article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
rectal foreign bodies can present a difficult management dilemma, because the types encountered vary widely and they can cause not only local trauma to surrounding tissues but also obstruction or perforation that requires surgical treatment. for effective removal, it is important to precisely determine the size, shape, and material of the foreign body by patient interview and imaging diagnosis, and then to evaluate the possibility of rectal perforation and peritonitis [1, 2 ]. in cases without perforation, transanal removal of a rectal foreign body is generally attempted as a first - line procedure in the emergency unit, with a reported success rate of approximately 75%. however, when the size is too large to grasp, transanal removal is difficult. we here report a patient with a large rectal foreign body that was successfully removed with manual compression from the abdominal wall, with assistance provided by endoscopic and x - ray fluoroscopic observation. a 50-year - old male came to the emergency room of our hospital and stated that a hand - made silicon rod had accidentally passed into his rectum 12 h prior to presentation. his vital signs were stable, and a physical examination showed that his abdomen was soft and without tenderness. there was a palpable elastic, hard mass in the lower abdomen and no signs of peritonitis. a digital rectal examination by palpation located the end of the foreign body in the deep rectum. an attempt to manually remove it in a transanal manner failed due to its shape, large size, and deep position. laboratory data were essentially normal, with the exception of slightly elevated c - reactive protein (1.76 mg / dl). plain abdominal x - ray imaging showed a foreign body in the pelvic area and absence of free air (fig 1a), while computed tomography (ct) revealed an 18 4 cm foreign body with a cylindrical shape in the rectum (fig 1b d). we decided to attempt removal in a transanal manner under endoscopic and x - ray fluoroscopic observation. following intravenous administration of 15 mg of pentazocine, a scope (pcf - q260azi ; olympus, japan) was inserted transanally with the patient in a left lateral decubitus position to directly visualize the foreign body. the lateral pelvic view obtained by x - ray fluoroscopy showed the foreign body in the rectosigmoid position. we attempted removal with endoscopic instruments, including a snare, biopsy forceps, grasping forceps, and net, though that failed because of the round shape and large diameter. when manually compressed from the abdominal wall under endoscopic and x - ray fluoroscopic observation, we noticed that the axis of the foreign body changed (fig 2). thus, we were able to guide it using manual abdominal compression with endoscopic and x - ray fluoroscopic assistance. once the object moved to the lower rectum, it could be removed transanally by manual extraction. after removal, we found that the foreign body was constructed of a silicon material and made by the patient himself, with a size of 18 4 cm (fig 3). sigmoidoscopy following extraction showed mild erosion in the rectal mucosa with no findings of bleeding or perforation. although not as common as upper gastrointestinal foreign bodies, the incidence has been suggested to be increasing, especially in urban areas [3, 4 ]. in a review of 196 cases of rectal foreign bodies in 193 patients, it was reported that the mean age at presentation was 44.1 years (range 1979) with a significantly higher proportion of males (ratio approx.. numerous types of objects have been described in the literature, with the most common being household objects (42.2%), such as a bottle or glasses, while others include sex toys, personal care, sports equipment, and food. the majority of rectal foreign bodies reported in adults have been purposefully inserted for self - gratification. as they are likely to be smooth, round, cylindrical, or egg shaped for easy insertion, it is difficult to grasp and remove them in a transanal manner using standard endoscopic devices. because of the wide variety of objects and variation in trauma to local tissues of the rectum and distal colon, a systematic approach to the diagnosis and management of rectal foreign bodies is needed [1, 2 ]. a physical examination and radiological imaging, such as plain x - ray and ct, are important to evaluate the general condition of the patient and to determine a treatment plan. in particular, ct can provide a great deal of information, such as the properties (shape, size) and precise location of the object, as well as the presence of perforation or obstruction. if a clinical or radiological examination shows signs of peritonitis or perforation, surgical procedures such as a laparotomy should immediately be considered. in cases without severe complications, transanal removal however, no specific criteria or guidelines have been established regarding an effective strategy for transanal removal of a rectal foreign body. the factors that determine whether a rectal foreign body can be removed transanally are the shape, size, and location of the object [2, 3 ]. to date, various methods for transanal removal of foreign bodies most objects can be safely removed during an endoscopy procedure with the assistance of endoscopic devices such as a snare or forceps, while kocher clamps, suction devices, and various grasping forceps, though designed for other purposes, have been effective [9, 10 ]. however, when foreign bodies are too large to be removed by those, other methods, including surgery, are required. in the present case, the object was located in the rectosigmoid area and considered to be removable, though its axial orientation made removal difficult. we attempted that by using various endoscopic instruments, but failed because the object had smooth sides and a large size. finally, we were able to use abdominal manual compression to guide the proximal end of the object under x - ray fluoroscopic observation and the distal side under endoscopic observation, and successfully removed it transanally without complications. in addition, gentle air insufflation performed during an endoscopy procedure can make it easier to move the object to the anal side by raising intraluminal pressure on the oral side of the foreign body, which may facilitate transanal removal. air insufflation is also useful to distend the collapsed distal bowel lumen and allow clear visualization of the foreign body. therefore, endoscopic assistance should be considered as a first step during management for rectal foreign bodies in cases without perforation. in conclusion, we report the successful transanal removal of a large - sized rectal foreign body. in cases without perforation, a minimally invasive endoscopic technique via a transanal approach should be considered as a first - line procedure. for transanal removal of the present, large - sized object, we found that endoscopic and x - ray fluoroscopic assistance were helpful to guide the direction and angle of abdominal compression. | we occasionally encounter patients with various types of rectal foreign bodies. when too large to grasp, transanal removal can be difficult. here, we report a case of successful manual transanal removal of an 18 4 4 cm silicon rod without complications. a 50-year - old male came to the emergency department of our hospital 12 h after transanal insertion of a whole silicon rod. an abdominal examination showed no evidence of peritonitis, while x - ray and computed tomography findings revealed a large foreign body in the rectum, without any sign of perforation. initially, we attempted removal using an endoscopy procedure with conventional endoscopic instruments, including a snare and grasp forceps, though we failed because of the large size. next, we manually compressed the foreign body from the abdominal wall under endoscopic and x - ray fluoroscopic observation, and successfully removed it in a transanal manner without complications. endoscopic and x - ray fluoroscopic assistance were helpful to guide the direction and angle of abdominal compression in this case. |
functional magnetic resonance imaging (fmri) studies in chronic pain patients have the potential to provide valuable information about the neural mechanisms and efficacy of analgesic therapies, including drug treatments, acupuncture, brain stimulation, distraction tasks, mindfulness meditation, and cognitive - behavioral interventions. furthermore, fmri studies in healthy individuals have provided insights into neural mechanisms of pain modulation, such as the placebo effect and conditioned pain modulation. such studies rely on the assumption that brain responses to pain are consistent in sessions conducted on separate days before, during, and after therapeutic interventions. despite this common practice, only one study specifically addressing the intersession reliability of pain - related fmri activation has been published. taylor and davis (2009) examined the spatial reliability of fmri activation associated with painful mechanical stimulation of the hand in 6 subjects across four biweekly sessions, finding high across - session spatial repeatability in second somatosensory cortex (s2), but lower and more variable spatial repeatability in primary somatosensory cortex (s1) and thalamus (taylor and davis, 2009) ; other areas that are part of the cortical network classically activated by pain (as reviewed in duerden and albanese, 2013) were not examined in the study. furthermore, studies examining across - session reliability of the amplitude (percent signal change) of pain - related fmri responses have not yet been published. gaining a better understanding of the stability of repeated, intersession measures of responses to pain (both spatial extent and bold signal amplitude) in the entire cortical pain network will enhance the ability to interpret data collected in studies of pain - reducing manipulations. thus, characterization of test retest reliability of pain - related fmri activation is a critically important issue to address. high test - retest reliability of fmri responses across two or more sessions has been reported for a wide variety of tasks, including motor, auditory detection, language, learning, and memory (atri., 2011 ; bennett and miller, 2010 ; cacares., 2009 gountouna., 2010 ; havel., 2006 ; kiehl and liddle, 2003 ; maitra., 2002 ; mcgregor., 2012 ; yoo., retest reliability of fmri responses has been found for other tasks such as mouth movements (havel., 2006), reward (fliessbach., 2010), and spatial attention (gorgolewski., 2013). while these results may reflect differences in reliability across tasks approaches have included measuring spatial extent or spatial overlap of significant task - related activation at the individual or group level, performing voxelwise group - level contrasts of the blood oxygenation level - dependent (bold) response, and calculating voxel - wise intraclass correlation coefficients (icc) based on the amplitude of the bold response. the first objective of this study was to characterize the intersession reliability of pain - related fmri activation elicited by painful contact heat stimuli in healthy volunteers, considering both spatial extent and amplitude measures. to address the possibility that reliability of pain - related fmri responses may vary across brain regions, the study separately evaluated reliability of responses in cortical areas that are part of the network classically activated by pain (as reviewed in duerden and albanese, 2013), including : s1, s2, pregenual anterior cingulate cortex (pacc), anterior midcingulate cortex (amcc), insular cortex (ins, distinguishing anterior and posterior), supplementary motor area (sma), and several frontal lobe regions ; the thalamus was also examined. stimulus paradigms using painful heat vary across studies, with some protocols using fixed temperatures for all subjects (resulting in highly variable perceived pain intensity reports across the group) and others using subject - specific temperatures that produce consistent perceived pain intensities across the group. a recent study reported no difference in pain - related fmri activation produced by fixed temperature stimuli and individually - determined contact heat pain stimuli (van den bosch., 2013) ; however, the question of whether these different stimulus paradigms produce equally reliable results across sessions remains unanswered. a second objective of this study was to compare the reliability of pain - related fmri responses for fixed temperature stimuli with that of subject - specific temperatures to address whether one or the other approach provides for more reproducible results. the subjects in this study also performed a simple motor task (finger - thumb opposition) in the same sessions as they experienced painful heat. to evaluate the appropriateness and validity of the analytical approach used to assess intersession reliability of pain - related fmri responses, this study used the same approach to assess the across - session reliability of motor - related fmri activation and compared the results with those previously published. fourteen subjects (mean age 44.3 years, sd 19, range 2275 ; 7 male) participated in the study. all subjects were healthy, with no major medical, neurological, or chronic pain disorders. young female subjects were tested during the follicular phase of their menstrual cycle (days 3 to 10) to reduce variance potentially related to effects of gonadal hormone fluctuations on pain perception. all postmenopausal women the protocol for this study was approved by the university of maryland institutional review board for the protection of human subjects. painful heat stimuli were delivered to the left dorsal forearm of each subject using an mr - compatible peltier thermal probe with a 2.6 cm contact surface (tsa - ii, medoc ltd., israel). two temperatures of painful heat were delivered to each subject : (1) 48 c and (2) a subject - specific temperature perceived as moderately painful, which was defined as the temperature the subject rated as 50 on a 100-point computerized visual analog scale (vas) for pain intensity. these stimuli will be referred to as 48 c and 50vas throughout this manuscript. temperatures that evoked the perception of moderate pain (50vas) ranged from 47.5 to 50.0 c (mean 49.0 c, sd 1.0). subjects participated in a training session in a laboratory room dedicated to psychophysical assessments at least one day prior to scanning. during the training session, subjects were first presented with an ascending series of thermal stimuli ranging from 42 to 50 c. each temperature was presented for 15 s (including ramp up and down time at a rate of 2.7 c / s), followed by a 30-s interstimulus period of nonpainful warmth (37 c). subjects were then presented with a series of heat stimuli expected to be in the painful range (4650 c), with temperatures presented twice each in a randomized order. after each stimulus, subjects used an mr - compatible trackball (fellowes, http://www.fellowes.com) to rate peak pain intensity on a computerized vas, which consisted of a vertical scale labeled no pain at the bottom and most intense pain imaginable at the top (dapsys, brian turnquist, johns hopkins university, http://www.dapsys.net). individual subject ratings for the range of temperatures were used to interpolate the subject - specific temperature that evoked a perception of moderate pain (50vas) and to confirm that the 48 c stimulus was perceived as painful. each subject participated in three scanning sessions conducted on separate days, with the mean interval between sessions 15 days (sd 18). the high variance in the between - session interval was mainly attributable to two women who were scanned across multiple months to ensure testing was conducted during the follicular phase of the menstrual cycle. most scans occurred between 4 and 9 pm and lasted about 90 minutes ; each of the 3 sessions for an individual subject began at about the same time each day to reduce circadian variability in perception and hormone levels. during each scanning session, information about functional brain responses was collected using bold fmri and information about brain anatomy was collected using mr imaging (details below). the fmri portion of the session consisted of two scans in which painful heat stimuli were delivered, separated by a 30-minute interval. the painful heat stimulus protocol for each fmri scan consisted of delivering the two temperatures (48 c and the subject - specific temperature perceived as moderately painful) six times each in a randomized order. each temperature was presented for 15 s (including ramp up and down time at a rate of 2.7 c / s), followed by a 30-s interstimulus period of nonpainful warmth (37 c). after each stimulus, the computerized vas was presented to the subject through mr vision 2000 goggles (resonance technologies, van nuys, ca) and the subject rated peak pain intensity using the mr - compatible trackball. the duration of each stimulus cycle was 45 s : painful heat application (15 s), vas rating task (15 s, or less if the subject responded more rapidly), and rest period (15 s, or more if the subject completed the rating task in less than 15 s). in the 30-minute interval between pain fmri scans, subjects rested quietly for approximately 10 minutes, performed a simple motor task (right hand finger - thumb opposition at approximately 1 hz) in a block design (24 s opposition alternating with 24 s rest) for 6 minutes and 54 s while fmri data were acquired, then rested quietly for the remainder of the interval. images were collected using a 1.5 tesla phillips eclipse scanner (phillips healthcare, cleveland, oh). functional mr images were acquired using a single - shot echo planar imaging t2 -weighted sequence with an echo time (te) of 35 ms and flip angle of 90. acquired image resolution was 3.2 3.2 mm over a 24-cm field - of - view (fov). the images were zero padded to 128 128 pixels to provide a resolution of 1.875 1.875 mm. the repetition time (tr) of 3 s provided full brain coverage using 24 axial slices (6 mm thick with no gaps between slices) prescribed parallel to the anterior - posterior commisural plane. high - resolution t1-weighted volumetric scans (4.5 ms te, 29 ms tr, 110 slices, slice thickness 1.5 mm, 0.938 0.938 mm in - plane resolution, 24-cm fov) were acquired in the same plane as the functional images for anatomical detail. image processing was performed using the software package analysis of functional neuroimages (afni ; cox, 1996). the first four volumes of each functional scan were discarded to exclude images acquired prior to stabilization of the magnetic resonance signal. data from the 2 functional pain scans conducted within each session were concatenated for analysis. functional images were motion - corrected by spatially registering the volumes from all functional scans to the first remaining volume (afni routine 3dvolreg). to minimize effects from possible spike - related artifacts, signals greater than 2.5 sds of the overall bold signal were reduced (afni routine 3ddespike). time series were temporally smoothed to reduce high frequency noise using a moving 3-point weighted (0.15 - 0.70 - 0.15) average. images were spatially smoothed to increase the signal - to - noise ratio using a 5-mm full width half - maximum gaussian kernel. trends in the time series (linear, second - order, and third - order) were removed on a voxelwise basis to reduce low frequency noise components. functional and anatomical images were transformed to common space (tailairach and tournoux, 1988), and the voxels resampled to 2 2 2 mm. voxelwise normalization was performed by dividing the signal intensity at each time point by the voxel s mean intensity. for each individual subject, a general linear modeling (glm) approach was used to identify brain regions in which the time course of the bold signal was significantly related to the task, either the painful stimulus or the motor task (afni script 3ddeconvolve). the glm for the pain scans consisted of three temporally independent regressors (one for each temperature of painful heat and for the vas rating task) each represented by a delayed boxcar function convolved using the afni block function to account for hemodynamic delay. though the glm included a regressor for the vas rating task, results for this regressor are not presented because brain activity during the vas rating task is not a variable of interest in this study. the glm for the motor scans consisted of a regressor for the motor task as well as motion correction parameters. voxelwise regression of the bold signal time course with the appropriate model resulted in statistical parametric maps for pain - related activation and motor - related activation for each individual subject. group maps of significant pain - related activation were calculated separately for each stimulus type (48 c and 50vas) using regression coefficients from the glm, collapsed across sessions, in a one - sample t - test (afni routine 3dttest). the resulting group statistical parametric maps (one for the 48 c stimulus and one for the 50vas stimulus) were thresholded to identify significant activation associated with each type of painful heat using a cluster threshold approach to correct for multiple comparisons across the brain. the cluster threshold criterion was determined using monte carlo simulations to estimate the likelihood of detecting false positives over multiple comparisons (afni routine 3dclustsim). based on the simulations, which were derived from whole - brain analyses, a significant cluster (overall corrected p 0.05, friedman test, fig. 1), indicating that within the parameters of this study, repeated testing did not change perceived intensity of the painful heat stimuli. variance of pain intensity ratings was greater for the 48 c stimulus than the perceptually - equalized 50vas stimulus (p 0.5, table 3), indicating moderately consistent spatial extent of activation regardless of whether the stimulus was of constant temperature or of constant perceived pain intensity. spatial overlap between the stimulus types showed regional differences, with the highest reliability coefficients in the ains and low reliability coefficients in the pacc. reliability of pain - related activation amplitude was assessed in a two - step process (see methods), by calculating voxelwise iccs and then applying a statistical filter to eliminate voxels with artifactually high icc values due to a combination of high wms and low ems. 5a shows the average bold response amplitude for each session in the voxel in the left ifg with the highest icc prior to the statistical filtering step. the graph shows a highly variable pain - related bold response in this voxel across sessions ; however, the icc value (0.75) calculated for this voxel was the highest in the roi and statistically significant. the high icc value obtained for this voxel is attributable to a combination of high bms, high wms and low ems. this example illustrates that it is possible to obtain a high icc value for a voxel despite high variability (low reliability) of the response from session to session. thus, relying entirely on icc values without examining the variances that contribute to the icc can result in a voxel being identified as having a reliable intersession response when in fact it does not (in other words, a false positive). the statistical filtering step employed here, which eliminates voxels with high wms (such as the voxel shown in fig. 5b shows the average bold response for each session in the voxel in the left ifg with the highest icc after the statistical filtering step. this voxel, which is anatomically close to the peak voxel found prior to statistical filtering, shows much more consistent and reliable pain - related responses across session, and an icc value (0.73) that more accurately reflects the low intersession variance. intersession reliability of pain - related activation associated with the 48 c stimulus is summarized in table 4 and fig. table 4 identifies the largest cluster of significantly reliable pain - related activation found in each roi and the icc value associated with the peak voxel in the cluster ; additional clusters were also found in most rois. fair - to - moderate reliability (based on shrout, 1998) was found in every roi except (1) contralateral pacc, which showed slight reliability, and (2) s1, pins, and ipsilateral thalamus, which contained no clusters that were significantly reliable across the three sessions. rois with the highest iccs (the upper portion of the moderate range) included amcc, ains, and several frontal lobe areas. clusters of significantly reliable pain - related activation from selected rois are shown in fig. intersession reliability of pain - related activation associated with the 50vas stimulus is summarized in table 5 and fig. table 5 identifies the largest cluster of significantly reliable pain - related activation found in each roi and the icc value associated with the peak voxel in the cluster ; additional clusters were also found in most rois. fair - to - moderate reliability (based on shrout, 1998) was found in every roi except (1) ipsilateral pacc and ipsilateral thalamus, which showed slight reliability, and (2) contralateral pacc, s1, and contralateral pins, which contained no clusters that were significantly reliable across the three sessions. rois with the highest iccs (the upper portion of the moderate range) included amcc and s2. clusters of significantly reliable pain - related activation from selected rois are shown in fig. the results of the group - level contrast between significantly reliable pain - related activation for the 2 stimulus types are summarized in table 6. voxelwise icc values for each stimulus type were contrasted to obtain these results. the constant temperature stimulus (48 c) produced more reliable activation than the constant perceived pain intensity stimuli in ains (bilaterally), ipsilateral mpfc, and ipsilateral dlpfc ; no significant differences in reliability were found for the other rois examined in this study. thus, though there were some differences, no consistent pattern emerged in terms of whether a painful stimulus of constant temperature or of constant perceived intensity produced more reliable bold fmri responses. clusters for which pain intensity ratings of the 48 c stimulus significantly predicted the magnitude of the bold response to the stimulus were found to be very limited, scattered, and with little overlap across sessions (supplemental fig. clusters for which pain intensity ratings of the 48 c stimulus significantly predicted the magnitude of the bold response to the stimulus were found to be very limited, scattered, and with little overlap across sessions (supplemental fig. 1). as a result, as shown in supplemental tables 1, 2, and 3, the effect of duration between sessions on the reliability of pain- and motor - related fmri activation was minor. the iccs calculated in our original analysis and the analysis that took between - session duration into account are comparable and did not differ in a large or consistent way in any pain- or motor - related region of interest. thus, the results suggest that with this data set, the duration between sessions did not contribute significantly to intersession variability. as shown in supplemental tables 1, 2, and 3, the effect of duration between sessions on the reliability of pain- and motor - related fmri activation was minor. the iccs calculated in our original analysis and the analysis that took between - session duration into account are comparable and did not differ in a large or consistent way in any pain- or motor - related region of interest. thus, the results suggest that with this data set, the duration between sessions did not contribute significantly to intersession variability. significant motor - related activation was found in expected brain rois (m1 and sma) bilaterally. intersession reliability of the spatial extent of significant motor - related activation is shown in table 7. the spatial reliability coefficient was high in m1 contralateral to the hand performing the motor task (0.78) but was much lower in contralateral sma (0.2). the spatial reliability coefficients in m1 and sma ipsilateral to the hand performing the motor task were notably lower than the contralateral regions. intersession reliability of the amplitude of motor - related activation is shown in table 7, which identifies the largest cluster of significantly reliable motor - related activation in each roi and the icc value associated with the peak voxel in the cluster ; additional clusters were also found in these rois. substantial reliability (based on shrout, 1998) was found in contralateral m1 (icc = 0.815) and moderate reliability in contralateral sma (icc = 0.657). fair reliability was found in m1 and sma ipsilateral to the hand performing the motor task. overall, motor - related activation showed greater reliability than pain - related activation for both the spatial extent and icc measures. this study quantitatively evaluated across - session reliability of pain - related bold fmri responses in brain areas that are typically regarded as part of the cortical pain network. while these brain areas show consistent and often robust activation in fmri studies across diverse pain modalities (as reviewed in duerden and albanese, 2013), the question of how reliable this activation is from session to session has not been comprehensively addressed in the literature. we used two reliability measures (voxelwise spatial overlap and iccs based on bold response amplitude) that are commonly used in the literature (bennett and miller, 2010) to assess test retest reliability of fmri responses to a wide variety of conditions (e.g., motor tasks, visual stimulation, memory) but have not been previously applied to pain. the results revealed that the two measures of intersession pain - related fmri activation reliability used in this study produced disparate results, with (1) reliability based on spatial measures generally low and highly variable across brain regions and (2) reliability based on signal amplitude (iccs) in the fair - to - moderate range for most brain regions. spatial reliability coefficients were low for most regions examined, indicating a low probability that the same voxels are activated across three separate sessions. the highest spatial reliability coefficients were found in the ains for both stimulus types but no spatial overlap across the three sessions was found for pins. for both stimulus types, spatial reliability coefficients were higher in s2 than in s1 or thalamus, which is consistent with the findings of taylor and davis (2009), who used a different measure of spatial reliability in a study involving mechanical pain applied across 4 sessions in 6 subjects ; their analysis was limited to s1, s2, and thalamus. while low s1 spatial reliability is in agreement with the inconsistency of s1 activation across fmri studies of pain (bushnell., 1999), the reasons for a total lack of spatial overlap in pacc are unclear. these results suggest that the precise location of pain - related activation is not highly reproducible across multiple sessions, perhaps due in part to variability introduced by motion correction, spatial normalization, and spatial smoothing procedures. as noted by taylor and davis (2009), conservative thresholding procedures such as those used in this study to avoid false positives may add to spatial variability across sessions by increasing false negatives ; for example, a voxel may be activated by pain in all sessions but be eliminated from one or more sessions if the activation falls slightly below threshold. as a result, spatial measures do not appear to be ideal for assessing intersession reliability because the threshold criterion has a major influence upon cluster sizes. however, suprathreshold clusters of voxels in a brain region may show reliable pain - related bold signal amplitude changes across sessions. to test this possibility, iccs were calculated based on pain - related bold signal amplitude changes., 2009 ; mcgraw and wong, 1996 ; shrout and fleiss, 1979). this study used a conservative two - step approach that involved calculating iccs based on bold signal amplitude changes in suprathreshold voxels and then applying a filtering step to eliminate voxels with artifactually high iccs based on the variance structure of the data. this approach revealed fair - to - moderate intersession reliability of pain - related activation in most regions of the cortical pain network, based on the conservative classification criteria described by shrout (1998). regional differences in intersession reliability were found, with the amcc (bilaterally) containing clusters with the highest iccs (0.7, with moderate reliability defined as 0.610.8) for both stimulus types. other areas with iccs in the moderate range included the ains and most frontal lobe areas for both stimulus types, as well as s2 for the 50vas stimulus. areas with the lowest intersession reliability based on the icc analysis also showed no to very low spatial reliability ; these regions included pacc, s1, and pins for both stimulus types. the finding of higher iccs in s2 than s1 is consistent with taylor and davis (2009), though their calculated iccs were higher than those in this study, likely because they included responses from subthreshold voxels in their analysis. the brain regions that displayed the highest intersession reliability in this study were ains (based on both spatial extent and icc measures) and amcc (based on iccs). both of these areas have been implicated in processing affective aspects of pain, and are anatomically and functionally connected (berthier., 1988 ; friedman., 1986 ; heimer and van hoesen, 2006 ; vogt, 2005). craig (2002, 2003, 2009, 2011) has postulated that the ains has a role in generating subjective emotional feelings about the internal state of the body and interacts with the acc, which initiates adaptive behavioral responses. evidence for the involvement of amcc in emotion - based response selection, including fear avoidance behavior (vogt, 2005), provides support for craig s model. thus, the consistently reliable activation of ains and amcc in this study may highlight the importance of and priority given to processing emotional - motivational aspects of pain. however, craig s model identifies pins as the region that generates the initial cortical representation of the body s homeostatic condition, providing ains with information upon which to generate emotions associated with that representation. the fact that the pins had very low intersession reliability in this study does not fit well with a model of a serial - processing insular system in which the anterior region response is highly dependent upon the posterior region response. the relatively high iccs and spatial overlap for contralateral s2 contrasts sharply with that of the pins. both regions have historically been considered important in nociceptive processing, and most functional neuroimaging studies do not describe differences in their nociceptive processing capacities. the current study reveals the much more reliable responsiveness of the s2 cortex to acute heat stimuli, compared to the pins. this difference suggests that s2 has a more essential role in nociceptive processing, at least within the context of responding to repetitively administered acute noxious heat stimuli. the second objective of this study was to evaluate whether bold fmri activation produced by painful heat stimuli of constant temperature or of constant perceived pain intensity was more reliable. as expected, spatial overlap of significant pain - related activation between these two conditions was relatively high, indicating that the experience of heat pain, regardless of these differences in intensities, activates common brain areas. this is consistent with a recent report that pain - related fmri activation did not differ for fixed temperature stimuli and perceptually equalized stimuli in any brain region, including the pacc, amcc, and ins (van den bosch. the icc contrast between the two stimulus conditions showed only a few brain regions where reliability differed (ains, s2, and some frontal lobe regions). among these brain regions, no clear pattern emerged : in some areas the constant temperature stimulus was more reliable across sessions while the opposite was found for other areas. thus, in this paradigm, no definitive conclusion can be made regarding intersession reliability differences in fmri activation resulting from stimuli of constant temperature versus stimuli that produce a constant perception. one possible explanation is that variation in perceived pain intensity is not an important contributor to the variability of the bold response, a notion that is supported by our finding of only scattered clusters for which pain intensity ratings significantly covaried with the bold signal amplitude response to painful stimuli. another possible explanation for failing to find a consistent difference is that the methodology of the current study (such as variability in the subject pool or choice of stimuli) did not provide the range of data adequate to draw out differences. thus, the possibility remains that in some populations or contexts, pain - related fmri activation may be more reliable for stimuli of fixed temperature or fixed perception ; studies that further explore this issue may provide valuable information to aid in the design of pain imaging experiments. a major strength of this study is that the analytical approach used to assess reliability of pain - related activation was also applied to fmri data collected from the same subjects during the same sessions as they performed a simple motor task (finger - thumb opposition). using this approach, intersession reliability of motor - related activation in this study was found to be comparable to previously published results for both spatial overlap and icc measures (bennett and miller, 2010 ; gountouna., 2006 ; kong., 2007 ; mcgregor., 2012 ; yoo., 2005). this supports the validity and appropriateness of the analytical approach used in this study to assess intersession reliability of pain - related fmri activation. this study is the first to quantitatively examine intersession reliability of pain - related fmri activation in the entire cortical pain network, expanding upon the work of taylor and davis (2009), who limited their analysis to somatosensory processing regions. furthermore, this study is the first to examine reliability of activation evoked by a ramp - and - hold contact heat stimulus paradigm, which is used in many pain imaging paradigms, including those assessing changes associated with pain - reducing manipulations. while the sample size of 14 subjects in this study is modest, it is the largest used to evaluate intersession reliability of pain - related fmri activation and is greater than the average number of 11 subjects across all test retest fmri activation studies (bennett and miller, 2010). furthermore, the diversity of our subjects in terms of age and gender, which likely added to inter - individual variability of brain responses, can be viewed as a strength, as the results should be more generalizable than those obtained from a more homogeneous subject population such as undergraduate students, as utilized in many test habituation is a possible explanation for finding poor intersession pain - related fmri reliability in some brain areas. however, consistent with published literature for the type of ramp - and - hold contact heat stimulus paradigm used in this study (quiton and greenspan, 2008), pain intensity ratings did not change across the three sessions and the temperatures required to produce subject - specific ratings of 50 on a 0100 scale did not change over the course of the experiments. furthermore, the data show no systematic decreases in either number of significant voxels or signal amplitude changes across the three sessions. 2008) required daily application of 60 painful heat stimuli to the forearm for 8 days before observing perceptual habituation and decreases in pain - related fmri responses in the brain. thus, it is unlikely that habituation is a major contributor to the poor intersession reliability observed for some brain areas in this study. conclusions from this study, in which 12 trials of each temperature were applied in each session, may not be generalizable to studies where the number of trials is significantly different. increasing the number of stimuli has the potential to increase statistical power and intersession reliability ; however, it also might introduce dynamic changes in the bold response that would add variability and thereby decrease intersession reliability. a separate study is needed to determine how reliability varies as a function of stimulus number. overall, in this paradigm, pain - related bold fmri responses showed fair to moderate test retest reliability in brain regions that are part of the classical pain network. a review of over 63 studies of fmri test retest reliability for various tasks, designs, and test retest intervals reported the average icc value was 0.5 (bennett and miller, 2010). the iccs calculated in this study for most brain regions were greater than 0.5, suggesting that pain - related fmri activation has better than average intersession reliability. the finding that some brain regions showed stronger test retest reliability than others may provide useful information to guide longitudinal pain studies. in addition, the study findings led to the following recommendations for test retest reliability analyses : (1) spatial extent and localization of activation do not appear to be useful measures of fmri response reliability at the group level. (2) the use of icc values alone as a measure of reliability may not be sufficient, as the underlying variance structure of a dataset may result in erroneously high icc values. methods to eliminate erroneously high icc values (such as the filtering step used in this study) should be incorporated into any analysis of this type. the following are the supplementary data related to this article.supplemental figure 1voxels for which pain intensity ratings of a 48c stimulus significantly covaried with the bold response to the stimulus in (a) session 1, (b) session 2, and (c) session 3.supplemental table 1brain regions with significantly reliable pain - related signal amplitude associated with 48c stimulus using between session duration as a covariateresults of original analysis (as presented in table 4)supplemental table 2brain regions with significantly reliable pain - related signal amplitude associated with 50vas stimulus using between session duration as a covariateresults using between session duration as a covariateoriginal results (as reported in table 5)supplemental table 3reliability measures for motor task activation using between session duration as a covariate brain regions with significantly reliable motor task - related signal amplitude using between session duration as a covariateresults of original analysis (as reported in table 7) voxels for which pain intensity ratings of a 48c stimulus significantly covaried with the bold response to the stimulus in (a) session 1, brain regions with significantly reliable pain - related signal amplitude associated with 48c stimulus using between session duration as a covariate results of original analysis (as presented in table 4) brain regions with significantly reliable pain - related signal amplitude associated with 50vas stimulus using between session duration as a covariate results using between session duration as a covariate original results (as reported in table 5) reliability measures for motor task activation using between session duration as a covariate brain regions with significantly reliable motor task - related signal amplitude using between session duration as a covariate results of original analysis (as reported in table 7) supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.nicl.2014.07.005. | as the practice of conducting longitudinal fmri studies to assess mechanisms of pain - reducing interventions becomes more common, there is a great need to assess the test retest reliability of the pain - related bold fmri signal across repeated sessions. this study quantitatively evaluated the reliability of heat pain - related bold fmri brain responses in healthy volunteers across 3 sessions conducted on separate days using two measures : (1) intraclass correlation coefficients (icc) calculated based on signal amplitude and (2) spatial overlap. the icc analysis of pain - related bold fmri responses showed fair - to - moderate intersession reliability in brain areas regarded as part of the cortical pain network. areas with the highest intersession reliability based on the icc analysis included the anterior midcingulate cortex, anterior insula, and second somatosensory cortex. areas with the lowest intersession reliability based on the icc analysis also showed low spatial reliability ; these regions included pregenual anterior cingulate cortex, primary somatosensory cortex, and posterior insula. thus, this study found regional differences in pain - related bold fmri response reliability, which may provide useful information to guide longitudinal pain studies. a simple motor task (finger - thumb opposition) was performed by the same subjects in the same sessions as the painful heat stimuli were delivered. intersession reliability of fmri activation in cortical motor areas was comparable to previously published findings for both spatial overlap and icc measures, providing support for the validity of the analytical approach used to assess intersession reliability of pain - related fmri activation. a secondary finding of this study is that the use of standard icc alone as a measure of reliability may not be sufficient, as the underlying variance structure of an fmri dataset can result in inappropriately high icc values ; a method to eliminate these false positive results was used in this study and is recommended for future studies of test retest reliability. |
the geriatric population, defined as people over the age of 65, comprised 6.2% of the world population in 1992 and is estimated to reach 20% by 2050. aging is associated with numerous chronic illnesses and comorbid conditions [2, 3 ], polypharmacy and immunosuppressive medications, and changes in the immune system [2, 4 ]. aging increases the susceptibility to infection. moreover, both morbidity and mortality for many infections may be several - fold higher in the elderly with respect to the young. although prevention is the most effective measure to reduce morbidity, mortality, and the expense of infections in the elderly, the prompt diagnosis and initiation of appropriate supportive and antimicrobial therapy is also a critical strategy for the management of infection in the geriatric patient. fever, being a cardinal symptom in the manifestation of infections, is an important clue for the diagnosis of noninfectious diseases such as rheumatic disease and malignancy as well. although many studies have thoroughly investigated the causes of fever of unknown origin, there are no studies up to date about the etiologies of acute fever in the geriatric population. geriatric patients hospitalized at the clinical microbiology and infectious disease department of istanbul faculty of medicine between 1999 and 2007 with the complaints of high fever and waning general health status were enrolled in this study. advanced age and very advanced age were defined as 65 and above, 85 and above, respectively [5, 6 ]. patients referring to the clinic within the first seven days of fever which was measured to be above 37.3c were accepted to have acute fever. in this group of geriatric patients evaluated for acute fever, our study aimed to determine the underlying diseases, the most useful clinical and laboratory findings for the accurate diagnosis. in addition, the mortality rates for specific infections and the risk factors contributing to high mortality rates were ascertained. the cause of the fever was infectious disease in 135 patients (72.9%), noninfectious disease in 32 patients (17.2%) ; 18 (9.7%) patients were undiagnosed. of the 135 patients with infection, 46 (24.8%) had lower respiratory tract infection (41 community acquired pneumonia, 5 pulmonary tuberculosis), 26 (14%) had urinary tract infection (uti), 23 (12.4%) had skin and soft tissue infection (10 cellulitis, 4 erysipelas, 2 diabetic foot infection, 3 pyomyositis, 1 carbuncle, 1 ophthalmic zoster, 2 thrombophlebitis), 3 (1.6%) had orthopedic infection (2 prosthetic infection, 1 septic arthritis), 7 (3.7%) had intra - abdominal infection (3 intraabdominal abscess, 2 liver abscess, 1 cholecystitis, 1 cholangitis), 10 (5.4%) had central nervous system infection, 1 (0.5%) had acute osteomyelitis, 5 (2.7%) had cardiovascular system infection, 6 (3.2%) had brucellosis, 3 (1.6%) had disseminated tuberculosis, and 1 (0.5%) had rickettsial disease. of the 32 patients with noninfectious disease, 8 (4.3%) had rheumatologic disease (5 adult 's still disease, 2 fmf, 1 seronegative arthritis), 7 (3.7%) had solid tumor (3 bronchogenic carcinoma, 3 colon cancer, 1 rectum cancer), 10 (% 3.7) had hematological disease (5 nhl, 4 cll, 1 aml), 7 (3.7%) had vasculitis (7 temporal arteritis). the patients ' history revealed the following underlying diseases in our study group ; 45 (24.3%) had diabetes mellitus, 35 (18.9%) had hypertensive ischemic heart disease, 28 (15.1%) had hematological disease (8 cll, 7 nhl, 7 aml, 4 cml, 1 multiple myeloma, 1 mds), 28 (15.1%) had history of surgical intervention within the past 6 months, 22 (% 11.9) had solid tumor (6 lung, 4 bladder, 2 colon, 2 rectum, 2 prostate, 4 brain -2 malign brain tumor, 1 pituitary adenoma, 1 meningioma, 1 mesothelioma, 1 nasopharnyx), 22 (11.9%) had chronic renal insufficiency, 13 (7%) had chronic pulmonary infection, and 4 (2.1%) had chronic liver disease. with respect to nondiabetic patients, the diabetics had significantly longer mean period of hospitalization (21.56 16.52 versus 16.73 12.81 days p =.04), significantly higher neutrophil counts (9765.9 1266.7/ml versus 7197.1 6266.7/ml p =.003), and significantly lower levels of albumin (2.9 0.7 gr / dl versus 3.1 0.4 gr / dl p =.03). among the diabetics, the cause of the fever was infectious diseases in 37 patients (82.2%), noninfectious disease in 6 patients (13.3%). the source of fever could not be identified in 2 patients (4.4%). the mean age of patients with infectious disease and noninfectious disease as the source of fever was 70.1 7.6 and 68.5 7 respectively. the mean period of hospitalization was 17.78 13.51 days, and 18.34 15.19 days respectively. at least one underlying disease (diabetes mellitus, hypertensive ischemic heart disease, solid tumor, hematological malignity, chronic renal failure, previous surgical intervention, chronic obstructive pulmonary disorder, chronic liver disease, corticosteroid administration over two weeks) was present in the remaining patients. in advanced aged patients with no history of underlying disease (n = 51), infection was identified as the cause of fever in 36 (70%) while in 1 (2%) patient noninfectious etiology was documented. on the other hand, in advanced aged patients with history of at least one underlying disorder (n = 134), the cause of fever was infection in 99 (73.8%) and noninfectious disease in 31 (23.1%) (table 1). the most common findings were rales (n = 83), tachypnea (n = 67), pallor (n = 57), tachycardia (n = 56), cough (n = 46), and hepatomegaly (n = 40). dyspnea, rales, and confusion were significantly more frequent in patients with infection identified as the cause of fever (p =.02, p =.04, p =.01, resp.) (table 2). laboratory analysis revealed significantly higher mean neutrophil count, total iron binding capacity, and mcv for infectious etiologies (p.05 for all comparisons). pneumonia was present in 10 (20%) geriatric patients with no underlying diseases and 31 (23%) patients with underlying diseases. in this study population, 9 of 41 patients with pneumonia died (22% mortality rate). the mean age of the deceased and survived patients was similar (70.6 5.8 versus 69.6 7.6, p >.05). the mean age for populations is currently rising. by 2030, every one of five individuals in the united states will be over age 65. the most rapidly growing segment of this population is those over age 85 years [5, 8 ]. in the united states, the average life expectancy at 65 is 18.9 years, 11 years at 75, and 7 years at 85. the waning function of cardiovascular, respiratory, and renal systems in the elderly is by itself a frequent cause of medical reference. it is important to acknowledge that the malfunction of the mentioned systems causes an immunocompromised state. this prepares the grounds for many infectious and noninfectious diseases contributing to the increased morbidity and mortality in this group of patients. the decline is prominent in cellular immunity. because of continuous antigenic stimulation circulating memory t cells increase while nave t cells decrease due to age - associated involution of thymus [12, 13 ]. response to foreign antigens is also diminished because of increasing lack of regulatory control of t cells on b cells. on the other hand, neutrophils, macrophages, and neutral killer cells malnutrition, poor circulatory, and breakdown of natural mechanical barriers which are commonly seen in the elderly also contribute to infections in this population. moreover, both morbidity and mortality for many infections may be several - fold higher in the elderly with respect to the young. this condition puts the patient at risk for certain disease states, examples of which include decreased cough reflex leading to aspiration pneumonia, impaired arterial and venous circulation, and compromised wound healing, making cellulitis a common infection. geriatric patients are susceptible to infections in a similar fashion to that of younger individuals ; however, there are a few exceptions. first, the immune systems of elderly patients may not respond as readily as those of their younger counterparts, because of either the well - known diminution of activity or the suppression due to intercurrent infection or other treatment. secondly, elderly patients may live in a different climate, preferring warmer temperatures and increased humidity. this study identified lower respiratory tract, urinary tract, and skin and soft tissue infections as the most common infectious causes of fever in the geriatric group. although pneumonia in the elderly patient is not reported as the most common cause of acute fever or fever of unknown origin, it is an important cause of morbidity and mortality in this group. diseases of the respiratory tract have long been associated with morbidity and mortality among the elderly population. although pneumonia accounts for 13% to 48% of infections among nursing home residents, mortality rates of those admitted to the hospital are as high as 44%. this study discriminated lower respiratory tract infections as one of the most common diseases and a very frequent cause of infection in the geriatric patients. in addition, our observations showed that pulmonary tuberculosis was not the cause of fever in the geriatric patient with no underlying illness. uti remains as one of the leading causes of infection in elderly patients. among otherwise healthy geriatric patients, rates for uti range from 5% to 30%, with higher rates seen in advanced age group. among institutionalized patients, the prevalence rates increase remarkably. 17% to 55% of women and 15% and 31% of men are reported to be bacteriuric in one study. the frequency of uti as the cause of fever in this study was 14% ; uti was relatively more frequent in those with underlying disease. in this study group, 14% of patients had skin and soft tissue infection identified as source of fever. it has been estimated that the prevalence of skin and soft tissue infection in the long - term care facility is 5% cellulitis is both more common and severe in the geriatric patient with respect to the young. cellulitis in the elderly is often attributed to chronic venous insufficiency, peripheral vascular disease, malnutrition, and trauma. furthermore, patient 's age plays an important role in many different forms of rheumatic disease. vasculitis, the most common rheumatologic cause of fever in this study, is associated with inflammation of vessels. vasculitis often presents with fever or / and with fever of unknown origin [2123 ]. the most common form of systemic vasculitis seen in humans, giant cell arteritis (gca), occurs almost exclusively in people over the age of 50. for this and many other forms of vasculitic disease that can develop in older patients, the challenges of diagnosis and treatment can be further compounded by the presence of comorbid diseases and concomitant medications. temporal arteritis, a form of giant cell arteritis, was the most common vasculitic disease identified as the cause of fever in this study group. adult 's still disease was the second most frequent rheumatologic cause of fever in this study. in this study, it was observed that noninfectious etiologies were more frequently identified as cause of fever in patients with known underlying disease. this finding may be attributed to the relatively more severe immunocompromised state in these patients. the analysis of the symptoms accompanying fever showed that dyspnea, presence of rales, and mental confusion were significantly more common in infectious etiologies (table 2). this could be explained by the increased frequency of infectious disease in the elderly with underlying disease and the general waning health status due to presence of fever. laboratory analysis showed that mean neutrophil counts were significantly higher in infections while mean esr and alp levels were significantly more elevated in noninfectious diseases. presence of esr over 100 mm / hour was significantly associated with noninfectious disease. the higher levels of alp in noninfectious disease were attributed to the infiltrative behavior of diseases such as vasculitis and malignancy. the most common underlying disease in our study group was diabetes mellitus followed by hypertensive ischemic heart disease and hematological disease. cardiovascular, respiratory, and renal insufficiencies are more readily encountered in the geriatric group. an important data gained from this study was the presence of malignity as the underlying disease in 11.9% of patients requiring hospitalization for acute fever. this study showed that infectious disease was the cause of 82.2% of diabetic patients evaluated for acute fever. this finding is not surprising when the decreased immune defense associated with diabetes is regarded. adherence, chemotaxis, and intracellular killing of neutrophils, monocytes, and lymphocytes ; reduced cell - mediated immune responses ; abnormal delayed type hypersensitivity responses are known factors for described abnormalities in immune functions associated with diabetes mellitus. however, humoral immunity is relatively intact in diabetic patients. patients with diabetes commonly develop oral candidiasis, urinary tract infections, skin and soft tissue infections, osteomyelitis, tuberculosis, pneumonia related to gram negative bacteria, cholecystitis, and gastrointestinal infections. noninfectious causes of fever were more commonly identified (23.1%) in patients with known underlying disease with respect to those with no underlying risk factors except for old age. mortality was not associated with age or presence of underlying diseases in this study population. infectious diseases are reported to be the cause of acute fever requiring hospitalization in 75% of patients. it is important to remember that infectious diseases especially with the copresence of known underlying diseases may show rapid progression. as the life expectancy increases, the numbers of geriatric patients and their mean age are going to increase. in those patients with no underlying predisposing conditions except for age, the evaluation must be prompt, and the treatment should begin as early as possible. in the elderly patient with underlying disease, it will be more rational to consider noninfectious etiologies as the cause of fever. | introduction. infectious diseases may present with atypical presentations in the geriatric patients. while fever is an important finding of infections, it may also be a sign of noninfectious etiology. methods. geriatric patients who were hospitalized for acute fever in our infectious diseases unit were included. acute fever was defined as presentation within the first week of fever above 37.3c. results. 185 patients were included (82 males and 103 females). mean age was 69.7 7.5 years. the cause of fever was an infectious disease in 135 and noninfectious disease in 32 and unknown in 18 of the patients. the most common infectious etiologies were respiratory tract infections (n = 46), urinary tract infections (n = 26), and skin and soft tissue infections (n = 23). noninfectious causes of fever were rheumatic diseases (n = 8), solid tumors (n = 7), hematological diseases (n = 10), and vasculitis (n = 7). a noninfectious cause of fever was present in one patient with no underlying diseases and in 31 of 130 patients with underlying diseases. conclusion. geriatric patients with no underlying diseases generally had infectious causes of fever while noninfectious causes were responsible from fever in an important proportion of patients with underlying diseases. |
the present study examines the dose - response relationship for 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd) promotion of histologic and biochemical parameters by using a two - stage model for hepatocarcinogenesis in female sprague - dawley rats initiated with a single intraperitoneal dose of 175 mg of diethylnitrosamine (den)/kg body weight at 70 days of age. starting 2 weeks after initiation, treatment groups of 8 - 10 rats were given tcdd by gavage in corn oil once every 2 weeks for 30 weeks. doses were 3.5, 10.7, 35.7, and 125 ng tcdd / kg body weight / day. a significant body weight reduction was present in the noninitiated group that received 125 ng tcdd. relative liver weight was statistically increased in initiated rats treated with > or = 10.7 ng tcdd and in noninitiated rats treated with > or = 35.7 ng tcdd. histopathologic evidence of cytotoxicity was dose - related in all tcdd - treated groups. there was a statistically significant dose response in the bromodeoxyuridine (brdu) s - phase labeling index (li) in the den - initiated rats (p < 0.01) and a marginally significant trend in the saline - treated rats (p = 0.10), but proliferating cell nuclear antigen s - phase li and growth fraction within altered hepatic foci showed no increase. among the den - initiated groups there was a significant increase in glutathione s - transferase altered hepatic foci stereological parameters in the 125 ng tcdd group. this study demonstrates that dose - response relationships for tcdd 's effects on cell proliferation growth of altered hepatic foci are different from previously reported effects on p450 gene expression, indicating that different biological or biochemical responses may exhibit different dose - response relationships.(abstract truncated at 250 words)imagesfigure 1.figure 1.figure 1.figure 1.figure 1.figure 2.figure 3.figure 4.figure 5.figure 6.figure 7. |
|
obesity elevates the risk of developing a number of diseases, including atherosclerosis, diabetes, nonalcoholic fatty liver disease, certain cancers, and immune - mediated disorders such as asthma [13 ]. there is also converging evidence that negative mood states and stress create susceptibility to physical illnesses such as the common cold and cardiovascular disease, resulting in premature mortality [46 ]. underlying mechanisms such as chronic inflammation have been extensively investigated as candidate pathways that subsequently link obesity and depression in an attempt to explain how each confers vulnerability to the other and subsequently elevate as the risk for physical illness. other potential mediators of the obesity - depression association, such as changes in adipokines, however, have not yet been well explored. adipose tissue is no longer considered an inert tissue devoted to energy storage, and is now recognized as an endocrine organ capable of secreting a variety of biologically active components. a number of these biomarkers are now being explored as a means of explaining the link between obesity and depression, and as a consequence, representing possible novel targets in the treatment of mental illness [9, 10 ]. the primary object of this paper was to review the literature regarding the association between adipokines and major depressive disorder (mdd). this novel area of investigation may lead to new discoveries that help us understand depression and obesity, conditions that represent the largest psychological and physical causes of disability worldwide, respectively. medline and pubmed searches were conducted of english - language articles published between 1950 and may 2010 using the following search terms : major depressive disorder, depression, cross - referenced with adipocytokine, adipokine, leptin, resistin, and adiponectin. leptin is produced primarily by differentiated adipocytes and exerts its influence on the central nervous system (cns), suppressing food intake and stimulating energy expenditure. it was initially identified as an antiobesity hormone, acting as a negative feedback adiposity signal to control energy homeostasis by interacting with its receptors in the hypothalamus. under conditions of regular eating cycles, leptin levels exponentially reflect the proportion of adipose tissue, and the most important variable that determines leptin concentration is body fat mass. as a consequence of its role in satiety, leptin was initially thought to have an application in obesity treatment, but conversely, obese individuals often have increased leptin concentrations. the high leptin levels associated with obesity are thought to be caused by leptin resistance, much as high insulin levels in type 2 diabetic patients are a consequence of resistance to insulin. leptin resistance may occur at several levels, including impaired transport of leptin across the blood brain barrier, reduced function of the leptin receptor, and defects in leptin signal transduction [16, 17 ]. the role of leptin in the pathophsiology of psychiatric disorders in general, and in depression in particular, is being explored. rats exposed to chronic stress have decreased levels of leptin and a variety of depressive - like behaviors have been reduced by leptin administration [18, 19 ]. the data on the role of leptin in humans is more equivocal, however, and studies have reported increased [20, 21 ], decreased [22, 23 ], or unchanged levels in people with depression. along with its more clearly understood roles in energy metabolism, leptin also plays a role in the bidirectional communication between the hypothalamic pituitary adrenal (hpa) axis and the adipose system ; however, the relationship between these systems have not been defined and most likely involve unknown factors. leptin expression is also stimulated by glucocorticoids but chronic or high intensity stress offsets this stimulatory effect and causes a reduction in leptin levels. leptin is involved in modulating the immune response and increases the production of proinflammatory cytokines such as tumor necrosis - factor - alpha (tnf - a) and interleukin-6 (il-6). given that mdd is considered to be a proinflammatory state and that dysregulation of the hpa axis represents the most common biological alteration found in depression, while further work is required to characterize the neural circuits and signal transduction pathways that mediate leptin 's action, there may be a potential role for this hormone both to explain some of the metabolic abnormalities associated with depression and as a trait marker of mdd itself. adiponectin is primarily an adipocyte secretory protein involved in glucose and lipid homeostasis, but it is also expressed by skeletal muscle cells, cardiac myocytes, and endothelial cells [3032 ]. a negative correlation between obesity and circulating adiponectin has been well established, and serum levels of adiponectin are markedly decreased in individuals with visceral obesity and states of insulin resistance, such as nonalcoholic fatty liver disease, atherosclerosis, and type 2 diabetes mellitus. adiponectin also has been increasingly linked to mood states and may be of particular interest to explain how stress arousal may impact psychiatric disease risk. the first epidemiological studies documenting an association between low levels of adiponectin and an increased risk of mdd were published in 2006 [34, 35 ]. since that time, adiponectin has become the most abundant adipose - derived plasma protein with antiinflammatory qualities observed to be associated with mdd [35, 36 ]. circulating adiponectin levels have also been shown to correlate inversely with anxiety scores, a condition highly comorbid with depression. adiponectin has been suggested as a mediating factor in the association between obesity and psychopathology, and the adiponectin hypothesis stipulates that the link between the two conditions is directly related to hypoadiponectinemia. while the original work in this area reported a decrease in plasma adiponectin concentrations in symptomatic patients with mdd and an increase in adiponectin in patients with depression that was successfully treated, other studies have been unable to find changes in people with depression [10, 38, 39 ]. this effect may be mediated by antidepressants in the short - term and weight gain over time, but recent work suggests that the presence of weight gain and depression also appears to be additive. the two conditions appear to have a greater effect on adiponectin that either does separately, indicating that an underlying vulnerability may be conferred and then compounded by either of the two conditions and their resultant hypoadiponectinemia. adiponectin regulates the expression of several pro- and antiinflammatory cytokines and has been shown to both reduce secretion and attenuate the biological effects of tnf - a [4345 ] and to induce the production of antiinflammatory cytokines such as interleukin-10 (il-10) and interleukin-1 receptor antagonist (il-1ra). expression of adiponectin is also regulated by proinflammatory mediators such as il-6, which have been shown suppress adiponectin transcription and translation. weight loss is a potent inducer of adiponectin synthesis and the decreased synthesis of adiponectin, apparent in individuals who are obese, might lead to dysregulation of the controls that inhibit the production of proinflammatory cytokines, thereby leading to the production of increased levels of proinflammatory mediators. the hpa axis also plays a role in adiponectin regulation ; adiponectin gene expression is reversibly downregulated by dexamethasone, and glucocorticoids have been shown to inhibit adiponectin function. interpretation of the role of adiponectin in depression is complicated by potential confounding variables such as weight, other cardiovascular risk factors, medical co - morbidities, and the role of pharmacotherapy, but its role is worth exploring. the links between adiponectin, inflammation, and hpa axis dysregulation highlight a biologically plausible mechanism linking it to mdd. resistin is produced by adipocytes, macrophages, myocytes, and pancreatic cells, but its physiological role in humans is still uncertain. initial animal studies suggested that obesity induced by a high - fat diet or mutation of the leptin gene or receptor is associated with increased circulating resistin concentrations [53, 54 ]. other groups, however, have observed opposite results, showing that resistin expression was downregulated in rodent models of diet - induced obesity [5658 ] and suppressed by free fatty acids. the proinflammatory properties of resistin do suggest that it has a role in inflammatory processes, however, and it is likely involved in the chronic inflammatory reactions associated with obesity [58, 61, 62 ]. as the role of resistin in inflammation and obesity has not been defined, there is limited information to ascertain whether it contributes to the increased risk of physical illness in people with mdd. only 3 studies have examined this adipokine as it relates to depression, and of these, the results are variable. one study found both an association between free cortisol and resistin in patients with depression and a subsequent decrease in resistin when patients were successfully treated that was not seen in medication nonresponders, while a separate study in chinese patients found no link between the two. a third study recently found a positive correlation between resistin levels and depression, but in this case the increase was for atypical, but not typical depressive symptoms only. these findings support previous biological data on differences between atypical and melancholic features subtypes of mdd and are consistent with the negative results of the investigation reporting no association between resistin and typical depressive symptoms. while much is left to learn about the role of resistin, what we do know does support the possibility of an association between resistin and depression. resistin has been reported to inhibit dopamine and noradrenaline release in the hypothalamus and, thus, through its contribution to decreased intrasynaptic monoamine levels, it could also predispose to depressive symptomatology. it also has links to inflammation and the hpa axis, and further work is required to investigate its role in mdd. cortisol is proposed as a pathophysiological mediator in excess weight gain and recent reports have suggested that a state of primary intracellular cortisol excess may exist in obesity. this pseudohypercortisolism could be a result of increased activity of 11-hydroxysteroid dehydrogenase-1 (11-hsd-1), the enzyme that reduces cortisone to cortisol and is capable of elevating intracellular cortisol levels in adipose tissue cells. interest in a link between cortisol and mdd was initially stimulated by work with cushing 's disease, an illness characterized by cortisol excess secondary to either endogenous hyperactivation of the hpa axis or treatment with corticosteroids. the typical physical phenotype of central obesity that accompanies this neuroendrocrine dysregulation is often accompanied by an alteration in mood that interestingly can be successfully treated by removal of the pituitary or adrenal tumors or by corticosteroid production inhibitors, rather than by use of classical antidepressants. the association between mdd and cortisol may be accounted for in part by exposure to stress ; chronic stress leads to cortisol elevation and both retrospective and prospective studies suggest that major psychological stressors both precede the first episode of a mood disorder and are related to relapse. as a consequence of elevated stress, a cascade of events occurs in the hpa axis beginning with increased release of corticotrophin releasing hormone (crh) and arginine vasopressin (avp) from the paraventricular nucleus (pvn) of the hypothalamus. crh and avp subsequently stimulate the release of adrenocorticotropic hormone (acth) from the pituitary, which travels via the peripheral circulation to the adrenals and enhances the secretion of cortisol. cortisol functions as a feedback regulator of the hpa axis, acting via glucocorticoid receptors (gr) in the hypothalamus, pituitary, and other brain regions. a significant subset of depressed persons show : (1) elevations in the 24-h excretion of cortisol in the urine ; (2) elevations in plasma cortisol and acth ; (3) elevations in cerebrospinal fluid levels of crh ; (4) failure of feedback inhibition of cortisol secretion by the cortisol analog dexamethasone ; and (5) a blunted acth but normal cortisol secretion to exogenously administered crh (reviewed in). the resolution of all previously dysregulated hpa axis parameters including hypercortisolemia, blunted acth response to crh, hypesecretion of crh, and adrenal hypertrophy following successful antidepressant treatment provides independent support for the involvement of the hpa axis in depression [6971 ]. all of the adipokines reviewed above regulate hpa function in some way, and all therefore have potential to impact circulating cortisol levels. obesity is not only accompanied by inflammation, but is also associated with altered levels of the adipokines, favoring an increase in leptin and resistin, a decrease in adiponectin, and alterations in levels of cortisol. the changes in these biomarkers are more difficult to quantify in patients with mdd but an emerging body of evidence suggests that further investigation is warranted to describe the links between obesity, depression, and adiokine levels. current mechanisms to explain the interrelationships between depression and adiposity using structured equation modeling hypothesized that depression promotes weight accumulation, causing an inflammatory response, which in turn entails either an expanded adipose tissue release of il-6 or a leptin - induced upregulation of il-6 release by white blood cells. this explanation, while biologically plausible, does not include the role of cortisol and more recent data on an expanding role of adipokines in linking stress and weight gain to inflammation and disease. while work in this area needs to be done in order to identify the cause and effect of these different contributors, there does appear to be evidence that would support exploring this area further. | objective. two major causes of disability, major depression and obesity, share overlapping psychosocial and pathophysiological etiologies. studies are now focused on biological mechanisms linking the two illnesses, and there is interest in the role that adipokines may have in mediating the association between obesity and depression. we reviewed the literature to look at what is currently known about this association, focusing on the adipokines leptin, adiponectin, and resistin. methods. a medline search, citing articles from 1966 onward, supplemented by a review of bibliographies, was conducted to identify relevant studies. results. this paper identified plausible pathways underlying a link between adipokines and depression. only a few studies have yet been conducted specifically examining these biomarkers in patients with depression, but the results are intriguing. conclusion. this paper is one of the first to examine the association between adipokines and depression. it provides an overview of the physiological role of adipokines and summarizes the data suggesting that they may be dysregulated in major depression. this area of research may become increasingly important as new treatment strategies are developed. |
development of renal replacement therapies such as hemodialysis (hd), peritoneal dialysis (pd) and renal transplantation in children with end - stage renal disease (esrd) has resulted in improved long - term survival1). however, esrd influences virtually every organ system and thus, has a major impact not only on morbidity and mortality but also on the quality of life (qol) of children with esrd2). in general, qol can be defined as a patient 's sense of well - being and functional outcome within several life domains including physical, psychological status, and social interaction3). qol should not be confused with the concept of standard of living, which is based primarily on income. based on previous studies of qol, spilker4) concluded that qol is a multifaceted / multidimensional phenomenon and there are next five domains in a conceptual definition of qol : 1) physical status and functional abilities, 2) psychological status and well - being, 3) social interaction, 4) economic and/or vocational status, and 5) religious and/or spiritual status5) (fig. 1). actually, we, pediatric nephrologists, should confront a lot of medical problems in children with esrd. these problems consist of general symptoms such as fatigue and malaise, hematologic problems such as anemia and dysfunction of platelet, gastrointestinal problems such as anorexia, nausea and vomiting, electrolyte imbalances such as hyperkalemia, metabolic acidosis, hyponatremia, hyperuricemia and hyperphosphatemia, genitourinary problems, nerve system, endocrine, musculoskeletal, cardiovascular, and dermal problems, etc. except for these medical problems, however, there are additional problems that we must resolve in children including the change of body image, too many medicines, side effects, psychiatric problems, growth, and development. if we do n't have concern about these issues, normal growth and development in these children can not be accomplished. kurtin.6) suggested that the definition of success in the care of pediatric esrd patients should not be limited to mortality rates, but must include the degree to which these children are allowed to grow, develop, and behave in the same manner as their healthy peers. the goal of this review was to help the understanding of clinical usefulness of assessment of qol in children and adolescents with esrd. the qol of adults with esrd has been evaluated more comprehensively than in children. in 1985 they concluded that transplantation can give better qol than dialysis because qol of transplant recipients compared well with that of the general population, whereas patients with dialysis did not work at the similar level as people in the general population. in the choice health experience questionnaire (cheq) study, the difference of qol according to dialysis modality in adults with esrd was evaluated by 36-item short - form survey (sf-36) and it was reported that pd can give better qol than hd in various domains including physical functioning, bodily pain and emotional functioning8). in 2002, kidney disease outcomes quality initiative (k / doqi) reported that impairment in functioning and well - being are associated with worse outcomes in chronic kidney disease (ckd) and compared with healthy population, dialysis patients tend to have more dysfunctions and limitations of behavior due to more bodily pain, poorer vitality, and poorer general health9). so, k / doqi clinical practice guidelines for ckd recommended that patients with glomerular filtration rate (gfr) < 60 ml / min/1.73 m should undergo regular assessment for impairment of functioning and well - being9). in korea, park.10) suggested that lower residual renal function is a risk factor for depression and impaired qol in korean pd patients. up to the present, several pediatric qol tools have been developed such as these lists ; child health questionnaire (chq), child health and illness profile - adolescent edition (chip - ae), dartmouth primary care cooperative functional health assessment charts (coop), functional status ii (r), pediatric quality of life inventory (pedsql) and the vineland adaptive behavior scale (vineland). the chq consists of 12 domains of health status (physical functioning, limitations in schoolwork and activities with friends, general health, bodily pain, discomfort, limitations in family activities, emotional / time impact on the parent, impact of emotional or behavior problems on school work and other daily activities, self - esteem, mental health, behavior, family cohesion and change in health) and is suitable for children aged 10 to 19 tears11). the chip - ae is 6 domain/153 item self - report instrument (discomfort, satisfaction, disorder, achievements, resilience and risk) and sensitive to age, gender and socioeconomic influences12,13). the coop chart system has 6 domains of health status including physical fitness, emotional feeling, school work, social support, family communication, and health habits14). the vineland is suitable for evaluating both handicapped and nonhandicapped persons from birth to age 19 years unlike the other qol instruments15). pedsql 4.0 generic core scale created by varni.16) is a 23-item generic health status instrument that assesses five domains of health including physical, emotional, psychosocial, social and school functioning in children and adolescents ages 2 to 18 years. although these modules have internal reliability and clinical validity and can be completed easily by children and their parents, they have some limitations because they were not disease - specific module. after then, varni.17 - 20) have developed disease - specific modules to assess qol in children with chronic diseases such as esrd, asthma, cancer, and rheumatoid arthritis. the 34-item pedsql 3.0 esrd module developed in 2002 includes 7 scales : 1) general fatigue (4 items), 2) about my kidney disease (5 items), 3) treatment problems (4 items), 4) family and peer interaction (3 items), 5) worry (10 items), 6) perceived physical appearance (3 items), and 7) communication (5 items). this module consists of 4 age categories of 2 - 4, 5 - 7, 8 - 12, and 13 - 18 years. the scales are composed of both the child - self report and parent - proxy report formats for children aged 5 to 18 years and a parent - proxy report format for children aged 2 to 4 years. items are reverse - scored and linearly transformed to a 0 - 100 scale (0=100, 1=75, 2=50, 3=25, 4=0)., we translated the original english version of the pedsql 3.0 esrd into new korean version based on the guideline of linguistic validation provided by the original developer (mapi research trust, lyon, france ; on behalf of dr. unfortunately, there are few studies of qol in children with esrd because first, it is very difficult to obtain suitable questions for children and second, proxy assessment is always needed. initially, there are several limited studies of qualitative status in children with esrd instead of typical qol. morton.22) reported that living with parents, lack of experience of close relationship, lack of educational qualifications and unemployment were more common in young adults with esrd. in other study, 30% of adolescents with esrd were neither enrolled in an educational program nor were employed23). recently, there have been several attempts to quantitate in systematically analyzable terms, the net outcome of a disease and its treatment on the patient 's perception of his / her ability to live a useful and fulfilling life during childhood. in 1994, kurtin.6) created parent - completed questionnaire validated in the children 's health and quality of life project and suggested that less compliant adolescents consistently reported more pain and poorer general and mental health than more compliant adolescents, as well as lower family involvement. it was also reported that qol scores of children with esrd were considerably lower than healthy controls24). in addition, marciano.25) suggested that children with ckd showed a higher proportion of behavioral and emotional disorders and there was a negative correlation between the presence of behavior and emotional disorders and qol score. there have been several studies of difference of qol between treatment modalities such as dialysis and transplantation in children with esrd. according to study of qol in children with esrd using chip - ae, transplantation can produce improved physical activity, better work performance, more satisfaction, and less discomfort compared with dialysis26). in other study using pedsql module, transplant patients reported better physical and psychosocial health than dialysis patients24). in addition, pediatric kidney transplant recipients also reported a higher qol score than other published studies of chronic illness cohorts27). some studies have been reported the difference of qol between child - self and parent - proxy reports. mckenna.28) reported that caregivers score their children lower in almost all categories than the child - self reports. on the other hand, goldstein.29) reported that although parent - proxy reports show a positive impact from renal transplantation on the majority of qol domains compared with dialysis, child - self reports show nonsignificant differences in favor of renal transplantation. therefore, buyan.30) concluded that parent - proxy scores on the qol were not equivalent to child - self scores and that evaluating both children 's and parents ' perspectives were important. comorbidities including cardiovascular, gastrointestinal, endocrinologic, hematologic and neurologic disorders can be also one of the significant factors to decide the qol in children with esrd. especially, hypertension, diabetes, and cardiovascular disorders khan32) classified patients into high, medium and low risk groups according to comorbidity and age and reported the significant difference of patients ' perception of health score among the 3 risk groups. in 2012, we published a cross - sectional study of the korean translations of the pedsql esrd module comparing child - self reported and parent - proxy reported hrqol of children with esrd based on a national - wide pediatric esrd registry, the so called ' the korea pediatric ckd registry'21). participants included children aged 2 to 18 years who received maintenance dialysis treatment or renal transplant care for at least 6 months and their parents. total 92 pediatric patients (11 hd, 44 pd, and 37 transplant) were enrolled. we reported that patients with pd had better qol than hd in several domains (including treatment problems in the child - self reports, about my kidney disease and worry in the parent - proxy reports) and transplant patients had better hrqol than dialysis patients in one domain of the child - self report (treatment problems) and in two domains of the parent - proxy reports (about my kidney disease and worry). however, there were no significant differences in the total qol scores of the child - self reports between the pd and transplant patients. compared with adults, studies of qol in children with esrd have been not popular yet. however, we should consider that assessment of qol can be essential to achieve normal growth and development in children with chronic diseases including esrd. in addition, although various assessment tools for children have been recently developed, the optimized qol instrument in our country should be developed to overcome the language problems and cultural gap. pediatric quality of life inventory 3.0 end - stage renal disease module child - self report item content (korean version). | quality of life in addition to various medical problems in children with end - stage renal disease (esrd) should be objectively assessed to accomplish normal growth and development during childhood. however, unfortunately, studies of quality of life (qol) in children with esrd have been not popular yet and there are only fewer suitable assessment tools compared with adults. recently, disease - specific modules to evaluate qol in children with chronic disease such as esrd have been developed. this review was made to introduce these qol instruments for children and help the clinical application of them. |
retrograde urethrogram (rgu) and voiding cystourethrogram (vcug) are used to define the length and location of urethral stricture prior to surgery. in patients with pelvic fracture urethral distraction defect (pfudd), the bladder neck sometimes fails to open on vcug, leading to erroneous estimation of the stricture length. these patients are often on prolonged suprapubic diversion, which leads to decreased bladder capacity and inability to open the bladder neck. silodosin is an alpha-1a - adrenoceptor selective antagonist that has been shown to increase urinary flow rates within 2 - 6 hours (1). we used a single dose of silodosin (8 mg tablet) before vcug to relax the bladder neck and achieve excellent visualization of the posterior urethra. our objective was to evaluate the efficacy of silodosin in improving visualisation of posterior urethra during vcug and compare our results with a control group. this study was carried out in a prospective manner from january 2013 to july 2013 among patients with post - traumatic urethral stricture on suprapubic cystostomy who attended the urology outpatient department. patients with partial disruption of the urethra (passing urine per urethra), straddle injury, anterior urethra stricture, and severe cardiac, hepatic, or renal disease were excluded from the study. the patients were divided into group a and group b containing 20 and 15 patients, respectively. the patients in group a were given a single dose of silodosin (8 mg) 3 hours prior to radiological studies. rgu and vcug were performed in the radiology suite with antiseptic precautions with the patient in an oblique position. a 5-fr infant feeding tube was placed in the fossa navicularis, and 15 - 20 ml of contrast (meglumine iothalamate, tazograf) was injected for the rgu. about 300 - 400 ml of diluted contrast (60:40 contrast : normal saline) was used. thirty - five men, divided into group a (n = 20) and group b (n = 15), were evaluated during the study period. the average age of the patients was 29.1 years (range = 22 - 45) in group a and 32.4 years (range = 20 - 41) in group b. in group a, 19 out of the 20 patients were able to achieve satisfactory opening of the bladder neck, while in group b, 10 out of the 15 patients were able to open the bladder neck. the results were analyzed using a paired t - test (95% confidence interval, p = 0.027). a combined rgu and vcug has remained the bedrock of the diagnosis of urethral stricture, although both magnetic resonance urethrography and urethral ultrasound have been shown to be superior (2). a poorly performed urethrogram leads to an incorrect estimation of the stricture length (3). sometimes the bladder neck fails to open on vcug, which leads to an erroneous estimation of the stricture length. the evaluation of the posterior urethra is extremely important in pfudd patients as this a critical factor determining the success of surgical procedures. the disruption of urethral continuity as well as the presence of hematoma and spongiofibrosis in the surrounding tissues can give rise to the wide separation of the urethral ends. although a static cystogram has been regarded as a sign of an intact bladder neck, this finding can be misleading. these patients are often on prolonged suprapubic diversion, which results in decreased bladder capacity and inability to tolerate sufficient bladder distension to open the bladder neck voluntarily. a technique of passing a curved urethral sound antegrade from the suprapubic tract into the posterior urethra has been described to identify the proximal limit of stricture. however, this can cause bleeding and bladder neck injury (4). it uses t1 and t2 echo - weighed spin sequences after the distension of the urethra with a sterile lubricating jelly. its disadvantages include its limited availability and the high cost of the investigation (4). the examination is performed after the instillation of sterile saline into the urethra using 7.5-mhz probes. the probe is placed on the ventral surface of the penis to evaluate the penile and bulbar urethra. a further limitation is the high degree of technical expertise required for the scan as most radiologists do not routinely perform this investigation (5). the antegrade urethrogram technique has been described to visualize the proximal bulbar urethra in anterior urethra stricture patients. an optical cystoscope is passed antegrade via the suprapubic cystostomy tract into the posterior urethra, and a ureteric catheter is used to inject the contrast prior to imaging. this technique is not useful to evaluate the posterior urethra because the contrast rapidly passes into the bladder without entering the posterior urethra. silodosin is an alpha-1a - adrenoceptor antagonist used for the treatment of the lower urinary tract symptoms associated with benign prostatic hyperplasia. it relaxes the bladder neck and prostatic urethra and has been shown to increase the urinary flow rates 2 - 6 hours after the first dose (1). it is associated with a high degree of affinity for the 1a subtype of alpha - adrenoceptors, predominantly located in the prostate and lower urinary tract. silodosin is associated with a low incidence of side effects (e.g. orthostatic hypotension and retrograde ejaculation) due to its selective action (7, 8). the ingestion of a single dose of silodosin led to a statistically significant increase in the bladder neck opening in our study. this leads to multiple fluoroscopic images being obtained with increase in the radiation exposure of the patient. silodosin circumvents these problems by opening the bladder neck and ensuring the flow of the contrast into the posterior urethra. in our cohort of patients, silodosin use prior to vcug conferred a statistically significant increase in the visualization of the posterior urethra and was safe with no adverse effects. | background : retrograde urethrogram and voiding cystourethrogram are used to define length and location of urethral stricture prior to surgery. we used a single dose of silodosin prior to vcug to relax the bladder neck and achieve visualization of posterior urethra.objectives:to evaluate the efficacy of silodosin in visualization of posterior urethra during vcug, and to compare the findings with a control group.patients and methods : patients were divided into two groups a and b containing 20 and 15 patients, respectively. patients in group a were given a single dose of silodosin prior to radiological studies.results:in group a 19 out of 20 patients were able to achieve satisfactory bladder neck opening while in group b 10 out of 15 patients were able to achieve bladder neck opening.conclusions:silodosin use prior to vcug confers a statistically significant increase in bladder neck opening and visualization of posterior urethra. |
at the end of december 1993 and also at the end of january 1995, the river meuse, one of the major rivers in europe, flooded and river banks were inundated. we investigated the possible health risks of exposure to heavy metal concentrations in river bank soils resulting from the flooding of the river meuse at the end of 1993. soil and deposit samples and corresponding aerable and fodder crops were collected and analyzed for heavy metals. although the soils of the floodplain of the river meuse appeared severely polluted mainly by cd and zn, the heavy metal concentrations in the crops grown on these soils were within background ranges. incidentally, the legal standard for cd as endorsed by the commodities act was exceeded in wheat crops. the main exposure pathways for the general population were through the consumption of food crops grown on the river banks and through the direct ingestion of contaminated soils. for estimating potential human exposure in relation to soil pollution, we used a multiple pathway exposure model. for estimating the actual risk, we determined metal contents of vegetables grown in six experimental gardens. from this study, it can be concluded that there is a potential health risk for the river bank inhabitants as a consequence of pb and cd contaminations of the floodplain soils of the river meuse, which are frequently inundated (averaged flooding frequency once every 2 years).imagesfigure 1figure 2 |
|
deprotonation typically takes place exclusively at the carbon atom to yield carbanions that can be considered acrolein acyl carbanion equivalents. the presence of the allene function in the products of nucleophilic addition of carbanions such as 1 and 2 confers reactivity due to the strain inherent in the allene, which is often advantageous for synthetic applications. our interest in 1 was initially as a reagent for the annulation of ketones to hydroxy 1,4-benzoquinones. subsequently, we discovered that 1 and 2 were exceptionally useful reagents for the allene ether version of the nazarov cyclization. [2f, 4 ] lithioallene 2 was the first reagent we developed for the chiral auxiliary controlled asymmetric nazarov cyclization. early on we had observed that the nucleophilicity of 2 was greatly attenuated compared to 1, and we attributed this to the presence in 2 of multiple ether functions that could effectively chelate lithium ion leading to unreactive aggregated species. consistent with this hypothesis, we found that the nucleophilicity of 2 and of related species was restored by the addition of up to two equivalents of lithium chloride to the reaction mixture, an observation that is consistent with the known lithium chloride - induced disaggregation of carbanions. this simple expedient addressed the immediate problem successfully, but it also raised questions regarding the solution phase structure of lithioallenes like 2. a better understanding of the solution structure of these species would be useful for determining the origins of stereochemical induction in the nazarov cyclization. all geometry optimizations, frequency calculations, and nmr chemical shift calculations were performed with the gaussian 03 program. geometry optimizations were performed at the b3lyp/6 - 31+g(d) level of theory, followed by frequency calculations at the same level. free energy corrections were calculated at 200 k and 298.15 k from the frequency calculations and added to the electronic energies at each level of theory, in order to obtain approximate free energies of each species. solvent effects were modeled by placing explicit tetrahydrofuran (thf) ligands on the lithium atoms. generally, two or three ligands per lithium are used for a monomer, one or two for a dimer, and one ligand per lithium for a higher aggregate. in some cases, special care is taken to ensure consistent handling of standard states.[9, 10 ] specifically, a correction term rtln(crt / p) must be added per mole of each species in the reaction under consideration, which represents the change in free energy involved in compressing the system from standard pressure p (or a concentration of p/rt) used in gas - phase calculations to the standard concentration of c=1 mol l commonly used for solutions. this term is numerically equal to + 1.1119 kcal mol at 200 k and + 1.8900 kcal mol at 298.15 k. while it cancels from both sides when the net change in the number of moles due to reaction n=0, it is a non - negligible correction in cases where n0. yet another correction is required for cases where a thf ligand dissociates, as in eq. since the concentration of pure thf is different from the standard concentration c, it was evaluated from its molar volume at 1 atm and 200 k or 273.15 k using the empirical expression provided by govender., and incorporated into the second term of eq. this correction to g amounts to 1.0273 and 1.4883 kcal mol per thf at 200 and 298.15 k, respectively. this approach to modeling solvation effects on organolithium compounds has been used in other studies,[1217 ] and has been found to give results in agreement with available experimental evidence. isotropic c nmr chemical shifts were calculated at the b3lyp/6 - 31+g(d) level of theory. chemical shift calculations were performed on the mp2-optimized geometry for each species and for tetramethylsilane (tms), and the chemical shifts of each carbon atom relative to tms were obtained by subtraction. we have previously reported that in the absence of lithium chloride, 1-methoxyallenyllithium exists as a dimer the optimized thf - solvated structures of two isomeric dimers and the tetramer are shown in figure 1. in order to examine the tendency of this compound to form mixed aggregates with lithium chloride in the absence of the influence of solvents, the gas - phase free energies of mixed aggregate formation were calculated at the b3lyp/6 - 31+g(d) and mp2/6 - 31+g(d) levels of theory. the optimized geometries of the gas - phase mixed aggregates are shown in figure 2. the calculated free energies of mixed dimer and mixed trimer formation are listed in table 1, and those of mixed tetramer formation are in table 2. comparison of the two tables shows that the formation of higher mixed aggregates is most energetically favorable in the gas phase. this is consistent with previously published studies.[1922 ] the free energies of gas - phase mixed aggregate formation calculated by the b3lyp and mp2 methods are in good agreement, generally within 12 kcal mole of each other. although the gas - phase calculations are valuable for comparison of different computational methods and for predicting the structures and aggregation states in non - polar solvents, the negligible solubility of lithium chloride in those solvents makes it unlikely that these mixed aggregates will be observed in solution. we therefore turned our attention to the thf - solvated structures and free energies of mixed aggregate formation. optimized geometries of thf - solvated 1-methoxyallenyllithium homo - aggregates. reproduced (adapted) with permission from ref.. grey : carbon ; white : hydrogen ; red : oxygen ; violet : lithium. mp2-optimized gas - phase geometries of 1-methoxyallenyllithium (aln) mixed aggregates with lithium chloride. grey : carbon ; white : hydrogen ; red : oxygen ; violet : lithium ; green : chlorine. free energies of gas - phase mixed dimer and mixed trimer formation of 1-methoxyallenyllithium with lithium chloride free energies of gas - phase mixed tetramer formation of 1-methoxyallenyllithium with lithium chloride dimeric lithium compounds can be solvated by one or two thf ligands per lithium, while steric constraints generally limit solvation to one thf per lithium in higher aggregates. to determine which solvation state should be used for calculations involving the dimers, the free energies of tetrasolvated dimers of 1-methoxyallenyllithium, lithium chloride, and the mixed dimer were calculated from the disolvated dimers, as shown in eq. free energies of solvation of 1-methoxyallenyllithium lithium chloride dimers and a 1:1 mixed dimer with lithium chloride we have previously shown that the b3lyp/6 - 31+g(d) method predicts the disolvate to be too stable, while the mp2 calculations with the same basis set predict the tetrasolvated form to be too stable, relative to higher level calculations. due to the anion - like character of these organolithium species, the diffuse functions on the heavy atoms are necessary to adequately describe the bonding, but little advantage was gained by using even larger basis sets. taking an average of the b3lyp and mp2 solvation free energies leads to the conclusion that the tetrasolvated form of each dimer was favored, and the tetrasolvates were used in subsequent calculations. the free energies of mixed dimer and mixed trimer formation in thf solution were calculated from the solvated homo - dimers of 1-methoxyallenyllithium and lithium chloride, as shown in eq. the free energies of thf - solvated mixed tetramer formation were also calculated from the 1-methoxyallenyllithium lithium chloride mixed dimer, according to eq. free energies of thf - solvated mixed dimer and mixed trimer formation of 1-methoxyallenyllithium with lithium chloride free energies of thf - solvated mixed tetramer formation of 1-methoxyallenyllithium with lithium chloride free energies of thf - solvated mixed tetramer formation from the mixed dimer mp2-optimized geometries of thf - solvated 1-methoxyallenyllithium mixed aggregates with lithium chloride. grey : carbon ; white : hydrogen ; red : oxygen ; violet : lithium ; green : chlorine. the data in tables 4 and 5 show a significant disagreement between the b3lyp and mp2-calculated free energies of mixed aggregate formation, with the former method predicting a greater tendency toward mixed aggregate formation. the two methods differ in the inclusion of electron correlation, as b3lyp (as well as other dft methods) includes it implicitly, while mp2 is based on perturbation theory. the mp2 calculations predict a modest tendency toward formation of the mixed dimer, with little tendency to form the mixed trimers. the data in table 6 predicts mixed tetramers to form at the b3lyp level, but the mixed dimer was predicted to be favored at the mp2 level. the calculations predict that mixed aggregates will be formed, but since neither computational method is perfect, it isnt possible to say for certain which mixed aggregates predominate from the free energies of formation alone. table 7 shows the calculated c nmr chemical shifts for the 1-methoxyallenyllithium dimers, tetramer, and its mixed aggregates with lithium chloride. the nmr spectrum of 1-methoxyallenyllithium without lithium chloride is shown in figure 4 a, and with 0.3 and 1.0 equivalent lithium chloride in figures 4 b and 4 c, respectively. as we previously reported, c1 at about 154 ppm and c2 at about 193 ppm give the most information about the aggregation state. the predominant species seen in figure 4 a is the 1-methoxyallenyllithium dimer 1, with smaller amounts of the tetramer, resonating downfield of the dimer (c1) and upfield of the dimer (c2). the small peak upfield of the c2 dimer 1 peak is consistent with a small amount of the second dimer described previously. calculated c nmr chemical shifts (b3lyp/6 - 31+g(d)) of thf - solvated 1-methoxyallenyllithium and its mixed aggregates with lithium chloride c nmr spectrum of 1-methoxyallenyllithium a) without lithium chloride at 100 c. c nmr (125.75 mhz, [d8]thf) : =194.34, 154.03 ppm ; b) with 0.3 equiv lithium chloride at 100 c. c nmr (125.75 mhz, [d8]thf) : =194.23, 153.84 ppm ; c) with 1.0 equiv lithium chloride at 100 c. c nmr (125.75 mhz, [d8]thf) : =194.23, 153.73 ppm. the calculated chemical shifts of the 1-methoxyallenyllithium lithium chloride mixed dimer are very close to those of the major homo - dimer from ref. the chemical shift of the mixed dimers c2 is calculated to be slightly upfield of that of dimer 1, and a partially overlapping peak, slightly upfield of the homo - dimer, was observed with 0.3 equivalents of lithium chloride, shown in figure 4 b. the expansion of the region of the c2 peak clearly shows a second species. the peak corresponding to c1 was broadened from 53.8 hz to 60.1 hz at 1/2 height with 0.3 equivalents lithium chloride, suggesting that the peaks are not fully resolved. with 1.0 equivalent lithium chloride, shown in figure 4 c, the spectrum is consistent with a single major species, and the c1 peak was narrowed to 42.8 hz. small peaks are visible in both spectra that may arise from small amounts of the 1-methoxyallenyllithium tetramer. those peaks are also consistent with small amounts of higher mixed aggregates. from the relative peak sizes of c1 and c2, the relaxation time of c1 decreases with increasing lithium chloride concentration. this is further evidence of a change in the chemical environment about c1. from comparison of the observed and calculated chemical shifts, mixed trimers and tetramers thus, the predictions of the mp2 free energies of mixed aggregate formation appear to be more reliable than b3lyp for this particular system. the calculated free energies of mixed aggregate formation at the b3lyp/6 - 31+g(d) and mp2/6 - 31+g(d) levels of theory predict 1-methoxyallenyllithium to form mixed aggregates with lithium chloride. the two methods generated different predictions of which mixed aggregates will be formed, with the former favoring mixed trimers and tetramers in thf solution, and the latter favoring mixed dimers. formation of the sterically unhindered mixed dimers is also consistent with the enhanced reactivity of these compounds in the presence of lithium chloride, as was described in the introduction. the spectra are also consistent with some residual 1-methoxyallenyllithium tetramer, as well as small amounts of higher mixed aggregates. although neither computational method is perfect, the mp2-calculated free energies are in better agreement with experiment than the b3lyp energies for this particular system. the c nmr spectra in [d8]thf were recorded on a varian unity inova 500 (varian, palo alto, usa) at 173, 193, 223, and 243 k at 125.75 mhz with a 3 s delay between pulses. since no new features were observed at the higher temperatures, only the spectra acquired at 173 k were reported. preparation of 1-methoxyallenyllithium in [d8]thf : an oven - dried nmr tube was charged with methoxyallene (50 mg, 0.71 mmol) under nitrogen. [d8]thf (750 l) was added by syringe through a septum, and the solution was cooled to 78 c. a 2.46 m solution of n - buli in hexanes (0.35 ml, 1.2 equiv) was added, and the solution was left standing at 78 c for 15 min. the total concentration of 1-methoxyallenyllithium was 0.65 m. the solution was then frozen in liquid nitrogen, and the nmr tube was flame - sealed. preparation of 1-methoxyallenyllithium in [d8]thf with 0.3 equiv of licl : an oven - dried nmr tube was charged with methoxyallene (39 mg, 0.56 mmol) under nitrogen. licl in [d8]thf (0.38 ml of a solution of 17.2 mg in 0.95 ml) was added by syringe through a septum, and the solution was cooled to 78 c. a 2.76 m solution of n - buli in hexanes (0.24 ml, 1.2 equiv) was added, and the solution was left standing at 78 c for 15 min. the total concentration of 1-methoxyallenyllithium was 0.90 m. the solution was then frozen in liquid nitrogen, and the nmr tube was flame - sealed. preparation of 1-methoxyallenyllithium in [d8]thf with 1.0 equiv of licl : an oven dried nmr tube was charged with methoxyallene (37 mg, 0.53 mmol) under nitrogen. licl in [d8]thf (0.59 ml of a solution of 36 mg in 0.95 ml) was added by syringe through a septum, and the solution was cooled to 78 c. a 2.76 m solution of n - buli in hexanes (0.25 ml, 1.3 equiv) was added, and the solution was left standing at 78 c for 15 min. the total concentration of 1-methoxyallenyllithium was 0.63 m. the solution was then frozen in liquid nitrogen, and the nmr tube was flame - sealed. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors. | a combined computational and 13c nmr study was used to investigate the formation of mixed aggregates of 1-methoxyallenyllithium and lithium chloride in tetrahydrofuran (thf) solution. the observed and calculated chemical shifts, as well as the calculated free energies of mixed aggregate formation (mp2/6 - 31+g(d)), are consistent with the formation of a mixed dimer as the major species in solution. free energies of mixed dimer, trimer, and tetramer formation were calculated by using the b3lyp and mp2 methods and the 6 - 31+g(d) basis set. the two methods generated different predictions of which mixed aggregates will be formed, with b3lyp/6 - 31+g(d) favoring mixed trimers and tetramers in thf solution, and mp2/6 - 31+g(d) favoring mixed dimers. formation of the sterically unhindered mixed dimers is also consistent with the enhanced reactivity of these compounds in the presence of lithium chloride. the spectra are also consistent with some residual 1-methoxyallenyllithium tetramer, as well as small amounts of higher mixed aggregates. although neither computational method is perfect, for this particular system, the calculated free energies derived using the mp2 method are in better agreement with experimental data than those derived using the b3lyp method. |
the ability to three - dimensionally interweave biological tissue with functional electronics could enable the creation of bionic organs possessing enhanced functionalities over their human counterparts. conventional electronic devices are inherently two - dimensional, preventing seamless multidimensional integration with synthetic biology, as the processes and materials are very different. here, we present a novel strategy for overcoming these difficulties via additive manufacturing of biological cells with structural and nanoparticle derived electronic elements. as a proof of concept, we generated a bionic ear via 3d printing of a cell - seeded hydrogel matrix in the precise anatomic geometry of a human ear, along with an intertwined conducting polymer consisting of infused silver nanoparticles. this allowed for in vitro culturing of cartilage tissue around an inductive coil antenna in the ear, which subsequently enables readout of inductively - coupled signals from cochlea - shaped electrodes. the printed ear exhibits enhanced auditory sensing for radio frequency reception, and complementary left and right ears can listen to stereo audio music. overall, our approach suggests a means to intricately merge biologic and nanoelectronic functionalities via 3d printing. |
|
iliotibial band (itb) friction syndrome is a common overuse injury typically seen in runners, cyclists, and military recruits (1). magnetic resonance imaging (mri) can show the characteristic imaging findings (2). however, coincidental findings or other accompanying mass lesions on mri have been rarely reported. a few reports described synovial cysts, meniscal cysts, periarticular ganglia, and synovial sarcomas causing itb friction syndrome (3, 4, 5). a fibroma of tendon sheath (fts) is an uncommon benign, painless, slowly growing tumor that usually occurs in the tendon or tendon sheaths of the distal upper extremity (wrist and hand). an intra - articular location arising in the knee joint is extremely rare (6, 7). intra - articular involvement with fts may irritate the surrounding soft tissue (7). we report a case of intra - articular fts in a knee joint associated with itb friction syndrome, confirmed by arthroscopy and pathology. a 45-year - old male presented with a history of several months of right lateral knee pain. he also complained of a creak and a movable mass at the lateral joint area during ambulation. an mri was performed using a magnetom vision 1.5-t mr imaging unit (siemens medical systems, erlangen, germany). the mri showed a thickened itb and poorly defined high signal intensity abnormalities in a compartment - like space bounded laterally by the itb on coronal fat suppressed proton density weighted images (repetition time [tr ] 1700 ms, echo time [te ] 10 ms) (fig. the t1-weighted image (tr 400 ms, te 20 ms) showed a decreased signal intensity lesion compared to adjacent fat, deep to the itb (fig. a well - demarcated, ovoid nodular lesion was also observed in the compartment - like space. the nodule showed iso - signal intensity compared to the knee muscle on a t1-weighted image, high signal intensity on t2-weighted images (tr 3200 ms, te 100 ms), and a slightly higher signal intensity with thin rim on fat suppressed proton density weighted images (fig. 1a - c). the initial diagnosis based on the mri findings, clinical history, and physical examination was itb friction syndrome. we suspected the nodular lesion was a ganglion, focal synovial thickening, focal villonodular synovitis, or focal degenerative change of invaginated extraaritcular fatty tissue. unfortunately, we did not consider the possibility of a fts. during an arthroscopic examination, the surgeon found an inflamed lateral synovial recess, which is typically observed in itb friction syndrome (fig. after a sequential arthroscopic inflamed synovial recess resection with synovial shaver, a whitish intraarticular polypoid nodule was observed, attached to the lateral joint capsule (fig. the nodule did not contain necrosis, mitotic activity, or cellular atypia (fig. arthroscopic debridement of the adjacent tissues near the surface between itb and lateral femoral condyle was also performed to relieve the symptoms of itb friction syndrome. the resected tissues showed fibrosis, marked hemorrhage, prominent capillary proliferation, and mild chronic inflammation that was consistent with itb friction syndrome (fig. fibroma of tendon sheath usually forms as a small, slow - growing, firm nodule in association with tendons and tendon sheath (6). an estimated 80 - 95% of fts occurred in the small joint of the upper extremity (finger, hand, and wrist) (8, 9). in 1979, chung and enzinger (8) reported that only 7 cases from 138 cases of fts were found around the knee joint, mostly in an extra - articular location. to date, less than 30 reported cases of the disease have been related to the knee (9). furthermore, the intra - articular location is less common. to our knowledge, only 7 cases of intra - articular fts in the knee joint have been reported (6, 7, 9). however, among cases of intra - articular fts, the knee joint is the most common location (7, 9). clinically, fts can occur at any age, with peak incidence at 20 - 50 years, and predominantly in males (8, 9). fts usually presents as a solitary, painless tumor that may later irritate the surrounding tissue (10). intra - articular fts usually present with symptoms of fullness or mechanical symptoms (7, 9, 11, 12). in the knee joint, 71% of lesion present with pain or discomfort and 31% present with palpable masses (9). this case was an intra - articular fts that presented with recurrent pain and a movable mass, consistent with itb friction syndrome. fibroma of tendon sheath typically show a smooth, well - circumscribed, lobulated architecture. fts has been described as a fibrotic neoplasm or a reactive fibrosis, but its precise origin is still unclear (7, 11). microscopically, the mass is composed of scattered, spindle shaped fibroblasts or myofibroblasts within a dense fibrocollageneous stroma and frequently bears dilated or slit - like vascular channels (8, 13, 14). actually, most of the cases do occur in close association with the tendon or tendon sheath (8, 14). however, various unusual locations have been reported (10, 11, 12, 15). intra - articular fts usually originates in the joint synovium or capsule, with no apparent connection to any tendons (7, 11, 12, 15). the major differential diagnosis of intra - articular fts includes giant cell tumor of the tendon sheath (gctts) and nodular fasciitis (nf) (12, 14, 15). fts is most often confused with gctts at clinical examination and even under gross pathology (14). fts is hypocellular with slit - like vascular channels within a dense collagen matrix (12, 14). gctts is less hyalinized and more cellular, with multiple multinucleated giant cells, foamy histiocytes, and hemosiderin - laden macrophages (12, 14). due to similarities between some forms of the two tumors, some authors have hypothesized that they may be two phenotypic extremities of a single entity (17). other authors have suggested that fts is the end sclerosing stage of gctts, probably consequent on progressive vascular impairment (18). intra - articular fts must also be distinguished from intra - articular nf (7, 15). nf is a benign myofibroblastic proliferation with a prediction for the subcutaneous tissue or muscle (16). nf resembles fts histologically and up to one fourth of cases of fts are indistinguishable from nf (19). intra - articular nf is very rare, similar to intra - articular fts (15, 16). but, most cases of intra - articular nf seem to have a longer clinical history and nonspecific symptoms, compared with subcutaneous or intramuscular nf (16). fibroma of tendon sheath usually appears as well defined, small, soft tissue mass on mri (9, 14). on t1-weighted images, the tumor is generally of a low signal intensity compared to the adjacent muscle. the mass shows heterogeneous, low to high signal intensity on t2-weighted images and a variable enhancement pattern (7, 9, 14). this variation on t2-weighted images and contrast enhancement study mostly rests on the contents of fibrocollagenous tissue and capillary vascularity near the mass (14). fibroma of tendon sheath can be hard to distinguish from other benign or malignant lesions, because of its infrequent occurrence in the knee joint and small, nonspecific nodular appearance on mri (9, 14). the radiologic differential diagnosis of fts includes gctts, nf, pigmented villonodular synovitis, and extra - abdominal desmoid tumor. inflammatory synovitis, juxta - articular myxoma, synovial chondromatosis, synovial sarcoma, and fibrosarcoma also could be considered (9, 14). the patients with itb friction syndrome can show the characteristic mr imaging findings, including thickened iliotibial band, poorly defined signal intensity alterations in the fatty tissue deep to the itb on coronal images, or circumscribed fluid collection in compartment - like space bounded laterally by itb (2). in chronic cases, mri studies are essential to rule out other pathologic entities causing lateral knee pain, such as lateral meniscal tear and lateral compartment degenerative joint disease (1). in our case, the mri showed a typical finding of itb friction syndrome with a small ovoid nodule in the compartment - like space of the lateral gutter. the nodule was confirmed as fts based on the histopathologic examination. to the best of our knowledge, we report the first case of an intra - articular fts in a knee joint associated with itb friction syndrome in english literature. generally proposed etiologies of itb friction syndrome include friction of the itb against the lateral femoral epicondyle during repetitive flexion and extension activities, compression of the fat and connective tissue deep to the itb, or chronic inflammation of the itb bursa (1, 21). nemeth and sanders (4) found and labeled a lateral synovial recess under the itb that consists of a synovium that is a lateral extension and invagination of the knee joint capsule and is not a separate bursa. biopsies of lateral synovial recesses in patients with itb friction syndrome showed histopathologic changes consisting of chronic inflammation, hyperplasia, fibrosis, and mucoid degeneration (4, 20). we found an inflamed lateral synovial recess on arthroscopic and histologic examination of our patient. even though we did not clearly understand the correlation between a fibroma of a tendon sheath and itb friction syndrome, the tumor can aggravate the itb friction syndrome. the mainstay therapy of itb friction syndrome is nonsurgical management. in persistent or chronic cases there are several different surgical techniques, percutaneous release of itb, open surgical release of itb, itb z lengthening, arthroscopic itb debridement, and open itb bursectomy (20, 21). if there is a nodular lesion in a patient with itb friction syndrome, mri recognition is also important to help the physician choose the proper surgical technique. when nodular lesions on mri are detected in patients with itb friction syndrome, a fibroma of tendon sheath could be included in the differential diagnosis. | iliotibial band (itb) friction syndrome is a common overuse injury typically seen in the active athlete population. a nodular lesion on the inner side of the itb as an etiology or an accompanying lesion from friction syndrome has been rarely reported. a 45-year - old male presented with recurrent pain and a movable nodule at the lateral joint area, diagnosed as itb friction syndrome. the nodule was confirmed as a rare intra - articular fibroma of the tendon sheath (fts) on the basis of histopathologic findings. we describe the mri findings, arthroscopic and pathologic features, in this case of intra - articular fts presenting with itb friction syndrome. |
anemia continues to be a major public health problem worldwide. according to estimates from the world health organization, two billion individuals suffer from anemia in the world.the highest prevalence of anemia exists in the developing world where its causes are multifactorial, ranging from micronutrient deficiencies such as iron, folate, vitamin b12 to infectious diseases such as malaria and worm infections. iron deficiency anemia is thought to affect the health of more than one billion worldwide and it is the most common form of anemia in the developing world. iron deficiency anemia accounts for most of the anemia cases that occur due to parasitic infections. it is very high in pre - term babies, low birth weight infants, adolescents, and in pregnancy, when an extra supply of iron may be necessary. recent research indicates that iron deficiency has important implications, which include less learning ability and behavioral abnormalities in children, a lower ability to work hard, and poor appetite and growth. the aim of this study was to estimate the prevalence of anemia in three rural villages in the ovia local government area of edo state, nigeria and to determine whether its cause was nutritional or due to malaria infection. the study was performed in the isiohor, evbuomore and ekosodin villages located in the ovia local government area of edo state, nigeria. the villages were selected for the study, as the population was well homogenized without much difference in style of living, culture and occupations practiced. both male and female children aged 1 - 15 years from schools and healthcare centers comprised the study population. prior to the commencement of the study, permission was obtained from the local education authority of ovia local government areas and from the elders of the community. personal hygiene and environmental sanitation information were provided by the children as well as through the teachers or health center nurses who were familiar with the local conditions. blood samples were collected by antecubital venipuncture by qualified personnel from the ekosodin health center into sample tubes containing anticoagulant (citric acetate) and stored on ice for transport to the laboratory later in the day. the weight, height and mid upper arm circumference (muac) measurements were taken following standard procedures and necessary precautions. laboratory analysis of the samples was conducted at the medical microbiology laboratory of the department of medical microbiology, university of benin teaching hospital, benin city, nigeria. malaria was investigated during the study by microscopic examination of giemsa stained thick blood smears. malaria parasites were counted against 100 white blood cells assuming a reference value for african white blood cells to be 6,000 /cm. hemoglobin concentration was measured using sysmex kx-21n hemoglobin auto analyzer instrument (sysmex corporation, state). anemia was defined as hb 15 years) during growth spurts have the greatest physiological demands for iron and are at highest risk of iron deficiency anemia. the mean age of children in this study was 5.67 years, the age range with the highest risk of anemia as reported by calis. when compared to the other two communities studied, evbuomore had a higher prevalence of anemia. the mean age of children in this community was 2.75 years, and this may explain the reduced hemoglobin concentration in these children, most of whom are in rapid growth spurts. this high rate may be indicative of the fact that the diet of the preschoolers is not adequate for their iron needs. during these studies, interviews performed with the children and observations by the community health workers revealed that the staple food of this area is garri. farming is the major occupation and only crops that are likely to yield some income are planted. the level of income of family breadwinners is also low, as evidenced by the housing and the yield from the farms. financial access to meat and other adequate animal sources of iron is, therefore, very limited. efforts by public health workers in the health center in evbuomore to encourage mothers to grow their own vegetable gardens have not met with much success. these reasons could account for the very high prevalence of anemia observed in the study area. malaria was more prevalent in the age group 1 - 5 years ; this agreed with the report by anumudu. it is known that the age group 1 - 5 years is the most vulnerable to severe and complicated malaria since their immunity is still low. the prevalence of plasmodium falciparum in the pooled subjects of 33.3% agreed with previous reports by ekpo, which examined malaria parasites in kwara, oyo and ogun states with a pooled prevalence of 33.6% among young children. this prevalence was higher than that reported by jeremiah in rivers state of nigeria, although less than that reported in ibadan. this study demonstrated heterogeneities in malaria prevalence among the studied communities in agreement with observation from a previous report, where parasites rates ranged from 12.0% to 37.8% among school children in the communities of moshie - zango and manhyia in ghana. this study adds to the growing body of evidence that malaria transmission can vary widely across communities and highlights the importance of targeting interventions to specific communities. it is evident that malaria causes anemia through one or more several mechanisms including blood loss, hemolysis, anemia of inflammation and splenic sequestration. in this study, there was no association between malaria infection and anemia. similarly, stoltzfus did not detect any association between malaria and anemia. in a recent study in river state, nigeria, with school children as subjects, the non - association in this study and those of others may be attributed to low level parasitaemia observed in most of the infected children, a condition that is usually associated with concomitant immunity with little or no adverse effects on hemoglobin concentration. the most common form of malnutrition in the children studied was underweight (44.0%) followed by stunting (37.0%) and wasting (19.3%). the prevalence of stunting in this study (36%) was similar to that estimated in the 4th world nutrition situation report for the west african sub - region (34.9%). the estimated prevalence of underweight in this study was higher than the current rate for west africa (36.5%) (16). even though underweight affects fewer children globally than stunting, west africa has seen an increase of 0.32% per year in recent years. wasting was not as common as stunting and underweight in any region of the world, and a similar pattern was observed in the results of this study. there has been a substantial increase in wasting among west african children, and this increase could explain the high rate of underweight in these countries. chronic malnutrition appeared to be a more pressing problem than acute malnutrition as indicated by the levels of stunting and underweight compared to the levels of wasting, and the higher prevalence of anemia in preschool children than in school aged children. it is necessary, therefore, to educate mothers in this study area on the importance to appropriately feed their children from an early stage of life. there were significant differences in the muac of normal children and wasting and underweight children, suggesting that muac could be accurately used for rapid assessment of on - going malnutrition in specific populations, since it will be easier to establish local standards. the significant correlation between muac and pcv, underweight and wasting also supported this argument. as seen in this study, serum ferritin levels, as measured by elisa, can be reliably used to diagnose anemia. there was no association between serum ferritin values and the presence of malaria parasites in this study ; this suggests that the anemia measured in this population may have been due mostly to nutritional status. this conclusion was confirmed by work done in lagos, which showed that ferritin levels were significantly higher in subjects with high densities of malaria parasites. the most likely explanation for the high rate of anemia in this population is, therefore, insufficient dietary intake of micronutrients, especially iron. it may explain a delayed recovery of iron deficiency anemia after the control of parasitic infections. the effect of helminthiasis on anemia status in these rural communities has been studied and will be reported in a later study. in rural communities of edo state, nigeria, anemia is highly prevalent ; however, it can not serve as a proxy indicator of malaria infections. this is likely caused by the marginal nutritional status of those at risk for malaria infection. infection control should be accompanied by monitoring of iron deficiency and, when needed, supplementation can be organized through a malaria control program. | background : the most common cause of anemia is an iron deficiency ; however, the condition may also be caused by deficiencies in folate, vitamin b12 and protein. some anemia is not caused by nutritional factors, but by congenital factors and parasitic diseases such as malaria.aim:this study attempted to estimate the prevalence of anemia among children in three rural communities of the ovia north east local government area, and to determine whether its cause was nutritional or could be attributed to malaria.patients and methods : a total of 316 children between the ages of 1 and 15 years were included in the study. children were examined for malaria parasites by microscopy. the world health organization (who) age - adjusted cut - off for hemoglobin was used to classify anemia.results:38.6% of the children were anemic, with hemoglobin levels lower than 11g / dl, although parasite prevalence and density were low. malnutrition was patent ; 37.0% of the children were stunted, 19.3% wasted and 44.0% underweight. serum ferritin was more sensitive than hemoglobin concentration in detecting anemic children. anemia was also significantly higher in the evbuomore village school than in the ekosodin and isiohor villages (p<0.001).conclusion : anemia detected in this population may be due more to malnutrition than to malaria. |
atrial electromechanical delays (aemds) are defined as the time intervals between the atrial electrical depolarization and the initiation or peak of atrial mechanical contraction. it has been shown that prolonged aemds can be used as markers to discriminate patients with paroxysmal atrial fibrillation (paf) from controls without paf or to predict the occurrence of paf in case - control or observational studies.1)2)3)4)5)6)7)8)9)10) the clinical evidence supports the notion that prolonged aemds reflect left atrial electrical remodeling, which is essential for the maintenance of atrial fibrillation (af).7) however, studies on this aspect have evaluated the single aemd using specific, yet independent definitions. the discriminative and predictive values of the aemds with such different definitions have not previously been compared with each other, and the potential influences of major clinical variables on aemds have not been sufficiently excluded in previous studies. in this study, we conducted a retrospective analysis to more accurately evaluate the discriminative values of aemds while excluding the influences of major clinical variables, and compared the discriminative values of predefined aemds when differentiating between the paf patients and the controls. patients were screened who were first diagnosed with paf between 2010 and 2013 with available electrocardiographic and echocardiographic records ; furthermore, those patients selected had clear p waves on surface electrocardiogram (ecg) channel, pulsed wave doppler images (pwdi) of trans - mitral inflow, and tissue doppler images (tdi) of mitral annular motion. those patients excluded from this study had ambiguous ecg or doppler study images, or abnormal rhythms other than normal sinus rhythm at the time of echocardiographic measurements. in addition, those patients were also excluded who reported current medication with drugs influencing intracardiac conduction (beta - blocker, nondihydropyridine calcium channel blocker, class ic or iii antiarrhythmic drugs) in the prior week (3 months for amiodarone) before echocardiographic measurements. however, the patients with the following were permitted to participate in the study : use of dihydropyridine calcium channel blockers, alpha - blockers, or diuretics. other exclusion criteria were : a history of previous cardiac surgery, reduced ejection fraction (55 mm), valvular heart disease (american college of cardiology / american heart association grade 2), any cardiomyopathy, coronary artery disease requiring interventional treatment, uncontrolled thyroid disease, advanced chronic kidney disease (estimated glomerular filtration rate 2.0 mg / dl), malignancy, chronic inflammatory or systemic connective tissue diseases, and the presence of moderate electrolyte imbalances. data for the healthy control group was extracted from the echocardiography registry of dong - a university medical center, busan, korea, and there was a screening of subjects who underwent echocardiography during health care examinations from 2010 to 2013. the excluded subjects from this study had documented atrial tachycardia, flutter, or fibrillation. the matched healthy controls were selected in a 1:2 ratio for those patients with available medical records, age, sex, a history of hypertension, and diabetes mellitus. age discrepancies of less than 5 years were allowed for patient - control age matching. the identical inclusion and exclusion criteria for the paf patient selection were used for the selection of the control subjects. the present study protocol was reviewed and approved by the internal review board of dong - a university hospital, busan, korea. echocardiography was performed using an ie33 ultrasound system and 2.5 mhz transducers (philips ultrasound, andover, ma, usa). the standard m - mode, 2d, and doppler echocardiography were routinely performed, in accordance with the recommendations of the american society of echocardiography.11)12) the ecg was recorded continuously during echocardiographic studies at a sweep speed of 100 mm / sec and the amplitude gain was set to 70%. the pwdi sample volume for late diastolic trans - mitral inflow velocity measurement was placed on the center of the mitral valve at the level of the mitral annulus, in the apical 4-chamber view. the sampling window was positioned as parallel as possible to the longitudinal axis of the left ventricle. the tdi echocardiography was performed using a transducer frequency of 3.5 to 4.0 mhz, adjusting the spectral pulsed doppler signal filters to obtain the nyquist limit of 15 cm / s to 20 cm / s with the optimal gain settings. the tdi sample volume for late diastolic mitral annular motion was placed at the lateral mitral annulus. all measurements were repeated 3 times and their average values were used for the analysis. the aemds were defined as the time interval (milliseconds, ms) from the atrial electrical depolarization to the initiation or peak of atrial mechanical contraction seen in the echocardiographic studies. the time intervals, from the initiation of p wave on surface ecg to the initiation and peak of late diastolic transmitral inflow on pwdi, were defined as aemdi and aemdp, respectively (fig. the time intervals, from the initiation of p wave on surface ecg to the initiation and peak of late diastolic lateral mitral annular motion on tdi, were defined as aemdim and aemdpm, respectively (fig. there was also a measurement of other conventional echocardiographic parameters : left ventricular ejection fraction, left ventricular end diastolic dimension, left ventricular mass index, left atrial volume index (lavi), peak trans - mitral inflow (mitral e and a) velocities on pwdi during diastole, as well as early diastolic lateral mitral annular motion velocity (mitral e ') on tdi. all echocardiographic measurements were performed by a well - trained and experienced sonographer who was blinded to each patient 's clinical information, furthermore, the data acquired were further confirmed by an echocardiologist. electrocardiographic parameters, including p wave duration, p wave amplitude, qrs duration, pr interval, and rr interval, were calculated in limb lead ii using a digital caliper of tracemaster viewer (philips electronics, andover, ma, usa). the presence of bundle branch block, pathologic q waves, abnormal st - segment elevation or depression, and t - wave inversion suggesting structural heart disease were evaluated using a standard 12-lead ecg acquired before the echocardiographic measurements. all electrocardiographic measurements were performed by a general cardiologist who was blinded to each patient 's clinical information, and the data acquired were further confirmed by an electrophysiologist. the data are presented as the mean valuesstandard deviation for continuous variables and as numbers with percentages for categorical variables. the differences between normally distributed continuous values were assessed by independent sample t - tests, whereas the proportional differences between categorical values were assessed by a chi - square test. the relationships between aemd values and electrocardiographic or echocardiographic parameters were assessed by pearson 's correlation and linear regression analysis. the discriminative values of the aemds for paf were identified using their receiver operating characteristic (roc) curves. all statistical comparisons were two - sided and p - values 55 mm), valvular heart disease (american college of cardiology / american heart association grade 2), any cardiomyopathy, coronary artery disease requiring interventional treatment, uncontrolled thyroid disease, advanced chronic kidney disease (estimated glomerular filtration rate 2.0 mg / dl), malignancy, chronic inflammatory or systemic connective tissue diseases, and the presence of moderate electrolyte imbalances. data for the healthy control group was extracted from the echocardiography registry of dong - a university medical center, busan, korea, and there was a screening of subjects who underwent echocardiography during health care examinations from 2010 to 2013. the excluded subjects from this study had documented atrial tachycardia, flutter, or fibrillation. the matched healthy controls were selected in a 1:2 ratio for those patients with available medical records, age, sex, a history of hypertension, and diabetes mellitus. age discrepancies of less than 5 years were allowed for patient - control age matching. the identical inclusion and exclusion criteria for the paf patient selection were used for the selection of the control subjects. the present study protocol was reviewed and approved by the internal review board of dong - a university hospital, busan, korea. echocardiography was performed using an ie33 ultrasound system and 2.5 mhz transducers (philips ultrasound, andover, ma, usa). the standard m - mode, 2d, and doppler echocardiography were routinely performed, in accordance with the recommendations of the american society of echocardiography.11)12) the ecg was recorded continuously during echocardiographic studies at a sweep speed of 100 mm / sec and the amplitude gain was set to 70%. the pwdi sample volume for late diastolic trans - mitral inflow velocity measurement was placed on the center of the mitral valve at the level of the mitral annulus, in the apical 4-chamber view. the sampling window was positioned as parallel as possible to the longitudinal axis of the left ventricle. the tdi echocardiography was performed using a transducer frequency of 3.5 to 4.0 mhz, adjusting the spectral pulsed doppler signal filters to obtain the nyquist limit of 15 cm / s to 20 cm / s with the optimal gain settings. the tdi sample volume for late diastolic mitral annular motion was placed at the lateral mitral annulus. all measurements were repeated 3 times and their average values were used for the analysis. the aemds were defined as the time interval (milliseconds, ms) from the atrial electrical depolarization to the initiation or peak of atrial mechanical contraction seen in the echocardiographic studies. the time intervals, from the initiation of p wave on surface ecg to the initiation and peak of late diastolic transmitral inflow on pwdi, were defined as aemdi and aemdp, respectively (fig. the time intervals, from the initiation of p wave on surface ecg to the initiation and peak of late diastolic lateral mitral annular motion on tdi, were defined as aemdim and aemdpm, respectively (fig. there was also a measurement of other conventional echocardiographic parameters : left ventricular ejection fraction, left ventricular end diastolic dimension, left ventricular mass index, left atrial volume index (lavi), peak trans - mitral inflow (mitral e and a) velocities on pwdi during diastole, as well as early diastolic lateral mitral annular motion velocity (mitral e ') on tdi. all echocardiographic measurements were performed by a well - trained and experienced sonographer who was blinded to each patient 's clinical information, furthermore, the data acquired were further confirmed by an echocardiologist. electrocardiographic parameters, including p wave duration, p wave amplitude, qrs duration, pr interval, and rr interval, were calculated in limb lead ii using a digital caliper of tracemaster viewer (philips electronics, andover, ma, usa). the presence of bundle branch block, pathologic q waves, abnormal st - segment elevation or depression, and t - wave inversion suggesting structural heart disease were evaluated using a standard 12-lead ecg acquired before the echocardiographic measurements. all electrocardiographic measurements were performed by a general cardiologist who was blinded to each patient 's clinical information, and the data acquired were further confirmed by an electrophysiologist. the data are presented as the mean valuesstandard deviation for continuous variables and as numbers with percentages for categorical variables. the differences between normally distributed continuous values were assessed by independent sample t - tests, whereas the proportional differences between categorical values were assessed by a chi - square test. the relationships between aemd values and electrocardiographic or echocardiographic parameters were assessed by pearson 's correlation and linear regression analysis. the discriminative values of the aemds for paf were identified using their receiver operating characteristic (roc) curves. all statistical comparisons were two - sided and p - values < 0.05 were regarded as statistically significant. case - control matching and all statistical analyses were conducted using statistical package for the social sciences version 20.0 (spss inc., was performed using medcalc (medcalc software company, brunswick, me, usa). among the 304 documented paf patients screened for the study, the following categories were excluded : 73 for underlying structural heart diseases or other significant medical conditions, 51 for e / a summation or ambiguous initiation of a wave, and 11 for ambiguous initiation of p waves ; and 42 patients had af, and 62 were taking drugs that could potentially influence intracardiac conduction at the time of echocardiographic measurements. furthermore, 130 matched healthy controls were then chosen, matched for age, sex, history of hypertension, and diabetes mellitus. the mean age of the study population was 5716 years and 117 subjects (60%) were male. there was no significant difference in the baseline clinical characteristics between the paf and control groups (table 1). the aemdi, aemdp, aemdim, and aemdpm measurements were consistently longer in the paf group (table 2), and the lavi and p wave amplitude values were higher. all 4 aemds were proven to be effective to discriminate the paf patients from controls (table 3). among the aemds, in discriminating the paf patients from the controls, a prolonged aemdi had a larger auc than the other aemds, lavi, and p wave amplitude. however, the aemdp, aemdim, and aemdpm measurements had aucs similar to those of lavi and p wave amplitude. the aemdi value of 64 ms had a sensitivity of 75% and specificity of 86% for the discrimination of patients with paf from the controls. there were weak correlations between the aemdi and lavi (r=0.311, p<0.001), and the p wave amplitude (r=0.088, p=0.227). the prolonged aemdi was not explained by lavi (r=0.011, p=0.140) or p wave amplitude (r=0.08, p=0.227) in linear regression analyses. among the 304 documented paf patients screened for the study, the following categories were excluded : 73 for underlying structural heart diseases or other significant medical conditions, 51 for e / a summation or ambiguous initiation of a wave, and 11 for ambiguous initiation of p waves ; and 42 patients had af, and 62 were taking drugs that could potentially influence intracardiac conduction at the time of echocardiographic measurements. furthermore, 130 matched healthy controls were then chosen, matched for age, sex, history of hypertension, and diabetes mellitus. the mean age of the study population was 5716 years and 117 subjects (60%) were male. there was no significant difference in the baseline clinical characteristics between the paf and control groups (table 1). the aemdi, aemdp, aemdim, and aemdpm measurements were consistently longer in the paf group (table 2), and the lavi and p wave amplitude values were higher. all 4 aemds were proven to be effective to discriminate the paf patients from controls (table 3). among the aemds, in discriminating the paf patients from the controls, a prolonged aemdi had a larger auc than the other aemds, lavi, and p wave amplitude. however, the aemdp, aemdim, and aemdpm measurements had aucs similar to those of lavi and p wave amplitude. the aemdi value of 64 ms had a sensitivity of 75% and specificity of 86% for the discrimination of patients with paf from the controls. there were weak correlations between the aemdi and lavi (r=0.311, p<0.001), and the p wave amplitude (r=0.088, p=0.227). the prolonged aemdi was not explained by lavi (r=0.011, p=0.140) or p wave amplitude (r=0.08, p=0.227) in linear regression analyses. previous studies have attempted to predict the occurrence of paf using various electrocardiographic or echocardiographic parameters, including p wave morphology on surface ecg, p wave - triggered signal - averaged ecg, and left atrial size and function.5)13)14)15)16) several aemds using a number of different definitions have also been tested to discriminate paf patients from healthy controls, or predict the occurrence of paf using m - mode tdi,1) aemdp,5)7) aemdim2)4)8), and aemdpm.3)6)9)10) the aemdp has been shown to be effective for discriminating patients with paf from controls with sensitivity of 78%-81% and specificity of 71%-78%.5)7) the aemdim and aemdpm have also been shown to be effective in predicting the occurrence of new onset af or the recurrence of af after coronary artery bypass surgery, radiofrequency catheter ablation, and electrical cardioversion.6)7)8)9)10) in this study, we measured the 4 aemds, each of which has been tested in other studies, except for aemdi, with different definitions to determine which aemd is the best discriminator for paf. for measurements of the aemds using tdi, the tdi sample volume was placed at the lateral mitral annulus, because previous studies have shown good discriminative or predictive values for paf when late diastolic atrial motion velocity is measured at this location.2)3)4)6)8)9)10) the aemds are known to be influenced by cardiac and non - cardiac factors. previous studies have revealed a significant prolongation of aemds in various cardiac and non - cardiac conditions including hypertension,17) valvular heart disease,17) cardiomyopathy,18) atrial septal defect,19) type i diabetes mellitus,20) obstructive sleep apnea,21) connective tissue diseases affecting the atrial myocardium,22)23) acute alcohol consumption,24) hypothyroidism,25) and other conditions. in this study, we attempted to evaluate the true discriminative value of prolonged aemd for paf by excluding patients and controls with potential confounding factors, including structural heart disease, cardioactive drugs, electrolyte imbalances, and other significant medical conditions. strict patient - control matching, for age, sex, history of hypertension and diabetes mellitus, was also incorporated to minimize potential influences. similar to previous study results, all the 4 aemds of different definitions were proven to be effective to discriminate the paf patients from the controls (table 3). among the 4 aemds, the aemdi value of 64 ms had a sensitivity of 75% and a specificity of 86%, which were comparable to previous study results. the aemdi was not evaluated in previous studies, possibly because of technical issues. in clinical practice, it is often impossible to measure the aemdi because of technical issues. however, if the aemdi is technically measurable, the prolonged aemdi may be a better discriminator than the other aemds for paf. although aemdp, aemdim, and aemdpm have been shown to be discriminators or predictors for paf in previous studies, most of the studies did not postulate whether aemds were superior to conventional risk factors for paf, such as left atrial chamber size. the results, of this study, show that the aemdp, aemdim, and aemdpm measurements were no better than the lavi and p wave amplitude approaches. it is not certain why the aemdi is superior to the lavi and p wave amplitude. the prolonged aemdi may actually reflect left atrial remodeling, which is a complex process consisting of anatomic and electrophysiologic changes. previous electrophysiologic studies already reported that prolonged aemds can reflect mechanical and electrophysiologic remodeling of the left atrium.7)10) intra - atrial conduction delay, resulting from left atrial remodeling, may prolong the coupling interval between atrial electrical depolarization and mechanical contraction. the difference in aucs between aemdi and lavi or p wave amplitude may reflect, at least in part, the proportion of left atrial anatomic and electrophysiologic remodeling that can not be measured by left atrial chamber size or p wave morphology alone. that hypothesis may be supported by results of this study, which showed a weak relationship between the aemdi and lavi or p wave amplitude. first, this is a relatively small case - controlled study involving a limited number of paf patients. because subjects with unsuitable echocardiographic images or potential confounding factors were excluded with strict patient - control matching performed for major clinical variables, the study results should be interpreted cautiously, bearing in mind the risk of patient selection bias. second, the burden of paf itself was not considered. the frequency and duration of paf episodes could not be quantified using a predefined electrocardiographic evaluation schedule and patients with at least a single episode of documented paf were included for analysis according to the initial study plan. the probable burden of paf could vary among the patients, and hence the degree of left atrial remodeling could be heterogeneous. the cut - off values for aemdi should be adjusted accordingly in further studies. third, the recovery time from atrial stunning after spontaneous cardioversion was not taken into consideration. the echocardiographic measurements were performed during normal sinus rhythm after spontaneous cardioversion, however, the time interval could not be evaluated from the electrocardiographic diagnosis to the echocardiographic measurement. thus, this study can not exclude the possibility of incorrect measurements of aemds because of early echocardiographic measurements before complete recovery from atrial stunning. fourth, although medical records were meticulously reviewed, this study can not exclude the possibility that subjects in the healthy control group could have had asymptomatic atrial arrhythmias or other medical confounders. fifth, although the aemdi was better discriminator, it is not always possible to measure the aemdi in clinical practice, possibly because of technical issues. in addition, many patients with suspected paf will already be receiving cardioactive drugs or have coexistent medical conditions, which potentially influence the aemdi at the time of echocardiographic measurements. although modern diagnostic technology is developing rapidly, paf diagnosis still relies on electrocardiographic studies. hence, the measurements of aemds during normal sinus rhythm may give more exact information for the presence of left atrial remodeling, in addition to conventional electrocardiographic and echocardiographic parameters such as the lavi and p wave amplitude. prolonged aemd analysis, in combination with typical history and suspicious electrocardiographic abnormalities, may help clinicians in making presumptive diagnoses and give guidance to perform regular electrocardiographic follow - up in order to confirm the diagnosis. in conclusion, all the 4 aemds were proven to be effective to discriminate paf patients from controls who were matched for age, sex, history of hypertension, and diabetes mellitus. among the 4 aemds, the prolonged aemdi was better discriminator than the other aemds, lavi, and p wave amplitude. however, the aemdp, aemdim, and aemdpm measurements were no better than the lavi and p wave amplitude in discrimination of the paf patients from the controls. in conclusion, all the 4 aemds were proven to be effective to discriminate paf patients from controls who were matched for age, sex, history of hypertension, and diabetes mellitus. among the 4 aemds, the prolonged aemdi was better discriminator than the other aemds, lavi, and p wave amplitude. however, the aemdp, aemdim, and aemdpm measurements were no better than the lavi and p wave amplitude in discrimination of the paf patients from the controls. | background and objectivesprevious studies have evaluated atrial electromechanical delays (aemds) with a number of different definitions to discriminate patients with paroxysmal atrial fibrillation (paf) from controls without paf. however, their discriminative values for paf have not previously been directly compared.subjects and methodsa total of 65 paf patients and 130 control subjects matched for age, sex, history of hypertension, and diabetes mellitus were selected. the aemdi and aemdp were defined as the time intervals from the initiation of the p wave on the surface electrocardiogram to the initiation and peak of the late diastolic transmitral inflow on pulsed wave doppler images, respectively. the aemdim and aemdpm were defined as the time intervals from the initiation of the p wave on the surface electrocardiogram to the initiation and peak of the late diastolic lateral mitral annular motion on tissue doppler images, respectively.resultsthere were no significant differences in the clinical characteristics between the two groups. all 4 aemds were consistently longer in the paf group, and proven effective to differentiate the paf patients from the controls. the aemdi measurement had a larger area under the curve (auc) than the other aemds, left atrial volume index, and p wave amplitude. however, the aemdp, aemdim, and aemdpm measurements had aucs similar to those of the left atrial volume index and p wave amplitude.conclusionthe findings suggest that the aemdi is better than the other aemds for the discrimination of paf patients from the controls. |
we report the case of a 58-year - old woman with intracranial hemorrhage associated with stress - induced cardiomyopathy. left ventricular dysfunction was confined to midventricular segments, and manifested with transient anterolateral wall aneurysm. although wall motion was severely impaired in the mid - segments, an almost preserved global midventricular radial strain forecasted rapid improvement of ventricular function. this case highlights how deformation imaging can help in clinical practice to interpret the subtle signs of recovery from left ventricular dysfunction. a 58-year - old woman was admitted one year ago to the neurointensive care unit of our hospital for sudden onset of intracerebral and subarachnoid hemorrhage of the right frontal lobe. she had a history of tobacco use and moderate alcohol abuse, hypertension and chronic obstructive pulmonary disease. her surgical history included left lumpectomy for breast cancer, amputation of the third finger on the right hand and jaw surgery a few years ago. at admission her vital signs were within the normal range : blood pressure 140/87 mmhg, heart rate 71 beats per minute (bpm), respiratory rate 20 breaths per minute and oxygen saturation on ventilator 100%. the electrocardiogram (ecg) at admission showed normal sinus rhythm (60 bpm) and possible septal necrosis. right craniotomy for evacuation of the hemorrhage and clipping of right middle cerebral artery aneurysm were performed. troponin i levels showed a slight increase from 0.33 to 3.55 ng / ml during the first two days, and then decreased to 1.96 ng / ml on the third day postsurgery, and similar variations were seen for the levels of creatine kinase - mb fraction (from 4.0 to 11.5 to 4.3 ecg on the second day showed deep negative t waves in almost all leads with prolonged qtc interval [figure 1 ]. due to abnormal myocardial necrosis markers and ecg, a two - dimensional (2d) transthoracic echocardiogram was ordered, and revealed a normal left ventricular cavity size with hyperdynamic basal motion, akinesis of midventricular segments and nearly normal apical motion [figure 2 ]. left ventricular global systolic function was moderately decreased with left ventricular ejection fraction at 35% (normal values > 55%). electrocardiogram on second day post - right craniotomy for evacuation of hemorrhage and clipping of right middle cerebral artery aneurysm showing deep negative t waves in almost all leads with prolonged qtc interval (580 ms) two - dimensional transthoracic echocardiography in the apical four - chamber view showing the left ventricle a) at end diastole and b) mid - systole. basal and apical segments contract well in contrast to midventricular segments the next day, the patient underwent coronary angiography, which ruled out any coronary artery disease. however, the ventriculogram surprisingly revealed an aneurysmatic anterior wall [figure 3 ], which then was characterized by another transthoracic echocardiogram as an anteroseptal wall aneurysm with near - normal motion of the other segments [figure 4 ]. global radial strain was calculated and, despite seriously compromised midventricular anteroseptal motion, midventricular - averaged radial strain was at the lower end of normal range (i.e. 16%). left ventriculogram showing systolic anterior wall aneurysm two - dimensional transthoracic echocardiography in the apical long - axis view showing anteroseptal wall aneurysm with nearly normal motion of the other segments in a) end diastole and b) mid - systole as predicted by the global radial strain in the previous examination, another transthoracic echocardiogram performed three weeks later documented the complete resolution of wall motion abnormalities [figure 5a and b ], with completely normal radial strain values [figure 5c ]. two - dimensional (2d) transthoracic echocardiogram in the apical long - axis view showing complete resolution of wall motion abnormalities at a) end diastole and b) mid - systole. on the left, a short - axis view of the mid - left ventricle is shown, and a 2d speckle tracking technique is used to obtain the curves representing radial deformation of each wall segment (right). the averaged global strain is 57% (represented by white curve) isolated left ventricular midventricular dyskinesia is a rare variant of stress - induced cardiomyopathy, although it has been described in association with cerebral injuries. left ventricular mechanics in stress - induced cardiomyopathy have not been well defined, although some data about the longitudinal and radial strain are available. our case highlights the importance of global radial strain as a predictor of myocardial wall motion improvement, even when 2d transthoracic echocardiogram did not forecast the improvement. | introduction : we report the case of a 58-year - old woman with intracranial hemorrhage associated with stress - induced cardiomyopathy.results:left ventricular dysfunction was confined to midventricular segments, and manifested with transient anterolateral wall aneurysm. although wall motion was severely impaired in the mid - segments, an almost preserved global midventricular radial strain forecasted rapid improvement of ventricular function.conclusions:this case highlights how deformation imaging can help in clinical practice to interpret the subtle signs of recovery from left ventricular dysfunction. |
aids - related stigma is formed in social environment. the circumstances in which the patients live l.is likely to internalize the stigmatized attitude in them. according to unaids (2000), in the developing world, the stigma and discrimination is a social and cultural phenomenon which is associated with interaction of all groups of people rather than the consequence of the patients behavior. this disease is incomprehensible and unacceptable by general population due to false beliefs and lack of information, and is associated with a negative viewpoint and a discriminatory thought even by medical care providers. the reason for this rampant discrimination is the relation of aids to sexual behavior and intravenous drug abuse, making negative label broadly conceivable for the disease. according to research talking about hiv / aids is associated with low levels of stigma, but as long as stigmatized attitude prevail and people do nt want to talk about their illness, stigmatized attitudes will continue. therefore, it is recommended to discuss about aids in order to reduce gender roles and stigmatization. the national experience of many countries, particularly the united states of america as the main origin of hiv and aids, and epidemic population movements from rich to poor countries show that, in fact, poor social levels are at a higher risk to suffer from this disease due to economic - cultural poverty, intensified structural pressures, and ultimately less chance of a positive life style away from risky behaviors. in this context, improper attitude of health personnel as people who are in touch with people can impose more pressure on patients. studies show that fear of disclosure of hiv due to stigma is the main obstacle for seeking care, resulting in lack of access to minimum care and support. aids - related stigma can have negative impact on medication adherence and use of health services, and for health professionals and patients, it is a significant obstacle in the treatment course and services and its postponing. in addition, internal stigma, negative self - image, and public perceived attitudes and stigma lead the patients to hide the disease, their depression, and suffering a low quality of life. according to previous findings, an average level of discriminatory attitudes exists among health care workers in many studies. factors associated with high levels of these attitudes among employees include high levels of irrational fear of hiv / aids, working in educational hospitals versus non - educational and medical diagnostic centers, low level of education, and being male gender. studies show that a significant relationship exists between hiv - related individual discriminatory attitudes and perceived institutional support and discrimination in the health care systems. also, lack of sufficient employees knowledge of the health sector, fear of communication due to imperfect knowledge about the routes of transmission, and believing that hiv is associated with unethical behaviors are three main reasons of hiv - related stigma in the health system. inadequate knowledge of health care professionals of transmission routes results in an inappropriate fear of transmission which will be followed by stigmatized attitude and discriminatory behavior. therefore, medical care professionals need to be alert about prevalent stigma and misinformation of the disease, and understand the negative effects of these factors on hiv patients living in the society. since stigma and discrimination is an obstacle to treatment and care and fear of health care providers due to stigmatized attitude often prevents the patients from referral to medical centers, in this research, we attempted to understand how much the viewpoints and behaviors of health care providers are associated with stigma and discrimination and how much they affect provision of services to patients. the study population consisted of all medical personnel of public and private hospitals in shiraz, providing health services for patients, including doctors, nurses, technicians, and laboratory staff, etc. eight hospitals were randomly selected from a list of private and public hospitals provided by research deputy of shiraz university of medical sciences using simple random sampling method. for this purpose, the name of each hospital was written on a piece of paper, put them into a box and 8 pieces were drown randomly. participants were selected randomly, according to the personnel lists existing in the hospitals wards. this obliged the researcher to frequently visit the respondents and in case of lack of response, new subjects were substituted. the sample size for estimation of any proportion with 6% precision was estimated 529 participants, using the following formula : n=(z1-b+za)p1(1-p1)/d =0.05, 1-=0.8, p=0.5, d=0.06 to reduce the error, we increased the completed questionnaire to 575. given the lack of a standard questionnaire to meet the objectives of this study, a questionnaire was designed and used as a tool for measuring and collection of data after reviewing the items of several questionnaires, the reliability and validity of which were measured in other communities. for measuring the knowledge of the personnel about transmission routes, a cut off point less than 25.6 was considered as low, 25.6 - 40.2 moderate and 40.2 - 55 as high level of knowledge. to evaluate stigma and discrimination, 12 items (four - choice question) were asked. the range of total score was 12 to 48, so that scores of 12 - 22.6, 22.6 - 33.26 and 33.26 - 44 were labeled as low, moderate and high, respectively. in the other section of the questionnaire, there were 5 items for stigmatized attitude of the society from the viewpoint of the participants, and 13 items for religious and spiritual beliefs, all assessed using 5-point likert scale. the range of total score of religious beliefs of the participants was 11 to 55. preference of health care providers to provide services was evaluated in three patient groups of injectors, prostitutes, and homosexuals, each measured on a likert scale, the reason for preference to provide services was evaluated in each group in terms of four causes. in addition, the employees behavior with patients and the information resources about aids were also questioned. to ensure the validity of the selected items, the viewpoints of experts and specialists were asked and after localization, the items were pretested on 60 subjects of the population. the amount of alpha was 0.74, 0.87, 0.50, and 0.77 for the scales of personal stigmatized attitude, social stigmatized attitude, knowledge, and the level of spiritual beliefs, respectively, which were acceptable given the sample size in pretest. as a check on face validity, the surveyed items are sent to experts to obtain suggestions for modification. there was an attempt to select items that are based on common sense, are persuasive and seem right to the readers. the data were analyzed using statistical package for the social sciences, version 21, and the results were described through descriptive statistics such as frequency distribution tables, comparison of the means to determine the relationships, and multiple regression test with correlation coefficient at the level of 0.05. this study was approved by the ethics committee of shiraz university of medical sciences (approved number : 92 - 01 - 59 - 6600). given the lack of a standard questionnaire to meet the objectives of this study, a questionnaire was designed and used as a tool for measuring and collection of data after reviewing the items of several questionnaires, the reliability and validity of which were measured in other communities. for measuring the knowledge of the personnel about transmission routes, a cut off point less than 25.6 was considered as low, 25.6 - 40.2 moderate and 40.2 - 55 as high level of knowledge. to evaluate stigma and discrimination, 12 items (four - choice question) were asked. the range of total score was 12 to 48, so that scores of 12 - 22.6, 22.6 - 33.26 and 33.26 - 44 were labeled as low, moderate and high, respectively. in the other section of the questionnaire, there were 5 items for stigmatized attitude of the society from the viewpoint of the participants, and 13 items for religious and spiritual beliefs, all assessed using 5-point likert scale. the range of total score of religious beliefs of the participants was 11 to 55. preference of health care providers to provide services was evaluated in three patient groups of injectors, prostitutes, and homosexuals, each measured on a likert scale, the reason for preference to provide services was evaluated in each group in terms of four causes. in addition, the employees behavior with patients and the information resources about aids were also questioned. to ensure the validity of the selected items, the viewpoints of experts and specialists were asked and the amount of alpha was 0.74, 0.87, 0.50, and 0.77 for the scales of personal stigmatized attitude, social stigmatized attitude, knowledge, and the level of spiritual beliefs, respectively, which were acceptable given the sample size in pretest. as a check on face validity, the surveyed items are sent to experts to obtain suggestions for modification. there was an attempt to select items that are based on common sense, are persuasive and seem right to the readers. the data were analyzed using statistical package for the social sciences, version 21, and the results were described through descriptive statistics such as frequency distribution tables, comparison of the means to determine the relationships, and multiple regression test with correlation coefficient at the level of 0.05. this study was approved by the ethics committee of shiraz university of medical sciences (approved number : 92 - 01 - 59 - 6600). the mean age of the participants was 32.98.27 years ; 71.7% of them were female, 28.3% male ; 41% were single, 57.4% married, and 1.4% divorced or widowed. also, 7.8% had diploma, 18.3% associate degree, 57.5% bachelor, 8.8% master, and 7.6% doctorate or higher. 1.8% of them were general practitioner and specialists, 31.9% nurses, 12.3% health workers, 23.8% laboratory technicians and experts, 5% midwives, 3.6% aestheticians and operating room nurses, and 15.3% of other occupational groups engaged in delivery of services. of the total respondents, 44.85% were working in private hospitals and 55.15% in government hospitals. regarding the sources of information about aids, the majority of respondents had used more than one source ; 54% have mentioned mass media, 65.6% textbooks, 27.3% non - academic books, and 33.9% training as their source of information. although the prevalence of stigmatized attitude was moderate in the majority of respondents (53.2%), all personnel had stigmatized attitude (table 1). stigmatized attitude and knowledge of the personnel the respondents who had an experience of plwha were asked to express their behavior ; only 45.5% stated that their attitude was normal with patients, while other respondents had a discriminatory feeling ; 42.42% of the subjects had a state of fear, 16.45% refused reception, 15.42% disgusted them, and 8.74% experienced anger. the most dominant attitude of the health care providers toward hiv / aids patients was dealing with fear. the results in table 2 show that 35.9% of the personnel disagreed with providing services to the hiv / aids patients infected through injection. almost half of the respondents were willing to provide services and the other half were opposed to provide services to this group of patients. 70.5% of the respondents mentioned that their unwillingness to provide services was due to exposure to the disease, followed by the patients engagement in unethical behavior (65.6%) was the reason. 39.6% and 46.2% of the respondents preferred not to provide services to the prostitutes and homosexual patients, respectively, and the majority of the subjects stated that prostitutes and homosexuals are involved in immoral behavior (83.1% and 84.2%, respectively) (table 2). the frequency distribution of the personnel s responses to the preference of service delivery in separate groups of patients represents the highest percent according to table 3, as a result of regression test, a significant relationship existed between stigmatized attitude of the personnel and willingness to provide services to the prostitute, drug injector, and homosexual patients (p<0.05). increased stigmatized attitude of the personnel is associated with increased unwillingness to provide services to the patients. among the three target groups, stigmatized attitude toward the prostitute patients explained 41% of the variations of unwillingness to provide health services. with a slight difference, the explanation was 39.1% and 38.1% in drug injectors and homosexuals, respectively (table 3). stigmatized attitude of the personnel and their unwillingness to provide health services to the patients according to table 4, there was a significant relationship between stigmatized attitude of the health care providers and their religious beliefs, society stigmatized attitude, and knowledge of transmission routes. knowledge of transmission routes is inversely related to the level of stigmatized attitude and it is expected that the individual s stigmatized attitude decreases with increased knowledge of transmission routes (p<0.05) (table 4). the relationship between religion, knowledge, and the present study aimed at assessing the prevalence of stigmatized attitude and discrimination in healthcare providers toward plwha. the results obtained from the analysis of the questionnaires completed by 575 participants from public and private hospitals and medical centers in shiraz showed that all personnel had a degree of stigmatized attitude toward aids patients. the level of stigmatized attitude was low to moderate in the majority of the respondents, and more than two - thirds of the personnel had a moderate level of knowledge about aids. the results of similar studies in bangladesh and iran also indicated that there was a moderate level of knowledge among hospital personnel. however, universality of stigmatized attitude among the study sample necessitates effective notifications about patients with hiv and the rout of infection. the findings did not show a significant difference between the personnel working in public and private hospitals in terms of stigmatized attitude and, revealing that this viewpoint existed in health care providers in all hospitals. the results of stigmatized attitude scale showed that all service providers had a stigmatized attitude along with discrimination. among the personnel who had an experience to deal with people with hiv / aids during their delivery of service, 45.5% had a normal behavior with plwha, while others had demonstrated states of discriminatory reactions or stigmatized attitude, i.e. states such as fear, anger, disgust, and refusal to accept. meanwhile, dealing with fear was the most dominant state that health care providers had in contact with patients with hiv / aids. previous findings also confirm the fact that high levels of irrational fear of hiv and aids is a related factor in high levels of stigmatized attitude among employees. based on the stigmatized attitude scale, it seems that the vision of the respondents about their behavior was slightly away from the level of their stigmatized attitude. this difference between the mind and action is probably due to the responsibility of the personnel to provide health services to the patients, despite the stigmatized attitude associated with discrimination in some of them. stigmatized attitude of the health professionals as one of the key personnel in dealing with plwha may result in undesirable consequences, such as dealing with fear, disgust, anger, and in some cases refusal to accept the patients. such discriminatory treatment and inequality of personnel dealing with people with hiv versus other patients can affect the service delivered by the personnel and may deprive the patients from their minimum health rights. therefore, decreasing the personnel s irrational fear is important to reduce their stigmatized attitude. perhaps this will improve the quality of services provided to patients on the one hand and their mental health on the other hand. the willingness of health personnel of hospitals to provide health services to the patients was assessed in this study. about a third of the personnel disagreed with service delivery to hiv / aids patients infected through injection. in a general overview, almost half of the respondents tended to deliver services and the other half were opposed to provide services to these people. most of the respondents stated that the reason for unwillingness to provide services was exposure to the disease and involvement of these patients in unethical behavior. a majority of the respondents preferred not to provide health services to prostitutes and homosexual patients and the majority of them stated it is due to their involvement in unethical behavior. this emphasizes the stigmatized attitude of the respondents, and perhaps the willingness to provide services to prostitutes and homosexuals was lower than that of injectors. comparison of the causes of unethical behavior indicated that prostitutes and homosexual patients are the reasons for reluctance of the personnel to provide health services. so, in the religious context of iran, the transmission routes of hiv explained the majority of the variations of unwillingness to provide health services. other factors that may affect the variance can be fear of infection, fear of being attributed to this group and engagement in unethical behavior. are not in the same line with the findings of this study indicating that high risk behaviors of the patients are associated with higher stigmatized attitude. the study of behravan. also confirms this fact that the tag of aids is associated with high risk behaviors such as promiscuity in sexual and moral affairs, homosexuality, and drug abuse. the results of univariate regression analysis showed a relationship between stigmatized attitude of health care providers and providing services to patients. previous studies have also confirmed the fact that aids - related stigma serves as an obstacle against provision of services, and that stigmatized attitude leads to a reduction in targeted interventions among health professionals. univariate regression also indicated the relationship of health care providers stigmatized attitude with their religious beliefs, stigmatized attitude of the society, and knowledge about the transmission routes. increased religious belief direct relationship between religious beliefs and the personnel stigmatized attitude seems logical and it is likely due to more prominent role of guilt and knowing the people involved in immoral behavior. stigmatized view of the society is directly related to stigmatized attitude. in other words, increased stigmatized attitude of the society is associated with increased stigmatized attitude of the personnel. knowledge of transmission routes is inversely related to the level of stigmatized attitude and it is expected that increased knowledge of transmission routes can result in reduced stigmatized attitude of the person. it shows that only knowledge of transmission routes has a significant role in reducing stigmatized attitude. the limitations of this study were the problem of completing the questionnaire due to the sensitive nature of the job of the studied groups and lack of their time, as well as the difficulty of cooperation of the health providers with higher education levels given the prevalence of fear as the most common behavior of the personnel in dealing with the patients, increased knowledge can be an effective step in reducing stigmatized attitude toward patients. this not only reduces inappropriate fear of dealing with patients, but also decreases hiv - associated stigmatized attitude. modified attitude toward aids patients given the dominant role of religion in countries like iran, stigmatized attitude toward aids is associated with unethical behaviors. thus, the role of the clergymen in eliminating aids taboo may be very impressive. taboo of the disease and the unequal social behavior with the patients not only do not solve the problem, but may result in patients isolation and their deprivation from their minimum rights of treatment. | background : despite the success of developed countries in preventing the spread of hiv / aids, the disease is expanding in developing countries where an unfavorable attitude exists among people, health professionals and employees. this study aimed to assess the stigmatized attitude among health care providers toward people living with hiv (plwha).methods : the study is a cross - sectional survey. the data were gathered using a structured questionnaire. the study sample included 575 health care providers of public and private hospitals in shiraz. the data were gathered using a structured questionnaire in spring 2014. data analysis was carried out using the statistical package for social sciences, version 21.results:the most dominant attitude of the health care providers toward hiv / aids patients was related to fear (42.42%). according to the results of this study, there was a significant relationship between stigmatized attitude of the health care providers and their religious beliefs, society stigmatized attitude, and knowledge of transmission routes. the relationship between social stigmatized attitude of health care providers and their knowledge of transmission routes, with their willingness to provide services to patients is significant, as well (p<0.05). 39.6% and 46.2% of the respondents preferred not to provide services to the prostitutes and homosexual patients.conclusion:fear of contamination and social stigmatized attitude are the main impediments to dealing with patients and providing services to them. hence, it seems that creating an effective knowledge about transmission and correcting the socio - cultural beliefs of health providers are two key strategies to tackle this problem. |
a 67-year - old male patient had undergone esophagectomy and intrathoracic esophagogastrostomy for carcinoma of the lower thoracic esophagus 27 months earlier. the original pathologic condition was determined to be moderately differentiated squamous cell carcinoma invading the lamina propria without lymph node metastasis (clinical t1bn0m0). he had undergone follow - up chest computed tomograph and esophagogastroduodenoscopy once or twice a year and a gastric carcinoma at the intra - abdominal part of the gastric conduit was found. the tumor was a 2a+2c type lesion and located in the posterior wall of the antrum. because of its morphology (flat and depressed type with ulceration), size (more than 10 mm) and poor localization, endoscopic mucosal resection or partial gastric resection was not suitable (fig. 1), so we decided to perform a total resection of the gastric conduit. the whole procedures were performed in 3 stages : first thoracic, second abdominal, and third thoracic and abdominal approaches. because of previous intrathoracic esophagogastrostomy, it was necessary to check the intrathoracic condition and operability. the esophago - gastric anastomosis was located at the upper part of the paratracheal area (figs. 2, 3). after dissecting the adhesions between the pleura, lung, and gastric conduit with blunt and sharp procedures, we resected the gastric conduit at the level of the previous anastomosis. the intrathoracic portion of the esophagus was about 4 cm segment long, so we saved it as long as possible and inserted the 28 mm anvil into it. the antral portion of the stomach was adhered to the diaphragm, liver, and surrounding structures. the length and vasculatures of the transverse and descending colon were considered to be suitable for an esophageal conduit. the left side of the colon with a pedicle of the left colic artery was prepared for esophageal reconstruction. the proximal sigmoid colon was connected (end to side) to the proximal part of the transverse colon with a 28 mm end - to - end anastomosis (eea) stapler. after the left - sided colon conduit into the thoracic cavity in the isoperistaltic manner, esophago - colonostomy was done with a 28 mm eea stapler. the distal part of the colon conduit was anastomosed at the side of the proximal jejunum with a 25 mm stapler in the manner of roux - en - y anastomosis. on the 10th postoperative day, an esophagogram showed no leakage or stenosis of the passage (fig. the patient has received follow - up care for 7 months after surgery without any problems. after warren and gates reported on it in 1932, the concept of multiple primary malignancies has been accepted widely and is supported by hypothesis of field cancerization. synchronous or metachronous multiple primary malignancies in esophageal cancer have since been reported with a frequency of about 10%. gastric conduit cancer is not only cancer arising in the remnant gastric conduit but also the second primary cancer following esophageal cancer. the incidence of gastric conduit cancer has been reported to be 0.2%-3.5% [2 - 4 ]. although the etiology of the secondary carcinoma in the gastric conduit is not well known, gastric conduit cancer has been reported increasingly because of survival prolongation of esophageal cancer patients after surgery. in our hospital, we have annually operated on about 30 esophageal cancer patients with gastric conduit and this surgical management of gastric conduit cancer was our first experience. because thoracotomy with adhesiolysis is necessary for performing a reoperation, total resection of the gastric conduit reconstructed via the posterior mediastinal route is very difficult. in addition, it is more invasive because it requires reconstruction with another organ such as the colon, jejunum, or skin, for the conduit. therefore, it is important to detect the lesion at an early stage so as to treat it with minimally invasive surgery such as endoscopic mucosal resection or partial resection. therefore, careful, periodic endoscopic evaluation after operation in the patient with esophageal cancer is needed. we had performed annual esophagogastoduodenoscopy evaluation and other radiologic studies twice in a year. in conclusion, a careful, periodic, and endoscopic evaluation after surgery for esophageal cancer is needed for early detection of other primary malignancies. in addition, surgical treatment of gastric conduit cancer after esophageal cancer surgery was found to be possible and safe in our experience. | we report a very rare case of surgery on gastric conduit cancer. a 67-year - old male patient underwent esophagectomy and intrathoracic esophagogastrostomy for squamous cell carcinoma of the lower thoracic esophagus 27 months ago. upon follow - up, a gastric carcinoma at the intra - abdominal part of the gastric conduit was found on an esophagogastroduodenoscopy. we performed total gastrectomy and esophagocolonojejunostomy in the manner of roux - en - y anastomosis. the postoperative course was not eventful and an esophagogram on the 10th postoperative day showed no leakage or stenosis of the passage. the patient was discharged on the 17th day with no complications. |
a 25-year - old female patient who earlier had implant placement in relation to 46 and 47 reported to our department for second stage surgery. 1994, in which the attached mucosa at the top of the ridge is moved in a buccal direction at second stage surgery to obtain a papilla like formation and increased bulk of tissue around implants. the following steps are involved in this technique.([figure 1]-schematic representation) technique (hand drawn representation) identify the location of the cover screws through the covering mucosa [figure 2 ] make an incision at the palatal / lingual aspect of the cover screws, followed by vertical releasing incisions in the buccal direction. it is important to preserve the gingival cuff at neighboring teeth [figure 3 ] elevate a full thickness flap in the buccal directionremove the cover screwsselect proper abutments and connect them to the fixtures [figure 4 ] make semilunar bevel incisions in the buccal flap toward each abutment. start at the distal aspect of the most mesially located implant [figure 5 ] disengage the pedicle, and then rotate it 90 in the palatal direction to fill in the inter - implant space [figure 5 ] suture the tissues, allowing no tension within the pedicles [figure 6 ]. identify the location of the cover screws through the covering mucosa [figure 2 ] make an incision at the palatal / lingual aspect of the cover screws, followed by vertical releasing incisions in the buccal direction. it is important to preserve the gingival cuff at neighboring teeth [figure 3 ] elevate a full thickness flap in the buccal direction remove the cover screws select proper abutments and connect them to the fixtures [figure 4 ] make semilunar bevel incisions in the buccal flap toward each abutment. start at the distal aspect of the most mesially located implant [figure 5 ] disengage the pedicle, and then rotate it 90 in the palatal direction to fill in the inter - implant space [figure 5 ] suture the tissues, allowing no tension within the pedicles [figure 6 ]. the clinical significance of attached gingiva around implants include prevent spread of inflammationprevents recession of marginal tissueprovides tight collar around implantsenable patients to maintain good oral hygiene. prevent spread of inflammation prevents recession of marginal tissue provides tight collar around implants enable patients to maintain good oral hygiene. this technique answered the above requirements, and yet it is very simple and provided excellent papilla like formation around implants. the healing abutment should be in place for 2 weeks for the tissues to heal like papilla [figure 7 ]. healing after 2 weeks with healing abutments the patient was observed every 6 months, till 2 years. after 8 weeks, the final abutments were connected and noted that excellent soft tissue manipulation around implants created a perimucosal soft tissue contour matching the gingival architecture [figures 8 and 9 ]. this thickness of tissue / seal around implants was present even after 1-year follow - up and 2 years follow - up periods [figure 10 ]. postoperative restoration postoperative after 3 months two years postoperative mainly because of the thickness of mucosa obtained during the procedure, the patient was able to maintain the soft tissue around the implant with lesser plaque formation. moreover, a tight tissue barrier was created like natural dentition, which correlated well with the tissue barrier concept postulated by goldman and cohen. zone of gingiva would facilitate subgingival plaque formation because of improper pocket closure resulting from the movability of the marginal tissue. the absence of keratinized mucosa increases the susceptibility of peri - implant lesions and plaque - induced destruction. mehdi adibrad. reported that there is a significant influence of the width of keratinized mucosa on the health of the peri - implant tissues. the absence of adequate keratinized mucosa around implants supporting over dentures was associated with higher plaque accumulation, gingival inflammation, bleeding on probing, and mucosal recession. the thickness obtained with this technique resulting in less plaque accumulation and better maintenance correlated well with the studies reported above. in order to have better papilla like formation the following should be considered : careful handling of tissues in order to minimize trauma and maximize vascularizationbevel incisions in the mobile flaps should be delicate and should vary according to the needsrotated pedicles should be tension freesuturing technique should provide a tight and firm connection of pedicles to bone and abutments. careful handling of tissues in order to minimize trauma and maximize vascularization bevel incisions in the mobile flaps should be delicate and should vary according to the needs rotated pedicles should be tension free suturing technique should provide a tight and firm connection of pedicles to bone and abutments. it is imperative and proved by this case report that the operating surgeon should know the importance of papilla and attached mucosa around the implant. this case report was followed for 2 years and excellent prognosis obtained is very much evident [figure 11 ]. this technique is simple and effortless in providing esthetic papilla formation and protective attached mucosa around implants. | peri - implant plastic surgery aims at improving the esthetic aspects of smile and masticatory function. over the years, several techniques such as tissue punch technique, full thickness flaps, and scalloping adjustment of flaps around implants have been employed ; it was very difficult to achieve a papilla like formation around implants. these added time and expense of the final results and led to undesirable complications. in order to overcome these difficulties, this case report describes a surgical technique where in papilla like formation and increase in width of attached gingiva around implants can be achieved with a single surgical procedure. |
we sequenced 8 melanoma exomes to identify novel somatic mutations in metastatic melanoma. focusing on the map3k family, we found that 24% of melanoma cell lines have mutations in the protein - coding regions of either map3k5 or map3k9. structural modelling predicts that mutations in the kinase domain may affect the activity and regulation of map3k5/9 protein kinases. the position of the mutations and loss of heterozygosity of map3k5 and map3k9 in 85% and 67% of melanoma samples, respectively, together suggest that the mutations are likely inactivating. in vitro kinase assay shows reduction in kinase activity in map3k5 i780f and map3k9 w333x mutants. overexpression of map3k5 or map3k9 mutant in hek293 t cells reduces phosphorylation of downstream map kinases. attenuation of map3k9 function in melanoma cells using sirna leads to increased cell viability after temozolomide treatment, suggesting that decreased map3k pathway activity can lead to chemoresistance in melanoma. |
|
type 1 insulin - dependent diabetes is the most common endocrine and metabolic disorders during childhood and adolescence which greatly influences both the physical and emotional development of individuals and have some long term complications such as nephropathy, neuropathy and retinopathy. according to the latest figures, more than 246 million people around the world suffer from diabetes. the number of diabetic people around the world was between 151 to 171 million people in 2000, which will reach 366 million people till 2030. according to the annual report, there is a 2 to 5 percent of increase in europe, middle east and australia. the highest prevalence has been reported for finland (37 to 45 for every 100000 children under 15 years old). this figure is about 400 times as much as that in venezuela and china with the least prevalence (0.1 to 0.5 in every 100000 children). in the u.s.a, type 1 diabetes, even by the increase of type 2 diabetes, accounts for approximately two - thirds of diabetes new cases for under 19 year old patients. according to 2006 census, the population of iran reached 70 million people, of whom 15435355 people were 10 to 19 years old. the frequency and diagnosis of diabetes among iranians is 8.1 and 5.1% for males and 10 and 4.7% for females. according to statistics, one in every one thousand iranian adolescents chronic diseases cause some biological, psychological, cultural and social challenges and have strong impacts on quality of life, biology, psychosocial aspects of the patients, their family members and caregivers. if an event influences one of the members, it will also have effect on all other members inside that institution. having a depressed parent will double the risk for children. if both parents are depressed, it is four times as possible for children to have mood disorder as compared with children with healthy parents. parental emotional adaptation influences the parents of the affected child and will develop some emotional turbulences and psychological complications in them. accordingly, it is stated that whenever a child is affected by diabetes the related physician has to visit two patients. during acute diabetes, this special responsibility will increase stress and the family problems and lead to conflicts between the child and his / her parents. in addition, it will affect the mental health and both mental and behavioral performance of parents. the parents are often afraid of disease symptoms of which are sensibly exposed to others and this will result in their isolation and adding a feeling of loneliness to their depression. the parents are often experiencing shocks, depression, anger, anxiety, feelings of guilt and shame, disease denial and frustration. these stresses provide hindrances in the way of individual performance regarding social, physical, psychological and family areas. the psychological variations such as increased irritability, neurological state and inability to have self - control will result in chaotic family and social relations. nematpour and shahbazian mentioned a study conducted in saudi arabia by flimban. about the psychological aspects of mothers the research s results showed that 27.7 percent of these mothers suffer from the mental problems and the most problematic areas regarding mothers reported in this study included insomnia, emotional instability, fear, feeling of fatigue, inability to concentrate, depression and anxiety. besides, in another study conducted by koizumi entitled responses of japanese mothers to their children s diabetes diagnosis, the results showed that japanese mothers demonstrated feelings of shock, defense, isolation and the increased anxiety at the first stage of diabetes diagnoses and they also suffered from depression, weight loss, pain, feeling of fatigue. also, this study showed that some of its results were in contrast with the studies conducted for american mothers and this difference had been probably related to their own cultures. the parents affective responses influence on their efficiency to take care of their own child, and it plays a crucial role in metabolic monitoring of their child. in this respect, a study was conducted by berg. entitled monitoring and adaptability of parents over the diabetic children s metabolic control. the results showed that the adaptability level of parents with disease of child was best in cases where it was accompanied by metabolic control. however, the monitoring of the disease by the fathers had a better impact on the child s metabolic control than the ones performed by mothers. all parents were chosen after the diagnosis of insulin - dependent diabetes in their children by the endocrinologist and after admission to diabetes center of amin hospital of isfahan university of medical sciences. continuous convenient sampling was used to select 45 parents out of whom 10 people dropped out during the study. the symptom checklist-90 (scl-90) questionnaire with 9 different dimensions (physical complaints, obsession and compulsion, sensitivity in the interpersonal relationship, depression, anxiety, aggression, phobia, paranoid thoughts and psychosis) was given to parents in 5 different stages (immediately, one month, 3 months, 6 months, and 12 months after diagnosis). statistical tests of paired t - test, repeated measure, t - test, pearson s and spearman s correlation coefficients and one way anova were used to analyze the data. the questionnaire consists of two parts : 1-personal specifications2-affective reactions personal specifications the scl90 questions consists of 5 level likert style of emotional discomfort ranging from score zero for null to four for severely. 1- parents with only one child with type 1 diabetes, who is not affected by any other chronic diseases. 2- there is no recent stress (death, divorce, etc.) during the sampling stages. 1- parents with only one child with type 1 diabetes, who is not affected by any other chronic diseases. 2- there is no recent stress (death, divorce, etc.) during the sampling stages. the research findings demonstrated that major problems of the subjects during the preliminary stages of diabetes diagnosis in children included depression (17.43), anxiety (11.2), obsession (11.02) and physical complaints (10.68) respectively, and paranoid (5.14), aggression with mean of 4.14, relationships with mean of 3.97, psychosis with mean of 3.54 and phobia with mean of 1.71 are considered as other problems. one month after diagnosis, major problems of the studied subjects were respectively depression (11.97), obsession (9.2), anxiety (8.37), physical complaints (7.74) and the paranoid thoughts and sensitivity in interpersonal relations and psychosis and phobia having mean of 4.88, 3.91, 3.08 and 1.42, following other problems in order. three months after diagnosis, major problems of studied subjects were respectively depression (9.9), obsession (5.68), physical complaints (5.6), paranoid with mean of 3.42, relationships with 2.71, aggression with mean of 1.71 and phobia with mean 0.97 were ranked as the next category. six months after the diagnosis, major problems of the studied subjects included depression with mean of 5.54, obsession with mean of 3.54 and physical complaints with mean of 3.31, paranoid with mean of 2.25, relationships, anxiety with mean of 1.54, aggression with mean of 1.28 and psychosis with mean of 1 respectively followed in order. twelve months after diagnosis, major problems the studied subjects were depression with mean of 3.6, obsession with mean of 2.05, physical complaints with mean of 1.94 and paranoid with mean of 1.31, anxiety and relationships with mean of 0.68, psychosis with mean of 0.6 and aggression with 0.48 and phobia with mean of 0.25 followed in order. the variance analysis test with repeated measure of observations indicated that passage of time has impacted the scores and over time, the mean score of mothers affective reactions reduced which indicated acceptance of children s disease on the part of parents. in addition, paired t - test indicated that the mean of the affective reactions during all times and in pairs had significant differences. also, the spearman s statistical test showed that there was a significant relationship between parent s education and mean difference of sensitivity in interpersonal relations during stages 1 and 5 (f = 0.27 and p < % 5), mean difference of depression during stages 1 and 5 (f = 0.38 and p < 0.11), mean difference of anxiety during stages 1 and 5 (f = 0.29 and p < 0.04), mean difference of aggression during stages 1 and 5 (f = 0.30 and p < 0.03) and the mean difference of paranoid thoughts during stages 1 and 5 (f = 0.305 and p < 0.03). anova during the first stage of sampling showed that the obsession, depression, anxiety, physical complain, phobia in the studied components had significant relationship with the family s occupation. also, there was a significant relationship between the mean difference of obsession during stages 1 and 5, mean difference of depression during stages 1 and 5, mean difference of sensitivity in interpersonal relations during stages 1 and 5, mean difference of phobia during stages 1 and 5 and the father s occupation. the t - test showed that there was a significant relationship between obsession, depression, anxiety, physical complaints, first stage aggression, phase 5 depression and the gender of the studied components. also, it showed that there was a significant relationship between phases 1 and 5 of obsession, mean difference of phases 1 and 5 of aggression and the gender of the studied components. in addition, t - test showed that there was a significant relationship between sensitivity of interpersonal ties of stage 1 and obsession of stage 2 with gender of the diabetic child and mean difference of paranoid thoughts in stages 1 and 5 and mean difference of sensitivity in the interpersonal relations during stages 1 and 5 had a significant relationship with gender of diabetic child. pearson s statistical test showed that there is a significant relationship between number of children and the sensitivity mean difference during stages 1 and 5 (f = 0.47 and p < 0.002), mean difference of paranoid thoughts (f = 0.42 and p < 0.006) and mean difference of psychosis during stages 1 and 5 (f = 0.33 and p < 0.02). also, it shows that there was a significant relationship between the birth order and the sensitivity in interpersonal relations mean difference during stages 1 and 5 (f = 0.33 and p < 0.02) and the paranoid thoughts mean difference (f = 0.395 and p < 0.009) (table 1). the research findings showed that major problems of studied subjects at early stages of child s diabetes diagnosis were depression, anxiety, obsession and physical complaints, respectively. and one month after diagnosis, they were depression, obsession, anxiety and physical complaints and three months later, the problems were depression, obsession and physical complaints, respectively and over time, the mean score of the parents emotional responses decreased, which indicated that they accepted their child s disease over time. whenever the child is diagnosed to have diabetes, members of a family especially parents usually feel shocked and sad and they experience affective reactions such as anger, anxiety, feeling of guilt and shame and sometimes there are continuous feelings of denial of child s disease, frustration and sorrow. nematpour and shahbazian referred to a study by staten that showed diagnosis of diabetes in children will develop emotional turmoil in the affected child and also his / her parents. nematpour and shahbazian realized in their own study that major problems stated on the part of the children include anxiety and depression, and over time, parents became more consistent and adapted to their child s disease. besides, study of gette and boam reported high incidence of psychological problems in parents of diabetic children which nematpour and shahbazian mentioned about in their study. the research findings showed that depression, anxiety, sensitivity in interpersonal relations has been higher in parents having higher education. shahmiri in his study showed that depression was higher in individuals having low education levels. in addition, nematpour and shahbazian in their own research found a relationship between parents stress levels and their education levels. also, other researches showed that obsession, depression, anxiety, physical complaints and phobia were in higher levels at the preliminary stages of diagnosis. increased levels of these responses at the beginning of diagnosis and their mitigation one year after diagnosis can be attributed to the higher education levels in employees. dehghi arough showed in his study that some personal attributes like income and education level of parents had relationship with the mental pressure experienced by them. more works and lower financial power will result in increasing mental pressures. also, the results indicated that obsession and aggression were higher in fathers at the beginning of diagnosis and physical complaints and depression were more in mothers one year after diagnosis. based on a study, 22 percent of children with type 1 diabetes experienced depression after diagnosis. in addition, in another study, mothers experienced more anxiety and depression than fathers. according to epidemiologic findings, women are at the risk of depression and men are at the risk of behavioral disorders. the female to male ratio of anxiety is 2 to 1 and that for physical complaints is 5 to 1. other findings showed that sensitivity in interpersonal relations at the beginning of diagnosis was higher in parents who had a male diabetic child and obsession was higher in the parents who had female diabetic children one year after diagnosis. the paranoid thoughts and sensitivity in the interpersonal relationships decreased one year after diagnosis, in parents who had a male diabetic child. the result of increased obsession one year after diagnosis can be due to the concerns of parents about marriage and future of their daughter. the affective responses developed in parents toward their diabetic son can be linked to the society s culture. dehghi arough showed that the personal attributes like gender has a relationship with mental pressure experienced by parents. other findings showed that sensitivity in interpersonal relationships, paranoid thoughts and psychosis at the beginning of diagnosis increased by increase in the number of children and birth order and decreased after one year. dehghi arough showed in his study that personal attributes like number of children has a relationship with mental pressure on parents. nematpour and shahbazian found that major problem reported by parents is anxiety and depression and referred to gett and boam that reported higher incidence of psychological problems in parents having diabetic children. in general, living a life with diabetes hurts affective responses or reactions of both the child and his / her parents and can influence self - care behaviors and finally, it may have some adverse impacts on the long - term monitoring of blood glucose, risk of long - term increased complications of the disease and the quality of life of the patients. therefore, we strongly recommend that there be a psychologist and/or psychiatric nurse for both parents and diabetic children in all endocrine and metabolism research centers. | background : these days, diabetes is deemed as one of the most important health and social - economic problems of the world. since parents play a major role in treatment of diabetes, the most important part of managing diabetes is in the hands of the parents of children affected by diabetes. this special responsibility will increase the stress and family challenges and impacts parents emotional responses. the affective reactions or responses of the parents can also be conveyed to the child himself and reduce self - care, increase glucose levels, increase the possibility of complications and reduce the quality of life. thus, it is highly important to recognize the affective reactions of parents during various stages of the disease for the purpose of intervention.materials and methods : all parents of children diagnosed with insulin - dependent diabetes who referred to sedigheh - ye - tahereh endocrinology and metabolism research center, isfahan, iran, were selected and the symptom checklist-90 (scl-90) was filled in five stages (immediately, one month, three months, six months and twelve months after diagnosis). convenient sampling was used to select 45 consecutive subjects out of whom 10 dropped out during the study.findings:the major problems of the study subjects at the beginning of diagnosis were depression, anxiety and physical problems, respectively. three, six and twelve months later, they were depression, obsession and physical problems. over time, the mean score of parents affective reactions declined which indicated the acceptance of the disease by parents over time.conclusions:in view of the fact that both mother and father of children with diabetes suffer from affective problems and since fathers refer to diabetes centers less than mothers, some decisions should be made to mentally support both fathers and mothers. |
the incidence of prostate cancer in japan has been increasing in recent years. radiation therapy (rt) has been playing an important role in the curative treatment of prostate cancer, because recent novel rt techniques, such as intensity - modulated radiotherapy (imrt), stereotactic radiotherapy, and particle radiotherapy with protons and carbon ions, can deliver a large dose to the target while sparing the surrounding normal tissues. permanent implants for prostate cancer have proved to be useful as an alternative highly conformal and high - dose rt approach. since the japanese government legalized the use of the iodine-125 (i) seed source in july 2003, i - brachytherapy has been a popular treatment method, mainly for low- to intermediate - risk prostate cancer in japan. it is well known that the actual benefits of prostate brachytherapy compared with external beam radiation therapy (ebrt) are lower incidences of sexual dysfunction and incontinence and a shorter treatment period. regarding rectal morbidity, however, radiation - induced rectal bleeding is still a problem in brachytherapy as well as in ebrt because of the close borders of the rectum and the prostate. several reports have shown improved outcomes of prostate cancer when higher irradiation doses are delivered both in ebrt and brachytherapy [39 ]. it is possible that increasing the irradiation dose to the target volume improves biochemical disease control, but it has a risk of increasing the rectal morbidity of rt for prostate cancer. therefore, the purpose of this study was to identify predictive factors associated with rectal bleeding after brachytherapy to carry out future dose escalation safely. a total of 98 patients with t1t2 prostate cancer (according to the international union against cancer tnm classification of malignant tumours 6th edition) underwent i permanent radioactive seed implantation between april 2005 and september 2009 at isesaki municipal hospital. among them, 90 patients who did not receive adjuvant ebrt were followed up for more than 36 months. one was excluded from this study, because the computed tomography (ct) data for post - implant dosimetry could not be used. hence, 89 patients were evaluated, and their clinical and treatment characteristics are shown in table 1. according to the national comprehensive cancer network guidelines, 48 and 39 patients had low - risk and intermediate - risk prostate cancer, respectively. the median age was 70 years (range 5180 years), and the median initial prostate specific antigen (psa) level before biopsy was 5.5 ng / ml (range 3.034.0 ng / ml). a total of 17 patients (19%) received anticoagulant therapy for various reasons. neoadjuvant androgen deprivation therapy (adt) was given to 43 patients (48.3%) for a median of 9 months (range 139 months). adt consisted of a luteinizing hormone releasing hormone agonist alone in 40 patients or in conjunction with an anti - androgen in 2 patients or an anti - androgen alone in 1 patient. table 1.clinical characteristics of patientsmedian (range)age (years)70 (5180)follow up (months)42 (1873)number of patients (%) clinical staget1c60 (67.4%)t2a18 (20.2%)t2b10 (11.2%)t2c1 (1.1%)gleason score3 + 355 (61.8%)3 + 433 (37.1%)4 + 31 (1.1%)initial psa20 ng / ml2 (2.2%)neoadjuvant hormonal therapy43 (48.3%)diabetes mellitus15 (16.9%)usage of anticoagulants17 (19.1%)psa = prostate specific antigen. clinical characteristics of patients psa = prostate specific antigen. about one month before the actual implant procedure, a volumetric study of the prostate was performed for all patients with transrectal ultrasound (trus) with patients in the dorsal lithotomy position. the prostate was scanned at 5-mm intervals from the proximal seminal vesicles to the apex. treatment planning was performed with the brachytherapy planning system variseed 7.1 (varian medical systems, palo alto, ca, usa) to calculate the well - designed dose volume histogram (dvh). the gross target volume (gtv) was defined as the prostate itself visualized on the trus images. the planning target volume (ptv) was determined from the gtv plus a treatment margin of 3 mm in the bilateral and anterior directions but no margin posteriorly. we set the treated volume to include the ptv within the prescribed isodose (145 gy), using a modified peripheral loading technique. implantation was performed under general anesthesia, via trus guidance of the preplanned seeds, with the patient in the extended lithotomy position, similar to the volumetric study. a mick applicator (mick radionuclear instruments, bronx, ny, usa) was used to deposit the seeds. one month after implantation, both computerized tomography (ct) and magnetic resonance imaging (mri) were carried out for dosimetric analysis. axial ct images 2.5 mm in thickness were obtained at 1.25-mm intervals, and t2-weighted images 2 mm in thickness were acquired within 1 h after ct examination. the ct and mr images were electronically fused using the manual - fusion procedure of the variseed fusion system by fitting the urethra, and then the prostate, rectum and urethra were contoured. to provide consistency in defining rectal volumes, all rectal outlining was redone by one person (k.h.). volumes were contoured as a solid structure defined by the outer wall from one slice above and below the prostate. the calculated dosimetric parameters included the % volume of the post - implant prostate receiving 100 and 150% of the prescribed dose (v100 and v150, respectively) and values of the minimal dose received by 90% of the prostate volume (d90). the urethral dose was expressed as values of the minimal dose received by 5% of the urethral volume (ud5). the rectal volumes in cubic centimeters that received > 50, 75, 100, 125, 150, 175 and 200% of the prescribed dose (rv50, rv75, rv100, rv125, rv150, rv175 and rv200, respectively) and the minimal doses received by 1, 2, 5, 10 and 30% of the rectum volume (rd1, rd2, rd5, rd10 and rd30, respectively) were determined. after brachytherapy, patients were followed - up at 3-month intervals to record information concerning disease status, rectal bleeding and cause of death. if patients were unable to visit our hospital due to various reasons, the information was obtained through letters or telephone contact directly with patients or relatives or through communication with the referring physicians. rectal bleeding was confirmed by rectal digital examination and endoscopy and was graded according to the national cancer institute common terminology criteria for adverse events version 4.0 (table 2). all time intervals were measured from the day of brachytherapy to occurrence of the rectal bleeding. the median follow - up time for this study was 42 months (range 1873 months). table 2.ctcae version 4.0 rectal hemorrhage criteriagradedescription1mild, intervention not indicated2moderate symptoms ; medical intervention or minor cauterization indicated3transfusion, radiologic, endoscopic, or elective operative intervention indicated4life - threatening consequences ; urgent intervention indicated5deathctcae = common terminology criteria for adverse events. ctcae version 4.0 rectal hemorrhage criteria ctcae = common terminology criteria for adverse events. the student 's t test and a chi - square test were used to compare the distribution of clinical and dosimetric parameters between the two groups. the cumulative incidence of rectal bleeding was calculated with the kaplan - meier method, and differences in cumulative incidence were compared with the log - rank test. biochemical psa failures as defined by the nadir + 2 definition were observed in two patients (2.2%). no grade 2 or greater rectal bleeding was observed, but 24 (27.0%) patients developed grade 1 bleeding. the median onset of the bleeding was 20 months (range 363 months), and it was resolved without treatment from 133 months (median 11 months). post - treatment planning data showed that d90, v100 and v150 of the implanted prostate were 157.5 13.4 gy, 92.9 3.4%, and 58.1 12.0%, respectively. the distributions of clinical parameters and treatment - related factors were compared between patients who did or did not develop rectal bleeding (table 3). there was a significant relationship between the occurrence of bleeding and taking anticoagulants (p = 0.007). there was no significant difference between the two groups regarding age, medical history of diabetes mellitus (dm), neoadjuvant hormonal therapy, prostate volume and number of seeds. table 3.correlation of clinical parametersrectal bleedingclinical parameteryes (n = 24)no (n = 65)p - valueage (years)0.525701433 1.0 cm was possibly a threshold value ; the cumulative incidence of rectal bleeding in patients with an rv100 > 1.0 cm was significantly higher than that with an rv100 1.0 cm (36% vs 14% at 36 months, p 1.0 cm was 36%, compared with 14% for patients with an rv100 1.0 cm (p 50, 75, 100, 125, 150, 175 and 200% of the prescribed dose, respectively ; rd1, rd2, rd5, rd10 and rd30 = the minimal doses received by 1, 2, 5, 10 and 30% of the rectal volume, respectively ; d90 = values of the minimal dose received by 90% of the prostate volume ; v100 and v150 = the percent volume of the prostate receiving 100 and 150% of the prescribed dose, respectively ; ud5 = values of the minimal dose received by 5% of the urethral volume. table 5.correlation of dosimetric parameters with rectal bleeding in patients not taking anticoagulantsrectal bleedingdosimetric parameteryes (n = 15)no (n = 57)p - valuerv50 (ml)5.8 1.95.1 1.80.176rv75 (ml)2.8 1.22.2 1.00.053rv100 (ml)1.2 0.80.77 0.580.022rv125 (ml)0.48 0.400.26 0.280.029rvi50 (ml)0.18 0.190.09 0.130.040rv175 (ml)0.08 0.100.04 0.060.085rv200 (ml)0.04 0.060.02 0.040.121rd1 (gy)207.7 51.7179.5 37.80.020rd2 (gy)182.2 38.5160.6 31.80.028rd5 (gy)149.8 29.0134.2 24.90.041rd10 (gy)123.1 24.8110.4 20.00.042rd 30 (gy)72.8 19.565.0 13.10.072d90 (gy)157.2 12.9157.5 13.40.944v100 (%) 56.4 12.357.6 12.00.745ud5 (gy)221.9 34.7223.7 41.30.877rv50, rv75, rv100, rv125, rv150, rv175 and rv200 = the rectal volumes in cubic centimeters that received > 50, 75, 100, 125, 150, 175 and 200% of the prescribed dose, respectively ; rd1, rd2, rd5, rd10 and rd30 = the minimal doses received by 1, 2, 5, 10 and 30% of the rectal volume, respectively ; d90 = values of the minimal dose received by 90% of the prostate volume ; v100 and v150 = the percent volume of the prostate receiving 100 and 150% of the prescribed dose, respectively ; ud5 = values of the minimal dose received by 5% of the urethral volume. table 6.correlation of dosimstric parameters with rectal bleeding in patients not taking anticoagulantsrectal bleedingdosimetric parameteryes (n = 9)no (n = 8)p - valuerv50 (ml)5.2 2.25.6 2.00.700rv75 (ml)2.4 1.42.5 1.40.857rv100 (ml)0.96 0.861.0 0 970.894rv125 (ml)0.38 0.450.43 0.550.836rv150 (ml)0.16 0.210.20 0.270.737rv175 (ml)0.07 0.090.10 0.140.594rv200 (ml)0.03 0.040.05 0.080.438rd1 (gy)194.2 50.0200.0 51.80.816rd2 (gy)173.2 42.6174.1 41.10.967rd5 (gy)142.6 33.9143.6 30.80.954rd10 (gy)117.1 29.6119.2 25.70.880rd30 (gy)69.9 21.172.6 19.70.791d90 (gy)154.9 9.8160.7 19.00.437v100 (%) 92.6 2.592.9 4.80.886v150 (%) 59.6 8.962.5 14.80.627ud5 (gy)227.0 24.2250.1 45.90.206rv50, rv75, rv100, rv125, rv150, rv175 and rv200 = the rectal volumes in cubic centimeters that received > 50, 75, 100, 125, 150, 175 and 200% of the prescribed dose, respectively ; rd1, rd2, rd5, rd10 and rd30 = the minimal doses received by 1, 2, 5, 10 and 30% of the rectal volume, respectively ; d90 = values of the minimal dose received by 90% of the prostate volume ; v100 and v150 = the percent volume of the prostate receiving 100 and 150% of the prescribed dose, respectively ; ud5 = values of the minimal dose received by 5% of the urethral volume. cumulative late grade 1 rectal bleeding rates according to receipt of 100% of the prescribed dose to the rectum (rv100) in patients who did not receive anticoagulation therapy (n = 72). the 3-year bleeding rate of patients with an rv100 > 1.0 cm was 36%, compared with 14% for patients with an rv100 1.0 cm (p 50, 75, 100, 125, 150, 175 and 200% of the prescribed dose, respectively ; rd1, rd2, rd5, rd10 and rd30 = the minimal doses received by 1, 2, 5, 10 and 30% of the rectal volume, respectively ; d90 = values of the minimal dose received by 90% of the prostate volume ; v100 and v150 = the percent volume of the prostate receiving 100 and 150% of the prescribed dose, respectively ; ud5 = values of the minimal dose received by 5% of the urethral volume. correlation of dosimetric parameters with rectal bleeding in patients not taking anticoagulants rv50, rv75, rv100, rv125, rv150, rv175 and rv200 = the rectal volumes in cubic centimeters that received > 50, 75, 100, 125, 150, 175 and 200% of the prescribed dose, respectively ; rd1, rd2, rd5, rd10 and rd30 = the minimal doses received by 1, 2, 5, 10 and 30% of the rectal volume, respectively ; d90 = values of the minimal dose received by 90% of the prostate volume ; v100 and v150 = the percent volume of the prostate receiving 100 and 150% of the prescribed dose, respectively ; ud5 = values of the minimal dose received by 5% of the urethral volume. correlation of dosimstric parameters with rectal bleeding in patients not taking anticoagulants rv50, rv75, rv100, rv125, rv150, rv175 and rv200 = the rectal volumes in cubic centimeters that received > 50, 75, 100, 125, 150, 175 and 200% of the prescribed dose, respectively ; rd1, rd2, rd5, rd10 and rd30 = the minimal doses received by 1, 2, 5, 10 and 30% of the rectal volume, respectively ; d90 = values of the minimal dose received by 90% of the prostate volume ; v100 and v150 = the percent volume of the prostate receiving 100 and 150% of the prescribed dose, respectively ; ud5 = values of the minimal dose received by 5% of the urethral volume. rectal bleeding is one of the major dose - limiting factors in curative rt for prostate cancer. table 7 summarizes the results of the incidence of rectal morbidities after prostate brachytherapy without ebrt reported by several investigators. the rates of grade 1, 2 and > 3 rectal morbidities ranged from 4.216.7%, 010.4% and 01.4%, respectively [1319 ]. the incidence of morbidities in the current study was almost comparable (grade 1, 27% and grade 24, 0%). in addition, the rates were lower than those observed after 3d - conformal rt and similar to those after current imrt studies [35, 2022 ]. in brachytherapy, the incidence of rectal bleeding seems to be tolerable because most cases can be managed with conservative therapy. table 7.reports of late rectal morbidity after prostate brachytherapyincidence of late rectal morbidity (%) gradestudyno. of patientsperiod (years)median follow - up (months)criteria1234snyder2121995199828modified rtognr10.400shah1351996200141nci cacte7.3000zelefsky2481988199748modified rtognr900.4zelefsky3671993200263nci cacte16.77.11.40.3gelblum685nrnrmodified rtog8.96.50.40waterman981997199932modified rtognr10.200martin2131994200160modified rtog4.2000rtog = radiation therapy oncology group.nci ctcae = national cancer institute common toxicity criteria for adverse events.nr = not reported. reports of late rectal morbidity after prostate brachytherapy rtog = radiation therapy oncology group. several randomized trials have shown improved outcomes when higher external beam radiation doses are delivered [35, 23 ]. in general, dose levels of 78 gy or higher were associated with better biochemical no evidence of disease rates for prostate cancer. similarly to ebrt, dose - response relationships were found in brachytherapy [69 ].. demonstrated that higher doses resulted in a lower incidence of positive cancer cells from post - radiation biopsies. positive biopsies were found in 24% of patients who received a d90 180 gy. in this study, no cases of grade 2 or worse rectal bleeding were observed. however, the rate of bleeding would probably increase if higher prescription doses to the prostate were given. as dose escalation to d90 = 160 gy was actually performed in our institution based on stone 's data [79 ], identification of risk factors for mild bleeding at the rectum with the prescription dose of d90 = 145 gy is very important for safe delivery of higher doses to the prostate. in this study, the rv75125 and rd110 were predictors for rectal bleeding, and rv100 was thought to be the most significant predictor (p = 0.02). the cumulative incidence of rectal bleeding in patients with an rv100 > 1.0 cm was significantly higher than that with an rv100 1.0 cm (36% vs 14% at 36 months, p < 0.05 ; fig. 1). reported that the risk of developing grade 2 proctitis following i brachytherapy with rectal dvh analysis, and the volume thresholds for < 5% risk of morbidity were 3 cm at 100 gy, 2 cm at 140 gy, 1.3 cm at 160 gy, and 0.8 cm at 200 gy. furthermore, waterman. showed that the rectum could tolerate doses of 100, 150, and 200 gy to approximately 30%, 20% and 10% of the rectal surface, respectively, with a < 5% risk of late morbidity. it is difficult to compare our results with theirs because a different definition of rectal dose and a different grade of criteria for rectal bleeding were used. however, to a varying degree, our results agree with theirs from the viewpoint of prediction for rectum morbidity. recent studies have shown that patients taking anticoagulation therapy have a substantial risk of bleeding toxicity with ebrt [24, 25 ]. our results show that rectal bleeding occurred in 9 of 17 patients with anticoagulation therapy, and usage of anticoagulants was one of the predictors for bleeding induced by irradiation. dvh parameters of the rectum were associated with the incidence of bleeding in all patients as well as in patients not taking anticoagulants, but this observation was not detected in patients taking anticogulants. taking these findings into consideration, additionally, a usage of anticoagulants seems to be an independent risk factor for the occurrence of bleeding after brachytherapy using this dose level. several investigators have shown that dm and adt are risk factors for rectal bleeding in rt for prostate cancer [2629 ]. however, no relationship of bleeding with dm and adt was observed in our study. this discrepancy is probably explained by the following reasons : (i) this study included a small number of cases, (ii) other studies focused on grade 2 but not grade 1 rectal bleeding, and (iii) adt was used as only short - term neoadjuvant therapy in this study. a previous phase ii trial of carbon - ion rt, which can deliver excellently localized irradiation doses to the target like brachytherapy, also revealed that the use of short - term adt was not correlated with rectal and urogenital complications. rectal dvh analysis is a practical and predictive method for assessing the risks of late rectal morbidity after treatment. to maintain less than 1 cm of the rv100 is very important to decrease rectal morbidity after brachytherapy. although we used a prescribed dose of 145 gy, the predictive risk factors proposed in this analysis may be useful tools for safely and effectively delivering higher doses to the target when dose escalation to 160 gy is also included. | the purpose of this study was to determine the risk factors for rectal bleeding after prostate brachytherapy. between april 2005 and september 2009, 89 patients with t1c-2cn0m0 prostate cancer were treated with permanent i-125 seed implantation alone. the prostate prescription dose was 145 gy, and the grade of rectal bleeding was scored according to the common terminology criteria for adverse events version 4.0. post - treatment planning was performed with fusion images of computerized tomography and magnetic resonance imaging 45 weeks after brachytherapy. patient characteristics and dosimetric parameters were evaluated to determine risk factors for bleeding. the calculated parameters included the rectal volume in cubic centimeters that received > 50200% of the prescribed dose (rv50200) and the minimal doses received by 130% of the rectal volume (rd130). the median follow - up time was 42 months (ranging 1873 months). grade 1 rectal bleeding occurred in 24 (27.0%) patients, but no grade 2 or severe bleeding was observed. usage of anticoagulants had a significant correlation with the occurrence of bleeding (p = 0.007). the rv100150 and rd110 were significantly higher in patients with rectal bleeding than in those without bleeding. the rv100 was identified as a possible threshold value ; the 3-year rectal bleeding rate in patients with an rv100 > 1.0 cm3 was 36%, whereas that with an rv100 1.0 cm3 was 14% (p < 0.05). although no grade 2 morbidity developed in this study, the rv100 should be kept below 1.0 cm3, especially in additional dose - escalated brachytherapy. |
atherosclerosis is a chronic inflammatory disease, which involves vascular cells, immune system, and several organs. although leukocytes, endothelial and smooth muscle cells have been shown to play a crucial role in atherosclerotic inflammation, recent evidence also supports a direct activity for the liver, lung, heart, kidney, adipose tissue, adrenal, pancreatic, pituitary, and sex glands. these organs produce several soluble inflammatory mediators, which orchestrate vascular and immune cell functions. although cytokines, chemokines as well as growth factors have been shown to modulate inflammatory processes, recent studies suggest new inflammatory activities for endocrine hormones [3, 4 ]. the renin - angiotensin system could serve an important role in promoting inflammation [4, 5 ]. however, despite its first description by tigerstedt and bergman over a century ago, the role of these hormones in inflammatory processes is still unclear. the recent identification of new angiotensins and the different roles of angiotensin and renin / prorenin receptors increased the complexity of this system, suggesting that further investigations are needed to better understand the role of renin - angiotensin axis in inflammation (figure 1) [79 ]. furthermore, the description of the angiotensin - converting enzyme (ace) 2 and its main product (angiotensin) raised some controversies [10, 11 ]. ace 2 and angiotensin levels are not influenced by ace inhibitors or angiotensin ii receptor blockers (arbs). on the other hand, the negative feed - back regulating plasma renin activity is modulated by these drugs (figure 2). ace 2 and angiotensin rather appear to be upregulated by these drugs maily in the myocardium and kidney [13, 14 ]. ace 2 is also highly expressed in hypothalamus and aorta, and it is considered as a possible modulator of the renin - angiotensin system. in particular, both ace 2 and angiotensin may counterbalance excess of activity of the classical renin - angiotensin system (figure 3). angiontenin ii has been detected also in peripheral tissues (such as aortic tissue), suggesting a possible role of the local renin - angiotensin system in atherosclerosis. both local and circulating angiotensin ii exert their activities through the binding to angiotensin ii type 1 (at1) or type 2 (at2) receptors. at2 receptors are ubiquitously expressed in foetus and dramatically fall in the first few hours after birth. recently, a local renin - angiotensin system characterized by the expression of both at1 and at2 receptors has been also shown in adipose tissue. furthermore, the rediscovery of the intracellular activity of angiotensin ii as a major factor involved in cardiac remodeling suggested new possible investigation fields [2022 ]. the present review will be focused on evidences from basic research studies and clinical trials, investigating the role of the revisited renin - angiotensin system and its pharmacological inhibitions in atherosclerotic inflammatory processes (figure 2). in the last decades, basic researches have strongly suggested that the renin - angiotensin system blockade exerts potent antiatherosclerotic effects, not only through the antihypertensive pathway but also through anti - inflammatory, antiproliferative, and antioxidant properties. among these hormones, angiotensin ii regulates not only adhesion molecule (vcam-1, icam-1, p - selectin) expression but also cytokine, chemokine, and growth factor secretion within the arterial wall. on the other hand, the renin - angiotensin system can modulate the activation of complement system in both atherosclerosis and renal injury [2527 ]. this inflammatory cascade activates the vascular inflammatory response by increasing inflammatory cell recruitment to intima. recruited cells can produce angiotensin ii (intracellular angiotensin system), resulting in a positive feedback response, which can maintain this inflammatory vicious circle. in humans, an analysis of both ruptured and hypercellular plaques demonstrated high levels of ace in macrophages. accordingly, little or no ace was found in areas with only fibrotic plaques [28, 29 ]. these data suggest that ace may be associated to atherosclerotic plaque development and vulnerability through the direct regulation of inflammatory cells. furthermore, angiotensin ii favors the intraplaque recruitment of monocytes and lymphocytes and directly enhances tnf-, il-6 and cyclooxygenase-2 expression in atherosclerotic arteries. angiotensin ii - mediated effect could be potentitated by c - reactive protein (crp) through the upregulation of at1 receptor expression in vascular smooth muscle cells. angiotensin ii has been also shown to increase ldl oxidation in macrophages [33, 34 ], oxldl receptor (lox-1) expression in endothelial cells, superoxide and metalloproteinase production, and lipid peroxidation. in addition, the inactivation of nitric oxide (no) and prostacyclin (pgi2) has been also observed in the presence of angiotensin ii [3740 ]. the binding between angiotensin ii and at1 receptor induced proinflammatory effect mainly through the down - stream activation of intracellular signaling cascade, which involves nuclear factor - kappab (nf-b) activation [4143 ]. however, henke. clearly showed that, despite the development of high blood pressure, in vivo nf-b pathway suppression in endothelial cells reduced hypertension - induced renal damage in mice with endothelial cell - restricted nf-b superrepressor ikappabalphadeltan overexpression. accordingly, the activation of nf-b pathways is also crucial in atherogenesis and macrophage activation / survival [4648 ]. therefore, angiotensin ii through the activation of nf-b pathway could directly increase atherosclerotic inflammation. the majority of the direct proinflammatory effects induced by angiotensin ii have been shown in studies with selective at1 receptor blockers. conversely, kato. showed that renin - angiotensin system - activated transgenic mice receiving bone marrow transplantation from at1a knockout (ko) mice. the lethal effect was mainly mediated by at1a ko macrophages that overexpressed a number of genes involved in atherogenesis and exhibited a greater uptake of modified lipoproteins. given the controversial role of at1 receptors, further investigations are needed. they are mainly localized in cardiac interstitial fibroblasts and are capable of binding not only angiotensin ii but also other angiotensins, including angiotensin iii. at2 receptors also signal through nf-b - mediated pathways but they may counterbalance at1 receptor - mediated effects through the activation of phosphatases rather than kinases [5052 ]. at2 receptor activation also inhibits growth of cultured vascular smooth muscle cells and cardiac myocytes [51, 52 ]. on the other hand, the selective at2 receptor blockade has been shown to inhibit in vivo medial smooth muscle hypertrophy and fibrosis in hypertensive rats. these controversial results suggest that also the role of at2 receptors is still not clear. in particular, this hormonal axis inhibits fibrinolysis and enhances thrombosis by increasing plasminogen activator-1 production in endothelial and vascular smooth muscle cells [5355 ] and by activating platelets. the renin - angiotensin system also stimulates platelets to release thromboxane a2 and platelet derived growth factor and increases tissue factor levels in atherosclerotic plaques in acute coronary syndromes. these basic research studies suggested that the pharmacological inhibition of the renin - angiotensin system may be of benefit against atherosclerotic inflammatory processes. in fact, ace inhibitors or arbs do not modulate exclusively kidney and arterial cell functions. inflammatory cell, adipocyte, and cardiomyocyte functions are directly regulated by these drugs [5963 ]. two decades ago, the first preclinical studies in vivo showed that ace inhibitors had not only blood - pressure - lowering properties but also direct protective effects on endothelium and atherogenesis. at an early stage of atherosclerosis, the treatment with different ace inhibitors reduced endothelial dysfunction in atherogenic diet - fed or hyperlipidemic rabbits. quinapril reduced macrophage infiltration in atherosclerotic lesions in femoral arteries in rabbits through the direct inhibition of macrophage chemoattractant protein (mcp)-1 expression. accordingly, angiotensin ii itself increased mcp-1 expression in atherosclerotic lesions, thus contributing to macrophage infiltration. the crucial role of the renin - angiotensin system in inflammatory processes regulating atherosclerosis was also observed in other animal models prone to develop atherosclerosis [6974 ]. in these studies, various ace inhibitors at doses comparable to those used clinically reduced atherosclerotic lesions independently of blood pressure. this was suggested by two independent findings : (1) the use of other antihypertensive drugs did not produce similar results ; (2) ace inhibitors reduced atherosclerosis without altering blood pressure. the beneficial effects of the renin - angiotensin pharmacological inhibition have been also observed in animal models of hypertension. the most used model was the stroke - prone strain (shr - sp) rats. treatment with ramipril in the pre - hypertensive phase in shr - sp rats strongly reduced mortality and improved left - ventricular hypertrophy, cardiac and endothelial functions, and metabolism. the administration of ace inhibitors in the later phases of hypertension in shr - sp rats also decreased mortality, suggesting that ace inhibitors reduce cardiovascular risk and atherosclerosis in animals in different stages of cardiovascular disease., some authors have also demonstrated that lowdose of trandolapril did not reduce both blood pressure and atherosclerosis in hyperlipidemic rabbits. arbs reduced blood pressure and atherosclerosis in different animal models [7982 ]. however, differently from ace inhibitors, the protective effect of arbs was observed at both high and lowdoses. although some authors did not confirm arb - mediated benefits at low doses, a possible dose - dependent impact on atherogenesis, not only mediated by blood pressure lowering, is strongly suggested. no data are available on the use of ace inhibitors and arbs on atherogenesis in transgenic rats with inducible angiotensin ii (ang ii)-dependent hypertension (tgr[cyp1a1-ren2 ]), two kidney - one clip (2k-1c) hypertension rats, or hypertensive double transgenic mice (r+/a+) that overexpress both human renin (r+) and human angiotensinogen (a+). few evidences are available about the use of ace inhibitors or arbs on mouse models with local (intracardiac) or systemic high angiotensin ii [84, 85 ]. however, these studies were not focused on atherosclerosis. therefore, further studies are needed to clarify the role of ace inhibitors and arbs in atherosclerosis in animal models with high angiotensin ii levels. in march 2007, the us food and drud administration approved a new renin - angiotensin blocker (aliskiren, a direct renin inhibitor) for the treatment of hypertension in humans without renal dysfunction. renin inhibition blocks angiotensin i generation with the consequent suppression of angiotensin ii as well as angiotensin peptide formation. recent evidence also suggested a possible direct role of renin inhibitors to reduce atherosclerotic inflammation [8789 ]. in a double - trangenic rat model (dtgr), overexpressing human renin and human angiotensinogen genes, aliskiren reduced cardiac hypertrophy, fibrosis, inflammation, and inducibility of arrhythmias and reversed already established cardiac and renal damage. the benicial effects of renin inhibition on organ damage are partially due to the suppression of hypertension. the blockade of direct proinflammatory activities of angiotensin ii and angiotensin peptides represents a crucial mechanism to reduce atherosclerosis. in fact, in the same dtgr rat model, aliskiren and arb losartan also reduced albuminuria and expression of inflammatory mediators, such as tnf-, c - reactive protein (crp) and complement c1q, c3, c3c, and c5b-9 in comparison with untreated controls. treatment with aliskiren has been also shown to protect against endothelial dysfunction and atherosclerosis in watanabe heritable hyperlipidemic rabbits as well as apoe deficient or ldl receptor deficient mice. at the beginning of the nineties, dzau and braunwald proposed the concept of the cardiovascular continuum in humans : cardiovascular disease can be seen as a pathophysiologic cascade induced by the presence of risk factors, such as hypertension, hypercholesterolemia, diabetes mellitus, and smoking. these conditions can produce well defined stages, such as endothelial dysfunction, atherosclerosis, and target organ damage, followed ultimately by the clinical syndromes (heart failure, stroke, and end - stage renal disease) and eventually death. experimental evidence clearly suggests a key role of the renin - angiotensin system and the induced inflammatory processes at all stages of this continuum and consequently a strong rationale for its blockade in order to prevent cardiovascular events. the possibility of a positive effect of the renin - angiotensin blockade at the early stages of the cardiovascular continuum, that is, the endothelial dysfunction, was specifically addressed by some clinical studies. although the complexity of the methodology applied to these investigations did not allow the recruitment of a very large number of patients, the results were clearly supportive about the role of the renin - angiotensin inhibition in the reversal of the endothelial dysfunction. early evidence came from the trend study, which showed that angiotensin - converting enzyme (ace) inhibition with quinapril improves endothelial function of the coronary arteries. similar results were obtained in the coronary circulation with the arbs : valsartan improved basal nitric oxide production and release in hypertensive patients as compared to diuretic - treated subjects, despite similar blood pressure decrease. the endothelial function was evaluated also in both the peripheral and the renal circulation, always showing a consistent improvement exerted by the renin - angiotensin blockade. in addition, in a small group of hypertensive patients, resistance arteries obtained from subcutaneous biopsies were studied before and after 1 year of treatment with either an arb (losartan) or a -blocker (atenolol) ; basal measurements were compared to those of normotensive controls. despite similar reductions in blood pressure, losartan normalized acetylcholine - dependent vasodilation and reduced media / lumen ratio. whereas different arbs exert their effects on endothelial function in a similar way (through at1 receptor antagonism) for ace inhibitors we have to consider the presence of both plasma ace, which regulates blood pressure, and tissue ace, which is involved in the regulation of tissue inflammation, fibrosis, and hypertrophy. in banff study, for example, an ace inhibitor with low activity at the tissue level, enalapril, was not able to affect endothelial function. more recently the trendy study tried to compare an arb, telmisartan, and an ace inhibitor, ramipril, in terms of improvement of the renal endothelial function : no significant differences between the two drugs were observed although the arb seemed to be a little more efficient. the demonstration of the prognostic significance of endothelial dysfunction was obtained from studies where it was possible to find an inverse association between the acetylcholine - stimulated forearm blood flow increase and the cumulative incidence of cardiovascular events. two other surrogate parameters, which have been evaluated in clinical studies extensively, are the circulating inflammatory markers and the extension of the vascular damage (carotid intima - media thickness [imt ], coronary circulation, and volume of the atherosclerotic plaques). although ace inhibitors reduce blood levels of inflammatory cytokines in vivo, this issue has been addressed more in depth for arbs. table 1 lists a series of clinical studies, in which ace inhibitors and arbs reduce serum levels of inflammatory markers in different diseases [93102 ]. as for vascular structure, the less invasive way to evaluate the possible atherosclerotic changes is the ultrasound determination of the carotid imt. in the secure trial, a significant decrease in the progression slope of mean maximal imt by 0.04 mm these results were not confirmed by another study, the part-2 trial, with the same active drug and the same parameter, and also by two studies (quiet and scat) with a coronary angiographic evaluation [115, 116 ]. more recently intravascular ultrasound (ivus) was used in a substudy of the camelot trial, which compared the effects of 3 different treatments on atherosclerosis progression : amlodipine, a calcium - antagonist, showed no progression ; enalapril, an ace inhibitor, a trend toward progression, which was more evident in the placebo group. also the effects of arbs were evaluated at the vascular levels : in a substudy of the life trial, losartan, an arb, but not atenolol, a -blocker, induced a regression of the carotid artery hypertrophy in hypertensive subjects. the first successful clinical application of the experimental observations about the role of the renin - angiotensin in the cardiovascular pathophysiology was the demonstration of the ace inhibitors as an undisputed treatment in patients with congestive heart failure or coronary artery disease (cad) and concomitant left ventricular dysfunction, all clinical syndromes characterized by a strong activation of the renin - angiotensin system. the first studies (save and solvd) demonstrated that these drugs reduced both mortality rate and risk of ischemic events ; moreover in save the effect of the aceinhibition by captopril was found to be independent of the degree of left ventricular dysfunction. therefore a subsequent step was proposed to demonstrate a significant positive effect of the renin - angiotensin blockade in subjects at high risk for cardiovascular events but without left ventricular dysfunction. the hope study was the first randomized controlled trial that reached this goal : in high - risk patients ramipril was able to induce an important 22% risk reduction of composite cardiovascular death, mi, or stroke compared to placebo. high - risk patients were defined as those with evidence of vascular disease (cad, stroke, peripheral vascular disease) or diabetes plus one other cardiovascular risk factor (hypertension, low high - density lipoprotein levels, elevated total cholesterol levels, smoking, microalbuminuria). the analysis of the results induced intense debate about the role of blood pressure decrease per se in the observed benefits. the results in the hope study and in the subsequent similar trials with other aceinhibitors occurred in a population of patients already receiving standard medical therapy, including platelet inhibitors, lipid - lowering therapy, and -blockers. two large trials (europa and peace) were performed to confirm hope study results with the same class of renin - angiotensin antagonists [124, 125 ]. the former was successful in demonstrating a similar (20%) relative reduction of cardiovascular risk (primary end point of cardiovascular death, mi, or cardiac arrest) ; instead the latter was not able to show significant differences between treatment groups (aceinhibitor versus placebo) in the primary end point, a composite of death resulting from cardiovascular causes, nonfatal mi, or revascularization. several hypotheses have been put forward to explain these discrepancies : the main reason could be the healthier conditions of the peace patients with respect to the patients enrolled in the other trials and therefore the difficulty for the active treatment to demonstrate clear positive effects on the outcomes. however a meta - analysis of the three placebo - controlled trials demonstrated a significant effect of ace inhibition on the occurrence of all - cause mortality, cardiovascular mortality, nonfatal mi, stroke, heart failure, and coronary bypass surgery. the results have shown that the active treatment (telmisartan) was not superior to placebo in the prevention of cardiovascular events, primary composite end point represented by cardiovascular death, mi, stroke, or admission to the hospital for heart failure events. ripley and harrison suggest that these partially unexpected data could be explained by the differences in patient number, event rates, and the use of other life - saving drugs between transcend and hope studies. however these results confirm the difficulty to demonstrate a significant effect of the renin - angiotensin blockade in the cardiovascular prevention beyond the blood pressure control. at present, the only suggestion of a therapeutical action which could be independent from the changes in blood pressure levels derives from the life study. in this large multicenter trial patients with left ventricular hypertrophy were randomized to receive treatment based on an arb (losartan) or a -blocker (atenolol) : the composite primary end point of death, mi, and stroke was reduced by 13% with the arb - based treatment compared with the -blocker - based treatment in presence of a similar amount of blood pressure decrease. another important issue is the mechanism of action of the different classes of renin - angiotensin blockers. if angiotensin ii is the key player in the inflammatory processes in cardiovascular disease, we have many pharmacological ways to inhibit its synthesis ; in addition the different classes of drugs demonstrate other effects, possibly related to a therapeutic gain (so called pleiotropic actions). in fact it is well known that ace inhibitors are able to reduce the breakdown of bradykinin, and this molecule can cause the most frequent untoward effects of these drugs (cough, angioedema) but it is believed also as an important contributor to the protective cardiovascular effects exerted by them. on the other hand, arbs significantly increase angiotensin ii levels, as a consequence of the antagonism at the at1 receptor site. the possible role of the at2 receptor stimulation in the beneficial therapeutic effects of arb remains a fascinating hypothesis [132, 133 ]. these pharmacological differences could explain the possible better results obtained with ace inhibitors in terms of prevention of coronary events and with arbs in terms of prevention of ischemic strokes in comparison with the direct competitors for renin - angiotensin blockade. this therapeutic hypothesis has been verified by a systematic review of the available clinical data about the two classes of drugs and by the recently published ontarget trial, a very large multicenter randomized trial in which the patients were treated with an ace inhibitor (ramipril), an arb (telmisartan), or the combination of the two drugs. after a median follow - up of 56 months, the occurrence of the primary outcomes, consisting of death from cardiovascular causes, mi, stroke, or hospitalization for heart failure, was not significantly different in the ramipril and telmisartan groups, although the arb was better tolerated. there were trends slightly favoring the ace inhibitor for mi prevention and the arb for stroke prevention but these differences did not reach statistical significance. the other issue addressed by the trial, the clinical role of the combined renin - angiotensin blockade, brought a word of caution about this strategy since more adverse events were observed [137, 138 ]. although in conditions of renin - angiotensin hyperactivation, such as advanced heart failure, and of marked proteinuria the double blockade can still exert beneficial effects, other recent studies confirmed the possible risk of the combination in both a cardiological and a nephrological setting [139141 ]. in 1957, skeggs. suggested another possible approach to pharmacologically the discovery of prorenin receptor constitutes an additional reason to develop a new class of renin inhibitors. an ambitious plan of primary and secondary prevention trials has begun in order to demonstrate possible advantages of the treatment with aliskiren alone or in combination with other renin - angiotensin blockers in patients with hypertension. at present, the effects independent of antihapertensive activity of aliskiren have been shown by one clinical trials focused on end - organ damage. in aliskiren in the evaluation of proteinuria in diabetes (avoid) trial, the treatment with aliskiren reduced proteinuria independently of blood pressure. other clinical trials have been started to investigate the possible benefits of aliskiren in cardiac remodeling after myocardial infarction (avant garde, aspire) and diabetic nephropathy (altitute). therefore, in the next future, further clinical evidence will be available to confirm these preliminary anti - inflammatory and antiatherosclerotic effects of aliskiren in humans. the inhibition of the renin - angiotensin system represents a pivotal approach for reducing atherosclerosis and its dramatic complications, such as stroke and myocardial infarction (mi). ace inhibitors and arbs are well - established pharmacological tools in both primary and secondary prevention of atherosclerotic cardiovascular disease. emerging evidence shows that their beneficial effects are not only due to blood pressure lowering but also due to a direct anti - inflammatory activity. further studies are needed to better understand this promising investigation field, with particular interest for the promising results with the new renin inhibitor treatment. | recent evidence shows that the renin - angiotensin system is a crucial player in atherosclerotic processes. the regulation of arterial blood pressure was considered from its first description of the main mechanism involved. vasoconstriction (mediated by angiotensin ii) and salt and water retention (mainly due to aldosterone) were classically considered as pivotal proatherosclerotic activities. however, basic research and animal studies strongly support angiotensin ii as a proinflammatory mediator, which directly induces atherosclerotic plaque development and heart remodeling. furthermore, angiotensin ii induces proatherosclerotic cytokine and chemokine secretion and increases endothelial dysfunction. accordingly, the pharmacological inhibition of the renin - angiotensin system improves prognosis of patients with cardiovascular disease even in settings of normal baseline blood pressure. in the present review, we focused on angiotensin - convertingenzyme (ace) inhibitors, angiotensin ii receptor blockers (arbs), and renin inhibitors to update the direct activities of the renin - angiotensin system in inflammatory processes governing atherosclerosis. |
the incidence has been estimated to be 2.5 - 5 per 100000 people per year with a prevalence of 35 per 100000 (1). neuroendocrine cervical carcinoma is a rare subtype of cervical cancer with a high proliferation rate and a marked propensity for regional lymph node metastases and distant metastases, which is similar to its counterpart in the lung and other anatomic locations. growing evidence indicates that 2-[f ] fluoro-2-deoxy - d - glucose positron emission tomography / computed tomography (f - fdg pet / ct) scan is feasible for assessing the pre - treatment staging, detecting lymph node metastases, and evaluating the treatment response in squamous cervical carcinoma. to the best of our knowledge, there are no f - fdg pet / ct studies with cervical - vaginal neuroendocrine tumor. here, we describe five cases of neuroendocrine cervical - vaginal carcinoma, and discuss the potential of the f - fdg pet / ct scans for the detection of this rare malignancy. from september 2009 to august 2011, five patients were diagnosed with neuroendocrine tumor in our hospital (four subjects had a tumor in the uterine cervix and one subject had a tumor in the vagina). the diagnosis of neuroendocrine carcinoma was made, according to the recently proposed classification of neuroendocrine tumors (2). all of the patients underwent f - fdg pet / ct scans for the initial staging procedure and three subjects received post - treatment f - fdg pet / ct scans for detecting possible tumor recurrences or distal metastases. each of them was intravenously injected with 370 megabecquerel (mbq) of f - fdg and rested on a supine position in a quiet, dimly lit room. imaging was performed with a pet / ct scanner (discovery ste, general electric healthcare, milwaukee, wi, usa). scanning began approximately 40 minutes after the injection of f - fdg. when patients were positioned in the scanner, a molded headrest and a head - restraining velcro band we used four - phase f - fdg pet / ct imaging protocol to improve the lesion detectability in patients with pelvic carcinoma. this protocol included the following : 1) saline infusion was given before the tracer injection. whole - body f - fdg pet / ct scan was acquired, approximately 40 minutes after the intravenous injection of 370 mbq of f - fdg ; 2) post - void delayed abdominal and pelvic f - fdg pet / ct images were obtained, approximately 70 minutes after f - fdg injection ; 3) after voiding of the urinary bladder again, the patients were injected with 20 mg of furosemide intravenously. focal supine abdominal and pelvic diuretic f - fdg pet / ct images were obtained, approximately 90 minutes after f - fdg injection ; 4) additional focal imaging of the abdomen and pelvis was performed, approximately 110 minutes after f - fdg injection, with the patients in the prone position. the pet / ct examinations started with the acquisition of a topogram of ct that is used to define the axial examination range of the pet / ct study. after the definition of the axial imaging range, a spiral non - contrast - enhanced low - radiation - dose ct scan (0.8-second rotation time, 120 kvp, variable ma with automa technique, 3.75-millimeter slice thickness and 1.75 : 1 pitch) were acquired, first, for anatomical references and attenuation correction. then, the pet emission images were acquired after ct scans at 2 minutes per field of view (fov) in the 3-dimensional acquisition mode with eleven - slice overlap at the borders of the fov. the ct images were reconstructed onto a 512 512 matrix, and then converted to a 128 128 matrix, 511-kev - equivalent attenuation factors for the attenuation correction of the corresponding pet emission images. then, the pet images were reconstructed to the same thickness of ct images, 3.27 millimeter transaxial slice thickness for further interpretation. a semiquantitative parameter, standardized uptake value (suv), was defined as the " tracer activity in the target region per unit mass, divided by the amount of injected radioactivity, per unit body mass ". the maximum standardized uptake value (suvmax) was calculated from each region of interest with increased f - fdg radioactivity. a 46-year - old female of gravida 3 and para 3 visited our emergency department with complaints of massive vaginal bleeding and abdominal fullness in july 2011. the pelvic examination revealed an exogenous mass lesion over the upper third of the vagina with malodorous discharge. colposcopic biopsy of the cervical lesion revealed a poorly differentiated, large - cell neuroendocrine cervical carcinoma. an f - fdg pet / ct scan was performed, subsequently, for the demonstration of possible metastases and shown in figure 1. the tumor was clinically staged as international federation of gynecology and obstetrics (figo) stage iva. pelvic examination found an area of easy bleeding over the uterine cervix, without parametrial extension, 4 cm in its largest dimension (figo stage ib2). a pre - treatment primary lesion was detected on the f - fdg pet / ct scan, as shown in figure 2. four months later, the progression of disease was evidenced by multiple lymph node and bone metastases. she was admitted for salvage chemotherapy, and was given cisplatin (500 mg / m) and 5-fu (1000 mg / m). she expired 24 months after the initial diagnosis. a 66-year - old postmenopausal woman, with a diagnosis of stage iia large - cell neuroendocrine cervical carcinoma was treated with radical hysterectomy, concurrent chemotherapy and radiation. ten months after she completed her treatment, general weakness and abnormal laboratory data were noted. f - fdg pet / ct scan, as shown in figure 3 was arranged for detecting possible metastases, and it revealed multiple f - fdg - avid lesions in the mediastinum, liver, and abdominal lymphatic chain. a 46-year - old woman was presented to our gynecology department with complaints of intermittent vaginal spotting and a malodorous vaginal discharge for 2 months. pelvic examination, which was done under anesthesia on dec. 3, 2010, showed a bulky tumor of about 4.0 cm in diameter. computed tomography scan revealed enlarged lymph nodes in the bilateral internal iliac and the left common iliac regions. however, she developed oliguria and was found to have acute renal insufficiency related to obstructive nephropathy. the f - fdg pet / ct scan of this patient is shown in figure 4. in addition to the primary tumor seen in the pelvis, the enlarged lymph nodes shown on a ct scan were hypermetabolic. the patient is currently receiving palliative chemotherapy consisting of cisplatin (50 mg / m), doxirubicin (50 mg / m) and etoposide (75 mg / m). a 42-year - old female presented with a right vaginal septum of about 2.3 2.0 0.5 cm in size, around the middle to lower third of the vagina on the annual exam. according to her statement, she suffered from painful sensation during sexual intercourse and post - coital bleeding for nearly 2 years. radical resection was done on december 7th, 2009. the first f - fdg pet / ct scan is shown in figure 5. the treatment plan for this patient, which consisted of six courses of chemotherapy with concurrent radiation and four courses of brachytherapy, was completed on march 4th, 2010. however, mildly elevated carcinoembryonic antigen, 19.13 ng / dl, was noted six months later. she underwent a second f - fdg pet / ct scan, which showed an f - fdg - avid lesion in the right side of the uterine cervical region. from september 2009 to august 2011, five patients were diagnosed with neuroendocrine tumor in our hospital (four subjects had a tumor in the uterine cervix and one subject had a tumor in the vagina). the diagnosis of neuroendocrine carcinoma was made, according to the recently proposed classification of neuroendocrine tumors (2). all of the patients underwent f - fdg pet / ct scans for the initial staging procedure and three subjects received post - treatment f - fdg pet / ct scans for detecting possible tumor recurrences or distal metastases. the patients were asked to fast for at least 4 hours before scanning. each of them was intravenously injected with 370 megabecquerel (mbq) of f - fdg and rested on a supine position in a quiet, dimly lit room. imaging was performed with a pet / ct scanner (discovery ste, general electric healthcare, milwaukee, wi, usa). scanning began approximately 40 minutes after the injection of f - fdg. when patients were positioned in the scanner, a molded headrest and a head - restraining velcro band we used four - phase f - fdg pet / ct imaging protocol to improve the lesion detectability in patients with pelvic carcinoma. this protocol included the following : 1) saline infusion was given before the tracer injection. whole - body f - fdg pet / ct scan was acquired, approximately 40 minutes after the intravenous injection of 370 mbq of f - fdg ; 2) post - void delayed abdominal and pelvic f - fdg pet / ct images were obtained, approximately 70 minutes after f - fdg injection ; 3) after voiding of the urinary bladder again, the patients were injected with 20 mg of furosemide intravenously. focal supine abdominal and pelvic diuretic f - fdg pet / ct images were obtained, approximately 90 minutes after f - fdg injection ; 4) additional focal imaging of the abdomen and pelvis was performed, approximately 110 minutes after f - fdg injection, with the patients in the prone position. the pet / ct examinations started with the acquisition of a topogram of ct that is used to define the axial examination range of the pet / ct study. after the definition of the axial imaging range, a spiral non - contrast - enhanced low - radiation - dose ct scan (0.8-second rotation time, 120 kvp, variable ma with automa technique, 3.75-millimeter slice thickness and 1.75 : 1 pitch) were acquired, first, for anatomical references and attenuation correction. then, the pet emission images were acquired after ct scans at 2 minutes per field of view (fov) in the 3-dimensional acquisition mode with eleven - slice overlap at the borders of the fov. the ct images were reconstructed onto a 512 512 matrix, and then converted to a 128 128 matrix, 511-kev - equivalent attenuation factors for the attenuation correction of the corresponding pet emission images. then, the pet images were reconstructed to the same thickness of ct images, 3.27 millimeter transaxial slice thickness for further interpretation. a semiquantitative parameter, standardized uptake value (suv), was defined as the " tracer activity in the target region per unit mass, divided by the amount of injected radioactivity, per unit body mass ". the maximum standardized uptake value (suvmax) was calculated from each region of interest with increased f - fdg radioactivity. a 46-year - old female of gravida 3 and para 3 visited our emergency department with complaints of massive vaginal bleeding and abdominal fullness in july 2011. the pelvic examination revealed an exogenous mass lesion over the upper third of the vagina with malodorous discharge. colposcopic biopsy of the cervical lesion revealed a poorly differentiated, large - cell neuroendocrine cervical carcinoma. an f - fdg pet / ct scan was performed, subsequently, for the demonstration of possible metastases and shown in figure 1. the tumor was clinically staged as international federation of gynecology and obstetrics (figo) stage iva.. pelvic examination found an area of easy bleeding over the uterine cervix, without parametrial extension, 4 cm in its largest dimension (figo stage ib2). a pre - treatment primary lesion was detected on the f - fdg pet / ct scan, as shown in figure 2. four months later, the progression of disease was evidenced by multiple lymph node and bone metastases. she was admitted for salvage chemotherapy, and was given cisplatin (500 mg / m) and 5-fu (1000 mg / m). she expired 24 months after the initial diagnosis. a 66-year - old postmenopausal woman, with a diagnosis of stage iia large - cell neuroendocrine cervical carcinoma was treated with radical hysterectomy, concurrent chemotherapy and radiation. ten months after she completed her treatment, general weakness and abnormal laboratory data were noted. f - fdg pet / ct scan, as shown in figure 3 was arranged for detecting possible metastases, and it revealed multiple f - fdg - avid lesions in the mediastinum, liver, and abdominal lymphatic chain. a 46-year - old woman was presented to our gynecology department with complaints of intermittent vaginal spotting and a malodorous vaginal discharge for 2 months. the pathological finding was small - cell neuroendocrine cervical carcinoma. computed tomography scan revealed enlarged lymph nodes in the bilateral internal iliac and the left common iliac regions. however, she developed oliguria and was found to have acute renal insufficiency related to obstructive nephropathy. the f - fdg pet / ct scan of this patient is shown in figure 4. in addition to the primary tumor seen in the pelvis, the enlarged lymph nodes shown on a ct scan were hypermetabolic. the patient is currently receiving palliative chemotherapy consisting of cisplatin (50 mg / m), doxirubicin (50 mg / m) and etoposide (75 mg / m). a 42-year - old female presented with a right vaginal septum of about 2.3 2.0 0.5 cm in size, around the middle to lower third of the vagina on the annual exam. according to her statement, she suffered from painful sensation during sexual intercourse and post - coital bleeding for nearly 2 years. radical resection was done on december 7th, 2009. the first f - fdg pet / ct scan is shown in figure 5. the treatment plan for this patient, which consisted of six courses of chemotherapy with concurrent radiation and four courses of brachytherapy, was completed on march 4th, 2010. however, mildly elevated carcinoembryonic antigen, 19.13 ng / dl, was noted six months later. she underwent a second f - fdg pet / ct scan, which showed an f - fdg - avid lesion in the right side of the uterine cervical region. a 46-year - old female of gravida 3 and para 3 visited our emergency department with complaints of massive vaginal bleeding and abdominal fullness in july 2011. the pelvic examination revealed an exogenous mass lesion over the upper third of the vagina with malodorous discharge. colposcopic biopsy of the cervical lesion revealed a poorly differentiated, large - cell neuroendocrine cervical carcinoma. an f - fdg pet / ct scan was performed, subsequently, for the demonstration of possible metastases and shown in figure 1. the tumor was clinically staged as international federation of gynecology and obstetrics (figo) stage iva. a 28-year - old female suffered from malodorous vaginal spotting for one month. pelvic examination found an area of easy bleeding over the uterine cervix, without parametrial extension, 4 cm in its largest dimension (figo stage ib2). a pre - treatment primary lesion was detected on the f - fdg pet / ct scan, as shown in figure 2. four months later, the progression of disease was evidenced by multiple lymph node and bone metastases. she was admitted for salvage chemotherapy, and was given cisplatin (500 mg / m) and 5-fu (1000 mg / m). a 66-year - old postmenopausal woman, with a diagnosis of stage iia large - cell neuroendocrine cervical carcinoma was treated with radical hysterectomy, concurrent chemotherapy and radiation. ten months after she completed her treatment, general weakness and abnormal laboratory data were noted. f - fdg pet / ct scan, as shown in figure 3 was arranged for detecting possible metastases, and it revealed multiple f - fdg - avid lesions in the mediastinum, liver, and abdominal lymphatic chain. a 46-year - old woman was presented to our gynecology department with complaints of intermittent vaginal spotting and a malodorous vaginal discharge for 2 months the pathological finding was small - cell neuroendocrine cervical carcinoma. computed tomography scan revealed enlarged lymph nodes in the bilateral internal iliac and the left common iliac regions. however, she developed oliguria and was found to have acute renal insufficiency related to obstructive nephropathy. the f - fdg pet / ct scan of this patient is shown in figure 4. in addition to the primary tumor seen in the pelvis, the enlarged lymph nodes shown on a ct scan were hypermetabolic. the biopsy of this lesion showed metastastic neuroendocrine carcinoma. the patient is currently receiving palliative chemotherapy consisting of cisplatin (50 mg / m), doxirubicin (50 mg / m) and etoposide (75 mg / m). a 42-year - old female presented with a right vaginal septum of about 2.3 2.0 0.5 cm in size, around the middle to lower third of the vagina on the annual exam. according to her statement, she suffered from painful sensation during sexual intercourse and post - coital bleeding for nearly 2 years. radical resection was done on december 7th, 2009. the first f - fdg pet / ct scan is shown in figure 5. the treatment plan for this patient, which consisted of six courses of chemotherapy with concurrent radiation and four courses of brachytherapy, was completed on march 4th, 2010. however, mildly elevated carcinoembryonic antigen, 19.13 ng / dl, was noted six months later. she underwent a second f - fdg pet / ct scan, which showed an f - fdg - avid lesion in the right side of the uterine cervical region. the clinical characteristics, treatment modalities and outcome data of the five patients with neuroendocrine cervical - vaginal carcinoma are listed in table 1. five cases of cervical neuroendocrine carcinoma were retrospectively collected within two years (from september 2009 to august 2011) at our hospital. the mean age of these patients at initial diagnosis was 44.8 years (range, 28 - 62 years). the clinical staging distributions were figo stage ib2 (1/5, 25%), stage iia (3/5, 75%) and stage iva (1/5, 25%). only one patient underwent radical hysterectomy (1/5, case 3), followed by postoperative concurrent chemotherapy and radiation therapy. two patients (2/5, cases 2 and 5) received concurrent chemotherapy and radiation therapy, one patient (1/5, case 4) received palliative chemotherapy and one patient (1/5, case 1) received palliative radiotherapy. the f - fdg pet / ct scan was performed after radical hysterectomy in case 3 ; therefore, no primary lesion was detected. 5), respectively. the mean suvmax of primary lesions was 5.89 in the early images, and 8.68 in delayed images. distant metastases were presented in the pretreatment f - fdg pet / ct scan in case 1 and 4. in case 1, the highest suvmax (11.46), the fdg - avid lesion with a highest suvmax (5.08) in the 3 phase was noted in the right iliac lymph nodes. the restaging f - fdg pet / ct in case 2 and 3 revealed previous unknown distant metastatic disease. the clinical characteristics, treatment modalities and outcome data of the five patients with neuroendocrine cervical - vaginal carcinoma are listed in table 1. five cases of cervical neuroendocrine carcinoma were retrospectively collected within two years (from september 2009 to august 2011) at our hospital. the mean age of these patients at initial diagnosis was 44.8 years (range, 28 - 62 years). the clinical staging distributions were figo stage ib2 (1/5, 25%), stage iia (3/5, 75%) and stage iva (1/5, 25%). only one patient underwent radical hysterectomy (1/5, case 3), followed by postoperative concurrent chemotherapy and radiation therapy. two patients (2/5, cases 2 and 5) received concurrent chemotherapy and radiation therapy, one patient (1/5, case 4) received palliative chemotherapy and one patient (1/5, case 1) received palliative radiotherapy. the f - fdg pet / ct scan was performed after radical hysterectomy in case 3 ; therefore, no primary lesion was detected. 5), respectively. the mean suvmax of primary lesions was 5.89 in the early images, and 8.68 in delayed images. distant metastases were presented in the pretreatment f - fdg pet / ct scan in case 1 and 4. in case 1, the highest suvmax (11.46), the fdg - avid lesion with a highest suvmax (5.08) in the 3 phase was noted in the right iliac lymph nodes. the restaging f - fdg pet / ct in case 2 and 3 revealed previous unknown distant metastatic disease. carcinoma of the uterine cervix is a common gynecologic malignancy with squamous cell histology, accounting for the majority of the cases. most cases of the uterine cervical carcinoma can be detected at an early stage of the disease by a pap smear test. early - stage squamous cell carcinoma of the uterine cervix has good prognosis and outcome. however, cervical - vaginal neuroendocrine tumors show evidence of distal metastases in the early stage disease (3 - 5). these tumors exhibit aggressive behavior, with early hematogenous and lymphatic metastases. in a recent analysis of the data from the surveillance epidemiology and end results program of the u.s. national cancer institute, it was stated that the neuroendocrine tumors of the uterine cervix are extremely aggressive, and that the survival is poor regardless of the stage at diagnosis, when compared with squamous cell types (6). a retrospective study, which enrolled 31 patients in northern taiwan, demonstrated that the 2-year and 5-year survival rates were 54.8% and 31.5%, respectively, for all types of cervical neuroendocrine tumor (7). this phenomenon, including poor prognosis and metastases in the early stages, was also observed in our patients. the staging methods of the figo system depend on conventional procedures, including plain chest radiography, barium enema, intravenous urography, lymphangiography, cystoscopy, proctoscopy, and physical examination, under general anesthesia. however, the figo system is inherently inaccurate in the advanced stage disease, and does not address nodal involvement. therefore, the expected roles of preoperative imaging are evaluation of invasion to the adjacent organs and assessment of the nodal involvement and distant metastases. some recent studies reported that primary uterine cervical cancers have an avid uptake of f - fdg with the suvmax, ranging from 4.0 to 33 (8 - 10). in our study, the suvmax of the primary cervical - vaginal neuroendocrine tumor ranged between 2.2 and 9.6. apparently, we can not differentiate the primary cervical - vaginal neuroendocrine tumors from primary uterine cervical cancers empirically based on suvmax. however, the metastatic patterns of these two types of tumors may have different appearances. the carcinoma of the uterine cervix is believed to typically advance with local growth and lymphatic spread initially, and by blood - borne metastases in the late stages. tumor emboli spread orderly to peri - cervical, obturator, presacralthe hypogastric, external iliac, para - aortic, and then supraclavicular lymph nodes (12). in the late stages, hematogeneous dissemination could happen, and mostly commonly, to the lung, liver, and bone. on the contrary, the dissemination of cervical - vaginal neuroendocrine tumor seems not develop in an orderly manner. the neuroendocrine tumor can be associated with hematogeneous spread even when no evidence of lymphatic spreading of the tumor is noted. in our study, there are multiple bone metastases without lymph nodes involvement in case 1. in case 4, metastatic lesion in the left breast there are few articles concerning mri findings in cervical - vaginal neuroendocrine tumor (13, 14).. demonstrated preoperative mri findings in seven patients with small cell neuroendocrine cervical carcinoma. in their study, 71% of patients had parametrial invasion and 86% of patients had lymphadenopathy even with small size of primary tumor. to the best of our knowledge, no study has been made to compare the diagnostic accuracies of cervical - vaginal neuroendocrine tumor, between f - fdg pet scan and magnetic resonance (mr) images. for the common types of squamous cervical cancer, a prospective study investigated the efficacy of f - fdg pet scan in comparison with mr images of patients, with newly diagnosed (35%) or recurrent (65%) cervical cancer (15), which showed f - fdg pet scan with significant superiority to that of the mri - ct in identifying metastatic lesions, although, the diagnostic accuracy was similar for local tumors. the pretreatment f - fdg pet / ct scan, which can reveal abnormal f - fdg uptake, consistent with nodal disease, is a robust predictor of disease recurrence and may alter the therapeutic management (16). the advantage of the whole body survey in an f - fdg pet / ct scan may be more important in the staging of cervical - vaginal neuroendocrine tumor, since hematogenous spread can occur early in this type of tumor. therefore, we considered that f - fdg pet / ct scans may be more appropriated than the local mr images for detecting the possible distant metastases, despite no evidence of local lymph node involvement. in our study, two cases were restaged (cases 1 and 4, shown in table 1) after f - fdg pet / ct scan. in case 4, however, several f - fdg - avid areas in the bilateral iliac, the retroperitoneal regions, and the left breast were demonstrated in the f - fdg pet / ct scan, which altered the therapeutic management. the patient received palliative chemotherapy for systemic metastases, and is still alive (as of november 2011, 11 months after initial treatment). multiple modalities, such as radical hysterectomy and node dissection, adjuvant chemotherapy, chemoradiation and brachytherapy for neuroendocine tumors, have recently been shown to improve local control and survival rates. however, the optimal treatment has not yet been completely clarified. approximately 30% of uterine cervical cancers eventually relapse, after the initial treatment (17). the recurrence rate in cervical - vaginal neuroendocrine tumor is even higher (18). follow - up protocols, including physical examination, evaluation of the serum tumor markers, ultrasonography, ct and/or mri, have certain limitations. f - fdg pet scan or f - fdg pet / ct scan is a valuable tool in the case of suspected recurrence of cervical cancer. cumulative data on 431 patients showed that f - fdg pet scan had the mean sensitivity of 94.7%, the mean specificity of 83.7% (60 - 100%), and the mean diagnostic accuracy of 87.9% (70 - 97.2%) for the detection of recurrences in the uterine cervical cancers (19). a retrospective study enrolled 40 patients, who were suspected of having cervical cancer recurrence (20). the f - fdg pet / ct scans in these patients (squamous or adenosquamous type on histology examination) provided higher sensitivity and accuracy rates than that of the conventional imaging (p < 10), with a sensitivity of 94% for pet / ct scan, compared to 42.5% for the conventional imaging. three patients (cases 2, 3, and 5) were suspected of having recurrence in our study, and they underwent a second f - fdg pet / ct scan. despite completion of the treatment (both chemotherapy and radiotherapy), rapid recurrence and lymph node metastases in the pelvis, para - aortic lymphatic chain and mediastinum were demonstrated in the second f - fdg pet / ct scan. two patients died from the disease within two years (21 months and 24 months), despite the ongoing treatment. stage and treatment in cervical - vaginal neuroendocrine tumor remain to be determined because of the rarity of this type of cancer. here, we described five cases of cervical - vaginal neuroendocrine tumor with early lymph node metastases and poor prognosis, despite multiple modalities of treatment planning. f - fdg pet / ct scan is a useful tool in cervical - vaginal neuroendocrine tumor. in initial staging, the f - fdg pet / ct scan may assess the possible nodal involvement or early hematogenous spreading, which altered the figo stage. we can also use the f - fdg pet / ct scan to detect local recurrence and to evaluate the treatment response after clinical manipulations. the limitations of our study are small case numbers and short - term follow - up stage and treatment in cervical - vaginal neuroendocrine tumor remain to be determined because of the rarity of this type of cancer. here, we described five cases of cervical - vaginal neuroendocrine tumor with early lymph node metastases and poor prognosis, despite multiple modalities of treatment planning. f - fdg pet / ct scan is a useful tool in cervical - vaginal neuroendocrine tumor. in initial staging, the f - fdg pet / ct scan may assess the possible nodal involvement or early hematogenous spreading, which altered the figo stage. we can also use the f - fdg pet / ct scan to detect local recurrence and to evaluate the treatment response after clinical manipulations. the limitations of our study are small case numbers and short - term follow - up. | objectiveneuroendocrine cervical carcinoma is a rare subtype of cervical cancer. these tumors exhibit an aggressive behavior with early regional lymph node and distant metastases. the purpose of our study was to describe five cases of neuroendocrine cervical - vaginal carcinoma and to discuss the potential of the 2-[18f ] fluoro-2-deoxy - d - glucose positron emission tomography / computed tomography (18f - fdg pet / ct) scan for the detection of this rare malignancy.materials and methodsfive cases of cervical - vaginal neuroendocrine tumor were retrospectively collected, during a two year (from september 2009 to august 2011) period in our hospital. the clinical staging distributions were international federation of gynecology and obstetrics (figo) stage ib2 (1 of 5), stage iia (3 of 5) and stage iva (1 of 5).resultstwo cases (cases 1 and 4) were restaged after 18f - fdg pet / ct scan in the initial staging process. post - treatment 18f - fdg pet / ct scans, in three patients, revealed positive findings for tumor recurrence or lymph node metastases. two patients (cases 2 and 3) died of tumor within two years.conclusion18f-fdg pet / ct scan is a useful tool in cervical - vaginal neuroendocrine tumor. in its initial staging, the 18f - fdg pet / ct scan may help assess the possible nodal involvement or early hematogeneous spreading. we can also use the 18f - fdg pet / ct to detect local recurrence and to evaluate the treatment response after clinical manipulation. |
switches between different phenotypes and their underlying states of gene transcription occur as cells respond to intrinsic developmental cues or adapt to changing environmental conditions. post - translational modification of the master regulatory transcription factors that define the initial phenotype is a common strategy to direct such transitions. emerging evidence indicates that the modification of key transcription factors by the small polypeptide ubiquitin plays a central role in many of these transitions1, 2. however, the molecular mechanisms by which ubiquitination regulates the switching of promoters between active and inactive states are largely unknown. ubiquitination of the yeast transcriptional repressor 2 is necessary to evoke the transition between mating - types3, and here, we dissected the impact of this modification on 2 dynamics at its target promoters. the ubiquitination of 2 does not alter dna occupancy by depleting the existing pool of the transcription factor, despite its well - characterized function in directing repressor turnover. rather, 2 ubiquitination plays a direct role in the rapid removal of the repressor from its dna targets. this disassembly of 2 from dna depends on the ubiquitin - selective aaa - atpase cdc48. our findings expand the functional targets of cdc48 to active transcriptional regulatory complexes in the nucleus, a far broader role than previously anticipated. these data reveal an ubiquitin - dependent extraction pathway for dismantling transcription factor - dna complexes and provide an archetype for the regulation of transcriptional switching events by ubiquitination. |
|
t2 dm is one of the most prevalent chronic diseases worldwide and accounts for 9095% of all diabetes cases. it encompasses individuals who have insulin resistance and usually have relative rather than absolute insulin deficiency. however, the underling mechanism of t2 dm is poorly understood, and the present prevention and treatment of the disease are not effective. the evidence of high prevalence of human cytomegalovirus (hcmv) infection in t2 dm patients and hcmv dna existing in cells suggest that viral infection plays an important role in the development of the t2 dm. hcmv is a member of the beta - herpesvirus family, which contains a large double - stranded dna genome. hcmv is ubiquitous, with seropositivity rates ranging from 40% to 100% in adults globally. like other herpesviruses however, as an important opportunistic pathogen, it is a major cause of morbidity and mortality among immunocompromised patients, such as patients with acquired immunodeficiency syndrome (aids) and recipients of solid organ and stem cell transplantation [57 ]. congenital hcmv infection is a leading non - genetic cause of sensorineural hearing loss in children. previous research has found that nucleic acid sequences specific for hcmv can be located in the islets of the pancreas. hcmv infection can result in inflammation by inducing immune reactions, eventually those leading to apoptosis of islets -cells, suggesting that hcmv can infect and damage -cells. therefore, hcmv infection, by causing the deficit and increased apoptosis of -cells, may be associated with t2 dm. however, the effect of human cytomegalovirus infection on t2 dm remains unclear and controversial [1,2,1113 ]. hcmv seropositivity with detectable igg antibodies to hcmv correspond with hemoglobin a1c (hba1c) and non - fasting glucose levels in patients with t2 dm. moreover, little is known about the role of acute hcmv infection in development of t2 dm. previous studies confirmed that accumulated hcmv burden, which normally presents as high hcmv igg titers, is linked to a variety of chronic diseases or symptoms, including increased rate of cognitive decline, functional impairment (e.g., in activities of daily living), frailty in older women, and all - cause and cardiovascular disease mortality. high hcmv igg titer also has a significant association with hypertension and coronary artery disease in cardiovascular disease (cvd) [2123 ]. metabolisms, hypertension, ageing, overweight, and obesity have been confirmed to be risk factors for cvd in diabetes patients. however, the effect of high hcmv igg titers on development of atherosclerosis in t2 dm patients has received little research attention and remains undefined. given the high prevalence of hcmv infection in people with t2 dm worldwide, and in view of the controversial and unclear relationship between hcmv infection and t2 dm, we conducted a cross - sectional study in patients with t2 dm. our aims were to assess the effects of active hcmv infection on glucose regulation in people with t2 dm and to study the role of hcmv infection in development of diabetic atherosclerosis among people with t2 dm. a total of 222 hospitalized patients with diabetes mellitus type 2 treated at the department of endocrinology, wuhan general hospital of guangzhou military command were recruited into the study between march 2014 and july 2014. the diagnosis of t2 dm was based on the diagnosis and classification of diabetes mellitus formulated by the american diabetes association in 2013. patients with diagnosed malignant disease, autoimmune disease other than diabetes mellitus, or immunosuppression were excluded. hypertension was diagnosed as a sitting systolic blood pressure 140 mm hg and/or a diastolic blood pressure 90 mm hg, or having medication history of using antihypertensive drugs. this study was approved by the ethics committee of wuhan general hospital of guangzhou military command. clinical data were collected, including age, sex, duration of diabetes mellitus, body mass index (bmi), smoking, and history of hypertension. blood samples were taken to test fasting blood glucose (fbg), postprandial blood glucose (pbg), c - peptide, hemoglobin a1c (hbalc), total cholesterol (tc), triglycerides (tg), high - density lipoprotein cholesterol (hdl - c), and low - density lipoprotein cholesterol (ldl - c). blood samples were also used for determining hcmv infection, including hcmv dna and igg antibody. dna from peripheral blood leukocytes (pbl) (separated by lymphoprep, axis - shield) was extracted according to the manufacturer s protocols (axygen, hangzhou, china). the nested pcr procedure and primers for amplification of hcmv ie gene samples determined to be hcmv dna - positive were further examined for viral load by quantitative pcr performed on a cfx96 real - time system device (bio - rad, usa). primers for the hcmv (strain ad169) ie gene amplification were designed using primer premier 5.0 software and synthesized by the sangon biotech company (shanghai) as primer 1(5-tttagcacgggccttagcct-3) and primer 2 (5-gctgcatgatgtgagcaaggg-3). each reaction sample had a final volume of 15 ul, consisting of 7.5 ul of master mix, 0.3 ul primers, 4.9 ul of distilled water, and 2 ul of the respective dna. pcr amplification was performed using these steps : initial denaturation at 94c for 3 min, followed by 40 cycles of (denaturation at 94c for 15 s, annealing at 62c for 15 s, and elongation at 72c for 15 s), and a final elongation at 72c for 15 min. a standard graph was constructed and the hcmv dna copy number was calculated according to a previously published protocol. hcmv igg titers were measured by use of a commercial chemiluminescence test kit (anti - cytomegalovirus antibody, immediate early, clone 6f8.2, roche diagnostics gmbh) according to the manufacturer s directions. among the 222 patients, igg titers were measured successfully in 206 participants (16 patients did not have hcmv igg concentration tested due to hemolysis) ; 204 were seropositive and the concentration of hcmv igg was > 1 u / ml (the remaining 2 participants were 1 u / ml (the remaining 2 participants were 1 u / ml). patients seropositive for hcmv igg were further categorized into 4 groups according to quartiles of hcmv antibody concentrations (u / ml) : group 1 with 51 patients (hcmv antibody concentrations 1126 u / ml), group 2 with 51 patients (127276 u / ml), group 3 with 45 patients (277499 u / ml), and group 4 with 57 patients (> 500 u / ml).the prevalence of diabetic atherosclerosis in different hcmv igg concentration groups was studied and we found that the prevalence of the atherosclerosis was significantly different among these 4 groups (p=0.002). we further examined the incidence of diabetic atherosclerosis within the groups, and significant differences were observed between group 1 and group 2 (p=0.014), as well as between group 1 and group 4 (p=0.0004). however, no significant difference was found between group 1 and group 3 (p=0.109). patients with higher hcmv igg concentrations were more likely to develop atherosclerosis (figure 1). according to the results shown above, a significant difference was found in atherosclerosis morbidity among the 4 groups with different hcmv igg titers, suggesting that hcmv igg concentration is associated with the development of diabetic atherosclerosis. we further analyzed the potential confounding risk factors of atherosclerosis in t2 dm patients with and without atherosclerosis. therefore, clinical data (sex, age, smoking, hypertension, bmi, tc, tg, hdl - c, ldl - c, and lipoprotein) of 222 patients with t2 dm were studied. the data showed that the median hcmv igg titers were higher in the atherosclerosis group than in the group without atherosclerosis [313.6 (159.2 > 500) u / ml vs. 159.2 (60.3366.1) u / ml, p=0.00045 ]. the patients with atherosclerosis (61.411.3 years) were older than the patients without atherosclerosis (45.714.6 years), (p 500. higher igg titer was an independent risk factor of atherosclerosis after adjustment for confounding risk factors (except for age) compared with the lowest hcmv igg quartile (500 u / ml and 127276u / ml igg titer were significantly associated with atherosclerosis. however, the p - value (0.073) was on the boundary for hcmv igg titers of quartile 3 (277499 u / ml) compared with the lowest quartile after adjustment for age (or=2.6, 95%ci : 0.97.5). we further categorized the igg titers into 2 groups (127 u / ml) ; hcmv antibody titers were significantly associated with diabetic atherosclerosis both in the unadjusted analysis and after adjustment for all confounding factors analysis (p=0.001 and p=0.001, respectively), and patients with hcmv igg titers > 127u / ml have a median - fold of 4.6 (95%ci : 1.911.3) increased incidence of atherosclerosis. therefore, titer > 127 u / ml of hcmv igg is an independent risk factor for the development of diabetic atherosclerosis (tables 3, 4). in the present study, the seroprevalence of hcmv igg was 99.0% (204/206), indicating a very high prevalence of hcmv infection in the t2 dm population. to determine if there is an association between hcmv infection and t2 dm, we first investigated the effect of active hcmv infection on glucose regulation in t2 dm. detection of hcmv dna in serum by nested pcr is considered as a marker of active hcmv infection. the patients with active hcmv infection were significantly younger than the patients without hcmv active infection (54.114.9 and 59.113.2, respectively) (p=0.028). we also compared the duration of the t2 dm, fbg, pbg, hba1c, and c peptide or 2-h c peptide, and no statistically significant differences were observed between the 2 groups (with and without active hcmv infection) (table 1). active hcmv infection showed no correlation with the glucose regulation according to the aforementioned results. therefore, we further investigated whether persistent hcmv infection had an effect on the diabetic atherosclerosis of t2 dm, using hcmv - specific igg as an indicator for long - term hcmv infection. hcmv igg titers were detected in 206 serum samples from 206 t2 dm patients ; 99.0% (204/206) of patients showed evidence of hcmv infection (hcmv igg titer > 1 u / ml). patients seropositive for hcmv igg were further categorized into 4 groups according to quartiles of hcmv antibody concentrations (u / ml) : group 1 with 51 patients (hcmv antibody concentrations 1126 u / ml), group 2 with 51 patients (127276 u / ml), group 3 with 45 patients (277499 u / ml), and group 4 with 57 patients (> 500 u / ml).the prevalence of diabetic atherosclerosis in different hcmv igg concentration groups was studied and we found that the prevalence of the atherosclerosis was significantly different among these 4 groups (p=0.002). we further examined the incidence of diabetic atherosclerosis within the groups, and significant differences were observed between group 1 and group 2 (p=0.014), as well as between group 1 and group 4 (p=0.0004). however, no significant difference was found between group 1 and group 3 (p=0.109). patients with higher hcmv igg concentrations were more likely to develop atherosclerosis (figure 1). according to the results shown above, a significant difference was found in atherosclerosis morbidity among the 4 groups with different hcmv igg titers, suggesting that hcmv igg concentration is associated with the development of diabetic atherosclerosis. we further analyzed the potential confounding risk factors of atherosclerosis in t2 dm patients with and without atherosclerosis. therefore, clinical data (sex, age, smoking, hypertension, bmi, tc, tg, hdl - c, ldl - c, and lipoprotein) of 222 patients with t2 dm were studied. the data showed that the median hcmv igg titers were higher in the atherosclerosis group than in the group without atherosclerosis [313.6 (159.2 > 500) u / ml vs. 159.2 (60.3366.1) u / ml, p=0.00045 ]. the patients with atherosclerosis (61.411.3 years) were older than the patients without atherosclerosis (45.714.6 years), (p 500. higher igg titer was an independent risk factor of atherosclerosis after adjustment for confounding risk factors (except for age) compared with the lowest hcmv igg quartile (500 u / ml and 127276u / ml igg titer were significantly associated with atherosclerosis. however, the p - value (0.073) was on the boundary for hcmv igg titers of quartile 3 (277499 u / ml) compared with the lowest quartile after adjustment for age (or=2.6, 95%ci : 0.97.5). we further categorized the igg titers into 2 groups (127 u / ml) ; hcmv antibody titers were significantly associated with diabetic atherosclerosis both in the unadjusted analysis and after adjustment for all confounding factors analysis (p=0.001 and p=0.001, respectively), and patients with hcmv igg titers > 127u / ml have a median - fold of 4.6 (95%ci : 1.911.3) increased incidence of atherosclerosis. therefore, titer > 127 u / ml of hcmv igg is an independent risk factor for the development of diabetic atherosclerosis (tables 3, 4). hcmv is ubiquitously distributed worldwide and 40100% of adults carry the virus with detectable hcmv igg in their serum. after primary infection, hcmv establishes latency with sporadic reactivation or exogenous reinfection in the host throughout life. in the present study, the prevalence of hcmv infection in a chinese t2 dm population was quite high and the serological positivity of hcmv igg reached 99.0%. epidemiology data showed that seroprevalence of hcmv igg was 94.9% in blood donors in the same region in china in 1991. this suggests that the prevalence of hcmv infection is probably higher in t2 dm patients than in the general population. in addition, it has been reported that the prevalence of hcmv infection in t2 dm patients is also high in other countries : 77% in the usa, 89.3% in the netherlands, and 77% in the czech republic. these findings raise the question of whether hcmv is one of the pathogenic agents causing t2 dm. previous studies showed controversial results regarding the pathogenic role of hcmv infection in t2 dm. in various populations, a clear positive association between hcmv infection and t2 dm has not yet been defined. researchers found that individuals with hcmv seropositivity were more likely to have t2 dm than were hcmv - seronegative participants (17.2% vs. 7.9%, p=0.016) among people age 85 and older. an investigation in patients undergoing hemodialysis showed that t2 dm patients had a higher seroprevalence of hcmv igg (97.6%) than in patients without t2 dm, suggesting that hcmv infection may be associated with t2 dm. however, another cross - sectional study in a multi - ethnic population (hispanic, african - american, white, and chinese) found no association between hcmv igg seropositivity and occurrence of t2 dm, suggesting hcmv has no etiological role in the development of t2 dm. in addition, most studies reported that hcmv seropositivity had no correlation with glucose regulation in t2 dm patients, except for the leiden 85-plus study, which showed that t2 dm patients with hcmv seropositivity had a significantly higher level of hba1c and higher non - fasting glucose than the sero - negative patients. therefore, information regarding the long - term clinical effect of persistent hcmv infection in t2 dm patients is limited. moreover, to the best of our knowledge, little is known about the effect of active hcmv infection on glucose regulation in t2 dm patients. to date, only liang hao. have evaluated the role of active hcmv infection in development of t2 dm ; they reported that t2 dm patients with positive hcmv dna in their serum had a significantly lower fasting c peptide level than those with hcmv - negative dna, but no significant differences in blood glucose and insulin level were found between the 2 groups. this suggests that active hcmv infection may play a role in t2 dm. in consideration of the few studies and the debatable results on the effect of active hcmv infection on t2 dm, it is important to determine the role of active hcmv infection in the development of t2 dm and the long - term clinical effect of persistent hcmv infection on t2 dm. in the current study, to determine if active infection indicated by sporadic reactivation and exogenous reinfection of hcmv might affect glucose regulation, we used nested pcr to amplify hcmv dna in pbl of t2 dm patients. we found that hcmv dna was more frequently detectable in the young group than in the older age groups. it is possible that exogenous reinfection is more easily acquired in younger populations due to lifestyle behaviors that importantly affect the epidemiology of hcmv infection. exogenous reinfection can more easily occur when there is close contact with children less than 3 years old and when there is sexual exposure to multiple partners. previous studies showed that hcmv viral load is highly correlated with the risk of hcmv disease in immunocompromised individuals [3234 ]. in the present study, although active hcmv infection was more frequently detectable in young patients, no significant relationship was found with hcmv active infection or hcmv viral load with glucose regulation, including level of hba1c, fbg, pbg, and c - peptide in t2 dm patients. these findings suggest that active hcmv infection does not acutely impair glucose regulation in t2 dm patients. higher hcmv igg titers are induced by frequent hcmv reactivations or long - term hcmv infection, which are generally observed in older individuals. our research showed that higher hcmv igg titers in the t2 dm patients aged 1988 years had no impact on fbg, pbg, hba1c, c peptide, or 2-h c peptide. it seems that hcmv infection is not correlated with glucose regulation in t2 dm patients, and although a positive association between hcmv igg and glucose regulation was observed in an 85-year - old individual, this discrepancy might be due to the differences in study populations. cumulative viral burden is induced by long - term hcmv infection and frequent reactivation of hcmv. in addition, the impairment of pancreatic endocrine function caused by the chronic inflammation and immune response of hcmv infection also needs time to develop. hcmv infection probably requires the coexistence of multiple risk factors, which is most common in the elderly ; these factors importantly contribute to t2 dm. therefore, hcmv infection may more strongly influence glucose regulation in an 85-year - old than in middle - aged people with t2 dm. hcmv has a broad cell tropism and can infect endothelial cells, epithelial cells, fibroblasts cells, smooth muscle cells, and macrophages, which are considered important in pathogenesis of vascular disease. hcmv antigen and dna in atherosclerotic vessels were confirmed in previous studies [4143 ], suggesting that hcmv infection may damage vascular cells. a previous study demonstrated that the mechanistic contributions of hcmv in atherosclerosis involve not only pro - atherosclerotic effects caused by the hcmv pathogen residing in the arterial wall, but also by the increasing occurrence of systemic inflammation [4650 ]. hcmv may also damage the vasculature by an immune response caused by molecular mimicry that occurs because the antigens expressed by hcmv infection are homologous to peptides expressed on uninfected host cells [5153 ]. thus, hcmv infection may play a role in progression of atherosclerosis via the aforementioned mechanisms. cell - specific anti - cytomegalovirus response has been found to be associated with cvd related to atherosclerosis. recent studies have reported that male patients undergoing vascular surgery for atherosclerosis had a higher hcmv igg titer than a matched control group of patients with high cholesterol levels. moreover, high anti - hcmv igg titer detected by enzyme - linked immunosorbent assay (elisa) was correlated with the carotid intima - media thickness (imt) and elastic pressure modulus in patients with carotid atherosclerosis. therefore, higher hcmv igg titers may predict post - coronary balloon angioplasty restenosis and may become a predictor for the highest quartile of carotid intima - media thickness in hiv - infected patients with low hiv viral load after anti - virus treatment. however, in the study of puz, anti - hcmv igg titers were not associated with atherosclerotic lesions, symptomatic stenosis, or unstable plaque in the carotid arteries. although most of the aforementioned studies demonstrated a positive relationship between high hcmv igg level and atherosclerosis in patients with cvd, little is known about whether hcmv igg level is an independent risk factor for diabetic atherosclerosis in t2 dm. patients with t2 dm are likely to have poor glycemic control, dyslipidemia, smoking history, and hypertension ; these promoters have been confirmed to be associated with atherosclerotic cardiovascular disease [5860 ]. mmol / l and hdl - c 0.88 mmol / l, have a significantly increased incidence of cvd. a 1997 study by frank. showed that patients with diabetes mellitus type 1 or 2 with clinical manifestations of atherosclerosis had a higher prevalence of hcmv igg and higher igg antibody titers than patients without atherosclerosis. in the present study we found that patients with higher hcmv igg titers corresponded to the incidence of atherosclerosis in t2 dm. our regression analysis demonstrated that hcmv igg titer is an independent risk factor for atherosclerosis in t2 dm patients after adjustment for important covariates, such as age, duration of dm, hypertension, and hdl - c. patients with t2 dm often have hyperglycemia and dyslipidemia, which are major contributors to atherosclerosis. our logistic regression analysis results suggest that t2 dm patients with hcmv infection are more likely to develop atherosclerosis. risk factors such as hypertension, smoking, dyslipidemia, and aging, which have been generally been the focus of endocrinologists in preventing atherosclerosis, are increasing the occurrence of diabetic atherosclerosis in t2 dm. importantly, we found that titer > 127 u / ml of hcmv igg is an independent risk factor for diabetic atherosclerosis in t2 dm patients (or=4.6, 95%ci : 1.911.3). this could help guide preventive treatment in order to avoid the serious consequences of atherosclerosis in t2 dm patients. this might have the potential to lead to a new treatment for vascular complications, directed at antiviral therapy of hcmv or prevention by vaccination in t2 dm patients. the present study demonstrates that active infection and reactivation of hcmv have no influence on clinical manifestations or glucose regulation in t2 dm patients. however, high anti - hcmv igg titers are associated with incidence of atherosclerosis in patients with t2 dm. titer > 127 u / ml of hcmv igg might be an independent risk factor for increasing diabetic atherosclerosis in t2 dm. the interpretation of our results is limited because this was a cross - sectional study. therefore, a large - scale prospective investigation is necessary to further confirm and extend our findings. | backgroundat present, whether human cytomegalovirus (hcmv) infection is associated with type 2 diabetes mellitus (t2 dm) is debatable. the effect of active hcmv infection on glucose regulation has been poorly studied. although hcmv infection is correlated with atherosclerosis in cardiovascular disease, the role of hcmv infection in the development of diabetic atherosclerosis in t2 dm is unclear and is usually neglected by endocrinologists. the aim of this study was to assess the effects of hcmv infection on glucose regulation and the development of diabetic atherosclerosis in t2 dm patients.material/methodsa total of 222 hospitalized t2 dm patients were enrolled. nested polymerase chain reactions were used to detect hcmv dna extracted from peripheral blood leukocytes. quantitative real - time pcr was used to determine viral load. hcmv igg antibody concentrations were analyzed by chemiluminescence immunoassay.resultshcmv active infection, viral load, and hcmv igg titers were not correlated with glucose regulation. binary logistic regression demonstrated that the highest quartile of hcmv igg concentration (> 500 u / ml) was correlated with the incidence of diabetic atherosclerosis (or : 8.0, 95%ci : 2.327.2), and that titer > 127u / ml of hcmv igg is an independent predictor for the development of diabetic atherosclerosis in t2 dm patients (or : 4.6, 95%ci : 1.911.3) after adjustment for all potential confounding factors.conclusionsactive hcmv infection is unlikely to influence glucose regulation in t2 dm. however, hcmv igg titers are associated with the incidence of diabetic atherosclerosis, and titer > 127u / ml of hcmv igg might be an independent risk factor for the development of diabetic atherosclerosis in t2 dm patients. |
distance between two genes was defined as the number of base pairs between their gene midpoints. relative distance refers to the distance of a tsg or a noncancer gene from an oncogene divided by the radius distance. the gene labels were randomly shuffled 10,000 times to generate new positions of oncogenes, tsgs and noncancer genes for the calculation of p - value. gene density is the number of tsgs or noncancer genes in a radius of specified distance divided by the radius distance. average density is the total number of all tsgs or noncancer genes on a particular chromosome divided by the length of that chromosome. a tumor types with cna profiles obtained by whole - genome sequencing were included in the present study. level 3 distance between two genes was defined as the number of base pairs between their gene midpoints. relative distance refers to the distance of a tsg or a noncancer gene from an oncogene divided by the radius distance. the gene labels were randomly shuffled 10,000 times to generate new positions of oncogenes, tsgs and noncancer genes for the calculation of p - value. gene density is the number of tsgs or noncancer genes in a radius of specified distance divided by the radius distance. average density is the total number of all tsgs or noncancer genes on a particular chromosome divided by the length of that chromosome. a tumor types with cna profiles obtained by whole - genome sequencing were included in the present study. | abstractfocal copy number gains or losses are important genomic hallmarks of cancer. the genomic distribution of oncogenes and tumor - suppressor genes (tsg) in relation to focal copy number aberrations is unclear. our analysis revealed that the mean distance of tsgs from oncogenes was significantly shorter than that of noncancer genes, suggesting that oncogenes and tsgs tend to be in close physical proximity in the human genome. such relationship was conserved in mouse and drosophila. pan - cancer analysis using data from the cancer genome atlas indicated that oncogenes without a nearby tsg are more prone to amplification. in conclusion, our study provides evidence for the nonrandom distribution of oncogenes and tsgs across different species. our data also support that the existence of a neighboring tsg can suppress amplification of an oncogene, shedding new light on a previously unappreciated protective mechanism of tsgs. |
it is incidentally found in autopsy specimens and surgical specimens with cryptorchidism and testicular germ cell tumor. this non - neoplastic lesion is usually seated in the mediastinum and septal part of the rete testis. it may present as a very small lesion detected in microscopic examination or a solid - cystic mass lesion which is macroscopically evident. in microscopic evaluation cryptorchidism was unilateral and the other testis was normal. there were no clinical or endocrine abnormalities. the testis measured 4 2.5 2.2 cm in size and there was no tumoral lesion in gross examination. on the cut section close to the testis parenchyma, there was a gland like tubular structures. some of these were in back - to - back position with little intervening stroma. the testicular parenchyma was comprised of seminiferous tubules that had sertoli cells only and no spermatozoa (fig. ema (novocastra ; 1/150, clone gp 1.4, newcastle, united kingdom) and pankeratin (novocastra ; 1/150, clone ae1/ae3, newcastle, united kingdom) immunohistochemical stains were performed for diagnosis. adenomatous hyperplasia of the rete testis is a benign lesion which can appear at any time during life and was first described by nistal.. it is important to recognize tumor - like lesions of the rete testis to make an accurate differential diagnosis whether the lesion is benign or malign. ahrt etiology is not well understood yet but there seem to be associated conditions such as cryptorchidism, some kidney diseases, and germ cell tumors. our case was cryptorchid and seminiferous tubules near the lesion were lined by only sertoli cells and had no spermatozoa. the authors reported an adult case with ahrt in unilateral testis with no luminal spermatozoa. there are different cases such as prostate adenocarcinoma or embryonal carcinoma together with ahrt in the literature [6, 7 ]. the true epithelial proliferation with gland - like or papillary proliferations replacing normal epithelium, continuous architecture of normal rete testis with adenomatous hyperplasia and lack of signs of malignancy are the proper diagnostic criteria for ahrt. in our case the differential diagnosis should include adenoma, papillary adenoma, primary and metastatic adenocarcinoma and rete testis cystic transformations with epithelial metaplasia. clinical history, localization, histologic features and immunohistochemistry are criteria for differentiating these lesions. complete surgical resection is the proposed therapy for ahrt cases and no report for recurrence has been identified. in conclusion, adenomatous hyperplasia of the rete testis is a rare lesion that can be confused with malignancy and should be remembered in the differential diagnosis of rete testis lesions. | there are several tumor - like lesions and miscellaneous neoplasms of the rete testis. we present a case with adenomatous hyperplasia of the rete testis (ahrt). the patient was 24 years old with undescended testis and was referred to our hospital. there were no clinical or endocrine abnormalities. cryptorchidism was unilateral and the other testis was normal. right orchiectomy was performed and sent to the pathology laboratory for examination. morphologic and immunohistochemistry findings confirmed the diagnosis of ahrt in this case. the patient 's postoperative course continues uneventfully. ahrt is a rare lesion and can be confused with malignancy. it is incidentally detected in microscopic investigation. it may present as a very small lesion detected in microscopic examination or a solid - cystic mass lesion which is macroscopically evident. clinical history, localization, histologic features and immunohistochemistry are criteria for differentiating these lesions.we present this rare case for both surgeons and pathologists due to its importance as it can be confused with malignancy. |
non - steroidal anti - inflammatory drugs (nsaids) are one of the most commonly prescribed drugs in the world for their analgesic and anti - inflammatory properties. however, nsaid has limitation in prescribing because of gastrointestinal (gi) toxicity. recently, nsaid - induced enteropathy has gained much attention due to the introduction of new emerging diagnostic modalities, capsule endoscopy (ce) and device assisted enteroscopy as well as due to the increased use of aspirin and nsaids. recent ce studies have demonstrated nsaid use in healthy volunteers raised the incidence (55% to 75%) of intestinal damage.1 - 6 nsaid - induced enteropathy has been under - examined or even ignored in clinical situation before the times of ce. previous attention or studies have focused primarily on upper gi events but recent researches have shifted to the small bowel and colon during chronic nsaid use. proton pump inhibitor (ppi) ca n't protect nsaid - induced intestinal injuries below treitz ligament while ppi is very helpful to reduce nsaid - induced gastroduodenal damages.7 until now, no medications are available yet to prevent or heal nsaid - induced intestinal injuries. it is important to extend the understanding about small bowel and colonic injuries associated with nsaid because all clinician, especially gastroenterologists, should have thorough knowledge of the gi toxicity of nsaids. it has been known that lower gi events accounted for one - third of all clinically relevant gi events. nsaid - induced lower gi complications (perforation, bleeding, or obstruction) are increasing while upper gi complications are decreasing.7 in fact, the ratio of upper / lower was 4.1 in 1996 and it has decreased to only 1.4 in 2005.7,8 current evidences suggest that nsaids increase the risk of lower gi bleeding and perforation to a similar extent to that seen in the upper gi tract.9 post - hoc analysis of a large - scale clinical outcome trial showed that lower gi events accounted for 40% of all serious gi events in patients on nsaids.10 there were notable ce studies in short - term nsaid users as well as chronic nsaid users. goldstein.5 reported that small bowel mucosal breaks were induced in 55% of healthy volunteers who had taken naproxen for 2 weeks. maiden.4 reported that 2-week ingestion of slow release diclofenac resulted in macroscopic injury to the small intestine in 68% to 75% of healthy volunteers. graham.3 performed ces in arthritic patients who had been using nsaids for at least 3 months and reported as high as 71% for the incidence of small intestinal mucosal injury after chronic nsaid administration. the japanese study group for double - balloon endoscopy reported that nsaid - induced enteropathy occurred in half of the patients taking nsaids based on the registry of a 2-year period.11 ce and double - balloon enteroscopy (dbe) findings suggest that the small intestinal mucosa is very sensitive to nsaid - induced injuries (table 1). the pathogenesis of nsaid - induced enteropathy is distinct from that of nsaid - induced gastropathy. unlike stomach, nsaid - induced lower gi injuries are not caused by sup - pression of prostaglandin synthesis due to inhibition of cyclo - oxygenase (cox) activity12,13 but, most of the time, by gram negative bacteria and bile.4 - 22 bjarnason.15 proposed a " three hit " hypothesis. first, nsaids solubilize lipids of phospholipids on the mucosal surface, so the epithelial mitochondria are directly damaged. second, the mitochondrial damage depletes intercellular energy and leads to calcium efflux and to induction of free radicals, a disruption of intercellular junctions occurs, and mucosal permeability increases in the small intestinal mucosa. third, the mucosal barrier becomes weakened, so bile acid, proteolytic enzymes, intestinal bacteria, or toxins can easily penetrate into the epithelial cells, resulting in mucosal injury. nsaid - induced small intestinal injuries augment through the enterohepatic circulation of the nsaid (fig. nsaids affect the entire gi system and can often cause various abdominal symptoms such as epigastric pain, nausea, indigestion, constipation, and abdominal distension.13 multiple ulcers and erosions are common nsaid - induced small intestinal lesions.14 ulceration often occurs in the gi tract without symptoms because of analgesic effect of nsaids. aspirin itself can also cause stomach and duodenal ulcers, but it is generally believed that aspirin does not usually cause small bowel damage according to intestinal permeability and fecal inflammatory marker studies and aspirin does not have enterohepatic circulation.14 enteric coated aspirin was originally designed to decrease adverse effects on the stomach, but the use of enteric coated aspirin may have shifted the damage to the distal small bowel. low dose aspirin is not safe, and chronic low dose aspirin use induced small bowel enteropathy that has many striking similarities with nsaid - induced enteropathy.23 nsaids were found to induce obscure overt gi bleeding which manifests as hematochezia or melena, or occult obscure gi bleeding, as positive guaiac fecal occult blood test or anemia of unknown etiology.24 nsaid - induced enteropathy is one of the most common causes of obscure gi bleeding.24 nsaid - induced enteropathy might be suspected strongly in patients with obscure gi bleeding and recent history of taking aspirin or nsaids. ce sensitively detects nsaid - induced small intestinal injuries such as red spot, erosion, and ulcer, while nsaid - induced small intestinal injuries are not specific in endoscopic findings and nsaid - induced ulcer is hard to differentiate from other causes of ulcer such as crohn 's disease. nsaid - induced small intestinal bleeding can be effectively controlled by a device assisted enteroscopy (fig. concentric diaphragmatic stricture is thought to be the pathognomonic symptom of nsaid injury.25 clinical presentation of diaphragm disease is nonspecific and may be presented with obstructive symptoms. it develops from scarring reaction secondary to ulcerative injury during long - term nsaid use. the histological features of the diaphragm - like stricture include fibrosis in the submucosa and thickening of the muscularis mucosa.26 since the muscularis propria layer is intact, the risk of intestinal perforation is low with endoscopic balloon dilation, which is why it is a preferred treatment modality than surgical intervention.27 capsule can be retrieved successfully by enteroscopy in case of the capsule entrapment. in randomized trials in patients with rheumatoid or osteoarthritis, diverticulitis and diverticular bleeding are the most common etiologies of nsaid - induced lower gi injuries, accounting for 30% to 50% of all serious gi events associated with nsaids.28 case control studies have shown a significantly higher prevalence of nsaid use with complications of diverticular diseases (diverticulitis and bleeding) compared to controls - their risk estimates varied widely with odds ratios ranging from 1.8 to 16.7 regular use of aspirin or nsaids was associated with increased risks of diverticulitis and diverticular bleeding.7,29 nsaids can induce a variety of abnormalities including ulcerations, perforations, bleeding, and diaphragm - like strictures in the human small intestine.7 difficulties in accessing the entire small intestine prevented comprehensive evaluation of the extent and localization of nsaid - induced small intestinal injury, however. thus, prior to the advent of ce and small bowel enteroscopy, most studies had to rely on surrogate markers such as urinary excretion of chromium-51-labeled ethylenediaminetetraacetic acid, which shows intestinal permeability and fecal level of calprotectin, a proposed marker of intestinal inflammation.30,31 calprotectin is a 36 kda calcium - binding protein constituting up to 60% of the cytosolic proteins in neutrophil granulocytes and plays an important role in inflammatory processes.32 it is excreted in feces and remains stable against bacterial degradation.33 the presence of calprotectin in feces is a consequence of neutrophils ' migration into the gi tissue.33 but now, with ce, we can easily locate the site of injury and evaluate the incidence rates and types of injuries. endoscopic findings of nsaid - induced enteropathy include reddish erosion, multiple sharply demarcated ulcer and concentric stenosis. nsaid - induced small intestinal lesions on ce include denuded areas, erosions and ulcers (fig. a denuded area is defined as a reddened area without villi.4 maiden.4 classified ce findings into five categories : reddened folds, denuded area, red spot, mucosal break, and blood. graham.3 divided ce findings into red spots, small erosions, large erosions, and ulcers, and they found mucosal lesions in 13 out of 21 patients (62%) with chronic nsaid use. small lesions such as erosions and red spots are detected more often by ce than dbe. previous efforts have focused primarily on gi events in the upper gi tract, but recently, efforts have been made to reduce nsaid - induced small bowel and colon injuries including mucosal damage, ulceration, overt bleeding, obstruction / perforation, protein - loss and occult blood loss (with an associated decrease in hemoglobin). fujimori.34 demonstrated the benefit of treatment with misoprostol in a small pilot study in which small intestinal damage was assessed by ce. misoprostol co - therapy reduced the incidence of small intestinal lesions induced by a 2-week administration of diclofenac sodium in healthy subjects. their subjects were gastric ulcer patients who were orally taking low dose, enteric coated aspirin. they were treated with ppi for 8 weeks, but all patients had redness and erosions in the small intestine on ce at 8 weeks. when misoprostol was administered instead of ppi for additional 8 weeks selective cox-2 inhibitors (coxibs) were introduced to the marketplace in the mid-1990s with a promise of improved gi safety. goldstein.5 reported that 2-week regimen with celecoxib, a selective coxib, caused less small intestinal injury than a regimen using naproxen. selective coxibs were believed to be less injurious than nonselective nsaids in the small bowel as well as in the stomach, but maiden.1 found no difference in the incidence of small intestinal injury between chronic users of nonselective nsaids and selective coxibs. selective coxibs are selective, but not exclusive, and thus have some cox-1 inhibitory activity. further studies with large samples are needed to decide whether or not selective coxibs can entirely control gi toxicity. niwa.36 conducted a prospective, double - blind study of ce using a mucosal protective agent, rebamipide, in healthy subjects. it was found that subjects who received placebo had significantly more mucosal injuries in the small intestine compared to those who received rebamipide. mucosal protecting agents such as teprenone, rebamipide, and irsogladine showed protective effect against nsaid - induced small intestinal injuries according to animal experiments using rats ; more specifically, the increase in inos mrna expression and myeloperoxidase activity due to indomethacin was inhibited by pre - treatment with these mucosal protecting agents.24 several strategies have been tried to develop new compounds with improved gi tolerability. several companies are developing drugs that co - release an nsaid (naproxen, aspirin, or ibuprofen) and a ppi (omeprazole, esomeprazole, or lansoprazole) ; these compounds are already filed with the fda or in very late stages of development.37 these compounds have been shown to reduce the incidence of nsaid - induced gastropathy but not enteropathy. (houston, tx, usa) has taken a strategy to reduce the topical irritant property of nsaids and has developed nsaids that are associated with phosphatidylcholine.38 extensive animal works have demonstrated that phosphatidylcholine - nsaids are less likely to damage the gi epithelium in rodents, and produce less severe mucosal injury while retaining the anti - inflammatory effects of the parent nsaid. in a randomized, double - blind, endoscopy study, ibuprofen preassociated with phosphatidylcholine showed superior gi toxicity than an equivalent dose of ibuprofen in the subgroup of patients older than 55 years.39 the discovery that nitric oxide (no) is a potent gastroprotective substance that modulates many aspects of gi mucosal defense led to the development of no releasing nsaids, which are also referred to as cox - inhibiting no donors.40 the compound has shown improved gi tolerability in some but not all clinical trials. like no, hydrogen sulfide (h2s) has been shown to exert protective effects in the gi tract and to accelerate the healing of preexisting ulcers. h2s - releasing nsaids, derivatives of naproxen, diclofenac, and indomethacin have been reported.41 - 43 phosphatidylcholine associated nsaids as well as no- and h2s - releasing nsaids are under extensive preclinical testing for their influence on nsaid - induced enteropathy. further studies are warranted to develop promising new nsaid with total gi (upper and lower gi tracts) tolerability and without cardiovascular toxicity. nsaids are one of the most commonly prescribed drugs in the world for analgesic and anti - inflammatory properties. previous studies have focused primarily on upper gi events ; but recently, nsaid - induced enteropathy has gained much attention due to the introduction of new emerging diagnostic modalities, ce and device assisted enteroscopy. lower gi events accounted for 40% of all serious gi events in patients taking nsaids.14 ce studies have demonstrated nsaid use in healthy volunteers raised the incidence (55% to 75%) of intestinal damage.1 - 6 unfortunately, however, ppi ca n't protect nsaid - induced intestinal injuries below treitz ligament ; selective coxibs improved upper and lower gi safety according to results of clinical trials,23 but coxibs are still capable of triggering gi adverse events and are still concerned to be associated with cardiovascular toxicity issues. thus, there is still a strong clinical need for effective anti - inflammatory drugs with superior safety profiles than the existing nsaids. | non - steroidal anti - inflammatory drugs (nsaids) are one of the most commonly prescribed drugs in the world. nsaid - induced lower gastrointestinal (gi) complications are increasing while upper gi complications are decreasing. lower gi events accounted for 40% of all serious gi events in patients on nsaids. capsule endoscopy and device assisted enteroscopy are available for detection of small intestinal lesions. capsule endoscopy studies have demonstrated that nsaids use in healthy volunteers raised the incidence (55% to 75%) of intestinal damage. it appears that selective cyclooxygenase-2 inhibitors (coxibs) improved upper and lower gi safety based on results of clinical trials. selective coxibs are still capable of triggering gi adverse events and cardiovascular toxicity issues were the main focus of concerns. unfortunately, definite strategies are not available to prevent or heal nsaid - induced intestinal injuries. thus, there is still a strong clinical need for effective drugs with improved safety profiles than the existing nsaids. |
a consensus has been sought from the data analyses in order to establish a standard for nutritional support in cancer. however, the term " nutritional support " has been applied almost exclusively for the use of total parenteral nutrition, instead of the entire modalities of nutrition intervention, including nutritional supplementation and enteral nutrition. moreover, several methodological errors have been shown, which has produced certain controversy in the data interpretation. despite the inconsistencies observed, the general indications of nutrition support in cancer have resulted in guidelines and recommendations published in the medical literature. the authors have reviewed 28 prospective randomized and controlled clinical trials evaluating the use of parenteral nutrition in cancer patients. the authors have concluded that parenteral nutrition can be used in the pre - operative period in patients having cancer of the gastrointestinal tract and it is beneficial in the reduction of major surgical complications and surgical mortality. on the other hand, no statistically significant benefit could be demonstrated in survival rate, treatment tolerance, treatment toxicity, and treatment response from patients submitted to chemotherapy and radiation therapy. indeed, there was an increase of the risk of infection in patients submitted to chemotherapy and receiving parenteral nutrition, underscoring the importance of demonstrating significant benefits in randomized trials before parenteral nutrition is used routinely in these patients. twenty - two of these studies were reported in full paper form and 6 as abstracts only. the quality of reporting was poor, with only 46% of applicable items being reported between the surgery, chemotherapy, or radiotherapy trials. based on the adopted criteria for data evaluating, the review has showed the following characteristics : 1) 73% of the studies showed eligibility criteria, 41% indicated the source of patients, and 77% gave the patient characteristics ; 2) the treatment plan was often clearly defined in 86% of the trials, but only 36% gave details of the therapy actually received ; 3) although the study objectives were described adequately in 77% of the studies, only 14% clearly described the method of randomization ; 4) no study described the use of a second party review or even an internal review of the data. 5) basic statistical methods were reported in 64% of the studies, but an in - depth description was reported in only 27% of the studies ; 6) prognostic factors were used in analyzing the study results in 36%, but this usually involved a subgroup analysis only, and 7) the statistical power was discussed only in 1 of the 22 trials. in addition, the authors stated that the review : a) does not rule out a possible positive effect of parenteral nutrition in cancer patients submitted to chemotherapy and radiotherapy ; b) has identified a small sample size in individual studies and the inability to group the data related to the end points, resulting in a high probability of not detecting a therapeutic effect, and c) has showed that patients severely malnourished were excluded from several studies, therefore reducing significantly the chances to identify the potential effect of parenteral nutrition in those patients with significant weight loss or unable to maintain an adequate nutritional intake. the second review is a position paper from the american college of physicians. a total of 12 randomized and controlled trials were evaluated to estimate the effects of parenteral nutrition on survival and tumor response rates in patients undergoing chemotherapy. the end points were efficacy and effectiveness of the method and safety, which result in recommendations known as ceap statement (clinical efficacy assessment project statement). the ceap evaluates and informs college members and others about the safety and efficacy of diagnostic and therapeutic modalities and medical practices. the ceap statements represent a synthesis of the literature and expert opinion and are intended to reflect the current state - of - the - art knowledge concerning technology and medical practice. the results of the pool analysis have shown that parenteral nutrition did not improve the tumor response rate and patients receiving parenteral nutrition were 81% as likely to survive as control patients. for short - term survival (3 months), the best estimate of the odds ratio was 0.74, (with 95% confidence limits ranging from 0.42 to 1.3). reviewed, the use of parenteral nutrition was associated with four times the increased risk of significant infection. the pooled odds ratio was 4.1, with 95% confidence limits of 2.4 to 6.9. although the recognition of considerable heterogeneity of patients, neoplasms, and circumstances of parenteral nutrition administration in the reviewed trials, and the reduced global number of patients, the formal statements and recommendations were : - the routine use of parenteral nutrition for patients undergoing chemotherapy should be strongly discouraged ; - as most of patients in the studies reviewed were not severely malnourished, the net effect of parenteral nutrition in these patients is unknown, and - clinical trials with subgroups of patients or modifications of parenteral nutrition can only be justified if such research provides valid arguments that the effect of parenteral nutrition support will be different than that observed to date. the third review is the american society for parenteral and enteral nutrition (aspen) 's guidelines for the use of parenteral and enteral nutrition in adult and pediatric patients. it is recommending the following practice guidelines : - enteral tube feeding and parenteral nutrition support may benefit some severely malnourished cancer patients or those in whom gastrointestinal or other toxicities are anticipated to preclude adequate oral nutritional intake for more than 1 week. patients who are candidates for nutrition intervention under these circumstances should receive nutrition support, if possible, in conjunction with the initiation of oncologic therapy ; - specialized nutrition support is not routinely indicated for well - nourished or mildly malnourished patients undergoing surgery, chemotherapy, or radiation treatment and in whom adequate oral intake is anticipated, and - tpn is unlikely to benefit patients with advanced cancer whose malignancy is documented as unresponsive to chemotherapy or radiation therapy. for the studies analyzed in the reviews, the conclusion drawn was correct : tpn was not beneficial. however, many people misinterpreted the conclusions without understanding the nuances of the issues being considered. this led, in turn, to erroneous assumptions about appropriate nutrition management in cancer patients in general. more recently, studies have been published suggesting the need to consider quality of life (qol) as end point in cancer trials [5 - 8 ]. the studies evaluating efficacy and effectiveness are taking into account the tumor response rate, survival, and qol assessment as well. the use of qol questionnaires has significantly modified the methodological procedure in cancer clinical trials. therefore, the indication criteria for nutrition support must also incorporate the qol assessment. klein and koretz brought first the idea that qol assessment should be present in clinical trials involving nutrition support in cancer patients. the authors reviewed 70 prospective randomized controlled trials of nutrition support in more than 4000 cancer patients and they found the same results as previously described. however, the authors highlighted the following shortcomings associated with the reviewed studies : - the statistical power of most studies was poor because of small sample size and most trials were unlikely to demonstrate a therapeutic effect of parenteral nutrition even if parenteral nutrition was efficacious ; - the patient population enrolled in the studies was heterogeneous consisting of patients with different tumor types and stages of disease ; - the composition of nutrients, timing of nutrition intervention, and duration of nutrition therapy differed among studies, making it difficult to pool data and to evaluate the efficacy of the method ; - specific cancer therapy varied among studies, therefore increasing the possibility of confounding the conclusions made after grouping studies together ; - the patient populations were not stratified in accordance with their nutritional status, and in many trials the patients were not limited to those who might benefit most from nutrition support, that is, those with severe weight loss ; - the quality of reporting most studies was poor ; - quality of life and other additional endpoints were rarely evaluated. in which extension nutrition support can improve qol in cancer patients, even knowing that the traditional end points will not be substantially modified ? the use of qol questionnaires developed to best evaluate qol in cancer patients has addressed this issue [10 - 16 ]. in a study published elsewhere, our group prospectively compared the qol effects of nutrition support in one hundred - forty - six patients with head and neck cancer submitted to radiotherapy receiving protein - caloric supplementation in routine basis (pcs). briefly, protein - caloric supplementation in a routine basis (pcs) was administered to 72 patients (pcs group). the supplementation consisted of a polymeric formula containing 794 cal and 6,72 g n2, which was daily supplemented with the regular supervised diet beginning seven days before radiotherapy continuing seven days after the last day of treatment. the control group (n = 74) received nutritional counseling and supervised diet with no nutritional supplementation. the qol was evaluated using the european organization for research and treatment of cancer quality of life questionnaire (eortc qlq c-30) in three instances : one week before radiotherapy (a1), 30 days (a2) and 60 days (a3) after the beginning of therapy. this tool is composed of both multi - item scale and single item measures that range in score from 0 to 100. a high score for a functional scale (physical functioning, and emotional functioning) represents a high / healthy level of functioning, high score for the global health status represents high qol, and high score for a symptom scale (fatigue, pain, and appetite loss) represents a high level of symptomatology / problems. statistical analysis was performed using the t - test for paired samples and the student t - test. the pcs group had high scores in physical functioning and emotional functioning and low scores in the scale of appetite loss. in contrast, the control group showed a persistent low score in physical functioning and a high score in the symptom scale such as fatigue, pain and appetite loss. in the analysis of global health status, the pcs group showed a high score and the control group showed a low score. the results have showed that protein - caloric supplementation in a routine basis improved the qol in head and neck cancer patients submitted to radiotherapy and should be considered as a useful supportive practice. moreover, these findings support the idea that studies related to the effects of nutrition support in cancer should incorporate the qol assessment as a primary endpoint. quality of life scores for each group the questionnaire is composed of both multi - item scale and single item measures that range in score from 0 to 100. a high scale score represents a higher response level for physical functioning and emotional functioning. a high score for the global health status represents high qol. a high score for fatigue, pain, and appetite loss represents a high level of symptoms. statistically significant results in pcs group pre - treatment period vs. post - treatment period (p < 0.05). statistically significant results in pcs group vs. control group at the post - treatment period (p < 0.05) spc protein - caloric supplemented group. based on the results of qol evaluation in cancer patients, the indications of nutrition support should be expanded and reviewed. the criteria to prescribe nutrition support have to take into account the following aspects : 1) related to the effectiveness of the anti - neoplastic therapy : - stage i curative, that is, the anti - neoplastic treatment is potentially curative - stage ii advanced stage disease, that is, the tumor response rate is low due to the aggressive behavior of the cancer or the staging of the disease - stage iii no therapy to be offered, that is, there is no effective therapeutic strategy and usually the treatment is supportive (for instance, anti - hemorrhagic radiotherapy) - stage iv terminal, that is, the end stage disease leaving the patient severely limited in his functions 2) related to the nutritional status - b at risk of malnutrition the nutritional assessment should be performed using the global subjective assessment or through the following criteria : - nourished : absence of weight loss of more than 5% of the usual body weight in the last 30 days - at risk of malnutrition : weight loss of 510% of body weight within the last 30 days - malnourished : weight loss of more than 10% within the last 30 days the patients should be further classified as shown in table 2. classification of nutritional status : nutrition support should be indicated based on the stage of the oncologic process and the nutritional status. the standard criteria for indication of nutrition support would follow the scheme below : ia, iia, iiia, iva follow up (periodical nutritional assessment) ib, iib, iiib, ivb protein - caloric supplementation and/or appetite stimulants ic, iic, iiic nutritional therapy (enteral nutrition, total parenteral nutrition, and peripheral parenteral nutrition) ivc enteral fluids / venous fluids (hydration) patients submitted to bone marrow transplantation and those undergoing gastrointestinal surgery are not targeted by these criteria. in both groups, standard criteria to indicate nutrition support in cancer patients should be implemented and qol assessment is an unconditional tool to determine the target population. therefore, nutrition support teams should consider qol benefits as an endpoint in further studies of the role of nutrition support in cancer. | the indications of nutrition support in cancer patients have been subject to controversy. most studies address the effects of the method in increasing the survival or the tumor response rate. few studies have focused on the effects in improving quality of life.after a brief review, we described the results of a study, which evaluated the effects of protein - caloric supplementation on the quality of life parameters in a group of head and neck cancer patients submitted to radiotherapy. the results support the suggestion of creating standard criteria to indicate nutrition support in cancer patients.based on our findings, nutrition support should be indicated for cancer patients considering the potential effects to improve the quality of life. |
conceptual methods for the correlation of binding affinities with drug structure (3d - qsars) are vital to the drug development process. the approaches include receptor - based methods, e.g., free energy perturbation, the linear response method, and the mining minima approach, and ligand - based methods for unknown receptors, e.g., comparative molecular field analysis (comfa). the methods have been developed and perform satisfactorily for the binding data measured with isolated macromolecules. unfortunately, binding affinities for isolated macromolecules are often unavailable because the receptors have not yet been identified, can not be isolated without denaturation or dissociation, or do not work in aqueous solutions. in such situations, more complex assays are used, deploying receptors reconstituted in lipid vesicles as the simplest system or utilizing intact cells, tissues, organs, or organisms. the effective concentrations of the drugs in the receptor surroundings vary among the studied compounds because of interactions with nonreceptor assay constituents. drug disposition has often been neglected in modeling the bioactivities measured in complex systems. at best, the 1-octanol / water partition coefficients and their squares, and sometimes the dissociation constants, as properties affecting the disposition, have been included in simplified linear forms. in many cell - level studies, 3d - qsar methods have been applied without any correction for ligand disposition or empirical models with various descriptors have been deployed. here, we propose a straightforward solution to the problem of qsar modeling of cell - level data : extend the proven 3d - qsar methods by accounting for the varying ligand disposition in the receptor surroundings using the disposition function (df). the conceptual cell - qsar approach is based on a new correlation equation combining the 3d - qsar expression and the df, whereby the coefficients in both parts can be optimized either simultaneously or separately if the uptake data are available. the exact form of the correlation equation depends on the kinetics of the processes underlying the drug effects and on the complexity of studied compounds (common skeleton, similarity of substituents, ability to ionize and form tautomers), as discussed in the methods. the df describes the kinetics of drug disposition and relates the dose or the initial concentration to the concentration in the receptor surroundings (see eq 2 in the methods). the first df forms were peak - shaped dependencies, on logarithmic scales, of the drug concentration inside the receptor compartment, which was separated from the dosing compartment by a few bilayers, on lipophilicity (the reference partition coefficient). these dependencies represented the basis of the first qsar techniques, such as the hansch approach and related methods. subsequently, other parameters, including the ionization constant, the exposure time, the metabolic rate parameters, the ratio of the partition coefficients in alkane / water and 1-octanol / water systems, and the polar surface area as descriptors of h - bonding ability, the partition coefficient between phosphatidylcholine headgroups and hexadecane as a predictor of bilayer localization and partitioning, the membrane - interaction qsar parameters, the polarizability, the cross - sectional area of the molecule, and numerous others, were added. the df functional forms developed from the parabolic, bilinear, nonequilibrium, equilibrium, and mixed models to the pseudoequilibrium df. some of these dfs predicted reliably outside the used property ranges, in contrast to empirical models. the df can also be calibrated independently using the data on cellular uptake and disposition, which are obtained by various experimental approaches. high - content screening techniques provide more detailed information than classical uptake experiments, as demonstrated for the disposition of a small library of lipophilic, fluorescent compounds in living hela cells. structure - dependent phenomena, such as active influx or efflux and metabolism, could be captured in this process. the additional effort to obtain and fit the disposition data can be spared in situations when the disposition is not complicated by structure - dependent phenomena. then the df depends on drug properties characterizing the bilayer transport and accumulation, nonspecific protein binding, hydrolysis, and other nonenzymatic reactions. an appropriate df can be selected from the armoire of available models and can be calibrated simultaneously with the 3d - qsar model using the cell - level data. this approach is demonstrated here using the selwood data on filaricidal activities of analogues of antimycin a, which inhibits mitochondrial electron transport and oxidative phosphorylation and induces apoptosis. these data are regarded as difficult to model and are frequently used to validate qsar methods on the basis of variable selection. the descriptive ability of the generated models did not exceed 6080% of the explained variance, so there is space for improvement. to the best of our knowledge, this cell - qsar study represents the first attempt at the qsar modeling of drug effects in complex systems, where both drug receptor interactions and drug disposition significantly vary among studied compounds and both are conceptually treated using a common correlation equation. the studied compounds, listed in table 1, have varying substituents, r1, on the phenol ring and large lipophilic substructures, r2, which replace a complex dilactone moiety of the parent compound. the compounds can be formally divided into three groups : two - ring analogues (23 and 31), three - ring analogues (216 and 2630), and alkyl - chain analogues (1, 1722, 24, and 25). the salicylamide moiety, present in all compounds except 31, exhibits a peculiar intramolecular h - bonding. two types of intramolecular h - bonds are formed, depending upon ionization of the hydroxyl (figure 1). clogp - predicted 1-octanol / water partition coefficient p. sparc - predicted acidity of the phenolic hydroxyl. affinities and disposition function values predicted from the df - msmm comfa model. conformational switching of an intramolecular h - bond in the salicylamide ring of antimycin derivatives upon ionization. the hydroxyl pka values (table 1) of the studied antimycins were estimated by the sparc method, which seems to take the intramolecular h - bond into account. the magnitude of the pka values (range 4.68.0) is determined mainly by the electron - withdrawing ability of the r1 substituents on the phenol ring, with the r2 substituents exhibiting a slighter influence. under neutral conditions, the compounds are present in the aqueous solution as a mixture of ionized and nonionized species, with the balance shifted toward the ionized species for most compounds, except compounds 1, 2, 4, 9, and 1719 having pka > 7. formation of tautomers and carbonyl hydrates was negligible, according to the sparc estimates ; otherwise, they would be included in the model in the same way as ionization. table 1 also contains the activities spanning almost 3 orders of magnitude and the 1-octanol / water partition coefficients p (clogp estimates for neutral molecules). antimycin a is a known inhibitor of oxidative phosphorylation. therefore, we examined whether the selwood data could be explained by our two - decade - old, conceptual qsar model for uncouplers. the model describes isoeffective concentrations eliciting a given degree of uncoupling as a nonlinear function containing lipophilicity (p) and acidity (pka). although the surface generated by the fit to the data was reminiscent of the expected shape, the deviations of individual compounds were too large to consider the fit satisfactory. we hypothesized that the deviations were caused by structure - specific interactions with an unknown receptor ; therefore, we decided to deploy a ligand - based 3d - qsar method. the cell - qsar correlation equation for the simplest drug effect scenario consists of the product of the drug receptor association constant k and the df (eq 3 in the methods). the receptor is unknown in this case, so k was expressed using one of the popular ligand - based methods, comfa. the antimycin analogues ionize to different degrees and are flexible ; therefore, we applied our multispecies (ms), multimode (mm) modification of comfa. the pseudoequilibrium form of the df (eq 10 in the methods), treating absorption as an instantaneous process, was chosen, because no lag phase was observed in the time course of toxicity. an additional reason for selecting this df form was the ability of the underlying model to handle speciation of the ligands. pharmacophores obtained for all species using the galahad procedure, which performs flexible superposition based on the active analogue approach, indicated that the salicylamide moieties are closely superimposed in all cases. this outcome is consistent with the apparent importance of this moiety for inhibition : an analogue capable of h - bond formation (figure 1) inhibited the cytochrome bc1 complex activity in submitochondrial particles much stronger than a similar analogue lacking this ability. a rigid compound that preferably exhibits a high activity would be very useful for guiding the superposition of the ligands. the three - ring compounds contain more rigid aromatic rings than other compounds, so we selected the most active compound in this group and in the entire series (7) as the template. because the pharmacophore - generating procedure did not provide clues about the conformation of the lipophilic fragments connected to the salicylamide ring, we used the low - energy conformations of compound 7 as the assumed bound conformations. this step is associated with the risk that the overall spatial organization of the binding site model may not completely correspond to that of the actual receptor. while the binding points will be positioned appropriately around individual rigid rings of the template, the relative positions of the individual groups of points surrounding the rigid fragments may differ from those of the actual receptor because of possible fragment rotations. this drawback would not affect the predictive ability of the model for compounds which can adopt the template conformation without significant conformational strain. the conformational space of compound 7 is characterized by four torsions (figure 2). conformational analysis identified the minimum - energy conformations for the h - bonded forms of both neutral and ionized molecules (figure 1). the common minimum conformations of ionized and neutral species without the intramolecular h - bonds were also looked up, for the possibility that the hydroxyl and the amide groups would interact with the receptor instead of forming the intramolecular bond. two skeleton conformations appear for each of the two species : one closed via the intramolecular h - bond and one open without the h - bond. four torsions of compound 7 (table 1) characterizing the conformations of three - ring analogues displayed in red color (c3c4c11o12), 2 (c11n13c15c20), 3 (c17c18o22c23), and 4 (c18o22c23c28). closed and open it has long been recognized that flipping of symmetrical rings with asymmetrically placed substituents results in similar but distinct bound geometries. if the receptor structure is unknown, preferred geometries can not be selected a priori and all geometries should be considered in model building. a total of 16 of 31 studied compounds (table 1) have substituents in meta - positions on either the middle ring (27, 9, 10, 12, 1416, 26, and 28) or the third ring (13 and 27). for these compounds, rotation of the asymmetrically substituted ring by 180 led to doubling of the existing two modes. the four basic templates of compound 7 were superimposed by the atom fit method in sybyl (figure 3b) to ensure the best overlap of the salicylamide moieties, as suggested by the generated pharmacophore. all other molecules were superimposed on the templates using the flexs procedure (figure 3c, d). superposition procedure : (a) four basic templates of compound 7, generated by conformational analysis and numbered as in table 2 ; (b) superposition of the four basic templates ; (c) superpositions of all compounds (table 1) to the four basic templates in respective species and conformations, numbered as in row a ; (d) final superpositions, enriched by flipping the benzene rings by 180 for the msmm situation (i ; 200 molecules = 31 compounds 2 species 2 skeleton conformations 1, 2, or 4 ring - flipping conformations), the mm situation (ii ; 100 molecules created as in situation i but with 1 species), and the standard one - mode situation (iii ; 31 molecules). the analysis is based on the correlation equation obtained by taking the logarithm of eq 3 (x = 0.5 because the ec50 values are modeled), with the association constant k expressed by eq 9, and the df given by eq 10 (the exposure time t = constant) combined with eqs 11 and 12. for both the receptor - binding and disposition parts, ionization is included and the coefficients are optimized simultaneously. optimization examines two forms of the df, for the aqueous phases (shown in eq 10) and membranes. if the receptors are localized in a membrane and the compounds bind to them from the hydrocarbon core of the bilayer, eq 10 needs to be multiplied by p (p is the reference partition coefficient and is the collander coefficient, which is one of the optimized regression coefficients) the water and membrane variants of eq 10 are initially used in fully expanded form : each of the coefficients a d is replaced by eqs 11 and 12. the optimization proceeds with gradual forward selection of energies in relevant grid points in the comfa part, which is done separately for the two forms of the df. the better df is selected on the basis of the statistical criteria and further optimized by omitting the parameters with higher standard deviations, if the elimination does not cause a significant decrease in statistical criteria. one, or sometimes both, of the coefficients c and d, describing lipophilicity - dependent and lipophilicity - independent elimination, can frequently be omitted. in each pair of coefficients a d (eq 11), the term for one species may or may not be significant. the combinatorial search for the best df - msmm comfa model was extensive for three reasons : many possible combinations of relevant grid points need to be examined, the df can have multiple functional forms, and many sets of the initial estimates of coefficients need to be tested to avoid trapping in local minima. the best model was selected on the basis of the r and q (for the leave - one - out cross - validation in the training set, used to eliminate unstable models) values and the number of optimized coefficients and and their standard deviations. for illustration, there were 65 021 models with r 0.6, 11 142 models with r 0.8 and q 0.6, and 3752 models with r 0.9 and q 0.7, of which 25 models had less than 11 coefficients, each with smaller than 60% standard deviation. the best df - msmm comfa model contained the df for the compounds interacting with the receptors in a membrane, with metabolism that was either insignificant or invariant for the studied compounds (c = 0 and d = 0), and five required comfa grid points. the final, pruned correlation equation, resulting from eq 3 (x = 0.5), with the association constant k expressed by eq 9 (the subscript i was omitted for fractions f), and the df given by eqs 1012, was1the first term is an msmm comfa expression for the receptor binding (log k), and the remaining terms describe disposition (log df). the fractions of ionized and nonionized molecules, f1 and f2, respectively, include the pka values and the optimized ph value as shown in eq 12 and are identical in both receptor - binding and disposition terms. the microscopic association constant kij for each of the m considered modes is represented by a k - summand. each of the k - summands contains five identical adjustable coefficients, c1c5, which, for the selected grid points (coordinates in table 3), multiply the energies xijkl for the given modes. the addition of multiple modes does not increase the number of optimized coefficients ; it only changes the form of the correlation equation by increasing the number of k - summands. nonlinear regression analysis resulting in eq 1 provided the following outcome for the best df - msmm model. for the receptor - binding expression, the results are summarized in table 3. the optimal values of the disposition - describing coefficients for the df were a1 = (7.142 2.213) 10, a2 = (2.636 1.254) 10, b1 = (9.989 4.233) 10, and ph 7.56 0.32. the optimization of the collander coefficient and the coefficient c0 did not lead to a sufficient improvement, so their values were fixed as = 1 and c0 = 0. the description statistics, calculated for the training set, consists of the sum of squares of errors (sse), where the error is the difference between calculated and experimental values, and the squared correlation coefficient (the coefficient of determination, equal to the percentage of explained variance) r = 1 sse / syy, where syy is the sum of squares of deviations of the experimental log k values from their average. the prediction statistics contains similar indices calculated for the test set that was not used in the development of the model : predictive sum of squares of deviations between predicted and experimental values (press) and the squared correlation coefficient q = 1 press / syy. table 4 summarizes the descriptive (sse and r for the training set) and predictive (q and press for the test set) statistical criteria for the df - msmm comfa model (1) and for the reduced models (213). for comparison, the random scrambling of bioactivities (50 runs) produced no significant correlations, with the average values of sse = 11.12 and r = 0.250. optimized eq 1 also provides the affinity (log k) and disposition (log df) components of bioactivity (table 1). a test set (table 1, compounds 2, 11, 17, 20, 24, and 30) covering the entire range of biological activities was selected before optimization. the use of multiple test sets, which would be a preferred way to examine the predictive abilities of the model, was precluded by the extent of the optimization procedure. for compounds 17 and 30 with semiquantitative activities, the q and press values (table 4) were calculated using the upper limits, i.e., log(1/ec50) = 5. because only the df - msms comfa model correctly predicted log(1/ec50) 4), indicating the optimal chain length for binding. on the other hand, compounds with 1214 methylene groups (table 1, 1, 1922) bind in a packed conformation (figure 5d) that results in low affinities (table 1, log k 6 have pka > 6.5 (table 1). however, lipophilic moieties including alkyl chains and two or three ring systems also affect the binding as well as disposition, so the structure activity relationships are complex. the strongest binders, compounds 17 and 18 (table 1, log k > 4) with a 3-formylamino group in the salicylamide ring predominantly bind as neutral species in the closed conformation. the shorter alkyl chains may allow sufficient conformational freedom for these two compounds to make the best possible interactions in the binding site, leading to high binding affinities. long - chain analogues (compounds 1922 and 24, table 1) predominantly bind in ionized open conformations or sometimes in ionized closed conformations, as seen for compounds 1 and 25. all long - chain analogues exhibit low to average binding affinity, possibly because of steric clashes of long chains in packed conformations (figure 5d) with the sterically unfavorable regions in the midsection of the binding site. compounds with a 2-no2 or 5-no2 group in the salicylamide ring bind predominantly as ionized species, either in open or closed conformations, depending upon the presence of a 3-cl substituent in the second ring (the absence of which seems to be compensated by the presence of a 2-cl or 4-cf3 substituent in the third ring). compounds 3, 6, 12, 14, 26, 28, and 29 with a 3-cl substituent in the second ring mainly bind in the open conformation, although compounds 12 and 29 bind about equally in the closed conformation as well, and compound 28 shows slightly higher preference for the closed conformation. this variation is possibly affected by the presence of a carbonyl linker group between the second and third rings in compound 12 and 4-scf3 and 3-cf3 groups in the third ring of compounds 28 and 29, respectively. compounds without a 3-cl substituent in the second ring (8, 11, 13, 23, 27, and 30) bind predominantly as ionized species and show higher preference for the closed conformation. the absence of steric hindrance by a chlorine substituent in the second ring allows these compounds to assume the preferred closed conformation with an intramolecular h - bond between the amide nh and phenoxide ion. compound 16 (with a 5-no2 group in the first ring and a 3-cl substituent in the second ring) prefers to bind in the closed conformation, possibly because of the presence of a thioether linkage between the second and third rings, resulting in a longer linker. the most active in this series, compound 7 with a 5-cn substituent in the salicylamide ring, binds predominantly as an ionized species in the open conformation. the disposition of antimycins in female worms of dipetalonema viteae after 120 h of exposure can be visualized for individual compounds as the difference between the experimental log(1/ec50) values and the log k values (table 1) calculated from the affinity part of the df - msmm comfa model (eq 1). these values are plotted as a function of the drugs lipophilicity (log p) and acidity (pka) in figure 7, along with the surface given by the disposition part of the df - msmm comfa model (eq 1) with optimized coefficients. the shape of log df(p, ka) is remarkably nonlinear : it is essentially composed of interconnected planes positioned at varying angles. no further curvatures are expected, according to the model, as the planes extend in all four directions to the limit property values, so this conceptual function safely predicts outside of the property ranges. using the correct form of the df for the correlations is essential, because its peculiar shape (figure 7) is difficult to emulate by polynomials, which are too flexible to approximate the planar areas. dependence of the pseudoequilibrium, membrane - based df on lipophilicity and acidity, as given by the disposition part of eq 1 with the optimized coefficient values listed in the text. the data for best binders with poor disposition (compounds 17 and 18, table 1) are shown as open points. the resulting fit (eq 1, table 3 and accompanying text) can be interpreted as follows. the hypothetical receptors are localized in a membrane, with the drugs accessing the binding site (the comfa model in figure 5) from within the bilayer. the optimized coefficients are associated with the processes that determine drug disposition : a, with bilayer accumulation and nonspecific protein binding ; b, with accumulation in aqueous phases, with subscripts 1 and 2 indicating the relatedness to the nonionized and ionized species, respectively. the coefficient b2 was not necessary for a good fit, indicating that accumulation of ionized molecules in the aqueous compartments did not cause significant variation in overall disposition. the exponent, coming from eq 10 and containing coefficients c and d describing metabolism, need not be used in eq 1, meaning that c1 = c2 = d1 = d2 = 0. the model indicates that the pseudoequilibrium disposition of the studied compounds was not affected by metabolism, which could be either negligible or similar for all compounds. the internal ph value in terms f1 and f2 (eq 12) was optimized as ph 7.56 0.32. this high value can normally be encountered only in one part of the cell : in the matrix of mitochondria. therefore, the fit indicates that the hypothetical receptors are localized in the bilayer that is in contact with the mitochondrial matrix. this indication agrees with the current knowledge about antimycin a s mechanism of action, which focuses on inhibition of electron transport. antimycin a binds at the ubiquinone binding site qi of the complex that is located on the matrix side of the cristae membrane. notably, the disposition function provides clear guidelines for the optimization of the drug structure for the best disposition. the top plateau in figure 7 indicates the range of log p and pka values that lead to the maximum drug disposition in the receptor surroundings. the region of the maximum disposition can be defined as pka log p for log p 6 and pka 6 for log p > 6. the knowledge of suitable combinations of log p and pka values provides unique clues for optimization of drug structure, also because the lower log p and pka values will lead to increased aqueous solubility. equation 1 defines two contributions to the affinity : log k (the first term) and disposition (log df ; the remaining terms). the two contributions were enumerated from the calibrated df - msmm comfa model (eq 1 and the accompanying text, table 3), summarized in table 1, and plotted against the experimental antifilarial activities (table 1) in figure 8. dissection of affinity (log k ; red symbols) and disposition (log df ; blue symbols) contributions to overall bioactivity by the calibrated df - msmm comfa model. figure 8 and table 1 show that two weakly active compounds (17 and 18) are actually the best binders, which are held back by poor disposition. their disposition can be, in principle, increased by 45 logarithmic units, leading to overall bioactivities approaching log(1/ec50) 9.5, which is almost 2 orders of magnitude better than that of the most active compound 7. disposition is easier to optimize than binding because the former depends on lipophilicity and acidity, which are well understood in terms of drug structure. the df - msmm comfa model, and cell - qsar models in general, provides unique clues for optimization of the compounds. the cell - qsar concept adapts ligand - based and receptor - based 3d - qsar approaches for use with the bioactivities measured in cells or more complex systems. the adaptation consists of the extension of the correlation equation specific for the given 3d - qsar method by the df. the df describes changes in the concentration of compounds in the receptor surroundings originating from membrane accumulation, binding to nonreceptor proteins, hydrolysis, and possibly other processes. the cell - qsar concept was used here with the popular ligand - based comfa method. a conceptual combination of the df with our msmm extension of the comfa model was applied to antifilarial activities of antimycin a analogues, representing a part of the difficult - to - model selwood data set that is often used as a test case for assessment of new variable - selection algorithms. the fitting results are very satisfactory and show that each component of the model (df, ms, mm) improves the predictive ability. the optimized form of the disposition function indicates that the compounds bind to the hypothetical, membrane - bound receptor in the cristae bilayer of mitochondria and the differences in their metabolic rates are negligible. the perceived complexity of the selwood data set may be explained by the nonlinearity of the model in lipophilicity and acidity in combination with the lack of proper descriptors for acidity in the original set, the peculiar intramolecular h - bonds in the salicylamide moiety that differ for neutral and ionized species, and the structure - specific receptor binding. the results also illustrate the utility of the cell - qsar approach in medicinal chemistry. specifically, the cell - qsar approach delineates the affinity and disposition contributions to bioactivity, which provide for a straightforward, separate structure optimization for affinity and disposition. although further testing is necessary, the cell - qsar concept seems to be a promising direction in the structure - based or ligand - based predictions of bioactivities in cellular or more complex systems and drug structure optimization. for larger and more diverse data sets, better superposition techniques and methods for prediction of species fractions the model - based nature opens the cell - qsar concept for incorporation of any future improvements in 3d - qsar techniques and the disposition function, as well as new pharmacology and pharmacodynamic scenarios. the simplest pl / pd scenario consists of a situation when the pl phase is represented by the 1:1, fast, and reversible ligand receptor interaction and the pd phase describes the biological effect, which is a direct and immediate consequence of the drug receptor interaction and is proportional to the fraction of occupied receptors. receptor association constant k is defined using the concentrations (denoted by square brackets) of the ligand (l), receptor (r), and complex (lr) as k = [lr]/([l][r ]). in a cellular system, the free ligand concentration [l ] varies because of the disposition, and consequently, all three concentrations are time - dependent. usually, the concentrations are sufficiently low to approximate activities. if the concentration of the free receptors [r ] is expressed as the difference between the total receptor concentration [r]0 and [lr ], the fraction of occupied receptors is given as [lr]/[r]0 = k[l]/([l ] + 1) = e / emax. the latter equality comes from the simplest pd phase, describing the primary effect e as being proportional to the fraction of occupied receptors, [lr]/[r]0. secondary effects lacking this simple tie to the receptor modification require more complex pd models. nevertheless, the above scenario applies to many drug effects caused by competitive enzyme inhibition or receptor binding. since the receptor - bound drug represents only a small drug fraction in the body, the disposition is not significantly affected by the receptor binding, and the ligand concentration in the receptor surroundings, [l ], can be expressed using the df with properties p and time t as variables and the initial ligand concentration c0:2 to obtain a pk / pl / pd expression, [l ] in the above expression for e / emax is replaced by the product df(p, t) cx(t), where cx(t) are the isoeffective drug concentrations eliciting the effect, which is equal to the fraction x of the maximum effect. with e / emax = x, the bioactivity, characterized by cx(t), is described as3equivalent pk / pl / pd dependencies were derived for the irreversible drug receptor interactions, either single or preceded by a fast, reversible step. equation 3 and equivalent pk / pl / pd relationships provide the blueprint for a conceptual combination of the disposition function with any ligand - based or receptor - based 3d - qsar method for prediction of binding affinities. the k term in eq 3 needs to be replaced by a suitable conceptual 3d - qsar correlation equation, and the disposition function this cell - qsar concept represents the recipe for the formulation of conceptual qsars for cell - based assays and other complex systems. studied antimycin analogues ionize under the conditions of the experiments, and each species forms different intramolecular h - bonds. the molecules are flexible, and each species can bind to the receptor r in different orientations or conformations (modes). the generalized multispecies multimode binding equilibria are outlined in the following equation:4each binding equilibrium is characterized by the microscopic association constant kijk (eq 5) and represents the receptor binding of the ith ligand in the jth species and the kth binding mode. in principle, the number of species s and the number of binding modes m can differ for individual ligands. in the studied case, there are only two species (s = 2, nonionized and ionized, with charges 0 and 1, respectively) for each ligand (table 1). the number of modes is unknown, since there is no experimental information available on either the receptor or the complex, and can differ for individual ligands. in the general expressions, s and m represent the maximum numbers of species and binding modes for the tested ligands. the missing species or modes of some ligands will have zero fractions fij or zero association constants kijk (see below). the microscopic association constant for the ith molecule s jth species in the kth binding mode is5usually, only the total association constant of the ith ligand (ki) is determined, although the microscopic association constants kijk are the relevant quantities to be correlated with the structure. to obtain a conceptual correlation equation for ki the experimentally measured ki reflects the total concentration of the ligand / receptor complexes in any species and any binding mode. a series of rearrangements to the definition of ki provides the desired function of kijk, shown in eq 6:6 (1) the total concentration of the complex [lri ] is expressed as the sum of bound concentrations of individual species, (2) each summand is formally multiplied by [lij]/[lij ] to introduce the fraction of each species, fij = [lij]/[li ], and (3) the bound concentration of each species [lrij ] is broken down to individual binding modes. the relationship between the microscopic and total association constants is obtained by expressing the m - summands in eq 6 using eq 5:7here fij is the fraction of the jth molecular species in the ith compound in solution. for compounds present in the solution as one species, the right - hand side of eq 7 is equal to the k - summation. in this case, eq 7 is in accordance with published analyses of formally analogous situations : the statistical thermodynamic and equilibrium treatment of multimode binding in ligand / protein interactions and kinetic analyses of a reversible unimolecular reaction leading to different products or isomers. the expressions for the fractions fij of the jth species can be derived from the definition of the ionization constants. only one molecule of a compound, in any species and any mode, can be bound in each complex. the distribution of species and modes in the bound state is characterized by their prevalences. for the kth mode of the jth bound species for the ith compound, the prevalence is8the numerator and denominator come from eqs 5 and 6, respectively. the third quasi - equality ensures that the sum of all s m prevalences equals unity. the prevalence of the jth bound species in all modes and the prevalence of the kth bound mode in all species can easily be calculated using eq 8. for the application in comfa, eq 7 needs to be logarithmized and the log kijk values must be replaced by the correlation equation for comfa:9here cl are the regression coefficients characterizing the weights of the ligand probe interaction energies x in individual cross - sections of a grid surrounding the superimposed ligands. the subscripts indicate the relatedness to the ith compound, jth species, kth mode, and lth grid point, and g is the total number of grid points. other contributions to the binding free energy (internal ligand energy, binding entropy, desolvation) can be added to the summation in the exponents. in this case, we only used the comfa energies because the size of the used data set did not allow a rigorous optimization of more than a dozen coefficients. the pseudoequilibrium df expresses the time course of the concentration of nonionized ligand molecules in the aqueous phases of the studied biosystem during the elimination period:10here p is the reference partition coefficient, is the empirical collander coefficient, and t is the exposure time. the terms a, b, c, and d characterize the key fate - determining processes the ligand molecules undergo in the biological system : a, accumulation in membranes / protein binding ; b, distribution in aqueous phases ; c, lipophilicity - dependent elimination ; d, lipophilicity - independent elimination. for the receptors localized in the bilayer, eq 10 needs to be multiplied by p. if compounds are present in the aqueous phase in the receptor surroundings in s species created by ionization, tautomerism, or carbonyl hydration, the model suggests that each of the parameters a, b, c, and d (represented by y) from eq 10 be expanded as11the fractions f of individual species are the same quantities as in eq 9, except the subscripts i, indicating the compound, are omitted. the subscripts j the fractions of nonionized, neutral molecules (subscript j = 1) and ionized molecules with an overall charge of 1 (subscript j = 2) are given by the definition of the dissociation constant ka for the given ph of the medium and can be written, respectively, as12 generally, on the basis of the probable intracellular localization of the receptors, a reasonable intracellular ph range is 58, the lower limit being observed in lysozomes and the upper limit in the mitochondrial matrix. the ph value of the cultivation medium could affect these values, but the exact ph of the assay was not published. for this reason and because the receptor localization is unknown, the ph value in eq 12 was treated as one of the adjustable coefficients. the selwood data set includes in vitro filaricidal activities against d. viteae of 31 antimycin analogues (table 1), which were determined by monitoring the leakage of incorporated radiolabeled adenine from intact female d. viteae after 120 h of exposure. the ec50 values for adenine leakage were calculated after 120 h of exposure to a range of drug concentrations at 37 c under neutral conditions. the 1-octanol / water partition coefficients p were calculated by the clogp program in bio - loom software for neutral molecules and are summarized in table 1. the values differ from the original data because of the developments in the clogp software. the differences are within 0.25 log unit, except for compounds 6 (table 1, log pold log pnew = 1.526), 10 (0.770), 12 (0.638), 14 (1.654), and 26 (0.325). the log p values were used with the belief that they properly reflect the relative lipophilicity of the studied compounds, although the values of log p > 7 were marked in the clogp output as unrealistically high. ionization decreases the log p values by several units, and most compounds were present mainly as ionized species under physiologic conditions. our multispecies approach can take into account tautomers and hydrates of aldehydes and ketones ; hence, formation of these species was examined using the sparc web server and was found negligible for all compounds on the basis of the following reasoning. as shown in eq 7, the binding contribution of each species is given by the product of the association constant kij (represented by the sum of the association constants kijk for individual modes) and the species fraction fij. the fraction limit for a species to be included in the correlation was set to 10 on the basis of the following considerations. the interaction of a rare species with the receptor can release about 23 kcal / mol more free energy than that of the prevalent species because both species bind by weak interactions and differ in a single, well - defined structural feature. for this situation, the product fijkij for the rare species would be less than 1% of the same quantity for the prevalent species. the ligands are first aligned flexibly to each other in torsional space, and then the conformations produced are rigidly aligned in cartesian space. pharmacophore and steric bitmaps (tuplet) representing h - bonding and steric terms, respectively, along with the total ligand energy, serve as input to a multiobjective fitness function. produced pharmacophores indicated that the salicylamide moieties of all compounds in all species are superimposed in all cases. in the absence of structural and other information on the receptor, the most active and, at the same time, one of most rigid analogues, compound 7 (figure 2, table 1), was selected as the template for superposition. conformational analysis was performed using the tripos force field in sybyl with an increment of 10 for all considered torsions. when the molecule forms an intramolecular h - bond (figure 1), either as a neutral species (oho = c) or as an ionized species (nho), the first torsion 1 is fixed and only 2, 3, and 4 are allowed to rotate in conformational analysis. in the opposite case, when analogues have no intramolecular h - bond, all four torsions in figure 2 are considered rotatable. the approximate minimum conformations were further optimized and mulliken charges were calculated in jaguar using the dft / b3lyp method with a 6 - 31 g basis set. charge and spin multiplicity were entered manually for different protonation states. in this way open conformation, the mode without the intramolecular h - bond has the same optimal geometries for both neutral and ionized species. in the mm approach, the user is allowed to enter several possible bound conformations of the template in one optimization run. the msmm approach extends this option to all species which are present in the solution surrounding the receptor. the four basic template molecules of compound 7 were superimposed by the atom fit method in sybyl (figure 3a). all studied compounds do not share a common skeleton ; therefore, for each compound, both species in all modes were superimposed on the templates using the flexs procedure as incorporated in sybyl (figure 3c). first, a base fragment of the ligand is selected and placed on the template. second, as the rest of the ligand parts are incrementally built, torsion angles are perturbed to generate new conformations, and each conformation is scored for superposition quality. the obtained conformations of all compounds were minimized by jaguar using the dft / b3lyp method with a 6 - 31 g basis set with all torsions fixed. the superposition was repeated, and the resulting conformations were used in the comfa analyses. steric and electrostatic interaction energies xijkl with an sp carbon probe with a + 1 charge were calculated for each compound (subscript i) in each species (subscript j) and each binding mode (skeleton conformations ring - flipping conformations, subscript k). the probe was placed at each lattice intersection (subscript l) of a 3d grid (2 in each coordinate direction). the grid has the following coordinates : 7 to + 18 along the x - axis, 121 along the y - axis, and 15 to + 11 along the z - axis. an energy cutoff of 30 kcal / mol was used to cap the maximum used energies. the correlation equation is obtained by taking the logarithm of eq 3, in which the association constant log k is replaced by eq 9 and the disposition function df(p, t) is given by eq 10, as combined with eq 11, in which the fractions are expressed by eq 12. the receptor - binding and disposition components have, from the optimization viewpoint, quite different properties : eq 9 has only one form, and the descriptive variables need to be selected from a large pool, while eqs 1012 contain only two variables, which are organized in one of two possible functional forms, depending upon the location of the receptors either in the aqueous phase or in membranes. for the receptor - binding part (eq 9), the coefficients cl are associated with the grid points and are independent of the species and modes. therefore, the final set of optimized coefficients is independent of the numbering of individual species and modes. notably, the inclusion of multiple species and multiple modes does not increase the number of optimized regression coefficients cl. the correlation equation is nonlinear in the coefficients cl in eq 9 and the coefficients a d, ph and in eqs 1012. all statistical procedures were written in c programming language and integrated in sybyl through the sybyl programming language (spl) scripts. the choice of one of the two implemented optimization methods depends on the total number (n) of coefficients c in the calibrated model and on the number of compounds (n). nonlinear regression analysis is applied when n n/2. otherwise, the developed software automatically switches to the pls analysis with a linearized form of eq 9. therefore, a forward - selection procedure, conceptually similar to that used before for multimode analysis, was a rational choice. before analysis, the xijkl variables (energy columns) were sorted using the following criteria : (1) high and sustained variability, (2) the minimal number of colinear columns with similar information, and (3) even distribution of selected grid points around the ligands. sustained variability means that the energy values cover the whole interval more or less evenly and are not clustered. an extreme case is the situation when all energies in a given column are equal (usually zero) and only one mode has a different energy. these singularities originate when only one molecule protrudes into a subspace and other molecules do not affect the probe interaction energies in that subspace. singular molecules need to be eliminated from the analysis because they do not provide statistically significant information about the poorly covered subspace. the model calibration can be steered by user - defined inputs, for which the default values are shown in parentheses. the process starts with a quick scan through the models consisting of a few (four) variables which are randomly selected from the top variables (10%). the initial values of the coefficients (0.1) are systematically evaluated by a grid search. in this step, no optimization is applied and the correlation equation is evaluated for the initial coefficients. for the best models (top 10% r), the coefficients are optimized. at each of the following steps, a reduction of the number of coefficients is attempted : the coefficients, which do not lead to a decrease in the r value, are eliminated. the best models (top 5% r) are developed by a gradual addition of groups of a few (three) variables until all variables from the selected set (top 10%) are used. the procedure is finalized by fine - tuning of the best models (top 5% r) by addition of single variables. the best model is selected on the basis of the following criteria : n, r, q for the leave - one - out cross - validation (applied to the training set only to eliminate unstable models), and the standard errors of the parameters. | we present the cellular quantitative structure activity relationship (cell - qsar) concept that adapts ligand - based and receptor - based 3d - qsar methods for use with cell - level activities. the unknown intracellular drug disposition is accounted for by the disposition function (df), a model - based, nonlinear function of a drug s lipophilicity, acidity, and other properties. we conceptually combined the df with our multispecies, multimode version of the frequently used ligand - based comparative molecular field analysis (comfa) method, forming a single correlation function for fitting the cell - level activities. the resulting cell - qsar model was applied to the selwood data on filaricidal activities of antimycin analogues. their molecules are flexible, ionize under physiologic conditions, form different intramolecular h - bonds for neutral and ionized species, and cross several membranes to reach unknown receptors. the calibrated cell - qsar model is significantly more predictive than other models lacking the disposition part and provides valuable structure optimization clues by factorizing the cell - level activity of each compound into the contributions of the receptor binding and disposition. |
ad is a progressive and invariably fatal neurodegenerative disease and the leading cause of senile dementia. metabolic imbalance in diseased neurons may contribute to neuropsychiatric symptoms that include delusions and hallucinations, anxiety, mood disorder, and sleep disturbance that are common in ad. recently we proposed a hypothesis that explains why elevated plasma homocysteine is a risk factor for ad [4, 5 ]. implicit in that hypothesis is development of neuronal heme deficiency, and evidence of heme deficiency in ad brains has been reported. here, we extend this theme by considering the possible impact of porphyria on ad. the porphyrias are metabolic disorders characterized by enzyme deficiencies in the heme biosynthesis pathway. we propose that an understanding of porphyria may provide novel insights into ad pathogenesis. molecular and biochemical aspects of the porphyrias and their diagnosis and treatment are the subject of several excellent reviews [713 ]. eight enzymes are required for de novo heme biosynthesis. with the exception of 5-aminolevulinic acid synthase [alas, ec 2.3.1.37 ], the initial and rate - limiting enzyme of the heme biosynthesis pathway, deficiency in one of the other seven enzymes is associated with a specific form of inherited porphyria. four of the hepatic porphyrias, so - called because liver is the major site of expression of the enzymatic defect in heme biosynthesis, are designated acute porphyrias because clinical expression of the disease is associated with an acute neurologic syndrome (the acute attack or porphyric crisis) [8, 11 ]. these are the extremely rare doss porphyria (deficiency of ala dehydratase, ec 4.2.1.24), acute intermittent porphyria (deficiency of porphobilinogen deaminase, ec 4.3.1.8), hereditary coproporphyria (deficiency of coproporphyrinogen oxidase, ec 1.3.3.3), and variegate porphyria (deficiency of protoporphyrinogen oxidase, ec 1.3.3.4). acute intermittent porphyria is generally the most common form of acute hepatic porphyria encountered. significantly, enzyme deficiencies are present in other organs, including the brain, and the enzyme deficiency is life - long. acute neurologic syndrome associated with clinical attacks of acute hepatic porphyria can include both neuropsychiatric symptoms and neurodegenerative change [8, 11, 12 ]. neuropsychiatric symptoms that include anxiety, insomnia, confusion, hallucinations, agitation, and paranoia (so - called porphyric encephalopathy-8) underscore cns involvement. autonomic neuropathy may underlie severe abdominal pain and cardiovascular symptoms. in severe cases, a peripheral neuropathy resembling guillain - barre syndrome can develop [8, 11 ]. clinical attacks of acute porphyria can be induced in latent individuals by a variety of environmental factors including many common medications, nutritional factors, restricted carbohydrate and calorie intake, smoking, and hormones such as progesterone ; lists of safe and unsafe drugs are available [9, 11, 12 ]. a common mechanism of inducing agents is believed to be greatly increased hepatic heme demand. thus, biosynthesis of cytochrome p450 enzymes that utilize heme as a prosthetic group can be induced as much as 4050-fold in liver by drugs such as barbiturates. increased heme demand results in the induction of alas and increased synthesis of the heme precursor, 5-aminolevulinic acid [ala ]. in individuals who have inherited a partial deficiency in one of the enzymes of the heme biosynthesis pathway, that enzyme and not alas then, ala and other heme precursors can accumulate. moreover, heme biosynthesis is insufficient to meet demand and heme deficiency is unresolved. acute attacks are treated with infusions of glucose and hemin [9, 12 ]. this suppresses hepatic alas induction and the overproduction of ala and other heme precursors. fasting, which can induce the acute attack, appears to activate transcriptional coactivator pgc-1 (via a camp / creb pathway) and pgc-1 greatly increases hepatic alas expression by activating transcription factors nrf-1 and foxo1 [14, 15 ]. in addition, alas may respond directly to camp [14, 15 ]. abdominal pain and psychotic symptoms resolve quickly upon timely treatment of the acute attack but peripheral neuropathy can require months to resolve and recovery is often incomplete. one suggests functional heme deficiency develops during the acute attack, in liver and possibly in neural tissues, and impairs critical cell processes dependent on hemoproteins such as energy production by the mitochondrial electron transport chain. studies utilizing mice deficient in porphobilinogen deaminase, an experimental model of acute intermittent porphyria, underscore the importance of functional heme deficiency in nervous tissue in the development of motor neuropathy [1618 ]. the second hypothesis suggests that heme precursors and their metabolites accumulate to toxic levels during the acute attack. ala, in particular, is implicated because it is produced excessively in all the acute hepatic porphyrias and may have neurotoxic properties [8, 11 ]. excessive ala production occurs in lead poisoning due to lead - mediated inhibition of ala dehydratase, and also in hereditary infantile tyrosinemia (type i) in which the enzyme defect leads to endogenous production of the ala dehydratase inhibitor, succinylacetone. in both diseases, neuropsychiatric symptoms that resemble while recent clinical studies underscore the potential importance of excessive hepatic production of heme precursors as the primary cause of the neurologic complications in the acute porphyric attack [20, 21 ], induced elevation of plasma ala in a human volunteer, by itself, did not produce symptoms of porphyria. we hypothesize that heme deficiency is important in ad pathogenesis and that ad may differ significantly in individuals possessing the genetic trait for an acute hepatic porphyria because there is the potential to develop more severe heme deficiency. ad - related factors may create an imbalance in neuronal heme supply and demand. in ad, heme supply may be reduced. aging is the greatest risk factor for development of ad, and at least in rat brain, heme biosynthesis declines in normal aging. pyridoxine deficiency in the aged could contribute to age - related decrease in heme biosynthesis because pyridoxal phosphate is a cofactor for alas. glycoxidation reactions are prominent in ad brain, and glycoxidation reactions might inactivate enzymes required for heme biosynthesis. moreover, heme biosynthesis requires mitochondrial integrity and mitochondrial damage is prominent in ad. in ad, heme demand may be increased. mitochondrial damage would necessitate increased mitochondrial turnover and de novo synthesis of heme - containing proteins such as cytochromes. moreover, mitochondrial damage may itself be caused by heme deficiency [29, 30 ] thus creating a vicious cycle further impairing heme biosynthesis. heme degradation may be favored over heme biosynthesis in ad neurons because of chronically elevated ho-1 [32, 33 ]. thus, amyloid- [a ] binds heme, which may contribute to development of a functional heme deficiency and affect a toxicity by inhibiting a aggregation [34, 35 ]. we speculate that the reduced capacity to synthesize heme in individuals with porphyria could exacerbate such an imbalance in heme supply and demand. in addition, the two proposed mechanisms of nervous system dysfunction in the acute porphyric attack, functional heme deficiency and toxic accumulation of ala, have cellular effects that could be important in ad pathogenesis. inhibition of heme biosynthesis produced senescence - associated changes in gene expression in cultured mouse cortical neurons and was proapoptotic in ngf - induced pc12 cells. increased oxidative stress, which is one of the earliest observed events in ad pathogenesis, and heme deficiency may help explain several pathophysiological features of ad including mitochondrial abnormalities and impaired energy metabolism, cell cycling and cell signaling abnormalities, neuritic pathology, and abnormal expression of iron regulatory protein 2 (irp2). ala is a source of oxygen free radicals in the presence of heavy metals such as iron. the product of iron - catalyzed oxidation of ala, 4, 5-dioxovaleric acid, is an effective alkylating agent of guanine moieties in dna in vitro [40, 41 ], and ala - induced mitochondrial and nuclear dna damage has been shown in several cell lines including pc12 cells. it released iron from ferritin in vitro [43, 44 ] and caused oxidative damage to the ferritin molecule. as in the toxic mechanism proposed for homocysteine in ad pathogenesis [4, 5 ], ala may make available a catalytic metal that can promote oxidative stress. clinically overt acute hepatic porphyria (predominantly acute intermittent porphyria) is relatively rare with a prevalence of perhaps 5 per 100,000. however, the prevalence of the genetic trait for acute porphyria is far greater because perhaps 90% of affected individuals are clinically latent [7, 12 ]. in a finnish population the estimated prevalence of porphobilinogen deaminase deficiency, the biochemical defect in acute intermittent porphyria, was 1 per 500. using gene analysis to supplement enzymatic analysis, the estimated prevalence of porphobilinogen deaminase deficiency in a french population was 1 per 1675. consistent with the possibility that deficiency in heme biosynthesis could increase susceptibility for ad is the intriguing observation that the chromosomal location of genes encoding enzymes in the heme biosynthesis pathway correlate with genetic loci linked to sporadic, late - 's disease (maximum lod score 1) (table 1). however, the significance of this observation is unclear. in cases such as deficiency in porphobilinogen deaminase, heme deficiency alone may be insufficient to cause ad but could contribute to disease progression when superimposed on other disease processes. however, effects may be indirect and not related to heme levels. for example, the proximity of the ala dehydratase gene to an ad - related locus is noted in table 1. ala dehydratase - porphyria is an extremely rare form of acute hepatic porphyria. moreover, ala dehydratase activity is far in excess of the activities of other enzymes in the heme biosynthetic pathway and for that reason > 95% loss of activity is needed before clinical symptoms of porphyria develop. however, ala dehydratase is also a high km enzyme. under ad - associated conditions, toxic levels of ala may possibly accumulate and contribute to ad pathogenesis. while interesting, any relationship between heme deficiency and ad is speculative. if the genetic trait for one of the acute hepatic porphyrias is a risk factor for ad, why has this relationship gone unnoticed ? the answer simply may be that the majority of individuals with the biochemical defects of acute porphyria are clinically latent, and that many genetic and environmental factors likely contribute to the development of sporadic, late - onset ad. ad may differ significantly in individuals who have the genetic trait for acute hepatic porphyria because there is the potential to develop more severe neuronal heme deficiency and possibly accumulate ala and other heme precursors. epidemiological data confirming a link between ad and porphyria would be an important test of the hypothesis. ad progression (from disease - free state, to mild cognitive impairment, to ad) in individuals with a genetic trait for acute hepatic porphyria could be compared with ad progression in an unaffected cohort. testing for the presence of a genetic trait for acute porphyria in individuals diagnosed with mild cognitive impairment or early ad might identify a unique subset of ad patients. management decisions may need to be adjusted in such individuals to avoid potential sensitivity to common medications and novel therapeutic agents which, if porphyrinogenic, could exacerbate porphyria and possibly ad symptoms. approaches such as these could yield significant new information on ad pathogenesis and treatment. ad and porphyria. oxidative stress and free radical damage occur early in ad. a consequence of oxidative stress predicted by the ferric cycle hypothesis is heme deficiency [4, 5 ]. moreover, ad - related factors such as accumulation of amyloid- may limit heme bioavailability. we hypothesize that reduced capacity for cells to synthesize heme, in individuals with the genetic trait for acute hepatic porphyria, contributes to development of heme deficiency (and possibly oxidative stress). ad - related pathological change and neuropsychiatric and behavioral symptoms associated with ad may be more severe in these individuals. chromosomal locations of genes encoding enzymes of the heme biosynthesis pathway and genes linked to development of late - 's disease. from meissner. | mechanisms that cause alzheimer 's disease (ad), an invariably fatal neurodegenerative disease, are unknown. important recent data indicate that neuronal heme deficiency may contribute to ad pathogenesis. if true, factors that contribute to the intracellular heme deficiency could potentially alter the course of ad. the porphyrias are metabolic disorders characterized by enzyme deficiencies in the heme biosynthetic pathway. we hypothesize that ad may differ significantly in individuals possessing the genetic trait for an acute hepatic porphyria. we elaborate on this hypothesis and briefly review the characteristics of the acute hepatic porphyrias that may be relevant to ad. we note the proximity of genes encoding enzymes of the heme biosynthesis pathway to genetic loci linked to sporadic, late - onset ad. in addition, we suggest that identification of individuals carrying the genetic trait for acute porphyria may provide a unique resource for investigating ad pathogenesis and inform treatment and management decisions. |
a 3-year - old, female, spayed, domestic shorthair cat presented for dysuria and haematuria, unresponsive to antibiotic treatment. a small, fleshy ultrasound identified a vaginal mass effect with mixed echogenicity measuring in excess of 3 cm. vaginoscopy confirmed an extensive, fleshy, irregular mass that was characterised histologically as pyogranulomatous vaginitis, with periodic acid a 6 week course of enrofloxacin 5 mg / kg q24h resulted in complete resolution of the mass and clinical signs. malakoplakia is a rare chronic inflammatory condition that has been previously reported in the bladder of two cats. this is the first reported feline case with vaginal involvement, intracellular e coli and successful treatment with a fluoroquinolone. malakoplakia is an important, non - neoplastic differential diagnosis when a mass is identified in the urogenital system of a young cat. malakoplakia is a rare, chronic inflammatory condition that has been described in humans for over 100 years, most commonly involving the urinary bladder of middle - aged women, although other parts of the urinary tract and, rarely, other organs can be involved. only more recently has this condition has been described as a spontaneous disease in animals, including two kittens, three pigs, and a cynomolgus monkey. the term was originally created to describe soft, plaque - like lesions seen within the urinary bladder that were thought to be neoplastic. grossly, human malakoplakia lesions vary from flat plaques to nodules and masses that resemble tumours. histology reveals the inflammatory nature of the lesions, which are characterised by large numbers of histiocytes (referred to as von hansemann cells) containing periodic acid the pathogenesis of this disease is unclear, but it is often linked to a bacterial infection such as escherichia coli, with 8090% of people diagnosed with malakoplakia having a persistent coliform urinary tract infection. immunosuppression or an innate host immune defect also could play a role, with some cases of malakoplakia reported in humans with aids, neoplasia or receiving immunosuppressive therapy for another disease. descriptions of malakoplakia frequently identify bacteria associated with histiocytes on light or electron microscopy, and the michaelis it has been speculated that this disease is a consequence of impaired bacterial killing by macrophages, perhaps associated with ineffective assembly of microtubules. experimental studies support this theory ; with similar lesions created in the kidney and testes of rats by injection of e coli lipopolysaccharide extracts, and in the skin of pigs by subcutaneous injection of rhodococcus equi. the microscopic appearance of these lesions, and the identification of e coli within them has been compared with e coli - associated granulomatous colitis in boxers and french bulldogs. a recent study of affected boxers and french bulldogs revealed genetic polymorphisms in a region of chromosome 38, which includes loci encoding signalling lymphocytic activation molecule family glycoproteins ; these have been linked to impaired killing of e coli, consistent with the proposed pathogenesis of malakoplakia. this report describes a case of malakoplakia involving the vagina of a young cat ; a novel location for the disease in animals, the first report describing intracellular e coli associated with feline malakoplakia, the second report of successful treatment of this disease, and also the first report of successful treatment with enrofloxacin. a 3-year - old, female, spayed, domestic shorthair cat was presented to the primary veterinary clinic for malaise, anorexia, stranguria, periuria, pollakiuria and macroscopic haematuria. the cat had no previous pertinent medical history, and had been spayed at 5 months of age, with no abnormalities or complications noted during or after surgery. no abnormalities were noted on clinical examination, and the cat was prescribed an empirical 6 day course of amoxicillin / clavulanic acid tablets at 12.5mg / kg q12h (clavulox ; zoetis animal health). a cystocentesis sample revealed well - concentrated urine (specific gravity 1.050), with microscopic haematuria and trace protein noted on dipstick evaluation. was seen protruding from the vulva ; a grab biopsy sample of this tissue was collected under general anaesthesia. pending histopathology the cat was prescribed prednisone orally at 5 mg q12h for 7 days, reducing it to 5 mg q24h for 7 further days and further amoxicillin / clavulanic acid at the previous dose. histopathology at a reference laboratory (new zealand veterinary pathology, hamilton) revealed dysplastic squamous epithelium, with moderate numbers of neutrophils, macrophages and activated fibroblasts, resulting in a diagnosis of chronic granulomatous and proliferative vaginitis with marked epithelial dysplasia. despite initial improvement with the new treatment regime, malaise, lethargy, vaginal swelling, macroscopic haematuria and periuria persisted, and so the cat was referred to an internal medicine specialist for further evaluation. on presentation to the veterinary specialist group, the sole abnormality noted on physical examination was a small, fleshy, erythematous mass protruding from the vaginal vault. feline immunodeficiency virus and feline leukaemia virus elisas were negative (snap fiv / felv combo ; idexx laboratories). abdominal ultrasound (ie35, c8 - 5 probe ; philips) identified free - floating and slowly settling echogenic debris and a single, 2.7 mm diameter mineralised structure revealing gravity dependence within the urinary bladder. imaging from a perineal window identified a vaginal mass effect greater than 3 cm in size with mixed echogenicity, a hyperechoic centre and a hypoechoic periphery (figure 1). the caudal limits of the lesion had a bulbous shape while the cranial limits revealed a thickened fusiform shape. longitudinal view of the vaginal mass, with calipers demonstrating the craniocaudal extent of the lesion. white arrows indicate the location of the lesion vaginoscopy, performed under general anaesthesia using a 3.5 mm rigid endoscope (64019 ba, 1030340 camera, dx pal 202420 - 20 processor ; karl storz) identified an extensive, fleshy, friable, irregularly shaped mass with diffuse attachment to the mucosa within the vaginal vault. thick, firm, white exudate was present, particularly around the cranial aspect of this lesion. extensive debridement and biopsy of abnormal tissue was performed with 2.8 mm round - cup biopsy forceps (fb-35c-1 ; olympus). the urethral orifice was not visible ; however, a urinary catheter was passed blindly to ensure urination after mass debridement. culture of the fresh tissue at a reference laboratory (gribbles veterinary, auckland) produced a heavy growth of e coli, sensitive to amoxicillin / clavulanic acid, cephalothin, enrofloxacin, trimethoprim sulpha, polymyxin b and neomycin by standard disc diffusion testing. the cat was hospitalised with the urinary catheter in situ for 48 h, and then discharged with no complications noted. in the light of the culture, sensitivity and histopathology results, enrofloxacin (baytril ; bayer animal health) was prescribed at a dose of 5 mg / kg q24h for 6 weeks. this resulted in rapid and complete resolution of the clinical signs and the cat is clinically normal 1 year after treatment. the biopsy samples were fixed in 10% neutral buffered formalin before routine histological processing and embedding in paraffin wax. on histopathological examination the biopsies were well preserved, and lined by dysplastic squamous epithelial cells ; similar cells also formed cords, islands or glandular / ductular structures infiltrated by neutrophils within the samples (presumed dysplastic vestibular glands). the adjacent stroma was heavily and diffusely infiltrated by neutrophils, lymphocytes and plasma cells admixed with many macrophages (figure 2). these had abundant, faintly granular eosinophilic cytoplasm, with variably strong pas - positive staining (figure 3). the macrophages sometimes contained a neutrophil, vacuolated space or short bacterial rods, found to be gram - negative on gram staining (figure 4) ; similar rods were also seen apparently within neutrophils. no basophilic bodies were seen within macrophages on haematoxylin and eosin or von kossa stains. faint basophilic objects consistent with bacterial rods are visible in macrophages (see inset, indicated by white arrow). schiff - positive granules (pas, 50) macrophages contain gram - negative bacterial rods (see inset, indicated by white arrow). gram stain, 100 unstained sections (5 m on charged glass slides) of formalin - fixed, paraffin - embedded tissue were submitted to cornell university for fluorescence in situ hybridisation (fish) analysis with a eubacterial probe and an e coli probe as described previously. specificity of hybridisation was controlled by co - hybridisation with an irrelevant labelled probe (non - eub-338 [actc - ctacgggaggcagc-6-fam ]), and the use of control slides of cultured e coli, streptococcus species and proteus species. hybridised samples were washed in phosphate - buffered saline, allowed to air dry and mounted with a prolong antifade kit (molecular probes). sections were examined on an axioskop 2 (carl zeiss) or a bx51 (olympus america) epifluorescence microscope, and images were captured with a zeiss axiocam or olympus dp-7 camera, respectively. multifocal clusters of short- and medium - sized rods that hybridised with eubacterial probe 338 were visualised within cells that were consistent with macrophages within mucosa. these bacteria also hybridised with e coli / shigella species probe, indicating the presence of intramucosal infection with e coli (figure 5). eubacterial fish revealed multifocal clusters of intracellular rods within the vaginal mucosa (arrows). this is the first reported feline case of malakoplakia with vaginal involvement, intracellular e coli and successful treatment with a fluoroquinolone. reports to date suggest that malakoplakia is an important differential diagnosis for lower urinary tract disease in a young cat, especially when a granulomatous mass is identified involving the urogenital system and, especially as these reports illustrate that this condition is treatable, in contrast to comments from another source. this case had pas - positive macrophages and invasive gram - negative bacteria but did not have the michaelis. however, their absence does not preclude a diagnosis of malakoplakia as they are not uniformly present or easily detected in malakoplakia in people or animals. smith described three stages of malakoplakia lesion development in humans, with the first (early) stage characterised by plasma cells, macrophages, eosinophils and an absence of michaelis gutmann bodies. an experimental study involving the injection of e coli into the kidneys and testes of rats produced lesions resembling those described in smith s stages, with michaelis gutmann bodies appearing later in the disease process. garrett and mcclure had similar findings but suggested an alternative explanation that the dose of e coli stimulus dictated whether or not michaelis gutmann bodies formed. in this case, the lesion location (close to the urethral orifice), microscopic appearance, presence of e coli and response to therapy lead to the diagnosis of pyogranulomatous vaginitis / vestibulitis consistent with malakoplakia. however, further investigation and treatment was directed at the obvious mass present in the vagina, with a plan to address the urinary bladder if the clinical signs did not resolve. the microscopic appearance of these lesions, and the identification of e coli within them has been compared to whipple s disease of humans, and granulomatous colitis of boxers and french bulldogs. it is relevant to this case that pas - positive macrophages are found in granulomatous colitis, but invasive bacteria are rarely seen on routine histopathology, and michaelis gutmann bodies have not been reported in those lesions. intracellular bacteria were not identified in the two case studies in cats, although e coli was cultured from the bladder wall and urine of one kitten. fish was performed in this case, in addition to gram staining and histopathology, to confirm the presence of intracellular bacteria. successful treatment with long courses of antibiotics capable of penetrating macrophages is common in human malakoplakia, and has recently been reported in one of the kittens with urinary bladder lesions. the second reported feline case, also in the urinary bladder, was diagnosed post mortem. it is interesting to note that the cat described herein was initially unsuccessfully treated with antibiotics to which the organism was susceptible in vitro. this is similar to a previous cat, which eventually responded to sulfamethoxazole and trimethoprim, in conjunction with amoxicillin and clavulanic acid. antibiotics other than fluoroquinolones, or trimethoprim / sulfamethoxazole, have not been effective in human medicine. it has been hypothesised that penetration of antibiotics into macrophages may be important in treatment success in people, and fluoroquinolone antibiotics are known to achieve this. one review of the human literature suggested long courses of fluoroquinolone antibiotics have a cure rate of 90%. the importance of combining antimicrobial sensitivity with the ability to penetrate macrophages is pivotal for successful treatment of e coli - associated granulomatous colitis in boxers. this is in contrast to humans, where the average age of presentation is > 50 years, and 40% of people have concurrent systemic illness. we are aware of another case of malakoplakia recently diagnosed in christchurch, new zealand, in the urinary bladder of a 3-month - old kitten (r fairley, 2016, personal communication), suggesting that malakoplakia is more common in young cats than previously thought. a survey of pathologists showed a low rate of correct identification of the classic histological appearance of this disease in people, which may also be the case in domestic animals, resulting in misdiagnosis. this report provides further evidence that malakoplakia is a treatable disease that needs to be considered as a differential diagnosis for lesions within the urogenital tract of cats, especially if young. this case report describes a unique presentation, and the first case of malakoplakia outside of the urinary bladder in a cat, and the first responding to enrofloxacin. further study would be beneficial to clarify the pathogenesis and prevalence of this disease, along with optimal treatment strategies. | case summarya 3-year - old, female, spayed, domestic shorthair cat presented for dysuria and haematuria, unresponsive to antibiotic treatment. a small, fleshy, erythematous mass protruded from the vaginal vault. ultrasound identified a vaginal mass effect with mixed echogenicity measuring in excess of 3 cm. vaginoscopy confirmed an extensive, fleshy, irregular mass that was characterised histologically as pyogranulomatous vaginitis, with periodic acid schiff - positive macrophages containing gram - negative bacteria. fluorescence in situ hybridisation analysis demonstrated invasive intracellular escherichia coli. vaginal malakoplakia was diagnosed. tissue culture and antimicrobial susceptibility of e coli was used to guide treatment. a 6 week course of enrofloxacin 5 mg / kg q24h resulted in complete resolution of the mass and clinical signs.relevance and novel informationmalakoplakia is a rare chronic inflammatory condition that has been previously reported in the bladder of two cats. the pathogenesis of malakoplakia is thought to involve ineffective killing of bacteria (eg. e coli), similar to granulomatous colitis in boxers and french bulldogs. the literature on malakoplakia in cats is sparse. this is the first reported feline case with vaginal involvement, intracellular e coli and successful treatment with a fluoroquinolone. malakoplakia is an important, non - neoplastic differential diagnosis when a mass is identified in the urogenital system of a young cat. |
we report a case of left adrenal schwannoma in a 62-year - old man, incidentally discovered on an abdominal computed tomography. on admission, no remarkable findings were recognized in the patient 's blood and urine examination, including adrenal function. macroscopically, the tumor (45 mm 30 mm, 60 g) arose from the medulla of the adrenal gland with a clear border distinguishing it from surrounding tissues. although an increasing number of adrenal incidentaloma have been identified with the recent advances in imaging techniques, only a few cases of schwannoma of the adrenal gland have been reported. we reviewed the cases reported previously in an attempt to reveal the characteristic features of this rare disease. schwannoma is a benign neurogenic tumor originating from schwann cells, which also produce the myelin sheath that covers peripheral nerves. however, schwannoma arising from the adrenal gland is an extremely rare entity ; only 11 cases have been reported in the literature. herein, we report a case of adrenal schwannoma, successfully treated with laparoscopic adrenalectomy and review the cases previously reported in an attempt to clarify the characteristic features of this rare disease. a 62-year - old man was referred to our hospital for further examination and treatment of his incidentaloma of the left adrenal gland. a local physician diagnosed the patient with mild liver dysfunction, and the patient had undergone an abdominal computed tomography as part of his workup. a round mass with a maximum diameter of 40 mm was recognized on the left adrenal gland. on admission, no physical features were present to suggest cushing 's syndrome or von recklinghausen 's disease. magnetic resonance imaging (mri) revealed a round mass 40 mm in diameter in the patient 's left adrenal gland. the mass had a clear border setting it off from surrounding structures, and a portion of the mass had a lobular surface. the mass had low - signal intensity on a t1-weighted image and demonstrated slightly heterogeneous high - signal intensity on a t2-weighted image (figure 1). endocrinological examinations revealed no remarkable findings to suggest a functioning adrenal tumor (table 1). although acth was slightly elevated, it was thought to be nonspecific, because no alterations in either the morning level or the daily rhythm of cortisol secretion was observed. the diagnosis was made of a nonfunctioning left adrenal tumor. because of the size and partly irregular shape of the mass, a laparoscopic transabdominal left adrenalectomy was performed to rule out a malignant tumor. the mass registered low - signal intensity on the t1-weighted image (a), and a slightly heterogeneously high - signal intensity on the t2-weighted image (b). endocrinological data on admission while under general anesthesia, the patient was placed in a right hemi - lateral position with a pillow under the right lower limb to lift up the left flank. an 11-mm trocar for a laparoscope was introduced by the open method at the level of 5 cm cranial to the navel on the left midclavicular line. after investigating the abdominal cavity to confirm no abnormal tumors, ascites, or adhesions, a 12-mm trocar for a vessel sealing system and 10-mm trocar for forceps were introduced under video vision at the left subcostal level on the anterior axillary line and on the median line, respectively. the spleen was mobilized by cutting the lieno - renal ligament, and the mass was easily found between the pancreas tail and the left kidney, surrounded by fatty tissue (figure 2). the tumor with the adrenal gland was carefully isolated with sharp or blunt dissection, with surrounding fatty tissue, by using a vessel - sealing system. after the left adrenal vein was clipped and cut, preserving the left subphrenic vein, the isolated tumor was enclosed within an endoscopic pouch and was extracted via the extended wound of the 12-mm trocar. a clearly bordered round, firm mass was found within the left adrenal gland. the operation time was 86 minutes, and the blood loss was 100 g. the 45 mm 30 mm 30 mm tumor was observed to have developed from the medulla of the adrenal gland and weighed 60 g (figure 3). histologically, the tumor consisted of spindle cells without atypia or mitosis. a thin, fibrous area indistinctly separated the tumor from the surrounding nonatrophic adrenal cortex. immunohistochemical analysis revealed that the tumor cells were uniformly positive for s-100, and partly positive for myeline, but were negative for c - kit, smooth muscle actin, cd34, and desmin. abdominal ultrasonography confirmed no recurrent disease, and the patient is in good health without disease 36 months after surgery. the tumor (arrows) was removed with left adrenal gland and surrounding fatty tissues. macroscopic view of the tumor that arose from the adrenal medulla, compressing the normally developed cortex. the majority of the tumors originating in the adrenal medulla are pheochromocytoma, neuroblastoma, or ganglioneuroma. schwannoma of the adrenal gland is rarely encountered, although it similarly originates from the cells of the neural crest. the origin of the adrenal schwannoma is considered to be either of 2 myelinized nerve systems innervated to the adrenal medulla. one is the sympathetic nerve from the upper lumbar plexus, and the other is the phrenic or vagus nerve. all reported cases demonstrate that the schwannoma originated in the medulla ; no schwannoma has been reported to arise from the cortex. this is likely the consequence of the nerve in the adrenal cortex developing quite poorly compared with that in the medulla and only a few thin nerves running along the vasculature. the diagnosis of schwannoma of the adrenal gland was difficult to make based on the imaging studies. typical mri findings report solid tumors with low - signal intensity on t1-weighted images and heterogeneously high - signal intensity on t2-weighted images, with occasional cystic components. however, imaging findings were nonspecific for the tumors with a nerve origin, such as neuroblastoma or ganglioneuroma. every reported case has been treated as a nonfunctioning incidentaloma of the adrenal gland, and the diagnosis of schwannoma was determined postoperatively through histological examination. conventionally, schwannoma are divided into 2 distinct subtypes, hyper - cellular antoni a type and hypo - cellular antoni b type. spindle cells are arranged in fascicles in areas of high cellularity with little stromal matrix in the antoni a type. nuclear - free zones called verocay bodies can also be found in between the regions of nuclear palisading. tumor cells are less densely found, forming loose meshwork often accompanied by microcysts or myxoid changes in antoni b type, and are considered to be a degenerated form of the antoni a type. both sub - types can be found as a mixture in adrenal schwannoma ; 3 of 11 reported cases demonstrated both subtypes in a tumor. the differential diagnosis made using immunostaining should exclude gastrointestinal stromal tumor (gist) or leiomyoma. by contrast, gist is positive for c - kit, and leiomyoma is positive for smooth muscle actin. eleven cases of adrenal schwannoma have been previously reported in english and japanese (table 2) as far as we can determine from a search of pubmed and japana centro revuo medicina. three patients experienced abdominal pain. the tumors in these 3 patients were large in size (75 mm, 90 mm, and 124 mm). in addition, a histological demonstration of a large cystic tumor and 2 small tumors incidentally found in the autopsy samples have been reported. excluding these 5 cases, 7 adrenal schwannomas, including our case, were incidentally found by imaging analyses performed as a part of the workup for the nonspecific symptoms. the size ranged from 28 mm to 90 mm (average, 56) when identified, which was not considered large enough to cause clinical symptoms. they were demonstrated to be large solid masses (60 mm and 180 mm) extending over the adrenal gland occupying the retroperitoneum, and with unfavorable outcomes. however, no case of catecholamine - secreting benign adrenal schwannoma has been reported. as in our case and however, these elevations were considered nonspecific because no evidence was present of alteration in cortisol secretion in either case. thus, features of adrenal schwannoma should be considered the same as so - called typical reported cases of adrenal schwannoma nd = not described ; us = abdominal ultrasonography ; ugi = upper gastrointestinal series ; ct : computed tomography died of myocardial infarction no abnormal findings with either 123i - metaiodobenzylguanidine nor 131i-6b - iodomethyl-19-nor - cholest-5(10)-en-3b - ol scintigraphy, incidentally observed asymptomatic tumor in the adrenal gland, incidentaloma, has been increasing, along with the advance in the field of imaging technology. these incidentalomas are most frequently cortical adenomas followed by carcinoma, pheochromocytoma, and myelolipoma. when excluding these major tumors by hormonal and imaging analysis, adrenal schwannoma should be expected, although it has been extremely rare. however, no well - established recommendation for surgical application has been developed for patients with tumors between 4 cm and 6 cm. the consensus suggests that criteria in addition to size should be considered in making the decision to monitor or proceed to adrenalectomy. relevant variables to perform laparoscopic adrenalectomy for incidentaloma have been proposed that include a low complication rate (less than 3%) and the informed consent. the present case suggests that application of laparoscopic adrenalectomy to the incidentaloma could be a feasible choice, when performed by an experienced surgical team with appropriate informed consent, not only as a minimally invasive treatment, but also as a whole tumor biopsy to establish a correct diagnosis. | objective : we report a case of left adrenal schwannoma in a 62-year - old man, incidentally discovered on an abdominal computed tomography. it was successfully treated with laparoscopic adrenalectomy.methods:on admission, no remarkable findings were recognized in the patient 's blood and urine examination, including adrenal function. laparoscopic left adrenalectomy was performed with the diagnosis of a nonfunctioning adrenal tumor.results:macroscopically, the tumor (45 mm 30 mm, 60 g) arose from the medulla of the adrenal gland with a clear border distinguishing it from surrounding tissues. histologically, the tumor consisted uniformly of spindle cells that were positive for s-100. the cortex was compressed but showed no atrophy. the diagnosis of adrenal schwannoma was made.conclusion:although an increasing number of adrenal incidentaloma have been identified with the recent advances in imaging techniques, only a few cases of schwannoma of the adrenal gland have been reported. we reviewed the cases reported previously in an attempt to reveal the characteristic features of this rare disease. |
odontogenic tumors of epithelial origin commonly seen in the posterior mandible are often treated with surgical excision. cantor and curtis provided a hemimandibulectomy classification for edentulous patient that can also be applied in partially edentulous arches. apart from the deviation of mandible to resected side, other dysfunctions observed are difficulty in mastication, swallowing, speech, mandibular movements, and even respiration. this case report describes prosthodontic management of a patient who has undergone a hemimandibulectomy and was rehabilitated using a provisional guide flange prosthesis followed by a definitive maxillary and mandibular cast partial denture designed to fulfill the patient 's needs and requirements. a 44-year - old female patient reported to the department of prosthodontics with the chief complaint of difficulty in chewing food due to the deviation of jaw, missing teeth, and wanted replacement of teeth [figure 1a ]. the patient gave a history of supari chewing since 20 years, 8 - 10 times / day. the patient was diagnosed with early squamous cell carcinoma involving left buccal mucosa and mandibular alveolus and thus left side hemimandibulectomy was performed 6 months ago. extraoral examination revealed facial asymmetry, deviated lower third of face, decreased mouth opening, significant deviation of mandible to left side on mouth opening, left corner of mouth drooping downward, angular cheilitis, and left condyle and ramus absent on palpation. intraoral examination revealed left mandibular defect distal to lateral incisor, surgical skin graft seen on resected side, 2327 ; 3437, 3243, and 4547 teeth missing. maxillary and mandibular arches were partially edentulous, representing kennedy 's class ii and class i condition respectively. both the ridges were smooth, round with well - keratinized mucosa with sufficient height and width for support. orthopantomogram revealed the absence of the mandible distal the mandibular left canine [figure 1b ]. treatment plan decided was mandibular guide flange prosthesis to aid in correction of mandibular deviation, followed by a definitive prosthesis of a maxillary cast partial denture with double row of teeth on nonresected side and a mandibular cast partial denture retained by precision attachments with a buccal guiding flange. (a) pretreatment intraoral view (b) pretreatment orthopantomogram preliminary impressions were made in addition silicone - putty (ad - sil putty, prime dental pvt. ltd., mumbai, maharashtra, india) in an adhesive coated custom tray. due to limited mouth opening, a satisfactory impression could not be made in a stock tray. custom trays were fabricated in autopolymerizing acrylic resin (dpi auto polymerized acrylic resin, mumbai, maharashtra, india) on primary casts of another patient having a closely resembling arch form [figure 2a ]. the maxillary impression was made in two parts, held together by orientation blocks made on polished surface of custom tray [figure 2a and b ]. casts were poured in type iii dental stone (dutt stone, dutt industries, mumbai, maharashtra, india). denture base was fabricated in autopolymerizing acrylic resin (dpi auto polymerized acrylic resin, mumbai, maharashtra, india), and occlusal rims were fabricated in modeling wax (maarc, shiva product, mumbai, maharashtra, india) and jaw relation was recorded. the patient 's tactile sense or sense of comfort the patient was advised to move the mandible as far as possible to the untreated side manually and then gently close the jaw into position to record a functional maxillomandibular relationship. maxillary cast was mounted using facebow record (hanau spring bow ; whipmix corporation, louisville, ky, usa) on a semi - adjustable articulator (hanau wide vue ; whipmix corporation, louisville, ky, usa) and mandibular with reference to the recorded jaw relation. the prosthesis was designed with a buccal guiding flange and a supporting flange on the lingual side [figure 3a ]. retention was provided by retentive clasps made from 19 gauge round, stainless steel orthodontic wire (kc smith and co, monmouth, uk). the guide flange extended superiorly on the buccal surface of the maxillary premolars allowing the determined occlusal closure. the guide flange was sufficiently blocked to avoid trauma to the maxillary teeth and gingival during functional movements. acrylization was done using heat cure acrylic resin (dpi heat polymerized acrylic resin, mumbai, maharashtra, india). clear acrylic (dpi heat polymerized clear acrylic resin, mumbai, maharashtra, india) was used for flange for esthetic purpose. the patient wore the guiding flange for 4 months followed by extraction of root pieces in the region 46, 47. (a) selected custom trays (b) sectional impression (a) guiding flange prosthesis (b) postinsertion intraoral view the definitive prosthesis was then fabricated consisting of maxillary and mandibular cast partial denture. crown preparation was done for 33, 44, and final impression was made in addition silicone (ad - sil light body, prime dental pvt. ltd., extracoronal attachment ot strategy (rhein 83, usa) was attached to the pattern such that it directed toward the center of the ridge. the final crowns with attachment were seated, pick up impression was made for mandibular arch and final impression for maxillary arch in addition silicone, double mix double step technique (ad - sil putty and light body, prime dental pvt. ltd., mumbai, maharashtra, india). casts were poured in die stone, type iv gypsum (ultrarock, kalabhai dental, mumbai, maharashtra, india) [figure 4a ] and blocked out. casts were duplicated in refractory material (wirovest, bego, germany) using agar (wirogel m, bego, germany). wax pattern was made and casting was done to obtain cast partial denture framework [figure 4b ]. india) was done [figure 5a c ] and trial denture was evaluated. acrylization was done in heat cure acrylic resin (lucitone 199, dentsply, york division, usa) [figure 6a ]. denture was finished, polished, and inserted in patient 's mouth [figure 6b and c ]. patient wore the denture for 10 days to acclimatize and the guiding flange was cut off. significant reduction in mandibular deviation was observed and maximum intercuspation could be achieved due to the guidance from the twin row of teeth. (a) precision attachment (b) cast partial denture framework (a - c) teeth arrangement (a) final prosthesis (b) denture insertion (c) deviation reduced due to guiding flange loss of mandibular continuity results in deviation of remaining mandibular segment toward the resected side primarily because of the loss of tissue involved in the surgical resection. the pull of the suprahyoid muscles on the residual mandibular fragment causes inferior displacement and rotation around the fulcrum of the remaining condyle thus giving the tendency to an anterior open bite. greater the loss of tissue, greater will be the deviation of the mandible to the resected side, thus compromising the prognosis of the treatment. the techniques described to reduce mandibular deviation by restraining the patients neuromuscular system include exercise programs, removable partial denture prosthesis for dentulous patients and complete denture prosthesis for edentulous patients together with modification in the occlusal scheme to compensate for deviation. guide flange helps in such cases to prevent deviation of the mandible, improve masticatory function and esthetics. this therapy is most successful in patients for whom the resection involves only bony structures, with minimal sacrifice of tongue, floor of the mouth, and adjacent soft tissues. the exercise as suggested by beumer. was suggested to the patient. in this procedure, following maximum opening, the patient manipulates the mandible by grasping the chin and moving the mandible away from the surgical side. these movements tend to loosen scar contracture, reduce trismus, and improve maxilla - mandibular relationships. the guide flange was used for a period of 4 months until the patient experienced considerable decrease in deviation (improvement was observed after 4 weeks of insertion). the success in rehabilitating a patient with hemimandibulectomy depends upon the nature and extent of surgical defect, treatment plan, type of prosthesis, and patient co - operation. the earlier the mandibular guidance therapy is initiated in the course of treatment, the more successful is the patient 's definitive occlusal relationship. any delays in the initiation of mandibular guidance appliance therapy, due to problems such as extensive tissue loss, radiation therapy, radical neck dissection, flap necrosis, and other postsurgical morbidities may result in an inability to achieve normal maxillomandibular relationship. root pieces were extracted later during the stage of the definitive prosthesis since the patient had a history of radiation therapy and the extraction was delayed to avoid osteoradionecrosis. definitive treatment involved fabrication of a maxillary cast partial denture with two rows of teeth. the palatal row of teeth provided favorable occlusal relationship, and the buccal row of teeth supported the cheeks. a functional occlusal record was obtained in wax placed lingual to the maxillary posterior teeth and used as an index to arrange the palatal row of teeth. to obtain stable occlusal intercuspation, the mandibular teeth on the unresected side were arranged buccal to the crest of the ridge and teeth on the resected side more lingually. the guide flange was cut off from the mandibular cast partial denture once the patient was acclimatized to the new prosthesis. mastication was confined to the nonresected side only and the teeth on the resected side provided bilateral occlusion and thus stabilization of the prosthesis. recalls were carried out over a period of 4 years, and the patient reported an increase in masticatory efficiency and seemed happy with the treatment. retention provided by the attachment can be increased with the various retentive caps as per the patients comfort. in this case, extracoronal attachment was used on a single tooth on ether sides, thus special attention was given to maintain favorable crown : root ratio. mesial rests coupled with precision attachments were used for effective stress distribution. both teeth exhibited sufficient root length and bone support. the teeth were evaluated during the periodic recalls and a healthy periodontal status was maintained. considerable improvement in facial profile of the patient was observed posttreatment [figure 7a and b ] and further improvement was seen during recall visits. (a and b) pre- and post - treatment facial profile adell. have carried out a retrospective evaluation to evaluate the possibility of providing every patient with dental rehabilitation after segmental resections and primary jaw reconstructions. however, they require extensive period for healing and acceptance of graft and are expensive. thus, more immediate and economical means of prosthetic rehabilitation are preferred by most patients. the prognosis of the prosthesis in functional rehabilitation of hemimandibulectomy patient who has undergone resection without reconstruction is guarded. however, in cases where sufficient numbers of abutment teeth are not present and where deviation is massive, providing twin occlusion rehabilitates the patient functionally. surgical reconstruction by implants and grafts of various types is the ideal treatment when feasible. however, it is not always feasible in every patient, alternative prosthodontic approach has to be considered to restore the esthetics and function in such subject. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. | loss of mandibular continuity results in deviation of remaining mandibular segment toward the resected side primarily because of the loss of tissue involved in the surgical resection. the success in rehabilitating a patient with hemimandibulectomy depends upon the nature and extent of the surgical defect, treatment plan, type of prosthesis, and patient co - operation. the earlier the mandibular guidance therapy is initiated in the course of treatment ; the more successful is the patient 's definitive occlusal relationship. prosthodontic treatment coupled with an exercise program helps in reducing mandibular deviation and improving masticatory efficiency. this case report describes prosthodontic management of a patient who has undergone a hemimandibulectomy and was rehabilitated using provisional guide flange prosthesis followed by a definitive maxillary and mandibular cast partial denture with precision attachments designed to fulfill the patient 's needs and requirements. |
the assessment of patient recovery, rehabilitation, and clinical outcome postoperatively is important for the validation of the safety, efficacy, and economic dynamics of various spine surgical techniques.1 traditionally, patient - based subjective ratings of symptoms and function have been used to gauge the success and extent of recovery. commonly used scores include the visual analog scale (vas) ; short form (sf)-8, sf-12, sf-36 ; and oswestry disability index (odi). although these scores have been used extensively to demonstrate the safety and efficacy of surgical interventions, the main drawback of this type of assessment is the inherent subjectivity involved in patient scoring.2 3 indeed, patients ' own perception of their disability and symptoms, as well as variation in each patient 's own environment, can have an unaccounted influence on the subjective patient - based scores.3 4 furthermore, the issue of subjective outcome rating is increasingly important in the compensation arena. the studies that assessed patient outcome and fusion status following anterior cervical decompression fusion for radiculopathy note similar rates of fusion between compensable and noncompensable patients, but with a higher rate of poorer outcome based on subjective scoring analysis in the compensable group.5 although pain scores have been previously used as a surrogate indicator of the level of ambulatory impairment, several recent studies have demonstrated poor correlation between subjective pain scores and ambulatory capacity measured using treadmill and walking test assessments.6 advances in technology have led to the advent of accelerometer devices, which have the ability to accurately record physical activity data in real time, including number of steps and distance traveled. accelerometer devices are able to produce objective measurements of physical activity outcome,7 and thus may potentially give rise to an opportunity to assess postoperative recovery in terms of physical capacity using objective measurements.8 to the best of our knowledge, no study thus far has prospectively investigated objective physical activity measurements after lumbar spine surgery and tested whether these measurements correlate well with subjective functional scores. therefore, the aim of this study was to objectively measure functional outcome in patients who had lumbar spine surgery using quantitative physical activity measurements as derived from the accelerometers. approval was obtained from the south eastern sydney local health district, new south wales, australia (hrec 13/090). the patients were enrolled between 2013 and 2014 by the senior author (r.j.m.), who performed all the surgical procedures. the inclusion criteria were patients who underwent lumbar spine surgery within this recruitment period, with indications including low back pain, radiculopathy, and claudication. the procedures performed included anterior lumbar interbody fusion (alif), laminectomy, diskectomy, and posterior lumbar interbody fusion. the exclusion criteria included infection, osteoporosis, cancer, and any other comorbid conditions that were thought to substantially limit activity beyond symptoms of back pain, radiculopathy, and neurogenic claudication. patients who were not motivated to pursue the requirements of the study, those with poor memory or mental health issues, and those who would not consent to the study were excluded. the fitbit activity monitor is a small, lightweight, commercially available device that is clipped to the patient 's belt or waistband or can be worn in pant pockets. the fitbit was utilized as the battery life was 6 months, which enhanced compliance. patients were given a unique username and password (consent obtained) to access the data. the fitbit was synced to the patients ' smartphone or computer, if a smartphone was not available. based on the inbuilt algorithms and validation studies,9 the fitbit device is able to estimate the number of steps taken, flights of stairs climbed, distance walked, and calories expended.) verified the accuracy of the fitbit by testing it while walking and running, and the accuracy was found to be 98 1%. the fitbit activity monitor was used to record average physical activity date, preoperatively and postoperatively. for the present study, follow - ups at 1, the parameters recorded included number of steps taken, distance traveled, and calories burned, which were used to calculate the average number of steps per day, distance traveled per day, and calories burned per day on follow - up. an example of such data recorded by the fitbit activity tracker and synced to a mobile / computer is demonstrated in fig. 1. screenshot of prospective data collection indicating (a) average steps per day and (b) average distance traveled per day from a patient recovering from a two - level fusion over 12-month periods. the initial month of data shown is the average number of steps per day or distance traveled per day preoperatively. patient clinical outcomes were measured using self - reported scores, including the 10-point vas for back and leg pain, the odi, and the sf-12, which included mental component summary (mcs) and physical component summary (pcs). the demographic variables including age and gender were summarized using descriptive statistics (mean standard deviation or percentage). the pre- and postoperative parameters were compared with a two - tailed, paired - sample t test. a p value < 0.05 was considered significant. all statistical analyses were performed using spss software (version 22.0, ibm, armonk, new york, united states). the pearson correlation test was performed to determine whether there was a significant correlation between changes in physical activity parameters (steps, distance, calories) versus changes in clinical outcome (vas, odi, and sf-12 mcs and pcs scores). the pearson correlation was presented as r and p value, where r signifies the strength of the correlation. the close the value of r is to 1 or 1, the stronger the correlation ; an r value close to 0 signifies almost negligible correlation. approval was obtained from the south eastern sydney local health district, new south wales, australia (hrec 13/090). the patients were enrolled between 2013 and 2014 by the senior author (r.j.m.), who performed all the surgical procedures. the inclusion criteria were patients who underwent lumbar spine surgery within this recruitment period, with indications including low back pain, radiculopathy, and claudication. the procedures performed included anterior lumbar interbody fusion (alif), laminectomy, diskectomy, and posterior lumbar interbody fusion. the exclusion criteria included infection, osteoporosis, cancer, and any other comorbid conditions that were thought to substantially limit activity beyond symptoms of back pain, radiculopathy, and neurogenic claudication. patients who were not motivated to pursue the requirements of the study, those with poor memory or mental health issues, and those who would not consent to the study were excluded. the fitbit activity monitor is a small, lightweight, commercially available device that is clipped to the patient 's belt or waistband or can be worn in pant pockets. the fitbit was utilized as the battery life was 6 months, which enhanced compliance. patients were given a unique username and password (consent obtained) to access the data. the fitbit was synced to the patients ' smartphone or computer, if a smartphone was not available. based on the inbuilt algorithms and validation studies,9 the fitbit device is able to estimate the number of steps taken, flights of stairs climbed, distance walked, and calories expended.) verified the accuracy of the fitbit by testing it while walking and running, and the accuracy was found to be 98 1%. the fitbit activity monitor was used to record average physical activity date, preoperatively and postoperatively. for the present study, follow - ups at 1, the parameters recorded included number of steps taken, distance traveled, and calories burned, which were used to calculate the average number of steps per day, distance traveled per day, and calories burned per day on follow - up. an example of such data recorded by the fitbit activity tracker and synced to a mobile / computer is demonstrated in fig. 1. screenshot of prospective data collection indicating (a) average steps per day and (b) average distance traveled per day from a patient recovering from a two - level fusion over 12-month periods. the initial month of data shown is the average number of steps per day or distance traveled per day preoperatively. patient clinical outcomes were measured using self - reported scores, including the 10-point vas for back and leg pain, the odi, and the sf-12, which included mental component summary (mcs) and physical component summary (pcs). the demographic variables including age and gender were summarized using descriptive statistics (mean standard deviation or percentage). the pre- and postoperative parameters were compared with a two - tailed, paired - sample t test. a p value < 0.05 was considered significant. all statistical analyses were performed using spss software (version 22.0, ibm, armonk, new york, united states). the pearson correlation test was performed to determine whether there was a significant correlation between changes in physical activity parameters (steps, distance, calories) versus changes in clinical outcome (vas, odi, and sf-12 mcs and pcs scores). the pearson correlation was presented as r and p value, where r signifies the strength of the correlation. the close the value of r is to 1 or 1, the stronger the correlation ; an r value close to 0 signifies almost negligible correlation. twenty - eight patients completed the accelerometer physical activity and clinical follow - up period. two patients lost their fitbit and therefore objective data analysis was not complete and they were excluded. the average age of the cohort was 42.60 10.34 years, and 17 patients were men (60.7%). alif was performed in 7 patients (25%), laminectomy in 13 patients (46.4%), posterior lumbar interbody fusion in 2 patients (7.1%) and diskectomy in 6 patients (21.4%). the primary indications included low back pain (n = 4), radiculopathy (n = 14), and claudication (n = 4) with several patients having multiple indications. in the preoperative period, the mean number of steps taken per day was 5,255 2,883 steps. following lumbar spine surgery, the number of steps per day at 1-month follow - up was 4,574 2,186, compared with 7,135 3,112 at 2-month follow - up and 8,312 4,218 at 3-month follow - up. there was a significant increase in the number of steps compared with preoperative status at 2-month follow - up (35.8%, p = 0.002) and 3-month follow - up (58.2%, p = 0.008 ; fig. 2). change in number of steps per day taken at follow - up. the mean distance traveled in the preoperative period was 3.8 2.2 km / d, compared with 3.4 1.7 km / d at 1-month follow - up. there was a 39.5% significant increase in distance traveled per day at 2-month follow - up to 5.3 2.5 km (p = 0.002), and 63% increase to 6.2 3.6 km / d at 3-month follow - up (p = 0.0004). there was no difference in the number of steps taken preoperatively versus early postoperative phase (1-month follow - up ; fig. the mean number of calories consumed in the preoperative phase was 2,137 481 per day, compared with 2,089 401 per day at 1-month, 2,228 490 per day at 2-month, and 2,592 1,185 per day at 3-month follow - up. 4). change in calories per day consumed at follow - up. at latest follow - up, there was a significant reduction in vas back pain score from 7.0 2.7 to 2.8 1.9 (p = 0.0002). vas leg pain scores also significant decreased postoperatively from 6.3 3.3 to 1.5 0.7 (p = 0.01). after surgery and follow - up, there was a significant increase in odi scores from 46.0 19.0 to 26.9 17.7 (p = 0.005). although there was no change in the mcs component of sf-12 scores (p = 0.65), a significant increase in the pcs component of sf-12 scores from 33.0 8.2 to 44.0 8.7 (p = 0.02) was noted (fig. preoperative and postoperative clinical outcomes following lumbar spine surgery : (a) visual analog scale (vas) back pain ; (b) vas leg pain ; (c) oswestry disability index (odi) ; (d) short form 12 (sf-12) mental component summary (mcs) score ; (e) sf-12 physical component summary (pcs) score. the pearson correlation test was used to evaluate the contributions of physical performance to clinical and function outcome. the analysis between improvement in number of steps per day with change in vas back pain (r = 0.446, p = 0.316), vas leg pain (r = 0.472, p = 0.285), and pcs (r = 0.058 there was also no significant correlation between improved distance traveled per day with change in vas back pain (r = 0.333, p = 0.348), vas leg pain (r = 0.012, p = 0.975), and pcs (r = 0.117, p = 0.747) scores. the current prospective series demonstrates that : (1) accelerometry is a feasible method of measuring objective physical activity parameters with high patient compliance ; (2) there was a significant improvement in steps per day and distance traveled per day at follow - up following lumbar spine surgery ; and (3) although both subjective pain / functional scores and physical activity parameters improved with follow - up, the lack of correlation indicates the limited power of subjective scores to predict physical activity levels during recovery and follow - up from lumbar spine surgery. few researchers have studied the role of accelerometers for objective measurements of physical activity in patients with lumbar spinal pathology and in patients undergoing lumbar surgery. in one such study in patients with lumbar spine stenosis by pryce,10 accelerometers was used to measure physical activity, including the number of calories consumed per kilogram per day, the intensity and duration of exercise, and ambulation via bout length. linear regression and adjusted models were then use to correlate this data with clinical outcome scores including odi and sf-36 in 33 patients with lumbar spinal stenosis. the authors concluded that subjective measurements for pain and disability had limited ability to predict real - life physical performance in patients with lumbar spine stenosis. this study is the first to our knowledge that is focused on patients undergoing lumbar spine surgery for pain, radiculopathy, or claudication. the physical activity parameters were very similar preoperatively versus the early postoperative phase (1-month follow - up), given that the patients were still recovering from their surgery and had reduced ambulation. however, beyond this temporal threshold, significant improvements in number of steps taken and distance traveled were seen at 2-month and 3-month follow - up. this result was also similarly reflected in the significant improvements in vas back and leg pain scores, odi, and physical component of sf-12. similar to the study by pryce,10 no correlation was found between clinical physical activity and functional clinical scores. thus, these results provide evidence that subjective patient - based scores are not adequate to predict real - life physical activity at follow - up. this trend suggests that pain is not the only factor responsible for physical activity impairment following lumbar surgery, and thus, data based only on patient self - scores should be interpreted with caution.1 rather, a holistic assessment of patient function and recovery following spinal surgery may be achieved with objective measurements, which can be obtained using accelerometers. overall, the present results suggest that the use of accelerometers to measure physical activity parameters over follow - up is feasible in patients having spine surgery. the use of objective physical activity measurements with the accelerometer may potentially help overcome several limitations of self - reported outcomes, including documenting inaccuracies, the prevalence of overreporting activity levels, and the lack of standardization across different publications as to which scoring system to use.11 12 in contrast to the relatively labor - intensive surveys and repetition at different follow - up periods, continuous accelerometer collection of data can be automated with inbuilt algorithms.8 13 14 however, objective physical activity measurements using accelerometers still require validation in a spine surgery population, which should be addressed in future prospective trials. the introduction of accelerometer - based objective physical activity measurements provides a whole new platform for new research opportunities. potential future studies may look to explore any differences between the different surgical approaches in terms of postoperative recovery physical activity. for example, objective physical activity measurements may have a potential role in the assessment of minimally invasive lumbar fusion surgery versus traditional open surgery, whereas the present studies in the literature based on self - scored clinical outcomes have been met with resistance and controversy. in addition, accelerometers may potentially be useful in planning and evaluating physical activity interventions as part of follow - up physiotherapy. this study is the first to evaluate physical activity in a spine surgery cohort using accelerometers. the strengths also include the prospective nature of the assessment and the relatively long - term evaluation of physical activity, with prior studies using only 7-day assessment.10 a high rate of compliance was found, demonstrating that the use of accelerometers for postoperative follow - up after lumbar spine surgery is feasible. first, the prospective study cohort is heterogeneous, including patients with various procedures such as alif, diskectomy, and laminectomy. given the relatively small number of patients in this cohort, subgroup and multivariate analysis to compare outcome differences between these procedures was not feasible.15 in addition, the indications for lumbar spine surgery were varied and included radiculopathy, claudication, and low back pain. because of the small number of patients and the different pathologies surgically treated in multiple ways, we could not assess which pathology and which surgery would be best suited for this activity - measuring technique. recent studies have also suggested differences in accuracies in various physical activity tracking technologies, with smartphone applications as a potential alternative for measuring objective measurements.16 future prospective studies should investigate the long - term outcomes in terms of objective physical activity measurements and how they compare and correlate with long - term clinical outcome based on subjective rating scores. future studies should also use a larger sample size and stratify outcomes according to surgery and indication. this study is the first to evaluate physical activity in a spine surgery cohort using accelerometers. the strengths also include the prospective nature of the assessment and the relatively long - term evaluation of physical activity, with prior studies using only 7-day assessment.10 a high rate of compliance was found, demonstrating that the use of accelerometers for postoperative follow - up after lumbar spine surgery is feasible. first, the prospective study cohort is heterogeneous, including patients with various procedures such as alif, diskectomy, and laminectomy. given the relatively small number of patients in this cohort, subgroup and multivariate analysis to compare outcome differences between these procedures was not feasible.15 in addition, the indications for lumbar spine surgery were varied and included radiculopathy, claudication, and low back pain. because of the small number of patients and the different pathologies surgically treated in multiple ways, we could not assess which pathology and which surgery would be best suited for this activity - measuring technique. recent studies have also suggested differences in accuracies in various physical activity tracking technologies, with smartphone applications as a potential alternative for measuring objective measurements.16 future prospective studies should investigate the long - term outcomes in terms of objective physical activity measurements and how they compare and correlate with long - term clinical outcome based on subjective rating scores. future studies should also use a larger sample size and stratify outcomes according to surgery and indication. this study is the first to examine the role of measuring objective physical activity and demonstrates high compliance and statistically significant improvement in patients having lumbar decompression and lumbar fusion. however, there was no significant correlation found between improvements in subjective clinical outcome scores with changes in physical activity measurements at follow - up the validity of objective physical activity measurements should be assessed in future larger, prospective studies. | study design prospective observational study.objective patient - based subjective ratings of symptoms and function have traditionally been used to gauge the success and extent of recovery following spine surgery. the main drawback of this type of assessment is the inherent subjectivity involved in patient scoring. we aimed to objectively measure functional outcome in patients having lumbar spine surgery using quantitative physical activity measurements derived from accelerometers.methods a prospective study of 30 patients undergoing spine surgery was conducted with subjective outcome scores (visual analog scale [vas ], oswestry disability index [odi ] and short form 12 [sf-12 ]) recorded ; patients were given a fitbit accelerometer (fitbit inc., san francisco, california, united states) at least 7 days in advance of surgery to record physical activity (step count, distance traveled, calories burned) per day. following surgery, postoperative activity levels were reported at 1-, 2-, and 3-month follow-up.results of the 28 compliant patients who completed the full trial period, mean steps taken per day increased 58.2% (p = 0.008) and mean distance traveled per day increased 63% (p = 0.0004) at 3-month follow - up. significant improvements were noted for mean changes in vas back pain, vas leg pain, odi, and sf-12 physical component summary (pcs) scores. there was no significant correlation between the improvement in steps or distance traveled per day with improvements in vas back or leg pain, odi, or pcs scores at follow-up.conclusions high compliance and statistically significant improvement in physical activity were demonstrated in patients who had lumbar decompression and lumbar fusion. there was no significant correlation between improvements in subjective clinical outcome scores with changes in physical activity measurements at follow - up. limitations of the present study include its small sample size, and the validity of objective physical activity measurements should be assessed in future larger, prospective studies. |
a 36-year - old man with an itching and tingling sensation in the left l2 dermatome area for 3 months was referred to our clinic for pain management. the patient did not have significant past medical history, and before coming to the clinic, he had been treated with gabapentin 600 mg 3 times a day by a dermatologist but the symptoms were not improved. there were no unusual finding in the biopsy other than subcorneal pustules, hyperkeratosis and parakeratosis ; therefore, he was referred to our department for pain control. he was also complaining of allodynia and paresthesia, and his visual analogue scale (vas) was 2 out of 10 (0 = no pain, 10 = worst possible pain). his motor function was intact and there was no sensory loss. his knee jerk reflex was increased (3+/3 +) thus a thoraco - lumbar spine magnetic resonance imaging (t - l mri) was performed due to suspicion of an upper motor neuron (umn) lesion. in the mri, an intramedullary lesion 1.2 cm in size was found in the dorsal subpial surface of the t11 - 12 level, and this was diagnosed as type ii avm in the t11/12 level of the spinal cord (fig. a spinal angiography was performed on the patient and the results revealed that the lesion was a spinal cord avm supplied by the anterior spinal artery from the left t9 intercostal artery. it was also contrasted from the left l1 lumbar artery (artery of adamkiewicz) (fig. the patient was transferred to another hospital for removal of avm with cyber knife, and after the operation, the symptoms were improved. laboratory tests are the tzank smear, a serological test such as the indirect fluorescent antibody method, and detection through molecular biology or immunology such as tissue cultures. a dermatomal rash is not present in zsh so it is difficult to suspect hz, and hence, serological, immunological, or molecular biological tests are not performed during the acute phase. only when the pain continues chronically are many cases diagnosed by the characteristics of pain. however, when a patient complains of continuing dermatomal neuropathic pain, a detailed history taking and accurate physical examination should be done to differentiate zsh from sciatica, collapsed intervertebral disc, spinal stenosis, tumor, angina, renal colic, cholecystitis, costochondritis, intercostal neuralgia, entrapment syndrome, pleurodynia, myofascial pain syndrome, and other neuropathic pain before diagnosis. in this case, the patient complained of tingling pain with a vas score of 2 and accompanying itching, paresthesia, and allodynia in the left l2 dermatome for 3 months. during the physical examination, motor and sensory function was intact but the knee jerk reflex was increased to 3 + on both sides. hence, an umn lesion above the l2 level was suspected, an avm in the t11/12 level was discovered in the t - l mri. the umn is the pathway from the brain and brainstem to the anterior horn of the spinal cord. the lower motor neuron (lmn) is the pathway from the anterior horn of the spinal cord to the skeletal muscles. in this case, only the knee jerk reflex was hyperactive with l2 dermatomal pain without any other general symptoms or symptoms in the upper extremity. therefore, a spinal cord lesion in a level higher than the l2 level was anticipated, and a t - l mri was performed to diagnose the avm. other symptoms that suggest an umn lesion are weakness, paralysis, spasticity, and muscle atrophy, but these symptoms were not observed in our patient. only the hyperactivity of the knee jerk reflex was observed, but if the babinski response (the most sensitive indicator of the umn) had been checked, it would have been more helpful in making the diagnosis. avm is the abnormal development of blood vessels which occurs during the 4th to 8th week of embryonic development when blood vessels are differentiated into arteries, veins, and capillaries. normally arteries and veins are connected by capillaries, but there is no true capillary bed in avm ; thus over time, a tangle is formed in the blood vessel connecting the artery and vein. therefore, oxygenated arterial blood is shunted and supplied directly into the venous system which can cause temporary or permanent ischemia in the surrounding tissue. avm can develop anywhere in the body and there can be various manifestations of symptoms according to the location and blood flow. usually, it develops in the limbs, neck, and face, and it can cause pain, congestive heart failure, and hypotension from vascular congestion and so on. cerebral avm can cause seizure or severe headaches, but mostly there are no symptoms. spinal avm has a prevalence of approximately 10% for cerebral avm and less than 5% for an intraspinal mass. as in this case, it usually occurs in middle - aged men in the lower thoracic or lumbar region. typical early symptoms are dermatomal lancinating pain, weakness / paralysis, numbness, and paresthesia [9 - 11 ]. spinal avm glomus - type (type 2) with a tightly compacted group of arterial and venous vessels inside a short segment of the spinal cord, and usually, it is supplied by one artery. spinal avm is very rare with a prevalence of less than 1%, shows various clinical symptoms, and is difficult to differentiate from other diseases such as tumors, herniated nucleus pulposus, multiple sclerosis, meningovascular syphilis, tuberculosis, and transverse myelitis. however subarachnoid hemorrhage or spinal cord hemorrhage due to avm rupture and the subsequent acute neurologic deficit are increasing by 2 - 3% every year, and the mortality at first hemorrhage reaches 10 - 30% ; therefore, an accurate differential diagnosis is very important. additionally, in this case, the avm was discovered in the mri, but there are many cases which can not be detected by mri thus an angiography must be performed for diagnosis. in this case, spinal avm was accurately diagnosed through a detailed neurologic examination, and the appropriate treatment was given. therefore, when a patient complains of dermatomal neuropathic pain without a rash, a detailed and accurate physical examination should be performed before diagnosing zsh, and laboratory tests should be performed for the acute phase to differentiate it from other diseases that cause neuropathic pain. | zoster sine herpete (zsh) is difficult to diagnosis during an acute period due to the absence of the characteristic zosteriform dermatomal rash ; therefore, progression to postherpetic neuralgia is more common than typical zoster. in addition, misdiagnosis of other neuropathic pain as zsh is common in clinical situations. here, we report a case of spinal arteriovenous malformation that mimics zsh. this is a rare condition ; therefore, high clinical suspicion for a correct diagnosis and proper examination are not easy. however, early diagnosis and definitive treatment are essential to prevent neurologic deficit and mortality. |
thyroid cancer is the most prevalent endocrine malignancy (accounting for > 92% endocrine malignancy), which can be classified histologically into follicular epithelial cell - derived papillary thyroid cancer (ptc), follicular thyroid cancer (ftc), anaplastic thyroid cancer (atc), and parafollicular c - cell - derived medullary thyroid cancer (mtc) [1, 2 ]. in the past several decades, the incidence of thyroid cancer worldwide has been steadily increasing, and this rising is mainly attributed to the increased diagnosis of ptc [29 ]. ptc is the most common histological type of thyroid cancers and accounts for approximately 80% of reported cases. however, the mortality of ptc with aggressive clinicopathological features was much higher when compared with ptc without these clinicopathological features. therefore, it is of great importance to identify biomarkers that are associated with aggressive clinicopathological features of ptc, and these biomarkers might also serve as potential pharmacological targets for ptc. braf mutation is the most common genetic alteration in thyroid malignances, exclusively existing in ptc and ptc - derived atc, but not in ftc and mtc. numerous studies have consistently shown that braf mutation, which upregulates thyroid cell division and proliferation by activating mapk pathway, is mutually exclusive with other common genetic alterations such as the rearrangement in transformation / papillary thyroid carcinoma (ret / ptc) signal and ras mutation [1113 ]. importantly, many studies have proved that braf mutation is correlated with high - risk clinicopathological characteristics, such as larger tumor size, extrathyroidal invasion, local lymph node metastasis, distant metastasis, and advanced disease stages, suggesting that it is not only an independent oncogenic event for ptc tumorigenesis, but also involved in progression of ptc [1416 ]. micrornas (mirnas) are small noncoding rna molecules, about 2125 nucleotides in length, which negatively regulate gene expression at the posttranscriptional level. more than 1000 mirnas are found in humans and up to one - third of the total human mrnas are predicted to be mirna targets. aberrant mirna expression has been described in a variety of tumors, including ptc [1721 ]. reported that 17 mirnas were upregulated in ptc compared to adjacent normal tissue and defined five mirnas (mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21) being able to predict cancer status. revealed the upregulation of mirna-21, mirna-31, mirna-221, and mirna-222 by real - time rt - pcr in ptc compared to multinodular goiter. among the various studies reported, the expression of 5 mirnas, including mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21, has been shown to be dysregulated. in our study, we sought to further validate the expression of these 5 previously reported mirnas in differentiating ptc from benign thyroid nodules (btns) in chinese patients. moreover, the associations between mirnas and braf mutation, as well as other clinicopathological features, will be addressed in the present study. data of patients (shown in table 1), archival ffpe surgical samples previously diagnosed as ptc (52 samples) and btn (52 samples), were obtained from the first affiliated hospital and cancer center of sun yat - sen university (guangzhou, china). informed consents were provided by all subjects and the study protocol was approved by the ethics committee of sun yat - sen university. for rna isolation, eight 10 m sections per sample were obtained from the selected block for extraction of mirna with the mirneasy ffpe kit (qiagen, hilden, germany). genomic dna was extracted from ffpe samples using the qiaamp dna ffpe tissue kit (qiagen). the rna and dna yields were determined using the nanodrop nd-1000 spectrophotometer (nanodrop, usa). a panel of 5 mirnas (mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21) was selected based on previous reports [1722 ]. quantification of these five mirnas was performed by using miscript pcr system (qiagen) as previously described. in brief, each 5 l sample of dissolved rna was polyadenylated and reverse - transcribed to cdna in a final volume of 20 l using the miscript reverse transcription kit (qiagen). real - time pcr was performed in duplicate using the miscript sybr green pcr kit (qiagen) with the abi prism 7500 sequence detection system (applied biosystems, foster city, ca, usa). the miscript primer assays are part of the miscript pcr system for mirna detection and quantification. exon 15, which contains the locus of the t1799a mutation, was amplified using primer pairs as previously reported. all statistical analyses were performed using statistical package for the social sciences (spss) software (version 16.0, chicago, il, usa). the mann - whitney u test was used to determine the significance of different levels of mirna expression. receiver operating characteristic (roc) curves were used to analyze the diagnostic utility of different markers. chi square test was used to identify possible associations between braf mutation and clinicopathological features of ptc patients. all p values were two - sided and a p value less than 0.05 was considered statistically significant. expression of five mirnas (mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21) in ffpe tissues from patients with ptc or btn was measured by qrt - pcr. all these five mirnas were significantly higher in ptcs than those in btns (20.98 46.52 versus 2.51 4.66, 15.82 26.07 versus 2.03 3.24, 195.67 426.14 versus 2.87 5.74, 5.98 11.20 versus 2.82 11.16, and 14.78 23.98 versus 3.44 12.03, resp., all p values < 0.001) (figure 1). to evaluate the diagnostic value of these five mirnas for ptc, individually, the aucs for mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21 were 0.872 (cutoff value 0.022, sensitivity 82.7%, specificity 78.8%), 0.868 (0.069, 71.2%, 88.5%), 0.952 (0.021, 90.4%, 88.5%), 0.837 (0.079, 71.2%, 84.6%), and 0.877 (0.071, 76.9%, 88.5%), respectively (figures 2(a)2(e)). the 5-mirna set had an area under the roc curve (auc) of 0.937 (95% confidence interval (ci) = 0.8910.983), with a sensitivity of 90.4% and a specificity of 88.5% at the cutoff value of 0.471 (figure 2(f)). when assessing the relationship between braf mutation and clinicopathological features, we found that braf mutation occurred more frequently in ptc patients (19/52) with advanced tnm stage (p = 0.014). however, other clinicopathological features, including tumor size and cervical lymph node metastasis, were not significantly different between patients with or without braf mutation. ptc patients were further divided into braf mutation group and non - braf mutation group and the expression of mirna was compared. the mirna-221, mirna-222, mirna-146b, and mirna-181 expression levels were significantly higher in braf mutation group than in non - braf mutation group (mirna-221, 15.29 (2.7062.02) versus 6.36 (0.68269.35), p = 0.001 ; mirna-222, 11.82 (2.7343.93) versus 4.73 (0.04168.94), p = 0.019 ; mirna-146b, 182.19 (10.701123.18) versus 55.11 (0.722917.96), p = 0.003 ; and mirna-181, 5.58 (2.0818.86) versus 2.46 (0.0980.72), p = 0.005). however, there was no significant difference in mirna-21 expression level between the two groups (p = 0.104) (figure 3(a)). we next accessed the differences in the expression levels of these 5 mirnas in ptc patients with different clinicopathological characteristics (table 2). the levels of mirna-221 and mirna-181 were significantly higher in patients with tumor diameter 2 cm than < 2 cm (p = 0.004 and p = 0.008, resp.) (figure 3(b)). the expression levels of mirna-221 and mirna-222 were significantly higher in ptcs with advanced tumor - node - metastasis (tnm) stage (p = 0.004 and p = 0.041, resp.) in addition, patients with lymph node metastasis had higher expression levels of mirna-221 and mirna-222 (p = 0.033 and p = 0.014, resp.) there were no significant differences in these mirna levels in ptc patients with other clinicopathological parameters, including age, gender, tumor multicentricity, heteromorphic nucleus, thyroid globulin quantification, and ames (risk definition including age, metastases, extent, and size) score (table 2). in the present study, we have reported the association of 5 previously reported mirnas and braf mutation and the clinicopathological features in chinese patients with ptc. we showed that the expression levels of these five mirnas (mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21) were significantly higher in ffpe tissues from ptcs than btns. mirna-221, mirna-222, mirna-146b, and mirna-181 expression levels were significantly higher in ptc patients with braf mutation. enhanced expression of mirna-221 and mirna-222 was found in patients with cervical lymph node metastasis and advanced tnm stage. although most of the thyroid nodules are benign, 5% to 30% of nodules are still malignant and require surgical intervention. at present, pathological study is the golden criteria of diagnosis of thyroid nodules. however, there are several limitations in the pathological diagnosis of thyroid nodules, including inadequate sampling, indeterminate result, and possible misdiagnosis. during the past decades, gene detection techniques have developed considerably, which make it possible to further explore tumorigenesis and progression of ptc at molecular level and to discover potential diagnostic and prognostic biomarkers. among these techniques, detection of some specific mirna expression levels is a promising method to provide information for molecular diagnosis of ptc [1820 ]. in our study on utility of mirna profiling, we have correlated this data with pathology of the surgical specimen, a gold standard of diagnosis, and we believe that our findings are certainly helpful in providing potentially diagnostic biomarker for ptc before operation. our results demonstrated that each of these 5 mirnas or the 5-mirna set (mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21) could be used as a potential biomarker to differentiate ptc from btn, with highest diagnostic value for mirna-146b (sensitivity of 90.4% and specificity of 88.5% at an auc of 0.952) and 5-mirna set (sensitivity of 90.4% and specificity of 88.5% at an auc of 0.937). therefore, we suggest that use of the 5-mirna set as a potential diagnostic biomarker for ptc might be more helpful. in order to further validate the potential diagnostic value of mirna in the preoperative evaluation of thyroid nodules, we will analyze the proposed mirnas data in intermediate or suspicious braf mutation is the most common mutation in ptc, which leads to a constitutive activation of the mapk pathway. activation of this pathway is a common and important mechanism in genesis and progression of human cancers through upregulating cell division and proliferation [1113 ]. a number of studies have reported that braf mutation was associated with aggressive ptc characteristics, such as extrathyroidal extension, lymph node metastasis, tumor recurrence, decreased survival, and need for cervical reoperation [1416 ]. in our present study, we found that braf mutation occurred more frequently in the ptc patients with advanced tnm stage, which is consistent with previous studies [14, 27, 28 ]. chou. demonstrated that mirna-146b was overexpressed in ptc with braf mutation. yip. also documented that overexpression of mirna-146b was associated with aggressive behavior in braf mutant ptc. however, sheu. reported that there was no correlation between braf mutation and the expression profile of a set of mirnas (mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21) in ptc. in our study, mirna-221, mirna-222, mirna-146b and mirna-181 expression levels were significantly higher in ptc patients with braf mutation. the discrepancy between these studies could be due to different sample origins and the fundamental methodological differences used in the profiling studies. therefore, it is of interest to further elucidate how these mirnas and braf mutation interact with each other in the pathogenesis and progression of ptcs. mirna-221 and mirna-222, which are encoded in tandem on the x chromosome, have been shown to be overexpressed in numerous human tumors including ptc [3235 ]. over - expression of mirna-221 and mirna-222 in cancer cell lines facilitates cell proliferation via downregulation of the expression of p27/kip1 and/or p57/kip2, both of which are cell cycle inhibitors and tumor suppressors. have demonstrated the upregulation of mirna-221 in uninvolved thyroid tissue from individuals with ptc compared to normal thyroid tissue from individuals without thyroid disease. confirmed that not only mirna-221 but also mirna-222 was overexpressed in some cases of multinodular goiter in comparison with ptc, suggesting that upregulation of mirna-221 and mirna-221 is perhaps early events in thyroid carcinogenesis. nevertheless, our current study showed that expression of mirna-221 and mirna-222 is significantly upregulated in ptc compared to btn and in patients with advanced tnm stage and lymph node metastasis. similar to our findings, a report from taiwan showed that mirna-221 and mirna-222 were significantly associated with extrathyroidal invasion of ptc. taken together, upregulation of mirna-221 and mirna-222 may not only be involved in the development of ptc, but also in invasion and metastasis of ptc. mir-181 has been demonstrated to function both as oncogene and tumor suppressor depending on the origin of tissues and cells. the downregulation of this mirna has also been noticed in gliomas and aggressive cll. in our study, mir-181 expression was significantly higher in ptc versus btn, suggesting that mir-181 might serve as an oncogene. moreover, the expression level of mirna-181 was higher in ptc with larger tumor size. reported that mir-181, by directly targeting on rassf1a, timp3, and nlk, might be involved in hepatocellular cancer stem cells differentiation and invasion. considering the roles of mir-181 in carcinogenesis, the target genes of mirna-181 in ptc are required to be identified in the future. mirna-146b over - expression has been shown in the majority of ptc studies [19, 20, 41 ]. in a series composing of seven pathologically distinct thyroid nodules, chen. demonstrated that mirna-146b, but not mirna-221 and mirna-222, was most consistently overexpressed in ptc. chou. suggested that mir-146b is a novel prognostic factor of ptc, and overexpression of mir-146b significantly increased cell migration and invasiveness. in our study, we showed that mirna-146b might be more helpful for distinguishing patients with ptc from btn subjects, while there was no significant difference in mirna-146b expression in ptc patients with different clinicopathological features. as to the expression levels of mirna-21, although it was significantly higher in ptc versus btn, there was substantial expression overlap between the two lesions and there was also no significant difference in mirna-21 level in ptc patients with any tested clinicopathological features. these mirnas might act as a tumor - related mirna, but their roles in the pathogenesis of ptc still need further investigation. in conclusion, we have confirmed that 5 previously reported mirnas (mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21) were up - regulated in chinese patients with ptc. enhanced expression of these mirnas occurred more frequently in ptc patients with braf mutation and some clinicopathological features. our findings showed a role of selected mirnas as potential biomarkers in differentiating ptc from btn and as a prognostic indicator of ptc in chinese population. | micrornas (mirnas) dysregulation has been shown to play a critical regulatory role in papillary thyroid carcinomas (ptcs). braf mutation is associated with poor clinicopathological outcomes in ptc. in order to identify a possible association between dysregulated mirna expression and braf mutation as well as clinicopathological features in chinese patients with ptc, we examined the expression levels of five reported dysregulated mirnas (mirna-221, mirna-222, mirna-146b, mirna-181, and mirna-21) and determined braf mutation status in 52 patients with ptc and 52 patients with benign thyroid nodules (btns). the expression levels of all five mirnas were significantly increased in ptc when compared to btn. the braf mutation occurred more frequently in ptc cases with advanced tnm stage. importantly, mirna-221, mirna-222, mirna-146b, and mirna-181 expression levels were significantly higher in ptc patients with braf mutation. in addition, enhanced expression of mirna-221 and mirna-222 was found in patients with cervical lymph node metastasis and advanced tnm stage. increased expression of mirna-221 and mir-181 was evidenced in patients with larger tumors. these findings showed a potential role of this distinct profile of mirnas in differentiating ptc from btn. braf mutation might regulate or interact with mirna in the pathogenesis and progression of ptc. |
why is egypt 's hepatitis c (hcv) epidemic so much more intense than elsewhere ? numerous lines of evidence point to the key role that the widespread use of parenteral antischistosomal therapy (pat) played in this regard [1, 2 ]. however, question marks remain : numerous other countries have experienced similarly intense mass intravenous injections campaigns with inadequate attention to injection sterility without dramatic hcv epidemics [3, 4 ]. furthermore, numerous contemporary studies have found that less than 20% of those testing hcv seropositive in egypt have a history of pat exposure [1, 2 ]. although there is some evidence of a reduction in incidence, this is disputed, and hcv incidence has remained high. nonsterile medical and dental activities have been convincingly shown to be important in this regard [2, 6 ], but little or no evidence has been provided that these practices are more prevalent in egypt than other middle - income countries. these considerations suggest that there may be other cofactors which may have been important in the generation of egypt 's uniquely high hcv prevalence. the results of a study to investigate the risk factors for prevalent hcv in egypt using the country 's first nationally representative sample found that female genital cutting (fgc) was associated with hcv on multivariate analysis but only in urban areas. since egypt is one of a small number of countries where fgc is widespread this relationship merits more attention. in this paper the egyptian demographic and health surveillance (edhs), conducted in 2008, entailed a three - stage probability sample that provided a representative sample of 12,780 men and women aged 1559. a third generation enzyme - linked immunosorbent assay was used to detect hcv antibodies (adaltis eiagen hcv ab, casalecchio di reno, italy). full details of the survey and sampling strategy have been previously published [1, 7 ]. firstly, we performed a linear regression to analyze the ecological association between hcv and fgc prevalence by the six major areas that the edhs was stratified by urban and frontier governorates and upper and lower egypt (each divided into rural and urban areas). this stratification is based on the fact that egypt, in 2008, was divided into 26 governates. the four urban governorates (cairo, port said, alexandria, and suez) have only urban populations. nine of these governorates are in the nile delta (lower egypt) and eight are in the nile valley (upper egypt). the remaining five frontier governorates are located on the western and eastern boundaries of egypt. secondly, we compared hcv prevalence according to who performed the circumcision. fgc prevalence here is defined as the percentage of women who turn 15 on a particular year and who report having ever experienced fgc. this variable was defined in this way since the edhs recruited women from age 15 and 99.6% of women who have ever experienced fgc have done so by age 15. the data for hcv prevalence trends is taken from the only longitudinal study of hcv prevalence from egypt. this is a study of hcv seropositivity in 55,922 first time blood donors from the mansoura region from 2000 to 2007. fourthly, we calculate the population attributable fraction of fgs for hcv infection in women. the statistical analyses were conducted in stata 12.0 (college station, tx ; usa) using the survey (svy) methodology. all hcv prevalence rates and 95% confidence intervals (ci) in the ecological analysis (figure 1(a)), we found a strong association between the prevalence rates of hcv and fgc at a regional level (pearson r74% ; p < 0.0001). we repeated the same ecological analysis at the level of egypt 's 26 governates and found a weaker but still statistically significantly related correlation between hcv and fgc prevalence. since the edhs was designed to provide samples that were representative at the six regional levels but not at governate level we do not display these governate - level results. this varied from 4.2% (95% ci 3.25.7) to 15.4% (95% ci 14.216.6) when a doctor and non - doctor, respectively, performed the procedure (p < 0.0001). 78.8% of all excisions were performed by informal health practitioners most commonly dayas (traditional birth attendants). as demonstrated in figure 1(b), there has been a decline in the proportion of women reporting fgc. this decline is most marked in those reporting that they had fgc performed by a non - doctor. hcv prevalence in first - time blood donors declined from 17.7% in 2000 to 7.4% in 2007. the declines in fgc prevalence by year predate the declines in hcv prevalence as demonstrated in figure 1. the analysis by guerra. of the edhs established that fgc was associated with hcv antibody positivity on multivariate logistic regression. there are a number of possible explanations for this, one of which is that fgc is so prevalent in rural areas that there are too few women who are not excised in these areas to be able to demonstrate an effect of fgc on hcv prevalence. for example, in one of the few other studies to consider the impact of fgc on hcv in egypt, no effect was found, but there was only 1 of 1989 individuals over 20 years old who was not excised. in the edhs only 4.0% (95% ci 3.25.0%) of women in rural areas, compared to 12.0% (95% ci 10.413.9%) in urban areas, reported not having had fgc performed. in this situation, where there may be insufficient heterogeneity in the exposure variable within particular regions, ecological analyses can be helpful. our ecological analysis reveals that the highest prevalence rates for both hcv and fgc are in the rural areas and that there is a strong correlation between hcv and fgc overall. the association found between female hcv prevalence and having had fgc performed by a non - doctor could be confounded by a number of other factors and thus the calculated population attributable fraction of fgc for hcv infection in women is likely an overestimate. other studies from egypt have found a link between male circumcision being performed by traditional healers and prevalent hcv infection. this issue is of relevance as the prohibitions on fgc legislated in 1995 mean that doctors risk losing their license to practice if they perform fgc. this could in turn lead to an increase in the proportion of fgc performed by non - doctors. although the decline in self - reported fgc, demonstrated in figure 1(b), predates the decline in hcv prevalence noted in blood donors, this relationship needs to be treated with extreme caution. firstly, the data from the blood donors was from the mansoura area (lower egypt) and therefore not representative of egypt. secondly, no mention is made in the study of changes in the type of donors over this eight - year period. for example, if there was a trend in the donors being more likely to be younger or from urban areas (which are both associated with lower hcv prevalence rates), this would have resulted in a decline of measured hcv prevalence with time. inadequate sterility could be a risk factor for hcv at the time fgc is performed. this possibility is enhanced in a place like egypt where traditional fgc occurred during a relatively short season, involving large numbers of persons being excised by a small number of operators [9, 10 ]. in addition the anatomical changes produced by fgc could promote subsequent female - to - male and male - to - female hcv transmission. a case - control study of primary infertility in sudan found that cases were more likely to have undergone the most extensive form of fgc. a case - control study of the determinants of infertility found that cases were more likely to have been excised by a traditional practitioner and more likely to have had more extensive forms of fgc. a representative cross - sectional study from the gambia found a strong association between prevalent fgc and herpes simplex virus-2 infection (or 4.7, 95% ci 3.76.4) and a weaker association between fgc and bacterial vaginosis. the epidemiological evidence presented here adds to that from the individual level analysis performed by guerra.. considerable more work is however required to unravel the complex interactions between fgc, who performs it, the type of fgc performed, and the subsequent risks for hcv transmission and acquisition. | a recent analysis of egypt 's first nationally representative survey of hepatitis c virus (hcv) infection found female genital cutting (fgc) to be an independent risk factor for hcv infection for women in urban areas. we use the same dataset to extend this analysis. in an ecological analysis, we find a strong association between fgc and hcv prevalence (pearson r274% ; p < 0.0001). hcv prevalence is significantly higher if fgc is performed by a non - doctor (15.4%) than a doctor (4.2% ; p < 0.001), and the calculated population attributable fraction of fgc for prevalent hcv seropositivity is high in women (79.8%). |
genome sequencing deciphered the number of protein - coding genes, establishing an initial estimation of complexity associated with human molecular biology. two recent articles described creation of a draft of the human proteome [2, 3 ]. nevertheless, considerable efforts are still required for exploring the space (or size) of the human proteome, as a compulsory constellation of molecular profiles of different tissues and organs. the human proteome is quite a dynamic entity and this property should be considered in two dimensions. the first is to estimate the number of different protein types (proteome width), as well as measure protein copies number in particular tissues (proteome depth). following the hypothesis of one gene = one protein, there should be at least ~20,000 nonmodified (canonical) human proteins. taking into account products of alternative splicing (as), those containing single amino acid polymorphisms (saps) arising from nonsynonymous single - nucleotide polymorphisms (nssnps), and those that undergo ptms [4, 5 ], of the many different terms proposed to describe protein variants, here, we chose protein species or this means that the sensitivity of the technology determines the ability to detect rare protein species. genomics relies upon pcr to amplify dna or rna molecules in a biological sample to concentrations above the detection threshold. however, there currently exists no comparable high - throughput technology capable of multiplying the copies of a single protein. the 100% coverage of protein sequence using bottom - up ms is not attainable ; thus, it is impossible to detect all potential protein species expressed from the same gene. generally, proteome investigations are focused on the master proteins resembling at least one of the many possible proteoforms, coded by the gene and containing at least one ms - detectable proteotypic peptide. the sequence could be modified or nonmodified, so this means that the master protein could be present as a single protein or as a set of proteins. master proteome of a single chromosome is the result of the identification and measurement of all master proteins encoded by the chromosome and expressed in the selected type of biological material. for experimental validation of proteoforms, the bioinformatic analysis of the diversity of protein species was anticipated to create the backbone for the future experimental exploration of the proteome space., we describe the theoretical prediction for the number of different proteoforms that might arise from as, sap, or ptm events. the data was derived from nextprot, which contains only human proteins and their modifications and sequence features. the nextprot annotation of as, sap, and ptm originated from biocuration of the data from repositories, literature, and prediction tools. information on possible protein sequence variability is represented as the number of as variants, nssnps / saps, and ptms per gene. our assumption was that database extension and annotation are a constituent process, whose rate is mostly limited by the number of the researchers and annotators around the world. the rate is slightly dependent on the capacity of communication channel and information accessibility, as these were not changed too much for 1015 years for the needs of pubmed or uniprot users. therefore, the extension of the number of annotations in a certain database would generally be affected by the technology achievements, gained by increasing the sensitivity / throughput of the bioanalytical method. from the above, we proposed that the volume of representative data uploaded to uniprot each year from 2005 was sufficient to calculate the average number of protein variants per one gene and the numbers for each type of variation. interestingly, since 2010, the average number of modifications per one gene has remained nearly the same, despite the continuous increase in reviewed annotations. the average number of modifications specifically by as (40% reviewed annotations out of all data records), sap (60% reviewed annotations), or ptm (37%) remains almost unchanged. the saturation in the number of annotations for genome - dependent saps, transcription - dependent ass, and posttranslational - dependent ptms is quite remarkable. while ptm determination depends upon the sensitivity of protein analytics, sap and as detection have virtually no limitations in sensitivity and are actively accumulated via large - scale projects. despite such differences, all of the technologies have synchronously acquired saturation levels, indicating balance between data derived from using standard protein - chemistry techniques (accumulated over the last 50 years) and data derived from high - throughput next - generation sequencing (ngs). for estimating the potential number of proteins, three different cases of combination of ptm, sap, and as events were considered (see (1)(3)). combinatorial variations were ignored, since there are no systematic experimental data describing the cooccurrence of various modification types in the protein species. this is just one of the possible ways for solving the problem of how to estimate a potential number of proteins based on the data of protein variance that has already been accumulated on the postgenomic knowledge bases. equation (1) assumes that ptms appear exclusively in the canonical sequences of proteins, but not in splice variants. equation (2) assumes that ptms and saps can occur both in proteins encoded by canonical sequences and in splice variants. equation (3) assumes that all modification types (as, sap, and ptm) occur independently. hence, (1)nps = nasav+sapav+ptmav, (2)nps = n+assapav+ptmav, (3)nps = nasavsapavptmav, where nps represents the number of protein species, n represents the total number of protein encoding genes, as is the number of species produced by alternative splicing, asav is the average number of splice variants per one protein encoding genes, sapav is the average number of nssnps, and ptmav is the average number of ptm events per one protein encoding gene. generally, saps are predetermined at the dna level, and as arises from modifications at the mrna level, while ptms occur at the protein level. these three processes can not be viewed as independent events, given that there is an intrinsic relationship between the processes of gene expression, transcription, and translation, aimed at regulating and preserving a cell. furthermore, enriching ms / ms searches through a database containing all possible combinations of protein variations would lead to combinatorial collapse, despite the type of approach used. 2015_06) search for protein as modifications revealed 21,921 as variants in 10,519 protein - coding genes (2.1 0.1 variants / gene, including one canonical sequence). the greatest number of modified forms (434,398, without cancer - related items derived from the cosmic cancer mutation database) was due to the emergence of saps resulting from nssnps in 18,986 protein - coding genes (22.1 3.9 variants / gene). ptms added 6.6 0.8 modified proteins / gene (94,036 ptms in 14,006 protein - coding genes). applying these numbers to the equations (n = 20,043), we estimate that in humans there exist 0.62 or 0.88 or 6.13 million protein species. the above results were matched to the data on as- and sap - derived variances obtained from our ngs results of liver tissue transcriptome profiling [1618 ]. according to ngs results, the average number of detected splice variants was 1.3 per protein - coding gene (or 2.3 per gene including canonical variant), which is comparable to nextprot data. the average number of sap - containing proteoforms was ~1.4 per one gene, so much lower than that calculated from nextprot data. these differences relate to the fact that nextprot provides information from many different experiments (aggregate human population), while specific ngs data indicates sap events for an individual sample or tissue (individual variances). as proteomic knowledge bases consolidate information regarding protein variability in the human population, several million different proteins will ultimately populate the aggregated human proteome. to decipher variability inherent in predicting proteome space for an individual, more precise estimation of the numbers of as- and sap - contained proteins can be achieved using results of transcriptome profiling of specific tissue samples. 06_2015), 10.5 thousand blood - plasma proteins have been detected and less than 10% (1278 of 20,043 human proteins) have been measured in a quantitative manner. the primary issue concerning experimental validation of existing sets of theoretically predicted proteins is the limit of analytical sensitivity of proteomic technology. analytical sensitivity is determined by instrument - dependent detection limit and biomaterial - dependent dynamic protein concentration ranges. blood plasma is a complex mixture with a dynamic range of protein concentrations varying by > 10 orders of magnitude, while the protein concentration range of tissue or cell lines is within seven orders of magnitude. the challenge is in detecting low- and ultralow - abundance species with concentrations 10 m. assuming the ultrasensitive capacity of oligonucleotide analytics, it is instructive to consider that transcriptome research results are often determined based on copies of rna molecules rather than concentrations. operating at low- (< 10 m) and ultralow (< 10 m) concentrations of proteins implies that quantifying protein in copy numbers rather than in concentration units enables comparison of transcriptomic and proteomic results. proteins are commonly quantified in the proteomics field by the concentration in the biological sample, c, reported as mol / l (molarity, m). the corresponding number of protein copies, n, in 1 l can be calculated out of concentration units as follows:(4)n = cvra, c = mmwv, where r a represents the reverse avogadro 's number, 10 m, v represents the sample volume, m represents the protein content, and m w represents molecular weight of the protein. formulas (4) address the major challenge of proteomics : shift from concept of the concentration units to counting single biomacromolecules in a sample (tissue). the triple - quadrupole mass spectrometer makes it possible to achieve 10 m [28, 29 ] sensitivity for targeted proteins. the sensitivity of srm protein detection can be further increased up to 10 m by irreversible chemical binding proteins from large volumes of biological samples (it is not intended to state that all proteins measured were determined with such sensitivity ; results of measurements can vary by several orders of magnitude due to different physicochemical properties of proteotypic peptides). in the context of proteome width, the targeted approach is limited by the need to measure only proteoforms exhibiting a priori assumption of proteotypic peptides, which correctly resemble ptm, sap, or as events. in contrast to shotgun ms, srm can not discover new, unexpected protein species. possibilities of top - down and bottom - up ms approaches to address the microheterogeneity of the human proteome were described earlier. targeted srm is readily available for detecting saps in association with disease, including obesity / diabetes and cancer. for example, srm / mrm method was applied to measure the quantities of splice forms : three isoforms for transforming growth factor were measured by srm at concentration level of 10 m in mouse plasma and human saliva. another example, osteopontin isoforms, was measured using the srm assay and revealed that level of isoform was significantly higher for non - small cell lung carcinoma compared with the control group (710 versus 3010 m). the application of targeted ms for the detection of ptms was illustrated for protein glycosylation : n - glycosides were detected in human plasma at a sensitivity level of 10 m and ubiquitination. from these pilot studies, it follows that the vast majority of predictable proteoforms seem to be present in the concentrations below limit of detection. further increase in sensitivity of analytical methods is important to uncover diagnostically relevant proteoforms in human biosamples. since it was shown that the set of proteins encoded by any human chromosome constitutes a representative portion for the whole human proteome, high-, medium-, and low - copied protein species can be evaluated by sampling master proteins encoded by a single chromosome. as an example of a chromosome - centric proteomic map, we uploaded data from passel (passel ids : pass00278, pass00276, pass00092, and pass00742) obtained for master proteins encoded by chromosome 18 [16, 17 ]. these proteins were measured in three types of biomaterial, including human plasma, liver samples, and hepg2 cells. the measurements were conducted according to tier 3 (exploratory studies) guidelines using the double targeted strategy, which combines chromosome - centric approach with bottom - up srm mass spectrometry. a bell - shaped distribution histogram for master proteins encoded by chromosome 18 was observed (figure 1(a)) revealing median of 10 copies per 1 l of blood plasma and 10 copies per liver / hepg2 cell. the ascending portion of the curve reflects high- and medium - copied proteins, whereas the descending portion may be explained by either diminished proteome diversity in a biological sample or more probably the notion that the proteins can not be detected due to low sensitivity of the analytical methods. interestingly, after increasing the sensitivity of the analytical method from 10 m to 10 m by irreversible binding of analytes, 14 additional low - copied protein species (< 10 copies per cell or per 1 l of blood plasma) were gained and quantitatively measured, with at least two proteotypic peptides in each type of biomaterial (see shaded areas in figure 1(a)). according to the results, there are much more high - abundant protein species in the plasma as compared with the liver or hepg2 cells. it is, therefore, likely that the difficulty in identifying ultralow - copied proteins in plasma is related to the high dynamic concentration range of plasma proteins. to demonstrate the proteome depth, the number of copies of a master protein in a biosample was plotted depending on the sensitivity of proteomic technology (figure 1(b)). the proteome coverage was expressed as percent share of detected proteins to the total number of chromosome 18 genes, which was 276 according to nextprot data. as shown in figure 1(b), the distribution curve for the plasma proteins shifts left relative to the curves for the cells. the total number of detected protein species in liver and hepg2 cells increased relative to human blood plasma. future successes in human proteome exploration depend upon the ability to use bioinformatics methods to elucidate existing protein species and targeted ms analysis, high - throughput measurement, and high - performance algorithms for de novo assembly of protein sequences based on ms results. furthermore, increasing the sensitivity of analytical technology will enable greater access to ultralow - copied proteins and expand opportunities for detection and analysis. in this context, theoretical prediction of the number of proteoforms (estimation of proteome width) and their distribution across the dynamic range (i.e., proteome depth) is ultimately required for planning the workload for the chromosome - centric human proteome project. | this work discusses bioinformatics and experimental approaches to explore the human proteome, a constellation of proteins expressed in different tissues and organs. as the human proteome is not a static entity, it seems necessary to estimate the number of different protein species (proteoforms) and measure the number of copies of the same protein in a specific tissue. here, meta - analysis of nextprot knowledge base is proposed for theoretical prediction of the number of different proteoforms that arise from alternative splicing (as), single amino acid polymorphisms (saps), and posttranslational modifications (ptms). three possible cases are considered : (1) ptms and saps appear exclusively in the canonical sequences of proteins, but not in splice variants ; (2) ptms and saps can occur in both proteins encoded by canonical sequences and in splice variants ; (3) all modification types (as, sap, and ptm) occur as independent events. experimental validation of proteoforms is limited by the analytical sensitivity of proteomic technology. a bell - shaped distribution histogram was generated for proteins encoded by a single chromosome, with the estimation of copy numbers in plasma, liver, and hepg2 cell line. the proposed metabioinformatics approaches can be used for estimation of the number of different proteoforms for any group of protein - coding genes. |
the packaging of eukaryotic genomes into chromatin has fundamental effects on gene expression but how this is brought about still remains poorly understood. histone proteins are highly conserved and are subject to many different posttranslational modifications (ptms) including acetylation and methylation (rando and winston, 2012). these modifications can influence nucleosome occupancy and position as well as the recruitment of a wide range of effector proteins implicated in a variety of cellular processes. histone methylation can be influenced by the conformation of the n - terminal region of histone h3, particularly cis - trans isomerization of bonds around proline residues (lu., 2007 ; nelson., 2006 ; youdell., the peptidyl - prolyl isomerase (ppiase) fpr4 increases the rate of cis - trans isomerization at all three prolines (16, 30, and 38) on h3 in vitro (monneau., 2013) and genome - wide mapping studies show that modification patterns are correlated with both gene structure and gene activity, often showing characteristic distributions on active or repressed genes (liu., 2005 ; pokholok., one such modification is set1-dependent methylation of lysine 4 on histone h3 (k4), present in most eukaryotes at active or potentially active genes (santos - rosa., 2002). this has led some to assume that k4 methylation by set1 is an activating modification yet, in yeast, most evidence points to k4 methylation having a repressive or adaptive role, silencing some rdna repeats (briggs., 2001 ; bryk., 2002), repressing genes in midsporulation and during exponential growth (carvin and kladde, 2004 ; fingerman., 2005 ; guillemette., 2011 ;, 2011 ; wang., 2011), and facilitating the transcriptional response to diamide stress (weiner., 2012). paradoxically, but consistent with a modulatory role, k4 methylation facilitates the recruitment of both lysine acetyl transferases (kats) and histone deacetylases (hdacs) (vermeulen and timmers, 2010). set1 is found in a complex (set1c) with seven other subunits (swd1, swd3, bre2, sdc1, spp1, swd2, and shg1) (briggs., 2001 ; 2003) that contribute to complex integrity and/or degree of methylation (k4me1, k4me2 or k4me3). spp1 is required for k4me3 (morillon., 2005) and contains a phd motif that interacts with k4me2 and k4me3 (murton., 2010 ; shi., 2007) thus maintaining high local levels of k4me3. loss of k4me3 from chromatin involves either histone dilution during dna replication (radman - livaja., 2010) or active demethylation by jhd2 (ingvarsdottir., 2007 ; liang., 2007 ; seward., 2007 ; tu., 2007). jhd2 is particularly important in sporulation to keep certain genes expressed (xu., methylated k4 is influenced by the modification state at distant residues on nucleosomal histones including h2bub1 and k14ac promoting, and h3r2me and k4ac antagonizing k4me2 and k4me3 to varying extents (briggs., 2002 ; guillemette., 2011 ; kirmizis., 2007 ; maltby., 2012 ; nakanishi., 2008). cells alternate between phases of growth and quiescence, known as the yeast metabolic cycle (ymc) (tu., 2005). global levels of k4me3 remain fairly constant but levels of h3 acetylation vary, for example on k14 (cai., 2011 ; tu., 2005). this may reflect fluctuations in the levels of acetyl coa, a cofactor for kats, which are lower in quiescent cells. quiescent cells are more resistant to stress (lu., 2009 ; slavov., 2012) and express genes that negatively correlate with growth rate (brauer., 2008) and genes whose expression increases during the common environmental stress response (esr) (gasch., 2014). feeding quiescent cells metabolic intermediates, such as acetate, induces cycling and growth (cai. moreover, the lysine acetyltransferase, gcn5 (kat2) a component of saga (baker and grant, 2007), is required for metabolic cycling (cai., 2011). this suggests that acetylation on histone h3 will reflect the metabolic state of the cell and environmental growth - related signals. as k14 acetylation is reported to be required for k4me3 (maltby., 2012 ; 2008) and k14 is subject to gcn5/saga - dependent acetylation (jiang., 2007 ; zhang., 1998), we wanted to explore in more detail the relationship between k14 and k4me3. here, we show that k14 modulates the conformation of the h3 tail at the alanine 15-proline 16 peptide bond (cis - trans isomerization) to control k4me3. substitutions at k14 (a, r, and q) and p16 (v and a) to mimic neutral, positively charged, acetylated or trans conformation of the h3 tail respectively reveal the different contributions of these residues in promoting spp1 association with chromatin and antagonizing jhd2-mediated demethylation of k4me3. strains lacking spp1 show a similar reduction (5-fold decrease) in global k4me3 levels to the k14a strain. this residual level of k4me3 is due to a spp1-, k14-, and p16-independent mechanism for deposition of k4me3, most evident at the ribosomal protein genes (rpgs). by contrast, environmental stress response (esr)-induced genes are most dependent on spp1, k14, and p16 for k4me3. we propose that changes in growth conditions and the availability of metabolic intermediates and regulators allow variable control over levels of k4me3 at different genic loci. proline is unique in its ability to form cis or trans peptide bonds with the preceding residue. we were interested in whether, as at p38 (nelson., 2006), cis - trans isomerization of p16 is important for h3 tail modifications. for evidence that p16 adopts cis or trans conformations in vivo, we raised antibodies against short h3 peptides in which the a15-p16 peptidyl - prolyl bond was fixed predominantly in the cis or trans configuration by hydroxylation of the proline ring (taylor., 2005). after extensive selection for specificity using the peptides (figure 1a), we obtained antibodies that specifically recognized the peptide with hydroxylated p16 in the desired conformation (the unmodified peptide will have the majority of p16 in trans). we further characterized these antibodies by western blot using a wt strain (both cis and trans conformations) and a strain with p16 substituted for valine, which fixes the a15-v16 bond in trans (lu. as expected, we observed a higher p16cis signal in the wt over the p16v strain but a higher p16trans signal in the p16v strain relative to the wt. the antibodies were used to perform a chromatin immunoprecipitation (chip) experiment to detect a15-p16 in cis and in trans in the chromatin over the long gene fmp27 (figure 1c and figure s1a available online ; adh1). p16trans is low at the 5 region of fmp27 and increases toward the 3 end of the gene. conversely, we observed p16cis at the 5 region of the genes, with a similar distribution to that we had previously observed for k4me3. both valine and alanine substitutions at p16 significantly reduced global levels of k4me3 (figures 1d and 1e). we tested other modifications on h3 but none, apart from k4me3, k14ac, and k18ac, were influenced by the p16 substitution (figure s1b). dot blot analysis demonstrated that antibodies raised against k14ac and k18ac were unable to bind peptides containing their epitope and a p16v substitution (figure s1c), but mass spectrometry revealed the level of k14ac in a p16v strain was roughly equivalent to wt (figure s1d). this suggests that the antibodies specific for k14ac and k18ac require p16 as part of their epitope. thus p16 adopts distinct conformations in vivo and is required for optimal levels of k4me3. it has been reported that substitutions at k14 also result in reduced k4me3 but not k4me1/2 (nakanishi., 2008). given the effect of p16 substitution on k4me3, we wanted to reexplore the relationship between k14 and k4me3. as described previously, substitution of k14 with alanine (a) or glutamine (q) causes reductions in the global level of k4me3. in contrast, substitution of k14 with arginine (r) resulted in less severe reductions in global k4me3 (figures 2a and 2b), confirmed in a range of strain backgrounds (figure 2c). lysines for which k to r and k to q substitutions have opposite effects are known acetylation substrates, such as k14 (weiner., 2012). as there are robust levels of k4me3 in the k14r strain, a lysine at position 14 is not absolutely required for k4me3 and this also rules out a strict dependency on acetylation of k14 for k4me3. moreover, as the arginine substitution was used to mimic the positively charged, unmodified lysine residue whereas glutamine is a mimic of the neutral, acetylated lysine (wang and hayes, 2008), this suggests that unmodified k14 is associated with k4me3. we suggest that k14 in its unmodified state is associated with k4me3, whereas three different groups have concluded, using strains lacking acetyltransferases such as gcn5 or sas3, that acetylation is required for k4me3 (govind. 2012). as these strains have a significantly reduced growth rate (zhang., 1998), it is possible that the reduction in k4me3 is not a direct consequence of reduced k14ac. to test this, gcn5 or sas3 with ada2 (ada2 is required for the kat activity of gcn5), were deleted in the k14r strain and a strain with wt histone h3. deletion of gcn5, or sas3 with ada2, reduced the global level of k4me3 in the presence of a wt copy of histone h3, as reported previously. however, deletion of gcn5 or sas3 with ada2 in the k14r strain further reduced the level of k4me3 when compared to the control k14r strain (figure 2d). because there is already no k14ac in the k14r strain, the additional reduction in k4me3 can not be due to loss of this modification. therefore, gcn5 and sas3/ada2 must be able to modulate k4me3 independently of k14ac, possibly via acetylation of other lysines, global changes in transcription or indirectly through the reduced growth rate of the deletion strains. many gene deletions cause slow growth and result in a transcriptional signature that correlates strongly with the common environmental stress response (esr) (oduibhir., 2014). however, there was no obvious difference in growth rate or stress resistance of the k14 and p16 substitution strains compared to wt that might explain reduced k4me3 (figure 2e). together, the varying levels of k4me3 in the p16 and the three k14 substitution strains point toward a more modulatory role for these residues rather than a strict requirement for acetylation at k14. to investigate if k14 and p16 were influencing k4me3 through a common pathway, k14 p16 double substitution strains were created (no growth defect observed, figure s2a) and levels of k4me3 were assessed globally or by chip at the 5 ends of rps15, sen1, fmp27, and pgk1 (figure 3). the global levels (figures 3a and 3b) and the chip signals (figure 3c) for k4me3 in the k14a p16v and k14q p16v strains were similar to the k14a and k14q single substitutions, respectively. by contrast, the signals in the k14r p16v strain were most reduced compared to the single k14r substitution. together, these findings imply that there may not be a simple linear pathway between k14, p16, and k4me3, perhaps consistent with a structural role for p16 and an additional function at k14. we note that the relative k4me3 levels by chip varied at the four genes (figure 3c), suggesting that genes respond nonuniformly to these substitutions. next, we wanted to uncover more about the mechanism by which the k14 and p16 substitutions modulate levels of k4me3. because spp1 is required for k4me3, we asked whether k14 and p16 substitutions influence the association of spp1 with chromatin. chip of spp1-ha at six genes in the four histone substitution strains revealed levels at or above wt in the k14r strain, reduced levels in the p16v strain and low levels in the k14a and k14q substitution strains, generally reflecting global levels of k4me3 in these strains (figure 4a). no change in global spp1-ha protein levels, or swd1-ha in the set1c, is observed in the h3 substitutions (figure s2b). this supports a role for k14 and p16 in spp1-dependent k4me3. once again, as the k14r substitution has near wt levels of both spp1 chromatin association and global k4me3, acetylation of k14 can not be required for spp1 binding and k4me3. we asked whether spp1 and substitutions at k14/p16 are epistatic by deleting spp1 from the k14/p16 substitution strains. levels of k4me3 were further reduced in the k14/p16-substituted spp1 strains but remained in proportion to the amount of k4me3 in the individual k14/p16 substitutions when spp1 is present (figures 4b and 4c). interestingly, levels of k4me2 are also substantially lower in the k14a spp1 and k14q spp1 strains than in the k14r spp1 strain, suggesting that these k14 substitutions render the residual k4 methylation in the spp1 strain more sensitive to demethylation by jhd2 (figure 4b). to test this, jhd2 was deleted in a variety of strains. first, we examined k4me3 in jhd2 strains with a wt copy of histone h3. an increase in k4me3 was observed upon jhd2 deletion at both the global level (figures 4c and 4d) and at the 5 end of fmp27 by chip (figure 4e) in the presence or absence of spp1. we note that levels of jhd2 protein do not change in these strains (figure s2c). upon jhd2 deletion, global levels of k4me3 whether any of the substitutions resulted in a greater increase in k4me3 in the absence of jhd2 (jhd2) compared to the increase in the wt histone h3 strain, we assessed the fold change in k4me3 (figure 4f). the k14a, k14q, and p16v strains all showed a larger fold change than observed in the wt or k14r strains, suggesting that these substitutions result in increased action of jhd2 toward k4me3, accounting in part for the reduced levels compared to wild - type (wt). finally, we examined the effects of the double spp1jhd2 deletions in the k14/p16-substituted strains (figures 4b and 4c). although levels are low, in all spp1jhd2 strains we observed an increase in k4me3 compared to the spp1 k14/p16 substitutions. interestingly, deletion of jhd2 did not even partially rescue levels of k4me2 in the k14a spp1 or k14q spp1 strains (figure 4b). therefore, reduced k4me2 in these strains can not be explained by increased demethylation, but could instead result from increased histone turnover or from the k14a / q substitutions compromising the capacity of the set1c to both di- and trimethylate k4 in the absence of spp1. thus the h3 substitutions are altering the balance of k4 methylation by set1/spp1 and demethylation by jhd2 to result in reduced levels of k4me3. so far we have demonstrated how k14 and p16 are both required for optimal k4me3. these residues influence k4me3 in an overlapping but distinct manner with similar altering of the balance of spp1 and jhd2 action. thus, we addressed how changes to the h3 tail around k14 and p16 might influence k4me3 genome - wide. to examine the effect of substitutions at k14 and p16 on levels of k4me3 genome - wide, chip - sequencing (chip - seq) experiments for k4me3 were performed with the wt, k14a, and p16v substitution strains, normalized to h3 levels in each strain. the k4me3 levels in the wt strain correlated well with the previously published data (kirmizis. all nondubious genes (n = 5,771) were ranked according to the ratio (from largest to smallest) of the average k4me3 over the transcription unit in the substitution strains relative to the wt strain (table s1). genome - wide, we observed a continuum from least to most affected genes (figure s3b). there was a positive correlation between the ratio of k4me3 (k14a / wt and p16v / wt) and nascent sense transcription (rs = 0.326 and 0.425, respectively), but no strong correlation with gene length (rs = 0.063 and 0.003). the 200 genes that maintained the highest k4me3 in the k14a or p16v stains relative to wt were classed as largely k14/p16-independent whereas the 200 genes that lost the most k4me3 in the h3 substitution strains were classed as most k14/p16-dependent (table s1 ; figures 5a and s3b). these classes were used in gene ontology (go) (huang., 2009a, 2009b) and overlap analyses, which revealed that the k14/p16-independent and k14/p16-dependent genes function in very different biological processes and show different transcriptional dependencies on saga (table s2 ; figures 5b and s3c). genes with the highest ratios of k4me3, in both the k14a and p16v strains relative to wt, are predominantly involved in translation, particularly ribosomal protein genes (rpgs), and are enriched in genes expressed during the oxidative phase of the ymc and repressed during the esr. in contrast, k14/p16-dependent genes, with k4me3 most reduced by the k14a or p16v substitutions, are predominantly regulated by saga, are involved in the response to environmental stresses and metabolic processes, and tend to be induced during the esr and reductive phase of the ymc. interestingly, in the p16v substitution strain, the genes with k4me3 most reduced encode proteins involved in sporulation and meiosis, in addition to some of the stress response pathways common to the k14a - affected genes (table s2). despite these differences, the spearman correlation between the ranked genes from the k14a and p16v strains is 0.772. this suggests that although the general trends are similar, k14 and p16 may contribute to different extents to k4me3 levels at individual genes, consistent with both overlapping and distinct functions. further analysis of the 200 k14/p16-independent and k14/p16-dependent genes revealed distinct differences (figures 5c and 5d). in the wt strain, the k14/p16-independent genes are particularly enriched in nascent sense transcription (churchman and weissman, 2011) and nrd1 (mayer., 2012), one of the few genome - wide transcription termination factors shown to be dependent on k4me3 (schulz., 2013 ; terzi., 2011), in a pattern distinct from the majority of genes. by contrast, the k14/p16-dependent genes are depleted for nrd1 and nascent sense transcription and enriched for antisense transcription (as expected due to low nrd1 levels), suggesting distinct regulation of these genes. we used chip at six genes to validate our genome - wide data and confirm that at two rpgs (rps15 and rpl10) a strain with a k14a substitution retains high levels of k4me3 (figure 5e ; see also figure 3c). at four other genes, occupying various positions in the ranking, given the link between k14 and spp1, we asked how loss of spp1 affects k4me3, using chip - qpcr at the same six representative genes (figure 5e). the profile of k4me3 in the spp1 strain is very similar to the k14a strain. spp1 is not required for k4me3 at rpgs but is required at the remaining four genes. we observed no significant change in k14ac at these genes in a spp1 strain that might explain changes in k4me3 (figure 5f). this suggests that spp1, like k14, is not essential for k4me3 and further links spp1 function to the integrity of k14 and p16. we conclude (1) that the integrity of k14 and p16 play a major role in determining k4me3 levels at spp1-dependent genes, and (2) there may be spp1-dependent and spp1-independent forms of set1c in vivo. given the similar effects of k14 and p16 substitution on k4me3 on different genes and the results from the k14 p16 double substitution experiments, we wanted to learn more about the relationship between these two residues, particularly how the k14r substitution might differ from other k14 substitutions. we have already demonstrated that the p16v substitution prevents antibodies raised against k14ac or k18ac from recognizing their epitopes on peptides (see figure s1c). we developed a second assay that involves monitoring the effect of the p16v substitution on the binding of the spt7 bromodomain to an h3 peptide modified by acetylation at k14 and/or k18 using surface plasmon resonance (spr) (figures 6a, s4a, and s4b) or by pull downs (figures 6b and s4c). bromodomains are acetyl - lysine binding domains, found in a number of chromatin - associated proteins (taverna., 2007) including spt7. the function and binding specificity of the spt7 bromodomain are currently unknown, but it preferentially interacts with hyperacetylated histones in vitro (hassan., 2007). the spt7 bromodomain (residues 363619) specifically recognized acetylated k18, as evidenced by the lack of binding to the unmodified h3 peptide, or a peptide acetylated at k14 (figures 6a and 6b), or of the bromodomain carrying alanine substitutions in residues known to influence acetyl - lysine binding (y500, y520, and n521) (figure s4c). the binding of the spt7 bromodomain to the p16v - substituted k18ac peptide improved binding by 2-fold. we reasoned that this could reflect an effect of the side chain on binding or an influence on the conformation of the a15-p16 bond. to test this, we introduced a valine substitution at p16 in the k14r - k18ac peptide, thereby fixing the a15-v16 peptide bond in the trans configuration and restored binding at levels between the p16v - k18ac and k18ac peptides. this suggests that in the k14r - k18ac peptide, the a15-p16 peptidyl - prolyl bond adopts the cis configuration, reducing binding of the bromodomain to k18ac, which can be restored by fixing the bond in trans. the corollary of this is that acetylation of k14 would correlate with the a15-p16 bond in the trans configuration, supporting ideas that the peptidyl - prolyl bond conformation is mainly determined by local effects in proteins (reimer., 1998). we tested this using a peptide acetylated at both k14 and k18 and show binding to the spt7 bromodomain similar to the p16v - k18ac peptide, consistent with our hypothesis that acetylation of k14 influences the conformation of the a15-p16 peptide bond to favor the trans configuration. to test more directly the influence of substitutions or modifications at k14 on cis versus trans conformations of the a15-p16 peptide bond, we used an established protease - coupled proline isomerization assay (fischer., 1984) we designed four peptides, in which k14 was unmodified or acetylated, or substituted with r or q and where p16 is followed by a phenylalanine and paranitroaniline (f - pna) group. chymotrypsin cleaves these peptides to release pna only if the a15-p16 peptide bond is in the trans conformation and with kinetics that are much faster than the spontaneous rate of cis - trans isomerization of the proline. thus, the initial rate of the chymotrypsin - dependent release of pna, measured spectrophotometrically at 395 nm, is a function of the amount of peptide with a trans proline conformation and for the unmodified peptide is comparable to that reported previously in a similar assay (nelson., 2006). acetylation of k14 increases the initial rate of cleavage of the peptide 3-fold, indicating that a higher proportion of the a15-p16 peptide bond is in the trans conformation (figure 6d). the k14q substitution resulted in an increase in the initial rate of cleavage of the peptide, consistent with an increase in the amount of peptide in the trans conformation. crucially, a k14r substitution reduced the initial rate of cleavage of the peptide below the unmodified peptide consistent with an increase in the cis conformation. taken together these data suggest that (1) the conformation of the a15-p16 peptidyl - prolyl bond influences the binding of protein effectors to histone h3, (2) the conformation of the a15-p16 peptidyl - prolyl bond is likely to be influenced by the nature of the residue at n-2 and that acetylation of k14 promotes the trans conformation (figure 6e), and (3) k4me3 is promoted by unmodified k14 increasing a15-p16cis (figure 6f). we have shown that acetylation at k14 influences the local conformation of histone h3 at the a15-p16 peptide bond in vitro, promoting a trans conformation, and we describe how these changes reduce levels of k4me3 in vivo. we propose that the h3 tail alternates between two dynamic forms in vivo : one with k14ac and p16trans and the other with unmodified k14 and p16cis (figure 6f). moreover, substitutions at k14 and p16 affect the balance of methylation by set1c / spp1 and demethylation by jhd2 to modulate k4me3 levels. we find that the amount of k4me3 lost on genes in strains lacking spp1 or with substitutions at k14 or p16 is not uniform. this is particularly evident on genes that are differentially regulated during the yeast metabolic cycle and environmental stress response (figure 6 g). we infer at least two distinct mechanisms for deposition of k4me3, one of which is sensitive to loss of spp1 from set1c and the conformation of the n - terminal region of histone h3. spp1 has been proposed to be critical for stimulating the trimethylase activity of set1 in set1c (takahashi., 2009). a remarkable finding from this study is that k4 trimethylation (k4me3) at the rpgs is largely independent of spp1 and mostly insensitive to the acetylation status of k14 or cis - trans isomerization of p16, which may regulate the association of spp1 with chromatin. this suggests an additional mechanism for stimulating k4me3 that predominates at rpgs but also functions at other genes to varying extents. set1 contains rrm rna binding motifs and the binding of rna by set1 is proposed to stimulate its k4me3 activity (schlichter and cairns, 2005 ; trsaugues., 2006). high levels of sense transcription, intronic rna (weiner., 2012), antisense transcripts (margaritis., 2012 ; murray., 2012), and nrd1-attenuated noncoding transcripts (schulz., 2013) at rpgs may contribute to spp1-independent alternative anchoring of set1 to this gene class. at the majority of yeast genes, including esr - induced genes, maintenance of k4me3 depends on the integrity of k14, a15-p16cis (bent) and spp1. these genes have lower levels of sense transcription that may not be sufficient for the deposition of k4me3 by a k14/p16-independent mechanism. although often thought of as unstructured, 50% of the h3 n - terminal tail adopts an -helical conformation in the nucleosome (banres., 1997). proline is known to disrupt helices and may act as hinge points in h3, dramatically affecting the relative trajectories of the flanking helices (lu., 2007) and thus the ability of modifying enzymes to find their substrates. rather than direct cause and effect, our data support a highly dynamic scenario in which levels of k4me3 are influenced by the action of the set1c methyltransferase with spp1 and the jhd2 demethylase, which in turn are influenced by the modification status of k14 and the conformation of the a15-p16 bond (figure 6 g). more generally, acetylation in proximity to proline residues may act as a metabolically controlled switch within intrinsically disordered regions of proteins to facilitate the alternative conformations required for interactions with a range of different proteins. although ppiases promote protein folding by increasing the rate of proline isomerization, in disordered regions the cis - trans switch may rely on the natural slower isomerization rate with local ptms, such as acetylation, influencing one state over the other, perhaps by steric hindrance. in vivo, these states could be captured by binding proteins to induce local folding. in summary, we describe a function for lysine acetylation in determining local protein conformation, in this case histone h3, by directly influencing proline 16 cis - trans isomerization. the potential for antibody occlusion in yeast expressing substituted histones or off - target effects resulting from hdac inhibition preclude further reliable in vivo validation of this relationship, although tools to explore this are being developed. k4me3 interacts with a variety of protein effectors in yeast (vermeulen and timmers, 2010), such as spp1, the kat components yng1 and sgf29, the chromatin remodeling atpase isw1, and the hdac complex rpd3l, potentially leading to acetylation or deacetylation of residues, including k14, in the vicinity. the resulting positive and negative feedback loops, coupled to variable concentrations of intracellular nadph and acetyl coa during the metabolic cycle and growth, could facilitate dynamic regulation of k14 acetylation / deacetylation, cis - trans isomerization at p16, and k4 demethylation / trimethylation at different gene classes, allowing the rapid switching between transcriptional states and adaptation to changing conditions. differential control of k4me3 could modulate many other processes, including initiation of dna replication (kan., 2008), 2013), and epigenetic memory (muramoto., 2010). given the many different enzymes and proteins capable of methylating, demethylating, and interacting with k4me3 in multicellular organisms and the variety of processes associated with k4me3 (vermeulen and timmers, 2010), fine tuning mechanisms such as those described here would extend the versatility of this near universal but still poorly understood histone modification. yeast cells were grown at 30c, shaking at 200 rpm in ypd, to exponential phase (1.25 10 cells / ml) for whole cell extracts, subject to western blots, and visualized using chemiluminescence (pierce) and exposure to x - ray film. peptide synthesis and antibody production to raise polyclonal antibodies against p16ohcis and p16ohtrans peptides were performed by pacific immunology and antibody affinity purified with 90 g p16ohtrans or p16ohcis peptides, respectively and 90 g unmodified h3 peptides dotted onto nitrocellulose for 48 hr at 4c. the p16 proline isomerase assay was performed as described (shan., 1994) using 10 l of 7.8 mm pna peptide (proteogenix) solution per 1 ml assay reaction and pna release monitored at 395 nm. chip - qpcr was performed as described (morillon., 2005). dna was multiplexed during library preparation and subjected to 50 nt paired - end single lane sequencing. the peptides used in these experiments had a minimum purity, determined by maldi - tof mass spectrometry and hplc, of 84%. spt7 bromodomain (amino acids 363619) was expressed and purified as described (boubriak., 2009). resin (200 l) was incubated with 350 l of bromodomain (final concentration of 30 g / ml) for 2 hr at 4c. after multiple washes with binding buffer, high salt (350 mm nacl), and te buffer, bound material was eluted by heating at 80c with 120 l lds (invitrogen). spr data for peptides binding to immobilized spt7 bromodomain was generated on biacore t100 and t200 instruments at 25c. sensorgrams, binding curves, and kd values were analyzed with bia t100 and t200 evaluation software (ge healthcare) using a 1:1 binding model. | summarygene transcription responds to stress and metabolic signals to optimize growth and survival. histone h3 (h3) lysine 4 trimethylation (k4me3) facilitates state changes, but how levels are coordinated with the environment is unclear. here, we show that isomerization of h3 at the alanine 15-proline 16 (a15-p16) peptide bond is influenced by lysine 14 (k14) and controls gene - specific k4me3 by balancing the actions of jhd2, the k4me3 demethylase, and spp1, a subunit of the set1 k4 methyltransferase complex. acetylation at k14 favors the a15-p16trans conformation and reduces k4me3. environmental stress - induced genes are most sensitive to the changes at k14 influencing h3 tail conformation and k4me3. by contrast, ribosomal protein genes maintain k4me3, required for their repression during stress, independently of spp1, k14, and p16. thus, the plasticity in control of k4me3, via signaling to k14 and isomerization at p16, informs distinct gene regulatory mechanisms and processes involving k4me3. |
the hormonal regulation of pheromone biosynthesis in moths was first demonstrated in the heliothine helicoverpa zea (raina., 1987) and a peptide isolated shortly thereafter (raina., 1989). pheromone biosynthesis activating neuropeptide (pban) was identified as a 33 amino acid c - terminal amidated peptide from the brain immunohistochemical procedures traced the neuronal production of pban to three groups of neurons in the subesophageal ganglion (blackburn., 1992 ; kingan., 1992 ; rafaeli and jurenka, 2003). the gene encoding for pban was subsequently identified (davis., 1992 ; one of these had been identified as the diapause hormone that regulates embryonic diapause in the silkworm moth (imai., the analysis of mrna from a number of moth species now indicates that five peptides could be produced by the pban gene (choi., 2004). evidence indicates that these peptides could be processed and released into circulation as active neuropeptides (ma., 1996). sequence similarities to the pyrokinins became evident after it was determined that the minimum activity required was the last five c - terminal amino acids (raina and kempe, 1990, 1992). leukopyrokinin was first identified in the cockroach leucophaea maderae due to the stimulation of hindgut muscle contraction (holman., 1986). a variety of pban / pyrokinin peptides have been found in all insects to date based on gene sequence and peptide isolation (jurenka and nusawardani, 2011). two of the peptides are periviscerokinins that usually have an fprvamide c - terminal ending. periviscerokinins are involved in a variety of functions including stimulating heart rate and affecting malpighian tubule functions. the third peptide, that can be produced by the capa gene, is related to the diapause hormone because it has a wfgprlamide c - terminal ending. as indicated above the first functions described for the pban / pyrokinin family of peptides was stimulation of pheromone biosynthesis in female moths and stimulation of hindgut muscle contraction in cockroaches. other functions were soon described for peptides in the family including induction of embryonic diapause in females and cuticle melanization in larvae of the silkworm moth, bombyx mori (matsumoto. once the peptides were identified it became apparent that these peptides belong to the same family with cross - reactivity of function. subsequently other functions were identified including acceleration of puparium formation in higher flies (zdarek., 1997) and this list of functions indicates the pleiotropic nature of the pban / pyrokinin family of peptides across the insecta. other functions could potentially be found for the family because these peptides are found in all insects (jurenka and nusawardani, 2011). the target tissue for the action of pban in adult female moths is the pheromone gland, which is found as intersegmental tissues located between the eighth and ninth abdominal segments of the ovipositor in heliothines (rafaeli and jurenka, 2003). pheromone biosynthesis can be stimulated by either injecting peptides into intact female moths or peptides can be incubated with an isolated pheromone gland on saline. the in vitro studies demonstrate that the pban - receptors are located in the epidermal cells of the pheromone gland. a biologically active biotinylated - pban analog was used to demonstrate specific binding to a protein from isolated pheromone glands (rafaeli. cloning and functional expression of a pban - receptor was first reported in h. zea, the same moth in which pban was first identified (choi., 2003). the pban - receptor was identified based on sequence similarities with a group of three receptors from d. melanogaster. after the d. melanogaster genome was sequenced and annotated peptide g - protein coupled receptors (gpcr) were identified based on sequence alignment with known vertebrate peptide gpcrs (hewes and taghert, 2001). one group of three receptors (cg8784, cg8795, cg9918) had sequence similarities with the neuromedin u (nmu) receptor from mammals. the ligand, nmu, has a c - terminal ending of frprnamide, which is similar to the c - terminal ending of pban, fsprlamide. choi. (2003) demonstrated that the vertebrate nmu peptide stimulated pheromone biosynthesis in female moths indicating cross - reactivity and receptor activation. the d. melanogaster sequences were used in a pcr based sequencing approach to obtain the full - length sequence from pheromone glands of h. zea. the three receptors from d. melanogaster were also characterized as being activated by pyrokinins (park., 2002) indicating that all of these receptors belong to a similar family. the functional expression of the h. zea pban - receptor indicated that pban activated the receptor at a half - maximum effective concentration of 25 nm (choi., 2003). several other peptides produced by the pban - gene were also active at similar concentrations. although, concentrations required to stimulate pheromone biosynthesis in vitro in helicoverpa armigera showed that pban was active at 0.5 nm and the other peptides at significantly higher concentrations (stern., 2007). pban - receptors have been characterized from several moths including b. mori (hull., 2004), heliothis virescens (kim., 2008), and plutella xylostella (lee., 2011). these studies indicate that pban will activate receptors at concentrations in the low nanomolar range. several other pban - receptors have been identified based on sequence homology from other moths including h. armigera (rafaeli., 2007), spodoptera exigua (cheng., 2010), and spodoptera littoralis (zheng., 2007). only one pban - receptor sequence was identified from pheromone glands of h. zea (choi., 2003). however, three pban - receptor sequences were identified from cdna obtained from the central nervous system of h. virescens fourth instar larvae (kim., 2008). the n - terminal and seven - transmembrane domain regions of the h. virescens pban - receptors are about 98.5% identical with the h. zea and h. armigera receptors. the h. virescens pban - receptor subtype c, was identified in pheromone glands of adult female h. virescens. the other two were identified from the larval central nervous system and did not have activity when tested in a calcium mobilization assay using a heterologous expression system (kim., 2008). the c - terminal extension of h. virescens pban - receptor subtype c is similar to the c - terminal of the b. mori pban - receptor (hull., 2004). the c - terminal extension in the b. mori pban - receptor is involved in efficient internalization of the receptor after activation (hull., it is interesting to note that the pban - receptors identified from pheromone glands of other moths have a shortened c - terminal ending similar to that of the h. zea pban - receptor. functional significance of a short c - terminal ending indicates that the receptor could remain active in the pheromone gland cell membrane for a longer period of time. time course studies on induction of pheromone biosynthesis in isolated pheromone glands indicated that the pban - receptor does remain active for a period of time after stimulation by pban (choi., 2004). the diapause hormone - receptor (dh - receptor) has high sequence homology to the pban - receptor especially in the transmembrane domains (jurenka and nusawardani, 2011). in lepidoptera the dh - receptor has only been characterized from b. mori (homma., 2006). other insects have a pyrokinin 1-receptor (pk1-receptor) that is similar to the dh - receptor in sequence and are activated by dh - like peptides with an fgprlamide c - terminal ending. a third gpcr is the perivicerokinin - receptor (pvk - receptor) that is activated by pvks but not by other pban / pyrokinin - like peptides (iversen., 2002 ; park., 2002 ; olsen., 2007). phylogenetic relationships of these receptors from insects indicate three groups of receptors that follow a typical evolutionary origin for orders of insects (figure 1). phylogenetic relationships of the pban / pk2-receptor, dh / pk1-receptor, and pvk - receptor. species abbreviations : aaeg, aedes aegypti ; agam, anopholes gambiae ; agos, aphis gossypii ; amel, apis mellifera ; apis, acyrthosiphon pisum ; bmor, bombyx mori ; cfor, coptotermes formosanus ; cqui, culex quinquefasciatus ; dvir, diabrotica virgifera virgifera ; dmel, drosophila melanogaster ; harm, helicoverpa armigera ; hzea, helicoverpa zea ; hvir, heliothis virescens ; msex, manduca sexta ; nvit, nasonia vitripennis ; othy, orgyia thyellina ; phum, pediculus humanus ; pxyl, plutella xylostella ; rpro, rhodnius prolixus ; sinv, solenopsis invictus ; sexi, spodoptera exigua ; slit, spodoptera littoralis ; tcas, tribolium castaneum (jurenka and nusawardani, 2011). g - protein coupled receptors have a seven - transmembrane domain motif that appears to be structurally conserved. with the x - ray crystal structure of rhodopsin, 1 and 2 adrenergic receptors, and a2a adenosine receptors published, it is possible to construct homology models based on these solved three - dimensional structures. a detailed model of the h. zea pban - receptor was built using the crystal structure of rhodopsin as a template and in silico binding studies indicated possible interactions with pban as a ligand (stern. a putative ligand binding pocket was indicated in a study utilizing an evolutionary trace approach in comparing the insect pban - receptors (jurenka and nusawardani, 2011). the conserved nature of the transmembrane domains and structural features of the ligand binding pocket for gpcrs allows the prediction of ligand interactions in a binding pocket of the pban - receptor. a model illustrating a putative h. zea pban - receptor binding pocket is shown in figure 2. this model will need to be verified with mutation studies to determine if the specified amino acids are involved in ligand binding. a model of the helicoverpa zea pban - receptor illustrating amino acids that could be involved in binding pban. several mutation studies have been conducted to determine which domains of the pban - receptor are involved in ligand recognition and activation. one study utilized chimeras where the extracellular domains were exchanged sequentially between the h. zea pban - receptor and the d. melanogaster pk1-receptor (choi., 2007). all extracellular domain chimeras reduced activity of the chimera receptor when challenged with pban. however the h. zea pban - receptor chimera with the third extracellular loop exchanged had increased activity when challenged with the diapause hormone. the d. melanogaster pk1-receptor chimera with the third extracellular loop exchanged had increased activity when challenged with pban. these results indicate that the third extracellular loop is important for peptide recognition and could be involved in accepting the correct peptide for binding to a receptor activation site which is the ligand binding pocket located in the transmembrane domain area of the receptor. alanine substitution mutations made in the third extracellular loop indicate that specific amino acids could be involved in peptide recognition (choi and jurenka, 2010). further studies will be required to validate these models and establish how this family of receptors recognize specific peptides and activate the receptor. pheromone biosynthesis activating neuropeptide activation of the receptor induces the influx of extracellular calcium and the subsequent increase in cytosolic calcium (jurenka., 1991 ; jurenka, 1996). in heliothine moths, as in all moth species examined to date, the presence of calcium in the extracellular medium is a prerequisite for pban action (rafaeli, 1994 ; choi., 2004 ; choi and jurenka 2006) suggesting that the opening of cation channels and the concomitant influx of calcium are most likely conserved features of pban activation. in the absence of calcium or the presence of calcium calmodulin inhibitors such as w7, pheromonotropic activity is abolished (rafaeli and gileadi, 1996a) and, conversely, the pheromonotropic effects of pban can be duplicated with calcium ionophores such as ionomycin, thapsigargin, and a23187 (rafaeli and gileadi, 1996a ; rafaeli and jurenka, 2003). however, unlike the signal transduction pathway determined for the silkworm b. mori, in the heliothine moths there is evidence that the increase in cystosolic calcium activates a calcium calmodulin sensitive adenylate cyclase which in turn promotes the production of cyclic - amp (rafaeli and soroker, 1989 ; soroker and rafaeli, 1995 ; rafaeli and gileadi, 1996a). furthermore, pharmacological compounds that affect cyclic - amp levels such as cyclic - amp analogs, isobutyl methyl xanthine (a phosphodiesterase inhibitor), and forskolin (an adenylate cyclase activator) have been shown to stimulate downstream events and thereby pheromone biosynthesis in h. armigera (rafaeli and soroker, 1989 ; rafaeli, 1994) and h. zea (jurenka., in addition, in h. armigera sodium fluoride, a g - protein activator can induce intracellular cyclic - amp levels and subsequent downstream events leading to pheromone production, independent of the ligand pban (rafaeli and gileadi, 1996b). as an outcome of the activation of the second messengers, kinase, and/or phosphatase is activated, which, in their turn, stimulate fatty acid biosynthesis in the pheromone biosynthetic pathway (figure 3). a diagrammatic representation of sex pheromone biosynthesis resulting from pban release into the hemolymph and its interaction with the pban gpcr in female pheromone glands (pg) and male hairpencil aedaegus - complexes of helicoverpa armigera. (male - complex illustration taken from bober and rafaeli, 2010 with permission). abbreviations : ac, adenylate cyclase ; accase, acetyl - coa carboxylase ; br, brain ; cam, calcium calmodulin ; camp, cyclic - amp ; cc, corpora cardiaca ; 11-des, 11 desaturase ; fas, fatty acid synthetase ; gpcr, g - protein coupled receptor ; oxi, oxidase ; pban, pheromone biosynthesis activating neuropeptide ; pk, protein kinase a ; red, reductase ; sog, subesophageal ganglion. what enzyme in the biosynthetic pathway is affected by the signal cascade brought about through pban binding to its receptor ? demonstration of the enzymatic key regulatory step in the biosynthesis of sex - pheromones primarily relies on following labeled precursors and intermediates into pheromone molecules in the absence and presence of pban. thus, if production of a labeled pheromone component from incorporation of labeled precursor occurs in the absence of pban to the same extent as in its presence the labeled precursor must be acting downstream of the regulatory enzyme and therefore regulation must occur upstream. the effect of pban on the different steps in the biosynthetic pathway has been investigated in several lepidopteran species including b. mori (arima., 1991 ; ozawa., 1993), thaumetopoea pityocampa (arsequell., 1990), s. littoralis (martinez., 1990 ; fabrias., 1994), manduca sexta (fang., 1995 ; tumlinson., 1997), h. zea (jurenka, 1991), h. armigera (tsfadia., 2008), and plodia interpunctella (tsfadia., 2008). studies of this nature have so far indicated that pban does not influence desaturase activity. using both stable isotopes and specific enzyme inhibitors the rate limiting step of pban pheromone biosynthesis regulation in h. armigera was determined (tsfadia., 2008). these studies showed that only incorporation of labeled acetate is affected by pban and that this incorporation can be inhibited by the acetyl coenzyme a carboxylase (accase) inhibitor, tralkoxydim. levels of incorporation of labeled malonyl coa or palmitic acid (downstream of acetate) were unaffected by the presence or absence of pban (tsfadia., 2008). thus, in h. armigera, the rate limiting step for pban control is regulation of the accase which catalyzes the rate limiting enzyme of fatty acid biosynthesis, prior to the action of fatty acid synthetase (figure 3). pban is also thought to influence accase activity in argyrotaenia velutinana (tang., 1989), p. interpunctella (tsfadia., 2008), and h. zea (jurenka., 1991). in contrast, in b. mori, t. pityocampa, s. littoralis, and m. sexta pban stimulates a reductase that converts an acyl - coa to an alcohol precursor (arsequell., 1990 ; martinez., 1990 ; ozawa., 1993 ; fang., 1995). in h. virescens a two - step regulatory role for pban was demonstrated (eltahlawy., 2007). this two - step theory entailed a push (accase) and a pull (acyl - coa) for the action of pban and may explain the controversial hypotheses suggested for identifying the rate limiting steps controlled by pban in the different moth species. an interesting feature revealed by studies on the mode of pban action is that in those species in which pban has been shown to regulate reductase activity, cyclic - amp has proven to be ineffective as a pheromonotropic agent whereas in those species in which pban regulates accase activity, cyclic - amp appears to be involved as a second messenger. moreover, it is interesting that different receptor subtypes maybe correlated with the different downstream intracellular signal cascades that are induced. it is apparent that at least two subtypes of pban - receptors could be located in pheromone glands : one with calcium signaling cascade including cyclic - amp and a shorter c - terminal tail (h. zea, h. armigera) ; the other dependent only on calcium having a longer c - terminal tail (b. mori). allocating these characteristics may be too premature until more evidence becomes available as to the involvement of cyclic - amp in the signal transduction of other pban - receptor subtypes. for example, pban induces calcium elevations by the p. xyllostella pban - receptor, which also has a short c - terminal tail ; however cyclic - amp levels were not analyzed in the p. xyllostella study (lee., 2011). male insects often possess scent - releasing organs in the form of hairpencils, coremata, or androconial scales (birch.,, studies have identified hairpencil secretions produced by several species (chow., 1986 ; teal and tumlinson, 1989 ; heath., 1992 ; thibout., 1994 ; huang., the behavioral role of these secretions is not well understood, but most often these odors have been deemed important in courtship behavior. in general male pheromones can be considered to have many possible functions : they can act as aphrodisiacs to stimulate female receptivity during courtship (birch, 1974) ; they have been reported to induce female calling (szentesi., 1975), females become immobile allowing copulation ; and they have been reported to function as male - to - male inhibitory compounds, thereby minimizing male - competition (hirai., 1978 ; teal., 1984 ; teal and tumlinson, 1989 ; wu., 1991 ; odors released by male hairpencils are important in male acceptance by the female and may play a role in mate choice and species isolation (hillier and vickers, 2004 ; lassance and lfstedt, 2009). in the european corn borer, ostrinia nubilalis, scents released during courtship by males close - range chemical cues have also been proposed as a trait used by females to assess male quality (eisner and meinwald, 1995). in species of lepidoptera belonging to the arctiidae and danaidae, scent gland composition is related to host plant consumption and sequestration of compounds during the larval and adult stages (birch and hefetz, 1987). however, in other moth species, as in the heliothine moths, these male odors are derived from the fatty acid biosynthetic pathway, and as such are similar to the female sex - pheromone blends (teal and tumlinson, 1989 ; huang., 1996). in o. nubilalis the male chemical signal is also analogous to the female signal in that structurally similar compounds are being used by both sexes and are governed by the same genes encoding biosynthetic enzymes (lassance and lfstedt, 2009). pheromone biosynthesis activating neuropeptide was originally isolated from female h. zea suboesophageal ganglia and its distribution in the female nervous system was studied using elisa (kingan., 1992) however the gene transcript was shown to be present in both the male and female central nervous system (ma., 1998). using an immunoassay, pban was also found in both female and male h. armigera central nervous systems and throughout the photoperiod (figure 4 ; hirsch, 1991 ; rafaeli., 1993). pheromone biosynthesis activating neuropeptide - immunoreactivity in the brain - subesophageal ganglion - corpora cardiaca - corpora allata complexes of helicoverpa armigera males (hirsch, 1991) and females (rafaeli., 1993). histograms represent means se of eight replicates each of a pool of at least five tissue equivalents. the function of pban in the males, however, has been a mystery since its discovery but its presence has been speculated to have other functional significances particularly in light of the pleiotropic action of pban and pban - like peptides in other insects. however, a recent temporal differential expression study of the pban - r revealed the presence of gene transcripts in both the male - complexes (hairpencil aedaegus complex) and female pheromone glands of two moth species, h. armigera and b. mori (bober., 2010) with levels dependent on the age of the adults and up - regulated on or just before eclosion. whilst the presence of pban in males can be understood in terms of the ubiquitous characteristic of this peptide family, the presence, as well as the transcriptional regulation of its receptor in the male - complex called for a re - examination of a possible function for pban and its receptor in this tissue. as discussed above, and, since fatty acid - derived pheromonal compounds were identified in male - complexes of several moth species including heliothine moths, we aimed to determine whether pban plays a role in the regulation of the biosynthesis of these compounds in male h. armigera. we utilized both physiological bioassays and rna interference (rnai) technology to identify several male pheromone components that are responsive to pban stimulation and to photoperiod, and are also significantly affected by silencing of the pban - r (bober and rafaeli, 2010). we hypothesized that these components are key in the chemical communication between females and males during copulation (figure 4). it remains to be demonstrated that those pban up - regulated male produced compounds are indeed responsible for a successful mating encounter by either arresting females for copulation, increasing their receptivity, or deterring co - specific males from competing. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | both males and females of heliothine moths utilize sex - pheromones during the mating process. females produce and release a sex pheromone for the long range attraction of males for mating. production of sex pheromone in females is controlled by the peptide hormone (pheromone biosynthesis activating neuropeptide, pban). this review will highlight what is known about the role pban plays in controlling pheromone production in female moths. male moths produce compounds associated with a hairpencil structure associated with the aedaegus that are used as short - range aphrodisiacs during the mating process. we will discuss the role that pban plays in regulating male production of hairpencil pheromones. |
the spleen is the greatest single mass of lymphatic tissue that lies between the left kidney, stomach and diaphragm (1). it has three surfaces : diaphragmatic, gastric and renal surface and the two borders : superior and inferior (1). this surface meets gastric and diaphragmatic surfaces respectively on the inferior border and a margin close to the splenic hilum (2). it plays vital roles in regard to blood storage, formation of lymphocyte and defense against foreign particles (3). accessory spleen is an ectopic splenic tissue develops result from the imperfect fusion of the splenic masses during embryonic life (4). it is found in 10 - 30 percent of the population (4, 5). accessory spleens are found near the splenic hilum, in the gastrosplenic ligament, in the splenorenal ligament, in the mesentery, in the greater omentum, around the pancreatic tail and along vascular pedicle of the spleen, but rarely in the gonads (6). spleen primordium develops from the mesoderm of the dorsal mesogastrium in the fifth week of development. accessory spleens rise from the dorsal mesogastrium as a result of failure fusion of the separate splenic nodules (4). in the text book of moore s anatomy has been mentioned the incidence of the accessory spleen was in 10% of the population (7). in the usa, the incidence of accessory spleen was found at autopsy in 10 - 30% of american population (4). in a european study was found that the accessory spleen was present in 11% of patients undergoing abdominal ct - scan (8). the incidence of accessory spleen ranged between 4.5% and 24.28% in asian population (9 - 11). hence, it is critical to correctly differentiate accessory spleens from tumors of the abdominal organs like adrenal tumor, pancreatic tumors or tumors of the retroperitoneal space (5, 12, 13). for example, when it is at pancreas region, it may mimic a pancreatic tumor. in addition, the present of the accessory spleen is important to avoid a recurrence of symptoms of the disease when spleen should be removed in hematological disorders (5, 12, 13). hence, the objective of this study was evaluation the incidence of accessory spleen in iranian cadavers. this study was carried out in the dissection hall of the forensic medicine organization, razavi khorasan province, from june 2014 to july 2015. the protocol of the research was approved by the ethics research committee of mashhad legal medicine organization. sixty hundred and ninety three spleens (541 males, 152 females) were excised from cadavers in the dissection hall of mashhad forensic medicine organization cadavers. inclusion criteria were as follows : fresh iranian cadavers with no history of alcohol, poisoning or drug abuse, and no evidence of pathologic abnormality or injury to the spleen. the presence of accessory spleens investigated near the splenic hilum, in the gastrosplenic ligament, in the splenorenal ligament, in the mesentery, in the greater omentum, and around the pancreatic tail., the spleen weight was measured with the help of an electronic weighing machine (pand azma 3100, iran). a 20-year - old female, with no history of personal or family diseases that had been referred to autopsy laboratory of forensic medicine, khorasan razavi province, iran, for medicolegal autopsy on august 3, 2014. the height, weight and bmi of cadaver were 162 m, 75 kg and 28.58 kg / m, respectively. an accessory spleen in the splenic hilum, measuring 3.5/2.5 cm, was observed (figure 1). (a - e) are images of the spleens in case numbers 1- 5, respectively. one accessory spleen was found in a female cadaver (age : 24 y, height : 165 m, weight : 69 kg, body mass index : 25.34 kg / m) that was under examination to determine a cause of death. the accessory spleen was located in the hilum with 3 cm long and 1.5 cm wide (figure 1). a 42-year - old male, with no history of poisoning, alcohol or drug abuse and no evidence of trauma or abnormality of spleen that had been referred to the mashhad legal medicine on august 27, 2014. the height, body weight and bmi of cadaver were 163 m, 59 kg and 22.21 kg / m, respectively. its length was 2.5 cm and its width was 1.5 cm (figure 2). an accessory spleen was observed in a female cadaver (age : 34 y, height : 170 m, weight : 79 kg, bmi : 27.34 kg / m) with no gross abnormality and injury of the spleen that needed autopsy. the measurements using a vernier caliper showed that it was 2 cm in length and 1 cm in width (figure 1). a 61-year - old male, with no history of pathologic abnormality or injury to the spleen was subjected to an autopsy on february 21, 2015, by the mashhad legal medicine, iran. the values obtained for height, weight and bmi were 169 m, 68 kg and 23.81 kg / m, respectively. the accessory spleen was measured 2.7 cm in length and 0.5 cm in width (figure 1). the main finding of this study was the present of accessory spleen at the hilum of the spleen in five cadavers of razavi khorasan province, mashhad, iran. in the text book of snell s anatomy has been reported the incidence of the accessory spleen 10 percent of the normal population and it may exist in the gastrosplenic ligament or in the lienorenal ligament (1). the incidence of accessory spleen was 10 - 30% of american population with a predominant site of the splenic hilum (4). in another american study found that the accessory spleen was present in 15.6% of cases undergoing abdominal ct - scan (14). their length ranged between 4 and 29 mm and the range of their width was from 4 to 25 mm (14). similarly, the most common site of accessory spleen was near the hilum of the spleen and the maximum its width was 25 mm. however, our findings showed that the incidence of accessory spleen was lower than that in this study (0.7% vs. 15.6%, respectively). in addition, the maximum length of accessory spleen was more than that in american people. romer and wiesner studied ct - examination of 1735 patients in switzerland, the accessory spleen was found in 11% of patients (8). in a study by rayhan, the incidence of accessory spleen has reported 24.28% in bangladeshi people (9). in another study in india, 4.5% of the splenic samples exhibited an accessory spleen (10). in a study by zhang and colleagues have reported that most there is one accessory spleen in which was consistent with our finding (11). our results showed that the incidence of accessory spleen was less than that in indian population. the limitation of this study was that there was not available data about accessory spleen in our population for comparison in this paper. an accessory spleen has clinical significance in that they may result in diagnostic errors for the oncologists or the persistence of the symptoms after splenectomy. hence, this report may help surgeons, oncologists, radiologists, and the anatomists regarding the incidence of the accessory spleen. | aim : an accessory spleen is an additional tissue of the spleen that may be found near the spleen. it is a congenital anomaly of the spleen that its incidence has been reported 10 - 30% of the population. hence, the objective of this study was evaluation the incidence of accessory spleen in iranian cadavers.method:sixty hundred and ninety three spleens (541 males, 152 females) were excised from cadavers in the dissection hall of mashhad forensic medicine organization cadavers. inclusion criteria were as follows : fresh iranian cadavers with no history of alcohol, poisoning or drug abuse, and no evidence of pathologic abnormality or injury to the spleen. the presence of accessory spleens, its dimension and weight investigated in cadavers.results:during routine postmortem examination, five cases with an accessory spleen were found in the autopsy laboratory of mashhad legal medicine organization between june 2014 and july 2015. of the cases, 3 were male and 2 were female. the accessory spleens were observed at the splenic hilum. the length of the accessory spleens ranged from 2 - 3.5 cm, while the range of width was between 0.5 and 2.5 cm. the accessory spleens were confirmed by histological examination.conclusion:an accessory spleen has clinical importance in some locations. when an accessory spleen is situated in another site, it may mimic some tumors such as pancreatic tumor and adrenal tumor. in addition, accessory spleen may cause hyperplasia after splenectomy and be responsible for a recurrence of the hematological disorders. |
chronic nasal airway obstruction is one of the most frequent complaints visited to otolaryngologists by the patients. deviation of nasal septum is a common anatomic variation and the most frequently causes of nasal obstruction (1, 2, 3). the nasal obstruction symptom evaluation scale (nose) has valid, reliable, and responsive instrument that is brief and easy to complete and has potential use for outcomes studies in adults with nasal obstruction (4, 5). rhinomanometry has been described as a gold standard for measurement of nasal obstruction (6). the definitive treatment of deviated nasal septum is septoplasty, and this surgical procedure is a very effective and satisfactory treatment and should improve the quality of life (7)., we evaluated the values of subjective parameters (nose score) and active anterior rhinomanometry parameters of deviated nasal septum before and three months after septoplasty. forty patients with nasal septal deviation for study group and 30 healthy adult volunteers participated belonged to the control group were accepted to the study. all individuals studied had no previous history of nasal surgery or active rhinological disease and had not taken antihistamines, systemic or nasal steroids during the previous three months. active anterior rhinomanomtry was the applied method using rhinomanometry to measure the transnasal airway resistance and nasal airflow. before the test, subjects were confined to a quiet room for at least 30 min and consumed / inhaled no caffeine, alcohol or nicotine for the period of the analysis (8). the nasal obstruction symptom evaluation scale (nose) questionnaire was the applied before and 3 months after surgery. inclusion criteria : 18 years or older ages, septal deviation consistent with symptom of chronic nasal obstruction. exclusion criteria : were sinonasal malignancy, septoplasty performed as access to other sites, prior septoplasty, rhinoplasty, or turbinoplasty, history or clinical evidence of chronic sinusitis, septal perforation, craniofacial syndrome, acute nasal trauma or fracture in the past 3 months, nasal valve collapse, adenoid hypertrophy, sarcoidosis, wegener s granulomatosis, uncontrolled asthma, pregnancy, and illiteracy. the kolmogorov - smirnov test assessed the compliance concerning the distribution of values in the normal curve. the anova test for compare parameters active anterior rhinomanometry and non - parametric wilcoxon t test was utilized in order to compare the nose questionnaire scores before and three months after surgery. we assessed the correlation between the preoperative score and the postoperative improvement, calculated by the difference between the postoperative and preoperative scores, using the pearson correlation test. a p value lower than 5% was deemed significant. we analyzed 40 examinees on the experimental group : male patients (62.5%), (age 27.6 years 10.80 ; range 16 - 55 years : median 25). the post - operative improvement in symptoms of nasal obstruction obtained in 92.5% patients and improvement parameters of the active anterior rhinomanometry in 42.5% patients. table 1 shown statistically significant differences in the measurement of active anterior rhinomanometry before and after the septoplasty. statistically significant improvement shown by the parameters : sum of inspiratory flow ; sum of expiratory flow ; expiratory resistance of left ; expiratory resistance of left (p0.05). testing the parameters of rhinomanometry before and after surgery. fsumi- sum of inspiratory flow ; fsume- sum of expiratory flow ; rel expiratory resistance of left ; fel expiratory resistance of left ; p0.05. there was a statistically significant improvement shown by the wilcoxon t test (z=-5.34 ; p<0.001) -between the preoperative nose questionnaire score and three months later (table 2). after the surgery correlated values of the parameters of active anterior rhinomanometry and nose scale. there was no statistically significant correlation between the values of active anterior rhinomanometry and nose scale. this is a prospective analysis of 40 patients with nasal septal deviations, before and three months after septoplasty. other studies have patients with similar age means (20 - 31 years) (3, 9, 10). in the current study the post - operative improvement in symptoms of nasal obstruction obtained in 92.5% patients and improvement parameters of the active anterior rhinomanometry in 42.5% patients. dinis and haider (12) reported that patients with significant nasal obstruction have milder degrees of septal deviation, while other patients with severe septal deformities have mild symptoms. the post - operative improvement in symptoms of nasal obstruction was reported to range between 26 and 94.4% depending on the length of follow - up and the method of assessment of results (7, 13 - 16). sipila and sounpaa (17) showed that postoperatively were satisfied with 85% of patients who had high preoperative intranasal resistance, compared with 69% of satisfied patients who have had a proper preoperative intranasal resistance. dommerby. (18) analyzed postoperative results of 161 patients after septoplasty (25 - 64 months). they reported that 35% of patients were not satisfied with the operation of which is 9% of cases the cause of dissatisfaction was not in compliance with postoperative rhinoscopic findings in 11% of patients the reason for dissatisfaction was associated with the results of operations. there is a lack of medical literature demonstrating a positive correlation between subjective and objective results in functional nasal surgery. the author presents his experience measuring nasal function subjectively and objectively before and after functional nasal surgery. statistically significant subjective and objective functional improvements were reported in 98.9% and 95.6% of patients, while 94.4% of patients had both subjective and objective statistically significant functional improvement. (20) in 41 patients before and after septoplasty, nasal resistance examined, olfactory function and subjective symptoms. the authors noted that after the surgery was not significantly changed olfactory functions. in addition, an increase of nasal ventilation, functional and cosmetic nasal surgery can lead to improved olfactory function. gupta. (21) investigated the olfactive function changes after septoplastics in 41 patients. the authors recorded the improvement in olfactory function in 29 patients (70.6%) ; there was no change in 5 patients (20.1%) ; and reduced olfactory function was noticed in 3 (7.3%) patients. the authors concluded that, even though the septal surgery is performed in an area remote from the olfactory epithelial area, changes in nasal airflow and intranasal volume can change the olfactory function of an individual. (9) noted that there is a significant correlation between the subjective sensation of nasal obstruction, clinical rhinoscopic findings and the objective rhinomanometric measurements of nasal airway resistance and nasal airflow. authors recommended to use rhinomanometry in patient selection who need septal surgical correction, knowing that the severity of nasal septal deformity does not always correlate with the severity of the clinical features. however, in our study was no statistically significant correlation between the values of active anterior rhinomanometry and nose scale. we found out the discrepancy between subjective (nose) and objective findings (rhinomanometry) after septoplasty. the correlation between the findings with rhinomanometry and subjective sensation of nasal patency remains uncertain. there still seems to be only a limited argument for the use of rhinomanometry for quantifying surgical results. | introduction : surgical and medical treatments of nasal obstruction are a common parts of otolaryngologist practice. the definitive treatment of deviated nasal septum is septoplasty.aim:in this study was to evaluate the values of subjective parameters, and active anterior rhinomanometry parameters prior and three months after the septoplasty.patients and methods : we analyzed the subjective parameters (nose scale), the active anterior rhinomanometry parameters according to international committee on standardization of rhinomanometry, on 40 patients. thirty healthy adult volunteers participated belonged to the control group. none of the patients or healthy volunteers had previous history of nasal surgery or active rhinological disease.results:the post - operative improvement in symptoms of nasal obstruction obtained in 92,5% patients and improvement parameters of the active anterior rhinomanometry in 42,5% patients.conclusion:the correlation between the findings with rhinomanometry and subjective sensation of nasal patency remains uncertain. there still seems to be only a limited argument for the use of rhinomanometry for quantifying surgical results. three months postoperative findings are very early results to interpret the permanent effects. |
beta - lactamase production is a common mechanism of resistance, particularly among gram - negative organisms.1 carbapenemases are distinct among the beta - lactams ; in addition to being able to hydrolyze most penicillins and cephalosporins, they are also able to hydrolyze the carbapenems. there are two biochemically distinct classes of carbapenemases : the serine beta - lactamases and the metallo - beta - lactamases (mbls). the fundamental difference between these two classes resides in their hydrolytic mechanisms and rate of hydrolysis. the serine beta - lactamases rely on serine residues within the active site for hydrolytic activity, whereas mbls rely on zinc ions. because of these mechanistic differences, these enzymes are inhibited differently ; serine beta - lactamases can be inhibited by beta - lactamase inhibitors (such as clavulanic acid), whereas mbls are inhibited by agents that can chelate divalent cations (such as edta). several mbls have been described in the literature.2 the imipenemase (imp) variety of mbls was among the earlier beta - lactamases in the class to be identified in the 1980s in japan. since their discovery, verona integron - encoded metallo--lactamase (vim)-type enzymes are another type of mbl with several described variants, and spm - type enzymes are another example of mbls that have been discovered. the new delhi metallo - beta - lactamase (ndm) is the most recently discovered, globally distributed enzyme.2 this review will focus on the impact of the ndm enzyme on beta - lactam antibiotics. ndm was first reported in the literature in 2009 in a klebsiella pneumoniae isolate and was referred to as ndm-1.3 this particular isolate was found on a urine culture from a male patient in sweden who had traveled to and had been hospitalized in india. further investigation of the blandm-1 gene found in this isolate revealed that ndm-1 bound and hydrolyzed all beta - lactams, with the exception of aztreonam. to date, there have been 13 variants of ndm that have been identified : ndm-1 to -14 (ndm-11 was not assigned to any unique variant).46 the variants arise from site mutations within the gene encoding the beta - lactamase. many of the variants, such as ndm-2 and ndm-3, share similar hydrolytic activity with ndm-1, as the mutations are not located in the active site of the enzyme. some variants, such as ndm-4, do have genetic alterations in the active site and have been observed to have increased hydrolytic activity toward carbapenems.7 as summarized in table 1, ndm-1 is the most common variant in cases of clinical infections and unless otherwise noted will be the focus of this paper. ndm was named so after its place of origin : new delhi, india.3 organisms carrying genetic material for ndm have been found to be very capable of transferring genes encoding ndm, as well as any other resistance genes the pathogen may be carrying.8 the ease with which the genes are transferred is concerning, and the implications for dissemination of ndm are immense. indeed, since its discovery, it has spread across the globe.9 the most recently published surveillance study reported a total of 135 ndm isolates from around the world.9 despite the fact that about half of the isolates came from india, the study established the presence of ndm - producing organisms in other parts of the world, such as vietnam, serbia, the philippines, the middle east, guatemala, and the usa. reports of ndm - producing organisms have also surfaced from pakistan,10 the uk,10 japan,11 the netherlands,12 and australia.13 figure 1 depicts the geographical distribution of ndm ; the areas where ndm producers are most commonly isolated are located on the asian continent.4 outbreaks have also been reported around the world in areas such as the uk and the middle east. the clinical cases outlined in table 1 also help demonstrate the wide spread of ndm producers. a variety of non - beta - lactam antimicrobials however, often these organisms producing ndm are resistant to many other antimicrobials, if not all antimicrobials, which may limit non - beta - lactam options. additionally, the antibiotics that retain activity have high rates of side effects or have limitations in drug delivery, colistin, and fosfomycin, respectively. given the worldwide spread and the broad resistance patterns detected, it is important to fully explore all our therapeutic options, including the clinical impact of these enzymes on beta - lactam antibiotics. the modified hodge test was a recommended screening tool by the clinical and laboratory standards institute (clsi) for carbapenemase - producing organisms.14 this test, however, only screens for a phenotype, and therefore will not distinguish between the various types of carbapenemases. mbls in particular can be difficult to detect using these methods, and as such, pose unique challenges in the laboratory.15 the carba np test has also recently been developed for better carbapenemase detection16 and is now a preferred method of detection per clsi standards.17 identification methods utilizing chelating agents have also been developed to help better identify mbls.14 these methods look for either additive or synergistic effect when a chelating agent is added to a hydrolyzable beta - lactam. the chelating agent, by binding zinc ions that are necessary for hydrolytic activity, prevents mbl from taking action on the beta - lactam. once an mbl is identified, to further determine which specific mbl is present requires genotypic identification. clinical experience with treating infections caused by ndm producers is limited, making it difficult to fully assess the impact of ndm on clinical outcomes. a study evaluating neonatal sepsis in a level iii neonatal intensive care unit (nicu) surprisingly insinuated that infection with an ndm producer did not confer higher mortality as compared to infections caused by other resistant pathogens.18 the study identified 105 blood cultures from a 5-year time span that were found to have either cephalosporin resistance genes or carbapenem resistance genes. the only carbapenemase identified in this cohort was ndm ; all the isolates had various combinations of different extended - spectrum beta - lactamases (esbls) and ampc beta - lactamases. cefotaxime combined with either amikacin or gentamicin were the preferred empirical antibiotics within the first year of the 5-year study period, which was switched to piperacillin / tazobactam combined with amikacin. severe infections warranting broader coverage were treated with combinations of ofloxacin, colistin, and meropenem. this broader therapy was more favored as empirical therapy after carbapenem resistance trends were identified. looking closer at the antibiotics used against ndm - producing isolates, there are a substantial number of patients who received antimicrobials without in vitro activity against the isolate and survived to be discharged from the nicu. interestingly, mortality rates for neonates with bacteremia caused by an ndm producer (13.3%) versus those with a non - ndm producer were not different. a similar result was seen in another observational study evaluating bloodstream infections caused by k. pneumoniae producing vim, another mbl ; production of vim was not found to be associated with an increase in mortality.19 these observations are unexpectedly positive, given the additional in vitro resistance that is conferred by these enzymes. however, with mortality rates for k. pneumoniae carbapenemase infections being reported from clinical experiences to be between 42% and 53%,20 the mortality rate seen with ndm seems staggeringly low. these studies call into question the magnitude of impact on clinical outcomes associated with mbl, and particularly, ndm production. most data describing clinical outcomes with infections caused by ndm producers are available in various case reports, summarized in table 1. these case reports also tend to report good outcomes despite mismatches with therapy and susceptibilities. specifically, there were instances in which appropriate therapy per culture was never reported to be initiated, and the patient s infection resolved.2123 there were also cases where therapy was switched to provide antimicrobials to match susceptibility results despite a lack of reported clinical failure on the inappropriate antimicrobials.2426 combination therapy at some point during treatment was commonly described and often included a carbapenem in the regimen.24,2730 of the 18 patients with ndm producers identified on blood culture, seven patients had isolates susceptible to antibiotics received during the course of treatment and survived.27,28,3032 five patients had pathogens isolated on blood culture that were not susceptible to any antibiotics received during the course of treatment and survived, three of which received a carbapenem.21,22,30,31,33,34 of the six patients with bacteremia who expired,30,31,3537 only one had an ndm producer isolated that was not susceptible to any of the antibiotics received during the course of treatment.31 one of the patients expired before antibiotics were initiated,30 and the remaining four patients who expired had an ndm - producing pathogen on blood culture that was considered susceptible to antibiotics received during the course of treatment.30,3537 two of these patients expired due to non - ndm related causes,30,35 and the remaining two patients had undergone stem cell transplantation approximately 23 weeks prior to expiring.36,37 the cases described in table 1 ultimately describe a broad range of patients and infection types with surprisingly positive outcomes. although a trend toward positive outcomes exists, there are many other patient - specific factors that contribute to the patients success rate, including underlying immune function and disease states, ability to drain / remove abscesses and infected necrotic tissues, and the management of invasive devices that might be colonized with the pathogen. however, these results further call into question the repercussions to be expected with ndm producers on patient outcomes and deserve further investigation in a controlled setting to investigate the possible rationale(s) for the discrepancies. literature reporting in vitro susceptibility of ndm producers often describes resistance to many antimicrobials and does not offer an explanation for the clinical successes recounted. a surveillance study gathering ndm - carrying clinical isolates from around the world characterized resistance patterns from 135 isolates.9 of the varieties of ndm, ndm-1 was most commonly seen, accounting for 96.3% of the isolates. only levofloxacin (12.7% susceptibility) and amikacin (16.4% susceptibility) had any activity against the isolates ; neither cephalosporins, piperacillin / tazobactam, nor ampicillin / sulbactam displayed any in vitro activity. based on this study, carbapenems did not appear to offer any substantial activity against these isolates either. ertapenem minimum inhibitory concentration (mic) values varied from 1 mg / l to > 4 mg / l, with mic50 value of > imipenem did not look any more promising, with an mic50 value > 8 mg / l. of note, 99 of the 135 isolates carried additional genes encoding other esbls, with ctx - m being the most common, followed by shv. aztreonam is expected to be stable against the mbls.9 it is thought that the chemical structure of aztreonam does not allow adequate molecular interaction with the active site of mbls, and therefore, hydrolysis of aztreonam does not occur.38 however, because of the additional beta - lactamases and other resistance mechanisms often carried by these organisms, in vitro susceptibility is not always demonstrated to aztreonam.39 the addition of the beta - lactamase inhibitor avibactam to aztreonam often restores activity of aztreonam against such ndm - carrying organisms. another study examining isolates from india and the uk confirmed high rates of resistance to carbapenems, cephalosporins, and other beta - lactams (including aztreonam), quinolones, and aminoglycosides.10 colistin was reported to have good in vitro activity against these isolates (89%100% susceptibility),10 but when tested in a murine lung infection model using susceptible isolates, it produced variable results.40 tigecycline had in vitro activity as well (56%67% susceptibility)10 and seemed to have more reliable activity in a murine lung infection against susceptible isolates.40 however, tigecycline against nonfermenting gram - negative organisms seems to fall to 15%, as compared to 60% susceptibility against enterobacteriaceae, as reported by jain.41 fosfomycin is another antimicrobial to consider ; susceptibility of ndm - producing organisms to fosfomycin has been reported in the literature to be 60.5%41 to 78%.42 the various pieces published that describe in vitro susceptibility mirror the susceptibilities seen in case reports, thus confirming consistency of in vitro reports, but further highlight the clinical response discrepancies. eravacycline is a new fluorocycline antibiotic currently in the development for treatment of infections caused by multidrug - resistant organisms.43 in a study investigating in vitro activity of eravacycline, five isolates showing nonsusceptibility to third - generation cephalosporins were confirmed to produce ndm. of these five isolates, two (both escherichia coli) had an mic 0.5 g / ml and three (all k. pneumoniae) had an mic of 12 g / ml. another potential advantage of eravacycline is the availability of both parenteral and oral formulations, which could provide for convenient parenteral - to - oral therapy changes.44 despite the small number of ndm - producing isolates evaluated and the lack of clinical data, this study provides hope for another potential drug against ndm. in vitro efficacy of combination therapy has also been evaluated against two ndm - producing k. pneumoniae strains.45 in a study done by tangden, despite both strains being resistant to fosfomycin, a combination of fosfomycin and colistin was found to have both bactericidal and synergistic activities after 24 hours. similar activity was seen with a combination of rifampin, meropenem, and colistin despite both strains being nonsusceptible to rifampin or meropenem alone. a combination of fosfomycin, meropenem, and colistin had both bactericidal and synergistic activities against one strain, but lacked bactericidal activity against the other strain. bacterial regrowth during the 24-hour period was observed for colistin - containing combinations (as well as with colistin alone), but clinical relevance of this is yet to be determined. another larger study looked for synergistic antimicrobial combination in 28 ndm producers with paired combinations of colistin, fosfomycin, and tigecycline.46 in this particular study, synergy was rarely observed when colistin was paired with another drug. in this study, however, another study investigating tigecycline and colistin combinations did identify antagonism when the two agents were combined.47 further studies are warranted to clarify the clinical significance of the interactions seen in these studies, particularly as it relates to possible antagonism. as it stands, available in vitro data for combination therapy also fails to provide insight into the unexpected good clinical outcomes seen in the literature. despite the grim outlook on therapy provided by in vitro data, in vivo data from animal studies paints a different picture in terms of antimicrobial options and potentially explains the discordant results of human clinical data. one study compared humanized doses of ceftazidime versus ceftazidime with avibactam against isolates producing ndm, as well as other beta - lactamases.48 in vitro susceptibility testing to ceftazidime, avibactam, and the combination of ceftazidime / avibactam showed that all ndm - producing isolates were resistant to the tested compounds. therefore, it was unexpected when humanized exposures of both ceftazidime alone and ceftazidime in combination with avibactam had activity against ndm - producing isolates in a murine thigh infection model (figure 2). ceftazidime alone showed a 1.4-log reduction against an isogenic strain harboring ndm-1, whereas only modest to no activity was noted against clinical strains. the addition of avibactam to ceftazidime restored activity against all the tested strains, showing 0.611.42-log reductions in bacterial growth. since ceftazidime was active against the isogenic ndm harboring the single enzyme, it was not surprising that the addition of avibactam essentially eliminated the impact of other beta - lactamases, preserving ceftazidime s activity against the clinical isolates. these data suggest that the magnitude of the in vivo expression of ndm beta - lactamase is not large enough in the context of conventional exposure to ceftazidime as used in the clinical setting. it also highlights that genotypic testing only for ndm may not be sufficient for determining clinical response to therapy. carbapenems provide another example of discordance between in vitro data and in vivo data. a murine thigh infection model performed by wiskirchen compared efficacy of humanized, high - dose, prolonged - infusion doripenem, and ertapenem against ndm - producing strains.49 an isogenic ndm - carrying k. pneumoniae strain as well as four clinical ndm - carrying strains all showed > 1-log reduction in bacterial density with carbapenem therapy in an immunocompetent murine thigh infection model (figure 3). the exception was one clinical strain with a doripenem mic > 32 g / ml, which showed only a modest decrease in bacterial density. this successful reduction in bacterial density was shown again in the same study using two clinical strains in a neutropenic murine thigh infection model, and the effect was shown to be sustained out to 72 hours in an extended immunocompetent murine model. the efficacy of carbapenems against ndm producers was confirmed in a second study done by wiskirchen in both immunocompetent and neutropenic murine thigh infection models (figure 4).50 this second study also confirmed the need for higher doripenem doses ; a dose providing the human exposure of 2 g every 8 hours infused over 4 hours consistently produced numerically higher bacterial reductions as compared to a standard dose of 500 mg given every 8 hours. this difference in bacterial reductions between the two regimens was statistically different in two of the four tested strains. both studies also noted efficacy with carbapenems despite high mic values and unmet pharmacokinetic / pharmacodynamic target for success (40% ft > mic).49,50 ndm - producing organisms are not the first mbls to demonstrate a mismatch between in vitro and in vivo efficacies. enterobacteriaceae carrying the vim mbl also show in vitro resistance to carbapenems, and yet, meropenem was able to produce a substantial reduction in bacterial density in a neutropenic murine thigh infection model (american society for microbiology, washington, dc, data on file, 2015). taken together, these studies suggest that carbapenems may make valuable contributions to fighting infections caused by ndm - producing organisms, and consideration should be given to utilizing these agents, especially when the organism fails to show susceptibility to other agents. aztreonam is expected to be stable against ndm - producing organisms, but is often not susceptible in vitro due to the presence of other beta - lactamases.9 conversely, the beta - lactamase inhibitor avibactam is protective against most other beta - lactamases, the exception being other mbls.39 activity of the two compounds together has been confirmed both in vitro and in vivo.39 a neutropenic murine thigh infection model utilizing human - simulated exposures of aztreonam alone and in combination with avibactam was performed.51 it showed aztreonam alone had poor activity against the 14 ndm - carrying enterobacteriaceae tested, but the combination had excellent antibacterial activity (figure 5). all the animals in the combination group remained alive, whereas deaths were seen in the aztreonam and the control group. based on these data, the combination of aztreonam and avibactam seems like a viable option for the treatment of infections caused by ndm - producing organisms, particularly when other beta - lactamases may be present. the mismatch between observed and expected efficacy highlighted by these animal studies brings hope that new therapy options may be uncovered from previously abandoned therapies. these data also underscore the need to further explore and identify potential therapies, whether they are in the form of new antimicrobials or old antimicrobials. it also highlights the need to not only properly identify the presence of ndm but also the presence of other beta - lactamases. the current state of evidence demonstrates that in the case of ndm producers, in vitro results do not appear to translate into clinical results as expected. in the absence of larger trials, numerous case reports demonstrated favorable clinical outcomes despite mismatches between antimicrobials and susceptibility results. moreover, carbapenems have unexpectedly demonstrated utility both in animal studies and in the clinical setting, despite in vitro hydrolysis. since most case reports utilize combination therapy with good outcomes, it seems reasonable that combination therapy using sufficient exposure of the selected compound is the preferred strategy against ndm producers. furthermore, available evidence suggests that carbapenems should continue to be included in the armamentarium against such infections. | since the first new delhi metallo - beta - lactamase (ndm) report in 2009, ndm has spread globally causing various types of infections. ndm - positive organisms produce in vitro resistance phenotypes to carbapenems and many other antimicrobials. it is thus surprising that the literature examining clinical experiences with ndm does not report corresponding poor clinical outcomes. there are many instances where good clinical outcomes are described, despite a mismatch between administered antimicrobials and resistant in vitro susceptibilities. available in vitro data for either monotherapy or combination therapy does not provide an explanation for these observations. however, animal studies do begin to shed more light on this phenomenon. they imply that the in vivo expression of ndm may not confer clinical resistance to all cephalosporin and carbapenem antibiotics as predicted by in vitro testing but other resistance mechanisms need to be present to generate a resistant phenotype. as such, previously abandoned therapies, particularly carbapenems and beta - lactamase inhibitor combinations, may retain utility against infections caused by ndm producers. |
a 28-year - old pregnant primigravida in her 36th week of gestation was admitted to the labor suite in an early stage of active labor. the patient was diagnosed with kss at the age of 23 years, which was confirmed by skeletal muscle biopsy. her medical history included pigmentary retinopathy, diabetes mellitus, hypothyroidism, depression, and paroxysmal supraventricular tachycardia. the patient was followed up by the highrisk obstetric clinic, a cardiologist, and an endocrinologist during her pregnancy. on admission, although she was afebrile, her vital signs were as follows : blood pressure (bp) : 145/95 mmhg, pulse rate : 95 - 100 beats / min ; and respiratory rate : 16 - 18 breaths / min. laboratory investigations revealed normal values with the exception of a hemoglobin level of 92 g / l and serum lactate level of 3.2 mmol / l (normal value, 0.5 - 1.6 mmol / l). precautions to manage possible dysrhythmias (such as paroxysmal svt) were taken, including ecg patient monitoring, antiarrhythmic medication preparation, and a standby dc shock defibrillator. the option of epidural analgesia was planned ahead and discussed with the patient, and she agreed. an initial bolus of 15 ml 0.1% ropivacaine with 3 g / ml fentanyl and 2 g / ml epinephrine was given, resulting in a bilateral t5 - 6 sensory level. then epidural analgesia was maintained by infusion of 0.08% ropivacaine with 2 g / ml each of fentanyl and epinephrine at a rate of 10 ml / h with a patient - controlled epidural analgesia bolus dose of 5 ml, 10 min delay time, and maximum of 40 ml / h. oxygen by nasal prongs and iv ringer 's lactate fluid infusion were initiated, and the patient was kept under continuous monitoring of spo2, invasive bp and hr as well as fetal monitoring. four hours after starting the epidural analgesia, the serum lactate was 2.2 mmol / l. due to failure of labor progression, the obstetric team decided to deliver the baby by cesarean section. we opted to use the already - inserted epidural catheter to establish anesthesia for the cesarean section. a total of 15 ml 2% lidocaine with 5 g / ml fentanyl and 2 g / ml epinephrine was administered into the catheter in divided boluses. a dense sensory block up to the t3 - 4 level resulted. cesarean section was performed without complications, and a live baby was delivered with apgar scores of 8 and 9 at 1 and 5 min, respectively, and a cord blood ph of 7.14. two milligrams of preservative - free morphine was given epidurally to provide postoperative pain control. hypothermia was avoided by giving warm iv fluids and providing heat with a forced - air warming blanket. the patient and the baby remained in a stable condition postoperatively and were discharged home on the third postoperative day. all laboratory results, including arterial blood gases and the serum lactate level were normal. kss is a rare mitochondrial myopathy syndrome characterized by the cardinal features of myopathies (especially of the eye muscles), bilateral pigmentary retinopathy, and cardiac conduction abnormalities. in addition to this triad, other body organs may be affected, resulting in cerebellar ataxia, proximal muscle weakness, deafness, diabetes mellitus, growth hormone deficiency, or other endocrinopathies. obstetric anesthetic management in patients with mitochondrial myopathies has been described in few papers in the literature. agents that trigger malignant hyperthermia (mh), such as volatile anesthetics and succinylcholine, have been recommended to be avoided in cases of mitochondrial disorders in some studies. there is one case report of mh in a pediatric patient after exposure to succinylcholine, while another study described a case of successful general anesthesia (ga) for a patient with kss who underwent laparoscopic cholecystectomy ; sevoflurane was used to safely maintain anesthesia. also described a case of exploratory laparotomy under ga in which isoflurane was used, and the patient developed respiratory depression and left bundle - branch block postoperatively. during labor, oxygen consumption increases above its value before pregnancy by 40% in the first stage and 75% in the second stage. the aerobic oxygen requirements of laboring parturient patients surpass oxygen consumption, resulting in a progressive rise in blood lactate. this might be more clinically significant in patients with kss because it will be added to the already - present liability to develop lactic acidosis ; therefore, arterial blood gases must be frequently monitored. instigation of neuraxial analgesia can alleviate these changes during labor by reducing this increase in oxygen consumption by 25%. increased serum lactate levels can occur with or without lactic acidosis. unlike hyperlactatemia, the buffering systems in lactic acidosis are deranged and tissue oxygenation is inadequate. in the present patient, however, epidural analgesia helps to decrease the serum lactate level and possibly the development of acidosis that may occur with increased oxygen requirements in the second stage of labor in liable patients. other benefits of epidural anesthesia include avoidance of ga and hence staying away from muscle relaxants, including succinylcholine, and avoidance of volatile anesthetics that might trigger mh or cause postoperative residual muscle blockade in a person with demonstrated muscle weakness. spinal anesthesia plus intrathecal morphine would have been a suitable alternative to epidural anesthesia for caesarean delivery in our case. an important consideration is to maintain the body temperature and prevent shivering during the perioperative period. in parturient patients with deficiencies of the electron transport chain and increased serum lactate concentrations, it is advised to best manage their labor with elective caesarean delivery using regional anesthesia. obstetric anesthetic management of parturient patients with kss should include a careful assessment of the neurologic, cardiac, muscular, and metabolic status. obstacles to regional anesthesia may include significant cognitive impairment, respiratory muscle weakness, or liver dysfunction affecting the coagulation status. cardiac involvement will require careful preoperative evaluation including cardiology consultation and a baseline ecg and echocardiogram. it is wise to avoid giving succinylcholine because of its possible mh - triggering effect in this group of patients and because of the probable risk of hyperkalemia after its administration. sensitivity to other neuromuscular blocking agents has also been reported ; hence, it is prudent to closely monitor patients for the development of neuromuscular blockade and to use drugs with a shorter duration of action. in addition, a patient may have sensitivity to intravenous (iv) anesthetic agents such as propofol and thiopentone, as has been reported in some studies ; this must be kept in mind to avoid the cardiac depressant effects of these medications. it may also be useful to have external or intravenous pacing capabilities and various vasopressors and antiarrhythmic agents available. the use of nitrous oxide and other inhalational anesthetic agents has been described without complications in patients with kss. careful titration of opioids and sedatives is necessary to prevent respiratory failure that can result from a decreased ventilator drive to hypoxia and hypercarbia. special attention should be paid to postoperative analgesia because it is essential to decrease oxygen consumption and begin early ambulation. iv patient - controlled analgesia with or without a transversus abdominis plane block can be used to control postoperative pain after caesarean section under ga. in summary, kss is a rare myopathy syndrome resulting from mtdna deletions with multisystemic involvement. successful obstetric analgesic and anesthetic management of parturient patients with kss will allow them to benefit from epidural analgesia / anesthesia, which might reduce the metabolic demands associated with the stress and pain of labor. it is also recommended to monitor blood gases and serum lactate levels in these patients and to avoid shivering. | kearns - sayre syndrome (kss) is a rare mitochondrial myopathy that usually develops before 20 years of age. it demonstrates multisystemic involvement with a triad of cardinal features : progressive ophthalmoplegia, pigmentary retinopathy, and cardiac conduction abnormalities. in addition, patients might have cerebellar ataxia, a high content of protein in the cerebrospinal fluid, proximal myopathy, multiple endocrinopathies, and renal tubular acidosis. we herein report the successful obstetric analgesic and anesthetic management of a 28-year - old parturient patient with kss who required labor analgesia and proceeded to deliver by cesarean section. we extrapolate that regional analgesia / anesthesia might be beneficial for reducing the metabolic demands associated with the stress and pain of labor in patients with kss. efficient postoperative analgesia should be provided to decrease oxygen requirements. |
teiser relies on calculating mutual information values between whole - genome measurements and millions of predefined structural motifs. the decoy / scrambled experiments and sirna knock - downs were performed using lipofectamin 2000 reagent (invitrogen). for hybridizations, we used human 444k whole - genome human arrays (agilent). isolation and identification of rna - binding proteins were based on previously published protocols. full methods and any associated references are available in the online version of the paper at www.nature.com/nature. | decoding post - transcriptional regulatory programs in rna is a critical step in the larger goal to develop predictive dynamical models of cellular behavior. despite recent efforts13, the vast landscape of rna regulatory elements remain largely uncharacterized. a longstanding obstacle is the contribution of local rna secondary structure in defining interaction partners in a variety of regulatory contexts, including but not limited to transcript stability3, alternative splicing4 and localization3. there are many documented instances where the presence of a structural regulatory element dictates alternative splicing patterns (e.g. human cardiac troponin t) or affects other aspects of rna biology5. thus, a full characterization of post - transcriptional regulatory programs requires capturing information provided by both local secondary structures and the underlying sequence3,6. we have developed a computational framework based on context - free grammars3,7 and mutual information2 that systematically explores the immense space of small structural elements and reveals motifs that are significantly informative of genome - wide measurements of rna behavior. the application of this framework to genome - wide mammalian mrna stability data revealed eight highly significant elements with substantial structural information, for the strongest of which we showed a major role in global mrna regulation. through biochemistry, mass - spectrometry, and in vivo binding studies, we identified hnrpa2b1 as the key regulator that binds this element and stabilizes a large number of its target genes. ultimately, we created a global post - transcriptional regulatory map based on the identity of the discovered linear and structural cis - regulatory elements, their regulatory interactions and their target pathways. this approach can also be employed to reveal the structural elements that modulate other aspects of rna behavior. |
fungal isolate bvk - sma-2 was obtained from a soil sample collected in buffalo valley, oklahoma. a blast analysis of its its sequence data demonstrated that the isolate was 99% identical to b. ochroleuca. for the purpose of comparing its growth and metabolite profiles using two solid - phase culturing techniques, the b. ochroleuca was inoculated onto cheerios breakfast cereal in (a) 50 1 l erlenmeyer flasks and (b) 3 mycobags (each 53 cm 35 cm). the amounts of cheerios and inoculum introduced into the mycobags and flasks were scaled relative to one another in order to ensure the ratios of inoculum to culturable surface area in the two types of vessels were approximately equivalent. both sets of cultures were incubated at 25 c under identical lighting for 4 weeks. the secondary metabolites from both sets of b. ochroleuca cultures were extracted with etoac for chemical analysis and biological testing. extracts were dissolved in meoh h2o (9:1), and the supernatants were subject to lc - pda - esims analysis. the resulting metabolite profiles for both sets of b. ochroleuca cultures were judged to be similar (figure 1). as an extension of this observation, the secondary metabolite profiles for several other fungi grown under both types of solid - phase culture conditions were also compared (figure s1). in the majority of cases, the fungi exhibited remarkably similar metabolite profiles, indicating that mycobags are a suitable alternative to flask - based fermentation. significantly, the culturable surface area of one mycobag (1855 cm) is equivalent to that of approximately 18 1 l erlenmeyer flasks. considering that mycobags are relatively inexpensive (0.500.60 usd / bag with one hydrophobic gas exchange patch), occupy limited vertical space (mycobags can be incubated in a relatively flattened position), and require no cleaning (mycobags are disposed of after autoclaving), their use for solid - phase fungal cultures presents many advantages. effects of different culture vessels on the secondary metabolome of b. ochroleuca grown on a cheerios - based medium. the b. ochroleuca cultures were grown in 1 l erlenmeyer flasks (a) or mycobags (b). the resulting secondary metabolome profiles (pda detection at 200400 nm) from the flask - derived (c) and mycobag - derived (d) cultures reveal relatively modest changes in their respective metabolite composition. after comparing the b. ochroleuca secondary metabolomes generated under both sets of conditions, the extracts were pooled, and the bioactive compounds were purified using normal - phase, size - exclusion, and reversed - phase chromatography methods to yield four known o - linked glycosylated polyketides, tmc-151s c f (14), and three new metabolites, named bionectriols b d (57). metabolites 14 were identified by comparisons of their ms data, h and c nmr spectra, and optical rotation values to published values. compound 5 was obtained as a colorless, amorphous solid that yielded an adduct ion with m / z 625.3934 [m + na ] under hresims conditions, which was determined to represent the molecular formula c32h58o10na (calcd 625.3928, 0.96 ppm). the h, c, and hsqc nmr data (table 1) suggested the presence of nine methyl, three methylene, six methine, one oxygenated methylene, eight oxygenated methine, and four olefinic carbons. the hmbc spectrum displayed a correlation from h3 - 19 to c-1, indicating the presence of an ester carbonyl carbon that had not been detected in the c spectrum. the other features of the c spectrum of 5 were similar to those for 1, except that the sugar alcohol moiety and one propenyl subunit (equivalent to c-2, c-3, and c-21 in 1) were missing (figure s5). the carbon chemical shifts at c 62.9, 68.5, 72.7, 75.7, 78.3, and 102.6 denoted the presence of a hexopyranose. an hmbc correlation from h-1 to c-11 indicated that the hexopyranose moiety was attached to c-11. additional hmbc correlations that were critical for verifying the planar structure of 5 are illustrated in figure 2. on the basis of 2d roesy correlations between h3 - 20 and h-6, as well as h3 - 22 and h-10 (figure 2), both the c-4c-5 and c-8c-9 olefins were determined to be e - configured. assignments based on h, c, and hsqc nmr (c 100/h 400 mhz) experiments at room temperature. the relative configuration of the glycan moiety was ascertained based on gated decoupling and roesy nmr experiments. in the gated decoupling experiment (figure s6), the coupling constant between the anomeric carbon and hydrogen atoms was determined to be jc-1,h-1 = 154.5 (4(f) ] data. the final difference map had maxima and minima of 0.889 and 0.427 e /, respectively. the intensity data were truncated to 1.05 resolution because data in higher resolution shells all had i/(i) 0.5 but < 4, indifference (no effect) ; and 4, antagonistic effect. colorless, amorphous solid ; uv (meoh) max (log) 206 (4.31) nm ; []d25 + 3 (c 0.24, meoh) ; h and c nmr (see table 1) ; hresims m / z 625.3934 [m + na ] (calcd for c32h58o10na, 625.3928). colorless, amorphous solid ; uv (meoh) max (log) 206 (4.27) nm ; []d25 + 12 (c 0.26, meoh) ; h and c nmr (see table 1) ; hresims m / z 929.5474 [m + na ] (calcd for c46h82o17na, 929.5450). colorless, prism - shaped crystals ; uv (meoh) max (log) 206 (4.29) nm ; []d25 + 7 (c 0.12, meoh) ; h and c nmr (see table 1) ; hresims m / z 723.4667 [m + na ] (calcd for c38h68o11na, 723.4659). nmr spectra were obtained on a varian unity inova spectrometer (400 mhz for h and 100 mhz for c) with a broad band probe at 20 0.5 c using methanol - d4 (cambridge isotope laboratories, inc.) as the solvent. hresims spectra were collected on an agilent 6538 ultra high definition accurate - mass q - tof system. the lc - ms data were acquired on a shimadzu uflc coupled to a quadrupole mass spectrometer using a phenomenex kinetex c18 column (3.0 mm 75 mm, 2.6 m particle size) and mecn h2o (with 0.1% hcooh) gradient (1:9 to 0:10 in 12 min) followed by a 100% mecn wash. column chromatography was conducted using silica gel 60 (4063 m particle size) and sephadex lh-20. tlc silica gel 60 f254 plates from emd chemicals inc. were used for tlc. separations were also carried out using a shimadzu hplc system equipped with lc-6ad solvent delivery pumps coupled to an spd-10av uv vis detector or a waters system equipped with a 1525 binary hplc pump coupled to a 2998 pdad detector. both systems utilized phenomenex c18 columns (21.2 250 mm or 10 250 mm, 5 m particle size) for preparative runs. x - ray diffraction data for compound 7 were collected using a diffractometer with a bruker apex ccd area detector and graphite - monochromated mo k radiation (= 0.710 73). a soil sample was collected from beneath a granite monument on the grounds of one of the author s (j.b.k.) family property in buffalo valley, oklahoma. the sample was processed using the method described by du., and 51 fungal isolates were purified. the large - ribosomal - subunit internal transcribed spacer 1 (its1) region of the rdna gene was sequenced at the laboratory for genomics and bioinformatics, ou health sciences center. sequence data for the isolate (genbank accession km000126) was compared by blast analysis to sequences publicly available through the ncbi database. for the 1 l erlenmeyer flask cultures, an 80 ml volume of cheerios breakfast cereal was added to each flask, and the flasks were autoclaved using a solid - cycle at 121 c for 30 min. after the flasks were cooled to room temperature, a 48 ml aliquot of autoclaved 0.3% sucrose with 0.005% chloramphenicol was pipetted into the flasks to rehydrate the cereal. one 5 mm 5 mm chunk of the fungal isolate grown on an agar plate was added to each flask, and the cultures were incubated for 4 weeks. when mycobags were used as the fermentation vessels, cheerios breakfast cereal was preautoclaved using a solid - cycle at 121 c for 30 min. after cooling, a 500 ml volume of cheerios was added to each bag, the openings of the bags were folded over once, the folds were sealed with clamps, and bags were autoclaved using a liquid - cycle at 121 c for 30 min. eighteen 5 mm 5 mm chunks of fungal culture grown on an agar plate were prepared and mixed with the cereal. the cereal was then rehydrated with 850 ml of an autoclaved solution consisting of 0.3% sucrose with 0.005% chloramphenicol. the bags were placed flat to facilitate the formation of a monolayer of cheerios across the bottom of the bag, and the cultures were incubated for 4 weeks. | one of the challenges presented by candida infections is that many of the isolates encountered in the clinic produce biofilms, which can decrease these pathogens susceptibilities to standard - of - care antibiotic therapies. inhibitors of fungal biofilm formation offer a potential solution to counteracting some of the problems associated with candida infections. a screening campaign utilizing samples from our fungal extract library revealed that a bionectria ochroleuca isolate cultured on cheerios breakfast cereal produced metabolites that blocked the in vitro formation of candida albicans biofilms. a scale - up culture of the fungus was undertaken using mycobags (also known as mushroom bags or spawn bags), which afforded four known [tmc-151s c f (14) ] and three new [bionectriols b d (57) ] polyketide glycosides. all seven metabolites exhibited potent biofilm inhibition against c. albicans sc5314, as well as exerted synergistic antifungal activities in combination with amphotericin b. in this report, we describe the structure determination of the new metabolites, as well as compare the secondary metabolome profiles of fungi grown in flasks and mycobags. these studies demonstrate that mycobags offer a useful alternative to flask - based cultures for the preparative production of fungal secondary metabolites. |
benign deep thoracic wall cyst is uncommon ; however, operative management using an endoscopic approach should be reserved primarily for symptomatic cases with multiple comorbidities, where multiple attempts at aspiration have failed because it is associated with less postoperative pain, lower morbidity and faster recovery [14 ]. a 62-year - old caucasian male presented with swelling and fullness in the left posterior chest. physical examination revealed a morbidly obese white male with a non - tender fluctuant mass on the left side of the upper back. the patient had two motor vehicle accidents that caused a lower right - sided lumbar injury. his past medical history was significant for hypertension, hyperlipidemia, sleep apnea, osteoarthritis, gastroesophageal reflux disease and chronic mild asthma. computed tomography (ct) scan of the chest demonstrated a large cystic mass between the posterior aspect of the thoracic ribs and deep to the muscles of the left back and scapula. chest magnetic resonance imaging delineated a large cystic mass extending from the level of the lower neck to just above the level of the diaphragm measuring 11 cm transversely, 4.5 cm anteroposteriorly and 23 cm craniocaudally (fig. 1). figure 1:(left) chest ct scan shows the large cystic mass (arrow) between the left posterior ribs and muscles of the left back and scapula. (right) chest mri shows the large cystic mass extending from the level of the lower neck to just above the level of the diaphragm. (left) chest ct scan shows the large cystic mass (arrow) between the left posterior ribs and muscles of the left back and scapula. (right) chest mri shows the large cystic mass extending from the level of the lower neck to just above the level of the diaphragm. when the mass returned 2 weeks later, he was referred to our institution for further treatment. due to symptoms referred to the cyst and the lack of response to aspiration the patient underwent general endotracheal anesthesia and was placed in the right lateral decubitus position. a 2.5-cm longitudinal incision was made at a paramedian position on the left mid - back and it was carried through the level of the fascia by cautery. the paraspinous muscle fibers were separated and the bottom of the cyst was bluntly dissected free and the cyst was aspirated of its serous contents. the balloon was inflated to grapefruit size and left inflated for 2 min for hemostasis. the balloon dissector created a larger space beneath the cyst and along its lateral margins. the balloon was then replaced with a hasson trocar, and two additional 5-mm trocars were placed under direct vision to allow access to the co2-filled cavity (fig. 2). using a combination of blunt and electrocautery dissection, the cystic lesion was circumferentially freed from the trapezius muscle and cervical structures. once freed, the cystic mass was removed in its entirety through the hasson trocar site. two 15-french round jp drains were inserted through the 5-mm trocar sites and placed to grenade suction. histologic analysis of the unilocular cyst revealed a primarily fibrous wall with some adipose tissue and associated vasculature. the cyst lacked a true epithelial lining and any malignant features such as hypercellularity, hyperchromasia, cellular pleomorphism or increased mitoses (fig. the final pathologic diagnosis was that of a benign, fibrous - walled cyst. while benign cysts are common within the skin and subcutaneous tissues of the posterior thorax, lesions deep to the muscles are rare. with aspiration of clear fluid devoid of malignant features, cysts such as these should undergo aspiration and, if reaccumulation occurs, repeat aspirations with injection of a sclerosing agent or surgical management are reasonable. with the potential need for repeated aspirations and sclerotherapy, our patient opted for cyst removal. while novel approaches are reported in abdominal wall surgery [1, 3 ], no reports document this technique for deep chest wall surgery. the balloon dissector and endoscopic resection facilitated free dissection of this large chest wall cyst. we have found no published reports of a deep thoracic cyst resembling our patient 's cyst in terms of histology or location. the differential diagnosis is not long, consisting primarily of seroma and secondarily of a synovial or ganglion cyst. these entities do not usually have a true epithelial lining, and they tend to occur in areas of previous trauma or surgery. our patient had undergone previous cervical spine surgery, which conceivably could be the cause of this cystic lesion. however, given its location off the midline, deep - seated nature against the rib cage, and virtually no scarring of the neck near the cyst, we believe that this cyst was unlikely related to the previous operation. other diagnoses to consider include sarcoma (which can be ruled out by absence of malignant features on pathology), epidermal inclusion cyst (unlikely given the large size, location deep to the dermal and subcutaneous region, and lack of squamous epithelial lining with keratinization) and abscess (unlikely given absence of inflammatory cells). given this patient 's cyst, it did not fit well into any of the above categories, our pathologists suggest that it is a benign and fibrous - walled cyst. | we present a 62-year - old male with a recurrent cyst in the left posterior chest. mri demonstrated a fluid - filled cavity measuring 23 cm in length and 11 cm in width. the cyst was aspirated demonstrating clear serous fluid. however, the cyst returned and he was referred to us for further treatment. the cyst was excised through a minimally invasive approach using a combination of blunt and electrocautery dissection. the cystic lesion was circumferentially freed from the trapezius muscle and cervical structures. pathologic examination revealed a benign, fibrous - walled cyst without a true epithelial lining. there are no published reports of a deep thoracic wall cyst resembling this case in terms of histology or location. this patient is free of recurrence 1 year later. |
the health and economic burden of this disease is very large and with an increasing trend. it is estimated that in the western countries, the prevalence of dm would increase 40 - 45% (1). diabetes mellitus type 2 is an established risk factor for development of coronary artery disease (cad) especially in women, and approximately 20% to 30% of the patients undergoing coronary artery bypass graft (cabg) have dm (2 - 4). the prevalence of dm has a rapid growth in india, china, central and south america, africa, and the middle east (5, 6). hyperglycemia is caused by impaired insulin secretion or insulin resistance, while both are known causes of dm type 2 (7). it was noted that an increase in intake of plant sources of fats and proteins in the diet would reduce the risk of cad and dm type 2 (8). several studies demonstrated that increased intake of mono- and poly - unsaturated fatty acids (mufas and pufas) and lower intake of saturated and trans - fatty acids are associated with a lower risk of dm type 2 (9 - 11). replacement of carbohydrates with mufas and pufas in the diet was shown as a known therapeutic strategy for dm type 2 (12). in this regard, daily intake of mufas in diabetic patients can restore high density lipoprotein (hdl)-cholesterol levels and improve blood sugar changes (13). among the foods containing different fatty acid compositions, nuts have received more attention based on epidemiological findings between their regular intake and protective role against cad (14, 15). increase in consumption of nuts was reported to reduce the risk of cad development and mortality caused by cad (16, 17). the risks for progression of dm type 2 and health threatening conditions were reduced by consumption of nuts such as walnut (18). in this regard, because of the lower mortality caused by cad and cancers in the mediterranean population, the mediterranean diet is still considered a favorable choice (19). a diet rich in walnut would have a positive effect on endothelial function and endothelium - dependent vasodilation in dm type 2. these dietary changes consequently would reduce the overall risk for cad (20). according to the reports of the us department of agriculture (usda), 100 g of walnut contains 15.2 g of protein, 65 g of fat, and 6.7 g of fiber. moreover, it contains higher amount of pufa (47%) when compared with other nuts, out of which 38% is n6 pufas (linoleic acid) and 9% is n3 pufas (linolenic acid) (21). considering the potential role of pufas in prevention of dm type 2 and lipid profiles improvement, and absence of studies on control of blood sugar in dm type 2 patients using a diet containing walnut, the current study was carried out to evaluate the effect of walnut oil on blood sugar in dm type 2 patients. this randomized control clinical trial was performed on dm type 2 patients referred to shiraz healthy heart house. all of the 100 males and females with dm type 2 were enrolled using the block randomization sampling method. they were regularly monitored in the shiraz healthy heart house for at least two years. patients were eligible to be included in the study if they had dm type 2 (fbs > 126), were diagnosed at least for two years according to the definition of the american diabetes association (ada), took less than three oral hypoglycemic agents, and were in the age range of 30 to 60 years. patients were excluded if one of the following criteria was met : alcoholism, smoking, any internal organ dysfunction, being on any therapeutic diet or calorie restricted regimen, and oral consumption of glucose lowering herbs during the past three months before beginning of the trial. all the patients received oral hypoglycemic agents and did not have a history of receiving insulin. also, during the past three months before the study, their medications and diet regimen must have been kept unchanged. the patients were randomly assigned to the experimental and control groups (each group with 50 patients) using the block randomization method. the research methodology was explained for the participants before the study and all the participants signed an informed consent as well. moreover, they were assured of the confidentiality of their data and their right to withdraw from the study if they were not willing to continue. all participants were examined by a physician and a nutritionist at the beginning of the study, and afterward on a monthly basis. nutritional recommendations, checking for diet and medication regimen and physical activity were recorded for all patients on a weekly follow - up telephone call program. this study was approved by the ethics committee of shiraz university of medical sciences in advance by ct.p.92.5670 number and was registered in the iranian registry of clinical trials (irct2014022216682n1). before initiation of the experiment, walnut oil used in this trial was prepared according to the first cold press method and was analyzed on a gas chromatography and a flame ionization detector (fid). fatty acid compositions were identified by comparing their relative and absolute retention times to those of authentic standards. the experimental group received walnut (juglans regia l.) oil (15 g / day for three months). all patients received dietetic consultation about a balanced diet and were advised according to their calorie needed for maintaining their weight unchanged. they were also asked to leave their physical activity habits unchanged during the study and take their hypoglycemic medications appropriately. before initiation of the experiment, the systolic blood pressure (sbp) and diastolic blood pressure (dbp) levels were measured by a standard sphygmomanometer (alpk2, japan) and were recorded. blood pressure was measured when the patient had at least 10 minutes rest and did not drink coffee or tea, or did not smoke during the past three hours. between 07:00 and 08:00 am, after at least 12 hours of overnight fasting, a 5-ml blood sample for each patient was collected in clot tubes. measurement of fasting blood sugar (fbs) and hemoglobin a1c (hba1c) values were done using enzymatic assay kits (parsazmoon, iran). at the end of a three - month period, another blood sample was collected to measure the fbs and hba1c levels again by considering the aforementioned procedure. statistical analysis the sample size for this study was determined to be 100 males and females with dm type 2, considering = 5%, power of 80% and also effect size of 40% using n = 2(z1 - /2 + z1 -)/(1-2) formula. the obtained data were analyzed using the spss software (version 16, chicago, il, usa). comparison of pre- and post - test means of the variables was carried out using paired t - test and the mean comparison between the groups was performed by the t - test. this randomized control clinical trial was performed on dm type 2 patients referred to shiraz healthy heart house. all of the 100 males and females with dm type 2 were enrolled using the block randomization sampling method. they were regularly monitored in the shiraz healthy heart house for at least two years. patients were eligible to be included in the study if they had dm type 2 (fbs > 126), were diagnosed at least for two years according to the definition of the american diabetes association (ada), took less than three oral hypoglycemic agents, and were in the age range of 30 to 60 years. patients were excluded if one of the following criteria was met : alcoholism, smoking, any internal organ dysfunction, being on any therapeutic diet or calorie restricted regimen, and oral consumption of glucose lowering herbs during the past three months before beginning of the trial. all the patients received oral hypoglycemic agents and did not have a history of receiving insulin. also, during the past three months before the study, their medications and diet regimen must have been kept unchanged. the patients were randomly assigned to the experimental and control groups (each group with 50 patients) using the block randomization method. the research methodology was explained for the participants before the study and all the participants signed an informed consent as well. moreover, they were assured of the confidentiality of their data and their right to withdraw from the study if they were not willing to continue. all participants were examined by a physician and a nutritionist at the beginning of the study, and afterward on a monthly basis. nutritional recommendations, checking for diet and medication regimen and physical activity were recorded for all patients on a weekly follow - up telephone call program. this study was approved by the ethics committee of shiraz university of medical sciences in advance by ct.p.92.5670 number and was registered in the iranian registry of clinical trials (irct2014022216682n1). before initiation of the experiment, walnut oil used in this trial was prepared according to the first cold press method and was analyzed on a gas chromatography and a flame ionization detector (fid). fatty acid compositions were identified by comparing their relative and absolute retention times to those of authentic standards. the experimental group received walnut (juglans regia l.) oil (15 g / day for three months). all patients received dietetic consultation about a balanced diet and were advised according to their calorie needed for maintaining their weight unchanged. they were also asked to leave their physical activity habits unchanged during the study and take their hypoglycemic medications appropriately. before initiation of the experiment, the systolic blood pressure (sbp) and diastolic blood pressure (dbp) levels were measured by a standard sphygmomanometer (alpk2, japan) and were recorded. blood pressure was measured when the patient had at least 10 minutes rest and did not drink coffee or tea, or did not smoke during the past three hours. anthropometric measurements, such as weight, and height were done using calibrated equipment. between 07:00 and 08:00 am, after at least 12 hours of overnight fasting, a 5-ml blood sample for each patient was collected in clot tubes. measurement of fasting blood sugar (fbs) and hemoglobin a1c (hba1c) values were done using enzymatic assay kits (parsazmoon, iran). at the end of a three - month period, another blood sample was collected to measure the fbs and hba1c levels again by considering the aforementioned procedure. statistical analysis the sample size for this study was determined to be 100 males and females with dm type 2, considering = 5%, power of 80% and also effect size of 40% using n = 2(z1 - /2 + z1 -)/(1-2) formula. the obtained data were analyzed using the spss software (version 16, chicago, il, usa). comparison of pre- and post - test means of the variables was carried out using paired t - test and the mean comparison between the groups was performed by the t - test. this study was conducted on 100 diabetic patients ; 50 in the experiment group and 50 in the control group. consort flow chart of the study population is presented in figure 1. among the participants in the experiment group, two subjects were withdrawn from the study because of gastrointestinal intolerance of the oil and three subjects did not follow their routine diet and were advised for oil consumption and were excluded from the study while the final number of cases in intervention group was 45 (24 females and 21 males). in the control group, one subject was excluded because of changing the advised diet, and four were excluded from the analysis because of loss in the follow - up (23 females and 22 males). the baseline characteristics of the participants in the two groups are presented in table 1. abbreviation : bmi, body mass index ; dbp, diastolic blood pressure ; fbs, fasting blood sugar ; hba1c, hemoglobin a1c ; sbp, systolic blood pressure. the interventions were well tolerated and adherence to the advised diet regimen and walnut oil consumption (15 g / day for three months) was good. according to the obtained results, the two groups were not significantly different in distribution of age, height, weight, body mass index (bmi), sbp, dbp, fbs level, and hba1c (table 1). three months after the beginning of the experiment, a statistically significant decrease was observed in the fbs level of the experimental group by 8.24% 16.77 (p = 0.001) from 158.37 48.16 before the intervention to 137.91 23.24 after the intervention. such finding was not observed for the control group and the fbs level remained relatively unchanged. comparing the two groups after the experiment indicated that the fbs level significantly decreased in the experiment group (p < 0.05). also, the hba1c level was significantly decreased in the experimental group by 7.86% 21.97 (p = 0.005) ; from 7.00 1.08 before intervention to 6.37 1.29 after intervention, but this value did not change significantly in the control group. comparing of the two groups after the intervention indicated that the hba1c level significantly decreased in the experimental group (p < 0.05). the values before and after the experimental variables and within group changes (mean sd), as well as, after treatment values of the variables compared between the groups using analysis of covariance with adjustment of baseline values are shown in table 2. the y column shows the negative or positive change percentage (%) at the end of the intervention and the x row presents different outcomes paired as control and experimental groups. abbreviation : bmi, body mass index ; dbp, diastolic blood pressure ; fbs, fasting blood sugar ; hba1c, hemoglobin a1c ; sbp, systolic blood pressure. data are presented as mean standard deviation, paired sample t test and ancova were used. considering the data shown in table 2 and comparison of the values obtained for each parameter before and after the experiment in each group, it can be suggested that none of the secondary outcomes, including weight, bmi, sbp, and dbp variables changed significantly in both groups. no remarkable adverse events were reported, except for two reports of gastro - intestinal irritation sense. this study was conducted on 100 diabetic patients ; 50 in the experiment group and 50 in the control group. consort flow chart of the study population is presented in figure 1. among the participants in the experiment group, two subjects were withdrawn from the study because of gastrointestinal intolerance of the oil and three subjects did not follow their routine diet and were advised for oil consumption and were excluded from the study while the final number of cases in intervention group was 45 (24 females and 21 males). in the control group, one subject was excluded because of changing the advised diet, and four were excluded from the analysis because of loss in the follow - up (23 females and 22 males). the baseline characteristics of the participants in the two groups are presented in table 1. abbreviation : bmi, body mass index ; dbp, diastolic blood pressure ; fbs, fasting blood sugar ; hba1c, hemoglobin a1c ; sbp, systolic blood pressure. the interventions were well tolerated and adherence to the advised diet regimen and walnut oil consumption (15 g / day for three months) was good. according to the obtained results, the two groups were not significantly different in distribution of age, height, weight, body mass index (bmi), sbp, dbp, fbs level, and hba1c (table 1). three months after the beginning of the experiment, a statistically significant decrease was observed in the fbs level of the experimental group by 8.24% 16.77 (p = 0.001) from 158.37 48.16 before the intervention to 137.91 23.24 after the intervention. such finding was not observed for the control group and the fbs level remained relatively unchanged. comparing the two groups after the experiment indicated that the fbs level significantly decreased in the experiment group (p < 0.05). also, the hba1c level was significantly decreased in the experimental group by 7.86% 21.97 (p = 0.005) ; from 7.00 1.08 before intervention to 6.37 1.29 after intervention, but this value did not change significantly in the control group. comparing of the two groups after the intervention indicated that the hba1c level significantly decreased in the experimental group (p < 0.05). the values before and after the experimental variables and within group changes (mean sd), as well as, after treatment values of the variables compared between the groups using analysis of covariance with adjustment of baseline values are shown in table 2. the y column shows the negative or positive change percentage (%) at the end of the intervention and the x row presents different outcomes paired as control and experimental groups. abbreviation : bmi, body mass index ; dbp, diastolic blood pressure ; fbs, fasting blood sugar ; hba1c, hemoglobin a1c ; sbp, systolic blood pressure. data are presented as mean standard deviation, paired sample t test and ancova were used. considering the data shown in table 2 and comparison of the values obtained for each parameter before and after the experiment in each group, it can be suggested that none of the secondary outcomes, including weight, bmi, sbp, and dbp variables changed significantly in both groups. no remarkable adverse events were reported, except for two reports of gastro - intestinal irritation sense. a relationship between increased risk of atherosclerosis and cad was previously shown (22). the study performed on the role of diet in control of blood sugar in dm type 2 patients emphasized on replacement of conventional fats with oils containing pufas (23). in our study, the effect of consumption of walnut oil, which contains high levels of pufas especially alpha linolenic acid (ala) was investigated on blood sugar control in dm type 2 patients. it was shown that consumption of walnut oil for three months (15 g / daily) could significantly reduce fbs and hba1c levels. however, no obvious changes were observed in the weight, bmi, and blood pressure levels. this is in agreement with the results of some previous studies (20, 21, 24). it has been demonstrated that oils containing pufas could exert their antidiabetic effect by reducing resistance and enhancing sensitivity to insulin via the mechanism of overexpression of glucose transporter glut4 and insulin receptors on the adipocyte membrane and also reducing the inflammatory effect on adipose tissue by reducing the inflammatory markers in this tissue (25). in a study on mice receiving a cis 9, trans 11- conjugated linoleic acid (cla)-enriched diet for six weeks, it was demonstrated that this cla isomer could reduce insulin resistance, and decrease fbs and serum insulin levels by increasing adipose tissue plasma membrane glut4. moreover, this type of cla could reduce inflammation in the adipose tissue by a 50% decrease in the tumor necrosis factor- (tnf-) level. therefore, it was suggested that this cla isomer attenuates insulin resistance by having anti - inflammatory effects on adipose tissue (25). it was reported that diabetes could potentially be associated with increased oxidative stress (26). furthermore, oxidative stress could be associated with activation of stress - sensitive signaling pathways or insulin resistance (27). thus, based on the idea that oxidative stress can act as an activator in initiation and progression of dm type 2, antioxidants have been suggested as a part of dm type 2 treatment (28). moreover, it has been shown that the high level of antioxidants in nuts could be a protective mechanism against oxidative injury (29). it has been noted that walnut has a higher antioxidant capacity when compared with other nuts (30). these antioxidants are possibly of phenolic compounds (31), including hydrolyzed tannins, tocopherol (22), and melatonin ; all of which have a high antioxidant capacity (32). in the study of ansar., the effect of daily consumption of alpha lipoic acid, as an antioxidant, for two months was compared with the placebo in dm type 2 patients. it was observed that in the group, which received alpha lipoic acid, the fbs and insulin resistance homeostasis model assessment (ir - homa) decreased significantly but body weight remained unchanged. in this regard, it was concluded that alpha lipoic acid could be used as an antioxidant in treatment and improvement of glucose homeostasis in patients with diabetes (23). in our study, fbs level significantly decreased in the group, which received walnut oil (p < 0.05), while no significant change was observed in weight, sbp and dbp.. performed on diabetic rats, it was reported that diabetic rats that received walnut oil had a statistically significant decrease in hba1c level, similar to receiving glibenclamide. thus, it was suggested that walnut oil could have antidiabetic effects (33). in a study performed by tapsell., the effects of pufas in walnut oil were evaluated on metabolic parameters of dm patients. they reported that dietary fat changed in dm patients (increase in the pufa / saturated fatty acid ratio) and could effectively decrease fbs, hba1c, and serum insulin levels after six months of the intervention (24). one of the strong points of our study is using nutritional strategy to stabilize physical activity and dietary intake in patients. these strategies were consulting, planning and monitoring the patient s diet during the study. the novelty of our study was to use first cold press oil without any process or extracting. also our study met some limitations such as lack of testing insulin secretion or insulin receptor respond or sensitivity changes, lack of dose - response analysis, low external validity of the study as it is a single center study and energy metabolism rate or indicators. also we recommend further studies considering nutritional intake and parameters information as a confounder and retrieving them for analysis, unlike our study in which we only monitored for any possible changes and did not compare statistically between the groups. in general, the results obtained from our study indicate that changes in dietary oil composition consumed by dm type 2 patients and shifting from fats containing saturated fatty acids to the containing pufas and ala, such as walnut oil, would lead to statistically significant decrease in the blood sugar levels. this eventually improved blood glucose homeostasis and prevented cardiovascular complications of diabetes without changing the weight or blood pressure. in conclusion, consumption of walnut oil (15 g / day for three months) led to statistically significant decrease in fbs and hba1c levels and generally improved blood glucose homeostasis. considering that this nut is a widespread part of the recipe and also use the whole plant instead of the processed product, it is easy and available for everyone. therefore supplementation with walnut can be effective in attenuation or prevention of the symptoms of dm type 2 as well as its main concomitant disorders, such as metabolic syndrome. | backgroundprevalence of diabetes mellitus type 2 (dm) is increasing globally. considering the potential role of poly - unsaturated fatty acids in prevention of dm type 2 and lipid profiles improvement, some studies have been carried out on walnut. however, there are no studies on control of blood sugar in dm type 2 patients using walnut.objectivesthe current study aimed to evaluate the effect of walnut oil on blood sugar in dm type 2 patients.methodsthis randomized control clinical trial was performed on 100 patients with dm type 2. for the experiment group (n = 50), walnut oil (15 g / day for three months) was added to their diet, while the control group (n = 50) did not undergo any interventions. before initiation of the experiment and after the experiment, the systolic and diastolic blood pressure (sbp and dbp) levels, fasting blood sugar (fbs) and hba1c were measured.resultsthe two groups were not significantly different for sbp, dbp, body weight, and body mass index. hba1c level decreased significantly in the experiment group by 7.86% 21.97 (p = 0.005) from 7.00 1.08 before the intervention to 6.37 1.29 after the intervention. also, fbs level decreased significantly by 8.24% 16.77 (p = 0.001) ; from 158.37 48.16 before the intervention to 137.91 23.24 after the intervention in the experimental group. these changes in the control group were not significant.conclusionsconsumption of walnut oil (15 g / day for three months) was shown to improve blood glucose level but, no changes were noted for bodyweight and blood pressure in type two diabetic patients. |
ischemic stroke has many causes, clinical presentations, risk factors, courses, and outcomes. management and prognosis of patients with ischemic stroke is directly related to specific mechanisms of the ischemic stroke. in the acute phase of stroke, the most important predictors of outcome are stroke severity [2, 3 ] and patient age. severe strokes seem to be more frequently caused by cardiac emboli and less frequently by large - artery occlusive mechanisms. functional status prior to stroke onset, presence of comorbid medical conditions [2, 69 ], cognitive impairment, and reduced consciousness at onset may also predict a worse prognosis after stroke, although with weaker evidence. the aim of this study is to estimate the predictors of stroke severity in the acute phase of stroke and to identify the predictors of all - cause long - term mortality subsequent to a first - ever ischemic stroke within a population - based setting. to determine the predictors is of paramount importance for clinicians to identify patients who are at higher risk for more severe strokes and death. the cerebrovascular aosta registry (care) is a population - based registry recording first - ever strokes in all age groups for a geographically defined area, the aosta valley, italy. the overall study design hasbeen published previously [10, 11 ]. no selection of patients was performed with regard to age, stroke severity, or comorbid medical conditions before admission. patients with recurrent stroke, intracerebral or subarachnoid hemorrhage, subdural hematoma, or other causes mimicking stroke (trauma, infection or an intracranial malignant processes) were excluded. hospital care is free, and a very high proportion (92.5%) of stroke patients were admitted to hospital. the aims of this study were to determine the characteristics of patients who initially presented with ischemic stroke, and to identify predictors of stroke severity and long - term (all cause) mortality. we retrieved medical history prior to the index stroke and the chads2 score was calculated for all patients. the following variables were analysed : gender, age (categorized as 2 were found to be statistically significant independent factors of long - term mortality among first - ever stroke ischemic patients. many of the identified predictors of long - term mortality have been already reported in previous studies [3, 5, 18, 2630 ] but hypertension, diabetes, or smoking. hyperglycemia at the time of the index stroke was not associated with a worse outcome. the strength of the present study is due to a community - based design and due to the use of rigorous case ascertainment procedures to enroll all patients with first - ever ischemic stroke. complete case ascertainment allowed precise estimation of the prevalence of the risk factors among our patients. however, the limitations of our study must also be recognized : the aosta valley population is predominantly caucasian, which may limit the possibility to generalize our findings to other ethnic groups, in whom the risk of af and other risk factors may differ ; the use of prestroke mrs is not standardized, because the mrs was designed and validated to measure global clinical function after stroke ; our study did not examine the role and impact of hospital treatment practices, given the observational nature of this investigation. in conclusion, the findings of this study suggest that very old age was a major contributing factor for poor prognosis in ischemic stroke patients. presence of af and cardioembolism were associated with severe stroke and reduced long - term survival. moreover, long - term mortality after ischemic stroke may be accounted for the presence of prestroke dependency, comorbidity, or at least a history of ischemic heart disease. | background. there is scant population - based information regarding predictors of stroke severity and long - term mortality for first - ever ischemic strokes. the aims of this study were to determine the characteristics of patients who initially presented with first - ever ischemic stroke and to identify predictors of severity and long - term mortality. methods. data were collected from the population - based cerebrovascular aosta registry. between 2004 and 2008, 1057 patients with first - ever ischemic stroke were included. variables analysed included comorbidities, sociodemographic factors, prior - to - stroke risk factors, therapy at admission and pathophysiologic and metabolic factors. multivariate logistic regression models, kaplan - meier estimates, and cox proportional hazards model were used to assess predictors. results. predictors of stroke severity at admission were very old age (odds ratio [or ] 2.98, 95% confidence interval [ci ] 1.755.06), female gender (or 1.73, 95% ci 1.212.40), atrial fibrillation (or 2.76, 95% ci 1.724.44), low ejection fraction (or 2.22, ci 95% 1.134.32), and cardioembolism (or 2.0, 95% ci 1.362.93). predictors of long - term mortality were very old age (hazard ratio [hr ] 2.02, 95% ci 1.652.47), prestroke modified rankin scale 35 (hr 1.82 ; 95% ci 1.462.26), charlson index 2 (hr 1.97 ; 95% ci 1.622.42), atrial fibrillation (hr 1.43, 95% ci 1.041.98), and stroke severity (hr 3.54, 95% ci 2.874.36). conclusions. very old age and cardiac embolism risk factors are the independent predictors of stroke severity. moreover, these factors associated with other comorbid medical conditions influence independently long - term mortality after ischemic stroke. |
with rapid and ongoing developments in sample preparation, instrumentation and computational analysis, mass spectrometry - based quantitative proteomics is increasingly emerging as an approach of choice for addressing many aspects of biology. one of the most popular formats of relative quantitative proteomics,(4) stable - isotope labeling by amino acids in cell culture (silac),(5) relies on internal metabolic labeling of cellular proteomes under study. conversely, absolute protein quantitation with stable isotopes depends on the external generation of isotopically labeled standards to accurately determine protein abundance in biological samples. this approach has been used for some time and has promising applications in systems biology and biomarker discovery. however, the popular employment of isotope - labeled peptides as standards, either synthesized chemically(6) or expressed in the form of a concatamer,(7) faces limitations compared to the more recently developed quantitation with full - length labeled proteins.(8) the important advantage of the latter approach, termed absolute silac(9) or psaq (protein standard absolute quantification),(8) is that standards are introduced earlier in the workflow and are subjected to the same fractionation and digestion conditions as the endogenous counterpart, thereby providing more reliable quantitation. until now, a limited number of labeled standards have been produced for specific mass spectrometric measurements, resulting in a single proof - of - principle study with little further use of the material. for single studies, picomole quantities of standard are often sufficient ; however, systems biology and biomarker discovery applications will require large - scale production of stringently quality controlled standards. large - scale labeled protein production fulfills the current trend toward uncoupling the production of standards from the actual experiment by centrally producing labeled proteins and distributin g them for use by the scientific community. a notable example of this trend is the super silac approach,(16) in which libraries of labeled cell lines are centrally prepared and distributed to end - user laboratories. in this context, the widespread uptake of absolute silac depends strongly on how inexpensively and efficiently labeled proteins can be produced. to address this need, we have generated a lysine and arginine auxotrophic form of the popular protein expression strain e. coli bl21 (de3). the strain can be used in conjunction with commonly applied prokaryotic protein expression techniques to express relatively large quantities of proteins labeled 100% with heavy we demonstrate the application of the technology by expressing a c6n4-arginine and c6n2-lysine labeled form of the small ubiquitin - like modifier (sumo-2)(17) and use it to calculate the copy number of sumo-2 in hela cells and two clinical samples. auxotrophic mutants of e. coli bl21 (de3)(18) were constructed by bacteriophage p1 transduction(19) to introduce in - frame deletions in lysa and arga genes from the keio collection of single - gene knockout library.(20) the deleted genes were replaced by a kanamycin resistance gene flanked by two flp recombinase target sites, and the p1 lysates were prepared from lysa and arga mutants retrieved from the keio collection. p1 transduction was then carried out according to standard procedures as described previously(19) to introduce each mutation into the recipient e. coli bl21 (de3). following the selection of the transductants in the presence of kanamycin, the kanamycin resistance cassette was removed by the transient expression of flp recombinase according to the procedure of datsenko and wanner.(21) this the mature form of human sumo-2 was subcloned into a phistev vector and expressed in escherichia coli bl21 (de3) lysa arga cells as an n - terminally his - tagged protein. expression was performed in m9 medium supplemented with 0.2% glucose, 50 g / ml kanamycin, 1 mm mgso4, 50 g / ml c6n4-arginine and 50 g / ml c6n2-lysine (cambridge isotope laboratories, andover, ma). after harvesting, recombinant, isotopically labeled sumo-2 was purified by ni - nta (ni - nitrilotriacetate)-affinity chromatography. after this first purification step, the his - tag was removed by tobacco etch virus (tev) protease in 50 mm tris / hcl ph 8.0, 5 mm -mercaptoethanol and 50 mm nacl and purified further by ni - nta - affinity chromatography and on a gel filtration superdex-75 column (ge healthcare, piscataway, nj). 6his - tev - yfp - sumo-2-fl - ecfp was expressed in e. coli b834 (de3) and purified from bacterial lysates using ni - nta - affinity chromatography and anion - exchange chromatography as described.(22) concentration of 6his - tev - yfp - sumo-2-fl - ecfp was calculated by measuring absorbance of ecfp at 433 nm and of yfp venus(23) at 515 nm. the average of 20 measurements of absorbances was used and determined the concentration based on the beer s law and extinction coefficients for yfp and ecfp (92,200 and 28,750 m cm, respectively).(22) isotopically labeled sumo-2 standard and 6his - tev - yfp - sumo-2-fl - ecfp were mixed, digested with the fasp method, as described below, and analyzed by mass spectrometry. the exact concentration of the labeled sumo-2 standard was calculated from silac ratios based on the fluorescently determined concentration of 6his - tev - yfp - sumo-2-fl - ecfp. semen was collected from healthy normozoospermic (as defined by who (1999) guidelines) donors. research donors were recruited at ninewells hospital, dundee (hfea centre 004) in accordance with the human fertilisation and embryology authority code of practice version 8 under local ethical approval (08/s1402/6) from tayside committee on medical research ethics. sperm cells were isolated using a 2 layer density gradient composed of 40% and 80% puresperm(nidacon int ab, mlndal, sweden) buffered with noncapacitating buffer (ncb) [1.8 mm cacl2, 5.4 mm kcl, 0.8 mm mgso4.7h2o, 116.4 mm nacl, 1.0 mm nah2po4, 5.6 mm d - glucose, 2.7 mm na pyruvate, 41.8 mm na lactate, 25 mm hepes, ph 7.4 ]. semen (maximum of 1 ml) was layered on top of each gradient and centrifuged at 300 g for 20 min in 15 ml conical centrifuge tubes. the 80% fractions were transferred to clean tubes by discarding the seminal fluid and the bulk of the density gradient then retrieving the sperm pellet from the bottom of the tube taking care to avoid contamination. white blood cells were removed using cd45 dynabeads (invitrogen, paisley, scotland) in accordance to the manufacturer s instructions. ten fractions of each cell suspension were mixed with water (to dilute and immobilize) and cells were counted using an improved neubauer hemocytometer (weber scientific international ltd., middlesex, u.k.). studies involving isolation and analysis of human chronic lymphocytic leukemia cells (cll) were approved by the tayside committee on medical research ethics and tayside tissue bank. following informed consent, an enriched population of cll cells was obtained by density gradient centrifugation (ficoll - paquetm plus, 1.077, ge healthcare bio - sciences as, uppsala) from 20 ml of blood. cells were counted with a coulter counter (beckman coulter, hialeah, fl). hela cells were cultured in dmem medium supplemented with 10% fbs and 100 units / ml penicillin and streptomycin. cells were counted using the cellometer auto t4 automatic cell counter (nexcelom bioscience llc, lawrence, ms). cell pellets were lysed in 100 mm tris - hcl (ph 7.5) containing 4% sds and processed by the fasp method.(24) the lysates were sonicated to reduce viscosity and incubated at 95 c for 5 min. following centrifugation for 20 min at 21 000 g, the supernatant was mixed with ua buffer (200 l of 8 m urea in 100 mm tris - hcl, ph 7.5), loaded onto vivacon 500 l ultrafiltration spin columns with nominal cutoff of 30 000 da (sartorius stedim biotech, epsom, u.k.) and centrifuged at 14 000 g for 15 min. the samples were washed with 200 l of ua buffer and centrifuged again to remove sds. the concentrates were diluted with 100 l of ua buffer containing 50 mm iodoacetamide and incubated in darkness for 30 min. after centrifugation the samples were washed three times with 200 l of ua buffer and twice with 100 l of 50 mm nahco3. next, 50 l of 50 mm nahco3 containing 2 g of trypsin (promega, madison, wi) was added to the concentrate and the samples were incubated at room temperature overnight. the resulting digested peptides were eluted by centrifugation followed by two additional elutions with 50 l of 50 mm nahco3 and were evaporated to dryness in a vacuum concentrator system (concentrator plus, eppendorf, hamburg, germany) to remove nahco3. the dried residues were reconstituted in 40 l of buffer a (0.5% acetic acid) and transferred to vials for ms analysis. ms / ms using an ltq - orbitrap velos instrument (thermo fisher scientific, bremen, germany) coupled to an ultimate u3000 (dionex corporation, sunnyvale, ca) via a proxeon nanoelectrospray source (proxeon biosystems, denmark). data were acquired in data - dependent mode : full scan spectra were acquired with a resolution of 60 000 after accumulation of 1 000 000 ions. lock mass option was used to improve the mass accuracy of precursor ions.(25) the 10 most intense ions were fragmented by collision - induced dissociation (cid) with normalized collision energy of 35% and recorded in the linear ion trap (target value of 5000) based on the survey scan and in parallel to the orbitrap detection of ms spectra. raw ms data were processed with maxquant, an integrated suite of software for quantitative proteomics (version 1.1.1.25). enzyme specificity was set to trypsin, allowing for cleavage n - terminal to proline residues and up to two missed cleavages. cysteine carbamidomethylation was considered as a fixed modification, and methionine oxidation and protein n - acetylation were set as variable modifications. ms / ms peak lists generated by maxquant were searched by the andromeda database search engine(27) against the human international protein index (ipi) database (version 3.68).(28) widespread use of absolute silac and its application in biomarker discovery and systems biology, which is the ultimate goal of absolute quantitation, rely on efficient and inexpensive production of protein standards. heavy arginine and lysine are the most frequently used stable isotope - labeled amino acids in silac - based studies ; however, these amino acids are nonessential to commonly available e. coli expression strains. hence, the endogenous production of lysine and arginine in a regular expression strain dramatically compromises the incorporation efficiency.(10) conversely, the use of strains auxotrophic for lysine and arginine, but not optimized for protein expression, leads to nonoptimal expression.(9) cell - free synthesis, an alternative approach that in absence of a dedicated absolute silac - compatible strain has in some cases been used to produce limited amounts of a standard, suffers from higher costs, relatively low levels of protein expression, difficulties in protein purification and occasionally incomplete labeling.(11) to obtain both the full incorporation of silac amino acids and optimal protein yields, the e. coli bl21 (de3) strain(18) was modified to be auxotrophic for lysine and arginine. bl21 (de3) is a widely used e. coli strain for high - level protein expression that employs the t7 rna polymerase - based system, carries additional trnas to overcome the problem of codon bias and is protease compromised to minimize post - translational processing. to abolish the synthesis of lysine and arginine we deleted the diaminopimelate decarboxylase (lysa) and n - acetylglutamate synthase (arga) genes by using the keio collection of mutants,(20) which allows in - frame single - gene deletion of target genes (figure 1a and materials and methods) an advantage of the system is that the same cosmid and resistance marker can be employed to make multiple knockouts due to the elimination of the resistance marker by flp recombinase. therefore, this auxotrophic strain does not have any antibiotic resistance and is amenable to generation of any protein that can be expressed recombinantly. arginine and lysine auxotrophy was confirmed by the absence of growth in the minimal medium without added arginine or lysine (figure 1b). importantly, although in many cases proteins expressed in e. coli are insoluble, whether or not the protein of interest is soluble is inconsequential for this method as insoluble aggregates are easily and completely purified by differential centrifugation and on metal affinity resins in presence of urea. the recently developed fasp digestion(24) allows complete solubilization of proteins under highly denaturing conditions before buffer exchange on the filter and subsequent proteolytic digestion. our strategy for the production of labeled standards and their incorporation into the workflow of quantitative mass spectrometry are outlined in figure 2a. (a) genetic modification of the e. coli bl21 (de3) strain. (b) silac - compatible strain auxotroph for lysine and arginine. growth on m9 minimal agar plates with and without lysine and arginine is shown. experimental workflow. (a) labeled sumo-2 is recombinantly expressed in the e. coli bl21 (de3) strain auxotroph for arginine and lysine and purified by nickel - affinity column chromatography and gel filtration. concentration of heavy sumo-2 was calculated by mass spectrometry using a fluorescently labeled sumo-2 as a reference. isotopically labeled sumo-2 was then spiked in cell extracts to determine the copy number of endogenous sumo-2. (b) purification of the sumo-2 standard labeled with heavy lysine and arginine : lane m, molecular mass marker ; lane 1, total cell lysate from uninduced cells ; lane 2, total bacterial extract from induced cells ; lane 3, supernatant ; lane 4, pellet ; lane 5, flow - through from the ni - nta column ; lane 6, wash ; lane 7, 6his - tev - sumo-2 purified from ni - nta - affinity column ; lane 8, cleavage by tev protease ; lane 9, purified sumo-2. after optimization of growth conditions (see materials and methods), we expressed and purified 30 mg of labeled sumo-2 from 0.5 l of modified medium. considering materials alone, this equates to less than 4 us$ per mg protein by current materials costs. the his6-tag was cleaved away from sumo-2 by tev protease and untagged sumo-2 was further purified by nickel affinity chromatography and gel filtration (figure 2b). crucially, we achieved complete incorporation of isotopically labeled arginine and lysine and observed no arginine to proline conversion (figure 3). this greater than 99.9% incorporation level of isotope - labeled proteins compares favorably with those generated in a regular bl21(de3) strain (i.e., not auxotrophic for arginine and lysine), which was only approximately 70%.(10) incomplete labeling of the standard, especially in case of labeling efficiency below 95%, constitutes a serious problem in the quantitation of low abundance proteins that will be masked by the contaminating light peptides. similarly, metabolic conversion of heavy arginine to heavy proline, reported in certain microrganisms and cell lines(31) but not here (figure 3d), compromises quantitation accuracy by creating multiple peaks for every heavy proline - containing peptide. recombinant isotopically labeled sumo-2 produced in bl21 (de3) lysa arga was digested in solution with trypsin and analyzed by lc ms / ms. the arrows show the isotopic distribution of the heavy peptides and the calculated positions of the light counterparts (b and c) or of the heavy proline - containing peptide (d). incorporation efficiency for both lysine (b) and arginine (c) containing peptides is greater than 99.9%. (d) labeled arginine is not converted to heavy proline in bl21 (de3) lysa arga. the accuracy of quantitation of a protein of interest relies on the knowledge of the concentration of the corresponding standard. the commonly used methods for protein quantitation, such as amino acids analysis and measurement of absorbance at 280 nm,(9) require the standard to be highly purified. otherwise, the presence of contaminating proteins would lead to an overestimation of the concentration of the standard. however, it is often desirable to avoid an extensive purification that is laborious, involves multiples steps and leads to loss of material. here we reasoned that fluorescence spectroscopy combined with quantitative mass spectrometry(11) can be used to determine the concentration of an absolute silac standard even in complex mixtures. contaminating proteins do not absorb light at absorbance wavelengths of fluorescent proteins and are therefore invisible to fluorescence measurements. thus, we adapted a previously developed fluorescence - based strategy(11) to quantify the protein concentration of the labeled sumo-2 standard. first, we purified a recombinant unlabeled yfp - ecfp fusion of sumo-2(22) and calculated its concentration from the absorbance measurements of yfp and ecfp. in the second step, the labeled sumo-2 standard was mixed with yfp - sumo-2-ecfp, digested with trypsin and quantified by mass spectrometry (figure 2a ; materials and methods). the silac ratio between the isotope labeled, nonfluorescent sumo-2 and its fluorescent analogue allows the calculation of the concentration of the absolute silac sumo-2 standard. it is theoretically possible that the accuracy of the fluorescence strategy is compromised by the incorrect folding of fluorophores. although the use of two fluorophores might help to compensate in case the activity of only one fluorescent protein is compromised, the incorrect folding of the whole fusion protein could affect both fluorophores. however, yfp - sumo2-ecfp is completely cleaved by the sumo-2 protease,(22) and as protease cleavage is dependent on the folded structure of sumo, it is likely that the protein is correctly folded and that therefore the two fluorophores are active. because of its important role in both physiological and pathological states, such as cancer,(32) and its nature as a protein modifier, we reasoned that absolute silac would be the ideal technique for the investigation of sumo-2 as a biomarker. several studies have already successfully adapted silac - based proteomics to the investigation of sumoylation dynamics. here we extend the scope of quantitative proteomic analysis of sumoylation to include absolute silac. as a proof of principle, we decided to determine the absolute abundance of sumo-2 in two clinically relevant human samples, namely sperm and cll cells, for which no evidence of sumo-2 modification has been reported so far. notably, this was achieved with no fractionation of the sample and without any targeted proteomics approach. cll cells were isolated from peripheral blood of a patient with chronic lymphocytic leukemia,(35) which is the most common type of adult leukemia and involves uncontrolled proliferation of b - cells, whereas sperm cells(36) were collected from healthy donors. cell lysis was performed under highly denaturing conditions to inactivate proteases and ensure complete solubilization of proteins. one of the main advantages of absolute silac compared to peptide - based absolute quantitation methods is that the standard can be added immediately after lysis and before any further manipulation of the sample, thus minimizing variations in sample preparation between endogenous protein and the standard. a known amount of the heavy sumo standard was spiked into the sample and tryptic digestion was performed on a centrifugal filter unit with nominal cutoff of 30 kda according to the fasp protocol.(24) note that the 30 kda cutoff was determined by the manufacturer with folded rather than denatured proteins(24) and that this filter efficiently retains detergent - denatured sumo-2 (data not shown). following digestion, ms / ms analysis and the ratios were determined by the maxquant data processing software(26) from 4 technical replicates. cll (chronic lymphocytic leukemia) cells had a copy number comparable to hela cells (3.63 0.003 10 and 3.80 0.05 10 molecules per cell, respectively) whereas sperm cells contained significantly fewer copies of sumo-2 (1.11 0.05 10 molecules per cell ; figure 4, table 1). ms spectra of the doubly charged peptide vagqdgsvvqfk from (a) hela, (b) sperm and (c) cll cells. physiochemical properties of sumo conjugated proteins are different among themselves and as compared to unconjugated sumo and the labeled sumo internal standard. thus, no fractionation should be performed at the protein level, as this would compromise the accuracy of quantitation, but rather proteins should be digested with an approach that does not discriminate between different subsets of sumo. here we have employed the fasp approach, which allows complete solubilization of proteins under highly denaturing conditions before subsequent proteolytic digestion. after digestion, peptides with the same sequence derived from the heavy sumo-2 standard have, apart from the higher mass, the same physiochemical properties of those derived from endogenous free and conjugated sumo-2. although in general a fractionation step at the peptide level would not affect the quantitation, it was not necessary in this study as sumo-2 was detectable and quantifiable in unfractionated complex mixtures. the bacterial strain described here allows high - yield and inexpensive production of full - length silac labeled protein standards with complete incorporation of labeled amino acids and no proline to arginine conversion. bl21 (de3) lysa arga could either be employed directly by individual laboratories or one large batch of rigorously quality controlled protein standards could be produced centrally and distributed to final users. low cost production of large amounts of labeled proteins will also make feasible the production of more sophisticated second - generation silac standards, such as the creation of different types of ubiquitin and sumo polymers and phosphorylated proteins by postproduction in vitro reactions. in addition, this system is not limited to the production of proteins, but it can also generate multiple labeled peptides as part of artificial proteins (qconcats). we envisage that our strain will be widely used and that it will dramatically improve the generation of labeled standards for absolute quantitation using mass spectrometry. | quantitative mass spectrometry - based proteomics is a vital tool in modern life science research. in contrast to the popularity of approaches for relative protein quantitation, the widespread use of absolute quantitation has been hampered by inefficient and expensive production of labeled protein standards. to optimize production of isotopically labeled standards, we genetically modified a commonly employed protein expression escherichia coli strain, bl21 (de3), to construct an auxotroph for arginine and lysine. this bacterial strain allows low - cost, high - level expression of fully labeled proteins with no conversion of labeled arginine to proline. in combination with a fluorescence - based quantitation of standards and nontargeted lc ms / ms analysis of unfractionated total cell lysates, this strain was used to determine the copy number of a post - translational modifier, small ubiquitin - like modifier (sumo-2), in hela, human sperm, and chronic lymphocytic leukemia cells. by streamlining and improving the generation of labeled standards, this production system increases the breadth of absolute quantitation by mass spectrometry and will facilitate a far wider uptake of this important technique than previously possible. |
kikuchi - fujimoto disease (kfd) is a benign, self - limited, inflammatory disorder, first reported in japan. this condition is more prevalent among women and typically occurs in the third decade of life. it normally manifests as persistent, isolated cervical adenopathy with a recurrence rate of 3%. the identification of this condition is of high significance, given the risk of misdiagnosis with other disorders such as malignant lymphoma and extensive necrosis. the patient was a 32-year - old female diagnosed with kikuchi - fujimoto disease via neck lymph node biopsy in august 2006 in the city of mashhad, iran. the disease regressed with proper follow - up, although after eight years the patient was readmitted to the hospital with severe weight loss, high fever, and uncommon symptoms of generalized adenopathy in cervical, axillary and inguinal regions. although kfd is an uncommon condition, it should be featured in the list of differential diagnoses of tender lymphadenopathy, especially lymphadenopathy localized to the cervical region. kikuchi - fujimoto disease (kfd), also known as histiocytic necrotising lymphadenitis (hnl), was first reported in japan in 1972. kikuchi and fujimoto simultaneously but independently described the histological and clinical features of this inflammatory disease of lymph nodes and termed it as subacute cervical necrotizing lymphadenitis. this disease occurs in all races, although the majority of cases have been reported among asians (2). the etiology of kfd is unknown, although some believe that viral agents are the main causes of this condition. kfd usually occurs as a persistent, isolated adenopathy and often appears in the neck area. this disease has been reported in different age groups (9 - 40 years old) and is more prevalent among women (3). definite diagnosis of kfd is dependent on the biopsy and histology of lymph nodes (4, 5). this disease usually resolves within 1 - 3 months and recurrence and death are quite rare (6). the patient was a 32-year - old female, a native of sistan and baluchestan province, iran, with complaints of afternoon fever (38c), night sweats, severe weight loss and anorexia. she was referred to the division of infectious diseases at shahid hashemi nejad hospital in mashhad, iran, in august 2006. a month before the admission, she had received three different doses of ceftriaxone and acetaminophen for her high fever ; given her non - responsiveness to the treatment, she was readmitted to the hospital. the patient was previously healthy and newly married, with no prior history of diseases or drug consumption. she was lethargic, though hemodynamically stable according to physical examinations, and her body mass index (bmi) was 17 kg / m at the admission time. the significant observation was a mobile mass (2 1 cm) with soft consistency behind the left sternocleidomastoid in left cervical, axillary and inguinal lymph nodes ; no redness or warmth was reported in the mass. ear, nose, and throat checkups showed normal results and the patient had no complaints of abdominal pain, lower limb pain, or diarrhea. in addition, no facial or body skin rash was reported and other findings were normal. in para - clinical evaluations, the results of chest radiograph, chest ct scan, electrocardiogram and echocardiography were normal. moreover, in pelvic and abdominal ultrasounds, no abnormalities were observed except for the enlargement of the spleen. in the patient s initial blood test, white blood cell (wbc) count of 2000 cells / mm and the presence of 1% atypical lymphocytes with an increase in immature neutrophils (bands), hemoglobin of 11.3 g / dl and a mild thrombocytopenia, as well as high alkaline phosphatase, high c - reactive protein, and an erythrocyte sedimentation rate (esr) of 48 were reported. blood tests and examinations of urine and stool samples were all negative. the results of sputum acid - fast bacilli culture and antinuclear antibody test were negative, as well. similarly, the results of autoimmune screening, as well as toxoplasma and cytomegalovirus tests were negative. macroscopic examination of the lymph node capsule showed a creamy grey - colored mass with soft consistency, homogeneity, and a dimension of 0.5 1 2 cm. in the microscopic study (at low magnification), partial effacement of the lymph node structure and pale patchy infiltrates were reported. at the center of the lesion, an extensive coagulative necrosis composed of cellular debris and free of neutrophilic or eosinophilic infiltrates was observed (figures 1 and 2). finally, the kikuchi s disease was diagnosed based on the findings. considering the improved symptoms of the patient after two weeks of hospitalization, she was discharged from the hospital in good general health and received anti - inflammatory medications. given the improvements in her symptoms, the medications were gradually discontinued and she started to be followed up on a monthly basis. during the 8-year follow - up of the patient, except for the mean sublingual temperature of 37.8c which was reported once or twice a year (continuing for a couple of days), no other significant findings were reported. the patient was in good general health during the follow - up and her examination results were normal. the patient had two healthy pregnancies in 2010 and 2012 and was in a good general condition during her pregnancies and lactation. in august 2014, the patient was referred to the hospital with high fever, night sweats, weight loss and anorexia (bmi = 16 after a one - month delay, painful generalized lymphadenopathy in left cervical, axillary and inguinal lymph nodes with soft consistency and mobility was reported ; however, no redness or warmth was reported in the mass. in the second blood test, neither leukopenia nor high esr was observed. the results of chest radiography as well as those of abdominal and pelvic ultrasounds were normal. considering the patient s unwillingness to undergo repeated biopsy, she underwent a corticosteroid regimen. after three months of using prednisone, the patient s fever subsided and her lymphadenopathy was impalpable. kfd, also known as hnl, is a self - limiting condition, causing lymphadenopathy. this disease is most commonly observed in adults younger than 40 years of age, with a female predominance in previous studies (3). other less commonly reported presentations include leukopenia, atypical lymphocytes on peripheral smear, liver dysfunction, bone marrow involvement, fatigue, hepatosplenomegaly, and skin rash (2). although the disease is characterized by regional lymphadenopathy, few patients show generalized lymphadenopathy. in the present case, there was simultaneous involvement of cervical lymph nodes with axillary and inguinal lymph nodes together with uncommon symptoms including leukopenia, severe weight loss and splenomegaly, indicating a generalized lymphoma which often leads to a misdiagnosis. a definite diagnosis of kfd may be made only via histopathological analysis by open lymph node biopsy (1). there is no specific treatment for kfd, although in severe cases, the use of corticosteroids has been recommended for the prevention of fatal complications (1). the signs and symptoms of kfd usually resolve after several months (1, 2). in a review of cases with kfd by kucukardali. in addition, a low recurrence rate (3 - 4%) has been reported in previous studies (1, 2). patients with recurrent episodes are more likely to present fever, cough, and fatigue, along with frequent extranodal involvement in the initial presentation (7). in comparison with previous studies, her disease was complicated by the return of symptoms eight years after the initial diagnosis, with symptoms such as fever, fatigue, severe weight loss and generalized lymphadenopathy. in the present case, a definite diagnosis of kfd is made by tissue biopsy, particularly whole lymph node biopsy (4, 5). in the present case, the diagnosis of hnl was confirmed according to the results from the pathological slices ; also, there is a chance that more severe cases get included with pathological confirmation, while mild cases get excluded due to follow - up loss. although the etiology of kfd recurrence is unknown, certain viral infections including epstein - barr (eb) virus, parvovirus b19 and human herpesvirus-8 have been hypothesized to be among the triggers for kfd relapse (8). as stephan. indicated, the recurrence of hnl is associated with the persistence of eb virus infections (9). in addition, atarashi., reported a case of recurrent hnl in a human t - lymphotropic virus type i carrier. in the present case, infectious etiologies including eb virus, cytomegalovirus and hiv were all negative (10). it is unknown whether other viral infections were associated with hnl in the present case. as evidence suggests, kfd may be a precursor for systemic lupus erythematosus (sle), as both conditions have concurrent, coexisting patterns in patients (11). cheng., described the clinical manifestations and outcomes of 195 patients diagnosed with hnl. in the mentioned study, a total of 14 out of 96 patients (14.6%) had recurrent hnl and five of them developed autoimmune diseases such as sle (12). it seems that individuals with hnl are more susceptible to sle ; thus, they should be routinely screened for this disorder (2). with the results of the present study, it is important to differentiate kfd from other conditions ; in this case, it can inhibit adverse drug reactions in patients and prevent empirical treatments, especially with antibiotics that impose financial burdens on families. in conclusion, although kfd is an uncommon condition, it should be featured in the list of differential diagnoses of tender lymphadenopathy, especially lymphadenopathy localized to the cervical region. however, although the disease takes a self - limiting clinical course in most cases, we reported a case of kfd with a prolonged relapse of eight years. full recovery with a good response to corticosteroid regimen was achieved after the recurrence ; therefore, considering the recurrence of kfd, long - term follow - up of patients with kfd is necessary. | introduction : kikuchi - fujimoto disease (kfd) is a benign, self - limited, inflammatory disorder, first reported in japan. this condition is more prevalent among women and typically occurs in the third decade of life. it normally manifests as persistent, isolated cervical adenopathy with a recurrence rate of 3%. the identification of this condition is of high significance, given the risk of misdiagnosis with other disorders such as malignant lymphoma and extensive necrosis.case presentation : the patient was a 32-year - old female diagnosed with kikuchi - fujimoto disease via neck lymph node biopsy in august 2006 in the city of mashhad, iran. the disease regressed with proper follow - up, although after eight years the patient was readmitted to the hospital with severe weight loss, high fever, and uncommon symptoms of generalized adenopathy in cervical, axillary and inguinal regions.conclusions:although kfd is an uncommon condition, it should be featured in the list of differential diagnoses of tender lymphadenopathy, especially lymphadenopathy localized to the cervical region. we reported a case of kfd with a prolonged relapse of eight years. full recovery with a good response to corticosteroid regimen was achieved after the recurrence. |
the th1/th2 cell dichotomy and the essential role of the cytokine environment in driving their differentiation are well accepted. interleukin (il)-12, acting via the transcription factors stat4 and t - bet, drives the differentiation of naive cd4 t cells into interferon (ifn)- producing th1 cells, whereas il-4, acting via stat6 and gata3, drives the differentiation of il-4producing th2 cells. th1 cells are responsible for the cell - mediated elimination of intracellular pathogens, whereas eradication of helminthic infestations is dependent on adequate th2 responses. however, the immunopathogenesis of autoimmune disease does not fit quite so neatly into this dichotomy. cd4 t cells can also differentiate into cells that produce the immunosuppressive cytokines il-10 and tgf, so - called th3 cells, and can become adaptive regulatory t cells. studies of experimental autoimmune encephalophalomyelitis and adjuvant - induced arthritis have pointed to the importance of yet another th cell subset, which produces il-17 and is now termed th17 cells. although this population of t cells has been implicated in the exacerbation of autoimmune pathology (13), the role of th17 cells in host defense remains to be elucidated. the subject of two papers in the issue (owyang., p. 843 and fallon., p. 1105) is the th2-like cytokine, il-25, which as a member of the il-17 family is also known as il-17e. structurally, this family of six cytokines (il-17a - f) is thought to form cystine knots and in this respect is related to other better known cytokines such as tgf and platelet - derived growth factor. il-17 (il-17a) was originally reported to be produced mainly by effector and memory cd4 t cell subsets, but has more recently been suggested to be more widely expressed (6, 7). il-17f is located adjacent to il-17 on mouse chromosome 1 (human chromosome 6), and although it seems to be regulated in a similar manner, it may be more widely expressed than il-17. less well studied are il-17b, il-17c, and il-17d, which are thought to be expressed in a variety of nonhematopoeitic tissues, although il-17d is reported to be produced by cd4 t cells (8). five il-17 receptors have been identified, but only the receptors for il-17/il-17f and il-25 have been characterized. the il-17 receptor is structurally distinct from other cytokine receptors, and engagement of the receptor activates map kinases and nf-b. signaling via il-25 is reported to be dependent on the adaptor molecule traf6 (9). with respect to their biological actions, il-17 and il-17f are most intensively studied. these cytokines evoke inflammation largely by inducing the production of chemokines, as well as granulocyte colony - stimulating factor and granulocyte macrophage colony - stimulating factor, with the subsequent recruitment of polymorphonuclear leukocytes. in some settings, however, il-17 or il-17f induced inflammation is dominated by macrophages (10). the induction of matrix metalloproteinase production by epithelial cells may be another important proinflammatory function of il-17 (11). abundant data point to pathogenic roles of il-17 in models of immune - mediated disease and in human autoimmune disorders. less well defined are the beneficial roles of il-17 family cytokines in host defense, although recent data indicate il-17 is important for resistance against klebsiella pneumoniae and mycobacterium tuberculosis (1214). unlike il-17 and il-17f, il-25 is produced by th2 cells and mast cells (15). administration of recombinant il-25 (ril-25) to mice has been shown to evoke an inflammatory response characterized by the overproduction of th2 cytokines, hyperproduction of immunoglobulins iga and ige, overproduction of mucus, epithelial cell hyperplasia, and eosinophilia. furthermore, the observed pathology was dependent on the classical th2 cytokines il-4 and il-13, as shown by the lack of effect of administering ril-25 to mice that lack these cytokines or their cognate receptor. th17 cells are now thought to be a separate lineage of effector th cells, but the optimal recipe to differentiate th17 cells in vitro remains somewhat unclear (10, 1618), and the in vivo requirements for their differentiation have yet to be firmly established. several groups have pointed to the importance of il-23 as a critical ingredient for the generation and/or maintenance of this lineage (10, 13, 1720). it should be kept in mind that because of its structural similarity to il-12 (p35/p40) (2124) il-23 (p19/p40) also has the potential to induce a th1-like response. recently, another group has come up with a different recipe to make th17 cells that involves a milieu of cytokines produced by lipopolysaccharide - activated dendritic cells (namely il-1, il-6, and tnf-) and the presence of tgf (25). these findings not only illustrate that there is overlap in the groups of cytokines that induce different populations of cd4 t cells, but also emphasize that a particular cytokine, in this case tgf, may have both proinflammatory (th17-inducing) and antiinflammatory (th3-inducing) roles, depending on the circumstances. in this issue, two new studies by owyang. (4) and fallon. (5) show that il-25 mice have increased susceptibility to the parasitic helminthes, trichuris muris, and nippostrongylus brasiliensis. both groups found that the antihelminth activity of il-25 depends on its ability to induce the th2-associated cytokines il-4, il-5, and il-13. in the case of t. muris infection, the susceptibility of il-25 mice was associated with impaired il-4 and il-13 production and reduced trichuris - specific igg1 and total ige. in addition, chronically infected il-25 mice had exacerbated pathology, which was characterized by severe inflammation and disruption of intestinal epithelial structure, and was associated with increased production of ifn-, il-17, and total igg2a. thus, in addition to an essential role in driving antihelminth th2 responses, this study implies an antiinflammatory role for il-25 in suppressing th1 and th17 responses. in contrast, fallon. (5) found that il-25 was not absolutely required for the generation of th2 responses in n. brasiliensis infection, but that il-25 was important for the timely resolution of the infection. when il-25 mice were challenged with n. brasiliensis, the polarization of the th2 response, manifested as enhanced il-4, il-5, and il-13 production, was delayed. ifn- antibodies reduced the worm burden and enhanced th2 responses in trichuris - infected il-25 mice, as well as in the naturally susceptible akr mouse strain. thus, il-25 does not appear to be absolutely essential for th2 responses to some helminthes, and may promote host defense by inhibiting expression of type 1 cytokines. which cell types produce il-25 and which cell types respond to it ? using mice that have the reporter lacz knocked into the il-25 locus, owyang. it was constitutively expressed by cd4 and cd8 t cells in the gut but was not expressed in a variety of innate immune cells. these data hint at the possible existence of effector t cells that selectively produce il-25 (a putative th25 lineage), which may play a specific role in mucosal immunity. in their study, fallon. (5) report that the target of il-25 is a nonlymphoid c - kit cell present in the draining lymph node. the finding that the il-25mediated expulsion of n. brasiliensis was t and b cell independent emphasizes the importance of this nonlymphoid population. using mice in which the reporter egfp was knocked into the il-4 locus, fallon. (5) show that nonlymphoid c - kit cells are major producers of il-4 during infection and their appearance in the draining lymph node precedes the expansion of il-4producing cd4 cells. these findings are consistent with previous work using ril-25, which indicated that this cytokine does not have direct effects on differentiating t cells, but rather that its action requires nonlymphoid cells. as all good studies should, these two papers raise more questions than they answer (4, 5). together the findings are of considerable interest because, compared to the seemingly clear cut mechanisms involved in th1 cell differentiation, the factors that drive th2 cell differentiation have been more difficult to understand. both groups convincingly show that il-25 is an important regulator of th2 responses and host defense. whether il-25 is produced by t cells for t cells or by apcs for nonlymphoid effector populations it indisputably serves to enhance il-4 production resulting in amplification of th2-mediated immunity. these reports also indicate that il-25 controls inflammation during helminth infection and dampens counterproductive th1 responses, independent of il-25 's effects on th2 cell differentiation. the duality of il-25 activity mirrors that of the well - known immunosuppressive cytokine tgf, which, as mentioned, induces the polarization of proinflammatory th17 cells (25). the paradigm of th1 and th2 responses is firmly supported by an immense amount of in vitro data but, more importantly, is substantiated in many infectious disease models and some autoimmune disease models. as the papers in this issue exemplify (4, 5), the generation of other t cell subsets in models of host defense is less clear cut (fig. ifn- promotes th1 cell differentiation by inducing t - bet, but inhibits both th17 cell and th2 cell differentiation (26, 27). similarly, il-4, by inducing gata-3, inhibits th17 cell and th1 cell differentiation. thus, it would appear that the generation of th1, th2, and th17 cells is carefully balanced. in contrast to the well - described positive effects of ifn- and il-4 on their respective lineages, no data have been provided indicating that il-17 directly regulates th cell differentiation, either positively or negatively (27, 28). furthermore, will we find that like th1 and th17 cells, il-25secreting cells are really a distinct lineage from th2 cells and subject to different modes of regulation ? to this end, the question of whether the putative th25 cell population expresses lineage - specific transcription factors that determine its cytokine production profile will likely be a focus of future studies. further studies are also needed to understand and define the functional role of th17 and th25 cells as either primary effectors similar to th1 and th2 cells, or sentinel populations that promote or enhance more specific cell - mediated immunity in mucosal tissues. one might envision a scenario in which pleiotropic cytokines such as il-17, tgf, and il-25 not only potentiate early th responses and recruitment of cells to lymph nodes and tissues, but also regulate aberrant inflammatory responses during the resolution of infection. the ability of il-25 to limit th1-induced inflammation might be an example of the latter. how all of this relates to human health and disease is less clear, and with future studies refined concepts of t cell differentiation will come to bear. on pathogen challenge, cd4 t cells will differentiate into either ifn-producing th1 cells or il-4producing th2 effector cells, which directly cross - regulate each other. two new reports now suggest that the il-17 family member il-25possibly produced by a population of t cells in the gut mucosa the target of il-25 may be a nonlymphoid c - kit population, which produces il-4 and in turn enhances th2 cell differentiation by cd4 t cells. in addition, il-25 may have a direct role in inhibiting both th1- and th17-producing cells during helminth infection in order to limit the inflammatory response. the extent to which il-25producing t cells are a distinct th lineage (th25) or if il-25 production is a feature of many th2 cells will need further investigation. in conclusion, this is a very exciting time for t cell biologists. in the age of monarchies, the expression le roi est mort ; vive le roi marked the passing of eras, ushering out one regime while introducing another. the simple notion of a dualistic view of th1/th2 cell differentiation is moribund, but the era of new complexities of immunoregulation promises to provide better understanding of mechanisms of host defense and immune - mediated disease. | in the dark ages of t cell biology, we considered two fates for differentiated cd4 + t cells : t helper (th)1 and th2 cells. now we know that the reality is much more complex and interesting. the newest th cell subset produces the cytokine il-17. new evidence shows that the il-17related cytokine il-25 is essential for th2 responses in two infectious disease models. |
a 61-year - old man came to the hospital complaining of bilateral flank pain. left flank pain began approximately a month earlier, followed by right flank pain 4 days later. the patient also complained of dyspnea on exertion, urinary frequency, and foamy urine. he was diagnosed with hypertension 15 years prior and had taken traditional korean herbal medicines, such as acanthopanax, phellinus, licorice root, and steamed red ginseng. one week before coming to our hospital, he visited a local ophthalmologic clinic for bilateral floater symptoms and was diagnosed with anterior uveitis and treated with systemic and topical steroids. laboratory tests conducted at the hospital showed a blood urea nitrogen of 26 mg / dl (the upper limit of normal), a serum creatinine of 2.3 mg / dl, and an estimated glomerular filtration rate (gfr) of 30.9 ml / min (normal, 80 to 120 ml / min). a kidney biopsy specimen revealed diffuse interstitial infiltration of lymphocytes and eosinophils and mild tubular atrophy with focal fibrosis of the interstitium (fig. systemic administration of prednisolone 1 mg / kg / day was started and slowly tapered ; furosemide and carvedilol were added for blood pressure control. the patient 's visual acuity was 20 / 20 in the right eye and 20 / 25 in the left eye. a slit lamp examination showed a mild degree (1 + to 2 +) of inflammatory cells in the anterior chamber of both eyes ; however, synechia of the iris was not observed. based on these findings, a diagnosis of tinu syndrome was made, and the patient was treated with a topical steroid (pred forte ; allergan, irvine, ca, usa) for anterior uveitis. tinu syndrome is reportedly three times more common in women than in men, with a median age at onset of 15 years (range, 9 to 74 years). although diagnosis of tinu syndrome is uncommon after 61 years of age, we experienced a patient with such a case. generally, renal involvement in tinu is mild ; however, in our patient the grf decreased to well below the normal range. failure to detect the disease earlier may have been the possible cause of the renal impairment. several medications, such as antibiotics and non - steroidal anti - inflammatory drugs, have been reported as a cause of tinu syndrome. using traditional korean medicines for 9 years tinu is an uncommon disease and is primarily a diagnosis by exclusion ; symptoms are associated with both uveitis and interstitial nephritis. general symptoms with tinu include fever (53%), weight loss (47%), general weakness and malaise (44%), and anorexia (28%). ocular effects seen with uveitis are limited to the anterior chamber in approximately 80% of cases ; both eyes are affected in 77% of cases. posterior uveitis can sometimes be seen. in most cases (65%), nephritis precedes uveitis ; however, in 21% of cases, uveitis is present before nephritis, and in 15% the two conditions occur simultaneously. symptoms associated with nephritis are typical of acute interstitial nephritis, such as flank pain, pyuria (mainly sterile), hematuria, and proteinuria (which is less severe than seen with nephrotic syndrome) an association with human leukocyte antigens has been mentioned in some reports, as well as sensitization of common antigens located both in the eye and the kidney as possible pathologic processes of tinu. in addition to hypersensitivity reactions, the causative drug may act as a hapten, inducing cytokine production or vasculitis. another possible etiology is cross reactivity of active transporters that are inhibited by carbonic anhydrase inhibitors in both the renal tubule and ciliary epithelium. eosinophilia, elevated c - reactive protein, elevated erythrocyte sedimentation rate, normocytic normochromic anemia, and abnormal liver function tests are among the possible findings. in addition, anti - neutrophil cytoplasmic antibody, anti - nuclear antibody, and rheumatoid factor may be positive, and complement levels may be decreased. in the present case, all laboratory findings were within the normal range except for kidney function. in the absence of proteinuria and pyuria, detection of beta-2 microglobulin in the urine the degree of proximal or distal tubular dysfunction may not be directly proportional to the decrease in gfr. tubulointerstitial edema and infiltration can be observed in kidney biopsy under a light microscopy, while the glomerulus and blood vessels are relatively normal ; this is consistent with the present case. infiltration with lymphocytes, plasma cells, and histiocytes may be observed, and in 34% of cases, eosinophils. immunofluorescent findings are negative for antibody or complement in 86% of cases ; similarly, no antibodies or complements were detected in our patient. the differential diagnosis of tinu includes sarcoidosis, sjogren 's syndrome, behcet 's disease, wegener 's granulomatosis, systemic lupus erythematosis, hyperthyroidism, primary hyperparathyroidism, and infectious diseases (e.g., tuberculosis, brucellosis, toxoplasmosis, and herpes). tinu is often not recognized and affected patients often fail to seek medical care, making the prevalence of the disease appear less than in actuality. topical steroids are commonly recommended as the treatment of choice of anterior uveitis. during the initial attack, topical steroids are usually sufficient to control the inflammation. based on published case reports, ocular symptoms resolved in 3 months in 44% of cases while symptoms persisted for more than 3 months in 14% of cases if the inflammation is not controlled with steroids or if steroid use is contraindicated or not tolerated, immunosuppressive agents such as azathioprine or methotrexate may be considered. a diagnosis of tinu should be considered in patients with idiopathic uveitis presenting with renal disease even in elderly patients. as tinu is diagnosed by exclusion, a kidney biopsy and a thorough ophthalmologic examination are needed. once the diagnosis of tinu is made, immediate steroid therapy is necessary together with a collaborative approach to treatment by an internist and an ophthalmologist. | tubulointerstitial nephritis and uveitis (tinu) syndrome is a rare disease entity usually occurring in children. in the present study a case of tinu syndrome in an elderly patient is described and relevant literature is reviewed. a 61-year - old man presented with bilateral flank pain, urinary frequency, and foamy urine. a kidney ultrasonography revealed an increase in kidney parenchyma echogenicity. following a kidney biopsy, the patient was diagnosed with acute tubulointerstitial nephritis. an ophthalmology examination initially performed for floater symptoms, revealed anterior uveitis in both eyes. acute tubulointerstitial nephritis and anterior uveitis in both eyes responded to treatment with oral prednisolone, furosemide, carvedilol, and a topical steroid. tinu syndrome can occur in the elderly and should be part of the differential diagnosis when seeing a patient who has uveitis in association with renal disease ; any therapy should be managed by both an internist and an ophthalmologist. |
organochloride insecticides are chlorinated cyclic hydrocarbons with molecular weights in the range of 300 - 550 da. they have a long half - life in the human body, and cause moderate toxicity. one of such insecticides is endosulfan (6,7,8,9,10 - 10 hexachloro 1,5,5a,,6,9,9a - hexahydro-6-methano-2,4,3-hexadithioxanthiepin 3-oxide), which has been widely used in agriculture since 1960. the uncontrolled use of these compounds in developing countries has resulted in the deaths of animals and humans. there are isolated case reports of accidental and suicidal poisoning with endosulfan in the literature. acute poisoning is usually accompanied with nausea, vomiting, parenthesis, giddiness, convulsion, coma and respiratory failure. hepatic, renal and myocardial toxicity, agranulocytosis, aplastic anemia and skin reaction have been reported. if severe metabolic acidosis is present, hemodialysis may be an important intervention and should be performed early. till date, there is no case report from india for the management of endosulfan poisoning with severe metabolic acidosis and hypotension. by reporting this case, we emphasize the role of continuous renal replacement therapy (crrt) as a rescue therapy for endosulfan poisoning with severe metabolic acidosis and hemodynamic instability, even though it is a non dialyzable poison. a 32-year - old male was brought to casualty department on 13 of march 2009 with history of oral ingestion of a poison along with nausea, vomiting and three episodes of generalized tonic - clonic seizures with hypotension. on examination, the patient had progressive worsening of blood pressure and blood gas analysis was suggestive of high anion gap severe metabolic acidosis [table 1 ]. arterial blood gas and other investigations of patient in view of high anion gap, metabolic acidosis with history of poisoning possibility of ethylene glycol poisoning was considered. he was treated with crystalloids, sodium bicarbonate and loaded with antiepileptic drug phenytoin 20 mg / kg. later midzolam infusion was started with rate of 5 mg / kg / h for repeated seizures.vasopressors were added as mean arterial pressure (map) was not responsive to fluid therapy. in view of repeated episodes of seizures, antiepileptic drugs were stepped up and the patient was started on infusion of thiopentone sodium with rate of 5 mg / kg / h. thiopentone sodium was continued for four days and then tapered. in view of worsening of general condition and severe refractory metabolic acidosis, a decision to start continuous venovenous hemodiafilteraion (a form of crrt) was taken. after starting of crrt, there was a slow but steady improvement in metabolic acidosis. within 3 - 4 h, blood pressure improved and hco increased to16 meq / l [table 1 ]. initial serum creatinine was 1.8 mg / dl and the patient was having good urine output of around 2000 ml / day. his cpk - total, cpk - mb and liver enzymes were high on first day which gradually improved [table 1 ]. after two days, his serum ph and bicarbonate normalized [table 1 ] with no fresh episode of seizures. hence one session of potassium free conventional hemodialysis was given and the next day one more session of crrt was given for 48 h. hyperkalemia and sensorium improved and the patient was extubated on 26/3/2009. on reevaluation of history from the patient and recovery of container by relatives, it was found to be endosulfan poisoning. there was gradual withdrawal of the antiepileptic and the patient was discharged in stable condition. the predominant toxicological effect is over stimulation of the cns, by inhibiting ca- and mg - atpase and antagonizing chloride ion transport in gamma - aminobutyric acid (gaba) receptors with little or no peripheral component. characteristic clinical signs following acute exposure are indicative of include seizures, nausea, vomiting, abdominal discomfort, hyperesthesia of the mouth and face, tongue and extremities, headaches, agitation, hyperactivity, in coordination, confusion, dizziness, and myoclonus. endosulfan is also toxic to the liver, kidney and lung, and can cause rhabdomyolysis in higher doses. his cpk enzyme was high and during later period of hospital course potassium was also high even with good urine output. the toxic effects generally seem to be completely reversible ; hence, it is necessary to identify the poison and to resuscitate the patient. a clinical diagnosis depends on a detailed history and suspicion and it may be necessary to measure concentrations of endosulfan for legal purposes. however, it has been reported that hemoperfusion is ineffective. phenytoin is probably less effective in these cases, given the effect of endosulfan on gaba receptors. in our patient, seizures were refractory to benzodiazepine, but controlled with infusion of thiopentone sodium. yavuz., reported two cases of unintentional exposure to endosulfan, one of which presented with neurological manifestations, liver toxicity, and required mechanical ventilation and emergent hemodialysis ; the other had only neurological manifestations and liver toxicity. in literature, endosulfan poisoning with severe metabolic acidosis and hypotension has not been reported. in our case, the patient presented with severe high anion gap metabolic acidosis that responded well to crrt. in this case, predominant symptoms due to endosulfan poisoning were due to the involvement of the cns and severe metabolic acidosis. endosulfan poisoning should be suspected in unknown poisoning in the presence of primary cns manifestations, with or without clinical or laboratory evidence of other organ dysfunctions such as liver failure and high anion gap metabolic acidosis in tropical countries like india. | organochloride insecticides are chlorinated cyclic hydrocarbons. one of such insecticides is endosulfan (6,7,8,9,10 - 10 hexachloro 1,5,5a,6,9,9a - hexahydro-6-methano-2,4,3-hexadithioxanthiep in 3-oxide) and it has been widely used in agriculture since 1960. the uncontrolled use of these compounds in developing countries has resulted in the deaths of animals and humans. characteristic clinical signs following acute exposure are indicative of cns disturbances or overstimulation. mortality and morbidity rates are high and there is no specific antidote. we present an uncommon presentation of endosulfan poisoning in a 32-year - old male with high anion gap severe refractory metabolic acidosis. the patient was treated with continuous renal replacement therapy and was salvaged. till date, there is no case report from india for endosulfan poisoning with severe metabolic acidosis and hypotension. through this case report, we emphasize the role of continuous renal replacement therapy as a rescue therapy for endosulfan poisoning with severe refractory metabolic acidosis and hypotension, even though it is a non dialyzable poison. |
treatment of differentiated thyroid cancer (dtc) is usually a dual step procedure which consists of thyroidectomy and radioactive iodine treatment. the other purposes are evaluating the disease regression by measuring the level of serum thyroglobulin and imaging of physiologic and pathologic radioiodine uptakes with gamma camera. the first and the most important consideration is its side effects which can occur immediately, few days or even months after the treatment, such as nausea, fatigue, metallic taste in the mouth, dry mouth, swollen salivary glands, bone marrow suppression, fertility problems, and even secondary cancers. because the most absorption of i is in thyroid tissue, it destroys the remaining thyroid cells by particles. besides of destroying the cancer cells, i can also enters to the other body organs such as salivary glands and affect them by its radiation, so some methods should be applied to extract the radioiodine from other body organs immediately after the administration to reduce its side effects. the second issue is that after radioiodine administration patients will be a mobile source of radiation and thus radiation safety after radioiodine therapy is important for patients, their families, and the public. due to the excretion of radioiodine, not only the patient 's body but also their body fluids such as urine, saliva and sweat are radioactive. according to the nrc guidelines, patients must be quarantined until their retained activity reduces to 0.05 represented the normal distribution. to have a better comparison, independent t - test were used. to assess the effect of each exercise periods, the average differences between the measurements which were performed before and after each exercise were calculated in the intervention group and compared with together. to evaluate the overall impact, the average differences between the first measurements and the last measurements (in the intervention group before the first exercise and after the last exercise and taking a shower) the calculated p value which can assess the effect of each exercise process was < 0.05. it was revealed that there was a significant difference between mean values before and after each exercise time. table 2 and figure 1 represent the average differences between the measurements which were performed before and after each exercise in the intervention group. table 3 and figure 2 demonstrate the average differences between the first and the last measurements in both groups. the calculated p value which evaluates the overall impact was 0.939 which revealed that there was no significant difference between total ambient equivalent dose reductions of both groups. mean differences before and after each exercise period in intervention group average differences between the measurements which were performed before and after each exercise in intervention group mean differences between the first and the last measurements in both groups (in the intervention group before the first and after the last exercise) mean differences between the first measurements and the last measurements there is no doubt that radionuclides can produce many hazards, particularly when high doses are administrated to the patients (e.g., radioiodine therapy). for this reason, the radiation dose should be reduced quickly to a reasonable level to decrease the radiation - induced side effects such as secondary malignancies. one of the methods which can be helpful in dose reduction is decreasing the biological half - life of radionuclide by increasing the excretion rate., we tried to present and evaluate a solution to shorten the dose reduction time in the patients who had undergone radioiodine therapy. as perspiration is one of the methods in which i can be excreted from the body, exercise which stimulates sweating was used immediately after radionuclide administration to decrease the radiation dose. according to table 2 and figure 1, there was a significant difference between mean values of ambient equivalent dose reduction before and after each exercise time which means exercise can reduce the dose due to perspiration in each patient, but considering table 3 and figure 2 in general, there was no significant difference between intervention and control group in dose reduction which can be due to patient 's physiological characteristics (the amount of perspiration, urination and the other factors which affect the biological half - life of i), amount of thyroid remnant tissue etc. patients with different amount of remnant thyroid tissue have different radioiodine absorption in their thyroid, which is in direct relationship with the measured value of the ambient equivalent dose. there are also some other factors which may affect the amount of perspiration and consequently the result of the study, such as age, sex and also the exercise habits. the results showed that there was a significant dose reduction after each exercise period in the intervention group, but the overall results revealed that there was no significant reduction in ambient equivalent dose values between the two groups. it should be noticed that although the intervention group had an increased demand for hydration due to sweating subsequent exercise, the liquid intake was definite (equal according to the estimated amount for each gender), thus they had a lower urinary output. consequently, we may be able to conclude that the nonsignificant result is due to lower urinary output in the intervention group. hence, we may conclude that sweating is an effective alternative way for radioiodine excretion. this could be an important consideration in patients which over - hydration is intolerable especially those with cardiac, liver, or renal problems. on the other hand, if sweating is accompanied with well hydrated status they may have synergism effect to shorten quarantine period. for future studies it is recommended to consider the effect of harder exercise programs, age, sex, physiological characteristics, the amount of the thyroid remnant tissue and other physiologic and pathologic iodine uptakes. according to the study it may conclude that sweating is an effective alternative way for radioiodine excretion, and if sweating is accompanied with the well hydrated status, they may have synergism effect to shorten quarantine period. this could be an important consideration in patients which over - hydration is intolerable especially those with cardiac, liver, or renal problems. | background : radioiodine therapy is used for the treatment of patients with differentiated thyroid cancer (dtc) who undergo total thyroidectomy. after radioiodine administration, regulations require to quarantine these patients until their retained activity reduces to <33 mci. some of the injected radioiodine is excreted by perspiration which helps dose reduction so that performing the activities which stimulate sweating such as exercise may shorten the time of dose reduction. to the best of our knowledge, this is the first study in the literature that has evaluated the impact of specific exercise program on the ambient equivalent dose of 131i gamma rays.materials and methods : patients with dtc without metastasis who had undergone total thyroidectomy and were treated with radioiodine were included in this study. 30 patients were chosen among patients who were able to exercise, did not have renal failure, and did not use diuretics. patients were divided into two control and intervention groups. intervention group members walked on treadmills under a specific program, in 3 time intervals. the control group did not have any specific activity. immediately after each exercise process, both groups took a shower, and their doses were measured by a survey dosimeter.results:it was revealed that there was a significant difference between mean values before and after each exercise time. the calculated p value which evaluates the overall impact was 0.939 which revealed that there was no significant difference between total ambient equivalent dose reductions of both groups.conclusion:according to the study, it may conclude that sweating is an effective alternative way for radioiodine excretion, and if sweating is accompanied with well - hydrated status they may have synergism effect to shorten quarantine period. this could be an important consideration in patients which over - hydration is intolerable especially those with cardiac, liver, or renal problems. |
the nature of one- and two - photon stimulated transition processes in organic molecules is a subject of both scientific and technological interest due to a number of nonlinear optical properties, such as two - photon induced fluorescence (2pf), nonlinear transmittance, two - photon absorption (2pa) processes, and light amplification of stimulated emission (lasing). several different types of stimulated transitions play important roles in the mechanisms of electric fieldmolecular structure interactions and should be considered in a broad variety of nonlinear optical measurements. for example, possible effects of saturation and stimulated emission(12) should be taken into account in the determination of 2pa cross sections by the 2pf method when sufficiently large pulse energies are used and the excitation wavelength overlaps with the fluorescence spectrum of the fluorophore. in the case of 2pa cross section measurements by the open - aperture z - scan method,(13) possible excited - state absorption (esa) and stimulated one - photon emission also need to be analyzed, as they can make significant contributions to the observed data.(14) excited - state dynamics and stimulated transitions that occur in organic molecules can be studied by fluorescence - quenching methodology, as described previously by lakowicz and co - workers. this methodology allows modification of the molecular orientational distribution in the excited states and creates anisotropic molecular ensembles with specific fluorescence properties.(17) as an example, the fluorescence anisotropy properties of 4-dimethylamino-4-cyanostilbene and tetraphenylbutadiene in the presence of stimulated light quenching have been described. in some cases, a noticeable deviation from a quadratic dependence of fluorescence emission on excitation power was observed. quite significantly, the use of stimulated emission transitions has provided a means to overcome the diffraction limit in fluorescence microscopy, resulting in the development of high resolution (60-nm) stimulated emission depletion (sted) microscopy. herein, the nature of one- and two - photon stimulated emission transitions for a new sulfonyl - containing fluorene, 2,7-bis(4-(phenylsulfonyl)styryl)-9,9-didecyl-9h - fluorene (1, figure 1a), is investigated in toluene and tetrahydrofuran (thf) at room temperature by a fluorescence quenching methodology based on different fluorescence excitation conditions. one - photon fluorescence excitation followed by one- or two - photon quenching was performed using a picosecond pumpprobe technique and two laser beams at different wavelengths. two - photon induced fluorescence along with concurrent one - photon quenching was detected using a single picosecond laser beam. fluorene 1 is a particularly attractive molecule for such a study because it is a highly fluorescent, photochemically stable compound that exhibits efficient one- and two - photon stimulated transitions. (a) normalized absorption (1, 2) and emission (1, 2) spectra of 1 in toluene (1, 1) and thf (2, 2). (bd) electronic molecular model of 1 and corresponding stimulated transitions : (b) one - photon excitation (pump) laser beam at 355 nm, followed by delayed one - photon quenching laser beam at 532 nm ; (c) one - photon excitation (355 nm) and delayed two - photon quenching (1064 nm) ; (d) two - photon excitation and simultaneous one - photon quenching by a single laser beam at 532 nm. precursors 2, 3, 5, and 6 were prepared according to the literature.(26) compound 4 was obtained from the oxidation of 3, using a modified literature procedure.(27) hornerwadsworthemmons coupling was performed as described below, affording 1 in 38% yield. the synthesis of (4-(bromomethyl)phenyl)(phenyl) sulfone (4) was performed according to a modified procedure from hsiao.(27) hydrogen peroxide (30%, 0.100 g, 0.80 mmol) was added to a solution of (4-(bromomethyl)phenyl)(phenyl) sulfide (3, 0.141 g, 0.51 mmol) in glacial acetic acid (0.200 g). the mixture was mildly heated until the exothermic reaction was initiated, and an additional 0.100 g of 30% hydrogen peroxide was added. the mixture was then taken to 100 c and monitored by thin layer chromatography (tlc) every 15 min. upon completion of the reaction (2 h), the mixture was cooled to room temperature, and the acetic acid was evaporated in vacuo. the crude product was dissolved in et2o, washed twice with saturated nahco3 (aqueous), washed twice with saturated nacl (aqueous), dried over anhydrous mgso4, and filtered. after concentration of the filtrate in vacuo, the resulting product was recrystallized (1:1 acetone / water) to obtain 0.155 g (98%) of a colorless solid ; mp 135136 c (lit. 132 c).(28)h nmr (300 mhz, cdcl3) : 7.94 (m, 4h, ar h), 4.45 (s, 2h, ch2).c nmr (75 mhz, cdcl3) 143.3 (c), 141.6 (c), 141.4 (c), 133.6 (ch), 130.1 (ch), 129.6 (ch), 128.4 (ch), 127.9 (ch), 31.8 (ch2). in a two - neck, 250-ml round - bottom flask, 0.245 g (0.79 mmol) of (4-(bromomethyl)phenyl)(phenyl) sulfone (4) the mixture was taken to reflux and monitored by tlc until complete conversion of the starting material was observed (5 h). unreacted p(oet)3 was evaporated by vacuum distillation, affording a viscous, pale yellow oil that was used for the hornerwadsworthemmons reaction without further purification. the phosphonate was dissolved in 10 ml of dry dimethylformamide (dmf), and 0.228 g of nah was added portionwise to the solution. the mixture was stirred at room temperature for 1 h. a solution of 2,7-diformylflourene, 6, (0.198 g, 0.39 mmol) in 5 ml of dry dmf was added dropwise to the solution, which was then monitored by tlc until no 6 was observed (24 h). once the reaction had reached completion, the solution was added dropwise to 150 ml of ice - chilled water. the resulting yellow oil was extracted with ch2cl2 (twice), washed (three times) with water, and dried over mgso4. the crude product was purified by column chromatography on silica gel (under n2) using a 1:1 mixture of ethyl acetate / hexane as the eluent. a yellow solid was obtained (0.142 g, 38% yield for two steps) ; mp 150.9151.5 c. h nmr (300 mhz, cdcl3) : 7.96 (m, 8h), 7.63 (m, 16h), 7.28 (d, 2h), 7.12 (d, 16.5 hz, 2h), 1.99 (m, 4h), 1.10 (m, 28h), 0.77 (t, 0.6.3 hz, 6h), 0.63 (m, 0.4h). c nmr (75 mhz, cdcl3) : 151.5 (c), 142.3 (c), 141.5 (c), 139.4 (c), 135.3 (c), 132.9 (c), 132.8 (ch), 131.2 (ch), 129.1 (ch), 128.0 (ch), 127.3 (ch), 126.7 (c), 126.7 (ch), 121.0 (c), 120.2 (c). 108.1 (c), 55.0 (c), 31.8 (c), 29.9 (c), 29.5 (c), 29.2 (c), 23.7 (c), 22.6 (c), 14.0 (c). hrms for (c61h70o4s2) : theoretical [m + h ], 931.4788 ; [m + nh4 ], 948.5054 ; [m + na ], 953.4608. found : [m + h ], 931.4769 ; [m + nh4 ], 948.5057 ; [m + na ], 953.4604. the absorption spectra were obtained with an agilent 8453 uvvisible spectrophotometer in 10-mm - path - length quartz cuvettes for concentrations, c, of (12) 10 m. the steady - state fluorescence spectra were recorded with a pti quantamaster spectrofluorimeter in 10-mm spectrofluorometric quartz cuvettes for dilute solutions (c 10 m). all spectra were corrected for the spectral responsivity of the pti detection system. the fluorescence quantum yields of 1 were determined relative to 9,10-diphenylanthracene in cyclohexane (= 0.95).(29) fluorescence lifetimes were measured with a picoharp300 time - correlated single - photon - counting system and 76 mhz femtosecond excitation (mira 900, coherent). optical stimulated transitions in 1 were investigated using a picosecond nd : yag laser (pl 2143 b ekspla) operating with exit wavelengths of 1064 nm (base), 532 nm (second harmonic), and 355 nm (third harmonic) ; a pulse duration of 21 ps (hw1/em) ; nearly gaussian time and space pulse intensity distributions ; and a 10 hz repetition rate. two separate laser beams were used (pumpprobe method(25)) for one - photon excitation and one- or two - photon induced quenching. excitation laser pulses at p = 355 nm with ep 12 j were focused into a 1-mm quartz cuvette (concentration c 5 10 m) with a waist of radius r0 0.15 mm. this fluorescence was partially quenched by another laser pulse at q = 532 nm (one - photon quenching, ep 50 j), propagating in the same direction, fully overlapped in space with the excitation volume and delayed for d 80 ps relative to the excitation pulse. the amount of spontaneously emitted fluorescence photons during delay time d was negligible given the condition d f. after the quenching pulse, the energy of the rest of the collected fluorescence photons was measured with a silicon photodetector. for two - photon induced quenching, the laser beam at q = 1064 nm (ep 200 j) was used at the same excitation conditions as for one - photon quenching : p = 355 nm, ep 12 j, r0 0.15 mm, d 80 ps, and full spatial overlap. experimental setup : (1) picosecond laser, (2) beam splitters, (3) polarizers, (4) wave plate /2, (5) 100% reflection mirror, (6) neutral density filters, (7) calibrated silicon photodetectors, (8) time delay line, (9) focusing lens (25 cm), (10) 1- or 10-mm quartz cuvettes with investigated solutions, (11) optical collection system, (12) set of neutral and interferometric filters, (13) fiber - optic spectrometer. optical elements 3 and 4 were used for ease of changing the pulse energies for the wavelengths used. a single laser beam at p = 532 nm was used in the case of two - photon excitation and simultaneous one - photon induced quenching of the fluorescence emission of 1. according to figure 1a, the wavelength p = 532 nm is within the fluorescence emission spectral range of 1 and the losses of pulse energy ep, determined by the ground - state one - photon absorption, are negligible. in this case, the laser beam with ep 200 j was focused in a 10-mm quartz cuvette (concentration c 3 10 m) to a waist of radius r0 0.3 mm. it should be mentioned that, in all measurements, the polarization of the laser beams was vertical, and the quality of the filtered scattered excitation and quenching light was controlled by a fiber - optic spectrometer usb2000 (ocean optics inc.). the linear absorption and steady - state fluorescence spectra of 1 in toluene and thf at room temperature are presented in figure 1a. the absorption spectra were nearly independent of solvent properties, whereas the fluorescence spectra exhibited a slight solvatochromic dependence. fluorene 1 has nearly identical extinction coefficients (molar absorptivity) in toluene and thf [absmax (9295) 10 m cm ] and a single exponential fluorescence decay with lifetimes of f 0.85 ns (toluene) and f 0.74 ns (thf). the fluorescence quantum yields of 1 were 1 and independent of the excitation wavelength in all solvents, as shown in figure 3a. a comprehensive analysis of the linear spectral properties of 1, including excitation anisotropy spectra, is reported separately.(30) (a) spectral dependence of the fluorescence quantum yield (1) and normalized absorption spectrum of 1 in toluene. (c, d) dependences 1 if / if0 = f(ep) for one - photon fluorescence quenching at q = 532 nm in (c) toluene and (d) thf. (e, f) two - photon fluorescence quenching at q = 1064 nm in (e) toluene and (f) thf. one - photon induced fluorescence of 1, and its delayed one- and two - photon quenching, can be analyzed from the data presented in figure 3bf. the dependences of the integrated fluorescence emission ifl on the excitation pulse energy ep at p = 355 nm (figure 3b) revealed a linear one - photon population of the fluorescent level s1 over the energy range used. a linear dependence ifl = f(ep) confirmed the validity of assumptions ii, iii, and v. the one - photon quenching wavelength q = 532 nm was chosen to be within the fluorescence emission spectral range of 1, and the quenching pulse was delayed to d 80 ps > 2 to avoid overlap with the excitation pulse. the dependences of 1 if / if0 on the quenching pulse energy ep for one - photon excitation at 355 nm and one - photon quenching at 532 nm are presented in figure 3c, d. from these data, the values of 1 if / if0 were found to exhibit a linear dependence on ep in both solvents, in agreement with eq 6. the values of the one - photon stimulated transition cross sections, 10(q), were estimated from the slopes of these dependences. for example, 10(532 nm) 2.5 10 cm in toluene, which is close to the corresponding value of 10(532 nm) 3 10 cm calculated from the known steady - state absorption abs() and fluorescence ifl() spectra. the values of 1 if / if0 exhibited a quadratic dependence on the quenching pulse energy ep (see figure 3e, f) in the case of two - photon fluorescence quenching at q = 1064 nm, which is in good agreement with eq 9. it should be mentioned that q = 1064 nm is outside the fluorescence emission spectral range of 1 and, thus, one - photon stimulated transitions at this wavelength are negligible. possible esa processes at q = 1064 nm from the s1 electronic state do not affect the fluorescence intensity, as discussed previously. as a result, the quadratic dependences 1 if / if0 the values of the corresponding cross sections were estimated from the slopes of the dependences in figure 3e, f : 2pe(1064 nm) 240 and 280 gm for 1 in toluene and thf, respectively. the nature of the stimulated transitions under two - photon fluorescence excitation and simultaneous one - photon fluorescence quenching at 532 nm was analyzed from the dependences presented in figure 4. the quenching wavelength is located sufficiently far from the linear absorption bands and can be absorbed only through the 2pa mechanism. the dependences of the integrated fluorescence emission ifl of 1 on excitation pulse energy ep exhibited nearly quadratic character at low excitation irradiance (ep 15 j), as shown in the insets of figure 4. these results are in good agreement with eq 11, describing a pure 2pa mechanism when the stimulated transitions s1 s0 are neglected. as can be seen in figure 4, the dependence ifl = f(ep) becomes close to linear in the intermediate range of excitation irradiance (ep > 15 j), providing evidence for the contribution of one - photon quenching at 532 nm. further increase in the pulse energy to ep > 200 j, along with an expected saturation effect, was not realized because of laser damage of the cuvette. for comparison, the same dependence ifl = f(ep) the fluorescence spectrum of this compound (curve 2 in figure 5a) did not overlap with p = 532 nm. as can be seen in figure 4b, the dependence ifl = f(ep) was close to quadratic over the entire energy range. these results for p - terphenyl in toluene at p = 532 nm were anticipated, reflecting the two - photon excitation origin of the induced fluorescence. dependences of the integrated fluorescence intensity of 1 in (a) toluene and (b) thf on excitation pulse energy ep at p = 532 nm. (a) normalized absorption (1) and fluorescence (2) spectra of p - terphenyl in toluene. (b) dependence ifl = f(ep) at p = 532 nm for p - terphenyl in toluene. a comprehensive investigation of stimulated transitions in sulfonyl - containing fluorene 1 in toluene and thf was accomplished with a picosecond fluorescence quenching method at room temperature. the fluorescence quenching processes exhibited good agreement with theoretical predictions and can be used to study the nature of stimulated transitions and to determine the corresponding one- and two - photon quenching cross sections. s0 with 2pe(q) 240280 gm were shown for 1 at q = 1064 nm, representing the first report of two - photon sted in a molecular system. a complex, nonquadratic dependence of two - photon induced fluorescence intensity on excitation pulse energy was obtained at p = 532 nm, providing compelling evidence for the contribution of one - photon induced quenching upon two - photon excitation. the determination of the spectral dependences and absolute values of one- and two - photon stimulated emission cross sections is not only fundamentally important but might help develop the tenets for a number of nonlinear optical applications that can exploit sted. in particular, the two - photon stimulated emission processes can be harnessed to further increase the spatial resolution of fluorescence microscopy imaging. based on the results of this study, sulfonyl - containing fluorene derivative 1, exhibiting a high fluorescence quantum yield and photochemical stability, is a promising fluorescence probe for one- and two - photon sted microscopy, a subject of further investigation in our laboratory. | one- and two - photon stimulated emission transitions were investigated by the fluorescence quenching of a sulfonyl - containing fluorene compound, 2,7-bis(4-(phenylsulfonyl)styryl)-9,9-didecyl-9h - fluorene (1), in solution at room temperature using a picosecond pumpprobe technique. the nature of stimulated transitions under various fluorescence excitation and quenching conditions was analyzed theoretically, and good agreement with experimental data was demonstrated. two - photon stimulated transitions s1 s0 were shown for 1 at q = 1064 nm, representing the first report of two - photon stimulated emission depletion (sted) in a molecular system. the two - photon stimulated emission cross section, 2pe(q), of fluorene 1 was estimated to be 240280 gm, suggesting that this compound may be a good candidate for use in two - photon sted microscopy. |
internal hernia is defined as a fossa or defect of unusual size within a body cavity, into which intestines may intrude and become incarcerated or strangulated. the origins of internal hernias are multiple and include congenital defects, inflammation, infectious processes, trauma, and postoperative defects. based on autopsy findings the most common presentation of an incarcerated internal hernia is acute small bowel obstruction, whereas 4.1% of all intestinal obstructions are caused by internal hernias. paraduodenal hernia is the most common type of internal hernia, accounting for 53% of reported cases. the term paraduodenal hernia refers to a hernia of the entire small bowel, or part of it, into a sac derived from folds of peritoneum and fossae normally found at the terminal or 4th portion of the duodenum. it represents a rare congenital anomaly which arises from an error of rotation of the midgut. there are two variants, right and left paraduodenal hernia, the right being less common. a right paraduodenal hernia is formed when the prearterial limb fails to rotate around the superior mesenteric artery (sma). the prearterial segment is the portion cephalic to the vitello - mesenteric duct and comprises the distal duodenum and the entire small bowel to the distal ileum. therefore, a portion of the small bowel remains to the right of the sma. fusion of the ascending colonic mesentery to the retroperitoneum causes entrapment of the bowel within the primitive coelom, affecting from a single loop to the entire small bowel. the result is a hernia orifice that is always to the right of the midline and usually faces medially and slightly downward. the mesentery of the ascending colon and a portion of the transverse colon make up the anterior wall of the sac, while the sma and ileocolic artery lie in the free edge of the sac [1, 4 ]. signs and symptoms of paraduodenal hernia are extremely variable and may occur at any age. based on the japanese literature, 70% of cases were male, and the mean age at onset was 39.5 years. the most common presentation is acute small bowel obstruction, with crampy abdominal pain, nausea, vomiting and distension. the patient may complain of vague and chronic abdominal pain or periodic distension, which results from partial obstruction. the severity of signs and symptoms is directly proportional to the degree of obstruction [3, 4, 5, 7, 8 ]. a paraduodenal hernia may be discovered incidentally at autopsy [4, 8 ]. in many cases it causes no symptoms and diagnosis may be made when a barium x - ray examination shows the small bowel either to the right or left of the midline in the abdomen. we report a case of right paraduodenal hernia in an adult patient, followed by a review of the literature. a 41-year - old male patient was referred to our department of general surgery with a 6-month history of intermittent episodes of postprandial nausea, vomiting, abdominal pain and distension, which aggravated during the last 3 months, importantly affecting oral intake. physical examination revealed mild distension and tenderness of the upper abdominal quadrants, which appeared tympanic at percussion. an abdominal ct scan with oral and intravenous contrast demonstrated an encapsulated cluster of small bowel loops occupying mainly the right upper quadrant, lateral to the duodenum, with the transverse colon located inferiorly (fig. upper gastrointestinal series with small bowel follow - through showed a large collection of contrast - filled dilated bowel loops in the right upper aspect of the abdomen and absence of small bowel loops in the lower abdomen, confirming the diagnosis of a right paraduodenal hernia (fig. the patient underwent a laparotomy ; a large sac containing dilated small bowel loops was identified as demonstrated with radiologic studies (fig. the ascending colon was normally located, whereas the transverse colon was displaced inferiorly. when the transverse colon was retracted in cephalic direction, the right paraduodenal hernia, through which most of the small bowel protruded, the medial aspect of the hernia neck included the superior mesenteric vessels, under a certain degree of tension due to the distended loops passing through, opposing difficulty to their reduction (fig. surgical correction was accomplished by dividing the lateral attachment of the ascending colon, opening the hernia sac widely and rotating the right colon medially, connecting the small bowel with the abdominal cavity. after an uneventful recovery, the patient initiated oral intake at the second postoperative day, and 6 months after the surgery the patient remains free of symptoms in a good nutritional status. paraduodenal hernia refers to a hernia of the entire small bowel, or part of it, into a sac derived from folds of peritoneum and fossae normally found at the terminal or 4th portion of the duodenum. no less than 10 such peritoneal fossae have been described, but the most frequently encountered are : inferior paraduodenal fossa of treitz (60%), combined superior and inferior paraduodenal fossae (30%), superior paraduodenal fossa (5%), paraduodenal fossa of landzert (2%), duodenojejunal or mesocolic fossa (2%), and fossa of waldeyer (1%) [9, 10 ]. occur on the left side of the abdomen and involve the paraduodenal fossa of landzert ; 25% develop on the right, involving the fossa of waldeyer, located in the mesojejunum, beneath the sma and immediately below the duodenum. their presence is more common in men than women, with a ratio of 3:1 [2, 7, 9 ]. paraduodenal hernias are derived from an error of rotation of the midgut, the portion of the intestinal tract receiving its blood from the sma. the portion cephalic to the vitello - mesenteric duct is called the prearterial segment and comprises the distal duodenum and the entire small bowel to the distal ileum. the caudal portion, or postarterial segment, comprises the distal ileum, cecum, appendix, ascending colon and proximal two thirds of the transverse colon. at about the 4th to 5th week of fetal development, the midgut rate growth exceeds the rate growth of the body stalk and elongates, forming the primary intestinal loop. due to this rapid elongation as well as the increasing size of the liver, a physiologic herniation at the umbilical ring occurs. by about the 10th to 12th week the abdominal cavity has increased in size and the midgut has gradually returned within it. the midgut has now rotated 90 in a counterclockwise direction on the axis of the sma. the prearterial segment occupies the right side of the abdominal cavity, and the postarterial segment the left side. arrest at this point of rotation will produce the relatively common picture of nonrotation of the intestine. normally the prearterial segment continues to rotate an additional 180 counterclockwise, first behind and then to the left of the sma, so that it comes to lie to the left of the midline in the abdominal cavity. the postarterial segment also rotates, led by the cecum, which passes counterclockwise anterior to the sma into the right upper quadrant. the cecum may not complete its descent to its normal position in the right lower quadrant until about the end of the 5th month of life of the embryo. later, fusion of the mesenteries and fixation of the midgut occurs, from the ligament of treitz in the left upper quadrant to the cecum in the right lower quadrant. the ascending and descending colon fuse with the retroperitoneum. as mentioned, a right paraduodenal hernia is formed when the prearterial limb fails to rotate around the sma, and a portion of the small bowel remains to the right of it [1, 4 ]. the age of our case falls in the most common range reported [5, 6 ]. the 6-month history of intermittent episodes of postprandial nausea, vomiting, abdominal pain and distension was suggestive of a partial small intestinal obstruction. unfortunately, these nonspecific symptoms are often mistakenly attributed to biliary disease, gastritis, or gastroesophageal reflux. physical examination is usually not revealing unless the hernia is large enough to produce an abdominal mass or causes intestinal obstruction. distension of the abdomen may be eccentric, situated on the corresponding side of the hernia. our patient manifested with mild distension and tenderness of the upper abdominal quadrants, which appeared tympanic at percussion. the first correct preoperative diagnosis of a paraduodenal hernia was made by kummer in 1921, who described its presence by a barium swallow. later, taylor in 1930 diagnosed a case of right paraduodenal hernia by radiologic appearances. a plain abdominal film will usually show an agglomeration of dilated small bowel loops. a definitive preoperative diagnosis may still be made by an upper gastrointestinal series with small bowel follow - through that shows an ovoid collection of contrast - filled small bowel loops either to the right or left of the midline of the abdomen. in a right paraduodenal hernia, as seen in our case, collection of bowel loops is noted lateral and inferior to the descending duodenum, in the right half of the transverse mesocolon, or behind the ascending mesocolon. there is absence of small bowel in the pelvis, except when most of the terminal ileum is outside the hernia sac. barium enema examination may show a colon in its usual position or the cecum may be only incompletely rotated and lie in the right upper quadrant [4, 5, 12 ]. the classic ct findings of a right paraduodenal hernia were visualized in our patient : clustering of small bowel loops in the right midabdomen. vascular findings include jejunal branches of the sma and superior mesenteric vein looping posteriorly and to the right to supply the herniated loops. additional findings include the presence of the sma, ileocolic artery, and right colic vein in the anterior margin of the hernial sac neck, displaced anteriorly [5, 12 ]. the surgical treatment of a right paraduodenal hernia, as performed in the present case, is to replace the pre- and postarterial intestinal segments to their normal positions at the end of the first stage of rotation, with the duodenum, jejunum and most of the ileum to the right, and the terminal ileum, cecum and colon on the left of the midline. this is their relation in the nonrotation of the intestine and will be accomplished by dividing the right lateral attachments of the colon and transferring it to the left side of the abdomen. therefore, the hernia sac is widely opened and the small opening through which the ileum passes is eliminated. the hernia sac will now be part of the general peritoneal cavity. since the sma and its branches to the cecum and ascending colon lie in the anterior wall of the hernia sac, its injury may result if hernia reduction is attempted by opening the sac in this area [4, 5 ]. surgical management has been successfully performed with the laparoscopic approach in patients with no bowel necrosis or severe dilatation. operative treatment of hernia found incidentally at laparotomy has been debated [4, 5 ]. paraduodenal hernias carry about a 50% lifetime risk of incarceration, which may lead to bowel obstruction and strangulation. therefore, treatment has been recommended. the mortality rate is not clear but approximates 20 - 50%, due to the large proportion of patients with intestinal obstruction and ischemia requiring emergency surgery. there is a poorer prognosis if strangulation occurs and a long segment of small bowel is rendered ischemic. moreover, this may result from delay in intervention, as signs of peritonitis may be masked by the retroperitoneal position of the hernia [14, 15 ]. the case reported herein is a male patient who showed proximal obstructive symptoms, being evaluated by contrast - enhanced gastrointestinal studies under nonurgent circumstances, which allowed a planned laparotomy. as recommended, the surgical correction avoided a reduction attempt of herniated bowel loops and hence the possibility of injury to the superior mesenteric vessels [4, 5 ]. | paraduodenal hernia, a rare congenital anomaly which arises from an error of rotation of the midgut, is the most common type of intraabdominal hernia. there are two variants, right and left paraduodenal hernia, the right being less common. we report the case of a 41-year - old patient with a right paraduodenal hernia with a 6-month history of intermittent episodes of intestinal obstruction. diagnosis was established by ct scan and upper gastrointestinal series with small bowel follow - through. in a planned laparotomy, herniation of the small bowel loops through the fossa of waldeyer was found. division of the lateral right attachments of the colon opened the hernia sac widely, replacing the pre- and postarterial segments of the intestine in the positions they would normally occupy at the end of the first stage of rotation during embryonic development. six months after the surgery, after an uneventful recovery, the patient remains free of symptoms. |
this descriptive cross - sectional study was conducted at a large 1200-bedded tertiary care hospital at pune. a total of 50 consecutive adult hiv seropositive individuals were included in the study after obtaining informed consent. the minimum age was 24 years, and the maximum age recorded was 73 years hiv seropositivity was confirmed by two different enzyme - linked immunosorbent assay (elisa) methods. staging of hiv seropositive case was carried out as per centers for disease control (cdc) classification. subjects more than 18 years of age with confirmed hiv seropositivity who were physically asymptomatic in stage ii or iii of cdc. subjects with past history of head injury with loss of consciousness, central nervous system (cns) disorders, psychiatric illness and those who qualify for aids defining criteria were excluded. the questionnaire was divided into several parts like patient 's particulars, details of hiv status and high - risk behavior, questions on family support and discrimination. personal particulars included questions on age, sex, occupation, residence (rural / urban), education, income, marital status, years of marriage, and number of children. details on hiv status like the reason, time and place of diagnosis and immediate reaction of the individual after knowing about his illness were included. questions on high - risk behavior like the mode of transmission, status of disclosure, and knowledge about the sources of infection were asked. further, the reactions received on disclosure at home and workplace along with the support levels was interrogated to assess the family support and discrimination. the ghq is a self - administered screening test, which is sensitive to the presence of psychiatric disorders in individuals presenting in primary care settings and non - psychiatric clinical settings. the ghq is not designed to detect symptoms that occur with specific psychiatric diagnose rather ; it provides a measure of overall psychological health or wellness. retest reliability and both content validity and construct validity. in the present study, the shorter version containing 12 items the ghq has been translated into 38 languages and used in diverse cultural groups. as it is primarily concerned with the detection of psychological illness, the items appear to have cross - cultural relevance despite cultural variations in the expression of mental illness. the hads was developed as a self - report questionnaire to detect adverse anxiety and depressive states. an analysis of scores on the two sub scales supported the differentiation of each mood state into four ranges : mild cases (scores 8 - 10), moderate cases (scores 11 - 15), and severe cases (scores 16 or higher). the who-5 well - being index is a short, self - administered questionnaire covering 5 positively worded items, related to positive mood (good spirits, relaxation), vitality (being active and waking up fresh and rested), and general interests (being interested in things). it has shown to be a reliable measure of emotional functioning and a good screener for depression. each of the five items is rated on a 6-point likert scale from 0 (= not present) to 5 (= constantly present). then the scores are transformed to 0 - 100 by multiplying by 4, with higher scores meaning better well - being. a score of 50 or below is indicative for low mood, though not necessarily depression. the scoring of the tests was done as per the test booklet of each scale. a total of 50 consecutive adult hiv seropositive individuals were included in the study after obtaining informed consent. the minimum age was 24 years, and the maximum age recorded was 73 years hiv seropositivity was confirmed by two different enzyme - linked immunosorbent assay (elisa) methods. staging of hiv seropositive case was carried out as per centers for disease control (cdc) classification. subjects more than 18 years of age with confirmed hiv seropositivity who were physically asymptomatic in stage ii or iii of cdc. subjects with past history of head injury with loss of consciousness, central nervous system (cns) disorders, psychiatric illness and those who qualify for aids defining criteria were excluded. the questionnaire was divided into several parts like patient 's particulars, details of hiv status and high - risk behavior, questions on family support and discrimination. personal particulars included questions on age, sex, occupation, residence (rural / urban), education, income, marital status, years of marriage, and number of children. details on hiv status like the reason, time and place of diagnosis and immediate reaction of the individual after knowing about his illness were included. questions on high - risk behavior like the mode of transmission, status of disclosure, and knowledge about the sources of infection were asked. further, the reactions received on disclosure at home and workplace along with the support levels was interrogated to assess the family support and discrimination. the ghq is a self - administered screening test, which is sensitive to the presence of psychiatric disorders in individuals presenting in primary care settings and non - psychiatric clinical settings. the ghq is not designed to detect symptoms that occur with specific psychiatric diagnose rather ; it provides a measure of overall psychological health or wellness. retest reliability and both content validity and construct validity. in the present study, the shorter version containing 12 items the ghq has been translated into 38 languages and used in diverse cultural groups. as it is primarily concerned with the detection of psychological illness, the items appear to have cross - cultural relevance despite cultural variations in the expression of mental illness. the hads was developed as a self - report questionnaire to detect adverse anxiety and depressive states. an analysis of scores on the two sub scales supported the differentiation of each mood state into four ranges : mild cases (scores 8 - 10), moderate cases (scores 11 - 15), and severe cases (scores 16 or higher). the who-5 well - being index is a short, self - administered questionnaire covering 5 positively worded items, related to positive mood (good spirits, relaxation), vitality (being active and waking up fresh and rested), and general interests (being interested in things). it has shown to be a reliable measure of emotional functioning and a good screener for depression. administering the who-5 well - being index takes 2 - 3 min. each of the five items is rated on a 6-point likert scale from 0 (= not present) to 5 (= constantly present). then the scores are transformed to 0 - 100 by multiplying by 4, with higher scores meaning better well - being. a score of 50 or below is indicative for low mood, though not necessarily depression. the scoring of the tests was done as per the test booklet of each scale. the mean age of the subjects was found out to be 37.92 (9.41) years. 66% individuals belonged to rural background as opposed to 34% who belonged to urban background. 100% cases were males. around 74% people interviewed in the study were army personnel out of which 62% were working, and 12% were ex - servicemen. 16% were farmers and 10% were of other occupations like banker, goldsmith, teacher etc. demographic characteristics of the 50 hiv seropositive cases most of them were diagnosed hiv positive after getting a blood test carried out for some other disease [table 2 ]. in this study, on being asked about the immediate emotional reaction on knowing about the disease status, 30% of the study group felt sad, and 16% reported hopelessness [table 3 ]. the influence of knowledge about mode of transmission on high - risk behavior is a moot question. although the knowledge about modes of transmission of hiv illness was present in 52% of the sample, the disease had already affected them, through high - risk sexual behavior that was reported by 28% of the study group. however, the awareness seems to have reduced the high - risk behavior in the remaining study group [tables 4 and 5 ]. it is interesting to observe that study group had disclosed their seropositive status, most of whom received support and cooperation from their family members. the maximum status of disclosure was to spouses and less to parents and children of the diseased. most of the individuals had disclosed their status in their workplace, 50% of whom were of the opinion that they had faced discrimination after disclosure [tables 69 ]. fifty - four percent individuals were suffering from anxiety with 26% people with severe anxiety. a relationship was found out between anxiety and depression levels by using the pearson correlation. the value was calculated as 0.682, which shows a significant correlation between anxiety and depression [tables 10 and 11 ]. the ghq revealed that most individuals did not suffer from any psychological morbidity [table 12 ]. the who well - being index also showed consistent findings as most of the affected individuals had a good score [table 13 ]. reason of getting tested for hiv in the sample population immediate reaction after knowing the hiv positive status details of knowledge about the disease before contracting it details of the mode of transmission of the disease status of disclosure in home reaction received on disclosure at home support received from parents, spouse and children on disclosure status of disclosure and discrimination faced in the workplace anxiety and depression levels mean scores on anxiety and depression scale interpretation of general health questionnaire interpretation of world health organization well - being index among psychosocial variables stigma remains the major area of concern. most researches emphasize that social support is an extremely important indicator of psychological well - being of an individual. in one of the studies, individuals in receipt of quantitatively different levels of support were found to differ in measures of depression, stress, coping efficacy, and self - esteem, while individuals in receipt of deficient levels of support were found to be more depressed. findings of the present study revealed internal consistency in respect of scores on ghq and who well - being scale. in the present study, the majority of the subjects (72%) were tested for hiv at the first instance for investigation of some other disease ; 6% were screened during routine medical examination and 8% were found to be seropositive on blood donation ; 14% were tested for other reasons like after their wife 's hiv positive status getting revealed on antental care (anc) examination, etc., primarily because of ignorance 32% of people felt no emotion on being told the positive result. another large number of people felt sorrow (30%), hopelessness (16%), disbelief (14%), and anger (2%) after knowing about it. studies suggest that while some individuals may experience psychiatric disorders, the emotional responses to illness (shock, disbelief, grief, sadness, anger, despair, fear, guilt, hopelessness, numbness, panic) are considered normal and appropriate reactions. a total of 52% people knew about the disease before contracting it whereas 48% did not. 38% people accounted for heterosexual transmission as a cause of their illness of which 28% felt it was not from their spouses. others said the cause was accidental inoculation (26%), parental blood transfusion (16%) and iv drug abuse (6%). the remaining did not disclose due to sheer neglect or fear of adverse reaction from their family members. on disclosure, maximum people got family support and cooperation (72%). however, 8% felt they faced isolation and neglect from family, and another 10% said they did not get any response, which can be attributed to lack of knowledge and ignorance. the patients had disclosed their status, mostly to their spouses (80%) and less to their children (40%) and parents (58%). majority of the cases had disclosed their seropositive status in their workplace (64%). however, 50% of those who had disclosed were of the opinion that they were facing discrimination. in the present study, 54% of the individuals suffered from anxiety out of which 26% had severe anxiety. findings of the present study are in concurrence with the available literature. according to an indian study, the authors found anxiety disorders manifesting throughout the course of hiv infection, with a general trend for increased prevalence of these disorders as the illness progresses. researchers have reported a prevalence range of 29 - 38% depending upon the stage of illness. the study states that in comparison to the western studies, the number of individuals diagnosed as having anxiety disorders in an indian study was higher, however, the sample in the study differed from that in the western studies in terms of recruiting greater number of individuals symptomatic (55% of the total sample) for hiv infection. according to this study, physical suffering, cultural factors like stigma, relative lack of appropriate treatments facilities, poor access to the health - care, and low educational level could have significantly contributed. it further emphasized that since the individuals were assessed for anxiety soon after revelation of hiv status (within 2 - 3 months), it could also account for the higher incidence of anxiety disorders. in addition, pain, concurrent alcohol abuse / dependence, poor family support, and presence of aids in the spouse accounted for 57% of the total variance in the level of anxiety. in our study, 30% individuals suffered from depression. furthermore, a significant correlation was seen in people having anxiety and depression. many studies state depression, anxiety, and suicidal tendencies have been found to be quite prevalent among hiv - positive individuals. in particular, depression is quoted as the most common psychiatric disorder in hiv - infected patients and pharmacological intervention may be warranted. rates of depression in hiv seropositive patients from the west have ranged from 5% to 25%. in earlier indian studies, majority (90%) of the patients who had depressive symptoms also had prominent anxiety symptoms and fulfilled the icd-10 criteria for generalized anxiety disorder. the relatively lower prevalence of depression in the present study could be due to the fact that they were evaluated soon after testing positive. though the figures appear alarming, this could give us insight into concerns of patients. early reports based on clinical observation or medical record reviews indicated high rates of distress and depressive symptoms among those infected with hiv or who had aids. later studies, however, used structured psychiatric evaluations and community samples with hiv - negative comparison groups and showed rates of psychiatric disorder to be largely equivalent between hiv - positive and negative people. the study carried out by bing. assessed a national probability sample of nearly 3,000 adults receiving care for hiv infection and found that more than a third screened positive for clinical depression, the most common disorder identified during study. in this study, 56% individuals do not show any morbidity in ghq and 54% show a good well - being status in who well - being index. these figures throw a light on the importance of social support being an important factor of quality of life. most of the studies support the notion that social support is an essential determinant of the well - being of an infected individual. individuals in receipt of quantitatively different levels of support were found to differ on measures of depression, stress, coping efficacy, and self - esteem, while individuals in receipt of deficient levels of support were found to be more depressed. aspects of psychological well - being were related to each of the adherence measures. it was suggested that people who feel well cared for are more likely to be adherent. the effect of repeated hiv - related bereavements upon an individual 's social network and the emotional, social, and physical sequel of bereavement have implications for hiv quality of life research as well. quality of survival time has become a paramount issue in the context of hiv spectrum disease. in the present study, 54% of the individuals suffered from anxiety out of which 26% had severe anxiety. findings of the present study are in concurrence with the available literature. according to an indian study, the authors found anxiety disorders manifesting throughout the course of hiv infection, with a general trend for increased prevalence of these disorders as the illness progresses. researchers have reported a prevalence range of 29 - 38% depending upon the stage of illness. the study states that in comparison to the western studies, the number of individuals diagnosed as having anxiety disorders in an indian study was higher, however, the sample in the study differed from that in the western studies in terms of recruiting greater number of individuals symptomatic (55% of the total sample) for hiv infection. according to this study, physical suffering, cultural factors like stigma, relative lack of appropriate treatments facilities, poor access to the health - care, and low educational level could have significantly contributed. it further emphasized that since the individuals were assessed for anxiety soon after revelation of hiv status (within 2 - 3 months), it could also account for the higher incidence of anxiety disorders. in addition, pain, concurrent alcohol abuse / dependence, poor family support, and presence of aids in the spouse accounted for 57% of the total variance in the level of anxiety. in our study, 30% individuals suffered from depression. many studies state depression, anxiety, and suicidal tendencies have been found to be quite prevalent among hiv - positive individuals. in particular, depression is quoted as the most common psychiatric disorder in hiv - infected patients and pharmacological intervention may be warranted. rates of depression in hiv seropositive patients from the west have ranged from 5% to 25%. in earlier indian studies, prevalence rates of depression among hiv seropositive individuals have ranged from 10% to 40%. majority (90%) of the patients who had depressive symptoms also had prominent anxiety symptoms and fulfilled the icd-10 criteria for generalized anxiety disorder. the relatively lower prevalence of depression in the present study could be due to the fact that they were evaluated soon after testing positive. though the figures appear alarming, this could give us insight into concerns of patients. early reports based on clinical observation or medical record reviews indicated high rates of distress and depressive symptoms among those infected with hiv or who had aids. later studies, however, used structured psychiatric evaluations and community samples with hiv - negative comparison groups and showed rates of psychiatric disorder to be largely equivalent between hiv - positive and negative people. the study carried out by bing. assessed a national probability sample of nearly 3,000 adults receiving care for hiv infection and found that more than a third screened positive for clinical depression, the most common disorder identified during study. in this study, 56% individuals do not show any morbidity in ghq and 54% show a good well - being status in who well - being index. these figures throw a light on the importance of social support being an important factor of quality of life. most of the studies support the notion that social support is an essential determinant of the well - being of an infected individual. individuals in receipt of quantitatively different levels of support were found to differ on measures of depression, stress, coping efficacy, and self - esteem, while individuals in receipt of deficient levels of support were found to be more depressed. aspects of psychological well - being were related to each of the adherence measures. it was suggested that people who feel well cared for are more likely to be adherent. the effect of repeated hiv - related bereavements upon an individual 's social network and the emotional, social, and physical sequel of bereavement have implications for hiv quality of life research as well. quality of survival time has become a paramount issue in the context of hiv spectrum disease. studies have reported depression being the most common psychiatric morbidity among the afflicted individuals. however, in this study, anxiety was found to be more prevalent as compared to depression. | background : reactions of people to a diagnosis of hiv and its effect on well - being vary greatly. there is paucity of indian studies in this area.aim:to assess the level of anxiety, depression and quality of life in hiv seropositive individuals.materials and methods : it was a descriptive cross - sectional study with a sample size of 50 seropositive individuals. they were assessed using a specially prepared proforma containing several questions pertaining to their demographic profile, details of hiv status and high - risk behavior, questions on family support and discrimination. in addition, all subjects were evaluated with who well - being index, general health questionnaire (ghq), and hospital anxiety, and depression scale.results:anxiety was noted in 54% of the individuals whereas only 30% suffered from depression. ghq showed psychological morbidity in 44% individuals. who well - being index noted poor psychological well - being in 46% of individuals.conclusion:the high level of anxiety and depression in hiv seropositive subjects reiterates the importance of psychological counseling in hiv afflicted individuals in conjunction with suitable pharmacotherapy. |
approximately, 12% of children and adolescents in china are overweight according to the latest report. the prevalence of overweight is even higher in big cities ; for example, in shanghai, 49.1% of boys and 30.8% of girls were reported to be overweight. in parallel with the prevalence of obesity, nonalcoholic fatty liver disease (nafld), which encompasses a spectrum of conditions ranging from simple steatosis to steatohepatitis, fibrosis, and cirrhosis, represents one of the leading causes for chronic liver disease. patients with simple steatosis may have benign prognosis, whereas those with nafld may develop progressive liver disease. however, the pathogenesis and metabolic effects of ectopic fat accumulation within the liver are still obscure. the mechanism of transition from simple steatosis to fibrosis and the associated factors are also poorly characterized. among the many tests, liver biopsy is considered to be the gold standard for nafld diagnosis. however, due to its invasive nature and cost, it is not appropriate for pediatric screening. furthermore, with only very small part of the liver mass examined, it can result in sampling error and selection bias. the b - mode ultrasound for testing hepatic steatosis is noninvasive and qualitative but not helpful for quantitative analysis. its accuracy in predicting the presence and severity of hepatic steatosis and mortality is poor. recently, proton magnetic resonance spectroscopy (1h - mrs) has been found to be a sensitive and noninvasive method to measure hepatic triglyceride content [7, 8 ]. the reproducibility of the test in patients with higher hepatic triglyceride content was also found to be higher. although 30% of the obese population is at risk of nafld, only 3% to 5% may have nash and 1% to 2% may have progressive liver fibrosis. indirect markers reflecting altered hepatic function include alanine transaminase (alt), aspartate transaminase (ast), albumin and nafld fibrosis score (nfs), aspartate transaminase - to - platelet ratio index (apri), and fibrosis index based on the 4 factor (fib-4) score. direct markers reflecting extracellular matrix (ecm) turnover include hyaluronic acid (ha), type iv collagen (civ), procollagen type iii (pciii), and laminin (ln). intrahepatic fat (ihf) assessment by 1h - mrs combined with both direct and indirect hepatic fibrosis markers in chinese obese children has not been investigated until now. the present study was undertaken to explore (1) the magnitude of hepatic fat content in severely obese adolescents, (2) the correlation between ihf content and liver fibrosis indicators, and (3) the impact of ihf and liver fibrosis on glucose homeostasis and metabolic syndrome (ms). one hundred and eighty - nine obese children aged between 6 and 16 years with a bmi > 95th percentile and waist circumference (wc) larger than 90th percentile for their age and sex (waist - to - height hip ratio > 0.48 for males and > 0.46 for females according to the consensus of chinese pediatric endocrine society, chinese pediatric cardiovascular disease society, and chinese child health society,) were recruited to the study in the endocrinology department. children with known endocrine diseases, hereditary diseases, viral hepatitis, and other chronic or infectious diseases were excluded. pubertal stage was assessed according to the tanner scale ; 77 were prepubertal and 112 were pubertal. obese children were further divided into three groups, simple obese (sob) group with ihf 5% and normal alt, and the nash group with ihf > 5% and alt > 50, according to the lab reference standard for impaired liver function. ms in children aged between 6 and 16 years was defined as central obesity (defined as waist circumference larger than 90th percentile) and at least two of the following ms components : (1) impaired fasting blood glucose level (> 5.6 mmol / l on the oral glucose tolerance test) or type 2 diabetes mellitus, (2) increased blood pressure > 130 mmhg systolic or > 85 mmhg diastolic, (3) high serum triglyceride (tg) level 150 mg / dl (1.7 mmol / l), or (4) decreased serum high - density lipoprotein cholesterol 5 (liver steatosis), all the direct and indirect hepatic fibrosis markers had auroc of less than 0.5. as shown in figures 2(a)-2(b), patients with ihf > 5 and alt > 50 (i.e., liver injury) were distinguished by civ, ha, and pciii levels and all the indirect markers showed auroc greater than 0.5 with p 1.659) and nafld fibrosis score (> 0.735) were found to have higher sensitivity and specificity for the prediction of advanced fibrosis. in our study, direct markers including civ, ha, and pciii correlated with ihf and distinguished fatty hepatitis. a previous study also indicated civ and pciii as the only markers of histological diagnosis of nash. another study reported that the detection of severe fibrosis (> f3) was excellent and the detection of fibrosis was modest by these markers. the smaller auc for discriminating fatty hepatitis based on these markers in our study compared with previous studies may be attributed to younger age and obesity during the early stages of fibrosis compared with the adult population. the best cutoff values of 148.8 ng / ml for ha and 292.5 ng / ml for ln were higher than the data in our study. the indirect markers were found to be better in discriminating fatty hepatitis from hepatic steatosis than direct markers, a fact which was especially true in case of apri (auroc 0.93). in the evaluation of ms, the patients who scored greater than score 2 have a higher ihf than those who scored less than 2. even in ms insulin resistance is also a major factor associated with nafld and significant liver fibrosis [30, 31 ]. nafld itself was a multisystem disease and associated with factors that mediate interindividual variations in the development of extrahepatic manifestations including type 2 diabetes mellitus. our study explored the relationship between glucose metabolism - related factors and hepatic fibrosis markers simultaneously. hba1c was related to ln and pciii ; insulin 120 was related to ha and fasting glucose was related to ln and ha. these facts demonstrate that the hepatic fibrosis markers were related to glucose and insulin metabolism indicators as well. therefore, liver steatosis and fibrosis were possibly involved in glucose metabolism and insulin resistance even in children. anthropometric measurements were associated with the severity of nafld based on gender, especially in women with larger wc showing a greater likelihood of liver injury. our data showed that age is related to ihf, nfs, and fib-4 similar to an earlier study, which indicated that age was related to liver fibrosis. the uric acid values increased from sob group to ss group and further to nash group. uric acid inducing fat accumulation via generation of endoplasmic reticulum stress in hepatocytes has been reported. the study findings reflect potential bias, with the boys constituting two - thirds of the total sample. however, gender distribution of obese children in the present study was similar to an early report from china. in a sample of 4,094 participants, 568 boys (26.7%) and 326 girls (16.6%) were found to be overweight or obese. other studies in china also reported that boys were more often obese than girls [3840 ]. the male - specific prevalence of obesity might be related to gender differences in feeding and perceptions of body image. in china, boys are placed at a higher value and considered strong, and big body is considered healthy, while girls are more concerned about their body shape, which also explains why boys were more obese than girls in our study. no significant relationship was found between pubertal developments (testosterone level, tanner stage, and testicle volume) and hepatic changes (ihf and fibrosis markers). the results were different from previous studies in adults and rabbit models [13, 41 ], which indicated that testosterone plays a protective role in nafld. this difference could be attributed to the fact that 45% of the boys were prepubertal (testicle volume < 4 ml) and 72% of the boys had a testosterone level < 20 mmol / l, which is prepuberty level. in conclusion, indirect hepatic fibrosis markers were better than direct markers in discriminating fatty hepatitis. | aim. we evaluated both direct and indirect hepatic fibrosis markers in obese children and their relationship with intrahepatic fat (ihf) content. we also aimed to investigate the possible roles of ihf and fibrosis markers in metabolic syndrome (ms). methods. 189 obese children were divided into simple obese (sob), simple steatosis (ss), and nonalcoholic steatohepatitis (nash) groups according to their ihf and blood alanine transaminase (alt) levels. they were also scored for the ms components. ihf was assessed as a continuous variable by proton magnetic resonance spectroscopy (1h - mrs). in addition, 30 nonobese children were enrolled as controls and their direct hepatic fibrosis markers and ihf were assessed. results. age was related to ihf, nfs, and fib-4. both nfs and apri were related to ihf more significantly than the direct markers. in the estimation of liver function impairment, indirect markers had greater auroc than direct markers. in ms, ihf and all the fibrosis markers showed similar auroc. conclusions. both direct and indirect markers played a valuable role in evaluating ms. indirect markers were more effective in distinguishing fatty hepatitis. age is an important factor underlying hepatic steatosis and fibrosis even in children. |
we analyzed passive surveillance data on hca cases reported to the national center for disease control and public health (tbilisi, georgia) during 20102012. self - reported source of infection was ascertained from categorical responses that included butchering / slaughtering cattle, handling / preparing meat, performing field work / harvesting crops, processing hair / wool, receiving an insect bite, unknown, or other. we also obtained information about regional - level anthrax cases in livestock (www.oie.int/wahis_2/public/wahid.php/diseaseinformation/statusdetail). hca cases and incidence per million persons were plotted over time with livestock cases. to estimate changes in hca risk over time, we compared data for the study period with data for 20072009 by using a cumulative incidence ratio (total cases / median year population). we calculated incidence risk ratios for demographic characteristics by using a negative binomial regression (technical appendix). data were anonymized and aggregated to each case - patient s community of residence and mapped in a geographic information system. we extrapolated current population from the 2002 census using the united nations medium variant population growth projections (http://data.un.org/). cumulative incidences per 10,000 population were calculated for each community (total cases / median year population). we adjusted for community population heterogeneity using empirical bayes smoothing estimates of the cumulative incidence (technical appendix). kernel density estimation was used to map the cumulative incidence risk / km (technical appendix). to identify community - level hca spatial clustering, we used the poisson model in satscan (7) with a maximum cluster size of 25% of the population at risk. we compared the proportion of urban and rural communities inside and outside clusters using a analysis (proc freq, sas institute, cary, nc, usa). during 20102012, a total of 251 hca cases and 74 livestock cases (38 cattle, 1 pig, 4 sheep / goats, 1 horse) were reported (figure 1). hca cases peaked in 2012 (142 cases), corresponding to a national incidence of 31.7 per million population (95% ci 28.436.1). compared with 20072009 (133 cases), the period studied had a higher risk for hca (cumulative incidence ratio 1.89 [95% ci 1.642.33 ], p<0.01). total number of human cutaneous anthrax cases (light gray) and livestock cases (dark gray), georgia, 20102012. incidence rates (irs) (95% cis) of human cutaneous anthrax per million population are displayed above the bars. cases occurred predominantly in males (209 [84% ]) (table 1). butchering / slaughtering cattle as a source of infection was more common among male patients (143 [68% ]) ; processing / handling meat was more common among female patients (28 [68% ]). the adjusted incidence risk ratios from the negative binomial model showed a stronger association of risk in males (4.95 [95% ci 2.918.42 ]) than in females (table 2). persons 5064 years of age were at greater risk than were persons in all other age groups. risk did not differ between case - patients who processed / handled meat and those who slaughtered / butchered cattle. population estimates were obtained from the georgian state statistical office (geostat, http://geostat.ge) and are based on median year population totals for the study period. goodness - of - fit test indicated the model fit the data (df = 31, = 40.71, p = 0.11). empirical bayes smoothed incidence per 10,000 population ranged from 0.11 (95% ci 0.030.37) to 213.8 (95% ci 72.8552.6) (figure 2, panel a). the kernel density analysis identified a higher risk per squared kilometer in the southeast and west (figure 2, panel b). we identified 3 spatial clusters of high risk ; the clusters comprised 58 communities with 197 cases (figure 2, panel c). cumulative incidence inside the clusters was 12.8/10,000 population compared with 0.96/10,000 population outside the clusters. the proportion (= 0.65, p = 0.4) of urban and rural communities (22 and 36, respectively) within clusters did not differ from the proportion outside clusters (urban : 14 ; rural : 24). clusters 1 and 2 in the southeast bordered the densely populated urban area of the capital (tbilisi) and were associated with grazing lands, whereas cluster 3 bordered the urban area of poti in the west and was associated with a higher percentage of croplands. a) empirical bayes smoothing cumulative incidence (per 10,000 population) of human cutaneous anthrax at the community level, georgia, 20102012. green star indicates the location of the capital, tbilisi ; gray star indicates the fourth most populous city, rustavi. c) spatial clustering of human cutaneous anthrax cases as determined by using satscan (7). rr, risk ratio. despite an apparent decline in hca cases worldwide (8), incidence in georgia has increased and is now comparable with that in turkey, where the disease is hyperendemic (1,9,10). our analysis identified clusters of communities that were of historical importance for hca risk and new communities that represent areas of (re)emergence (6). our findings indicate that hca cases were concentrated within specific areas associated with agriculture and in close proximity to urban centers (figure 2), consistent with research linking urban livestock trading centers and markets to outbreaks and higher rates of hca (5,911). sick and dying animals are often slaughtered and brought to market quickly to mitigate economic losses, thereby exacerbating exposure risk while limiting livestock reporting (10,11). hca is primarily associated with rural, agrarian areas (2,3,12), but we found no difference in the proportion of urban and rural communities in high - risk clusters. this association with urban zones suggests reliance on these areas for commerce, coupled with increased agricultural employment from 25% of the population in 1990 to 55% in 2010 (5,13). one hypothesis is that contaminated meat is brought into urban areas and sold at informal meat markets that because of fiscal constraints have little to no regulation. cases were predominantly linked to contact with infected livestock or meat, as observed elsewhere (2,3,9,11). field work was a self - reported source of infection in 27 (10.7%) cases. this risk factor is not well documented and might reflect recall bias or unwillingness to admit to slaughtering infected animals. our findings that males were at higher risk than females for hca, as reported elsewhere (2,14) might reflect occupational exposures or gender roles, with males slaughtering / butchering livestock and females more involved in preparing meat (14). in contrast, no gender differences were reported in turkey or kazakhstan (3,9). although age was not a risk factor in other regions (2,3), persons 5064 years of age in this study were at higher risk for infection (table 2), reflecting changing sociocultural practices related to an agrarian lifestyle. although the true cause of the increase in hca cases is unknown, it is probably due to a combination of factors related to decreased public health funding and agricultural reform resulting in a shift from collectivization to private ownership (1,5,13). these factors, coupled with limited veterinary control and the cessation of compulsory livestock vaccination, have played plausible roles in the increased incidence of hca. livestock cases were out of sync temporally and spatially with human cases, indicating anthropocentric reporting or high incidence from relatively few animals, although differences in the aggregation of livestock cases limit the inference of spatial synchrony. controlling hca requires controlling the disease in livestock (1,2,9) and highlights the need for a one health approach. our findings can be used to formulate public health interventions aimed at controlling anthrax in livestock and increasing awareness of the disease, particularly in urban areas. given the limited resources available, future efforts should focus on high - risk areas for livestock surveillance and control, such as targeted vaccination campaigns (15). | we assessed the occurrence of human cutaneous anthrax in georgia during 2010-2012 by examining demographic and spatial characteristics of reported cases. reporting increased substantially, as did clustering of cases near urban centers. control efforts, including education about anthrax and livestock vaccination, can be directed at areas of high risk. |
multiple sclerosis (ms) is a chronic disease that is associated with demyelination of neurons and affects the myelin sheath of neurons in the central nervous system.the cause of this disease is still unknown, but it seems that activation of immune mechanisms against myelin antigen is involved in this regard. ms usually occurs at ages 20 - 40 and affects women more than men. currently, 2 million people worldwide, including 400,000 americans, are afflicted with ms. in iran, 15 - 30 out of the emergence of this disease is usually coincident with situations such as family formation, career choice, and providing financial security. ms threatens a person s independence and ability to effectively participate in society, on the one hand, and its prognosis and unpredictable periods considerably affect quality of life and health, on the other hand. ms patients are unable to find an appropriate way to solve problems and achieve approaches to improve their quality of life and health. in chronic diseases, quality of life is highly influenced by severity and duration of disease and drugs taken by the patient. since ms patients are no exception, complications of this disease, in addition to causing physical discomforts, imposes mental, social, and economic pressures on patients and their family. moreover, this disease leads to a decline in personal and social performance of patients and thereby greatly affects their roles in life, job status, and quality of life (physical and mental health). studies have shown that ms patients have a significantly lower quality of life compared to healthy people and patients with other chronic diseases such as epilepsy, diabetes, and rheumatoid arthritis. the findings show that fatigue is one of the most common mental symptoms of ms which negatively affects quality of life, as highest prevalence of fatigue in ms patients is 70 - 90%. ms patients make complaints of fatigue as the worst and most debilitating symptom of their condition. in fact, ms - related fatigue is a common abnormal lack of energy which dramatically limits one s physical and mental ability, regardless of the level of neurological disability. this fatigue affects the cognitive and motor abilities manifested as loss of energy, illness, motor weakness, and difficulty in maintaining the focus. ms - related fatigue can also negatively affect employment, socialization process, and coping with the disease and thereby reduce the level of daily activities and quality of life of patients. as reported by previous studies, clinical manifestations of ms play an important role in adaptation of patients to the disease. hence, psychotherapy interventions aimed at these manifestations can help patients to better cope with this disease. the best treatment for improvement of quality of life and reduction of fatigue is to train patients on self - care and help them adapt to changes in their physical and mental status. one of the most common treatment for decreasing of anxiety, depression, and stress and improving life quality is mindfulness - based stress reduction program (mbsr) that has been presented by kabat - zinn in medical centre of massachusetts university in 1979. this is an 8-week program which every session lasts 2 hours and mindfulness skills for coping with life stresses and raising awareness of the present moment are taught and include thought - related meditation, relaxation and hatha yoga. mindfulness means paying attention to the present time in a special, targeted, and without judgment way. one of the main goals of this program is promoting the health and reducing stress. one of the main concepts of mindfulness training is that to be honest to ourselves and our feelings. along with increasing individual s ability to mindfulness, the person can accurately detect what is happening in the body and mind as it is happening in the environment around.it seems that the mbsr and conscious yoga in a group can be useful for ms patients. it is believed that group therapy can be used effectively for most mental disorders, because group therapy is a process through in which the insight of individuals is improved. in addition, patients in a group feel more powerful and have a higher level of self - confidence. many studies have been conducted on the useful effects of mbsr and mindfulness - based cognitive therapy (mbct) on chronic diseases such as low back pain, fibromyalgia, breast cancer, and prostate cancer. the results of studies conducted by gu., about the effect of mindfulness on ms patients have indicated that mindfulness caused no significant change in the management of symptoms among ms patients. however, the effect of mbsr and conscious yoga program on ms patients has not been studied in the previous studies. in this program, mindfulness means to pay attention to real objectives and being in the present moment in a purposeful manner and devoid of judgment. mbsr is basically designed to facilitate the compliance with and adaptation to medical conditions and considered a self - regulatory approach to stress reduction, emotion management, and health promotion. if ms patients regularly do conscious yoga exercises, they will experience some states of balance, relaxation, and in - depth awareness. since high fatigue and low quality of life are prevalent among ms patients and this disease poses many psychological problems not only for patients but also for their family, the present research aimed to study the effect of group mindfulness - based stress reduction and conscious yoga program on the quality of life and fatigue severity among patients with ms. the present research was a quasi - experimental study with pretest - posttest design with control and intervention groups and was conducted by authorising from the honorable management of tehran m.s association. the statistical population included all male and female ms patients aged 20 - 45 who were a member of ms society of tehran, 24 of whom were selected as the sample based on the convenience sampling method and the inclusion criteria. the inclusion criteria were ms diagnosis by a specialist (neurologist), being in the relapse - suppression stage of the disease, independency on wheelchair, a minimum educational attainment of high school diploma, non - use of psychotropic drugs and psychological treatments throughout the study, and being aged 20 - 45. the exclusion criteria were absence of patients in yoga and meditation classes before and during the study, affliction with acute or chronic problems like severe depression, psychosis, and so on, not obtaining a written consent for participation in the study, and absence of more than two sessions in the program. the samples were selected by convenience sampling method and were randomly (a random sample is drawn from a population by using a probability device. we put everyone s name on a slip of paper, mix thoroughly, and select the number of names we need. the use of a probability device to select the subjects allows us to make valid generalizations from the sample to the population) assigned into experimental and control groups. the adequacy of sample size was examined by basic statistical methods (krejcie and morgan table, g - power software) and results of the previous studies, with a confidence level of 95% and error of 5%. significance level of less than 5% error rate that we are committed to reject the null hypothesis. then, after obtaining written informed consent from all participant, pre - test evaluations were conducted. data were collected by following tools. a : clinical version of the structured clinical interview for axis i disorders in dsm - iv (scid - i / cv) (diagnostic and statistical manual of mental disorders - iv) : this is a standardized tool for assessment of the major psychiatric disorders based on the definitions and criteria of dsm - iv which has been developed for clinical and research purposes. implementation of scid - i / cv requires clinical judgment of the interviewer on the interviewee s responses therefore, the interviewer should have enough knowledge on psychopathology. an acceptable validity and reliability of this tool for instance, a cohen s kappa coefficient of above 0.7 has been reported in the diagnostic reliability between raters. according to the findings of another study, the validity of this tool was confirmed by experts and its test - retest reliability, in a week interval, was reported to be 0.95. this tool has been translated into farsi and its validity and reliability has been confirmed by sharifi., in iran. b : fatigue severity scale (fss) : fatigue severity scale has been developed by krupp., for assessing the severity of fatigue in chronic diseases such as multiple sclerosis and lupus. this scale measures fatigue in 9 items based on 7-point likert scale and higher scores indicate greater fatigue. cronbach s alpha of this scale for healthy people, ms patients, and lupus patients has been reported to be 0.88, 0.81, and 0.89, respectively. the internal consistency (cronbach s alpha) and test - retest reliability of the farsi version of this scale have been obtained equal to 0.98 and 0.93, respectively. in the present study, test - retest reliability (within two months) and internal consistency (cronbach s alpha) of fss c : multiple sclerosis quality of life- 54 (msqol-54) : this scale has been developed by barbara vickrey for ms patients. it consists of 54 items, modified by adding 18 items to the 36-item short questionnaire, and measures quality of life in 13 areas. each subscale is scored from 0 to 100 and score of each area is determined by calculating the mean scores. two important scores are the score of physical dimensions and score of mental dimensions of quality of life. in a study on ms patients, subscales of quality of life presented a good internal consistency with cronbach s alpha coefficients between 0.75 and 0.96. to assess the reliability by using the test - retest method, correlation coefficient for subscales was obtained between 0.66 and 0.96. the validity of msqol-54 have been assessed and confirmed by faculty member of tarbiat modarres university and medical universities of tehran, iran, and shahid beheshti. split method was used to examine the reliability of this scale and pearson correlation coefficient was used for determining the correlation level. the reliability of msqol-54 using internal consistency and cronbach s alpha was obtained 0.86 and 0.88, respectively in patients with ms. after sincere cooperation of tehran ms society with authors, all members of this society were invited to voluntarily attend in a meeting session in summer 2014. in this meeting, those willing to participate in the study were invited to an interview. after interview and screening, 24 ms patients were selected as the sample considering the inclusion and exclusion criteria. after filling out the questionnaire as the pretest, subjects were assigned into experimental and control groups. it should be noted that 3 subjects in the experimental group showed a decline withdrawal. in the experimental group, a group mbsr program and conscious yoga were performed in 8 two - hour sessions. the content of each session are as follow : first session : the introduction of automatic guidance system / knowing how to use present moment awareness of bodily sensation, thoughts and emotions in reducing stress / practicing eating raisins (object attention training), giving feedback and discussion about the practice / three - minute breathing, giving assignment for next week and distributing leaflets of the first session and cds of meditation. second session : re - examining body workout/ giving feedback and discussion about examining body workout/ practicing breathing mindfulness meditation/ yoga stretching exercise / distributing leaflets of the second session and cds of meditation. third session : having conscious sitting with awareness of breathing(the sitting meditation)/practicing yoga exercises(in the hospital chapel)/ practicing three -minute breathing /distributing leaflets of the third session and video tape of yoga practices. fourth session : re - examining body workout /practicing exercises related to conscious yoga(in the hospital chapel)/5-minute practicing of seeing or hearing/ re - practicing conscious session with awareness of breathing and body/ distributing leaflets of fourth session and cds of meditation. fifth session : practicing breathing /re - practicing conscious session(awareness of breathing, body, sounds and thoughts)/explaining the stress and identifying participants reactions to stress / examining awareness of pleasant and unpleasant events on feeling, thoughts and bodily sensations / practicing conscious yoga exercises / practicing 3-minute breathing /distributing leaflets. sixth session : practicing conscious yoga / practicing sitting meditation (mindfulness of sounds and thoughts)/distributing leaflets of the sixth session and number 4 video tape to participants. seventh session : practicing mountain meditation / sleep hygiene/ repeating exercises of the previous session / making a list of enjoyable activities / distributing leaflets of the seventh session. eighth session : examining body workout /overview of program / examining and discussing programs /practicing stone, beads and marbles meditation. at the end of all therapy sessions in addition, due to ethical considerations, subjects in the control group were explained that the implementation of this treatment is will be done for them for a certain period of time (two months). however, they were put in the waiting list and will be invited for treatment after this period. in order to calculate the mean and standard deviation, descriptive statistics were used and data analysis was done using the univariate analysis of covariance. considering the normal distribution of data and homogeneity of variances, the univariate analysis of covariance was used for analysis. data were analyzed by spss ver.13 software. before participating patients in the study, the necessary information on the objects, the duration of study, and how to cooperate during the study was given to the patient and his / her attendant then after receipting them through the written informed consent as written form, they were selected as a research unit. the research units were assured the collected information and results of all patients will remain confidential and they may canceled if they do nt want to go on. it was provided a necessary call to contact with researcher if necessary. there was no significant difference between control and experimental groups in terms of mean of demographic characteristics such as sex, age, education, and marital (p < 0.05). the mean age of the patients in the intervention and control groups was 32.50 (5.14) and 32.13 (5.04) years, respectively. according to table 2, the results of the multivariate analysis of covariance showed that there was a significant difference between subjects in the experimental and control groups in terms of mean score of some subscales of quality of life including physical health (p=0.001), role limitations due to physical and emotional problems, energy, emotional well - being, health distress, health perception, satisfaction with sexual function, overall quality of life (p<0.05), and fatigue severity (p<0.001). but about 3 subscales of pain (p=0.10), social performance (p=0.08) and health change (p=0.66) therefore, it can be stated that mbsr and conscious yoga caused improvement of the above - mentioned subscales of quality of life and reduction of fatigue severity in subjects of the experimental group compared to those in the control group. univariate analysis of covariance, statistically significant the present study was approved by regional ethics committee at behavioral sciences research center, shahid beheshti university of medical sciences (ethics code : 1287). the present research aimed to study the effect of group mbsr and conscious yoga program on the quality of life and fatigue severity among patients with ms. the study findings revealed that group mbsr and conscious yoga program have significantly improved the physical and mental quality of life in ms patients. shapiro., concluded that mbsr not only causes a reduction in anxiety and depression symptoms in ms patients but also enhances the quality of life and well - being of individuals.. senders., showed that, conventionally mind - body therapies (mindfulness) can be safe and helpful for treating common ms symptoms and especially non - pharmacological options, but for treating specific ms symptoms, it is needed more rigorously designed trials of mind - body interventions to increase our understanding and awareness on it.as an explanation to these findings, it can be acknowledged that group mbsr and conscious yoga program, through meditation and mindfulness techniques, can increase self - acceptance and self - awareness abilities and thereby improve the quality of life. mindfulness (focus and automatic exercises) and relaxation training (body scan, relaxation and hatha yoga), as stress management skills, should be regularly and permanently used in patients everyday life. studies have shown that mindfulness has been effective in improvement of mental and physical well - being and reduction of physical symptoms. in another explanation, it can be noted that mindfulness is a balanced and non - judgmental feeling of awareness which helps the clarification and acceptance of physical and emotional phenomena. therefore, mindfulness training in patients with ms, who suffer from physical and mental problems, leads to the acceptance of physical and emotional symptoms and this acceptance reduces their excessive sensitivity to their problems. in this regard, the results show that emotional inhibition is considered a negative strategy for regulation of the emotion causing chronic diseases such as ms and cognitive - emotional assessment is regarded a positive strategy for regulation of the emotion leading to the improved mental and physical quality of life and reduction of physical symptoms of specific diseases such as ms. in contrast, our results are not consistent with the results of dodd., and rampelo., have shown that quality of life after exercise training program changes as well, but no significant changes. in the present study, mbsr program has not caused significant difference in some of quality of life subscales including pain, social performance and health change. because it seems that low number of research participants is the reason for achieving different results in few quality of life subscales. lack of significant difference in social functioning subscale between experimental and control group can be affected by different factors such as family relationships, culture, attitude and economic condition in individuals. like our study, henderson., carletto., and ulrichsen., showed that the treatment of mbsr highly affected on the quality of life, well - being, and hope in traumatic brain injury and ms samples and significantly in reducing subscales of depression, anxiety, and hostility. as the study findings show, group mbsr and conscious yoga program significantly reduced scores of fatigue severity in ms patients. in addition, the results of arch and krask showed that the participants who had 15 minutes of focused breathing (as a common exercise in mbsr) reported to suffer from less mental fatigue. yet, fatigue severity causes loss of physical strength and reduction of physical functions on the one hand and reduces the psychological aspects related to quality of life in patients on the other hand., showed that fatigue and depression can significantly impact ms patients ' quality of life. furthermore, for improving quality of life in ms patients ; effective interventions may help, as target fatigue and depression. in addition, the results of a study conducted by flegal., indicated that yoga improves the quality of life and reduce fatigue in these individuals. as an explanation to the findings, it can be stated that mindfulness training means focusing one s awareness on the present moment, while calmly acknowledging and accepting one s feelings, thoughts, and bodily sensations. in the presence of mind, one learns to be aware of his / her own mental state at any moment and focus on a certain issue. participants continuously focus on different parts of their body and feelings related to any area of the body are carefully observed. then, in a relaxed and wide awake state with eyes closed, they focus on breathing senses. individuals are encouraged to pay attention to their inner experiences at any moment, such as physical sensations, thoughts, and feelings. in addition, focusing on environmental aspects such as sights and sounds are encouraged. mindfulness should create the attitude in individuals that have a non - judgmental acceptance in the face of affairs and issues. participants also apply mindfulness and focus during everyday activities such as walking, standing, and eating, be aware of their moods at any moment, and observe without judgment whenever emotions, feelings, and cognitions are processed. when participants find that the mind is wandering in thoughts, memories or speculations, they direct their attention to the present moment without regard to the content and nature of them. therefore, participants are taught to pay attention to their thoughts and feelings but do not stick with their content. one of the outcomes of mindfulness exercises is that individual find that most of feelings, thoughts and emotions are fluctuating or fleeting. on the other hand, these exercises of mindfulness in the present time reduce fatigue severity, because individuals lose energy in the process of past and future thoughts and continuously repeat it during daily activities. one of the limitation of this research was the lack of treatment follow - up due to time limitations. therefore, it is recommended that the results of treatment to be followed up in future studies. in this research the group mindfulness - based stress reduction program and consciousness yoga improved the mental and physical aspects of quality of life and reduced the fatigue in patients with ms. we thanks all ms society staff in tehran and patients who has participated in this study is appreciated. | introduction : the chronic nature of multiple sclerosis (ms), have can leave devastating effects on quality of life and fatigue. the present research aimed to study the effect of group mindfulness - based stress reduction (mbsr) and conscious yoga program on the quality of life and fatigue severity among patients with ms. methods : this study was quasi - experimental with intervention and control groups. the statistical population included all members to ms society of tehran province, 24 of whom diagnosed with ms were selected as the sample based on the inclusion criteria. the subjects were randomly assigned into the test group (12 patients) and the control group (12 patients). ms quality of life-54 (msqol-54) and fatigue severity scale (fss) were used for data collection. subjects in the test group underwent a mbsr and conscious yoga program in 8 two - hour sessions. the data were analyzed using the spss ver.13 software. results : the study findings showed that there was a significant difference between subjects in the experimental and control groups in terms of mean score of some subscales of quality of life including physical health, role limitations due to physical and emotional problems, energy, emotional well - being, health distress, health perception, and satisfaction with sexual function, overall quality of life, and fatigue severity. conclusion : the results show that the program is effective in reduction of fatigue severity and improving some subscales of quality of life in ms patients. hence, this supportive method can be used as an effective way for improving quality of life and relieving fatigue in ms patients. |
for this study a priority intervention is one that has been shown, based on the best scientific data available, to deliver large population health benefits at a relatively low cost. population - wide interventions, many of which are based on the implementation of healthy public policies, legislation and regulation that reduce the main shared modifiable risk factors for ncds (16), are a highly cost - effective approach to targeting ncds (5, 7). while some individual - based treatment interventions have been identified as being high - impact and relatively cost - effective (5), this study focused on population - wide measures. this also excludes interventions that rely primarily on personal behaviour change through social marketing or individual counselling at the community or health care facility levels and publications focused on epidemiological evidence, surveillance, and biomedical science. the selected interventions are grouped into three categories : tobacco control, healthy diets and physical activity, and reducing harmful alcohol use (table 1). the priorities for tobacco control in lmics are four key measures specified in the world health organization (who) framework convention on tobacco control (fctc) that can prevent millions of deaths each year at a cost of less than us$1 per person per year : tobacco price increases, legislation of health warnings, smoking bans in both the work place and public places, and bans on tobacco advertising and promotion (17, 18). the category healthy diets and physical activity encompasses approaches that promote healthy living by improving the dietary environment, for example, by undertaking salt reduction efforts (1822) and by modifying the built environment to facilitate active commuting through walking and cycling (23). due to the anticipated low number of articles on physical activity priority interventions these articles were grouped with healthy diets to facilitate easier analysis and comparison across intervention types. the priority interventions to reduce harmful alcohol use are alcohol price increases through taxation, restricting the availability of retail alcohol, and implementing legislation to ban alcohol marketing and sponsorship (24). non - communicable disease interventions identified as priority interventions and examined in bibliometric analysis the research articles included in this study were located through a systematic journal database search using 33 unique search strings that were developed for comprehensiveness and tested for relevance and scope. the names of the 144 lmics on the world bank 's country classification list (25) were incorporated into the search string, along with generic terms used to refer to this group of countries or their regions (e.g. developing country, low- and middle - income country, sub - saharan africa). the search strings were applied to the fields of article title, abstract and keywords for the document categories of articles, articles in press, reviews and conference papers in scopus, a large multidisciplinary, multi - lingual research database with numerous open access publications (26). though the search terms were english - language, all non - english records in scopus have an english title and abstract (27) and thus were covered in the search. the searched time period encompassed the 12 years from january 1, 2000, to december 31, 2011, and was conducted on february 13, 2012. the bibliographic records found were exported and combined in a single microsoft excel spreadsheet where duplicates were eliminated for a total of 11,211 unique articles. excel was used for all data coding, data management, and analysis. using the title and abstract, each publication was assessed based on three inclusion criteria : one, a focus on the development, implementation or evaluation of one or more of the priority interventions ; two, the research was set in one or more low- or middle - income country (lmic) ; and three, the publication was a research article and not a news report, letter or editorial, etc. a total of 525 articles three inclusion criteria and made up the data set. using the bibliographic information (i.e. title, abstract, and authors institutional affiliations) and, if necessary, the full length article, each included article was reviewed and coded according to several dimensions (table 2). following a calibration exercise on a subset of articles, of the 525 included publications, 72.9% were articles, 22.6% reviews, and 4.5% conference papers. approximately 86.3% were published in english, 8.2% spanish, 2.5% portuguese, and 4.4% were published in other languages (summed values are greater than 100% since some publications were available in multiple languages). coding categories for included articles three options : tobacco control, healthy diets and physical activity, and reducing harmful alcohol use if the article focused on more than one risk factor, article was coded for all applicable options if the article focused on more than one country (e.g. two lmics or one lmic and one hic), article was coded as multiple countries regional classification is determined by the world bank 's country classification list if the article was a multiple countries study and all the countries were in the same region, it was coded for that region. if the multiple countries were in more than one region or and the countries are in different regions, the article was coded as multiple regions. however, a multiple countries study where all the countries are in the same region was coded as that region there were seven regional groups : east asia & pacific, europe & central asia, latin america & caribbean, middle east & north africa, south asia, sub - saharan africa and multiple regions could be any country in the world each country was designated as either a low- or middle - income country (lmic) or a high - income country (hic), according to the world bank 's listing, permitting authors to be coded as either an lmic author or ' hic author using excel, the findings were tallied by year of publication, region of focus, type of the intervention by risk factor, first author 's country, and first author type (lmic author or hic author). sub - tallies were calculated for each year, region group, country, intervention category, first author 's country, and author type. for this study a priority intervention is one that has been shown, based on the best scientific data available, to deliver large population health benefits at a relatively low cost. population - wide interventions, many of which are based on the implementation of healthy public policies, legislation and regulation that reduce the main shared modifiable risk factors for ncds (16), are a highly cost - effective approach to targeting ncds (5, 7). while some individual - based treatment interventions have been identified as being high - impact and relatively cost - effective (5), this study focused on population - wide measures. this also excludes interventions that rely primarily on personal behaviour change through social marketing or individual counselling at the community or health care facility levels and publications focused on epidemiological evidence, surveillance, and biomedical science. the selected interventions are grouped into three categories : tobacco control, healthy diets and physical activity, and reducing harmful alcohol use (table 1). the priorities for tobacco control in lmics are four key measures specified in the world health organization (who) framework convention on tobacco control (fctc) that can prevent millions of deaths each year at a cost of less than us$1 per person per year : tobacco price increases, legislation of health warnings, smoking bans in both the work place and public places, and bans on tobacco advertising and promotion (17, 18). the category healthy diets and physical activity encompasses approaches that promote healthy living by improving the dietary environment, for example, by undertaking salt reduction efforts (1822) and by modifying the built environment to facilitate active commuting through walking and cycling (23). due to the anticipated low number of articles on physical activity priority interventions these articles were grouped with healthy diets to facilitate easier analysis and comparison across intervention types. the priority interventions to reduce harmful alcohol use are alcohol price increases through taxation, restricting the availability of retail alcohol, and implementing legislation to ban alcohol marketing and sponsorship (24). the research articles included in this study were located through a systematic journal database search using 33 unique search strings that were developed for comprehensiveness and tested for relevance and scope. the names of the 144 lmics on the world bank 's country classification list (25) were incorporated into the search string, along with generic terms used to refer to this group of countries or their regions (e.g. developing country, low- and middle - income country, sub - saharan africa). the search strings were applied to the fields of article title, abstract and keywords for the document categories of articles, articles in press, reviews and conference papers in scopus, a large multidisciplinary, multi - lingual research database with numerous open access publications (26). though the search terms were english - language, all non - english records in scopus have an english title and abstract (27) and thus were covered in the search. the searched time period encompassed the 12 years from january 1, 2000, to december 31, 2011, and was conducted on february 13, 2012. the bibliographic records found were exported and combined in a single microsoft excel spreadsheet where duplicates were eliminated for a total of 11,211 unique articles. using the title and abstract, each publication was assessed based on three inclusion criteria : one, a focus on the development, implementation or evaluation of one or more of the priority interventions ; two, the research was set in one or more low- or middle - income country (lmic) ; and three, the publication was a research article and not a news report, letter or editorial, etc. a total of 525 articles three inclusion criteria and made up the data set. using the bibliographic information (i.e. title, abstract, and authors institutional affiliations) and, if necessary, the full length article, each included article was reviewed and coded according to several dimensions (table 2). following a calibration exercise on a subset of articles, of the 525 included publications, 72.9% were articles, 22.6% reviews, and 4.5% conference papers. approximately 86.3% were published in english, 8.2% spanish, 2.5% portuguese, and 4.4% were published in other languages (summed values are greater than 100% since some publications were available in multiple languages). coding categories for included articles three options : tobacco control, healthy diets and physical activity, and reducing harmful alcohol use if the article focused on more than one risk factor, article was coded for all applicable options if the article focused on more than one country (e.g. two lmics or one lmic and one hic), article was coded as multiple countries regional classification is determined by the world bank 's country classification list if the article was a multiple countries study and all the countries were in the same region, it was coded for that region. if the multiple countries were in more than one region or and the countries are in different regions, the article was coded as multiple regions. however, a multiple countries study where all the countries are in the same region was coded as that region there were seven regional groups : east asia & pacific, europe & central asia, latin america & caribbean, middle east & north africa, south asia, sub - saharan africa and multiple regions could be any country in the world each country was designated as either a low- or middle - income country (lmic) or a high - income country (hic), according to the world bank 's listing, permitting authors to be coded as either an using excel, the findings were tallied by year of publication, region of focus, type of the intervention by risk factor, first author 's country, and first author type (lmic author or hic author). sub - tallies were calculated for each year, region group, country, intervention category, first author 's country, and author type. among the 525 included articles there was a clear increase in the number of articles published each year on the topic of ncd priority interventions in lmics (fig. 1), increasing from 20 articles in 2000 to 96 articles in 2011 (a 480% growth). (it is expected that the number of 2011 articles will increase as more articles published in that year become available through electronic journal databases.) the growth was moderate for the first 10 years (a 270% increase from 2000 to 2009), with some fluctuation in yearly numbers. the year 2010 marked a substantial jump in publications (105 articles) with almost double the 2009 quantity, an increase that continued in 2011 with 96 publications. of all identified articles on ncd priority interventions in lmics, 38.3% were published in the last 2 years and nearly half (48.6%) in the past 3 years. each research article addressed one or more non - communicable disease priority intervention and focused on one or more low- or middle - income country. there is a substantial difference in the number of articles addressing each geographical region (fig. three regional groups received the greatest focus : latin america & caribbean (127 articles, representing 24.2% of the total articles included), east asia & pacific (121 articles, 23.0%), and multiple regions (112 articles, 21.3%). three regions had less than half as many articles : europe & central asia (60 articles, 11.4%), south asia (47 articles, 9.0%), and sub - saharan africa (47 articles, 9.0%). lmics in the middle east & north africa were the least frequently addressed in the target research articles (11 articles, 2.1%). when examining the distribution of articles according to each region 's total population size, latin america & caribbean has the highest number of articles per capita, while sub - saharan africa, middle east & north africa, and south asia have the lowest number of articles per capita. each region 's peak yearly output has occurred in either 2010 (latin america & caribbean with 35 articles ; east asia & pacific, 31 ; multiple regions, 21 ; sub - saharan africa, 8 ; europe & central asia, 14), or 2011 (south asia, 12 ; middle east & north africa, 4), creating the escalation in articles for the years 2010 and 2011. percent of articles set in a low- or middle - income country within a particular geographical region. of the total number of included research articles, the percentage of them (and number) focusing on one or more low- or middle - income country within a particular geographical region. articles focusing on more than one region are classified as multiple regions. in every regional group except middle east & north africa, one or two countries dominate the focus of the publications. for east asia & pacific, almost half of the region 's articles focus on china (60 of 121 articles), a recent increase that established east asia & pacific as the region with the highest number of articles for the year 2011. thirty - four articles out of the 47 south asia publications (72.3%) focus on india and for europe & central asia, the russian federation leads (15 of 60 publications, 25%). some countries regional dominance was consistent with their proportion of the region 's population. for example, mexico and brazil were the topic of nearly half of the latin america & caribbean articles (63 of 127) and contain approximately half of the region 's lmic population. in other countries and regions, china has a smaller proportion of articles in comparison with their percentage of the region 's population. south africa is an opposite extreme ; the country has less than 6% of sub - saharan africa 's population but almost 50% of the region 's articles focus on south africa (23 of 47). in each of these five regions, articles focusing on more than one country within the region (classified as multiple countries) ranked third or higher as the country of focus for the region. of the 525 articles, 365 (69.5%) addressed tobacco control interventions, 130 (24.9%) addressed healthy diets and physical activity (of which 16 covered physical activity) and 94 (18.0%) addressed reducing harmful alcohol use. most of the articles focused on one intervention category (475 and 90.5%) ; 6.8% of articles (36 articles) focused on two risk factors ; 2.7% (14 articles) focused on all three groups of risk factors. approximately 86.8% (317 articles) of all tobacco control publications focused on only that topic, 72.3% of healthy diets and physical activity addressed only that topic and 68.1% of reducing harmful alcohol use. among the tobacco control publications, the most common priority interventions were smoke - free spaces and tobacco taxes. in the early stages of the examined time period, there was relatively little difference in the number of publications for each risk factor (table 3), the growth of tobacco control publications quickly outpaced the other risk factors, undergoing a 1,014% increase from the year 2000 to 2011. publications addressing priority healthy diet and physical activity interventions have grown steadily, with a 650% increase from 2000 to 2011. the top producing years for research publications on alcohol interventions were 2010 (17 articles), 2007 (13 articles), and 2000 (12 articles). in the year 2000, alcohol intervention was the highest number of articles out of the three intervention groups. yearly articles for each intervention group as a percentage of total number of included articles tobacco control was the leading topic in all geographic regions (fig. 3), with east asia & pacific as the region having the highest number of tobacco control articles (80.2% of the region 's articles). latin america & caribbean tied with multiple regions for the second highest number of tobacco control intervention articles, but had the lowest percent of articles on tobacco control (59.8%). healthy diets and physical activity articles ranked second place in five of seven regional groups (latin america & caribbean, east asia & pacific, multiple regions, south asia, and middle east & north africa). latin america & caribbean had the highest number of articles addressing this topic and tied with multiple regions for highest percent of articles on this topic). articles on reducing the harmful use of alcohol ranked second among the two regional groups (europe & central asia and sub - saharan africa). thirty - five percentage of articles on europe & central asia and 29.8% of articles on sub - saharan africa addressed alcohol interventions. the regional group of middle east & north africa had no articles on priority interventions for reducing harmful alcohol use. percent of articles on each intervention by risk factor for geographical regions. of the total number of included research articles, the percentage of them (and number) addressing a non - communicable disease priority intervention. interventions are grouped in three categories : tobacco control, healthy diets and physical activity, and reducing harmful alcohol use. multiple regions. of the 525 included articles, a large proportion had a first author whose institutional affiliation was with a high - income country (hic) (51.2%, 269 articles) ; 48.8% of first authors (256 articles) provided an institutional affiliation in a lmic (table 4). the yearly output values indicate a trend in the past 3 years toward a higher proportion of lmic authors. this increase in lmic authorship coincided with recent increased first authorship from researchers with institutions in china, mexico, and india. in 2010 and 2011 authors from these three countries were first authors on 25.4% of all publications for those years. yearly articles by country income classification for each article 's first author country of institutional affiliation the united states was overwhelmingly the most common country of institutional affiliation (annexe 1). the five most frequently listed high - income countries for first author institutional affiliation were united states (30.3% of all articles), united kingdom (5.7%), australia (3.8%), canada (2.5%), and switzerland (2.1%). the 11 most frequently listed lmics for first author institutional affiliation were china (6.9%), india (5.5%), brazil (5.1%), mexico (4.6%), south africa (4.4%), argentina (2.5%), thailand (2.5%), turkey (2.1%), pakistan (1.7%), chile (1.5%), and the russian federation (1.5%). authorship was examined for each regional group by comparing the proportion of lmic authors to hic authors in a region 's publications (fig. middle east & north africa is the regional group with the highest percent of lmic first authors (90.0%, nine of 11 articles). however, given the small number of articles from this region, it is possible that this difference could diminish with a larger sample. articles addressing multiple regions had by far the lowest rate of lmic authorship (12.5% ; 14 of 112 articles). articles focused on the regions of south asia and latin america & caribbean had high lmic authorship rates (83 and 61.4%) and contributed a large volume of lmic authored papers. there was no difference in lmic versus hic authorship when articles were compared across intervention groups. comparison of country income classification for first authors countries of institutional affiliation. for each geographical region of focus, a comparison of the percent of first authors who have an institutional affiliation in a low- or middle - income country versus the percent of first authors with a high - income country institutional affiliation. among the 525 included articles there was a clear increase in the number of articles published each year on the topic of ncd priority interventions in lmics (fig. 1), increasing from 20 articles in 2000 to 96 articles in 2011 (a 480% growth). (it is expected that the number of 2011 articles will increase as more articles published in that year become available through electronic journal databases.) the growth was moderate for the first 10 years (a 270% increase from 2000 to 2009), with some fluctuation in yearly numbers. the year 2010 marked a substantial jump in publications (105 articles) with almost double the 2009 quantity, an increase that continued in 2011 with 96 publications. of all identified articles on ncd priority interventions in lmics, 38.3% were published in the last 2 years and nearly half (48.6%) in the past 3 years. each research article addressed one or more non - communicable disease priority intervention and focused on one or more low- or middle - income country. there is a substantial difference in the number of articles addressing each geographical region (fig. three regional groups received the greatest focus : latin america & caribbean (127 articles, representing 24.2% of the total articles included), east asia & pacific (121 articles, 23.0%), and multiple regions (112 articles, 21.3%). three regions had less than half as many articles : europe & central asia (60 articles, 11.4%), south asia (47 articles, 9.0%), and sub - saharan africa (47 articles, 9.0%). lmics in the middle east & north africa were the least frequently addressed in the target research articles (11 articles, 2.1%). when examining the distribution of articles according to each region 's total population size, latin america & caribbean has the highest number of articles per capita, while sub - saharan africa, middle east & north africa, and south asia have the lowest number of articles per capita. each region 's peak yearly output has occurred in either 2010 (latin america & caribbean with 35 articles ; east asia & pacific, 31 ; multiple regions, 21 ; sub - saharan africa, 8 ; europe & central asia, 14), or 2011 (south asia, 12 ; middle east & north africa, 4), creating the escalation in articles for the years 2010 and 2011. percent of articles set in a low- or middle - income country within a particular geographical region. of the total number of included research articles, the percentage of them (and number) focusing on one or more low- or middle - income country within a particular geographical region. multiple regions. in every regional group except middle east & north africa, one or two countries dominate the focus of the publications. for east asia & pacific, almost half of the region 's articles focus on china (60 of 121 articles), a recent increase that established east asia & pacific as the region with the highest number of articles for the year 2011. thirty - four articles out of the 47 south asia publications (72.3%) focus on india and for europe & central asia, the russian federation leads (15 of 60 publications, 25%). some countries regional dominance was consistent with their proportion of the region 's population. for example, mexico and brazil were the topic of nearly half of the latin america & caribbean articles (63 of 127) and contain approximately half of the region 's lmic population. in other countries and regions, there is an imbalance. china has a smaller proportion of articles in comparison with their percentage of the region 's population. south africa is an opposite extreme ; the country has less than 6% of sub - saharan africa 's population but almost 50% of the region 's articles focus on south africa (23 of 47). in each of these five regions, articles focusing on more than one country within the region (classified as multiple countries) ranked third or higher as the country of focus for the region. of the 525 articles, 365 (69.5%) addressed tobacco control interventions, 130 (24.9%) addressed healthy diets and physical activity (of which 16 covered physical activity) and 94 (18.0%) addressed reducing harmful alcohol use. most of the articles focused on one intervention category (475 and 90.5%) ; 6.8% of articles (36 articles) focused on two risk factors ; 2.7% (14 articles) focused on all three groups of risk factors. approximately 86.8% (317 articles) of all tobacco control publications focused on only that topic, 72.3% of healthy diets and physical activity addressed only that topic and 68.1% of reducing harmful alcohol use. among the tobacco control publications, the most common priority interventions were smoke - free spaces and tobacco taxes. in the early stages of the examined time period, there was relatively little difference in the number of publications for each risk factor (table 3), the growth of tobacco control publications quickly outpaced the other risk factors, undergoing a 1,014% increase from the year 2000 to 2011. publications addressing priority healthy diet and physical activity interventions have grown steadily, with a 650% increase from 2000 to 2011. the top producing years for research publications on alcohol interventions were 2010 (17 articles), 2007 (13 articles), and 2000 (12 articles). in the year 2000, alcohol intervention was the highest number of articles out of the three intervention groups. yearly articles for each intervention group as a percentage of total number of included articles tobacco control was the leading topic in all geographic regions (fig. 3), with east asia & pacific as the region having the highest number of tobacco control articles (80.2% of the region 's articles). latin america & caribbean tied with multiple regions for the second highest number of tobacco control intervention articles, but had the lowest percent of articles on tobacco control (59.8%). healthy diets and physical activity articles ranked second place in five of seven regional groups (latin america & caribbean, east asia & pacific, multiple regions, south asia, and middle east & north africa). latin america & caribbean had the highest number of articles addressing this topic and tied with multiple regions for highest percent of articles on this topic). articles on reducing the harmful use of alcohol ranked second among the two regional groups (europe & central asia and sub - saharan africa). thirty - five percentage of articles on europe & central asia and 29.8% of articles on sub - saharan africa addressed alcohol interventions. the regional group of middle east & north africa had no articles on priority interventions for reducing harmful alcohol use. percent of articles on each intervention by risk factor for geographical regions. of the total number of included research articles, the percentage of them (and number) addressing a non - communicable disease priority intervention. interventions are grouped in three categories : tobacco control, healthy diets and physical activity, and reducing harmful alcohol use. of the 525 included articles, a large proportion had a first author whose institutional affiliation was with a high - income country (hic) (51.2%, 269 articles) ; 48.8% of first authors (256 articles) provided an institutional affiliation in a lmic (table 4). the yearly output values indicate a trend in the past 3 years toward a higher proportion of lmic authors. this increase in lmic authorship coincided with recent increased first authorship from researchers with institutions in china, mexico, and india. in 2010 and 2011 authors from these three countries were first authors on 25.4% of all publications for those years. yearly articles by country income classification for each article 's first author country of institutional affiliation the united states was overwhelmingly the most common country of institutional affiliation (annexe 1). the five most frequently listed high - income countries for first author institutional affiliation were united states (30.3% of all articles), united kingdom (5.7%), australia (3.8%), canada (2.5%), and switzerland (2.1%). the 11 most frequently listed lmics for first author institutional affiliation were china (6.9%), india (5.5%), brazil (5.1%), mexico (4.6%), south africa (4.4%), argentina (2.5%), thailand (2.5%), turkey (2.1%), pakistan (1.7%), chile (1.5%), and the russian federation (1.5%). authorship was examined for each regional group by comparing the proportion of lmic authors to hic authors in a region 's publications (fig. middle east & north africa is the regional group with the highest percent of lmic first authors (90.0%, nine of 11 articles). however, given the small number of articles from this region, it is possible that this difference could diminish with a larger sample. articles addressing multiple regions had by far the lowest rate of lmic authorship (12.5% ; 14 of 112 articles). articles focused on the regions of south asia and latin america & caribbean had high lmic authorship rates (83 and 61.4%) and contributed a large volume of lmic authored papers. there was no difference in lmic versus hic authorship when articles were compared across intervention groups. comparison of country income classification for first authors countries of institutional affiliation. for each geographical region of focus, a comparison of the percent of first authors who have an institutional affiliation in a low- or middle - income country versus the percent of first authors with a high - income country institutional affiliation. this study found that there is still relatively little published research on ncd priority interventions in lmics, with only 525 articles published in the last 12 years, a contribution that could be insufficient for influencing the local adoption and implementation of the interventions most promising for tackling the ncd epidemic. other research has shown that a low publication level is a result of little activity on target interventions since publication outputs have been shown to follow the development and practice of interventions (28). in view of this, the scarcity of publications found in this study indicates that research activity on ncd priority interventions in lmics is at a minimal level, especially in regards to ncd risk factors other than tobacco use. the current research focus on tobacco control priority interventions relative to healthy diets, physical activity, and alcohol reduction priority interventions may largely reflect the fact that the case for action is currently different for each specific risk factor. the fctc laid out clear global tobacco control priorities and 175 countries have now signed and ratified the treaty (29). while the evidence base for priority interventions related to healthy diets, physical activity, and alcohol reduction is now rapidly expanding on a global scale, the level of political commitment and resources devoted to implementing them remain relatively low, especially in lmics. experts are exploring what lessons can be learned from tobacco control efforts that can be applied to address other ncd risk factors (30). there are calls, for example, to use an approach similar to tobacco with alcohol through a framework convention on alcohol control (31). this is a misconception which persists and continues to influence research agendas, government agendas, and funding opportunities as infectious diseases remain the focus of development efforts. other health - related bibliometric analyses focusing on lmics show greater levels of research intensity on hiv / aids, malaria and tuberculosis, global health challenges that are already firmly on the development agenda. for example, from 1998 to 2009 indian scientists alone had published 2,786 articles on malaria research (32). when ncd research is conducted, a high proportion of studies focus on epidemiology and surveillance and not on intervention research (33, 34). it may also be that ncd intervention research focuses on non - priority interventions or interventions that target communities or special populations. for example, during our review of the over 11,000 articles yielded in our literature search, we observed a high number of publications addressing smoking cessation counselling or health education interventions for school - based populations. though these types of approaches have a role in an integrated effort to reduce ncds, current evidence indicates that in resource - constrained settings their implementation should not come at the expense of population - wide interventions (5). though global efforts have been made to create a prioritised research agenda, the resulting outcomes have a seemingly inclusive approach to them, creating the chance that the true priorities may be lost (35, 36). within some countries and regions, capacity for developing and implementing an ncd intervention research agenda remains relatively limited and challenges in publishing peer - reviewed research persist. this study highlights that researchers from hic institutions have a strong presence in ncd research conducted on lmics. with the exception of tropical medicine (37), other branches of health research, including medicine (38), palliative care (39), and nutrition (40), have found similar results. in addition to the relative newness of ncd prevention research, locally led research in lmics is hindered by low numbers (per capita) of qualified public health researchers (41), poor access to research funding and challenges with the publication of research results (42), which includes limited capacity for writing articles for peer - reviewed journals (43), insufficient time to prepare manuscripts and possible manuscript selection bias (44, 45). research topics of high - priority for lmic researchers do not always appeal to journal editors who are catering to an audience of hic researchers (42), as may be the experience of lmic researchers from countries at earlier stages in the ncd epidemic who wish to publish research covering topics addressed in prior research in high - income countries. despite the overall low number of publications identified through this study, the increase in yearly outputs provides encouraging evidence that research activity on ncd priority interventions in lmics has increased over the 12-year period examined. furthermore, lmic researcher leadership has increased both as a proportion of articles and in the number of publications, a growth that represents not only increased publishing but also local activity within lmics on the development and implementation of evidence - based solutions. in our study as in other studies, lmic authorship was highest in researchers from middle - income countries (46). however, considering that among the lmics with a high proportion of ncd many are middle - income countries (47), this income group 's high proportion of ncd intervention research may be appropriate and equitable. during the examined time period the high number of articles published in 2010 and 2011 may be a result of the maturation of work initiated years earlier and it remains to be seen whether research on ncd priority interventions in lmics will continue to increase and accelerate especially with the passing of the political declaration of the un high level meeting on ncds (4). the articles and data used in this study were limited by the results obtained through the use of a specific set of search terms at the time of searching the journal database scopus. though scopus has a high number of non - english publications, there might be better databases that are more comprehensive for foreign language publications. scopus does not provide information on the authors nationalities and since many researchers are based in countries different from their nationality and some researchers have multiple institutional affiliations, it can not be assumed that the country of institution is the author 's country of birth. we chose to focus on the first author 's characteristics since first authorship represents research leadership ; we did not examine the number of authors on each publication and co - authorship characteristics. this quantification of research articles is only a proxy for a measurement of research activity. it is possible that there is actually a substantial amount of research that has been conducted on ncd priority interventions in lmics, but it is not being published or is published in sources not available through our scopus searches. since we could not track what article data was primary or secondary research, it may be that a large proportion of the articles we found are re - analysing the same data sets. if this is the case, our analysis overestimates the degree of ncd research activity. the strength of this study lies in the comprehensive nature of the search strategy and specificity of the data coding. we reviewed over 11,000 articles to identify only those articles that met the inclusion criteria of informing a set of carefully - selected ncd priority interventions based in one or more of the 144 low- or middle - income countries. to our knowledge, this is the first study to use this method to conduct a bibliometric analysis on this topic. we believe that by using this approach, our findings provide a solid estimation of the state of research publication on ncd priority interventions in lmics. research activity around ncd prevention priority interventions in lmics, while increasing, remains minimal and is particularly underdeveloped in certain topics and geographical regions. though there is still a need for better epidemiologic evidence on diseases and risk factors, there should also be a clear emphasis on local intervention and implementation research. given the limited resources available for ncd research, there is a need to strike a balance between generating evidence to understand the problem versus generating evidence more directly related to the implementation and evaluation of population - wide interventions. the less than perfect picture about the scale of the problem should not be used as an argument to postpone cost - effective measures for ncd prevention or the commitments laid out in the un high - level meeting on ncds will not be met. finally, the global research funding agenda should be influenced to provide more resources for ncd priority intervention research in lmics. in general, there is a huge gap in the research funding available for developed countries versus developing countries (54). the political declaration adopted at the un high level meeting on ncds succeeded in firmly establishing ncds as a global development issue requiring urgent action. however, development agencies have been slow to follow recommendations calling for an adjustment of current funding programs and the increased availability of resources targeting ncds. funding models should make it possible to take advantage of situations where policy changes have created a natural experimental setting (5557) and should also encourage and support local ownership, local leadership, and local translation of evidence to policy in order to increase the uptake of results by decision makers. amanda jones is supported by a research award from the international development research centre (idrc) ; robert geneau is an employee of idrc. the publication fee was funded by the non - communicable disease prevention program, idrc. | introductionaction is urgently needed to curb the rising rates of non - communicable diseases (ncds) in low- and middle - income countries (lmics) and reduce the resulting social and economic burdens. there is global evidence about the most cost - effective interventions for addressing the main ncd risk factors such as tobacco use, unhealthy diets, physical inactivity, and alcohol misuse. however, it is unknown how much research is focused on informing the local adoption and implementation of these interventions. objectiveto assess the degree of research activity on ncd priority interventions in lmics by using bibliometric analysis to quantify the number of relevant peer - reviewed scientific publications.methodsa multidisciplinary, multi - lingual journal database was searched for articles on ncd priority interventions. the interventions examined emphasise population - wide, policy, regulation, and legislation approaches. the publication timeframe searched was the year 20002011. of the 11,211 articles yielded, 525 met the inclusion criteria.resultsover the 12-year period, the number of articles published increased overall but differed substantially between regions : latin america & caribbean had the highest (127) and middle east & north africa had the lowest (11). of the risk factor groups, tobacco control led in publications, with healthy diets and physical activity and reducing harmful alcohol use in second and third place. though half the publications had a first author from a high - income country institutional affiliation, developing country authorship had increased in recent years.conclusionswhile rising global attention to ncds has likely produced an increase in peer - reviewed publications on ncds in lmics, publication rates directly related to cost - effective interventions are still very low, suggesting either limited local research activity or limited opportunities for lmic researchers to publish on these issues. more research is needed on high - priority interventions and research funders should re - examine if intervention research is enough of a funding priority. |
recent advances in stem cell research have brought the possibility of using somatic stem cells for organ regeneration one step closer to realization. newly developed organs can then be used in clinical organ replacement. however, anatomically complicated organs such as the kidney have proven more refractory to stem cell - based regenerative techniques. the kidney retains the potential to regenerate if the damage is not too severe, and the kidney structure remains intact. it was previously believed that bone marrow - derived stem cells could differentiate into renal - resident cells and participate in kidney regeneration after renal ischemia / reperfusion injury [1, 2 ] ; however, recent studies have suggested that the number of bone marrow - derived cells that engraft injured tubules and develop into functional renal tissue is very low and, thus, their overall contribution to renal repair would be minor in the setting of acute kidney injury [3, 4 ]. also, during the progression of chronic renal failure, bone marrow - derived stem cells supplied by intravenous administration located in the kidney and contributed to attenuate renal fibrosis. however, in cases of irreversible damage to the kidney, as can occur with long - term dialysis, the kidney structure is totally lost and, therefore, these cell therapy approach seems not to be applicable. thus, any application of regenerative medicine in end - stage renal disease will require the de novo development of an entire functional kidney. in terms of a functional whole kidney, chan. reported the first attempt to develop a functional whole renal unit by developing a transplantable pronephros in xenopus. xenopus presumptive ectoderm, which becomes epidermis and neural tissue in normal development, contains pluripotent stem cells and can be differentiated into multilineage tissue cells under particular culture conditions. the researchers designed conditions for the induction of pronephric tubule - like structures from animal caps that involved a combination of activin and retinoic acid for only 3 hours. this pronephros - like tissue was transplanted into bilaterally nephrectomized tadpoles to test for its functional integrity as a pronephros. bilateral pronephrectomy induces severe edema in tadpoles owing to their inability to excrete internal water, and tadpoles die within 9 days ; transplantation of the pronephros - like unit at least partially corrected the edema, and tadpoles survived for up to 1 month. to our knowledge, this study is the only one to develop a transplantable functional whole kidney unit in vitro, although the pronephros structure formed was too primitive for any clinical application in humans. since then, many attempts have been made worldwide to regenerate whole kidneys applicable for mammals from stem cells. the present article reviews the challenges and recent advances in renal stem cell research and discusses its potential for clinical application for kidney regeneration in humans. woolf. reported that the metanephros may continue to grow if it is transplanted into the renal cortex of host mice. the developed transplant contains vascularized glomeruli and mature proximal tubules and may have the capacity for glomerular filtration. collecting duct - like structures appear to extend from the transplant toward the papilla of the host. although there is no direct evidence that these collecting duct - like structures connect with the host 's collecting system or that the transplant functions in a manner similar to that of a native kidney, the results provide a rationale for the existence of renal stem cells in the metanephros from early embryos, which may be a potential source of transplantable regenerated kidney. potential problems with this system include questions as to the suitability of the renal capsule of dialysis patients as a transplant site, given the significant disruptions to this area, including the vasculature, and the fact that space limitations beneath the renal capsule may hinder the growth of transplants. these researchers also used the metanephros as a source of transplantable artificial kidney but transplanted the graft into a host omentum, which is not confined by a tight organ capsule or disturbed by dialysis. metanephroi from rat, mouse, and pig were implanted into the omenta of the rat or mouse, and the success of transplanting across xenogeneic barriers and the extent of differentiation into a functional nephron were evaluated. this experiment was based on previous studies showing minimal immunogenicity in tissues harvested at earlier gestational stages, including the metanephros. in cases of allotransplantation (rat metanephros to rat omentum), transplants assumed a kidney - like shape in situ that was approximately one - third the diameter of the native kidney. with xenotransplantation, the pig metanephros grew and differentiated into renal tissue in the rat omentum, showing glomeruli, proximal tubules, and collecting ducts ; however, immunosuppressants were required because without these agents the transplants disappeared soon after transplantation. what is interesting is that the graft pig metanephros was slightly larger in volume (diameter and weight) as compared to that of a normal rat kidney. furthermore, the transplanted tissue produced urine and, surprisingly, after intact ureteroureterostomy with the ureter of the kidney that was removed, anephric rats started to void and showed a prolonged lifespan. this success holds the promise of a new and practical therapeutic strategy for kidney disease in which a functional renal unit can be established by implanting xenometanephros together with immunosuppression. recently, osafune. reported an in vitro culture system in which a single sall1 highly expressing cell from the metanephric mesenchyme forms a 3d kidney structure consisting of glomeruli and renal tubules. more recently, unbekandt and davies reported that single - cell suspensions dissociated from metanephros can reaggregate to form a organotypic renal structure if they are treated with an inhibitor of rho - associated kinase. these systems are useful for examining mechanisms of renal progenitor differentiation and suggest the possibility of developing a whole kidney from a single stem cell. one possible means of creating an optimal niche for pluripotent stem cells to differentiate into a kidney is to provide an artificial scaffold upon which the stem cells can function. this strategy was used recently by ott. to successfully develop a functional artificial rat heart using a cadaveric heart as the artificial scaffold. a whole - heart scaffold with intact 3d geometry and vasculature this decellularized heart was then repopulated with neonatal cardiac cells or rat aortic endothelial cells and cultured under physiological conditions to simulate organ maturation. the injected neonatal cardiac cells formed a contractile myocardium, which performed the stroke function. cadaveric scaffolds have also been used to develop transplantable liver and lung using mature hepatocyte and alveolar epithelial cells, respectively [15, 16 ]. after transplantation of the recellularized grafts, they were successfully functioning as a hepatocyte and gas exchanger. however, pluripotent stem cells should be used if this technique is used for kidney regeneration, because the kidney is composed of multiple cell types, such as tubular epithelial cells and glomerular cells. for this purpose es cells are undifferentiated pluripotent stem cells isolated from the inner cell mass of blastocysts. es cells can differentiate into several cell types of mesodermal, endodermal, and ectodermal lineages, depending on culture conditions. because human es cells can differentiate into kidney structures when injected into immunosuppressed mice [18, 19 ], studies have focused on identifying the precise culture conditions that allow the differentiation of es cells into renal cells in vitro. to this end, schuldiner. showed that human es cells cultured with 8 growth factors, including hepatocyte growth factor (hgf) and activin a, differentiated into cells expressing wt-1 and renin. more recently, mouse es cells stably transfected with wnt4 (wnt4-es cells) were differentiated into tubular structures expressing aqp-2 in the presence of hgf and activin a. an ex vivo culture system in which es cells (or es - derived cells) were cultured in the developing metanephros was also investigated to determine the capacity of es cells to differentiate into kidney cells integrated into the kidney structure. rosa26 es cells were stimulated with developmental signals in the microenvironment of a developing kidney following injection into a metanephros cultured in vitro. es cell - derived, -galactosidase - positive cells were identified in epithelial structures resembling renal tubules with an efficiency approaching 50%. based on these results, kim and dressler attempted to identify the nephrogenic growth factors needed to induce differentiation of es cells into renal epithelial cells. when injected into a developing metanephros, es cells treated with retinoic acid, furthermore, vigneau. showed that es cells expressing brachyury, a marker of mesoderm specification, became a renal progenitor population in the presence of activin a. after injection into a developing metanephros, these cells might be incorporated into the blastema cells of the nephrogenic zone. in addition, a single injection of the same cells into developing live newborn mouse kidneys saw them stably integrated into proximal tubules with normal morphology and polarization for 7 months without teratoma formation. taken together, these data highlight es cells as a potential source of renal stem cells to be differentiated into renal - resident cells. based on this series of studies, ross and coworkers after decellularization, murine es cells were infused via the renal artery and were found to localize to the vasculature and glomeruli, with subsequent migration into the tubules. although renal function is yet to be examined, this approach may be useful for the production of an entire kidney. to address the adverse effects of immunosuppressants, lanza. attempted to develop a self - kidney unit to eliminate the immune response problem and, therefore, the need for immunosuppression. to generate a histocompatible kidney for artificial organ transplantation, lanza. used a nuclear transplantation technique in which dermal fibroblasts isolated from adult cow were transferred into enucleated bovine oocytes and then transferred non - surgically into progestin - synchronized recipients. after 6 - 7 weeks, metanephroi were isolated from embryos, digested using collagenase, and expanded until the desired cell number was obtained by culture in vitro. these cells were then seeded onto a specialized polymer tube, followed by implantation into the same cow from which the cells had been cloned. what is striking is that this renal device seeded with cloned metanephric cells appeared to produce a urine - like liquid, whereas those without cells or those seeded with allogeneic cells did not. histological analysis of the explant revealed a well - developed renal structure composed of organized glomeruli - like, tubule - like, vascular elements that were clearly distinct from one another but continuous within the structure. therefore, these renal tissues appeared integrally connected in a unidirectional manner to the reservoirs, resulting in the excretion of urine into the collecting system. although it is not clear how the cultured cells digested from the metanephros gained polarity and self - assembled into glomeruli and tubules, this technique successfully used nuclear transplantation for renal regeneration without the risks and long - term effects of immunosuppression. it was previously reported that injection of normal es cells into the blastocysts of recombination - activating gene 2 (rag-2)-deficient mice, which have no mature b or t lymphocytes, generated somatic chimeras with es cell - derived mature b and t cells. injection of wild - type es cells into the blastocysts of sall1-null mice, which lack kidneys, generated metanephroi composed exclusively of es cell - derived differentiated cells. this strategy, however, was assessed to be unsuitable for human clinical application, because it is quite difficult to generate interspecific chimeras in livestock. many groups have sought to generate interspecific chimeras between mouse and rat, achieving success with chimeric preimplantation embryos in vitro but failing with live chimeric animals [28, 29 ]. extraembryonic lineage cells like trophectoderm, derived from xenogenic embryos, may suffer from inhibition of implantation on exposure to the host uterus, suggesting that only cells of preblastocyst origin can contribute to the extraembryonic lineage cells. in this context ips cells were produced by takahashi and yamanaka from cultured somatic cells by retroviral transfer with oct3/4, sox2, c - myc, and klf4, which are transcription factors associated with pluripotency. rate - reprogrammed ips cells were subsequently derived by the reactivation of fbx15, oct4, or nanog, all of which carry a drug resistance marker inserted into the respective endogenous locus by homologous recombination or a transgene containing the nanog promoter. furthermore, ips cells were also isolated based on their es - like morphology, without the use of transgenic donor cells, and the therapeutic potential of autologous ips cells in a mouse model of a hereditary disease has been reported. recently, human ips cells were successfully induced from adult skin fibroblasts using the same 4 factors as detailed above. ips cells are epigenetically and biologically indistinguishable from normal es cells, and, therefore, it is suggested that they be used to produce interspecific chimeras. kobayashi and coworkers recently reported successful regeneration of rat pancreas in mouse via an interspecific blastocyst injection of ips cells. they injected rat ips cells into pdx-1 (pancreatogenesis - disabled) mouse blastocysts and found that the newborn chimera of rat and mouse processed almost entirely ips - derived pancreas. this success proves that when an empty developmental niche for an organ is provided (as with the pdx1 mouse and the pancreatic niche), ips cell - derived cellular progeny can occupy that niche and can compensate developmentally for the missing contents of the niche, forming a complicated organ composed almost entirely of cells derived from donor ips cells even if the blastocyte complementation involves different species. furthermore, instead of tetraploid complementation, espejel and coworkers generated chimeric mice that experienced progressive liver repopulation with ips cell - derived hepatocytes postnatally using blastocytes deficient in fumarylacetoacetate hydrolase. the entire liver was composed of ips cell - derived hepatocytes by the time the mice reached adulthood. they replicated the unique proliferative capabilities of normal hepatocytes and were able to regenerate liver after transplantation and two - thirds partial hepatectomy. these successes strongly suggest that blastocyst complementation is one of the most promising strategies for regenerating the kidney. however, these systems are not available for clinical use at this time, because it is not possible to generate the vascular and nervous systems. in addition, the more important ethical issues involved with manipulating blastocysts with ips cells remain unresolved. nonetheless, this success highlights the rationale that the eventual clinical application of kidney regeneration must depend on developmental programming. we attempted to develop an entire kidney using scaffolding from mesenchymal stem cells (mscs). it has been shown that mscs have the capacity for site - specific differentiation into various cell types of mesodermal lineage, including chondrocytes, adipocytes, myocytes, cardiomyocytes, bone marrow stromal cells, and thymic stromal cells [38, 39 ] ; this suggests that they may also differentiate into kidney residential cells. initially, we tried to reconstruct an organized and functional kidney structure using a developing heterozoic embryo as an organ factory. during embryogenesis, a single fertilized cell develops into a whole body within 266 (for humans) or 20 days (for rodents). this neonate has every organ positioned correctly, indicating that a single fertilized ovum contains a blueprint from which the body, including the kidney, can be built. borrow this programming of a developing embryo by applying the stem cells at the niche of organogenesis. during development of the metanephros, the metanephric mesenchyme initially forms from the caudal portion of the nephrogenic cord and secretes glial cell line - derived neurotrophic factor (gdnf), which induces the nearby wolffian duct to produce a ureteric bud. the metanephric mesenchyme consequently forms the glomerulus, proximal tubule, loop of henle, and distal tubule, as well as the interstitium, as a result of reciprocal epithelial - mesenchymal induction between the ureteric bud and metanephric mesenchyme. for this epithelial - mesenchymal induction to occur, gdnf must interact with its receptor, c - ret, which is expressed in the wolffian duct. we hypothesized that gdnf - expressing mscs may differentiate into kidney structures if positioned at the budding site and stimulated by numerous factors spatially and temporally identical to those found in the developmental milieu. to investigate this hypothesis, we initially injected human mesenchymal stem cells (hmscs) into the developing metanephros in vitro, although this was not sufficient to achieve kidney organogenesis. this suggests that hmscs must be placed before the metanephros begins to develop in a specific, defined embryonic niche to allow their exposure to the repertoire of nephrogenic signals required to generate the organ. this can be best achieved by implanting hmscs into the nephrogenic site of a developing embryo. therefore, we established a culture system in combination with a whole - embryo culture system, followed by metanephric organ culture (figure 1). this relay culture allows the development of the metanephros from structures present before budding until the occurrence of complete organogenesis ex utero. in this system, embryos were isolated from the mother before budding and were grown in a culture bottle until the formation of a rudimentary kidney so that it could be further developed by organ culture in vitro. using this combination, rudimentary kidneys continued to grow in vitro, as assessed by the observation of fine tubulogenesis and ureteric bud branching, indicating that the metanephros can finish developing ex utero even if the embryo is dissected prior to sprouting of the ureteric bud. based on these results, hmscs were microinjected at the site of budding and subjected to relay culture. before injection, the hmscs were genetically engineered to express gdnf temporally using adenovirus and were labeled with the lacz gene and dioctadecyl-3,3,3,3-tetramethylindocarbocyanine. viral free manipulation can also be performed using thermoreversible gdnf polymer. soon after injection, the embryos, together with the placenta, were transferred to the incubator for whole embryos. after the relay culture, x - gal - positive cells were scattered throughout the rudimentary metanephros and were morphologically identical to tubular epithelial cells, interstitial cells, and glomerular epithelial cells. in addition, reverse transcription - polymerase chain reaction revealed the expression of several podocyte- and tubule - specific genes. these data demonstrated that using a xenobiotic developmental process for growing embryos allows endogenous hmscs to undergo an epithelial conversion and be transformed into an orchestrated nephron consisting of glomerular epithelial cells (podocytes) and tubular epithelial cells that are linked. we then examined the next issue in the successful development of an artificial kidney de novo : urine production. this requires that the kidney formed have the vascular system of the recipient ; therefore, the primary system must be modified to allow for vascular integration from the recipient to form a functional nephron. described above, according to which the metanephros can grow and differentiate into a functional renal unit with integration of recipient vessels if it is implanted into the omentum. we confirmed that the omentum is a suitable site for vascular integration by comparing several transplantation sites. we transplanted metanephroi from different embryonic stages into the omentum and found after 2 weeks that only metanephroi from rat embryos older than embryonic day 13.5 developed successfully. therefore, the relay culture system was modified such that organ culture was terminated within 24 hours, by which time the metanephros was allowed to develop sufficiently and the kidney primordia could be transplanted into the omentum (termed modified relay culture system). as a result, to examine the origin of the vasculature in the neokidney, we generated lacz - transgenic rats as recipients so that donor- and recipient - derived tissues would be distinguishable by x - gal assay. the usefulness of genetically marked transgenic (tg) rats in organogenesis has been confirmed previously, using gfp as a marker, in the rat. thus, we chose to use the lacz tg rat, which expresses the marker gene ubiquitously, to determine the vascular origin in our experiments. using the modified relay culture, we found that several vessels from the omentum appeared to be integrated into the neokidney, and x - gal staining showed that most of the peritubular capillaries were lacz positive, suggesting that they were of recipient origin. these data indicated that the vasculature of the neokidney in the omentum originated from the host and communicated with the host circulation, suggesting its viability for collecting and filtering the host blood to produce urine. to verify this what is surprising is that the structure developed hydronephrosis, confirming the ability of the neokidney to produce urine. if the ureters were buried under the fat of the omentum, the urine would have no egress, resulting in hydronephrosis. analysis of the liquid from the expanded ureter showed higher concentrations of urea nitrogen and creatinine than the recipient sera in the native urine. therefore, we concluded that the neokidney that developed in the omentum was capable of producing urine by filtering the recipient 's blood. production of erythropoietin (epo) to maintain erythropoiesis is another important function of the kidney. we found 3 major findings regarding the hmsc - derived neokidney in rats : (i) human epo is produced in rats harboring an organoid derived from autologous human bone marrow cells, (ii) human epo production is stimulated by the induction of anemia, suggesting that this system preserves the normal physiological regulation of epo levels, and (iii) levels of epo generated by the neokidney in response to anemia in rats in which native epo was suppressed are sufficient to restore red cell recovery to a rate similar to that in control rats. taken together, these data suggest that the neokidney derived from hmscs may be able to fulfill all renal functions, including urine production. this work could lead to a new generation of therapy modalities for kidney disease. as mentioned earlier, kidney is formed by a reciprocal interaction between the metanephric mesenchyme and the ureteric buds and is, thus, derived from a collecting system (such as the ureters and the collecting ducts), which is a derivative of the ureteric bud, and other components (such as the glomeruli and tubules, which are derivatives of the metanephric mesenchyme). our current system may regenerate the derivatives of the metanephric mesenchyme but not the derivatives of the ureteric bud. concerning this issue, we assessed whether mscs are able to differentiate into the ureteric bud progenitor ; we did this using chick embryos, which can be more easily manipulated and cultured as compared to mammalian embryos. when hmscs expressing pax2 were transplanted into the chicken ureteric bud progenitor region, they migrated caudally with the elongating wolffian duct and were integrated into the wolffian duct epithelia and then expressed lim1, showing that they can differentiate into the wolffian duct cells under the influence of local xenosignals. this suggests that the whole kidney may be rebuilt by transplanting hmscs at the suitable time and part for derivatives of the metanephric mesenchyme and ureteric bud (figure 3). based on our successes, we are currently investigating the possibility of experimenting on a larger animal, that is, the pig, because the porcine kidney has almost the same volume as the human kidney. the ultimate size of the developed metanephros appears to be imprinted during the very early stages of development in the host embryo, as the metanephroi of larger animals transplanted into the omenta of smaller hosts develop into organs of larger volume (diameter and weight) as compared to that of a normal host kidney. we hope that this system will facilitate the development of larger organs that are more suitable for use in humans (figure 4). in this article, we reviewed recent research on using renal stem cells to treat kidney diseases and proposed their possible application in kidney regeneration. we know that prior to the total loss of renal structure, kidney function can be restored by reactivating quiescent renal stem cells and/or supplying renal stem cells expanded sufficiently in vitro. such stem cells may contribute to kidney regeneration, leading to recovery from organ failure. we believe that emerging knowledge of kidney stem cell biology and developmental biology will enable the development of new therapeutic strategies for kidney regeneration that aim to regain damaged components of the kidney or restore kidney function. | significant advances have been made in stem cell research over the past decade. a number of nonhematopoietic sources of stem cells (or progenitor cells) have been identified, including endothelial stem cells and neural stem cells. these discoveries have been a major step toward the use of stem cells for potential clinical applications of organ regeneration. accordingly, kidney regeneration is currently gaining considerable attention to replace kidney dialysis as the ultimate therapeutic strategy for renal failure. however, due to anatomic complications, the kidney is believed to be the hardest organ to regenerate ; it is virtually impossible to imagine such a complicated organ being completely rebuilt from pluripotent stem cells by gene or chemical manipulation. nevertheless, several groups are taking on this big challenge. in this manuscript, current advances in renal stem cell research are reviewed and their usefulness for kidney regeneration discussed. we also reviewed the current knowledge of the emerging field of renal stem cell biology. |
a significant cause of medical error in health care is poor communication [1, 2 ]. for the past three years, miscommunication has been identified as one of the most frequently identified root causes of sentinel events reported to the joint commission, with 82% of the sentinel events in 2010 identifying communication as the primary root cause. according to rucker and colleagues, up to 75% of clinical decisions differences in status and discipline may be part of the confounding factors associated with poor communication. this includes various job categories (supervisor / supervisee), expertise level (novice / expert), and discipline (doctor / nurse). although variations in status and discipline are abundant in the healthcare environment, it is critical for all members of the healthcare team to communicate effectively with one another, despite these differences. in an effort to understand how status and discipline differences may impact perceptions of communication, the purpose of this study was to explore the impact of nursing characteristics (e.g., job category, education, experience, and expertise) on perceptions of communication in the acute care setting, while also considering the impact of the work environment. the act of communication between nurses and physicians is a central activity in healthcare, and a failure to communicate has been linked with poor quality and patient errors. effective communication and collaboration among nurses and physicians has been shown to result in improved quality of care [6, 7 ], increased patient and professional satisfaction [6, 8 ], and greater intent to stay [8, 9 ]. specifically, the presence of poor communication among nurses and physicians may result in an almost doubled risk for mortality and length of stay among intensive care unit (icu) patients [8, 10, 11 ]. manojlovich and colleagues, while surveying nurses in 25 icus, found timeliness of communication to be inversely correlated with pressure ulcer development (r =.38, p =.06). in addition, higher variability of understanding which can occur with a variety of education and experience levels was significantly correlated with ventilator associated pneumonia (r =.43, p =.03). current research evaluating the impact of nursing characteristics on communication has resulted in mixed findings. miller and colleagues, while examining the presence of individual characteristics and perceptions of nurse - physician interactions, found nurses with greater than six years of experience rated openness of communication and problem solving higher than less experienced nurses (p =.04). foley and colleagues found a significant relationship between nurse - physician relationships and nursing expertise and the number of professional certifications (p =.05). in contrast, mark and colleagues evaluated the relationship between nurse staffing, professional practice, and several patient outcomes and found no significant relationship between nurse staffing variables (education, experience, and skill mix) and professional practice. although nursing characteristics such as education and expertise level may determine levels of communication and collaboration (i.e., physicians may respect nurses who are more educated), values supported in the environment in which care is delivered may also impact communication patterns. when the values of the organization include trust, respect, and teamwork, collaborative relationships are more likely to ensue. according to schmalenberg and colleagues, who conducted interviews with physicians and nurses, environmental values play a role in fostering the development of effective communication / collaboration. one interviewee described collaboration as a prevailing unit and organizational norm based on mutual trust, respect, teamwork, and open communication. findings from focus groups of nurses and physicians conducted by simpson and colleagues identified an agreement among participants that many interactions and experiences with one another over time were the basis for trust and confidence in one another. in summary, the current literature has failed to identify specific communication strategies that have consistently impacted quality of care and patient safety. this may be due to the failure to consider individual characteristics, such as education, experience, and expertise levels, as well as the values present in the environment. in addition, little work has been done beyond the critical care areas icus, emergency rooms, and operating rooms. for this reason, the purpose of this study was to identify the relationship between individual nursing characteristics (education, experience, expertise, and job type), environmental values, and perceptions of communication with the healthcare team in the acute care setting. this study used a cross - sectional, descriptive design with a convenience sample of four in - patient medical surgical units in two midwestern hospitals. a total of 161 registered nurses (rns) and 18 licensed practice nurses (lpns) were eligible for study participation. based on a power analysis (multiple regression with 11 predictors) with an of 0.05, medium effect size (f =.15), and power (1) =.80 the number of questionnaires returned was 135, with response rates for the units ranging from 69% to 82% (overall response rate of 76%). the survey tool used to identify perceptions of communication was a modified version of shortell 's organizational management in the intensive care unit survey. the entire survey included 44 questions asking nurses ' perceptions of communication, collaboration, the environmental values present in their respective units, as well as nursing demographic information. for the purpose of this study, the questions regarding communication, environmental values, and nursing demographics were used. communication openness refers to the degree to which physicians or nurses are able to say what they mean ' when speaking with members of the other group, without fear of repercussions or misunderstanding [19, page 712 ]. four questions on the survey instrument addressed the openness of communication among nurses and four additional questions considered the openness of communication between nurses and physicians. each item was measured by a 7-point likert scale with anchors 1 (strongly disagree) to 7 (strongly agree). communication accuracy refers to the degree to which nurses and physician believe in the accuracy of the information conveyed to them by the other party. four questions on the survey instrument addressed the accuracy of communication among nurses and four additional questions considered accuracy of communication between nurses and physicians. each item was measured by a 7-point likert scale (1, strongly disagree, to 7, strongly agree). reliability estimations in this study also supported consistency in the items : open communication among nurses (= 0.89) and between nurses and physicians (=.92), accuracy of communication among nurses (=.79) and between nurses and physicians (=.84). nursing characteristics included in this study were education, years of experience, and self - reports of expertise. level of education was measured categorically with the following options being present : diploma, associate 's degree, bachelor 's degree master 's degree, or higher. nursing experience was measured through a single - item question : how many years have you been working in your current job category ? the final measure of nursing expertise required the nurses to identify their perceived level of expertise on a 10-point scale with anchors novice (1) to expert (10). respondents were asked to circle the number on the scale that best reflects his / her level of expertise. other nursing characteristics included in the study were job category (e.g., lpn or rn), unit of employment, and shift worked (e.g., day, evening, night, or rotating). the previous literature has identified environmental values as important precursors to the development of effective communication and collaborative relationships, including trust, respect, power equity, and time availability. questions related to each of these values was developed and measured by a single question on a 7-point likert scale with anchors strongly agree (1) to strongly disagree (7). data from this study supported a highly positive correlation between the four factors, as noted by the following correlation values : trust and respect (r =.82), trust and time (r =.54), trust and status (r =.67), respect and time (r =.60), respect and status (r =.66), and finally time and status (r =.62) (p =.001 for each bivariate association). this supported the development of an overall environmental value variable, which was the combined average of each of the unit value items (per nurse). reliability estimation for the environmental value variable was considered well above the acceptable range (= 0.88). prior to distribution of the survey, nurses were presented with a 10-minute overview of the study. this overview was given to each unit at four different times of the day, in an effort to attain maximum participation. upon completion of the in - service, each nurse received a copy of the survey. a reminder was placed in each nurse 's mailbox two weeks after the initial survey distribution in an effort to increase response rate. a secure box was also placed in the nursing lounge of each unit for completed surveys. descriptive statistics were used to examine the demographics of nurses ; analysis of variance (anova) and chi - square tests were performed to test homogeneity of unit characteristics. to identify the difference in communication between nursing characteristics, hierarchical multiple regression analysis was conducted to identify predictors of openness and accuracy of communication. a test for multicollinearity was conducted using tolerance and vif ; no multicollinearity was identified. residual analysis identified a normal distribution, linearity of residual, and homoscedasticity of errors. nursing respondents (n = 135) were split nearly equally between hospital a (n = 74, 55%) and hospital b (n = 61, 45%). the majority of the nurses were rns (n = 119, 88%) while 15 were lpns (11%). seventy - three (54.1%) nurses had earned an associate / diploma degree and 58 (43%) had a baccalaureate degree. sixty - eight nurses worked the day shift and 43 nurses worked the night shift. work experience as nurses was on average 12.30 years, ranging from 6 weeks to 46 years. self - rating of expertise level was 6.98, with a range of 1 (novice) to 10 (expert). comparisons of nurse educational level, work experiences, and expertise levels by study units revealed no difference in educational level and expertise level (table 1). a significant difference in work experiences was noted, with unit a having the highest work experiences as nurses, followed by unit b (p =.046). as noted in table 2, nurses (e.g. rns and lpns) perceived communication to be more open among nurses than between nurses and physicians (t = 10.227, p <.001). however, nurses perceived that communication was more accurate with physicians than with nurses (t = 2.18, p =.031). when comparing openness and accuracy of communication between job category (e.g., rn and lpn) (table 2), lpns perceived significantly higher levels of open communication with nurses than did rns (p =.042). in contrast, rns noted higher levels of accuracy of communication among nurses than did their lpn counterparts (p <.001). no significant difference between lpns and rns was noted in openness and accuracy of communication with physicians. hierarchical multiple regression analysis was conducted to identify the variables which predicted openness of communication (table 3). individual nursing characteristics were entered in step 1, explaining 8.4% of the variation in open communication among nurses (nonsignificant). after entry of the unit and environmental value variables (step 2), the total variance explained by the model was 33.1% (f = 5.25, p <.001). only environmental values (p <.001) and unit (p =.009 and p =.011) were significant predictors of open communication among nurses. specifically, the more positive the environmental values (e.g., high trust, respect, etc.), the greater the perception of communication openness among nurses. in addition, unit was a significant predictor, such that nurses on units c and d noted lower levels of communication openness than the referent group (unit a). a second analysis, with dependent variable open communication between nurses and physicians, was computed with independent variables job category, education, shift, experience, and expertise entered in step 1. specifically, higher education levels were associated with greater perceptions of communication openness with physician colleagues. in step 2, the final model explained 64.6% of the variance (f = 19.396, p <.001). the significant predictors of open communication with physician included the evening shift (p =.048), years of experience as a nurse (p =.035), environmental values (p <.001), and unit (unit 4, p =.022). nurses working the evening shift perceived lower openness of communication compared to day shift nurses. nurses with more years of experience noted higher levels of openness in communication (b =.125, p =.035). in addition, a more positive environment was predictive of greater openness in communication (b =.797, p <.001). hierarchical multiple regression analysis was also used to identify the variables which predicted accuracy of communication (table 4). individual nursing characteristics entered in step 1 explained 23% of the variance in accuracy of communication among nurses (f = 5.03, p <.001). an additional 11.1% of variation was explained with the inclusion of the unit and the environmental value variables entered in step 2. the final model (f = 5.345, p <.001) explained 34.2% of the variance in accuracy of communication (among nurses). job category (e.g., lpn) (p =.001), shift (p <.001) were significant predictors. specifically, lpns perceived less accuracy in communication among the nursing staff than their rn counterparts. another analysis, with dependent variable accuracy of communication between nurses and physicians, was computed with the following independent variables : job category, education, shift, expertise, years of experience, environmental values, and unit. the first model (step 1) included the nursing characteristics variables and explained 14.1% of the variance in the dependent variable (f = 2.80, p =.01). the unit and environmental values variables, entered in step 2, explained an additional 19.3%, for a total of 33.4% of variance explained (f = 5.235, p <.001). significant predictors included shift (night, p <.001, and rotating, p =.028) and environmental values (p <.001). specifically, nursing staff working night and rotating shifts identified greater accuracy in communication between nurses and physicians than did day shift nurses. in addition, a work environment with greater trust, respect, time, and status equity was predictive of lower accuracy of communication between nurses and physicians (p <.001). this study sought to identify the relationship between individual nursing characteristics and perceptions of communication with the healthcare team. overall, nurses (both rns and lpns) reported greater openness among nurses than between nurses and physicians. in contrast, they reported communication between nurses and physicians to be more accurate than among the nursing team. significant variation in perceptions of openness and accuracy of communication were identified between rns and lpns. rns identified significantly more accurate communication among nurses whereas lpns identified significantly greater communication openness. this may in part be related to the role expectations of the lpn and rn. the lpn, due to licensure restrictions, must be assigned to an rn, and therefore frequent interaction among the nurse dyad (rn - lpn) is required. due to an increase in interactions with rns, rns in contrast to lpns can work autonomously due to his / her greater scope of practice, and therefore, do not rely on communication from others to determine patient care needs. specifically, years of experience of the nurse was significantly related to openness of communication among nurses and physicians. this may be in part due to the need for frequent interaction for antecedents of effective communication, including trust and respect, to develop. also, nurses with greater years of experience may be viewed as having greater expertise among physician colleagues, especially in an acute care environment where physician colleagues may rotate monthly. higher levels of education were associated with greater perceptions of nurse - physician communication, but when the environment was considered, this was nonsignificant. this may be related to the fact that unit c and d had the lowest average for years of experience and self - reported expertise, which was shown to predict openness in communication between nurses and physicians. nurse shift was also significantly associated with perceptions of communication openness and accuracy. specifically, night shift nurses identified greater levels of accuracy of communication among nurses, and between nurses and physicians compared to nurses on the day shift ; in contrast, evening shift nurses identified lower levels of communication openness than the day shift. these findings may be related to the presence of physicians on these shifts. at night, less staff (both nursing and medical) are present, which may result in a greater need to work together to ensure optimal care delivery ; communication must be more accurate for timely implementation of appropriate interventions. the values present in the environment were predictive of all four outcome variables (e.g., openness / accuracy of communication among and between nurses and physicians). as expected, when positive values, such as trust, respect, and status equity, are present on the environment, openness in communication among the healthcare team ensues. this finding is similar to other studies [16, 17 ] which have noted the impact of these variables on effective communication. work environments that foster trust, respect, status equity, and time availability create an atmosphere were communication can flourish. interestingly, the same values that fostered open communication seem to reduce accuracy in communication. according to the study findings, one potential reason for this may be that staff working in a positive environment (e.g., trust and respect present) is more willing to state their opinions about patient care needs ; jones and george found trust among team members fostered greater willingness to share information freely among the team. in contrast team members who do not feel valued or believe information may be used inappropriately are less willing to share pertinent information. in such an environment (e.g., low trust and respect), staff may be less likely to share their thoughts, and instead state only facts that are fully supported. the data for this study came from four acute care units located in one of two midwestern hospitals, thus generalizability is limited to similar medical - surgical acute care units.. therefore, the actual accuracy and openness of communication was not measured. to study actual communication patterns when communication is not open and accurate, medical errors result. findings from this study identified nursing characteristics (e.g., experience, unit, shift worked) and the environmental context as essential for open communication. understanding the environment (e.g., presence or absence of trust, respect, status equity, and time availability) is a foundational step that must occur before implementing any strategies aimed at improving communication. a failure to understand the environment may in part explain why no one strategy has been shown to consistently improve nurse - physician communication. further research is needed to determine the best strategies for developing trust and respect among the healthcare team. current work environments where staff both nursing and physicians rotate, create less opportunity for interaction. one potential strategy for increasing interactions among the healthcare team would be through consistent team nursing (e.g., nurses on a team work the same shifts / days). this would result in frequent interactions where the antecedents to effective communication (e.g., trust / respect) could develop among the nursing team, and subsequently with other members of the healthcare team. another possible strategy for improving communication among the healthcare team includes multidisciplinary education. according to a position paper on interdisciplinary education and practice from the american association of colleges of nursing (aacn), programs and curricula must be developed that incorporate opportunities for collaborative learning and decision making. educating nurses and physicians together may result in greater role clarity, shared decision making, and more positive attitudes towards collaboration. additional strategies for improving communication include encouraging open dialogue, collaborative rounds, and engagement on interdisciplinary committees. this can provide opportunities for discussing problem areas and collaboratively determining strategies to reduce miscommunication. regardless of strategies implemented, all healthcare professionals have a common commitment to serving the patient and assisting them in reaching their optimal level of functioning. | failure to communicate openly and accurately to members of the healthcare team can result in medical error. the purpose of this study was to explore the impact of nursing characteristics and environmental values on communication in the acute care setting. nurses (n = 135) on four medical - surgical units in two hospitals completed a survey asking nurses ' perceptions of communication, work environment, and nursing demographics. lpns perceived significantly higher levels of open communication with nurses than did rns (p =.042). rns noted higher levels of accuracy of communication among nurses than did lpns (p <.001). higher experience levels resulted in greater perceptions of open communication. only environmental values (e.g., trust, respect) were a significant predictor of both openness and accuracy of communication. these findings suggest understanding the environment (e.g., presence or absence of trust, respect, status equity, and time availability) is a foundational step that must occur before implementing any strategies aimed at improving communication. |
nucleotide sequences diverge over time due to the combined effects of point mutation and homologous recombination. recombination events cause changes to regions of contiguous bases in single events and were generally assumed to be rare in bacteria. however, there is growing evidence that homologous recombination has a significant impact on sequence diversification during bacterial genome evolution. a recent analysis on the mlst (multilocus sequence typing) data of 46 bacterial and two archaeal species revealed 27 (56%) species in which homologous recombination contributed to more nucleotide changes than point mutation. the rapid genetic change introduced by homologous recombination could facilitate ecological adaption and drive pathogenesis in bacterial pathogens. currently, the mlst scheme, using dna fragments from seven housekeeping genes, has been routinely used to characterize bacterial isolates. the standard mlst scheme has also been extended to construct fine - scale relationships and further subdivide identical multilocus sequence types (sts) using more loci or a large amount of shared genomic sequences. given the common occurrence of homologous recombination, it becomes crucial to investigate the genome - wide extent of homologous recombination, which could also benefit the construction of the strain history and tracking the spread of emerging pathogens. identifying recombinational exchanges in closely related strains is challenging as recombinational exchanges involved in a small number of nucleotides may be mistaken as point mutations. guttman and dykhuizen (1994) have successfully examined the clonal divergence of e. coli strains in the ecor group a by considering the divergence time and mutation rate and showed that recombination has occurred at a rate 50-fold higher than the mutation rate in four loci. (2000) estimated the ancestral allele for the isolates that differ only one locus out of the seven mlst loci and assigned recombination based on the number of derived nucleotides from the ancestral allele and on whether the nucleotides are novel in the population. we adopted a new approach (illustrated in fig. 1) to identify recombinant genes in neisseria meningitidis strains with identical sts, which does not require the estimation of divergence time and ancestral alleles and can be applied on any two strains with identical sts. in brief, nucleotide substitution was assumed to follow a binomial distribution and an upper bound of genome - wide divergence () by point mutation was calculated for no observed substitution in all nucleotide sites of the seven mlst loci. the estimated maximum genome - wide divergence was then used as a benchmark to compute a p - value for the observed nucleotide changes of each gene in the genome to be explained by point mutation. genes that have more than the expected number of nucleotide changes at a significance level of 0.001 were deemed as recombinant genes. our results revealed that up to 19% of commonly present genes in n. meningitidis strains with identical sts have been affected by homologous recombination. inference of homologous recombination in strains with identical sts. under a binomial distribution of nucleotide substitution, there is a probability for no nucleotide change in the seven mlst loci. that is (1-) = 0.001, here n is the number of nucleotides in the seven mlst loci and is the upper bound of genome - wide nucleotide divergence () at 0.001 significance level given no change in the seven mlst loci. at genome - wide divergence, genes that have more than the expected number of nucleotide changes at 0.001 significance level were deemed as nonvertically acquired genes. in another study on e. coli o104 (st678) genomes, we visualized recombinant genes by plotting the pairwise dna distance of orthologous genes along the genome and identified 167 genes in three gene clusters that have likely undergone homologous recombination. a reanalysis on the orthologs between e. coli on2010 and 55989 (labeled as ec55989 thereafter to avoid unnecessary confusion) genomes using both pairwise dna distance and the p - values as described in ref. in fact, the use of nucleotide divergence between two genomes for homologous recombination detection has been successful in other studies, one of which was on two e. coli st131 strains. it has been observed that a higher portion (at least 9%) of core genes in the e. coli st131 genomes than in the e. coli st678 genomes (fig. 2) are affected by homologous recombination. the findings in both n. meningitidis and e. coli showed extensive genomic variation within identical sts. since many bacterial species have a comparable or higher level of recombinogenicity than n. meningitidis or e. coli, extensive genomic variation within identical sts should be expected in many bacterial species. inferring genes involved in homologous recombination by comparing orthologs between two e. coli strains on2010 and ec55989. (b) p - values were calculated based on the maximum genome - wide divergence given the seven identical mlst loci as illustrated in figure 1. for simplicity, please note that more genes (4207 genes in total) were examined here than in our previous study (3794 genes), since our previous study focused on the genes present in both the o104 strains and the iai1 strain. it is important to note that the high genomic variation discovered within identical sts should not be interpreted as artifacts of these studies. the high level of genomic variation within identical sts could, instead, be explained by that many non - vertical genes within identical sts are deleterious or transiently adaptive and undergo fast rates of evolution. in fact, the ratio of recombination to mutation rates was higher in the comparison of clonally related strains than of relatively broadly sampled strains from the corresponding species. such a discrepancy between the estimated recombination - mutation ratios highlights the need for a population genetics framework for the study of recombination and bacterial genome evolution. among the three gene clusters of recombinant genes we identified in e. coli o104, one gene cluster contained 125 genes and was likely involved in direct chromosomal homologous recombination specific to the on2010 strain. these 125 genes were found in 20 different functional categories and 70 of them were found in all the studied 57 e. coli and shigella genomes. this is consistent with the conclusion that genes from all functional categories are subject to dna exchange. furthermore, the nearest phylogenetic neighbors of these genes were not clustered in a single phylogenetic group. we hypothesized that extensive recombination with a broad spectrum of strains has taken place in one genome, and this highly mosaic genome then recombined with the precursor to the on2010 genome. the other two gene clusters of recombinant genes in e. coli o104 were located in the prophage regions, but the genes in these two gene clusters were identical between on2010 and ec55989 genomes. it is noteworthy that the reanalysis with more single - copy genes (with details in fig. these prophage genes are not present in all o104 strains and the outgroup iai1 strain. this could be explained by frequent recombination of the prophage genes with infecting phages or different prophages from other bacterial chromosomes. since all examined o104 genomes are of conserved genome synteny, our observations support the argument that homologous (legitimate) recombination drives module exchange between phages. together, these findings suggest that homologous recombination takes place frequently in both core genes and dispensable genes. as the cost of sequencing drops, the characterization of bacterial isolates has utilized more shared genes or loci and shifted toward phylogenomic analysis. quite often, multiple gene alignments were concatenated into a single super - alignment, from which phylogenies were reconstructed using a variety of methodologies. such a data set, also known as a supermatrix, has been demonstrated to solve previously ambiguous or unresolved phylogenies, even in the presence of a low amount of horizontal gene transfer in the data set. unfortunately, the supermatrix approach becomes very sensitive to recombination when applied to strains with identical sts due to limited genuine sequence diversity. the concatenated sequences of 3794 genes in the e. coli o104 strains were overwhelmed by the phylogenetic signal of the 125 recombinant genes, as many other genes are identical among the e. coli o104 strains (fig. the accuracy and robustness of the constructed evolutionary relationships can be improved by the exclusion of recombinogenic and incongruent sequences. in fact, the removal of the 125 recombinant genes from the e. coli o104 data set has resulted in consistent phylogenetic relationships of o104 strains by different phylogenetic approaches. one interesting finding of our e. coli o104 study is that the number of identical loci implemented in bigsdb was less sensitive to homologous recombination than the concatenated sequences of all loci. this could be explained by the fact that recombination has affected a relatively small number of genes but introduced a substantial amount of diversity in the on2010 genome. it is further noteworthy that supertrees, another widely used approach for phylogenomic analysis are not suitable for characterizing strains with identical mlst types, as many individual genes are identical or nearly identical and contain no or very limited phylogenetic information for each individual gene tree. homologous recombination can bring the beneficial mutations arising in different genomes together and have a strong impact on ecological adaptation. one well - known example was the recombination in the pena genes during the emergence of penicillin resistance in n. meningitidis. variation of the pena gene corresponding to different levels of penicillin susceptibility has also been observed between n. meningitidis strains with the same mlst types. furthermore, genetic variation within the same mlst types has been evident in the capsule gene cluster and genes used for vaccine target in n. meningitidis. these observations suggest a strong relationship between homologous recombination and pathogenic adaptation involved in antibiotic resistance, capsule biosynthesis and vaccine efficacy. recombination has affected fimh which encodes mannose - specific type 1 fimbrial adhesin, resulting in distinct fluoroquinolone - resistance profiles in st131 strains. a survey of the fimh gene on the 57 e. coli and shigella genomes revealed that on2010 was the only e. coli o104 genome containing a fimh blast hit > 10% of length (fig. on the on2010 genome scaffold, fimh is upstream adjacent to a fructuronic acid transporter gene gntp, which is universally present in all e. coli and shigella genomes. the gntp gene in on2010 2), and most importantly, the most similar sequences to the on2010 gntp were also in e24377a and s88 (data not shown). the shared origin between the adjacent fimh and gntp genes in on2010 suggested that patchily distributed genes involved in pathogenesis could be introduced by homologous recombination of the conserved flanking genes. only informative sites are shown with coordinates at the top. the on2010 sequence and its most similar sequences (differing by one nucleotide) | due to divergence, genetic variation is generally believed to be high among distantly related strains, low among closely related ones and little or none within the same classified clonal groups. several recent genome - wide studies, however, revealed that significant genetic variation resides in a considerable number of genes among strains with identical mlst (multilocus sequence typing) types and much of the variation was introduced by homologous recombination. recognizing and understanding genomic variation within clonal bacterial groups could shed new light on the evolutionary path of infectious agents and the emergence of particularly pathogenic or virulent variants. this commentary presents our recent contributions to this line of work. |
dens in dente is a developmental malformation incident due to the in folding of enamel and dentin or an accentuation of the lingual pit of an incisor before calcification sets in. various causes of this condition have been proposed which include focal growth retardation (kronfeld 1934), infection (fischer 1936, sprawson 1937), rapid proliferation of a part of the inner enamel epithelium into the dental papilla (rushton 1937), increased localized external pressure (euler 1939, atkinson 1943), fusion of two tooth germs (bruszt 1950), trauma (gustafson and sundberg 1950), distortion and protrusion of the enamel organ during tooth development (oehlers 1957), and absence of signaling molecules for morphogenesis and therefore, genetic factors are involved (grahnen., 1959, casamassimo., 1978, ireland., 1987, and hosey and bedi, 1996) the maxillary lateral incisor is most commonly affected and one of the reasons being the external forces applied on the lateral incisor tooth bud by the developing central incisor or canine which develops 6 months prior. however, oehlers classification is most widely used due to its ease of application [figure 1a ] with the only disadvantage being that it fails to explain the true extent and complexity of the invagination as it is based on the radiographic representation. therefore, a classification for treatment protocol needs to be devised on the basis of advanced three - dimensional (3d) imaging. (a) oehlers classification, (b) intraoral lesion, and (c) cone beam computed tomography images to confirm dens invaginatus a wide array of treatment modalities ranging from the placement of sealants to retrograde fillings is rendered on the severity of invagination. success in endodontic treatment is achieved when a tooth has predictable morphology that can be easily debrided by cleaning and shaping followed with a 3d obturation. a female patient aged 13 years referred to the department of conservative dentistry and endodontics in m. a. rangoonwala dental college, pune, for evaluation and treatment of constant pain and draining sinus in relation to maxillary anterior tooth [figure 1b ]. clinical examination revealed tenderness and sinus tract in the buccal mucosa associated with the maxillary left lateral incisor. close examination of the orthopantomogram revealed altered tooth morphology in relation to the affected tooth. a clinical diagnosis was established of dens invaginatus. for better understanding of the crown - root morphology, cone beam computerized tomography (cbct) was performed to confirm the diagnosis as dens invaginatus type iiib [figure 1c ]. initial access preparation showed four orifices that were confirmed by the help of microscope (moller - wedel) of magnification (16) and mesially and distally angulated radiographs. the canals were prepared using hand and mechanical instrumentation after establishment of working length by the apex locater. the canals were intermittently irrigated with 5% naocl and saline, and calcium hydroxide dressing [figure 2a ] was placed for the periapical pathology. (a) calcium hydroxide intracanal dressing (b) 3-month follow - up radiograph (c) 6-month follow - up radiograph (d) 9-month follow - up radiograph, (e) 12-month follow - up radiograph, and (f) radiograph at 1 year and 2 months obturation done, healing of periapical lesion was seen the patient was recalled at regular intervals of 3, 6, 9, and 12 months [figure 2b e ] to monitor the periapical pathosis, and the calcium hydroxide dressing was replaced. on further canal preparation, communication was seen resulting in one canal splitting into two in the apical region. obturation of the canals was done at 1 year and 2 months using down pack and backfill technique with elements obturating system (sybron endo) [figure 2f ]. the postoperative restoration was done using packable composite resin bisfil core (bisco, schaumburg, il, usa). the patient was recalled every month for review till complete healing of the periapical lesion was observed [figure 2f ]. conventional and digital radiography renders 3d anatomical structures two dimensionally with inherit distortions in different planes. this limitation posts a steep learning curve for novice operators to interpret information from the resulting images. cbct gives us a 3d view of the image allowing us to view it in different planes. in endodontics, in the above case presented, cbct helped in diagnosing the altered tooth morphology which further helped in proper treatment planning. dens invaginatus can be present in varying degrees of severity and is prone to infection. its histology confirms a thin layer of enamel and dentine separating the pulpal tissue which can be hypoplastic and may predispose to the entry of irritants and thereby lead to necrosis of the pulp and infection. according to oehlers classification, the case was den invaginatus type iii, where the additional canal located palatal to the main canal extended till the apex of root separately without communicating with the main canal. although the case had a periapical lesion, since the root was well formed and had apical constriction, a conservative orthograde approach was chosen. healing of the intraoral sinus is also a positive indicator to show that the treatment rendered was working efficiently. for teeth with complex anatomy where satisfactory debridement is difficult to achieve as in this cases of dens in dente, a good shaping followed by maximum cleaning, optimum irrigant interaction with the root canal dentin, and a good coronal seal periodic follow - up of the case at 3, 6, 9, and 12 months also played an important role in healing of the periapical lesion. if on follow - up appointments, the lesion is seen to persist or increase, then a surgical intervention is warranted. the current treatment protocol includes early detection of the lesion, prophylactic or preventive sealing of the invagination, root canal treatment, endodontic apical surgery, and intentional replantation. treatment of dens in dente has phased into an endodontic approach from an extraction - oriented one, but with the advent of newer elaborate diagnostic tools. clinically, microscopes have a massive contribution in the success of endodontic therapy not only in teeth with atypical morphology but also teeth with normal anatomy. there are no conflicts of interest. | dens invaginatus, also known as dens in dente, is a rare anomaly affecting human dentition. the condition results in invagination of an amelodental structure within the pulp. this case report discusses the current management protocol of dens invaginatus using a minimally invasive and nonsurgical treatment option. as with most conditions, early diagnosis and preventive measures help minimize complications in dens invaginatus cases. |
silicosis is a fibrotic disease of the lungs caused by the inhalation and deposition of free crystalline silicon dioxide (sio2) or silica in the lung tissue1. silica exposure has long been a well - known occupational hazard in sandblasting, tunnelling, mining, but also in a range of other professions. although silica - associated diseases are preventable, they remain common worldwide, particularly in developing countries2. there are several clinical and pathologic varieties of silicosis, including acute silicosis, accelerated silicosis, chronic silicosis, and conglomerate silicosis (progressive massive fibrosis or complicated silicosis)3. development of different forms of silicosis is dependent on duration of exposure, concentration and the surface of silica particles4. chronic (nodular) silicosis that develops after 1020 yr of exposure to silica is the most frequent form of the disease2. acute silicosis is also referred to in the literature as silicoproteinosis or silicolipoproteinosis, because of its typical histological pattern of periodic acid - schiff - positive lipoproteinaceous material in the alveoli, producing a picture of alveolar lipoproteinosis. whereas acute silicosis occurs after intense short exposures within a few years after the initial exposure, accelerated silicosis develops within 5 to 10 yr of initial exposure to silica dusts5,6,7. radiologically, classic simple chronic silicosis is typically characterized by multiple nodular opacities with predominance in the upper lobe and posterior part of the lung. with increased duration and intensity of exposure, enlargement of hilar and mediastinal lymph nodes with calcification at the periphery of the node is common7. accelerated silicosis may be radiologically similar to chronic silicosis, with more rapid development of changes following initial exposure. however, it may also possess features typical for acute silicosis5, 8, 9. patients with accelerated silicosis are at a higher risk of developing progressive massive fibrosis as well as other complications5, 10. in acute silicosis (silicolipoproteinosis), due to intra - alveolar accumulation of lipoproteinaceous material, bilateral consolidation, multifocal patchy ground - glass opacities with perihilar distribution and centrilobular nodular opacities accelerated silicosis is similar to acute silicosis in developing alveolar lipoproteinosis with accumulation of granular lipoproteinaceous material containing alveolar surfactant in alveolar spaces and interstitial inflammation. in addition, accelerated silicosis is associated with the presence of silicotic nodules that develop sooner than in chronic silicosis2. a 38-yr - old man presented with progressive dry cough and dyspnoea on exertion of 6-month duration. his personal history indicated that he was a former smoker (10 pack - year cigarette smoking history). he completed his apprenticeship as a metal processor and worked in this profession for 2 yr. for the next ten years, he worked as a locksmith and then, for the last 5 yr prior to his disease, as a sandblaster. he used compressed air and foundry sand containing high amounts of silicon dioxide to blast stainless steel materials before welding or welded products. on admission, high - resolution computed tomography (hrct) scans showed interstitial shadowing and diffuse small nodules, a subpleural reticular pattern and mediastinal lymphadenopathy in all areas (subcarinal lymph nodes 29 20 mm) (fig. complete laboratory examination revealed positivity of antinuclear antibodies, increased levels of lactate dehydrogenase (25.9 kat / l), gamma - glutamyl transferase (2.8 kat / l), circulating immune complexes (89 u), soluble il-2 receptor (1252 ku / l), iga (6.6 g / l), ige (247 u) and tumour markers thymidine kinase (tk, 53.5 g / l), 2-microglobulin (5.4 mg / l), neuron - specific enolase (nse, 68.0 g / l) and cytokeratin fragment 19 (cyfra 211, 7.7 functional testing revealed mild restrictive ventilatory impairment (vc 3,550 ml = 76%, fev1 3,000 ml = 80%, fev1/fvc = 84%, tlc = 67%) and the diffusing capacity for carbon monoxide (dlco) was moderately reduced (40%). cytology of bronchoalveolar lavage fluid (balf) showed lymphocytic alveolitis with a slightly increased percentage of eosinophils (lymphocytes 46%, eosinophils 1% and alveolar macrophages 53%), numerous pigmentophages, crystals and pas - positive amorphous material. polarized light microscopy examination of balf revealed birefringent crystals that conformed to sio2. morphologically, transbronchial lung biopsy confirmed a combined picture of lymphocytic alveolitis and alveolar lipoproteinosis with a tiny silicotic nodule of up to 1 mm. 2.transbronchial lung biopsy.the picture clearly shows a silicotic nodule (asterisk) and lung tissue with thickened alveolar septa infiltrated with lymphocytes and histiocytes. in the alveoli, pas - positive protein material is present, corresponding to surfactant in alveolar lipoproteinosis (upper arrow). in some alveoli, there are optically empty spaces previously occupied by cholesterol crystals (lower arrow). the picture clearly shows a silicotic nodule (asterisk) and lung tissue with thickened alveolar septa infiltrated with lymphocytes and histiocytes. in the alveoli, pas - positive protein material is present, corresponding to surfactant in alveolar lipoproteinosis (upper arrow). in some alveoli, there are optically empty spaces previously occupied by cholesterol crystals (lower arrow). six months later, hrct showed slightly progressing bilateral diffuse interstitial thickening and diffuse nodules with a diameter < 2 mm, and stationary mediastinal lymphadenopathy. ventilatory impairment was worsened (vc 2,920 ml = 63%, fev1 2,370 ml = 64%, fev1/fvc = 85%, tlc = 62%), whereas dlco was stationary (42%). the patient underwent video - assisted thoracoscopic surgery with biopsy of the mediastinal lymph node and left upper lobe. histological examination showed already diffuse fibrosis of the alveolar septa with intensive reaction of intra - alveolar macrophages and apparently resolved lymphocytic infiltrates. in some areas of the lung, alveolar lipoproteinosis persisted. dispersed individual silicotic nodules of up to 1 mm the subpleural lung regions contain compact fibrotic lesions (asterisk) with numerous cholesterol crystals (arrows). the final histological findings were endogenous lipid pneumonia and alveolar lipoproteinosis with hyaline nodules suggesting silicosis. the subpleural lung regions contain compact fibrotic lesions (asterisk) with numerous cholesterol crystals (arrows). given his occupational history and the fact that the patient worked as a sandblaster which put him at a risk for developing silicosis, after completion of the diagnostic process, industrial hygiene specialists were asked for objective assessment of professional exposure at his workplace. the assessment, completed approximately 10 months after clinical diagnosis had been made, concluded that the patient had worked for at least 3 yr and 2 months (probably even as long as 5 yr) as a sandblaster in a small closed room with neither natural ventilation to the outside nor extraction. moreover, for the first two years, he had only been equipped with a respirator instead of adequate protective wear such as an air - fed helmet with a filter. foundry silica sand was found to contain 99% of sio2. blasting activity accounted for approximately 60% of his working time. unfortunately, exact data on dust loading associated with such massive exposure were unavailable as at the time of assessment, the method was no longer used. however, quantification of workplace risk conditions suggested a respirable fraction of sio2 of approximately 0.3 mg / m. with respect to the evidence and disease dynamics, the patient s condition was recognized as an occupational disease. the patient was treated with systemic corticosteroids (prednisone 40 mg daily initially) for 9 months. in the first 2 yr of the disease, the patient had several infections of the upper and lower airways with fever and attacks of dry cough treated with antibiotics. after 2 yr, significant signs of disease progression were revealed by chest x - ray and hrct scans, with more pronounced mediastinal lymph node enlargement, diffuse ground - glass opacities, foci of consolidation, reticular pattern, nodules and pleural thickening (fig. 4.hrct scans after 2 years of disease progression.). the restrictive ventilatory impairment on spirometry was worsened (vc 2,100 ml = 45%, fev1 1,880 ml = 51%, fev1/vc = 90%, tlc = 50%). dlco was moderately decreased (dlco = 44%, dlco / va = 76%). during bronchoscopy, the patient was diagnosed with exercise - induced hypoxemia and started on long - term home oxygen therapy. due to the milky appearance of balf and presence of ground - glass opacities on hrct scans, progression of secondary alveolar proteinosis was considered. therefore, whole lung lavage of the left lung was performed with 5,000 ml of saline under general anaesthesia. this brought no improvement of symptoms and findings on chest radiograph ; the functional parameters were even worse (vc = 40%, fev1 = 38%, fev1/vc = 76%, tlc = 46% ; dlco = 33%). considering the progression of the disease and the lack of treatment options, transplantation of the silicotic lung was indicated. the patient died during the transplantation, less than five years from diagnosis, due to massive pulmonary embolism. furthermore, fibrosis of the alveolar septa and chronic inflammatory changes of the lung interstitium were present. acute and accelerated silicosis are commonly associated with heavy exposure to silica dust and usually occur in sandblasting, silica flour milling, surface drilling, tunnelling and other crushing operations3. sandblasting involves projecting a stream of abrasive particles, mostly silica sand, onto a target surface by compressed air or steam11. there have been reports of individual cases of accelerated silicosis in foundry and masonry industries, such as an interesting case of accelerated silicosis in small private agate mill workers in china12, 13. to our knowledge, numerous cases of acute / accelerated silicosis in turkish denim sandblasters have been reported since 20058, 9, 11. the common denominators of circumstances of occupational exposure were small plants with massive exposure to silica during sandblasting in closed and poorly ventilated rooms, long working hours and absence of adequate protective equipment11. histopathologically, accelerated silicosis is characterized by picture similar to acute silicosis with developing alveolar lipoproteinosis and interstitial inflammation, but in addition silicotic nodules are present2. histological changes in our patient are similar to findings from lung biopsy described in two cases of acute silicosis in sandblasters11. in the first case, silicotic nodule composed mainly of bundles of interlaced collagen with minimal inflammatory reaction and accumulation of lipoproteinaceous material within the alveoli were found. in the second case, exudative alveolar lipoproteinosis associated with chronic inflammation, thickening of alveolar septa with hypertrophic and hyperplastic type ii epithelial cells were described. in our case of accelerated silicosis, two biopsies were performed. a combined picture of lymphocytic alveolitis and alveolar lipoproteinosis with a tiny silicotic nodule of up to 1 mm was present in the first transbronchial lung biopsy. 6 month later, histological examination showed already diffuse fibrosis of the alveolar septa with intensive reaction of intra - alveolar macrophages, alveolar lipoproteinosis persisting in some areas of the lung, and silicotic nodules of up to 1 mm. a great limitation for comparison of findings in transbronchial and surgical lung biopsies is the difference in the size of biopsy specimens, so a time progression of morphological changes could not have been correctly assessed. according to the literature, increasing evidence shows that lung inflammation and apoptosis are hallmarks of acute silicosis14. in animal models of acute silicosis, severe lung inflammation, alveolar lipoproteinosis, apoptosis, induction of reactive oxygen species, production of proinflammatory cytokine / chemokine, and tissue destruction the accelerated acute inhalation model also led to the development of acute - like injury (e.g. apoptosis, inflammation, tissue destruction)15. animal models have shown that genes regulating fibrosis, oxidative stress, and metalloproteases contribute to both acute and chronic silicosis, but proinflammatory cytokines are associated with acute but not chronic silicosis14. radiographic findings in our patient comprised features of both acute and chronic silicosis, with the development of acute changes later in the course of disease. on initial presentation, hrct scans showed only interstitial thickening, diffuse small nodules and mediastinal lymphadenopathy, characteristic for simple chronic silicosis. apart from progression of these radiographic findings, ground - glass opacities and areas of consolidation typical for lipoproteinosis appeared after 2 yr follow - up. increased serum levels of tumour markers tk, tpa, 2-microglobulin, nse and cyfra 21 - 1 were observed in our patient. also neoplastic diseases (e.g. lung cancer, lymphoproliferative disorders, lymphangitic carcinomatosis) were suspected in the current case due to the elevation of tumour markers. however, tumour was histologically found neither in biopsy samples nor at autopsy. except for lung cancer, increased concentrations of tumour markers have been shown also in benign pulmonary diseases, but only few studies have evaluated the clinical significance of tumour markers in patients with silicosis16. in primary pulmonary alveolar proteinosis, an increase in cyfra 21 - 1, carcinoembryonic antigen, ca 19 - 9, ca 15 - 3 and tpa was observed in serum and balf17, 18. the elevation of tumour markers can be partly attributed also to the presence of secondary alveolar proteinosis in this case of accelerated silicosis. recently a study has demonstrated increased serum concentrations of nse and ca 125 in silicosis patients without malignancy16. nse and ca 125 levels were significantly correlated with spirometric parameters and ldh concentrations, thus predicting disease severity in silicosis patients16. these results support the finding of significantly increased levels of nse in our case, whereas concentrations of ca 125 were in this patient normal. it is speculated that increased serum nse concentrations in silicosis may originate from hyperplasia of neuroendocrine cells in the silicotic lungs. the release of nse into the peripheral circulation may be facilitated by the increased alveolocapillary membrane permeability16. whole lung lavage (wll) is considered to be a therapeutic option both in silicosis and pulmonary alveolar proteinosis. in silicosis patients wll may remove large quantities of dust, soluble materials, and inflammatory cells from the lungs and relieve respiratory symptoms, but sustained improvement in lung function parameters has not been shown in a clinical trial1. has described a case of acute silicoproteinosis treated with wll leading to significant clinical, physiological and radiological improvement19. the patient had no recurrence of the disease after the treatment. in the study of zhang. wll has been shown as an effective therapy especially for early and accelerated silicosis, but wll should be used cautiously in the treatment of advanced silicosis21. lower progression rate on chest x - ray, slower decrease of functional parameters, improvement of the cough and expectoration were found in the group of silicosis patients treated with wll21. however, in our case wll brought no clinical or radiological improvement and functional findings worsened. lung transplantation (lt) is a potential alternative for end - stage silicosis, especially for young patients1, 22, 23.. singer. have reported a 2-fold increased mortality risk in subjects undergoing lt for occupational lung diseases23. this risk of death was limited to the patients with non - silicotic occupational lung diseases in the first post - transplantation year. these observations differ from an earlier single - centre report of poorer post - lt survival of patients with silicosis in comparison with subjects with idiopathic pulmonary fibrosis23, 27. unfortunately, in the current case of accelerated silicosis neither lt led to a therapeutical success. in the current case, a rare diagnosis of accelerated silicosis was confirmed by diagnostic considerations and methods. initially, the patient presented with progressive dry cough and exertional dyspnoea. given his occupational history and known high - risk exposure to respirable silica particles in his profession of a sandblaster, a possible occupational aetiology was considered in the early diagnostic process. eventually, this was confirmed by histological, clinical, hygiene and autopsy findings. although accelerated silicosis is a rare disease, it may be seen today, even in series of cases related to new an important factor is always massive exposure to respirable silica particles, frequently potentiated by unsatisfactory hygienic conditions in the workplace. given the poor prognosis of this condition, its potential development in association with high - risk industries should not be underestimated. careful prevention measures are necessary, in the form of both the maximum possible reduction of workers exposure at the workplace and the use of suitable and effective protective equipment. | sandblasting is traditionally known as a high - risk profession for potential development of lung silicosis. reported is a case of a sandblaster with confirmed accelerated silicosis, a condition rather rarely diagnosed in the czech republic. initially, the patient presented with progressive dry cough and exertional dyspnoea. in the early diagnostic process, a possible occupational aetiology was considered given his occupational history and known high - risk exposure to respirable silica particles confirmed by industrial hygiene assessment at the patient s workplace. the condition was confirmed by clinical, histological and autopsy findings. the patient died during lung transplantation, less than five years from diagnosis. |
an 18-year - old female patient presented with inability to open both eyes for 6 weeks. she had a history of fever from malaria 2 months back for which she was treated with oral chloroquin phosphate 500 mg. she developed erythematous papular eruptions on the trunk, mouth, and limbs along with pain, redness, and watering from both eyes 5 days after taking the medication followed by gross diminution of vision and inability to open her eyes. the erythematous lesions resolved completely at 4 weeks with medications, but she was unable to open her eyes and she was referred to us for further evaluation and management. at the time of presentation, her visual acuity was positive perception of light in both eyes, with both the upper lids adhered to almost the whole of the cornea, and part of the lower bulbar conjunctiva with the lower lid [fig. 1 ]. b - scan ultrasonography (usg) revealed acoustically clear vitreous, normal chorioretinal thickness, and normal optic nerve head with an attached retina. close - up view shows the cornea and upper tarsal conjunctiva being totally adhered in both eyes (b) routine blood examination, blood glucose, and serum urea and creatinine levels were within normal limits. physician evaluation was done by meticulous history taking, clinical examinations, and key laboratory examinations to exclude other blistering skin diseases such as pemphigus vulgaris, bullous pemphigoid, mucocutaneous diseases like behet 's syndrome and reiter 's syndrome, and vasculitis like systemic lupus erythematosus. the patient was taken up for surgery and superficial lamellar dissection of the cornea was done to separate the conjunctivocorneal adhesion, followed by release of symblepharon between palpebral and bulbar conjunctiva. the inspection of the limbus revealed areas of scattered peripheral corneal neovascularization affecting less than 3 clock hours in both eyes, which implied the areas of limbal stem cell deficiency (lscd) of the corresponding areas. the buccal mucous membrane was harvested after injecting 2% xylocaine with adrenaline (1 in 200,000) into the proposed site and the graft was removed from below moving upward. after harvesting, the extra fat was removed from the graft. a mucous membrane graft (mmg) of size 27 8 mm (right eye) and 26 8 mm (left eye) was placed over the raw area of superior bulbar conjunctiva and secured with interrupted stitches using 8 - 0 vicryl. the lower bulbar conjunctiva was covered by a mmg of size 15 7 mm (right eye) and 14 7 mm (left eye) and sutured in a similar fashion. this was followed by the placement of a symblepharon ring to prevent the recurrence of symblepharon and a temporary tarsorrhaphy was placed in both eyes to achieve some pressure effect on the mmg by the symblepharon ring [fig. 2 ]. the patient was given a systemic antibiotic (cephalexin 500 mg three times a day for 5 days) and a nonsteroidal anti - inflammatory (ibugesic 100 mg, paracetamol 500 mg, combination twice daily after meal for 4 days) along with a topical antibiotic steroid (gatiflxaciin with dexamethasone, one drop six times a day for 1 month) combination, and a tear substitute (carboymethylcellulose) was prescribed for six times a day for 6 months. early post - operative view (seventh day) : gross appearance (a). close - up view of both eyes with the bandage contact lens and symblepharon ring seen in situ (b) the re - epithelialization of the corneal epithelium was completed by in 10 days. temporary tarsorrhaphy was removed after 2 weeks and both the bcl and the symblepharon ring was removed at 4 weeks. except few sectors of peripheral corneal vascularization, no other sequelae were observed postoperatively. best corrected visual acuity of 20/120 in both sides after 1 month and 20/80 after 3 months [fig. 3 ] was achieved and maintained till the 2.5-year follow - up without any other sequelae. close - up view showing well reconstruction in the inferior fornix in both eyes (b) the exact etiology of sjs is not known and the understanding of the etiopathogenesis and management protocol of ocular adnexal complication of sjs has been limited so far. often, patients of sjs are treated by a physician or dermatologist in early phases and later referred to an eye care center. patients often consult an ophthalmologist with severe ocular sequelae only after the resolution of skin lesions, as in our case. the acute stage of the sjs is characaterized by bilateral catarrhal and membranous conjunctivitis. during the chronic stage of the disease, most patients have various alterations of the ocular surface, such as symblepaharon, entropion, trichiasis, dry eye, limbal cell deficiency, conjunctival inflammation and corneal neovascularization. the major aim of treatment in late phases of sjs is ocular surface reconstruction to correct cicatricial sequalae and chronic inflammation. management option in late cases is a challenge and is often frustrating, because of the combination of various alterations in surface milieu causing severe dryness and surface inflammation leading to treatment failure. several surgical approaches for the reconstruction of the ocular surface in cicatricial disorders with or without significant lscd have been tried with encouraging results. to reconstruct and maintain the ocular surface, a full - thickness oral mmg is the simplest graft to use if a conjunctiva is not available. it is preferred over split - thickness mucosal grafts as it contracts less in comparison, though a split - thickness graft is more preferable from the cosmesis point of view because of its lesser bulk and pinky appearance however, amniotic membrane transplantation (amt) is an accepted approach to the surgical management of chronic symblephera because of the unique properties of the membrane, especially in cases with significant lscd. it can be combined with limbal transplantation and with an adjunctive antimetabolite. however, in cases with an adequate reserve of limbal stem cells, mucosal tissue transplantation achieves equally good results as seen in our case. mucosal tissue transplantation can be considered in situations where cost and inadequate infrastructure are concerned. our case had a partial lscd which was scattered and amounting to 34 clock hours in each eye. as such the corneal re - epitheliazation was satisfactory after the procedure. in cases of severe bilateral lscd, an additional procedure of stem cell harvesting and ex vivo culture would have been required. the ultimate aim of treatment of the chronic phase of ocular surface disorders like sjs is restoration of the anatomical structures and physiologic properties of the ocular surface. | an 18-year - old woman was referred with late sequelae of chloroquine - induced steven johnson syndrome. at the time of presentation, the symblepharon was involving the upper lids to almost the whole of the cornea, and part of the lower bulbar conjunctiva with the lower lid bilaterally. other ocular examinations were not possible due to the symblepharon. b - scan ultrasonography revealed acoustically clear vitreous, normal chorioretinal thickness, and normal optic nerve head, with an attached retina. conjunctivo - corneal adhesion released by superficial lamellar dissection of the cornea. ocular surface reconstruction was carried out with a buccal mucous membrane. a bandage contact lens was placed over the cornea followed by the symblepharon ring to prevent further adhesion. the mucosal graft was well taken up along with corneal re - epithelization. best corrected visual acuity of 20/120 in both sides after 1 month and 20/80 after 3 months was achieved and maintained till the 2.5-year follow - up. |
primary teeth injuries are common in young children due to their lack of muscle coordination in the early years of life.14 these injuries primarily affect anterior primary teeth ; as a result of the resilient bone surrounding the primary teeth, these injuries are usually luxations.2,57 for laterally luxated teeth with no occlusal interference, the preferred treatment is follow - up for spontaneous repositioning. in cases of minor occlusal interference, slight grinding is recommended. when serious occlusal interference occurs, repositioning with pressure is recommended ; however, if repositioning with pressure is impossible because of the time lapse between injury and application, then extraction is preferred. in the case reported here, instead of extraction, a laterally luxated primary central incisor with occlusal interference was repositioned, using a composite inclined plane. a 4-year - old girl applied to our clinic 3 days after a traumatic injury with a complaint of pain and transposition of the left primary maxillary central incisor. clinical and radiographical examination showed the tooth to be laterally luxated (figures 1 and 2). the crown was displaced in the palatinal direction, and the germ was judged to be safe. the tooth exhibited serious occlusal interference with the mandibular left primary incisor, and the child suffered from spontaneous pain. however, due to the length of time elapsed between the time of injury and the presentation at our clinic, the tooth could not be replaced in its original position in the alveolar socket. the chosen treatment plan consisted of repositioning the tooth using a composite inclined plane, following the application of a root - canal treatment. the root canal treatment was performed using calcium hydroxide paste (metapaste, meta biomed, cheongju, korea), and the tooth was restored with compomer (dyract ap, dentsply international). following restoration, the labial and incisal surfaces of the lower primary central incisors were etched with phosphoric acid for 40 s, washed for 30 s, and dried. composite - resin restoration material (grandio, voco, cuxhaven, germany) was applied to the incisal surfaces to form a 34 mm plane, inclined at a 45 to the longitudinal axes of the teeth. the only contact between the two arches was at the incisal edge of the luxated tooth and the inclined plane (figure 3). by the end of the first week, the left maxillary central incisor had moved in the labial direction, but it had not yet repositioned completely. after two weeks of close follow - up, the tooth had returned to its original position, the inclined plane was removed, and the lower central incisors were polished with prophylaxis paste. during the follow - up period, the treated tooth was examined for percussion and palpation sensitivity, mobility, swelling, periapical radiolucency, and pathological root resorption. no clinical or radiographical pathology was observed. at the 1-year follow - up examination, the treatment was judged to be both clinically and radiographically successful (figures 4 and 5). the recommended treatment for laterally luxated primary teeth with occlusal interference is repositioning with pressure;8 however, a delay between the time of injury and presentation for treatment may prevent repositioning. in such cases, grinding may correct the occlusal interference ; however, if the interference can not be resolved by grinding, then extraction of the tooth is required. whereas the grinding procedure can harm the structure of a healthy tooth, the loss of an anterior tooth, especially in a young child, can lead to poor phonetics, the development of bad habits, and loss of function. in addition, poor esthetics due to tooth loss can cause psychological and social problems for children.1 in this case report, instead of extraction, an inclined plane constructed from composite resin was used to reposition a primary incisor with a crossbite caused by lateral luxation. the literature describes a number of different methods for the correction of crossbite in primary and permanent teeth. (i.e., a wooden tongue blade), which children are instructed to bite during their free time. however, used alone, this method has been reported to be unsuccessful because it depends on the cooperation of the patients and their parents.13 another method for correcting an anterior crossbite is the use of a removable acrylic appliance, 10,12,14 consisting of an acrylic plate that opens the posterior bite and a finger spring that tips the anterior teeth forward. however, like tongue blades, the success of acrylic appliances also depends on patient cooperation, which is difficult to achieve with younger children. numerous studies have reported the use of inclined planes for the correction of an anterior crossbite. by directing vertical bite forces forward, the inclined plane helps to tip the tooth in a labial direction. various authors have reported different ways of forming fixed inclined planes, each with its own advantages and disadvantages. reversed stainless steel crowns have been used successfully for this purpose,911,13,15,16 but considering their poor esthetics, they do not appear to be the best alternative for children. a lower inclined acrylic bite plane is another type of fixed inclined plane ; however, it must be prepared in a laboratory, 9,11,16 which results in an increase in both cost and number of appointments needed. compositeresin inclined planes used to correct an anterior crossbite have been reported to be safe, quick and easy to apply, comfortable, and esthetically acceptable.17,18 in the case reported here, a composite - resin inclined plane was used successfully to treat a laterally luxated primary tooth. although the treatment was successful in this case, clinicians should be aware of some possible risks posed by using this method to treat laterally luxated teeth in young children. it can be difficult to achieve follow - up cooperation from young children, who may not be capable of tolerating the posterior open - bite that occurs during the treatment period. additionally, the use of force on a tooth that has already been injured may not be appropriate. because the guidelines recommend using appropriate pressure on laterally luxated teeth with occlusal interference to reposition them in the alveolar bone,8 and because the force applied by an inclined plane is limited, this method could provide a safe method for repositioning laterally luxated teeth after a root - canal treatment. the use of a composite - resin inclined plane after a root - canal treatment, along with careful follow - up, can be an alternative to extraction for laterally luxated primary incisors with occlusal interference. | this case report describes the repositioning of a laterally luxated primary central incisor with occlusal interference, using a composite inclined plane. the patient was a 4-year - old girl who applied to our clinic three days after the injury. because of the time delay between injury and presentation, it was not possible to reposition the tooth with pressure. following a root - canal treatment, an inclined plane was prepared on the lower primary incisors, using composite resin. the tooth was repositioned in two weeks, and the inclined plane was then removed. after 1 year of follow - up, the treatment was found to be successful, both clinically and radiographically. the use of a composite inclined plane, accompanied by careful follow - up, is an effective alternative to extraction for laterally luxated primary incisors with occlusal interference. |
equimolar amounts of each of the naturally occurring amino acids was used to a total of 10-fold molar excess. cysteine was not included in this mix and arginine was used at 1.5 molar concentration to compensate for previously observed low incorporation of this amino acid (4). the randomness of the peptide mixture was then analyzed by hplc and laser - desorption time of flight mass spectrometry. hla - b53 and hla - b8 were produced using vectors pgmt7b53his (5) and pgmt7b8, respectively. hla - a2 and 2 m were produced using the vectors phn1a2 and phn12 m, respectively (a gift from d. garboczi, harvard university, cambridge, ma). hlab53 and hla - a2 were refolded with a random mix of peptides using a dilutional method as previously described (6). in brief, 30 mg of random peptide pool was dissolved in a small volume of 8 m urea and added to a solution of 1 m heavy chain, 2 m 2 m in refolding buffer (0.4 m l - arginine, 0.1 m tris [ph = 7.5 ], 2 m edta, 5 mm reduced glutathione, 0.5 mm oxidized glutathione, 0.5 mm pmsf). after incubation for 3648 h at 4c, the solution was concentrated and the refolded complex purified by gel filtration. hla - b8 was refolded using a dialysis method of refolding. in brief, peptide, 2 m, and heavy chain were mixed with 20 mm tris (ph = 7.5) and 150 mm nacl and then dialysed against refolding buffer. additional heavy chain was added during incubation at 4c for 48 h, then the solution was concentrated and the refolded complex purified by gel filtration. in both methods, random peptides were used at a final concentration of 200-fold molar excess over heavy chain in the refolding reaction. self - peptides from hla - b53 were purified using a w6 - 32 affinity column as previously described (7). bound peptides were eluted from the mhc class i molecules as previously described (7). in brief, mhc class i peptide complexes were first concentrated on a centricon-3 microconcentrator (amicon, beverly, ma) before the addition of 0.1% trifluoroacetic acid. the eluate was collected and separated by hplc before sequencing with an applied biosystems 473a protein sequencer (applied biosystems, foster city, ca). individual self - peptides eluted from affinity - purified hla - b53 were sequenced as previously described (8). equimolar amounts of each of the naturally occurring amino acids was used to a total of 10-fold molar excess. cysteine was not included in this mix and arginine was used at 1.5 molar concentration to compensate for previously observed low incorporation of this amino acid (4). the randomness of the peptide mixture was then analyzed by hplc and laser - desorption time of flight mass spectrometry. hla - b53 and hla - b8 were produced using vectors pgmt7b53his (5) and pgmt7b8, respectively. hla - a2 and 2 m were produced using the vectors phn1a2 and phn12 m, respectively (a gift from d. garboczi, harvard university, cambridge, ma). hlab53 and hla - a2 were refolded with a random mix of peptides using a dilutional method as previously described (6). in brief, 30 mg of random peptide pool was dissolved in a small volume of 8 m urea and added to a solution of 1 m heavy chain, 2 m 2 m in refolding buffer (0.4 m l - arginine, 0.1 m tris [ph = 7.5 ], 2 m edta, 5 mm reduced glutathione, 0.5 mm oxidized glutathione, 0.5 mm pmsf). after incubation for 3648 h at 4c, the solution was concentrated and the refolded complex purified by gel filtration. hla - b8 was refolded using a dialysis method of refolding. in brief, peptide, 2 m, and heavy chain were mixed with 20 mm tris (ph = 7.5) and 150 mm nacl and then dialysed against refolding buffer. additional heavy chain was added during incubation at 4c for 48 h, then the solution was concentrated and the refolded complex purified by gel filtration. in both methods, random peptides were used at a final concentration of 200-fold molar excess over heavy chain in the refolding reaction. self - peptides from hla - b53 were purified using a w6 - 32 affinity column as previously described (7). bound peptides were eluted from the mhc class i molecules as previously described (7). in brief, mhc class i peptide complexes were first concentrated on a centricon-3 microconcentrator (amicon, beverly, ma) before the addition of 0.1% trifluoroacetic acid. the eluate was collected and separated by hplc before sequencing with an applied biosystems 473a protein sequencer (applied biosystems, foster city, ca). individual self - peptides eluted from affinity - purified hla - b53 were sequenced as previously described (8). analysis of the random peptide library by hplc and laser desorption - mass spectrometry showed that the library was a homogeneous mix of peptides without any obvious peaks of abundant peptides and conformed to the mass range expected for nonamer peptides. refolding of mhc class i molecules with the random peptide mixture resulted in the formation of stable complexes of heavy chain, peptide, and 2 m, which migrated at the correct mass using gel filtration. a final concentration and wash step before peptide elution ensured that only peptides that formed complexes stable enough to remain associated during these procedures were analyzed. peptides were eluted from 500 g of mhc class i. the results of pool sequencing of these peptides and of the random peptide library showed that while there were no significant enrichments for any amino acids in the random library, such enrichments were found in the mhc class i associated pool. positions where the yield of a particular amino acid was increased to 150% or more of the previous cycle were considered significant (fig. the motif identified using this method could be compared with that identified by previous studies (fig. 2). it can be seen that although the motifs were not identical, the same anchor residues were observed by both methods with the exception of the cooh - terminal hydrophobic anchor previously observed in studies of hla - a2 and hla - b8. in addition, in some cases in which enrichment for anchor residues did not reach the 150% level, the same patterns of enrichment were seen for both the naturally bound peptides and the peptides bound by the recombinant class i. it is also interesting that the strength of motifs for different mhc class i alleles is conserved using both methods, so that, for example, whereas hla - a2 shows strong enrichment for several possible minor anchors in both pool sequences, hla - b53 shows a relatively weak proline anchor at position 2 using both methods (fig. 2). in addition, whereas analysis of four individual self - peptides eluted from hla - b53 and three t cell epitopes suggests a preference for hydrophobic cooh termini (fig. 3), this was not observed in the results from pool sequencing. thus the amino acid preferences observed from pool sequencing of hla - b53 seem somehow less strong than those of, for example, hla - a2. previous studies of the peptide binding motifs of mhc class i molecules have indicated that most hla class i alleles show a preference for a hydrophobic cooh - terminal amino acid, with a small number favoring a positive charge at this position (reviewed in reference 3). the majority of these motifs are derived from analysis of the peptides bound to mhc class i on the surface of b cells and thus reflect both the specificity of the mhc class i molecule itself and the effects of processing and transport. direct binding of synthetic peptides to mhc class i has also been used to study the peptide binding specificity of these molecules. although a number of methods have been used (reviewed in reference 3), it is difficult to reflect the dynamic interactions of mhc and peptide using single peptides. the number of mhc peptide complexes on the cell surface will be determined both by the ability of peptides to compete for binding and also by the stability of the subsequent complex. parker and colleagues (9) have described experiments in which they measured the stability of complexes formed between recombinant hla - a2 and synthetic peptides. interestingly, when the requirements of the peptide cooh terminus were analyzed, these did not conform with the expected restrictions. the motifs observed in this study differ from those previously reported because they show no preference for a cooh - terminal hydrophobic or positive charge. a trivial explanation for this would be that the solutions and the temperature at which binding was carried out may interfere somehow with peptide mhc interactions. however, since preferences for both hydrophobic and other peptide anchors are conserved elsewhere in the motifs, this seems unlikely. one simple mechanism to explain the observed differences in peptide cooh termini is that naturally processed peptides are subject to selection for transport into the endoplasmic reticulum by the tap transporter, whereas our random mixture is not. studies of the substrate specificity of the tap protein in human, mouse, and rat have suggested that whereas the rat tap2 and murine tap were highly selective for hydrophobic or aromatic cooh termini, the human tap and the rat tap2 transporters were only weakly selective for hydrophobic or positive charge and against negative charge (10). therefore, this bias would tend to favor hydrophobic cooh termini in most mhc class i alleles. those mhc class i molecules that appear to exhibit a preference for positively charged cooh termini instead may simply be those which are less able to tolerate hydrophobic cooh termini and thus bind the next most abundant species, those with positively charged cooh termini. however, analysis of hla - a2-associated peptides in a mutant cell line lacking the tap transporter suggests that the preference for a hydrophobic cooh terminus is still observed (11). therefore, it is likely that other mechanisms of peptide processing may act independently of or synergistically with the tap transporter to affect the cooh terminus of the peptides. experiments to determine the alterations in substrate specificity conferred by the mhc - encoded lmp2 and lmp7 subunits of the proteasome have suggested that the presence of these subunits enhances proteolysis after hydrophobic and positively charged amino acids and decreases proteolysis after negatively charged amino acids (12, 13). in addition, we can not exclude the possibility that other processes involved in the generation and assembly of mhc peptide complexes, such as the involvement of molecular chaperones, may also act to bias the repertoire of peptides available for binding to mhc class i. the preference of both the putative proteolytic enzymes and transporter molecules involved in class i processing for hydrophobic or positively charged cooh termini of peptides appears to accord with the observation that most mhc class i motifs have hydrophobic cooh termini, and the few that do not have positively charged coohtermini. this has been interpreted as suggesting that the antigen processing machinery has evolved to supply the mhc class i molecule with peptides optimal for binding. however, because most mhc class i motifs are derived from the analysis of peptides eluted from mhc class i molecules on the cell surface, these motifs include the effects of both antigen processing and mhc binding. therefore, we favor an alternate explanation for the observed preference for hydrophobic or positively charged cooh termini in mhc class i motifs, namely that this is largely an effect of processing and that in the absence of such processing this preference is not found. this observation does not affect the use of currently available mhc class i motifs in the prediction of t cell epitopes, since a hydrophobic cooh terminus will still be required for natural processing and presentation of antigens. on the other hand, these observations necessitate a reevaluation of the role of processing in the selection of peptides for binding to mhc class i. a preference for cooh - terminal hydrophobic residues for both the processing machinery and class i molecules would imply that the system had evolved to optimize peptide delivery to class i. if class i does not select for hydrophobic cooh termini in the absence of processing, then it would seem that the selection for cooh - terminal hydrophobic anchors, in fact, acts to restrict the repertoire of peptides available to bind mhc class i. although this may seem counterproductive, a precedent for such a limitation of peptides is already known. the tap transporter of human, mouse, and rat appears to be a poor transporter of peptides with proline at positions 2 and 3 (14). however, a number of hla - b alleles (including hla - b53) appear to bind a proline anchor at position 2 of the peptide. thus, it would seem that either the selectivity of the transporter is acting to reduce the number of peptides available to bind these, or that there is some advantage in longer peptides being transported and then cleaved to generate the mhc binding peptide within the endoplasmic reticulum. if the former is the case one can only speculate as to the possible benefits to the host of reducing the repertoire of endogenous peptides presented on mhc class i. however, it is possible that this acts to decrease the effective hole in the t cell repertoire caused by negative selection of t cells in the thymus. the results of this work demonstrate that recombinant mhc class i molecules produced in e. coli retain their peptide specificity during refolding with peptide and 2 m molecules in vitro. in addition, the observed differences between the peptide binding motifs derived from naturally processed peptides and peptides bound to mhc class i in vitro suggest that peptide processing and transport play a dominant role in determining which peptides will ultimately be presented in association with mhc class i. the yield of each amino acid (indicated by single letter code) for each position of the peptide is shown for hla - a2, hla - b8, and hla - b53. positions where the yield of amino acid is 150% greater compared with the previous cycle are underlined. comparison of the peptide binding motifs for hla - a2, hla - b8, and hla - b53 derived by different methods. (2), namely, dominant or strong anchor residues are indicated in bold type, and listed vertically in order of descending importance. it should be noted that different criteria were used to assign anchors in some studies, particularly when individual peptide as opposed to pool sequences were analyzed. sequences of individual self - peptides eluted from hla - b53 and sequenced using tandem mass spectrometry. the isobaric residues isoleucine and leucine could not be distinguished in the unknown peptide. | recombinant hla - a2, hla - b8, or hla - b53 heavy chain produced in escherichia coli was combined with recombinant 2-microglobulin (2 m) and a pool of randomly synthesised nonamer peptides. this mixture was allowed to refold to form stable major histocompatability complex (mhc) class i complexes, which were then purified by gel filtration chromatography. the peptides bound to the mhc class i molecules were subsequently eluted and sequenced as a pool. peptide binding motifs for these three mhc class i molecules were derived and compared with previously described motifs derived from analysis of naturally processed peptides eluted from the surface of cells. this comparison indicated that the peptides bound by the recombinant mhc class i molecules showed a similar motif to naturally processed and presented peptides, with the exception of the peptide cooh terminus. whereas the motifs derived from naturally processed peptides eluted from hla - a2 and hla - b8 indicated a strong preference for hydrophobic amino acids at the cooh terminus, this preference was not observed in our studies. we propose that this difference reflects the effects of processing or transport on the peptide repertoire available for binding to mhc class i molecules in vivo. |
ige mediated anaphylactic reaction can result in clinical symptoms ranging from mild cutaneous effects (grade i) to cardiac arrest from profound hypotension and circulatory collapse (grade 4) terr classification. to date we are unable to predict the severity of these reactions from the ige levels alone or the allergen but the most severe reactions involve angioedema and hypotension. the effects of released histamine are central to this and produce falls in systolic blood pressure with angioedema from histamine effects on the microcirculation [2, 3 ]. subjects tend to repeat their reactions on subsequent exposure unless the allergen dose is small [3, 4 ]. there are unanswered questions as to which host factors may be influencing the effects of the released histamine [57 ]. angiotensin - ii (aii) is the most potent vasoconstrictor that is rapidly generated in response to hypotension and protects against profound falls in systemic blood pressure such as those that occur in haemorrhage or shock [810 ]. the generation of aii from angiotensin - i (ai) is by the angiotensin converting enzymes known as ace, and is influenced by an individual ace genotype [1113 ]. serum ace also catabolises bradykinin (bk) which influences the manifestation of angioedema in allergic disease [1418 ] (figure 1). bk is a nonapeptide kinin formed from a plasma protein 2-globulin (kininogen) by the action of the enzymes kallikrein ; it is a very powerful vasodilator that increases capillary permeability and angiooedema in allergic reactions via plasma extravasation from postcapillary venules [14, 15 ]. typically this is mainly limited to the face, lips, tongue, and oropharynx including the upper respiratory tract. bk 's half - life is significantly shorter in subjects with a dd genotype due to the increased serum ace activity of this genotype which reduces the effects of bk [16, 17 ]. the ace gene exists in 2 allelic forms, with the presence of i or absence d of a 287 base pair intron of the gene [12, 19 ]. the deletion d genotype is associated with high aii generation and increased plasma bk catabolism [15, 18, 19 ]. i is associated with lower ace activity and impaired bk catabolism [14, 19, 20 ]. individuals, who are homozygous for the d genotype (dd), have the highest serum ace activity with higher plasma levels of aii. bk degradation is also increased by high ace activity [13, 22 ]. the ii genotype is associated with reduced ace activity which improves basal levels of bk with its effects on nitric oxide and vasodilatation of the microcirculation [15, 16 ]. the heterozygous genotype i d follows the ii genotype pattern for baseline ace activity, plasma aii levels, renin activity, and blood pressure responses to exercise [18, 19, 23 ]. renin activity reflects ai levels in the plasma and is the enzyme responsible for ai generation [23, 24 ]. in 1993 hermann and ring examined the ras in patients with hymenoptera venom induced anaphylaxis and healthy controls. using terr 's classification they demonstrated a significant reduction in the renin angiotensin hormones with increasing grade of anaphylactic severity (13). recent studies of peanut and tree nut anaphylaxis have confirmed lower serum ace concentrations, 95%) developed airway swelling affecting mouth, tongue, or throat. since these symptoms would relate more directly to likely ace activity, they were analysed as a separate group and related to their genotype. subjects in the cra group described all previous reactions to consist of chest symptoms (bronchospasm, cough, and wheeze) with pruritus, urticarial, and conjunctivitis also present to varying degrees. in some abdominal cramps no subject in this group described angiooedema or hypotensive symptoms in any of their previous reactions. these were measured in all cases of hymenoptera venom allergy and drug induced anaphylaxis, where the information was combined with skin prick testing and intradermal testing as appropriate. the food induced anaphylactic subjects had ige and specific ige tests only if strong confirmation by skin prick test was judged unsatisfactory. since ige levels were only measured where indicated, no subsequent analysis involving ige for the cohorts could be made. most measurements were performed in house by our immunology laboratory department at st helier by phadia 250 unicap analysis. a range of products were used, alk - abello for airborne allergens and hymenoptera venom, and hollister stier for food allergens with fresh food tests in some subjects. skin prick tests were read at fifteen minutes with appropriate positive and negative controls, and without antihistamine use for five days. blood samples for serum ace were collected as a morning fasting sample with the subject supine for at least 20 minutes. the samples were collected in tubes at 4c and spun in a refrigerated centrifuge at 4c for 10 minutes at 4500 g. the serum was removed into labelled tubes at 4c and rapidly stored at 20c until analysis at the end of the study. measurement was performed by our biochemistry department, st helier hospital, using the bulmann ace kinetic test kits. this measures the cleavage of a synthetic substrate (fapgg) by the ace enzyme, which is measured by absorbance at 340 nm. quality controls and standard curves were plotted. the normal ranges for serum ace activity were 2070 u / l with variation in ranges known to reflect ace genotypes variations. the ace gene polymorphisms follow mendelian characteristic as predicted by the hardy - weinberg equilibrium and described by butler. and rigat.. edta samples were collected and centrifuged for ten minutes at 4500 g. plasma was removed without disturbing the buffy coats. genomic dna was subsequently prepared from the buffy coats (300 l) using the promega maxwell 16 semiautomated extraction system (promega). the extracted dna samples were quantified (eppendorf biophotometer) and stored at 20c until ready for pcr. the pcr reaction was set up in a total volume of 25 l with 20 l of reddy mix pcr master mix (abgene ltd, uk, thermo scientific) containing 1.5 mm mgcl2, 20 mm ammonium sulphate in 75 mm tris - hcl buffer and 50 pmol of the forward and reverse oligonucleotide primer (mwg biotech, germany), and 5 l of 50100 ng of genomic dna template. the sense and antisense primers had the following sequences : 5 ctggagaccactcccatcctttct 3 5 gatgtggccatcacattcgtcaga 3 pcr cycling conditions were heating at 94c for 2 min followed by amplification for 35 cycles ; each cycle consisted of denaturation at 94c for 1 min, annealing at 55c for 30 sec, and extension at 72c for 90 sec. the pcr products (10 l) were separated on 2% agarose gel with ethidium bromide using tbe buffer solution. a 100 bp dna ladder size marker (8 l) was used. i and d alleles were identified at 490 bp and 190 bp, respectively. samples identified as dd were subjected to a second round of pcr amplification using insertion specific sequence as described by tomita. this pcr identified a 335 bp in the presence of the i allele but not in dd homozygotes. measurement was performed by elisa kit (e90889hu) supplied by uscnk life science, china. normal plasma levels of renin range were 11302920 pg / ml resting supine (j physio 2011 ; 589 : 1272 - 81). replete levels are 75200 nmol / l, severe deficiency < 25 nmol / l. the level of significance was adjusted in bonferroni fashion for multiple comparisons predetermined by the number of comparisons using the bonferroni correction to avoid false positive findings, which for 3 main groups comparison would give a statistical significance at (0.05/3 = 0.016)p = 0.016. with sem, sd, and 95% ci genotype profiles of all the groups and subgroups with different grades of anaphylaxis were compared by pearson 's chi - square test for categorical data. chi - square test was used for assessment of the hardy - weinberg equilibrium for the distribution of genotypes. the genotype frequency for atopics and anaphylactic groups were firstly compared with healthy controls using a chi - square test (2df). odds ratios were calculated with 95% confidence intervals comparing the presence of i d and ii with dd. genotypes in anaphylactic subjects with aacvs were compared with those with cra, and also for traditional anaphylaxis grades 14. mean plasma renin levels in pg / ml were calculated for the groups and compared with the ace genotypes and aacvs / cra subdivisions by anova and unpaired t - test. mean levels (nmol / l) were calculated for the groups and comparisons made by anova and unpaired demographic information (table 1) shows the demographics of the 3 main groups including allergen sensitivity and anaphylaxis grading 14. the mean ages are similar and do not influence the genotype or serum ace levels. allergic disease also has a female predominance, with a female / male ratio of 1.35 reported in the uk. table 2 serum ace levels shows that all groups fell within the normal range (2070 u / l). hc and atopics had a similar mean (48 u / l), while the anaphylaxis group was significantly lower (33.2 u / l). within the cra and aacvs subgroups, the serum ace differences between the groups were confirmed by anova testing and individual t - tests with significance at the p = 0.016 level. this confirmed serum ace levels were significantly lower in the anaphylaxis group and aacvs subdivision compared with hc and atopics. from work related to serum ace levels and sarcoid, it has been demonstrated that dd genotypes occupy the upper end of the normal range while ii genotypes give serum values at the lower end. table 3, ace genotypes, shows the genotype frequency distribution including chi - squared analysis and p values. among the healthy controls, the gene frequency was consistent with european population data (eu data of general population dd 43% there were no statistical differences between hc and atopics, although atopics had a higher percentage of i d gene frequency suggesting that they may be half way between normal and anaphylaxis. anaphylaxis patients were different with a predominance of i d and ii genes, and a reduction in dd. this difference was most marked in the aacvs group. compared with atopics, cra showed increased dd genotype frequency and aacvs showed increased ii gene frequencies- but the p values did not reach the bonferroni adjusted p value of 0.016. we did not find any definite associations between genotype and specific allergen (e.g., nuts, shellfish, venom, etc.) this grading system does not clearly distinguish between cra only symptoms and aacvs, because these symptoms are mixed together in each grade (table 5). the chi - squared analysis did not show a significant difference between the 4 grades. table 4 analysis of gene frequencies-, shows that anaphylaxis patients were more likely to be an i d genotype (odds ratio 3.3) or ii genotype (odds ratio 3.1) than dd, p = 0.001. atopic controls showed a similar tendency towards a lower prevalence of dd genotype but this did not reach significance (p = 0.082). while ii genotype was more common among aacvs than the healthy controls, none of the cra subjects had ii genotype although they showed a frequency of dd genotypes similar to the healthy controls. there was a strong relationship between anaphylaxis and genotype compared with healthy controls, which is due to aacvs group, with dd being more common in healthy controls. atopic subjects also have less dd than healthy controls, but this is not significant. however the atopic group is relatively small and this data suggests the atopics fall between anaphylaxis and healthy controls but there is insufficient data to show significant results. mean plasma renin levels in pg / ml were identical between the groups, which was confirmed by anova as well as individual t - tests. hc = 3647, atopics = 3553, cra = 3510, and aacvs = 3570, suggesting that renin did not influence our findings. mean serum 25-oh vitamin d levels were in the insufficient range of < 75 nmol / l for all groups which may represent our uk climate and latitude. hc had higher mean vitamin d levels 54.3 nmol / l 26 sd than atopics 44.8 nmol / l 23 sd (p = 0.032, 95% ci 18.1, 0.89), or anaphylaxis ; mean was 46 nmol / l 19 sd (p = 0.020, 95% ci 15.1, 1.32), but these did not reach the bonferroni adjusted p value of 0.16. in the uk, 2% of the adult population carry adrenaline due to prior anaphylactic reactions. the genes for atopy, bronchial hyperresponsiveness, and asthma are being recognised and form a polygenetic pattern of inheritance but there are no links between individuals with anaphylaxis and any specific allergy genes. current research is examining food allergy and conformational and sequential antibody - antigen binding sites. this may ultimately confirm a difference in ige binding which may affect levels of histamine release and the manifestation of these reactions. our study demonstrates a link between ace genotype and anaphylaxis to food, venom, and drugs, particularly for reactions that include cardiovascular collapse and severe angioedema. here these two genotypes share similar ace activity and ai and aii plasma levels and physiological responses [14, 15, 18 ] and are therefore likely to behave in a similar manner clinically in response to hypotension and bk metabolism [12, 15, 18, 23 ]. the aacvs pattern of symptoms would be very consistent with low levels of ace activity, producing both inadequate or delayed a2 generation to prevent hypotension and impaired bk metabolism that could facilitate angioedema. few patients with the dd genotype were found in the anaphylactic group, and most of those manifested cutaneous and respiratory symptoms only, which are least likely to be associated with reduced ace activity and more likely to be related to histamine effects [11, 19 ]. the cra group only represented 23% of the total group and so may be subject to bias. the atopic group is smaller than the other groups and so may lack sufficient power to examine fully its relationship with healthy controls. atopics do show an increased i d genotype population although this was not significant (p = 0.14), but may suggest that they lie somewhere between hc and anaphylaxis and warrants further investigation. examined angiotensinogen (mm / mt) and ace gene (i / d) polymorphisms in 107 patients with grades iii and iv anaphylaxis to insect venom and 113 controls. in addition they identified polymorphisms in the angiotensinogen gene m235 t resulting in low levels of angiotensinogen in 29.9% of subjects compared with 17% of controls (p = 0.02). in grade iv anaphylaxis this frequency increased to 39% (p = 0.001, odds ratio 2.5). since this is the substrate for renin to generate ai this could be an important additional genetic factor in anaphylaxis. our serum ace levels appear to reflect the genotype findings, with hc and atopics being similar, but anaphylaxis showing significantly lower levels especially for the aacvs subdivision. these findings fit well with those of summers. who examined serum ace levels in patients with tree / nut allergy. he found that mean ace levels above 47 mmol / l were not associated with pharyngeal oedema, while serum ace levels < 37 mmol / l were a risk factor for pharyngeal oedema but not asthma. he suggested that since ace levels are stable in adult life and independent of age or sex, they reflect genetic inheritance. in women of reproductive age it is now understood that oestrogen protects against cardiovascular disease due to the inhibitory effects of oestrogen upon mrna synthesis of ace. this protective effect contributes to the hypotension of pregnancy as oestrogen levels climb and is lost at menopause when serum ace levels rise unless inhibited by the use of hormone replacement therapy [4042 ]. this could suggest that premenopausal women effectively inactivate a d gene, through their oestrogen effects on ace synthesis, rendering themselves more ace deficient than men for the same genotype. this could offer one explanation as to why adult premenopausal women show an increased anaphylaxis rate compared to men ; an observation which is lost after menopause. anaphylaxis research in rodents suggests that platelet activating factor (paf) is involved in cardiovascular collapse in murine models of anaphylaxis which can be prevented by paf antagonists [43, 44 ]. in paf knockout mice, paf levels have been measured in man, and are reduced immediately following anaphylaxis [45, 46 ], but other data indicates that these levels are normal if measured away from the event. paf maybe acting through endothelial nitric oxide (eno), when mediating its hypotensive effect in anaphylaxis [4, 43, 45 ]. eno is now of interest in murine models of anaphylaxis, where chronic blockade of eno increases expression of mrna for renin, ace, and ai receptors in the aorta, with the risk of hypertension [47, 48 ]. in man eno is involved in regulation of the microcirculation but has links with ras, bk, and renal function [6, 10, 48 ]. activation of ras enhances eno production, giving vasodilator effects on the microcirculation to protect against the vasoconstrictor effects of aii. oestrogens have been shown to increase eno levels and protect the circulation leading to the better renal function and resistance to renal injury observed in women [7, 47 ]. this may suggest that individuals with dd genotypes, and therefore higher basal levels of aii, would be more protected from the risk of cardiovascular collapse via enos and paf in anaphylaxis [15, 31, 39, 47, 49 ]. this may not be true for i d and ii genotypes especially in premenopausal women, where the presence of oestrogen reduces basal aii levels giving higher levels of bk and enos. vitamin d has effects on renin levels and several publication suggest a link to allergy, anaphylaxis, and epi - pen prescription [29, 50 ]. renin synthesis is lowered by vitamin d at the mrna level and is suggested to be cardioprotective in this way [30, 5154 ]. lowering levels of renin would theoretically reduce its enzymatic activity and ai generation which may reduce enos productions. this observation is probably minimised in our study, since nearly all subjects had vitamin d insufficiency, although the atopics and anaphylaxis groups had the lowest levels. our results suggest that anaphylactic reactions to foods, venom, and drugs which involve acute angioedema and cardiovascular collapse may have links with ii and i d ace genotypes and lower serum ace levels, which is less clearly related to the conventional anaphylaxis grades i iv. oestrogen and its effects on serum ace levels may explain the difference in anaphylaxis rates between men and women with further research of interest including the links between the renin angiotensin system to eno and paf. | circulating angiotensin - ii protects the circulation against sudden falls in blood pressure and is generated by the enzymatic action of angiotensin converting enzyme (ace) on angiotensin - i. the ace genes have 2 allelic forms, i and d. the d genotype has both highest angiotensin - ii generation and serum ace levels compared to i. 120 patients with ige - anaphylaxis, 119 healthy controls, and 49 atopics had serum ace levels, ace genotype, and renin levels determined. plasma renin levels were identical for all groups. serum ace levels and genotypes were similar for healthy controls (hc) and atopics, but lower in anaphylaxis (p = 0.012), with ace genotypes also showing increased i genes (p = 0.009). this effect was more pronounced in subjects manifesting airway angioedema and cardiovascular collapse (aacvs) than mild cutaneous and respiratory (cra) symptoms. aacvs was significantly associated with the presence of i genes. for i d genotype or is 5.6, 95% ci 1.8 to 17.4, and for ii genotype or is 44, 95% ci 5 to 1891 within the anaphylaxis group = 0.001. the results show a difference in the genotype frequency between control and anaphylaxis, suggesting a role for the renin angiotensin system in anaphylaxis manifesting with airway angioedema and cardiovascular collapse. |
mechanical systems are used in buildings to provide conditioned air, dissipate thermal loads, dilute contaminants, and maintain pressure differences. the characteristics of these systems and their operations h implications for the exposures of workers to environmental tobacco smoke (ets) and for the control of these exposures. this review describes the general features of building ventilation systems and the efficacy of ventilation for controlling contaminant concentrations. ventilation can reduce the concentration of ets through dilution, but central heating, ventilating, and air conditioning (hvac) can also move air throughout a building that has been contaminated by ets. an understanding of hvac systems is needed to develop models for exposures of workers to ets.imagesfigure 1figure 2figure 3 |
|
endoscopic submucosal dissection (esd) is a standard treatment for early gastric cancer (egc) that does not have any risk of lymph node or distant metastases. the indication for esd is determined by the lesion size, shape, ulceration, depth of invasion, and histologic differentiation. here, we report a case of egc that resembled a diverticulum, which made it difficult to estimate the lesion size, shape, ulceration, and depth of invasion. this lesion was treated with esd, which revealed type i+iic egc confined to the submucosal layer, shaped like a false diverticulum because of submucosal inflammation and infiltration. a 47-year - old korean man visited our hospital for periodic health examination in october 2014. he had a history of immunoglobulin g nephropathy, and had undergone bilateral kidney transplantation 15 years ago. he had an intraductal papillary mucinous neoplasm of the pancreas, and underwent a distal pancreatectomy and splenectomy in october 2012. we performed an esophagogastroduodenoscopy (egd), endoscopic ultrasound (eus), and abdomen - pelvis computed tomography (ct). the egc was shaped like an elevated nodular mucosal lesion with a central inverted area. the operation history may have contributed to the shape and the inverted type of the central depressed lesion, such as a false diverticulum. the egc was 15 mm in size and classified as type i+iic according to the japanese classification. endoscopic forceps biopsy was performed three times at the anterior wall, two times at the posterior wall, and three times at the center opening of the main lesion. the eus showed that the main lesion was mostly located in the mucosal layer ; however, partial submucosal invasion was observed, and there was no regional lymph node enlargement (fig. because of his prior surgery, he needed a total gastrectomy although the lesion was located on the antrum. for this reason, although the exact character of the lesion was uncertain, esd was done to resect the egc. for the esd technique, we used a gif - q260j instrument (olympus optical co. ltd., tokyo, japan). the lesion was raised by means of a submucosal injection of a 37 ml mixture of indigo carmine, epinephrine, and hypertonic saline (1:100,000). although it was difficult to differentiate between true and false diverticulum in this lesion, lifting of the lesion with indigo carmine and epinephrine mixed in saline would suggest that the lesion is a false diverticulum induced by inflammation or the previous operation. after the injection of indigo carmine solution, the submucosal layer appeared grossly as a white web - like structure (fig. in addition, full submucosal dissection was done by using an insulation - tipped (it) knife and a hook knife, with a coagulation current of 60 w (fig. the en bloc resected tumor was 5.64.7 cm in size and had a central opening with nodular submucosal exposure (fig. the safety margin was 0.9 cm of the proximal part, 0.15 cm of the distal part, 1.0 cm of the anterior wall, 0.4 cm of the posterior wall, and 150 m of the basal part. type i+iic egc coexisted with the false diverticulum, and the pathologic tumor size was 3.61.8 cm, which was larger than the extended criteria for esd (fig. the cancer was a tubular adenocarcinoma, intestinal type, based on the lauren classification, and was moderately differentiated. invasion of the submucosa (pt1b, depth of submucosal invasion : 450 m) was observed (fig. he had no specific complications and was discharged from the hospital after 4 days. on the basis of the pathologic report, additional surgery was needed ; however, he wanted to undergo follow - up care instead of surgery. esd was developed for the complete removal of egc in the late 1990s, by using a scope with endoscopic knives. in 2007, gotoda proposed the extended esd criteria for egd. the extended esd criteria were compatible with surgical resection for egc in terms of safety, efficacy, risk of recurrence, and complications. the definition of gastric diverticulum was suggested in 1661 by moebius in rare cases of gastric wall transformation. recent articles have commented that the best diagnostic tool for detecting a gastric diverticulum is upper gastrointestinal contrast radiography or egd. first, true (congenital) diverticulum is relatively common, and comprises 70% to 75% of all gastric diverticulum cases. they are usually located on the posterior wall of the cardiac region. on the 20th and 50th days of gestation, the stomach is transformed from a fusiform swelling of the foregut into its adult form, during which a 90 rotation of the stomach occurs, including the duodenum, pancreas, and dorsal mesentery. second, conversely, false (acquired) diverticulum consists of partial layers of the stomach. this type occurs as a result of secondary conditions such as a malignancy, peptic ulcer disease, pancreatitis, or prior surgery. the false type is most common in adults and is usually located near the gastric antrum. false diverticula are subdivided into the following groups : (1) the pulsation type, which may arise from conditions associated with increased intraluminal pressure or impaired gastric wall by gastric ulcer or gastric cancer or surgery, or (2) the traction type, which can develop owing to perigastric adhesions and can result from inflammatory lesions of the spleen, gallbladder, pancreas, liver, or peritoneum, or from stomach surgery. until recently, surgical management is considered only when medical treatment is refractory or symptomatic, the tumor is large, and complications such as bleeding or perforation are observed. since the first successful laparoscopic resection was done for the treatment of a gastric diverticulum in the late 1990s, the safety and feasibility of laparoscopic resection however, no studies have reported successful treatment of egc with the endoscopic approach in false gastric diverticulum cases. until now, the relation between gastric diverticulum and gastric cancer has not been clearly defined. the egc was type i+iic, shaped with a central depressed area, and resembled a gastric diverticulum. precise evaluation of the egc was impossible in the endoscopic examination because of the lack of mucosa, inflammation, and submucosal infiltration. also, the comorbidity of the patient and the risk due to the previous surgery indicated that an endoscopic approach was needed. therefore, esd was done to resect the false gastric diverticulum that coexisted with the egc. the main lesion had an invaded submucosal layer (sm1) in the endoscopic examination. for the procedure, marking with argon plasma coagulation was performed first, as usual ; then, most of the lesion was dissected with an it knife. for the dissection of a lesion with a diverticular shape, the submucosal layer should be definitively identified and careful dissection is pertinent. for this reason, a hook knife was used to dissect the central area where the fibrosis seemed to be severe in this case. compared with an it knife, dual - type and hook type knives are favored for dissecting fibrotic areas within a narrow field of view. after 3 months, follow - up egd and five endoscopic forceps biopsies for the post - esd scar lesion were performed. esd has been established as a standard treatment option for egc with an absolute or extended indication. however, endoscopists are generally reluctant about performing the endoscopic maneuver for egc with an unusual or difficult - to - resect shape. this is the first report to demonstrate the application of endoscopic resection to an unusually shaped, inverted - type, egc - forming false gastric diverticulum, and its successful treatment with esd. | endoscopic submucosal dissection (esd) is a standard treatment for early gastric cancer (egc) that does not have any risk of lymph node or distant metastases. here, we report a case of egc resembling a diverticulum. diverticular formation makes it difficult for endoscopists to determine the depth of invasion and to subsequently perform esd. because the false diverticulum does not have a muscular layer, this lesion can be treated with esd. our case was successfully treated with esd. after esd, the egc was confined to the submucosal layer without vertical and lateral margin involvement. this is the first case in which esd was successfully performed for a case of egc that coexisted with a false gastric diverticulum. an additional, larger study is needed to determine the efficacy of esd in various types of egc, such as a false gastric diverticulum. |
more than 95% of thyroid cancers originate from thyroid follicular epithelial cells. among the well - differentiated forms, papillary thyroid carcinoma (ptc) is the most prevalent one, accounting for 7580% of cases, followed by the follicular thyroid carcinoma (ftc), which represents approximately 1015% of all thyroid cancers. distinction between ftc and its benign counterpart (follicular adenoma) is impossible on cytological grounds. pathological examination showing capsular or vascular invasion is necessary to establish the diagnosis of ftc [24 ]. activating alterations in the canonical ras / raf / mek / erk pathway (mapk pathway) the braf v600e activating mutation is the most frequent genetic alteration in ptcs. in ftcs, however, this alteration is virtually absent and oncogenic alterations of ras proteins are instead the most prevalent ones [1, 5 ]. although a single oncogenic alteration in mapk pathway might be sufficient to drive thyroid cell neoplastic transformation, further supportive molecular events are likely to be associated with thyroid malignant progression leading to more aggressive phenotypes and poorer clinical outcomes. we have recently described rac1b, a splicing variant of rac1, as a potential new prognostic marker for clinical outcome in ptc patients. rac1 belongs to the rho family of ras - like small gtp - binding proteins, a class of molecular switches that regulate cellular functions by cycling between an inactive, gdp- and an active, gtp - bound state. these small gtpases have been implicated in cancer since they regulate signaling pathways involved in processes such as gene expression, cell proliferation, and cell migration. the rac1 splice variant, rac1b, contains 57 additional nucleotides that result in an in - frame insertion of 19 amino acid residues in the vicinity of an important regulatory region of the gtpase. rac1b overexpression has been documented in colorectal, breast, lung, and pancreatic cancer [9, 1115 ]. in our previous study we have, previously, shown that rac1b is overexpressed in ptcs compared to normal thyroid tissue and that rac1b overexpression is significantly associated with braf v600e mutation and poorer clinical outcome in ptc. here, we aimed to broaden the study of rac1b expression to follicular lesions including follicular adenomas and follicular carcinomas and to seek for clinical correlations. samples representative of 23 ftcs and samples representative of 33 follicular adenomas from 56 patients, who underwent surgery at our institution, were analyzed. tissue sample collection was carried out in accordance with protocols approved by the institutional review board and written informed consent was obtained together with the consent for surgery. total rna was obtained from frozen tissues using rna easykit (qiagen), according to manufacturer 's instructions, and 2 g was reverse transcribed using random primers and superscript ii (invitrogen). mutational analysis of kras, hras, and nras was performed by sanger sequencing method : the full coding regions of ras transcripts were amplified by reverse transcription polymerase chain reaction (rt - pcr) (primers and pcr conditions available upon request). pcr purified products were directly sequenced using bigdye terminator v1.1 cycle sequencing kit (applied biosystems, foster city, ca, usa). the rac1b and total rac1 expression levels were quantified by quantitative reverse transcription polymerase chain reaction (rt - qpcr) on an abi prism 7900ht sequence detection system, as previously described. for each sample, rac1b normalized values were then expressed relative to that of a pool of normal thyroid tissues, used as reference sample. rac1b overexpression was defined as a value above a threshold level of rac1b expression corresponding to the mean plus two standard deviations of the rac1b expression level found in the set of normal thyroid tissue samples ; this threshold level was set at 2.133 (arbitrary units). similarly, to monitor total rac1 expression among samples, total rac1 levels were normalized to beta - actin expression level (housekeeping gene normalization) and expressed relative to that of the reference sample. the primary antibodies rabbit polyclonal anti - rac1b (millipore) and mouse monoclonal anti--actin (sigma) were used in western blot at 1 : 1000 and 1 : 3000 dilutions, respectively. detection was carried out using secondary peroxidase - conjugated anti - mouse igg (bio - rad) or anti - rabbit igg (bio - rad) antibodies followed by chemiluminescence. statistical analysis was carried out using graphpad prism statistical software (san diego, ca). statistical comparisons of rates and proportions were made using unpaired two - tailed student 's t - test or the two - tailed fisher exact test, when appropriated. rac1b expression levels in tumor samples were obtained following normalization to the levels from a pool of normal thyroid tissues used as reference sample in all rt - qpcr assays. the mean level for rac1b expression was significantly higher in ftcs (2.137 0.5515) compared to ftas (0.9656 0.07342) (p value = 0.0152, two - tailed student 's t - test), corresponding to a 2.2 mean fold increase in the levels of rac1b expression (figure 1(a)). in order to distinguish tumors that overexpressed rac1b from those that did not, we defined a threshold level of rac1b expression relative to the normal thyroid tissue (see section 2) above where we considered rac1b to be overexpressed. rac1b was found to be overexpressed in 7 out of 23 ftcs (30%). notably, none of the cases belonging to the ftas group was found to overexpress rac1b. consistently, the difference in rac1b overexpression between follicular adenomas and carcinomas was statistically significant (p value = 0.001, two - tailed fisher 's exact test ; figure 1(b)). since the assessment of rac1b overexpression by immunohistochemistry in paraffin - embedded tissues might be relevant for diagnostic purposes, we further explored this possibility using the only rac1b specific antibody that is commercially available. unfortunately, we were not able to detect a clear difference in rac1b protein levels either comparing rac1b overexpressing and nonoverexpressing tumors or tumor and normal tissue. nevertheless, a notorious difference in rac1b expression was observed when protein levels were assessed by western blot. this discrepancy is likely to be due to antibody nonspecific binding as pointed out by the band of 50 kda observed in the immunoblot (figure 1(c)) that hampers an accurate analysis by immunohistochemistry. to investigate whether rac1b overexpression was associated with histopathological parameters and clinical outcome, ftcs were grouped based on the clinical data available (see table 1). a comparative analysis between ftc patients without distant metastases (m0, 16 cases) versus ftc patients with distant metastases (m1, 7 cases) disclosed a higher prevalence of rac1b overexpression in the latter group (m15/7 ; m02/16). the association between rac1b overexpression and presence of distant metastases was statistically significant (p value = 0.01 ; figure 1(c)). no statistical significant correlation was found between rac1b overexpression and histopathological features such as multifocality, angioinvasion, hrthle cell subtype, or presence of poorly differentiated areas. group i (70% of patients) included patients who reached full sustained remission (no evidence of disease) and patients presenting only biochemical evidence of disease. in contrast, group ii (30% of patients) included patients with structural evidence of disease and those who died due to disease progression. the correlation between rac1b overexpression and group ii was statistically significant (p value = 0.01 ; figure 1(d)), reinforcing that rac1b might be associated with poorer clinical outcomes in ftc patients. at present, stratification risk of patients with follicular cell - derived thyroid carcinomas mainly relies on clinical and histological criteria proved to be insufficient to tailor case management to individual risk levels. a major effort to improve the panel of prognostic indicators has entailed the molecular characterization of thyroid tumors, seeking for molecular markers with a reliable prognostic value [17, 18 ]. previous studies from our group provided evidence for a contributory role of rac1b in ptc development and clinical outcome. we, therefore, hypothesized that rac1b might also be involved in follicular thyroid carcinoma development. moreover, taking into account the impossibility of distinguishing a follicular carcinoma from a follicular adenoma, preoperatively, we wondered whether the rac1b expression could contribute to the distinction of these two entities. our data suggest that rac1b is likely to have a differential expression in follicular adenomas and carcinomas, since rac1b was overexpressed in 30% of ftcs whereas no overexpression was found among ftas. furthermore, we also found a significant correlation between rac1b overexpression and the presence of distant metastases, hence, with poorer outcome. papillary thyroid carcinoma and follicular thyroid carcinoma are collectively designated well - differentiated thyroid carcinomas (dtcs). nonetheless, the underlying genetic alterations promoting the development of these two types of thyroid cancer are different. it is not definitely established whether braf v600e initiates ptc tumorigenesis or is a secondary event. in a previous study, we have shown that rac1b overexpression significantly associates with braf v600e mutation in ptcs. this suggests that a functional cooperation between rac1b and braf v600e may play a role in ptc progression, similarly to that previously described in colorectal cancer. in fact, in colorectal tumors, the elevated levels of rac1b expression were significantly associated with mutant braf but not with mutant k - ras genotype, suggesting that rac1b is needed to sustain braf - induced but not ras - induced cell transformation. the mechanism of action of rac1b in tumorigenesis may, however, differ in other tissues. concerning follicular thyroid lesions, braf v600e is virtually absent in this tumor subtype and the most common mapk - pathway alteration is the presence of ras mutations. notably and contrary to that found in colorectal cancer, oncogenic alterations in k - ras have also been associated with rac1b overexpression in lung cancer and rac1b was shown to promote k - ras - induced lung tumorigenesis. in our series of ftc patients, the incidence of ras mutations in follicular adenomas, which are considered premalignant lesions, suggests a role for ras in early phases of follicular cell tumorigenesis. this is in agreement with the hypothesis that the progression of a premalignant lesion into cancer, with different grades of aggressiveness, is linked to a continuum of molecular changes dependent on late and/or modifier events that are not necessarily exclusive of a specific type of tumor or mechanism of tumorigenesis. overexpression of rac1b may thus be one of these modifier events that can occur in different subtypes of dtcs despite having different triggers. the clinical usefulness of rac1b overexpression in the context of thyroid malignancies remains to be definitively established. nevertheless, our data suggest that rac1b might be involved in the modulation of malignant progression of ftcs, contributing to poorer clinical outcomes, similarly to that previously documented in ptcs. our data also support the potential of rac1b as a molecular marker likely to contribute, in conjunction with other putative markers, to the diagnosis and prognosis of ftcs. | rac1b is a hyperactive variant of the small gtpase rac1 known to be a relevant molecular player in different cancers. previous studies from our group lead to the evidence that its overexpression in papillary thyroid carcinoma (ptc) is associated with an unfavorable prognosis. in the present study, we intended to extend the analysis of rac1b expression to thyroid follicular neoplasms and to seek for clinical correlations. rac1b expression levels were determined by rt - qpcr in thyroid follicular tumor samples comprising 23 follicular thyroid carcinomas (ftcs) and 33 follicular thyroid adenomas (ftas). rac1b was found to be overexpressed in 33% of carcinomas while no rac1b overexpression was documented among follicular adenomas. patients with a diagnosis of ftc were divided into two groups based on longitudinal evolution and final outcome. rac1b overexpression was significantly associated with both the presence of distant metastases (p = 0.01) and poorer clinical outcome (p = 0.01) suggesting that, similarly to that previously found in ptcs, rac1b overexpression in ftcs is also associated with worse outcomes. furthermore, the absence of rac1b overexpression in follicular adenomas hints its potential as a molecular marker likely to contribute, in conjunction with other putative markers, to the preoperative differential diagnosis of thyroid follicular lesions. |
jarid2 (jumonji, at - rich interactive domain 2) is the founding member of the jumonji family of proteins that can demethylate histones, although jarid2 itself is unable to do so (klose., 2006 ; landeira and fisher, 2011). jarid2 was discovered in 1995 as a regulator of neural development in a gene trap screen in mice (takeuchi., 1995), and jarid2 deficiency was later shown to result in a range of phenotypes with variable severity and onset with defects in heart and neural tube formation and hypoplasia of liver, spleen, and blood tissues (jung., 2005 ; landeira and fisher, 2011 ; takeuchi., 2006). in humans, mutations in jarid2 have been linked to congenital defects including nonsyndromic cleft lip, spina bifida, and congenital heart abnormalities (scapoli., 2010 ; 2004), and haploinsufficiency is linked to intellectual disability and brain dysfunction including schizophrenia (bary., 2013 ; celestino - soper., 2012 ;, jarid2 is known to inhibit myogenic differentiation in mouse and human cells (walters., 2014), is important for the scheduled proliferation of epidermal stem and progenitor cells (mejetta., 2011), and is thought to input into cell - cycle control by regulating cyclin d1 (nakajima., 2011 ; toyoda.,, jarid2 is particularly abundant and has been implicated as a hub component of transcriptional networks that underpin pluripotency (assou., 2009 ; kim., 2008 ; loh., 2006 ; sun., 2008 ; zhou., 2007). escs lacking jarid2 remain viable and pluripotent but are unable to efficiently differentiate in culture and show alterations in growth kinetics and in colony morphology (landeira., 2010 ; li., 2010 ; pasini., 2010 ; shen., 2009). jarid2 is a critical component of the polycomb repressor complex 2 (prc2), implicated in guiding the deposition of h3k27me3 across the genome (landeira., 2010 ; li., 2010 ;, 2010 ; peng., 2009 ; shen., 2009). in escs, jarid2 binds to a similar set of genomic sites as core prc2 components, such as embryonic ectoderm development (eed), suppressor of zeste 12 (suz12), and enhancer of zeste 2 (ezh2) (landeira., 2010 ;, 2010 ; peng., 2009 ; shen., 2009). in drosophila, jarid2 also binds to sites that broadly overlap with other core prc2 members, albeit at slightly different levels and with some exceptions (herz., 2012). although these results support a role for jarid2 in prc2 recruitment, in concert with co - factors such as aebp2, pcl1, 2, 3, and esprc2p48 (hunkapiller., 2012 ; kalb., 2014 ; kim., 2008 ; walker., 2010 ; zhang., 2011), the consequence of jarid2 loss for h3k27me3 levels is unclear, as both increased (peng., 2009 ; shen., 2009) and decreased h3k27methylation have been reported (landeira., 2010 ; li., 2010 ; in addition, recent studies of x - inactivation have shown that, while jarid2 is necessary for efficient prc2 recruitment, jarid2 binds to xist rna - associated chromatin domains independently of prc2 (da rocha., 2014). jarid2 also binds to other non - coding rnas in escs (kaneko., 2014) and has been shown to bind nucleosomes directly (son. these findings suggest that jarid2 may have multiple functions in pluripotent escs and could act as an intermediate in the chromatin events that occur as pluripotent cells move toward differentiation (da rocha., 2014). consistent with this view, jarid2-null escs grow and self - renew robustly in culture but are severely compromised in their capacity to generate mesoderm, endoderm, or ectoderm lineages in vitro (landeira., 2010 ; jarid2-null mouse embryos develop normally until e10.5 or beyond (jung., 2005 ; takeuchi., 2006), suggesting that jarid2-null escs may be capable of differentiation but fail to do so in standard in vitro cultures. here, we examined the properties of jarid2-null escs derived from different sources, as well as the factors that were consistently de - regulated in these cells. our results show that jarid2-null escs express constitutively high levels of nanog proteins, indicative of a naive pluripotent state, together with dramatically reduced planar cell polarity (pcp) and wnt signaling components. in particular, expression of prickle1, fzd2, wnt9a, e - cadherin, and -catenin activity were all reduced in jarid2-null escs, while wnt antagonists such as sfrp1 were upregulated. remarkably, this inverse correlation between pcp / wnt signaling and nanog expression was replicated in wild - type escs depleted of prickle1/fzd2/wnt9a, or engineered to overexpress nanog. co - culture of jarid2-null escs with wild - type partners allowed the mutant cells to regain variable nanog expression and -catenin activity and restored their capability for differentiation. surprisingly, we showed that disruption of pcp / wnt signaling early in mouse embryogenesis, by introducing jarid2-null escs (but not eed - null escs), resulted in multiple icm formation. this emphasizes the importance of the jarid2-nanog - pcp / wnt core circuit for normal development and revealed a non - canonical (prc2-independent) role for jarid2 in coordinating this process. pluripotency factor expression by escs has been generally assumed to be unaffected by deletion of prc2 (azuara., 2006 ; boyer., 2006 ; lee., 2006 ; consistent with this, jarid2-null escs (landeira., 2010) expressed substantial levels of each of the core pluripotency factors oct4, sox2, and nanog as indicated by western blotting analysis (figure 1a, clones e4 and e8). surprisingly, however, we detected an inverse correlation between jarid2 gene dose and nanog expression [jm8(wild - type) 2, p value 80% nestin positive by day 10, figure s4c), and fewer cells were recovered overall (5%10%). co - culture of e8 cells with jarid2-null escs, fibroblasts, t or b cells, or with conditioned media derived from wild - type escs did not rescue the capability of e8 cells to differentiate (data not shown) or enhance -catenin activity in these cells (as shown in figure s4d). because -catenin activity is reportedly required for esc differentiation (atlasi., 2013 ; lyashenko., 2011), jarid2-null escs may be unable to execute differentiation efficiently because of low -catenin activity. in this scenario, co - culture with wild - type escs restores -catenin activity and may enable mutant escs to differentiate (figure s4e shows a hypothetical scheme). to investigate whether jarid2 regulation of nanog pcp / wnt signaling is likely to be important in vivo as well as in vitro, we examined the distribution of prickle1 in the pre - implantation mouse embryo. depletion of pcp components, including prickle1, has been reported to lead to defects in cell adhesion that affect the development of early mouse embryos (larue., 1994 ; na. 2009), and previous studies have shown that although prickle1 is detected at e5.5 and earlier (tao., 2009, 2012), canonical wnt signaling is operational slightly later in development (na., 2007). we examined mouse embryos from e3 to e4.5 for prickle1 expression using dapi as a counterstain (blue) to assess cell number. immuno - labeling with antibodies to nanog (red), oct4 (data not shown), or gata6 (red) was used to assess the stage and orientation of the developing inner cell mass (icm) (figures 5a and 5b). as illustrated in figure 5a, prickle1 (green) was abundantly detected in 32- and 64-cell embryos and showed a prominent cytoplasmic distribution in nanog positive cells destined to form the epiblast (region outlined in white, figure 5a). by e4.5, nanog - high cells were condensed to the pole of the embryo where they expressed high levels of prickle1 distributed equivalently between nuclei and cytoplasm. the surrounding gata6-expressing cells (red) also expressed high levels of prickle1 (green), but in this case expression was predominantly nuclear (figure 5b, region highlighted in white). an exception was of a small group of two to six mural trophectoderm cells, in which prickle1 expression was high and located in nuclei and particularly within nucleoli (summarized in the schematic diagram shown in figure 5c). the selective distribution of cytoplasmic prickle1 in cells of the epiblast versus primitive endoderm or trophectoderm was confirmed in optical sections of e4.5 embryos as shown in figure s5a (green labeling and traces). e - cadherin (red, figure 5d) was prominent throughout the blastocyst at these stages. escs that lack jarid2 expressed high levels of nanog and low levels of prickle1, vangl1, and -catenin activity and show severely compromised differentiation (landeira., 2010). as these defects were partially compensated by in vitro co - culture with wild - type escs, we asked to what extent mutant cells would contribute to the developing embryo. wild - type e3.5 blastocysts were injected with either 1015 gfpjarid2-null escs (e8) or an identical number of gfp - labeled wild - type escs (jm8) and then were cultured for 1620 hr before being examined. remarkably, we found that blastocysts injected with jarid2-null escs routinely initiated the formation of more than a single icm (16/39, illustrated in figure 5e, lower panels), a feature that was not detected in any of the controls injected with wild - type escs (0/90, upper panels). importantly, although these secondary icms appeared to be focused around small clusters of jarid2-null escs (marked in green), in which higher levels of nanog might be anticipated, gata6 expression (red) was induced in the underlying wild - type cells (figure 5f). this suggested that injection the mutant escs was sufficient to instruct neighboring wild - type blastomeres to upregulate gata6 and thus contribute to the formation of multiple icms. to distinguish whether multiple icm formation was due to defective prc2 function, or defective nanog, pcp, and wnt circuitry, we injected e3.5 blastocysts with escs lacking prickle1/fzd2/wnt9a, overexpressing nanog, or that lacked eed (azuara., 2006) a core component of the prc2 complex. as shown in table 1, injection of wild - type (e14) and eed - deficient (b1.3) escs generated only a single icm in multiple experiments, whereas blastocysts injected with equivalent numbers of jarid2-null (jarid2#3), prickle1/fzd2/wnt9a - depleted (pcp#5), or nanog - overexpressing escs formed multiple icms in approximately 35%48% of samples. first, we show that jarid2, a polycomb group member implicated in prc2 recruitment, chromatin structure, and gene repression, acts as a positive regulator of pcp / wnt signaling pathways in escs. absence of jarid2 or depletion of prickle1/fzd2/wnt9a results in constitutive nanog expression by esc, which, in turn, results in reduced levels of active -catenin. these observations identify an important jarid2-sensitive core circuit in escs that regulates pluripotency and differentiation. in previous studies, jarid2-null escs were shown to have a profoundly compromised ability to differentiate in culture (landeira., 2010 ; li., 2010 ; pasini., 2010 ; peng., 2009 ; shen., 2009). here, we show that canonical and non - canonical wnt signaling is reduced in jarid2-null escs, and these cells are unable to establish coherent colonies with each other. introduction of wild - type escs supports the formation of colonies and increases -catenin activity within jarid2-null escs, allowing them to properly execute differentiation programs in response to appropriate cues, although the nature of the support offered by wild - type escs is at present unclear. these results are perhaps surprising in view of reports implicating jarid2 in the regulation of notch1 (mysliwiec., 2011), or showing that nanog represses the expression of dkk1 (a secreted wnt inhibitor) in escs to enhance -catenin expression (marucci., 2014). current literature contains many conflicting reports on whether -catenin is essential or dispensable for maintaining esc pluripotency (okumura., 2013 ; soncin., 2009 ; ten berge., 2011 ; wray., 2011 this discrepancy probably reflects the fact that -catenin is pleotropic and regulates both gene transcription and cell adhesion (reviewed in brembeck., 2006 and heuberger and birchmeier, 2010). in addition, the requirement for and effects of -catenin appear to be context dependent (lyashenko., 2011 ; okumura., 2013 ; wray., 2011 ; yi., 2008) and are reported to differ between naive and primed escs (kurek., our data show that jarid2-null escs maintained in lif and serum have low -catenin activity despite unchanged levels of total protein. co - culture of mutant cells both restored -catenin activity and allowed them to differentiate, consistent with several reports showing that nuclear -catenin is required to execute differentiation in vitro (atlasi. previous studies have shown that non - canonical wnt signaling is present in mouse blastocyst before implantation (tao., 2009, 2012). early blastomeres express cytoplasmic dishevelled (dvl) proteins but may not activate canonical wnt signaling as judged by sensitive bat - gal wnt reporters (na., 2007). overexpression of dvl, a downstream target of prickle1, vangl, and frizzled (fz) (gmez - orte., 2013 ; 2011), has been shown to dramatically alter the morphology and adhesion properties of 4-cell stage mouse embryos, resulting in a lack of coherence in the resulting blastocyst (na., 2007). likewise, deletion of prickle1 in mouse embryos results in local disorganization of epiblast tissue (tao., 2009) and early embryonic death (e5.5e6.6), while lower levels of wnt9a promotes cell proliferation (xiang., 2008 we show that pcp expression is reduced in jarid2-null escs, and their introduction into e3.5 blastocysts induces the formation of multiple icms in around half of the embryos. canonical wnt signaling is thought to begin at implantation in the mouse (na., 2007), and it is tempting to speculate that the group of cells in the mural trophectoderm identified by high levels of prickle1 in nucleoli may be cells destined to mediate implantation into the uterus. whatever the explanation, our demonstration that wild - type cells can rescue the differentiation of jarid2-null escs in vitro may provide important insights for understanding the conflicting differentiation status of jarid2 cells in vivo and in vitro. in homogenous clonally derived cultures, mutant cells are unable to establish bona fide cell - cell interactions or enhance -catenin activity, whereas in heterogenous cultures (with wild - type esc partners) or in vivo (with other blastocyst - derived cells) -catenin activity and pcp / wnt signaling may be partially compensated. our discovery that jarid2 is a regulator of pcp / wnt is also important for re - evaluating some of the emerging evidence that jarid2 mutations (or snps) are risk factors for several human diseases. genetic studies have for example linked jarid2 with nonsyndromic cleft lip (scapoli., 2010). in mice, jarid2 is highly expressed in epithelial cells and in the merging palatal shelves. in this context, as well as in congenital heart defects where jarid2 mutations have also been reported (volcik., 2004), the potential for jarid2 mutations to de - regulate pcp / wnt signaling might be very informative for understanding the molecular basis of these malformations and could potentially offer different opportunities for intervention. in the case of cancer, jarid2 mutations have been linked to metastases at diagnosis in soft - tissue sarcoma (walters., 2014), to non - small cell lung carcinoma (manceau., 2013), t - all, and to myeloproliferative disease (saunthararajah and maciejewski, 2012). although it is possible that jarid2 has an impact on these diseases based on its canonical role in prc2-mediated chromatin modulation, it is also possible that jarid2 is more directly involved in metastatic progression through its potential impact on cell sorting, cellular adhesion, and pcp / wnt signaling. thus, in addition to influencing prc2 recruitment and h3k27 hmtase activity in escs, we have shown that jarid2 is necessary to maintain a balance between nanog expression and pcp / wnt/-catenin in escs that is essential to enable them to properly respond to differentiation cues. regulation of this core circuit is also critical for normal pre - implantation development, since it appears to enable clusters of developing blastocysts to be discriminated and form a single inner cell mass. the discovery that jarid2 regulates pcp / wnt signaling in addition to its canonical role in prc2 highlights an important intersection between cell signaling and chromatin - based regulation, relevant for understanding the interplay between pluripotency and differentiation. esc lines were grown using standard conditions on 0.1% gelatin - coated dishes in the presence of lif and 10% fetal calf serum. neural differentiation was carried out as described previously (conti., 2005). analysis of wnt signaling pathway genes was performed using sybr green pcr array rt profiler (sabioscience). gene - expression analysis by rt - qpcr using sybr green (qiagen) was performed as previously described (landeira., 2010). western blots were carried out using the following antibodies : mouse antisera to total -catenin (bd biosciences) and active -catenin (millipore), rabbit antisera to nanog (cosmo bio), jarid2 (abcam), and goat antisera to oct4 (santa cruz biotechnology), sox2 (santa cruz), tcf3 (santa cruz), and lamin b (santa cruz). immunofluorescence analyses of esc colonies and mouse blastocysts were carried out using the following primary antibodies : mouse antibodies against oct4 (bd), e - cadherin (bd), mash1 (bd) ; rabbit antisera against nanog (cosmo bio), vangl1 (sigma), and prickle1 (gift from a.g. bassuk) (bassuk., 2008) ; and goat antisera against gata6 (r&d systems) and nestin (santa cruz). flow cytometry analysis of nanog expression was carried out as previously described (festuccia and chambers, 2011) with the following modifications : 2 10e cells were stained using rabbit antisera against nanog (2.5 g / ml, cosmo bio) and anti - rabbit conjugated to alexa 647 (6 g / ml, molecular probes). 10 to 15 gfp - expressing escs were injected in the inner cell mass of c57bl/6 blastocysts at e3.5. injected embryos were cultured for 16 hr in ksom media after which they were fixed for immunofluorescence analysis. single - guide rna sequences were cloned into human codon optimized spcas9 and chimeric guide rna expressing px330 plasmid (cong., 2013) followed by co - transfection into escs. cells (10 per well) were transfected with 1 g topflash and 0.1 g renilla luciferase plasmids in 6-well plates using lipofectamine 2000 reagent (life technologies) and analyzed using the dual luciferase reporter assay system (promega). 2 10 escs were crosslinked using 1% formaldehyde. tcf3 chip was carried out as described previously (cole., 2008). chip was carried out as described previously (landeira., 2010). animals used in the study were maintained and handled according to the guidelines of the imperial college animal welfare ethical review committee and the regulations set out by the british home office. | summaryjarid2 is part of the polycomb repressor complex 2 (prc2) responsible for genome - wide h3k27me3 deposition. unlike other prc2-deficient embryonic stem cells (escs), however, jarid2-deficient escs show a severe differentiation block, altered colony morphology, and distinctive patterns of deregulated gene expression. here, we show that jarid2/ escs express constitutively high levels of nanog but reduced pcp signaling components wnt9a, prickle1, and fzd2 and lowered -catenin activity. depletion of wnt9a / prickle1/fzd2 from wild - type escs or overexpression of nanog largely phenocopies these cellular defects. co - culture of jarid2/ with wild - type escs restores variable nanog expression and -catenin activity and can partially rescue the differentiation block of mutant cells. in addition, we show that escs lacking jarid2 or wnt9a / prickle1/fzd2 or overexpressing nanog induce multiple icm formation when injected into normal e3.5 blastocysts. these data describe a previously unrecognized role for jarid2 in regulating a core pluripotency and wnt / pcp signaling circuit that is important for esc differentiation and for pre - implantation development. |
patients who underwent maxillectomy due to benign or malignant tumor, will have defect in palatal area. because of this defect, patients will be more likely to have oro - nasal communication, change of facial profile, difficulty in speaking, mastication, and even deglutition. to overcome these problems, surgical intervention or prosthetic treatments are used. often, surgical reconstruction is very difficult to achieve when the defect area is large. when treating these patients with prosthetic means, several factors should be considered ; the size and location of the defect, accessibility, degree of jaw opening, and the condition of oral tissue after radiation therapy. the factors affecting general treatment planning are the age of the patients, presence of any systemic factors, prognosis of the tumor itself, esthetic and functional expectations of the patient along with the motivation. in the course of the treatment of the disease, much of the oral tissues must be surgically removed. when it happens, surgical reconstruction or implants placement becomes prohibitive and removable prosthesis becomes only remaining option to cover large defects. aramany categorized the defect areas after maxillectomy into six classes based on the relationship of the defect to the remaining abutment teeth.1 class i : the resection is performed along the midline of the maxilla, teeth are maintained on one side of the arch. class ii : the defect is unilateral, retaining the anterior teeth on the contralateral side. class iii : the palatal defect occurring on the central portion of the hard palate and may involve part of the soft palate class iv : the defect crosses the midline and involves both sides of the maxilla. class v : the surgical defect is bilateral and lies posterior to the remaining abutment teeth. class vi : anterior maxillary defect with abutment teeth present bilaterally in the posterior segment. removable prosthesis gets retention, support and resistance mainly through anatomical structures such as teeth, alveolar bones and palate. when surgical intervention removes much of these structures, remaining tissue becomes too vulnerable to support the necessary prosthesis. the prognosis for prosthesis becomes worse for class iv defect which has too few remaining teeth or for class i defect which has disadvantages in retention, support or resistance.23 therefore, considerations should be given to attain extra retention, support and resistance when planning for obturators of maxillary defects. swing - lock attachment design uses vertical retentive strut and palatal bracing component, making many labial and lingual contacts. it enables the prosthesis to have extra retention, support and resistance.456 in this case, aramany class ii defect was restored. if conventional partial denture were to be used, the prognosis of the abutment teeth would be uncertain. to distribute the load to many healthy abutment teeth while getting a rigid closure, swing - lock design framework was used to fabricate obturator closing palate - maxillary defect. a 56-year - old female patient had malignant melanoma removed at ajou university medical center in 2014. the results of radiographic examination did not reveal anything specific except missing tooth number # 37 in the mandible. it did not bother the patient and she did not want any treatment for it. tooth number # 12 had grade i mobility and distal bone loss due to the long use of surgical obturator. # 26 and # 27 were restored with gold crowns (fig. 1, fig this patient who went through maxillectomy has overall sound teeth alignment and periodontal health except the mobility of # 12 due to the bone loss and tissue undercut. conventional removable partial denture design deemed unreliable to achieve adequate retention, support and seal. proper hybrid gate framework design with swing - lock attachment on # 12 as a removable splint would bring more retention to the remaining teeth. also, post - operative tissue undercut superior to distal of # 12 would bring more advantageous path of insertion. the goals for the new obturator were to enhance the retention and stability and to better fit the palatal closure so that patient can speak better as well. disadvantages of swing - lock attachment are that it is unaesthetic and it ca n't be used when labial vestibule is shallow. the patient in this case had a lower lip line, showing less than 75% of the central incisors when smiling. diagnostic cast was made by alginate impression (aroma fine df ii, gc, tokyo, japan) (fig. teeth # 11, 21, 22, and 23 had lingual rest seat and # 24 had mesial rest seat to improve stability and support of the obturator (fig. border molding was done by modeling compound in the same way as conventional partial denture fabrication. impression was taken by silicone impression material (express light and regular body, 3 m espe, st. acrylic teeth were set on the semi - adjustable articulator (kavo protar evo 7, kavo, biberach, germany) (fig. " gate clasp " was suggested for the first time by ackerman in 1955.7 simmons introduced the swing - lock design concept. 8 it 's mechanical retention was explained by javid and dadmanesh.9 on this foundation, obturator restoration by swing - lock design frameworks was discussed by several authors.1011 swing - lock design gets mechanical retention and support by labial or buccal bar which is made of hinge and latch.11 for the labial bar, at least 6 - 8 mm of labial vestibule is needed. labial bar should be at least the length of 4 teeth or more and there is no maximum limit as long as the anatomy allows. patients with maxillectomy get retention, support and stability from remaining tissues which are hardly optimal. the advantage of swing - lock attachment design is having multiple contacts on labial and lingual side of the abutment teeth by retentive strut and palatal bracing component.1213 because the force is distributed equally to abutment teeth, abutment teeth of poor prognosis can be benefited from it. it is a viable option even when canine is missing, or when abutment teeth are not aligned optimally. rotated or tipped teeth would need endodontic, prosthodontic treatment or even splinting to support the key abutment teeth in conventional removable prosthodontics. however, swing - lock attachment design could bypass all those procedures, making it a more financially attractive option. it is also more advantageous to cover soft tissue defects which are hard to reach with conventional prosthesis. swing - lock attachment design is not indicated when the patient does not understand the concept or can not wear it due to the lack of cognitive or motor skills. patient with unrealistic esthetic expectation would not be satisfied with showing labial bar or strut.1415 this case belongs to class ii arch form. edentulous area is located ipsilateral to the midsuture line, extending from upper right canine to the posterior area. in this case, support is achieved from the near and far rests of the edentulous area and the palate. in conventional design, the retention is achieved from the nearest abutment tooth from the missing area by circumferential clasp, cast i bar and wrought wire. retention is often achieved by circumferential clasp in posterior teeth while rests are made on first bicuspid or canine as indirect retainers. therefore, flexible clasp is encouraged in planning while the undercut should be less than the usual. meanwhile, swing - lock attachment enables the most of the residual teeth as abutment teeth, enabling the prosthesis to be more stable. abutment teeth are stabilized and protected by palatal plate, labial strut and proximal plate. swing - lock attachment design has many advantages over conventional design, while having esthetic disadvantages due to the presence of labial strut and bar. | patients who underwent resection of maxilla due to benign or malignant tumor, or accident will have defect in palatal area. they get retention, support and stability from remaining tissues which are hardly optimal. the advantage of swing - lock attachment design is having multiple contacts on labial and lingual side of the abutment teeth by retentive strut and palatal bracing component. because the force is distributed equally to abutment teeth, abutment teeth of poor prognosis can be benefited from it. it is also more advantageous to cover soft tissue defects which are hard to reach with conventional prosthesis. a 56-year - old female patient who had undergone a maxillectomy due to malignant melanoma complaining of loose and unstable surgical obturator. surveyed crowns were placed on # 12, 26, and 27. teeth # 11, 21, 22, and 23 had lingual rest seat and # 24 had mesial rest seat to improve stability and support of the obturator. this clinical report presents the prosthetic management of a patient treated with obturator on the maxilla using swing - lock attachment to the remaining teeth. |
polymyositis is a rare and gradually progressive autoimmune disease of skeletal muscle.1 two main types of renal involvement have been described : acute tubular necrosis related to rhabdomyolysis and glomerulonephritis.2 previous reports have demonstrated glomerular proteinuria in polymyositis ; however, overflow proteinuria associated with rhabdomyolysis secondary to polymyositis is not well - described. herein, we report a case of polymyositis presenting with edema of both lower extremities, which was associated with hypoalbuminemia and a moderate amount of proteinuria of non - glomerular origin. a 41-year - old man visited our clinic with swelling and weakness of both lower extremities of 1-month duration. recently, he had begun to have pain in both thighs and difficulty in lifting his legs. he had no history of recent trauma, administration of drugs, infections, physical exercise, endocrinopathies, or other factors that could cause rhabdomyolysis. on physical examination, the urine dipstick showed a positive test for blood in the absence of red cells in the sediment. a 24-hour urine collection showed protein excretion of 3,140 mg / day and albumin excretion of 122.5 mg / day. the serum electrophoresis pattern showed decreased albumin and increased 1-fraction, -fraction, and -globulins, suggesting polyclonal gammopathy (figure 1a). the urine electrophoresis showed increased -fraction, which accounted for 53.3% of the urinary proteins (figure 1b). immunofixation of serum and urine was performed to identify monoclonal immunoglobulins and/or free light chains, and gave negative results. despite fluid replacement, the patient s creatine phosphokinase (cpk) level increased to 21,450 iu / l and his leg weakness did not improve. nerve conduction studies were normal but the electromyography showed short - duration, low - amplitude, and polyphasic patterns in all of the left upper and lower extremity muscles, suggesting inflammatory myopathy. the test for anti - jo-1 antibody was positive, with a titer more than 8.0 eu. biopsy of the left vastus lateralis muscle demonstrated endomysial chronic inflammation and muscle fiber necrosis (figure 2a), and immunohistochemical stain showed infiltration by cd8 + t cells (figure 2b). polymyositis was diagnosed by the criteria of bohan and peter,3 as he had symmetric proximal muscle weakness, histologic evidence of myositis, elevated serum muscle enzymes, and characteristic myopathic changes on electromyography, without skin changes. the patient was started on prednisone, 1 mg / kg daily, which resulted in gradual improvement of his leg pain, weakness, and swelling. after 1 month, his cpk level decreased to 461 iu / l and the spot urine protein - to - creatinine ratio decreased to 24.1 mg / g. this case describes a patient with polymyositis who presented with edema of the lower extremities because of overflow proteinuria of non - glomerular origin, which was demonstrated by the electrophoresis of urine. polymyositis is a rare and gradually progressive autoimmune disease of skeletal muscle.1 the two main renal manifestations of polymyositis are known as acute kidney injury (aki) secondary to rhabdomyolysis2,4,5 and polymyositis - associated glomerulonephritis.2,68 however, overflow proteinuria with rhabdomyolysis has been rarely described. our patient exhibited hypoalbuminemia and a moderate amount of proteinuria of non - glomerular origin without acute aki. as the patient had muscle weakness and myalgia, inflammatory myopathy would be one of the possible conditions in this case. this case implies that muscle weakness and myalgia should not be overlooked in patients with rhabdomyolysis. this is because of the overflow excretion of urinary myoglobin and low molecular weight proteins and the altered glomerular permeability induced by either myoglobin or other substances released from muscles.9 rhabdomyolysis rarely develops in patients with polymyositis,10 and about 6% of patients have cpk levels higher than 3,000 iu / l,11 as was found in the present case. in patients with polymyositis, proteinuria is related to various types of glomerulonephritis,2,68 or myoglobinuria.2 as the patient had hypoalbuminemia and a moderate amount of proteinuria, we initially expected the proteinuria was of a glomerular origin. it was reported that renal involvement occurred in 23.3% of patients with inflammatory myopathy.12 therefore, glomerulonephritis might have been combined in this case, and the lack of renal biopsy is a limitation of our report. however, albuminuria accounted for only 3.9% of total proteinuria and our patient did not have dyslipidemia, which is unusual in nephrotic syndrome. the electrophoretic analysis of his urine showed that most of the urinary protein was restricted to the -fraction, not to the albumin fraction. this suggested that the proteinuria was of non - glomerular origin.13 recently, rostagno and ghiso reported a case of myoglobinuria associated with rhabdomyolysis exhibiting a similar pattern of urine electrophoresis to that in our patient.14 the authors demonstrated that the predominant homogenous urinary band in the -fraction showed a high immunoreactivity with anti - myoglobin antibody and the molecular mass was 17,053.1 da, which corresponds to the molecular mass of myoglobin.15 therefore, we speculate that in this case, the urinary proteins in the predominant -fraction were probably myoglobins and other low molecular weight proteins, which resulted in overflow proteinuria. in this case, urine dipstick showed a positive test for blood, but urine myoglobin was not detected. this is because myoglobin rapidly disappears in plasma by hepatic metabolism,16,17 and myoglobin begins to be detected in the urine when the plasma concentration exceeds 1.5 mg / dl.18 patients with polymyositis are reported to have moderately raised concentrations of serum myoglobin but not overt myoglobinuria.19 as the serum myoglobin level in our patient was 0.405 mg / dl, the level of urine myoglobin might not have been sufficient to be detected. in summary, this case shows that polymyositis can be accompanied by overflow proteinuria although overt myoglobinuria is absent. the diagnosis of polymyositis must be considered in patients with rhabdomyolysis and muscle weakness, and biochemical analysis of the accompanied proteinuria may help to identify the type of renal involvement in this rare disease. early recognition and prompt immunosuppressive therapy are essential to prevent kidney injury in these patients. | polymyositis is a rare and gradually progressive autoimmune disease of skeletal muscle. two main types of renal involvement have been described : acute tubular necrosis related to rhabdomyolysis and glomerulonephritis. however, cases of overflow proteinuria related to polymyositis have rarely been reported. herein, we report a case of a 41-year - old male who presented with edema of both lower extremities. laboratory studies revealed elevated creatine phosphokinase level, hypoalbuminemia, and a moderate amount of proteinuria, although albuminuria was not dominant. urine electrophoresis showed an abnormally restricted zone in the -fraction, which suggested overflow proteinuria of non - glomerular origin. despite intravenous hydration, his serum creatine phosphokinase level did not decrease and his symptoms did not improve. electromyography showed myopathy, and muscle biopsy revealed findings consistent with polymyositis. after corticosteroid therapy, his creatine phosphokinase level and proteinuria decreased and his clinical symptoms improved. this case demonstrates an atypical presentation of polymyositis manifested by overflow proteinuria. |
since iron deregulation is relevant for alzheimer 's disease (ad), in this review we focus on the relevance of iron metabolism regulation, particularly in the central nervous system (cns). iron accumulation occurs in specific brain areas that are affected in ad patients, such as the hippocampus and the cortex (crichton., accumulate in the amyloid plaques (silvestri and camaschella, 2008 ; leskovjan., 2011) and appear to play a role in the degree of tau phosphorylation (egana., 2003). furthermore, molecules that are directly or indirectly involved in the amyloidogenic pathway, such as amyloid precursor protein (app) (duce., 2010) and paired basic amino acid cleaving enzyme (pace / furin) (silvestri and camaschella, 2008), have an iron - related physiological function that depends on the brain iron levels. iron access into the brain is modulated by the brain barriers, which have recently been proposed as active modulators of brain iron homeostasis (moos., we will focus mostly on the choroid plexus (cp), since several functions (and dysfunctions) of the cp, both in healthy and pathological conditions, may impact on the cns mostly by influencing the composition of the cerebrospinal fluid (csf). overall, we intend to highlight how the barriers of the brain, as modulators of regional iron - homeostasis, can influence ad pathology. iron is an essential element for cell metabolic processes and tissue homeostasis, since it is part of enzymes, cytochromes, and protein prosthetic groups. although essential, deficiency or excess of iron can lead to pathological conditions such as anemia or hemochromatosis (hfe), respectively ; therefore, iron metabolism must be tightly regulated. once within enterocytes, iron enters a common intracellular pool and is subsequently transferred across the basolateral surface into the bloodstream by the well characterized mammalian iron exporter ferroportin (fpn) (graham., 2007). the released ferrous (fe) iron is then oxidized to ferric (fe) iron by hephaestin, a homolog of the serum ferroxidase ceruloplasmin, binds to circulating plasma transferrin (tf) and is subsequently taken up by cells through transferrin receptor 1 (tfr1)-mediated endocytosis (graham., 2007). the liver, particularly the hepatocyte, is the main site of iron deposition and storage (anderson and frazer, 2005). however, most of the body iron content exists in circulation inside erythrocytes. within the cells, iron is incorporated into ferritin (composed by a heavy and a light chain, fth and ftl). when the body is iron - replete, macrophages of the liver, spleen, bone marrow, and reticuloendothelial system can also store iron recovered from the phagocytosis of senescent erythrocytes. inside the macrophage, iron is released from hemoglobin and can either be stored or released back into the circulation (steele., 2005 ; camaschella and pagani, 2011). depending on the intracellular iron levels, each cell regulates iron uptake mostly by modulating the expression of tfr1, while the efflux of iron through fpn is regulated systemically under the control of the liver - derived peptide hepcidin (hamp) (krause., 2000). circulating hamp binds fpn on the surface of enterocytes, macrophages, and other cell types causing its internalization and degradation (ganz, 2011). under physiological conditions the level of hamp is regulated by body iron requirements via a complex cell signaling pathway that includes several cell membrane proteins such as hfe, transferrin receptor 2 (tfr2), and hemojuvelin (hjv) (schmidt., 2008). of interest, hamp expression can also be modulated by proinflammatory cytokines such as interleukin-1 and -6 (il-1 and il-6), which are up - regulated early during an inflammatory response (lee., 2005). iron metabolism is impaired in several diseases where the level of specific iron - related proteins, such as hamp or hfe, is low or absent. for example, in hfe, a disease characterized by mutations in the hfe gene, hamp production is impaired leading to a wide generalized iron overload in peripheral organs (chua., 2004 ; schmidt., 2008 ; ganz and nemeth, 2011). interestingly, a striking observation is that the concentration of iron in the brain of mice with hfe appears to remain unaltered, despite the increase in circulating iron (moos., 2000) and severe iron - overload in hepatocytes (chua., 2004). these observations support the idea that the barriers of the brain may play an important role by preventing brain iron - overload (rouault and cooperman, 2006). however, in the context of several diseases in which iron accumulates in the cns, such as ad (duce., 2010), parkinson 's disease (lei., 2012), or multiple sclerosis (williams., 2012), the barriers of the brain appear to become progressively dysfunctional which is likely to impair their ability to regulate iron exchange between the periphery and the cns. in fact, we recently showed that the cp epithelial cells, which compose the blood - csf barrier (bcsfb), express all the genes known to participate in the modulation of iron homeostasis in the periphery, and therefore, seem well positioned to similarly regulate brain iron homeostasis (marques., 2009a). in all mammals, the cp is formed by a monolayer of epithelial cells that surround and enclose a central stroma. these epithelial cells are juxtaposed due to the apical localization of tight junctions (engelhardt and sorokin, 2009). the adult cp is highly irrigated by sinusoidal and fenestrated capillaries that are present in the inner stroma (johansson., 2008 ; wolburg and paulus, 2010). the apical cytoplasmic membrane of the cp epithelial cells faces the csf and contains numerous villosities, while the basolateral side faces the blood in the inner stroma, although indirectly, by contacting with the fenestrated capillaries (emerich., 2005). under physiological conditions, the cp epithelium forms a barrier that selectively restricts the access of molecules and blood circulating cells, from the stroma to the csf and hence to the brain parenchyma (engelhardt., 2001 ; engelhardt and sorokin, 2009). the cp is responsible for the secretion of the major components of the csf and the transport of nutrients and trophic factors from the blood into the csf (figure 1) (johanson., 2004). moreover, the cp is involved in brain detoxification processes, by clearing several brain metabolites, such as amyloid beta (a) in the context of ad, from the csf to the blood stream (carro., 2005 ; vargas., 2010 ; wolburg and paulus, 2010). the choroid plexus (cp) these features are aggravated in alzheimer 's disease (ad) and relate with increased oxidative stress and inflammation and decrease nutrient transport and secretion into the cerebrospinal fluid (csf). importantly, both the bcsfb and the blood - brain barrier (bbb) were shown to be two major sites of iron exchange between the periphery and the cns. it is well - established that iron - loaded tf and its receptors are in part responsible for most of the iron content of the cns. however, there are still some missing details concerning the mechanisms through which iron reaches the brain. in the bbb interface, holo - tf present in the circulating blood reaches the luminal surface of the endothelial cells and binds tfr1. the tf - receptor complex is internalized and, inside the endosome, the acidic environment leads to the release of the two fe particles from tf, which are thought to be reduced into fe by duodenal cytochrome b (dcytb). the transport of fe from the endosomes into the cytosol of the endothelial cells remains controversial, due to absence of divalent metal transporter-1 (dmt1) expression in these cells (moos., 2006). nevertheless, fe is released into the cytosol and reaches the abluminal side of the endothelial cell (moos., 2007), to be excreted out of the cell through fpn. once in the brain side, ceruloplasmin, produced in astrocyte end - foot processes, oxidizes newly released fe to fe, which again binds to tf (benarroch, 2009) that is the main source of iron for neurons. alternatively, fe can bind to low - molecular weight constituents, such as atp and citrate that are present in the interstitial fluid in high concentrations and constitute an important source of iron to oligodendrocytes and astrocytes (petroff., 1986 ; montana.,, iron can be exported back into the interstitial fluid from astrocytes, oligodendrocytes, and neurons through fpn (wu., 2004). as mentioned, in addition to the endothelial cells, the cells that compose the bcsfb also play a crucial role in the modulation of regional iron levels, namely by the iron exchange between the blood and the csf (morris., 1992 ; rouault., similarly to endothelial cells, cp epithelial cells express tfr1 in the basolateral membrane, which binds to tf - bound iron arriving from the blood stream, inducing its internalization (morris., 1992). iron will then reach the cytosol of the epithelial cells following the tfr1 mechanism previously described that involves the endosomal proteins dmt1 and dcytb (figure 2) (rouault., 2009). moreover, the presence of fpn in the apical membrane of cp epithelial cells (figure 2) (wu., 2004) leads to the release of iron into the csf, where it circulates bound to tf. of notice, cp epithelial cells express other iron - related proteins under physiological conditions, namely hjv, hfe, tfr2, fth, ftl, hephaestin, and ceruloplasmin (figure 2) (rouault and cooperman, 2006 ; rouault., 2009). the cp epithelial cells may participate in the regional regulation of brain iron metabolism due to the presence of specific membrane and secreted proteins. these epithelial cells express receptors that are directly or indirectly involved in iron uptake, such as transferrin receptors type 1 and 2 (tfr1 and 2) (1) as well as hemochromatosis (hfe) protein that is able to bind to tfr2 ; (2) duodenal cytochrome b (dcytb) and divalent metal transporter 1 (dmt1) are present in the basolateral membrane and, respectively, reduce ferric iron (fe) to ferrous iron (fe) and transport it into the cell ; (3) an iron exporter localized in the apical face of the cp epithelial cell, ferroportin (fpn), can be internalized and degraded through the action of hepcidin (hamp) ; (4) a hormone also produced by the cp in response to specific conditions, such as an inflammatory stimulus, through stat3 and smad4 transcription factors. while the activation of stat3 is likely to occur through il-6, smad4 activation is probably mediated through the complex hemojuvelin (hjv)-bone morphogenetic protein (bmp)/smad4 ; (5) hamp may then be secreted into the csf and bind, in the apical side, to fpn and induce its internalization and degradation, therefore, preventing iron release into the csf ; (6) heme oxygenase 1 (ho-1), which is expressed by the cp, is an inducible oxygenase that has the ability to recycle heme, originating free fe ; (7) additionally, the cp epithelial cells can also produce important peptides that are directly or indirectly involved in iron transport, oxidation, and storage, such as lipocalin 2 (lcn2), transferrin (tf), ceruloplasmin, ferritin, and hephaestin ; (8) in the context of aging and ad, other important molecules, which are also expressed in the cp, have recently been shown to be involved in iron homeostasis, like pace / furin and amyloid precursor protein (app) ; (9) overall, changes in the expression of iron - related genes at the blood - csf barrier may interfere with the level of iron in the brain and consequently trigger and/or aggravate aging and ad - related pathological events. in a mouse model of peripheral inflammation, the cp was shown to rapidly respond also under adverse conditions, acting as an immune sensor for the brain (marques., 2007, 2009b). surprisingly, as early as one hour after peripheral administration of bacterial lipopolysaccharide (lps), the up - regulation of il-1 and tnf gene expression is observed in the cp (quan., 1998, 1999 ; marques., 2007). both proinflammatory molecules are able to modulate the expression of iron - related proteins, such as hamp, whose expression was similarly found increased (marques., 2009a). additionally, the analysis of the cp 's transcriptome in response to the peripheral lps injection revealed that the most up - regulated gene encodes for lipocalin 2 (lcn2), an increase that is similarly reflected in the csf protein concentration (marques., 2008). lcn2 is an acute phase protein initially found in neutrophil granules (kjeldsen., 1993) and later described as a liver acute phase protein (liu and nilsen - hamilton, 1995). lcn2 is also an iron - related protein since it is able to sequester bacterial iron - loaded siderophores and, therefore, participate in the mammalian innate immune response by limiting iron availability for bacteria (sunil., 2007). however, in light of the recent discovery of an endogenous mammalian siderophore (devireddy., 2010), and also since lcn2 requires catechol to bind and transport iron in the blood (bao., 2010), it became clear that lcn2 can have an important physiological role, which is not completely unraveled, and may include iron uptake and release by cells that express lcn2 receptors, namely 24p3r. additionally, other reports have implicated different roles for lcn2 in various cell types, namely as a protective protein against oxidative stress (roudkenar., 2011), as a mitogen (lee., 2009) and as an inducer of apoptosis (devireddy., 2005). despite these findings and the well - characterized role of lcn2 in neutrophils and in response to infection, still, recent studies have suggested lcn2 participation in processes such as inflammation, astrogliosis, and cell migration in the brain (lee., 2009, 2011 ; rathore., 2011), and also anxious (mucha., 2011) and cognitive behaviors (choi., 2011). altogether, the ability of the cp to rapidly respond to peripheral inflammatory stimuli by modulating the expression of iron - related proteins such as hamp and lcn2 (marques., 2009b, c) may be relevant when addressing aging or aging - associated diseases such as ad, where an increased in the basal level of peripheral proinflammatory molecules is observed in the absence of infection (villeda., 2011) and iron seems to play a crucial role in the development and progression of the disease (duce and bush, 2010). ad is a neurodegenerative disease characterized by two main brain pathological hallmarks : the formation of extracellular senile plaques, resulting from a peptide deposition, and the presence of neurofibrillary tangles composed by intracellular hyperphosphorylated tau. it is thought that much of the early pathological events in ad are due to the formation of dimeric and oligomeric forms of a, which are formed through site - specific cleavage of app (walsh., 2005 ; importantly, a accumulation may result from decreased clearance of the a peptides through the barriers of the brain (serot. although the mechanisms that elicit the formation of these toxic soluble agglomerates and, later on, insoluble fibrils and senile plaques are still poorly understood (walsh and selkoe, 2007 ; querfurth and laferla, 2010), it is thought that free divalent metals such as iron, which give rise to strong oxidative radicals, maybe closely involved (duce., 2010 ; leskovjan., 2011 ; liu., 2011). several observations in various cellular and animal models link iron and ad. for instance, app, whose physiological function is still uncertain, was recently suggested to be up - regulated by iron and to favor the presence of iron deposits in amyloid plaques (gaeta and hider, 2005 ; cahill., 2009). indeed, an iron - responsive element (ire) exists within the 5'-untranslated region of the app transcript and this ire allows iron to regulate the intracellular app level the same way it regulates the transcription of genes that encode for fth and ftl (rogers., 2002). additionally, the app - ire is also located up - stream of an il-1 responsive domain (rogers., 1999), which means that a proinflammatory stimulus may trigger app gene expression. importantly, app was shown to have an iron - export ferroxidase activity (duce., 2010). as a ferroxidase, app participates in the export of iron from the cells, by mediating the oxidation of fe into fe (duce., 2010). app shares similarities with other ferroxidases, such as fth and ceruloplasmin, being its activity inhibited by zinc and not by copper, a resembling feature of fth but not of ceruloplasmin. however, app is similar to ceruloplasmin since it interacts with fpn in order to export iron out of cells, a fact that was shown in a study using human embryonic kidney 293 t cells that do not express ceruloplasmin (duce., 2010). moreover, in vivo experiments have shown that app - null mice fed with an iron - rich diet have decreased fe efflux and increased iron accumulation inside brain cells, as well as a higher percentage of protein carbonylation and lower level of glutathione in the brain and liver (duce., 2010). another interesting observation is that pace, which is responsible for the activation of -secretase involved in the amyloidogenic pathway, is positively modulated by iron uptake. high cellular iron content indirectly favors the formation of amyloidogenic peptides in ad, through the activation of pace (silvestri and camaschella, 2008). moreover, one of the products of the enzymatic action of pace is soluble hemojuvelin (shjv) (silvestri., 2008), which was shown to compete with membrane hjv (mhjv) for bone morphogenetic protein (bmp) signaling. since bmp signaling can lead to the up - regulation of hamp (babitt., 2006), namely in cp epithelial cells (figure 2) (marques., 2009a), the activity of pace may indirectly modulate the expression of hamp in the brain. the influence of excessive brain iron on the toxicity of a peptides and fibrils in ad is, in part, explained by the effect of this metal on the formation of oxidative hydroxyl radicals (rival., 2009). by increasing the levels of the intracellular iron binding protein, ferritin, it was possible to rescue the phenotype associated with deposition of a in a drosophila fly model (rival., 2009), which was correlated with a decreased level of protein carbonylation. recently, iron was also linked to the aggregation process of a (liu., 2011). the presence of fe during the aggregation process of a monomers into fibrils was shown to impede, later on, the fusion of fibrils into the less toxic amyloid deposits and to favor the stabilization of more toxic intermediate forms of a. toxic a intermediates originated by fe do not interact with thioflavin t and their final structure is less ordered, which delays the formation of senile plaques. importantly, the formation of fibrils in the presence of iron was shown to lead to increased apoptosis in a neuronal cell line (liu., 2011). in accordance, metal chelation with clioquinol (that sequesters iron, copper, and zinc) was shown to increase the lifespan of flies overexpressing a142 (rival., 2009), to improve the cognitive performance and to reduce brain amyloid load in a mouse model of ad (grossi., 2009). the senescence of the cp is a gradual aging process. aged cp epithelial cells present a general atrophy when compared to the adult cp (figure 1). the epithelial cells display a decrease in height, total volume (serot., 2000) and length of the apical microvilli (serot., 2003) a striking deterioration of the cp epithelial cells is observed in ad (wen., 1999 ; johanson., 2004) ; the basement membrane, stroma, and blood vessel walls of the cp become thicker with age and acquire an irregular form in ad (serot. the accumulation of a140 and a142 peptides in cp epithelial cells (figure 1) is, to a great extent, responsible for an increased level of oxidative stress and cell death (vargas., 2010). additionally, the extracellular deposition of a in the apical membrane, near the tight junctions, further enhances the disruption of the bcsfb (figure 1) (marco and skaper, 2006 ; vargas., 2010). the barrier properties of the cp progressively decay, which becomes leakier (chalbot., 2011). in addition, its ability to secrete a-carrier proteins and to express important receptors that scavenge amyloidogenic peptides was shown to decrease with age and to be compromised in several models of ad (figures 1 and 3) (zlokovic., 1996 ; crossgrove., 2005 ; antequera., 2009). a decreased activity of enzymes involved in oxidative phosphorylation (preston, 2001) and mitochondrial respiratory chain, such as cytochrome c oxidase (emerich., this decrease in the metabolic activity of cp epithelial cells is in part correlated with a-induced mitochondrial dysfunction (figure 1) (cornford., 1997 ; these harmful events that damage the cp 's morphology and architecture (figure 1), together with a massive and extensive fibrosis observed in the central stroma and the surroundings of the cp, are also responsible for the deficits in molecular exchanges between the cp and the csf (johanson., 2004). moreover, the cp 's capacity to promote the flow and the renewal of the csf also declines with age and in ad (preston, 2001 ; redzic., 2005 ; a strong interaction is observed between the different cells that compose the blood - csf barrier and the cells from the brain parenchyma. in the context of aging and ad, the development and progression of the disease strongly depends on the formation of different size amyloid beta (a) oligomers that deposit in the brain and are highly toxic. in order to prevent this, the cp epithelial cells secrete peptides to the csf, which have the ability to bind, sequester, and remove a peptides, from the brain and csf into the blood stream, through specific receptors present in the apical membrane (aat, alpha 1 antitrypsin ; apo - j, apolipoprotein - j / clusterin ; igf-1/2, insulin - like growth factor 1/2 ; p - gp, p - glycoprotein ; ptgds, prostaglandin d2 synthase ; lrp-1/2, low density lipoprotein receptor - related protein-1/2 ; ttr, transthyretin). the decrease in protein secretion and renewal of the csf as mentioned, some cp proteins are known to interact with a and this could be in the basis of a clearance. one of such proteins is transthyretin (ttr), which is the major protein synthesized and secreted by the cp into the csf (dickson., 1986) and has been shown to bind and stabilize soluble a (li., 2000 ;, the absence of ttr in the mouse has been shown to accelerate the aging - associated cognitive decline (sousa., 2007) and is associated with anxious behavior (sousa., 2004). additionally, transgenic mice that overexpress mutated forms of human app and presenilin 1, and comprise hemizigous deletions for the ttr gene, present an accelerated deposition of a in the hippocampus and cortex (doggui., 2010) and increased a-toxicity in the hippocampus when compared to control mice (choi., 2007). these features appear to be directly involved with the decreased level of ttr in the brain. moreover, decreased level of ttr in the csf has been reported in patients with severe dementia and in ad (riisoen, 1988 ; serot., 1997), but some controversy subsists regarding the levels and functions of ttr in the brain and in cognition (wati., 2009). other two important proteins produced and secreted by the cp are insulin growth factors 1 and 2 (igf-1 and -2). both are relevant in the context of ad (preston, 2001 ; emerich., 2005) since they seem to modulate the clearance of a from the ad brain (figure 3). importantly, the presence of igf-1 in the csf stimulates cp epithelial cells to express megalin / lrp-2 and to secrete a-binding proteins that are recognized by megalin, namely ttr and clusterin, which favor the transport of these a complexes from the brain into the blood (figure 3) (carro., 2002 ; shutting down the igf-1 receptor signaling pathway in the cp was shown to exacerbate ad brain pathology in a mouse model (carro., 2006) and silencing the expression of insulin and insulin - like growth factors in the brain was linked to increased levels of app, gliosis, and lower level of acetylcholine (carro. interestingly, two studies performed with samples from ad patients point to increased levels of igf-1 (salehi., 2008) and igf-2 (tham., 1993) in the serum and csf, which indicate that controversy still remains. whilst these observations implicate dysfunction of the bcsfb regarding the modulation of a sequestration and clearance in aging and in ad, available data also suggest a role of the barriers in iron deregulation and oxidative stress, as it will next be addressed. in models of aging and ad, the cp was shown to contribute for the increase in reactive oxygen and nitrogen species observed in the brain. this increase in oxidative stress may, to some extent, be connected to an increased iron concentration, which in itself may lead to the formation of reactive species through the fenton 's reaction (kell, 2009). however, a central question remains to be answered in the ad brain : whether cp epithelial cells accumulate iron in excess, as an attempt to protect the brain parenchyma, or present some sort of deficit regarding the transport of iron out of the brain. a hypothetical increase in intracellular iron in cp epithelial cells may prevent the correct functioning of enzymes involved in the mitochondrial respiratory chain, which could be one of the causes for increased mitochondrial stress and cell apoptosis, shown to occur in the cp from patients with ad (vargas., 2010). moreover, in ad, besides the formation of reactive species and protein carbonylation, traditional markers of oxidative stress are up - regulated in cp epithelial cells, namely heat shock protein-90 and heme oxygenase-1 (ho-1) (anthony., ho-1 in particular is directly involved in iron - metabolism, since it recycles heme, therefore, releasing free iron and contributing to increased levels of intracellular iron (figure 2). surprisingly, a high expression of app was shown to inhibit ho-1 and ho-2 activity and to accentuate free heme and possibly free iron neuronal toxicity (takahashi., 2000). besides oxidative stress, inflammation is another process that is closely associated with the brain iron levels. as mentioned before, it has been recently suggested that increased levels of peripheral inflammation can induce a response in the cp and influence iron - metabolism (marques. as early as 3 h after peripheral lps administration, the expression of il-6 and hamp is significantly up - regulated in the mouse cp (figure 2) (marques., 2009a). taking this feature of the cp epithelial cells into account, it is plausible that the cp is functioning in the brain as a regulator of iron - metabolism when an inflammatory environment is established. it would be of great interest to know if that is the case in aging and in ad, since it is recognized that the levels of proinflammatory cytokines in the blood increase with age (villeda., 2011), which can influence the secretion of iron - metabolism - related proteins, such as hamp, by cp epithelial cells. a recent study has shown that increased peripheral markers of inflammation, measured in the blood of aged subjects, do not correlate with increased levels of blood circulating hamp or low iron status in the brain (ferrucci., 2010) ; however, nothing is known concerning the levels of hamp in the brain cells or csf of aged individuals. on the other hand, il-6, that is able to trigger the cell 's stat3 signaling pathway, appears to be associated to old - age anemia and is over - expressed in the aged mouse brain in response to lps (chen., 2008). since il-6 was shown to participate in the regulation of the expression of hamp, not only in the liver (lee., 2005) but also in the cp (marques., 2009a) of adult mice, it remains to be assessed if the cp contributes to the level of il-6 in the aged brain (figure 2). moreover, the cp is able to up - regulate genes that encode for iron - related proteins and transcription factors, such as tfr2, fth, cp (ceruloplasmin), stat3, and smad4 (figure 2), in conditions of peripheral inflammation, and these may contribute to regional regulation of iron in the cns (marques., 2009a). in aging and in ad, however, the pattern of expression of these genes by the cp is still unknown. altogether, the aging process is accompanied by increasing levels of inflammation and oxidative stress, both in the periphery and in the brain, which can elicit changes in the cp 's capacity to regulate iron metabolism and to impact on the initiation and progression of brain pathology in ad. the cp, as a secretory tissue, influences the composition of the csf and, therefore, the brain milieu. age - dependent alterations at the level of the bcsfb may impact on the pathological events that take place in the ad brain. additionally, recent studies strongly suggest that alterations in iron metabolism and iron - related proteins can impact on initiation and progression of ad pathology. since the barriers of the brain can act as important regulators of iron metabolism, it is timely to investigate how they impact on brain homeostasis in aging and in ad. the senescent - aged / ad cp epithelial cells may present alterations in the expression of iron - carrier proteins and their receptors, such as lcn2 and 24p3r or tf and tfr1, or in proteins involved in iron export and storage, like hamp, fpn, and fth (figure 2) that will strongly influence iron homeostasis in the mammalian brain. a dysregulation of the level of iron in the brain will enhance the amyloidogenic pathway and potentiate the aggregation and toxicity of a which, together with a decreased excretion of a through the csf / cp / bbb (figure 3) may impact on the progression of brain pathology in ad. we believe that the modulation of the cp 's function in this context can be a new potential therapeutic target to prevent or delay the rapid aging and decay of the brain in ad. importantly, progressive aging - related changes in the transcriptome and secretome of cp epithelial cells may be associated with the diagnosis and prognosis of ad, and may eventually lead to the discovery of reliable markers of ad initiation and progression. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | iron is essential for mammalian cellular homeostasis. however, in excess, it promotes free radical formation and is associated with aging - related progressive deterioration and with neurodegenerative disorders such as alzheimer 's disease (ad). there are no mechanisms to excrete iron, which makes iron homeostasis a very tightly regulated process at the level of the intestinal absorption. iron is believed to reach the brain through receptor - mediated endocytosis of iron - bound transferrin by the brain barriers, the blood - cerebrospinal fluid (csf) barrier, formed by the choroid plexus (cp) epithelial cells and the blood - brain barrier (bbb) formed by the endothelial cells of the brain capillaries. importantly, the cp epithelial cells are responsible for producing most of the csf, the fluid that fills the brain ventricles and the subarachnoid space. recently, the finding that the cp epithelial cells display all the machinery to locally control iron delivery into the csf may suggest that the general and progressive senescence of the cp may be at the basis of the impairment of regional iron metabolism, iron - mediated toxicity, and the increase in inflammation and oxidative stress that occurs with aging and, particularly, in ad. |
giant cell tumors commonly occur around the knee joint in the age group of 20 - 30 years. management of large bone defects after resection is a challenge and is of ten complicated with non - union of grafts, infection and delayed weight bearing. a 37-year - old male presented with an aggressive recurrent giant cell tumor of the distal femur. he was and was diagnosed with a gct of the left distal femur 2 years ago for which he was treated with an intralesional curettage and poly methylmetacrylate implantation. a resection arthrodesis using a bilateral non - vascularised intramedullary fibular graft and a custom made intramedullary nail was performed. the follow - up radiographs showed union at graft - host junction and hypertrophy of the grafted fibula at 2 years post surgery. non - vascularised fibular graft is an effective alternative for resection arthrodesis with the advantages of a simpler and shorter surgical procedure and without the needs for a microsurgical setup. a giant cell tumor (gct) most commonly affects the distal femur or proximal tibia between the 2nd and 4th decade. large defects of bone resulting from wide local excision of these tumors continue to be a problem for the surgeon. fresh autogenous grafts, homografts, custom - made implants, and microvascular bone grafts have been used by different investigators, with various results. with the success of vascularized fibular grafts, the use of non - vascularized grafts is now uncommon due to the lack of biological activity and the risk of graft resorption[3, 4 ]. however, this technique is simple, economical and shorter in comparison to a vascularised grafts as well as has relatively low donor site morbidity. we present a case of a 37-year - old male who presented with a recurrent gct of the distal femur following curettage and poly methyl methacrylate (pmma) cement implantation 2 years ago. the patient was treated with a wide local excision of the distal femur and limb reconstruction performed using a bilateral non - vascularized inlay fibular grafting and stabilization performed using a custom made intramedullary nail. a 37-year - old male presented with complains of pain around the left knee joint. the patient had similar complains 2 years ago and was diagnosed with a gct of the left distal femur for which he was treated with an intralesional curettage and poly methylmetacrylate implantation. on examination, there was a swelling over the left knee, which was bony in consistency and was associated with painful and restricted movements of the knee joint. 1) which indicated a recurrence of the gct with the hallmark honeycomb appearance, ballooning and breach of the cortex posteriorly as well as a soft tissue mass, suggestive of an aggressive giant cell tumor. magnetic resonance imaging (fig. 2) revealed an area of hypointensity corresponding with the cement and multiple loculated hyperintense lesions in the metaphysis of distal femur. also noted was the breach of the cortex with extension of the mass into the adjacent soft tissue (campanacci grade 3 lesion). antero - posterior radiograph of the left knee joint 2 years after the first surgery showing the radiopaque bone cement (thin arrow) in the distal femur and medial condyle. (b) lateral radiograph shows the honey - comb pattern superior and around the bone cement (thick arrow) mri of left knee reveals an aggressive lesion characterized by extensive local bony destruction (thin arrow), breach of the cortex and a soft - tissue lesion (thick arrow). a curvi - linear skin incision was taken anteriorly in line with the previous surgical scar and a medial para - patellar approach to access the distal femur. the distal end of the femur up to the distal third of the diaphysis was excised. the desired length of the fibular graft (x) was estimated using the calculation (fig. 3) : pre - operative planning. length of fibular graft (x) was calculated taking into account the post resection gap (a), the desired intramedullary length in the femur (b) and the tibia (c). x = a + b + c ; where a was the estimated bone gap ; b was the length of the fibula to sink intramedullary into the femur. length of the fibular graft was calculated to 11.5 cms (x= 10 + 0.5 + 1). b was estimated to be 0.5 cms since the fibular graft was to be inserted into the narrow medullary canal of the femoral diaphysis. c was estimated to be 1 cm since the fibula was to be inserted into the broad metaphyseal region of the proximal tibia. the desired length of the limb was calculated to allow for post arthrodesis limb clearance and final graft length was estimated by subtracting the desired limb shortening from the graft length. final length of the graft (y) in situ was calculated to 9.5cms, (y = x-2 ie 11.5 - 2 = 9.5 cms) a fibula graft of approximately 12 cms was harvested from both the legs using the postero - lateral approach, was fashioned to the calculated length and tied to a custom - made intramedullary interlock nail using a no.1 polyglactin 910 suture and was inserted from the piriformis fossa extending up to the distal metaphysis of the tibia. thereby, an intramedullary bone grafting was done with the dual fibular graft spanning over the defects with the grafts wedged proximally and distally in the medullary canal of the femur and tibia to achieve the desired limb length. suture removal was done at 2 weeks post surgery and there were no post operative wound complications. a variety of treatment modalities are available for a gct, which include curettage and application of cryotherapy or phenol along with bone grafting or implantation of bone cement (methylmethacrylate or hydroxyapatite). intralesional curettage is a standard treatment for giant cell tumours (gct) of long bones, with or without the use of polymethylmethacrylate (pmma). this however, is associated with high risk of recurrences as compared to wide local resection.[1, 5 - 9 ] the autologous fibula graft is commonly used for reconstruction of the upper and lower limbs post tumor resection. the choice of graft varies from unilateral vascularized or non - vascularized fibular graft ; a mantle fibular graft, which essentially is a combination of an allograft and an autologous graft or a bilateral fibular graft. also, the immediate postoperative course involves long periods of none or partial weight - bearing of the affected limb, leading to complications like muscular insufficiency, demineralization of the native or grafted bone and pathological fractures. the advantage of bilateral fibular grafts in long bone reconstructions is that the autologous transplant provides excellent chances for remodeling at the recipient site and shows good results with lesser complications particularly in the reconstruction of femoral defects. also, being a simpler procedure, it reduces the surgical time and need for microsurgical setup thereby being cost effective. for reconstruction of femoral defect, a bilateral free fibular graft can increase the primary stability and weight bearing can be accelerated. internal fixation is generally preferred since implant removal is not required and patients may receive postoperative chemotherapy, thereby reducing the risk of infection during times of pancytopenia. weight bearing is increased individually according to osseous integration of the fibular graft. our patient was kept non - weight bearing for the first 3 months and was started on partial weight bearing subsequently. full weight bearing was initiated at 8 months, as was suggested by previous studies. 4) indicated signs of union and no signs of graft resorption or infection. at 2 years post surgery, the patient was walking full - weight bearing with a shortening of 2 cms, a healthy scar and no evidence of a recurrence. x - rays (fig. 4 [d ]) revealed consolidation of the graft and union at the graft - host junction. hypertrophy of the fibular graft was also noted in comparison to the immediate post - operative radiographs. follow - up radiographs at 2 weeks (a). at 6 months (b) and 1-year post surgery (c), signs of union at the graft - host interface. at 2 years post surgery (d) resection arthrodesis with dual fibular graft of fers limb reconstruction as an alternative to amputation, providing a stable and functional limb in aggressive and recurrent giant cell tumors around the knee joint providing a painless, stable and functional lower limb non - vascularised fibular graft is an effective alternative for resection arthrodesis with the advantages of a simpler and shorter surgical procedure and without the needs for a microsurgical setup. | introduction : giant cell tumors commonly occur around the knee joint in the age group of 20 - 30 years. they are treated with intra - lesional curettage or local resection and limb reconstruction. management of large bone defects after resection is a challenge and is of ten complicated with non - union of grafts, infection and delayed weight bearing.case presentation : a 37-year - old male presented with an aggressive recurrent giant cell tumor of the distal femur. he was and was diagnosed with a gct of the left distal femur 2 years ago for which he was treated with an intralesional curettage and poly methylmetacrylate implantation. a resection arthrodesis using a bilateral non - vascularised intramedullary fibular graft and a custom made intramedullary nail was performed. the follow - up radiographs showed union at graft - host junction and hypertrophy of the grafted fibula at 2 years post surgery.conclusion:non-vascularised fibular graft is an effective alternative for resection arthrodesis with the advantages of a simpler and shorter surgical procedure and without the needs for a microsurgical setup. |
the rapid growth of technological possibilities in health care is accompanied by a growing need to determine an emerging technology s desirability before it is introduced in the health care system. in the 1970s and 1980s health technology assessment (hta) was developed as a way to facilitate collective decision making on the desirability of new biomedical technologies. the birth of hta is often dated in 1975, when the american congress asked its office for technology assessment (ota) which justification was necessary to introduce a new medical technology [4, p. 2 ; 6, p. 276 ]. the report, published in 1976, defined technology assessment quite broadly as : a comprehensive form of policy research that examines the short- and long - term social consequences (e.g. societal, economic, ethical, legal) of the application or use of technology [33, p. 45 ]. from the start hta has had a complicated relationship with ethics and politics or with normativity in general [6, 36, 38, 44 ]. some advocates approach hta as the first step in a two - tiered process (e.g.). in this conception hta researchers collect evidence about the probable consequences of a technology (assessment), which is subsequently weighed by ethicists or political actors (appraisal). others argue, in contrast, that hta - reports should pass judgment on the value of a technology itself (e.g.). although not everyone agrees that hta should include normative conclusions as to what is or is not desirable, many authors have criticized the idea that factual assessment and normative appraisal can be clearly separated. they point out that hta methods to collect evidence on a technology s performance are inevitably imbued with values. therefore, its results are not as neutral as often purported [21, 27, 30, 36, 38, 43, 44, 58 ]. for example, the selection of consequences to take into account, as well as the choice of specific outcome measures to assess them both have a normative impact. disability or quality of life [20, 21, 32, 38 ]. at about the same time philosophers, sociologists and anthropologists they criticized the common idea that technology is a neutral instrument designed to perform a specific function. some argued that technology is a complex phenomenon, consisting of material, social and organizational elements [1, 26 ]. others pointed out that, because of this complexity, technology does much more than it is intended to do [5, 31 ]. many of these effects are indirect : technology mediates our experience of reality and the options for action we perceive [22, 62 ]. such analyses imply that the effects of a novel technology are much more difficult to foresee than the instrumentalist view of technology suggests. this conceptual and empirical work on the character of technology in practice seems to suggest that tools and methods of traditional forms of hta may be problematic partly because they are based on an instrumentalist conception of technology that fits badly with the workings of technology in practice. in this paper, i will explore this hypothesis by reconstructing and discussing an early endeavor to systematically assess a technology s desirability : the assessments and deliberations preceding the introduction of breast cancer screening in the netherlands in the 1970s and 1980s. hta, the case is interesting precisely because it shows the ideal of hta in the making and set the stage for subsequent hta activities.1 in this period a model of hta emerged that was widely used, both in the netherlands and abroad, for many years (as is visible, for example, in the special issue on the history of hta in the international journal of technology assessment in health care 25, supplement 1, 2009). first i will reconstruct the processes preceding the decision to introduce a nation wide program for breast cancer screening in the netherlands. this reconstruction is based on a systematic survey of : (1) the relevant advisory reports and policy documents in the years 19682005 ; (2) the minutes of dutch parliament in the years 19701995 ; (3) the medical professional journals nederlands tijdschrift voor geneeskunde (19602005) and medisch contact (19602005) ; and (4) opinion articles on breast cancer screening in the dutch national newspapers (19602005). subsequently i will reconstruct the stepwise model of hta that emerged during the process and analyze how this model was based on an instrumentalist conception of technology. these episodes illustrate how the actors during the process were already confronted with or became aware of unanticipated effects, and how this in some cases led to adjustments in the hta procedures. the historical analysis enables me, in the end, to argue how and why an instrumentalist conception of technology is not a good starting point for hta. i will conclude with some suggestions for improving the fit between hta methods and the actual character of technology in practice. the history of breast cancer screening starts in the 1950 s and 1960 s, when in france and the usa a radiological device for diagnosing breast diseases was developed. it was noticed soon that this device, called mammography, detected lesions that were not found by palpation (the current diagnostic standard). mammography thus seemed to offer promising possibilities for earlier diagnosis of breast cancer, which in turn might improve curability and survival rates. when an american study showed that mammographic screening might reduce breast cancer mortality by 30% concerned scientists in the netherlands set up several pilot projects to corroborate the effectiveness of mammographic screening in a dutch setting. in 1975 projects started in nijmegen, utrecht and leiden the leiden project was meant as a pilot project offering a novel health care service and lasted only 1 year. the projects in nijmegen and utrecht had scientific goals and were designed as case control studies. in 1977 the dutch minister of health asked the health council to report on the desirability and acceptability of a national breast cancer screening program. the committee established by the health council consisted of a number of medical professionals and a sociologist ; a psychologist was added later on. the committee soon concluded that the available evidence on the effectiveness of mammographic screening was limited and decided to wait for the results of the pilot projects in utrecht and nijmegen before formulating its advice. since the dutch projects were case control studies and thus liable to bias, results from randomised clinical trials (rct s) in other countries were taken into account as well. the health council s committee issued two interim reports and a final report [1517 ]. when the second interim report cautiously judged the available evidence for effectiveness of screening as promising, the minister of health ordered an independent study of the cost effectiveness of such a screening program actually the first such a study to be ordered by dutch government. this study, written by the institute for health technology assessment of erasmus university, was published in 1990. the study not only calculated the costs per saved life year ; it also used qaly s (quality adjusted life years), a relatively new tool to take into account effects of screening on the screened individual s wellbeing. to sum up, although the label hta was not used yet, mammographic breast cancer screening was the first health care technology in the netherlands to be systematically assessed for its efficacy, safety, cost effectiveness and impact on quality of life, with the explicit aim to inform and facilitate political decision making. when the experts judged that the performance of mammographic screening on these items was acceptable, the minister proposed to gradually introduce breast cancer screening for women aged 5069 on a national scale, as the health council had advised. the dutch health insurance council was asked for advice on the financial and organizational aspects of such a screening program. it proposed to make screening free for participants and to organize it in a centralized way, closely resembling the set up of the pilot projects. the desirability of the screening program was not only discussed in scientific reports, however. both during the preparatory phase and immediately after the health council published its final report, a small group of opponents voiced criticism. they wrote pieces in newspapers and medical journals arguing that a screening program would seriously contribute to medicalization [8, 41, 4550, 61 ]. in response, others (often investigators of the pilot projects or members of the health council s committee) stressed the advantages of breast cancer screening and the evidence for the positive effects of such a program [10, 12, 37, 54 ]. the first extensive parliamentary debate took place in 1991, when the parliamentary commission on health care discussed the proposed national breast cancer screening program with the minister of health. although no one completely opposed the screening program, several members of parliament took up criticism voiced earlier in newspapers and journals. some suggested that if women were really to decide autonomously about their participation, the invitational letter should explicitly mention the uncertainties and potentially negative effects of screening. others questioned the justification of the proposed age limits. and some argued that the program might lead to overdiagnosis, overtreatment, and thus to unnecessary medicalization. in his response, the minister first pointed out that many of the potential negative effects of screening had been taken into account in the cost effectiveness study, in particular by the use of qaly s. in a second debate between the minister and the parliamentary commission on health care, in 1993, the minister recognized, however, that there might be a tension between voluntary participation and the need for high participation rates. he promised to guarantee (1) respect for the freedom of choice and personal life of the women involved (by giving even handed information) ; (2) equal access (again by giving good information and by making participation free) ; and (3) a high quality of care (by installing an extensive monitoring system) [53, pp. thus, between 1989 and 1995 breast cancer screening was gradually introduced in all regions of the netherlands. since 1995, all dutch women between 50 and 69 have been invited for breast cancer screening every 2 years. effectiveness, efficiency and quality of care of the screening program continued to be monitored by an independent scientific committee. participation rates (and thus apparent acceptance by the target group) slowly increased from about 75% in 1990 to 82% in 2007. since then, the first debate took place when practice with regard to the upper age limit was changed. although the upper age limit was set at 69, initially participants reaching the age of 70 could continue screening if they liked to. in 1992 the health insurance council announced that from now on the age limit would be strictly kept. this decision was justified mainly with budgetary reasons, but doubts about effectiveness and worries about the impact of screening on older women s lives were also mentioned [56, p. 139 the decision initiated a heated debate, in which representatives of associations for the elderly claimed a right to be screened and accused the council of age discrimination and paternalism., the upper age limit was increased to 75 years in 1998 when new evidence suggested that screening this age group could be effective after all. a second surge of debate occurred when the cochrane collaboration in 2001 published a critical metareview of the available evidence for the effectiveness of breast cancer screening. the authors concluded that this effectiveness was doubtful and that screening might even produce harm, in terms of overdiagnosis and overtreatment [34, 35 ]. this led to a renewed public exchange of arguments pro and contra screening, in which the strengths and weaknesses of the scientific methods to establish effectiveness were also subjected to debate. some critics argued once more that the information given to women when invited for screening was too biased to enable autonomous decision making. the debate subsided after a health council committee, hastily asked by the minister of health to advise whether the dutch program should be adjusted or even abolished in view of the cochrane review, concluded that there was no need to do so. effectiveness might be somewhat lower than previously expected, but it was sufficient to justify a national screening programme. in effect, then, mammographic breast cancer screening was the first health care technology in the netherlands to be subjected to a more or less systematic assessment, with the aim to inform and facilitate political decision making. in the process a model of hta emerged that now seems quite familiar and self - evident because since then it has been used widely, both in the netherlands and in other countries. what is interesting about the historical case discussed here is that it shows the gradual birth of this widespread model in the dutch context.2 in reconstruction, the process consisted of four stages, each considering a specific aspect of mammographic screening : health gainscost - effectivenessorganizational conditionsethical considerations (like justice, autonomy, screening rights, medicalization) organizational conditions ethical considerations (like justice, autonomy, screening rights, medicalization) the first three stages occurred in a chronological chain : the next stage was initiated only when the results of the preceding one appeared to be sufficiently positive. the ministry of health delegated the first three stages to scientific experts : the health council, independent economic scientists and the health insurance council respectively. in contrast, the ethical considerations were (implicitly) left to public and political debate. they occasionally popped up during the process, with a clear increase in the final stages of decision making. this procedure seems to have been inspired by an implicit instrumentalist view of technology in several respects. such a view perceives technology as a material device that is designed to perform a specific function. it is an instrument (just a means) to realize a specific goal ; the instrument itself is value neutral. this view has been widespread in western thinking [14, 62 ], so it is not surprising that it influenced ideas and tools for hta. what is the task of (h)ta from an instrumentalist perspective ? if technology is a device designed to fulfil a specific function, the first question is of course whether the proposed device is indeed capable to fulfil this function. assessments should ask, then, to what extent the device realizes the intended effect. the goal (the intended effect) itself is supposed to be clear and is taken for granted for the time being, as is the device s actual design. seen this way, it makes sense to separate the factual assessment of a device s performance from the normative evaluation of the intended goal. such a separation is clearly implied by the split between stages 13 and stage 4 in the mammographic screening case. whereas establishing the facts was considered a task for scientific experts, evaluating goals was assigned to the political domain. the experts involved in the mammographic screening research endorsed this view. in its final report, the health council deliberately refrained from statements about the desirability of a national screening program, because this was considered a political issue [17, cover letter p. 2 ]. in a similar vein, the authors of the cost - effectiveness study stated that considerations other than cost - effectiveness could of course play a large role in the political deliberations [9, p. 7 the instrumentalist view is also clearly visible in the set up of the first assessment stage. mammography was approached as a material device designed to diagnose women with asymptomatic breast cancer, in order to increase the life expectancy of these women. to decide about the desirability of this device did it diagnose sufficient asymptomatic cancers, and did this early diagnosis lead to increased survival ? the pilot projects and the report of the health council thus initially were set up to produce factual evidence on the actual magnitude of the intended effect only.3 the only additional effect that was taken into account was the potential causation of new tumours resulting from the radiation necessary to make the mammograms a side effect, that is, that would directly detract from the intended effect. in the second and third stage of the assessment the financial and organizational efforts needed to realize the intended effect were charted, to enable an informed comparison with potential alternatives. the hta procedure developed in this historical episode this is visible in particular in (1) the separation of assessment of facts by experts from the deliberation on desirability by political actors and (2) the exclusive focus on the intended effect (i.e. mortality reduction). however, a closer look at the historical episode shows that the actors involved also encountered problems resulting from limitations and shortcomings of the instrumentalist view. some of these problems were diagnosed already by the actors themselves, resulting in modifications of the assessment procedure or other attempts to compensate for the procedure s weaknesses. other problems can be identified with the benefit of hindsight, suggesting a need for further modification. thus, while trying to invent a systematic procedure to assess mammographic screening, the actors involved learned important lessons about the lack of fit between an instrumentalist view of technology and the way technology works in practice. in the next part of this paper, i point out how difficulties arose with respect to three presuppositions inspired by an instrumentalist view of technology : technology is a means to realize intended effects;technology is a material device;morality may influence technology, but technology does not influence morality. technology is a means to realize intended effects ; technology is a material device ; morality may influence technology, but technology does not influence morality. as described above, the first publications on mammography present it as a tool to improve the prognosis of women with asymptomatic breast cancer. the actors involved in the assessment process are aware, however, that measuring improved prognosis is rather complicated. counting cases of early detection does not suffice ; the screening program is successful only if subsequent treatment is effective and results in prolonged healthy lives. therefore the outcome measures proposed at first are 10 years survival and mortality rates. however, because an increase of 10 years survival rates without a concurrent mortality reduction is considered undesirable, reduction of breast cancer mortality quickly becomes the central measure of effectiveness. the pilot projects in utrecht and nijmegen are explicitly set up to investigate to what extent mammographic screening reduces breast cancer mortality. the health council in its first report (1981) affirms this choice : this is the intended effect of mammographic screening and it should be the central focus of the assessment procedure. the actors gradually become aware, however, that mammographic screening does more than it was intended to do and that these additional effects may also be relevant when assessing the technology. the health council s 1984 report, for example, mentions quality of life as an additional outcome measure for the effectiveness of mammographic screening : therapeutic effectiveness in the above is translated as reduced breast cancer mortality. it is important to point at the so called breast saving surgery techniques that have gained ground in the treatment of early stage breast cancer lately. development of breast saving surgery techniques was actually spurred by the increasing number of pre - clinical tumors becoming available as a result of screening [13, p. 95 ]. the novel surgery techniques were thus co - produced by mammographic screening, resulting in an unforeseen (and up to then unintended) effect. decreased mutilation and increased wellbeing of patients now emerged as a potential additional goal of breast cancer screening, next to mortality reduction. it is important to point at the so called breast saving surgery techniques that have gained ground in the treatment of early stage breast cancer lately. ] thus, the assessors initial focus on the intended effect only started to look too narrow. the concept of quality of life was proposed to broaden the scope of the assessment, to allow different types of presumably positive effects of screening to become visible. although such effects were not explicitly intended at the start of the projects, the health council appears to have been willing to include this novel measure in the assessment. however, the investigators of the two dutch pilot projects did not include quality of life as an additional measure of effectiveness, presumably because they did not want to change the design of their long term studies. it is only in the cost - effectiveness study (1990), therefore, that quality of life first appears as a measure of effectiveness. the authors of this report motivate the introduction of the concept in a way that is very different from the health council s earlier suggestion : next to mortality reduction, inevitably undesirable effects will occur. an undesirable effect is, for example, anxiety in women who are referred for further diagnostics and who in the end appear not to have breast cancer (the false positives ()). another undesirable effect is that a number of women now know they have breast cancer whereas for some of them the prognosis wo nt improve. () weighing the amount of desired and undesired effects on the one hand and the expected costs and reduced expenses on the other is necessary. quality of life is not meant to measure additional positive effects of screening ; on the contrary, it is a measure for any impact (both desirable and undesirable) screening might have on the lives of individual participants. an undesirable effect is, for example, anxiety in women who are referred for further diagnostics and who in the end appear not to have breast cancer (the false positives ()). another undesirable effect is that a number of women now know they have breast cancer whereas for some of them the prognosis wo nt improve. () weighing the amount of desired and undesired effects on the one hand and the expected costs and reduced expenses on the other is necessary. ] thus, the actors involved in the assessment of breast cancer screening gradually realized that mammographic screening may have significant impacts besides the intended increase in life expectancy, and that these effects, moreover, need not always be positive. voices from the public debate (on breast cancer screening, but also on other medical technologies) may have played a role here. the introduction of quality of life was an attempt to accommodate a broader array of effects, in a way that apparently enabled a sensible comparison of these effects. this history corroborates the argument made by armstrong and caldwell, who claim that the emergence of quality of life in the 1970s and 1980s among others expressed a general discomfort regarding the human costs of technological interventions [2, p. 36 ]. in the dutch case, the concept helped to weigh the various effects of mammographic screening. the desire to include patients perspectives (often mentioned as a justification to include quality of life) apparently hardly played a role. it is clear from the cost - effectiveness report how the researchers struggled with the operationalization of quality of life [9, pp. what should or should not be included ? how to operationalize the more subjective types of impacts ? and how to compare different types of impacts ? interestingly, the questionnaires to assess quality of life impacts were not filled out by women participating in the pilot projects, because the questions were considered too complex for these participants. instead, stand ins like economists and medical professionals involved in cancer screening and care acted as respondents. the first were considered to be more used to this type of questionnaire, and the latter were supposed to have a reliable view of how breast cancer may affect women s lives. since then, struggles have continued, leading to a proliferation of instruments measuring quality of life, most of which do involve patients (or healthy subjects) as respondents. quality of life, in addition to mortality reduction, has become a widely accepted dimension for assessing the impact of novel medical technologies. the history of assessing breast cancer screening shows why hta should not focus on a technology s intended effect only. technology does more than it is intended to do, both directly and indirectly. as for the direct effects, screening may increase one s life expectancy and decrease wellbeing at the same time. focusing exclusively on the intended (hoped for) effects inevitably biases the assessment and leads to (avoidable) implicit normativity of the results. including a broad array of potential effects is important for even handed decision making on the desirability of a novel technology. this is even truer for indirect effects, like the improved surgery techniques resulting from the emergence of early diagnostics. good hta should nonetheless try to anticipate and include such effects, both at the start and on the way, as the dutch assessors tried to do. as described above, the reduction of breast cancer mortality by mammographic screening not only requires a well functioning mammographic device, but also an effective therapeutic follow up. breast cancer screening has, then, clear social and organizational conditions from the start. however, at first both the researchers and the political actors involved approach mammographic screening as a material device that processes input (asymptomatic women) to deliver a specific output (mortality reduction). the pilot projects are presented as a means to find out how effective this new diagnostic technology will be when applied to asymptomatic women. practical conditions like setting age limits and frequency of screening do get some attention, but only in relation to the question how to increase the screening s effectiveness. it is interesting to see how the actors in the dutch screening assessment seem to have become gradually aware of the importance of social and organizational conditions ; an awareness that in the end led to a strict regulation of the national screening program and even to a law on population screening. when the results of the pilot projects seem sufficiently promising to warrant serious consideration of a nation - wide screening program, the researchers start pointing out that the organizational setting of screening is crucial. the positive results can be repeated only, they state, when the national program is conducted in a way similar to the pilot projects. the health council agrees. in its second report it states : the committee emphasizes that a potential screening program will succeed or fail depending on the way the introduction and design are organized. () guarantees are needed for the quality of the work of participating centers (diagnostics, treatment and counseling of the women involved). in this respect a newly instituted center of reference might serve quality control as well. [16, p. 28 ] the committee emphasizes that a potential screening program will succeed or fail depending on the way the introduction and design are organized. () guarantees are needed for the quality of the work of participating centers (diagnostics, treatment and counseling of the women involved). in this respect a newly instituted center of reference might serve quality control as well. [16, p. 28 ] both the scientific and the political actors thus gradually became aware that mammography is more than a material device and that breast cancer screening requires more than the distribution of mammography devices. as a result, they concluded that a national screening program should be as similar to the pilot projects as possible. the awareness that organizational conditions are crucial in realizing a certain effect motivated the health council s advice to centralize the organization of screening and make it a uniform practice. moreover, since the pilot projects were designed as a separate, autonomous service, situated between gp s and hospitals, the national program also became a separate service next to primary and secondary health care. thus, because the sociotechnical character of mammographic screening came into the picture relatively late, the organizational choices of the scientific pilot project became indicative for the organization of the national program. as one critic stated, when the committee developed a refined constellation of protocols and procedures for national screening practice, it was actually trying to approach the conditions of scientific research whether or not all actors agreed with the proposed division of roles and responsibilities was hardly discussed. the growing awareness of the social conditions for realizing the aimed for mortality reduction also influenced the approach of and the role ascribed to female participants. in its final report the health council explicitly mentions a high participation rate as a condition for attaining the aimed for effect : the committee emphasizes the importance of a maximal participation in screening for breast cancer. if the participation rate is too low, the aimed for mortality reduction on the population level may also become too low [17, pp. recommendations were formulated to make screening as accessible as possible : the invitational system should function well, screening should be affordable, the location of screening centers should be accessible, counseling should be available, and education should be as persuasive as possible : careful education of the female population is necessary. research into the effectiveness of education with regard to the participation of the women involved in screening is necessary [17, p. 72 ]. here, the need for a high participation rate to achieve the aimed for effects actually led to a neglect of a potentially conflicting value : the autonomy of participants. the implicit tension between effectiveness and women s autonomy came to the fore once more in 1991, when the minister of health in a letter to the health insurance council in 1991 simply states that invitations, leaflets and campaigning material should contribute to high participation rates as well as enable considered choices by the women in the target group [51, p. 11 ]. in the parliamentary debates on screening, however, mp s stressed that autonomy was the most important value. this position in the end was confirmed by the minister in a memo from 1993, stating that information on screening should include negative aspects of screening, even if this would lead to a decrease of participation rates [53, pp. this episode shows how the implicit view that technology is a material device led the assessors of mammographic screening to neglect the social and organizational elements of this technological practice for a long time. in the end they did stress the importance of social and organizational conditions, but because the outcomes of the assessment by then were quite promising, this did not result in discussion on the pros and cons of the specific design of the screening practice in the pilot studies. on the contrary, the practice investigated in the pilot projects now was put forward as the most desirable. moreover, these conditions were approached only in terms of effectiveness ; issues of feasibility and desirability did not come to the fore. these episodes show once more how the view that technology assessment is about the intended effects of a material device may lead to implicit normative effects of the assessment procedure, in this case with regard to the social and organizational conditions. it tends to limit or even close off the space to discuss the pros and cons of alternative designs of the practice at hand. moreover, it may lead to roles for both professionals and lay users that are not acceptable to them or that severely diminish the realization of alternative values (like autonomy). conceiving novel technology in terms of a sociotechnical practice might help to avoid this implicit normativity by including such social and organizational aspects in the assessment procedures right from the start. the third and last presupposition of the assessment procedure for mammographic screening i want to discuss here is that the development of mammographic screening itself would not affect morality. as pointed out above, the instrumental view of technology implies that humans can first set goals and then decide whatever technology serves their goals best. in the case of mammographic screening the assessment, then, need not focus at the goal aimed for, but only at the question to what extent screening would realize this goal. the history of the hta process and the resulting screening practice show, however, that both the meaning of and the weight assigned to since this is a long term process, it is easier to discern with the benefit of hindsight. one of the first dutch professional publications on early detection of cancer pointed out that the authors explicitly asked : is it desirable indeed to ask people s attention for their own body as a source of disease time and again ? or would a healthy life rather consist in living without having to worry about one s breasts, intestinal tract or stomach ? [24, p. 67 ] the issue was both conceptual (a shift might occur in the way health is generally interpreted) and psychological (this conceptual shift might have impact on people s lived experience). typically, the authors of this report declared they were not competent to address such questions. is it desirable indeed to ask people s attention for their own body as a source of disease time and again ? or would a healthy life rather consist in living without having to worry about one s breasts, intestinal tract or stomach ? [24, p. 67 ] not surprisingly, then, the issue was hardly taken into consideration in the subsequent assessment and deliberation processes. as discussed earlier the scientists first defined health exclusively in terms of survival and later also in terms of quality of life. considerations on the impact of screening on views and experiences of health incidentally reappeared in newspaper contributions arguing against screening. however, since empirical evidence for such soft impacts was absent (and hard to investigate anyway), they were easily dismissed in view of the positive evidence for the effectiveness of screening. in retrospect it seems nonetheless justified to conclude that the introduction of breast cancer screening, albeit in conjunction with many other technologies for early detection of disease, did contribute to a new understanding of what it means to be healthy or diseased. the long standing view that health means absence of complaints has been exchanged for the view that disease can be a - symptomatic. as a result, most people now probably accept the view that they can have a disease without noticing anything. this is actually a generalization of the shift that mammography brought about earlier in the medical domain. the starting point of the debates on screening was, after all, the observation that this technology enabled doctors to identify lesions in women who had up to then seemed perfectly healthy, both to themselves and to their doctors. this novel view of disease and health has brought along new norms as well. on the one hand, now that it is possible to diagnose a - symptomatic disease, people are expected to subject themselves to these technologies. even though dutch women are not legally required to participate in the mammographic screening program, those who do not participate often have to justify their choice. they may even be accused of irresponsible behavior, especially if they are diagnosed with breast cancer later on. participation in screening, that is, has become a social norm. on the other hand, novel rights have been claimed. at the introduction of a nation wide program for breast cancer screening the age limits of the target group evidence for the effectiveness of screening older women was thought to be lacking (another example of how the design of the pilot projects became normative for the national program). as described above, in 1992 the health insurance council (responsible for the funding of the national program) decided to keep a strict hand at the upper age limit, partly motivated by overspending. the council was confronted with an indignant public response from elderly women as well as medical professionals. they argued that women had a right to be screened, and that denying this right to a subgroup of women on the basis of their age amounted to age discrimination. apparently women above 70 who had been screened for some years felt that they were denied something valuable. of course one may question the legitimacy of this claim. however, just the fact that it was actually claimed shows that a substantial group of people had come to perceive screening as a thus, the screening providers and politicians were confronted with moral considerations they had not anticipated when assessing and deliberating the desirability of mammographic screening. as a result interestingly, the issue was approached in a way resembling the original assessment process : judgment on desirability was postponed pending the production of evidence on the effectiveness of screening older women. novel research was started ; in the meantime the age limits were strictly kept. in 1998 a dutch case control study claimed to have shown that reduction of mortality for 7075 years olds was possible and that screening could significantly improve the quality of life of this group. some actors argued that this evidence was not sufficiently conclusive, since it was not based on rct s and thus could be biased. however, the political decision makers thought it would be unacceptable to let older women wait any longer for the outcomes of such (usually very long term) studies [57, p. 1098 ]. in this respect, the claim that a moral right was at stake mitigated the standard of scientific rigor used in the political decision making. in sum : although the initial assessment procedure was predicated on the assumption that mammographic screening would not affect the value of health, both common views of health and disease, as well as related obligations and rights were affected by the development and introduction of mammographic screening. to be sure, the concurrent emergence of many other technologies for early diagnosis definitely played a role as well. partly for practical reasons : if the actors involved reflect on the potential impact of technology on morality, they will be confronted with unanticipated changes in morality less often. another reason is that such changes may affect judgment on the desirability of a technology. since it is usually very difficult to withdraw or prohibit a technology already in use (as the controversy on age limits shows), it makes sense to try to anticipate an emerging technology s long term impacts. this presupposes, however, that hta discards the assumption that morality is stable and independent from technology. as described above, the first publications on mammography present it as a tool to improve the prognosis of women with asymptomatic breast cancer. the actors involved in the assessment process are aware, however, that measuring improved prognosis is rather complicated. counting cases of early detection does not suffice ; the screening program is successful only if subsequent treatment is effective and results in prolonged healthy lives. therefore the outcome measures proposed at first are 10 years survival and mortality rates. however, because an increase of 10 years survival rates without a concurrent mortality reduction is considered undesirable, reduction of breast cancer mortality quickly becomes the central measure of effectiveness. the pilot projects in utrecht and nijmegen are explicitly set up to investigate to what extent mammographic screening reduces breast cancer mortality. the health council in its first report (1981) affirms this choice : this is the intended effect of mammographic screening and it should be the central focus of the assessment procedure. the actors gradually become aware, however, that mammographic screening does more than it was intended to do and that these additional effects may also be relevant when assessing the technology. the health council quality of life as an additional outcome measure for the effectiveness of mammographic screening : therapeutic effectiveness in the above is translated as reduced breast cancer mortality. it is important to point at the so called breast saving surgery techniques that have gained ground in the treatment of early stage breast cancer lately. development of breast saving surgery techniques was actually spurred by the increasing number of pre - clinical tumors becoming available as a result of screening [13, p. 95 ]. the novel surgery techniques were thus co - produced by mammographic screening, resulting in an unforeseen (and up to then unintended) effect. decreased mutilation and increased wellbeing of patients now emerged as a potential additional goal of breast cancer screening, next to mortality reduction. it is important to point at the so called breast saving surgery techniques that have gained ground in the treatment of early stage breast cancer lately. ] thus, the assessors initial focus on the intended effect only started to look too narrow. the concept of quality of life was proposed to broaden the scope of the assessment, to allow different types of presumably positive effects of screening to become visible. although such effects were not explicitly intended at the start of the projects, the health council appears to have been willing to include this novel measure in the assessment. however, the investigators of the two dutch pilot projects did not include quality of life as an additional measure of effectiveness, presumably because they did not want to change the design of their long term studies. it is only in the cost - effectiveness study (1990), therefore, that quality of life first appears as a measure of effectiveness. the authors of this report motivate the introduction of the concept in a way that is very different from the health council s earlier suggestion : next to mortality reduction, inevitably undesirable effects will occur. an undesirable effect is, for example, anxiety in women who are referred for further diagnostics and who in the end appear not to have breast cancer (the false positives ()). another undesirable effect is that a number of women now know they have breast cancer whereas for some of them the prognosis wo nt improve. () weighing the amount of desired and undesired effects on the one hand and the expected costs and reduced expenses on the other is necessary. quality of life is not meant to measure additional positive effects of screening ; on the contrary, it is a measure for any impact (both desirable and undesirable) screening might have on the lives of individual participants. an undesirable effect is, for example, anxiety in women who are referred for further diagnostics and who in the end appear not to have breast cancer (the false positives ()). another undesirable effect is that a number of women now know they have breast cancer whereas for some of them the prognosis wo nt improve. () weighing the amount of desired and undesired effects on the one hand and the expected costs and reduced expenses on the other is necessary. ] thus, the actors involved in the assessment of breast cancer screening gradually realized that mammographic screening may have significant impacts besides the intended increase in life expectancy, and that these effects, moreover, need not always be positive. voices from the public debate (on breast cancer screening, but also on other medical technologies) may have played a role here. the introduction of quality of life was an attempt to accommodate a broader array of effects, in a way that apparently enabled a sensible comparison of these effects. this history corroborates the argument made by armstrong and caldwell, who claim that the emergence of quality of life in the 1970s and 1980s among others expressed a general discomfort regarding the human costs of technological interventions [2, p. 36 ]. in the dutch case, the desire to include patients perspectives (often mentioned as a justification to include quality of life) apparently hardly played a role. it is clear from the cost - effectiveness report how the researchers struggled with the operationalization of quality of life [9, pp. what should or should not be included ? how to operationalize the more subjective types of impacts ? and how to compare different types of impacts ? interestingly, the questionnaires to assess quality of life impacts were not filled out by women participating in the pilot projects, because the questions were considered too complex for these participants. instead, stand ins like economists and medical professionals involved in cancer screening and care acted as respondents. the first were considered to be more used to this type of questionnaire, and the latter were supposed to have a reliable view of how breast cancer may affect women s lives. since then, struggles have continued, leading to a proliferation of instruments measuring quality of life, most of which do involve patients (or healthy subjects) as respondents. quality of life, in addition to mortality reduction, has become a widely accepted dimension for assessing the impact of novel medical technologies. the history of assessing breast cancer screening shows why hta should not focus on a technology s intended effect only. technology does more than it is intended to do, both directly and indirectly. as for the direct effects, screening may increase one s life expectancy and decrease wellbeing at the same time. focusing exclusively on the intended (hoped for) effects inevitably biases the assessment and leads to (avoidable) implicit normativity of the results. including a broad array of potential effects is important for even handed decision making on the desirability of a novel technology. this is even truer for indirect effects, like the improved surgery techniques resulting from the emergence of early diagnostics. good hta should nonetheless try to anticipate and include such effects, both at the start and on the way, as the dutch assessors tried to do. as described above, the reduction of breast cancer mortality by mammographic screening not only requires a well functioning mammographic device, but also an effective therapeutic follow up. breast cancer screening has, then, clear social and organizational conditions from the start. however, at first both the researchers and the political actors involved approach mammographic screening as a material device that processes input (asymptomatic women) to deliver a specific output (mortality reduction). the pilot projects are presented as a means to find out how effective this new diagnostic technology will be when applied to asymptomatic women. practical conditions like setting age limits and frequency of screening do get some attention, but only in relation to the question how to increase the screening s effectiveness. it is interesting to see how the actors in the dutch screening assessment seem to have become gradually aware of the importance of social and organizational conditions ; an awareness that in the end led to a strict regulation of the national screening program and even to a law on population screening. when the results of the pilot projects seem sufficiently promising to warrant serious consideration of a nation - wide screening program, the researchers start pointing out that the organizational setting of screening is crucial. the positive results can be repeated only, they state, when the national program is conducted in a way similar to the pilot projects. the health council agrees. in its second report it states : the committee emphasizes that a potential screening program will succeed or fail depending on the way the introduction and design are organized. () guarantees are needed for the quality of the work of participating centers (diagnostics, treatment and counseling of the women involved). in this respect a newly instituted center of reference might serve quality control as well. [16, p. 28 ] the committee emphasizes that a potential screening program will succeed or fail depending on the way the introduction and design are organized. () guarantees are needed for the quality of the work of participating centers (diagnostics, treatment and counseling of the women involved). in this respect ] both the scientific and the political actors thus gradually became aware that mammography is more than a material device and that breast cancer screening requires more than the distribution of mammography devices. as a result, they concluded that a national screening program should be as similar to the pilot projects as possible. the awareness that organizational conditions are crucial in realizing a certain effect motivated the health council s advice to centralize the organization of screening and make it a uniform practice. moreover, since the pilot projects were designed as a separate, autonomous service, situated between gp s and hospitals, the national program also became a separate service next to primary and secondary health care. thus, because the sociotechnical character of mammographic screening came into the picture relatively late, the organizational choices of the scientific pilot project became indicative for the organization of the national program. as one critic stated, when the committee developed a refined constellation of protocols and procedures for national screening practice, it was actually trying to approach the conditions of scientific research this blocked serious consideration of alternative options. even the question whether or not all actors agreed with the proposed division of roles and responsibilities was hardly discussed. the growing awareness of the social conditions for realizing the aimed for mortality reduction also influenced the approach of and the role ascribed to female participants. in its final report the health council explicitly mentions a high participation rate as a condition for attaining the aimed for effect : the committee emphasizes the importance of a maximal participation in screening for breast cancer. if the participation rate is too low, the aimed for mortality reduction on the population level may also become too low recommendations were formulated to make screening as accessible as possible : the invitational system should function well, screening should be affordable, the location of screening centers should be accessible, counseling should be available, and education should be as persuasive as possible : careful education of the female population is necessary. research into the effectiveness of education with regard to the participation of the women involved in screening is necessary [17, p. 72 ]. here, the need for a high participation rate to achieve the aimed for effects actually led to a neglect of a potentially conflicting value : the autonomy of participants. the implicit tension between effectiveness and women s autonomy came to the fore once more in 1991, when the minister of health in a letter to the health insurance council in 1991 simply states that invitations, leaflets and campaigning material should contribute to high participation rates as well as enable considered choices by the women in the target group [51, p. 11 ]. in the parliamentary debates on screening, however, mp s stressed that autonomy was the most important value. this position in the end was confirmed by the minister in a memo from 1993, stating that information on screening should include negative aspects of screening, even if this would lead to a decrease of participation rates [53, pp. this episode shows how the implicit view that technology is a material device led the assessors of mammographic screening to neglect the social and organizational elements of this technological practice for a long time. in the end they did stress the importance of social and organizational conditions, but because the outcomes of the assessment by then were quite promising, this did not result in discussion on the pros and cons of the specific design of the screening practice in the pilot studies. on the contrary, the practice investigated in the pilot projects now was put forward as the most desirable. moreover, these conditions were approached only in terms of effectiveness ; issues of feasibility and desirability did not come to the fore. these episodes show once more how the view that technology assessment is about the intended effects of a material device may lead to implicit normative effects of the assessment procedure, in this case with regard to the social and organizational conditions. it tends to limit or even close off the space to discuss the pros and cons of alternative designs of the practice at hand. moreover, it may lead to roles for both professionals and lay users that are not acceptable to them or that severely diminish the realization of alternative values (like autonomy). conceiving novel technology in terms of a sociotechnical practice might help to avoid this implicit normativity by including such social and organizational aspects in the assessment procedures right from the start. the third and last presupposition of the assessment procedure for mammographic screening i want to discuss here is that the development of mammographic screening itself would not affect morality. as pointed out above, the instrumental view of technology implies that humans can first set goals and then decide whatever technology serves their goals best. in the case of mammographic screening the assessment, then, need not focus at the goal aimed for, but only at the question to what extent screening would realize this goal. the history of the hta process and the resulting screening practice show, however, that both the meaning of and the weight assigned to since this is a long term process, it is easier to discern with the benefit of hindsight. one of the first dutch professional publications on early detection of cancer pointed out that the authors explicitly asked : is it desirable indeed to ask people s attention for their own body as a source of disease time and again ? or would a healthy life rather consist in living without having to worry about one s breasts, intestinal tract or stomach ? [24, p. 67 ] the issue was both conceptual (a shift might occur in the way health is generally interpreted) and psychological (this conceptual shift might have impact on people s lived experience). typically, the authors of this report declared they were not competent to address such questions. is it desirable indeed to ask people s attention for their own body as a source of disease time and again ? or would a healthy life rather consist in living without having to worry about one s breasts, intestinal tract or stomach ? [24, p. 67 ] not surprisingly, then, the issue was hardly taken into consideration in the subsequent assessment and deliberation processes. as discussed earlier the scientists first defined health exclusively in terms of survival and later also in terms of quality of life. considerations on the impact of screening on views and experiences of health incidentally reappeared in newspaper contributions arguing against screening. however, since empirical evidence for such soft impacts was absent (and hard to investigate anyway), they were easily dismissed in view of the positive evidence for the effectiveness of screening. in retrospect it seems nonetheless justified to conclude that the introduction of breast cancer screening, albeit in conjunction with many other technologies for early detection of disease, did contribute to a new understanding of what it means to be healthy or diseased. the long standing view that health means absence of complaints has been exchanged for the view that disease can be a - symptomatic. as a result, most people now probably accept the view that they can have a disease without noticing anything. this is actually a generalization of the shift that mammography brought about earlier in the medical domain. the starting point of the debates on screening was, after all, the observation that this technology enabled doctors to identify lesions in women who had up to then seemed perfectly healthy, both to themselves and to their doctors. now that it is possible to diagnose a - symptomatic disease, people are expected to subject themselves to these technologies. even though dutch women are not legally required to participate in the mammographic screening program, those who do not participate often have to justify their choice. they may even be accused of irresponsible behavior, especially if they are diagnosed with breast cancer later on. participation in screening, that is, has become a social norm. on the other hand, novel rights have been claimed. at the introduction of a nation wide program for breast cancer screening the age limits of the target group evidence for the effectiveness of screening older women was thought to be lacking (another example of how the design of the pilot projects became normative for the national program). as described above, in 1992 the health insurance council (responsible for the funding of the national program) decided to keep a strict hand at the upper age limit, partly motivated by overspending. the council was confronted with an indignant public response from elderly women as well as medical professionals. they argued that women had a right to be screened, and that denying this right to a subgroup of women on the basis of their age amounted to age discrimination. apparently women above 70 who had been screened for some years felt that they were denied something valuable. however, just the fact that it was actually claimed shows that a substantial group of people had come to perceive screening as a thus, the screening providers and politicians were confronted with moral considerations they had not anticipated when assessing and deliberating the desirability of mammographic screening. as a result interestingly, the issue was approached in a way resembling the original assessment process : judgment on desirability was postponed pending the production of evidence on the effectiveness of screening older women. novel research was started ; in the meantime the age limits were strictly kept. in 1998 a dutch case control study claimed to have shown that reduction of mortality for 7075 years olds was possible and that screening could significantly improve the quality of life of this group. some actors argued that this evidence was not sufficiently conclusive, since it was not based on rct s and thus could be biased. however, the political decision makers thought it would be unacceptable to let older women wait any longer for the outcomes of such (usually very long term) studies [57, p. 1098 the claim that a moral right was at stake mitigated the standard of scientific rigor used in the political decision making. in sum : although the initial assessment procedure was predicated on the assumption that mammographic screening would not affect the value of health, both common views of health and disease, as well as related obligations and rights were affected by the development and introduction of mammographic screening. to be sure, the concurrent emergence of many other technologies for early diagnosis definitely played a role as well. partly for practical reasons : if the actors involved reflect on the potential impact of technology on morality, they will be confronted with unanticipated changes in morality less often. another reason is that such changes may affect judgment on the desirability of a technology. since it is usually very difficult to withdraw or prohibit a technology already in use (as the controversy on age limits shows), it makes sense to try to anticipate an emerging technology s long term impacts. this presupposes, however, that hta discards the assumption that morality is stable and independent from technology. to sum up : the actors involved in the assessment of mammographic screening in the netherlands not only developed a general procedure for hta. in the process of assessing mammography, they were also confronted with several limitations and weaknesses of this procedure. with the benefit of hindsight we can trace even more. my reconstruction of the case displays how at various moments a misfit emerged between the instrumentalist presuppositions of the procedures and the way technology actually works. these misfits produced implicit normative effects because important considerations were not or only marginally taken into account. this significantly reduces the moral and political legitimacy of the judgment on the desirability of mammographic screening even though mammographic screening since the historical case is interesting because it reminds us that hta procedures and tools should fit with the way technology works. too many assessments today still resemble the procedure emerging in this early example. how to tailor hta methodology to technology, then ? in this section i will summarise the lessons for hta that can be drawn from the case of mammographic screening, while briefly suggesting which tools or measures might help to avoid the weaknesses from the past. first, technology does more than it is intended to do : it has a broad array of effects. moreover, complex interactions may occur. as a result, many effects are difficult to foresee. it would be nave to suggest that all effects can be anticipated and included in hta of emerging technologies. a first step is to engage users, or more generally stakeholders, early in the assessment process [23, 39, 60 ]. including actors with different backgrounds in the assessment process will help to chart and imagine the wide variety of effects a technology might have. it also contributes to the democratic legitimacy of the deliberation process. to avoid foreclosing or steering of such an inventory, it may be advisable to start with explorative, qualitative research [28, 29 ]. this would allow stakeholders to respond as much as possible from their own perspective and in their own words. stakeholders could also be asked to participate in the selection of effects to be measured and to comment on proposed outcome measures, to ensure these do justice to the rich meaning of anticipated effects. it also influences our (to list just a few) health care practices, roles, responsibilities and identities. because such effects usually emerge only gradually and do not lend themselves for quantitative research, they are easily neglected. earlier examples, ongoing trends and patterns can help to make us more aware of the soft impacts. in addition, they can be used to enhance our imagination of what might happen in the future (for an example see. historical and sociological insights can be incorporated, for example, in scenarios of possible futures. the second lesson from the case discussed above, partly related to first one, is that technology should not be approached as a device, but as a sociotechnical practice. this means that the social and organizational conditions for making the material device work have to be included right from the start of the assessment. the aim here is not to assess how effective they are with regard to the intended outcome, but to explore additional impacts, for example on the division of roles and responsibilities of the actors involved. to avoid normative effects resulting from the experimental design, it might help to experiment with alternative sociotechnical designs at the same time (for a similar suggestion see. this would enable comparisons and thus result in informed debate on the acceptability and desirability of proposed practices. finally, the third lesson is that morality is not a stable phenomenon ; it is evolving and technology is an important driver of this evolution. when assessing and debating the desirability of an emerging technology one should, then, take into account the mutual interaction of morality and technology and try to anticipate such effects. a tool to support this is, again, historical analysis, which could then be used to construct plausible scenarios that serve as input for public and political debate. as i indicated above, all this will not suffice to foresee and predict a new technology s impact. technology is a complex phenomenon and so is society, and the confrontation of the two is bound to produce events and effects no one would have been able to imagine in advance. if this is true, it makes sense to construct assessment procedures as flexible as possible. it should be possible to incorporate unexpected effects or adjust outcome measures later on. overall, these lessons and the suggested tools aim to broaden the number and type of considerations that can be put forward in deliberation and debate on the desirability of novel biomedical technologies. the underlying thought is that this both improves the quality of the assessment (since fewer aspects will be neglected) and enhances the democratic legitimacy of the process (since all views can be seriously considered). i have hardly paid attention to the division of roles and responsibilities in the deliberation and decision making processes. much more should be said, for example, about the relation between scientific experts, clinicians, lay people and politicians, but this will have to wait for another occasion. the tools, methods and procedures for hta are the evolving products of historical learning processes. the first attempts to perform hta in the netherlands started with the endeavour to provide decision makers with scientific evidence on the effectiveness of mammographic screening. the resulting procedure was to a large extent informed by an instrumentalist view of technology. in the process, the actors performing and using the results of the assessments were confronted with the weaknesses and limitations of the instrumentalist view. the case shows how the actors involved partially responded to these surprises by adjusting their assessment methods. today, hta can pride itself on quite some history in many countries. as a result however, the history of hta is not only a source of standard models, tools and methods. hta could take advantage of these latter experiences more often, to improve the fit between methodology and technology. improving this fit | health technology assessment (hta) was developed in the 1970s and 1980s to facilitate decision making on the desirability of new biomedical technologies. since then, many of the standard tools and methods of hta have been criticized for their implicit normativity. at the same time research into the character of technology in practice has motivated philosophers, sociologists and anthropologists to criticize the traditional view of technology as a neutral instrument designed to perform a specific function. such research suggests that the tools and methods of more traditional forms of hta are often inspired by an instrumentalist conception of technology that does not fit the way technology actually works. this paper explores this hypothesis for a specific case : the assessments and deliberations leading to the introduction of breast cancer screening in the netherlands. after reconstructing this history of hta in the making the stepwise model of hta that emerged during the process is discussed. this model was rooted indeed in an instrumentalist conception of technology. however, a more detailed reconstruction of several episodes from this history reveals how the actors already experienced the inadequacy of some of the instrumentalist presuppositions. the historical case thus shows how an instrumentalist conception of technology may result in implicit normative effects. the paper concludes that an instrumentalist view of technology is not a good starting point for hta and briefly suggests how the fit between hta methods and the actual character of technology in practice might be improved. |
darwin referred to the rapid success of flowering plants in evolution as an ' abominable mystery '. a great deal of this success relies on the peculiar ways of sexual reproduction that they have evolved. the facts that delight us and spark our curiosity about the sexual behavior of animals, in fact the essence of many novels - attraction, deception, chemistry, male competition, female selection, abortion, death and sacrifice - take place just below our noses every time we appreciate the fine scent of a flower. the lovers, usually invisible to the eye, are the male and female gametophytes, the pollen grain and the embryo sac ; the plot occurs inside the female reproductive organs, collectively known as the pistil (figure 1). the final act involves the irresistible attraction to the ovule through specific molecules, leading inevitably to the altruistic self - sacrifice of the pollen tube cell, which explodes to deliver the sperm cells to the embryo sac. a pistil is shown, with pollen at various stages of pollination. in a typical compatible pollination, pollen adheres to and germinates on the stigma, producing a pollen tube. the tube grows through the female tissues toward the ovary, where it needs to adjust its growth trajectory to find an ovule and then turn again to enter the micropyle and penetrate the embryo sac. white boxes indicate the main organs that take part in these interactions ; blue boxes indicate the main processes (from adhesion at top left to fertilization at the bottom) ; red text indicates representative arabidopsis mutants that affect these processes in any way ; red arrows show the main cell - cell interaction between the male gametophyte (pollen grain and tube) and the different female organs and gametophyte (embryo sac). in arabidopsis the whole process, from pollen adhesion to fertilization, takes about 4 to 8 hours. ever since linnaeus, the process has intrigued biologists, and although the fundamental basis of the interactions were understood in the 19th century by researchers such as robert brown, giovanni battista amici, darwin and sergei nawaschin, the molecular nature of this fatal attraction is only now beginning to be understood. mathematics is now being used to investigate the problem for the first time, in a ground - breaking article recently published in bmc plant biology. in this study, stewman and colleagues use a semi - vivo system to better quantify the nature and range of the ovule 's attractants. more importantly, they applied a stochastic mathematical model of whole - cell motility to pollen tube growth. this sort of model has previously been used with success to describe chemotaxis in various eukaryotic cells, such as leukocytes and listeria. when calibrated with the new experimental data, the model enabled predictions to be made about the size and physical features of the attractant. the results suggest that the growth features observed greatly enhance the attraction efficiency of the ovules. most of the beauty that flowers may have for us through their combinations of colors, shapes and scents have, from a developmental point of view, only one purpose : attracting insects and other animals through deception to perform pollination. reproduction occurs when a pollen grain lands on the receptive surface of pistil, the stigma (figure 1), whether it arrives there through a sophisticated relationship between insects and orchids or through the mere dispersion of grass pollen by the wind. there, the word ' chemistry ' has a literal meaning as well as a metaphorical one, because the bonding between the specialized outer layers of the cell walls of the pollen and the outer stigma cells has been calculated to be stronger than the strongest industrial superglue. many receptors and ligands come into place to assure proper recognition, and if the match is compatible, the stigma cells nurture the highly dehydrated pollen grains by providing them with water and nutrients, allowing germination. the pollen tube then grows out of the pollen grain in an extreme example of polarized, apical cell growth that results from an unusual set of cell features. the pollen tube is one of the fastest growing cells in nature, and encodes a very specialized transcriptome for cell signaling and communication, which makes them efficient stimulus - perception machines. but how and why these cell - cell interactions take place and navigate the pollen tube so precisely to target the ovule 's entrance - the micropyle - are still matters of debate. these events all take place deep inside the pistil tissues, and it has only recently been possible to image them directly by means of two - photon microscopy. in the decades since the pioneering work of rosen, mascarenhas and others, evidence has accumulated that a combination of chemotropic molecules is probably needed for some of the steps. however, for most of the path (from adhesion to entry into the ovary ; figure 1), the anatomical arrangement of the tissues seems to be sufficient to mechanically provide a limited freedom for tube growth. the physical and chemical features of the tissues that make direct contact with pollen tubes (lipids, water, glycosylated proteins, and so on) provide the rest of the signals. with the advent of genetics, a number of screens in arabidopsis isolated mutations for most steps of this so - called progamic phase of reproduction (a representative list of mutants for each step is shown in red in figure 1). some of these mutants have provided evidence for long - range targeting, with signaling occurring over perhaps as far as 500 m. the list of genes involved is likely to get significantly larger as new screening methods reveal dozens of male- and female - specific mutations, especially in arabidopsis, but so far none has brought us close to the specific chemotaxis molecule(s). curiously enough, answers to the question of the chemotaxis molecule 's identity came from classical experimental embryology. for a long time, various teams have been developing partially artificial fertilization schemes, for either fundamental or applied reasons. in most of these schemes, pollen is allowed to germinate in the stigma, but the style is excised and the pollen tubes are allowed to grow out of the style into an artificial medium. this semi - vivo method has more recently been combined with isolated ovules to test the hypothesis of whether the system is sufficient to provide attraction to the pollen tube ; this would validate the existence of gradients of attractants secreted from the ovules. such a system was first shown to work in the succulent plant gasteria and more recently in the model species arabidopsis, the lily lilium and maize. but none of these has been as powerful and informative as the system developed by higashiyama and colleagues using the wishbone flower, torenia fournieri. starting from the anatomical observation that in this species the female gametophyte - the embryo sac - is naked and exposed without any surrounding tissue, these authors developed a series of experiments that showed for the first time the explosive discharge of the pollen tube inside the ovule and identified the synergid cells (figure 2) as the source of the diffusing attractant signal. in a tour - de - force of proteomics, the same authors recently isolated the first proteins to be shown to be specifically involved in the attractant signal : small, defensin - like, cysteine - rich peptides called lures. a model of pollen tube attraction by diffusion of molecules from the micropyle now seems to be well established (figure 2a). if comparisons can be drawn from the animal field, many more classes of proteins are expected to be described, as the proteomics effort is only just starting and many screening efforts are getting under way. a pollen tube carrying two sperm cells leaves the placenta to grow along the funiculus (the foot of the ovule) into the micropyle (the entrance of the ovule) following gradients generated by the maternal tissues of the ovule and by the female gametophyte. an embryo sac contains the egg apparatus (egg cell and two synergid cells), the central cell with two polar nuclei, and three antipodal cells. it is usually surrounded by a supportive tissue - the nucellus - and two layers of protective tissue - the inner and outer integuments. in torenia pollen is germinated in the stigma, but the style is cut (top in (b)) and co - cultivated with dissected ovules (bottom in (b)). when coming out of the style, pollen tubes grow in the surface of a semi - solid agar medium, and eventually target the micropyles of the ovules (c). if penetration is achieved, the contents of the tubes are discharged inside one synergid ; if the system is carried out with pollen tubes (arrows in (c)) labeled with green fluorescent protein, the moment of fertilization is visible by fluorescence (arrowheads in (c)), and ovules can be scored in terms of successful attraction. (d) depiction of the angles used in the analysis of pollen tube turning made by stewman.. these angles indicate how much the pollen tube would have to turn to take the most direct path toward the micropyle (qmp), and describe the new direction chosen by the pollen tube in response to the gradient (qtip). these quantitative data were then gathered for various incubation periods to deduce the nature and effect of the gradient produced by the diffusion of an attractant from the ovule 's micropyle. the development of a suitable semi - vivo system of fertilization for arabidopsis (figure 2b, c) has not only enabled the use of genetics, it has also been used to investigate the physical nature of the diffusing molecule in arabidopsis, as it has in torenia. have now carefully analyzed the growth curvature angles of torenia pollen tubes (figure 2d) in various experimental conditions, namely with different incubation times of the ovules (presumably corresponding to different levels of a standing gradient), and could thus determine important quantitative parameters of the attraction process. first, they found that the gradient action could extend a distance of 100 to 150 mm, a distance significantly longer than had been previously thought or than had been experimentally tested with artificial gradients of isolated molecules. this distance estimate probably means that various types of molecules with different ranges and actions come together to produce the biological reaction. there is no doubt that species specificity must be assigned by gene - encoded proteins, and that the isolated lures and the zea mays egg apparatus 1 protein (zmea1) both produce positive tropic effects. however, the evidence seems to implicate many other non - specific, small, diffusible chemicals, such as ions or even the signaling gas nitric oxide (no). in fact, the involvement of no is not a surprise, because various behaviors shown by pollen tubes when no concentration is disturbed seem to indicate a slowing down of growth of the pollen tube as it approaches the diffusion source ; these effects fit with those found in the model of stewman and colleagues. the apparent simplicity of pollen tube growth is leading to various approaches to mathematical modeling of its main features. looking from a different angle, the prominence of the signaling systems of pollen tube growth was recently modeled by assuming that soluble n - ethylmaleimide sensitive factor attachment protein receptors (snares) and small signaling gtpases are the main effectors of growth.. took a step further and focused on the formal properties of the system as shown from the kinetic parameters precisely derived from the semi - vivo system. the problem of gradient sensing is not trivial, and the authors followed the strategy of building on stochastic whole - cell motility models, which basically assume that pollen tubes can sense a difference in the fraction of the receptors bound to an attractant and change their growth depending on this fraction. one prediction of the model was that a slower growth rate inside a standing gradient of attractant (which is assumed to exist from the isotropic diffusion of the attractant from the ovule) would greatly enhance the ability of pollen tubes to successfully target ovules, a prediction that they could statistically validate with their experiments. furthermore, the model describes the observed patterns of random and directed growth observed during growth of pollen tubes in vitro. although the assumption of a purely formal mathematical description of any biological phenomenon may lead to purely phenomenological descriptions of limited experimental value, the complexity of the system and the number of different cellular components that seem to be fundamental for growth make these approaches highly informative, or even fundamental, to understanding the mechanistic basis of the macroscopic response of the system. for example, this model may help us to understand how pollen tubes couple external guidance cues with intracellular ion gradients or other known cell steering mechanisms. in addition, the model assumes that there are at least two patches of receptors, which are separated in the pollen tube. although this assumption says nothing about what the receptors are, it does suggest that a minimal model of a sensor with a strict apical point location would not work ; instead, it favors a membrane or cytosolic spatially segregate or a receptor that stretches across (at least) the diameter of the tube. the model also assumes that the change in concentration across the tip of the tube is much less than the average concentration at the tip. despite being affected by the limitation of the two - dimensional modeling performed, this is a strong quantitative prediction that can be validated when searching for novel molecules that might fit the profile. and how does slowing down of the tubes take place near the micropyle ? no, for example, is known for slowing down growth rates, and the formulation of the model does, in fact, allow for multi - factorial interactions affecting the growth process. importantly, this mathematical formulation may allow discrimination of different effects during experimental procedures based both on the deviation of the growth angle and/or the relationship of the growth rate to successful targeting. as with many other mathematical approaches to complex biological behavior, this new model from stewman. raises more questions than answers. but the fact that new approaches are contributing to a precise experimental description of the system may make mathematical modeling an important tool for testing and selecting candidate molecules that may fit the in vivo biological profile of the final step of plant sexual attraction. i thank leonor boavida for drawing and compiling figure 1. financial support for my laboratory | pollen tubes follow attractants secreted by the ovules. in a recent paper in bmc plant biology, stewman and colleagues have quantified the parameters of this attraction and used them to calibrate a mathematical model that reproduces the process and enables predictions on the nature of the female attractant and the mechanisms of the male response.see research article : http://www.biomedcentral.com/1471-2229/10/32 |
levamisole, an anthelmintic agent that targets the nicotinic acetylcholine receptors, is usually used as an immunostimulant in combination with 5-fluorouracil (5-fu) to treat colorectal cancer since 1990. it has been shown that combination of these two drugs decrease the risk of clinical recurrence and to increase survival in patients with stage iii adenocarcinoma of the colon., we describe multifocal inflammatory leukoencephalopathy in a patient with accidentally consumption of levamisole after 8 months of gastric lavage of the drug. a 53-year - old man was admitted to the neurology department of farabi hospital (kermanshah, iran) with walking inability and recognition disorder. patient history showed that he had referred to hospital with vomiting, vertigo and headache 8 months before after consumption of two sachet of levamisole (for veterinary use) which each sachet contained 1.5 gram of levamisole hydrochloride. one month later, he had been stricken by progressive walking inability and recognition disorder up to administration to our hospital. the patient had not any previous illness. on neurologic examination, he was confused and did not establish a good relationship with the bystander. on mental and cognitive power examinations, using the mini mental state examination (mmse), he earned 17 points (out of a total score of 30) with no signs of meningeal irritation (such as stiffness of neck). the power of limbs was within normal range but deep tendon reflexes in all of four limbs had increased in conjunction with extensor plantar response and reduced abdominal skin reflex. on cerebellar examination, finger to nose test and heel to shin was impaired and the gait was ataxic. on the initial laboratory tests, complete blood count (cbc), in cerebrospinal fluid analysis, color, pressure, cells, and sugar were normal but protein was increased (69 mg / dl). on electroencephalography (eeg), bilateral paroxysmal slow waves were seen. in visual evoked potential (vep), there was a bilaterally prolonged p100 latency. brain magnetic resonance imaging (mri) showed mild cerebral atrophy and multiple focal lesions distributed in periventricular and cerebellar white matter and also in pons and midbrain (figure 1). these lesions had low - signal intensity on t1-weighted images and high - signal intensity in fluid - attenuated inversion recovery (flair) view and t2-weighted images. initial brain mri in the patient with multifocal demyelinating leukoencephalopathy after accidental consumption of levamisole ; a : brain mri on t1wi revealed multifocal subcortical white matter lesions in the periventricular ; b and c : brain mri on t2wi revealed multifocal subcortical white matter lesions in the periventricular, cerebellar and pons ; d and e : brain mri on flair revealed multifocal subcortical white matter lesions in the periventricular area, cerebellum and pons following clinical examinations and ruling out of other causes, including infectious and vascular causes, trauma and metabolic, central nervus system (cns) vasculitis and paraneoplastic syndromes ; and according to the patient 's history, the patient was diagnosed as multifocal inflammatory leukoencephalopathy following levamisole consumption. the patient was treated with intravenous methylprednisolone (500 mg) every 12 hours for 7 days followed by two weeks oral consumption of the prednisolone (50 mg / day) during hospitalization. no change was noticed in cerebellar signs and gait disorder but a brief improvement was seen in mentality and cognition after 1 and 3 months. after a month of treatment (figure 2) the follow - up brain mri in patient with multifocal demyelinating leukoencephalopathy, after 1 month treatment with methylprednisolone disclosed no recovery of the subcortical white matter lesions ; a : brain mri on t1wi revealed multifocal subcortical white matter lesions in the periventricular area ; b : brain mri on t1wi with contrast revealed multifocal subcortical white matter lesions in the periventricular area and no evidence of enhancement ; c : brain mri on t2wi revealed multifocal subcortical white matter lesions in the periventricular area ; d, e and f : brain mri on flair revealed multifocal subcortical white matter lesions in the periventricular area, cerebellum and pons this paper reported the clinical features and mri changes that were occurred suddenly after consumption of high dose levamisole and 8 months later. clinical investigations and also mri imaging showed the drug induced toxicity in the brain after 8 months of treatment. toxicity of levamisole is generally mild, even when levamisole is used alone, and is negligible in a series of patients in whom it is associated with 5-fu (leucovorin). the spectrum of side effects (partly dose - dependent) includes myalgia, arthralgia, fatigue, fever, chills, skin rash, nausea, vomiting, anorexia and neurological symptoms. the latter mainly consist of depression, anxiety, insomnia, difficulty in concentration, headache and vertigo. clinical investigations of the patient showed memory loss, confusion, ataxia, dysarthria, and hyperreflexia that can not be considered as the side effects of the drug alone but are the main symptoms of multifocal inflammatory leukoencephalopathy. here, it seems that if a case subjected to only one but high dose of levamisole, the catastrophic effect is such prominent that may induce multifocal inflammatory leukoencephalopathy. on the other hand, mri imaging showed inflammation in many parts of the brain that led us to diagnose the patient as multifocal inflammatory leukoencephalopathy. multifocal inflammatory leukoencephalopathy, a central nervous system disorder characterized by demyelination with perivascular inflammation, has recently been reported in several patients treated with the combination of fluorouracil and levamisole chemotherapy. it has been suggested that the neurotoxicity derived by combination of these two drugs was mainly due to 5-fu rather than levamisole alone. however, some authors confirmed that multifocal inflammatory leukoencephalopathy could be induced by levamisole alone. in parallel with these studies, we also suggest that levamisole alone can induce multifocal inflammatory leukoencephalopathy. on the other hand, in previous studies, levamisole was administered as a drug choice and there was no document in the literature for monitoring the effect of this drug following accidental consumption. in addition, gastric lavage followed by delayed treatment of the patient with methylprednisolone can not diminish the neurotoxicity of levamisole. these data highlights the fact that the drug must be unavoidable to children and the usage of the drug must be used vigilantly. | levamisole is an anthelmintic agent and also immunostimulant drug which is used to treat colorectal cancer. the present study aimed to show accidental consumption of levamisole alone induced multifocal inflammatory leukoencephalopathy. a 53-year - old male was admitted to the neurology department of farabi hospital (kermanshah, iran) with walking inability and recognition disorder. following clinical examinations, the patient diagnosed as multifocal inflammatory leukoencephalopathy following levamisole consumption.the patient was treated with intravenous methylprednisolone followed by prednisolone. the magnetic resonance imaging (mri) was done 1 month later and did not show a reduction or remission in the lesions. history of the patient showed that he had accidentally consumed levamisole 8 months ago. it seems that the consumption of levamisole can induce multifocal inflammatory leukoencephalopathy and delayed treatment of the patient with corticosteroid can not diminish the neurotoxicity of levamisole. in addition, the cytotoxic dose of levamisole induces irreversible multifocal inflammatory leukoencephalopathy. |
most of our current knowledge about the central nervous system (cns) and neural function in patients with neurological diseases has been obtained from postmortem tissues that often represent the end stage of the disease. the inability to sample live cns tissues impedes our progress to understand aspects of the neuropathological abnormalities that develop during the course of the disease [14 ]. animal models can mimic genetic forms of human neurological diseases, and our understanding of the mechanisms of neurological diseases has been significantly advanced with transgenic / knockout technologies. however, these technologies are mainly limited to monogenetic disorders and thus only represent a minority of diseases. additionally, in many cases of neurological disorders with a defined causal gene(s), modeling with animal transgenic technology is inadequate due to species differences, genetic backgrounds, or other technical challenges [3, 5, 6 ]. more strikingly, numerous candidate drugs with promise in animal model screening have failed when translated to human clinical trials. the failure of translation to the clinic centers on the complexity of the human brain and the difficulty to model disease specific phenotypes in nonhuman systems. this situation indicates that an advancement towards more human relevant models is definitely needed to accurately study neurogenetic disorders. the elegant and seminal work by takahashi and yamanaka showed that retroviral expression of a set of four genes (oct4, sox2, klf4, and c - myc) can convert somatic cells into a pluripotent state [7, 8 ]. like other pluripotent stem cells, induced pluripotent stem cells (ipscs) can be coaxed to differentiate into neurons and glial cells, as well as other terminally differentiated cell types by exposure to a combination of growth factors and cell culture conditions [9, 10 ]. neurons derived from ipscs carry the genetic information from patients with a specific mutation or a neurological disease [3, 11, 12 ]. over the past few years, the progress in cell reprogramming has accelerated the generation of ipscs, and ipscs have now been derived from several easily accessible human cell types, including blood cells, keratinocytes, and dermal fibroblasts [4, 5, 1315 ]. the ipsc technology has opened new windows for modeling human diseases, identifying therapeutic targets, developing drug screening systems, and providing continuous autologous cell sources with potential for cell therapies [1, 5, 11, 1520 ]. here, the recent efforts and key findings when using ipscs to model neurogenetic disorders are reviewed. the potential of ipscs from patients as platforms for drug screening and as a source for cell therapy are presented. additionally, some of the challenges in ipsc modeling and in ipsc based therapy of neurogenetic disorders are highlighted. genetic neurodevelopmental disorders include a wide range of diseases characterized by impairment of neuronal function during development. these conditions are monogenic or multigenic. disease - specific ipsc lines have been generated from patients with neurodevelopmental diseases including rett syndrome, fragile x syndrome, down syndrome, angelman syndrome, prader - willi syndrome, and timothy syndrome (table 1). the ipsc based models of neurodevelopmental disorders recapitulate the early steps in neural development within genetic backgrounds that are linked to the specific disorder and may help to identify the underlying cellular and molecular mechanisms and establish novel therapeutics. rett syndrome (rtt) is a neurodevelopmental autism spectrum disorder, caused by mutations in the methyl cpg - binding protein (mecp2) gene [2125 ]. the ipsc derived neurons from patients with rtt reveal relevant neuronal phenotypes, such as neuronal maturation defects [2628 ]. consistent with rtt animal models and human postmortem brain tissues, the cell soma size of rtt neurons is decreased in comparison with nonaffected controls. additionally, neurons derived from rtt ipscs have fewer synapses, reduced spine densities, altered calcium signaling, and electrophysiological defects, suggesting a communication problem in rtt neuronal networks. treatment with insulin growth factor 1, a growth factor known to ameliorate the phenotype of rtt mice, improves the rtt ipsc - neuronal phenotypes, indicating that synaptic defects can be rescued in neurons derived from rtt patients [27, 30 ]. the ipscs can be directed to produce glutamatergic neurons that generate action potentials and form functional excitatory synapses. a recent study found that ipsc derived neurons from heterozygous mecp2 mice showed defects in the generation of evoked action potentials and in glutamatergic synaptic transmission, as previously reported in brain slices [3234 ]. these mecp2 deficient neurons fired fewer action potentials and displayed decreased action potential amplitudes, diminished peak inward currents, and higher input resistance relative to wild - type ipsc derived neurons, suggesting that disturbed sodium channel function may contribute to the dysfunctional rtt neuronal network. these phenotypes were further confirmed in neurons derived from independent wild - type and hemizygous mutant ipsc lines, indicating that these reproducible deficits are attributable to the mecp2 deficiency. taken together, these studies demonstrate that rtt ipsc derived neurons recapitulate deficits observed previously in primary neurons, and these identified phenotypes further indicate the requirement of mecp2 in neuronal development and the maintenance of normal brain function. the activity of l1 retrotransposons during brain development can have an impact on gene expression and neuronal function. l1 neuronal transcription and retrotransposition in rodents are increased in the absence of mecp2 [3941 ]. studies with neuronal progenitor cells derived from human ipscs revealed that patients with rtt, carrying mecp2 mutations, have increased susceptibility for l1 retrotransposition, suggesting a new potential molecular mechanism underlying rtt. mecp2 is an x - linked gene subject to random x chromosome inactivation (xci) resulting in mosaic expression of mutant mecp2. some reported rtt ipscs in which the inactive x chromosome of the founder somatic cell is reactivated. conversely, others reported that rtt ipscs retain the inactive x chromosome of the founder somatic cell. cheung. reported that ipscs from classic female rtt patients with a functionally null mutation retained the mecp2 mutation and an inactive x - chromosome in a non - random pattern. by taking advantage of the nonrandom pattern of xci, they generated a pair of isogenic wild - type and mutant mecp2 expressing rtt ipsc lines that retain the mecp2 expression pattern upon differentiation into neurons. the mutant rtt ipsc derived neurons showed a reduced soma size compared with the isogenic control rtt ipsc derived neurons. kim. found that some ipscs could maintain xci, whereas in others the x chromosome was reactivated. they isolated ipscs that retained a single active x chromosome expressing either mutant or wild - type mecp2, as well as ipscs with reactivated x chromosomes expressing both mutant and wild - type mecp2. consistent with rtt phenotypes, the mutant monoallelic or biallelic rtt ipsc derived neurons also showed maturation defects. thus, the isogenic control and mutant rtt ipsc lines represent an additional promising source for investigating the pathogenesis of rtt and the role of mecp2 in human neurons. classic rtt is caused by mutations in the mecp2 gene, whereas variants could be due to mutations in cdkl5. mutations in cdkl5 have been identified both in females with the early onset seizure variant of rtt and in males with x - linked epileptic encephalopathy [4447 ]. cdkl5 is a kinase protein highly expressed in neurons, but its exact function inside the cell is largely unknown [46, 48, 49 ]. by using ipscs derived from fibroblasts of patients with cdkl5 mutations, amenduni. demonstrated that female cdkl5 mutated ipscs maintain xci and clones express either the mutant cdkl5 allele or the wild - type allele that serve as an ideal experimental control. furthermore, these ipscs can be differentiated into neurons and are suitable to model the pathogenesis of cdkl5 related disorders. fragile x syndrome (fxs) is the most common inherited form mental impairment that is caused by an expanded cgg trinucleotide repeat in the 5 untranslated region of the fragile x mental retardation (fmr1) gene leading to gene silencing and loss of the fragile x mental retardation protein (fmrp) [5155 ]. in twenty years since the identification of the fmr1 gene, numerous efforts have focused on understanding the consequences of loss of fmrp on neuronal development and function [5154, 5664 ]. the advent of ipscs provides an option to study fxs in human models and allows investigations into aspects of fxs that are difficult to study in animal models. human embryonic stem cell lines derived from embryos diagnosed with a full mutation showed that fmr1 is unmethylated when expressed in these cells, and fmr1 gene silencing occurs only upon differentiation of embryonic stem cells [65, 66 ]. in contrast, for ipscs generated from the fibroblasts of fxs patients, fmr1 remains methylated and transcriptionally silenced with the reprogramming process failing to reverse the methylation state of fmr1. it seems that the current fxs ipscs may not be suitable to model the effects of fmr1 silencing during neuronal differentiation. a subsequent study further characterized the differentiation of fxs ipscs into postmitotic neurons and glia. in this study, the authors found that clones from reprogrammed fxs patient fibroblast lines exhibit variation with respect to the predominant cgg repeat length in the fmr1 gene. in two cases, ipsc clones contained predominant cgg repeat lengths that were shorter than the corresponding input population of fibroblasts. in another case, reprogramming a mosaic patient having both normal and premutation length cgg repeats resulted in genetically matched ipsc clonal lines differing in fmr1 promoter cpg methylation and fmrp expression. using this panel of patient - specific fxs ipsc models, the authors demonstrated that aberrant neuronal differentiation from fxs ipscs is correlated with the epigenetic modification of the fmr1 gene and a loss of fmrp expression. these findings provide evidence for roles of fmrp in early neurodevelopment prior to synaptogenesis and show potential for modeling fxs with ipsc technology. down syndrome (ds) is neurodevelopmental disorder caused by trisomy of chromosome 21 [6872 ]. considering that mice do not have chromosome 21 however, human neural progenitor cell (npc) lines have been generated to model ds, and the ipsc models provide scientists with an additional approach to study underlying mechanisms. adults with ds develop early - 's disease (ad), probably due to increased expression of a gene on chromosome 21 that encodes the amyloid precursor protein (app) [7577 ]. a recent study found that cortical neurons generated from ipscs of ds patients could develop ad pathologies over months in culture, rather than years in vivo. these cortical neurons processed app resulting in secretion of the pathogenic peptide amyloid 42, which formed insoluble amyloid aggregates. additionally, hyperphosphorylated tau protein, a pathological marker for ad, was found to be localized to cell bodies and dendrites of ad ipsc derived cortical neurons, which mimics the phenotypes of later stages of ad. the generation of ipsc lines to investigate other similar defects, such as the trisomy of other chromosomes may be rewarding. angelman syndrome (as) is a neurodevelopmental disorder associated with genomic imprinting which results from a loss of function of the ubiquitin protein ligase e3a (ube3a) gene [7982 ]. although ipscs present an invaluable approach to modeling human disease, their usefulness could be limited in as if the genomic imprinting marks are disturbed by the nuclear reprogramming of somatic cells to pluripotent stem cells. however, chamberlain. found that genomic imprinting was retained in as ipscs following nuclear reprogramming. the imprinting of ube3a could be established during neuronal differentiation of as ipscs like normal brain tissue. in this case the paternal ube3a allele was repressed in parallel to upregulation of the ube3a antisense transcript. in addition, electrophysiological recordings detected ampa - receptor - mediated spontaneous activity in mature neurons derived from as ipscs, indicating that functional neurons can be generated from as ipscs. the ipsc models will be further utilized to investigate the events related to as, such as the developmental timing and mechanism of ube3a repression in human neurons. prader - willi syndrome (pws) is a neurological genomic imprinting disorder, characterized by the lack of gene expression in the paternal chromosome region 15q11-q13, while the same region in the maternal chromosome is repressed by means of dna methylation [8486 ].. found that the pws ipsc lines show no disrupted methylation patterns in the prader - willi syndrome imprinting center this study indicated that similar to as, genomic imprinting of pws can be refractory to the epigenetic erasure produced during reprogramming. another study by yang. further confirmed that pws ipscs retain a high level of dna methylation in the imprinting center of the maternal allele and show concomitant reduced expression of the disease - associated small nucleolar rna hbii-85/snord116. moreover, these ipscs could readily differentiate into tissues of the three germ layers, including neurons. timothy syndrome (ts) is a neurodevelopmental disorder caused by a missense mutation in the l - type calcium channel cav1.2 that is associated with developmental delay and autism [8890 ]. the authors found that the cells from these individuals have defects in calcium ca signaling and activity - dependent gene expression. the cells also showed abnormalities in differentiation, including decreased expression of the genes that are expressed in lower cortical layers and in callosal projection neurons. moreover, neurons derived from individuals with ts show abnormal expression of tyrosine hydroxylase and an increase in production of norepinephrine and dopamine. these biochemical changes were reversed by treatment with roscovitine, a cyclin - dependent kinase inhibitor and an atypical l - type - channel blocker. this study provided evidence that l - type calcium channel cav1.2 is involved in the regulation of cortical neuronal differentiation in humans and offers new insights into the pathogenesis of autism in patients with ts. genetic neurodegenerative disorders include a variety of diseases that involve the chronic and progressive loss of neuronal structure and function. to date, ipscs have been generated from patients of many neurodegenerative disorders, including spinal muscle atrophy, familial dysautonomia, amyotrophic lateral sclerosis, huntington 's disease, friedreich ataxia, machado - joseph disease, x - linked adrenoleukodystrophy, alzheimer 's disease, and parkinson 's disease (table 2). we will comment on the current ipsc technology for these disorders in the following section and illustrate how these cell lines are helping to unravel the mechanisms of neurodegeneration. spinal muscular atrophy (sma) is an autosomal recessive genetic disorder caused by mutations in the survival motor neuron 1 gene (smn1) that significantly reduces smn protein expression and leads to the selective degeneration of lower -motor neurons [9295 ]. although patient fibroblasts have been widely used to study sma, motor neurons provide a better model to study the anatomy and physiology in the inherent pathology. sma was the first neurodegenerative disease to be modeled by human ipscs. to model sma, ebert. generated ipscs from a child with a mutation in smn1 and from his unaffected mother. they found that ipscs retained the capacity to generate differentiated neural tissue and motor neurons. however, the lack of smn1 expression and the disease phenotype of selective motor neuron death were maintained. interestingly, two compounds, valproic acid and tobramycin, which have been known to increase smn levels, could partially restore the reduction in the smn protein. recently, chang. reported the establishment of five ipsc lines from the fibroblasts of an sma patient. the authors found that neuronal cultures derived from these sma ipsc lines exhibited a reduced capacity to form motor neurons and showed abnormal neurite outgrowth in culture. ectopic smn expression in these ipsc lines restored normal motor neuron differentiation and rescued the phenotype of delayed neurite outgrowth. these findings indicate that the observed abnormalities are indeed caused by the smn deficiency and not by phenotypic diversity among ipsc lines. taken together, these studies show that human ipscs are useful to model the specific neuronal pathology of sma and human ipscs represent a promising resource to screen new drug compounds and develop new therapies for sma. familial dysautonomia (fd) is a rare but fatal peripheral neuropathy, caused by a point mutation in the ikbkap gene involved in transcriptional elongation [99101 ]. the specificity to the peripheral nervous system and the mechanism of neuron loss in fd are poorly understood owing to the lack of an appropriate model system [99, 102 ]. reported the derivation of patient specific fd ipscs and the directed differentiation into cells of all three germ layers including peripheral neurons. gene expression analysis in purified fd ipsc derived lineages demonstrated tissue - specific missplicing of ikbkap in vitro. patient - specific neural crest precursors expressed particularly low levels of the normal ikbkap transcript, suggesting a mechanism for disease specificity. fd pathogenesis has been further characterized by transcriptome analysis, and cell - based assays reveal marked defects in neuronal differentiation and migration behaviour. furthermore, fd ipscs were used for validating the potency of candidate drugs in reversing aberrant splicing and ameliorating neuronal differentiation and migration. this study, while limited, has laid the groundwork to use reprogramming technology for modeling fd. amyotrophic lateral sclerosis (als) is mainly characterized by muscular atrophy and weakness that accompanies a fast and progressive degeneration of motor neurons in the brain and spinal cord [104109 ]. the majority of als cases are sporadic (sals) and approximately 10% of cases are inherited (familial ; fals). more than 10 different genes have been implicated in als, including superoxide dismutase 1 (sod1, als1), transactive response dna - binding protein-43 (tdp-43, als10), fused sarcoma (fus, als6), and vamp - associated protein b / c (vapb, als8) [107111 ]. clinical trials based on als animal models have been disappointing, indicating a need for the exploration of new als models [104, 105, 112 ]. to date, three groups have successfully generated ipscs from three different familial forms of als with previously identified mutations. they found that the patient - specific ipscs possess properties of embryonic stem cells and could be directed to differentiate into motor neurons. however, no assay of als related phenotypes was completed for the ipscs derived motor neurons in this study. mitne - neto. generated ipsc lines from patients with mutations in the vapb gene as well as from noncarrier siblings (controls). they showed a significant reduction in the levels of vapb protein in als8 ipsc derived motor neurons, suggesting that the reduction in vapb could be involved in the pathogenesis of als8. they further demonstrated that the level of vapb protein gradually increased during the differentiation of control ipscs but not als8 ipscs, suggesting that the als8 mutation causes a failure of vapb protein upregulation during the induction of motor neurons. this regulation of vapb is likely to happen at the posttranslational level since there is no difference in the mrna levels during the differentiation between control and als8 ipscs. these findings may be relevant to other forms of als, as the reduction in vapb protein has been documented in motor neurons from sporadic als patients [115, 116 ]. the ipscs that carry the tdp-43 mutation could differentiate into neurons and functional motor neurons. the mutant neurons showed the cellular phenotypes of als and other tdp-43 proteinopathies, including elevated soluble and detergent - resistant tdp-43 protein levels, decreased survival, and increased vulnerability to blockade of the phosphoinositide-3-kinase (pi3k) pathway. since other cells, such as astrocytes and microglia that associate with the motor neuron niche, have been shown to play a role in the pathology of als [118120 ], it will be interesting to see if the ipsc derived astrocytes or microglia can also recapitulate the nonneuronal aspects of the disease. huntington 's disease (hd) is an autosomal dominant neurodegenerative disorder caused by an excessive expansion of a cag trinucleotide repeat in the gene encoding the protein huntingtin, producing an elongated stretch of glutamines near the n - terminus of the protein [121124 ]. the expanded repeat region causes a gain of function in the huntingtin protein, which then forms aggregates within the nucleus of certain neuronal cells [121, 122 ]. many tissue culture models for huntington 's disease have been generated by a wide range of techniques. modeling systems include nonneural human cell types (fibroblasts and lymphoblasts), immortalised or primary neurons from mice, and mouse and human es cells [125127 ]. these models can recapitulate many of the phenotypes seen in patients with hd. at this time, ipscs have been generated from patients with hd [74, 128 ], transgenic hd monkeys, and mouse models [12, 129 ]. the hd ipscs derived striatal neurons, and neuronal precursors contain the same cag expansion as the mutation in the hd patient from whom the ipsc line was established. moreover, the hd neural stem cells showed enhanced caspase activity upon growth factor deprivation, which is indicative of apoptosis. the hd monkey ipscs develop cellular features comparable to hd, including the accumulation of mutant huntingtin (htt) aggregates and the formation of intranuclear inclusions paralleling neural differentiation in vitro. ipscs from transgenic hd monkeys represent nonhuman primate modeling of human diseases. in the generation of ipscs through somatic reprogramming of fibroblasts from the r6/2 transgenic hd mouse line, cag expansion has no effect on reprogramming efficiency, cell proliferation rate, brain - derived neurotrophic factor levels, or neurogenic potential. in addition, these ipscs do not show an increase in cell death either under self - renewal or differentiated conditions. however, genes that are involved in the alteration of the cholesterol biosynthesis pathway in hd are also affected in hd ipsc lines. furthermore, one lysosomal gene is upregulated and the lysosome number is increased in hd ipsc lines. one recent study further demonstrated that hd patient specific ipscs were able to generate phenotypically normal, functional neurons in vitro and could survive and differentiate into neurons in the adult mouse brain after transplantation. however, astrocytes derived from these hd ipscs showed a vacuolation phenotype, a phenomenon found in primary lymphocytes from hd patients. these findings suggest that ipscs from hd animals or patients can replicate some, but not all, of the phenotypes typically observed in the disease. in the future, modeling of other phenotypes, including the pathological changes only seen in the autopsy of patients and the electrophysiological changes seen in animal models may, become possible. friedreich ataxia (frda) is an autosomal recessive disorder characterised by neurodegeneration and cardiomyopathy [131134 ]. it is caused by a trinucleotide (gaa) repeat expansion in the first intron of the fxn gene that results in reduced synthesis of fxn mrna and its protein product, frataxin [135, 136 ]. the gaa repeats in fxn in ipscs exhibit instability similar to the patient families, where they expand and/or contract with discrete changes in length between generations. the mismatch repair enzyme msh2, which is implicated in repeat instability in other triplet repeat diseases, is highly expressed in ipscs and occupies the fxn intron 1. liu. reported the generation of ipsc lines derived from skin fibroblasts from frda patients. the authors found that the patient - derived ipsc lines maintain the gaa repeat expansion and the reduced fxn mrna expression patterns that are characteristic of the patient. interestingly, the instability of the gaa repeat length was also found within these frda ipsc lines. they further demonstrated that following in vitro differentiation, the ipscs can produce the two cell types primarily affected in frda, namely peripheral neurons and cardiomyocytes. thus, these frda ipsc lines have the potentials to provide powerful tools to study the cellular pathology of frda. machado - joseph disease (mjd), also known as spinocerebellar ataxia type 3, is a dominantly inherited late - onset neurodegenerative disorder caused by expansion of polyglutamine (polyq)-encoding cag repeats in the mjd1 (atxn3) gene [139142 ]. proteolytic liberation of highly aggregation - prone polyq fragments from the protective sequence of the mjd1 gene product ataxin 3 (atxn3) may trigger the formation of atxn3-containing aggregates, the pathological hallmark of mjd [140, 141 ]. the levels of atxn3 fragments in brain tissues of mjd patients increases with disease severity, supporting a relationship between atxn3 processing and disease progression. the formation of early aggregation intermediates is believed to be critical for disease initiation, but the precise molecular mechanism in mjd is unknown [140, 141 ]. to investigate this, koch. the authors found that l - glutamate induced excitation of patient specific ipsc derived neurons initiated ca - dependent proteolysis of atxn3, followed by the formation of sodium dodecyl sulphate (sds)-insoluble aggregates. this phenotype could be abolished by calpain inhibition, indicating a key role of calpain in atxn3 aggregation. they further demonstrated that aggregate formation depended on functional na and k channels as well as ionotropic and voltage - gated ca channels. however, these channel effects were not observed in ipscs, fibroblasts, or glia and hence may explain the neuron - specific phenotype of mjd. this study demonstrates the usefulness of ipscs to investigate the aberrant protein processing associated with late - onset neurodegenerative disorders in patient - specific neurons. x - linked adrenoleukodystrophy (x - ald) is caused by mutations in the abcd1 (adenosine triphosphate (atp)-binding - cassette transporter superfamily d member 1) gene encoding a peroxisomal atp - binding cassette (abc) transporter, abcd1, which is responsible for entry of long chain fatty acids (vlcfas ; c26:0 and c24:0) into peroxisomes for degradation [144147 ]. with abnormally high vlcfa levels, primary manifestations occur in the nervous system, the adrenal cortex, and the leydig cells of the testis [144, 145 ]. x - ald, with an incidence of 1 in 20,000 males, shows a wide range of phenotypic variability which does not directly correlate with abcd1 gene mutations [146150 ]. due to the lack of an appropriate animal model system and the inaccessibility of human oligodendrocytes in vivo [147, 151 ], ipscs may provide a unique cellular model for studying the pathology of x - ald. generated ipscs from patients with the 2 major types of x - ald, namely, childhood cerebral ald (ccald) and adrenomyeloneuropathy (amn). they found that both ccald and amn ipscs normally differentiated into oligodendrocytes, the cell type primarily affected in the x - ald brain, indicating no developmental defect due to the abcd1 mutations. although low in x - ald ipscs, long chain fatty acid (vlcfa) levels were significantly increased after oligodendrocyte differentiation. vlcfa accumulation was much higher in ccald oligodendrocytes when compared to amn oligodendrocytes, whereas no significant difference between ccald and amn neurons was reported, indicating that the severe clinical manifestations in ccald might be associated with abnormal vlcfa accumulation in oligodendrocytes. they further showed that the abnormal accumulation of vlcfa in the x - ald oligodendrocytes can be reduced by upregulating abcd2 gene expression after treatment with lovastatin or 4-phenylbutyrate. therefore, the x - ald ipsc model recapitulates the key events of the disease process and provides a new way to understand and diagnose x - ald disease subtypes. ad is the most common age - related dementia, characterized by progressive memory loss and cognitive disturbances [153157 ]. mutations of presenilin 1 (ps1) and presenilin 2 (ps2) are causative factors for autosomal - dominant, early - onset familial ad (fad) [158161 ]. generated ipscs from fibroblasts of fad patients with mutations in ps1 (a246e) and ps2 (n141i) and characterized the differentiation of these cells into neurons. they found that fad ipsc derived differentiated neurons have increased amyloid 42 secretion, recapitulating the molecular pathogenesis of mutant presenilins. amyloid 42 secretion from the neurons sharply responded to -secretase inhibitors and modulators, indicating the potential for the identification and validation of candidate drugs. this study demonstrates that the fad ipsc derived neurons could be an effective model of ad and provides an innovative strategy for the study of age - related neurodegenerative diseases. more recently, israel. reprogrammed fibroblasts from patients with fad caused by a duplication of the app gene (termed app (dp)) into ipsc lines. compared to controls, ipsc - derived purified neurons from the app (dp) patients exhibited significantly higher levels of the pathological markers amyloid 40, phospho - tau (thr 231) and active glycogen synthase kinase-3 (agsk-3), but all cells exhibited normal electrophysiological activity. neurons from app (dp) also accumulated large rab5-positive early endosomes compared to controls. treatment of purified neurons with -secretase inhibitors, but not -secretase inhibitors, reduced the phospho - tau (thr 231,) and agsk-3 levels. these results suggest a direct role of app proteolytic processing, but not amyloid, in gsk-3 activation and tau phosphorylation in human neurons. more recently, koch. demonstrated that neurons derived from ipscs with the ps1 (l166p) mutation showed a partial loss of -secretase function, which results in the decreased production of amyloid 40 and an increased amyloid 42/40 ratio. these neurons are also resistant to -secretase modulation by nonsteroidal anti - inflammatory drugs (nsaids). the patient - specific ipscs thus provide a human neuronal system to study ad pathogenesis and to screen compounds for the pharmaceutical treatment of ad. it is due to the progressive degeneration of the dopaminergic (da) neurons in the substantia nigra and is accompanied by the appearance of intraneuronal inclusions enriched in alpha - synuclein called lewy bodies [165, 166 ]. it is becoming increasingly clear that genetic factors contribute to the complex pathogenesis of pd. genes including park2, snca, parkin, pink1, dj-1, uchl1, lrrk2, park7, gba, sncaip, and atp13a2 have been found to be directly associated with parkinson 's disease [166169 ]. the ipscs have been successfully generated from pd patients with mutations in some of these genes [170175 ]. nguyen. generated ipscs that carry the mutation in the leucine - rich repeat kinase-2 (lrrk2) gene and differentiated the cells into da neurons. the high penetrance of the lrrk2 mutation and its clinical resemblance to sporadic pd was observed in this process, suggesting that ipscs could serve as a platform for studying pd. the authors found that the expression of key oxidative stress - response genes and the -synuclein protein was increased in the da neurons derived from pd ipscs. the mutant da neurons were also more sensitive to caspase-3 activation and cell death when exposed to stress agents. this enhanced stress sensitivity is consistent with early phenotypes of pd and may become a potential therapeutic target for this disorder. reported that da neurons differentiated from pd ipscs with the lrrk2 mutation showed morphological alterations, such as reduced numbers of neurites and neurite arborization, as well as accumulation of autophagic vacuoles. these morphological alterations could be greatly exacerbated by further induction of autophagy and/or inhibition of lysosomal proteolysis, indicating autophagic compromise in da neurons from pd ipscs, which occurs at the level of autophagosome clearance. seibler. reported the generation of ipscs from skin fibroblasts of pd patients with nonsense or missense mutations in the pten - induced putative kinase 1 (pink1) gene. when differentiated into da neurons and processed for mitochondrial depolarization, the cells showed impaired recruitment of lentivirally expressed parkin to the mitochondria, increased mitochondrial copy number, and upregulation of peroxisome proliferator- (ppar) coactivator-1 (pgc-1), an important regulator of mitochondrial biogenesis. importantly, these alterations were corrected by the lentiviral expression of wild - type pink1 in mutant ipsc derived pink1 neurons. this study indicates that fibroblasts from genetic pd can be reprogrammed and differentiated into da neurons. these ipsc derived neurons exhibit distinct phenotypes that should be amenable to further studies of molecular and cellular mechanisms of pd. triplication of snca, encoding -synuclein, causes a fully penetrant, aggressive form of pd with dementia. the -synuclein dysfunction is the critical pathogenic event in parkinson 's disease that leads to multiple system atrophy and dementia with lewy bodies [167, 169 ]. devine. produced multiple ipsc lines from a snca triplication patient and from an unaffected first - degree relative. they found that da neurons differentiated from the ipscs of the patient produced double the amount of -synuclein protein in comparison to the neurons from the unaffected relative, thus precisely recapitulating the primary cause of pd in these individuals. this model represents an exceptional experimental system to screen compounds that reduce the levels of -synuclein and to investigate the cellular mechanisms of neurodegeneration caused by -synuclein dysfunction. the lack of a phenotype in parkin knockout mice suggests that the human neuronal system is needed to model the disease. jiang. demonstrated that in da neurons from ipscs of pd patients with parkin mutations, the transcription of monoamine oxidases and oxidative stress are greatly increased, da uptake is reduced, and spontaneous da release is increased. lentiviral expression of parkin, but not the pd related mutant, rescues these phenotypes, suggesting that parkin controls dopamine utilization in da neurons by modulating da neurotransmission and suppressing dopamine oxidation. one obvious limitation in the application of ipsc technology is the inability to perform experiments under genetically defined conditions. this is especially crucial to late age onset disorders in which the in vitro phenotypes are usually subtle and susceptible to effects of genetic background variations. to solve this problem, soldner. they generated sets of isogenic disease and control human pluripotent stem cells that differ exclusively at either of two susceptibility variants for pd by modifying the point mutations in the -synuclein gene. this approach to genetically correct disease - causing point mutations in patient derived ipscs represents significant progress in basic biomedical research and an advance for ipsc technology. although ipscs are promising for modeling neurogenetic disorders, there are still limitations. in most cases of neurogenetic disorders, we need to determine whether typical traits of neurogenetic disorders can be observed in the context of the ipsc models. at the molecular level, such as disorder associated protein expression or global gene expression levels, it is likely that patient ipsc derived neuronal cultures will recapitulate phenotypes of the disorders. but for late - onset neurodegenerative diseases, the patient ipsc derived neurons may not be able to show typical patient brain pathology, such as lewy bodies in pd [5, 19, 176, 177 ]. on the other hand, it is also very important to reproduce or validate data derived from patient - specific ipsc lines, given the substantial phenotypic diversity of these cell lines and the genetic heterogeneity of the patients. notably, suppression of patient ipsc culture associated phenotypes by repair of the relative genetic defects could further validate these models. despite all these concerns, previous studies have already provided strong evidence for ipsc technology as a powerful approach to model neurogenetic disease [5, 19, 176, 177 ]. ipsc technology provides a platform for the discovery of novel bioactive compounds through molecular dissection of the pathological process. the inspiring examples to demonstrate the potential of ipscs in screening drug candidates arise from the above mentioned studies in modeling neurogenetic disorders, such as rtt, ts, sma [96, 97 ], fd [102, 103 ], mjd, x - ald, ad [162, 163 ], and pd [170172 ]. currently, ipscs have been shown to be valuable for testing small numbers of compounds for efficacy and toxicity in a specific patient or population of patients. it is clear that ipsc technology can be a useful approach for determining which drugs or drug combinations are effective in humans or in specific patients [5, 16, 19, 102 ]. to make this technology more powerful, it is essential and crucial to validate the molecular and cellular phenotypes identified in ipsc derived neurons or glial cells. high - throughput drug screening and development requires uniform populations of neurons or glial cells. with the development of ipsc technology, ipsc derived neurons or glial cells the generation of ipscs from patients with neurogenetic disorders permits the production of large numbers of cns cells with the patients ' exact genotype. ipscs provide autologous cell sources for cell replacement / neuroprotection strategies in patients with neurodegenerative diseases. promising results have been reported with rodent and human ipsc derived neurons such as the improvement of the behavioural symptoms in the rat model of pd [178, 179 ]. in addition to the transplantation of specific neurons from ipscs for replacement therapy, transplantation of glial cells from ipscs can also be used for neuroprotection. in patients with spinal motor neuron diseases, the problem of replacing motor neurons seems daunting, considering that these cells must extend and correctly innervate specific cns areas. transplanting cells as therapeutic support cells, rather than as replacement neurons, is an additional and potentially alternative mode of cell therapy for motor neuron diseases [5, 176 ]. the ipsc technology has largely circumvented political and ethical hurdles previously associated with human embryonic stem cell research. however, several major challenges must be overcome before cell therapy using ipsc technology can be applied clinically. first, among many other safety issues, the risk of cancer must be resolved. ipsc derived neurons and glial cells will not be suitable for transplantation until the oncogenic genes and retroviruses used are replaced with more controlled cell reprogramming [19, 176 ]. new strategies to reprogram cells in the absence of integrating viral vectors have been reported [181183 ] in addition to more efficient integrative approaches [184, 185 ]. second, differentiating ipscs to the specific type(s) of required cns cells or devising accurate methods to purify the desired cells are key priorities. building on the progresses that have already been made using stem cells, researchers should continue to improve the understanding of directed differentiation and to develop new protocols. these protocols will bring ipsc technology one step closer to patient - matched cells or tissues for clinical transplantation. third, it should be necessary to understand and correct any genetic defects in the patient 's neurons and glial cells before they can be rationally used for cell therapy. a major concern here is that ipsc derived therapeutics may recapitulate the patient 's disease process, due to their genetic propensity. in the context of single - gene disorders, such changes may theoretically be genetically repaired in vitro prior to transplantation. for neurodegenerative disorders, such as pd, the relatively brief lifetime of the reprogrammed cells may sufficiently delay an intrinsic pathogenic program. however, cell extrinsic factors in the host patient cns environment may promote pathogenesis in therapeutic transplanted cells. if the goal is to actually repair the neural circuit, then the most significant hurdle will be the regrowth of projections to the proper target structure in a manner that respects the organization of the neural network. the mechanical barrier caused by disease or injury related gliosis may also affect the restoration of damaged neuronal networks in the adult cns. these represent some, but certainly not the only pressing issues that must be overcome before cell therapy can be translated in efficacious ways to the clinic. despite all these potential challenges, ipsc technology, although nascent, represents a remarkable progress toward cell therapy for neurological disorders. given all the limitations and disadvantages discussed above, we must realize that ipsc derived modeling systems are only one tool in the array of approaches needed to understand and treat human neurogenetic disorders. in consideration of ipsc models for the advancement of therapy for these disorders a full understanding will require the balancing and integration of information at multiple levels [177, 187 ]. the data derived from primary cns cells, human ipsc, or other stem cell derived cns cells, transgenic animal models, and human studies must be integrated into the broader landscape. in this landscape, each level of information will be able to inform the other to enhance our understanding as we move forward. the ipscs fill a critical gap in our experimental approaches by providing live, functioning human cns cells with the genetic backgrounds of patients. they provide an essential link between animal model studies and the assessment of human postmortem brain tissue and live brain functioning. studies of human cns cells derived from the ipscs of patients will give us valuable insights into the mechanisms of pathogenesis and future ipsc research will facilitate drug discovery, cell therapy, and new modes of diagnosis for neurogenetic disorders [3, 19, 177 ]. | remarkable advances in cellular reprogramming have made it possible to generate pluripotent stem cells from somatic cells, such as fibroblasts obtained from human skin biopsies. as a result, human diseases can now be investigated in relevant cell populations derived from induced pluripotent stem cells (ipscs) of patients. the rapid growth of ipsc technology has turned these cells into multipurpose basic and clinical research tools. in this paper, we highlight the roles of ipsc technology that are helping us to understand and potentially treat neurological diseases. recent studies using ipscs to model various neurogenetic disorders are summarized, and we discuss the therapeutic implications of ipscs, including drug screening and cell therapy for neurogenetic disorders. although ipscs have been used in animal models with promising results to treat neurogenetic disorders, there are still many issues associated with reprogramming that must be addressed before ipsc technology can be fully exploited with translation to the clinic. |
demineralization or white spot lesion (wsl) development in the enamel in association with orthodontic treatment with fixed appliances remains a well - known clinical problem for dental specialists. various methods how to prevent its formation are discussed in the literature, but still it is not determined which one is the most effective. wsls can become visible around fixed appliances within one month of bracket placement, although the formation of regular caries usually takes at least 6 months (figure 1). individuals with malocclusion usually have difficulty in performing proper oral hygiene because of many retention sites. in addition, bonding attachments to teeth make conventional oral hygiene more difficult, and can prolong plaque accumulation on tooth surfaces. wsls mainly appear on buccal surfaces of the maxillary teeth in the following order : lateral incisors, canines, premolars, and central incisors. according to the literature the prevalence of wsls after orthodontic treatment is about 50% and its prevention is the purpose of every orthodontist [7 - 12 ].. primary prevention of wsls can be done adjacent to fixed appliances and secondary prevention (treatment) is done when the braces are removed. wsls can be very difficult or sometimes even impossible to improve when fixed appliances are removed, and complete resolution of the lesions can rarely be achieved, it influences aesthetics and the patients satisfaction with their smile. moreover, untreated wsls can lead to the formation of dental caries and restorative treatment. saliva can re - mineralize wsls to some degree, although this process is faster during the first few months, and later it becomes slower. thus an early prevention of the wsls is one of the goals of modern orthodontic treatment. natural remineralization through saliva involving mineral gain in the surface layer of wsls has little improvement on the aesthetics and structural properties in the deeper lesions. therefore, it is necessary to apply remineralizing agents to repair the deeper parts of wsls for better aesthetic results. the use of various fluoride and casein phosphopeptide - amorphous calcium phosphate (cpp - acp) derivatives, such as high - fluoride toothpaste, varnish, mouth rinse, gel or topical cream used for remineralization was reported in literature [18 - 23 ]. in his study willmot concluded that cpp - acp was capable of absorbing through the enamel surface and could influence the carious process. cpp - acp is a delivering system that allows freely available calcium and phosphate ions to attach to enamel and reform into calcium phosphate crystals. in the clinical studies it was found that various methods are used for prevention of wsls, but discussion which is the most effective method of the prevention is still proceeding. the aim of the systematic literature review is to update the evidence for the prevention of wsls, using materials containing fluoride and/or casein phosphopeptide - amorphous calcium phosphate during and after treatment with fixed orthodontic appliances. protocol and registration this systematic review was conducted following the prisma (preferred reporting items for systematic reviews and meta - analyses) statement. evaluating the results of scientific researches hypothesis arises if it is possible to prevent development of wsls using materials containing fluoride and/or casein phosphopeptide - amorphous calcium phosphate during and after treatment with fixed orthodontic appliances. the following focus question was developed according to the population, intervention, comparison, and outcome (picos) study design (table 1). the review included all human prospective and retrospective follow - up studies and clinical trials, cohort studies, case - control studies, and case series studies published between january 2008 and february 2016, on development and prevention of wsls, using materials containing fluoride and/or cpp - acp during and after treatment with fixed orthodontic appliances. the literature search was performed in pubmed (national library of medicine, ncbi), embase, sciencedirect and cochrane databases. the references of each relevant study were screened to discover additional relevant publications and to improve the sensitivity of the search. the search was conducted using the following keywords : (casein phosphopeptide - amorphous calcium phosphate nanocomplex or calcium phosphate or casein phosphopeptide - amorphous or cpp - acp or casein phosphopeptide amorphous calcium phosphate) and (orthodontic brackets or fixed appliances or dental debonding or bonding) and (fluoride or fluoride varnish or fluoride rinse or fluoride toothpaste) and (orthodontics or orthodontic treatment or orthodontic treatment complications) and (white spot lesion or dental caries or demineralization or decalcification or enamel defects). the choice of keywords was intended to be broad, in order to collect as much relevant data as possible without relying on electronic means alone to refine the search results. the resulting articles were independently subjected to clear inclusion and exclusion criteria by two reviewers as follows. reviewers compared decisions and resolved differences through discussion, consulting a third party when consensus could not be reached. inclusion and exclusion criteria inclusion criteria for studies were : patients of any age undergoing orthodontic treatment with fixed appliances ; preventive treatment of wsls with fluoride - containing product and/or casein derivatives. exclusion criteria for studies were : subjects underwent any non - remineralizing therapy (bleaching or restoration) during trial. sequential search strategy following the initial literature search, all article titles were screened to eliminate irrelevant publications, review articles, case reports, and animal studies. next, studies were excluded based on data obtained from screening the abstracts. the final stage of screening involved reading the full texts to confirm each study s eligibility, based on the inclusion and exclusion criteria. the data were independently extracted from studies in the form of variables, according to the aims and themes of the present review, as listed onwards. data were collected from the included articles and arranged in the following fields : participants, examination methods, preventive treatment methods, study design, main findings. assessment of methodological quality the risk of bias assessment of the included trials was undertaken independently and in duplicate by at least two review authors as part of the data extraction process. this was conducted using the recommended approach for assessing risk of bias in studies included in cochrane reviews. relevant data of interest on the previously stated variables were collected and organised into table. the initial search identified a total of 326 references. following the screening of the article titles, independent screening of the abstracts resulted in the selection of 42 publications for possible inclusion. finally, 12 articles that met the predefined criteria were included in the systematic review (figure 2). prisma flow diagram illustrating the literature search protocol. the reasons for excluding studies after full - text assessment were as follows : non - human studies (n = 1), in vitro studies (n = 6), trials with patients who underwent any non - remineralizing therapy (bleaching or restoration) during trial (n = 1), case reports and review studies (n = 9), could not be excluded before careful reading (n = 13). the quality assessment of the included studies revealed an unknown risk of bias (for one or more key domains) for the majority of the included studies [5,8,19,20,27 - 34 ], one study was classified as low risk (of bias for all key domains) (table 2). study characteristics the included studies were compared regarding to the number of the participants, examination methods, preventive treatment methods, study design, main findings. the mentioned 12 articles were published between january 2008 and february 2016, two studies were performed exclusively on topical fluoride, two studies were performed on high - fluoride toothpaste, four studies were performed on casein derivate, there were one mixed study (fluoride vs. casein vs. oral hygiene) and one mixed study (fluoride vs. casein vs. microabrasion), also oral hygiene study and study performed on fluoridated chewing sticks (miswaks). no meta - analysis could be performed due to the heterogeneity in the study designs and treatment modalities. influence of materials containing fluoride and/or cpp - acp on wsls multiple preventive agents had been tested over years to evaluate their effectiveness in prevention and treatment of wsls associated with orthodontic treatment with fixed appliances. materials containing fluoride and/or casein phosphopeptide - amorphous calcium phosphate have been proven to be the most effective in fighting demineralization. number of patients, examination methods, preventive treatment methods, study design, main findings (statistically significant) were used to determine which material is more effective in treatment and prevention of wsls (table 3). clinical studies evaluating the effectiveness of fluoride and casein supplements use in vivo four clinical studies reported no better effect of products containing fluoride (fluoride varnish, fluoride toothpaste) on wsls than normal home care for improving the appearance of wsls. 4 of 12 studies showed significantly better results in wsls appearance when using materials containing fluoride. the use of cpp - acp was reported to be more beneficial than fluoride rinse for postorthodontic remineralization. four clinical studies reported topical treatment with a cpp - acp agent to significantly reduce are of wsls and help in prevention of the development of wsls. two of 12 studies found no clinical advantage for use of the topical treatment with a cpp - acp agent in improvement of the appearance of wsls. however, 9 of 12 studies proved treatment using materials containing fluoride and/or cpp - acp to be beneficial for managing and preventing wsls. prevention of demineralization during orthodontic treatment is one of the greatest challenges faced by clinicians despite modern advances in caries prevention. evaluating short duration of time during which wsls can develop and become irreversible, early diagnosis is considerably important, as modern dentistry is focused on a preventive approach instead of invasive restorations of carious defects. the individual oral hygiene status of orthodontic patients must be accurately followed especially in the first months of orthodontic treatment, in order to prevent wsls development and its complications. the modern methods for the evaluation of wsls are the following : the optical caries monitor, quantitative laser and light - induced fluorescence (qlf), digital imaging with fiber - optic transillumination, and computer analysis of digital photographs. the well - accepted and most popular methods for wsls evaluation are digital intraoral photography and qlf. most relevant articles from the literature review used proportional rather than absolute measurements of luminance or size. other studies used a combined scoring system based on the surface area and the severity of the opacity. a number of scientific studies were performed over the last eight years in order to evaluate the effectiveness of the various remineralization methods, but data of these clinical researches were controversial. in some clinical studies, it was found that high - concentration fluoride varnish is significantly effective in reducing wsls. results of the experimental study, evaluating the effect of fluoride varnish, showed that high - concentration fluoride varnish reduces 40% of wsls during orthodontic treatment. controlled clinical trial stated that fluoride varnish was effective during the first three months after bonding and six months after debonding. in the other study the effectiveness of fluoridated chewing sticks in reducing wsls in post - orthodontic patients some scientist reported that the usage of highly fluoridated tooth paste and fluoride varnish during orthodontic treatment are significantly beneficial as a preventive material in the reducing wsls around braces. while huang. and bailey. discussed warnings against the use of high concentrations of fluoride because the superficial layer might prevent calcium and phosphate from penetrating to the deeper layers of the enamel, thus inhibiting deeper remineralization and limiting the cosmetic improvement of the wsls. richter. concluded that fluoride varnish or fluoride mouth rinse was not effective, no significant association between the decrease in number of new lesions and application of materials containing fluoride was found. contradictory results were reported in some clinical studies, no significant difference between the use of fluoride varnish, mi paste or the usual oral hygiene using 1100 ppm fluoride toothpaste, a toothbrush, and dental floss was found. in these clinical trials size of the study sample, duration of the fixed orthodontic treatment, period, when preventive remineralization procedures are used, are variable. the heterogeneous methodology was applied in order to evaluate the formation of wsls. therefore it influences the outcomes of the studies and clarifies the contradictory results of the effectiveness of the preventive procedures. in recent scientific researches the use of mi paste during orthodontic treatment was overlooked and its effect in remineralization of wsls was confirmed. although in some studies there was reported no significant usefulness of mi paste or mi paste plus, some improvement in wsls was found. compared the effectiveness of mi paste on wsls after orthodontic treatment with control group and stated that the size of the lesion area has not changed significantly over time or between the groups. the other factor that can influence the reduction of wsls is topical fluoride and cpp - acp applications, which effectiveness was compared in several studies. for the last eight years clinical in vivo studies have been evaluating the effectiveness of fluoride and cpp - acp therapy during and after orthodontic treatment with fixed appliances. some studies proved that high - fluoride derivates significantly reduces wsls after 6 weeks to 6 months, while their opponent failed to demonstrate an additional effect of fluoride varnish compared with normal home care over an 8 week period. the conclusions about the effect of cpp - acp derivates are debatable, bailey. and brchner. claimed that casein supplements are effective after 4 and 12 weeks, the opponents huang. proved in their trials that cpp - acp is as effective as normal oral care over a 8 to 12 weeks period. according to present study, the most important factors for preventing decalcification and formation of wsls were a good oral hygiene regimen and a modifying diet with low carbohydrate intake. other additional methods such as fluoride varnish, rinse, chewing sticks, or cpp - acp supplements did not totally prevent the formation of wsls, but their incidence could be significantly reduced. clinical in vivo studies investigating wsls prevention and treatment are still very rare. some clinical studies were not comparable due to small sample sizes, various inclusion criteria, unreliable statistical analyses that failed to account for clustering effects and use of unproven assessment methods without relating them to more accepted techniques (only visual examination). the lack of high - quality clinical studies makes it difficult to determine whether various agents are effective and which of them are more effective than others. concerns have been raised against the use of highly concentrated fluoride to assist remineralization since it may lead to unsightly staining. though, there were no recent trials available that could either confirm or reject this important question. evaluating the results of the present study, we can claim that the usage of fluoride and casein supplements during and after fixed orthodontic treatment is significantly effective in the reduction of demineralization spots, however the use of cpp - acp can be more beneficial than fluoride rinse for postorthodontic remineralization. it is also important to analyse if there are any other predictors for the degree of wsls improvement - such as time since the removal of the appliances, or the severity of the lesions. further clinical studies evaluating the effectiveness of the methods for preventing and treatment of wsls must be performed in order to get more clinically significant evidence of these measurements and standardized procedures have to be presented. early detection of white spot lesions during orthodontic treatment is of great importance as it would allow implementing preventive measures to control the demineralization process before lesions progress. the systemic review of studies performed over the last years has showed that the usage of fluoride and casein supplements in ameliorating white spot lesions during and after fixed orthodontic treatment is significantly effective in the reduction of demineralization spots. clinical evidence showed that treatment using materials containing fluoride and/or casein phosphopeptide - amorphous calcium phosphate is beneficial for managing and preventing white spot lesions. for higher - risk patients additional measures such as high - concentrated fluoride varnish or casein derivate the use of casein phosphopeptide - amorphous calcium phosphate can be more beneficial than fluoride rinse for postorthodontic remineralization. it is suggested to use casein phosphopeptide - amorphous calcium phosphate tooth mousse twice in addition to high fluoride toothpaste for 6 months to succeed in treating postorthodontic demineralized white spot lesions. future clinical studies need to focus on the preventive measures in reducing the prevalence of white spot lesions. the authors declare that there are no financial or other conflicts of interest related to this publication. | abstractobjectivesthe aim of the systematic literature review is to update the evidence for the prevention of white spot lesions, using materials containing fluoride and/or casein phosphopeptide - amorphous calcium phosphate during and after treatment with fixed orthodontic appliances.material and methodsinformation search for controlled studies on humans published between january 2008 and february 2016 was performed in pubmed, sciencedirect, embase, the cochrane library. inclusion criteria were : the english language, study on humans, patients undergoing orthodontic treatment with fixed appliances, randomized or quasi - randomized controlled clinical studies fluoride - containing product or casein derivates used throughout the appliance therapy or straightaway after debonding.results326 articles were reviewed (embase 141, pubmed 129, sciencedirect 41, cochrane 15). twelve clinical studies fulfilled all inclusion criteria. use of fluoridated toothpaste had a remineralizing effect on white spot lesions (wsls) (p < 0.05) ; fluoride varnish and casein supplements were effective in prevention and early treatment of wsls (p < 0.05).conclusionsearly detection of white spot lesions during orthodontic treatment would allow implementing preventive measures to control the demineralization process before lesions progress. the systemic review has showed that the usage of fluoride and casein supplements in ameliorating white spot lesions during and after fixed orthodontic treatment is significantly effective. however the use of casein phosphopeptide - amorphous calcium phosphate can be more beneficial than fluoride rinse in the reduction of demineralization spots. |
prescribing psychotropic medication in pregnancy is a complex issue involving assessment of the risk of leaving an untreated psychiatric illness with its attendant complications versus the risk of adverse effects on the fetus. olanzapine, one of the 2 generation antipsychotics, is a category c drug and there is no unequivocal evidence of harm to the fetus. here, we report a case of microcephaly with anopthalmos in a patient who was treated with olanzapine for unspecified non - organic psychosis. to the best of our knowledge, ms. a, a 25-year - old married lady presented in the hospital 's walk - in clinic with the symptoms of suspiciousness and hearing voices. she also suffered few episodes suggestive of dissociative spells in which she would call herself goddess kali. there was also occasional history of disinhibition in the form of taking of her clothes in front of her family members. she was diagnosed as having unspecified non - organic psychosis on international classification of diseases, tenth edition. after 1 month of treatment with olanzapine, the patient became pregnant (this was her first pregnancy) and sought consultation for safety of medications during the 2 month of gestation. considering the severity of the symptoms in the past and duration of illness, on mutual discussions, it was decided to continue olanzapine. she was referred to the obstetrics service of the hospital to keep a close watch for any untoward event. she followed - up there regularly as advised by the obstetrician. a discussion with the consulting obstetrician and review of records revealed no major untoward event during pregnancy. antibody titers for herpes simplex, varicella, cytomegalovirus, toxoplasma and rubella were conducted and found to be normal. fasting and postprandial blood glucose levels performed at the time of first consultation and repeated in the 2 and 3 trimesters were found to be in the normal range. on follow - up, the fetus was detected to have microcephaly on ultrasonography. a delivered a female baby weighing 3.4 kg with microcephaly and congenital anopthalmos (bilateral) at full term. the head circumference was 30.5 cm at birth, which falls below the third percentile. no additional causative factors could be elicited despite the above mentioned specialist referrals. however, detailed imaging and genetic investigations could not be done due to cost limitations. the history was corroborated by the patient 's mother as well as husband although this adverse event scored only three on the the naranjo. adverse drug reaction probability scale, the lower scores were due to non - applicability of some questions to this situation. for instance, the issue of improvement on discontinuation of drug or administration of antagonist obviously does not apply to this case. similarly, re - administration and replication of the adverse effect also can not be done in this case for ethical reasons. one study involving pregnancy outcomes in 151 patients on different atypical antipsychotics (60 were on olanzapine) did not find any statistically significant differences in various pregnancy outcomes between the exposed and comparison groups, except the rate of low birth weight, which was 5 times higher in the exposed babies and a higher rate of therapeutic abortions. one case of encephalocoele with cleft lip and aqueductal stenosis was reported in a patient on olanzapine. arora and praharaj reported a case of meningocoele and ankyloblepharon in the child of a patient on olanzapine. reis and klln reported craniosynostosis and ureteral reflux in one, an upper limb reduction defect in a second and a ventricular septal defect and upper gastrointestinal tract malformation in the third infant whose mothers were exposed to olanzapine during pregnancy. another study on 37 prospective and 11 retrospective pregnancies with exposure to olanzapine did not find any increase in the rate of spontaneous abortion and malformation compared with the general population. of the prospective pregnancies, 84% had normal delivery and postnatal course. the remaining 16% suffered problems such as prematurity, postmaturity and low or high birth weight. newport. measured placental passage of medication from mother to fetus by measuring levels in umbilical cord serum and documented neonatal outcomes in 54 women followed through pregnancy. they concluded that olanzapine has the highest rate of placental passage, compared with haloperidol, risperidone and quetiapine. neonates exposed to olanzapine showed trends toward lower birth weights and more neonatal intensive care unit admissions than neonates exposed to other antipsychotic medication. some authors have reported varying results among pregnant women treated with olanzapine while others have not reported any harm to either mother or fetus. to the best of our knowledge, this is the first report of microcephaly along with anopthalmos following intranatal exposure to olanzapine. we made attempts to rule out alternative causes and several of the causes that are responsible for baseline rates of congenital anomalies were ruled out. our patient was continuously exposed to olanzapine even before conception until birth of the infant. authors have earlier hypothesized that this may increase the risk as the early developmental period is crucial for organogenesis. they also highlighted that many negative studies had olanzapine exposure after the 8 week of pregnancy. thus, we hypothesize that early and sustained exposure to olanzapine may impair embryonic development in ways that may not occur with shorter or later periods of exposure. calmodulin antagonism during early development has been proposed as a possible mechanism for antipsychotics in general ; although, its specificity to olanzapine is unclear. however, our report by virtue of being a case report has its obvious limitations of not being able to conclusively prove a causal link. furthermore, for reasons mentioned earlier, some of the investigations could not be performed. the largest of the studies in pregnant women so far had only 60 patients on olanzapine. the purpose of this case report is more to stimulate further research in this direction. | olanzapine, a 2nd generation antipsychotic, is in use in the clinical practice for nearly a decade and a half now. it is classified as a category c drug with very few reports of its toxic effects on the fetus. in general, the risk benefit analysis warrants its use in pregnancy. we report a case of microcephaly and anopthalmos associated with the use of olanzapine in pregnancy. although a causal role can not be unequivocally proven, it calls for larger studies to explore this issue. |
equilibrium simulation of molecular systems entails sampling of conformations from the appropriate distribution corresponding to a thermodynamic ensemble, such as the boltzmann distribution for the isothermal canonical ensemble. given a potential energy function that describes the interatomic interactions, equilibrium sampling is required to compute the thermodynamic observables, such as internal energy and heat capacity. development of efficient sampling methods is an important and highly active field of research in biomolecular simulation and molecular science in general. most thermodynamic sampling methods are based on either the molecular dynamics (md) or monte carlo (mc) approaches. md simulations are prone to trapping in local minima of the potential energy surface (pes) if there exist barriers that are larger than the available thermal energy. consequently, long simulations may be required for equilibration on the high dimensional energy landscapes corresponding to biomolecules of practical interest. mc simulation involves random perturbations, or moves, in the conformational space, designed to preserve the canonical distribution. due to the random perturbations, the system may directly jump between local minima of the pes. however, due to the bonded topology and compact structures of biomolecules, large jumps in the conformational space typically require cooperative motion of multiple atoms. designing such cooperative moves, which satisfy detailed balance and are computationally efficient, is the primary difficulty in the mc simulation of biomolecules. we recently developed a method, namely, kirkwood sampling, for surveying the n = 3 m 6 dimensional conformational space of a molecule containing m atoms. the key challenge in random conformational sampling of compact biomolecules is to avoid steric clashes. kirkwood sampling addresses this problem by incorporating correlations among internal coordinates, as captured by the joint probability distribution between them. the joint distributions may be obtained from relatively short high temperature md or mc simulation trajectories, or even using an informatics approach by exploiting statistics from structural databases such as the protein data bank or the cambridge structural database. results for small molecules and small peptides suggest that incorporating low order (pairwise and/or 3-fold) correlations may be sufficient to greatly reduce the occurrence of steric clashes in comparison with sampling that ignores all correlations. this is fortuitous, since, in practice, sufficient data is likely to be available for populating only the low order pdf s. furthermore, neglect of the higher order correlations leads to greater coverage of the conformational space compared to the data used to populate the joint distribution functions. kirkwood sampling is a geometrical conformational sampling method, independent of the potential energy surface. in the present contribution, we describe two new algorithms, which combine kirkwood sampling with existing monte carlo and replica exchange based approaches. the idea in each case is to improve convergence by taking advantage of the greater conformational space coverage and random (or non - markovian) sampling properties of the kirkwood procedure. section 2 describes the various aspects of the underlying theory, including the kirkwood sampling algorithm, application of kirkwood sampling for conformational sampling of molecules, and the description of the new equilibrium sampling algorithms introduced in this work. section 3 defines a model nine - atom molecule with an unbranched chain topology, characterizes its energy landscape, and presents a detailed analysis of the convergence of the new algorithms. section 3 concludes with results for alanine dipeptide, a popular molecule for benchmarking simulation approaches. let x1,..., xn be n discrete random variables such that the ith variable takes di discrete values, xi { vi,1,..., vi, di}. we denote the kth order probability distribution function (pdf) of a set of k such variables (corresponding to coordinates in the present work) { x1,..., xk } as pk(x1,..., xk). using lower case letters for specific values for a random variable, pk(x1,..., xk), denotes pk(x1 = x1,..., xk = xk). kirkwood sampling refers to a family of algorithms for sampling points in the full n - dimensional space consistent with select joint distributions among different subsets of the variables, as described previously. the doublet level kirkwood sampling employs only the 1-d, or singlet, p1(xi), and 2-d, or doublet, p2(xi, xj), pdf s. in this work, we employ the doublet level sampling algorithm, but extensions using different sets of pdf s are feasible.algorithm 1 (main text) presents the pseudo code for generating a point, x = (x1,..., xn), in the n - dimensional space using the doublet level sampling algorithm. the variables are sampled sequentially from their corresponding one - dimensional conditional pdf, p1(2)(xk|x1,.., xk1). the normalization factor, nk, of the conditional pdf in algorithm 1 is obtained numerically by summing the probability for all possible values of xk, the variable to be sampled. the various kirkwood sampling algorithms differ in the expression for the conditional probability distribution. the doublet level algorithm samples points from the n - dimensional probability distribution1following previous notation, the superscript (2) in the above equations denotes doublet level and will henceforth be dropped. the sampling probability, pn(2), can be readily computed for any given point. the computational complexity for doublet level kirkwood sampling (algorithm 1) is o(n), since there are n(n 1)/2 doublet pdf s. the kirkwood sampling distributions are normalized by construction via normalization of the conditional probability distribution of each variable. in general, the kirkwood sampling distribution involves the product of all pdf s employed. as a result, if certain cells in the pdf s have zero probability, then the corresponding combinations of coordinates will never be generated. thus, if the input pdf s contain such zero probability cells, or holes, then, strictly speaking, kirkwood sampling will not be ergodic, since it eliminates certain regions of the conformational space. in principle, this problem can be remedied by filling the holes with a small but finite probability. however, if the pdf s employed are representative of the true distributions, then the conformational regions eliminated by the holes are likely to correspond to high potential energy due to unfavorable interactions such as steric clashes. for example, the unpopulated regions of the ramachandran plots for the backbone and torsion angles of a protein correspond to conformations with steric clashes. hence, one can think of the input pdf s as constraints on the conformational space, and the accessible conformational space shrinks as more pdf s are included. one approach for obtaining the input pdf s is to populate them using conformations generated through an alternative sampling approach. in the present work, the input pdf s among the coordinates were populated using a representative set of conformations of the molecule obtained by molecular dynamics simulations. in practice, since the order of the input pdf s is likely to be much smaller than the dimensionality of the system, the conformational space accessible to kirkwood sampling will invariably be much larger than that represented by the conformations used to populate the pdf s. this effect is illustrated for a three - dimensional system in the supporting information. note that the representative set of conformations need not be exhaustive, just large enough to ensure the absence of spurious holes. in practice, even for high dimensional systems, sufficient data is likely to be available for avoiding spurious holes in the low order (1- and 2-d) pdf s. in the present context of molecular conformational sampling, the random variables, xi, denote discretized internal coordinates of a molecule. following previous work, we employ the bond - angle - torsion (bat) internal coordinate system. the singlet and doublet pdf s are obtained as histograms of the internal coordinate values observed using md. individual binning of each coordinate provides the n singlet (or 1-d) pdf s, and joint binning of all pairs of coordinates provides the n(n each coordinate is discretized into b equally spaced bins between the minimum and maximum values observed in md. the random variables xi now denote a bin number and can take values in the discrete set { 1,..., b }, that is, for all variables di = b and vi, j = j. the bin width for discretizing the ith coordinate is set to i = i / b, where i is the range of values observed in the simulation. to visualize a conformation and for computing energies, the bin numbers for the discrete bat coordinates need to be mapped into real values, and subsequently to cartesian coordinates. a discrete bat coordinate, xi { 1,..., b }, is mapped to the continuous space value, i, by picking a random point in the corresponding bin2where i, min is the minimum value for the ith coordinate and r is a uniformly distributed random number in [0, 1 ]. the left edge of the bin is given by the first two terms of eq 2. the conformational distribution for a molecule in contact with a heat bath is given by the boltzmann distribution. assuming translational and rotational invariance of the potential energy, the boltzmann distribution in terms of internal coordinates is given by3where = kbt is the inverse temperature and kb is the boltzmann constant. in eq 3, e() is the potential energy and j() is the jacobian for the transformation from internal to cartesian coordinates. to present the equations in the following sections using a more familiar notation, we define4so that the boltzmann distribution can be written as5 monte carlo (mc) sampling is a general method for generating points from a multidimensional probability distribution function. mc sampling involves generation of trial points or moves, which are then subjected to an acceptance criterion designed to impose detailed balance with respect to the distribution of interest, here the boltzmann distribution. the first mc algorithm, referred to here as perturbation mc (pmc), is a standard implementation of mc for molecular systems, where a trial conformation, t, is generated by random perturbation of each coordinate of the current conformation, c,6with r being a uniform random number in [0.5, 0.5 ] and s a vector of step sizes for the n coordinates. the trial conformation is accepted or rejected using the metropolis acceptance function7the trial conformation is accepted and added to the markov chain if fpmc is greater than or equal to a random number uniformly generated in [0, 1 ] ; otherwise, the move is rejected and the current conformation is added to the chain. during equilibration, components of the step size vector s can be adjusted to achieve a specified acceptance ratio. after an optimal s has been found, it must be fixed for production runs to guarantee detailed balance.algorithm 2 gives the pseudo code for perturbation mc. the second mc algorithm is a variant of standard biased mc (bmc) where the trial conformations are drawn from a probability distribution, termed the biasing distribution, bn(), which is defined over the full conformational space8 in contrast to pmc, which is sequential, the moves in biased mc are independent of the current conformation. figure 1 schematically compares how the conformational space is explored by the two schemes. for biased mc, the acceptance function of pmc is modified to reweight the current and the trial conformation according to the boltzmann distribution9algorithm 3 provides the pseudo code for biased mc. given a temperature, the acceptance ratio in a biased mc simulation is completely determined by the biasing distribution. mc moves are more likely to be accepted if the overlap between the biasing and the boltzmann distribution is high. indeed, all moves will be accepted if the biasing distribution matches the boltzmann distribution. biased move mc can be trivially parallelized, since the trial conformations are generated independent of the current conformation in the markov chain. as a result, unlike perturbation mc, no equilibration is required for a biased mc simulation. here, we apply the biased mc algorithm with the trial moves generated by kirkwood sampling. the key objective of this work is to obtain a boltzmann distributed set of conformations corresponding to a given potential energy function and temperature, using conformations generated by kirkwood sampling. schematics for the exploration of conformational space by (a) perturbation monte carlo (algorithm 2) and (b) the biased monte carlo algorithm (algorithm 3). the square box represents the conformational space, arrows represent perturbation moves, and filled circles represent conformations. in the case of biased mc, conformations are sampled independently from a biasing distribution. replica exchange (rex) is an enhanced sampling method designed to overcome the trapping problem in canonical simulations. in rex, multiple canonical simulations, or replicas, are run in parallel and occasionally exchanges between one or more pairs of replicas are attempted. in temperature replica exchange (t - rex), all replicas are run using the same potential energy function but at different temperatures. the lowest replica temperature is usually the temperature of interest where the trapping problem is most severe. exchanges with the high temperature replicas help the low temperature replicas to escape traps, thereby enhancing sampling in the low temperature replicas. in the present work, mc simulation is used for canonical sampling for each replica so that the exchanges depend only on the potential energy, and not the kinetic energy. let 1, 1 and 2, 2 be the inverse temperatures and instantaneous conformations of two replicas between which an exchange is being attempted. the exchange probability function in t - rex is given by10the conformations are exchanged if ft - rex is greater than or equal to a uniform random number in [0, 1 ]. usually, exchanges are attempted between replicas that are adjacent in the temperature ladder, though other schemes have also been suggested.algorithm 4 provides the pseudo code for the present implementation of t - rex. in t - rex, each replica may be considered as a reservoir of boltzmann distributed conformations for other replicas, albeit at different temperatures. exchanges may also be performed with a reservoir of non - boltzmann distributed conformations, as long as the probability distribution of the reservoir is known. kirkwood sampling satisfies this condition, as the probability of sampling a given conformation can be computed (here, using eq 2). a temperature replica exchange where one (or more) temperature replica(s) are coupled to a kirkwood sampling scheme will be referred to as kirkwood reservoir replica exchange (kr - rex). the probability for exchanges between a temperature replica at inverse temperature and a reservoir with distribution bn() is given by11where is the conformation from the temperature replica and r is a conformation drawn from the reservoir, that is, r note that the acceptance function involves the reservoir probability of the conformation from the temperature replica, bn(), as well as the potential energy of the reservoir conformation, u(r;). the likelihood of acceptance from the reservoir depends on the conformational overlap between the reservoir and the actual boltzmann distributions. the acceptance ratio for biased mc simulation at a given temperature gives the probability of exchange with a replica at the same temperature. therefore, given an acceptance ratio for exchanges with the reservoir, short biased mc simulations are performed at multiple temperatures to determine the lowest temperature to which the kirkwood reservoir can be coupled. schematics of the exchange protocols and exchange probability function for t - rex and kr - rex are shown in figure 2. exchanges with the reservoir are attempted at every alternate exchange cycle, as detailed in algorithm 5. schematic representation of (a) temperature (t - rex, algorithm 4) and (b) kirkwood reservoir (kr - rex, algorithm 5) replica exchange. the horizontal lines represent different replicas with the lower lines corresponding to lower temperatures. the green dotted box in part b represents the kirkwood reservoir, filled green circles represent conformations sampled from the reservoir distribution, and green arrows indicate exchange attempts between the reservoir and the highest temperature replica. note that conformations in the reservoir are not updated with conformations from the temperature replicas. the kirkwood replica exchange strategy can efficiently sample thermodynamic states by coupling a set of temperature replicas to a reservoir of kirkwood - generated structures. although the trial configurations are sampled from the kirkwood distribution, which is different from the underlying boltzmann distribution, the acceptance criterion, eq 11 above, guarantees that the move satisfies detailed balance, ensuring that each of the temperature replicas samples its correct equilibrium distribution. we employ the overlapping distribution method to verify that the kirkwood exchange moves do not disturb the underlying equilibrium ensembles in the temperature replicas. this approach was originally introduced by bennett for free energy calculations but can also be used as a consistency check on equilibrium sampling for replica exchange simulations. we wish to verify that each of our temperature replicas samples its corresponding equilibrium distribution. let us consider a pair of temperature replicas, a and b, at inverse temperatures a and b, respectively. in the canonical ensemble, a particular replica, a, for example, samples energy e with distribution12where (e) is the energy density of states and f = a1 ln z is the helmholtz free energy of the system. (we emphasize that the relevant quantity to analyze with this method is the energy e, not the quantity u which contains the jacobian factors.) we have a similar expression for p corresponding to replica b. although p and p are generally unknown (due to the unknown density of states), they are related to each other in a simple way as13here, = b a and f = b f a f is the reduced free energy difference between the two replicas. hence, these two energy distributions are connected via the unknown constant f. this relation can be seen as a manifestation of crooks fluctuation theorem, and is in general true only when both distributions sample their respective equilibrium states, eq 12 above. hence, a verification of eq 13 for the temperature replicas in a kirkwood reservoir replica exchange simulation provides a consistency check on the sampling. to proceed with this consistency check, we follow bennett and define two functions:14a14balthough la and lb are functions of e, from eq 13, we see that15is a constant, whose value corresponds to the reduced free energy difference. this relationship can be verified from simulation data by binning the sampled energies from our various replicas, constructing the functions la and lb, and plotting their difference in each bin. a plot of l as a function of e should, within statistical errors, provide a horizontal line with a slope of zero. in section 3.1.4, we apply this test to our replica exchange simulations in order to verify equilibrium sampling. the equilibrium sampling algorithms, described in section 2, were implemented in matlab and octave. we first applied the methods on a model nine - atom chain molecule (figure 3) with a simplified force field. the model system was constructed for computational efficiency and for ease of implementing internal coordinate monte carlo moves. kirkwood based biased mc and reservoir replica exchange are applied to the model system, and results are compared with conventional alternative approaches. the simulations were designed with the objective of validating the new sampling algorithms and describe the considerations for setting up the simulations. the last section presents biased mc results for alanine dipeptide illustrating the applicability to small biomolecules. (a) bond - angle - torsion (bat) coordinate system for an m atom chain molecule and (b) electrostatic charge and lennard - jones well - depth of the test system studied in this work. atoms without charge and lennard - jones interaction are represented by unfilled dashed circles. this section describes the force field and coordinate system for the model system, characterizes its energy landscape, and generates benchmark results using an independent well - converged md replica exchange simulation. we then present results for perturbation and biased mc simulations applied to our system at progressively lower temperatures. we will see that both of these methods fail to converge below a certain temperature. finally, we present results from t - rex and kr - rex replica exchange simulations, which enhance convergence at the lower temperatures. the number of mc steps is 5 10 for all mc and replica exchange simulations described in this section. the conformation of the model system is specified by 21 bat coordinates, which include eight bond lengths (bi), seven bond angles (ai), and six torsion angles (ti). figure 3 gives the atom labeling and the definition of the bat coordinates. the functional form of the potential energy of the molecule employs a molecular mechanics - type force field, which includes bonded and nonbonded terms16where m = 9 is the number of atoms. the terms associated with the bonded, angular, and torsional degrees of freedom are eb, ea, and et, respectively. a harmonic functional form was used for the bonded and angular contributions, while the ryaekart bellman functional form was used for the torsional term. in eq 16, elj and ee denote the nonbonded lennard - jones (lj) and electrostatic interactions, respectively, and ri, j denotes the distance between atoms i and j. to compute distances between atoms, the bat coordinates were transformed to anchored cartesian coordinates. in the present study, the potential energy of the test system included all bonded terms but only selected nonbonded contributions (see figure 3 and the supporting information). lj interactions were considered only for atom pairs (1,7) and (3,7), while electrostatic interactions were included only for atom pairs (1,7), (3,7), (1,9), and (3,9). atoms 1, 3, and 9 carried positive charges of + 0.1, + 0.1, and + 0.2, respectively. atom 7 carried a negative charge of 0.4, and the remaining atoms were neutral. fewer nonbonded interactions were included to reduce the cost of the energy evaluation and obtain accurately converged results for the benchmarking more efficiently. the full energy function and its parameters and the input files for gromacs and amber are provided as supporting information. although the potential that we have defined is relatively simple, the corresponding landscape can still provide a useful benchmark to compare different sampling schemes. in order to gain some idea of this complexity, we sampled local minima using basin - hopping global optimization, and then computed pathways connecting the global minimum with all other minima using the doubly nudged elastic band method with accurate refinement of transition states by hybrid eigenvector - following. the resulting database of minima and transition states was used to plot the disconnectivity graph shown in figure 4, which suggests a largely funnelled potential energy surface. the low energy minima adopt a more compact conformation with similar geometry of the oppositely charged atoms. the energy of the global minimum was 22.6 kj / mol, and there are three prominent funnels at energies below 16 kj / mol, with barriers between funnels of roughly 4.14 kj / mol, corresponding to a temperature of 500 k. thus, at temperatures significantly lower than 500 k, the system is likely to be trapped in one of the low energy funnels. in this section, we investigate convergence of thermodynamic quantities for temperatures ranging from 20 to 500 k. disconnectivity graph constructed from a database of 236 minima and 1454 transition states. branches leading to select minima (a e) are colored red. conformations of these labeled minima are shown with the positively charged atoms in blue and the negatively charged atom in red (see figure 3b for atom numbering and the supporting information for potential energy definition). distances between atom pairs (1,7) and (3,7) are also shown. note that the low energy minima (b e) are more compact than the high energy minimum (a) and have a similar arrangement of atoms 1, 3, and 7. the energy of the global minimum (d) is 22.6 kj / mol, and that of minimum (a) is 9.9 kj / mol. typical barriers between minima belonging to the three low energy funnels are around 4.8 kj / mol, corresponding to a temperature of roughly 1000 k. reference canonical potential energy distributions were generated at different temperatures using md replica exchange. twelve replica temperatures were used : 10, 20, 30, 50, 75, 100, 130, 165, 200, 300, 400, and 500 k. the md rex simulations were performed with gromacs 4.6.5, using langevin dynamics with a time step of 1 fs and a friction coefficient of 5 ps. conformations and energies were saved every 0.5 ps (500 time steps), giving 10 data points per replica. figure 5 shows the potential energy distribution observed during the production run, and table 1 displays the average energy and heat capacity computed for the simulation temperatures using the potential energy values observed in each replica. the heat capacity for the replica at temperature t was computed using17the average energy and heat capacity were interpolated between each replica exchange simulation temperature by applying the multihistogram method to the md rex potential energy distributions, using an energy bin width of 0.1 kj / mol. the peak heat capacity from the multihistogram heat capacity curve is 26.6 kb/2 at 104.5 k. figure 6 shows the two quantities computed at 50 equally spaced temperatures between 10 and 500 k. at the simulation temperatures, the interpolated values are in good agreement with the values directly computed from the simulation data (see table 1). potential energy distributions obtained from reference md replica exchange simulation described in section 3.1.2. the distributions correspond to temperatures 10, 20, 30, 50, 75, 100, 130, 165, 200, 300, 400, and 500 k, from left to right. the inset shows the energy distribution of doublet level kirkwood samples from refpdfst500 (line marked by boxes) and refpdfst200 (solid line by circles) overlaid on select canonical energy distributions (unmarked lines). kirkwood samples generated using refpdfst200 and refpdfst500 have significant overlap with the canonical distribution at 200 and 500 k, respectively. average energy and configurational heat capacity computed using the md rex potential energy distributions shown in figure 5. bat coordinates were extracted from all 12 trajectories, giving 12 10 data points for each coordinate, with 30 equally spaced bins between the minimum and maximum observed values in each case. the discretized coordinates were used to populate the 1-d (singlet) probability distribution for each coordinate and 2-d (doublet) probability distribution for all pairs of coordinates. in all, 21 singlet and 210 doublet distributions were populated and used to sample conformations using the doublet level kirkwood algorithm (algorithm 1). note that, since data from all replicas were pooled together, the conformations used to populate the pdf s are not boltzmann distributed for a single temperature. nevertheless, since more conformational space is covered at higher temperatures, the configurations will be more representative of the highest temperature replica at 500 k. we refer to this set of pdf s as refpdfst500. another set of pdf s, referred to as refpdfst200, was generated using 2 10 conformations from a separate 200 ns md simulation at a lower temperature of 200 k. kirkwood sampling was performed to generate 10 conformations for each pdf set. the figure 5 inset shows the distribution of potential energies of the kirkwood samples overlaid on the canonical potential energy distributions at different temperatures. the energy distribution of kirkwood samples generated from refpdfst500 (curve marked by boxes) has significant overlap with the canonical distribution at 500 k, and the distribution corresponding to refpdfst200 (curve marked by open circles) has significant overlap with the canonical distribution at 200 k. these results are consistent with earlier work, where the energy distribution of the kirkwood samples was found to overlap strongly with the original boltzmann distribution from which the conformations used to populate the reference pdf s were generated. indeed, kirkwood sampling was originally developed for approximating the boltzmann distribution at a given temperature. note that the energy distributions of the kirkwood samples are shifted to higher values relative to the original canonical distribution, due to the greater coverage of the conformational space, and the fact that there are more conformations at higher energies. perturbation mc (algorithm 2) and biased mc (algorithm 3) simulations were performed for successively lower temperatures starting from 500 k. both simulations were performed at temperatures of 200, 300, 400, and 500 k ; perturbation mc was also conducted at the lower temperatures of 100, 50, and 20 k. the number of mc steps for all simulations was 5 10. for the biased mc simulations table 2 gives the average energy and heat capacity computed from the potential energies from different simulations and their difference with respect to the reference values in table 1. the acceptance ratio observed in the biased mc simulations and reference values from table 1 are also given. considering the biased mc results first, figure 7 shows the distribution of potential energies for each simulation overlaid on the reference distributions from figure 5. the biased mc and reference distributions are in good agreement for temperatures 300 k, consistent with the average energy and heat capacity results in table 2. these results show that kirkwood sampling with a fixed set of input pdf s can be used to obtain boltzmann distributed conformations at different temperatures. the biased mc algorithm may be viewed as a resampling approach wherein a set of kirkwood distributed conformations are resampled to generate a boltzmann distributed set. in figure 7, resampling effectively shifts the right - most distribution (line marked by boxes) to match with the different boltzmann distributions. note that boltzmann distributions can be generated for temperatures lower than that of the md simulation used to populate the input pdf s. biased mc simulations in figure 7 used input pdf s effectively populated with 500 k md simulation data but were able to generate boltzmann distributions at 300 k. potential energy distributions (in black) from biased move mc simulations (section 3.1.3) at t = 200, 300, 400, and 500 k using kirkwood moves with refpdfst500. the potential energy distribution of the original kirkwood samples is also shown marked by boxes. acceptance ratios for the biased mc simulations were 0.29, 0.25, 0.07, and 0.009 for t = 500, 400, 300, and 200 k, respectively. the acceptance ratio falls as the temperature is reduced, consistent with the decreasing overlap between the kirkwood potential energy distribution and the canonical energy distributions (see figure 5). note that the conformations obtained by kirkwood sampling are completely determined by the input pdf s. as a result, in contrast to perturbation mc, the acceptance ratio can not be adjusted for a given temperature. in other words, a given acceptance ratio would impose a lower limit on the temperatures for which biased mc simulations can be run. note that the overlap of the kirkwood distribution with a target canonical distribution can be determined even in the absence of the target distribution. the acceptance ratio of a biased mc simulation is a direct measure of the overlap. moreover, since no equilibration is required for biased mc simulations, a relatively short run can provide an estimate of the acceptance ratio. we now characterize the perturbation mc simulations, which are used in the next section for canonical sampling in the replica exchange simulations. in each pmc simulation, a 10 000 step preliminary run was performed to adjust the step size for an acceptance ratio between 0.2 and 0.3. figure 8 shows the comparison of the pmc potential energy distributions with the reference distributions (see figure 5). table 2 and figure 8 show that the pmc simulations are in good agreement with the reference values for t 100 k, with higher temperatures producing better agreement. the deviations at low temperatures are due to the trapping of the markov chain in local potential energy wells. potential energy distributions (in black) from the perturbation mc simulations (section 3.1.3) overlaid on the reference distributions (in blue). the successful convergence for pmc at the low (relative to typical barriers of the pes) temperature of 100 k is likely due to the efficiency of the internal coordinate bat moves. for comparison, we performed a 100 k pmc simulation using random cartesian moves, which was 10 times longer than the above bat move pmc simulation. figure 9 shows that the energy distribution from the cartesian move simulation is in much poorer agreement with the reference distribution. we note that, even though the coordinates are perturbed independently, bat coordinate moves are particularly effective here because of the unbranched chain topology of the molecule. absence of side chains greatly reduces the chances of steric clashes, even if a torsion angle in the middle of the chain is perturbed substantially. potential energy distributions from perturbation mc simulations at 100 k using bond - angle - torsion (bat) and cartesian coordinate moves. the cartesian move simulation was run for 5 10 steps, while the bat move simulation was 10-fold shorter at 5 10 steps. the distributions show that bat coordinate moves are move efficient than cartesian coordinate moves. we now compare temperature replica exchange (algorithm 4) and reservoir replica exchange (algorithm 5), focusing on the low temperatures (100 k) for which the mc simulations of the previous section failed to converge. replica exchange simulations were performed for two sets of temperatures, namely, a high temperature set, 20, 50, 100, and 200 k, and a low temperature set, 20, 30, 50, and 100 k. the high temperature set was chosen to inspect the convergence of the heat capacity peak at 104.5 k, and the low temperature set was used to inspect the impact of the reservoir on the convergence. in the case of reservoir replica exchange simulations, for both sets the kirkwood reservoir for the high temperature set was based on refpdfst500, and that for the low temperature set was based on refpdfst200. perturbation mc was used for canonical simulation in the temperature replicas, and for each temperature, the step size was adjusted during equilibration to achieve an acceptance ratio between 0.2 and 0.3. the length of the production run was 5 10 steps, and exchanges were attempted every 20 steps using the exchange protocols described in algorithm 4 and algorithm 5. energy values were saved at every mc step generating 5 10 energy values per replica. we first discuss the rex simulations using the high temperature pdf set. for all rex simulations, we performed the overlap test (section 2.6) to validate the implementation of the algorithms and, in the case of kr - rex simulations, also verify that coupling to the reservoir did not disturb the boltzmann distribution in the temperature replicas. figure 10 shows the analysis for replicas 2 and 3, corresponding to 50 and 100 k, respectively, for the kr - rex simulation. the inset in the lower panel of figure 10 also shows the plot of l for the corresponding replicas in the t - rex simulation. we see that the function l is flat within statistical errors, indicating that the fluctuation theorem, eq 13, is satisfied, and hence both replicas are sampling their respective canonical distributions correctly. the overlap test is performed on replicas 2 and 3, at temperatures 50 and 100 k, respectively, taken from the kr - rex simulations described in section 3.1.4 using the high temperature pdf set. lower panel : the overlap functions l2, l3, and l (eqs 14 and 15). the function l is flat within statistical error, indicating that the replicas are sampling their correct equilibrium distributions (see section 2.6). inset : the function l expanded (red crosses), compared to l as calculated from the same temperatures in the t - rex simulation (blue circles). we next analyze and compare the convergence of the t - rex and kr - rex simulations using the high temperature set. for both simulations, the exchange acceptance ratios were 0.02, 0.08, and 0.08 for replica pairs (20,50), (50,100), and (100,200), respectively. the lowest exchange acceptance ratio of 0.02 corresponds to 5000 successful exchanges. for kr - rex simulation, the number of successful exchanges with the reservoir was roughly 1100, consistent with the expected acceptance ratio of 0.009 based on the biased mc simulation at 200 k. the convergence of a replica exchange simulation is limited by the time needed for a trajectory to diffuse between its lowest temperature, where it is trapped in a metastable state, to a high temperature one, where it can overcome its energetic barriers via enhanced thermal fluctuations or the kirkwood reservoir. to analyze this convergence, we investigate the diffusion of replica trajectories among the ladder of temperatures. figure 11 shows the trajectory that began in the lowest temperature replica in the kr - rex simulation. trajectory of the 20 k replica from the kr - rex simulation described in section 3.1.4 using the high temperature pdf set. the trajectory for the first 5 10 exchange attempts is depicted here. figure 12 compares the energy distributions of the t - rex and kr - rex simulations with the reference distribution from md rex. the three distributions are essentially identical for all temperatures, including 20 and 50 k, which failed to converge in the case of single temperature perturbation mc simulations (see figure 8). the t - rex and kr - rex simulations were also compared in terms of convergence of the average energy and heat capacity as a function of temperature, which is a more stringent test of convergence than comparison of energy distributions. the average energy and heat capacity were obtained by applying the multihistogram method to the potential energy distributions computed using successively larger fractions of the simulation data. figure 13 shows the convergence of the average energy and heat capacity overlaid on the reference curves, and figure 14 shows the difference between each curve and the reference. for both t - rex and kr - rex, the average energy converges to within 0.5 kj / mol over the full temperature range of 20 and 200 k using only 10% (500 000 steps) of the production data. the convergence of the heat capacity is, as expected, slower than that for the average energy. nevertheless, both the t - rex and kr - rex curves converge to within 0.25 kb of the reference with 50% of the production data. these results show that the t - rex and kr - rex simulations were consistent with each other. however, from these simulations, it is difficult to gauge the impact of the reservoir on the convergence. potential energy distributions for t - rex (blue) and kr - rex (red) simulations using the high temperature set described in section 3.1.4. distributions are shown for t = 20 (left - most), 50, 100, and 200 k (right - most). the three distributions are nearly overlapping for all temperatures, with t = 50 k (inset) showing the largest deviations. convergence of average energy (left panels) and heat capacity (right panels) for t - rex (top) and kr - rex (bottom) simulations using the high temperature pdf set (section 3.1.4). the legend indicates the fraction of data used from the 5 10 step production run. the reference curves (from figure 6) are in black. differences between the average energy and heat capacities in figure 13 and the reference values from figure 6. the horizontal dotted lines in the left panels indicate energy differences of 0.2 kj / mol, and those in the right panel indicate heat capacity differences of kb/4. the effect of the reservoir in the high temperature set rex simulations was not discernible probably because the highest temperature of 200 k was sufficiently high to avoid trapping, so that additional jumps in the conformation space through exchanges with the reservoir did not improve convergence. to investigate the effect of the reservoir however, for temperatures below 200 k, refpdfst500 could not be used to set up the reservoir because of a low acceptance ratio. we therefore created the refpdfst200 set of pdf s (see section 3.1.2) using data from a 200 k md simulation. recall that the potential energy distribution of the kirkwood samples from this set has high overlap with the canonical distribution at temperatures around 100 k (see figure 5, inset). the acceptance ratio for a preliminary 10 step biased mc simulation at 100 k using refpdfst200 was found to be 0.05. pdf set refpdfst200 could, therefore, be used to set up the reservoir for kr - rex simulation using the lower temperature set where the highest replica temperature is 100 k. figure 15 shows the energy distributions obtained from the t - rex and kr - rex simulations for the low temperature set. the distributions from the kr - rex simulation (lines marked by circles in the bottom panel of figure 15) are substantially closer to the reference distribution than those from the t - rex (top panel of figure 15) simulation. table 3 gives the average energy and heat capacity at the simulation temperatures computed from the raw simulation data, without multihistogram analysis. for the lowest temperature replica at 20 k, the average energy from the t - rex simulation deviates from the reference by 0.62 kj / mol, while the deviation of average energy from kr - rex is much smaller at 0.09 kj / mol. the number of successful exchanges with the reservoir was over 23 000, consistent with the biased mc acceptance ratio of 0.05. the results show that coupling with the reservoir enhances sampling in the low temperature replicas. potential energy distributions (lines marked by circles) from the 5 10 steps (a) t - rex and (b) kr - rex simulations described in section 3.1.4 using the low temperature pdf set with replica temperatures of 20 k (black), 30 k (red), 50 k (blue), and 100 k (green). the distributions from the kr - rex simulation are much closer to the reference than those from the t - rex simulation, indicating that coupling to the reservoir enhanced convergence. the pdf set refpdfst200 was used to set up the reservoir in kr - rex simulation. the numbers in parentheses are differences with respect to the reference values. in this section, we apply biased monte carlo (algorithm 3) to alanine dipeptide. similar to the model system, the bat internal coordinate system was used for kirkwood sampling as described elsewhere. the conformation of the 22-atom molecule was defined using 21 bond lengths, 20 bond angles, and 19 bond torsions. the range for angular coordinates was [0,2 ] radians, while that for bond coordinates was [0.6,2 ]. md data for populating the pdf s was generated by a 1000 ns replica exchange simulation with replica temperatures of 300, 400, and 500 k. in each replica, coordinates were saved at regular intervals to generate 10 conformations for each temperature. the all - atom amber99sb force field was used, and the simulations were performed with gromacs 4.6.5. kirkwood sampling was performed in matlab and octave, and force field energy was computed using openmm 6.2. in terms of computational cost, most (> 90%) of the time was spent in generating the kirkwood samples. md data were used to populate the 60 singlet pdf s and 1770 doublet pdf s corresponding to all pairwise combinations of the coordinates. two separate sets of pdf s, namely, refpdfst400 and refpdfst500, were constructed using data from the 400 and 500 k replicas of the md simulation, respectively. each pdf set was used to generate 5 million conformations using doublet level kirkwood sampling. figure 16 shows the distribution of the potential energy of the kirkwood samples overlaid on the distribution from the md replica exchange simulation. kirkwood samples from the two sets of pdf s have good overlap with the reference distributions for the corresponding temperatures, suggesting overlap between the md and kirkwood sampled conformational spaces. the energy distribution for kirkwood samples follows the reference distribution such that the distribution for refpdfst400 (red dashed line) is shifted to lower energies as compared to the distribution using refpdfst500 (blue dashed line), consistent with the observations for the model system. reference distributions from md replica exchange simulation are in solid black lines with 300 k being the left - most, followed by 400 and 500 k. the dashed lines show distributions for 5 10 kirkwood samples with red corresponding to refpdfs400 and blue to refpdfs500 pdf sets. the marked lines are distributions from different biased mc simulations. blue squares and circles correspond to biased mc using refpdfs500 at 300 and 400 k, respectively. we performed biased mc simulations to obtain a canonical distribution for temperatures lower than that of the original md simulation used to populate the reference pdf s. doublet level kirkwood sampling is employed to set up the biasing distribution, and 5 10 mc steps are taken for all simulations in this section. we first present results for 300 and 400 k biased mc simulations with refpdfst500 used for kirkwood sampling. figure 16 shows the energy distribution obtained from the mc simulations overlaid on the reference md potential energy distributions. the 400 k distribution (blue circles) is in good agreement with the target distribution, unlike the 300 k distribution (blue squares) which is shifted to higher energies. the acceptance ratio at 300 k was lower (0.007), consistent with the poorer agreement of the 300 k energy distribution. it is instructive to compare the ramachandran plots of the alanine residue for ensembles generated by the different sampling methods. in figure 17, each two - dimensional plot shows normalized joint distribution of and angles computed using 10 conformations. the left - most plot represents the 500 k replica of the 1000 ns md rex simulation which was used to populate the refpdfst500 pdf s. the plot for kirkwood generated conformations is in good agreement with the 500 k md plot, though the kirkwood plot has a slightly smaller coverage. recall that the kirkwood sampling was performed while accounting for the pairwise correlations of the and angles with all remaining 59 bat coordinates. by relaxing some correlations, for example, ones with side chain coordinates, a greater conformational space is likely to become accessible by kirkwood sampling. note that the number of conformations (10) for the kirkwood ramachandran plot is several orders of magnitude smaller than the number of time steps (3 10) in the md rex simulation. ramachandran plots for the alanine residue of alanine dipeptide with torsion on the horizontal axis and on the vertical axis. the other plots employ refpdfst500 for kirkwood sampling, which was populated using data from the 500 k md replica. figure 17 also shows the ramachandran plot for the biased mc simulations using refpdfst500 and the reference plots from the md replica exchange simulation. biased mc effectively resamples from the kirkwood distribution to reproduce a target distribution, here the boltzmann distributions at 300 and 400 k. all regions of the ramachandran plot that are sampled by the md simulation are represented in the biased mc simulation. at both temperatures, the basins in the 0 region are poorly sampled by the biased mc simulations, and may explain the deviations in the energy distribution (figure 16). nevertheless, in spite of the low acceptance ratio, since all regions are sampled in the biased mc simulation, it would be advantageous to combine kirkwood sampling with md or mc based local sampling, as demonstrated for the model system above. finally, we performed a t = 300 k biased mc simulation using the refpdfst400 pdf set which was populated using conformations from the 400 k md replica. an acceptance ratio of 0.024 was obtained in a 5 10 step simulation. the energy distribution of the mc samples using refpdfst400 (marked by red triangles in figure 16) is in much better agreement with the reference distribution as compared to that using refpdfst500 (marked by blue boxes). note that the acceptance ratio for t = 400 k biased mc simulation using refpdfst500 is comparable to that of t = 300 k simulation using refpdfst400. one could envision a multistage simulation to enable simulating arbitrarily low temperature where each stage would consist of biased mc simulation followed by repopulation of the pdf s using biased mc sampled conformations. the successive stage would simulate lower temperature with the first stage employing pdf s populated by high temperature md or other enhanced sampling methods. in this contribution, we have presented two methods for barrierless equilibrium sampling of molecular systems. our approach builds upon kirkwood sampling, which employs low - order correlations among internal coordinates of a molecule for random sampling of the conformation space. both methods make use of the property of kirkwood sampling whereby the normalized probability of generating a given conformation can be computed. we have presented proof - of - concept results for the new methods using a model system with nine atoms where the intramolecular force field can be adjusted to highlight particular sampling issues. we also showed results for alanine dipeptide, a commonly used model system for benchmarking sampling algorithms. the first of the two algorithms is based on biased monte carlo where the kirkwood samples are used as mc moves. in contrast to standard molecular dynamics or monte carlo simulations, no equilibration is required in the biased mc simulation, since successive kirkwood samples are generated independently. as a result, biased mc using kirkwood moves can be trivially parallelized in a distributed computing environment, with no communication required between the compute nodes. furthermore, since kirkwood sampling is a geometrical sampling method, independent of the energy landscape, the same set of samples can be used to generate boltzmann distributions for different temperatures and potential energy functions. the convergence of a biased mc simulation depends primarily on the overlap of the kirkwood sampling distribution and the target boltzmann distribution. the conformational space covered by kirkwood sampling is determined by the input set of probability distribution functions. in the present work the results showed that kirkwood samples could be used to generate a boltzmann distribution, not only for the temperature of the original md simulation but also for lower temperatures, although the convergence slows as the temperature is reduced. one can imagine an iterative scheme where the initial set of pdf s is constructed in a manner that provides coverage of a wide conformational space. for instance, the pdf s could be populated using high temperature md, or using a database of conformations from the pdb or a fragment pdf library. given this initial set of pdf s and a potential energy function, one could then perform successive stages of biased mc simulations and repopulation of the pdf s to reach arbitrarily low temperatures. the second algorithm introduced in this work is a modification of temperature replica exchange where a temperature replica is coupled with a kirkwood reservoir of conformations. exchanges with the reservoir help to enhance sampling for that replica. as for biased mc, the acceptance ratio for exchanges with the reservoir is determined by the overlap of the kirkwood distribution and the boltzmann distribution for the coupled replica. note that in the absence of a reservoir the highest temperature in a replica exchange simulation needs to be high enough to overcome the energy barriers and avoid trapping. by coupling to a kirkwood reservoir, the highest temperature can be set independent of the energy barriers. in the presence of a kirkwood reservoir, the criterion for setting the highest temperature becomes the requirement of sufficient overlap to facilitate frequent exchanges with the reservoir. thus, coupling with a reservoir effectively places a limit on the highest temperature required, which may be lower than the highest temperature dictated by the barriers of the pes. indeed, if the reservoir has good overlap with the boltzmann distribution corresponding to the temperature of interest, then just a single replica would suffice. in that case, the temperature replica essentially performs local sampling, while the reservoir facilitates global sampling of the conformational space. finally, we also note that the sampling for the lowest temperature replicas can be enhanced by coupling to a reservoir constructed from a set of low energy minima from the potential energy landscape. in this scenario, kirkwood samples could be used for seeding basin - hopping simulations in order to generate the low energy minima of the system, or in the mc part of a basin - sampling calculation. in the present work, canonical sampling for the temperature replicas of a kr - rex simulation the kirkwood reservoir can also be coupled with temperature replicas evolving via heat bath coupled molecular dynamics. coupling to an md replica would require a relatively minor modification of the current algorithm to assign velocities to the reservoir generated conformations. the velocities would be sampled from the maxwell boltzmann distribution corresponding to the temperature of the coupled temperature replica. it should therefore be straightforward to enhance the performance of existing md based replica exchange codes by coupling them to a kirkwood sampler. therefore, it can be boltzmann inverted to construct a reference energy function. we can then define intermediate potentials, which progress from the potential energy of the physical force field to the kirkwood reference energy. the intermediate potentials could be used to perform hamiltonian replica exchange with the two boundary replicas corresponding to the reference and physical energy functions. all replicas may now be simulated at the temperature of interest using standard perturbation move monte carlo. this approach would facilitate coupling of the kirkwood sampling with existing monte carlo codes. the number and spacing of the intermediate replicas will depend on the overlap between the reference and the physical energy surfaces. we note that molecular dynamics can not be used for canonical simulation with hamiltonian replicas, since the reference energy surface is piecewise continuous and its gradients are not well - defined. this limitation arises because the kirkwood distribution is constructed over a discretized conformational space. note that in this scheme kirkwood sampling is only used for defining a reference energy function and not for generating mc moves. we are currently working on hamiltonian replica exchange using a kirkwood reference energy and will present the results in a separate publication. finally, nonequilibrium simulations, which switch the hamiltonian between the physical and reference energy functions, can also be used to enhance replica overlap and reduce the number of intermediate replicas. application of the present methods to systems of practical interest from small drug - like molecules to large proteins would require a flexible and scalable implementation of kirkwood sampling. some of the strategies that could be pursued in this direction are as follows. in the present work, the low order pdf s were populated using conformations for the full molecule. the pdf s can also be generated for smaller molecular fragments and assembled for an arbitrary molecule. we are currently working on developing such a fragment pdf library for proteins using peptide fragments up to five residues long. the fragment pdf s will be populated using pdb data and/or exhaustive md simulations. for small fragments, it is computationally feasible to calculate triplet or even quadruplet pdf s, which would help better account for local packing. we note that the kirkwood framework can be used to sample a subset of coordinates while keeping the other coordinates fixed. in the context of conformational sampling of polymers, local packing can be accounted for by incorporating correlations among coordinates of adjacent subunits. therefore, kirkwood sampling is likely to be particularly useful for sampling small molecules, short peptides, or for sampling side - chain conformations for a fixed backbone. construction of pdf libraries for proteins is relatively straightforward, since proteins are built from a fixed set of amino acid residues. in the case of small molecules, it may be necessary to enumerate the different possible bonded topologies for a given number of atoms and atom types. certain simplifications, such as treating rings or other groups as rigid bodies, may also be beneficial. for certain families of molecules, such as macrocycles, it may be necessary to explore alternative internal coordinate systems that better capture the constraints imposed by the cyclic bonded topologies. we note that auxiliary variables could be used in the kirkwood framework to impose constraints on the samples. for example, for the system studied in this work, by using end - to - end distance as a sampled variable, one could generate samples with a given end - to - end distance. in principle, kirkwood sampling can be performed using any number of pdf s of different orders. in practice, however, it is desirable to use as few pdf s as possible, since the computational cost is proportional to the number of pdf s used and also the accessible conformational space reduces with increasing pdf s. therefore, it would be useful to develop an adaptive scheme that successively adds pdf s for different combinations of variables to achieve a certain overlap with a target distribution. the overlap could be measured in terms of the acceptance ratio in a biased mc simulation. finally, we note that kirkwood sampling is a general method for sampling points in high dimensional spaces and methods presented here may be applicable to other areas which deal with high dimensional probability distributions such as machine learning. | we present two methods for barrierless equilibrium sampling of molecular systems based on the recently proposed kirkwood method (j. chem. phys.2009, 130, 134102). kirkwood sampling employs low - order correlations among internal coordinates of a molecule for random (or non - markovian) sampling of the high dimensional conformational space. this is a geometrical sampling method independent of the potential energy surface. the first method is a variant of biased monte carlo, where kirkwood sampling is used for generating trial monte carlo moves. using this method, equilibrium distributions corresponding to different temperatures and potential energy functions can be generated from a given set of low - order correlations. since kirkwood samples are generated independently, this method is ideally suited for massively parallel distributed computing. the second approach is a variant of reservoir replica exchange, where kirkwood sampling is used to construct a reservoir of conformations, which exchanges conformations with the replicas performing equilibrium sampling corresponding to different thermodynamic states. coupling with the kirkwood reservoir enhances sampling by facilitating global jumps in the conformational space. the efficiency of both methods depends on the overlap of the kirkwood distribution with the target equilibrium distribution. we present proof - of - concept results for a model nine - atom linear molecule and alanine dipeptide. |
it is now widely recognized that many rna molecules are predisposed to forming complexes with proteins by fluctuating spontaneously through an ensemble of structural states. protein recognition is referred to as conformational capture. a description of the physical principles involved in forming rna protein complexes via conformational capture requires complete description of the dynamics of these structurally labile rna molecules, including a characterization of long- and short - lived conformational states sampled by the rna. however, experimental characterization of transitory states is complicated by the fact that the rate of transition may be too fast to allow for a comprehensive catalogue of all states. thus, although progress has been made recently in experimentally isolating the partially folded states of proteins, the complete elucidation of protein or nucleic acid dynamics requires analytical and computational modeling to complement experimental observations. a common approach toward this goal is to fit a limited set of model parameters to experimental data that are sensitive to dynamics, such as nmr relaxation rates, line shapes, or residual dipolar couplings. this procedure involves guessing - and - checking, using physical constraints on possible motions of the labeled residue(s) to guide the model - building process. however, this semianalytic approach becomes complicated when further degrees of freedom and new free parameters are required by the model to fit the data adequately. a purely computational approach to the description of molecular states requires an accurate potential energy function (pef), followed by either molecular dynamics (md) or energy - minimization calculations. molecular dynamics simulations are able to generate dynamic trajectories of the molecule and, in principle, explore molecular parameter space if sufficient numbers of trajectories are available ; examples are found using the amber and charmm packages and others, such as lindorff - larsen. however, the extrapolation of dynamics in nucleic acids to time scales of the order of microseconds or longer, where many conformational changes are expected to take place, has only recently begun to be explored. energy - minimization techniques also rely on a well - validated energy function but involve the subsequent alteration of the relative conformations of parts of the molecule in an iterative manner to find the global energy minima. it is then possible to generate multiple sample structures more easily than for a complete md calculation. in the current manuscript, we utilize structures generated by energy - minimization techniques as a complement to md - based analyses of dynamics. use of energy - minimized structures is facilitated by the availability of structures on the rosetta server. other servers such as the mc - sym / mc - fold pipeline are also available that allow the user to obtain all - atom rna models. we use the hiv-1 tar (trans - activation response) rna molecule as a model for a dynamics simulation based on a set of 500 low energy models generated using the program farfar for the 29-nucleotide apical section of the rna (figure 1). the tar rna binds the viral regulatory protein tat, a critical transcription elongation factor essential for viral replication. the tat binding site surrounds the single - stranded, trinucleotide (ucu) bulge and is contained within the 29-nucleotide construct. the bulge region interlinking the two helical stems is the primary binding site for the tat protein and exhibits considerable flexibility allowing for the two helical regions to adopt a wide range of relative orientations., where the free tar rna exchanges between multiple conformers, one or more of which are amenable to tat binding. tar rna also provides a common rna structural motif, where two helices are connected by a single - stranded bulge on one end and a backbone hinge at the other. other rna s exhibit similar structures, such as k - turns, or the hiv-1 rre (rev - response element). it is therefore worthwhile to characterize the dynamics of such fundamental motifs, especially to characterize large - scale motions (as opposed to more localized motions) of one helical domain relative to another. 29-nucleotide apical stem - loop of hiv-1 tar rna : (a) secondary structure ; (b) sample tertiary structure. the different submotifs and the component residues used in the analyses are color - coded : upper helix (turquoise), lower helix (red), and the single - stranded bulge (green). earlier work in our group used solid - state nmr to identify intermediate rate motions for the residue u38 in the upper helix. we more recently characterized the motions of u40 and u42 in the lower helix (wei huang, unpublished data). these data indicate that the two helices move relative to each other at slow rates (10 to 10 s) relative to the rotational diffusion rate of the entire molecule (10 s). these results motivated us to look at the distributions of the orientations of the upper helix relative to the lower helix among the set of lowest energy structures, as characterized by the euler angles of an upper helix - attached reference frame relative to a different frame attached to the lower helix. reduction to a set of three angles characterizes many features of the dynamical trajectory of this particular structural motif, while simplifying a very large - dimensional problem to a set of three essential coordinates. local base librations, i.e., rotations of the bases around a base normal (representing vibrations of the base around the equilibrium base - paired orientation) or rotations of the base around the glycosidic bond (for the single stranded bases), are included in the simulations as well and provide atomistic detail regarding the motions of individual residues. here we extend our prior studies of nonrigid rotation and helix reorientation in tar rna to a full description of the concerted dynamics of the upper and lower helices and the bulged loop. our approach describes a dynamic trajectory based on an ensemble of energy minimized structures with the rosetta program farfar. because farfar does not provide a boltzmann - weighted distribution of states (and thus does not provide the entropy and free energy) our calculations rely on fitting phenomenological parameters to the data. to reduce the complexity of the problem, a predominant set of conformers we used experimental residual dipolar couplings (rdcs) obtained from partial alignment of the tar rna by one alignment medium to achieve this selection, and other groups have recently used similar filtering techniques. in addition to filtering out a set of long - lived conformers along the stochastic trajectory, we acquire information regarding their relative populations. we complement the rdc filter with principal component analyses (pcas) based on a judiciously chosen set of backbone torsion angles, as done to establish conformational clustering and free energy landscapes of rnas and proteins, and a pca can serve as a useful aid in setting up dynamics calculations. finally, we use the outcome of that analysis to calculate solution spin lattice relaxation times t1 and the rotating - frame spin lattice relaxation time t1 for c spins in nucleotides located in the upper and lower helices and in the bulge. the protocol would allow extensions to other observables as well, but the current work focuses on these to provide a clear proof of method. we direct the interested reader to more extensive work on other nmr relaxation parameters and their simulations. the first approach (slow exchange or se model) assumes an effectively infinite time scale of exchange (i.e., the conformational exchange is much slower than any other relevant motional time scale). the second approach (general rate or gr model) allows for an arbitrary time scale of exchange (including one that overlaps with the rotational diffusion time scale). by combining complementary experimental and analytical techniques into a single framework, we have been able to construct a viable dynamic trajectory for the tar rna. protocol used in this manuscript for the simulation of domain - dynamics in a molecule. we present here the solid - state nmr (ssnmr)-derived models that served as motivations for the solution relaxation simulations. ssnmr studies of the dynamics of the uridine bases u38, u23, and u25 in tar were carried out using samples selectively deuterated at the 5- and 6-carbon base sites. u38 was chosen to represent the dynamics of the upper helical stem, whereas u23 and u25 are of interest on account of their positions in the single - stranded bulge. more recently, 5,6-h labels were introduced at the u40 and u42 positions in tar, in correspondence with the lower helix (u42) and an unstable base pair that closes the bulge region (u40) (wei huang, unpublished data). the data included line shapes as well as t1z and t1q relaxation times collected on samples hydrated in all cases to 16 water molecules per nucleotide to reproduce conditions where motions were shown to be solution - like. each of the upper helical and single - stranded sites investigated had characteristically distinct spectral features. within the lower helix, u40 and u42 showed results similar to each other, but distinct from the upper helix or single - stranded sites. motional models generated to fit the data included a slower base motion consisting of jump between two equally populated sites, superposed on a faster motion occurring around the normal to the base - plane for the helical residues and around the glycosidic bond for the bulge residues. the analyses of the spectra recorded for the upper and lower helical sites were done independently resulting in two different sets of parameters. the u38 base was modeled as undergoing a two - site 4 jump process around the base - normal at a rate of 2 10 s in addition to a two - equivalent - site conformational exchange process, where the upper helix underwent a 9 bend and a 15 twist at a rate of 10 s relative to a crystal - fixed frame. a similar model could fit the data for the lower helix bases u40 and u42 as well, resulting in a 018 bending motion and a 1825 twisting motion of the lower helix, but at slower rates on the order of 10 s. by analyzing relaxation data, we observed small amplitude (6 to 9) local motions of the base at a rate of 10 s for both u40 and u42. the u23 data were fit by significantly different models, involving a local two - site jump about the glycosidic bond of 11 at a rate of 10 s, and a 24 hop of the base at a rate of 10 s, whereas u25 was modeled as experiencing a 30 jump at 6 10 s in addition to a much slower twisting of the base (6 10 s) with a large amplitude of 40. we utilized the same two - site jump models for the local base motions of both the helical and bulge residues, under the rationale that solid - state sample conditions should be able to replicate solution conditions at least in the small - amplitude local motions at the hydration conditions of our studies. we also used the time scale of the local base jumps as a starting point for simulations of the solution conditions. finally, we used the observation that conformational exchange motions in solution conditions occur on a time scale similar to that in solid - state samples. formalism for part of the relaxation simulations, which assumes an exchange process much slower than all other motional rates. we did, however, also consider the more general case of an arbitrary rate of conformational exchange. the torsion angles that were altered in the generation of the structures used here were those of the residues in the bulge and the bulge - adjacent base pairs of the two helical domains. the 500 lowest energy structures represented a distribution in energy of about 13 rosetta units, where 1 rosetta unit is approximately 1 kbt (rhiju das, private communication). to reduce the dimensionality of the problem, we assumed that the simple motif of a helix bulge helix can be represented by a reduced set of relative helical orientation parameters. a set of three euler angles transforming between the two helices is taken to be sufficient to discriminate between helical conformations (figure 3) if the helices behave as rigid units. relation between the euler angles determined from the atomic coordinates and the associated domain motions. we have used experimental residual dipolar couplings (rdcs) for several bonds along the molecule. because rdcs are long - time weighted averages over all conformational states of the molecule, they potentially provide means of extracting both the best - fit conformers and their relative populations. the structures that were selected by this rdc - filtering process, along with the best - fit populations, were subsequently used to simulate the solution relaxation times. we incorporated the local base motions obtained by fitting the ssnmr data into the rdc - selected structures and calculated the solution relaxation times using previously published methods. when a small amount of variation for the local amplitudes and rates of motion, and for the rates of conformational exchange between the selected structures, was allowed, the solution relaxation times for the 17 residues in the molecule could be calculated (7 in the lower helix, 3 in the bulge, and 7 in the upper helix) with this method. the relative orientations of the upper and lower helices were quantified by considering the orientation of the normal vector of the u38 base relative to a frame defined by a z - axis aligned with the lower helical axis. the method of evaluating this relative orientation and the subsequent binning of structures within this scheme is as follows:(a)define the upper and lower helical axes for all structures using the program 3dna. the upper helical axis is taken to be the average local helical axis of the a27-u38::g28-c37 and g28-c37::c29-g36 dinucleotide steps, where the base pairs flanking the bulge were excluded due to possible distortions from ideal a - form helical structure. the lower helical axis is calculated similarly as the average over the c19-g43::a20-u42 and a20-u42::g21-c41 dinucleotide steps.(b)define the lower helix coordinate frame (lhf) by choosing the lower helical axis (calculated above) as the z - axis and the perpendicular from the z - axis to the g43 c8 atom as the y - axis. this choice of the y - axis was made as the 500 structures did not differ in the orientations of the first few base pairs (including c19-g43), so the y - axis would be the same across all structures. however, the specific choice of the g43 c8 atom for this purpose was arbitrary.(c)calculate the angles for each structure, defined as the angle between the projection of the upper helical axis onto the xy - plane of the lhf and the x - axis of the lhf.(d)calculate the angles, defined as the angle between the upper helical axis and lower helical axis.(e)the angle is then defined by the orientation of the normal of u38 base (the vector perpendicular to the c4c2 and c6c2 bonds) about the upper helical axis. extracting this information from the structures requires first removing the and dependence by rotating the original u38 base - normal vector vu38norm about the fixed lhf axes as follows : vu38norm = rylhf()rzlhf()vu38norm. the resultant vectors are distributed around the lhf z - axis as a function of their angles. the euler angles described above are related to the domain motions as shown in figure 1.(f)bin the 500 structures as a function of the euler angle set {,, }. the bins were chosen in 10 increments for (0 360) and (0 180) angles, resulting in 36 and 18 bins, respectively. instead of binning the angle in terms of degree increments, we fixed the number of bins to 5 because of an observed correlation between the and angles, which results in a shift in the values of for every bin, as well as the restriction of the values to only a portion of the full phase space. thus, trying to bin all possible angles would have unnecessarily increased the computational time. define the upper and lower helical axes for all structures using the program 3dna. the upper helical axis is taken to be the average local helical axis of the a27-u38::g28-c37 and g28-c37::c29-g36 dinucleotide steps, where the base pairs flanking the bulge were excluded due to possible distortions from ideal a - form helical structure. the lower helical axis is calculated similarly as the average over the c19-g43::a20-u42 and a20-u42::g21-c41 dinucleotide steps. define the lower helix coordinate frame (lhf) by choosing the lower helical axis (calculated above) as the z - axis and the perpendicular from the z - axis to the g43 c8 atom as the y - axis. this choice of the y - axis was made as the 500 structures did not differ in the orientations of the first few base pairs (including c19-g43), so the y - axis would be the same across all structures. however, the specific choice of the g43 c8 atom for this purpose was arbitrary. calculate the angles for each structure, defined as the angle between the projection of the upper helical axis onto the xy - plane of the lhf and the x - axis of the lhf. calculate the angles, defined as the angle between the upper helical axis and lower helical axis. the angle is then defined by the orientation of the normal of u38 base (the vector perpendicular to the c4c2 and c6c2 bonds) about the upper helical axis. extracting this information from the structures requires first removing the and dependence by rotating the original u38 base - normal vector vu38norm about the fixed lhf axes as follows : vu38norm = rylhf()rzlhf()vu38norm. the resultant vectors are distributed around the lhf z - axis as a function of their angles. the euler angles described above are related to the domain motions as shown in figure 1. bin the 500 structures as a function of the euler angle set {,, }. the bins were chosen in 10 increments for (0 360) and (0 180) angles, resulting in 36 and 18 bins, respectively. instead of binning the angle in terms of degree increments, we fixed the number of bins to 5 because of an observed correlation between the and angles, which results in a shift in the values of for every bin, as well as the restriction of the values to only a portion of the full phase space. thus, trying to bin all possible angles would have unnecessarily increased the computational time. to select a subset of structures for multisite jump simulations from a starting set of 500 energy - minimized structures generated by farfar we only consider the data from a peg / hexanol mixture because this uncharged medium aligns the charged rna only through steric hindrance of the overall rotation. this situation does not require a detailed characterization of the rna charge density, as would be required for the simulation of rdcs measured in charged alignment media. extension to charged media data may be considered in the future. the purely steric version of pales was used to calculate the eigenvalues and eigenvectors of the saupe alignment tensor of the molecule by sampling multiple allowed orientations in the presence of a flat (infinitely large) obstruction. the alignment tensor eigenvalues are then used in conjunction with directional information for a particular bond relative to the alignment tensor principal axis frame (pas). for the purposes of simulating the experimental rdcs, the only motions to be considered are then the exchanges between distinct conformers. to include dynamic sampling of multiple conformations, we use the weighted average of the rdcs of each conformer rdcistotal = i=1nconformerspirdcisi for the rdc of a bond between spins i and s, with the population of each conformer i being represented by pi. the residues considered for this study were c19, a20, g21, a22, u40, c41, u42, and g43 from the lower helical stem, u23, c24, and u25 from the bulge, and g26, a27, g28, c29, g36, c37, u38, and c39 from the upper helical stem. the bond types included the c6h6 bond (pyrimidines), the c8h8 bond (purines), and the c5c6 bond (pyrimidines) from the bases, the c1n1 (pyrimidines) and the c1n9 (purines) glycosidic bonds, the c1h1 and c4h4 bonds from the furanose rings, and the c5h5 and c5h5 bonds from the backbone. furthermore, the rdcs for the bulge residues were considered separately, and not in the same simulations as the helical residues. this is because the bulge is likely to be significantly more mobile than the helices and will sample a significantly larger number of configurations, requiring a different set of simulation conditions. effective bond lengths of the species in question are required in the final pales calculation. the values we chose for the bond lengths are the aliphatic c h bond length, rch, aliph = 1.1, the aromatic c h bond length, rch, arom = 1.09 (average of ying. and allen.), the aromatic c c bond length, rcc, arom = 1.4, the glycosidic c n bond length for the cytosines, rcn, glyccyt = 1.47, and the glycosidic c n bond lengths for the remaining base types, rcn, glycrest = 1.48. to gain a geometric perspective on the best - fit structures from the rdc comparison, we binned the simulated couplings for each structure according to the {,, } angles determined for the 500 structures. the rdcs within each bin were then uniformly averaged to produce a single bin - rdc for each bond type and residue, rather than retaining the values for individual structures. this was done because, although the structures within each bin have similar helical conformations, they may differ in the orientations of bonds of certain residues relative to the large - scale conformations. by averaging over these variations in the bonds, we effectively included in the simulations the small amplitude thermal fluctuations of the atomic bond orientations. to select the best - fit set of structures, we started with an arbitrary initial set of n structures and allowed the choice of the (n + 1)th angular bin to float while attempting to optimize the total as well as the pearson s correlation coefficient between the simulated and experimental rdcs. in addition, we varied the relative weights of the (n + 1) bins. once the best - fit parameters were obtained for this first iteration, the (n + 1)th bin so obtained replaced the lowest probability structure from the remaining n, and the search was repeated for a second iteration and beyond. to make the final choice of n, we started with n = 2 and after minimizing the for a choice of two structures, we added a third and repeated the process. proceeding thus, we found that n = 5 structures (i.e., 5 bins which also happened to have only one structure in each of them) were sufficient to produce the best - fit to the rdc data, with no improvement after the fifth iteration. in addition, as a separate, independent check of the results of the previous procedure and to allow for the variation of the number of bins more easily, we generated a markov - chain monte carlo (mcmc) simulation to search through the bins and populations for a best - fit to the rdcs, with the potential for varying the number of bins. the number of parameters for an n - conformer search was 2n 1 (n bin choices + n 1 probabilities to be floated). the markov - chain monte carlo method did not yield better results than the iterative technique. to determine the number of exchanging conformers required to describe the dynamics in tar rna, and to corroborate the results of our rdc filter, we performed a principal component analysis (pca), following procedures applied to molecular ensembles of proteins, and rnas. the covariance matrix ij = (qi qi)(qj qj) was calculated as described by mu., i.e., by proposing the following variable set { q2j}:1where j is the jth torsion angle of interest, and ntorsion is the number of torsion angles used in the analysis. the use of the cosine and sine functions removes complications associated with the periodicity of the torsion angles by helping to uniquely identify particular values of the angles. the covariance matrix of these variables is calculated with averages over the full ensemble of structures and is subsequently diagonalized. the eigenvalues (and associated eigenvectors) are arranged in descending order, with the highest values representing modes with the largest contributions to the structural scatter. in our results, we have found that 2 or 3 modes contain a majority (70%) of the total variance in the data. in addition, histograms of the projections of the ensembles for each eigenvalue are examined for gaussianity. as discussed in the above references, a mode whose histogram consists of a single gaussian - like peak only represents continuous fluctuations about a central structure, whereas multimodal distributions describe discrete conformations separated by free - energy barriers. thus, from the perspective of assessing the conformational transitions of the molecule, only modes with multimodal distributions are considered relevant. our results for pcas with different choices of torsion angle sets (as described in the following) indicate that the first 2 or 3 modes were non - unimodal in distribution and therefore of primary significance in describing conformational exchanges. the first set included all torsional suites along the bulge and hinge region (pca method 1). the sugar - to - sugar suite as defined in the above reference consists of the set of 6 backbone torsion angles {,,,,, } as well as the glycosidic torsion angle. in our study, we focused attention only on the 6 backbone torsion angles. the residues included were a22, u23, c24, u25, g26, c39, and u40. these were meant to encompass the conformationally relevant part of the molecule under the assumption of relatively rigid helices. the number of torsion angles considered was therefore 42 (7 bases 6 torsion angles) resulting in an 84 dimensional pca (because the cosine and sine functions of the angles are treated as separate variables). however, the pca of this set resulted in several modes which contributed substantially, with no clear clusters in any of the largest modes. the inclusion of the single - stranded bulge region may have caused the lack of structure in the pca projections calculated in this first method, because single - stranded regions are significantly more flexible and may add a level of disorder to the torsional distribution. to isolate the interhelical motions, we evaluated the pca of only those torsional suites that extend from u38 to c39 and from c39 to u40 (pca method 2). these suites include only the hinge region of the molecule, and resulted in a 24-dimensional pca. to check the robustness of the clustering results obtained from method 2, we then carried out a series of pcas by successively including an additional sugar - to - sugar backbone suite : u38 through c41 (pca method 3), u38 through u42 (pca method 4), c37 through u42 (pca method 5), and c37 through u40 (pca method 6). the results of these analyses and the relation to the results from the rdc fit will be discussed in the results below. the evaluation of the solution relaxation times is based on two previously explored techniques. both methods involve the calculation of the two - time correlation function for the orientation of an atomic bond located within a nonrigid brownian rotator relative to a fixed laboratory frame. the evaluation proceeds by introducing an intervening reference frame associated with the principal axis system (pas) for the rotational diffusion tensor, which is time dependent as a result of exchange between different structural conformers. the correlation function then becomes dependent on wigner rotation matrices whose arguments are the euler angles that orient the rotational diffusion tensor of the molecule relative to the laboratory frame. in turn, the fokker planck equation in three - dimensions allows the evaluation of the transition probabilities from one set of euler angle orientations to another. planck equation, which accounts for coupling between rotational diffusion and conformational changes, is2where p(,,t|0,) is the probability that the molecule will transition from a diffusion tensor - to - laboratory frame orientation of 0 at time 0 and in a conformational state to an orientation of and a conformational state at time t, given diffusion tensor elements of dij in the conformational state and an exchange rate of r between conformational states and. this equation can also formally cover the case of continuous transitions to new conformational states by allowing the number of conformers to be infinite. however, in all cases considered in the original references, and here as well, only discrete jumps will be considered. if the exchange rate is much slower than the rate of diffusion and all other time scales of exchange processes, yet faster than the relaxation rates themselves, the rotational diffusion problem is effectively decoupled from conformational exchange. under these conditions, the se model applies, and it is possible to calculate the relaxation rates for the molecule as the weighted - average over the relaxation rates for the individual conformational states of the molecule:3 expressions for the noes can also be derived by appropriate weighting of the noes of individual conformational states. the procedure to calculate the relaxation times for each conformer are provided in the original reference. solution of eq 2 for the case of a general exchange rate (i.e., the gr model) between conformers involves considerably more analytical and computational processing. we have solved this problem for the case in which the eigenvectors of the diffusion tensors of the exchanging conformers are coincident at the moment of exchange (see ryabov. for general case) and correlation functions have been published. this general rate analysis also indicates that the slow exchange regime occurs at time scales longer than about 1 s. for the carbons considered in this analysis, the rotating frame z - relaxation time t1 was measured instead of t2. under the application of a weak spin - lock field and the assumption of lorentzian spectral densities therefore, for the purposes of this paper we operate under this assumption and simulate the t2 relaxation times. the structure set and the corresponding populations preselected by the rdc filter are the basis for simulations of the relaxation times using eq 2. eigenvalues and eigenvectors of the rotational diffusion tensor are first calculated using the public - domain program hydronmr. then orientations of the atomic bonds of the residues of interest are calculated with respect to this axis system, i.e., the principal axis system of the rotational diffusion tensor. the orientational parameters, together with the diffusion tensor eigenvalues are input into the two algorithms we have derived for simulations of the relaxation times of nonrigidly rotating macromolecules : (a) the slow - exchange formalism, describing the case where the conformational jumps occur at a rate much slower than the rate of overall rotational diffusion of the molecule, and (b) the general rate formalism, where arbitrary rates of exchange are allowed. the slow - exchange formalism, though merely a limiting case of the general rate theory, has the advantage of being significantly faster and easier to implement and so is considered here. the residues considered were a20, g21, a22, u40, c41, u42, and g43 from the lower helical stem, u23, c24, and u25 from the bulge, and g26, a27, g28, c29, g36, u38, and c39 from the upper helical stem. in the current work, we have only simulated the motions of the bases of these residues : the c6h6 bonds for the pyrimidines and the c8h8 bonds for the purines. the parameters used in the simulation include the atomic element radius (aer), the radius of the beads used in the hydronmr calculation of the diffusion tensor, and the bond lengths. the aer was chosen to be 2.3 and the bond lengths for the carbon hydrogen bonds for the aromatic bases were chosen to be 1.1, both choices having been justified in previously published work. the viscosity was chosen to be 1.096 cp to correspond to the conditions of the solution experiments (99.9% d2o at 25 c). we have also incorporated the two - site base motions inspired by simulations of the solid - state nmr (ssnmr) data : the so - called base libration occurs around a vector normal to the plane of the base in the case of helical residues, whereas the two - site motion is modeled to be around the glycosidic bond for the bulge residues. we floated the values of the rates and amplitudes of these two - site jumps relative to the ssnmr models, which were found to be on a time scale much shorter than that of the conformational exchange. for the slow exchange simulations, these internal, local motional rates and amplitudes were the only free parameters, whereas in the general rate simulations we floated the conformational exchange rates between the states. the fitting procedures were carried out in a combination of grid - searches and mcmc techniques. five structures provided the best values to fit the rdc data, as obtained by iteratively searching through the bins and updating the choices of bins and relative populations. they are shown in figure 4, and key characteristics are summarized in table 1. for simplicity, the structures will be referred to by their respective bend angles. thus, the highest population structure will be called the 45 structure, the second highest populate structure as the five structures obtained by the rdc - filtering procedure to represent the ensemble of tar conformation that describes the experimental data, together with their interhelical euler angles and population percentages. the for the best - fit set of structures was 11 460 for a set of 48 rdcs, with 9 degrees of freedom (5 bin choices and 4 probabilities), for a reduced r2 = 302 (= 11460/(48 9 1)), whereas the pearson s correlation coefficient was 0.72. it is to be noted that the represent unweighted values ; i.e., the discrepancies between the experimental and simulation rdc values are not inversely weighted with the error bars of the rdc values (which have not been calculated). this assumption is equivalent to assuming that the error on all measurements is 1 hz, which is likely to be a considerable underestimation of the true error bars. the comparison between experiment and simulation is shown in figure 5. in the figure, we further attempted an mcmc fit procedure with the possibility of 6, 7, or 8 structures but were unable to improve upon the fit. it is possible that this fit may be improved by the continuation of the mcmc procedure to a greater numbers of iterations, but the pca analysis reported in the following section provides further corroboration that the model found by rdc fitting represents the conformational landscape of the molecule well. comparison of the experimental rdcs (red triangles) with the rdcs generated by the best - fit simulation parameters (blue circles) for the helical residues in hiv-1 tar rna. the values shown include those for backbone (c5c5, c5h5), furanose (c1h1, c4h4), glycosidic (c1n1 for pyrimidines, c1n9 for purines), and base (c5c6 and c6h6 for pyrimidines, c8h8 for purines) bonds. plotting the calculated rdcs against the experimental values (figure 6), we found that the trend, on average, is toward an underestimation of the rdcs by the simulations. the dashed blue line in figure 6 is the best - fit line to the data and has a slope of 0.4 and a y - intercept of 3.9. an underestimation of the rdcs may arise from using a smaller degree of alignment in the simulations than in the actual experimental situation. one possible source of this discrepancy may be the current assumption of a simple steric model for the alignment of the molecule by peg / hexanol. recent work has proposed that there are subtleties in the alignment process, including the possible contributions of complex alignment medium topology and electrostatic alignment, that are not incorporated in simulations using only the basic steric version of the pales algorithm. plot of calculated rdc values vs experimental rdc values for the best - fit set of structures and populations. the dashed blue line is a linear fit to the data, and the solid red line is the ideal case where the calculated and experimental values match perfectly. this result is a cautionary statement in the application of simple steric models in the simulation of potentially complex alignment media. we attempted to fit rdc data collected in glucopone / hexanol mixtures and in pf1 filamentous bacteriophage media and found that the models selected were different (two or three of the structures chosen were the same compared to the peg / hexanol model). one obvious reason for this was the availability of rdc data for different bonds in the different media. however, there is potentially a fundamental difference in the alignment properties of the media as well. for example, the pf1 phage medium is negatively charged and, thus, as may be the case with peg / hexanol as well, the alignment has an electrostatic component. this must be taken into account more carefully in future analyses. to further discern the causes of the discrepancy in the fit, we looked at all helical rdc values that contributed to a deviation of magnitude 10 or greater and found a set of 18 rdcs : 8 correspond to c1h1 furanose ring bonds, 2 to c4h4 furanose ring bonds, and the remaining 6 to c6h6/c8h8 base bonds, occurring in 12 helical residues in both the upper and lower stems as well as among all four nucleotide types. the large deviations observed for furanose ring bonds indicate the existence of additional motions localized to the furanose rings, as has been reported for dna, that have not been accounted for using the current set of 500 structures. these motions involve an exchange between the c2-endo and c3-endo conformations, and on the time scale of the rdcs these motions may be averaged out to produce an intermediate conformation. it is likely that the furanose ring samples these conformations even for the residues stacked in a helical configuration. a similar argument holds for those base bonds that show a large discrepancy in rdc values : there may be additional vibrations in the base orientations that are not adequately sampled by the 500 structures. we also compared the five structures selected above to the set of 20 lowest energy tar rna structures recently generated on the basis of noe data that have not been constrained by rdc data. upon calculating helical axes and orientations in the same manner as for the 500 farfar structures in this manuscript, we find that 11 out of 20 of the structures, including 3 out of the 5 structures that best fit the noe data, occur within the same 10 bend angle bin as the highest population structure from the rdc fit described above. thus, we believe that our approach identifies a predominant conformation set. to test the robustness of the search algorithm, we performed two simulations of fitting a reduced data set upon the random removal of (a) 10 rdcs and (b) 15 rdcs (different rdcs were deleted in each of these two cases). removing the first set of 10 resulted in the selection of the same 5 conformers as from the full set, along with a sixth new structure with a population of 4%. the populations of the 5 full - set best - fit structures were slightly different (maximum change of 12%). removal of 15 rdcs reproduced 4 out of the 5 full - set best - fit structures, and two new conformers with populations of 7% and 5%. the maximum change in population among the 4 best - fit structures was 7% in this case. these results indicate that the choice of structures is robust to a reduction in the size of the experimental data set. jumps between the five conformers shown in figure 4 require a combination of bending and twisting about either the lower or the upper helices. among the entire set of energy - minimized structures, there was an observed correlation between the and angles, as has been reported previously. these correlations may be reflected even in the jumps among this set of five structures, representing a free energy landscape where the exchanges between minima involve coupled shifts in euler angle values. we carried out a series of pcas to (a) identify the choice of torsion angles that best captures interhelical motions, (b) corroborate the rdc - filtered set by overlaying the five chosen structures on the clusters obtained from the pca of choice, and (c) identify jump matrix elements for the exchanges between the five rdc - filtered structures in the dynamics calculation. given the lack of clear clustering results from pca method 1, which incorporates all backbone torsion angles in the bulge and hinge, we examined whether torsion angles on one side of the helical joint would suffice to describe the interhelical reorientation (pca method 2, incorporating the backbone torsion angle suites between u38 and u40). when this was done, only the first two principal components (pcs) contributed significantly, accounting for 75% of the fluctuations in the molecule (figure 7). furthermore, these two pcs were the only ones with a multimodal probability distribution across the 500 structures. this non - single - gaussian distribution signals the presence of conformational clusters in energy minima separated by significant free energy barriers. the map of these two pcs is shown in figure 7a and shows the presence of three to four major conformational clusters. the large red dots superimposed on the 2d plot correspond to the five structures selected from the rdc filtering procedure. parts b and c of figure 7 show the population distribution histograms for pc 1 and pc 2, respectively. again, the positions of the five structures from the rdc filter are indicated by red arrows. principal component analysis of the torsion angle suites along the hinge (residues u38 through u40). (a) principal components 1 and 2 for the 500 structures, represented by blue dots, with the positions of the five best - fit structures marked explicitly by red dots, and further encircled for clarity. (b) histogram of the first principal component (corresponding to the largest eigenvalue of the covariance matrix), with the positions of the five best - fit structures marked explicitly by red arrows. (c) histogram of the second principal component (corresponding to the next - to - largest eigenvalue of the covariance matrix), with the positions of the five best - fit structures marked explicitly by red arrows. first, the five structures chosen as the best - fit set match up well with the main conformational clusters obtained from this pca, suggesting that our rdc - filtered set has captured the relevant information about the major conformational clusters of the molecule. second, structures with similar interhelical bend angles have similar values of each of the principal components. the principal component values of the two structures with bend angles of 115 and 132 occur in close proximity to each other. the same is true of the pair of structures with bend angles of 61 and 76 (it is true, however, that the 45 structure does not differ significantly from the 61 structure ; the pca suggests that there is a free energy barrier that separates even these two neighboring structures). this is important because other pca methods (described below) separate structures with similar interhelical orientations, possibly due to the presence of additional degrees of freedom that do not contribute significantly to interhelical reorientation. finally, the sums of the probabilities of the best - fit structures within each cluster are similar to each other : the 45 bend structure has a population of 29%, the 61 and 76 structures have a joint population of 40%, and the 115 and 132 structures have a joint population of 31%. because the histogram heights do not correlate well with the nearly uniform probability distribution, we fit the jump rates numerically, as described below. subsequent attempts at testing the robustness of our cluster analysis yielded further interesting results. pca method 3 (u38 through c41) showed a marked difference in clustering of the structures. three pcs contributed significantly, yielding about 70% of the total fluctuations, with all three now being multimodal. however, the five structures do not all seem to fall within major clusters. moreover, the 61 and 76 structures no longer fall within the same cluster, nor do the structures with bend angles of 115 and 132. this occurs because of the intervention of the torsion angles associated with u40. when the helical parameters of the 500 structures were searched, about 37% of the structures u40 did not form a canonical watson crick pairing with a22, indicating considerable conformational variability of this residue, at least within the physical picture generated by the energy - minimization ensemble. to test this hypothesis, we extended the pca up to u42 (pca method 4) on the lower stem and up to c37 on the upper stem (pca method 5). both these methods gave very similar clustering to method 3, with three significant pcs. we interpret this observation as confirmation that, after the inclusion of u40, the remaining residues behave fairly rigidly and do not change the results of the pca. as a final confirmation of this conclusion, we carried out a pca including only torsion angles from c37 to u40 (pca method 6). the clustering results for this pca proved to be the same as for pca method 2. given the change in clustering associated with the inclusion of the u40 degrees of freedom, we utilized the results of pca method 2 to set up the rate matrix for the relaxation time simulations. in general, for n conformers, the number of combinations of pairwise rate constants that need to be fit is c2. given the clustering suggested by the pca, we reduce the fit problem from 10 (= c2 for the five rdc filter structures) to five parameters in the following manner. for pairs of structures that occur within the same cluster in the two pc distributions, we allow for only one distinct exchange rate between both members of the pair in that cluster and any structure in another cluster. thus, the rates used in the fitting process were for the following exchanges : these exchange processes are shown graphically in figure 8. the assumption in this parameter reduction is that all the structures within a cluster are separated from other clusters by similar free energy barriers. exchange between clusters inferred from the pca, together with the five rates used in the jump matrix for the relaxation time simulations. the rdc - filtered conformer set of five structures, together with the relative probabilities, were used to calculate the t1, t2 and noe values. we used two different approaches to calculate the c6h6 (pyrimidine) and c8h8 (purine) relaxation times : (a) the slow exchange method, where the assumption is that the exchanges occur at an infinitely slow rate (compared to the rotational correlation time), and (b) the general rate method, where we fit the relaxation times by allowing the exchange rates to vary arbitrarily. the general rate analysis has shown that the slow exchange regime in tar rna effectively occurs for time scales longer than about 1 s. thus, the results of this subsection assume conformational exchanges occur on a scale longer than 1 s. as a starting point for the fitting process, we use rates and jump amplitudes for the base librations close to those obtained to fit the solid - state nmr data of the uridines, and changed both the rates and amplitudes in small increments to improve on the. using the fit to the t1 values as a benchmark, we found that it suffices to fit only two base - libration rates, one for the upper helix residues and one for the lower helix residues. this simulation model was inspired by the results of the two solid - state nmr analyses. the exceptions, however, are the parameters for u40 and u42 in the lower helix. we obtain a significantly better fit by using the rates and jump amplitudes for the upper helix for these two residues, indicating that these residues are more similar in local base motion to the upper helix. windows in the plot for the local motion parameters, with the upper and lower helical parameters behaving independently. the rates in these windows vary between 10 s and 10 s, whereas the amplitudes are less than 20. we did attempt simulations of additional models of base - libration such as a treatment of the rates of purines and pyrimidines independently, and the assumption of a constant rate across the entire molecule. there is always the possibility that more complex models of base libration rates may fit the data better ; for example, we may treat the libration rate of each individual residue as an independent parameter, or choose the purines and pyrimidines in the lower helix as independent from the purines and pyrimidines, respectively. however, this would increase the number of free parameters in the problem, and we chose the above model as a balance between an arbitrary increase in free parameters and an attempt at a physically realistic representation. the following representative values of the local motion parameters simulate the relaxation times well:(a)upper helix, u40 and u42 base - libration rate = 4.6 10 s(b)upper helix, u40 and u42 base - libration jump amplitude = 13.7(c)lower helix (without u40 and u42) base - libration rate = 6.6 10 s(d)lower helix (without u40 and u42) base - libration jump amplitude = 9.8 upper helix, u40 and u42 base - libration rate = 4.6 10 s upper helix, u40 and u42 base - libration jump amplitude = 13.7 lower helix (without u40 and u42) base - libration rate = 6.6 10 s lower helix (without u40 and u42) base - libration jump amplitude = 9.8 the match between the experimental and simulation relaxation t1 and t2 values is shown in figure 9. for quantitative comparison, we calculated the root - mean - square deviation (rmsd) across the 14 helical t1 values to obtain an rmsd of 5.3 ms. relaxation time simulations for the c6h6 (pyrimidine) and c8h8 (purine) bonds using the slow exchange method, and comparisons of residuals (discrepancies relative to experimental values) to statistical error bars : (a) t1 simulations (blue circles) compared to the experimental t1 values (red triangles) ; (b) t2 simulations (blue circles) compared to the experimental t2 values (red triangles) ; (c) difference between simulation t1 and experimental t1 values, together with the statistical error bars on experimental data (red dashed lines) at 3.2 ms ; and (c) difference between simulation t2 and experimental t2 values, together with the statistical error bars on experimental data (red dashed lines) at 0.5 ms. the error bars shown in figure 9 describe the statistical error in the measurements. however, the potential systematic error, not quantified by the authors, is larger. yet, even at this level of uncertainty there is a consistent difference between the best - fit local jump amplitudes for the upper and lower helices, with the lower helix amplitudes being larger on average (this is not reflected in the parameter set shown above but is true for the best - fit windows in general). thus, the solution relaxation times can be fit to an rmsd close to the statistical error in the experiments by assuming a slow exchange rate (i.e., slower than 10 s) between the five structural configurations of tar rna shown in figure 4 with populations determined by rdc filtering and further corroborated by principal component analysis. the model assumed base - libration rates that range between 10 and 10 s, and libration - rate - dependent jump amplitudes less than about 20. the solid - state nmr parameters for the local base - libration parameters fall within the windows described above, consistent with the notion that solid - state experiments are able to capture the solution - state local motions accurately. although the slow exchange method provides an approximate scale for exchange processes, the general rate method could further resolve the values of the exchange rates between conformers. for ease of comparison, we used the local base motion rates and jump amplitudes from the slow - exchange fit, whose results were shown in figure 9. although several combinations of 5 pca - inspired rates were found that could be fit to the 14 helical t1 and 14 helicalt2 values with comparable rmsd s, in all cases the inter- and intracluster exchange rates were on the order of 1010 s, which confirms the validity of the slow exchange approximation. for example, the set of inter- and intracluster exchange rates in table 2 yield the base relaxation times shown in figure 10 with an rmsd for t1 values of 5.2 ms and an rmsd for t2 values of 1.4 ms. interestingly, there is no clear distinction between the intercluster and intracluster rates, as may be expected from a significant difference in the free energy barriers. relaxation time simulations for the c6h6 (pyrimidine) and c8h8 (purine) bonds using the general rate method with inter- and intracluster exchange rates from table 2, and using the same local base motion parameters as for figure 9 : (a) t1 simulations (blue circles) compared to the experimental t1 values (red triangles) ; (b) t2 simulations (blue circles) compared to the experimental t2 values (red triangles) ; (c) difference between simulation t1 and experimental t1 values, together with the statistical error bars on experimental data (red dashed lines) at 3.2 ms ; (c) difference between simulated and experimental t2 values, together with the statistical error bars on experimental data (red dashed lines) at 0.5 ms. to summarize, if we fix the local motion parameters to the best - fit set obtained using the slow - exchange method but float the conformational exchange rate parameters, we obtain a slight improvement in the quality of the fit. best fits to experimental relaxations using general rate theory are achieved with inter- and intracluster exchange rates on the order of 1010 s, thus justifying the slow exchange approximation of the prior section. we did not float both local motion parameters and conformational exchange parameters simultaneously, but it is reasonable to assume that the results will be similar, especially when we constrain the scale of the local base motion parameters to those observed under solid - state conditions. in addition to helical residues, we also simulated the relaxation times for the bulge residues using the slow exchange and general rate algorithms. in table 3, we present relaxation time simulations assuming exchange between the conformations shown in figure 4 using the slow exchange and general rate algorithms. the base rotation rate is selected as 5 10 s and the amplitude as 15 (to yield good matches to the t1 values). for the general rate simulations, inter- and intracluster exchange rates shown in table 2 were assumed. we obtain simulated t1 values that are within 2% of experimental data, but simulated and experimental t2 values for u23 deviate by about 16% ; for c24, the relative deviation is even greater. this is likely due to the fact that the t2 relaxation time has a spectral density component (the j(0) term) that makes this observable sensitive to motions much slower than the larmor frequencies of carbon-13 and protons (which are on the order of nanoseconds). the fact that we have been unable to capture the t2 values may indicate that there are additional slower motions of these relatively underconstrained residues that are missing from the conformer set we have selected. although we have been able to successfully match most of the solution relaxation times to almost within the statistical error bars using the rdc - filtered conformer set, we must address the basic question, are the relaxation times sensitive to motions occurring at rates on the order of microseconds or slower ? though the t1 time has no spectral density dependence slower than a time scale of a nanosecond, the t2 are determined by slower motions as well and their expressions contain a dependence on the j(0) spectral density. more importantly, the slow exchange and general rate methods depend on the fact that the time scales of rotational diffusion of many molecules (including the tar rna considered here) overlap with the time scales to which both t1 and t2 are sensitive. thus, two different conformers, with slightly different diffusion tensors will have different characteristic relaxation times when calculated separately. even the slow exchange averaging process will result in a unique linear combination of relaxation rates that becomes discernible when enough data points are compared. the general rate theory loses some sensitivity to dynamics for rates much slower than a microsecond, but our least - squares simulations for relaxation times have shown that there is still discernible information to be gained at these time scales. in this manuscript, we introduce a methodology based on energy - minimized structures that ties together structural and dynamic data, as well as solid - state and solution nmr, to build a dynamic trajectory for the hiv-1 tar rna to atomic - level detail. the protocol uses (a) solid - state nmr data to acquire information about local motions of the bases, (b) solution nmr rdc data to identify conformational states and their relative populations, (c) pca analyses to identify degrees of freedom relevant to the overall reconfiguration of the molecule, as well as to corroborate the clustering of structures and choose parameters for the dynamics analysis, and (d) solution nmr relaxation time simulation techniques previously developed to simulate experimental data and fit the jump rates between the molecular conformers. the experimental data utilized covers a wide spectrum of motional time scales, from the picosecond scale for solution relaxation times and micro- to nanosecond times derived from solid - state nmr line shapes to the submillisecond time scale investigated with rdcs. the method reproduces relaxation data at multiple helical residues within the molecule using only five structures out of a set of just 500 possible conformers. the advantage of this approach lies in the coverage of multiple time scales, including long time scales that are difficult to sample with md, and the ease with which energy - minimized conformers may be obtained for small - to - midsized molecules using public - access software like the rosetta suite of programs. the use of these structures inverts the problem of dynamics relative to md methods : instead of starting with an initial structure and running the clock forward from t = 0, we filter out long - lived structures using experimental data and interconnect them in a stochastic trajectory. thus, the results from such a technique would prove valuable to corroborate md - based simulations, and the protocol could provide a less computationally intensive alternative to extended molecular dynamic simulations. we have been able to simulate relaxation times of most of the helical residues in the molecule with limited conformational sampling from an already small set of structures. the success in matching the experimental data indicates that, to gain an understanding of the gross motional properties of rna, it is sufficient to sample the limited phase space of the particular structural motifs that constitute the molecule. this protocol was designed to derive a geometric picture of interhelical reorientation based on the limited conformational space available to the torsion angles in and around the bulge and hinge regions. the assumption that the helices are rigid and the requirement to close the loop formed by the single stranded bulge, adjacent helical base - pairs and the hinge backbone should restrict conformational possibilities for the entire molecule. steric hindrances and limitations on the stretchability of the single - stranded region would further impose constraints on molecular reorientation. in practice, we found that parameter space for the reorientation of one helix relative to the other was expanded by the possibility of one of the bulge adjacent base pairs opening up. among the energy - minimized structures, a significant number had a missing a22-u40 base pair the u40 base often forms a stabilizing interaction with u25 instead and, among the full set of 500 structures, sometimes with u23 and c24 as well. we allowed these possibilities to occur in our sample set to reflect fluctuations in the residue orientations, as well as the impacts of these fluctuations on overall molecular conformation. thus, we believe that models generated using well - vetted potential energy functions can identify sites where new intramolecular bonding and conformational variability might occur. furthermore, we made a conscious choice to characterize the structural bins by their euler angles. this choice of parameters has been made previously to enhance reproducibility and comparability to other analyses of the molecule. such a parametrization represents the core ingredient of most molecular analyses : reduction of the dimensions of the problem to render it tractable. molecular studies often aim to distill out a few degrees of freedom that are implicated in determining either the structure or dynamics of the system, and many different techniques (ramachandran plots, phenomenological models, pca analyses) are directed toward identifying a minimal set of relevant coordinates. the methodology relies on the assumption that energy - minimized structures sufficiently populate the available conformational space, i.e., on the assumption of ergodicity. if ergodic behavior holds, then a sufficiently representative characterization of the energy landscape of the phase space will allow a calculation of the requisite time averages of observables. in the case of the tar rna, the structural motif (helix bulge helix) is fairly simple, and it is possible to cover a large region of the interhelical orientation space with a relatively small number of structures. for more complex structural motifs, it would be necessary to generate a sample set that covers both the space of molecular reorientations and the range of conformations of local residues relative to a fixed large - scale molecular orientation. even in the current work, it is possible that we have under - sampled the full range of conformations available to the bulged loop. a richer sample of both interhelical orientations and orientations of bulge residues relative to particular interhelical orientations may improve the rdc fit. a second assumption is that the slow exchange (se) and general rate (gr) methods assume coincidence of the diffusion tensors at the moment of exchange. this is not a significant problem for conformers that are not significantly different, but it could pose problems for conformers that are widely separated in conformational space. we have not attempted to quantify the actual deviation in relaxation times on account of this assumption. finally, it bears mentioning that there is a 2-fold degeneracy in the choice of the unit eigenvectors of the rotational diffusion tensors, with the negative of a given choice of unit vector being acceptable as the eigenvector as well. the choice of eigenvectors does not change the results for the slow exchange formalism (the expressions are invariant to such changes) but does impact the general rate theory expressions. for example, keeping the z - axis the same, the two choices of a right - handed coordinate system vary by 180 and would artificially introduce such an extra jump into the calculations. the means of consistently dealing with such a jump is to track the diffusion tensors as a function of changes in the shape of the molecule, either visually or geometrically and ensure that there is no additional change in the diffusion tensor orientations due to axis inversions. in our particular case, we tested our calculations by artificially inverting the orientation of the diffusion tensors of some of the structures and found very small changes in the relaxation times as a result : a change of at most 0.25 ms in t1 and at most 0.02 ms in t2. these changes would not significantly impact the conclusions of this manuscript and a detailed analysis is omitted here. we examined the five structures selected from the rdc - filter in light of unbound tar rna structures generated using noe constraints (but not rdc constraints) by one of the authors. these 20 energy - minimized structures, termed the tar2013 series, have angles in the range 3859, but the five lowest energy structures cover a smaller range of 4553. this range corresponds well to the bend angle of highest population structure we have obtained (i.e., = 45). in fact, the lowest energy tar2013 structure has an value of 202 and a value of 225, similar to the we previously published two studies where the new methods developed to simulate relaxation times were applied to u38 relaxation data and used to select regions of interhelical motional parameter space that fit the data. the models consisted of two - site jumps between the lowest energy structure of 1anr and structures artificially modified from that structure to reflect changes in interhelical orientation. the closest approximation to a two - site jump in this manuscript is found by considering only exchanges between pairs of conformers within the three most populated structures (the 45 structure, the 61 structure, and the 115 structure, which are almost equal in population). the exchange between the 45 and the 61 structures involves a bend angle modification of 16, and a twist angle about the upper helix of 2. cross - checking this parameter set against the results of applying the general rate theory, we find that the u38 data was fit by a two - site jump model with a twist of 0 and bend angle between 5 and 12 (among other possible models). thus, the 45 and 61 structures fit the profiles of two structures selected previously on the basis of the u38 data alone. exchanges between either of these structures and the 115 structure, however, are of a magnitude not simulated in the previous studies. we can also make a few basic comparisons to the results of dayie., even though the authors consider the hiv-2 tar rna, as both molecules consist of a helix bulge helix motif. given our focus on the c6 and c8 atoms in the current work, we first observe a similarity in the fact that in the relaxation data used in this work (from bardaro.) the helical residues seem to have similar c (c6 and c8) t1 relaxation times, a fact observed in the work of dayie. as well however, the u23 c t1 is nearly half the value of the corresponding u25 time in dayie., whereas bardaro. report values much closer in magnitude. also, the magnitudes of the t1 and t1 relaxation times in the two papers are different. we mention these facts to bring up three relevant considerations in interpreting the results of the two different sets of experiments : (a) the obvious difference made by the presence of only two residues in the bulge in hiv-2 rna versus three in the hiv-1 rna ; (b) the fact that the relaxation times of dayie. include a component from the c5c6 dipolar coupling for pyrimidines, whereas this coupling is explicitly suppressed in bardaro. (see shajani and varani) ; (c) the use of a model - free analysis in dayie. versus the se and gr methods used herein. notwithstanding these caveats, the common results we can extract are that both papers observe significant flexibility in the u23 and u25 residues and rigid, slow motions in the helices. to examine the extent to which our approach matches results obtained by the md approach, we compare our results to those of salmon., where the authors describe the selection of conformers from 8.2 s md simulations of the tar rna using pf1 phage - aligned rdc data sets. it was reported that the best fit to rdc data is obtained with a set of 20 conformations selected from the full md ensemble. though it is not possible to compare the absolute values of the interhelical bend and twist angles due to differing methods of characterizing the helices and their relative orientations, we can compare the spans of the angles reported for their ensemble to those in ours. ensemble of 20 span 88 (from 3 to 91) whereas those in our ensemble span 87, the rotations of the upper helix about the lower helical axis span 191 in their ensemble whereas those in our set span 215, and the rotations of the upper helix about its own symmetry axis span 224 in their ensemble and 210 in ours. thus the span of angles obtained by the two approaches are in excellent agreement. moreover, the full, prefilter ensembles in both papers show correlations between the and twist angles. a more fine - grained comparison relates to the behavior of individual residues. we have already mentioned that the a22-u40 base pair is often found to be open among the full set of 500 structures. we also find that, among our five rdc - filtered structures, four (the 45, 76, 115, and 132 structures) lack a a22-u40 base pair. however, the g26-c39 base pair is maintained in all five of these structures. find a similar asymmetry between the a22-u40 base pair and the g26-c39 base pairs in their rdc - selected ensemble, with the former adopting a broader conformational distribution and the latter being in an a - form helix - like conformation. report the occurrence of three clusters within their rdc - selected ensemble : a 66% population cluster with a22 stacked on u23, a 19% population cluster with u23 flipped out, and a 15% cluster with paired u25-u40 and unpaired u23 and c24. with regard to the third cluster, nearly 30% of the 500 energy - minimized structures used in our analysis show a u25-u40 pair, with three of the rdc - filtered structures (the 45, 76, and 132 structures) included in this list as well. the 115 structure simply lacks the a22-u40 pair and does not have any alternative pairings of either residue. stated that the u25-u40 pair is predicted to be the second most energetically favorable bulge conformation in mc - fold. a visual inspection of our structures shows the following behavior for the bulge:(1)the 45 structure has u23 flipped into the interhelical space but not stacked, c24 is flipped in but not stacked and u25 is paired with u40.(2)the 61 structure has u23 stacked on a22 and has c24 and u25 flipped out.(3)the 76 structure has u23 flipped out, c24 stacked with u25, and u25 paired with u40.(4)the 115 structure has u23 flipped out, c24 flipped in and stacked close to u25, and u25 flipped in and stacked only with c24.(5)the 132 structure has u23 and c24 flipped in but not stacked and has u25 paired with u40. the 45 structure has u23 flipped into the interhelical space but not stacked, c24 is flipped in but not stacked and u25 is paired with u40. the 61 structure has u23 stacked on a22 and has c24 and u25 flipped out. the 76 structure has u23 flipped out, c24 stacked with u25, and u25 paired with u40. the 115 structure has u23 flipped out, c24 flipped in and stacked close to u25, and u25 flipped in and stacked only with c24. the 132 structure has u23 and c24 flipped in but not stacked and has u25 paired with u40. thus, only one of the structures in our ensemble (the 61 structure with a 27% population) has a significant a22-u23 stacking interaction and two have u23 flipped out (39% total population), a clear deviation from the results of salmon., suggesting that the conformational variability of this region is more than can be captured by a small number of sampled structures. a solution to this problem is to generate energy - minimized structures where the interhelical orientation is fixed (or nearly so) and the bulge flexibility is evaluated under the constraint of fixed end points. such an analysis would establish the inherent conformational flexibility of the bulge. to cross - check the results of the program hydronmr, we recalculated the diffusion tensors using the program best, which tessellates the solvent - accessible surface of the molecule and calculates the various diffusion properties using a finite element analysis. the eigenvalues of the rotational diffusion tensors (in ascending order) of the two programs are compared in table 4. we find that the diffusion tensor eigenvalues as found by best were uniformly smaller than those found by hydronmr, indicating that hydronmr underestimated the hydration effect relative to best. we subsequently calculated the relaxation times using the slow exchange formalism and found a t1 shift of at most 18 ms and a t2 shift of at most 1.2 ms, corresponding to a shift of about 4% of the experimental values for both relaxation times. this may modify the choice of parameters described above, but we believe that the impact will not be substantial. we have carried out a characterization of the essential dynamics of the tar rna molecule using techniques with time scale sensitivities ranging from subnanosecond (solid - state and solution relaxation times) to millisecond (rdcs). we have been able to capture the long - time scale behavior of the conformational exchange processes that characterize this molecule and fit experimental relaxation times very well, with exchanges between discrete conformers occurring at time scales longer than 1 s. the similarities of results of this method with those of extended md simulations provide independent corroboration of our conformational analysis. further computational explorations and sample - size increases will enhance the results obtained by this methodology. | complex rna structures are constructed from helical segments connected by flexible loops that move spontaneously and in response to binding of small molecule ligands and proteins. understanding the conformational variability of rna requires the characterization of the coupled time evolution of interconnected flexible domains. to elucidate the collective molecular motions and explore the conformational landscape of the hiv-1 tar rna, we describe a new methodology that utilizes energy - minimized structures generated by the program fragment assembly of rna with full - atom refinement (farfar). we apply structural filters in the form of experimental residual dipolar couplings (rdcs) to select a subset of discrete energy - minimized conformers and carry out principal component analyses (pca) to corroborate the choice of the filtered subset. we use this subset of structures to calculate solution t1 and t1 relaxation times for 13c spins in multiple residues in different domains of the molecule using two simulation protocols that we previously published. we match the experimental t1 times to within 2% and the t1 times to within less than 10% for helical residues. these results introduce a protocol to construct viable dynamic trajectories for rna molecules that accord well with experimental nmr data and support the notion that the motions of the helical portions of this small rna can be described by a relatively small number of discrete conformations exchanging over time scales longer than 1 s. |
cellular genomes are constantly exposed to various sources of dna damage (ciccia and elledge, 2010, hanawalt, 2015, hoeijmakers, 2009, jackson and bartek, 2009), threatening not only genome stability, but also the integrity of chromatin organization (adam., 2015, lukas., 2011, the basic unit of chromatin is the nucleosome core particle, in which dna is wrapped around a histone protein octamer comprising an (h3-h4)2 tetramer flanked by two h2a - h2b dimers (kornberg, 1974, oudet., 1975, luger., 1997). variations at the level of this repetitive unit, through histone variants and post - translational modifications (bannister and kouzarides, 2011, maze., 2014, talbert and henikoff, 2010), as well as further chromatin compaction, constitute a major source of information that regulates gene expression and cell identity (filipescu., 2014, probst., 2009). how chromatin is reorganized in response to dna damage and to which extent the information that it carries can be preserved is thus of fundamental importance. our current view of chromatin dynamics following dna damage in human cells is based on the access - repair - restore (arr) model (polo and almouzni, 2015, smerdon, 1991). this model postulates that chromatin is first disorganized in response to dna damage, which facilitates access to repair factors, followed by restoration of chromatin structure. yet, it is still unclear whether, when, and by which mechanisms the pre - damage chromatin state is restored (dabin., 2016). notably, chromatin restoration after damage involves the deposition of newly synthesized histones (adam., 2013, luijsterburg., 2016, polo., 2006), which could potentially replace damaged histones and leave a mark of the damage experience. thus, assuming that nucleosome density remains at a steady state, a subset of parental histones should be evicted from chromatin during the access step, which would limit the capacity to recover the original epigenetic information at damaged sites (figure 1a). consistent with this idea, recent reports provide evidence for nucleosome destabilization and histone eviction during dna double - strand break repair (goldstein., 2013, li and tyler, 2016, xu., 2010) and in response to uvc irradiation (lan., 2012, uvc damage sites also show reduced histone density, promoted by the uv damage sensor ddb2 (dna damage - binding protein 2) (luijsterburg., 2012). however, a massive loss of parental histones from damaged chromatin would certainly threaten epigenome maintenance. to fully understand how chromatin integrity is preserved or altered in response to genotoxic stress, it is critical (1) to examine the fate of parental histones present in chromatin before damage and which carry the original epigenetic information and (2) to track them long enough after damage to examine their contribution to repaired chromatin together with newly deposited histones. we developed two complementary approaches for specific tracking of parental histones following uvc damage in human cells. challenging our current view of damaged chromatin rearrangements, we show that rather than being massively evicted and lost from damaged chromatin, parental histones redistribute in a conservative manner and subsequently recover. our mechanistic studies demonstrate that both the redistribution and recovery of parental histones are tightly coordinated with repair progression through the uvc damage sensor ddb2. we thus propose a conservative model by which parental histone dynamics coupled to dna damage repair contribute to the maintenance of epigenome integrity during the response to uvc damage. we developed two complementary approaches combining uvc laser micro - irradiation with specific tracking of parental histones in living cells. we first took advantage of the snap - tag technology, which we exploited previously to follow new histone deposition at uvc damage sites (adam., 2013), to fluorescently we used u2os cells that stably express h3.3-snap histones (dunleavy., 2011) and a gfp - tagged version of the repair factor xpc (xeroderma pigmentosum c) for visualizing damage sites in live cells (figure s1a). real - time imaging of parental h3.3 dynamics after local uvc irradiation revealed a rapid reduction of the red fluorescence associated with parental h3.3, which was restricted to the damaged chromatin area marked by gfp - xpc and detectable at least for 1 hr after irradiation (figure 1b). we observed a similar decrease of parental h3.3 signal in cells that do not express gfp - xpc (figure 1c ; movie s1), thus showing that exogenous expression of the repair factor xpc does not alter the histone response to uvc. uvc damage led to a progressive reduction of the red fluorescence associated with parental histones, with a maximum of 40% loss 10 min after dna damage infliction (figure 1c). we verified that the region of low histone density observed after damage did not correspond to a nucleolus (figure s1b). we also ruled out the possibility that the decrease in parental h3.3 signal could result from photo - bleaching of the red fluorescence by the uvc laser, as irradiating paraformaldehyde - fixed cells with uvc did not reduce the red signal intensity (figure 1c). thus, the observed decrease in old h3.3 signal in uvc - irradiated chromatin regions actually reflects enhanced dynamics of parental h3.3 histones in response to genotoxic stress. considering that snap - tag - based labeling may interfere with parental h3 dynamics, we also developed a complementary method to track parental histones based on photo - activation of pa - gfp (photoactivatable gfp) in u2os cells engineered to stably express h3.3-pa - gfp and rfp - xpc (figures s1a and s1c). consistent with our previous findings, we observed a marked reduction of parental h3.3 signal in uvc - damaged chromatin regions within minutes after laser micro - irradiation in live cells and not in paraformaldehyde - fixed cells (figures s1d and s1e). thus, using two distinct methods to monitor old histone dynamics, our data reveal a local loss of parental h3.3 histone signal in damaged chromatin regions. furthermore, we observed an altered distribution of parental histones upon uvc damage in all irradiated cells throughout interphase (figure s2a), and this was not restricted to the h3.3 variant since parental h3.1 signal was also reduced at uvc damage sites (figures s2a and s2b). we recapitulated these results in mcf7 cancer cells and in bj primary fibroblasts and observed similar dynamics for parental histone h4 (figures s2c s2f). collectively, these results reveal a rapid reduction of parental h3 and h4 histone density in uvc - damaged chromatin. we next sought to determine whether the local reduction in parental h3 staining upon uvc irradiation actually reflects parental histone loss from damaged chromatin. for this, we measured changes in old h3.3 fluorescence within the entire cell nucleus after local uvc damage. to maximize sensitivity in this assay, we reduced the size of the area of interest by photo - bleaching h3.3-snap - associated fluorescence in the whole nucleus apart from a small patch (figure 2a). next, photo - bleaching 40% of the fluorescence inside this patch led to a 20% fluorescence reduction in the entire nucleus (figure 2b). in contrast, targeting uvc irradiation to the fluorescent patch, while leading to a comparable 40% loss of signal in the irradiated area, did not result in a detectable loss of fluorescence from the entire nucleus (figure 2b). from these results, we conclude that parental h3 histones mobilized early after genotoxic stress remain in the damaged nucleus and do not undergo massive degradation, as also supported by biochemical analyses of parental h3.3 levels after uvc damage (figure s2 g). we then refined our analysis by measuring the spatial distribution of parental h3.3 histones around the damaged area (figure 2c). notably, we observed that the reduction of parental histone signal in the damaged region was counterbalanced by an increase of signal in the surrounding area (figures 2d and 2e). importantly, this conservative redistribution of parental histones did not occur upon local photo - bleaching of parental h3.3 fluorescence (figures 2c and 2d), and we obtained similar results by photo - activation - based tracking of parental histones (figures s3a s3d). furthermore, the area showing reduced histone density gradually increased over time post - irradiation (figure 3a), which reveals that parental histone dynamics proceed radially outward. such redistribution of parental histones argues against their eviction from damaged chromatin, because, if solubilized in the nucleoplasm, they would not be retained in a defined space in the periphery of the irradiated region. supporting the fact that mobilized histones remain chromatin associated, detergent extraction of live cells after uvc irradiation did not alter the redistribution pattern of parental histones (figure s3e). altogether, these data demonstrate that parental h3 histones redistribute to the periphery of damaged chromatin. such redistribution can involve parental nucleosomes sliding away from dna lesions and/or an expansion of chromatin in the irradiated region, pushing away surrounding undamaged chromatin fibers. to test these hypotheses and gain further insights into the mechanisms underlying parental histone dynamics in uvc - damaged regions thus, we found that parental h3.3 redistribution was accompanied by a decrease in dna density within uvc - damaged regions (figures 3b and s3f), indicative of chromatin opening. the area of uvc - damaged dna increased by a factor of 1.26 within 15 min post - damage (figure 3c), consistent with the 20% dna density loss measured in the same experimental conditions (figure 3b). this strongly supports the idea that the reduced dna density in the damaged region results from chromatin opening. interestingly, while histone and dna signal loss both increased with the exposure time to uvc laser, histone signal loss exceeded dna signal loss in all conditions examined (figure 3d). this observation can not be accounted for by chromatin opening only, which would lead to an equal reduction in histone and dna densities in the damaged area. since we already ruled out the possibility of histone dissociation from chromatin and extensive histone degradation (figures 2 and s3), a possible explanation is that the extra loss in histone density reflects histone mobilization on chromatin away from damage sites (figure 3e). the biphasic shape of the curves for histone and dna signal loss as a function of uvc damage (figure 3d) also points to a possible dual mechanism driving parental histone redistribution, each plateau corresponding to the saturation of a distinct process (figure 3f). our findings suggest that chromatin opening along with histone mobilization on damaged chromatin drive parental histone redistribution to the periphery of uvc - damaged regions. to search for molecular determinants of parental h3 redistribution upon uvc damage, we examined the connection with uvc damage repair by knocking down factors involved at different steps in the ner (nucleotide excision repair) pathway (figure 4a and s4a ; reviewed in alekseev and coin, 2015, marteijn., 2014). decreasing the expression of the late repair factor xpg (xeroderma pigmentosum g), required for excision of the damaged oligonucleotide before repair synthesis, only moderately reduced parental h3.3 redistribution upon uvc irradiation (figure s4b). similarly, knocking down the early repair factor ercc6 (excision repair cross - complementing 6) involved in damage recognition within transcribed genes did not markedly impair parental h3.3 dynamics (figure s4b). consistent with this, cells treated with a transcription inhibitor prior to uvc irradiation did not show major defects in old h3.3 redistribution (data not shown). these results indicate a relatively minor contribution of transcription - coupled repair and late repair steps to the reduced parental h3 histone density at damaged sites. in contrast, when knocking down the uvc damage sensor ddb2 involved in global genome repair, we observed a striking impairment in parental h3.3, h3.1, and h4 density loss at uvc damage sites (figures 4a and s4c s4e). we did not observe comparable defects in parental h3.3 dynamics upon downregulation of xpc, another early repair factor involved in global genome repair (figure s3f), or upon knockdown of the ddb2 partners ddb1 and cul4a (cullin 4a) (figure 4a), which are part of an e3-ubiquitin ligase complex that modifies various substrates at sites of uvc damage (nouspikel, 2011). consistent with a minor contribution of ddb1 and cul4a to parental h3.3 density loss, we found that preventing de novo ubiquitylation reactions by treating cells with a proteasome inhibitor or with a neddylation inhibitor did not markedly alter the redistribution of old h3.3 in damaged chromatin (figures s4f and s4 g). these data indicate that the ubiquitylation activity of the ddb1-ddb2-cul4a - containing complex does not play a major role in parental histone dynamics following uvc damage. parental histone redistribution to the periphery of damaged chromatin regions is thus coupled to the earliest steps of global genome ner with a prominent role for ddb2. to further characterize the contribution of ddb2 to parental histone redistribution upon uvc damage, we tested the effect of ddb2 overexpression. expressing exogenous ddb2 significantly increased the area of parental histone signal loss after local uvc irradiation : this area was 50% larger in cells overexpressing ddb2 than in cells overexpressing another early ner factor, xpc (figure 4b). these results thus indicate that ddb2 levels are limiting for parental histone redistribution in uvc - irradiated chromatin regions. furthermore, artificial tethering of ddb2 to a laco (lactose operator) array in the absence of dna damage led to a marked reduction of parental h3.3 histone density at the laco array (figure 4c). ddb2 tethering also triggered an expansion of the laco array, as previously reported (luijsterburg. these results reveal that ddb2 binding to chromatin is sufficient for parental histone redistribution even in the absence of dna damage. to gain mechanistic insights into ddb2 effect on parental histone dynamics, we tested the potential contribution of chromatin remodelers with reported connections to the ddb2 complex, namely alc1 (amplified in liver cancer 1) and ino80 (inositol - requiring 80) (jiang., 2010, pines., 2012). knocking down these remodelers did not recapitulate the effect of ddb2 downregulation (figures s5a and s5b). similarly, interfering with poly(adp - ribosyl)ation, which has been associated with ddb2 and uv - damaged chromatin decompaction (luijsterburg., 2012, pines., 2012), did not impact parental histone redistribution at uvc damage sites (figures s5c and s5d). however, our analyses of dna and histone signal loss at uvc sites upon ddb2 knockdown (figure s5e) indicate a major contribution of ddb2 to chromatin opening only, consistent with previous observations (luijsterburg., 2012), suggesting that additional factors come into play to promote histone mobilization on chromatin. collectively, our data put forward the early repair factor ddb2 as a master regulator of parental histone redistribution by chromatin opening at uvc sites. as we previously demonstrated that ddb2 controls the recruitment of the histone chaperone hira (histone regulator a), which promotes the deposition of newly synthesized histones h3.3 at uvc damage sites (adam., 2013), we investigated the potential coupling between parental and new h3.3 dynamics in response to uvc irradiation. for this, we labeled parental and new histones in different colors within the same sample and compared the kinetics of parental histone density loss and new histone deposition upon local uvc damage (figure 5a ; movies s2 and s3). while parental h3.3 histones are redistributed within minutes after damage induction, new histone h3.3 accumulation at damage sites becomes detectable only 30 min after local uvc irradiation (figure 5a). we obtained similar results when we swapped the snap reagents, labeling old h3.3 in green and new h3.3 in red (data not shown). thus, our assay reveals that parental histone density loss precedes new histone deposition at uvc damage sites. given that the histone chaperone hira promotes the deposition of newly synthesized h3.3 at uvc damage sites (adam., 2013), we tested whether the same chaperone was responsible for parental h3.3 dynamics in uvc - damaged regions. interestingly, hira downregulation did not impair old h3.3 signal loss at uvc sites (figure 5b), showing that this histone chaperone does not participate in any significant manner in parental h3.3 dynamics after uvc damage. consistent with this, preventing the synthesis of new h3.3 by sirna (small interfering rna) (figure 5c, green) did not interfere with parental h3.3 displacement from uvc - damaged regions (figure 5c, red ; note that this treatment did not affect parental h3.3 levels). altogether, these data demonstrate that parental histone h3.3 redistribution in uvc - damaged regions is functionally independent of new h3.3 deposition. since parental histones are still detected in the periphery of uvc - damaged regions early after dna damage, we investigated whether and to which extent they contribute to chromatin restoration after damage. for this purpose, we examined both parental and new h3.3 dynamics in parallel with repair progression in u2os cells stably expressing h3.3-snap and cfp - xpc (figure s6a). this analysis revealed that parental histones recovered in chromatin undergoing uvc damage repair, reaching almost complete recovery (90% of the initial signal) 9 hr after uvc irradiation, which mirrors the slow kinetics of uvc damage repair (figure 6a). a similar extent of parental histone recovery at uvc damage sites was measured in u2os cells stably expressing h3.3-pa - gfp (figure s6b) and in mfc7 cells transiently expressing h3.3-snap (figure s6c). noteworthy, parental histone recovery was delayed compared to new histone incorporation (figure 6a), suggesting that they involve distinct mechanisms. to gain insight into how parental histones recover, we compared their dynamics to basal histone mobility assessed by frap (fluorescence recovery after photo - bleaching). while parental histone recovery in uvc - damaged regions reached 80% within 12 hr after irradiation, it did not exceed 20% in an undamaged chromatin region of the same nucleus within the same time frame (figure s6d), consistent with a previous report (kimura and cook, 2001). this demonstrates that parental h3.3 recovery in chromatin undergoing repair does not result from basal histone turnover but actually reflects the relocation of parental histones that were mobilized away from uvc - damaged regions. notably, when measuring the area of parental histone density loss over time after uvc damage, we observed that parental histone recovery proceeded radially inward (figure 6b), suggesting that displaced histones were moving back by an opposing mechanism to their initial redistribution. the area of new histone accumulation by contrast did not shrink (figure s6e), arguing that chromatin restoration does not proceed solely via re - compaction. as a result, recovered parental histones mix with newly synthesized histones in repairing chromatin (figure s6f). we next sought to determine whether parental h3.3 recovery in damaged chromatin was coupled to repair progression. for this, we depleted the late repair factor xpg, which interferes with repair progression with no major effect on the early redistribution of parental histones in damaged chromatin (figure s3b). parental h3.3 recovery, however, was markedly impaired in xpg - depleted cells (figure 6c ; movies s4 and s5) down to a rate similar to basal histone turnover (figures s6d and s6 g). these results indicate that parental histone recovery in damaged chromatin is dependent on repair progression. given that xpg depletion also significantly delayed ddb2 release from chromatin, we assessed more directly the role of ddb2 in parental histone recovery. for this, we triggered lacr - ddb2 release from the laco array by iptg addition (figure 6d). this resulted in rapid recovery of old h3.3 at the laco array, which highlights the key role of ddb2 in controlling parental histone dynamics in uvc - damaged chromatin. collectively, our results underline the major contribution of parental histones to chromatin restoration coupled to repair and establish that parental histone recovery is coordinated with repair progression through ddb2 release from damaged chromatin. by exploiting real - time tracking of parental h3 and h4 histones after local uvc damage in human cells, we provide novel insights into epigenome maintenance in response to dna damage. our study indeed identifies a conservative process, tightly coordinated with repair progression, whereby parental histones rapidly redistribute away from uvc - damaged chromatin regions and subsequently recover (figure 7). we propose that parental histones are kept in the periphery of the damaged areas to help restore chromatin organization after dna repair, which may contribute to preserving a memory of chromatin identity in response to dna damage. chromatin rearrangements coupled to the early stages of the ddr, although considered to be critical for efficient dna repair, still remained poorly characterized. here, we provide evidence for a redistribution of parental histones to the periphery of uvc - damaged chromatin regions, which prompt us to re - evaluate our views on the access - repair - restore model. even though histone solubilization has been reported in response to genotoxic stress (goldstein., 2013, wang., 2006, xu., 2010), our data support a model where parental h3 histones do not massively dissociate from chromatin but are redistributed away from uvc - damaged sites, possibly via nucleosome sliding and chromatin opening. this is consistent with a recent study suggesting that h2b histones are not solubilized following uv irradiation in human cells (morisaki and mcnally, 2014). the extent of chromatin rearrangements in response to local dna damage is a matter of debate. while one study indicates that chromatin destabilization affects the whole nucleus upon local uvc irradiation (rubbi and milner, 2003), several lines of evidence rather support the idea that chromatin is locally disorganized upon genotoxic stress (dinant., 2013, goldstein., 2013, hinde., 2014, 2013). here, we reconcile these data by demonstrating that a local loss of parental histone density in uvc - damaged areas has a long - range impact on chromatin, potentially affecting the whole nucleus, because parental histone redistribution actually spreads over long distances away from the damaged regions (figure 2e). whether and how histone redistribution facilitates access to damaged dna and repair progression are not entirely clear. the recruitment of the damage sensor ddb2 to uvc lesions precedes and orchestrates parental histone dynamics. it is tempting to speculate that this may also contribute to protect parental histones from modifications by histone - modifying enzymes recruited to regions of ongoing repair, thereby promoting the maintenance of the original epigenetic information. mechanistically, both histone mobilization on chromatin and chromatin opening potentially contribute to chromatin disorganization in response to uvc damage. whether they use similar regulatory factors as those promoting chromatin mobility in response to dna breaks (dion and gasser, 2013) is an attractive possibility. in terms of molecular players, we identify the damage sensor ddb2 as a master regulator of parental histone dynamics at sites of uvc lesions, mostly via its ability to promote chromatin opening. interestingly, while the ubiquitylation activity of ddb2-containing complex is required for new histone deposition in uvc - damaged chromatin (adam., 2013), it is largely dispensable for parental histone dynamics. consistent with our findings, ubiquitylation - deficient mutants of ddb2 induce chromatin expansion like wild - type ddb2 when artificially tethered to chromatin (luijsterburg., 2012). thus, ddb2-mediated chromatin expansion is largely independent of the other members of the uvc damage recognition complex. whether ddb2 acts alone or in association with other factors to fulfill this activity will be important to investigate in future studies. remarkably, ddb2 has very strong affinity for uvc - damaged dna (kulaksiz. 2005), and ddb2 binds damaged dna on nucleosomes (osakabe., 2015). we can speculate that ddb2 binding to damaged chromatin may on its own push away surrounding nucleofilaments leading to chromatin opening. given that ddb2 does not display atpase / helicase or histone - binding domains, we rather favor a model where it works in concert with other factors directly involved in chromatin dynamics such as histone chaperones and/or chromatin remodeling complexes that remain to be identified to promote chromatin disorganization in damaged regions. our study identifies a pathway that may contribute to preserving the integrity of chromatin architecture in response to dna damage. we unraveled that damaged chromatin reorganization is a two - step process with new histone incorporation preceding parental histone recovery. the biphasic nature of chromatin restoration is consistent with an early model based on the accessibility to nucleases of chromatin undergoing ner (reviewed in smerdon, 1991). while we can not formally exclude that a limited amount of parental histones are ultimately degraded after uvc damage as reported for hyperacetylated histones in response to ionizing radiation (qian., 2013), the conservative nature of parental histone redistribution around uvc damage sites and the almost complete recovery of parental histones during repair progression argue against massive histone degradation. furthermore, the retention of parental histones proximal to the site of damage offers a possible redirection to the original site to promote a conservative restoration of chromatin architecture. it will be important to develop higher - resolution approaches to determine whether parental histones retrieve their original positions on the dna sequence upon recovery and whether the topological organization of parental chromatin is fully re - established. the major contribution of parental histones to the composition of repaired chromatin is crucial to envision mechanisms for epigenome maintenance after dna damage. indeed, it opens up the possibility that parental marks can be preserved and transferred to the new histones, which initially carry their own set of post - translational modifications (ptms) (loyola., 2006). in this respect, a parallel can be drawn between the restoration of chromatin after dna damage and dna replication (alabert and groth, 2012, groth. the maintenance of chromatin identity is achieved by old histone recycling with their ptms and by subsequent modifications of new histones to mirror the parental ones (alabert., 2015). noteworthy, while cells have to cope with 50% histone renewal during replication, most parental histones recover in damaged chromatin regions, which could facilitate the re - establishment of the original chromatin landscape. it is tempting to speculate that the presence of parental and new histones in neighboring nucleosomes may allow old ptm transmission to newly deposited histones after repair. finally, our data open up new avenues for understanding the etiology of several human diseases, including h3 mutant - associated cancers (reviewed in kallappagoudar., 2015, yuen and knoepfler, 2013) and ner disorders (reviewed in digiovanna and kraemer, 2012, marteijn., 2014 considering that ddb2 dynamics strongly impact the fate of parental histones in response to uvc damage, the phenotype of xpe patients harboring ddb2 mutations that prevent its binding to damaged dna may not only reflect a dna repair defect but also altered chromatin plasticity in response to genotoxic stress. similarly, h3 mutations could contribute to the development of human cancers by affecting the resetting of the epigenome following dna damage. in conclusion, our work sheds new light to our current view of dna damage - induced chromatin rearrangements and suggests that parental histone dynamics are critical to the maintenance of epigenome integrity in response to genotoxic stress. our findings also pave the way for the identification of new factors that contribute to restoring damaged chromatin identity and for understanding how this protects cells against pathological conditions. snap labeling of histone proteins was done as described (bodor., 2012). photo - activation experiments were performed in u2os cells stably expressing h3.3-pa - gfp on a zeiss lsm710 confocal microscope using the 30 mw 405 nm laser focused through an ld lci plan - apochromat 25/0.8 oil objective. uvc laser micro - irradiation was done as described (adam., 2013, dinant., 2007). details for the frap procedure and for image acquisition and analysis are in supplemental experimental procedures. sirnas (supplemental experimental procedures) were transfected into cells using lipofectamine rnaimax (invitrogen). cells were transiently transfected with plasmid dna (1 g / ml final, supplemental experimental procedures) using lipofectamine 2000 (invitrogen) 48 hr before subsequent cell treatment. these procedures, including lists of antibodies and primer pairs, are described in supplemental experimental procedures. p values for mean comparisons between two groups were calculated with a student s t test, including welch s correction when necessary, using r software. multiple comparisons were performed by one - way anova with bonferroni post - test using graphpad prism. (equal contribution), and s.e.p. designed and performed experiments, analyzed the data, and wrote the manuscript. g.a. provided inputs for experimental design using the uvc laser technology and snap tagging and for data analysis and writing. | summarychromatin integrity is critical for cell function and identity but is challenged by dna damage. to understand how chromatin architecture and the information that it conveys are preserved or altered following genotoxic stress, we established a system for real - time tracking of parental histones, which characterize the pre - damage chromatin state. focusing on histone h3 dynamics after local uvc irradiation in human cells, we demonstrate that parental histones rapidly redistribute around damaged regions by a dual mechanism combining chromatin opening and histone mobilization on chromatin. importantly, parental histones almost entirely recover and mix with new histones in repairing chromatin. our data further define a close coordination of parental histone dynamics with dna repair progression through the damage sensor ddb2 (dna damage - binding protein 2). we speculate that this mechanism may contribute to maintaining a memory of the original chromatin landscape and may help preserve epigenome stability in response to dna damage. |
critical limb ischaemia (cli) needs straight line blood flow to the foot for adequate revascularization. five - year follow up on cli revascularization with either an endovascular or open surgery first approach showed that both methods had equivalent limb salvage rates and amputation - free survival in properly selected cases. success rate for endovascular treatment of infra - popliteal stenosis is up to 100% but failure rate for occlusion - type lesions ranges from 20 to 40%,. our case report highlights three patients who underwent successful recanalization of long tibial chronic total occlusion (cto) for tissue loss using a hybrid procedure of below knee angioplasty and open retrograde access. first described this open exposure of pedal vessels and subsequent direct open puncture of pedal arteries as an alternative approach for failed percutaneous antegrade access. all three cases underwent an open cutdown surgical approach of the artery at the foot and direct needle cannulation of the target tibial vessel. attempt was initially made of cannulating the artery percutaneously using a retrograde approach either under ultrasound or fluoroscopic guidance. the failure of percutaneous angiographic retrograde approach was due to either a poor fluoroscopic window despite adequate contrast instillation proximally or poor visualization of patent lumen within the target vessel with the ultrasound approach because of heavy wall calcification. the adjunct use of intra - arterial nitroglycerin to relieve vasospasm and improve flow for distal puncture was also unsuccessful. a 29-year old male chronic smoker (10 pack years) with a negative vasculitis screen presented with a three - week history of poor healing of a right third toe ulcer. 1) found that the anterior tibial artery (ata), which was the target angiosome vessel, was occluded. the patient underwent a tibial angioplasty. an attempt to reopen the ata antegradely resulted in the guidewire traversing subintimally in the mid ata and was unable to re - enter the true lumen distally. retrograde attempt with fluoroscopy was technically difficult as the visible target dorsalis pedis artery (dpa) was too small. an ultrasound guided approach could not find a sufficient patent lumen. in view of poor imaging quality from both techniques but with a potential target distal dpa, as the patient had preoperatively undergone a popliteal nerve block, the skin overlying the dpa was cut longitudinally for 3 cm (fig. the surrounding tissue around the vessel provides a stable platform for direct puncture. using the transpedal / micropuncture 4 fr needle kit (angiodynamics inc., ny) the dpa was punctured and back bleeding was obtained. a v18 (0.018) (boston scientific, ma, usa) wire (fig. 2c) was used to traverse the occluded point of the distal ata supported with a 2.6 fr angled cxi (cook, bloomington, usa) catheter. subsequently an antegradely passed cxi catheter was passed just proximal to the puncture point of the dpa and the v18 wire was retrieved. a pt2 0.014 (boston scientific, ma, usa) wire was passed antegradely and passed beyond the puncture point and into the tarsal branch of the dpa. a 0.014 2 mm 80 mm nanocross (ev3, covidien, plymouth, usa) balloon angioplasty was performed across the puncture followed by 0.014 2.5/3.0 mm tapered balloon (ev3, covidien, plymouth, usa) to the ata (fig. 3). check angiogram revealed good run off to the dpa and the metatarsal artery and a palpable dpa was present. he underwent a third toe ray amputation with good bleeding from the raw edges of the wound. patient was subsequently placed on double antiplatelet therapy, a statin and was advised to stop smoking. during his routine follow up in the clinic (8 weeks post angioplasty) the wound had healed and he still had a palpable dpa. a 62-year old female with end stage renal failure on haemodialysis, diabetes, hypertension and hyperlipidaemia, presented with a 3-week history of left fourth toe wet gangrene. 4) revealed pta and ata occlusions but ata reconstituted distally by the peroneal artery (main run off). an antegrade angioplasty of the ata was attempted with multiple wires and supporting catheters and balloons, which proved unsuccessful. the vessel wall was moderately calcified and an attempt at retrograde percutaneous technique using an ultrasound also failed. as the patient was already under regional anaesthesia (popliteal nerve block), dpa was exposed by surgical cutdown and directly punctured with a 4f micropuncture set (angiodynamics inc. a 2.6 fr angled cxi (cook, bloomington, usa) crossing catheter over a v18 (boston scientific, usa) wire was used to guide the wire transluminally towards the proximal ata, where it was snared with 4 fr berenstein 2 (angiodynamics inc. the angled 2.6 fr cxi (cook, bloomington usa) catheter was then inserted antegrade up to the retrograde puncture point at which point the v18 wire was exchanged with an antegrade pt2 (0.014 boston scientific) guidewire to traverse into the dpa. post dilatation with a 0.014 balloon angioplasty showed significant recoil (> 50%) at the dpa. a maris deep (medtronic mn, usa) nitinol self - expanding stent 3 mm 80 mm was deployed across the ata to proximal dpa. however the distal dpa still showed significant stenosis with poor outflow therefore a 3 mm 28 mm xience prime (abbott, santa clara, usa) drug eluting stent was deployed across the distal dpa (covering the puncture point). the third, fourth and fifth toes were amputated, which showed brisk back - bleeding. one month post intervention the wound showed poor healing and a surveillance duplex scan showed the ata and dpa stents were thrombosed. patient underwent a successful antegrade passage of guidewire across the blocked stent and into the metatarsal artery. on angiogram it was discovered the proximal ata stenosis was the cause of early occlusion and this was treated with a proximal stent. a 64-year old male with diabetes and hypertension was admitted with a 3-weeks history of left heel gangrene. duplex imaging revealed multi - level peripheral artery disease with left superficial femoral, tibioperoneal trunk (tpt) stenosis and pta occlusion. he underwent an antegrade femoral angiogram and successful balloon angioplasty of his sfa, popliteal and tpt. however, the guide wire was not able to re - enter the true lumen of the distal pta, despite using a supporting catheter and a multitude of wires (fig. the pta was dissected out and punctured under direct vision with a micopuncture set (4 fr angiodynamics inc., ny). a v18 (0.018 boston scientific, ma, usa) wire on a supporting catheter was used and the wire stayed intraluminally and was retrieved at the distal end of the proximal pta with an antegradely passed 4f berenstein catheter (angiodynamics inc. after crossing the distal puncture site with a lower profile wire, balloon angioplasty of the whole length of the pta was performed. the patient was started on dual antiplatelet and the wound healed completely 10 weeks after revascularization. the technical success of antegrade or retrograde approach angioplasty for revascularizing lower limb vessels is determined by factors such as lesion length, calcification, distal vessel run off and operator experience. although subintimal crossing of below the knee cto lesions is a useful technique, it is associated with major complications. inability to re - enter the true lumen after subintimal passage and extension of the subintimal passage beyond the occluded segment, compromises collateral vessels and restricts potential surgical bypass targets. repeated attempts and prolonged procedural time increases the risk of radiation exposure, contrast induced nephropathy and risk of hematoma related complications such as nerve compression and compartment syndrome to the patients. the retrograde approach usually offers a higher success rate of crossing the cto lesion because the distal atheroma cap is often softer in composition. the cto lesions of less than a year old are usually composed of soft cholesterol laden foam cells lesions and those that are more than one year old are usually composed of fibrocalcific iron and hemosiderin deposits thus forming the hard plaque variety. walker. showed that retrograde pedal access after a failed antegrade approach was successful in 96% of patients (rutherford 46 with occlusive disease) and those with vessel diameters > 1.5 mm. case 1 had buerger s disease (rutherford 5) where surgical revascularization is usually not possible because of diffuse distal disease with inadequate runoff. the angiographic findings showed absence of arterial calcification and presence of cockscrew vessels.. showed in his series of 20 consecutive cases using extended angioplasty of a single tibial and foot arteries, was able to achieve a technical success rate of 95%. the second case involved a diabetic with end stage renal failure with rutherford 5 toe gangrene and extensive medial calcification of the tibial vessel. estimated rates of major lower extremity amputations in the dialysis population has been estimated to be 4.3% after 1 year and 13% among the dialysis patients with diabetes. technical success for endovascular revascularization in this group of patients with tibial disease has been reported as high as 42%. in our second patient although the retrograde open approach was successful the wound healing was delayed because of restenosis at the proximal anterior tibial artery. however the secondary revascularization procedure was successful as the distal run off was still patent. successful endovascular antegrade or retrograde options with myriad of devices can be a costly adventure. however limb salvage can still be carried out with a hybrid procedure such as this open retrograde approach in patients with poor quality autologous venous conduits for bypass and unsuccessful percutaneous retrograde puncture. the open technique provides an additional option to a vascular surgeon for revascularization in an otherwise doomed percutaneous approach. the success of this approach is also determined by the relatively good outflow distal to the puncture point. a written and signed consent to publish this case report was obtained from the patient or next of kin prior to submission. dr saravana kumar study concept and design, data collection and writing of the paper. dr tang tjun yip, dr steven kum, dr tan yih kai correction and final approval for publication. | retrograde puncture via patent pedal vessels can be attempted in failed antegrade approach for infrapopliteal long chronic total occlusion. however in cases where the pedal vessels are unable to be visualized via duplex ultrasonography or fluoroscopy an open approach offers an additional option to a vascular surgeon for successful recanalization. our case report highlights 3 cases where successful hybrid open retrograde approach was able to achieve recanalization of long chronic total occlusion.presentation of casesthe three cases in our series presented with critical limb ischaemia. all three cases had undergone duplex imaging of the affected arterial system. as the antegrade approach to cross the lesion failed a retrograde approach was attempted in all 3 cases. however when the usual modality of retrograde puncture via the use of ultrasound or fluoroscopy failed we proceeded with an open approach.discussionretrograde approach usually offers a better chance of successfully crossing a chronic total occlusion lesion. however puncturing a distal vessel successfully and traversing a catheter or guidewire across proves to be a challenge. an open approach offers an additional pathway for puncturing the target vessel when duplex imaging or fluoroscopic guidance fails.conclusionopen approach is usually attempted as a last resort by many endovascular surgeons. however procedural time, contrast and radiation usage could have been cut short in cases where the distal target vessels pose a technical challenge for approach via a percutaneous method. |
chronic myeloid leukemia (cml) is a myeloproliferative disorder of blood stem cells.1 the causative molecular defect is the bcr - abl protein, which is encoded by the philadelphia chromosome (ph).2 this genetic anomaly arises from an exchange of genetic material between chromosomes 9 and 22, which results in the fusion of the breakpoint cluster region (bcr) and the abelson leukemia virus (abl) proto - oncogene.3,4 the resulting gene encodes a constitutively active protein kinase that activates a number of proteins involved in cell - cycle regulation that hasten cell division and affect dna repair.58 imatinib, also known as gleevec (novartis, basel, switzerland), is a selective inhibitor of not only abl but also kit and pdgfr kinases, and exerts significant antileukemic activity in the majority of cml patients. according to the current national comprehensive cancer network (nccn) guidelines9 and the european leukemianet (eln) recommendations,10 a response outcome to imatinib therapy is classified as optimal, suboptimal, and failure based on the level of response achieved at various time points throughout the course of treatment using specific hematologic, cytogenetic and molecular criteria. optimal responses proposed by the nccn closely corresponding to the eln recommendations and defined as the achievement of a ccyr after 12 months of imatinib at 400 mg daily. in patients with suboptimal responses to first - line imatinib, the use of high - dose (600 or 800 mg / day) is recommended as an alternative therapeutic option by both the eln and the nccn. failure to achieve any cytogenetic response from standard - dose imatinib after 6 months of therapy or major cytogenetic response and a ccyr after 12 and 18 months of therapy, respectively, are considered treatment failure by the nccn. in such cases, it is recommended that treatment should be changed for a second - generation tyrosine kinase inhibitor (tki). these criteria became particularly important as several kinase targeted therapies with long half - lives were developed for the treatment of patients who fail or are intolerant to imatinib therapy. according to the most recent results from the international randomized study of interferon versus sti571 (iris) trial, the estimated overall survival for patients still on imatinib was 85% at 8 years, or 93% when only cml - related deaths or deaths prior to stem cell transplant were included. a total of 92% of the patients were free of disease progression. among those who achieved ccyr, only 3% progressed during the 8-year follow - up.11 nevertheless, of the 259 patients receiving imatinib as front - line therapy who had treatment discontinuation, 30 (5.4%) and 77 (13.9%) patients stopped their therapy because of intolerance or unsatisfactory therapeutic effect, respectively. the inability of patients to tolerate treatment and the emergence of bcr - abl mutations that reduced the binding affinity of imatinib prompted pharmaceutical research that led to the discovery of several similarly effective, targeted, second generation tkis such as nilotinib (tasigna, amn107, novartis, basel, switzerland) and dasatinib (sprycel ; bristol - myers squibb, new york, ny).1214 evidence from an in vitro study has indicated that nilotinib is 20 times more potent than imatinib against cells expressing the wild - type bcrabl. 15 dasatinib is a multi - targeted kinase inhibitor that is structurally unrelated to imatinib and is able to bind and inhibit both the active and inactive conformations of abl, resulting in 100- to 300-fold higher activity than imatinib for unmutated bcr - abl, and greater inhibition against mutants with high levels of imatinib resistance (except for t315i and relative insensitivity to f317l).1517 dasatinib is generally well tolerated. however, adverse events (aes) associated with its use, such as pleural effusions, hemorrhage, and febrile neutropenia have been frequently reported in the advanced stage of the disease (reviewed by wong18). the nccn guidelines9 recommend that at the onset of grade 3/4 thrombocytopenia (platelet count < 50,000/mm), therapy with dasatinib should be held. once the toxicity has resolved (platelet count 50,000/mm), dasatinib should be resumed at original starting dose if recovery occurs within 7 days or reduced one dose level if platelet count decreased to < 25,000/mm for more than 7 days. attempts to identify the optimum and effective dose of dasatinib continue and include modification of scheduling, management of toxicity and dose optimization. to determine the optimum administration schedule, the efficacy, response and tolerability of dasatinib has been investigated in several clinical trials. it is now apparent that a scheduled once daily starting dose of 100 mg offers an improved safety profile and shows similar efficacy for patients with chronic phase cml (cp cml) compared to a 70 mg twice daily dose.1921 the recommended dosage schedule for patients in the advanced phase of the disease is 140 mg once daily.22,23 however, some intolerant patients may require a dose adjustment from 140 to 100 mg / day or from 100 to 80 mg / day to continue treatment and thus maintain control of their disease. even at a dose of 80 mg / day, some patients require further dose reduction due to substantial toxicities. because of the clinical difficulty posed by this subgroup, we report the effects of an unusually low dosage of dasatinib during the treatment of four patients (2 in chronic phase and 2 in accelerated phase) with proven efficacy almost identical to that seen with conventional dosage. a 31-year - old man was admitted to our department in march 2008 with leukocytosis (wbc 88.900/mm) and splenomegaly of cml. the patient was treated with imatinib mesylate at 400 mg / day in july 2008. one month after starting the therapy, the patient developed a grade (g) 4 thrombocytopenia (8.000/mm platelets) with epistaxis and needed a platelet transfusion. the patient had a therapy break of 4 months. in october 2008, after resolution of thrombocytopenia to the g1 level, he was restarted on a reduced imatinib dose of 300 mg per day, but therapy was again discontinued for thrombocytopenia g3 (26.000/mm platelets). in february 2009, because of severe intolerance to imatinib, dasatinib was started at a dose of 100 mg / day. after 2 weeks of treatment under this therapy, the patient developed a g4 thrombocytopenia. as a result, treatment was suspended until (march 2009) recovery to g1 (78.000/mm) and then resumed at a dose of 80 mg / day. however, the patient experienced the same side effects one week after restarting dasatinib. the dose was then decreased to 50 mg / day with gradual increase of platelets. in june 2009, after 4 months of treatment, the patient achieved a ccyr. the patient continued the same dasatinib dose and in july 2009, the platelet count reached 130.000/mm and molecular analysis showed a bcr - abl / bcr ratio of 0.01% indicating that the patient had achieved a major molecular response (mmr). a 46-year - old male was admitted to our department in july 2008 with cp cml. this patient had two breaks in his imatinib therapy due to the recurring of g 3 thrombocytopenia. after the second break, the patient progressed to ap cml without evidence of mutations in the abl kinase domain. in march 2009, dasatinib was prescribed to this patient at 140 mg / day and after four weeks of therapy, the patient developed g3 thrombocytopenia, after which we decided to maintain the therapy at a lower dose of 70 mg / day. in june 2009, after three months of treatment, the patient reached a ccyr and his thrombocytopenia improved to g1. to achieve mmr, we decided to increase the therapeutic dose to 80 mg / day in may 2010. by august 2010, on his last evaluation, this patient s bcr - abl / a 69-year - old male was admitted to our department in march 2009 with a history of cml, first diagnosed in august 2007 in japan. six months before the referral, he complained of fatigue, weight loss and splenomegaly. a diagnosis of ap cml was confirmed with the appearance of additional chromosomal aberrations besides the ph chromosome (47xy, + 8, t(9,22), add(13)(q33) in 20/20 metaphase analyzed) and, in march 2009, imatinib was initiated at a daily dose of 600 mg. after 1 month, the patient experienced g3 neutropenia (700/mm) and g2 thrombocytopenia (62.000/mm). the patient continued imatinib at the same dose with 300 g granulocyte - colony - stimulating factor (g - csf) added simultaneously every week to stimulate myelopoiesis. in october 2009, the patient experienced g3 thrombocytopenia (41.000/mm) and his bcr - abl / bcr ratio was 7.68% without any cytogenetic response after 6 months of therapy. at this time, sequencing of the bcr - abl kinase domain revealed no evidence of mutations in the abl kinase domain. based on these results, the patient was, therefore, considered resistant to imatinib and, in november 2009, was placed on dasatinib at a daily dose of 140 mg. after the first 3 weeks of treatment, dasatinib was reduced to 100 mg / day because of the occurrence of g2 thrombocytopenia (61.000/mm). two weeks later, his platelet count dropped to 50.000/mm. at this time, dasatinib was lowered to a dose of 70 mg in an attempt to maintain a stable platelet count. however, after another 2 weeks, in january 2010, the patient developed g3 neutropenia (900/mm) and his platelet count dropped to 26.000/mm. at this time, the patient s bcr - abl / bcr ratio was 9.87%. as dasatinib was the only option for the treatment of this patient s disease, it was again reduced to a dose of 50 mg / day with g - csf. in february 2010, the patient s bcr - abl / bcr ratio was decreased to 0.81% and his platelet numbers started to increase gradually. as a result, g - csf was stopped and the patient continued dasatinib at the same dose. five months after initiation of dasatinib, in april 2010, cytogenetic analysis revealed a ccyr and complete disappearance of the initially detected additional chromosomal aberrations. in may 2010, dasatinib was increased to 60 mg once daily to achieve mmr and no toxicity was noted on follow - up examination. one month later, in june 2010, the patient achieved mmr, with a transcript ratio of 0.01%. the patient, a 58-year - old man, was presented to our hospital in march 2009 with a clinical history of rheumatoid arthritis, hypertension, gastritis and chronic renal failure and undergoing conservative therapy. at presentation, a routine blood count showed leukocytosis with a left shift and physical examination revealed no splenomegaly. a diagnosis of cp cml was made after further laboratory studies and, in april 2009, imatinib was initiated at a daily dose of 400 mg. after a one month, despite a complete hematological response, the patient s pancreatic enzymes elevated to g1 and then gradually increased in severity to g4 in may 2009. after a one month period of interruption, imatinib was resumed at the same dose. however, the patient experienced the same side effects again and treatment was permanently discontinued. one month later, the patient s pancreatic enzyme values returned to normal but he lost his hematologic response. at that time, dasatinib was initiated at a dose of 100 mg / day. during follow - up, the patient had two breaks in the dasatinib therapy at a daily dose of 100 mg and 40 mg because of recurring g2 and g4 pancreatitis, respectively. after the second break, a 10-week interruption, the serum lipase level was returned to normal and dasatinib was reintroduced at a further reduced dose of 20 mg / day taken in combination with pancrelipase (creon) capsules. at a subsequent clinic visit, the patient presented with g2 pancreatitis and the treatment schedule and doses were maintained. in february 2010, the patient underwent a switch to alternate - day dasatinib at dosages of 20 and 40 mg every other day. in march 2010, after 3 months of taking a lower dosage (20 mg / day) of dasatinib, the patient achieved a ccyr and his bcr - abl / bcr showed a ratio of 0.1%. the measurement of his transcript was repeated in august 2010 and confirmed the mmr (bcr - abl / bcr ratio = 0.018%). at that time, the patient had mild pancreatitis with serum lipase level and was scored as grade 1. a 31-year - old man was admitted to our department in march 2008 with leukocytosis (wbc 88.900/mm) and splenomegaly of cml. the patient was treated with imatinib mesylate at 400 mg / day in july 2008. one month after starting the therapy, the patient developed a grade (g) 4 thrombocytopenia (8.000/mm platelets) with epistaxis and needed a platelet transfusion. the patient had a therapy break of 4 months. in october 2008, after resolution of thrombocytopenia to the g1 level, he was restarted on a reduced imatinib dose of 300 mg per day, but therapy was again discontinued for thrombocytopenia g3 (26.000/mm platelets). in february 2009, because of severe intolerance to imatinib, dasatinib was started at a dose of 100 mg / day. after 2 weeks of treatment under this therapy, the patient developed a g4 thrombocytopenia. as a result, treatment was suspended until (march 2009) recovery to g1 (78.000/mm) and then resumed at a dose of 80 mg / day. however, the patient experienced the same side effects one week after restarting dasatinib. the dose was then decreased to 50 mg / day with gradual increase of platelets. in june 2009, after 4 months of treatment, the patient achieved a ccyr. the patient continued the same dasatinib dose and in july 2009, the platelet count reached 130.000/mm and molecular analysis showed a bcr - abl / bcr ratio of 0.01% indicating that the patient had achieved a major molecular response (mmr). a 46-year - old male was admitted to our department in july 2008 with cp cml. this patient had two breaks in his imatinib therapy due to the recurring of g 3 thrombocytopenia. after the second break, the patient progressed to ap cml without evidence of mutations in the abl kinase domain. in march 2009, dasatinib was prescribed to this patient at 140 mg / day and after four weeks of therapy, the patient developed g3 thrombocytopenia, after which we decided to maintain the therapy at a lower dose of 70 mg / day. in june 2009, after three months of treatment, the patient reached a ccyr and his thrombocytopenia improved to g1. to achieve mmr, we decided to increase the therapeutic dose to 80 mg / day in may 2010. by august 2010, on his last evaluation, this patient s bcr - abl / bcr ratio showed 0.8%. a 69-year - old male was admitted to our department in march 2009 with a history of cml, first diagnosed in august 2007 in japan. six months before the referral, he complained of fatigue, weight loss and splenomegaly. a diagnosis of ap cml was confirmed with the appearance of additional chromosomal aberrations besides the ph chromosome (47xy, + 8, t(9,22), add(13)(q33) in 20/20 metaphase analyzed) and, in march 2009, imatinib was initiated at a daily dose of 600 mg. after 1 month, the patient experienced g3 neutropenia (700/mm) and g2 thrombocytopenia (62.000/mm). the patient continued imatinib at the same dose with 300 g granulocyte - colony - stimulating factor (g - csf) added simultaneously every week to stimulate myelopoiesis. in october 2009, the patient experienced g3 thrombocytopenia (41.000/mm) and his bcr - abl / bcr ratio was 7.68% without any cytogenetic response after 6 months of therapy. at this time, sequencing of the bcr - abl kinase domain revealed no evidence of mutations in the abl kinase domain. based on these results, the patient was, therefore, considered resistant to imatinib and, in november 2009, was placed on dasatinib at a daily dose of 140 mg. after the first 3 weeks of treatment, dasatinib was reduced to 100 mg / day because of the occurrence of g2 thrombocytopenia (61.000/mm). two weeks later, his platelet count dropped to 50.000/mm. at this time, dasatinib was lowered to a dose of 70 mg in an attempt to maintain a stable platelet count. however, after another 2 weeks, in january 2010, the patient developed g3 neutropenia (900/mm) and his platelet count dropped to 26.000/mm. at this time, the patient s bcr - abl / bcr ratio was 9.87%. as dasatinib was the only option for the treatment of this patient s disease, it was again reduced to a dose of 50 mg / day with g - csf. in february 2010, the patient s bcr - abl / bcr ratio was decreased to 0.81% and his platelet numbers started to increase gradually. as a result, five months after initiation of dasatinib, in april 2010, cytogenetic analysis revealed a ccyr and complete disappearance of the initially detected additional chromosomal aberrations. in may 2010, dasatinib was increased to 60 mg once daily to achieve mmr and no toxicity was noted on follow - up examination. one month later, in june 2010, the patient achieved mmr, with a transcript ratio of 0.01%. the patient, a 58-year - old man, was presented to our hospital in march 2009 with a clinical history of rheumatoid arthritis, hypertension, gastritis and chronic renal failure and undergoing conservative therapy. at presentation, a routine blood count showed leukocytosis with a left shift and physical examination revealed no splenomegaly. a diagnosis of cp cml was made after further laboratory studies and, in april 2009, imatinib was initiated at a daily dose of 400 mg. after a one month, despite a complete hematological response, the patient s pancreatic enzymes elevated to g1 and then gradually increased in severity to g4 in may 2009. after a one month period of interruption, imatinib was resumed at the same dose. however, the patient experienced the same side effects again and treatment was permanently discontinued. one month later, the patient s pancreatic enzyme values returned to normal but he lost his hematologic response. at that time, dasatinib was initiated at a dose of 100 mg / day. during follow - up, the patient had two breaks in the dasatinib therapy at a daily dose of 100 mg and 40 mg because of recurring g2 and g4 pancreatitis, respectively. after the second break, a 10-week interruption, the serum lipase level was returned to normal and dasatinib was reintroduced at a further reduced dose of 20 mg / day taken in combination with pancrelipase (creon) capsules. at a subsequent clinic visit, the patient presented with g2 pancreatitis and the treatment schedule and doses were maintained. in february 2010, the patient underwent a switch to alternate - day dasatinib at dosages of 20 and 40 mg every other day. in march 2010, after 3 months of taking a lower dosage (20 mg / day) of dasatinib, the patient achieved a ccyr and his bcr - abl / bcr showed a ratio of 0.1%. the measurement of his transcript was repeated in august 2010 and confirmed the mmr (bcr - abl / bcr ratio = 0.018%). at that time, the patient had mild pancreatitis with serum lipase level and was scored as grade 1. dasatinib is a highly effective targeted therapy in patients with cml who are unresponsive to imatinib, or as an alternative where imatinib is poorly tolerated. as such, it provides a valuable therapeutic option for those patients who are at high risk for disease progression. although dasatinib is generally well tolerated, serious toxicities can occur in some patients, even at a lower recommended dose of 80 mg / day, and can pose particular challenges to clinicians caring for this subgroup of patients. patients intolerant of dasatinib and other tkis are unlike those resistant to therapy ; they often suffer increased treatment interruptions and compromised therapeutic benefits. therefore, to fit an individual s unique profile, adjustment of dose on the basis of the patient s response and tolerability is required. our experience in this short case series demonstrate that dasatinib at a dose well below the minimum recommended dosage has clinical activity associated with only minor toxicity in 4 dasatinib - intolerant patients who had previously experienced imatinib - related hematological (3 cases) and non - hematological complications (1 case). at the time of initiation of dasatinib therapy, all 4 patients had been initially treated with imatinib as a first - line therapy at either 400 mg / day or 600 mg / day and all but one developed hematological toxicities (table 1). the same pre - existing complications that occurred during imatinib therapy were observed after crossover to dasatinib. it is possible that the complications manifested in our patients during imatinib therapy may have increased the likelihood of these abnormalities shortly after initiation of dasatinib. alternatively, it is also possible that tkis predisposed our patients to these aes. in all patients, dasatinib, was the only second generation tkis available at that time, had to be reduced to a lower dose because of the dose - limiting toxicity. the mean time to a ccyr in the first 3 patients was 3 and 5.5 months ; similar to durations of < 6 months that have been reported previously for standard doses.21,24 administration of dasatinib at a reduced daily dose thus induces remissions in a similar time frame compared with administration of a conventional dosage amount. moreover, under continuous treatment with dasatinib under low dosage, there was progressive improvement of the platelet count in all of our first three patients, with progression to g1 thrombocytopenia (case 1 and 2) and complete normalization (case 3). although the third patient developed g3 neutropenia with dasatinib, it was easily managed by the weekly administration of g - csf. the myelosupression can occur as a result of a sudden hematopoiesis suppression that was maintained by ph+ cells without equilibrium of the reappearance of the ph - cells. the fourth patient developed g4 pancreatitis after being initiated on imatinib mesylate and recurred with the same symptoms after switching to dasatinib even at the lower dose of 40 mg / day. the patient had no risk factors for pancreatitis and was taking no medications known to cause pancreatitis other than imatinib. the reason why it was unlikely for this patient to develop pancreatitis due to cml is because the onset of this complication appeared during the imatinib treatment and then gradually improved upon suspension of therapy. pancreatitis is an extremely rare adverse event which occurs after the use of tkis.23,2529 the pathophysiology of tkis - induced pancreatitis remains speculative, but has been proposed by plandari and colleagues26 to be due either to the inhibition of c - abl, which might interfere with the molecular mechanisms that regulate pancreatic cell death and thus induce pancreatic damage, or to the indirect effect of the drug on the release of calcium from the intracellular acinar stores, which regulate exocrine pancreatic secretion, and may enhance the accumulation of fatty acid inside the pancreatic acinar cell, which disturbs exocytosis. at the time of this report, it is possible that the greater potency of bcr - abl inhibition of dasatinib compared to imatinib contributed to the induction of remissions in our patients. because of its greater potency (325-fold), it has previously been reported that exposure to low or subnanomolar concentrations of dasatinib is sufficient to commit cell lines expressing bcr - abl to apoptotic cell death.15,16 these results may help to explain the improved tolerability and efficacy observed in our patients. an increasing number of investigators are exploring the use of a lower dose intensity of dasatinib for the treatment of therapy intolerant patients. in one recent study, the frequency and significance of dose reductions and treatment holidays among 280 patients treated with 2nd generation tkis were retrospectively analyzed.30 the results revealed that 176 (63%) of these patients required treatment interruptions and/or dose reduction at least once during therapy. the authors conclude that lower doses of dasatinib and nilotinib may potentially have similar efficacy in the therapy of cml as standard doses. in another small study, bergeron investigated pleural and pulmonary complications in 40 patients who received dasatinib (70 mg twice daily) for imatinib resistance or intolerance. dasatinib treatment was interrupted in eight patients, either immediately after diagnosis of lung involvement (five patients), or after a course of diuretics (three patients). after treatment holidays, lung abnormalities were resolved in all cases and did not recur in three out of four patients when dasatinib was reintroduced at a dose of 40 mg twice daily. in addition, breccia treated a 34-year - old ph+ cml female patient who had a molecular relapse after haploidentical bmt with chronic liver gvhd and was severely intolerant to both imatinib and dasatinib at a standard dose ; she had a cmr to dasatinib at a reduced dose of 20 mg / day without serious adverse events. a recent case report published by yamaguchi.33 described a successful treatment of a 70-year - old man with cml who developed a megakaryoblastic crisis concomitant with myelofibrosis despite imatinib therapy with dasatinib at a starting dose of 80 mg / day. despite the successful clinical response in these patients, conclusions drawn from this series should be interpreted with caution and considered tentative until experimental studies to define the minimum effective dose and optimal dosing schedule for dasatinib - intolerant patients are carried out. however, our series lend support to previous reports that showed a comparable efficacy of standard and low - dose dasatinib with very minor toxicities ; thus, for patients intolerant to dasatinib at a standard dose, a gradual dose reduction may be tried before drug discontinuation. | we report our experience in 4 patients with chronic myeloid leukemia (cml) who had discontinued imatinib as a result of adverse events and had switched to dasatinib. the chronic phase (n 2) and accelerated phase (n 2) cml patients received dasatinib at starting dose of 100 and 140 mg once daily, respectively. reappearance of hematological toxicity was observed in 3 patients and pancreatitis in one patient. treatment was given at a lower dose and patients were followed. the median follow - up was 13 months and the median dose of dasatinib until achievement of complete cytogenetic remission (ccyr) was 60 mg daily (range = 20 to 120 mg). all four patients had achieved ccyr at a median of 4 months (range = 3 to 5 months) and among them, three had also achieved major molecular remission. we conclude that low - dose dasatinib therapy in intolerant patients appears safe and efficacious and may be tried before drug discontinuation. |
atopy is characterised by a tendency to mount immunoglobulin e (ige)-mediated, type i hypersensitivity reactions to allergens. 10 - 20 percent of the population are affected by atopy and the prevalence of atopic diseases in children and adults has increased in these countries from the 1970s (asher., 2006 although there is evidence of genetic heritability (swarr and hakonarson, 2010), little is known about modifiable risk factors for atopy that might be used in prevention. vitamin d is a key regulator of calcium homeostasis, and biological evidence suggests that vitamin d and calcium might be implicated in atopic diseases and respiratory health, (hughes and norton, 2009 ; litonjua, 2009 ; hirota., 2007 ; chhabra., 1999) though epidemiological evidence is limited and inconsistent (devereux., 2007 ; laaksi., 2007 ; ginde., 2009 ; erkkola., 2009 ; hypponen., 2009 ; searing., 2010 ; miyake., differences in how vitamin d exposure and outcomes were assessed or differences in the confounders that were taken into account in different studies may have contributed to differences between them. wheezing and associated reduced lung function are amongst the wide range of symptoms associated with atopy and there is some evidence of positive association between vitamin d (measured as serum 25-hydroxyvitamin d [25(oh)d ] and lung function (devereux., 2007 ; searing., 2010 ; brehm., 2009 ; black and scragg, 2005 ; sutherland., 2010), although a null association has also been reported (devereux., 2009). previous studies in the us third national health and nutrition examination survey (nhanes iii) have shown positive association between serum calcium and forced expiratory volume in one second (fev1) (mckeever., 2008) but not with atopy (mckeever., 2004). in addition, higher serum 25(oh)d levels were associated with better lung function in the same study (black and scragg, 2005), but it is unknown whether the associations of 25(oh)d were independent of calcium and vice versa. our study adds to these previous papers by : (i) examining whether the associations of 25(oh)d and calcium are independent of each other : (ii) examining the association of 25(oh)d and calcium with specific allergen sensitisation : (iii) studying the association between serum calcium and fvc and (iv) comparing whether the magnitudes and/or directions of these associations differ between adolescents and adults. the previous lung function studies have included participants older than 17 years only (mckeever., the association between calcium and atopy was studied in 6 - 16 year olds and 17 - 59 year olds (mckeever., 2004). nhanes iii, conducted between 1988 and 1994, is a survey of the civilian non - institutionalized population of the united states. serum 25(oh)d and calcium measurements were available for participants aged 12 years and skin prick allergen responses for participants up to age 59 years (with a random 50 percent of 20 - 59 year olds having these tests). thus, we included participants aged 12 - 59 years, examining adolescents (12 - 19 years) and adults (20 - 59 years) separately. figure 1 shows the flow of participants who attended mobile examination clinics and final analyses samples for the studies in adolescents and adults. we only included individuals with complete data on exposures, outcome and all covariables in any analyses meaning that the final sample sizes were 2446 and 2315 adolescents for associations with lung function and allergy tests, respectively and 8049 and 3656 adults for associations with lung function and allergy tests, respectively. the nhanes iii study was approved by nhanes institutional review board and documented consent was obtained from participants. 25(oh)d was assayed with incstar 25-oh - d i radioimmunoassay (diasorin, stillwater, mn, usa) and serum calcium with nova 7 analyzer (nova biomedical, waltham, ma, usa). ionised calcium (adjusted for serum ph) was used in these analyses. lung function and allergy tests lung function [fev1 and forced vital capacity (fvc) ] was assessed with a ohio 827 rolling seal spirometer (ohio medical instrument company, cincinnati, oh usa) according to american thoracic society criteria (1987) (american thoracic society, 1987). the allergen panel consisted of 10 common allergens (dermatophagoides farinae, cat, german cockroach, short ragweed, perennial rye, alternaria alternata, bermuda grass, russian thistle, white oak and peanut) and a negative (glycerinated diluent) control. hypersensitivity reactions were evaluated 15 minutes after administering the allergens on separate sites of examinee 's forearms with prick - puncture technique. a positive test response was defined as maximum weal diameter3 mm for allergen and <3 mm for negative control. individuals with severe eczema or signs of skin infection on both arms, those with previous severe response to allergen testing or participants with signs of breathing difficulties were excluded from the allergy tests. we appreciate that these might include individuals with most severe atopy, but due to small numbers (39 adolescents ; 111 adults) it was not possible to examine this as an outcome by itself in both adolescents and adults. the following were considered potential confounding factors due to their known or plausible associations with exposures and outcomes : age, gender, race / ethnicity, height, health status, socioeconomic position, outdoor activity and smoking. height and weight were measured using standard research procedures at the mecs and were used to calculate body mass index (bmi). physicians ' impressions of health status (poor / fair / good / very good / excellent) at the mecs were used as an indicator of general health. data on self - reported race / ethnicity, smoking, pets, socioeconomic background, outdoor physical activity and history of respiratory / allergic diseases (emphysema, chronic bronchitis, asthma and hay fever) were obtained during interview. family poverty - income ratio (below / equal to or above 1) was used as indicator of socioeconomic position. outdoor activity during past month for adults was derived from the interview data according to method by scragg and camargo (scragg and camargo, jr., 2008). these data were not collected from those aged 18 or younger. in adolescents, we adjusted for pubertal stage, which was assessed by tanner scales (tanner jm, 1962). among adults, smoking status was defined as never, former (has smoked 100 cigarettes but not currently smoking), and current smoker. pack - years of smoking were calculated using answers to 12 tobacco questions and included assessment of current number of cigarettes smoked, maximum number of cigarettes smoked, and periods during which a current smoker did not smoke. due to the skewed distribution, a categorical variable for pack - years was derived (0, 0.1 - 4.9, 5 - 9.9, 10 - 19.9 and 20 pack - years). because of missing data on pack - years (22% of the adults), in our main analyses we adjusted for smoking status only and in sensitivity analyses we examined the effect of adjusting for pack - years in those with these data. in adolescents, smoking status was classified as current smoker or non - smoker currently due to low frequency of ex - smokers (n=67, 6.3% of those with smoking data available). because 61.7% of adolescents did not answer the smoking questionnaire, we did not include smoking as a covariable in the main analyses in adolescents but conducted a sensitivity analysis in those with smoking data available to see if adjusting for smoking affected the associations. statistical analyses were conducted with stata 11.0 (stata corp lp, college station, tx usa), using the svy procedure to account for cluster effects and sampling weights from mecs (lung function) and allergy subsamples (allergen sensitisation). a more detailed description of recommended statistical methodology is available in (landis., 1982). the associations of 25(oh)d and calcium levels with lung function were analyzed with multivariable linear regression. nhanes iii, conducted between 1988 and 1994, is a survey of the civilian non - institutionalized population of the united states. serum 25(oh)d and calcium measurements were available for participants aged 12 years and skin prick allergen responses for participants up to age 59 years (with a random 50 percent of 20 - 59 year olds having these tests). thus, we included participants aged 12 - 59 years, examining adolescents (12 - 19 years) and adults (20 - 59 years) separately. figure 1 shows the flow of participants who attended mobile examination clinics and final analyses samples for the studies in adolescents and adults. we only included individuals with complete data on exposures, outcome and all covariables in any analyses meaning that the final sample sizes were 2446 and 2315 adolescents for associations with lung function and allergy tests, respectively and 8049 and 3656 adults for associations with lung function and allergy tests, respectively. the nhanes iii study was approved by nhanes institutional review board and documented consent was obtained from participants. 25(oh)d was assayed with incstar 25-oh - d i radioimmunoassay (diasorin, stillwater, mn, usa) and serum calcium with nova 7 analyzer (nova biomedical, waltham, ma, usa). ionised calcium (adjusted for serum ph) was used in these analyses. lung function [fev1 and forced vital capacity (fvc) ] was assessed with a ohio 827 rolling seal spirometer (ohio medical instrument company, cincinnati, oh usa) according to american thoracic society criteria (1987) (american thoracic society, 1987). the allergen panel consisted of 10 common allergens (dermatophagoides farinae, cat, german cockroach, short ragweed, perennial rye, alternaria alternata, bermuda grass, russian thistle, white oak and peanut) and a negative (glycerinated diluent) control. hypersensitivity reactions were evaluated 15 minutes after administering the allergens on separate sites of examinee 's forearms with prick - puncture technique. a positive test response was defined as maximum weal diameter3 mm for allergen and <3 mm for negative control. individuals with severe eczema or signs of skin infection on both arms, those with previous severe response to allergen testing or participants with signs of breathing difficulties were excluded from the allergy tests. we appreciate that these might include individuals with most severe atopy, but due to small numbers (39 adolescents ; 111 adults) it was not possible to examine this as an outcome by itself in both adolescents and adults. the following were considered potential confounding factors due to their known or plausible associations with exposures and outcomes : age, gender, race / ethnicity, height, health status, socioeconomic position, outdoor activity and smoking. height and weight were measured using standard research procedures at the mecs and were used to calculate body mass index (bmi). physicians ' impressions of health status (poor / fair / good / very good / excellent) at the mecs were used as an indicator of general health. data on self - reported race / ethnicity, smoking, pets, socioeconomic background, outdoor physical activity and history of respiratory / allergic diseases (emphysema, chronic bronchitis, asthma and hay fever) were obtained during interview. family poverty - income ratio (below / equal to or above 1) was used as indicator of socioeconomic position. outdoor activity during past month for adults was derived from the interview data according to method by scragg and camargo (scragg and camargo, jr., 2008). these data were not collected from those aged 18 or younger. in adolescents, we adjusted for pubertal stage, which was assessed by tanner scales (tanner jm, 1962). among adults, smoking status was defined as never, former (has smoked 100 cigarettes but not currently smoking), and current smoker. pack - years of smoking were calculated using answers to 12 tobacco questions and included assessment of current number of cigarettes smoked, maximum number of cigarettes smoked, and periods during which a current smoker did not smoke. due to the skewed distribution, a categorical variable for pack - years was derived (0, 0.1 - 4.9, 5 - 9.9, 10 - 19.9 and 20 pack - years). because of missing data on pack - years (22% of the adults), in our main analyses we adjusted for smoking status only and in sensitivity analyses we examined the effect of adjusting for pack - years in those with these data. in adolescents, smoking status was classified as current smoker or non - smoker currently due to low frequency of ex - smokers (n=67, 6.3% of those with smoking data available). because 61.7% of adolescents did not answer the smoking questionnaire, we did not include smoking as a covariable in the main analyses in adolescents but conducted a sensitivity analysis in those with smoking data available to see if adjusting for smoking affected the associations. statistical analyses were conducted with stata 11.0 (stata corp lp, college station, tx usa), using the svy procedure to account for cluster effects and sampling weights from mecs (lung function) and allergy subsamples (allergen sensitisation). a more detailed description of recommended statistical methodology is available in (landis., 1982). the associations of 25(oh)d and calcium levels with lung function were analyzed with multivariable linear regression. the weighted mean (standard error) 25(oh)d and ionised serum calcium levels among adolescents were 80.3 (1.80) the correlation coefficient r for serum 25(oh)d and ionised calcium was 0.02 (p=0.34) in adolescents and 0.04 (p=0.0009) in adults. there was no statistical evidence that any associations differed between males and females (p for interaction 0.13). supplementary tables 1 - 4 summarise the age- and gender - adjusted characteristics of adolescents and adults across quartiles of serum 25(oh)d and ionised calcium. the proportion of females, non - hispanic blacks and persons from households with poverty / income ratio below 1 decreased across the quartiles of 25(oh)d in adolescents, while the proportion of non - hispanic whites increased across the quartiles. mean age and bmi decreased across quartiles of 25(oh)d, and mean serum level of ionised calcium and height increased across the quartiles. the proportion of men, non - hispanic whites, those reporting outdoor physical activity during past month, and those who had a pet increased across the quartiles of 25(oh)d. the proportion of non - hispanic blacks, individuals with fair health status and individuals from households with poverty - income ratio below 1 decreased across the quartiles of 25(oh)d in adults. the proportion of men increased linearly across the quartiles of ionised serum calcium in adults. mean age and number of pack - years smoked decreased across the calcium quartiles in adults. among the 12 - 19 year olds, in the adult group, mean serum 25(oh)d increased across the quartiles, while the proportion of mexican - american and other ethnicities decreased across the quartiles. with respect to outcomes, in these age- and gender - adjusted models 25(oh)d was associated positively with fev1 and fvc and inversely with responsiveness to german cockroach allergen in both age groups. in adults, 25(oh)d was inversely associated with the prevalence of atopy, and in adolescents, decreased responsiveness to ragweed, bermuda grass and perennial rye. serum ionised calcium was positively associated with sensitisation to short ragweed, bermuda grass, white oak and peanut allergens in adults only. ionised calcium was not associated with any outcomes in adolescents, or with other outcomes in adults. tables 1 and 2 show multivariable associations of 25(oh)d and calcium with lung function in adolescents and adults respectively. in adolescents (table 1), 25(oh)d was positively associated with fvc in the confounder adjusted model, but not with fev1. additional adjustment for pubertal stage (n=1566) did not alter the associations presented (results available from authors). in adults (table 2) serum 25(oh)d levels were positively associated with both fev1 and fvc after adjusting for all potential confounders (model 2). ionised serum calcium was not associated lung function in adolescents or adults (tables 1 - 2). with additional mutual adjustment (associations of 25(oh)d adjusted for ionised calcium and vice versa) tables 3 and 4 summarise the multivariable associations of 25(oh)d and calcium levels with previously diagnosed respiratory or allergic diseases and atopic outcomes in adolescents and adults. no associations were observed in adolescents (table 3) and serum 25(oh)d levels were not associated with allergic diseases or allergen sensitisation in adults, apart from slightly decreased sensitisation to german cockroach allergen (table4), higher calcium levels were associated with increased sensitisation to short ragweed, bermuda grass, white oak and peanut allergens, when adjusted for age, gender, race / ethnicity and height (model 1). with adjustment for additional confounders (model 2) and 25(oh)d (model3) the associations with sensitisation to short ragweed and bermuda grass allergen remained, but other associations were attenuated to the null. sensitivity analyses are shown in supplementary tables 5 - 12. in the subgroups of adolescents with smoking data and adults with data on pack - years associations that were the equivalent of models 1 - 3 for the whole eligible sample (tables 1 - 4) were markedly different in inconsistent ways, suggesting that analyses in these subgroups may be affected by selection bias. adjusting for smoking in adolescents and pack - years in adults did not markedly alter associations in these subgroups. we showed that the previously reported positive association of 25(oh)d with fvc and fev1 in adults (black and scragg, 2005) is independent of serum calcium levels, and not due decreased risk of allergen sensitisation or respiratory diseases, as serum 25(oh)d levels were not associated with these outcomes. in addition, the association between 25(oh)d levels and fvc, but not with fev1 was observed in adolescents, whereas a previous publication using nhanes iii data had only explored this association in adults (black and scragg, 2005). as with adults, this association was independent of calcium and allergen sensitisation. we did not find an association between ionised serum calcium and lung function in either adolescents or adults, although a previous study reported a positive association between ionised calcium and fev1 among nhanes iii participants age17 years (mckeever., 2008). that previous study did not address the association between fvc and calcium. the difference between our results and those of that previous nhanes study are likely to be due to differences in age ranges and numbers of participants included in the analyses of the two papers. we were interested in exploring whether associations differed between adolescents (defined as those aged 12 - 19) and adults, who had data on allergen sensitisation (20 - 59 year old). were exploring associations in adults only (defined as anyone aged 17 years or older), consequently they had larger numbers. also categorised calcium in a different way to the way we have used this variable. when we repeat our analyses using calcium in the same way as that used by mckeever. we still find no strong statistical evidence of an association in either of the age groups we examined, by contrast we can perfectly replicate mckeevers results in those aged 17 years and above. the positive association of 25(oh)d with lung function might be the result of vitamin d protecting against atopic asthma, but we found no evidence that higher levels of 25(oh)d were associated with decreased allergic responsiveness to common allergens. fev1 is primarily used as a measure of intrathoracic airway obstruction, as seen in asthma, in clinical and epidemiological settings, although changes in total lung capacity (tlc) will affect both fev1 and fvc. fvc is a dynamic representation of the difference between tlc and residual volume and, in healthy subjects, it is likely to vary with tlc and reflect lung growth. it is therefore possible that the positive association of 25(oh)d with fvc in adolescents reflects the established role of vitamin d in skeletal growth (holick, 2005), i.e. higher 25(oh)d is related to greater height via beneficial effects on skeletal development and greater height is associated with greater lung volume. however, all associations were adjusted for height and so this is unlikely to fully explain the association. in adults 25(oh)d was positively associated with both fev1 and fvc, supporting a role beyond the relation to skeletal development. high consumption of antioxidants have been associated with lung function,(e.g (gilliland., 2003)) so it is possible that the association of vitamin d is mediated via its antioxidative properties. alternative mechanisms might be the regulation of immune response, cellular differentiation and/or proliferation by vitamin d (bikle, 2009 ; van etten., 2008). vitamin d receptor is present in human bronchial smooth muscle cells, epithelial cells lining the respiratory tract, activated lymphocytes and antigen - presenting cells(van etten., 2008 ; bosse., 2007), which support the local functions of vitamin d in the lungs and in the immune system. therefore, it could be that vitamin d regulates the growth of bronchial smooth muscle cells or protects from the lung inflammation by promoting the expression of antimicrobial peptides and through anti - inflammatory mechanisms (bikle, 2009 ; van etten., 2008). alterations in calcium homeostasis are known to occur in asthma sufferers (chhabra., 1999), so it would be tempting to speculate this as a possible mechanism, although in our study circulating levels of ionised calcium were not associated with lung function, however, despite the lack of association between serum calcium levels and lung function, local calcaemic effects such as alterations in intracellular calcium signalling could still relate to the mechanism. our results suggest that variation in ionised serum calcium is more robustly associated with allergic response to common allergens in adults than is variation in vitamin d. in adults positive associations were found with sensitisation to grass allergens and peanut, although apart from short ragweed and bermuda grass, these associations were attenuated towards the null after adjusting for confounders. experimental studies suggest that calcium is involved in allergic response : bronchial smooth muscle contraction, mast cells granulation and histamine release from mast cells are calcium - dependent (hirota., 2007 ; alm, 1984) and effects of vitamin d on the immune system depend on adequate calcium levels (cantorna., 1999). both intra- and extracellular calcium levels have been shown to regulate the histamine release (alm, 1984), so one would perhaps expect to see a disruption of calcium homeostasis in atopy, although intracellular calcium levels are strictly controlled and thus unlikely to be affected by normal variation in serum calcium levels. in addition, the calcium - binding motifs in allergens, especially of grass origin, are necessary for ige binding and the chelation of calcium ions from sera of allergic patients lead to decreased allergen - ige binding or prevented this occurring (suphioglu., 1997 ; ledesma., only one previous study has examined the association of circulating calcium with allergic response and that cross - sectional study found no association (mckeever., 2004). the main strengths of this study are its sample size, examination of associations with serum measurements of 25(oh)d and calcium rather than dietary reports, examination with objectively assessed outcomes of lung function and allergic response to common allergens, comparison of associations in adolescents and adults and the ability to adjust for a wide range of potential confounding factors. in adults we were only able to adjust for smoking status (current / ex / never) for our main analyses and, whilst sensitivity analyses suggested that adjustment for pack - years in the subgroup with these data did not result in greater attenuation compared with smoking status similarly, in adolescents we were unable to adjust for smoking in the main analysis and those with smoking data appeared to be a selected subgroup. because this study is cross - sectional, we can not rule out reverse causality as an explanation for the observed associations. further exploration in prospective studies are warranted, though we are unaware of any studies that currently have measurements of serum 25(oh)d and calcium with later objectively measured lung function and response to common allergens. nhanes iii has single measurements of calcium and 25(oh)d, which may be inadequate to reflect long - term status (schram., 2007), although a single measurement may be a useful biomarker of season - specific vitamin d status over a longer time (hofmann., 2010) and serum calcium levels are normally maintained at relatively narrow limits within individuals (parfitt, 1987). other studies, including those finding associations with bone phenotypes (jesudason., 2002), have used single measurements of 25(oh)d. our findings contribute to the emerging literature on a possible role of vitamin d and calcium with lung function and atopy. we showed that the positive cross - sectional association between serum 25(oh)d levels and lung function is independent of variation in ionised calcium levels and does not appear to be driven by increased allergen sensitisation. by contrast we report a novel positive association between serum levels of ionised calcium and grass allergen sensitisation in adults, which is independent of a wide - range of potential confounding factors and of vitamin d. the positive association of 25(oh)d with lung function might be the result of vitamin d protecting against atopic asthma, but we found no evidence that higher levels of 25(oh)d were associated with decreased allergic responsiveness to common allergens. fev1 is primarily used as a measure of intrathoracic airway obstruction, as seen in asthma, in clinical and epidemiological settings, although changes in total lung capacity (tlc) will affect both fev1 and fvc. fvc is a dynamic representation of the difference between tlc and residual volume and, in healthy subjects, it is likely to vary with tlc and reflect lung growth. it is therefore possible that the positive association of 25(oh)d with fvc in adolescents reflects the established role of vitamin d in skeletal growth (holick, 2005), i.e. higher 25(oh)d is related to greater height via beneficial effects on skeletal development and greater height is associated with greater lung volume. however, all associations were adjusted for height and so this is unlikely to fully explain the association. in adults 25(oh)d was positively associated with both fev1 and fvc, supporting a role beyond the relation to skeletal development. high consumption of antioxidants have been associated with lung function,(e.g (gilliland., 2003)) so it is possible that the association of vitamin d is mediated via its antioxidative properties. alternative mechanisms might be the regulation of immune response, cellular differentiation and/or proliferation by vitamin d (bikle, 2009 ; van etten., 2008). vitamin d receptor is present in human bronchial smooth muscle cells, epithelial cells lining the respiratory tract, activated lymphocytes and antigen - presenting cells(van etten., 2008 ; bosse., 2007), which support the local functions of vitamin d in the lungs and in the immune system. therefore, it could be that vitamin d regulates the growth of bronchial smooth muscle cells or protects from the lung inflammation by promoting the expression of antimicrobial peptides and through anti - inflammatory mechanisms (bikle, 2009 ; van etten., 2008). alterations in calcium homeostasis are known to occur in asthma sufferers (chhabra., 1999), so it would be tempting to speculate this as a possible mechanism, although in our study circulating levels of ionised calcium were not associated with lung function, however, despite the lack of association between serum calcium levels and lung function, local calcaemic effects such as alterations in intracellular calcium signalling could still relate to the mechanism. our results suggest that variation in ionised serum calcium is more robustly associated with allergic response to common allergens in adults than is variation in vitamin d. in adults positive associations were found with sensitisation to grass allergens and peanut, although apart from short ragweed and bermuda grass, these associations were attenuated towards the null after adjusting for confounders. experimental studies suggest that calcium is involved in allergic response : bronchial smooth muscle contraction, mast cells granulation and histamine release from mast cells are calcium - dependent (hirota., 2007 ; alm, 1984) and effects of vitamin d on the immune system depend on adequate calcium levels (cantorna., 1999). both intra- and extracellular calcium levels have been shown to regulate the histamine release (alm, 1984), so one would perhaps expect to see a disruption of calcium homeostasis in atopy, although intracellular calcium levels are strictly controlled and thus unlikely to be affected by normal variation in serum calcium levels. in addition, the calcium - binding motifs in allergens, especially of grass origin, are necessary for ige binding and the chelation of calcium ions from sera of allergic patients lead to decreased allergen - ige binding or prevented this occurring (suphioglu., 1997 ; ledesma., only one previous study has examined the association of circulating calcium with allergic response and that cross - sectional study found no association (mckeever., 2004). the main strengths of this study are its sample size, examination of associations with serum measurements of 25(oh)d and calcium rather than dietary reports, examination with objectively assessed outcomes of lung function and allergic response to common allergens, comparison of associations in adolescents and adults and the ability to adjust for a wide range of potential confounding factors. in adults we were only able to adjust for smoking status (current / ex / never) for our main analyses and, whilst sensitivity analyses suggested that adjustment for pack - years in the subgroup with these data did not result in greater attenuation compared with smoking status similarly, in adolescents we were unable to adjust for smoking in the main analysis and those with smoking data appeared to be a selected subgroup. because this study is cross - sectional, we can not rule out reverse causality as an explanation for the observed associations. further exploration in prospective studies are warranted, though we are unaware of any studies that currently have measurements of serum 25(oh)d and calcium with later objectively measured lung function and response to common allergens. nhanes iii has single measurements of calcium and 25(oh)d, which may be inadequate to reflect long - term status (schram., 2007), although a single measurement may be a useful biomarker of season - specific vitamin d status over a longer time (hofmann., 2010) and serum calcium levels are normally maintained at relatively narrow limits within individuals (parfitt, 1987). other studies, including those finding associations with bone phenotypes (jesudason., 2002), have used single measurements of 25(oh)d. our findings contribute to the emerging literature on a possible role of vitamin d and calcium with lung function and atopy. we showed that the positive cross - sectional association between serum 25(oh)d levels and lung function is independent of variation in ionised calcium levels and does not appear to be driven by increased allergen sensitisation. by contrast we report a novel positive association between serum levels of ionised calcium and grass allergen sensitisation in adults, which is independent of a wide - range of potential confounding factors and of vitamin d. | backgroundevidence suggests that higher levels of vitamin d and calcium are associated with greater lung function and that vitamin d is inversely associated with atopic sensitisation. it is unknown whether the associations of vitamin d and calcium with lung function are independent of each other or mediated by atopic sensitisation.objectiveto study the associations of 25-hydroxyvitamin d [25(oh)d ] and ionised calcium levels with lung function and specific allergen sensitisation in adolescents (12 - 19 years) and adults (20 - 59 years) and to assess whether the associations with lung function are due to altered atopic sensitisation.methodscross-sectional analysis of the data from the third national health and nutrition examination survey.results25(oh)d levels were positively associated with forced vital capacity in adolescents [0.035(95 % ci : 0.007 - 0.064) standard deviations;sd in model adjusted for multiple confounders ]. this association and the previously reported association between higher serum levels of 25(oh)d and better lung function in adults were independent of serum calcium levels, which were not associated with lung function. in adults, calcium was associated with sensitisation to grass allergens [or per sd,1.17(1.03 - 1.32), 1.15(1.01 - 1.31) and 1.18 (1.06 - 1.32) for white oak, bermuda grass and short ragweed, respectively ] and peanut or 1.21 (95%ci 1.02 - 1.43) after adjusting for age, gender and race / ethnicity, but these associations attenuated towards the null after adjusting for additional confounders. the associations were independent of 25(oh)d levels, which were not associated with allergen sensitisation.conclusionscirculating levels of 25(oh)d are positively associated with lung function and this does not appear to be driven by allergen sensitisation or influenced by calcium levels. |
a total of 4 representative aquatic plants, eleocharis kuroguwai ohwi (belonging to the order cyperales), hydrocharis dubia backer (belonging to the order psammophytes), salvinia natans all. (a pteridophyte belonging to the order polypodiales), and zizania latifolia turcz. (a gramineous plant, belonging to the order braminales) are native to the daepyeong and jilnal wetlands. these species commonly live at the edge of water or float at the surface of freshwater (table 1). sampled plants (16 individuals per each species) were harvested along with freshwater from their habitats to minimize physiological changes. sterile distilled water (sdw) and sterilized 0.1% tween 80 solution (sigma - aldrich, st. louis, mo, usa) was sprayed on the surface of samples to eliminate suspended solids or normal microflora on the plant surfaces. the plants were submerged in 1.0% perchloric acid (hclo4) 2 times for 10 min each, and were subsequently washed with sdw 3~4 times. residual water was eliminated with dried, sterile gauze and 50 pieces of root from a plant sample was cut to a length of 3~4 cm. pre - treated samples were loaded into hagem minimal medium containing 80 ppm of streptomycin (sigma - aldrich) to exclude root bacteria, and incubated at 25 for 15 days. sub - culturing of endophytic fungi for pure isolation was performed with the same media and conditions. finally, pure isolates were incubated on potato dextrose agar (difco, detroit, mi, usa) and selected based on morphological differences. all endophytic fungi from the 4 aquatic host plants were inoculated into potato dextrose broth (difco) media and incubated at 25 for 7 days with 120 rpm using a rotary shaker. the dneasy plant mini kit (qiagen, germantown, md, usa) was used for the extraction of genomic dna from lyophilized mycobionts and primers targeting the its regions, its1 and its4 were used for amplification. the pcr conditions were pre - denaturation (94, 4min), denaturation (94, 1 min), annealing (55~58, 1 min), and extension (72, 2min) for a total of 35 cycles, followed by a final extension (72, 2 min). the pcr products were confirmed by electrophoresis (1.5% agarose gel, stained with ethidium bromide) and observation of the resulting band pattern under a uv transilluminator. the accuprep pcr & gel extraction kit (bioneer, daejeon, korea) was used for the purification of pcr products, and an abi 3730xl dna analyzer (applied biosystems, carlsbad, ca, usa) was used for the sequencing of its regions. the its region sequences of endophytic fungi were compared with sequences of other fungal species showing similarity over 99%, as determined by analyzing data from the genbank databases of national center for biotechnology information (ncbi). the phylogenetic trees were inferred with the neighbor - joining algorithm with the kimura 2-parameter. the stability of relationships was evaluated by a bootstrap analysis with a resampling of 1,000 times. diversity at the genus level was revealed using the margalef 's richness index (dmg) and mehinick 's index (dmn). a total of 4 representative aquatic plants, eleocharis kuroguwai ohwi (belonging to the order cyperales), hydrocharis dubia backer (belonging to the order psammophytes), salvinia natans all. (a pteridophyte belonging to the order polypodiales), and zizania latifolia turcz. (a gramineous plant, belonging to the order braminales) are native to the daepyeong and jilnal wetlands. these species commonly live at the edge of water or float at the surface of freshwater (table 1). sampled plants (16 individuals per each species) were harvested along with freshwater from their habitats to minimize physiological changes. sterile distilled water (sdw) and sterilized 0.1% tween 80 solution (sigma - aldrich, st. louis, mo, usa) was sprayed on the surface of samples to eliminate suspended solids or normal microflora on the plant surfaces. the plants were submerged in 1.0% perchloric acid (hclo4) 2 times for 10 min each, and were subsequently washed with sdw 3~4 times. residual water was eliminated with dried, sterile gauze and 50 pieces of root from a plant sample was cut to a length of 3~4 cm. pre - treated samples were loaded into hagem minimal medium containing 80 ppm of streptomycin (sigma - aldrich) to exclude root bacteria, and incubated at 25 for 15 days. sub - culturing of endophytic fungi for pure isolation was performed with the same media and conditions. finally, pure isolates were incubated on potato dextrose agar (difco, detroit, mi, usa) and selected based on morphological differences. all endophytic fungi from the 4 aquatic host plants were inoculated into potato dextrose broth (difco) media and incubated at 25 for 7 days with 120 rpm using a rotary shaker. the dneasy plant mini kit (qiagen, germantown, md, usa) was used for the extraction of genomic dna from lyophilized mycobionts and primers targeting the its regions, its1 and its4 were used for amplification. the pcr conditions were pre - denaturation (94, 4min), denaturation (94, 1 min), annealing (55~58, 1 min), and extension (72, 2min) for a total of 35 cycles, followed by a final extension (72, 2 min). the pcr products were confirmed by electrophoresis (1.5% agarose gel, stained with ethidium bromide) and observation of the resulting band pattern under a uv transilluminator. the accuprep pcr & gel extraction kit (bioneer, daejeon, korea) was used for the purification of pcr products, and an abi 3730xl dna analyzer (applied biosystems, carlsbad, ca, usa) was used for the sequencing of its regions. the its region sequences of endophytic fungi were compared with sequences of other fungal species showing similarity over 99%, as determined by analyzing data from the genbank databases of national center for biotechnology information (ncbi). phylogenetic relationships were analyzed using the mega program ver. 6.0 with an alignment of sequences that was prepared using clustalw software. the phylogenetic trees were inferred with the neighbor - joining algorithm with the kimura 2-parameter. the stability of relationships was evaluated by a bootstrap analysis with a resampling of 1,000 times. diversity at the genus level was revealed using the margalef 's richness index (dmg) and mehinick 's index (dmn). plant community of e. kuroguwai and h. dubia, around the daepyeong and jilnal wetlands, had floral axes of about 70~80 cm. s. natans had a floral axis of about 70 cm in length, and z. latifolia has an axis of about 80~90 cm with a leaf width of 3~4 cm. sampling information of aquatic plants a total of 8 strains isolated from e. kuroguwai belonged to the genera cladosporium, clonostachys, fusarium, leptosphaeria, pestalotiopsis, and plectosphaerella. a total of 11 strains from h. dubia belonged to genera cladosporium, fusarium, mucor, myxotrichum, penicillium, pestalotiopsis, talaromyces, and trichoderma. a total of 8 strains from s. natans belonged to 7 genera, including aspergillus, cladosporium, diaporhte, fusarium, pestalotiopsis, plectosphaerella, and pseudocercosporella. finally, 11 strains from z. latifolia belonged to 6 genera, including acremonium, alternaria, fusarium, leptosphaeria, penicillium, and talaromyces (table 2). a total of 6 strains isolated from e. kuroguwai belonged to 4 genera, including clonostachys, leptosphaeria, massarina, and penicillium, and 4 strains from h. dubia belonged to 3 genera, including aspergillus, fusarium, and leptosphaeria. a total of 9 strains from s. natans belonged to 8 genera, including cladosporium, fusarium, gibberella, leptosphaeria, paraphaeosphaeria, phoma, sarocladium, and talaromyces, and 8 strains from z. latifolia belonged to 6 genera, including acephala, cephalosporium, clohesyomyces, fusarium, talaromyces, and zalerion (table 3). a total 38 fungal strains from 16 genera were isolated from the daepyeong wetland, while 27 strains from 16 genera were isolated from the jilnal wetland. common isolates from both the daepyeong and the jilnal wetlands were identified as belonging to the species aspergillus, cladosporium, clonostachys, fusarium, leptosphaeria, penicillium, and talaromyces. on the other hand, there were 9 unique genera from the daepyeong wetland, including acremonium, alternaria, diaporthe, mucor, myxotrichum, pestalotiopsis, plectosphaerella, pseudocercosporella, and trichoderma. in contrast, there were 8 unique genera from the jilnal wetland, including acephala, cephalosporium, clohesyomyces, gibberella, massarina, paraphaeosphaeria, phoma, sarocladium, and zalerion (tables 2 and 3). the its sequences of endophytic fungal strains from each wetland were registered into the genbank database of ncbi, including isolates of e. kuroguwai (kr091772~kr091779), h. dubia (kr091780~kr091790), s. natans (kr091791~kr091798), and z. latifolia (kr091799~kr091809) from the daepyeong wetland, and isolates of e. kuroguwai (kr091810~kr091815), h. dubia (kr091816~kr091819), s. natans (kr091820~kr091828), and z. latifolia (kr091829~kr091836) to the jilnal wetland. phylogenetic trees of endophytic fungi isolated from the roots of aquatic plants native to the each wetland were constructed (fig. the richness of fungal isolates from the daepyeong and jilnal wetlands was analyzed at the genus level using mehinick 's index (dmn) and margalef 's richness index (dmg). in terms of generic richness calculated by margalef 's index, the fungal biota from each aquatic plant was as follows : e. kuroguwai (2.404, 1.674), h. dubia (2.919, 1.443), s. natans (2.885, 3.186), and z. latifolia (2.085, 2.404). using mehinick 's index, the generic richness was calculated as follows : e. kuroguwai (2.121, 1.633), h. dubia (2.412, 1.500), s. natans (2.475, 2.667), and z. latifolia (1.809, 2.121) (table 4). e. kuroguwai and h. dubia from the daepyeong wetland showed higher diversity values than those from the jilnal wetland. in contrast, s. natans and z. latifolia from the jilnal wetland showed higher values than those from the daepyeong wetland. the high values of fungal diversity from e. kuroguwai and h. dubia in the daepyeong wetland may be due to the greater number of isolates or variety of confirmed genus than from the jilnal wetland. similarly, the high values of fungal diversity from s. natans and z. latifolia in the jilnal wetland may be due to the greater number of confirmed genera than from the daepyeong wetland. mehinick 's index is similar, conceptually, to margalef 's richness index for analyzing species richness. the deduced diversity values from each of the two indices showed similar patterns in this study. because of the endophyte sample size, shannon 's diversity index (h ') and simpson 's diversity index (d) were not used. isolated fungi were found to belonging to 7 genera, and aspergillus, cladosporium, fusarium, and penicillium were commonly isolated. some fungal species belonging to the genus fusarium or leptosphaeria have been revealed as plant pathogens, but the genus clonostachys has not been studied well. each strain belonging to the 9 genera that can be differentiated by the source wetland is thought that result from the unique environment features of the two habitats. this result indicates that fungal biota of host plants can be differentiated by habitat location, even if they are from the same plant species, and that this could be a result of adaptation to their unique environments. these positive roles might be applied to aquatic plants to the purpose of effective water purifying. first, endophyte diversity from water purifying aquatic plants native to freshwater marshes must be secured prior to this tactic. this study provides endophytic diversity as basic data from these wetland environments and on aquatic plant - endophyte interactions that will be valuable for further study. differences in the thicknesses of a root epidermis or root cap between each aquatic plants species can lead to distinctive types of fungal biota. furthermore, these plants have evolved with independent morphological characteristics, even if the species diversity of aquatic plants is less than that of mesophytic plants. up to now, endosymbiotic microorganisms of aquatic plants have not been studied well, so this study can serve as a starting point for further research. e. kuroguwai, h. dubia, and z. latifolia form flowers and fruit and are perennial plants. in contrast, s. natans, a pteridophyte, is an annual plant that does not form flowers and fruit and that thrives by sporulation. generally, pteridophytes are more primeval type of vascular plants than others, and they hold a key position in the evolution of vascular plants. pteridophytes adapted to the drastic environmental changes of primitive ages, and sporulation allows for an explosion of the population under favorable conditions. s. natans can eliminate nitrogen and phosphorus from eutrophied water, and a very effective due to their strong propagation ability. because of this, s. natans is a highly valued bio - resource that can remediate contaminated natural environments. therefore, research on how endophytes interact with s. natans has become an important field. however, s. natans can also cover the surface of a wetland with blooms and decrease the dissolved oxygen concentration in the water. in conclusion, endophytes may play a major role in growth modulation of s. natans, an outstanding eutrophication controller. however, the interaction between the water purifying s. natans and their endophytes has not been studied well. in this study, s. natans showed the highest fungal diversity value of the plants surveyed (table 4). this may have resulted from a prolonged period of endosymbiosis with pteridophytes that appeared at an early stage of tracheophyte evolution. researches that screen the biological activity (isr, plang growth promoting) from endophytes secured in this study and application of promising endophytes to s. natans to promote (control) their growth or increase the efficiency of water purification activity in eutrophied water, have to be done. this study compared the distribution of endophytic fungi from aquatic plants native to two representative wetlands in korea for the purpose of discovering diverse and effective microorganisms. plant community of e. kuroguwai and h. dubia, around the daepyeong and jilnal wetlands, had floral axes of about 70~80 cm. s. natans had a floral axis of about 70 cm in length, and z. latifolia has an axis of about 80~90 cm with a leaf width of 3~4 cm. sampling information of aquatic plants a total of 8 strains isolated from e. kuroguwai belonged to the genera cladosporium, clonostachys, fusarium, leptosphaeria, pestalotiopsis, and plectosphaerella. a total of 11 strains from h. dubia belonged to genera cladosporium, fusarium, mucor, myxotrichum, penicillium, pestalotiopsis, talaromyces, and trichoderma. a total of 8 strains from s. natans belonged to 7 genera, including aspergillus, cladosporium, diaporhte, fusarium, pestalotiopsis, plectosphaerella, and pseudocercosporella. finally, 11 strains from z. latifolia belonged to 6 genera, including acremonium, alternaria, fusarium, leptosphaeria, penicillium, and talaromyces (table 2). a total of 6 strains isolated from e. kuroguwai belonged to 4 genera, including clonostachys, leptosphaeria, massarina, and penicillium, and 4 strains from h. dubia belonged to 3 genera, including aspergillus, fusarium, and leptosphaeria. a total of 9 strains from s. natans belonged to 8 genera, including cladosporium, fusarium, gibberella, leptosphaeria, paraphaeosphaeria, phoma, sarocladium, and talaromyces, and 8 strains from z. latifolia belonged to 6 genera, including acephala, cephalosporium, clohesyomyces, fusarium, talaromyces, and zalerion (table 3). a total 38 fungal strains from 16 genera were isolated from the daepyeong wetland, while 27 strains from 16 genera were isolated from the jilnal wetland. common isolates from both the daepyeong and the jilnal wetlands were identified as belonging to the species aspergillus, cladosporium, clonostachys, fusarium, leptosphaeria, penicillium, and talaromyces. on the other hand, there were 9 unique genera from the daepyeong wetland, including acremonium, alternaria, diaporthe, mucor, myxotrichum, pestalotiopsis, plectosphaerella, pseudocercosporella, and trichoderma. in contrast, there were 8 unique genera from the jilnal wetland, including acephala, cephalosporium, clohesyomyces, gibberella, massarina, paraphaeosphaeria, phoma, sarocladium, and zalerion (tables 2 and 3). the its sequences of endophytic fungal strains from each wetland were registered into the genbank database of ncbi, including isolates of e. kuroguwai (kr091772~kr091779), h. dubia (kr091780~kr091790), s. natans (kr091791~kr091798), and z. latifolia (kr091799~kr091809) from the daepyeong wetland, and isolates of e. kuroguwai (kr091810~kr091815), h. dubia (kr091816~kr091819), s. natans (kr091820~kr091828), and z. latifolia (kr091829~kr091836) to the jilnal wetland. phylogenetic trees of endophytic fungi isolated from the roots of aquatic plants native to the each wetland were constructed (fig. the richness of fungal isolates from the daepyeong and jilnal wetlands was analyzed at the genus level using mehinick 's index (dmn) and margalef 's richness index (dmg). in terms of generic richness calculated by margalef 's index, the fungal biota from each aquatic plant was as follows : e. kuroguwai (2.404, 1.674), h. dubia (2.919, 1.443), s. natans (2.885, 3.186), and z. latifolia (2.085, 2.404). using mehinick 's index, the generic richness was calculated as follows : e. kuroguwai (2.121, 1.633), h. dubia (2.412, 1.500), s. natans (2.475, 2.667), and z. latifolia (1.809, 2.121) (table 4). e. kuroguwai and h. dubia from the daepyeong wetland showed higher diversity values than those from the jilnal wetland. in contrast, s. natans and z. latifolia from the jilnal wetland showed higher values than those from the daepyeong wetland. the high values of fungal diversity from e. kuroguwai and h. dubia in the daepyeong wetland may be due to the greater number of isolates or variety of confirmed genus than from the jilnal wetland. similarly, the high values of fungal diversity from s. natans and z. latifolia in the jilnal wetland may be due to the greater number of confirmed genera than from the daepyeong wetland. mehinick 's index is similar, conceptually, to margalef 's richness index for analyzing species richness. the deduced diversity values from each of the two indices showed similar patterns in this study. because of the endophyte sample size, shannon 's diversity index (h ') and simpson 's diversity index (d) were not used. isolated fungi were found to belonging to 7 genera, and aspergillus, cladosporium, fusarium, and penicillium were commonly isolated. some fungal species belonging to the genus fusarium or leptosphaeria have been revealed as plant pathogens, but the genus clonostachys has not been studied well. each strain belonging to the 9 genera that can be differentiated by the source wetland is thought that result from the unique environment features of the two habitats. this result indicates that fungal biota of host plants can be differentiated by habitat location, even if they are from the same plant species, and that this could be a result of adaptation to their unique environments. these positive roles might be applied to aquatic plants to the purpose of effective water purifying. first, endophyte diversity from water purifying aquatic plants native to freshwater marshes must be secured prior to this tactic. this study provides endophytic diversity as basic data from these wetland environments and on aquatic plant - endophyte interactions that will be valuable for further study. differences in the thicknesses of a root epidermis or root cap between each aquatic plants species can lead to distinctive types of fungal biota. furthermore, these plants have evolved with independent morphological characteristics, even if the species diversity of aquatic plants is less than that of mesophytic plants. therefore, microbial distribution and diversity may differ from one another. up to now, endosymbiotic microorganisms of aquatic plants have not been studied well, so this study can serve as a starting point for further research. e. kuroguwai, h. dubia, and z. latifolia form flowers and fruit and are perennial plants. in contrast, s. natans, a pteridophyte, is an annual plant that does not form flowers and fruit and that thrives by sporulation. generally, pteridophytes are more primeval type of vascular plants than others, and they hold a key position in the evolution of vascular plants. pteridophytes adapted to the drastic environmental changes of primitive ages, and sporulation allows for an explosion of the population under favorable conditions. s. natans can eliminate nitrogen and phosphorus from eutrophied water, and a very effective due to their strong propagation ability. because of this, s. natans is a highly valued bio - resource that can remediate contaminated natural environments. therefore, research on how endophytes interact with s. natans has become an important field. however, s. natans can also cover the surface of a wetland with blooms and decrease the dissolved oxygen concentration in the water. in conclusion, endophytes may play a major role in growth modulation of s. natans, an outstanding eutrophication controller. however, the interaction between the water purifying s. natans and their endophytes has not been studied well. in this study, s. natans showed the highest fungal diversity value of the plants surveyed (table 4). this may have resulted from a prolonged period of endosymbiosis with pteridophytes that appeared at an early stage of tracheophyte evolution. researches that screen the biological activity (isr, plang growth promoting) from endophytes secured in this study and application of promising endophytes to s. natans to promote (control) their growth or increase the efficiency of water purification activity in eutrophied water, have to be done. this study compared the distribution of endophytic fungi from aquatic plants native to two representative wetlands in korea for the purpose of discovering diverse and effective microorganisms. | a total of 4 aquatic plants, eleocharis kuroguwai ohwi, hydrocharis dubia backer, salvinia natans all., and zizania latifolia turcz., were sampled from representative two wetlands of south korea. a total of 38 endophytic fungal strains were isolated from aquatic plants native to the daepyeong wetland, and 27 strains were isolated from the jilnal wetland. the internal transcribed spacer regions of fungal isolates were sequenced and a phylogenetic analysis was performed. in addition, endophytic fungal diversity from each wetland and host plant species was deduced. a total of 25 fungal genera were purely isolated, and 16 fungal genera were isolated from each of the two wetlands. commonly isolated genera from both wetlands were aspergillus, cladosporium, clonostachys, fusarium, leptosphaeria, penicillium, and talaromyces. this study revealed that fungal diversity varied with environmental conditions and by host plant in representative two wetlands. |
pgp 9.5 is a ubiquitin - carboxyl hydrolase that is expressed in nerve tissues from mice brains at all stages of differentiation, and thus it has been regarded as an universal cytoplasmic marker for neuroendocrine cells and neuroendocrine tumors (nets) since the 1980s. however, pgp 9.5 has not gained popularity as a diagnostic and prognostic marker in the past because of the limited supply of the antibody, but the immunostaining characteristics for 4 kinds of islet cells were not known. commercial pgp 9.5 antibodies are now available for both polyclonal rabbit and monoclonal antibodies ; rabbit anti - pgp 9.5 was used for pancreatic endocrine tumors (pets) in this study. pets have been classified by the widely accepted who 2004 and 2010 classifications for nets including pets in the gastroenteropancreatic system. this study aimed to correlate pgp 9.5 immunocytochemical staining with both of the 2004 and 2010 who classifications for gastroenteropancreatic nets. in normal pancreatic islets, all islet cells, including -cells for insulin, -cells for glucagon, -cells for srif, and pp cells for pp, were moderately to strongly positive for pgp 9.5, showing diffuse cytoplasmic staining for all islet cells and strong staining for the peripherally located islet cells, which corresponded to -cells (fig., -cells were the major islet cells and were mainly located in the middle of islets, whereas -cells were mainly located at the periphery of islets and the outer margin of islet lobules (fig. -cells were located in middle of islets adjacent to -cells and were moderately positive for pgp 9.5 (fig. scattered fine nerve fibers were identified in the interacinar and abundantly in the perivascular connective tissues. periductal, peri - islet, and inter - islet fine nerve fibers were also positively immunostained together with scattered, strongly immunostained ganglion cells with plump cytoplasm (fig. eight insulinomas (75%), excluding 2 benign cases (cases 4 and 7) and one g2 malignant case (case 9), were at least moderately positive for pgp 9.5 (fig. 2 ; table 1). two glucagonomas were negative for pgp 9.5, and one srifoma was positive (fig. 3a and b ; table 1). three of 6 ppomas (cases 24), 3 of 9 gastrinomas (cases 4, 6, and 7), and 2 of 4 non - functioning pets (cases 1 and 3) were negative for pgp 9.5 (fig. 3, table 1). using the 2004 who classification, 11 of 12 insulinomas (92%) were wdnet, one case of primary insulinoma was originally wdnet, and a liver metastasis (case 9) 3 y after tumor resection was wdnec. two glucagonomas were wdnec, and one srifoma was wdnet (table 1). among 6 ppomas, cases 1, 2, and 3 were from the same patient, who presented initially with a large ppoma as wdnec, which metastasized to the liver as the same wdnec 2 y after hemipancreatectomy and subsequently involved the entire remaining pancreas diffusely and the liver 4 y after the initial surgery as pdnec of small cell pdnec (table 1). in the remaining 3 cases of ppomas, one liver metastasis (case 4) was wdnec, and 2 cases of tumors smaller than 1.5 cm (cases 5 and 6) were wdnet (table 1). among 8 primary gastrinomas, 6 cases of tumors smaller than 1.5 cm (cases 1, 2, 3, 5, 8, and 9) and one 3-cm tumor (case 6) were wdnet, and one case of a tumor larger than 3.5 cm (case 7) and one liver metastasis (case 4) were wdnec (table 1). among 4 non - functioning pets, 2 primary cases of tumors smaller than 1 cm (cases 2 and 4) were wdnet, and two cases one a large primary tumor (case 1) and the other a lymph node metastasis (case 3)were wdnec (table 1). figure 1. the majority of islet cells were -cells (brown), and -cells (blue) were located at the periphery of islets and islet lobules (a). srif cells were minor islet cells, located in the middle of islets adjacent to -cells (b and c). all of the islet cells were moderately immunostained for pgp 9.5 with the stronger staining for scattered ganglion cells and the peripheral islet cells, the latter corresponding to -cell (d). in the well - fixed tissues, fine nerve fibers were identified in intra- and inter - islet, inter - acinar and perivascular stroma together with stronger immunostained scattered ganglion cells containing plump cytoplasm (e). d, duct ; g, ganglion cells ; i, islet ; intra - islet, intra-, and inter - acinar and peri - ductal nerve fibers. (a) insulin and glucagon, (b) insulin and srif, (c) glucagon and srif double immunostained, (d and e) pgp 9.5 immunostained. this tumor was strongly positive for insulin (a) and moderately positive for pgp 9.5 (b). this insulinoma was moderately positive for insulin as compared with normal -cells embedded in the tumor (c) and was also moderately positive for pgp 9.5, whereas ganglion cells were strongly positive in the plump cytoplasm (d). the tumor cells were weakly positive for insulin (e) but strongly positive for pgp 9.5 (f). ganglion cells were more strongly immunostained for pgp 9.5 than the normal islet cells (f). (a, c, and e) insulin, (b, d, and f) pgp 9.5 immunostained. ln, lymph node. who classification 2004 : wdnet, wdnec, and pdnec. who classification 2010 : g1, g2, and g3. non--cell pets, srifoma case 1, gastrinoma case 7, and non - functioning pet case 2 srifoma, case 1. the tumor cells were weakly positive for srif (a) and moderately positive for pgp 9.5 (b). the tumor cells were moderately positive for gastrin (c) and were negative for pgp 9.5 (d). non - functioning pet case 2 : the tumor cells were positive for cga (e) but negative for insulin, glucagon, srif, pp and were weakly positive for pgp 9.5 (f). (a) srif, (c) gastrin, (e) cga, (b, d, and f) pgp 9.5 immunostained. using the 2010 who classification, we used ki-67 immunostaining ; this provided more consistent results than mitotic figures, which appeared to be less consistent depending on the tissue preservation and fixation, and mitotic figures more than 10 to 20 per 10 high - power fields were not common even in the g2 and g3 cases. all of the wdnets were g1, all wdnecs were g2, and one small cell pdnec in one post - chemotherapy ppoma was g3 (table 1). immunocytochemical staining revealed that 11 of 12 insulinomas were moderately positive for pgp 9.5 in 8 cases (cases 1, 2, 3, 6, 7, 8, 10, and 11) and strongly positive in one case (case 5) (9/12, 75%), whereas 2 cases (cases 4 and 7) were weakly positive and one case was negative (case 9) (3/12, 25% ; fig. 2 ; table 1). scattered ganglion cells with plump cytoplasm adjacent to the normal pancreas were much more strongly immunostained for pgp 9.5 than normal islet cells were (fig. two glucagonomas were negative, and one srifoma was weakly positive for pgp 9.5 (fig. 3a and b ; table 1). among 6 ppomas, 2 wdnets, g1 (cases 5 and 6) and 2 wdnecs, g2 (cases 1 and 2) were positive for pgp 9.5, whereas one pdnec, g3 (case 3) and one liver metastasis (case 4), wdnec, g2 were negative for pgp 9.5 (fig. 3 ; table 1). among 9 gastrinomas, 6 wdnets, g1 (cases 1, 2, 3, 5, 8, and 9) were weakly positive for pgp 9.5, whereas one wdnet (case 7) and two wdnecs, g2 (cases 4 and 7) were negative for pgp 9.5 (fig. 3c and d ; table 1). among 4 non - functioning pets, which were positive for cga but negative for all 4 pancreatic hormones and gastrin, 2 wdnets, g1 (cases 2 and 4) were weakly positive for pgp 9.5, and 2 wdnecs, g2 (cases 1 and 3) were negative for pgp 9.5 (fig. pets are relatively rare tumors occurring in fewer than 1 in 100,000 populations, representing 12% of all pancreatic neoplasms, and the incidence in random autopsy studies has been reported as 0.51.6%. most pets are well - differentiated, relatively low - grade neoplasms, but their association with characteristic paraneoplastic syndromes has drawn more attention to pets than their prevalence in proportion to such syndromes. among all pets, insulinomas and gastrinomas used to be the most common pets presenting in 1 of 2 cases out of a million per year among mea-1 family members, who present the typical hyperinsulinemia / hypoglycemia symptoms of insulinoma and the peptic ulcers of gastrinoma, but non - functioning pets with no clinical symptoms were reportedly the most common in the general autopsy cases. the histopathological definition of nets has been expanded in the who 2010 classification to include necs in adenoendocrine carcinomas, which include small cell or large cell pdnecs in adenocarcinomas with no hormone - associated symptom as the major pets including non - symptomatic hormone secreting ppomas. the most common clinically symptomatic insulinomas were reported to be 90% benign and were detected early because of the typical symptoms, whereas non--cell pets usually followed a more aggressive clinical course and at least 50% of these tumors presented as biologically malignant, which included all non--cell pets (e.g., glucagonomas, srifomas, ppomas, vasoactive intestinal polypeptidomas [vipomas ], gastrinomas, and non - functioning pets). nine of 12 insulinomas (9/12, 75%) were moderately to strongly positive for pgp 9.5, whereas 2 glucagonomas (2/2, 100%), 4 of 6 ppomas (4/6, 67%), 3 of 9 gastrinomas (3/9, 33%), and 2 of 4 non - functioning pets (2/4, 50%) were negative for pgp 9.5 (table 1). thus, among 22 non--cell pets, 13 of 22 cases (13/22, 59%) were negative for pgp 9.5, and all 22 non--cell pets were either weakly positive or negative for pgp 9.5, which matches well with the incidence of biological malignancy of non--cell pets. about 10% of insulinomas develop metastasis, whereas non--cell tumors develop higher percentages of metastasis : 60% for both gastrinomas and glucagonomas, 70% for vipomas, and 50% for srifomas and non - functioning pets. the who 2004 and 2010 classifications are widely used for nets of the gastroenteropancreatic system including classic gastrointestinal carcinoids tumors and pets. pathology reports on pets thus should include the 2004 and 2010 who classifications along with the hormone - secreting status, location, and size of each tumor as presented in this study. an example was the case 1 ppoma in a 33-y - old male from an mea type 1 family who presented a large 13 14 15-cm tumor in the body and tail of his pancreas, a ppoma with more than 10 times the serum pp levels (stimulated by fasting and protein meals) than the age - matched control values. this pet was wdnec, g2 with moderate pp immunostaining and 10 times more tissue pp levels than that of the control pancreatic tissue extracts. the tumor metastasized to the liver 2 y after the initial hemipancreatectomy, which presented as wdnec, g2 with scant pp immunostaining and less tissue pp levels than that of the normal control pancreas. the patient died of diffuse tumor involvement in the remaining pancreas and multiple metastases to the liver, lymph nodes, and bones 5 y after the initial surgery presented as pdnec, g3 of small cell pdnec with a trace of pp immunostaining and tissue pp levels, ending up as a non - functioning small cell pdnec. the new who 2010 classification allowed for more nets to be added to the classic gastrointestinal carcinoids by including small cell and large cell pdnecs in adenoendocrine carcinomas within the entire digestive system. thus, classic carcinoids used to occurred in the digestive tract extending only from the stomach to the rectum, but the newly classified nets now include necs anywhere within the tract from the oral cavity to the rectum. pgp 9.5, an ubiquitin carboxyl - terminal hydrolase expressed in nerves and some neuroendocrine cell cytoplasm, is a neuron - specific peptide. pgp 9.5 is also used as a new member of all sensory nerve fibers including small - diameter fibers transmitting pain and large fibers transmitting proprioception. at present, moderately to strongly positive pgp 9.5 immunostaining suggests the presence of a positive cytoplasmic marker for biological benignity ; absent or weakly positive pgp 9.5 immunostaining in non--cell pets suggests potentially biological malignancy ; and negative staining that is more aggressive than weakly positive staining as similarly shown in negative nuclear immunostaining for caspase-3 suggests an aggressive marker in non--cell pets. pgp 9.5 immunostaining is localized for the water - soluble proteins and is characterized by diffuse, homogenous staining in the entire cytoplasm with especially strong staining for ganglion cells (fig. 1e ; fig. 2d and f), which is reportedly not related to the cell type of hormone products. with cryosections, fine details of nerve fibers are clearly immunostained using monoclonal pgp 9.5 antibody but not rabbit polyclonal pgp 9.5 antibody (unpublished data). i / ii and pgp 9.5, rodriguez - diaz.s cryosections demonstrated that human islets have less innervation than mouse islets. similarly, using polyclonal lyve-1 antibody and monoclonal d2 - 40 antibody for lymphatic vessel staining resulted in better immunostaining with frozen sections than with routine paraffin sections. as shown in this study, pgp 9.5 immunostaining is a reliable and useful cytoplasmic marker for all nets of the gastroenteropancreatic system, and negative and weakly positive immunostaining for pgp 9.5 may serve as a potentially biologically malignant marker especially for non--cell pets as shown in all 22 cases of non--cell pets (table 1). pgp 9.5 immunocytochemical phenotype may be added as not only a diagnostic marker but also a prognostic marker. a total of 34 cases of pets obtained between 1974 and 2001 from the university of kansas medical center were included in this study and were selected among the previously reported cases. the pets consisted of 12 insulinomas, 2 glucagonomas, 1 somatostatinoma (srifoma), 6 pancreatic polypetidomas (ppomas), 9 gastrinomas, and 4 non - functioning pets. all primary tumor tissues including the adjacent normal pancreatic tissues were routinely fixed in 10% neutral formalin and embedded in paraffin. for immunocytochemical staining, all deparaffinized tissue sections were treated with 0.1 n citric buffer (ph 6.2) at 100 c for 10 min using a high pressure cooker (biocare medical)., gtx 17039) was used at 1:100 dilution for overnight incubation at 4 c. as previously reported by us, ki-67 immunostaining was performed as were insulin, glucagon, somatostatin (srif), pancreatic polypeptide (pp), gastrin, and chromogranin a (cga) immunostaining. the percentage of ki-67-positive tumor cells was calculated in the cumulative 1,000 tumor cells in the 5 hot spots examined at 10 40 = 400 magnification. for control islets, double immunostaining was performed to reveal the relative locations of each of the 2 pancreatic hormones, including insulin and glucagon, insulin and srif and glucagon and srif, respectively. the sections were initially immunostained for the first pancreatic hormone for brown color using diaminobendidine tetrahydrochloride ; then the same sections were subsequently immunostained for the second pancreatic hormone for blue color using vector sg (sk-4700, vector lab). we defined the strongest immunostaining in the adjacent strongest immunostained pancreatic islet cells as + + +, moderate staining as + +, weak staining as +, and negative staining as 0. pets were histopathologically graded according to the 2004 and 2010 who classifications of the gastroenteropancreatic net as follows : the 2004 classifications are well - differentiated net (wdnet) with benign and uncertain behavior, well - differentiated neuroendocrine carcinoma (wdnec), and poorly differentiated neuroendocrine carcinoma (pdnec). the 2010 classifications, in which mitotic figures per 10 high - power fields and the ki-67 positive percentage index were used, are g1, mitotic figures fewer than 2 per 10 high - power fields and the ki-67 index less than 2% ; g2, mitotic figures 220 per 10 high - power fields and the ki-67 index 320% ; and g3, mitotic figures greater than 20 per 10 high - power fields and the ki-67 index greater than 20% of tumor cells. | aims / hypothesis : protein gene product 9.5 (pgp 9.5) is a marker for neuroendocrine cells but has not been used for pancreatic islet cells and pancreatic endocrine tumors (pets). antibodies for pgp 9.5 are now commercially available for immunocytochemical study, with which immunostaining may be able to differentiate between benign and malignant pets.results : all 4 kinds of normal islet cells were positively immunostained for pgp 9.5moderately positive for -cells and strongly positive for -cells, whereas ganglion cells were immunostained more strongly than islet cells. nine of 12 insulinomas were moderately to strongly positive for pgp 9.5. two glucagonomas, 3 of 6 pancreatic polypeptidomas (ppomas), 3 of 9 gastrinomas, and 2 of 4 non - functioning pets were negative for pgp 9.5.materials and methods : thirty - four pets were immunocytochemically stained for pgp 9.5 using a rabbit polyclonal antibody together with immunostaining for 4 pancreatic hormones, chromogranin a (cga), and gastrin. pets consisted of 12 insulinomas, 2 glucagonomas, 1 somatostatinoma (srifoma), 6 ppomas, 9 gastrinomas, and 4 non - functioning pets.conclusion/interpretation : pgp 9.5 immunostaining was universally positive for 4 kinds of islet cells and was moderately to strongly positive for 9 of 12 (75%) insulinomas. all 22 non--cell pets were negative or weakly positive for pgp 9.5, and thus negative or weakly positive pgp 9.5 immunostaining may be used as a marker for potential malignancy and poor prognosis for non--cell pets. |
etomidate is a popular anesthetic agent since it is associated with hemodynamic stability, minimal respiratory depression, cerebral protection, and rapid recovery after either a single dose or a continuous infusion. the mechanism of myoclonus is not clear and does not seem to be associated with seizure - like electroencephalographic activities. however, myoclonus is believed to be the result of activities either in the brainstem or deep cerebral structures. the incidence of myoclonus is highly variable (0 - 80%) and can be problematic in patients with open globe injuries or those at high risk of aspiration. the incidence of myoclonus can be reduced after premedication with either opioid or benzodiazepine. among the evaluated medications, both midazolam, and sufentanil, as pretreatment agents, have been reported to effectively reduce the myoclonus. however, a comparison between midazolam and sufentanil has not been made so far, and it is not clear which agent is a better option for reducing myoclonus after etomidate injection. therefore, we conducted a prospective, randomized, double - blind, clinical trial to compare the efficacy of midazolam and sufentanil in reducing the incidence and severity of myoclonus after etomidate injection in patients, undergoing elective ophthalmic surgery with general anesthesia. fifty adult patients with american society of anesthesiologists class ii or iii, who were scheduled for elective eye surgery under general anesthesia, were selected for the study. the exclusion criteria were allergy to benzodiazepine or opioid, neuropsychological or neuromuscular diseases, adrenal dysfunction or epilepsy, addiction ; and analgesic or sedatives administration within 24 h before the procedure. patients did not receive premedication and were randomly assigned to one of the two groups (n = 25 per group) group m consisted of patients receiving midazolam (0.015 mg / kg) and group s consisted of patients receiving sufentanil (0.2 /kg). an anesthesiologist, who was blinded to the study and was not involved in anesthesia induction, prepared and coded syringes containing a total volume of 4 ml of medications. patient monitoring included electrocardiography, pulse oximetry, noninvasive blood pressure (bp) monitoring, and capnography. patients received isotonic saline solution (5 ml / kg) over 10 min at room temperature and were preoxygenated with 100% oxygen ; then, the medication was injected over 30 s. ninety seconds after pretreatment with the medication, etomidate (0.3 mg / kg) was intravenously injected within 20 s. two minutes after intravenous (iv) administration of etomidate, anesthesia was completed by atracurium (0.5 mg / kg) and fentanyl (2 /kg) to guarantee adequate anesthetic induction. patients were continuously monitored during anesthesia by one single physician, blinded to treatment procedures. heart rate (hr), bp and mean arterial pressure (map) in pre- and post - induction (90 s after administration) were recorded. the intensity of myoclonus was clinically graded as follows : 0 = no myoclonus, 1 = mild myoclonus (short movement of a body segment), 2 = moderate myoclonus (mild movements of two different muscles), and 3 = severe myoclonus (intense clonic movements in two or more muscle groups). based on previous studies, a minimum number of 23 patients were required in each group (with a significance level of 90% and a power of 80%). hence, 25 patients in each group were included in this study. t - test and chi - square were performed to compare patients ' characteristics, and comparisons between the groups were performed by mann - whitney test. based on previous studies, a minimum number of 23 patients were required in each group (with a significance level of 90% and a power of 80%). hence, 25 patients in each group were included in this study. t - test and chi - square were performed to compare patients ' characteristics, and comparisons between the groups were performed by mann - whitney test. demographic information of the patients is shown in table 1 ; there was no significant difference between the two groups in terms of age, although they were different regarding sex distribution (p = 0.047) [table 1 ]. demographic characteristics of the patients the incidence of myoclonus was significantly different between the two groups ; it was 28% (7 patients) in the sufentanil group and 84% (21 patients) in the midazolam group (p = 0.001). the intensity of myoclonus was also significantly more severe in midazolam groups compare to sufentanil group [table 2 ]. severity of myoclonus in sufentanil and midazolam groups the mean duration of myoclonus was significantly less in sufentanil group than in midazolam group (5.8 13.2 s vs. 69 47.8 s ; p < 0.001). there was a significant difference in hr pre- and post - anesthesia induction in the sufentanil group. the mean hr was 83.96 18.1 before the induction and 71.8 15.2 after the induction in this group (p < 0.001). however, the difference in hr before and after the induction in the midazolam group was not significant (77.24 15.1 vs. 76.2 13) (p = 0.705). mean arterial pressure was significantly different before and after the induction in the sufentanil group ; it was 120.46 15.4 mmhg before the induction and 109.5 18.8 mmhg after the induction (p = 0.0001). however, map was not significantly different before and after the induction in the midazolam group ; it was 123.12 19 mmhg before the induction and 116.2 25.5 mmhg after the induction (p = 0.098). the mean hr before and after the induction was significantly different between the two groups (p = 0.002). the mean difference in hr before and after the induction was 12.16 10.3 in the sufentanil group and 1.04 13.5 in the midazolam group. the mean of map before and after the induction was not significantly different between the two groups (p = 0.406). the mean difference in map before and after the induction was 10.09 12.6 mmhg in the sufentanil group and 6.9 20 mmhg in the midazolam group. the current study showed that pretreatment with sufentanil 0.2 g / kg significantly prevents the occurrence and reduces the severity of myoclonus during anesthesia induction with etomidate. the mean duration of myoclonus in the sufentanil group was significantly less than that of the midazolam group. the mean of variations in hr before and after the induction between the two groups was significantly different, but the mean of map before and after the induction was not significantly different between the two groups. application of different medications, as pretreatment agents, has been investigated for the reduction of myoclonus after etomidate injection.. however, diazepam (0.0625 - 0.0125 mg / kg iv) or flunitrazepam (0.01 mg / kg iv) failed to reduce myoclonic movements. on the other hand, doenicke. reported a significant reduction in the incidence of myoclonus when 0.1 mg / kg of diazepam was administrated 5 min before etomidate. reported that the incidence of myoclonic movements was significantly lower in patients, who were pretreated with midazolam 0.015 mg / kg (20%), compared to the placebo group (90%). in this study, all patients in the study groups were premeditated with oral midazolam ; however, in our study, patients did not receive premedication. in the study by hwang., iv administration of midazolam 2 min before etomidate injection reduced the incidence of myoclonus up to 17%. in the current study, the incidence of myoclonus in the midazolam - treated group was 84%, which was significantly higher than that observed in the study by hwang. in the study by hwang, etomidate was administered 2 min after midazolam (0.05 mg / kg) ; the higher dosage and longer interval in the study by hwang may account for the lower incidence of myoclonus, following midazolam administration in their study, compared to ours. use of higher fentanyl doses (500 g) significantly reduced myoclonic movements ; however, the incidence of apnea increased during induction. in a study by fassoulaki., they found no change in myoclonic occurrence when fentanyl 100 g was administered before anesthesia induction with etomidate. remifentanil (1 g / kg), administered 2 min before etomidate injection, was reported to reduce the incidence of myoclonus to 7%, without any clinically relevant side - effects. in another study, pretreatment with remifentanil (with the same dose) was associated with a 17% incidence of myoclonus, which was higher than that observed in the study by kelsaka. furthermore, 10% of the remifentanil - treated patients experienced clinically relevant side - effects such as chest muscle rigidity and bradycardia. therefore, their results suggested that remifentanil may not be a good option for routine pretreatment during etomidate injection. other investigators have recommended sufentanil (0.3 g / kg) as a pretreatment agent before anesthesia induction with etomidate. in fact, this medication has been shown to completely prevent myoclonus without causing any side - effects. studies with other opioids such as alfentanil and buprenorphine have not shown higher efficiencies. in our study, pretreatment with sufentanil (0.2 g / kg) was associated with a significantly reduced incidence and severity of myoclonus ; however, pretreatment with midazolam resulted in a higher incidence and severity of myoclonus (including moderate and severe grades of myoclonus). the duration of myoclonus in the sufentanil group was also less than that of the midazolam group. due to the findings of the current study, in the sufentanil group, hr reduced after induction, but the mean difference in map was not clinically significant after sufentanil administration. the sample of our study was small so further studies are required for comparing different doses of opioids (e.g., sufentanil) and determining other adverse effects. the sample of our study was small so further studies are required for comparing different doses of opioids (e.g., sufentanil) and determining other adverse effects. according to the results of this study, it seems using sufentanil as a pretherapeutic agent might reduce the risk of development of etomidate - induced myoclonus. | background and aims : myoclonus is a major side - effect following etomidate injection requiring use of medical intervention.material and methods : in this double - blinded clinical trial, 50 consecutive patients, randomly received sufentanil 0.2 g / kg or midazolam 0.015 mg / kg, 90 s before induction of anesthesia with etomidate (0.3 mg / kg). then, the patients were monitored for any myoclonic movements during anesthesia.results:the incidence of myoclonus was 28% in the sufentanil group and 84% in the midazolam group. the frequency and intensity of myoclonus were significantly higher in the midazolam group, compared to the sufentanil group (p < 0.001). myoclonus duration in the sufentanil and midazolam groups were 5.8 13.2 and 69 47.8 s, respectively (p < 0.0010).conclusion : the frequency, intensity and duration of myoclonus in the midazolam group, were significantly more prevalent than the sufentanil group. |
metabolic syndrome refers to a cluster of known disorders that increase the risk for morbidity and mortality from cardiovascular disease (cvd) and type 2 diabetes [1, 2 ]. metabolic syndrome is defined as the occurrence of 3 of any of the 5 following factors : obesity, elevated triglyceride (tg), low hdl - c, elevated blood pressure (bp), and elevated fasting glucose (fg). lifestyle factors such as alcohol consumption, cigarette smoking, and physical activity have been reported to affect an individual 's metabolic profile [4, 5 ]. a large population based study in the united states reported that mild to moderate alcohol consumption of alcohol was associated with a favorable influence on lipids, waist circumference, and fasting insulin in comparison to nondrinkers. smoking has been associated with a negative lipid profile, hypertension [7, 8 ], and a higher risk of all forms of cvd. studies have also reported an inverse relationship between physical activity and certain components of metabolic syndrome such as waist circumference [10, 11 ], hdl - c [12, 13 ], and blood pressure [14, 15 ]. although there has been limited number of studies reporting an association between lifestyle factors and metabolic syndrome in african american (aa) population [1621 ], very few studies have used national level data. the current study was designed to estimate gender specific prevalence of metabolic syndrome and to evaluate an association between lifestyle factors and metabolic syndrome in the aa population, using a nationally representative database, the national health and nutrition examination survey (nhanes). this study utilized national level datasets available from the national center for health statistics (nchs) under the center for disease control and prevention. the nchs has conducted the nhanes from 1971 to 1994 focusing on different population groups or health topics. the survey became a continuous program from 1999, examining a nationally representative sample of about 5,000 persons each year. this study used datasets from 1999 to 2006, including all records from aa men and nonpregnant women who were 20 years or older who participated in the household interview and mobile examination center exam and attended the morning examination and fasted for at least 8.5 hours. this exclusion criterion was established as waist circumference was used as an important indicator for determining the status of metabolic syndrome in our study, where pregnancy impacts waist circumference measurement. metabolic syndrome was defined in this study as the occurrence of any three of the five components based on the criteria specified by atp iii : (i) abdominal obesity, waist circumference 102 cm in men and 88 cm in women ; (ii) elevated triglyceride (tg)tg 150 mg / dl in both men and women or taking medication for dyslipidemia ; (iii) low hdl - c hdl - c value < 40 mg / dl in men and < 50 mg / dl in women ; (iv) elevated blood pressure (bp)systolic bp 135 mm hg or diastolic bp 85 mm hg, or taking medication for hypertension ; (v) elevated fasting glucose (fg)fg 100 mg / dl in both men and women, or taking medication for diabetes. lifestyle variables included alcohol consumption, cigarette smoking, and physical activity. alcohol drinking status was created following guidelines from the us department of health and human services (hhs) with three - level categories of nondrinkers (i.e., never drank alcohol during their lifetime or had quit alcohol drinking), moderate drinker (i.e., having no more than two drinks per day for men and no more than one drink per day for women, and heavy drinker using), and heavy drinkers (i.e., more than two drinks per day for men and more than one drink per day for women). cigarette smoking was also categorized into a three - level variable as nonsmokers (i.e., those who never smoke cigarettes during their lifetime or who had quit cigarette smoking), light smokers (i.e., who smoked 110 cigarettes per day), and heavy smokers (i.e., who smoked more than 10 cigarettes per day). physical activity was defined as a four - level categorical variable based on guidelines by hhs including inactivity (i.e., no physical activity beyond baseline activities of daily living), low activity (i.e., less than 150 minutes (2 hours and 30 minutes) of moderate intensity physical activity a week, or the equivalent amount (75 minutes, or 1 hour and 15 minutes) of vigorous intensity activity), medium activity (i.e., moderate intensity activity of 150 minutes to 300 (5 hours), or 75 to 150 minutes of vigorous intensity physical activity per week), and high activity (i.e., more than the equivalent of 300 minutes of moderate intensity physical activity a week). marital status, income, and educational levels were also included as socio - demographic variables using available data components from the database. the focus of the analyses was to estimate the prevalence of metabolic syndrome in aa men and women and to determine predictive factors for metabolic syndrome using a final analytic database that was constructed from 1999 to 2006, over the 4 cycles of the continuous nhanes : 1999 - 2000, 2001 - 2002, 2003 - 2004, and 2005 - 2006. national estimates were calculated using sampling weights available from the database using the survey functions in sas, version 9.1.3 (sas institute, cary, nc). all analyses were conducted using weighted data and variance estimates were calculated to account for the complex sampling methodology of nhanes. relative standard errors (rse) for all the weighted estimates were calculated and reported in our analysis. gender specific logistic regression models were created to determine the association between lifestyle variables and metabolic syndrome while adjusting socio - demographic variables. bivariate and multivariate analyses were employed to examine the relationship between study variables and produced both unadjusted odds ratio (orunadj) and adjusted or (oradj), respectively. the weighted estimates were calculated as either means or proportions, with the associated 95% confidence intervals (ci) and standard errors (se). the characteristics of participants in the study are presented in table 1. from the 19992006 nhanes, a total of 1,326 aa men and nonpregnant aa women (i.e., 654 aa men and 672 aa nonpregnant women) were identified as study population. our study identified significant gender differences across socio - demographic and lifestyle factors as well as in the prevalence of metabolic syndrome along with its clinical components (table 1). more specifically, a higher proportion of aa men reported being married and earning a higher income than aa women. a higher proportion of aa men were associated with alcohol drinking than aa women (65.85% versus 50.74% ; p < 0.0001). the percentage of cigarette - smoking in aa women was lower than that in aa men (15.87% versus 28.58% ; p < 0.0001). metabolic syndrome was more prevalent in aa women than aa men (39.43% versus 26.77% ; p < 0.0001). findings also showed that there were gender differences among several components of metabolic syndrome (table 1). for example, abdominal obesity was more prevalent in aa women (73.46%) than that in aa men (34.47%), but elevated triglyceride was more prevalent in aa men than aa women. predictive factors of metabolic syndrome were evaluated by bivariate and multivariate logistic regression analyses for aa men (table 2) and aa women (table 3). in aa men, age had a significant association with metabolic syndrome (oradj = 1.05, 95% ci 1.041.06) (table 1). although no significant association was found between lifestyle factors and metabolic syndrome for aa men from the adjusted model, bivariate analyses produced significant associations of metabolic syndrome with marital status (orunadj = 0.61, 95% ci 0.440.83), income (orunadj = 1.56, 95% ci 1.042.34), and heavy alcohol drinking (orunadj = 0.63, 95% ci 0.410.98) (table 2). age was also a significant factor for metabolic syndrome in aa women (oradj = 1.06, 95% ci 1.041.07) (table 3). education, alcohol drinking, and physical activities were strong predictors for metabolic syndrome in bivariate model, but none of the lifestyle factors were significantly associated with metabolic syndrome and marital status was a significant factor from the multivariate model (oradj = 0.66, 95% ci 0.430.99) indicating that single aa women were less likely to have metabolic syndrome than married aa women (table 3). main findings of the study conclude that the prevalence of metabolic syndrome was higher in aa women (39.43%) than in men (26.77%). higher prevalence of metabolic syndrome in aa women could be explained in part with the prevalence of abdominal obesity in aa women being twice as high as in aa men (73.46% versus 34.47%). similar findings were documented in published literatures with higher prevalence of metabolic syndrome in aa women nhanes 20032006 and a higher prevalence of obesity that are associated with high caloric food intake, little exercise, and dietary behavior influenced by cost, media, and cultural traditions [1620, 26 ]. our study showed that metabolic syndrome in aa men was more associated with income $ 45,000 or above as compared to men with income less than $ 20,000. ogden and colleagues reported that aa men with higher income are more likely to be obese than those with low income. our findings on lower prevalence of metabolic syndrome in single aa women as compared to married women are in contrast to published reports that married people are more likely to engage in positive health behaviors than widowed, divorced, or single people [28, 29 ]. it is not clear how marital status contributes to metabolic syndrome, but a study by troxel and colleagues reported marital quality as one of the important factors that mediates the association between marital status and metabolic syndrome. our findings showed no significant association between metabolic syndrome and lifestyle factors among aa men and aa women while literatures described alcohol drinking, cigarette smoking, and lack of physical activity as risk factors for metabolic syndrome [6, 3137 ]. however, there are published studies also describing protective effects of smoking and alcohol on metabolic syndrome. for example, a u- or j - shaped relation between alcohol drinking and metabolic syndrome has been reported [38, 39 ]. a large population study using nhanes iii by freiberg and colleagues reported corroborating findings with our study that mild to moderate consumption of alcohol was associated with a favorable influence on lipids, waist circumference, and fasting insulin in comparison to current nondrinkers. in regards to the impact of physical activities on metabolic syndrome, our study showed significant bivariate associations between physical activity and metabolic syndrome where medium or high activity level was a protective factor for metabolic syndrome in aa women. ford and colleagues reported a similar finding on gender differences in relationship between physical activity and metabolic syndrome where physical inactivity was a predictive factor for metabolic syndrome in women but it was not a predictor in men. more investigation might be needed to identify clearer relationships between lifestyle factors and metabolic syndrome among aa population. one of the strengths of our study is that it provides unique information about metabolic syndrome in aa population. very few studies have examined the association in aa and even fewer studies have utilized national representative databases with gender specific models. although our findings did not find any associations between lifestyle factors like alcohol drinking, cigarette smoking, and physical activity and metabolic syndrome in both aa men and aa women, it highlighted the importance of early detection and intervention to reduce the risk of metabolic syndrome due to high blood pressure, elevated fasting glucose, and dyslipidemia among aa so that the progression of metabolic syndrome can be prevented at an early age. there are several limitations to our study, primarily due to the data source being self - reports. the cross - sectional design of the study limits the ability in addressing causality and the present work only describes the association between lifestyle factors and metabolic syndrome. | background. although there is a reported association between lifestyle factors and metabolic syndrome, very few studies have used national level data restricted to the african americans (aas) in the united states (us). methods. a cross - sectional evaluation was conducted using the national health and nutrition examination survey from 1999 to 2006 including men and nonpregnant women of 20 years or older. multiple logistic regression models were constructed to evaluate the association between lifestyle factors and metabolic syndrome. results. aa women had a higher prevalence of metabolic syndrome (39.43%) than aa men (26.77%). after adjusting for sociodemographic factors, no significant association was found between metabolic syndrome and lifestyle factors including alcohol drinking, cigarette smoking, and physical activity. age and marital status were significant predictors for metabolic syndrome. with increase in age, both aa men and aa women were more likely to have metabolic syndrome (aa men : oradj = 1.05, 95% ci 1.041.06, aa women : oradj = 1.06, 95% ci 1.041.07). single aa women were less likely to have metabolic syndrome than married women (oradj = 0.66, 95% ci 0.430.99). conclusion. lifestyle factors had no significant association with metabolic syndrome but age and marital status were strong predictors for metabolic syndrome in aas in the us. |
the incidence of tooth abnormalities in children with cleft lip and palate is higher than that in children without clefts3,5,16. tooth abnormalities reported in the literature are related to the number, size, shape and eruption of teeth3,8,16. disturbances involving anomalies in tooth eruption are called ectopia and may be observed in several regions around the oral cavity, as well as in other areas of the human body. there are reports of teeth in the maxillary sinus, mandibular condyle, coronoid process, orbit, palate, mentum and skin. teeth have also been found in unusual sites, including the ovaries, testicles, anterior mediastinum, retroperitoneal, sacral and coccygeal areas4,6,7,10,12,13. transmigration or migration is the term assigned to ectopia when teeth are present in areas distant from the alveolar process2. the term unerupted tooth is used to designate a tooth that presented failure in eruption as a result of malpositioning, delayed eruption or impaction23. the term dental migration may indicate the movement of an unerupted tooth to an area far from its regular place of development. this denomination does not refer to displacement of a totally or partially erupted tooth to an abnormal position in the dental arch. according to peck (1998), dental migration refers to the horizontal movement of unerupted teeth and occurs only in the mandible. the unerupted teeth most frequently presenting migration are the premolars15,22, with predominance of females over males11,22, canines15,22, and mandibular 3rd molars22. intraosseous migration of premolars is less frequently found in the literature than migration of the canine. the first description of migration of mandibular 1st molar was published by shields19 in the early 1900 's. since then later reports presented cases of migration of the mandibular 2nd premolars due to early loss of the permanent mandibular 1st molars10,11,15,18,20,22. matteson,.11, (1982) reported the importance of the knowledge of the mechanism of tooth eruption to understand ectopic migrations, which aids in the diagnosis, prevention and treatment of these occurrences. sutton22 (1968) suggested that the initial angulation of the tooth and frequent loss of primary mandibular 1st molars are important for distal migration of mandibular premolars. however, peck15 (1998) suggested that canine migration may have a genetic cause based on observation of cases of bilateral migration, while migration of premolars is either casual or idiopathic, rather than genetic. distal migration is not yet completely known, since the teeth tend to present mesial movement due to masticatory efforts. the chance of intraosseous migration of the 2nd premolar is significantly increased in case of early loss of the permanent 1st molar, that is, before eruption of the 2nd premolar. after loss of the permanent mandibular 1st molar, the possibility of distal migration of the mandibular 2nd premolar ranges from 5 to 10%11. mandibular 2nd premolars presenting severe migration from their usual site to the region mesial to the permanent mandibular 2nd molar, where it then erupts normally, are named paramolar - wanderung 1. however, decision on surgical removal depends on the symptoms reported by the patient, the site where the tooth is found, and presence or not of associated pathologies. surgical removal can be performed via intraoral or extraoral access with care to avoid damage to the inferior alveolar nerve or jaw fracture9,6,12. even though the occurrence of tooth abnormalities is higher in permanent teeth, they have also been reported in the primary dentition, more frequently in children with cleft lip and palate3,16,5. no reported case of migration of mandibular teeth in patients with cleft lip and palate was found in the literature. this paper presents a case report of migration of the mandibular left 2nd premolar in a patient attending the hospital for rehabilitation of craniofacial anomalies of the university of so paulo (hrac / usp), brazil. the patient m. c. f. a., a 4-year - year - old female child with bilateral complete cleft lip and palate, first attended the hospital for rehabilitation of craniofacial anomalies of the university of so paulo (hrac / usp) in 1976 for clinical and surgical treatment. it was observed that the patient presented normal aspect of the tooth buds of maxillary right and left 1st premolars, mandibular left 1st and 2nd premolars, and mandibular right 1st premolar. the maxillary right and left 2nd premolars and mandibular right 2nd premolars were congenitally absent (figure 1). a new radiograph was taken at the age of 8, which revealed abnormal angulation of the tooth bud of the mandibular left 2nd premolar, whereas the other teeth presented normal eruption pathway (figure 2). when the patient was 11 years old, the tooth bud of the mandibular left 2nd premolar presented an horizontal position in relation to the midsagittal plane. the other teeth were erupted, except for the maxillary and mandibular right and left 2nd molars, which were in the course of eruption (figure 3). at the age of 12, the tooth bud of the mandibular left 2nd premolar was positioned ectopically and had its crown impacted against the mesial root of the mandibular left 1st molar (figure 4). three years later, a periapical radiograph of the mandibular left 1st molar was obtained and extraction of the mandibular left 1st molar was planned (figure 5). surprisingly, only 2 months after extraction, the mandibular left 2nd premolar presented distal migration, still in a horizontal position in relation to the midsagittal plane, reaching the area of the mandibular left 3rd molar (figure 6). two - year radiographic follow - up revealed that the mandibular left 2nd premolar was migrating to the mandibular ramus, without any symptomatology. the root apices were positioned in the retromolar area and the crown was located in the mandibular ramus (figure 7). a panoramic radiograph taken at the age of 23 (figure 8) showed that the mandibular left 2nd premolar was positioned in the mandibular notch area. the last radiograph was taken when the patient was 30 years old (figure 9). the prevalence of intraosseous migration of premolars is low compared to other teeth, such as canines15. this case report shares some characteristics with reports in the literature. in this case, when the patient was 8 years old, the tooth bud of the mandibular left 2nd premolar presented an abnormal angulation. there was also early loss of the mandibular left 1st molar at the age of 15, which allowed distal migration of the mandibular left 2nd premolar. these events agree with those reported by sutton22 (1968), matteson,. 11, (1982), loh and ho10 (1986), jasmin7 (1989), spyropoulos20 (1990), peck15 (1998), and shapira and kuftinec18 (2003). it may be inferred that the association of these two factors was determinant for distal migration of the mandibular 2nd premolar. thus, if early diagnosis of this situation is established, the dentist may initiate the treatment before the tooth reaches a more difficult access. in the present case, the ectopic mandibular left 2nd premolar moved to the mandibular notch, differently from the cases reported by loh and ho10 (1986) and infante - cossio,.,6 (2000), who reported dental migration to the mandibular angle ; orton and mcdonald13 (1986), jasmin,.7 (1989) and okada,.12 (2002), who described migration to the coronoid process ; loh and ho10 (1986), who reported migration to the ascending mandibular ramus ; and okada,.12 (2002), who described migration to the mandibular condyle. treatment for this type of anomaly varies according to the position and conditions presented by this tooth, as well as the presence of any discomfort to the patient. in the present case, it was decided not to extract the mandibular left 2nd premolar, since it did not cause discomfort to the patient or any evidence of alteration, as reported by infante - cossio and hernandez - guisado, gutierrez - perez6 (2000) and okada,.12 (2002). however, lehman9 (1987) recommended the extraction of ectopic teeth with evidence of cyst associated with the tooth crown. it may be concluded that intraosseous distal migration of the mandibular left 2nd premolar associated with cleft lip and palate is a rare condition, since no previous reports were found in the literature. however, the present case demonstrates that it occurred in a similar manner as in individuals without clefts. the presence of intraosseous distal migration seems not to be directly related with the presence of cleft lip and palate. | disturbances involving abnormalities in tooth eruption are named ectopia. transmigration is the name assigned to ectopia in the presence of teeth in areas distant from the alveolar process. initial angulation of the tooth bud of the second premolar and premature loss of permanent mandibular 1st molars can influence the distal migration of the second premolar. some studies have observed that ectopic teeth can be found in a variety of places around the oral cavity and also in other areas of the human body. there are records of teeth in the maxillary sinus, mandibular condyle, coronoid process, mandibular angle, orbit, palate, mentum and also the skin. the prevalence of tooth abnormalities is higher in children with cleft lip and palate compared to children without clefts. this paper presents a case report of migration of the mandibular left second premolar in a patient attending the hospital for rehabilitation of craniofacial anomalies of the university of so paulo (hrac / usp), brazil. migration of the mandibular left 2nd premolar was confirmed by 8 panoramic and 1 periapical radiographs obtained during patient 's treatment between 1978 and 2002, which were available in the files of the department of dental radiology of hrac / usp. it can be assumed that distal migration of the mandibular left 2nd premolar is not associated with presence of cleft lip and palate ; observation of these two events in a same patient is rare, since no similar reported cases were found in the literature. |
c c bond activation / functionalization recently merged a useful method for synthesizing complex scaffolds from relatively simpler starting materials. c bonds was first reported by liebeskind using a stoichiometric co - complex (fig. seminal work by murakami / ito described intramolecular insertions of styrene - type olefins into cyclobutanones catalyzed by either cationic rh or ni, albeit limited to benzo - fused skeletons (fig. 1c). one key challenge for developing cyclobutanone - olefin couplings via metal - mediated oxidative addition into c 1c), which leads to either ring contraction or fragmentation (for cyclobutanone activations via -carbon elimination, see refs 3239). therefore, in order to develop a general cyclobutanone - olefin coupling that is broadly applicable for synthesizing bridged type ii - imda - like products, the decarbonylation challenge has to be overcome and the scope of the olefin substrates (e.g. both aryl and alkyl substituted alkenes) as well as the variety of the bridged - scaffolds must be extended. our strategy is inspired by a cofactor-assisted c c activation mode initially developed by jun, which utilizes 2-amino-3-methylpyridine as a co - catalyst to generate an imine intermediate that serves as a directing group for cleaving the imine c c bond. this strategy has been effectively utilized to cleave medium to large cyclic ketimines in the presence of alkenes to afford ring - opened products (fig. however, to the best of our knowledge, utilization of this mode in small - ring activation has not been reported previously. we hypothesized that employment of 2-amino-3-methylpyridine as a co - catalyst would benefit the desired intramolecular cyclobutanone - olefin coupling, depicted in fig. 2. the amine would first form an imine with the cyclobutanone, which would then direct c c cleavage through forming a chelation complex with the metal (e.g. rh). subsequent olefin migratory insertion followed by reductive elimination is expected to provide the bridged scaffold and regenerate the metal catalyst. finally, the resulting imine can be hydrolyzed to give the bridged - ketone product and 2-amino-3-methylpyridine, which can be recycled. hence, this strategy, distinct from the previous cyclobutanone activations, can ease the c c cleavage but more importantly prevent the aforementioned decarbonylation problem, because the carbonyl group would be in situ protected by the imine formation. moreover, in principle, both the transition metal and the aminopyridine can be catalytic. to test our hypothesis, cyclobutanone 1a was used as the model substrate, which was readily prepared in three steps from inexpensive commercially available materials. in the presence of 3-methyl-2-aminopyridine (3), a variety of rh precatalysts, ligands and solvents were examined (for details, see supplementary information). the conditions (cationic rh with dppp) that gave the best results in the previous example (fig. 1c, murakami / ito) did not provide any of the desired bicycle (entry 1, table 1). however, [rh(cod)cl]2 was found to be a promising precatalyst and the desired bridged bicycle (3-azabicyclononanone) 2a was obtained albeit in low yields (entry 2). the solvent effect was next evaluated and 1,4-dioxane proved to be the best solvent (entries 35). while the yield of bicycle 2a can be improved by adding more cod ligand (entry 6), employment of a monodentate electron - deficient phosphine ligand was found more effective likely due to that the migratory insertion and reductive elimination steps can be accelerated with more -acidic ligands (entries 79). use of bidentate ligands, such as dppp and dppb, showed no catalytic activity. [rh(cod)cl]2 (10 mol %) with p(3,5-c6h3(cf3)2)3 (22 mol %) was found to give full conversion with an 82% isolated yield of product 2a (entry 9). use of a catalytic amount of cofactor 3 (20 mol %) is also feasible albeit giving a slightly lower yield (76%) with extended reaction time (entry 10). ultimately, use of 5 mol% [rh(c2h4)2cl]2 (10 mol% total on rh) and 24 mol% p(3,5-c6h3(cf3)2)3 provided azanonanone 2a in 87% isolated yield (entry 11). the use of cofactor 3 was critical. in the absence of 3, no [4 + 2 ] product was observed ; decarbonylation products and the rh - carbonyl complex (a dead catalyst, see supplementary information) can be detected by lcms, hrms and h - nmr (entry 12). this control experiment strongly supports our hypothesis that decarbonylation can be inhibited by using 2-amino-3-methylpyridine (vide supra). the structure of bridged - bicycle 2a was unambiguously confirmed by h, c nmr, ir, hrms and x - ray crystallography. given that the nitrogen - containing scaffold was obtained when the nitrogen - tether was employed, we expect this method can potentially be useful for alkaloid synthesis (fig. 1a). with the optimized conditions in hand, we next investigated the substrate scope (table 2). in general, cyclobutanones tethered with 1,1-disubstituted olefins were converted into the corresponding 3-azabicyclononanones smoothly. not surprisingly, increasing the steric bulk on the olefin substituent from methyl to isopropyl to cyclopentyl slowed the reaction (entries 15), but the desired bridged bicycles were all nevertheless obtained in good to modest yields. monosubstituted olefins can also insert into the c c bond of cyclobutanones efficiently (entries 6 and 7). changing the protecting group on the nitrogen from ts to carbamate (co2me) did not significantly affect the reactivity (entry 7 vs 6). aryl - substituted olefins were found to be more challenging substrates likely due to their stability issue under the reaction conditions ; nevertheless, it is encouraging to note that they can still participate in this transformation, albeit with relatively lower efficiency. the more electron - rich aryl olefins provided much higher yields than the corresponding electron - poor substrates (entries 810). changing the quaternary carbon substitution (from me to et) on cyclobutanones both cis and trans - disubstituted olefins are suitable substrates, and higher reactivity was observed with the cis substrate (entries 12 and 13). both substrates 1l and 1 m provided the products with the same diastereomeric ratio (dr), probably due to an enamine equilibration. besides forming 66 bridged [3.3.1 ] systems, the 56 bridged [3.2.1 ] scaffolds can also be obtained using this strategy. the vinyl sulfonamide 1n can participate to give the desired bridged ring (2n) (entry 14). in addition, substrates with all - carbon linkages were also found suitable (entries 15 and 16). it is interesting to note that with 1o as the substrate, a stable enamine derivative of 2o (with 2-amino-3-methylpyridine 3) can be isolated as the major product, which was confirmed by x - ray crystallography (see supplementary information). subsequent hydrolysis with diluted acetic acid provided the ketone 2o in 54% (81% brsm) yield (entry 15). the substrate with an arene linkage (1p) provided the desired benzo - bicycle (2p) in nearly a quantitative yield under the standard conditions, suggesting a potentially broad substrate scope (entry 16). two diastereomers of the desired product were obtained due to the diastereotopic difference between the two -c the products 2q - i and 2q - ii contain interesting tricyclic bridged and fused scaffolds, which have been found in a number of aconitum / delphinium alkaloids (fig. structures of both products were unambiguously confirmed by x - ray crystallography of their 2,4-dinitrophenylhydrazone derivatives (see supplementary information). furthermore, preliminary studies have revealed that chiral phosphoramidite ligands, such as 4, effect the desymmetrization of cyclobutanone 1b with promising levels of enantioselectivity (fig. this result suggests that the cofactor-assisted c c activation mode is amenable to asymmetric catalysis, and work on this topic is ongoing. finally, we demonstrated the carbonyl group in the formed bridged bicycles can serve as a convenient handle to access other ring systems through either ring contraction or expansion (fig. subsequent favorskii rearrangement afforded the ring - contraction product (6) in 78% yield. oxime formation followed by beckmann rearrangement provided the ring - expansion product (76 bridged amide, 8) uneventfully. saturated analogue of type ii - imda reaction between cyclobutanones and simple alkenes via a rh - catalyzed cofactor-assisted c c activation approach. substrates with different tethers and olefin substitutions (both aryl and alkyl alkenes) underwent this transformation. while sharing a common feature to form 6-membered rings, this approach can provide scaffolds that are difficult to prepare using conventional imda reactions. another advantage is that unactivated alkyl or aryl - substituted alkenes, instead of michael acceptors (typically used in type - ii imda), can be used as coupling partners. we expect the strategy developed here may provide inspirations for designing new tactics to synthesize complex natural products and other bioactive molecules. in a nitrogen filled glove box, a 1-dram vial was charged with [rh(c2h4)2cl]2 (1.9 mg, 5 mol%), tris[3,5-bis(trifluoromethyl)phenyl]phosphine (16 mg, 24 mol%) and 2-amino-3-picoline (10 l, 0.1 mmol). a solution of starting material 1a (32 mg, 0.1 mmol) in dioxane (1 ml, 0.1 m) was added and the 1-dram vial was capped and the solution was maintained at 152 c for 48 h. the reaction was removed from the glove box and purified by flash chromatography. the product 2a was obtained as a bright orange solid (28 mg, 87%). the procedure to prepare compound 2a is generally representative for all the products shown in table 2. | bridged - ring systems are widely found in natural products and successful syntheses of them frequently feature intramolecular diels - alder (imda) reactions. these reactions are subclassified as either type i or type ii imdas depending on how the diene motif is tethered to the rest of the substrate - type i are tethered at the 1-position of the diene and type ii at the 2-position. while the type i imda has been used to great success, the molecular scaffolds accessible by type ii imdas are limited by the strain inherent in the formation of a sp2-carbon at a bridgehead position. here, we describe a complementary approach that provides access to these structures through the cc activation of cyclobutanones and their coupling with olefins. various alkenes have been coupled with cyclobutanones to provide a range of bridged skeletons. the ketone group of the products serves as a convenient handle for downstream functionalization. |
although dental caries significantly decreased in the western countries, it is still considered a major public health problem affecting, in the form of early childhood caries (ecc), most of the preschool children in many countries world - wide. the american academy of pediatric dentistry defined ecc as the presence of one or more decayed (noncavitated or cavitated lesions), missing (due to caries), or filled tooth surfaces in any primary tooth in a child in a child 71 months of age or younger. prevalence of ecc has been reported to range from 1 to 12% in infants from developed countries. considering the potential negative impact on overall oral health and on oral health related quality of life of children aged 25 years and their parents, ecc represents an indicator of missed prevention programs, either in developed or developing countries. clinical evidence has succinctly demonstrated the relationship between caries development in early childhood and wrong behaviors. the habit of falling asleep with a bottle of sweetened drinks or with a sweetened pacifier, mothers and/or playmates with untreated dental caries, and sharing of food and utensils (horizontal transmission) expose infants at increased risk for the development of ecc if daily at - home oral health hygiene practices are lacking. the focal reason for this situation is attributable mainly to the parents or caregivers lack of awareness of the potential infection. it follows that interventions designed to assess their knowledge and to consequently change their practices, known to be associated with the ecc, may be useful in the prevention of caries at an early age. the aim of this survey was to evaluate the knowledge and awareness of parents and caregivers of infants and young children about the incorrect daily behaviors as potential causes that could increase the oral health risk status of children in their first months of life (330 months). the study protocol conformed to the ethical guidelines of the 1975 declaration of helsinki was approved by the appropriate ethics committee of sapienza university of rome. written informed consent was obtained from all parents or caregivers of infants and young children aged 330 months attending the health promotion unit of the public consulting service in latina for mandatory vaccinations. a self - administered 16-point survey questionnaire was filled at the initial consultation to assess behavioral habits of parents and caregivers about the oral health care of their children. confidential information was obtained regarding demographic variables of the child, previous infant feeding practice (breastfeeding or baby bottle using), maternal oral health during and after pregnancy, children 's oral hygiene habits (toothbrushing, fluoride usage) and general behavioral variables (sharing cutlery, tasting of baby food, nightly usage of baby bottles or sippy cups with sugared beverages or sugared pacifier), knowledge about caries, and its transmission by a series of closed questions. the questionnaire was prepared together with a statistician that established the sample size sufficient for study validity ; questionnaire validation was checked in a previous pilot study used as thesis dissertation. the data gathered with the questionnaire were recorded with a specially designed computer program and collated in a microsoft excel database. descriptive statistics were computed for each items and the percentage of participants answering yes / no to each of the 16 items was calculated. the analysis of the data was performed using spss 14.0 for windows (spss inc., the variance analysis and chi - square test were used to investigate the relationship between the variables. there were 72 fathers (23.6%) and 232 mothers (76.4%). among 304 children attending the public health service in latina, 156 (51.3%) were males and 148 (48.7%) were females. written informed consent was obtained from all parents during the period june to august 2014. seventy - five (24.7%) of the respondents referred that tooth decay is not a disease and 67 (22%) referred not to know ; 53.6% was not aware about the possibility of caries transmission ; 100% of the respondents (304) reported that each family member had their own toothbrush ; 38.5% (117) referred to usually share the cutlery with children, and 53% (161) to taste the baby food. descriptive results of the survey (total percentages) from the questionnaire it emerged that 80.6% of the gynecologists did not suggest the pregnant woman to perform a routine dental visit during the period of pregnancy ; despite this, 116 pregnant women (38.16% of the sample) asked for a dental visit for the following reasons : control check - up (46.3%), professional oral hygiene (24.8%), operative treatment (9.9%), emergency and pain (19%). about children nightly habits, 48% reported routine use of sugar before sleeping and overnight as follow : 2.9% sweetened pacifier, 35% sweetened milk in the baby bottle, 9.5% sweetened juice or chamomile, and 0.7% other drinks. among the parents who answered positively to the previous question, 26.7% reported doing so to calm the crying baby and 39.3% for making falling the baby asleep. in addition, 75.5% reported that this habit lasted less than 1 year, 23.1% less than 2 years, and 1.4% more than 2 years. with regard to children oral health care, 74.7% (227) of parents reported not to have administered fluoride (pre or post - eruptive) in the first 3 years of their child 's life. for what concerns the beginning of children toothbrushing, figure 1 shows the distribution of the beginning of this practice, according to the age. more than half of respondents (53.1%) reported no toothbrushing for their children in the first 3 years of life, whereas 22.5% started toothbrushing in the first year and the 23.75% started it during the second year. the relationship between the two variables concerning caries transmissibility and tools sharing carried out on through pearson chi - square test identifies p = 0.32 [table 2 ]. most noteworthy features of data analysis from this survey showed as more than half of respondents were aware about dental caries as an infectious disease. however in fact, from this study, it emerged that the common tendency of parents to have direct contact with their children, often with salivary exchanges can favor bacterial contamination of the oral cavity, especially when parents have current untreated caries. regarding scientific literature, prevalence of eec among italian children is approximately 22% in the fourth of age and 44% in the twelfth ; early acquisition of streptococci mutans (ms) is a key event for the beginning of the disease. the major reservoir of ms is the mother, from whom the child acquires it during a window period of around 2 years of age. furthermore, ecc has often been labeled as baby bottle tooth decay, suggesting that the use of a sugar - containing liquid in a bottle at night may be an important etiological factor in the enhancement of the disease. primary oral colonization by ma coupled with caries - promoting feeding behaviors and poor oral hygiene habits results in accumulation of these organisms to levels exceeding 30% of the total plaque flora, which leads to rapid demineralization of tooth structure. from this survey it emerged that 48% of parents use to offer their children sugar - containing liquid or sweetened pacifier at night, mainly to calm or facilitate them to sleep. available experimental evidence shows that cow milk is essentially non - cariogenic because of its mineral content and low level of lactose but saliva production decreases during sleep, and the protracted sucking of sugar - containing milk can result in promoting the cariogenic potential of milk itself. children experiencing caries as infants or toddlers have a much greater probability of subsequent caries in both deciduous and permanent dentitions. some young children with ecc may be severely underweight because of associated pain and their disinclination to eat. in addition, from the survey it was found that gynecologists did not suggest pregnant women to make a dental visit in 80.6% of the cases. dental caries is a preventable disease, and therefore, it should be better if prevention of ecc begins in the prenatal and perinatal periods (including pregnancy and the first months after birth) and addresses the health of both the mother and the infant. infants whose mothers have high levels of ms due to untreated dental decay are at greater risk of oral colonization. the literature shows, however, that the collaboration between gynecologist, dentist and dental hygienist is of primary importance to implement prevention strategies for oral health of pregnant women. in addition, it emerged that 53.1% of respondents never brushed their children 's teeth in the first 3 years of life and 74.7% never administered fluoride (pre or post - eruptive) to their children. the results obtained from this survey point out that knowledge and awareness on information, health education, and health promotion are lacking throughout respondent parents, and this can potentially increase the oral health risk status of their children. although we do not have information about social background of the parents, lack of statistical significance (p = 0.3) indicates that despite a good knowledge of etiology and transmissibility of dental caries often parents take potentially risky behaviors for oral health of their children ; this emphasizes the need for better information of parents on these issues and the importance of preventive dental visits from a young age. primary prevention health promotion projects should be therefore organized targeting them in order to improve : feeding and eating habits of the baby. specifically, it must be highlighted not to sleep with baby bottles containing liquids out than water ; avoid prolonged consumption of sugared drinks ; not dipping pacifier in honey or sweetened solutions ; reducing the use of baby bottles from 14 months onwards, checking child 's diet in the amount and frequency of exposure to sugars ; restraining the intake of sugar during the main meals, since the salivary flow increases.care of parental oral health and nutrition to limit the transmissibility of cariogenic bacteria, specifically performing regular professional and home oral hygiene and regular dental visits. in case of mother untreated caries, limiting salivary exchange habits, such as cleaning the pacifier with water instead of saliva, not blowing and/or tasting child 's food during the weaning, and not sharing the same cutlery;oral hygiene of the baby. following international and national oral health guidelines : from birth to the first tooth eruption baby gums cleansing twice a day using a wet gauze or special soft gloves ; after the eruption of the first primary tooth, brushing teeth after meals (or after taking medication containing sucrose), with a smear / pea - size of low fluoride toothpaste (500 ppm) to minimize the risk of accidental ingestion ; using individual fluoride supplements for children at medium / high risk for tooth decay). feeding and eating habits of the baby. specifically, it must be highlighted not to sleep with baby bottles containing liquids out than water ; avoid prolonged consumption of sugared drinks ; not dipping pacifier in honey or sweetened solutions ; reducing the use of baby bottles from 14 months onwards, checking child 's diet in the amount and frequency of exposure to sugars ; restraining the intake of sugar during the main meals, since the salivary flow increases. care of parental oral health and nutrition to limit the transmissibility of cariogenic bacteria, specifically performing regular professional and home oral hygiene and regular dental visits. in case of mother untreated caries, limiting salivary exchange habits, such as cleaning the pacifier with water instead of saliva, not blowing and/or tasting child 's food during the weaning, and not sharing the same cutlery ; oral hygiene of the baby. following international and national oral health guidelines : from birth to the first tooth eruption baby gums cleansing twice a day using a wet gauze or special soft gloves ; after the eruption of the first primary tooth, brushing teeth after meals (or after taking medication containing sucrose), with a smear / pea - size of low fluoride toothpaste (500 ppm) to minimize the risk of accidental ingestion ; using individual fluoride supplements for children at medium / high risk for tooth decay). there are no conflicts of interest. | aim : the aim of this survey was to evaluate the knowledge and awareness of parents and caregivers about potential oral health risk factors for their children in their first months of life (330 months).materials and methods : the participation to the survey was proposed to all parents or caregivers of children attending the public consulting service in latina for mandatory vaccinations during the period of june to august 2014. a self - administered questionnaire was completed to obtain information regarding demographic variables, infant feeding practice, maternal oral health during and after pregnancy, children 's oral hygiene habits and risk behaviors (e.g., sharing cutlery, tasting of baby food, nightly using of baby bottles with sugared beverages, or sugared pacifier), and knowledge about caries and its transmission. the analysis of the data was performed using spss 14.0 for windows (spss inc., chicago, il, usa). the variance analysis and chi - square test were used to investigate the relationship between the variables.results:overall, the parents of 304 children consented to fill the questionnaire. data analysis showed that about 50% of respondents considered dental caries an infectious disease, however, 53.6% was not aware of the potential vertical transmissibility of cariogenic bacteria through contaminated saliva. it is a common trend in the early stages of weaning to taste the baby food (53%) and sharing cutlery (38.5%). with regard to children oral health care, parents reported no toothbrushing for 53.1% of the children in their first 3 years of life. the relationship between the two variables concerning caries transmissibility and tools sharing carried out on through pearson chi - square test identified p = 0.32.conclusions:from this survey, the need for parental oral health promoting program emerged to control children oral health risk status. |
feigned illness with the goal of receiving medical treatment for its own sake is known as munchausen 's syndrome. the syndrome is named after baron von munchausen (1720 - 1791) by asher in 1951. these patients have dramatic, but nonexistent symptoms and demand radical treatment. a similar entity of symptoms is often referred to as munchausen 's syndrome by proxy in which caretaker of the child (most commonly mother) creates symptoms in the child or makes the physician believe it. index case was a 7-year - old female child who presented to the pediatric opd of smimer hospital, surat, with a history of spontaneous bleeding from face, forehead, cheek, and scalp for last 20 days. as per history, bleeding was sudden, intermittent, not related to any time and was 1 to 2 cc in amount. the blood was red in color, not associated with any bruise, abrasion or petechiae on the skin. index case had no history of trauma, bleeding diathesis, pain, joint swelling, itching, fever, drug ingestion, chemical ingestion or insect bite. her clinical examination was completely normal and laboratory investigations which included complete blood count, bleeding time, clotting time, prothombin time, aptt, platelet counts, sickling test, test for dengue and leptospirosis were found negative. she was discharged with a request to make a follow - up if the episode of bleeding reoccurred. after 2 days, she presented to the opd again with similar complaints along with 4 other children. all were of different age groups (ranging from 3 to 10 years), different families but of the same locality and sociocultural background. all the investigations like cbc, bleeding time, clotting time, pt, aptt, platelet counts, sickling, dengue and leptospirosis were negative. various differential diagnoses like viral hemorrhagic fever, hemarthrosis, functional platelet defects and toxic irritant material were put under discussion. blood samples from the bleeding sites were collected and were sent to the pathology lab for further investigations. later, the blood grouping of the blood from bleeding sites and vein of the index child was carried and it matched. on close microscopic examination of the blood, it was found that there were plenty of mucus strands and epithelial cells in the blood [figure 1 ]. at this stage, patients were referred for psychiatric consultation. microscopic view of blood during the psychiatric evaluation, three of the mothers appeared indifferent to the manner of occurrence of the whole episode. they did not believe that it could be a psychiatric illness and many a times showed their discontent in the form of anger to even simplest of the questions asked. mothers were apprehensive about the cause of the bleeding, but at the same time were seemingly not very serious regarding the illness of their children. on insisting for cooperation from parents to have a detailed psychiatric evaluation of both children and parents, they left the hospital against medical advice. there was considerable media hype regarding this in the community because the news was out in a leading local paper as a mysterious illness. two days after leaving the hospital, three patients returned back to wards to collect reports where they were again counseled for a detailed history and were admitted in psychiatry ward. two fresh cases of bleeding were reported from the city but were from different locality where the index case visited recently. the significant thing that emerged was that index case was present when bleeding occurred in those new cases. it was observed that whenever children were given suggestions in playful manner, bleeding occurred. it was also noticed that every time when there was a fresh bleeding from forehead, it was accompanied with a transient visit to some other room or in a place of isolation by the child. to gain an insight into the entire clustering of cases and to avert a possible panic in population about this mysterious disease, it was decided to put two children under video surveillance (including index case) while interviewing them. the 7-year - old index child was found biting her buccal mucosa with her teeth and then spitting the blood on her hand and applying it on her forehead. on examining her oral cavity, multiple small ulcerations on her buccal mucosa [figures 2 and 3 ] were found. index child was shown the recorded video and was again asked about the whole act. she accepted that she did it herself and confessed that she did it to get attention. when the films were shown to the mothers, the reaction was unusual, it could not be ascertained from the reaction if the mothers had either been assisting them or were aware of her behavior. ulcers in buccal mucosa keeping in view of new evidences, an in - depth interview of the mothers and other children was planned again, but could not be completed as parents were not cooperative. no new cases were found or reported in the locality after the discharge of all the cases. munchausen 's syndrome alone or munchausen 's by proxy with similar type of presenting symptoms in a group is rarely reported in the literature. although we were able to prove munchausen 's only in the index case, we suspected it by proxy in other children as they had bleeding only in scalp not on the face and few of them were too young to do it by themselves (3 patients were just 3 years old). second, in - depth interview of index case suggested possible involvement of the mother ; however, we were not able to prove it as all took discharge and were not cooperative. older children who are the victims of munchausen by proxy may fear consequences of revealing the factitious illness. most of the time, evidence of unresolved trauma or loss reactions in mothers is seen. it was suspected that index case might be responsible for causing bleeding in other patients but the purpose for the same was not clear. this was suggested by the fact that when the index case made a visit to one of their relatives for few days, a 20-year - old lady had bleeding from her scalp but she did not take medical advice. in factitious disorders, the patients inflict lesions to satisfy an internal psychological need to gain attention and sympathy. many a times, even the patient is not able to clearly give reasons for this behavior. in this case probably, she (index child) did it to gain attention from her mother. media hype and its effect on the community was one of the most important issues that led to an immediate confrontation, following which they fled away and hence time to go for structured in - depth interview could not be borrowed. primary aim for this rapid response from investigators was to prevent occurrence of fresh new cases. lastly, the importance of covert video surveillance in these types of cases was once again highlighted. number of experts from different fields were suspecting some mysterious bleeding disorder or hemorrhagic fever in this group, and it was covert surveillance which proved out to be diagnostic. certain questions are still unanswered and unclear and are left open. were the other older children taught by the index child or did they learn it to gain attention as well?who applied blood to the younger cases?was there any involvement of mothers and, if yes, why ? were the other older children taught by the index child or did they learn it to gain attention as well ? who applied blood to the younger cases psychiatrist approach to such syndrome is to limit investigations and harmful procedures on the suspected cases. a therapeutic approach after diagnosis and confrontation, symptoms usually resolve significantly but cases deny their role in the production of symptoms and refuse psychiatric treatment and like in the present communication where all went for a premature discharge. when this syndrome presents with community - level effect, we should act really fast to prevent further consequences. | this short communication is about munchausen 's syndrome in a group of pediatric patients and co morbid munchausen 's syndrome by proxy. a 7-year - old girl presented with spontaneous bleeding from forehead, eyes and scalp. the girl was investigated thoroughly by pediatricians at a tertiary care hospital in western india for all possible bleeding disorders, but there was no conclusive diagnosis. after two days, cases with similar complaints were reported among children residing in the same locality and with similar socioeconomic background. all of them were investigated in detail for possible causes of bleeding but nothing came out. there was a media reporting of the cases as a mysterious bleeding disorder. at this point of time, an expert opinion from the psychiatrist was demanded. covert video surveillance and series of interviews revealed munchausen 's syndrome and possible munchausen 's syndrome by proxy. an in - depth literature review with special reference to munchausen 's syndrome was carried out to come to a final conclusive diagnosis. |
the harmony of the smile is determined not only by the shape, the position, and the colour of teeth but also by the gingival tissues it is one of the several developmental or acquired deformities and conditions that manifest in the periodontium. it is an aesthetic concern that can affect a large portion of the population, with a reported prevalence between 10.5% and 29%. in the recent years, egd has received an increased emphasis in dental literature and various treatment options are now available for correction of gummy smile. the various causes of gummy smile include vertical maxillary excess, anterior dentoalveolar extrusion, altered passive eruption, short or hyperactive upper lip, or combinations thereof. treatment of egd by esthetic crown lengthening with or without osseous resection is well documented. egd, due to vertical maxillary excess, can be successfully treated by orthognathic surgery. however, this surgery is associated with significant morbidity and requires hospitalization. lip repositioning results in shallow vestibule restricting the muscle pull thereby limiting the gingival display during smiling. a 22-year - old female patient undergoing orthodontic treatment, presented with the complaint of gummy smile following retraction of maxillary anterior teeth [figure 1 ]. patient 's teeth were visible from maxillary right first molar to maxillary left first molar with 5 - 6 mm of gingival display. orthognathic surgery as a treatment option was discussed with the patient. however, patient preferred less invasive lip repositioning procedure over orthognathic surgery. adequate local anesthetic (lignocaine 2% with epinephrine 1:100,000) was administered in vestibular mucosa and lip from maxillary right first molar to maxillary left first molar. a partial thickness flap was raised from mesial line angle of left maxillary first molar to the mesial line angle of right maxillary first molar at the mucogingival junction [figure 2 ]. a second incision 1012 mm above the first incision was made in the labial mucosa. the two incisions were joined on either side and a strip of partial thickness flap was removed, exposing the underlying connective tissue [figure 3 ]. removal of split thickness flap exposed underlying connective tissue margins approximated by sutures patient was prescribed nonsteroidal anti - inflammatory drugs (diclofenac sodium 50 mg three times daily for 3 days) and oral antibiotics (amoxicillin 500 mg three times daily for 5 days). patient was instructed to apply ice pack post operatively and minimize lip movement for 1 week. suture line healed in the form of a scar which was covered by labial mucosa and therefore not visible on smiling [figure 5 ]. adequate local anesthetic (lignocaine 2% with epinephrine 1:100,000) was administered in vestibular mucosa and lip from maxillary right first molar to maxillary left first molar. a partial thickness flap was raised from mesial line angle of left maxillary first molar to the mesial line angle of right maxillary first molar at the mucogingival junction [figure 2 ]. a second incision 1012 mm above the first incision was made in the labial mucosa. the two incisions were joined on either side and a strip of partial thickness flap was removed, exposing the underlying connective tissue [figure 3 ]. removal of split thickness flap exposed underlying connective tissue margins approximated by sutures patient was prescribed nonsteroidal anti - inflammatory drugs (diclofenac sodium 50 mg three times daily for 3 days) and oral antibiotics (amoxicillin 500 mg three times daily for 5 days). patient was instructed to apply ice pack post operatively and minimize lip movement for 1 week. suture line healed in the form of a scar which was covered by labial mucosa and therefore not visible on smiling [figure 5 ]. gingival display at baseline was 5 - 6 mm which changed drastically at 3 and 6 months postoperatively [figure 6 ]. at 3 month and at 6 months. however, the lip reverted back to its original position with almost complete relapse after 12 months [figure 7 ]. this report aimed to document lip repositioning technique to decrease the amount of gingival display in patients with gummy smile. the results showed esthetic satisfaction up to 6 months postoperatively after which lip slowly reverted back towards its original position with almost complete relapse at the end of 1 year. studies have shown that minimal gingival display during smile is considered esthetically acceptable. however, aesthetic perception varies depending on social environment, personal experience and culture. the amount of gingival display that is considered attractive varies from 1 - 3 mm. the results showed that the employed surgical procedure successfully reduced the gingival display with low morbidity. lip repositioning procedure began as a plastic surgical treatment and ever since variations have been reported. the original technique did not include severing the muscle attachment after flap reflection. however, some authors suggested performing myectomies to detach smile muscle attachment to prevent relapse. another method to prevent reattachment of smile elevator muscles is the placement of spacer between elevator muscles of lip and anterior nasal spine thereby preventing superior displacement of repositioned lip. contraindications for lip repositioning surgery include inadequate width of attached gingiva in maxillary anterior sextent. patients with severe vertical maxillary excess cases are also not the ideal candidates for lip repositioning and should be treated with orthognathic surgery. silva. in 2012 reported successful management of excessive gingival display in a study wherein thirteen patients with excessive gingival display were treated with a modified lip repositioning technique. treatment consisted of the removal of two strips of mucosa, bilaterally to the maxillary labial frenum and coronal repositioning of the new mucosal margin. the baseline gingival display of 5.8 2.1 mm significantly decreased to 1.4 1.0 mm at 3 months and was maintained until 6 months (1.3 1.6 mm). subjects were satisfied with their smile after surgery and would likely choose to undergo the procedure again (92%). similar results were obtained in other case reports by rosenbaltt, simon, and humayun. who achieved approximately 4 mm of reduction in gummy smile. jacobs. in 2013 reported a case series where seven patients were successfully managed with trial, and then definitive, lip repositioning wherein a mean reduction in gingival display of 6.4 1.5 mm was achieved. presented case report of two patients treated with modified lip repositioning technique and obtained significant improvement in the amount of gingival exposure and esthetic satisfaction after a 6 month follow up. several authors have presented case reports of single patients successfully treated with lip repositioning surgery with a follow up period of 6 months. this case report shows that although the results of lip repositioning surgery appear stable for up to 6 months postoperatively, its utility as a long term treatment option remains questionable. more studies with larger sample size and long term follow - up are necessary to establish the level of scientific evidence of this procedure. however, long - term stability of the results needs to be seen. none the less, this procedure appears to be a promising alternative treatment option for excessive gingival display. | excessive gingival display, commonly referred to as gummy smile is a major hurdle in overall personality of an individual. gummy smile, secondary to altered passive eruption and tooth mal - positioning, can be predictably treated with surgery and orthodontic therapy. in patients with jaw deformities, orthognathic surgery can be performed. however, this requires hospitalization and entails significant discomfort. lip repositioning is a simple surgical procedure to treat gummy smile. the procedure restricts the muscle pull of the elevator lip muscles thereby reducing the gingival display while smiling. this procedure is safe and predictable with minimal risk or side effects. this case report describes the successful treatment of excessive gingival display using surgical lip repositioning procedure which can be used as an alternative treatment modality for treatment of excessive gingival display. |
Subsets and Splits