing the first follow - up exam on the first postoperative day. between this first postoperative exam until two week after surgery, the patient is advised to reduce the application of the aforementioned combination of eye drops to merely 5 times a day. thereafter no further medical therapy is required. the next follow - up exam is usually performed 3 months after surgery to evaluate whether the result is already optimal or may be further enhanced. this is called the initial postoperative observation period. according to the suggested visual potential of the individual eye, the enhancement is performed either by optimizing the position in relation to the real postoperative optical axis or by exchanging the myoring for one with different dimensions. an enhancement is accomplished easily and takes usually less than one minute without causing the patient intra- or postoperative pain. this iterative optimization procedure is based on the rationale that an a priori clinical determination of all information required for a nomogram that predicts the initial result in 100% of the cases is simply impossible in the in vivo corneal system. in other words, complex nomograms with many decision criteria suggest a nomogram accuracy to the user which is completely unreal. in the case of myoring treatment, the accuracy of the nomogram therefore reflects the real accuracy of the maximum possible degree of determination of the corneal system. this results in some 20% of patients who benefit from a simple enhancement 3 months after initial surgery. in other words, if the prediction accuracy of a system is 80% for the initial approach, it only takes a simple, short and safe procedure for further enhancement in a second step to achieve a success rate of nearly 100%. two postoperative follow - ups per patient have been included : the first one approximately one year after the last surgical intervention and the second one approximately 5 years later. the examination performed at the end of both follow - up periods used for the study included scheimpflug measurement for topography, pachymetry at the thinnest point (ct) and k - readings sim k1, sim k2 and k = (sim k1 + sim k2)/2 using the pentacam (oculus gmbh, germany), uncorrected distance visual acuity (udva) and corrected distance visual acuity (cdva). statistical evaluation was performed using the two - tailed paired t - test for comparison of data having gaussian distribution. the normality testing for gaussian distribution was performed using the dagostino & pearson omnibus normality test. in the case of non - gaussian data distribution, the data were compared using the wilcoxon matched - pairs signed rank test. to qualify data as being significantly different in statistical terms, the statistical data are presented in mean standard error (se) in the case of gaussian distribution and as median and range in case the normality test was not passed. 53 eyes of patients pertaining to a central european population from all over austria and germany were treated within the selected period. a subgroup of 17 eyes of 13 patients fulfilled the criteria of having 2 independent follow - up exams within the selected follow - up periods with all required data available (corneal thickness, topography including k - readings, manifest refraction, uncorrected distance visual acuity udva, corrected distance visual acuity cdva). many patients had to cover a long distance of sometimes more than 1000 km for examination in our center. the majority of that patients refused to spend two days and a flight for long - term follow - up examination when they were happy with the results. the study had to be limited to patients representing a homogenous ethnic group (central european population) to rule out an influence resulting from ethnic variations. the nomograms of patients from the middle east, for example, must be different from those used for european populations to avoid overcorrections. the first follow - up exam performed in the eyes included in the study was between 3 months and 24 months after surgery (9 1.8). the second follow - up exam was between 36 months and 90 months after surgery (56 3.9). 10 eyes were right eyes (od) and 7 were left eyes (os). two patients (4 eyes) were female and 11 patients (13 eyes) were male. the age of the patients at the time of surgery ranged from 21 to 50 years (median 35 years). of the 17 eyes 3 (17.5%) had grade i, 4 (23%) had grade ii, 5 (30%) had grade iii, 3 (17.5%) had grade iv and 2 (12%) had grade v according to the grading after alio. a minimum of 3 eyes (17%) experienced progression of the disease in the year prior to surgery. four of the 17 eyes (23.5%) had an enhancement intervention 3 months after the initial treatment, during which the implant was replaced by a stronger or weaker one. for these 4 eyes, the postoperative follow - up period started with the date when the enhancement was performed. all surgeries were performed by one surgeon (a.d.) and did not result in any intra- or postoperative complications. the corneal thickness measured at the thinnest point showed no statistically significant changes at both follow - ups compared to the preoperative value or compared to the other postoperative value. the values for corneal thickness were 440 9 microns preoperatively, 445 8 microns at the first follow - up and 442 7 microns at the second follow - up, respectively. the average central k - value determined by k = (sim k1 + sim k2)/2 was significantly lower than the preoperative value of 50.68 1.1 diopters (d) at both follow - ups. no significant changes occurred between the first (45.27 0.88 d) and second postoperative follow - up (45.76 0.74 1b shows the time course of k. the manifest sphere (sph) as well as the cylinder (cyl) were significantly reduced at both follow - ups compared to the preoperative value (sph 5.21 1.13 d, cyl 4.79 0.39 d). however, no significant change was observed between the first postoperative follow - up (sph 1.25 0.48 d, cyl 1.46 0.30 d) and the second follow - up (sph 0.93 0.52 d, cyl 1.18 0.31 d) (fig. 1c and d). uncorrected distance visual acuity (udva) improved significantly between the preoperative exam (1.58 0.38 logmar) and the first postoperative follow - up (0.30 0.041 logmar), as was the case between the preoperative exam and the second postoperative follow - up (0.22 0.038 logmar). 1e shows the time course of udva, demonstrating an improvement of some 12 lines on average. all eyes gained lines at both postoperative follow - ups when compared to the preoperative state. corrected distance visual acuity (cdva) had no gaussian distribution in the preoperative exam nor after both postoperative follow - up periods because the average natural limit for improvement at 20/20 (0.0 logmar) is closer to the measured cdva values when compared to udva. the median of cdva at the first follow - up was 0.15 (range 0.00.52),and at the second follow - up 0.1 (range 0.00.4), respectively. a particular improvement of cdva was observed between the preoperative exam and the first postoperative follow - up ; a further significant improvement was seen between the first and second postoperative follow - up. the related graph in fig. 1f demonstrates an improvement of approximately 23 lines on average. all eyes gained lines and no eye lost lines in the two postoperative follow - ups compared to the preoperative state. 2 shows the line improvement of uncorrected and corrected distance visual acuity as a function of the severity of the disease measured as preoperative visual acuity. this makes sense as the potential for improvement is different for mild and advanced cases ; mild cases require fewer lines to reach 20/20 than advanced ones. the same is true when comparing udva and cdva : the improvement potential for cdva is less than for udva. 2a shows the line improvement of udva at first and second follow - up compared to preoperative udva as a function of preoperative udva. 2b shows the line improvement of cdva at first and second follow - up compared to preoperative cdva as a function of preoperative cdva. the dashed lines are the result of the linear regression of line improvement in udva (r = 0.8865, y = 8.844x 1.21, fig. 2a) and cdva (r = 0.5591, y = 6.69x 0.53, fig. the solid lines are the result of the linear regression of the line improvement of udva (r = 0.8992, y = 8.691x 0.114, fig. 2a) and cdva (r = 0.7588, y = 7.0x + 0.17, fig. the dotted lines represent the maximum possible (ideal) improvement to 20/20 visual acuity. in udva and particularly in cdva, visual acuity additionally improves between the first and second follow - up ; this improvement is indicated by a shift of the linear regression line toward the ideal (dotted) line. the results of the present study show a significant improvement of k - reading, sphere and cylinder as well as udva and cdva after myoring implantation in keratoconus at the first follow - up approximately 9 months after surgery. while k - reading, sphere and cylinder remain unchanged between the first and the second follow - up around 5 years after surgery, udva and cdva show a continued statistically significant improvement during this second postoperative period (figure 1, figure 2). the statistically significant improvement of udva and cdva even during the long - term postoperative period not only indicates a significant degree of visual rehabilitation but may also indicate a stabilization of the diseased cornea following myoring implantation. moreover, the continuous improvement in cdva during the postoperative course in all grades of the disease (fig. 2) points at an ongoing postoperative regularization process of the diseased cornea after treatment. the average visual improvement of 12 lines and more in udva and 3 lines in cdva correlates with earlier reports which consider one - year follow - ups after treatment. this data is in striking contrast to the data obtained from ring segments, which hardly reach comparable improvements in visual acuity.6, 7, 8 ring segments have the disadvantage of resulting in a long - term postoperative loss of visual acuity.9, 10 myoring implantation, by contrast, stabilizes the corneal thickness even in previously progressive cases, as several reports indicate.11, 12, 13 none of the 3 eyes (17%) in the present study that had documented progression during the year prior to treatment did so after myoring insertion. however, since the keratoconic cornea of an individual patient can only be characterized as progressive through a retrospective analysis, it is generally impossible to qualify such a cornea as progressive. in other words, if a cornea was progressive in the recent past but is no longer progressive after treatment, there may be two possibilities : either the past progression and future halting of progression is the natural course of the disease or the treatment is effective and stops progression. another possibility is that the disease is not progressive at a certain point of time but becomes progressive in the future. therefore, the efficacy of a therapy in halting keratoconus progression can not be evaluated by simply comparing two groups of cases in terms of their past individual behavior : progressive and non - progressive. moreover, it is necessary to compare a treated group with a similar group not undergoing treatment, and to relate the number of patients that would have progressed during the follow - up period without treatment to those who progressed after treatment. longitudinal studies show a progression rate of approximately 25% in patients with an average age of 25 years suffering from mild to moderate keratoconus. considering that the population included in the present study has a higher average age (35 years) and the percentage of documented cases showing progression immediately prior to treatment was 17%, it can be estimated that approximately 20% of the eyes would have progressed during the average follow - up period of 5 years without treatment. the estimation is based on the assumption that at least one eye out of the preoperatively not progressing eyes is likely to progress during the 5 year observation period but counting it just with 50% probability. the fact that no significant progression was observed in the present study after myoring treatment during an average follow - up period of some 5 years is no total proof that myoring implantation stops progression, but it is a very strong indicator. one explanation for the stop of progression of keratoconus after myoring implantation may be found in the biomechanics of the cornea before and after myoring implantation. since the myoring is a continuous full ring implant, with no disruption of continuity along its circumference, it acts in the cornea like a second (artificial) limbus and supports the cornea biomechanically in much the same way as a ceiling beam supports the ceiling of a room under load by separating the ceiling (cornea) into two compartments and reducing the load on each compartment. specifically, the myoring is able to take up a significant amount of the load acting on the cornea. this mechanism may result in a strengthening of the cornea by a factor of 3 after myoring implantation, which corresponds to an increase in effective corneal thickness of a factor of 3. a discontinuous ceiling beam (in analogy to ring segments), in turn, is unable to stabilize a ceiling under load. another important difference between ring segments and the myoring is that the myoring provides the surgeon with all three possible degrees of freedom to achieve the optimal result in any given case (implant thickness, implant diameter and implant position), whereas ring segments provide only one degree of freedom (implant thickness). specifically, the position of the segment is determined by the preparation of the circular tunnel relating to the preoperative fixation (optical axis), which in turn depends on the preoperative corneal shape. in this context, it is important to understand that the misalignment of an implant by about 0.5 mm may have a dramatic impact on the visual results. the myoring is placed inside a corneal pocket with a diameter of 9 mm, which allows to align the implant to the postoperative fixation of the eye at the end of the surgical intervention. this may be a further reason why myoring implantation outperforms ring segments in terms of vision improvement. to be able to exploit the full potential of the myoring, it is also important to understand the natural boundaries of a nomogram in predicting the perfect implant dimension in any specific situation and to draw the right conclusion from this understanding. while the nomogram for the myoring treatment of keratoconus is very simple (it depends only on the average sim k), the nomograms for ring segments tend to be much more complex yet often do not allow a satisfactory prediction of the results.17, 18 it seems that ring segment nomograms overestimate the biomechanical predictability for keratoconic corneas in vivo. myoring treatment pursues a different strategy than ring segments and tries to avoid pseudo - accuracy in the nomogram. the rationale of myoring treatment is : if a system can not be predicted preoperatively with 100% accuracy, the surgical approach has to be designed in such a way that it becomes extremely simple to enhance the result in a certain percentage of cases postoperatively, and this enhancement procedure is then incorporated into the treatment strategy. consequently, myoring treatment is based on a lamellar surgical concept focusing on a small lamellar incision that does not require suturing. the replacement of a myoring implant is a one - minute job which causes no pain or irritation. the costs for exchanging the implant after 3 months is covered by the initial payment of the patient so the patient do not have to pay extra for that. in the present study, 4 out of 17 myorings (23.5%) were replaced after the initial postoperative observation period of three months to achieve optimal individual results. the results are independent of cone position (central or non - central) because the myoring inside a corneal pocket automatically corrects the corneal area in the right way. stronger or weaker one, may differ depending on the following situations. if visual acuity (udva, cdva) at the end of the postoperative observation period of three months is as preoperatively planned, no further intervention is needed and treatment is completed. in these cases, the refraction (spherical equivalent se) is normally close to zero and the topography shows a certain characteristic pattern in the postoperative tangential map (fig. 3a) ; the color - marked local corneal curvature has the shape of a central island and the ring - shaped topography of the myoring is of homogeneous intensity (local curvature). if visual acuity at the end of the postoperative observation period of three months does not match preoperative expectations, refraction and topography will have to play a role in further decision making. in the case of overcorrection, the refraction shows a hyperopic shift and the color - marked intensity of the concentric ring in the tangential map is most pronounced over the central island the spherical equivalent is usually in the myopic range, and the prominent feature in the tangential map is the weaker means that the implant has a larger diameter and/or is thinner, stronger means the opposite. the rationale of myoring treatment of keratoconus for achieving optimal results is somehow related to hard contact lens fitting. but instead of analyzing fluorescein patterns as in contact lens fitting, the myoring is optimally adjusted to match the tangential topography map. as sometimes seen in myoring - treatment videos (e.g. on youtube), another mistake is to mark the cornea prior to implantation for the purpose of aligning the myoring. this procedure does not allow to achieve the best possible result in each individual case because optimal treatment requires alignment to the real postoperative fixation. the best results are achieved when the surgical microscope has a concentric light - source which the patient can fixate. at the end of the surgical intervention, once the myoring has been implanted into the corneal pocket, the patient is asked to fixate this light source. then the myoring is shifted to its central position inside the pocket (between the center of the pupil and the central spot between the first and the second purkinje reflex of the concentric microscope light source). this procedure also helps to minimize the paralaxis error and to properly determine the center of the pupil. to be able to assess the individual results of myoring treatment achieved by a specific surgeon, 2 allows to analyze the results, including the surgeon 's specific performance, in detail. 4). in conclusion, the myoring when used according to the treatment principles described above has the potential to produce excellent long - term vision results in mild, moderate and advanced keratoconus cases, regardless of cone position and disease progression. dr. daxer has an investment interest in dioptex gmbh, dr. ettl and dr. | purposeto study long - term results of myoring treatment of keratoconus.methodsretrospective study of myoring implantation into a corneal pocket for keratoconus.resultscorneal thickness at the thinnest point remained unchanged, sim k 's, manifest sphere and cylinder were significantly improved at the first follow - up 9 months postoperatively and remained stable until the last follow - up about 5 years after surgery. uncorrected and corrected distance visual acuity (udva, cdva) were significantly improved at the first follow - up 9 months postoperatively and were further ameliorated until the last follow - up about 5 years after surgery.conclusionthe treatment was safe and effective with continuing improvement of visual acuity during the 5 years after surgery. |
there is a robust corpus of behavioral studies showing that, at a young age, infants discriminate phonetic contrasts from different languages of the world (e.g., [14 ]). the capacity of infants to acquire linguistic information from their native language is well established, but the mechanisms neural or other underlying the plasticity of the infant brain as well as the impact of linguistic exposure on acquisition are not well understood. in fact, the behavioral literature documents developmental changes for infants in various linguistic environments, but to our knowledge no data have been reported regarding cross - linguistic speech perception and its neural correlates in normally developing spanish learning mexican infants, more specifically comparing their neural responses to those of infants of the same age using the same phonetic stimuli, but learning english. our goal in the present study was to enhance our understanding of how exposure to the phonetic units of a particular language, as well as acoustic salience, differentially affects the type and timing of neural responses to phonetic units early in development and how these relate to neural plasticity and neural commitment. it is accepted that infants aged 68 months discriminate most native and foreign consonant differences at a similar behavioral level [57 ]. for vowels, the effects of language experience are already present at this age. by 1012 months of age linguistic experience affects the perception of consonants ; there is a decline in the ability to discriminate foreign consonant contrasts [57, 914 ], and more recent reports have also demonstrated that perception of native - language phonetic consonants increases significantly at these ages [7, 15 ]. more specific to the present study, eilers and her colleagues reported in a cross - linguistic study that spanish - learning 68-month - old infants were capable of discriminating both an english and a spanish voicing contrast, whilst infants the same age but acquiring english could only overtly respond to the english contrast. eilers and collaborators suggested that specific auditory experience was important in the discrimination of the spanish contrast, but that the english contrast contains other acoustic information (aspiration) that makes it easier to discriminate, even in the absence of specific exposure. in other words, eilers. argued that the english contrast was relatively unaffected by linguistic history, because of it acoustic salience. both the discriminatory capacities as well as the enhancement in native - language phonetic discrimination have been demonstrated using neural responses [1824 ]. neural responses, such as the recording of event - related potentials (erps), provide a continuous record of brain activity during the time period in which the cognitive processes under investigation actually occur. erps are part of the voltage changes within the electroencephalogram (eeg) that are related to the brain 's response to specific events. in other words, erps are the brain voltage changes time - locked to the presentation of some external (presentation of a stimulus, e.g.) or internal (decision making, e.g.) event. the waveforms ' deflections are typically classified according to polarity (positive or negative), sequence (first positive peak, etc.), and latency (time window in ms where a peak occurs, e.g.). different erp patterns recorded during speech processing may reflect different levels of representation or information processing. of particular interest to the present report are the findings of rivera - gaxiola and collaborators describing auditory brain potentials to native and foreign contrasts in a longitudinal study where american infants learning english were tested at 7 and 11 months of age. in that study, using cv - syllables differing in vot, erp group differences at 7 and 11 months of age mirrored the behavioral literature regarding perception of native and foreign contrasts [57, 12 ]. more specifically, at 7 months of age, infants showed evidence of neural discrimination to both spanish and english contrasts, whilst at 11 months of age, erp group data showed no evidence of discrimination to the foreign (spanish) contrast and an enhancement of neural discrimination to the native (english) contrast. the authors observed that neural discrimination at the group level was represented by erp amplitude differences in a negativity occurring between 250 and 550 ms after syllable onset (henceforth n250550) but they also described differences over an earlier, positive - going deflection occurring between 150 and 250 ms after stimulus onset when infants ' erps were evaluated individually. while one group of infants showed a larger p150250 in response to both contrasts at 7 months, the other group of infants showed a larger n250550. when evaluated at 11 months of age, the group that responded over the p150250 time window at 7 months of age remained the same for the foreign contrast but changed to an n250550 response to the native contrast. on the other hand, infants in the n250550 responding group at 7 months remained n250550 responders to both types of contrasts at 11 months. the authors concluded that erp group data may underestimate individual discriminatory capacities and that the brain remains capable of discriminating foreign contrasts at 11 months of age ; that is, there is no absolute loss in sensitivity to the foreign contrast, as also shown by the adult behavioral data [13, 26 ], and later buttressed by adult electrophysiological data, and other reports on infants [6, 7 ]. also, differences in polarity in erps to speech stimuli during the first year of life have been widely documented [18, 2844 ], however, there is no current consensus about what these different timing and polarity effects mean. in a second study, rivera - gaxiola and collaborators replicated the patterns described earlier using the same methods on a larger sample of 11-month - old monolingual american infants. in this second study, the authors reported that responding over the p150250 time window (p - response) or over the n250550 time window (n - response) to the foreign contrast at 11 months of age predicted vocabulary production at 18, 22, 25, 27, and 30 months of age. p - response to the foreign contrast produced significantly more words than infants showing an n - response at the same ages. the authors conclude that showing a p - response to the foreign contrast and an n - response to the native contrast signifies more commitment to their native language than displaying an n - response to both contrasts (see [24, 45 ] for additional discussion). furthermore, in a scalp distribution analyses considering 7-, 11-, 15-, and 20-month - old infants, corroboration was obtained by showing that the p150250 and the n250550 components also differ in scalp distribution. dehaene - lambertz and gliga have also reported that different erp components with different topographies can signal different types of underlying neural processing (see for a review). in other words, in our studies, displaying an n - response to both contrasts means that the infant is not attending differentially to native language patterns and this in turn affects later language development. a recent study with bilingual infants learning spanish and english showed that the strength of erp response to either language predicted word production in that particular language 6 months later. the goal of the present study was to replicate, extend and compare our previous developmental and cross - sectional findings that combined electrophysiological measures (namely, event - related potentials) and a cross - language approach. do mexican infants learning spanish show the same erp differences observed in monolingual american infants ? we hypothesized that 1013-month - old infants learning spanish in mexico would show erp discriminatory evidence for both the native and foreign contrast types : as a group, these infants would show early p150250 differences to the foreign contrast because of its acoustic salience, and n250550 differences to the spanish contrast because it is native to them. using the exact same stimuli, and following the exact same criteria as the rivera - gaxiola and collaborators ' previous studies [19, 20 ], we also expected to encounter a subgroup of infants responding with amplitude differences over the p150250 time window and another one responding with amplitude differences at the n250550 time window to the foreign contrast. thirty five mexican infants (20 boys/15 girls) aged 1013 months (mean age = 11.5, range 10.1013.5 months) were recruited by word of mouth in two different cities in mexico. all infants recruited were born at term (> 39 weeks), with a normal birth weight (610 lbs.), and their mothers had normal pregnancies and deliveries. parents signed uw ethics committee - approved consent forms and procedures were described in spanish before testing. mexican parents received forms in spanish and were paid $ 15 dollars for their participation in the study. data from 18 of the mexican infants (9 boys and 9 girls) were accepted for erp analyses and are here reported. data from the remaining infants recruited and recorded were eliminated due to a low number of artifact - free trials to average (total number of trials = 1000, with 800 standards and 200 deviants including native and foreign ; minimum number of deviant trials to be accepted for erp analyses = 80). the stimuli used in the present study were identical to those used in previous investigations with english monolingual infants (see [19, 20 ] and spanish / english bilingual infants. in brief, cv syllables naturally produced by a spanish / english bilingual female were used. the syllables differed in the relative onset of voicing versus the syllable burst, or voice - onset time (vot), and included a phoneme that was common to both languages, an unaspirated alveolar voiceless /ta/ (heard as da by native english speakers and heard as ta by spanish native speakers ; vot = 12 ms), a voicing - lead dental /da/ (heard as da by spanish and english native speakers ; vot = 24 ms), and a voiceless aspirated alveolar english /ta/ (heard as ta by english and spanish speakers ; vot = 46 ms). syllables were equal in duration (229.65 0.3 ms), intensity, average root mean square power, and vowel color. behavioral discrimination of the experimental stimuli was tested using the active oddball paradigm in adult native speakers of english and in adult native speakers of spanish. the comparison was the english voiceless aspirated /ta/ and 7% when the comparison was the spanish voiced /da/. in contrast, native adult spanish speakers scored 85% correct on the /ta/ and 98% correct on the spanish /da/. strange form of /ta/. syllables were tested beforehand to ensure goodness of the english /da/ and /ta/ in english speakers and goodness of the /ta/ and /da/ in spanish speakers. the syllables selected were equally good : native english and native spanish speakers rated their native syllables with best labels from a selection of poor, fair, ambiguous, good, and head - turn behavioral studies in our laboratory show that 11-month - old american infants discriminate their native contrast (/ta/-/ta/) at about 70 percent correct, well above chance, and the foreign /da/-/ta/ near chance at about 53% percent correct [48, 49 ]. participants were tested using the same double - oddball paradigm used in our studies with english monolingual infants and spanish / english bilingual infants. the voiceless unaspirated sound (spanish /ta/ ; english /da/) was used as the standard sound and it was presented 80% of the time. the remaining two syllables were the deviants (spanish /da/ and english /ta/), each presented 10% of the time in a semirandom fashion : no consecutive deviants occurred and at least 3 standards occurred between deviants. the inter - stimulus interval (offset to onset silence) was 700 ms. one minute silences were inserted every 2 minutes to allow for interaction with the infant. the syllables were played by two loudspeakers placed approximately 1 m in front of the child, at 69 dba spl. eeg from all participants was recorded while they were passively listening to the series of 1000 cv syllables. infants were awake and sat on a high - chair placed inside a silent room or on the parent / guardian 's lap. the parent or guardian sat next to / with the child. a research assistant was located in front of the infants and entertained them with silent toys. the electroencephalogram (eeg) amplifier used was the isolated bioelectric amplifier system (sc-16/24 ba ; sa instrumentation san diego, ca). the eeg was recorded using electrocaps (electro cap international) with preinserted tin ag / agcl electrodes and referenced to the left mastoid from fp1, fp2, f3, f4, c3, c4, p3, p4, f7, f8, t3, t4, fz, cz, and the active right mastoid of the 10/20 international system. the vertical electro - oculogram (veog) was recorded from 1 infra - orbital electrode placed on the infant 's left upper cheek. all electrode impedances were kept homogeneous across sites and below 5 k. signals were amplified with a gain of 20000. eeg segments of 700 ms with a prestimulus baseline time of 100 ms were selected and averaged off - line to obtain the erps. segments with large eye movements, blinks, or other artifacts were automatically eliminated (electrical activity exceeding 150 v was considered artifact). erp data were accepted for analyses when at least 80 artifact - free trials for each type of deviant and 80 of the standard could be obtained. all erps accepted showed clear auditory p - n complexes within the first 600 ms. following rivera - gaxiola and collaborators, the waveforms obtained were explored within three time windows : n30120 (negative deflection between 30 and 120 ms after stimulus onset), p150 and 250 (positive deflection between 150250 ms after stimulus onset), and n250550 (negative deflection 250550 ms after stimulus onset). peak amplitude values for standard preceding a deviant and deviant stimuli within each time window for each child and condition were obtained and used to calculate three independent three - way repeated - measures anovas. the factors included were condition : native contrast (standard voiceless unaspirated versus deviant spanish voiced /da/) and foreign contrast (standard voiceless unaspirated versus deviant voiceless aspirated /ta/), lateral electrode position (left and right), and anterior - posterior location (frontal - polar, frontal, central, parietal, frontal - lateral, and temporal). for simplicity purposes, the speech contrast relating the standard voiceless unaspirated sound and the deviant spanish voiced /da/ is referred to here as the native contrast. also, the speech contrast relating the standard voiceless unaspirated sound and the deviant voiceless aspirated /ta/ is referred to here as the foreign contrast. data from 18 participants (9 girls) could be included in the analyses (at least 80 artifact - free trials of each and all types of syllables). erps from all of these showed clear n30120/p150250/n250550 complexes distributed over frontal, central, parietal, and temporal recording sites. the n30120 was small but present, and not significantly different across conditions. at the group level, normally developing 1013-month - old mexican infants learning spanish displayed statistically significant amplitude differences between standard and deviant over the n250500 time - window (n - response) for the native contrast, f(1,17) = 6.29 p = 0.02, partial = 0.270, and observed power = 0.658. the amplitude differences between standard and deviant for the foreign contrast over the n250550 time window only approached significance, f(1,17) = 4.0 p = 0.06, partial = 0.191, and observed power = 0.471. however, as a group, these infants did show an important p150250 peak amplitude difference (p - response) between standard and deviant for the foreign contrast [/ta/ versus /ta/ ], f(1,17) = 9.636, p = 0.007, partial = 0.376, and observed power = 0.830, but not for the native contrast [/ta/ versus /da/ ], f(1,17) = 1.370, p = 0.259, partial = 0.079, and observed power = 0.196. no left - right hemispheric differences were observed but there was an anterior - posterior main effect at the group level, with anterior amplitudes being larger than posterior ones, p 0.05) (figure 2). for these infants, we found that the differences only approached statistical significance, f(1,6) = 5.5, p = 0.058, partial = 0.476, and observed power = 0.5, which could be explained by the low number of infants (figure 3). because the present study involved a double - oddball paradigm where one oddball is foreign to spanish speaking infants and one is foreign to english learning infants, an important part of the research presented here was to compare the same paradigm and stimuli in both english and spanish learning infants. table 2 presents a comparative table showing the responses obtained in the present mexican sample and the ones previously reported for our american 11-month - old sample ; table 2(a) shows group results, and table 2(b) shows p- and n - responders ' subgroups. at the group level, the results mirror the behavioral literature, but attention to individual variation supports the notion that the brain continues to process acoustic differences regardless of prior exposure. both p- and n - responders show significant differences to their native contrast over the n250550 time window. in this study, we explored whether mexican infants acquiring spanish showed a similar pattern of erp differences to native and nonnative phonetic contrasts that we observed previously when testing monolingual american infants using the exact same stimuli and analysis procedures [1921 ]. we hypothesized that 1013-month - old infants acquiring spanish in mexico would show erp discriminatory evidence for both the native and foreign vot contrast types, one reflecting the acoustic salience of the english lag contrast (seen in the early p - response) and the other reflecting the status of the spanish vot lead contrast as a phonemic contrast in the language (seen in the group results showed significant amplitude differences for monolingual spanish infants ' native /ta/-/da/ contrast over the n250550 time window. rivera - gaxiola, silva - pereyra, and collaborators reported that, at a group level, american 11-month - old infants also showed an moreover, the sample of mexican infants also clearly responded to the foreign contrast /ta/ versus /ta/, with the amplitudes of the p150250 being significantly larger for the foreign deviant aspirated /ta/, than for the standard /ta/. these results conformed to our hypotheses and also with the behavioral literature that reports that spanish learning 612-month - old infants are able to respond to both the english and spanish contrasts, regardless of phonemic status. we hypothesize that the p - response observed in the majority (70%) of mexican infants to the foreign contrast is reflecting acoustic discrimination of the english voicing contrast, which involves aspiration, an acoustically salient cue for all listeners, regardless of its phonetic status in their language. in other words, despite the fact that the aspirated /ta/ does not have phonemic status in spanish, inexperienced adults are able to perceive the aspiration in the syllable. the data presented here are consistent with our proposal that the p - response may reflect a less specialized (and more universal) form of detection of acoustic differences in speech contrasts. it is also well known that there is a great deal of individual biological variability across infants, and this variability is meaningful in that it can predict future language abilities [15, 1921, 24, 43, 45, 51 ]. it is therefore worthwhile to analyze individual erps. in the present work, we analyzed peak amplitude values of the p150250 and the n250550 components resulting from the presentation of a standard syllable and two different types of deviant syllables using the exact same method employed in our previous reports [19, 20 ]. we again observed that 10- to 13-month - old infants vary in the neural responses they display to a foreign contrast. when analyzing infants ' responses to the foreign contrast, we observed a subgroup of infants who showed our results show that eleven out of 18 infants displayed qualitative amplitude differences over the two time windows explored, though the only significant difference occurred over the p150250 time window. rivera - gaxiola and collaborators, showed that all of the american infants responded over the n250550 time window for their native /da/ versus /ta/ contrast at 11 months of age ; some responded over the p150250 time window and some over the n250550 time window to the spanish /ta/ versus /da/ this pattern observed for the mexican sample in the present study mirrors that seen in the american in the previous study, but for the opposite speech contrast. in short, across the two studies, we show that neural responses to native sounds at 11 months of age occur over the n250550 time window, whereas neural discrimination to a foreign contrast can be reflected either as a n - responses to both the native and the foreign contrasts are showing less native language neural commitment (nlnc,, as they reflect similar neural analyses to the two types of contrasts irrespective of the language status of those contrasts. in the subset of this result is similar to cheour and collaborators, who showed that a larger acoustical difference evoked a small mmn if the status of the vowel contrast was foreign. displaying n - responses to a foreign contrast does not appear to be advantageous in monolingual language learning (see [24, 45 ] for discussion). in the rivera - gaxiola and collaborators report, the american infants who showed the p - response to the foreign contrast later scored higher in vocabulary and sentence complexity (18 to 30 months of age) compared to their n - responding peers. other behavioral [15, 48 ] and erp data also indicate a negative correlation between the capacity to discriminate foreign contrasts and concomitant word comprehension or later word production / comprehension. given the nature of the paradigm used, we can not determine how the discriminatory responses observed in the populations studied to date are connected to attentional processes. we do not know what role the p - response plays in infants ' behavioral discrimination responses to their native contrast at 68 months of age, but not at 1012. this can only be explored using erps and behavioral methods with the same infants at the same time. [15, 24 ] examined both behavioral measures and erp measures to native and foreign contrasts in the same infants at the same age but in separate sessions and showed significant correlations between an mmn - like difference waveform at 250500 ms and performance in the behavioral task (head - turn conditioning). in both cases, better discrimination of the native contrast at 7.5 months predicted a more rapid advance in the acquisition of words and sentences, whereas better discrimination of the foreign contrast predicted a slower advance toward the mastery of words and sentences. n - response to the foreign contrast in the present study, like those who showed a strong mmn - like difference waveform in kuhl. to the foreign contrast the presence of two types of responders may vary not only with age and exposure but also with the specific contrast involved. cross - linguistic and developmental studies allow us to explore and understand which aspects of speech perception may hold for all languages or cultures, and which depend on experience. the fact that individual variation in the erp responses predicts differences in later language development indicates that these differences are meaningful, and not simply noise. in sum, across our studies, we have shown that the erp responses from infants being raised in different cultures english - learning, spanish - learning, or both are analogous and depend on the native or foreign status of a speech sound. for spanish learners, the prevoiced /da/ is the native deviant and the aspirated /ta/ is the foreign deviant, whereas for english learners the reverse is true, yet the infants responded similarly to their respective native and foreign deviants. our erp evidence reveals that the infant brain still responds to foreign sounds at 1013 months of age, but that the neural responses to foreign sounds are weaker than to native sounds. our results suggest that the brain retains a capacity to discriminate small differences in speech sounds regardless of prior exposure. moreover, our results indicate that the time - course, polarity, and later language implications of the p150250 and the n250550 are different. these two electrophysiological components together reflect how the brain is shaped by exposure to a specific language. the p- and n - responses reported here are related to both acoustic salience and the phonetic status each deviant has for the infant depending on the language of her environment. we propose that because p - responders are allocating resources differentially depending on the phonetic status of the contrast involved, they are more committed to their native language and will advance more rapidly in language acquisition, while the n - responders are not distinguishing between what may be useful to attend to (native contrast) and what not (nonnative contrast) at this age, and therefore that their progression towards language may proceed at a different pace. | we report brain electrophysiological responses from 10- to 13-month - old mexican infants while listening to native and foreign cv - syllable contrasts differing in voice onset time (vot). all infants showed normal auditory event - related potential (erp) components. our analyses showed erp evidence that mexican infants are capable of discriminating their native sounds as well as the acoustically salient (aspiration) foreign contrast. the study showed that experience with native language influences vot perception in spanish learning infants. the acoustic salience of aspiration is perceived by both spanish and english learning infants, but exposure provides additional phonetic status to this native - language feature for english learning infants. the effects of early experience and neural commitment as well as the impact of acoustic salience are further discussed. |
fecal microbiota transplantation (fmt) has gained worldwide attention in recent years 1. in 2013, it was recommended as the clinical choice in guidelines for treatment of recurrent clostridium difficile infection (cdi) 2. in addition, clinical studies have shown that fmt has a therapeutic role in inflammatory bowel diseases, refractory constipation, chronic diarrhea, and metabolic syndrome 3 4. since 2012, our group has been evaluating possible applications for and new methods of applying fmt 5 6 7. previous reports on fmt for delivery of treatment have involved the upper, middle, and lower gut 8 9 10 11. fmt via colonoscopy is a classic approach, but patients have to endure bowel preparation and colonoscopy, especially when they need repeat treatment over a short period of time 12. a traditional enema delivers solution only within the rectal and sigmoid colon which is way, in our previous studies of crohn s disease and ulcerative colitis, why we chose to use fmt for delivery through the mid - gut 6 7. however, patients may find it psychologically difficult to accept fmt through the upper and middle digestive tract. importantly, reflux and aspiration of bacterial liquid may occur and even cause asphyxia 13 14. there is currently no technique for placing a tube through the anus into cecum for whole - colon administration of treatment that could be maintained for repeat fmts or while awaiting fresh fecal microbiota from the lab. therefore, to solve these problems, we designed a new technique called transendoscopic enteral tubing (tet). as shown in fig. 1, the tet tube is fixed to the cecum with clips under endoscopic guidance. concept sketch of fmt treatment by tet. a prospective observational study (nct02560727) was conducted at the second affiliated hospital of nanjing medical university from october 2014 to september 2015. all patients met the inclusion criteria, which were age 10 to 70 years, safety for the pilot study, suitability for endoscopy, and consent to undergo fmt and tet for their diseases and conditions. patients were excluded it they had severe bowel lesions with stenosis, fistula, or the risk of perforation ; complex perianal lesions or serious lesions in the ileocecal junction or ascending colon ; and no proper site for titanium clip fixation. the study was approved by the institutional review board of the second affiliated hospital of nanjing medical university. regular colonoscopy was performed under intravenous anesthesia. after examination and evaluation of the whole colon, the tet tube (fmt medical, nanjing, china) was inserted into the ileocecal junction through the endoscopy channel (fig. 2). the colonoscope was removed from the colon while the tet tube was maintained at the ileocecal junction. the line circle on the tet tube was affixed to the intestinal wall using titanium clips under direct vision (generally two titanium clips at the first station and one to two clips at the second and/or third station as necessary) (fig. 3 and fig. 4). the distal tube was affixed to the skin of the buttocks (preferably on the left side) with medical adhesive plaster. a valve was connected to the terminal tet tube. the procedure time and all related adverse events (aes) attachment of titanium clips to the tet tube to the cecum mucosa at the first station under endoscopic guidance. the tip of the guidewire can be seen within the tube. the second station of tet tube attachment in the ascending colon mucosa with titanium clips under endoscopic guidance. the guidewire can be seen within the tube. according to the concept shown in fig. 1, the patient was required to be in the right - lateral position and then 200 ml of suspension was injected through the tet tube. the 200-ml suspension was a mixture of 150 ml saline and 50 cm centrifuged microbiota that was purified following our lab protocol and using the automatic system genfmter (fmt medical, nanjing) 6 7. the duration of the injection was recorded and intended to be more than 1 minute so as to avoid the abdominal discomfort that would be associated with a quicker procedure. after fmt, patients were required to remain in the right - lateral position for 30 minutes. retention of the microbiota suspension for over 1 hour indicated successful delivery of the microbiota through colonic tet. in some cases, fmt was repeated during subsequent days to ensure infusion of the microbiota to the whole colon. reports from patients of discomfort during fmt were recorded and all of them agreed to participate in the post - treatment survey on satisfaction with tet and fmt. a prospective observational study (nct02560727) was conducted at the second affiliated hospital of nanjing medical university from october 2014 to september 2015. all patients met the inclusion criteria, which were age 10 to 70 years, safety for the pilot study, suitability for endoscopy, and consent to undergo fmt and tet for their diseases and conditions. patients were excluded it they had severe bowel lesions with stenosis, fistula, or the risk of perforation ; complex perianal lesions or serious lesions in the ileocecal junction or ascending colon ; and no proper site for titanium clip fixation. the study was approved by the institutional review board of the second affiliated hospital of nanjing medical university. regular colonoscopy was performed under intravenous anesthesia. after examination and evaluation of the whole colon, the tet tube (fmt medical, nanjing, china) was inserted into the ileocecal junction through the endoscopy channel (fig. 2). the colonoscope was removed from the colon while the tet tube was maintained at the ileocecal junction. the line circle on the tet tube was affixed to the intestinal wall using titanium clips under direct vision (generally two titanium clips at the first station and one to two clips at the second and/or third station as necessary) (fig. 3 and fig. 4). the distal tube was affixed to the skin of the buttocks (preferably on the left side) with medical adhesive plaster. a valve was connected to the terminal tet tube. the procedure time and all related adverse events (aes) attachment of titanium clips to the tet tube to the cecum mucosa at the first station under endoscopic guidance. the tip of the guidewire can be seen within the tube. the second station of tet tube attachment in the ascending colon mucosa with titanium clips under endoscopic guidance. the guidewire can be seen within the tube. according to the concept shown in fig. 1, the patient was required to be in the right - lateral position and then 200 ml of suspension was injected through the tet tube. the 200-ml suspension was a mixture of 150 ml saline and 50 cm centrifuged microbiota that was purified following our lab protocol and using the automatic system genfmter (fmt medical, nanjing) 6 7. the duration of the injection was recorded and intended to be more than 1 minute so as to avoid the abdominal discomfort that would be associated with a quicker procedure. after fmt, patients were required to remain in the right - lateral position for 30 minutes. retention of the microbiota suspension for over 1 hour indicated successful delivery of the microbiota through colonic tet. in some cases, fmt was repeated during subsequent days to ensure infusion of the microbiota to the whole colon. reports from patients of discomfort during fmt were recorded and all of them agreed to participate in the post - treatment survey on satisfaction with tet and fmt. as shown in table 1, 54 patients were included in this prospective study : 32 males and 22 females aged 10 to 70 years (mean sd, 34.5 10.4). of the patients, 23 cases had ulcerative colitis, 16 had crohn s disease, five had unexplained chronic diarrhea, five had constipation, three had small intestinal bacterial overgrowth, and 2 had irritable bowel syndrome. the mean time from advancement of the tet tube through the channel to the end of the tubing was 14.8 minutes. three clips were used on two fixation stations of the tet tube in 36 cases during our preliminary observational period or in patients who only needed short - term retention of tet tube retaining. in the remaining 15 cases, no complications such as mild to serious abdominal pain and bleeding stool were observed. during the tet tube retention period, 98.1 % of patients (53/54) were satisfied with tet ; one patient with ulcerative colitis complained of tolerable mild anal discomfort ; no other patients complained of anal pendant expansion. fmt, fecal microbiota transplantation ; tet, transendoscopic enteral tubing ; sd, standard deviation. a total of 200 ml of fecal microbiota suspension was given to each patient and the mean injection time was 3.2 minutes. in all cases (100 %), fmt through colonic tet was successful. in 88.4 % of cases (49/54), patients reported no discomfort during fmt. one patient (1.9 %) with severe ulcerative colitis complained of abdominal pain after infusion through tet tube, and the symptoms were alleviated with rest. four patients (7 %) reported tolerable mild abdominal distension. in one case, we encountered difficult with the infusion because of bending of the tube at an angle in the intestines, which was resolved with injection of normal saline at high pressure. the time from the end of the fmt to the first defecation was 6.3 0.7 hours. in 35 patients with ulcerative colitis or crohn s disease mesalazine was delivered daily to them through the tet tube until the tube fell off. the retention duration was 12.4 2.3 days. in 19 patients, removal of the tet tube reports exist of use of fmt to deliver treatment to the upper gut, mid - gut and lower gut. the capsule dissolves in the small intestine and bacteria are distributed in the gastrointestinal tract. in mid - gut, the microbiota suspension is injected into the small intestine below the second duodenal segment under endoscopic direct vision or via a nasogastric tube, small intestine stoma or percutaneous endoscopic gastrostomy with jejunal extension (pegj)15. fecal microbiota can be delivered to the lower gut through colonoscopy, enema, distal ileum stroma, colostomy, and colonic tet. the advantages and limitations of different methods of delivering fmt are shown in table 2. fmt : fecal microbiota transplantation ; pegj : percutaneous endoscopic gastrostomy with jejunal extension ; sibo : small intestinal bacterial overgrowth ; tet : transendoscopic enteral tubing. in this study, tet and fmt were successfully performed in all 54 cases (100 %), and fmt retention time was longer than 1 hour. this tet technique and the novel tet accessary devices used demonstrate the feasibility and significance of colonic administration. no serious aes were observed during the tet procedure, infusion of fmt through the tet tube, the period during which the tet tube was left in place, or removal of the device. during the fmt procedure, the mean retention time for the microbiota suspension was enough to meet the requirement for fmt according to our protocol. for patients who required repeat fmt and combined colonic administration of mesalazine, it was a convenient and economic way to use the colonic tet tube. importantly, this method may be less psychologically challenging for patients than delivery of fmt via the upper and middle digestive tract. in 19 patients, the tet tubes were removed after a single fmt or colonic administration. of them, 4 with ibd required removal of the tet tube after fmt and 1-week administration of mesalazine (7 enemas in a single package of salofalk) because there was no need to leave the tet tube in place. according to our lab protocol and clinical flow 6 7, for consideration of improving possible clinical efficacy, the time from defecation of stool to infusion of microbiota was required to be no more than 1 hour. therefore, 15 patients agreed to the use of tet while waiting for fresh microbiota from the lab and because they preferred psychologically delivery through the lower gut, and their tet tubes were removed after fmt. it should be emphasized that the patients daily lives were not affected by tet, and in 98.1 % of cases (53/54), they were satisfied with fmt through tet. for patients with ulcerative colitis that involved the entire colon or crohn s disease, tet should be a wonderful choice for frequently delivering medication into the whole colon. in the current study, all 23 patients with ulcerative colitis and 16 patients with crohn s disease were administered a mesalazine enema through the tet tube. of them, six patients were discharged with the tube and they were able to conveniently infuse medication by themselves at home. besides this pilot study on colonic study for whole - colon administration through a colonic tet tube, a study on the similar concept of tet used for interventional therapy by duodenal or jejunal tet under gastroscopy is ongoing in our center. the sample size of this pilot study was small, but a larger prospective study based on these preliminary results is ongoing. this study did not evaluate clinical responses to whole - colon administration compared with other traditional treatments ; that will be part of our future studies. a cost - efficacy analysis is necessary and the results may vary from country to country depending on policies for medical charges. patients who require only a single fmt (e. g. cdi) may not need to generally may not need to undergo colonic tet if use of fresh fecal microbiota is not a consideration and that is why there were no cdi patients in this study. in conclusion, this study is the first report of colonic tet as a convenient and safe way of delivering fmt. the results highlight the significance of colonic tet as a promising technique for single and repeat whole - colon administration of medication. | background and study aims : placement of a tube through the anus into the cecum has not yet been established as a method of administering whole - colonic treatment. the aim of this study was to evaluate the safety, feasibility, and value of transendoscopic enteral tubing (tet) for fecal microbiota transplantation (fmt) through the colon. patients and methods : a prospective observational study was performed of fmt using a new colonic tet technique. under endoscopic guidance, a tet tube was affixed to the cecum with clips. the safety, value, and satisfaction with the fmt by tet were evaluated. results : a total of 54 patients underwent tet. the success rate of the tet procedure was 100 % (54/54). duration of the tet procedures was 14.8 5.8 min. during the tet tube retention period, 98.1 % (53/54) of patients were satisfied with tet. the retention time for whole - colon delivery of the fecal microbiota suspension was 12.4 2.3 days. in 88.4 % (49/54) of cases, no discomfort was reported during injection through the tet tube of the microbiota suspension. no adverse events were see in patients who required tube extubation after fmt. conclusions : colonic tet is a novel, safe, convenient, and reliable procedure for fmt that results in a high degree of patient satisfaction. |
in 2010, about 8,900 ontario women were diagnosed with breast cancer while 2,100 died of the disease. compared to women without a family history of breast cancer, women with an affected first - degree relative are about twice as likely to develop breast cancer, with risks increasing when any first - degree relatives are diagnosed prior to age 50, and when larger numbers of first - degree relatives are diagnosed [2, 3 ]. a recent review indicated that screening mammography reduced breast cancer mortality for women 3969 years, and while no differentiation was found by familial breast cancer risk, other studies support the effectiveness of mammography and clinical breast examination (cbe) in breast cancer detection in elevated risk women [5, 6 ]. during the study time period, the canadian task force on preventive health care recommended breast screening by mammography and cbe every 1 - 2 years for average risk women aged 5069 years. for women with elevated familial risk, mammogram, cbe, and breast self - examinations (bse) worry is a central construct in theories concerning preventive health behaviours like breast cancer screening, and the self - regulation theory suggests that, depending on conditions, worry may impede or advance disease management. in an earlier paper, hailey hypothesized that the inverted u - shaped curve best portrayed associations between anxiety or fear and screening behaviours in contrast to linear associations. building on self - regulation theory and the hailey hypothesis, the cognitive - social health information processing (c - ship) model proposed a curvilinear or inverted u relationship between worry intensity and screening adherence. according to this model, negative feelings about the self are frequently activated during health information processing, and, once activated, high levels of negative effect and anxious arousal promote avoidance, while lower levels lead to reduced motivation, such that very low and very high levels are associated with lower screening adherence, and middle levels are associated with higher adherence levels. extensive research has been conducted examining the association of worry and breast cancer screening behaviours in average risk women [1517 ]. in particular, the meta - analysis of prospective studies by hay. supports a positive influence of breast cancer worry on screening behaviours (mammography and bse). however, since these studies included women at average risk, most exhibited a narrow range of mild worry, it precluded the examination of potential nonlinear associations. other observational studies on women at elevated familial breast cancer risk found inconsistent associations between worry and breast cancer screening adherence. the majority have examined associations between current worry levels and past breast screening behavior, and, in two of the cross - sectional studies, no significant associations were found between cancer - related worry and mammography utilization [18, 19 ], while a third reported an inverse association between higher levels of mammography screening adherence and lower levels of breast cancer worry. but in other types of screening, namely, cbe and breast ultrasound use, no associations were found between higher uptake levels and higher worry levels [18, 19 ]. only two prospective studies examined the association between breast cancer worry and breast screening in high familial risk women [21, 22 ], and, in one, cancer worry at moderate levels significantly predicted greater mammography adherence, while in the other women with higher levels of breast cancer worry that impacted mood were significantly less likely to utilize mammography than those with low worry levels. to further examine the association between worry and breast screening and to identify potential nonlinear associations, our study prospectively followed a population - based cohort of women at high familial risk. we examined associations between baseline worries of developing breast cancer and screening behaviours at one - year followup for these women with at least one first - degree relative diagnosed with breast and/or ovarian cancer. breast screening adherence behaviours were compared between women at low, medium, and high breast cancer worry levels according to familial risk. this study identified a cohort of female relatives of incident invasive breast cancer cases from the ontario site of the breast cancer family registry (bcfr) funded by the united states national cancer institute. the details of the bcfr and the ontario site of the bcfr have been previously described. invasive breast cancer cases (probands), pathologically confirmed and diagnosed between 1996 and 1998, were identified from the ontario cancer registry. physicians were contacted to obtain permission to mail patients a cancer family history questionnaire (fhq). respondents meeting defined family history criteria and a random sample (25%) of those not meeting criteria were asked to participate in the ontario bcfr site. of those eligible (n = 2587), 1851 (72%) probands participated. these probands were asked for address information and for permission to contact relatives (first degree, those affected with breast, ovarian, or certain other cancers, and their first degree relatives). an invitation letter to participate in the ontario bcfr site was sent to relatives, and those who agreed to participate were sent an epidemiology questionnaire (eq) between 1998 and 2004. this study was conducted a few years after initial recruitment of relatives and included all female relatives enrolled in the ontario bcfr site who completed an eq between 20 and 69 years of age and who were unaffected by breast cancer at the time of the proband 's diagnosis date. from the 3374 participating female relatives, 1514 were residents of ontario and met study criteria. of the 1514 women who were sent a personal history and screening questionnaire (phsq) between november 2005 and march 2007, 1314 (86.8%) were contacted, and 1114 (84.8%) consented to interview. upon exclusion of the 37 with a breast cancer diagnosis, the year one follow - up personal history and screening questionnaire (y1fphsq) was sent to 1077 women approximately one year following the phsq interview. of the 1049 (97.6%) women contacted and eligible, 965 (92.0%) agreed to participate. participants who only had a second - degree relative with breast cancer (n = 30), who had bilateral mastectomy (n = 6), or who had a breast cancer diagnosis since the phsq (n = 6) were excluded. since women at elevated familial breast cancer risk are recommended to have annual breast screening, the 22 women who completed the y1fphsq more than 548 days (1.5 years) of completing the phsq were also excluded. this study was approved by the research ethic boards of mount sinai hospital and the university health network. the first (eq) was self - administered during recruitment of female relatives into the ontario bcfr site ; it collected detailed information on demographics and key behavioural risk factors for breast and ovarian cancers. the two subsequent questionnaires (phsq and y1fphsq) of similar contents were telephone administered, and they updated changes in health behaviours and key demographic characteristics from the eq questionnaire and collected detailed information on breast cancer screening examinations and breast cancer worries. eligible participants were sent an introductory letter with a copy of the phsq or the y1fphsq approximately two weeks prior to contact by phone. this allowed time for participants to recall specific dates and events and allowed reference to the questionnaire during the interview ; further clarification was provided by the trained telephone interviewer during the interview process when necessary. overall baseline worry of developing breast cancer was assessed by two questions on the phsq adopted from earlier work by lerman. each question had choice options of not at all or rarely, sometimes, often, and almost all the time. the questions were (1) during the past month, how often have you thought about your own chances of developing breast cancer ? and (2) during the past month, how often have you worried about your own chances of developing breast cancer ? participants were considered to have low levels of breast cancer worry if responding not at all or rarely to both questions, a medium level if answering sometimes to either or both questions, and a high level if responding often or almost all the time to either or both questions. the phsq (baseline assessment) also asked if participants had a mammogram, cbe, or breast ultrasound since eq completion. both questionnaires asked participants whether the main reason for having these examinations was for screening or for a nonscreening purpose (e.g. due to a breast problem or symptom, followup of a previous breast problem, or participation in a research study). for each screening test in the prospective analysis, participants were dichotomized into those who had a test at year one followup and those who did not. women who had these examinations for nonscreening purposes were excluded for analyses involving the specific test. self - reported date of last mammogram was validated against medical records to assess recall accuracy. age at interview at baseline was calculated as the difference in years between date of birth and date of phsq interview. the highest level of education attained at baseline was obtained from the corresponding question on the phsq. body mass index in kg / m at baseline (< 25, 25 to < 30, and 30) of the participants was derived from information on height (eq) and weight (phsq). the average annual frequency of visiting a health care facility in the past two years (once a year or less, 2 to 3 times a year, and 4 or more times a year) was determined using responses to the phsq. both the eq and phsq assessed prior benign breast diseases. a positive history of benign breast disease was defined as a positive response to either or both questionnaires, whereas negative responses to both questionnaires were considered as absence of benign breast disease history. perceived risk of developing breast cancer (much below or below average, same average risk, above average, much above average) was determined using the phsq question adopted from a comparative measure used earlier by lipkus., compared to other women your age, how likely are you to get breast cancer in your lifetime ? classification of family history of breast and/or ovarian cancer was based on information collected from the fhq completed by the relatives ' proband using a modified definition of previously referenced groups for familial breast cancer risk [5, 9 ]. table 1 shows the criteria for classifying women to low, moderate, or high familial risk to breast and/or ovarian cancer. chi - square tests assessed the association of worries of developing breast cancer (categorized as high, medium, or low) with each demographic or personal characteristic. the internal consistency between the two questions that assessed baseline worry was estimated using chronbach 's alpha. multivariate logistic regression examined relationships between breast cancer worry assessed at baseline and breast cancer screening behaviours at year - one followup. for each screening behavior final models were adjusted for age, education, annual frequency of visiting a health care facility, perceived breast cancer risk, the corresponding baseline screening behavior, and familial risk. as familial risk was identified as a potential effect modifier in the model between baseline worry and mammogram screening at followup, further analyses stratified by familial breast cancer risk were also conducted. since many study participants were related and might share common cancer screening behaviours, potential correlation due to family clustering was corrected by using robust error variances in all regression models. to test for nonlinear associations between breast cancer worry and screening behaviours, likelihood ratio tests compared the model with worry defined as a continuous (0, 1, 2) variable to the model with worry defined by a categorical (low, medium, and high) variable. due to stratification and linearity assessment, a large number of statistical tests were performed ; however, as these did not examine independent association hypotheses (even the two primary outcomes mammography and cbe are strongly associated, chi - square p < 0.0001), a multiple testing correction was not applied. all statistical analyses were conducted using sas version 9.1, and significance of all statistical tests was evaluated using two - sided p values at the 5% level. the analysis cohort included 901 women aged 2371 years from 593 unique families of which 395 (67%) had one family member, 122 (20%) had 2 family members, and 76 (13%) had 3 and up to 6 family members. chronbach 's alpha, which measured the internal consistency between the two questions that assessed baseline worry, was 0.85. of the women interviewed, 305 (34%) reported a low level of worry, 433 (48%) reported a medium level, and 163 (18%) reported a high level under our overall worry level categorization (table 2). women with either medium or high levels of worry compared to low were significantly more likely to be less than 60 years of age, to have visited a health care facility at least twice annually and to perceive their breast cancer risk as above or much above average compared to other women their age (table 2). there were no significant differences between the three worry levels within strata defined by educational level, familial breast cancer risk, body mass index, or history of benign breast disease. at year - one followup (table 3), a significant nonlinear relationship was observed between breast cancer worry and mammography screening in all women (p value = 0.034). compared to all women at a medium worry level of developing breast cancer, women at low worry were significantly less likely to have a screening mammogram (or : 0.66, 95% ci : 0.450.98). consistent with an inverted u - shaped relationship, all women with high compared to medium worry were less likely to have a mammogram although this association was not significant (table 3 and figure 1(a)). although not significant, a similar inverted u - shaped relationship was observed for women at moderate or high familial risk. compared to those with medium worry levels, women with low worry (or : 0.52, 95% ci : 0.300.90) and with high worry levels (or : 0.77, 95% ci : 0.411.44) were less likely to have a screening mammogram. for all women and for women at low familial risk, those at high worry levels were significantly less likely than those with medium worry to have cbe screening at year - one followup (or : 0.52, 95% ci : 0.340.82 ; or : 0.40, 95% ci : 0.210.76, resp.). in both groups, a significant nonlinear inverted u - shaped relationship was observed between worry and cbe (table 3 and figure 1(b)). compared to those with medium worry, all women with high levels of worry were more likely to have a screening breast ultrasound at year one followup (or : 1.90, 95% ci : 1.003.62) although this relationship did not reach significance. a borderline significant nonlinear relationship (p - value = 0.051) these women were more likely to have a screening breast ultrasound if their breast cancer worry was low or high compared to medium (low versus medium or : 1.76, 95% ci : 0.78 3.96 ; high vs. medium or : 2.36, 95% ci : 0.916.10) although these associations were not significant. in contrast, women at low familial risk were less likely to have a breast ultrasound if their worry was low compared to medium (or = 0.53 ; 95% ci : 0.191.46) (table 3 and figure 1(c)). among all women in this cohort, we observed a significant nonlinear inverted u relationship indicating a lower likelihood of obtaining a screening mammogram at followup if baseline worry levels were low or high compared to medium. a similar and significant inverted u association was found between worry and cbe for all women and women at low familial risk. our prospective analyses are consistent with the cognitive - social health information processing model, as medium worry levels predicted the likelihood of screening mammogram uptake at one year followup in all women. moderate cancer worry levels significantly associated with greater mammography adherence at one - year followup, while in the other, the odds of obtaining a mammogram at 12 months were 70% lower for women reporting a higher level of worry that impacted mood, compared to lower worry levels. our study is the first to examine the relationship between breast cancer worry and cbe utilization prospectively, and to find a significant inverted u - shaped association for all women and women at low familial risk. women were less likely to have a screening cbe at year - one followup if worry was low or high compared to medium. as previous cross - sectional studies reported no significant association between breast cancer worry and cbe utilization [18, 19 ], it is likely that differences in study design accounted for these discrepant results. the reverse influence of screening results on worry would be of greater concern in a cross - sectional examination as compared to our prospective analysis. we found higher but insignificant breast ultrasound uptake for women regardless of familial risk level at high cancer worry compared to medium worry ; this finding is consistent with a previous cross - sectional study where no significant associations between worry and breast ultrasound examination were reported. as breast ultrasound is usually recommended as a supplement to mammography in breast cancer screening in women with higher familial risk, worry levels may play a smaller role on its uptake in comparison to those of mammography or cbe. this could explain the differences in the associations observed between mammogram and cbe versus breast ultrasound. the present study had notable strengths ; a large cohort of female relatives of breast cancer cases from a population - based registry were studied with adequate power to examine all associations. to - date, our study is the first to examine prospectively the associations between breast cancer worry and cbe and breast ultrasound, in addition to mammography. our analysis was stratified by degree of familial breast cancer risk, after a significant interaction between worry and familial risk was observed for mammography screening uptake at followup. in other studies, women with family histories of breast cancer exhibited a higher level of worry than women without [31, 32 ], and higher familial risk influenced breast cancer screening practices [33, 34 ]. attempts were made to reduce study limitations by minimizing misclassifications through the use of self - reported breast screening behaviours. although self - reported mammography data has been found to be accurate for determining whether a woman had a mammogram, self - reported data is less accurate in determining the duration since last mammogram since women tend to underestimate resulting in overestimations of recent mammography use [36, 37 ]. to minimize recall inaccuracy, the phsq and yifphsq were mailed to the participants to allow recollection of dates and events prior to telephone interview. to estimate the magnitude of recall bias, self - reported date of last mammogram was validated against medical records, and approximately 92% of women reported their last mammogram to be within 12 months of the actual date. participants in this study were residents of ontario with universal health care coverage and an organized breast cancer screening program for women 50 years of age and older. therefore, findings may be less applicable to populations where there is more limited health care coverage or access to screening. in this cohort of women at elevated familial risk for breast cancer, medium levels of worry were more influential than either low or high worry levels for the uptake of screening mammography and cbe. furthermore, the strength of association between worry and screening behaviours depended on the level of familial risk. findings from this study are important for clinical management and development of educational materials that address worry levels for women with various levels of familial breast cancer risk in order to achieve optimal breast cancer screening adherence. | background. few prospective studies have examined associations between breast cancer worry and screening behaviours in women with elevated breast cancer risks based on family history. methods. this study included 901 high familial risk women, aged 2371 years, from the ontario site of the breast cancer family registry. self - reported breast screening behaviours at year - one followup were compared between women at low (n = 305), medium (n = 433), and high (n = 163) levels of baseline breast cancer worry using logistic regression. nonlinear relationships were assessed using likelihood ratio tests. results. a significant non - linear inverted u relationship was observed between breast cancer worry and mammography screening (p = 0.034) for all women, where women at either low or high worry levels were less likely than those at medium to have a screening mammogram. a similar significant non - linear inverted u relationship was also found among all women and women at low familial risk for worry and screening clinical breast examinations (cbes). conclusions. medium levels of cancer worries predicted higher rates of screening mammography and cbe among high - risk women. |
porcine circovirus (pcv) is a small nonenveloped virus that contains a single - stranded circular dna of about 1.76 kb. pcv was originally isolated as a noncytopathic contaminant of the pk-15 cell line and was classified as a member of circoviridae family, genus circovirus, based on its morphological and genomic characteristics [2, 3 ]. pcv-1 was first detected as a contaminant of the porcine kidney pk-15 cell line whereas pcv-2 has been associated with postweaning multisystemic wasting syndrome (pmws) [5, 6 ], porcine dermatitis and nephropathy syndrome (pdns), proliferative necrotizing pneumonia, and reproductive disorders, all of them included by the term porcine circovirus associated diseases (pcvad). pmws is an emerging disease in pigs first described in a swine herd in canada in 1991 and also endemic in many swine - producing countries. in argentina, diagnosis of pmws is based on the presence of compatible clinical signs, characteristic histopathological lesions, and detection of pcv-2 antigen within typical lesions [10, 13 ]. the genomic structure of pcv-2 consists of two intergenic regions flanked by three open reading frames (orfs) : orf-1, which encodes two replication proteins (rep and rep), orf2, which encodes the cap protein containing the immunoreactive epitopes and is more variable at nucleotide sequence than orf1, and orf3, which encodes a proapoptotic protein. currently, pcv-2 genotype definition and nomenclature has been proposed according to the genome sequence of the whole genome and/or orf2 [15, 16 ]. five genotypes have been identified to date [17, 18 ] : pcv-2a and pcv-2b, which correspond to the main phylogenetic groups, pcv-2c, which has been described only in denmark, and pcv-2d and 2e, which have been described in china. pcv-2a has been further subdivided into five clusters (2a2e) and pcv-2b into three clusters (1a1c). since 2005, high mortality outbreaks of pmws reported in north america have been associated with pcv-2b [19, 20 ]. in south phylogenetic studies have shown that pcv-2 isolates belong to pcv-2b and pcv-2a [21, 22 ]. the objectives of this study were to compare the nucleotide and amino acid sequences of the pcv-2 orf2 identified in lymph nodes from pigs with pcvad from different herds of argentina between 2003 and 2008. immunohistochemistry was performed with a polyclonal anti - pcv-2 antibody (vmrd, inc., wa, usa, 210 - 70 pcrv). slides were flooded for 15 min with 3% h2o2 to remove endogenous peroxidase activity. tissues were rinsed for 5 min in 0.1 m pbs (ph 7.5) and then incubated with preheated 0.05% protease xiv for 40 minutes. tissue sections were rinsed in pbs and flooded with 0.5% skim milk in pbs for 20 min at room temperature. pcv-2 antibody was used at a 1/200 dilution in 0.1 m pbs, and incubated for 1 hour at 37c. biotinylated g protein (1/500) was used as a secondary antibody and was incubated for 40 min at room temperature. streptavidin - peroxidase (lsab2 system hrp k0673, dako laboratories co., ca, usa) was applied for 15 min at room temperature. sections were finally incubated in diaminobenzidine - hydrogen peroxide solution for 8 min and counterstained with harris ' haematoxylin. immunohistochemistry were graded based on the intensity of immunolabelling as follows : + = slight, + + = moderate, and + + + = abundant. the samples used in this study corresponded to pig submissions to the diagnostic pathology service, faculty of veterinary science, la plata national university, argentina, from 2003 to 2005, and to the virology laboratory from the faculty of veterinary science of buenos aires from 2007 to 2008. these samples originated from 101 lymph nodes from pigs (36 to 140 days old) with confirmatory pcvad diagnosis by immunohistochemistry (ihc). samples from 2003 to 2005 were pooled in nine groups (610 samples / pool) according to the farm, province, and year of collection. samples were homogenized with a mortar and pestle, in some cases after deparaffinization with xylene, and kept at 80c until processed. dna extraction was carried out using the qiaamp dna mini kit (qiagen, valencia, usa) in accordance with the manufacturer 's instructions. pcv-2 specific dna was amplified by pcr with gotaq (promega) in a mycycler thermocycler (biorad, uk). the orf2 from positive samples was further amplified from nucleotides 998 to 1757 (pcv-2b genome ; genbank accession number, af112862), using the protocol reported by fort.. in this protocol, two internal primers (caparv 5-accctttgaatactacaga-3 and capbfw 5-gggaggagtagtttacata-3) were added to make the sequencing process more reliable, since it amplifies the whole orf2 in two partially overlapping fragments. cycling conditions were as follows : 94c 5 min, 35 cycles of 45 sec at 94c, 45 sec at 42c and 1 min at 72c, and a final extension cycle of 7 min at 72c. orf2 amplified fragments were sequenced with the bigdye terminator kit (applied biosystems, foster city, ca, usa) on an abi 3500xl genetic analyzer (applied biosystems, foster city, ca, usa). then, all available isolates obtained were included in a multiple alignment using clustal x version 1.8.3 program, and the percent identities were calculated. the phylogenetic trees, calculated by the neighbor - joining method, were computed with the dnadist and neighbor modules of the phylip package. bootstrapping values (1000 replicates) were calculated with the seqboot, dnadist, neighbor, and consense modules. branches with bootstrapping values 70 were considered significant, corresponding to a confidence interval 95%. for visualization and printing of the trees, the treeview program,, we used the sequence of a porcine circovirus 1 (genbank accession number ay184287). the signs that predominated in the affected pigs were principally wasting in which the animals presented slow growth, lethargy, anorexia, cachexia, diarrhea, and dyspnea (table 1). from those animals, 101 lymph nodes were processed and 58 (57.4%) were positive for pcv-2 by ihc. samples from 2003 to 2005 were grouped in 9 pools and 8 (88.8%) were positive for pcv-2 by pcr. seven samples from 2007 and 2008 were processed individually and all resulted positive by pcr. the entire cap coding region of 16 argentinean samples was amplified and sequenced (table 1). the sequence analysis showed that they contained 699 nt, and no gaps were detected. all sequences presented the typical pcv-2 1486 motif tcaaacccc / cgc. at the amino acid level, only two polymorphic sites were detected in the following samples : in 7109 we found k63r and in 7013, 7108, and 7198 we found t190a. only the k63r mutation was localized in an immunogenic domain, specifically at the domain a. these sequences were aligned with cap gene sequences from pcv-2 strains available in the genbank database from different countries. all argentinean amino acid sequences showed high identity with the sequences grouped in genotype 2b. the phylogenetic tree obtained with the argentinean and reference pcv-2 strain sequences showed two main clusters wellsupported by bootstrap analysis (figure 1). all the argentinean sequences analyzed grouped together in one cluster and were closely related to sequences from genotype pcv-2b isolates, and more specifically to cluster 1a - b. in this last case, the low bootstrap values made the differentiation of the two clusters uncertain. this cluster grouped also isolates from europe (hungary, france, austria, and the netherlands), asia (china), and north america (usa and canada). in the other cluster, named 1c, only grouped sequences from asia (china). recent phylogenetic analysis of complete pcv-2 genomic sequences obtained from genbank and full - length orf2 sequences resulted in two major genogroups : 2a and 2b, which are circulating worldwide, 2c, which have been sporadically reported in the 80s, and 2d and 2e, recently described in china. the significance of these differences in terms of disease and/or geographic location is currently unknown. however, the severe re - emergence of pcvad in north america in 2005 coincided with the identification of the pcv-2b genotype. in addition, an epizootic of pmws in switzerland was found to be associated with pcv-2b while pcv-2a was identified in single cases of pmws prior to 2003. furthermore, experimental studies in gnotobiotic pigs with or without immunostimulation using pcv-2b alone have shown only moderate lesions in various organs, thus indicating that pcv-2b - stimulated pigs became infected but did not progress to a disease state. however, another study using gnotobiotic pigs and cell culture - derived pcv-2a and pcv-2b clones showed that both were able to induce severe disease in this model. a study has highlighted the importance of the order of infection in which gnotobiotic pigs inoculated with pcv-2b seven days after a pcv-2a infection, but not vice versa, cause pmws. unfortunately, sequence studies with pcv-2a followed with pcv-2b in conventional pigs are still lacking. the above results are indicative of sometimes contradicting information regarding pcv-2 genotyping and its relationship with disease condition. although it is generally believed that the causes of illness depend on unknown factors, more information related to pcv-2 genotyping could help for a better understanding of the pathogenic mechanisms of pcv-2. in the present study, pcv-2 sequences obtained from 16 different farms belonging to the main pig - producing provinces of argentina were analyzed to determine the pcv-2 genotype. only samples from 2003 to 2008 with confirmatory diagnosis of pcvad sequence and phylogenetic analyses clustered the pcv-2b group with a common a - b subgroup, with an identity of 99.8%. the reason we named a new cluster a - b is because bootstrap values were not suitable enough, based on the sequences used in this study, to support the differentiation between clusters a and b. the pcv-2b sequences identified were very similar to an isolate previously reported in argentina in 2005 (genbank ef458306). the argentinean pcv-2b genotype isolates were found to be closely related to some isolates from brazil 2004, north america 2005, europe 2003 - 2004, and china 2002. in addition, all sequences present the 1486 motif tca / aac / ccc / cgc belonging to the pcv-2b genotype described by cheung. 2007, and contain amino acid substitutions similar to those described by grau - roma. 2008. in canada, pcv-2b isolates from pmws outbreaks in 2005 share an interval identity between 99% and 100%. however, other studies have identified distinctive genotypes from pcvad samples [28, 32 ] and a variable identity within each genotype. in argentina, the first outbreak of pmws was reported in 2002 and thereafter clinical pcvad emerged as emerging diseases. our study comprised pcvad samples taken from 2003 to 2008 and the results suggest that pcv-2b is the predominant genotype in argentina and that it could be associated with a systemic form of pcvad, namely, pmws. in argentina, serological or immunohistochemical retrospective studies on pcv-2 have not been carried out and, therefore it remains unknown how and when pcv-2b was introduced in the argentinean herds. other sources of infection such as inappropriate used of vaccines can be ruledout because only inactivated pcv-2 and pcv-2 orf2 protein vaccines have been licensed. in summary, the present study contributes to the knowledge on the distribution of pcv-2 genotypes circulating in argentina. our findings may also help to establish a base of information to study the emergence of new viral variants in this region. | porcine circovirus type 2 (pcv-2) has been associated with syndromes grouped by the term porcine circovirus associated diseases (pcvad). the pcv-2 isolates have been grouped into two major groups or genotypes according to their nucleotide sequence of whole genomes and/or orf-2 : pcv-2b, which have, in turn, been subdivided into three clusters (1a1c), and pcv-2a, which has been subdivided into five clusters (2a2e). in the present study, we obtained 16 sequences of pcv-2 from different farms from 2003 to 2008, from animals with confirmatory diagnosis of pcvad. since results showed an identity of 99.8% among them, they were grouped within a common cluster 1a - b. this preliminary study suggests a stable circulation of pcv-2b among the argentinean pig population. |
hydatidosis is a chronic infection of medical and veterinary importance caused by the larval stage of cosmopolitan parasitic platyhelminth echinococcus granulosus. this disease is considered as re - emerging zoonosis in several countries and endemic in algeria ; it is considered as disease for obligatory declaration by the national institute of public health (insp). although surgery is the main therapeutic approach, medical and percutaneous treatments have been used in recent years. percutaneous treatment and injection with scolicidal compounds has become an alternative to the surgery because of successful results obtained in recent studies [4, 5 ]. the hydatid cyst consists of two layers : an inner germinal layer and an outer carbohydrate - rich laminated acellular layer which protects the parasite from host immune cells [6, 7 ]. the germinal layer (gl) nitric oxide (no) has been postulated to play a role in the host defence mechanism in hydatidosis [9, 10 ]. we have previously shown the production of no2 in sera and cystic fluids obtained from patients carrying different cystic localization. furthermore, human inducible no synthase (nos2) expression during hydatidosis has been detected in liver biopsies from patients by immunochemical method. nos2 expression was observed in hepatocytes and kuppfr cells from hydatid patients [9, 11 ]. it is synthesized by a family of nos isoforms using l - arginine as the substrate. it has been implicated in neurotransmission, vasodilatation, and immune regulation. in response to stimuli, activations of nadph oxidase and nos2 this high no production has been implicated in several cytostatic and cytotoxic actions against a number of pathogens, owing to the radical nature of no. no is very reactive toward oxygen ; it yields nitrite (no2) and nitrate (no3) as end products. the simultaneous production of superoxide anion (o2) and no combines at diffusion controlled rates to produce peroxynitrite (onoo). peroxynitrite oxidizes and nitrates a variety of targets ; it was received much attention as the potential mediator of no cytotoxic effects. antiparasitic effect of no has been reported on protozoan parasites (leishmania, trypanosoma, entamoeba) and metazoa including schistosoma, fasciola, and echinococcus. despite the production of no in the host response to e. granulosus infection, direct effects of no metabolites the present study is designed to test the efficacy of these metabolites on the viability of pscs and cystic wall of human hydatid cysts in vitro. using culture system of pscs and pieces of cystic walls, we investigated the effects of (no3, no2, onoo) on pscs tegument and cystic walls integrity. the morphological changes are important in indicating the efficacy of metabolites because the hydatid cyst walls constitute the interface between the macroparasite and hosts. the time of incubation is an important factor in defining the susceptibility of the parasites to the action of metabolites in vitro and might be a promising protoscolicidal agent in hydatid surgery. twelve e. granulosus hydatid cysts were obtained from hydatid patients who carried hepatic and pulmonary cysts after surgical extirpation. all patients were admitted to the mustapha bacha hospital (department of surgery, algiers, algeria). all subjects are informed consent for the present study, which was carried out according to the guidelines of the local ethics working group. cyst fertility was determined by the presence of free protoscolices (pscs) in cystic fluid. other parameters of cyst fertility are considered such as a whitish color of laminated layer and limpidity of cystic fluid. peroxynitrite was synthesized from sodium nitrite and hydrogen peroxide using a quenched flow method and assayed spectrophotometrically at 302 nm (extinction coefficient = 1670 mcm). after aseptic dissection of the intact hydatic cysts, the fluid was removed and centrifuged at 3000 rpm for 30 minutes at 4c. the pellet containing pscs was washed resuspended in pbs (phosphate buffered saline) ph 7.2 then adjusted and adjusted to 10 pscs / ml in rpmi1640 medium supplemented with 15 mm tris hcl ph 7.5, 2 mm glutamine, and 10% fetal calf serum. it was determined by body movement observed under inversed microscopy and vital staining with 0.1% methylene blue. germinal layer (gl) joined to laminated layer (ll) was dissected from open intact cysts. protoscolices and pieces of germinal and laminated layers were cultured in rpmi1640 medium supplemented with 10% fetal calf serum (fcs). they were cultured in the absence and presence of increasing concentration of sodium nitrite (nano2), sodium nitrate (nano3), and sodium peroxynitrite (noona) (20, 40, 80,160 and 320 m) incubated at 37c in humid atmosphere of 5% co2 for 24 hours and 48 hours. this observation was confirmed by statistical study (anova) for 24 hours and 48 hours compared with the control culture. it has no significant differences between the mortality of cultured pscs in presence of increasing concentrations of nitrate for 24 hours (p =.99) and 48 hours (p =.993) compared to control culture (table 1). microscopic examination showed that majority of pscs were still viable ; they exhibited distinct movements and conserved with conserv the membrane integrity, order of hooks, and calcareous corpuscles. of those, some were invaginated, others were evaginated, and suckers were clearly visible (figure 1(c)).these observations indicate the morphological evolution of pscs in culture medium in spite of treatment with nitrate. loss of pscs viability in nitrite - treated cultures became after 24 hours with 71.14 2.39% of mortality in presence of 320 m of no2 (table 1). after 48 hours, we observed that scolicidal activity was affected by nitrite in concentration dependent manner. this tegumental disruption concerned the both forms of invaginated and evaginated pscs (figure 1(d)). alteration of pscs structure showed disruption of external plasma membrane of soma (caudal region) with liberating vesicles and calcareous corpuscles in culture medium. the presence of free hooks in culture medium indicated their detachment and destruction of the tegument (figure 1(d)). a significant reduction in motility was observed after few minutes in cultures treated with 80 m of peroxynitrite.the pscs viability is dramatically affected after 20 minutes of incubation (100% of mortality) (table 1). the mortality of pscs is significantly different between treated parasites with different concentrations of peroxynitrite after 24 hours of incubation at 37c. the presence of residues of membranes (ghost membranes) indicates destruction of the tegument (figures 1(e) and 1(f)). incubation of isolated germinal layer (gl) from laminated layer (ll) with 80 m of peroxynitrite shows a high cytotoxic effect with alteration of the membrane integrity (figure 2(c)) compared to the action of the nitrite (figure 2(b)). untreated laminated membrane (ll) is constituted of lamellar layer observed under microscope of inversed phase (see figure 3(a)). the effects of nitrite are observed after 24 hours of incubation of layers with 320 m. the first modifications related to the cytotoxic action of peroxynitrite appeared with time after 15 minutes of incubation in presence of 80 m of onoo. loss of lamellar structure is also observed (figures 3(g) and 3(h)). in vitro study of peroxynitrite toxicity on pieces of hydatid membranes intensity of cytotoxic action is characterized by darkening of germinal layer and pieces of joined layers. these modifications depend on the concentrations of the two metabolites and the time of exhibition (figure 3). cytotoxic effects of no on hydatid cysts were previously investigated by determining the no2 levels in sera of hydatid patients and human cyst fluids (fertile and infertile). furthermore, pbmcs from hydatid patients incubated with ifn- alone are effective in killing the pscs in vitro [10, 17 ]. in the present work, the comparative study of the direct effects of no metabolites suggests that reactive nitrogen intermediates (rnis) play an important role in the antihydatic mechanism. moreover, we have observed that the onoo is a most effective and rapid scolicidal metabolite which may well be of clinical value than no2. thus it may be possible to use this metabolite as the scolicidal agents in surgery to avoid the risk of dissemination of viable pscs coming from fertile fluids and germinal layer that leading to secondary infection. based on these results, the cytotoxic effect of no on pscs viability and hydatid layers suggests the relevant role of no in the host defense against hydatid infection. our results are in agreement with most studies related to the antiparasitic role of no. endogenous and exogenous no has been reported in inhibiting the development of intracellular parasites including trypanosoma, leishmania, plasmodium, toxoplasma and extracellular protozoa (entamoeba) as well as schistosoma. it has been shown that apoptosis is induced in vitro by no species in entamoeba histolytica and renders them incapable of surviving in hamster 's livers. moreover, no produced from activated peritoneal macrophages and s - nitroso - n - acetylpenicillamine has been reported in killing murine hydatid cysts of echinococcus granulosus. moreover, no produced from murine activated macrophages has been reported in killing pscs of echinococcus multilocularis in vitro. interestingly, the therapeutic treatment of cutaneous leishmaniasis with no - releasing drugs has been approached [23, 24 ]. in terms of the time course of no2 and onoo action, our observation indicated that peroxynitrite is a rapid scolicidal metabolite but nitrite had a slow action. disruption of the tegument and desorganization of the double crown of hooks are observed 24 hours after incubation of parasites with 320 m of no2 ; its cytotoxicity appeared to be a progressive process. on exposure to no, brugia malayi and onchocera linealis showed reduction in motility within 530 minutes. these results suggest a functional alteration of pscs metabolism. indeed, inactivation of parasite enzymes by no appears to be relevant in inhibition of physiological functions that contribute to survival of parasite in the host and viability was affected. inhibition has been suggested to explain the cytostatic effect of no on trypanosoma brucei gambiense and t. b. brucei. [the present study is the first to demonstrate the in vitro cytotoxic effect of the onoo on the hydatid viability (pscs and cystic layers). however, recent studies have demonstrated the onoo - mediated leishmania amazonensis amastigote killing in vitro. more ever, onoo can decrease the life span of ovine liver flukes fasciola hepatica and dicrocoelium dendriticum in vitro., the onoo induces a dramatic effect on pscs viability with loss of tegument integrity. treated pscs with 80 m of this anion showed rapid degenerative changes suggesting its usefulness in surgery as scolicidal agent (figures 1(e) and 1(f)). onoo induces cellular damage by triggering one of the basic cell death pathways, apoptosis or necrosis. however, enzymes containing a redox active transition metal center are the prime targets of the oxidant. reactions of onoo are affected by the local ph and the microenvironment with hydrophobic membrane compartments favoring nitration and aqueous environments favoring oxidation. specifically, the reaction of carbon dioxide with peroxynitrite produces carbonate radical anion and nitrogen dioxide, whose concerted action leads to nitration of tyrosine residues forming nitrotyrosine, a marker of the toxic no pathway. the detection of nitrotyrosine illustrates the site of peroxynitrite production and oxidative stress, providing evidence of the toxicity of no. in vivo studies of the leishmanicidal effect of peroxynitrite functional alteration of membrane proteins may impair intracellular ionic composition and transport of essential metabolites, all of which are processes crucial to cell survival. these data combined with our results suggest probable in vivo production of onoo during hydatidosis and may be implicated in the host defense mechanism against e. granulosus. this no species is likely to be the main cytotoxic effector produced by the macrophages in vivo. for this, it is relevant to investigate cytotoxic effects of this anion in vivo during hydatidosis. in addition to its efficacy against pscs, onoo also exhibits a considerable damaging effect on the hydatid membranes that characterized by darkening of the pieces of cystic layers. germinal layer of e. granulosus had been shown also to be susceptible to the nitrite. in comparison of the cytotoxic effects of these two metabolites, after three days of incubation of pieces of cystic walls, we observe residues of germinal layer in culture medium isolated from laminated layer. the separation of the germinal layer (g.l.) from laminated layer (l.l.) deprives the first one to the source of nutriments essential in pscs development, and this contributes to the nonviability of the hydatid, this may be a line to therapy approach. prospectively, the introduction of no donors could help patients suffering from cystic echinococcosis undergo improved chemotherapy by resorption of hydatid. in conclusion, with this comparison study, we provide here multiple lines of evidence for the role of no and many other derived radicals in immune response against e. granulosus. the production of no species by activated macrophages may be capable of a significant role in preventing the dissemination of e. granulosus infection. the results described here suggest the possible in vivo production of onoo and its involvement in the antihydatid mechanism. in addition to the beneficial effect of no, it can be detrimental to the host organs carrying the hydatid cysts. more human in vivo investigations are required to define the mechanisms by which peroxynitrite is cytotoxic. | hydatidosis is characterized by the long - term coexistence of larva echinococcus granulosus and its host without effective rejection. previous studies demonstrated nitric oxide (no) production (in vivo and in vitro) during hydatidosis. in this study, we investigated the direct in vitro effects of no species : nitrite (no2), nitrate (no3) and peroxynitrite (onoo) on protoscolices (pscs) viability and hydatid cyst layers integrity for 24 hours and 48 hours. our results showed protoscolicidal activity of no2 and onoo 24 hours and 3 hours after treatment with 320 m and 80 m respectively. degenerative effects were observed on germinal and laminated layers. the comparison of the in vitro effects of no species on the pscs viability indicated that onoo is more cytotoxic than no2. in contrast, no3 has no effect. these results suggest possible involvement of no2 and onoo in antihydatic action and point the efficacy of these metabolites as scolicidal agents. |
aniline is a solvent used in dyes, antioxidants, rubber accelerators, drugs, photographic chemicals, isocyanates, herbicides, and fungicides.. antidote methylene blue [figure 1 ] 12 mg should be started after 4 h of exposure as the symptoms or extent of toxicity of poisoning can not be determined before that. depending on the type of exposure and extent of poisoning, there are different nonpharmacological management strategies. here methylene blue is the antidote for aniline poisoning, unfortunately methylene blue itself can cause fatal methemoglobinemea and hemolytic anemia, which warrants close observation here we present two cases of occupational exposure to aniline fumes leading to methemoglobinemea and hemolytic anemia. a 45-year - old male patient came to the emergency ward with a history of exposure to chemical fumes at work, in a pharma company in mysore. the patient was conscious, oriented, and on examination bluish discoloration of the skin and tongue was seen ; he was extremely cyanotic and complaining of breathlessness, dizziness, and tingling sensation of extremities gradually increased over 2 - 3 h. immediately on his arrival, high - flow oxygen therapy was instituted along with bronchodilators and hydrocortisone. aniline poisoning was suspected and 75 mg stat dose of methylene blue was intravenously administered as per standard treatment protocol. arterial blood gas analysis was performed, which showed significantly elevated methemoglobin levels and was suggestive of respiratory acidosis. in the meanwhile, the chemical fumes inhaled by the patient were confirmed as aniline by the company officials. few hours after methylene blue administration, a repeat arterial blood gas analysis showed drastically reduced methemoglobin levels. the patient on a later stage was diagnosed to have hemolytic anemia due to methemoglobinemea. a 24-year - old male patient, who works in a pharmaceutical company was admitted to the emergency department with the complaints of difficulty in breathing, 34 episodes of vomiting, confusion, and disorientation. the patient presented with a history of inhalation of fumes of caustic water mixed with chemicals. details of chemicals were not known at the time of admission. on examination, bluish discoloration of skin and mucous membrane, respiratory distress, and epigastric tenderness was seen. as part of symptomatic management, high - flow oxygen therapy was instituted, along with bronchodilators and hydrocortisone. aniline poisoning was suspected and 75 mg stat dose of methylene blue was administered intravenously. on enquiry pertaining to the chemical fumes inhaled, it was later on found from the company officials that, the patient inhaled fumes of 4-bromo- 2-fluro aniline. all laboratory investigations were normal except fmethb (methemoglobin fraction) (normal < 1.5%), which was found to be elevated (3.4%) suggestive of methemoglobinemia. after receiving three doses of methyl blue, patient 's fmethb levels reached near - normal values, but red blood cell count has significantly reduced from 4.71 to 3.20 trillion cells / l suggestive of hemolytic anemia. a 45-year - old male patient came to the emergency ward with a history of exposure to chemical fumes at work, in a pharma company in mysore. the patient was conscious, oriented, and on examination bluish discoloration of the skin and tongue was seen ; he was extremely cyanotic and complaining of breathlessness, dizziness, and tingling sensation of extremities gradually increased over 2 - 3 h. immediately on his arrival, high - flow oxygen therapy was instituted along with bronchodilators and hydrocortisone. aniline poisoning was suspected and 75 mg stat dose of methylene blue was intravenously administered as per standard treatment protocol. arterial blood gas analysis was performed, which showed significantly elevated methemoglobin levels and was suggestive of respiratory acidosis. in the meanwhile, the chemical fumes inhaled by the patient were confirmed as aniline by the company officials. few hours after methylene blue administration, a repeat arterial blood gas analysis showed drastically reduced methemoglobin levels. the patient on a later stage was diagnosed to have hemolytic anemia due to methemoglobinemea. a 24-year - old male patient, who works in a pharmaceutical company was admitted to the emergency department with the complaints of difficulty in breathing, 34 episodes of vomiting, confusion, and disorientation. the patient presented with a history of inhalation of fumes of caustic water mixed with chemicals. details of chemicals were not known at the time of admission. on examination, bluish discoloration of skin and mucous membrane, respiratory distress, and epigastric tenderness was seen. as part of symptomatic management, high - flow oxygen therapy was instituted, along with bronchodilators and hydrocortisone. aniline poisoning was suspected and 75 mg stat dose of methylene blue was administered intravenously. on enquiry pertaining to the chemical fumes inhaled, it was later on found from the company officials that, the patient inhaled fumes of 4-bromo- 2-fluro aniline. all laboratory investigations were normal except fmethb (methemoglobin fraction) (normal < 1.5%), which was found to be elevated (3.4%) suggestive of methemoglobinemia. after receiving three doses of methyl blue, patient 's fmethb levels reached near - normal values, but red blood cell count has significantly reduced from 4.71 to 3.20 trillion cells / l suggestive of hemolytic anemia. aniline has previously been implicated as a methemoglobin - producing chemical, but the mechanism of action for this response has not been fully elucidated. it has been postulated that a metabolic transformation of aniline to an oxidative metabolite is necessary for the production of methemoglobin. hemolytic anemia developed in these patients could be broadly attributed to aniline poisoning and antidote used, that is, methylene blue as both aniline and methylene blue could cause oxidative stress, which destroys the red cells in the blood. some studies suggest that the patient with glucose-6-phosphate dehydrogenase (g6pd) deficiency are more prone to get hemolytic anemia ; however, g6pd in these patients was not determined. the seemingly innocuous inhalation exposure to 4bromo-2fluro aniline can lead to life - threatening methemoglobinemia. strict measures should be fostered to possess specific antidote at all times in sufficient quantity in every company that makes use of chemicals so as to ensure safety and wellbeing of employees. | methylene blue is utilized as the main treatment of methemoglobinemia. here we report two cases, in which patient suffered from aniline - induced methemoglobinemia with initial good response but later developed haemolytic anemia due to methylene blue therapy. he was treated with hydration, high flow oxygen and steroid therapy. caution should be exercised while using methylene blue as antidote of acute methemoglobinemia as both methemoglobinemia and its antidote methylene blue can itself precipitate fatal haemolytic anemia. |
chronic lymphocytic leukaemia (cll), the commonest type of leukaemia, is a generalised malignancy of lymphoid tissue originating in the bone marrow. it is characterised by an accumulation of monoclonal lymphocytes, usually of b cell type. the malignant lymphocytes spread from the bone marrow to blood, lymph nodes and other organs. cll is regarded as small lymphocytic lymphoma when lymph nodes are involved but the blood film and, in particular, the white blood cell count is normal. we report a case of a 71-year - old man who had cll discovered incidentally in the gall bladder wall following laparoscopic cholecystectomy with no history of cll prior to surgery. a 71-year - old man underwent elective laparoscopic cholecystectomy following an episode of gallstone pancreatitis. the gall bladder was received opened with an empty lumen, the presence of gallstones having been noted at the time of surgery. the mucosa was its usual green, velvety appearance and the serosal surface showed shaggy adhesions. the gall bladder was sampled in the standard way, namely with sections from the neck, fundus and head. the sections from the neck and fundus showed acute - on - chronic mucosal inflammation with focal mucosal erosion. histology of the section from the head of the gall bladder showed an acute - on - chronic inflammatory infiltrate within the mucosa along with a dense lymphoid infiltrate in the gall bladder wall (figure 1). the lymphocytes were small and, other than the monomorphous appearance, were cytologically unremarkable. initial immunohistochemical staining showed that the infiltrate was predominantly b - cell in nature (cd20 and bcl-2 positive with the t - cell marker cd3 decorating a much smaller population of t - cells dispersed within the infiltrate), confirmed on immunohistochemical staining with the b - cell marker cd20 (figure 2). further analysis by the regional haematological malignancy diagnostic service confirmed the cll phenotype (cd10 negative, bcl - l negative, bcl-2 positive, cd5 positive, cd20 positive, cd23 positive, cd79 positive, bcl-6 equivocal, cd27 equivocal). high power photomicrograph of an immunohistochemical stain for the cd20 antigen decorating small b - lymphocytes. following the incidental finding of cll in the gall bladder wall, the patient underwent further clinical evaluation, which ruled out lymphadenopathy and hepatosplenomegaly. a peripheral blood smear revealed a normal myeloid lineage with small to medium size lymphocytes. computed tomography of the chest, abdomen and pelvis was essentially normal, showing no evidence of hepatosplenomegaly or mediastinal, abdominal and pelvic lymphadenopathy. a bone marrow biopsy was not performed in view of the normal peripheral blood smear and imaging. at haematological review a bone marrow biopsy confirmed marrow infiltration by b - cell chronic lymphocytic leukaemia. in the absence of b symptoms, cll primarily affects adults in later life and is characterised by a proliferation of b - lymphocytes associated with suppression of the immune system, failure of the bone marrow and infiltration of malignant cells into organs. cll originates in the bone marrow and can spread to the blood and organs of the haemopoietic system. in end - stage disease, cll can spread to non - haemopoietic structures such as the liver, lungs, gastrointestinal tract, skin, central nervous system, bone, heart, adrenal glands and kidneys (1). unusual cases of early stage cll with infiltration into prostate, pituitary, myocardium, thyroid, lung, and orbit have been reported (2,3,4,5). extramedullary involvement is more frequently seen in patients with acute lymphoblastic leukaemia where common sites of infiltration include the central nervous system, spleen, liver, lymph nodes, ovaries and testes. skin involvement (leukaemia cutis) and gingival infiltration are seen in approximately 10% of patients with acute myeloid leukaemia (6). extramedullary involvement of the gastrointestinal tract is relatively rare and the reported autopsy incidence ranges from 5.7% to 13% and is as high as 20% in cases of acute lymphoblastic leukaemia (7). in one of the largest autopsy series, cornes and colleagues evaluated almost 15,000 consecutive autopsies and identified 264 cases of leukaemia. the most frequently involved sites were the stomach, ileum, and proximal colon, whereas the duodenum and distal colon were less frequently affected (8). the only case of gall bladder involvement by cll that has been published to date in the reviewed literature, concerned a 62 year old woman who underwent an emergency cholecystectomy for acute cholecystitis. she had a history of rai stage iv b - cell chronic lymphocytic leukaemia and was in partial remission, having been treated with prednisolone and chlorambucil. histology revealed transmural infiltration of the gall bladder with small lymphoid cells, which on immunohistochemistry were positive for cd20 with aberrant expression of cd5 (9). this is the first reported case of gall bladder involvement by cll without a previous diagnosis of cll. this patient was subsequently confirmed to have leukaemic marrow infiltration with cll and remains stable with no b symptoms. this case reinforces the necessity of subjecting all gall bladder specimens for histopathological examination following routine cholecystectomy contrary to recent suggestions by some studies that this is not necessary if the gall bladder is marcoscopically normal (10). | extramedullary involvement in early stage chronic lymphocytic leukaemia (cll) is rare. we report the first case of an incidental finding of gall bladder infiltration in a patient who underwent a cholecystectomy for gallstone pancreatitis with no preceding history of cll. this case reiterates the importance of subjecting even routine cholecystectomy specimens for histopathology examination in the context of this unusual presentation. |
pityriasis amiantacea (pa) is a scalp disorder presenting with thick, silvery / yellowish, asbestos - like scales wrapping around and binding down tufts of hair. it is typically considered to be a reactive condition to several inflammatory diseases, which may affect the scalp, mainly including psoriasis, atopic dermatitis and seborrheic dermatitis. however, although rarely, pa may be the presenting clinical pattern of dermatophyte infection (pa - like tinea capitis), thus emphasizing the importance of ruling out / confirming the possibility of tinea capitis when dealing with a case of pa we here describe for the first time the usefulness of dermoscopy as a supportive diagnostic tool in an instance of pa - like tinea capitis. a 9-year - old girl presented with a five - week history of a progressively worsening, asymptomatic, scaling patch on the scalp. her past medical history was unremarkable and there was no personal or family history of atopic diathesis and skin diseases. physical examination showed thick, adherent, whitish, asbestos - like scales on the right parietal region of the scalp, surrounding and binding the hair (figure 1a) ; no other significant skin, nail or mucosal finding was evident. dermoscopic examination (performed with dermlite dl3 x10 ; 3gen, san juan capistrano, ca, usa) revealed diffuse white scales and compact white keratotic material adhering to tufts of hair (asbestos - like scaling) without erythema (figure 1b) ; interestingly, several hairs displayed a question mark or (hair shaft bent at more than one point) appearance (figure 1b). as such dermoscopic findings may be found in tinea capitis [37 ], we decided to carry out a direct microscopic examination of 10% koh preparation of the scales scraped from the scalp, which showed septate branching hyphae. specimens were also cultured on conventional sabouraud s dextrose agar medium, with evidence of microsporum canis growth after three weeks, thus confirming the diagnosis of tinea capitis. the patient was treated with oral griseofulvin (15 mg / kg once daily) with complete resolution of the clinical picture after eight weeks of therapy. clinical distinction between pa due to inflammatory noninfectious diseases and pa - like tinea capitis is a challenging task, with a significant likelihood of diagnostic errors / delays and prescription of inappropriate therapies. over the last few years, dermoscopy has been showed to be a useful auxiliary instrument for the recognition of several hair disorders [89 ], particularly dermatophyte infections [37 ]. indeed, beside nonspecific findings (broken and dystrophic hairs, black dots, scaling, erythema, etc.), tinea capitis may display peculiar dermoscopic features such as comma hairs, corkscrew hairs, zigzag hairs, interrupted (morse code - like) hairs, elbow - shaped hairs and question mark hairs [37 ]. regarding the present instance, even though we observed dermoscopic findings that may be commonly seen in pa, i.e., diffuse white scaling and the characteristic compact white keratotic material adhering to a tuft of hair (asbestos - like scales), dermoscopy turned out to be very helpful in suspecting tinea infection by showing the aforementioned zigzag and question mark hairs. in fact, although such features (or similar findings) may be rarely found in other hair disorders (e.g., zigzag hairs in trichorrhexis nodosa, alopecia areata and monilethrix, and question mark hairs in alopecia areata) [37 ], they are typically not visible in classic pa. in conclusion, even though the final diagnosis relies on mycological testing, dermoscopy might come in very handy for raising the suspicion of tinea capitis presenting with a pa - like appearance by showing peculiar dermoscopic findings (e.g., as shown in this case, zigzag and question mark hairs), which are typically not detectable in instances of pa due to inflammatory diseases. obviously, further studies on larger groups of patients are needed to confirm our observations. | clinical distinction between pityriasis amiantacea - like tinea capitis and pityriasis amiantacea due to noninfectious inflammatory diseases is a troublesome task, with a significant likelihood of diagnostic errors / delays and prescription of inappropriate therapies. we report a case of pityriasis amiantacea - like tinea capitis with its dermoscopic findings in order to highlight the usefulness of dermoscopy in improving the recognition of such a condition. |
the world organization for animal health has identified ppr as a notifiable and economically important transboundary viral disease of sheep and goats associated with high morbidity and mortality. clinically, symptoms of this disease include severe pyrexia, oculo - nasal discharges, necrotizing and erosive stomatitis, enteritis, and pneumonia. the causative agent, ppr virus (pprv), is genetically grouped into four lineages (i, ii, iii, and iv) based on partial sequence analysis of the fusion (f) gene. however, a recent appearance of lineage iv was associated with a large epizootic in morocco, and posed a probable risk of introduction to europe. ppr was first reported in the ivory coast of west africa and was later found in other parts of the world incuding sub - saharan africa, the arabian peninsula, the middle east, and the parts of asia. india has a sheep and goat population of approximately 211 million (ministry of agriculture, india). among these livestock, therefore, major emphasis should be given to animal productivity, organized marketing, and prevention of existing and emerging diseases like ppr. in india, ppr was first recorded in the tamil nadu state during 1987 and was later an epidemic in northern india. at present, ppr is enzootic in india and outbreaks occur regularly among small ruminants throughout the country, incurring significant economic losses in terms of morbidity, mortality, and loss of productivity due to trade restriction. annual losses due to this disease have been estimated at approximately inr 1,800 million (us$ 39 million) with more than 200 million small ruminants at risk. sequence and phylogenetic analyses of structural protein genes from indian isolates and vaccine strains of pprv showed that all viruses have belonged to lineage iv along with other asian isolates since ppr was first reported. information on prevalence of this disease is available from a number of countries in which the disease has been reported. however, only a systematic study of pprv infection has been performed in small ruminants from india. efficient and sensitive diagnostic tests would be very useful for providing quick evidence indicating whether or not pprv antigens are present in a susceptible population. the clinical prevalence of ppr among sheep and goats could be of epidemiological significance, and data about ppr outbreaks are essential for effective disease management. therefore, the current study was performed to generate baseline data to determine the prevalence (laboratory confirmed outbreak status) of ppr in india over a period of 6 years. the ppr outbreaks investigated in this study occurred in various parts of india between 2003 and 2009. samples were received from numerous organizations such as state disease investigation units and research institutes. clinical samples such as infected nasal swabs along with spleen, lymph node, and other post - mortem tissues were collected from goat and sheep farms in different geographical locations of the country. these samples were submitted by the disease investigation units of different state animal husbandry departments to the rinderpest and allied disease laboratory, division of virology, indian veterinary research institute, mukteswar for analysis and ppr diagnosis. in most cases, the samples used for laboratory confirmation were transported directly via a courrier. upon receipt, clinical samples were stored at -20. prior to analysis, the tissues samples were tricturated in phosphate buffered saline (pbs) (ph 7.2) and 10% (w / v) suspensions were prepared. the contents of the swab materials were extracted with 500 l of pbs into eppendorf tubes. all the clinical samples mentioned above were deposited into the virus repository of the division of virology, indian veterinary research institute, mukteswar (india). a monoclonal antibody - based sandwich elisa (s - elisa) kit for detecting pprv antigen is commonly used to determine ppr clinical prevalence or diagnose ppr in india. in brief, a capture antibody (anti - rabbit polyclonal antibodies against rinderpest virus) at 1 : 4,000 dilution (100 l / well) in pbs was used to coat 96-well flat - bottomed elisa plates (maxisorp ; nalgene nunc, germany). the plates were incubated at 37 for 1 h with constant shaking and then washed three times with washing buffer (0.002 mol / l pbs containing 0.05% tween 20). suspensions of the clinical samples (50 l / well) were added to the wells in duplicate. after incubation 37 for 1 h and washing three times with washing buffer, a pprv - specific anti - nucleocapsid protein monoclonal antibody (1 : 20 dilution, 100 l / well) was added and the plates were incubated 37 for 1 h. anti - mouse horseradish peroxidase conjugates (sigma - aldrich, usa) diluted 1 : 1,000 in blocking buffer (pbs containing 0.1% tween 20 and 0.5% negative serum) were then added (100 l / well). after incubating at 37 for 1 h, substrate solution [0.4 mg / ml o - phenylene diamine (opd) with 4 l of 3% h2o2/ml of opd ] was added (100 l / well) and the plate was incubated at 37 for 15 min for color development. the reaction was stopped with 1 m h2so4 (100 l / well) before absorbance was read at 492 nm with an elisa reader (labsystems multiskan plus ; thermo fisher scientific, usa). estimation of disease prevalence with a 95% confidence interval (ci) and a chi - square test were performed and data analysis were carried out statistically using statistical analysis system, sas software (ver. the ppr outbreaks investigated in this study occurred in various parts of india between 2003 and 2009. samples were received from numerous organizations such as state disease investigation units and research institutes. clinical samples such as infected nasal swabs along with spleen, lymph node, and other post - mortem tissues were collected from goat and sheep farms in different geographical locations of the country. these samples were submitted by the disease investigation units of different state animal husbandry departments to the rinderpest and allied disease laboratory, division of virology, indian veterinary research institute, mukteswar for analysis and ppr diagnosis. in most cases, the samples used for laboratory confirmation were transported directly via a courrier. upon receipt, clinical samples were stored at -20. prior to analysis, the tissues samples were tricturated in phosphate buffered saline (pbs) (ph 7.2) and 10% (w / v) suspensions were prepared. the contents of the swab materials were extracted with 500 l of pbs into eppendorf tubes. all the clinical samples mentioned above were deposited into the virus repository of the division of virology, indian veterinary research institute, mukteswar (india). a monoclonal antibody - based sandwich elisa (s - elisa) kit for detecting pprv antigen is commonly used to determine ppr clinical prevalence or diagnose ppr in india. in brief, a capture antibody (anti - rabbit polyclonal antibodies against rinderpest virus) at 1 : 4,000 dilution (100 l / well) in pbs was used to coat 96-well flat - bottomed elisa plates (maxisorp ; nalgene nunc, germany). the plates were incubated at 37 for 1 h with constant shaking and then washed three times with washing buffer (0.002 mol / l pbs containing 0.05% tween 20). suspensions of the clinical samples (50 l / well) were added to the wells in duplicate. after incubation 37 for 1 h and washing three times with washing buffer, a pprv - specific anti - nucleocapsid protein monoclonal antibody (1 : 20 dilution, 100 l / well) was added and the plates were incubated 37 for 1 h. anti - mouse horseradish peroxidase conjugates (sigma - aldrich, usa) diluted 1 : 1,000 in blocking buffer (pbs containing 0.1% tween 20 and 0.5% negative serum) were then added (100 l / well). after incubating at 37 for 1 h, substrate solution [0.4 mg / ml o - phenylene diamine (opd) with 4 l of 3% h2o2/ml of opd ] was added (100 l / well) and the plate was incubated at 37 for 15 min for color development. the reaction was stopped with 1 m h2so4 (100 l / well) before absorbance was read at 492 nm with an elisa reader (labsystems multiskan plus ; thermo fisher scientific, usa). estimation of disease prevalence with a 95% confidence interval (ci) and a chi - square test were performed and data analysis were carried out statistically using statistical analysis system, sas software (ver. a total of 1,504 clinical samples from sheep (n = 592) and goats (n = 912) in different states of india were screened for pprv antigen using a ppr - specific s - elisa kit. based on our results, the percent of sheep and goats positive for ppr infection were 24.5% [95% ci, 31.86% to 50.16%) ] and 38.2% [95% ci, 37.18% to 55.04% ], respectively, with an overall percent of 32.8% [95% ci, 36.78% to 50.34% ] ppr - positive small ruminants (table 1). clinical samples from sheep and goats screened for pprv antigen and the percent of positive samples are shown in tables 1~3. there was no significant difference in percent positivity between the various tissue samples screened for pprv antigen. additionally, no significant difference in pprv infection was observed among samples from sheep and goats taken between the years studied or samples from different states of india (fig. 2), it was found that the number of outbreaks increased during the summer and the september and october months during which wet season occurrs. for effective control of ppr, accurate diagnostic techniques and timely vaccination of susceptible populations are necessary. ppr eradication depends on rapid and accurate diagnosis, and implementation of prompt control measures. due to the immense economic impact of ppr,, several ppr outbreaks were not accurately recorded due to inadequate animal disease reporting and surveillance systems. measuring the clinical prevalence of ppr in different geographical areas of the country with varying agro - climatic conditions may be helpful for establishing disease control strategies and can be useful for determining the actual infection rate. organized clinical surveys or confirmation of outbreak status has not been performed for ppr in india except for a few isolated clinical reports from different state animal husbandry departments. the majority of these reports except for the one by singh. included only regional data from various states of india since 1994. the present study has provided preliminary information about confirmed ppr outbreaks or infection among sheep and goats in india between 2003 and 2009. such information will be very useful for effective disease management and implementing a ppr control program using vaccines against indigenous pprv. current vaccination programs are being implemented in some states of india which will alter ppr epidemiology, particularly distribution of the disease. greater ppr positivity was observed in samples from goats than sheep, which may be due to samples being collected from suspected cases of ppr. soundararajan. also reported a higher mortality rate among infected goats than sheep in a large organised farm that was probably experiencing a ppr outbreak, while analyzing the samples from suspected cases. based on difference in the virulence of field strains from both species, sheep might have greater innate resistance to clinical development of the disease than goats. this hypothesis appears to be supported by data previously collected during several outbreaks of ppr. it is also possible that the pprv prefers goat over sheep when both of these natural hosts are reared contiguously. studies of the molecular aspects of virus affinity and species susceptibility would further elucidate mechanisms underlying the greater ppr susceptibility of goats compared to sheep as described. besides the regular ante- (blood and swabs) and post - mortem (spleen and lymph nodes) samples, tissues from lung, liver, and heart also showed high positivity for pprv antigen, showing that the lung, liver, and heart samples from infected animals are also useful for diagnosing ppr. when the tissue samples from sheep and goats were analyzed according to geographic region, high positivity was observed in animals from tamil nadu (78.6%) and uttarakhand (66.2%) compared to other states. since relatively small numbers of samples from some states were tested, differences in ppr prevalence among sheep and goats from these various states may not be significant. low rates of positivity recorded in punjab and haryana states in sheep and in andhra pradesh in goats. this could be due to small sample sizes, restricted movement of the animals, and decreased transmission of the virus between infected animals. a relatively high proportion (70~80%) of the goat population in india is at risk of infection, particularly in northern parts of the country as reported earlier. since 1994, a number of ppr outbreaks have been reported in different states of india with variable morbidity and mortality rates. studies in india and other countries have reported that morbidity and mortality rates vary with different isolates / strains of pprv in both sheep and goats. mortality in susceptible flocks varies from 10 to 100% and morbidity ranges from 50 to 100%. however, this scenario is likely to change drastically once intensive vaccination programs are implemented for the target species. earlier studies indicated that the disease is widely distributed in india, which could probably be attributed to agro - climatic conditions, socio - economic factors, and migration patterns of small ruminants dependent on different factors such as season or flock size. ppr outbreaks among sheep and goats in india can occur at any time of the year, but are most frequent during the wet (april to september / october) or cold dry (january and february) seasons. when the temporal distribution of ppr outbreaks was analyzed in the current study, increased numbers of outbreaks occurred during the summer and wet seasons. this could be due to limited availability of feed during these periods and close confinement of the animals in farm buildings. however, taylor believed that increased incidence of the disease might reflect the increased introduction of susceptible young animals to the flocks rather than a seasonal surge in viral activity. moreover, wosu found that disease incidence peaks during the dry season rather than the rainy season. inclement dry cold weather during december to february coupled with poor nutrition over this period promotes the spread of ppr. in india, sheep and these animals are free - range or pasture - grazed and receive minimum veterinary care, which may further augment the chances of acquiring ppr infection. during the lean period (between march and june), the animals are flocked from one place to another in search of pasture and to be traded. temporal occurrence of ppr outbreaks correlate with animal movement and climatic factors that favor the survival and spread of the virus. trading small ruminants at market places, where animals from different locations and sources are brought into close contact with one another, also promotes pprv transmission. most investigators have linked ppr outbreaks with the introduction of new animals into flocks. in india, animals are usually under stress during the lean period due to traveling over long distances and nutritional deficiencies. during their migration, these animals frequently infect local populations along the migration route. this may be one of the reasons for the higher frequency of ppr outbreaks among nutritionally deficient animals in which increased susceptibility to infection was previously reported. these infected animals then help to maintain viral circulation throughout the year via frequent animal - to - animal transmission. with commencement of the monsoon season, diets of the animals improve and migration of the animals also ceases due to the availability of local fodder, resulting in substantial decrease in outbreak frequency. similar observations were also made during a 5-year study of ppr in the tropical humid zone of southern nigeria. hence, animal husbandry practices, agro - climatic conditions, and geographical locations impact seasonal distribution of the disease. the movement of animals therefore plays an important role in the transmission and maintenance of pprv in nature. in india, present clinical surveillance systems for detecting pprv antigen by s - elisa can be synergistically improved with the additional detection of nucleic acid targeting either nucleocapsid or matrix or fusion protein coding gene sequences in clinical samples collected from sheep and goats either suspected of having the disease, are in the incubatory stages, or are at risk of acquiring the disease any time. perhaps the most effective molecular techniques will be in high - throughput assays such as the identification and monitoring of viruses circulating among free - range sheep and goat populations. molecular epidemiology will help identify the geographical origin and sources of viruses responsible for the regular outbreaks that occur in endemic countries. in india, decreased number of outbreaks as well as changes in the severity of disease patterns recently observed might be due to the effectiveness of live attenuated vaccines, timely vaccination of sheep and goats, and circulation of a single asian lineage iv pprv since the disease was first reported in india.. the reasons could be variations in husbandry practices in different geographical regions, agro - climatic conditions, and livestock migration. vaccination against ppr has been practiced in some states of india since 2002 to control the disease. the nation - wide vaccination programme (national control programme of ppr) has been launched during 2010 with an aim to eradicate this disease from india. currently available ppr vaccines and various ppr - specific diagnostic kits / techniques have been recommended for a collaborative nation - wide control program implemented by state animal husbandry departments under the direction of the department of animal husbandry, dairying and fisheries. | this study measured the clinical prevalence of peste des petits ruminants (ppr) among sheep and goats in india between 2003 and 2009 by analyzing clinical samples from suspected cases of ppr that were submitted to the rinderpest and allied disease laboratory, division of virology, ivri, mukteswar for ppr diagnosis. ppr outbreaks were confirmed by detecting ppr virus (pprv)-specific antigen in the clinical samples. clinical samples (blood, nasal swabs, spleen, lymph node, kidney, liver, intestine, and pooled tissue materials) were taken from a total of 592 sheep and 912 goats in different states of india and screened for the presence of pprv antigen using a monoclonal antibody - based sandwich elisa kit. a total of 20, 38, and 11 laboratory - confirmed ppr outbreaks occurred among sheep, goat, and combined sheep and goat populations, respectively. our findings provide evidence of widespread ppr endemicity in india. the underlying reasons could be variations in husbandry practices in different geographical regions, agro - climatic conditions, and livestock migration. furthermore, decrease in the number of ppr outbreaks over time might be due to the effectiveness of current live ppr vaccines and timely vaccination of target species. vaccination against ppr has been practiced in india since 2002 to control this disease. |
today 's technology makes it feasible to sequence the genome of almost any species of interest and to investigate complex genetic relationships in populations of animals [13 ]. however, the task of translating enormous amounts of genetic data into practical applications is still a work in progress [46 ]. as the ability to predict the functional impact of genetic variations within a population improves, genomics data could provide a powerful tool for informing the management of captive endangered species. whole genome sequencing has the potential to be very effective in conservation efforts. in the past, genetic studies have focused on a few loci from many individuals ; genomics now allows the focus to switch to many genes from a few individuals. this is particularly important when studying endangered species and working with very limited sample sizes. in addition, genomics provides us with the opportunity to look at the entire genome and not just the pieces that directly code for proteins in attempts to better understand if they contribute to survival. overall, genomics has the opportunity to play a pivotal role in proactively understanding pressures and potential stressors that are leading some species into extinction. endangered species can benefit greatly from the use of comparative genomics. using the genome sequence from close relatives as reference, the genome of endangered species can be compiled with relatively few samples, which is particularly important when only a limited number of animals exist in captivity. once the genome is sequenced, identifying deleterious mutations caused by single nucleotide variants (snvs) provides a valuable resource for management of captive populations. for example, the california condor diverged from the chicken over 100 million years ago but comparison of the genomes reveals useful information in the management of this endangered species. a bac library was created for the condor and comparative genomics was employed, identifying 93 genes that were aligned with the chicken chromosome map. using this approach, several genes involved in bone and cartilage formation have been identified, and further tests may reveal the role these genes play in the condor chondrodystrophy, a heritable embryonic lethal phenotype that is present in the population. understanding the genetic basis of this disease greatly increases the ability to manage and progress the care of this captive population. another finding in these birds is a mutation in one of the estrogen receptors that has been linked to altered receptor activation by endocrine - disrupting chemicals, such as dichlorodiphenyltrichloroethane (ddt) and its metabolites. a comparative genomics approach could be used to identify additional genes associated with reproduction that might also be impacted by environmental contaminants and other factors, providing a multifaceted view of reproductive issues in these animals. major histocompatibility complex (mhc) genes are the most polymorphic genes in the vertebrate genome and can be helpful markers in identifying population diversity as well as indirectly measuring immunologic fitness. ujvari and belov emphasize the use of markers like mhc to better plan conservation and manage captive populations. for example, mhc has been implicated in mate choice and pregnancy outcomes, which could be very important when working with captive breeding programs. the mhc class ii b polymorphism was investigated in a number of wild populations of gorilla via noninvasive fecal sample collection coupled with next - generation sequencing. the analysis led to the identification of 18 different alleles that had not been previously characterized in the gorilla populations. mhc genes have been identified as markers for immune function and survival in almost all vertebrates, and genetic variation of this region can lead to increased or decreased disease susceptibilities [14, 15 ]. the tasmanian devil has recently suffered a major population crash from the result of devil facial tumor disease, and genomics approaches have been implemented to further understand the specifics of the disease and potentials for more effective treatments. hawaiian honeycreepers are an adaptive radiation that contains numerous endangered species and is of particular interest due to their diverse phenotypes and heterogeneous responses to avian malaria. genome sequencing and assembly with snp discovery are providing insight into why some of these birds are malaria - resistant and others are not. in attempts to preserve some of the most endangered species, zoos and other organizations have established captive breeding programs and in some cases reintroduced endangered species back into the wild. genomics has the potential to facilitate assessing the genetic fitness of individuals within a population and assist programs in correctly identifying the most successful breeding pairs to ensure genetic diversity among future generations. identifying the best founder individuals in a captive breeding program can greatly increase the success of the program and potentially enhance fitness of the species [1821 ]. genomic sequence data provides the foundation of an annotation framework anchored to primary nucleotide sequence organized around contigs and scaffolds comprising individual chromosomes. sets of sequence intervals corresponding to genes, exons, introns, promoters, enhancers, untranslated regions (utrs), and intergenic regions comprise the organizational structure of genomics sequence data. protein coding gene level annotation is structured around the one - to - many relationship that potentially exists between genomic loci and their paired rna transcripts and protein sequences. together, the set of transcripts derived from a single genomic locus represents the sequence complexity of gene expression. additional levels of complexity arise through the tissue and cell specific patterns of expression associated with each transcript as well as the combination of cis regulatory elements responsible for both the transcript sequence and expression patterns. transcriptome sequencing can provide a wealth of information about the pattern of gene expression including the alternative isoforms, protein coding single nucleotide polymorphisms (snps), and tissue specific patterns of expression important in development, health, and disease. genetic variation is an integral component of genomics data and represents the ability to investigate relationships that may exist between genes, tissues, individuals, and phenotypes. among the genetic variants that exist are repetitive elements, copy number variations, single nucleotide substitutions, single nucleotide insertions / deletions (indels), genomic inversions, and genomic duplications, to name a few. the most prevalent variants are snps, and once a sizable set has been identified, relationships between allelic variation and phenotypes can be empirically investigated. traditionally, genotyping in conservation genetics was accomplished using individual assays targeting a single polymorphism, such as restriction fragment length polymorphism (rflp) analysis. as the number of polymorphisms assayed increased, pcr - based methods of genotyping replaced the more cumbersome rflp methods. in parallel, repeat polymorphisms can also be interrogated via pcr - based sequencing methods to take advantage of the increased value associated with multiallelic markers. as the number of polymorphisms under investigation approaches thousands to hundreds of thousands, nucleotide hybridization chips become the platform of choice. other methods, such as genotyping by sequencing (gbs) and snp analysis via transcriptome sequencing, offer opportunities not only to genotype known polymorphisms, but also to detect de novo and private variants that are unique to a specific individual. sequencing methods of polymorphism discovery have the potential to identify hundreds of thousands to millions of snps, depending upon the depth of sequencing coverage and the relative extent of genetic diversity represented in the samples. over the past decade, genomic data acquisition has become increasingly routine. since the year 2005, data output from next - generation sequencing (ngs) platforms has more than doubled each year. whole human genomes worth of sequence data can be produced as cheaply as $ 1000, a staggering decrease from the original human genome project 's cost of nearly $ 3 billion, and produced over days or hours instead of what was originally many years. ngs technology has enabled a multitude of scientific investigations that previously could never have even been considered. genomics analyses in general, including comparative genomics studies, depend heavily on having an available high - quality genome reference sequence. unfortunately, unlike model organisms such as mouse, endangered species typically lack significant or any available genomic resources. an important first step in genomics - enabled endangered species management is, therefore, development of a high - quality genome reference sequence. while it is not an insignificant undertaking, reference genome sequence development is becoming more and more commonplace. while reference sequences of large complex eukaryotic species constructed entirely from single molecule sequencing technology is becoming more common, typically such projects are largely based on paired - end and mate - pair data from ngs platforms. paired - end data results from sequencing the paired - ends of inserts in the range of hundreds of base pairs, while mate - pair data results from sequencing the ends of inserts in the range of thousands of base pairs. sufficient coverage from both library types is imperative for the resulting genomic reference sequence to be of sufficient quality. these genome sequence data are then processed and assembled using appropriate methods based on actual data types, with the resulting assembly constituting the species draft genome sequence. once a draft genome sequence is constructed, structural annotation can proceed (figure 1). here, features such as genomic repeats, genes, and noncoding rnas are identified, a process that can be informed by closely related model organisms. for example, the well - annotated mouse and human genomes and structural annotations can be used to help identify genes in mammalian endangered species, resulting in higher quality gene and other feature calls than what would be available without such additional information. genomic data from more closely related species (e.g., domestic bovine genome for endangered bovine species) can be used, if available. typically, repeats are first identified and used to mask the draft genome sequence, a step necessary to help reduce false positive gene calls resulting from transposable elements and other nongene features. noncoding rna molecules genes are then identified on the repeat masked genome sequence, informed by closely related model organismal sequence, and, if transcriptome data from the target endangered species is available, these transcript data as well. once genes have been identified, functional assignments can be made via homology to related species functional annotation, homology versus compiled databases such as the ncbi nr database (http://www.ncbi.nlm.nih.gov/refseq/), the uniprot database (http://www.uniprot.org/), conserved elements from genomic alignments (cega, http://cega.ezlab.org/), and motif - based methods such as those leveraged with interproscan (http://www.ebi.ac.uk/tools/pfa/iprscan5/). these genomic resources, including the (1) draft genome sequence, (2) structural annotation, and (3) functional annotation, form the basis of all subsequent genomic analyses (figure 1). whereas a high depth of sequencing is required in development of the draft genome sequence itself, comparatively very low coverage is all that is needed to assess genomic traits of further individuals. while illumina recommends 30x coverage for accurate single nucleotide polymorphism (snp) and short insertion and deletion (indel) identification, it is typical to perform such analyses using much lower coverage on the order of 1015x. it is common to sequence tens of individuals together (provided with identification labels such as multiplex identifiers, mds) in a single sequencing unit and then bioinformatically separate by individual and analyze the resulting sequence data on a per - individual basis. such methods form a powerful mechanism on which we analyze large numbers of individuals for very low cost. a per - individual and practically exhaustive genomic fingerprint, or the identification of all snps and indels in each individual, allows direct comparison between all available members in an endangered species population [3537 ]. just as comparative physiology and comparative anatomy offer a context for appreciating the mechanisms underlying variation in form and function, comparative genomics aids in elucidating conserved and divergent genetic mechanisms associated with specific phenotypes. comparative genomics methods represent undervalued, yet extremely powerful tools for exploring patterns of shared and divergent biology between pairs of organisms ' genomes. unlike well - studied model organisms, such as mouse and dog, captive endangered species are relatively poorly studied, and the possibility of developing knockouts or transgenic strains of endangered species expressly for experimental exploration of their biology is not a feasible option. subsequently, the rate at which functionally important genomic signals are identified in endangered species lags significantly behind the rate for typical model organisms. in fact, sometimes genomics sequence data provides relatively little benefit for endangered species conservation efforts, even well after the genomics resources have been produced and deposited into a public database / repository. this is not a consequence of poor genomic quality, but rather the challenge in translating the raw genomic data into management informing knowledge. of particular interest are comparative genomics approaches that can rapidly identify functionally important genomic regions with implications for health and disease. the mouse is one of the most widely studied genetic models in the world, resulting in the production of mouse lines having mutations in over one - third of the genes encoded in the mouse genome. the international mouse phenotyping consortium (impc) is a collaborative functional genomics effort between laboratories in america, germany, united kingdom, france, canada, china, and japan. the impc has characterized phenotype data for approximately 2000 mouse genes and plans to have a total of 5000 genes characterized by 2016. the mouse genome database (mgd) is a central repository for mouse functional genomics data and resources including phenotype annotations for mouse genes. functional annotation in the form of ontologies, such as the gene ontology and mammalian phenotype ontology, is integrated with the mouse genome. the tremendous wealth of mouse genomic data can be employed to enable discovery in endangered species through ortholog - based mapping (figure 2) of mouse phenotype annotations onto endangered species genomes (figure 3). such an approach would provide a set of one - to - one orthologs in an endangered species with which phenotypes experimentally identified in the mouse can be associated. combining these phenotype associated orthologs with functional genetic variation, such as missense mutations in critical residues of highly conserved domains and nonsense or frameshift mutations occurring at the n - terminal portion of protein coding genes, offers high confidence candidates for alleles likely to modulate specific phenotypes. these potential genotype - phenotype relationships can serve as the foundation for identifying members of the endangered species population that may be at risk for undesirable phenotypes. genomes from domesticated species, such as the dog, cat, and chicken, have also proved useful in the management of endangered species. for example, comparative genomics approaches using domestic cat mhc loci have been used to quantify mhc diversity in endangered felids including the florida panther and the cheetah. this information provides a metric for assessing population susceptibility to emerging immunological threats such as bacteria and viruses. evolutionary conservation of short tandem repeat polymorphisms between domestic cat and cheetah facilitated the creation of pcr - primers capable of amplifying polymorphic loci in the cheetah to determine population - level genetic diversity in this endangered species. similarly, the dog genome has been used to identify short tandem repeat markers in the maned wolf, a threatened species in brazil. microsatellite markers have been developed to identify hybrids in the population and remove them in an effort to conserve the red wolf. the value of model genomes for management of endangered species was exemplified in the development of chicken - condor comparative physical maps [9, 10 ] that were subsequently used to ultimately develop genetic tests for identifying condors at risk for producing offspring with undesirable phenotypes. the utility of comparative genomics in the conservation of endangered species will continue to be valuable, especially as new and improved tools and resources for comparative genomics are developed in the future. the identification of genetic variants within genes implicated in specific phenotypes provides a framework for identifying members of the endangered captive population that might be at risk for clinically relevant phenotypes. it is important to make the distinction between validated genetic associations that are identified in typical genetic association studies and the bioinformatics based identification of genotype - phenotype candidates. however, the comparative genomics association these orthologs have with their mouse counterparts offers evidence for their involvement in related phenotypes within the captive population. unlike domesticated species, such as cats and dogs, endangered species are at risk of extinction, and therefore it is worthwhile to mention that, unlike the commercial veterinary environment where, for example, proven canine genetic diagnostics may be sold to enhance the clinical management of a pet, there is relatively little financial incentive to develop commercial genetic diagnostics for endangered species as their population size is unlikely to provide an acceptable economic return on the initial investment. another critical distinction to point out is that predicting the increased susceptibility for a particular undesirable phenotype is not the same as stating a particular member of the species which will eventually have the undesirable phenotype. rather, it is the first step in a bidirectional communication exchange between scientists and personnel managing the species (ssp managers, zoo veterinarians, and zoo animal caretakers) (figure 5). management plans for endangered species rely upon multiple stake holders including veterinarians, conservation organizations, and zoos. in particular, the value of the phenotype predictions is immediately realized at the level of the individual member of the endangered captive species, even if the prediction turns out to be a false positive. as an illustration, consider an endangered species in which a subset of the population has been annotated as potentially having an increased risk for certain phenotypes. if this information is made available to the zoo veterinarian, these at - risk annotated animals may receive additional scrutiny when presenting with signs associated with the predicted clinical phenotype. for example, an animal that is predicted to have an increased risk for bladder cancer may be more likely to benefit from earlier detection of disease if zoo keepers are aware that an increased rate of urination may be indicative of a problem. regardless of whether or not the animal actually has the disease, the management is informed by the genomics knowledge, which ultimately effectively triages members of a captive population in a way that maximizes their care, health, and well - being in captivity. just as the sharing of genomics information from the scientist to the zoo provides a more informed management of the endangered population [3, 51 ], sharing of the diagnosed phenotype information from the zoo veterinarian to the scientist provides feedback on the predictions and allows the scientist to refine and ultimately identify those predicted genotype - phenotype associations for which multiple clinical assessments have provided statistically significant evidence of a true genotype - phenotype relationship. because each zoo that contains members of a captive population can contribute to the clinically relevant phenotyping, open communication among scientists, veterinarians, and zoo staff forms the basis of a genetic association study within the captive population. if every member of an endangered captive population is classified as either susceptible or nonsusceptible to a specific phenotype, based on bioinformatics based predictions of functional polymorphism consequences, it becomes possible to assess the increased relative risk (if any) associated with that particular genotype or allele. in this particular clinical - management application of genotype - phenotype predictions, the information is only used to more effectively identify and medically manage the members of the captive population. moreover, at this stage, the information does not need to be included in the breeding program. in fact, individual ssps can decide when (if ever) to include predicted / verified genotype - phenotype relationships in the selection of breeding pairs. one plan for incorporating genotype - phenotype relationships in the breeding program might be based on the validation of the association based on multiple years of zoo veterinarians treating susceptible and nonsusceptible individuals. threshold parameters for inclusion in a breeding program might include the calculated increased relative risk of the clinical phenotype associated with the genotype. alternatively, the decision can consider the overall prevalence of the clinical phenotype within the captive population as well as the implications for population members that acquire the undesirable phenotype. the potential value in using genomic information to identify individuals at risk for an undesirable clinical phenotype depends upon the overall prevalence of the undesirable phenotype (disease) in the total captive population, as well as the prevalence of the susceptibility genotype (exposed) and the prevalence of the disease in the individuals with the susceptibility genotypes (disease in exposed group). as an example, consider an endangered captive population of 100 individuals, for which the overall prevalence of disease is 30%, the prevalence of the susceptibility genotype is 30%, and the prevalence of the disease within the exposed group is 70% (figure 4). this population would have an increased relative risk of 5.4 within the exposed group compared to the nonexposed group. this model assumes that some individuals without the susceptibility genotype(s) also have the undesirable phenotype, which more appropriately models polygenic and complex genetic traits. similarly, this model assumes that some individuals with the susceptibility genotype do not have the undesirable phenotype due to incomplete penetrance. in this scenario, the 95% confidence interval for increased relative risk of the exposed group is 3.55 to 8.35 while the overall population relative risk is 2.33. likewise the exposed group 's odds ratio is 15.82 with the 95% confidence interval of 5.54 to 45.13 and the overall population odds ratio is 2.91. a considerable number of studies investigating the relationships between allele frequency and disease in domestic animal species have been reported recently. these reports provide a framework for considering the relationship between inherited disease phenotypes and their relationship with specific alleles and/or genotypes. for example, one study investigated a specific mutation in sod1 and the prevalence of canine degenerative myelopathy in a population of german shepherd dogs concluded that the association of the allele with the disease supported genetic testing in clinical applications. the study results showed that 8 of 50 dogs exhibited homozygosity and additional 19 dogs were heterozygous. of the dogs homozygous for the undesirable allele that were greater than 8 years old, 42% exhibited a pelvic limb ataxia phenotype while none of nonataxic dogs were homozygous. another study investigating a retinal degenerative disease allele in 41 cat breeds determined that the undesirable allele frequency ranged from a high frequency of 33% to a low frequency of 2% in the 16 breeds in which it was detected. the authors conclude that, in breeds with the highest allele frequency, 7 to 13% of the individuals within the breed would be expected to develop the disease. finally, a 2010 study of polysaccharide storage myopathy in horses, caused by a mutation that had been identified in over 20 different horse breeds, determined that the prevalence of inherited susceptibility to the undesirable phenotype varied within these breeds from high prevalence of 62% to low prevalence of 0.5%. the management implications for this genetic information included (1) strategies for breed associations to consider screening for this specific mutation and (2) use of the undesirable allele as an alert for veterinarians to more closely evaluate a horse for myopathy related clinical signs such as altered gait, muscle pain, and rhabdomyolysis. in these scenarios, the relationship between allele frequency and disease prevalence (or incidence) depends upon the mode of inheritance. in practice, the threshold limit of minor allele frequency in the population as well as the population disease prevalence will affect the ability to successfully employ genotype - phenotype predictions in endangered captive populations. since the clinical assessment of undesirable phenotypes is required to validate a particular prediction, the frequency with which members of the species are clinically assessed each year will contribute to the rate at which validation can occur. ultimately, for some phenotypes in certain species, this approach may not be viable ; however, true value in this approach lies in cases where an autosomal recessive genotype - phenotype relationship can be established in the endangered captive population. this knowledge can be applied to more effectively manage breeding by selecting breeding pairs that minimize the production of the undesirable phenotype by allowing only propagation of carriers carrier - only approach can maximize genetic diversity in the captive population by including affected individuals in breeding programs, especially if they are prolific breeders, while minimizing the production of affected offspring produced by these carriers of undesirable traits. ultimately, genomic resources coupled with per - individual genomic fingerprints can lead directly to highly improved endangered species management. for example, deleterious mutations can be identified by examining how each snp and indel impact the gene in which the mutation is found. highly impactful snps, such as those interrupting a coding region, can be mapped on a per - individual basis. if phenotypes are available in sufficient numbers of individuals, these mappings can be used to map genomic traits to the phenotype of interest using techniques such as whole genome association studies (gwas). where phenotype data is not sufficiently available, these mappings can be used to infer likely nondesirable configurations and used in a similar fashion on a per - individual basis. for example, if a gene has been identified and predicted to provide a phenotypically relevant function, variation mappings across individuals can be used to separate those likely healthy from those likely unhealthy. such results can be directly applied to development of individualized health plans and to guide breeding strategy. the challenge in effectively applying genomics knowledge to the management of endangered captive species arises through a combination of various stake holder opinions and assumptions coupled with the limitations posed by a small highly prized population, for which individuals are easily perceived as devalued via undesirable health labels (i.e., phenotypes). part of the issue lies in the perceived value or quality of a particular member of the species. for example, if a zoo seeks to participate in an ssp 's breeding program for a particular species, acquiring an animal that may produce less desirable offspring may be problematic. currently, an animal may be included or excluded from a breeding program based on the ssp 's determination of its impact on genetic diversity of the population as determined by mean kinship calculations. it also may be excluded from breeding due to the presence of an undesirable phenotype or chromosomal abnormalities. if genomic - based information was to identify a greater number of individuals with a genotype linked to that phenotype, some stakeholders fear that more genetically valuable animals would be excluded from the breeding population. the power of genomics in captive endangered species may be to identify targeted breeding strategies that would minimize the impact of such variants phenotypically while still maintaining acceptable genetic diversity. in fact, removing all individuals with undesirable phenotypes from the breeding pool can result in considerable loss of genetic diversity and may even permanently remove low frequency polymorphisms of high value from the endangered captive population. in order to maximize the value of genomics information in the management of captive endangered species successful application of genomics information in captive management will require a shift in management culture to integrate the use of the burgeoning information from the variety of resources now available to those entrusted with the care of these animals. just as important, in order to achieve the maximum benefit that genomic information can offer, bidirectional communication must occur between caretakers managing the health of the endangered animals and scientists mining the genetic information. a shared database containing phenotypic information for each species, including physical characteristics and variations, physiologic parameters and ranges, and disease prevalence and expression, would be invaluable for functional genomics investigations. ultimately, conservation efforts will benefit from a prioritized commitment to value shared knowledge among all stakeholders. the benefits of using genomics can enhance the role of zoos and ssps by giving us knowledge about the health and attributes of a specific animal much earlier in that animal 's life than our current and traditional process of waiting for and observing traits and symptoms only when they become physically apparent. this can be tremendously beneficial to breeding programs as more will be known about each animal at a much earlier point in their breeding career, allowing for healthier matches and better long term genetic outcomes for the species. endangered species are the ideal species for the use of genomics knowledge for a number of reasons. there is tremendous public interest in and support for endangered species and the programs to preserve them. therefore utilizing new science - based approaches, especially those that have no negative impact on the endangered individuals themselves, will enhance the public standing of the facilities and groups involved. by illustrating the value of genomics information in endangered species and the management decisions their protection requires, we can shift the paradigm for many conservation stakeholders and ultimately benefit many species fairly rapidly. the successful conservation of wild and captive endangered species will undoubtedly evolve as genomics knowledge becomes more widely applied to management decisions. functional genomics, as applied to conservation genetics in animal populations, entails understanding how the genome of an individual animal or the collective genomic properties of a population influences the well - being and survival of that individual or population. genomics knowledge, such as sequence data, polymorphism data, and gene expression data, provides an unprecedented opportunity to consider the entire genome to better understand how genetics contributes survival for a particular species. just as comparative physiology and comparative anatomy offer a context for appreciating the mechanisms underlying variation in form and function, comparative genomics aids in elucidating conserved and divergent genetic mechanisms associated with specific phenotypes. of particular interest are comparative genomics approaches that can efficiently and effectively identify functionally important genomic regions with implications for health and disease. model organism genomes, from animal species, such as the mouse, dog, and cat, have already contributed to advances in the management of endangered felids and canids. as bioinformatics algorithms and pipelines become more sophisticated, the identification of genetic variants within genes implicated in specific phenotypes will facilitate identifying members of the endangered captive population that might be at risk for clinically relevant phenotypes. such individuals can be given additional medical scrutiny to maximize the opportunity for early detection of clinically important conditions. additionally, this genomic information can be used to better manage breeding programs, for example, to limit the production of homozygous autosomal recessive undesirable phenotypes. however, to most effectively maximize the value of genomics information in the management of captive endangered species, all stakeholders must appreciate the utility genomics knowledge can bring to management decisions. successful application of genomics information in captive management will require a shift in management culture to integrate the use of the burgeoning information from the variety of resources now available to those entrusted with the care of these animals. | many endangered captive populations exhibit reduced genetic diversity resulting in health issues that impact reproductive fitness and quality of life. numerous cost effective genomic sequencing and genotyping technologies provide unparalleled opportunity for incorporating genomics knowledge in management of endangered species. genomic data, such as sequence data, transcriptome data, and genotyping data, provide critical information about a captive population that, when leveraged correctly, can be utilized to maximize population genetic variation while simultaneously reducing unintended introduction or propagation of undesirable phenotypes. current approaches aimed at managing endangered captive populations utilize species survival plans (ssps) that rely upon mean kinship estimates to maximize genetic diversity while simultaneously avoiding artificial selection in the breeding program. however, as genomic resources increase for each endangered species, the potential knowledge available for management also increases. unlike model organisms in which considerable scientific resources are used to experimentally validate genotype - phenotype relationships, endangered species typically lack the necessary sample sizes and economic resources required for such studies. even so, in the absence of experimentally verified genetic discoveries, genomics data still provides value. in fact, bioinformatics and comparative genomics approaches offer mechanisms for translating these raw genomics data sets into integrated knowledge that enable an informed approach to endangered species management. |
it has been recognized that cardiac autonomic nervous system activity is of great significance in the initiation and maintenance of atrial fibrillation (af). stimulation or inhibition of selective extracardiac neural structures may be a useful therapeutic option for cardiac arrhythmias, including af, and other abnormalities. as the major part of the intrinsic cardiac autonomic nervous system, most cardiac ganglionated plexus (gps) embedded in the fat pad around 4 pulmonary veins (pvs), play an important role in the early stage of af.1 increased gp activity can induce the increase of both parasympathetic and sympathetic activity, which promotes rapid focal firing in the pv myocardium.2, 3 clinical evidence also suggests that additional gp ablation to pv isolation could increase success rates in eliminating af.4, 5 as a tetrodotoxinresistant periphery nerve voltagegated sodium channel, nav1.8 (encoded by scn10a) plays a significant part in the upstroke of action potential in neurons, and is responsible for repetitive firing.6 it is found primarily expressed in small and mediumdiameter nociceptive sensory neurons, which mediate pain perception.7 genomewide association study highlights the role of nav1.8 in cardiac conduction and arrhythmic diseases. in addition to the canonical cardiac sodium channel nav1.5/scn5a, nav1.8 is recently considered a new cardiac sodium channel.8 scn10a is adjacent to scn5a on the same chromosome, and there is 70.4% of similarity in the amino acid sequence between these 2 sodium channels. our previous research shows nav1.8 could physically interact with nav1.5 by using coimmunoprecipitation when both are expressed in vitro.9 others prove that nav1.8 could modulate the activity and expression of nav1.5 at the transcriptional level, which may be intermediated by tbx3/5.10, 11 increasing evidence indicates that nav1.8/scn10a plays a critical role in af. both common and rare variants of scn10a were associated with the risk of af.12, 13 some rare scn10a variants have been identified in patients with earlyonset af (rs141207048, rs202143516, rs202192818, rs139861061,), and the relevant mechanism implied by functional study in vitro might be through the modulation of peak sodium current (ina, p) and late sodium current (ina, l) of nav1.8.14 certain common variants, such as rs6795970, have been proved to be related to af susceptibility.12, 13 one recent study has suggested that blockade of nav1.8 suppresses vagalmediated af most likely by inhibiting the neural activity of gp.15 however, the exact electrophysiological role of nav1.8 in af, especially at the early stage of acute af, is uncertain, and the relevant mechanisms still need to be assessed. in this study, we aim to explore the expression of nav1.8 and nav1.5 in canine cardiac ganglia, and to evaluate the role of the nav1.8 blocker a803467 in cardiac gp in an acute af canine model. we have further investigated the changes of the channel density and kinetic characteristics in the presence of a803467 when the scn5a and scn10a coexpressed in vitro, which might provide the potential mechanism to explain its effect in a canine af model. experiments were approved by the animal ethics committee of wuhan university under approval number 20150072 and followed the guidelines outlined by the care and use of laboratory animals of the national institutes of health. sixteen mongrel dogs weighing from 20 to 25 kg were included in this study. surgeries were performed under anesthesia with sodium pentobarbital with an initial dose of 50 mg / kg and an additional dose of 2 mg / kg per hour. bilateral thoracotomy was conducted at the fourth intercostal space, as previously described16, 17 (figure 1a and 1b). in brief, multielectrode catheters were sutured to obtain recordings at the surface of the atrium and pvs and to pace at the left atrial appendage (laa). all recordings were displayed on a computerized bard electrophysiology system (cr bard inc, billerica, ma). highfrequency stimulation (20 hz, 0.1 ms duration, square waves) was applied at the fat pad to identify gps by a bipolar electrode stimulator (grasss88 ; astromed, west warwick, ri). anterior right ganglionated plexi (argp) was located at the rspvatrial junction and superior left ganglionated plexi (slgp) at the left superior pv (lspv)atrial junction. a successful gp stimulation was marked at the 50% sinus rate slowing or second or thirddegree atrioventricular block developing. schematic catheter positions in the atria and pulmonary veins and representative traces. a, left thoracotomy approach. electrode catheters were sutured to the left superior pulmonary vein (lspv), left inferior pulmonary vein (lipv), left atrium (la), left atrial appendage (laa), right superior pulmonary vein (rspv), right inferior pulmonary vein (ripv), right atrium (ra), and right atrial appendage (raa). argp indicates anterior right ganglionated plexi ; ilgp, inferior left ganglionated plexi ; irgp, inferior right ganglionated plexi ; ivc, inferior vena cava ; lpa, left pulmonary artery ; lv, left ventricle ; slgp, superior left ganglionated plexi ; svc, superior vena cava ; rv, right ventricle. c and d, representative traces in the electrophysiological study before and after administrating a803467 at ganglionated plexus. two groups were set in this study based on injecting saline (0.5 ml per gp) or the selective nav1.8 blocker a803467 (1 mol/0.5 ml per gp) into both argp and slgp. after drug administrating, rap was delivered at the laa (20 hz, 10 diastolic threshold) for 6 hours. at the end of rap, targeted parameterseffective refractory period (erp) and window of vulnerability (wov) were evaluated as previously described.16, 18 briefly, we measured erp by using s1s1 programmed stimulating at 330 ms interval and s1s2 interval from 150 ms with decrementing at 10 and 1 ms when approaching the refractory period (s1:s2=8:1, 10 th). to delineate af inducibility, erp dispersion was assessed as the coefficient of variation of erp at all 8 recording sites. af was defined as irregular atrial rates related with irregular atrioventricular conduction at more than 500 bpm lasting at least 5 seconds. af cycle length was measured as the averaged first 10 fibrillation waves at the onset of af. the number of af episodes and averaged af duration were also recorded at each group. representative traces in the electrophysiological study before and after administrating a803467 at gps are shown in figure 1c and figure 1d. cardiac ganglia were quickly obtained from 3 canine heart fat pads located at the atria posterior wall. after that, they were placed into normal krebs solution in ice, dissected under a stereomicroscope, and put into liquid nitrogen for flash freezing. cryosections from embedded ganglia tissue were fixed in 4% paraformaldehyde for 10 minutes, permeabilized in 0.3% triton x100 in pbs for 15 minutes, and all blocked in 5% donkey serum for 30 minutes at room temperature. tissue sections were incubated at 4c overnight with primary antibody specific for rabbit polyclonal antinav1.8 (alomone labs, jerusalem, israel), rabbit polyclonal antinav1.5 (alomone labs, jerusalem, israel), goat polyclonal antipgp9.5 (abcam, cambridge, ma), goat polyclonal anticholine acetyltransferase (chat, chemicon international, temecula, canada), and mouse monoclonal antityrosine hydroxylase (th, alpha diagnostic international, san antonio, tx). alexa 488conjugated secondary antibody was then added according to a different source of primary antibody and incubated for 90 minutes at room temperature. stained samples were visualized under an olympus fluoview laser scanning confocal microscope (olympus, orangeburg, ny). tsa201 cells transfected with scn5a, scn10a, and scn3b plasmids were used for patch clamp study. a plasmid encoding egfp was used to identify transfected cells. briefly, transient transfection using fugene 6 (roche diagnostics, indianapolis, indiana) was carried out with scn10a, scn5a, and scn3b with a molar ratio of 5:5:1 (for a total of 2.25 g of dna). 15140 ], life technologies) on polylysinecoated 35 mm culture dishes (cell+, sarstedt, newton, nc). cells were placed in a 5% co2 incubator at 37c for 24 to 48 hours prior to patch clamp study. all recordings were obtained at room temperature (2022c) using an axopatch 200b amplifier equipped with a cv201a head stage (axon instruments inc./molecular devices, union city, ca). currents were filtered with a 4pole bessel filter at 5 khz and digitized at 50 khz. series resistance was compensated at around 80% to assure that the command potential was reached within microseconds with a voltage error 0.05, 10x threshold). after administrating saline or a803467, respectively, to the 2 groups at argp and slgp, rapid pacing was implemented at laa. the erps were reevaluated at the end of 6hour rap by the same protocol. compared with the control group, the shortening of erp at all pv and atrial sites was suppressed in the a803467 group (figure 3, p0.05 ; p0.05 [figure 4d and 4e ]). after 6hour rap, both erp dispersion and wov were significantly increased in the control group. however, injecting a803467 at gps attenuated the increase in erp dispersion and wov apparently at all sites, underlying the decrease in af inducibility (figure 4d and 4e, erp dispersion : 0.290.15 versus 0.150.13, wov : 180.7020.47 versus 21.645.84 ms ; p0.05 ; p0.05, 10x threshold). after administrating saline or a803467, respectively, to the 2 groups at argp and slgp, rapid pacing was implemented at laa. the erps were reevaluated at the end of 6hour rap by the same protocol. compared with the control group, the shortening of erp at all pv and atrial sites was suppressed in the a803467 group (figure 3, p0.05 ; p0.05 [figure 4d and 4e ]). after 6hour rap, both erp dispersion and wov were significantly increased in the control group. however, injecting a803467 at gps attenuated the increase in erp dispersion and wov apparently at all sites, underlying the decrease in af inducibility (figure 4d and 4e, erp dispersion : 0.290.15 versus 0.150.13, wov : 180.7020.47 versus 21.645.84 ms ; p0.05 ; p 100fold selective versus human nav1.2, nav1.3, nav1.5, and nav1.7 (ic50 > 1 mol / l).35 in the present study, tsa201 cells were transfected with scn5ascn10ascn3b, a803467 at 100 nmol / l potently inhibited ina, p by 42.02%, and it suppressed more in ina, l by 68.57%. gating properties were also changed under a803467 with hyperpolarized steadystate inactivation and delayed recovery from inactivation. interestingly, the leftshifted steadystate inactivation was quite consistent with the effect of a803467 in isolated mouse intracardiac neurons delineated by verkerk.36 like other sodium channel blockers, our results support that a803467 might block sodium channels in an inactivated state and the number of trapped inactivated sodium channels might be increased during repeated stimulation. obvious delay of recovery was displayed as 2 times slower in f and more than 3 times in s. the changes in gating properties, together with udb, indicate reduced availability of the sodium channel under sustained depolarization or repetitive stimulation, especially in a rapinduced af model. in the present study, we utilized the scn5ascn10ascn3b cotransfected model to analyze the effect of a803467 on sodium current and gating properties to provide a possible explanation for the results we found in animal experiments. compared with scn5ascn3b transfected tsa201 cells, the current density was significantly increased and was sensitive to a803467 when scn10a were added together with scn5ascn3b. since others ' and our studies have reported the extremely low current density in scn10ascn3b transfected cell lines,9, 21 it is reasonable to deduce that the increased current is not an arithmetic addition of current component produced by scn10a. it implies that scn10a might interact with scn5a as a new sodium complex (figure 8), and a803467 could have an effect on scn10ascn5a complex, as indicated in our patch clamp study. although the complicated protein network of this new complex needs to be further explored, this model cells might be help us to understand the electrophysiological role of nav1.8 in arrhythmias. our previous results demonstrated the association between nav1.8 and nav1.5 at the protein level when expressed separately ex vivo.9 in the present study, a803467 have apparent effects on current density and gating kinetics when coexpressed sodium complex of scn10ascn5ascn3b, which indirectly show the functional interaction between the 2 alpha sodium units. the detailed components of the complicated sodium complex in the cytoplasm need to be specifically explored. given their proximity to one another, scn5a and scn10a may be subject to common regulatory mechanisms, such as transcriptional control by tbx3 and tbx5. many association studies have discovered the intensive relationship between scn10a variants and af phenotype or incidence. in addition to the significant effect on gp, nav1.8 might directly influence the electrophysiological characteristics of cardiac tissue with suppressed trigger activity and reduced substrate during af (figure 8). the decreased current in ina, p by a803467 might prolong erp in atrium by virtue of postrepolarization refractoriness and reduce excitability at the fast rate due to udb. the significantly reduced ina, l seen in our study might suppress the incidence of early afterrepolarization during af. yang also showed that 30 nmol / l a803467 can remarkably reduce ina, l in mouse and rabbit myocytes with less effect on ina, p. in addition, the inhibition of sodium channel by a803467 can reduce na in myocytes during repolarization, which may prevent the ca loading to inhibit delay after repolarization. the suppressed trigger activity and reduced substrate could also be potential mechanisms for inhibiting af initiation and maintenance. several independent loci of scn10a were indicated to increase pr and/or qrs intervals, which were regarded as intermediate phenotypes, suggesting the risk of conduction disease and arrhythmia susceptibility.37, 38 there is an increased number of studies that focus on the relationship of scn10a / nav1.8 with cardiac diseases. in spite of several disputes such as the expression of nav1.8 in the heart,36, our previous study first reported 17 putative pathogenic scn10a variants in 25 of 150 brugada syndrome probands with a positive proband yield of 16.7%, approaching our historical yield of 20.1% for scn5a. subsequent studies from others also emphasize the importance of scn10a in both rare and common variants in brugada syndrome.9 one recent study concluded that rs6795970 might be associated with cardiac conduction abnormalities in patients with hypertrophic cardiomyopathy.40 therefore, it has come a long way as the new cardiac sodium channel, and the exact roles of nav1.8 in arrhythmia still have a long way to go. it can be considered as a novel target in understanding cardiac electrophysiology, and its selective blocker or other relative drug might be promising in scn10arelated arrhythmias. we did not record gp activity directly in our rapinduced canine af model in the absence or presence of a803467. however, previous studies have demonstrated that blocking gp activity can inhibit rapinduced atrial electrical remodeling and af inducibility. after we administrated a803467 in gps, the shortening of the erp in all recording sites and the increase in erp dispersion and wov were all attenuated, potently indicating the suppressed gp activity under the effect of a803467. since neurotransmission is not static and circumscribed, the nav1.8 blockade within the gps on af can have effects throughout the cardiac neuraxis. due to the plasticity in the nervous system, based on present data, we can not deduce that the observed effects may be limited only to the gps. meanwhile, our previous study showed the colocalization of nav1.5 and nav1.8 when we transfected their cdna separately into tsa201 cells. it would be more desirable if we could demonstrate this relationship in canine gp directly. however, our patch clamp study displayed that scn5a could evidently increase scn10a current in tsa201 cells, which can be blocked by a803467. we did not record gp activity directly in our rapinduced canine af model in the absence or presence of a803467. however, previous studies have demonstrated that blocking gp activity can inhibit rapinduced atrial electrical remodeling and af inducibility. after we administrated a803467 in gps, the shortening of the erp in all recording sites and the increase in erp dispersion and wov were all attenuated, potently indicating the suppressed gp activity under the effect of a803467. since neurotransmission is not static and circumscribed, the nav1.8 blockade within the gps on af can have effects throughout the cardiac neuraxis. due to the plasticity in the nervous system, based on present data, we can not deduce that the observed effects may be limited only to the gps. meanwhile, our previous study showed the colocalization of nav1.5 and nav1.8 when we transfected their cdna separately into tsa201 cells. it would be more desirable if we could demonstrate this relationship in canine gp directly. however, our patch clamp study displayed that scn5a could evidently increase scn10a current in tsa201 cells, which can be blocked by a803467. in the present study, we found that the nav1.8 selective inhibitor could decrease the incidence of acute af with suppressed electrical remodeling of atrial and pv myocardium in a rapinduced af model. nav1.8 could be a promising target in early af, as gp activity were more important in early electrical remodeling process of af begets af compared with progressed stages with prominent fibrosis and structural remodeling. in addition, we displayed that nav1.8 could probably interact with nav1.5, which may form a novel functional complex affecting cardiomyocyte and (or) cardiac gp properties, as shown in figure 8. and it could be supported by our electrophysiological study with noticeable changes in ina and gating kinetics under a803467. this study was supported by national natural science foundation of china (no. 81670304), china ; independent research project of wuhan university (no. 2042016kf0138), china ; national natural science foundation of china (no. 81530011), china ; and the masons of new york, florida, massachusetts, connecticut, maryland, wisconsin, and rhode island, usa. | backgroundganglionated plexus have been developed as additional ablation targets to improve the outcome of atrial fibrillation (af) besides pulmonary vein isolation. recent studies implicated an intimate relationship between neuronal sodium channel nav1.8 (encoded by scn10a) and af. the underlying mechanism between nav1.8 and af remains unclear. this study aimed to determine the role of nav1.8 in cardiac electrophysiology in an acute af model and explore possible therapeutic targets.methods and resultsimmunohistochemical study was used on canine cardiac ganglionated plexus. both nav1.5 and nav1.8 were expressed in ganglionated plexus with canonical neuronal markers. sixteen canines were randomly administered either saline or the nav1.8 blocker a803467. electrophysiological study was compared between the 2 groups before and after 6hour rapid atrial pacing. compared with the control group, administration of a803467 decreased the incidence of af (87.5% versus 25.0%, p<0.05), shortened af duration, and prolonged af cycle length. a803467 also significantly suppressed the decrease in the effective refractory period and the increase in effective refractory period dispersion and cumulative window of vulnerability caused by rapid atrial pacing in all recording sites. patch clamp study was performed under 100 nmol / l a803467 in tsa201 cells cotransfected with scn10awt, scn5awt, and scn3bwt. in a, p was reduced by 45.34% at 35 mv, and in a, l by 68.57% at 20 mv. evident fast inactivation, slow recovery, and usedependent block were also discovered after applying the drug.conclusionsour study demonstrates that nav1.8 could exert its effect on electrophysiological characteristics through cardiac ganglionated plexus. it indicates that nav1.8 is a novel target in understanding cardiac electrophysiology and scn10arelated arrhythmias. |
blood - oxygen - level - dependent (bold) functional magnetic resonance imaging (fmri) is an imaging technique that makes it possible to dynamically and noninvasively track metabolic and hemodynamic changes in the brain [1, 2 ]. the early developments of bold fmri data analysis have mostly relied on a method called general linear model (glm), whose objective is to pinpoint the differential involvement of certain regions during various tasks [35 ]. voxel clusters that exhibited such a behavior are declared activated and gathered into a so - called activation map that provides the output of the glm approach ; each map represents all regions that are significantly correlated with the stimulus time course. glm - based methods have been extensively used in order to extract regions in a wide variety of conditions (see, e.g., for a review of activation studies related to the premotor cortex). the glm, however, does not properly render the brain 's intricate organization, which is believed to be based on two major principles : segregation and integration [7, 8 ]. according to these two principles, functional tasks are performed by specific collections of brain regions, also called networks, that are anatomically connected and can engage in complex interactions [911 ]. even though the bold contrast is only remotely related to neuronal activity, it was first hypothesized, and then evidenced, that this imaging modality is able to reflect, at least to some extent, the strong constraints imposed on the brain by segregation and integration. first, studies showed that brain regions could still be correlated at rest, hinting for the existence of functional brain networks that could still be present and imaged even when no task was explicitly required from the subject [12, 13 ]. network investigation also started with a closer examination of the baseline, that is, the signal measured when a subject is in the rest condition of a protocol, between two task conditions. this approach was justified from the fact that, from an energetic perspective, the brain uses a significant part of the body 's energy, independently of the presence or absence of a task [15, 16 ]. as methods of increasing complexity were developed and validated, the objective of many methodological developments shifted from glm - related procedures to methods that were able to extract networks from bold fmri data. this paper is an attempt to review the latest advances in investigation of extended large - scale networks in fmri from a methodological perspective, as well as the networks that have been found using these methods. this new methodology, if confirmed, has very deep implications in terms of methods that should be developed, and we discuss some of the issues that such methods will have to deal with in order to provide reliable and useful results. an extended large - scale functional brain network may be defined as a (potentially large) number of segregated regions (potentially spread over the whole brain) that interact in order to execute a coherent task. while bressler and tognoli mostly consider high - level brain functions of which cognition is comprised, it is important to emphasize the fact that about any function that the brain is able to process is likely to have a network representation (see, e.g., section 4 for a description of some low - level brain functions, such as vision and audition processing). first, they are widely distributed over the brain. as a consequence of the segregation principle, it is hypothesized that they can be broken down into small brain regions, coined nodes by mesulam, units by marrelec., and local cortical area networks by bressler and tognoli, each region being characterized by a consistent functional behavior. such nodes can readily be identified in subcortical structures, which are often gathered into nuclei. as to the cortex, despite cytoarchitectonic features (embodied, e.g., by the work of brodmann and his eponymous regions) that vary across its surface, its parcellation based on structural criteria alone remains globally a challenge. for instance, primary sensory regions (e.g., visual) have been localized in a quite reproducible manner ; within these regions, areas responding more specifically to certain types of inputs have been successfully identified (e.g., vertical versus horizontal lines in the primary visual cortex). still, even though various levels of specialization can usually be observed, there is a general agreement that most regions can not be unambiguously associated with one specific function (see, e.g., for broca 's area) and, in general, a region will exhibit a certain level of multifunctionality : its contribution will not be limited to one task but will be allowed to vary within a given range of functions that it is able to implement. as a consequence of the integration principle, large - scale networks are also characterized by potentially distant regions with strong (anatomical) connections and (functional) interactions. whether top - down or bottom - up, serial or parallel, connections and interactions are quintessential of networks [18, 24, 25 ]. anatomically, interregional connectivity is suspected to be rather sparse [2630 ]. even though most connections originating from one region are thought to re - enter the same region, axons are known to connect regions that are far apart from each other, for example, homologue regions [e.g., [3133 ] ]. functionally, these connections have translations at all levels, from electrophysiology [3438 ] to measures of the electromagnetic field and of the bold signal [12, 13 ]. whether coined new phrenology or considered as being beyond phrenology, such an approach leads to a model of brain functions in which most functional tasks are subserved by functional brain networks, that is, collections of specialized regions that collaborate in order to generate a coherent behavior [11, 36 ]. in support of this approach, luria refers to three blocks : one that regulates the energy level and tone of the cortex, another one that is strongly implicated in information processing, and a last one that is involved in higher, complex tasks, such as the formation of intentions and programs for behavior. first, based on the co - occurrence of functions with similar features, the brain can be divided into five major subtypes : primary sensory - motor, unimodal association, heteromodal association, paralimbic, and limbic. there are also at least five large - scale networks, each dealing with a specific cognitive function : spatial awareness, language, explicit memory / emotion, face - object recognition, and working memory - executive function. these networks are not isolated from one another, but interact in very complex fashion, for example, through transmodal areas. relying on the assumption that bold fmri is indeed able to image brain networks (see, e.g., for a review of the neurophysiological substrate of neuroimaging), two categories of methods may be identified for such studies : approaches that make use of prior cognitive information and fully exploratory methods. correlational methods were historically the first ones to be applied to investigate large - scale networks in fmri data analysis, in the form of functional connectivity studies and functional connectivity maps [12, 4147 ]. one extracts all voxels whose time courses are significantly correlated with that of the seed. measures other than temporal correlation have also been used, such as coherence and partial coherence [48, 49 ]. selection of the seed region is a key issue in studies of functional connectivity. first, a brain region is selected according to its function (e.g., cortical representation for hand movement,). the corresponding seed is then obtained from either prior anatomical knowledge or functional manipulation. anatomically, common approaches consist of using coordinates in a standardized space (talairach or mni), or having an expert delineate the region on anatomical images. functionally, the seed can be obtained from an activation map, provided that the region of interest can be characterized by its implication in a specific task (e.g., the primary motor cortex in a simple movement) [41, 45, 47 ]. as opposed to effective connectivity where gonlaves and hall showed that results of sem analyses may vary depending on the choice of the seed voxel robustness of functional connectivity maps with regard to the selection of the seed region and its spatial extent have barely been examined yet. vincent. showed that, for the visual or the somatomotor network, the resulting functional connectivity map was robust to the choice of the starting seed region. many other parameters (e.g., design, size of each region) may have an influence on the outcome of the analysis, potentially leading to different spatial structures or correlation values between structures. full exploration of a whole network (i.e., with many regions) would imply the recourse to several successive computations of functional connectivity maps, each map being used to select a region significantly correlated as seed voxel for the next step a procedure that is lengthy, complex, and whose convergence is not assured. wang and xia have recently proposed a method to perform this exploration in only one step. the goal of fully exploratory methods is to provide data - driven approaches of large - scale network detection in which no prior cognitive information is required for the methods to proceed. a number of such procedures have been proposed, most of them relying more or less closely on either of the two key features of large - scale networks, namely integration and segregation. based on a similarity measure, they gather voxels irrespective of their anatomical proximity (and, hence, of segregation) into separate classes that are strongly similar to each other and dissimilar from one another. for each class, the output is a map representative of the class and an associated time course. all methods have one or several parameters whose tuning affects the number of classes. since each class tends to gather voxels that are strongly correlated, it is often univocally identified with a large - scale network. blind approaches include methods based on eigenvalue decomposition, such as principal component analysis (pca) [5355 ], correlation clustering, kendall 's coefficient of concordance [57, 58 ], k - means [59, 60 ], fuzzy clustering methods [54, 56 ], self - organizing map algorithms, kohonen clustering neural network and fuzzy c - means, hierarchical clustering [60, 63 ], integration and information - theoretic quantities [64, 65 ], and spatial independent component analysis (sica). while most methods provide maps that are exclusive (a voxel can only belong to one map), a few (e.g., fuzzy clustering or ica) provide an index of the plausibility for a voxel to belong to each of the different classes. most methods also provide local criteria, calling for stepwise analyses, at the exception of pca and ica that use global measures and, consequently, are able to perform classification in one step. most approaches mentioned in the previous paragraph have only been used a limited number of time in fmri data analysis so far. this can probably be accounted for by the complexity of their algorithms, which is commensurate with the difficulty of the task at hand. outstandingly, sica has been used quite a lot recently, with results that are rather promising. regardless of its popularity, though, the network interpretation of the results obtained needs to be proved beyond simple criteria (these include, e.g., that voxels located close to each other or in homologue regions tend to belong to the same class). for instance, for pca, friston and bchel mention that the interpretation of the eigenimages in biological terms might be dubious, since they could be rotated in the data space and still be a solution to the problem (but see). by contrast, components obtained through ica can be more easily related to known physiological noises or functional processes [66, 69 ]. the methodological reasons for this success are, however, still not clear, and many explanations are plausible : the relevance of the assumption of spatial independence, the adequacy of the underlying mixing model, the efficiency of the global criterion / one - step discrimination approach, or some interesting feature of the information - theoretic optimization algorithm. in any case, the fact that its application simplifies the results to a maximum and produces a very limited number of widespread networks, making interpretation easier, clearly plays in its favor (compare, e.g., with [70, 71 ], or). its sensitivity, which is much higher than that of clustering methods, might also explain its success. nevertheless, it must still be kept in mind that the assumptions underlying ica (perfect synchrony within a network and spatial independence between networks) impose an extreme and unrealistic case of integration. while the simplification of several time courses into one is performed only once for ica, the stepwise procedures implemented by other methods essentially go through the same approximation at each step, leading to an error that is probably far larger. unlike the numerous approaches to functional integration, few methods have specifically sought to extract segregated regions. some methods decrease the complexity of the data by using predefined regions (e.g., according to the tzourio - mazoyer. approaches using predefinite regions do not check that all voxels within a region exhibit homogeneous bahaviors ; they merely assume that it is the case. average signals are then extracted from each region, on which any integration - based approach, such as hierarchical clustering [71, 72 ], can be applied. intuitively, many clustering methods mentioned previously (e.g., k - means, hierarchical clustering, or information - theoretic measures) could easily be applied for the purpose of detecting segregated regions by incorporating a constraint of contiguity between voxels that could be merged. among these, only the information - theoretic approach explicitly takes both within- and between - classes measures of similarity into account. specifically, they optimize a so - called functional clustering index (fci) that keeps a balance between region homogeneity (strong segregation) and sparseness of inter - regional interactions (low integration) [64, 65]the latter constraint being hard to justify from a network perspective. as to other clustering methods, as noted by goutte. in accordance to huygens ' formula, maximizing a measure of the internal coherence of a class (associated with segregation) is often equivalent to minimizing the same measure of coherence but computed between classes (that could be associated with integration). as such, the behavior of such methods with regard to networks would again lead to questioning. a tentative approach to consider simultaneously segregation and integration has been conducted by the large scale network identification (lsni) method by bellec.. lsni first clusters neighboring voxels into small regions using a region - growing algorithm and then selects regions that exhibit a significant correlation with other distant regions. such a procedure allows to define brain functional regions and networks in a purely data - driven way. while the sensitivity of the algorithm proposed was rather low, it had the great advantage to explicitly define and address the two principles of functional segregation and integration. so far, this method seems adapted for individual analyses ; its extension to group studies seems limited due to the subject - dependent definition of regions. during the last decade, several brain systems have been studied in fmri using functional connectivity - related approaches. these studies have revealed integrated systems, including primary systems and associative networks. exploratory approaches have also allowed to extract several functional networks at once. even if all brain areas are not included in a network, these networks involve many areas and constitute a possible functional parcellation of the brain. the motor network was the first network studied through functional connectivity analyses. reported correlations in low - frequency resting - state fluctuations between left and right motor areas using single - slice fast - sampled acquisitions. this result was later reproduced with multislice acquisitions where an extended motor network was shown to correlate with a region in the primary motor cortex [44, 47 ]. lowe. showed that other functional networks could be detected using other seed regions, namely the visual network with a seed around the calcarine fissure and a limbic network with a seed in the amygdala. an auditory and a language systems were later extracted in the same way [41, 43 ]. other networks were also studied using the seed - region functional connectivity approach, such as the default - mode network [8386 ], the attentional networks [42, 83, 87 ], and memory networks [46, 88 ]. more recently, a larger number of functional networks were revealed using exploratory methods based on ica [7678 ]. even if the number of extracted networks varied, their spatial organizations were reproducible across studies. for instance, all three studies just mentioned found functional networks involving the same systems that were sometimes split into different parts (e.g., left / right, rostral / caudal). using group ica studies of resting - state datasets [7678 ], which were the most reproducible, we selected seven functional networks : a motor / sensorimotor system, a visual system, an auditory system, a default - mode network, a dorsal attentional network, a ventral attentional network, and an executive control network. van de ven. systematically studied the reproducibility of ica results on individual datasets and the results using hierarchical clustering and self - organizing map algorithm (som) were presented on an individual level. the results from studies that provided a systematic description of all networks found are reported in table 1. in figure 1 and table 2, we also reported results from a study on a population of 20 healthy subjects acquired at rest, where networks were extracted using spatial ica and a hierarchical clustering approach similar to that of esposito.. the sensorimotor system involves at least the pre- and postcentral gyri (including the primary motor cortex and supplementary motor area). the visual system involves both medial striate and extrastriate regions (calcarine sulcus and lingual gyrus), as well as lateral occipital regions (nonprimary visual regions) ; these two visual networks (primary and associative) were identified separately by the three group - ica studies. the auditory system involves principally lateral superior temporal gyri, the heschl 's gyrus and insular cortex. the so - called default - mode network involves the anterior and posterior cingulate cortices, the medial prefrontal cortex and lateral parietal regions [15, 8991 ]. the dorsal attentional network involves lateral prefrontal and dorsal partietal cortex ; these regions are involved in visio - spatial control [42, 92, 93 ]. the ventral attentional network involves inferior occipito - parietal regions and inferior lateral prefrontal regions ; these regions are principally involved in new item recognition [42, 94 ]. last, the executive control network involves superior and middle prefrontal cortices, ventrolateral prefrontal cortex and anterior cingulate gyrus. other studies have applied these exploratory approaches to extract integrated functional networks from fmri datasets acquired during external stimulation [73, 79, 80 ]. these results showed that the detection of the functional networks not directly related to the stimulation were less sensitive than that without external stimulation. tracking the presence of extended large - scale networks in bold fmri data raises many issues. we have here focused on some aspects related to the neurocognitive aspects of networks, their identifiability by fmri, and the methodological questions raised by network analyses. the major issue to be faced is arguably the very definition of an extended large - scale brain network. indeed, even though the brain is far from being fully connected, any region is eventually connected to any other regions if one takes polysynaptic connections into account. obviously, stating that the brain can be considered as one network is by no way satisfying, no more than it is to say that each macrocolumn forms a networks by itself. the strongly hierarchical nature of the brain 's anatomical and structural organization induces similar characteristics at all levels. as the brain can be decomposed in networks, each network can in turn be further partitioned into subnetworks, subnetworks into subsubnetworks, and so on. furthermore, even though there probably is a (potentially loose) relationship between anatomical and functional organizations, it is still unknown how functional integration and segregation are coded in anatomical terms. for the exact same structural organization, it has been shown that networks can be observed to break down as one discriminates different sets of functional tasks or behaviors with increasing precision. for instance, the visual system can be decomposed into a ventral and a dorsal stream. these two subnetworks, albeit interacting, have very distinct functions [42, 92, 96 ]. similarly, the motor system can be further separated into a cerebello - cortical and a basal - cortical loop with different patterns of involvement [97, 98 ]. for instance, it has been argued that the fronto - parietal network could be further partitioned into two subnetworks subserving attention and working memory, respectively,, while the working memory network itself could be further broken down in two, with one subnetwork mediating attentional selection and another one rather underlying language functions. for instance, activation of some fronto - parietal regions is observed during different cognitive tasks ; are these regions transmodal or part of a subnetwork that has a specific function ? similarly, the insular cortex is typically a multimodal association area that is not specifically activated by auditory stimuli. however, as reported in section 4, recent papers have consistently classified it as belonging to a so - called auditory system. as evidenced by figure 1, there are also some overlapping between networks, and voxels can be simultaneously classified as belonging to different networks. what is the function of such regions ? could this overlapping between networks be related to synchronization through distinct frequency - bands if such a phenomenon is indeed visible through fmri bold imaging ? regarding the influence of a task on a network, an issue that has not received much attention yet, studies have shown that networks could indeed be influenced by the processing of a task, either during the task or even after it. it is hence not unrealistic to suspect that processing of a task might also modify the very structure of some networks. another cogent question is the relationship between networks as detected by fmri data analyses and those mentioned in the literature. networks extracted from fmri are the consequence of the optimization of a mathematical criterion whose link to neuroscience is, at the very least, not obvious. while some results have been rather successfully related to the neurocognitive literature (e.g., attentional network), other results are more complex to interpret. some networks extracted seem to share commonalities with some of the subtypes described by mesulam (e.g., the motor network ; cf. section 2), while others seem to be rather related to mesulam 's neurocognitive networks (e.g., the attentional network). besides, the union of all reported networks (e.g., by sica) does not include the whole brain. some brain regions globally, the criterion used for network extraction might make the methods sensitive to some functions or types of connections. for instance, top - down and bottom - up influences have distinct features [25, 34, 3638 ]. apart from these difficulties, there has also been evidence of variability across healthy subjects [80, 103 ] that could be explained by many factors, such as development and/or age [104, 105 ], and, in general, all forms of plasticity [106, 107 ]. pathologies, for example, stroke [108, 109 ] or tumors [110113 ], render the issue even more complex. some studies have shown that certain pathologies can have network - specific effects : behavioral deficits in spatial neglects for the fronto - parietal network ; epilepsy and alzheimer 's disease for the default - mode network. nonetheless, these results must be used with caution, for it is not clear yet whether they truly reflect a change in neuronal properties or, as, for example, in grade ii glioma, a mere modification of the metabolic and vascular properties of the surrounding tissues. use of bold fmri as a way to investigate large - scale networks relies on three successive assumptions, namely, that information exchanges between neurons is related to synchronies, synchronies to the bold contrast, and the bold contrast to the fmri data effectively measured. synchronies are the blueprint of communication between regions [17, 39, 117120 ] and, as such, should be strongly related to large - scale networks. a challenging issue is to determine the exact relationship between the spatial distribution and interaction pattern of regions within a large - scale network on the one hand and, on the other hand, the spatial and frequential distribution of oscillations. another issue is the connection between neuronal activity / synchrony and the appearance of a bold signal. while much still needs to be unraveled as to the connection between neuronal synchronies and the bold signal, it now seems more and more accepted that a sustained change in neuronal activity is likely to entail a relative change in the bold level [121124 ], even though the exact relationship is expected to be rather complex. still, the bold signal is only a fraction of the total signal that is acquired in fmri, a signal that is not exempt from many kinds of artifacts [126128 ]. in particular, some physiological processes (e.g., cardiac, respiratory, or movement - related) induce spurious effects that contaminate the bold signal in the whole brain [129, 130 ]. such artifacts are predominant in certain regions of the brain, such as the basal arteries for cardiac activity or the interfaces between cerebrospinal fluid pools and brain tissus for breathing and head movements. some network detection algorithms may hence recognize voxels influenced by the same spatially structured artifact as meeting the requirement for strong temporal coherence and, hence, assign them to a common structure. this feature has been successfully used by ica techniques to provide efficient noise separation and removal techniques [66, 131, 132 ]. yet, the issue arises when structures induced by noise are wrongly interpreted as functional networks ; their detection and removal is hence of very high importance. the fundamental question, while examining spatial structures with a similar temporal behavior, is do we measure neurally induced signal or consequences of physiological processes ? even though our understanding of the potential artifacts that can contaminate the bold fmri signal improves, the consequences of many potential sources of structured noise have barely been mentioned, investigated. for instance, it is believed that some mechanisms related to the regulation of blood flow (e.g., through the level of co2 in the blood) could induce coherent changes in bold signal throughout the brain giving birth to an effect likely to be identified as a functional network. in fact, such an effect has been used to explain the presence of the default - mode network in fmri [134, 135 ]. now, whether these regions are wrongfully classified as belonging to a common functional network because their voxels are corrupted by the same artifact, or whether they are actually regions that drive the physiological response is a matter that remains to be solved. we here quickly discuss issues related to the choice of a model, the redundancy of fmri signals, the necessity to provide both individual and group analyses, the importance of result representation, and the validation of fmri results with other modalities. procedures used to investigate networks are usually based on mathematical methods that have been discovered independently of the field of fmri data analysis. while it can be accepted that most methods are general enough to be applied to a wide variety of problems, they still require a careful assessment of how best to adapt them to the issue at hand. we believe that the major point to cope with here is how do methods code for segregation and integration ? does it make sense ? a relevant approach could be to try to derive out consistence requirements from cognitive consideration of what an ideal method should be able to do : quantify integration between voxels, regions, or networks using the same principled measure (such as the multiple correlation coefficient or integration [7, 137 ]) ; differentiate between direct and indirect information exchanges (such as partial correlation [19, 72, 138141 ]) ; discriminate causality from simple co - occurrence (such as granger causality [138, 142144 ]). some methods are able to deal with one aspect of the problem, but none has been proposed to answer all these questions simultaneously. besides, investigation of large - scale networks face a very interesting problem, namely that of determining the spatial precision under which data should be considered as segregated and over which they should be said to be integrated. while it is obvious that neighboring voxels share a great deal of information, methods that model and summarize the behavior of a whole network with one single time course clearly oversimplify the problem and discard a lot of cogent information. proposed a statistical model that provides a critical distance that separates segregation and integration. however, the parameters that characterize the clustering coarseness are set a priori, when they should be determined by the intrinsic properties of the data and allowed to vary across the brain (e.g., between subcortical and cortical structures, which have distinct characteristic spatial extents). at least for this reason, it is a crucial step, because network investigation requires multivariate analyses that are computationally very demanding (the computational burden roughly exponentialy increase with the number of regions). in neurocomputing, models investigating issues very similar to that of large - scale networks have already been developed [145148 ]. however, most methods developed so far for effective connectivity, such as structural equation modeling (sem) [149152 ], dynamical causal modeling (dcm) [153155 ], or generative models including neural mass models [145, 156 ] and large - scale neural models [147, 157159], have been of little use to the investigation of extended large - scale networks, since their intrinsic complexity prevent them from modeling systems with that many degrees of freedom (but see,). methods originating from graph and/or network theories might prove more adapted to such problems [161163 ], since they provide global quantification of structures that, besides from being ubiquitous [164, 165 ], are not unlike some models of brain networks. using such methods, brain networks have been shown to exhibit small - world [70, 166170 ] and scale - free [171, 172 ] features. the fact that networks simultaneously exhibit both properties has strong structural [104, 173 ] and functional [174, 175 ] implications. being able to devise methods that can deal with both individual and group analyses is also an important issue. at the individual level, it is essential to assess the significance of the different networks [80, 85, 176 ]. with procedures of increasing complexity, nonparametric resampling procedures, mostly used in the context of the glm so far, this has been done by either considering a model for the group or solving the problem at an individual level and then performing clustering. validation of such methods have to be developed ; a first step in this direction has been proposed by calhoun.. though computationally tractable on a large - scale network of n units, even for n large, such a method generates n(n1)/2 correlation coefficients (e.g., 4950 for as few as 100 voxels / regions ; 19900 for 200 ; 499 500 for 1000). simply representing these on a graph as is commonly done [72, 140, 181 ] procedures that summarize the information have to be proposed ; these can rely on pca / mds [71, 79, 182 ] ; they could also use other representational techniques [183, 184 ]. last, but not least, an essential point to validate and better understand the large - scale network approach in fmri is the comparison with results form other imaging modalities or areas of neuroscience, such as electrophysiology [3438 ], electroencephalography (eeg) or magnetoencephalography (meg) [39, 125, 185, 186 ], and diffusion tensor imaging (dti) [187190 ]. to be able to efficiently compare results from different imaging modalities, it is essential to better understand how each modality images the activity of large - scale brain networks. in this perspective, providing a unified generative and/or statistical model for several of these modalities would be of the utmost importance, granting access to multimodal in vivo imaging of the brain in action. | a large - scale brain network can be defined as a set of segregated and integrated regions, that is, distant regions that share strong anatomical connections and functional interactions. data - driven investigation of such networks has recently received a great deal of attention in blood - oxygen - level - dependent (bold) functional magnetic resonance imaging (fmri). we here review the rationale for such an investigation, the methods used, the results obtained, and also discuss some issues that have to be faced for an efficient exploration. |
transfection of small interfering rna (sirna) molecules into mammalian cells induces post - transcriptional gene silencing via sequence - specific mrna degradation (rna interference) (1,2). sirna molecules for rnai experiments can be generated by chemical or by enzymatic synthesis (1,3). expressed hairpin molecules are intracellularly processed into functional sirna by the ribonuclease dicer (24). only a fraction of randomly chosen 19 bp sirna sequences has the capability of inducing efficient gene silencing (5). therefore, gene knock down experiments typically require a labour and cost - intensive optimization of potent sirnas and protocols for efficient sirna delivery into the cell lines of interest that are frequently refractory toward sirna incorporation. the availability of functional sirna sequences and sirna transfection protocols is steadily increasing due to the rapidly growing number of published applications of rnai. this prompted us to establish the human sirna database (husida) (http://www.human-sirna-database.net). the database serves as a repository for both, sequences of published functional sirna molecules targeting human genes and important technical details of the corresponding gene silencing experiments. it aims at supporting the setup and actual procedure of specific rnai experiments in human cells. published articles describing functional sirna sequences in pubmed are identified by a query with the keywords rnai, rna interference and sirna. the effectiveness of each sirna sequence was judged by its gene silencing activity as shown in the results section of the publication. mismatches or lack of a corresponding mrna sequence are automatically detected and indicated in the husida. each database record consists of the target gene name including the corresponding gene accession numbers (unigene, refseq), the sirna sequence (sense strand), its activity in the percentage of gene silencing (if available), manuscript reference (pubmed), the cell line and transfection method used, the sirna source and the target gene description. recently, it has been proven that 15 (perhaps sometimes even as few as 11) contiguous nucleotides are sufficient for directing the degradation. this implies that a given sirna may elicit effects even on mrnas that were not intended to be down - regulated but additionally targeted because of sequence similarities (6). to address this issue, we employed the refseq database search to identify the length of the longest contiguous part of the sirna that in addition to the target mrna also matches other mrna sequences. this value, becoming larger when chances for off - target effects increase, we term specificity and we calculate it for all sirnas. to retrieve functional sirnas sequences for a specific gene, the human sirna database can be searched for unigene cluster ids, gene names, refseq accession numbers and target gene descriptions via a web interface (www.human-sirna-database.net) downloads of the complete database content are available. another important feature of the sirna database is the availability of technical background information as a basis for the design of rnai experiments. for instance, the option to search for cell lines enables the user to readily identify suitable sirna transfection protocols. rna interference in research and experimental therapy, the availability of new sirna sequences is growing exponentially. we therefore strongly encourage the submission of sirna sequence datasets by users, provided that the sequences have been accepted for publication in a peer - reviewed journal. for this purpose, owing to the known limitations of sequence alignment, many published sirnas may lead to sequence - dependent off - target effects (7). therefore, in future versions of the database, calculation of the specificity will consider position - dependent target mismatch tolerances. published articles describing functional sirna sequences in pubmed are identified by a query with the keywords rnai, rna interference and sirna. the effectiveness of each sirna sequence was judged by its gene silencing activity as shown in the results section of the publication. mismatches or lack of a corresponding mrna sequence are automatically detected and indicated in the husida. each database record consists of the target gene name including the corresponding gene accession numbers (unigene, refseq), the sirna sequence (sense strand), its activity in the percentage of gene silencing (if available), manuscript reference (pubmed), the cell line and transfection method used, the sirna source and the target gene description. recently, it has been proven that 15 (perhaps sometimes even as few as 11) contiguous nucleotides are sufficient for directing the degradation. this implies that a given sirna may elicit effects even on mrnas that were not intended to be down - regulated but additionally targeted because of sequence similarities (6). to address this issue, we employed the refseq database search to identify the length of the longest contiguous part of the sirna that in addition to the target mrna also matches other mrna sequences. this value, becoming larger when chances for off - target effects increase, we term specificity and we calculate it for all sirnas. to retrieve functional sirnas sequences for a specific gene, the human sirna database can be searched for unigene cluster ids, gene names, refseq accession numbers and target gene descriptions via a web interface (www.human-sirna-database.net) downloads of the complete database content are available. another important feature of the sirna database is the availability of technical background information as a basis for the design of rnai experiments. for instance, the option to search for cell lines enables the user to readily identify suitable sirna transfection protocols. rna interference in research and experimental therapy, the availability of new sirna sequences is growing exponentially. we therefore strongly encourage the submission of sirna sequence datasets by users, provided that the sequences have been accepted for publication in a peer - reviewed journal. for this purpose, owing to the known limitations of sequence alignment, many published sirnas may lead to sequence - dependent off - target effects (7). therefore, in future versions of the database, calculation of the specificity will consider position - dependent target mismatch tolerances. several attempts have been made for identifying sequence characteristics associated with highly effective sirnas molecules. statistical analysis of the correlation between sirna sequence and efficacy has led to the development of several sirna design algorithms (5,814). they are based on various criteria including sequence features, hairpin formation potential, duplex stability and secondary structure features of mrna. a recently published comparative analysis revealed significant qualitative differences in the performance of these algorithms. three out of four of the well - performing algorithms are based on sequence features ; the best performing one is based on weighted sums of sequence motifs and patterns (15). this suggests that the relevant information required for the efficient prediction of sirnas efficacy is contained in its primary sequence and that the relevance of flanking sequences and mrna secondary structure have probably been overrated in the past. it is important to note that all previous experiments for sequence optimization have been restricted to synthetic sirna molecules. reports indicating that sirna sequences sometimes lose silencing activity when embedded in a short hairpin format (16) suggest that the key determinants of silencing activity may be distinct in the short hairpin context.. only sirna sequences of 19 bp length and validated silencing activity have been included to ensure a homogeneous, well defined dataset. the dataset db_all consists of 603 sequences, targeting 396 different genes ; the dataset db_sh (short hairpin) consists of 87 active short hairpin sirna sequences (see supplementary material). the statistical analysis includes (i) the analysis of position - dependent base preferences within the 19 bp sirna sequence core and the 5 and 3 flanking dinucleotides, (ii) global gc - content, (iii) the exclusion of base repetitions and (iv) the existence of stable hairpin structures. we first analyzed the frequencies of concurrencies of g or c nucleotides at specific positions of the 19 bp sirna core of the 603 active sirna sequences listed in our database (figure 1). in addition, positions 4, 7 and 10 preferentially harbor g or c nucleotides, while g or c nucleotides at position 6 were underrepresented. approximately 80% of the published sirna sequences have been designed according to the recommendations of elbashir. these sequences reside in the coding regions of their target genes and follow aa dinucleotides. a statistical analysis of nucleotide preferences of random 19mers and random 19mers that follow aa dinucleotides is displayed in figure 1e and f. selection for preceeding aa dinucleotides precludes sequence preferences for g or c nucleotides at positions 1, 4, 7, 10, 13 and 16. this 3 bp periodicity is due to different base compositions within reading frames (17). for instance, the first position in most reading frames has an excess of g nucleotides. if the rule of preceding aa dinucleotides is applied, the resulting 19 mers are preferably in the reading frame and, consequently, g nucleotides are overrepresented at positions 1, 4, 7, etc. this could, at least partially, contribute to the observed preferences for g or c nucleotides at positions 1, 4, 7 and 10 in the selected sirna population (figure 1d). (8). however, in our opinion, these results are due to the sirna design rules, as described above, and are not an underlying principle of functional sirnas. the analysis of sequence position - dependent preferences for g or c nucleotides in db_all and the subset of short hairpin sirna sequences (db_sh) gave comparable results (see supplementary material). (5) have identified eight criteria (i viii) associated with functional sirna molecules. for example, to match criterium ii, sirna sequences must exhibit a low internal stability of the 3 end of the sense strand. this is the case if the sense strand harbors at least 3 a / u bases at positions 1519. a detailed statistical analysis of our db_all dataset (603 sequences) revealed that sequences matching this criterion are not over but slightly underrepresented (47.1% of active versus 52.2%), when compared to a set of randomly selected 19mers (see supplementary materials). the same holds true for most of the other criteria. it would be interesting to analyze subsets of highly active sirnas (> 80% silencing) instead of the complete database (> 50% silencing). however, at present, the number of sequence entries with assigned well - defined silencing efficacies is still limiting. it is our intention to facilitate the refinement of sirna design algorithms by providing a collection of rapidly accessible sirna sequences. are supported by the german federal ministry of education and research (bmbf) and the german research foundation (dfg). are supported by a grant (ngfn kr - s01t06) from the german federal ministry for research and education (bmbf). | small interfering rnas (sirnas) have become a standard tool in functional genomics. once incorporated into the rna - induced silencing complex (risc), sirnas mediate the specific recognition of corresponding target mrnas and their cleavage. however, only a small fraction of randomly chosen sirna sequences is able to induce efficient gene silencing. in common laboratory practice, successful rna interference experiments typically require both, the labour and cost - intensive identification of an active sirna sequence and the optimization of target cell line - specific procedures for optimal sirna delivery. to optimize the design and performance of sirna experiments, we have established the human sirna database (husida). the database provides sequences of published functional sirna molecules targeting human genes and important technical details of the corresponding gene silencing experiments, including the mode of sirna generation, recipient cell lines, transfection reagents and procedures and direct links to published references (pubmed). the database can be accessed at http://www.human-sirna-database.net. we used the sirna sequence information stored in the database for scrutinizing published sequence selection parameters for efficient gene silencing. |
previous studies showed that a novel, combined haemophilus influenzae type b (hib) and neisseria meningitidis serogroups c and y conjugate vaccine that uses tetanus toxoid as carrier protein (hibmency - tt) was immunogenic with an acceptable safety profile when administered to infants as a 3-dose primary series, with a fourth dose in the second year of life. the vaccination schedule for hibmency - tt is consistent with the current hib immunization schedule recommended by the united states (us) advisory committee on immunization practices, which includes a fourth dose of hib at 12 to 15 mo of age. in australia, a fourth dose of hib conjugate vaccine is routinely given at 1 y of age. according to these schedules, hibmency - tt could potentially be coadministered with the combined measles, mumps, and rubella vaccine (mmr) and monovalent varicella vaccine (var). to facilitate integration of hibmency - tt into toddler vaccination schedules, it is important to demonstrate a lack of immune interference and an acceptable safety profile when mmr, var, and hibmency - tt are given at the same time. in 2 randomized controlled studies, infants received either hibmency - tt or hib polysaccharide conjugated to tetanus toxoid (hib - tt ; acthib, sanofi pasteur sa, lyon, france) at 2, 4, and 6 mo of age, followed at 12 to 15 mo of age by 1 dose of hibmency - tt or hib polysaccharide conjugated to n. meningitidis outer membrane protein (hib - omp ; pedvaxhib, merck and co. inc., whitehouse station, nj, usa) coadministered with mmr (m - m - r ii ; merck and co. inc.) and var (varivax ; merck and co. inc.). hib - omp was used for the toddler dose at the request of the us food and drug administration, because us prescribing information for hib - tt does not include immunogenicity data for children aged between 12 and 15 mo. the hib, menc, and meny immunogenicity results from both studies were reported previously. the designs of the studies were sufficiently similar to allow a pooled analysis of immune responses to the coadministered mmr and var in the hibmency - tt group relative to those in the hib - omp control group at 12 to 15 mo of age. immunogenicity data available from australian children included in a phase ii randomized controlled study (nct00134719) and us children enrolled in a phase iii randomized controlled study (nct00289783) were assessed. the studies, which were described in detail previously, were designed in a similar way within the context of each country s immunization schedule, with the pre - specified objective of pooling data for the primary objective of assessing the non - inferiority of mmr and var co - administered with hib - mency compared with co - administration with a licensed hib vaccine. conditions to pool the data were therefore defined prospectively, and were determined on the grounds of comparable immunogenicity between studies and were met if the point estimates of the difference between the hibmency - tt and hib - omp groups were above the predefined noninferiority limits in each study in terms of anti - measles seroconversion, anti - mumps seroconversion, anti - rubella seroresponse, and anti - varicella seroconversion. immunogenicity analyses were performed on the pooled according - to - protocol (atp) cohorts for immunogenicity from each study, defined as vaccinated children who eligibility criteria, complied with protocol - defined procedures, and had antibody assay results available for at least 1 antigen component. cut - offs for seropositivity were defined as follows : anti - measles, enzyme - linked immunosorbent assay (elisa) value 150 miu / ml ; anti - mumps, neutralization test value 28 ed50 ; anti - rubella, elisa value 4 iu / ml ; anti - varicella fluorescent antibody membrane assay value 1:5. seroconversion for antibodies to measles, mumps, and varicella was defined as the presence of detectable levels of the relevant antibodies at 42 d post - vaccination in subjects who were seronegative before vaccination. seroresponse for rubella was defined as the appearance of anti - rubella virus antibodies to a concentration 10 iu / ml in subjects who were seronegative before vaccination (concentration 40.0c was infrequent (40.0c ; rash with 200 or more papules, vesicles and/or crusts. in 2 randomized controlled studies, 3 doses of hibmency - tt in infancy followed by 1 dose at 12 to 15 mo of age induced robust anti - hib and anti - meningococcal serogroups c and y immune responses and had an acceptable safety profile. here, pooled analysis of data from these studies demonstrated noninferiority of immunological responses to mmr and var when concomitantly administered with the fourth dose of hibmency - tt compared with coadministration with a fourth dose of monovalent hib - omp. previous analyses showed the percentages of children with anti - polyribosylribitol phosphate (prp) antibody concentration 1.0 g / ml were high after the fourth hibmency - tt dose and consistent with the hib - omp control group, and that anti - prp geometric mean concentrations were significantly higher than in hib - omp recipients. these results were in line with a study of hibmency - tt vs. monovalent hib - tt vaccine in which mmr and var were not coadministered with the fourth dose. this suggests immune responses to hibmency - tt, mmr, and var are not compromised when administered together, although the possibility of interference can not be completely excluded because no group in the current study received a fourth dose without mmr or var, or received mmr and var alone. the reactogenicity profile of mmr and var was comparable when coadministered with hibmency - tt or hib - omp, as indicated by similar incidences of mmr- and var - specific solicited symptoms in both groups. also, the incidence of fever > 38.5c in the hibmency - tt and hib - omp groups was consistent with the incidence of fever 38.9c reported in a study in which a group of children aged 12 to 23 mo received mmr and var alone. parotid / salivary gland swelling was reported in less than 1% of subjects in the hibmency - tt group, which was consistent with a review of various randomized studies involving 3 different mmr vaccines that also showed low incidence of this adverse event (1.8%). approximately one - third of enrolled infants in the us immunogenicity cohort were excluded from the atp cohort for immunogenicity because of noncompliance with the blood sampling schedule or insufficient blood samples. additionally, the majority of subjects in both studies were white / caucasian. other potential limitations were the lack of a control group that did not receive m - m - r ii and varivax without the co - administration of licensed hib vaccine, and lack of blinding of study personnel to treatment group, which could have influenced the assessment of reactogenicity, although in this instance one might expect the bias to be against the investigational vaccine, which includes two additional antigens. also, the results of group comparisons should be interpreted with caution considering that there was no adjustment for multiplicity and the study was not powered for these comparisons, meaning that definite conclusions can not be made regarding the relative risk of a given adverse event. in conclusion, the results of this pooled analysis of data from 2 randomized controlled studies indicate that a dose of hibmency - tt at 12 to 15 mo of age, given as part of a 4-dose hibmency - tt series, can be administered with an acceptable safety profile without diminishing immune responses to mmr and var. | a pooled analysis was conducted of 1257 toddlers who received a fourth dose of haemophilus influenzae type b - neisseria meningitidis serogroups c and y - tetanus toxoid conjugate vaccine (hibmency - tt) or hib conjugate vaccine (hib polysaccharide conjugated to n. meningitidis outer membrane protein) coadministered with measles - mumps - rubella (mmr) and varicella (var) vaccines (nct00134719/nct00289783). noninferiority of immunological responses to mmr and var was demonstrated between groups and incidences of mmr- and var - specific solicited symptoms were similar, indicating that hibmency - tt can be coadministered with mmr and var. |
in the yoga sutras, yoga is defined as union of mind, body and spirit. these days it is assuming importance in improving mental health and quality of life in the treatment of a number of disorders. for example, a rash of psoriasis may not bother some people while it may make some feel depressed and more ill. for example, with some mental illnesses one may not eat, or take care of oneself, and this can cause physical problems. who defines quality of life as individuals perceptions of their position in life in the context of the culture and value systems in which they live and in relation to their goals, expectations, standards and concerns. quality of life means a good physical and mental condition, consisting of two elements : the ability to cope with everyday tasks (the biopsychosocial level) and the patient 's satisfaction from his activities at all levels as well as control over the disease and symptoms connected with the treatment method being applied. the most important and frequently used generic health - related quality of life assessment is the sf-36 comprising of 36 questions providing functional health and well - being scores. the sf-12 is a multipurpose short - form survey with 12 questions, all selected from the sf-36. the questions are combined, scored, and weighted to create mental and physical functioning and overall health - related - quality of life. the present study evaluates the changes in quality of life following short - term lifestyle modifications based on yoga. to study the effect of short - term yoga therapy program on quality of life in patients suffering from psychosomatic ailments. the study was done in svyasa arogyadhama, bangalore in the month of july 2011. it was based on the data collected on 94 subjects who were diagnosed for psychosomatic ailments based on history and previous investigations and who attended integrated approach to yoga therapy (iayt). ethical clearance was obtained from institutional ethical committee of svyasa and written informed consent was obtained from all subjects. all subjects, more than 18 years of age and who understood english were included. subjects from psychiatry section of arogyadhama, who came for rehabilitation and who were severely ill, with complications and uncontrolled disease were excluded from the study. the subjects were a heterogeneous group, having hypertension, bronchial asthma coronary artery disease, diabetes mellitus, obesity, neurological disorder, chronic backache and arthritis and they were divided into different departments according to their ailments. in no subject, the physical condition prevented from participation in yoga therapy. all subjects underwent iayt, which included physical postures (asanas), voluntary breathing (pranayamas), meditation, internal cleansing processes (kriyas) and lectures on practice of yoga and derived special techniques in their respective sections. these procedures were offered daily and each session lasted for 1 h. all subjects were given self - administered sf-12 questionnaire with no time limit and their doubts were cleared then and there on the first day of their admission and again after 1 week of yoga practice at arogyadhama. the quality of life was assessed by sf-12 questionnaire and thereby calculating physical and mental composite scores (pcs and mcs) before and after the yoga therapy. pcs and mcs were computed using the rating on 12 questions from 0 to 100, where a 0 score indicates the lowest level of health and 100 indicates the highest level. the study was done in svyasa arogyadhama, bangalore in the month of july 2011. it was based on the data collected on 94 subjects who were diagnosed for psychosomatic ailments based on history and previous investigations and who attended integrated approach to yoga therapy (iayt). ethical clearance was obtained from institutional ethical committee of svyasa and written informed consent was obtained from all subjects. all subjects, more than 18 years of age and who understood english were included. subjects from psychiatry section of arogyadhama, who came for rehabilitation and who were severely ill, with complications and uncontrolled disease were excluded from the study. the subjects were a heterogeneous group, having hypertension, bronchial asthma coronary artery disease, diabetes mellitus, obesity, neurological disorder, chronic backache and arthritis and they were divided into different departments according to their ailments. in no subject, the physical condition prevented from participation in yoga therapy. all subjects underwent iayt, which included physical postures (asanas), voluntary breathing (pranayamas), meditation, internal cleansing processes (kriyas) and lectures on practice of yoga and derived special techniques in their respective sections. all subjects were given self - administered sf-12 questionnaire with no time limit and their doubts were cleared then and there on the first day of their admission and again after 1 week of yoga practice at arogyadhama. the quality of life was assessed by sf-12 questionnaire and thereby calculating physical and mental composite scores (pcs and mcs) before and after the yoga therapy. pcs and mcs were computed using the rating on 12 questions from 0 to 100, where a 0 score indicates the lowest level of health and 100 indicates the highest level. the mean sd of age of the study group was 46.18 16.58 years. about 55.3% of the subjects were females and rest 44.7% were males. in the whole study group, there was a statistically significant improvement in both pcs (p < 0.001) and mcs (p < 0.001) with minor variations in patients of various departments [table 1 ] which are as follows : comparison of pcs and mcs before and after 1-week yoga in different departments a significant improvement was seen in pcs in patients of all departments - neurology / spinal disorders (p < 0.001), pulmonology / cardiology (p < 0.001), metabolic disorders (p < 0.001), endocrinology (p < 0.001), others (rheumatology / gastroenterology / promotion to positive health) (p < 0.001). similar results were observed in mcs with statistically significant improvement seen in patients of neurology / spinal disorders (p < 0.001), pulmonology / cardiology (p < 0.001), metabolic disorders (p < 0.001), endocrinology (p < 0.001), others (rheumatology / gastroenterology / promotion to positive health) (p < 0.001). the study intervention was a short - term ; iayt comprised of daily practice of asanas, pranayamas, meditation, kriyas and lectures on practice of yoga and derived special techniques and diet. the results showed that even a short - term that is, just 7 days of yoga practice showed a significant improvement in both pcs and mcs. this implies that yoga improved not only the physical wellbeing of the subjects but also improved the mental state. these benefits were observed over a wide range of chronic diseases, which implies that yoga intervention has an effect regardless of the diagnosis. according to yoga sutra, the body and mind can not be separated. this logic indicates that all physical benefits resulting from the practice of yoga are coupled with mental benefits such as development of inner consciousness, positivity, awareness, and appreciation of nature, combining to offer a whole - body therapy. the physical benefits of yoga are linked to the release of -endorphins and the shift caused in neurotransmitter levels linked to emotions such as dopamine and serotonin and implicit dominance of the parasympathetic nervous system. yoga stimulates an under active parasympathetic nervous system and increases the inhibitory action of a hypoactive gaba system in brain pathways and structures that are critical for threat perception, emotion regulation, and stress reactivity. a 30 min session of yogic stretching and breathing exercises produces a marked augmentation in perceptions of physical and mental energy. such exercises also increase feelings of alertness and enthusiasm, and make subjects feel distinctly less sluggish and sleepy than before the session began. a simple and inexpensive essentially educational intervention based on yoga improves subjective well - being. as the study does not have a control group, the effect of yoga therapy on quality of life can not be generalized. the present study suggests that a short - term integrated yoga therapy can improve the overall general well - being of subjects irrespective of their disease. hence, daily practice of yoga on regular basis will improve the quality of life. to conclude, yoga could be prescribed as a supplement to conventional therapy of a psychosomatic disease. | objective : the aim was to study the effect of short - term yoga therapy program on quality of life in patients suffering from psychosomatic ailments.methods:sample size and study period : all the subjects coming to svyasa arogyadhama in month of july 2011 for yoga therapy for various psychosomatic ailments and were free of any primary psychiatric illness and volunteering to participate were enrolled in the study after taking informed consent. their physical condition was healthy enough to practice yoga as judged clinically. all subjects (n = 94) who were enrolled in the study underwent integrated approach to yoga therapy, which included asanas, pranayamas, meditation, kriyas and lectures on practice of yoga and derived special techniques in their respective sections. the quality of life was assessed by sf-12 questionnaire and thereby calculating physical and mental composite scores (pcs and mcs) before and after 1 week of yoga therapy. data thus obtained was analyzed using paired t-test.results:a significant improvement (p < 0.001) was seen in the study group in both pcs (from mean sd of 37.50 9.58 to 43.7 8.73) and mcs (from 45.87 9.57 to 53.35 7.9.) with minor variations in patients of various departments.conclusion:a short - term yoga therapy program leads to a remarkable improvement in the quality of life of the subjects and can contribute favorably in the management of psychosomatic disorders. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.