article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
the changes of gene expression level after estrogen stimulation could be the result of hormone receptor interaction via estrogen response elements (eres), activation of the target gene transcription through interaction with co - activators or over non - genomic pathways (1,2). a number of genes whose transcription is affected by estrogen have been well documented in manually curated estrogen responsive genes database (ergdb) (3). although ergdb provides information about genes responsive to estrogen proved in experiments, it does not give any clue about the way these genes are regulated and what functional properties these genes may have. thus, to facilitate functional analysis of estrogen responsive genes we do need a different framework not available in ergdb. the new knowledgebase for estrogen responsive genes (kberg) provides users with such options to explore some of the genes ' functional properties and complements the experimental - information - rich ergdb.since the set of estrogen responsive genes covers a broad spectrum of functionality, belongs to many different pathways and may be related to many diseases, it is thus a significant challenge to characterize functions of these genes and to provide clues on how these genes are regulated and what potential effects we should expect. as a part of functional analysis, transcription regulation of these genes is an important step to unravel parts of the underlying estrogen driven signal pathways and to help develop insights of estrogen effects that can bring us closer to efficient therapies for estrogen - related diseases. the binding of transcription factors (tfs) to specific regulatory elements is a primary mechanism for controlling gene transcription. promoter region is the control center for such transcription regulation, where multiple transcription factor binding sites (tfbss) are clustered forming specific regulatory modules (4). a comparative genome study found that the complexity of the organism is not correlated to the number of genes (5) but to the complexity of gene regulation systems. recent studies (6,7) document that the richness of transcript variants stemming from multiple transcription start sites (tsss) in the vast majority of mammalian gene loci are controlled in various ways at the promoter level. in brief, dynamic gene regulation is achieved through multi - level manipulation in which transcription level control is an essential step. the sophisticated gene regulatory modes characterized by a set of tfbss determine when, where and how gene will express based on the integration of internal and external signals. broad gene groups are subjected to different regulatory programs as shown in (8). thus, identification of the structure and organization of tfbss in promoters is the primary step towards gaining understanding of the gene 's transcription regulation. however, detection of functional tfbss is challenging due to features such as short motif length, high degeneration and flexible distance location. position weight matrix (pwm) approach has been widely used in tfbs detection although high false positive rate is the main drawback (9). comparative genomic approach that searches for highly preserved motifs across different species has been applied to improve the accuracy of prediction (10). the method has been corroborated in a genome - wide screen for high - affinity ere in human and mouse (11). through analyzing remarkably consistent patterns in orthologous promoters, we aim to provide highly selective promoter motifs that could be involved in the control of transcription of genes responsive to estrogen. in addition to the detection of conserved motifs in promoter regions, mapping these motifs to known tfbs provides hints of the interaction with tfs and the formation of transcription initiation complex. as typical tfs, estrogen receptors (ers) influence their target genes by either directly binding to ere or indirectly interacting with a wide range of co - regulators forming complexes that bind to promoters (12). however, the experimental detection of co - regulators is time and labor consuming. in kberg, we provided partial solution regarding these issues by matching the highly preserved motifs in promoters to the transfac database., we found that sp1-binding site is the most frequent tfbs in promoter regions in our collection. this prediction result is in good concordance with promoter deletion studies that specifies the essential role of er / sp1 complex for gene 's response to estrogen at transcription level (13,14). the top 10 most frequently found tfbss are given on the kberg website under the section statistic. systematic assessment of gene functionality can help us to understand the complexity of living cells. co - expression is a biological property that reflects functional relationship among a group of genes. co - expressed genes tend to share certain regulatory mechanism by using similar sets of tfs. the phenomenon of co - expression can also be a result of the biological dependency among a group of proteins. it has been observed that proteins working closely in the same interaction network are also likely to be co - expressed under the same biological condition. sets of nf-b target genes were overexpressed in aggressive breast cancer comparing with non - aggressive breast cancer (15). thus, clustering genes based on their expression profile is one method to potentially deduce gene functional characteristics. another systematic approach to cluster gene for functional annotation is to group them based on gene ontology (go) (16) categories by using well - defined terminology to describe biological process, molecular function and cellular component where genes exert their activity. owing to the important impact of estrogen in human physiology and its involvement in numerous diseases, we believe that functionally characterizing estrogen responsive genes can benefit both basic research and clinical applications. however, up to date, there is no supporting system that facilitates such functional exploration. to complement currently available estrogen - related database and to provide researchers with comprehensive information related to potential functionality of estrogen responsive genes, we developed kberg. users can obtain integrated information covering the following aspects : orthologous gene information from human, mouse and rat ; ab initio determined dna motifs preserved in promoter regions ; possible relation between motifs and known tfs based on the transfac database (17). the system also helps user to deduce functional association of gene groups annotated by the same go term or possessing the same expression characteristics. links to unigene, entrez gene, homologene, genbank, go (16), evoc (18) and ergdb (3) make kberg a unique site for exploring estrogen responsive genes. at current stage, kberg contains information of 1362 homolog groups and 1526 estrogen responsive genes from human, mouse and rat. although kberg is specialized for estrogen responsive gene, the framework can be adapted to other gene groups for their functional exploration and annotation. kberg is free for academic and non - profit users and can be accessed at. we have created a comprehensive system that presents functional properties of estrogen responsive genes from multiple viewpoints. all genes in kberg are experimentally proved to respond to estrogen their expression levels are significantly altered by estrogen. these genes were derived from a manually curated estrogen - specific database, ergdb (3). each module performs specialized functions that provide users a convenient way to find desired information. the goal of this module is to identify highly conserved promoter motifs from groups of orthologous genes. to facilitate promoter analysis, we built an in - house promoter database. using genes derived from ergdb as a primary list, orthologous genes from human (homo sapiens), mouse (mus musculus) and rat (rattus norvegicus) genomes are downloaded from the ncbi homologene site (). recent genome comparison study (7) indicates that the availability of precise tsss increases the accuracy of finding conserved motifs by focusing on phylogenetically relevant promoter sequences. to accurately analyze functional motifs from selected promoters, we first identified tsss with solid experimental evidence. each mouse and human tss is identified through multiple selection steps. supporting evidences include (i) full - length cdna from fantom3 database () ; (ii) cage tags from riken tag - cluster database () ; and (iii) 5-utr sequences based on ucsc human gene sorter database (). we limited search for conserved motifs to the region [1200, + 500 ] relative to tss as most functional tfbss are located in these region, although some can be found several thousand base pairs away from the tss. the shorter promoter sequence also reduces the noise in motif identification. dragon motif builder (19,20) the highly preserved motifs were detected without any presumption of what may be tfs that control activation of the respective genes. however, sets of motifs within close mutual distance and in preserved orders in orthologous sequences are considered embedding more reliable and more significant information for transcriptional regulation. we expect some of these predicted motifs will turn out to be functional tfbss, although further experimental validation is needed. in the report page, we provide both graphic overview of the motif arrangements and details of the motif sequence information, which enable users to further investigate these motifs experimentally, or to compare them to the known tfbs through other data sources. the length of motifs we considered was 9 bp. in each orthologous promoter group, five motifs were selected based on their sequence preservation, motif combination order and maximum allowed distance between motifs (50 bp). details of motif family consensus, matrix, positions, strands and rough graphic distribution in the orthologous promoter group are provided in the report page. we also matched each motif to the transfac professional database, version 9.2, to suggest possible tfbss that these motifs contain or overlap with. we allowed one mismatch in 9 bp motif using the patch program (transfac) and the similarity score was given in the report page. although the evaluation of motif prediction is beyond the scope of this paper, we would like to suggest the user to take full advantage of the information in the report page. the matching score of potential tfbs with transfac, the total information content and position distribution, the degree of sequence preservation and the combination pattern with neighboring motifs are valuable indicators to estimate the accuracy of prediction. this module enables users to group estrogen responsive genes that share common go category annotation. in this way genes in kberg can be clustered into functionally related groups. using go terms we associate wide range of biological knowledge to groups of gene. by examining the frequency of the used go terms for the gene group the browse gene ontology function in kberg allows user to select estrogen responsive genes that share the same go annotation term and the statistic information about the term. for example, there are 101 genes under the go term receptor activity (go:0004872) and only 22 genes belong to steroid hormone receptor activity (go:0003707). users can easily obtain two relevant but not identical lists of genes to study receptors with specific annotation and with broad annotation. we believe that clustering genes according to go terms is a complementary way to associate genes with their functions and a logical way to assess genes. allowing user to download the list of classified genes is one of the helpful features of the system. evoc (18) associates human gene expression data with controlled ontology terms in sets of hierarchical vocabularies, covering categories such as anatomical system, cell type, pathology, developmental stage, etc. we use evoc ontology in our system to provide an alternative approach to cluster gene for functional assessment. the expression data provide extensive information about the gene co - expression under various biological conditions, which, although coarse, becomes essential indicators for gene co - regulation and interaction. expression results also represent important gene behaviors that should not be missed out in gene functional characterization. in kberg, we integrated evoc (version 2.7) to reveal gene expression in terms of human organ, cell type, disease and age. thus, a user can easily find out some of the associated information for gene expression (organ and cell type, whether in normal or diseased tissues and in the age group). the downloadable list of classified genes is provided and could be useful for user 's further exploration. designed for estrogen - related research, kberg provides a wide range of information about estrogen responsive genes through promoter motifs and functional associations via well - defined vocabularies from go and evoc. we summarized the main functions of the system in table 1. in brief, through searching this system, within a short period of time, a user can gain valuable information related to either individual gene or a group of genes that share the same ontology description. however, there is limitation of the system that user needs to bear in mind. the promoter motif prediction is a pure computational estimation and needs to be verified by experiments. also, classifying gene based on ontology categories may not always be the best way to reveal its biological function. the goal of this module is to identify highly conserved promoter motifs from groups of orthologous genes. to facilitate promoter analysis, we built an in - house promoter database. using genes derived from ergdb as a primary list, orthologous genes from human (homo sapiens), mouse (mus musculus) and rat (rattus norvegicus) genomes are downloaded from the ncbi homologene site (). recent genome comparison study (7) indicates that the availability of precise tsss increases the accuracy of finding conserved motifs by focusing on phylogenetically relevant promoter sequences. to accurately analyze functional motifs from selected promoters, we first identified tsss with solid experimental evidence. each mouse and human tss is identified through multiple selection steps. supporting evidences include (i) full - length cdna from fantom3 database () ; (ii) cage tags from riken tag - cluster database () ; and (iii) 5-utr sequences based on ucsc human gene sorter database (). we limited search for conserved motifs to the region [1200, + 500 ] relative to tss as most functional tfbss are located in these region, although some can be found several thousand base pairs away from the tss. the shorter promoter sequence also reduces the noise in motif identification. dragon motif builder (19,20) was used to identify ab initio dna motifs in each orthologous promoter sequence group. the highly preserved motifs were detected without any presumption of what may be tfs that control activation of the respective genes. however, sets of motifs within close mutual distance and in preserved orders in orthologous sequences are considered embedding more reliable and more significant information for transcriptional regulation. we expect some of these predicted motifs will turn out to be functional tfbss, although further experimental validation is needed. in the report page, we provide both graphic overview of the motif arrangements and details of the motif sequence information, which enable users to further investigate these motifs experimentally, or to compare them to the known tfbs through other data sources. the length of motifs we considered was 9 bp. in each orthologous promoter group, five motifs were selected based on their sequence preservation, motif combination order and maximum allowed distance between motifs (50 bp). details of motif family consensus, matrix, positions, strands and rough graphic distribution in the orthologous promoter group are provided in the report page. we also matched each motif to the transfac professional database, version 9.2, to suggest possible tfbss that these motifs contain or overlap with. we allowed one mismatch in 9 bp motif using the patch program (transfac) and the similarity score was given in the report page. although the evaluation of motif prediction is beyond the scope of this paper, we would like to suggest the user to take full advantage of the information in the report page. the matching score of potential tfbs with transfac, the total information content and position distribution, the degree of sequence preservation and the combination pattern with neighboring motifs are valuable indicators to estimate the accuracy of prediction. this module enables users to group estrogen responsive genes that share common go category annotation. in this way genes in kberg can be clustered into functionally related groups. using go terms we associate wide range of biological knowledge to groups of gene. by examining the frequency of the used go terms for the gene group the browse gene ontology function in kberg allows user to select estrogen responsive genes that share the same go annotation term and the statistic information about the term. for example, there are 101 genes under the go term receptor activity (go:0004872) and only 22 genes belong to steroid hormone receptor activity (go:0003707). users can easily obtain two relevant but not identical lists of genes to study receptors with specific annotation and with broad annotation. we believe that clustering genes according to go terms is a complementary way to associate genes with their functions and a logical way to assess genes. allowing user to download the list of classified genes is one of the helpful features of the system. evoc (18) associates human gene expression data with controlled ontology terms in sets of hierarchical vocabularies, covering categories such as anatomical system, cell type, pathology, developmental stage, etc. we use evoc ontology in our system to provide an alternative approach to cluster gene for functional assessment. the expression data provide extensive information about the gene co - expression under various biological conditions, which, although coarse, becomes essential indicators for gene co - regulation and interaction. expression results also represent important gene behaviors that should not be missed out in gene functional characterization. in kberg, we integrated evoc (version 2.7) to reveal gene expression in terms of human organ, cell type, disease and age. thus, a user can easily find out some of the associated information for gene expression (organ and cell type, whether in normal or diseased tissues and in the age group). the downloadable list of classified genes is provided and could be useful for user 's further exploration. designed for estrogen - related research, kberg provides a wide range of information about estrogen responsive genes through promoter motifs and functional associations via well - defined vocabularies from go and evoc. we summarized the main functions of the system in table 1. in brief, through searching this system, within a short period of time, a user can gain valuable information related to either individual gene or a group of genes that share the same ontology description. however, there is limitation of the system that user needs to bear in mind. the promoter motif prediction is a pure computational estimation and needs to be verified by experiments. also, classifying gene based on ontology categories may not always be the best way to reveal its biological function. | estrogen has a profound impact on human physiology affecting transcription of numerous genes. to decipher functional characteristics of estrogen responsive genes, we developed knowledgebase for estrogen responsive genes (kberg). genes in kberg were derived from estrogen responsive gene database (ergdb) and were analyzed from multiple aspects. we explored the possible transcription regulation mechanism by capturing highly conserved promoter motifs across orthologous genes, using promoter regions that cover the range of [1200, + 500 ] relative to the transcription start sites. the motif detection is based on ab initio discovery of common cis - elements from the orthologous gene cluster from human, mouse and rat, thus reflecting a degree of promoter sequence preservation during evolution. the identified motifs are linked to transcription factor binding sites based on the transfac database. in addition, kberg uses two established ontology systems, go and evoc, to associate genes with their function. users may assess gene functionality through the description terms in go. alternatively, they can gain gene co - expression information through evidence from human est libraries via evoc. kberg is a user - friendly system that provides links to other relevant resources such as ergdb, unigene, entrez gene, homologene, go, evoc and genbank, and thus offers a platform for functional exploration and potential annotation of genes responsive to estrogen. kberg database can be accessed at. |
in a recent issue of critical care, brandt and coworkers performed fluid resuscitation on pigs with endotoxemia or fecal peritonitis using either moderate volumes of crystalloids (103 ml / kg / h) or larger volumes of crystalloids supplemented by 130/0.4 hydroxyethyl starch (combined 203 ml / kg / h). these protocols were designed to mimic the relative ' restrictive ' and ' liberal ' fluid resuscitation policies that have been previously compared in human major surgery and acute lung injury / acute respiratory distress syndrome [2 - 4 ]. in both sepsis models, mortality increased with ' liberal ' fluid loading protocols in spite of better haemodynamic stabilization. although supplemental hydroxyethyl starch use in both study arms was partially ' goal - directed ' - on the basis of cardiac output responses assessed by esophageal doppler - the doses used for fluid loading were relatively fixed rather than completely based on cardiac fluid responses (fluid responsiveness). the latter is preferable at the bedside, even if we do not formally know whether such therapy causes less morbidity and mortality in septic shock than using fixed volumes or guiding infusion according to relatively crude hemodynamics, such as the central venous pressure, as currently recommended. it is likely, however, that tailored ' liberal ' therapy decreases the risk for iatrogenic and detrimental fluid overload compared to fixed ' liberal ' therapy [6 - 8 ]. the debate about fixed ' restrictive ' versus ' liberal ' versus ' goal - directed ' therapy in the case of major surgery is also unresolved. differing results among studies, which may relate to differing case mixes, definitions, hemo - dynamic monitoring techniques / endpoints and treatment strategies, preclude unequivocal conclusions. the authors used different types of fluid in the ' restrictive ' and ' liberal ' arms, with hydroxyethyl starch used particularly in the latter. a toxic effect of hydroxyethyl starch can not thus be ruled out, so it is possible that the higher mortality in the ' liberal ' arm was caused, in part, by toxicity rather than large volumes. indeed, mortality in the control non - septic pigs receiving the ' liberal ' protocol was 13% (1 out of 8). toxicity may include renal damage, as was particularly noted from the histology of the ' liberal ' endotoxin - challenged animals. in any case, the histology of several tissues suggested that overhydration and (pulmonary) edema had not increased in the ' liberal ' compared to the ' restrictive ' fluid loading groups, even in the presence of so - called colloid plaques observed in lungs, for instance, although the nature of these remains relatively unclear. finally, starch preparations may have multiple anti - inflammatory effects, but we do not know whether this is good or bad during sepsis. collectively, the experiments reported raise the interesting idea that too much of a good thing is detrimental, whether related to relative overtreatment or to toxicity of the hydroxyethyl starch colloid. a comparison of these experimental results with the literature is difficult because of, for example, highly varying study goals and endpoints. morisaki and colleagues found that starches (more so than ringers lactate) ameliorated progression of microvascular and parenchymal injury during the development of peritonitis in sheep. su and colleagues noted that starch, albumin, gelatin and ringers lactate fluid resuscitation afforded similar survival benefits during protracted fecal peritonitis in sheep, in spite of greater hemodynamic effects with the first two. this illustrates that the current data provided by brandt and colleagues may need to be confirmed. the observations that hemodynamic and mortality endpoints may not go in the same direction also deserve further explanation. what are the clinical implications of these experimental results ? the potential but unconfirmed (renal) toxicity of hydroxyethyl starch is indeed a subject of ongoing research in human septic shock and the current experimental observations may further fuel these efforts [13 - 15 ]. for instance, the potential renal toxicity of starch preparations may depend on volume, type, substitution of starch and the underlying condition of patients in whom fluids are infused, so that general conclusions are hard to draw at this stage [13 - 15 ]. that colloids have greater hemodynamic effects, for a given fluid infusion volume, than crystalloids, even in sepsis with increased permeability and potential leakage of the compounds, is corroborated by recent clinical observations. the outcome benefits and drawbacks of fluid resuscitation in sepsis and shock may not solely relate to hemodynamic effects, so that more is not always better, even if overt overhydration and (pulmonary) edema do not occur. the experimental findings remind us that outcome may also be a matter of the type of fluid used for initial resuscitation during septic shock. obviously, this relates, among other factors, to the increasing evidence that starch solutions have important side effects, particularly when exceeding recommended maximum daily doses. | in a recent issue of critical care, brandt and colleagues report the effects of a ' liberal ' fluid loading protocol compared to a more ' restrictive ' protocol on hemodynamics and mortality in pigs in which septic shock had been induced. it appears that the former protocol was associated with higher mortality in spite of improved hemodynamics compared to the latter. the results of the paper are discussed here in view of the scope and mechanisms of these findings. with regard to fluid resuscitation, they indicate that too much of an otherwise good thing is harmful, even if overhydration and edema formation seem to have been prevented. they also do not exclude a specific toxic effect of the larger volumes of hydroxyethyl starch in the ' liberal ' strategy. the precise nature of a toxic effect remains obscure, however, but may involve the kidneys. |
cystatin c is a nonglycosylated, low molecular weight (13.250 da), basic protein that is a member of the cystatin superfamily of cysteine protease inhibitors [13 ]. it consists of 120 amino acids, it is produced by all nucleated cells at a constant rate, and it is excreted by the kidneys by free glomerular filtration and complete tubular reabsorption and degradation [46 ]. therefore, serum concentration levels of cystatin c are almost totally dependent on the glomerular filtration rate and unlike serum creatinine levels which increase after glomerular filtration rate has fallen by approximately 50%even a slight reduction in glomerular filtration rate causes a rise in serum cystatin c [7, 8 ]. besides its usefulness as a marker of renal function, serum cystatin c appears to be a prognostic marker of cardiovascular events and death among elderly persons without chronic kidney disease [9, 10 ]. therefore, it is important to establish reference values of cystatin c not only for nephrologists, but for cardiologists as well. in this study, serum cystatin c concentrations were measured in a healthy greek adult population, and reference intervals were derived after taking under consideration sources of variation for this population. between april 2009 and january 2010, a total of 490 consecutive adults (85% participation rate), who had visited the polykliniki general hospital for an annual health check, agreed to participate in the study. the retrieved data were confidential, and the study followed the ethical considerations provided by the world medical association (52nd wma general assembly, edinburgh, scotland, october 2000). moreover, the institutional review board approved the design, procedures, and aims of the study (ga 23/14.05.2009). all participants were informed about the procedures of the study and agreed to participate providing written informed consent. subjects who reported chronic diseases such as renal failure, diabetes mellitus, cardiovascular diseases, cancer, thyroid dysfunctions, or pregnancy were excluded as well as those treated with drugs that may influence renal function or cystatin c concentrations (i.e., antihypertensives, diuretics, antiinflammatory agents, hypoglycemic agents, anticonvulsants, and antibiotics). other exclusion criteria were : (1) fasting serum glucose 126 mg / dl, (2) systolic blood pressure 140 mmhg or diastolic blood pressure 90 mmhg, (3) body mass index (bmi) 18.5 or 30, to avoid the extremes of body size, and (4) egfr (glomerular filtration rate) 6 were considered as highly active. alcohol consumption was assessed as the self - reported number of drinks per week and participants were categorized as never / rare (i.e., 0 - 1 drink / week) and current drinkers (i.e., > 1 drink / week). systolic and diastolic blood pressures, together with fasting serum glucose, serum creatinine, and cystatin c, were measured in all participants. blood pressure was measured by the same physician using a standard mercury sphygmomanometer on the right arm of the seated subject. venipuncture was performed for each participant, early in the morning (between 07:00 am and 11:00 am), after a 12-hour fasting period by applying a natural latex rubber strap and using a 20 ml syringe. samples were left undisturbed for 20 minutes to clot and then centrifuged at 4000 rotations per minute (relative centrifugal force : rcf 2.7) for 10 minutes so as to obtain serum. glucose was determined via an enzymatic colorimetric test (glucose oxidase pap, trinder endpoint reaction, god - pap). serum creatinine was determined via a kinetic colorimetric assay based on the reaction of creatinine with picric acid in alkaline solution and cystatin c via a particle - enhanced immunoturbidimetric assay. in the latter case, human cystatin c agglutinates with latex particles coated with anticystatin c antibodies, and the aggregate is determined turbidimetrically at 546 nm. reproducibility in the lab has been determined using human samples and controls in an internal protocol. for the above mentioned tests, within run and between day, coefficients of variation (cv) were less than 8%. two levels of control sera were used for these assays (precinorm u plus 12149435122 & precipath u plus 12149443122 for glucose and serum creatinine, cystatin c control set 04975936190 for cystatin c). control recovery for all tests was very close to the recommended target values (tv 5%). accuracy of results is further supported by participation in suitable external quality assurance program for glucose and serum creatinine (eseap). reagents, calibrators, controls, and consumables were purchased from same supplier (roche diagnostics gmbh, sandhofer strae 116, d-68305 mannheim, germany). continuous variables are presented as mean standard deviation and categorical variables as absolute (n) and relative frequencies (%). comparisons of continuous variables between groups of study were performed using the independent samples t - test and the analysis of variance, after controlling for the normality of the distribution. distribution of cystatin c levels was presented for the 2.5th, 5th, 10th, 25th, 50th (median), 75th, 90th, 95th, and 97.5th percentile. subgroups analyses were performed by gender, age category (i.e., 1844, 4564, and 65 years old), obesity status (< or 25 kg / m), current smoking (yes versus no), alcohol drinking (yes versus no), and physical activity status (low / moderate versus high). all statistical analyses were performed using the spss version 14 (spss inc., thirty - seven percent of participants were male, while the mean age between genders did not differ (40 14 for males, 40 13 for females, p =.81). differences were not observed as well in physical activity status between genders (i.e., 5.8 2.1 for males versus 5.9 2.3 for females, p =.91). percentage of current smokers was similar between males (34%) and females (36%) (p =.79). approximately 2/3 of males and 27% of females were considered as overweight / obese (p <.001), while 85% of males and 73% of females were current drinkers (p =.02). cystatin c levels varied from 0.50 to 1.21 mg / l among males and from 0.52 to 1.14 mg / in addition, cystatin c levels were normally distributed among the 176 healthy women and 103 healthy men that comprised the studied population (figure 1). the distribution of cystatin c levels among age groups between the two genders is presented in table 1. in general, higher levels were observed for males as compared to females in all age groups. mg / l among males aged 1844 yrs, from 0.52 to 1.21 mg / l among males aged 4564 yrs, and from 0.83 to 1.18 mg / l among males over 65 yrs. among females, the cystatin c levels varied from 0.52 to 1.05, 0.61 to 1.12, and 0.74 to 1.14 mg / l, respectively, for each age group (table 1). the distribution of cystatin c levels was furthermore examined according to obesity and current smoking status. levels of cystatin c varied from 0.52 to 1.12 mg / l for participants with bmi < 25 kg / m and from 0.50 to 1.21 mg / l for overweight / obese participants. moreover, cystatin c levels varied from 0.50 to 1.21 mg / l for never or ex - smokers and from 0.52 to 1.18 mg / regarding the distribution of cystatin c levels according to physical activity status, this varied from 0.50 to 1.18 mg / l among participants with low physical activity and from 0.52 to 1.21 mg / l among highly active participants. differences in mean values of cystatin c levels were observed between genders, age group, smoking, and obesity status. in particular, higher values were noticed among males (p =.04), older participants aged over 65 yrs (p <.001), current smokers (p <.001), and overweight / obese participants (p =.03). in contrast, cystatin c levels did not seem to differ regarding alcohol drinking status and physical activity status (p =.61, p =.95, resp.) (table 3). various physiological sources of variation for serum cystatin c such as age, gender, bmi, cigarette smoking, and alcohol consumption have been reported based on analysis of healthy adult populations. most studies have shown age - related differences in serum cystatin c, demonstrating that its levels increase with age [1317 ]. these studies have documented a variation in cystatin c levels as a function of age, probably due to the physiological aging of renal function [1820 ]. in this study, higher values were noticed among older participants aged over 65 yrs (p <.001). such differences were significant in some studies, especially for adults below 60 years of age [2022 ], but not significant in others [13, 23 ]. in this study, gender differences in cystatin c were revealed, with higher values of cystatin c among males as compared with females. the findings of this study, regarding the influence of smoking in the levels of cystatin c, have been also confirmed by other studies [13, 24 ]. it seems likely that smoking is an independent source of variation for cystatin c, although the mechanism is not known. previous studies with respect to positive association of cystatin c levels with bmi support the above mentioned results of this study [25, 26 ]. specifically, higher values of cystatin c levels among overweight / obese individuals in comparison with normal weight individuals were revealed. laboratory studies have examined the expression of cathepsin s as a new biomarker of adiposity and have shown that human adipose tissue secretes and expresses cathepsin s, which is upregulated in obesity. it has been found that cystatin c secretion increased and cathepsin s decreased during preadipocyte differentiation, suggesting a possible role of cystatin c in adipogenesis. alcohol consumption and physical activity did not seem to influence cystatin c levels in the studied population. this is in accordance with most studies that have been conducted until today [13, 29, 30 ]. as it is clearly mentioned on the package insert of the commercial assay for cystatin c each laboratory should investigate the transferability of the expected values to its own patient population and if necessary determine its own reference ranges. this is to the best of our knowledge the first study for determination of cystatin c reference values in greek population. in the era of newly discovered properties and clinical significance of cystatin c, factors such as age, gender, bmi, and cigarette smoking need to be considered when interpreting serum cystatin c values even in a carefully selected healthy adult population. | background. the aim of the present study was to examine sources of variation for serum cystatin c in a healthy greek population. methods. cystatin c together with basic clinical chemistry tests was measured in a total of 490 adults (46 16 yrs, 40% males) who underwent an annual health check. demographic, anthropometric, and lifestyle characteristics were recorded. results. higher values of cystatin c were observed among males (p =.04), participants aged over 65 years (p <.001), current smokers (p =.001) and overweight / obese participants (p =.03). on the contrary, alcohol consumption and physical activity seemed to have no influence on cystatin c levels (p =.61 ; p =.95, resp.). conclusions. in interpreting serum cystatin c values in a healthy adult population, age, gender, body mass index, and cigarette smoking need to be considered, and determination of reference ranges among distinct subpopulations seem to be prudent. |
in the previous issue of critical care, huang and colleagues try to answer the unresolved question of the prognostic value of sepsis - related cardiomyopathy. since margaret parker and colleagues originally reported in 1984 that 65% of patients had significant left ventricular (lv) systolic dysfunction in the early phase of sepsis associated with acute lv dilatation (> 100% increase in size !) and that such patients had a better prognosis, various groups have failed to replicate these results, leading to confusion and controversy. the article by huang and colleagues is interesting because it reports a large meta - analysis including more than 700 septic patients available for lv analysis. the meta - analysis failed to find any evidence for a protective effect of a decreased lv ejection fraction (ef). nevertheless, the nonindexed lv dimension was moderately higher among survivors than nonsurvivors. these results have to be interpreted with caution since in most studies included in the meta - analysis patients with lv systolic dysfunction received inotropic drugs. in the study by cariou and colleagues in 10 patients, most patients were infused with epinephrine or dobutamine. in the study performed by our group in 68 patients, bouferrache and colleagues reported recently that dobutamine significantly improves the macrocirculation in patients with a low flow state who show a 40% increase in cardiac output despite normal venous oxygen saturation. de backer and colleagues demonstrated that the proportion of functional capillaries was decreased in septic patients compared with volunteers and that dobutamine, by inducing a 21% increase in cardiac output, led to a nearly complete reversal of such alterations. in the study by rivers and colleagues, demonstrating a better prognosis in the early goal - directed therapy group, close to 14% of patients received dobutamine in the first 6 hours in the interventional group versus 0.8% in the control group. finally, rhodes and colleagues, kumar and colleagues, and vallet and colleagues reported similar results - a huge decrease in mortality in septic patients who respond to dobutamine in terms of cardiac output [9 - 11 ]. more interestingly, however, the article by huang and colleagues allows us to try to clarify the meaning of lv function in septic shock patients. a lot of confusion exists. in all experimental models of septic shock, lv contractility impairment - called septic cardiomyopathy - has been reported to be constant. in these studies, as in the study by barraud and colleagues, intrinsic contractility is assessed using a parameter that is not dependent on load conditions ; that is, systolic elastance. unfortunately, this assessment requires the generation of pressure / volume loops, something difficult to achieve in human subjects at the bedside. this difficulty is why in clinical practice most intensivists use lv systolic function parameters that are for the most part dependent on load conditions. more than 20 years ago, robotham and colleagues nicely reiterated that lvef reflects the coupling between lv contractility and lv afterload. in other words, a normal lvef may be observed when the arterial tone is severely depressed, despite seriously impaired intrinsic lv contractility. everyone understands that it is crucial to remember this in septic shock, in which arterial tone is initially severely decreased. lv systolic function, evaluated using an echocardiograph or another device, is more a reflection of arterial tone (and its correction) than of intrinsic lv contractility. in a 1990 study, jardin and colleagues elegantly showed that patients with a normal lvef had a significantly lower systemic vascular resistance than patients with a low lvef in whom resistance was corrected. as shown in figure 1, it is then easy to understand that the incidence of lv systolic dysfunction greatly depends on the time of the evaluation. this dependence only reflects the fact that, during resuscitation and treatment, vasoplegia and then lv afterload are corrected, thus unmasking septic cardiomyopathy. h6, h12, h24, h72, the time (hours) between admission and echocardiographic evaluation. with these points in mind, we can revisit the results of margaret parker and colleagues ' study : it is not that the patients with a low ef survived better, but rather that the other patients had an increased mortality due to persistent profound vasoplegia. this was suggested by our group in a study where 100% of patients with a hyperkinetic state (lvef 67 7%) finally died, compared with ' only ' 43% of patients with a hypokinetic state (lvef 34 10%). weng and colleagues showed recently that high peak systolic velocity measured at the mitral annulus by tissue doppler imaging might be associated with mortality in patients with septic shock, suggesting that profound vasoplegia inducing high contractility is linked to poor prognosis. in conclusion, it will be very difficult to demonstrate that lv systolic dysfunction is associated with prognosis. septic cardiomyopathy is constant and lv systolic function is more a reflection of the status of lv afterload. rather, we have now to demonstrate what the best mortality - reducing strategy is when there is lv systolic dysfunction. persistence of a hyperkinetic state is a warning signal suggesting that the septic process is not under control and that the patient has a high probability of dying. | the meta - analysis of huang and coworkers failed to find any evidence for a protective effect of a decreased left ventricular (lv) ejection fraction (ef). these results have to be interpreted with caution since in most studies included in the meta - analysis patients with lv systolic dysfunction received inotropic drugs. we have some arguments suggesting that such a treatment may improve macrocirculation and microcirculation and finally prognosis. this paper allows us to clarify the meaning of lv function in septic shock patients. in all experimental models of septic shock using the load - independent parameter of lv systolic function, lv contractility impairment, called septic cardiomyopathy, has been reported to be constant. however, lvef reflects the coupling between lv contractility and lv afterload. a normal lvef may be observed when the arterial tone is severely depressed, as in septic shock, despite seriously impaired intrinsic lv contractility. lv systolic function, evaluated using an echocardiograph or another device, is then more a reflection of arterial tone (and its correction) than of intrinsic lv contractility. as a consequence, the incidence of lv systolic dysfunction greatly depends on the time of the evaluation, reflecting the fact that, during resuscitation and treatment, vasoplegia and then lv afterload are corrected, thus unmasking septic cardiomyopathy. with these points in mind, we can revisit the results of margaret parker 's original study : it is not that the patients with a low ef survived better, but rather that the other patients had an increased mortality due to persistent profound vasoplegia. |
subsequent to the first report in the 1940s on incubation of tissue sections with fluorescein - conjugated antibodies for localization of antigens, a great number of modifications were introduced to improve the validity of immunohistochemistry which has become a growingly popular tool. the use of immunoenzymatic techniques eliminates the need for expensive fluorescence microscopy equipment, the lack of permanency of preparations and the lack of electron density required in ultrastructural localization of antigens. regardless of the technique, it is also important to choose a correct fixation which allows the proper preservation of antigens and morphology and the penetration of antibodies through the entire thickness of the preparation. a variety of immunohistochemical techniques have been applied to study several components of the lung, such as collagen, surface active material, lung specific antigens, and enzymes and the detection of tumor markers, immunoglobulins and infectious agents in the respiratory system which is reviewed. the large surface area and the multiplicity of cell types provided by the respiratory tract epithelium of humans for exposure to microbial as well as toxic substances in the environment make this organ system very vulnerable but a good early indicator of adverse health effects. immunohistochemistry provides valuable information complementary to the immunochemical and biochemical characterization of this barrier.imagesfigure 2.figure 3.figure 3.figure 4.figure 4.figure 5. |
|
type 2 diabetes mellitus causes excessive morbidity and premature cardiovascular (cv) mortality. although studies have documented the benefits of optimal glycemic control on microvascular complications, the effect of tight glycemic control on macrovascular complications is unclear. in the action to control cardiovascular risk in diabetes study, glitazones and saxagliptin (a dipeptidyl peptidase 4 inhibitor) increase the risk of hospitalization for heart failure [3, 4 ]. in the empagliflozin, cardiovascular outcomes, and mortality in type 2 diabetes study, empagliflozin, an inhibitor of sodium - glucose co - transporters 2 (sglt-2), was associated with remarkable reduction of cv morbidity and mortality and all - cause death. in contrast, stroke incidence was slightly increased, although the result did not reach statistical significance. a large meta - analysis of sglt-2 inhibitors effect on cv risk resulted in a significant increase of stroke risk with their use. possible explanations are an increase in hematocrit and therefore blood viscosity as secondary effects of this class of drugs. whole blood viscosity (wbv) is inversely related to flow of insulin and glucose to insulin - sensitive tissues and might therefore lead to insulin resistance, metabolic syndrome (ms) or type 2 diabetes. wbv has been shown to be a risk factor for type 2 diabetes and coronary heart disease. the relationship between wbv and ms has been investigated in non - diabetic population [11 - 13 ] ; however, there was, as far as we know, no report on this issue in diabetic patients despite increased wbv in this population. we, therefore, have evaluated the relationship between estimated wbv and ms in patients with type 2 diabetes. among ms as postprandial hypertriglyceridemia is common in type 2 diabetes patients and it is a component of ms [14, 15 ], we evaluated association between wbv and post - breakfast triglyceridemia as well. we studied 168 patients with type 2 diabetes, whose details have been reported elsewhere [16, 17 ]. they had been regularly attending the clinic for more than 6 months prior to enrollment and had eight or more monthly visits with anthropometric and blood pressure (bp) measurements and blood samplings during the following 12 months after enrollment. patients who had aspartate aminotransferase (ast) and alanine aminotransferase (alt) of 100 u / l or greater, serum creatinine 2.0 mg / dl and proteinuria in nephrotic range were also excluded. study protocol was consistent with the japanese government s ethical guidelines regarding epidemiological studies in accordance with the declaration of helsinki. for each subject on each monthly visit, waist circumference, weight and bp bp was measured by nurses using a sphygmomanometer after patients sat and rested for at least 5 min. blood was withdrawn at 2 h after breakfast taken at home and after an overnight fasting every other month as previously reported in details [16, 17 ]. plasma glucose, serum creatinine, hepatic enzymes, uric acid and other blood tests were measured by standard methods using an autoanalyzer. hba1c values were determined by high performance liquid chromatography. low - density lipoprotein (ldl) cholesterol was calculated using friedewald s formula in blood samples taken after an overnight fasting. complete blood cell count was analyzed using an automated blood cell counter. of 168 patients with type 2 diabetes, 153 patients (91%) blood was obtained after an overnight fasting. in each patient, we calculated a mean of 12 measurements of body mass index (bmi), waist circumference, wbv estimated as described below, total and high - density lipoprotein (hdl) cholesterol, hba1c, uric acid, bp, serum protein, hepatic enzymes and hematocrit. six measurements of fasting and post - breakfast glucose, ldl cholesterol, fasting and post - breakfast tg averaged in each patient as well. those means are shown in table 1 and were used for the diagnosis of ms. wbv : whole blood viscosity ; pg : plasma glucose ; tg : triglycerides ; acr : albumin / creatinine ratio ; egfr : estimated glomerular filtration rate ; ast : aspartate aminotransferase ; alt : alanine aminotransferase ; ggt : gamma - glutamyl transferase ; bp : blood pressure. p < 0.05, p < 0.01. ms was defined according to the modified criteria of the national cholesterol education program adult treatment panel iii guidelines. abdominal obesity was defined as a waist circumference greater than 85 cm in men and greater than 90 cm in women, according to the japan society for the study of obesity criteria. elevated bp was defined as systolic / diastolic bps of 130/85 mm hg or greater and/or current use of antihypertensive medicine. hypertriglyceridemia was defined as a serum fasting tg level of 150 mg / dl or greater and/or current use of fibrates. low hdl cholesterol level was defined as less than 50 mg / dl in women and as less than 40 mg / dl in men. patients in the present study had at least one component as all patients had diabetes. wbv at 208/s of shear stress was calculated by a previously validated formula that takes into account hematocrit and serum proteins : wbv (208/s) = (0.12 h) + 0.17 (p - 2.07), where h is hematocrit (%) and p is serum protein concentration (g / dl). hematocrit and serum protein concentrations used were respective averages of 12 measurements over 12 months in each patient. the unit for viscosity is the centipoise (cp) corresponding to the ratio of the shear rate of blood to the shear rate of water. urinary albumin was measured once during the first 3 - 4 months after enrollment in random urine samples using a turbidimetric immunoassay and expressed as albumin / creatinine ratio (acr). serum and urinary creatinine were measured enzymatically and estimated glomerular filtration rate (egfr) was determined using the equation recommended by the japanese society for nephrology. differences between two groups were analyzed by t - test and frequencies of conditions by chi - square tests. associations of the number of ms components with wbv and hematocrit and p values for trend were derived using jonckheeree - terpstra test. stepwise multiple regression analyses were performed to further identify the most significant variables contributing to the variation of wbv. differences between two groups were analyzed by t - test and frequencies of conditions by chi - square tests. associations of the number of ms components with wbv and hematocrit and p values for trend were derived using jonckheeree - terpstra test. stepwise multiple regression analyses were performed to further identify the most significant variables contributing to the variation of wbv. of 168 patients, 77 patients (45.8%) had ms and wbv averaged 5.95 0.04 cp. as previously reported [16, 17 ], patients had relatively good glycemic, bp and lipid control (table 1) ; 53 (31.5%) were treated with, 85 (50.6%) on oral anti - hyperglycemic drugs and 30 (17.9%) on insulin with or without oral drugs. of 75 patients (44.6%) on lipid - lowering drugs, 63 and 12 patients were on statins and fibrates, respectively. as patients with anemia (hemoglobin < 13 g / dl in men and < 12 g / dl in women) and renal failure (egfr < 45 ml / min/1.73 m) were small in number (n = 15, 8.9% and n = 6, 3.6%, respectively), they were not excluded. among ms components other than hyperglycemia (all participants had diabetes), elevated bp was the most prevalent (111 patients ; 66.1% ; hypertension in 91 patients), followed by abdominal obesity in 63 patients (37.5%) and then fasting hypertriglyceridemia (38 patients, 22.6%) and low hdl cholesterol (43 patients, 25.6%). diabetes patients with ms had higher wbv and hematocrit as compared to those without ms (fig. the number of patients with component number from 1 to 5 was 33 (19.6%), 58 (34.5%), 42 (25.0%), 27 (16.1%) and 8 (4.8%), respectively. there was no difference in age, sex, duration of diabetes and therapy for diabetes between patients with and without ms as well as among five component number groups (data not shown). although the proportion of patients on antihypertensive medications was higher in patients with ms as compared to those without (68.8% vs. 37.4%, p < 0.001), there was no difference in the proportion of patients on diuretics between the two groups (7.8% vs. 2.2%, p = 0.09). whole blood viscosity and hematocrit in patients with type 2 diabetes as a function of the number of components of metabolic syndrome (mean se). the number of patients with component number from 1 to 5 is 33 (19.6%), 58 (34.5%), 42 (25.0%), 27 (16.1%) and 8 (4.8%), respectively. associations of the number of ms components with wbv and hematocrit and p values for trend were derived using jonckheere - terpstra test. whole blood viscosity and hematocrit in type 2 diabetes patients in the absence (white columns, n = 91) and presence (black columns, n = 77) of metabolic syndrome (mean se). by univariate analysis (table 1, simple), wbv was positively associated with male gender and smoking. it was also positively associated with fasting and post - breakfast tg and inversely with hdl cholesterol. in addition, wbv was associated with diastolic bp, uric acid and leukocyte count. after controlling for sex (table 1), associations with diastolic bp, fasting and post - breakfast tg remained significant whereas smoking, liver enzymes, uric acid and leukocyte count were no longer associated with wbv. those with bmi and waist circumference turned out to be significant after adjusting for sex. we have done multiple regression analysis, which included variables that showed significant associations with wbv in partial correlation analysis as independent variables (table 2). male gender, diastolic bp and post - breakfast tg emerged as independent determinants of wbv in type 2 diabetes (r = 0.258). other independent variables included in the model were bmi, waist circumference and fasting triglycerides, all of which showed significant associations with whole blood viscosity after controlling for sex shown in table 1. after controlling for age, sex and smoking, hematocrit correlated positively to bmi (r = 0.221), waist circumference (r = 0.161), fasting and post - breakfast tg (r = 0.210 and 0.200, respectively) and diastolic bp (r = 0.256, all p < 0.05 or less) whereas no association was found with glycemia, hdl cholesterol and systolic bp (data not shown). the present study has demonstrated that both the presence of ms and the number of ms components were associated with higher wbv and hematocrit in patients with type 2 diabetes. the current study also has demonstrated in type 2 diabetic patients that blood viscosity is associated with post - breakfast tg independent of fasting tg. we confirmed the previous findings in non - diabetic subjects that high wbv was associated with all diagnostic criteria for ms except for glycemia [11 - 13 ]. it is noted that in the present study ms was diagnosed using intrapersonal means of 12 measurements of waist circumference, bp and hdl cholesterol and those of six measurements of fasting tg during 12 months. the relationship between wbv and ms has been investigated in non - diabetic population [11 - 13 ] ; however, there was, as far as we know, no report on this issue in type 2 diabetic patients despite increased wbv in this population. one of the reasons may be that most patients with type 2 diabetes mellitus will have ms, specifically in western countries. for example, ms was found in more than 90% of type 2 diabetes patients in a uk hospital whose bmi averaged 33 kg / m. therefore, we evaluated association between the two conditions in japanese patients with type 2 diabetes, whose bmi averaged 24.2 kg / m. to the best of our knowledge, this is the first report on the relationship between wbv and ms in type 2 diabetes although wbv was calculated, not measured. associations between the number of ms components and measured hemorheological variables including wbv had been reported in some [11, 13, 23 ] but not in another study. among ms components, fasting hypertriglyceridemia has been reported to independently predict hemorheological alterations. in the present study, post - breakfast tg was associated with wbv independently of fasting tg in type 2 diabetes patients. it has been reported that insulin resistance directly measured using the hyperinsulinemic glycemic clamp technique, a gold standard for assessing insulin sensitivity, is associated not only with an increase in the large very - low - density lipoprotein / chylomicron remnant particles during the postprandial period in type 2 diabetes mellitus but also with an increase in directly measured wbv. taking these observations into consideration, it may be reasonable to assume that wbv may be associated with insulin resistance even in type 2 diabetes. blood viscosity and hematocrit were higher in type 2 diabetes patients with ms as compared to those without in the present study. the edinburgh artery study noted a significant association between blood viscosity or hematocrit and risk for stroke, independently of other risk factors. a cross - sectional study reported that high wbv is present not only in subjects with acute brain infarction, but also in those with risk factors for stroke. several studies with empagliflozin have shown an increase in hematocrit and therefore blood viscosity as secondary effects of this drug. therefore, physicians need to follow type 2 diabetes patients with ms on sglt-2 inhibitors closely. it has been clearly demonstrated that the prevalence of ms is higher in winter than in summer in japanese male workers in general, in subjects aged greater than or equal to 40 years in particular. this is due to higher serum levels of hdl cholesterol, fasting glucose and systolic and diastolic bp in winter than in summer. in the present study, all variables including hdl cholesterol, and systolic and diastolic bp were repeatedly measured throughout 12 months and hence, seasonal variations in the diagnosis of ms had been avoided. postprandial tg concentrations were measured after breakfast taken at home in their day - to - day life. we had no direct measurement of blood viscosity and data on other blood components of blood viscosity, such as erythrocyte rigidity and aggregability. our estimates, however, were based on a prediction equation that has been validated in three prior studies [20, 25, 30 ] and wbv is largely determined by hematocrit and plasma protein levels. antihypertensive treatment has been shown to decrease both wbv and bp, independently of the class of drug [32 - 35 ]. in contrast, diuretic therapy tends to increase wbv, at least in the early phase of treatment. therefore, possible contribution of antihypertensive drug treatment on wbv and other variables can not be excluded in the present study. both the presence of ms and the number of ms components were associated with higher wbv and hematocrit in patients with type 2 diabetes. postprandial hyperlipidemia may contribute to elevated wbv in type 2 diabetes, and may represent important confounders of the relationship between postprandial hyperlipidemia and atherogenesis in this population. both the presence of ms and the number of ms components were associated with higher wbv and hematocrit in patients with type 2 diabetes. postprandial hyperlipidemia may contribute to elevated wbv in type 2 diabetes, and may represent important confounders of the relationship between postprandial hyperlipidemia and atherogenesis in this population. sm, akt, ju, ayt and mk have made substantial contributions to acquisition, analysis and interpretation of data. tk has been involved in revising it critically for important intellectual content, have given final approval of the version to be published, and agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. albumin / creatinine ratio aspartate aminotransferase alanine aminotransferase estimated glomerular filtration rate gamma - glutamyltransferase whole blood viscosity | backgroundassociations of whole blood viscosity (wbv) with metabolic syndrome (ms) have not been extensively studied in patients with type 2 diabetes.methodsintrapersonal means of 12 measurements of waist circumference, blood pressure (bp) and high - density lipoprotein cholesterol and those of six measurements of fasting and post - breakfast triglycerides (tg) during 12 months were calculated in a cohort of 168 patients with type 2 diabetes. based on these means, ms was diagnosed according to the modified national cholesterol education program adult treatment panel iii criteria with the asian definition of abdominal obesity. wbv was calculated from hematocrit and total serum protein concentrations by a validated formula.resultsdiabetes patients with ms (n = 77) had higher wbv as compared to those without ms (6.38 0.06 vs. 6.10 0.07 cp, p = 0.004). as the number of ms components increased, wbv increased (component number 1 : 6.12 0.10, 2 : 6.09 0.10, 3 : 6.37 0.08, 4 : 6.42 0.10, 5 : 6.30 0.15 cp, p for trends = 0.001). multiple regression analysis revealed that male gender, diastolic bp and post - breakfast tg were determinants of wbv independent of fasting tg, body mass index (bmi) and waist circumference (r2 = 0.258).conclusionsboth the presence of ms and the number of ms components were associated with higher wbv in patients with type 2 diabetes. physicians need to perform a close follow - up of type 2 diabetes patients with ms on inhibitors of sodium - glucose co - transporters 2, which may increase stroke risk associated with an increase in hematocrit and therefore blood viscosity. post - breakfast tg was an independent determinant of wbv. elevated wbv may represent an important confounder of the relationship between ms, postprandial hyperlipidemia and elevated cardiovascular risk in this population. |
the purpose of the danish database for cervical cancer screening is to provide an annual status for the nationwide screening program and to document the screening quality over time by monitoring nine quality indicators. the first annual report covered the activities in 2009 and the latest report covered the activities in 2014.16 cervical cancer screening with cytology started in the late 1960s in denmark, and a decrease in both incidence and mortality has been seen since then, as shown in figure 1. in 1986, the danish national board of health issued the first national recommendations.7 women aged 2359 years were recommended to be screened every third year.8 it took 20 years before these recommendations were fully implemented. in 2007, the recommendations were changed to screening every third year for women aged 2349 years and every fifth year for women aged 5064 years.9 in 2012, screening at the age 60 years and over could be replaced by a human papillomavirus (hpv) check out test.10 the annual report of the database describes the result of nine quality indicators. the indicators represent a selected and simplified version of the characteristics of a screening program recommended for monitoring in the european guidelines for quality assurance in cervical cancer screening.11 all quality indicators are calculated from data available in already established national registers. for each indicator, the steering committee for the database has agreed on a standard that the program should aim to reach as confirmed by the national board of health. the indicator data are tabulated on national level, by region, and, in some cases, also by pathology department. the indicators, the standards, and the achieved outcomes for each year are tabulated in table 1. cervical cancer cases constitute the study base for indicators 9a, 9b, and 9c. various parts of the cervical cytology samples constitute the study base for the other indicators. for instance, all cervical samples constitute the study base for indicator 3, while only samples showing atypical squamous cells of undetermined significance (ascus) in women older than 30 years constitute the study base for indicator 6. population data are obtained from the central population register, including all persons with a permanent address in denmark. cervical cytology samples are collected from the patobank covering all activities in danish pathology laboratories online. the central population register forms the basis for all contacts between the citizens and the authorities ; the danish cancer register is nowadays based on direct input from the national health registers ; and the patobank includes data on all specimens analyzed by danish pathologists. the total annual number of cervical cytology samples was 443,000 in 2009 ; 390,000 in 2010 ; 428,000 in 2011 ; 441,000 in 2012 ; 458,000 in 2013 ; and 417,000 in 2014. indicator 1 (number of cervical cytology samples per pathology laboratory) has the aim to monitor the centralization of cytology service in denmark (table 1). the danish national cervical cancer screening program is organized in an integrated fashion, where only women not already registered with a cytology sample in the patobank within the recommended screening interval are invited. therefore, indicator 2 (participation rate) covers only response to invitation, which means that it is calculated as the number of women who participate after having received invitation divided by the number of all invited women. indicator 3 (percentage of unsatisfactory samples) shows that this percentage has dropped from a previous level of 3.1% to a present level of 1.7%.1,6 this percentage has decreased with the introduction of liquid - based cytology, which is used throughout denmark from 2014. indicator 4 (diagnostic quality) represents an attempt to calculate sensitivity and specificity based on the already available data in the patobank. cytology samples from a given year are divided into normal and abnormal tests and compared with the outcome of follow - up samples within the next 3.5 years. normal cytology not followed by any high - grade cytology / histology or not followed by any test is defined as true negative. normal cytology followed by any high - grade cytology / histology is defined as false negative. abnormal cytology followed by any abnormal cytology not followed by any high - grade cytology / histology or not followed by any test is defined as false positive. these indicators are not comparable with sensitivity and specificity data from other sources, eg, from the scientific literature. they are included nevertheless to facilitate the detection of differences in performance across danish pathology laboratories and the development over time. the purpose of indicator 5 (percentage of samples answered in 10 days) is to monitor workflow in the laboratories. indicator 6 (percentage of ascus, women > 30 years with hpv - triage) is recommended by the danish national board of health in 2007, although at that time still optional as not all pathology laboratories were able to undertake hpv testing in 2007.9 it became mandatory in 2012, and indicator 6 monitors this implementation.10 indicator 7 (coverage) measures the target population s coverage by screening within the recommended time interval, which means that it is calculated as the number of women screened in the recommended time interval divided by the total number of women. the danish national board of health has published a flow diagram to be followed for non - normal samples. unsatisfactory samples for instance have to be followed by a new cytology sample within 3 months. high - grade lesions (high - grade squamous intraepithelial lesions [hsils ], adenocarcinoma in situ, atypical squamous cells can not exclude hsil, and atypical glandular cells) have to be followed with colposcopy and biopsies within 3 months. indicator 8 (percentage of non - normal and unsatisfactory samples not followed up as recommended) summarized the completion of follow - up across all non - normal samples. the percentage has dropped from a previous level of 20.6% to a present level of 15.9%.1,6 indicator 9 gives the number of incident cervical cancer cases reported to the danish cancer register. as the cancer register is normally 12 years behind the annual report, numbers from previous years are included in the annual reports. the national guidelines from 2012 audit should include rereading of all previously normal cytology and histology samples 3.5 years back for women aged 2349 years and 5.5 years back for women aged 5064 years. audit has been difficult to implement, among other things, because some discrepancies have been found between the danish cancer register and the patobank. this means, for instance, that the data in the 2014 annual report for indicator 8 were taken from the period october 1, 2012, to september 30, 2013, which allows for observation of follow - up activities within the recommended time intervals. follow - up is possible because all data are registered online in the patobank by personal identification number. it is thus possible to link samples from a given woman into a screening history. first, despite the inclusion of all opportunistically taken samples in the patobank, and the use of two reminders for women not responding to an invitation, denmark still has similar to other countries a screening coverage of only 75%.6 as in other countries, coverage is the main indicator of program success. among incident cases of cervical cancer in 20032007, 45% had not been screened at any time with the last two screening rounds.12 the database shows that use of reminders is an efficient tool in increasing participation and thus coverage. based on the reported data from 2014, it can be calculated that 40% of invited women responded to the invitation, 16% responded to the first reminder, and 8% responded to the second reminder.6 self - sampling of non - responders is now being pilot tested in the capital region, in order to increase the coverage further by expected 5%7% points. second, a screening program will fail if non - normal samples are not followed up adequately. but the reality turned out differently. in 20092012, almost 20% of non - normal samples had not been followed up within the recommended time intervals.14 timely follow - up of non - normal samples is a challenge for the screening program, one of the problems being that the responsibility rests with the sample taker, which is normally the general practitioner. various measures have been implemented in order to ensure timely follow - up, and since 2012 an automatic mail reminder is sent directly to the sample taker, if there is no follow - up according to the recommendation. nevertheless, in 2013 still 15.9% of non - normal samples were not followed up as recommended. when the time window for follow - up was extended to 450 days, 6.4% of samples were not followed up.6 when only severe cellular abnormalities (hsil, adenocarcinoma in situ, atypical squamous cells can not exclude hsil, and atypical glandular cell) were considered, 4.7% were not followed up as recommended within 90 days, and 2.8% of these samples were not followed up within 180 days. women aged > 30 years with ascus and negative hpv - triage are recommended to return to the screening program. the database shows that hpv - triage for these women is now with 96.4% almost completely implemented.6 this has saved many women from the repeated cytology testing after 6 months and again after 12 months, which was recommended before the use of hpv - triage. the danish quality database for cervical cancer screening is managed by a national steering committee consisting of pathologists from the local steering group in each of the five danish regions and representatives from the national societies for pathology, cytology, gynecology, and the patobank. the steering committee provides an annual web - based report and is responsible for optimizing and managing the database. the database receives support from the registry support centre of epidemiology and biostatistics (north) and registry support centre of clinical quality and health informatics (west). the database is available for research according to rules in the danish legislation for register - based research. the danish quality database for cervical screening is funded by the danish regions (accessed january 15, 2016). the database has been instrumental in indicating the weak spots in the danish national cervical cancer screening program : the relatively low coverage and the lack of adequate follow - up of non - normal samples. for both problems, various measures the ultimate check on these measures is the number of incident cervical cancer cases, which although close to the target of < 350 cases per year has remained fairly stable over the past 5 years with an incidence rate of 13.3 per 100,000 (standard : danish women 2005).6 | aim of databaseto monitor and improve the quality of the danish national cervical cancer screening program, an annual report is published, including nine quality indicators.study populationthe screening target group consisted of 1.5 million danish women aged 2364 years, but in the calculation of quality indicators, the dataset varies according to indicators being danish women, cervical cancer cases, or cytology samples.main variablesthe variables include the number of cytology samples per pathology laboratory, participation rate, percentage of unsatisfactory samples, diagnostic sensitivity and specificity, percentage of samples answered within 10 days, percentage of atypical squamous cells of undetermined significance samples in women aged > 30 years with human papillomavirus - triage, coverage, percentage of non - normal samples not followed up according to recommendations, number of incident cervical cancers, incidence of cervical cancer in the past 5 years, and upcoming percentage of incident cervical cancers undergoing audit.descriptive dataannual reports have been published since 2009. better fulfillment of quality standards has been seen for the size of pathology departments, percentage of unsatisfactory samples, percentage of atypical squamous cells of undetermined significance with human papillomavirus - triage, and a slight decrease in the percentage of non - normal samples not followed up within the recommended time intervals. stable patterns have been observed for participation rate, coverage, and number of incident cervical cancer cases. with a coverage of 75%, and with presently 16% of non - normal samples not followed up in a timely manner, there is definitely a scope for improvement in the screening program.conclusionthe database has pinpointed the strengths and weaknesses of the national cervical cancer screening program. measures to enhance participation rate / coverage and to improve follow - up of non - normal cytology samples are warranted. |
friction and resistance to sliding (rs) are topics that have been well studied within the orthodontic literature. kusy and whitley define rs as a combination of classical friction, binding or notching depending on the contact angle. in terms of this research terminology, classical friction is defined as the friction resulting from the active ligation method pressing the archwire against the bracket slot base. the contact angle is the angle between the archwire and the bracket slot during second - order rotations or tipping. the critical contact angle (c) is the angle at which the archwire makes initial contact with the opposite corners of the bracket slot wall, and it is at this angle that binding begins. binding represents friction resulting from the force couple within the bracket as the archwire engages the corners of the bracket slot wall. as c, the friction associated with this wire and bracket slot wall interaction begins to play a larger role in rs than classical friction. if the contact angle exceeds what kusy and whitley refer to as z, then notching occurs. notching, when present, dominates over classical friction with respect to rs. the only systematic review on the frictional resistance of passive versus conventional brackets concluded that passive ligated systems show lower friction with round wires, relatively aligned segments, and the absence of tipping or torqueing moments. it would seem intuitive that passive ligated systems would be beneficial in situations where minimal friction is desired such as during initial leveling and aligning. this is due to free movement of the wire inside the bracket being allowed, as the ligation method does not actively engage the two. likewise, higher friction is desired during anchorage or finishing and detailing, which may benefit from conventional ligated systems as a result of the ever - present archwire and bracket engagement. that is, the archwire will at the very least be engaged with the ligation elastics which will exert a vertical force on the archwire. a variety of in vivo studies have been conducted which suggest that the ligation method does not influence treatment outcome. this may be explained by the strengths of each system : passive ligated brackets may treat initial stages quicker while conventional ligated brackets may be more efficient in the latter stages resulting in similar overall treatment time. another proposed explanation is that small vibrations or perturbations temporarily reduce the rs, possibly allowing both systems to operate similarly. intra - orally, these perturbations may be of small magnitude resulting from talking or breathing, or of large magnitude from bruxism and mastication. in vivo studies regarding the impact of ligation method on clinical outcome are necessary to understand the reality of orthodontic appliances ; however, they do not allow for the strict control of many variables (e.g. perturbation magnitude or frequency, temperature, etc.). while acknowledging limitations in matching the clinical situation, in vitro experiments allow for strict control of experimental variables. thus, in fully understanding the causality of similarities in ligation methods, it is necessary to isolate the impact of single variables and use these results in conjunction with in vivo studies. research studies related to the role of perturbations in rs have only surfaced within the last 15 years, and none have compared active and passive ligation while varying the contact angle and subjecting the system to perturbations. the aim of this study is to investigate and quantify the effect of perturbations on rs while varying the bracket additionally, force measurements in all three dimensions will be quantified at the location of the for determination of rs values. both frequency and amplitude of vibration will be varied in order to understand whether one has a more significant effect on rs over the other. maxillary left canine (# 2.3) brackets were selected to simulate canine retraction during space closure. unitek victory twin series 0.022-in slot brackets (3 m unitek, monrovia, ca) were selected to represent conventional ligated brackets, and damon q (ormco, orange county, ca) 0.022-in slot brackets were selected to represent passive ligated brackets. bracket widths were 0.127 and 0.110 in for the 3 m and ormco series, respectively, as specified by the manufacturers. the c as defined by kusy and whitley for the conventional bracket was 1.81 and 2.08 for the passive ligated bracket. the wire used in all test conditions was a 0.018 0.025 stainless steel wire (ormco, orange county, ca). stainless steel wire was selected for this experiment as this is the material typically used for sliding mechanics due to the fact that it has the lowest coefficient of friction among the materials used in orthodontic wires. a medium effect size and power of 0.8 was selected for this study leading to a minimal sample size of 28 per test condition as per table c.4 provided by portney and watkins. we incorporated two additional tests per group in case of bracket failure (e.g. debond), for a final sample size of 30 per test group. there were a total of four test conditions and a control for both conventional ligated and passive ligated brackets resulting in a total sample size of 300. the damon q brackets used in this experiment had a preprogramed 7 of torque. in order for the bracket to sit perpendicular to the long axis of the dowel, a 7 offset was cut into the dowel, functionally transforming the torque to 0. conventionally ligated brackets did not have a torque prescription and thus did not require customized dowels. each bracket dowel unit was numbered and randomly assigned into one of the test groups. the bracket dowel combinations were each individually imaged in three planes using a charge coupled device (ccd) camera (bausch & lomb, rochester, ny) under magnification and analyzed using a custom image measuring program written in matlab (mathworks, natick, ma) to determine orientation in three dimensions. this program allows for identification of the offset from the center of the dowel in the x-, y-, and z - axes as well as any rotations around these axes identified by angles,, and (figure 1). using a transformation matrix, measurements are made at the load cell and translated to the location of the bracket. diagramatic view of the x-, y-, z - axes orientated to bracket as well as angles,, (note : the bracket depicted is not meant to represent a particular type or design, and is only provided to aid in placing the coordinate system). a custom three - dimensional (3d) frictional (figures 2 and 3) device was designed. the conical load cell adaptor connects the load cell with the test bracket dowel. both the bracket dowel sample and conical load cell adaptor have a flat edge which allows reproducible orientations on separate tests. the load cell (nano 17 si-50 - 0.5, ati industrial automation, apex, nc) is mounted to a programmable micro - adjusting rotating platform (precision rotation platform, pr01, thor labs, newton, nj) which when turning reproduces second - order movements in the x z plane. this particular load cell is capable of measuring forces up to 50 n in the x- and z - directions with a resolution of 1/80 n, and up to 70 n in the y - direction with the same resolution. when considering moments, it can measure up to 500 n mm in all three directions with a resolution of 1/16 n mm. there are also two manual translation stages (1/2-in translation stage, mt1, thor labs, newton, nj) that allow for micro - adjustments in the y- and z - axes to allow proper positioning of the wire into the bracket slot. that is, initially, the wire will not engage with the bracket slot. the wire is secured into a programmable linear micro - actuator (m230.10 dc - mike actuator, physik instrumente (pi) gmbh&co, karlsruhe, germany) which allows the operator the ability to pull the wire along the x - axis at a consistent and constant speed. the micro - actuator and rotating platform are operated by calibrated custom software so that programmed test conditions were exactly repeatable for each bracket. parameters of the experiment such as speed of pull, rate of sampling, averaging of samples, and amount of rotation are predetermined by the investigator and inputted into the software using a configuration file. each individual bracket dowel combination will have a unique configuration file with these parameters along with its specific offsets. load cell data were collected at a sampling rate of 4000 hz. data collection occurred over a total distance of 0.2 mm at each angle increment with the wire speed set at 0.05 mm / s. a custom perturbation device was designed (figure 4). the weighted disks designed to fit on the head of the rotating motor have off center weights that create imbalance and vibrations when spun. as the weight is moved farther away from the center of the disk the rotating motor is run by a function generator (gw instek gfg-8216 a, new taipei, taiwan) monitored by an oscilloscope (tektronix tds 2024b, beaverton, or) and a custom - built 5 v power supply. by adjusting the duty cycle on the generator and the amount and offset of weight in the disks, the device can create distinct combinations of frequency and amplitude of perturbations. the device is mounted directly to the test dowel so that perturbations are delivered at the source which simulates force on a tooth. perturbations generated by this device were felt at the location of the the x- and z - axes of the bracket, that is, in the mesial - distal and axial directions of the tooth with no labial - lingual component. as the bracket begins to tip and contact is established with the wire, forces are created along the x- and z - axes with little influence in the y - axis. as the critical contact angle is reached and exceeded, contact forces at opposite ends of the bracket produce an increasing couple in the y - direction of the bracket. force components related to rs are along the x- and z - axes, so that the resultant force representing the rs is resistance to sliding(rs)=(fx)2+(fz)2 for each individual randomized test, the bracket dowel complex was mounted to the load cell. the custom perturbation device was secured so that it was flush to the dowel surface and perpendicular to the bracket slot. the 0.018 0.025 stainless steel wire (ormco, orange, ca) was secured to the micro - actuator and using the translation stages the wire was positioned over the bracket slot. with the aid of a bausch & lomb microscope (bausch & lomb, rochester, ny) and the micro - adjustments on the rotating platform, the bracket slot was lined up parallel to the wire so that equal space existed above and below the wire. the wire was also set so that it was not contacting the bracket base prior to ligation. in the passive ligated system, the gate was closed. in the conventional ligated bracket, a standard elastomeric ligature (silver color power o modules, size 0.120, ormco, orange, ca) was used to secure the wire to the bracket. to ensure that elastomeric ligatures were stretched the same amount and that no distortions or twisting occurred when securing the bracket wings, a straight shooter ligature gun (tp orthodontics, la porte, in) was used. table 1 provides the description of the test conditions with respect to amplitude and frequency of perturbations. initial testing was done to determine the amount of force that the perturbations would deliver by measuring the forces and moments at the level of the bracket without a wire. because the perturbations were generated by a rotating disk, the force pattern was cyclical. averaging these values resulted in a net effective force of 0. instead, the root mean squared (rms) value was used to establish the force value of the perturbations. several combinations of rotating wheels and frequencies were tested and final test conditions were chosen based on similar force - rms values with different frequencies. because of the relatively slow (compared to the rate of data acquisition from the load cell) cyclical nature of the perturbation, the rate of sampling allows enough time that the force associated with the perturbations averages out to 0, leaving only the force associated with rs. the amplitude chosen for both low and high perturbation group consisted of force levels which are within the range (0.71.2 n) recommended for tooth translation. based on limitations of the equipment (primarily dynamic range of the load cell), it was not possible to replicate amplitudes associated with processes such as mastication ; however, this range is indicative of tooth movement, and would form the lower bound for which perturbations could be expected to influence rs. rms : root mean squared. although data - sets were collected and presented for seven different angulations (06), we chose to only report statistics at 0 and 6. these two angles represent angles that are well below and well above the critical contact angle. the data were first tested using repeated measures analysis of variance (anova) for main effects and interactions. for post hoc testing, angulation was fixed and bracket type and test condition were investigated with separate two - way anova. when comparing bracket type, = 0.05. because there were four planned comparisons between the test conditions and to prevent inflation of type i error rate, the bonferroni (multiple - comparison) correction was applied and was divided by 4 resulting in = 0.05/4 = 0.0125. the relation between rs and tip angle for the two ligation methods and various perturbation conditions are shown in figure 5 (conventional ligation) and figure 6 (passive ligation). graph of second - order movement versus resistance to sliding for conventional ligated (cl) brackets. lf : low frequency ; hf : high frequency ; lp : low perturbations ; hp : high perturbation. graph of second - order movement versus resistance to sliding for passive self - ligated (sl) brackets. lf : low frequency ; hf : high frequency ; lp : low perturbations ; hp : high perturbation. as mentioned above, statistical analysis was performed at two tip angles (above and below the critical angle for the onset of binding). table 2 presents mean rs for test groups, mean difference in rs for test groups compared to controls for conventional and passive ligated brackets at 0. at fixed angulation of 0, there was a statistically significant reduction in rs (p c, perturbations of high amplitude independent of frequency produced a reduction in rs where low amplitude perturbations did not. although high amplitude perturbations have the largest effect on rs for both conventional and passive ligated brackets at both tested angulations, there was a larger net reduction in passive ligated brackets at 6. the data for this experiment suggest that amplitude of perturbations may have a more significant role in reducing rs than frequency, and that higher perturbations are more effective than lower levels of perturbation. an inherent limitation to this study based on experimental equipment was the inability to maintain the same low and high frequency of vibration for both levels of perturbation ; however, while this is indeed a limitation, it also helps to support the notion that amplitude of vibration plays a larger role than frequency. the high and low frequencies of the low and high perturbations, if there is no significant difference from the mean at one scenario but there is at another, it can reasonably be suggested that perturbation was the cause. for example, when studying rs values for passive ligation at 6 of rotation in table 3, it can be seen that the low perturbation high frequency case was not statistically different from the mean ; however, the high perturbation low frequency scenario was statistically different. the fact that the frequency did not remain consistent for the levels of perturbation tested is a limitation that should be remedied in future work, yet when viewing the results in this light it aids in further supporting conclusions. this particular result provides a better understanding of the similarities between passive and active ligation in the clinical scenario. while the tested force range of perturbation is significant enough to generate movement in the system, forces well over 100 n may be obtained which would produce more tooth movement than in this study. based on the trend observed here, it can be suggested that with additional amplitude of perturbation the rs would continue to decrease regardless of the frequency. in such a case, especially for low contact angles, it is certainly possible that typical daily activities could cause a reduction in rs to negligible values allowing for archwire movement. it is not suggested that vibration is the sole cause of similarities between the types of ligation tested here ; however, it can be seen as a significant contributing factor. the wire was pulled at a rate of 0.05 mm / s, which is significantly faster than what is seen clinically (1 mm / month = 3.8 10 mm / s). therefore, it is important to consider the time scale carefully when designing the experiment. perturbations must be delivered at a higher frequency to compensate for the faster rate of wire pull in order to keep ratios of perturbations per mm movement consistent. perhaps a more meaningful way of describing the rate of perturbations is to measure the number of perturbations per millimeter of wire movement, rather than the number of perturbations per second. by measuring the rate of perturbations in this manner, the speed at which the wire was pulled would no longer be a factor. experiments would have to be conducted to determine the speed of tooth movement as well as the rate of perturbation events intra - orally to determine this relationship. caution must always be exercised when conferring results from in vitro studies to an in vivo model. the oral environment is extremely complex, and although our experiment is able to account and measure several factors previously not quantified (e.g. forces and moments in all three directions), it still represents a simplified model. because of the variability of frequency and amplitude of bite force in individuals, a limitation of this study was the determination of the test groups for perturbations used in this study. the biology and physiology of teeth and bone are also factors which are difficult to control. teeth and bone are not as rigid as metal dowels, and the effect of periodontal ligament space is difficult to reproduce accurately in the lab setting. 3 m victory twin type (3 m, monvrovia, ca) bracket was used to represent a typical conventional ligated bracket and damon q (ormco, orange, ca) bracket was used to represent a typical passive ligated bracket. although clinically, this represents a good representation of a conventional versus passive bracket, it does introduce variables such as bracket design which have to be considered. because brackets were not retested in this experimental design, individual bracket differences due to manufacturer tolerances may introduce some variability in the data. rs is higher in conventional ligated when compared to passive ligated brackets in the presence and absence of perturbations. greater reductions in rs are seen using higher amplitude perturbations in both conventional and passive ligated systems suggesting that amplitude may play a larger role in reducing rs than frequency. while the range of frequencies and amplitudes tested did not reduce the rs entirely to zero for all contact angles, it can be suggested that this would certainly be achievable at lower angles for both methods of ligation. this in vitro study aids in understanding the causality for conventional and passive ligation methods leading to similar clinical outcomes. | orthodontic literature has shown all ligation methods to behave similarly in the clinical situation ; however, the reasoning behind this still requires further investigation. a novel frictional device able to measure forces at the level of the with a custom perturbation device was used to investigate the effect of perturbations on resistance to sliding (rs) using conventional and passive ligated brackets. 150 3 m victory series twins (0.022 slot) and 150 damon q brackets (0.022 slot) were tested using an 0.018 x 0.025 stainless steel wire for rs. there were 5 test groups consisting of equal numbers (n=30) representing combinations of high and low amplitude and frequency of perturbations along with a control. second order angulation tested ranged from 0 to 6 degrees. results for conventional brackets in the presence of perturbations at 0 degrees showed there was a statistically significant reduction (p<0.001) in rs when compared to controls. at 6 degrees, this difference (p<0.001) was seen in both high perturbation groups and one of the low perturbation groups. for passive ligated brackets, no statistically significant difference between groups was seen at 0 degrees. however, at 6 degrees high perturbation groups both resulted in statistically significant (p<0.001) reductions in rs when compared to controls. from this study it was concluded that passive ligated brackets have a lower rs when compared to conventional ligated brackets under all test conditions and angulations. also, amplitude of perturbations has a larger role than frequency in reduction of rs values. |
with the rise in the prevalence of obesity, the field of bariatric surgery is witnessing an ever increasing demand. along with that, comes the challenge of operating on patients with high body mass index (bmi), revisional bariatric procedures (rbp), managing complications and reoperative abdomens. performing bariatric surgery can be technically demanding in many situations because of large patients, large livers, thick abdominal walls and substantial visceral fat making exposure, dissection, and reconstruction difficult. the super obese (so) patients with a bmi 50 kg / m is a difficult to manage population because of limited working space, excessive torque on instruments due to thick abdominal wall, co - morbidities and high - risk anaesthesia. the management of patients with super - super obesity (bmi > 60 kg / m) also remains a challenge. moreover, the surgeons encounter very difficult ergonomic positions, which can potentially be career shortening for them. the surgeons have been looking for methods to improve the patient outcomes, surgical technique and decrease complications on one hand, and reducing the number and size of incisions on the other hand. robotic surgery has provided the surgeons with the advantage of three - dimensional vision, increased dexterity and precision by downscaling surgeon 's movements enabling a fine tissue dissection and filtering out physiological tremor. it overcomes the restraint of torque on ports from thick abdominal wall, and minimises port site trauma by remote centre technology. the main limitation with robotic surgery is the perceived higher cost and set - up time compared with laparoscopy. but with increased experience, it is seen that set - up times reduce, and costs may also come down as material prices reduce. the mainstream bariatric procedures are adjustable gastric banding (agb), sleeve gastrectomy (sg), roux - en - y gastric bypass (rygb) and biliopancreatic diversion with duodenal switch. using pubmed, we reviewed the published evidence of using robotics for these procedures as well as performing rbp. the search terms included bariatric surgery, robotic bariatric surgery, robotic gastric banding, robotic sg, robotic roux - en - y gastric bypass (rrygb), robotic biliopancreatic diversion and robotic revisional bariatric surgery. the inclusion criteria were english language, original research, bariatric surgical procedures using robotics and human studies. the use of agb has decreased tremendously all over the world because of low efficacy and high revision / complication rate associated with it. there have been few studies published in the literature looking at outcomes of robotic assistance in agb, and showed little benefit for using the robot. edelson. reported the largest study with 287 patients of robotic agb compared with 120 patients who underwent laparoscopic agb. no significant differences were found in the operating room (or) times, hospital stay, complication rates, or excess weight loss. they did find a shorter operative time by 12 min in the robotic arm when compared for so patients. as of now, robot is used mostly for managing complications and revising gastric band to another weight loss procedure, and this is dealt with in the section on rbp. sleeve gastrectomy is increasingly becoming popular because of its low morbidity, excellent outcome and perceived technical simplicity. it is especially so in indian sub - continent because of high prevalence of a vegetarian population, who tend to choose a restrictive procedure rather than a malabsorptive one. there are certain peculiarities in sg like it has a long staple line with the potential to leak, and a precise and safe dissection is required in the area of the left crus and hiatus entirely to mobilize the fundus. compared to laparoscopic surgery, robotic surgery offers the possibility for endowrist, and this action facilitates the hiatal dissection and over sewing of the staple line. five studies have been published, which focus on robotic sleeve gastrectomy (rsg). compared 30 robotic with 39 laparoscopic sg procedures and found no difference in length of hospital stay, complication rates or excess body weight loss at 1-year. they found a significantly longer or time for rsg (135 vs. 114 min), due to the fact that they had oversewn the staple line in the robotic arm and not in the laparoscopic arm. he also published a large comparative series on sg including 100 patients each in robotic and laparoscopic arms. they found that or time was significantly longer in a robotic group by 12 min. they did found that leaks occurred only in those patients in whom they did not oversew the staple line, but used a buttress material. they concluded that rsg is a good stepping stone to robotic gastric bypass and rbp. published their experience of 134 rsg cases and compared it with descriptive results of a systematic review of laparoscopic sg (n = 3148). the or time was significantly higher by 12 min (p = 0.006), whereas the length of stay was lower by 1.1 days in a robotic group (p 0.005). leaks were found in 0 rsg versus 1.97% laparoscopic sg (p = 0.101) ; strictures in 0 versus 0.43% (p = 0.447) ; bleeding in 0.7 versus 1.21% (p = 0.594) ; and mortality in 0 versus 0.1% (p = 0.714), respectively. we performed a comparative study of rsg in morbidly obese (mo) versus so patients at our centre. 11 so patients were compared with 24 mo patients who underwent robotic sg with oversewing of the staple line in all the cases. there was no significant difference in or time, length of hospital stay or complications in between the two groups. thus, presumably, using a robotic system overcomes many difficulties in the so patients and enables the surgeon perform the similar procedure as in mo patients with equal precision, similar time and little or no extra effort. roux - en - y gastric bypass is considered as the gold standard surgical procedure for morbid obesity by many specialists. as rygb involves two anastomoses (gastrojejunostomy [gj ] and jejunojejunostomy), robotic surgery is currently considered as an attractive technology that could help perform rygb, given its well - described advantages. there have been nine significant published series comparing outcomes of rrygb versus laparoscopic rygb (lrygb). these studies represent the entire literature on rrygb and its outcomes. for each study, we report the number of patients, mean age, mean preoperative bmi, mean or time, type of gj (sutured or stapled), length of hospital stay, overall complication rate, leak rate, gj stricture rate and mortality. these results are compiled in tables 1 and 2. robotic vs. laparoscopic rygb : preoperative data robotic vs. laparoscopic rygb : peri - operative data there was a total of 3337 patients in these 9 studies with 1381 in a robotic arm and 1956 in the laparoscopic arm. the mean age in rrygb and lrygb group was 43.3 years and 42.4 years, respectively. average bmi was 45.8 in rrygb patients and 46.7 in lrygb patients. the mean or time was 211.9 min in robotic arm versus 185.1 min in the laparoscopic arm. three studies report a significantly shorter operative time in a robotic group, while four studies report a significantly longer operative time in a robotic arm. this may be compounded by the fact that in all the studies, a sutured gj was done in the robotic arm, while a stapled gj was done in the laparoscopic arm in six out of nine studies. the average length of stay was 5 days in robotic group versus 7.1 days in the laparoscopic group. three studies found a statistically significant shorter hospital stay in the robotic arm, while one study found a significantly longer stay in the robotic arm. found a significantly lower incidence of complication in a robotic group (11.6% vs. 16.1%). the average leak rate across studies was 0.9% in rrygb versus 1.6% in lrygb, while the gj stricture rate was 3.1% in a robotic arm and 3.2% in the laparoscopic arm. of all the published studies, there is only one prospectively randomized trial by sanchez. the other studies are either comparative studies, case series, retrospective or prospective analyses. there is a surgeon skill bias at play in the majority of these studies as it is very difficult to find a surgeon equally skilled in both robotic and laparoscopic techniques. most of the surgeons and their teams become proficient in either of the two techniques. but learning curve for lrygb has been reported to be 75 - 100 cases in order to normalize complications. analysed the learning curve for rrygb and found it to be 14 cases in order to achieve mastery for a surgeon well versed in laparoscopic surgery but not in bariatric procedures. studied complications in first 100 cases of rrygb, and found no leaks and one reoperation. the published literature seems to suggest that the learning curve for robot assisted rygb is shorter than laparoscopic technique. reported the outcomes, learning curve and technique of robotic biliopancreatic diversion with duodenal switch (rbpdds). they published experience of 47 patients who underwent this procedure with a mean bmi of 45 kg / m and the mean age of 38 years. the median or time was 514 min, which decreased to 379 min in last 10 patients. the learning for rbpdds was found to be around 50 cases after which the complications and or time normalised. revisional bariatric procedures are difficult and complex situations in which use of robotics hold a great potential. with increasing numbers of bariatric procedures, more and more patients require revisional procedures for inadequate weight loss or complications arising out of previous surgery. the anatomy in these situations is distorted which along with adhesions present a challenge to the surgeons. complication rates of laparoscopy in these situations have been high with leak rates of 13.2% and mortality of 2%. there is a couple of studies available on rbp that show better outcomes with robot assistance in these challenging cases. however, there was no leak, haemorrhage or mortality in the series, which is promising considering the high incidence of these complications in these situations. compared the outcomes of rbp performed by robotic (n = 11), laparoscopic (n = 21) and open (n = 28) method. they found that the robotic arm had fewer complications (0 vs. 14.3% for laparoscopy, vs. 10.7% for open), but took longer to perform (352 vs. 270 vs. 250 min, respectively). there were fewer conversions in robotic group (0 vs. 14.3% for laparoscopy) and a significantly shorter hospital stay (6 vs. 8 vs. 9 days, respectively). the use of agb has decreased tremendously all over the world because of low efficacy and high revision / complication rate associated with it. there have been few studies published in the literature looking at outcomes of robotic assistance in agb, and showed little benefit for using the robot. edelson. reported the largest study with 287 patients of robotic agb compared with 120 patients who underwent laparoscopic agb. no significant differences were found in the operating room (or) times, hospital stay, complication rates, or excess weight loss. they did find a shorter operative time by 12 min in the robotic arm when compared for so patients. as of now, robot is used mostly for managing complications and revising gastric band to another weight loss procedure, and this is dealt with in the section on rbp. sleeve gastrectomy is increasingly becoming popular because of its low morbidity, excellent outcome and perceived technical simplicity. it is especially so in indian sub - continent because of high prevalence of a vegetarian population, who tend to choose a restrictive procedure rather than a malabsorptive one. there are certain peculiarities in sg like it has a long staple line with the potential to leak, and a precise and safe dissection is required in the area of the left crus and hiatus entirely to mobilize the fundus. compared to laparoscopic surgery, robotic surgery offers the possibility for endowrist, and this action facilitates the hiatal dissection and over sewing of the staple line. five studies have been published, which focus on robotic sleeve gastrectomy (rsg). compared 30 robotic with 39 laparoscopic sg procedures and found no difference in length of hospital stay, complication rates or excess body weight loss at 1-year. they found a significantly longer or time for rsg (135 vs. 114 min), due to the fact that they had oversewn the staple line in the robotic arm and not in the laparoscopic arm. he also published a large comparative series on sg including 100 patients each in robotic and laparoscopic arms. they found that or time was significantly longer in a robotic group by 12 min. they did found that leaks occurred only in those patients in whom they did not oversew the staple line, but used a buttress material. they concluded that rsg is a good stepping stone to robotic gastric bypass and rbp. published their experience of 134 rsg cases and compared it with descriptive results of a systematic review of laparoscopic sg (n = 3148). the or time was significantly higher by 12 min (p = 0.006), whereas the length of stay was lower by 1.1 days in a robotic group (p 0.005). leaks were found in 0 rsg versus 1.97% laparoscopic sg (p = 0.101) ; strictures in 0 versus 0.43% (p = 0.447) ; bleeding in 0.7 versus 1.21% (p = 0.594) ; and mortality in 0 versus 0.1% (p = 0.714), respectively. we performed a comparative study of rsg in morbidly obese (mo) versus so patients at our centre. 11 so patients were compared with 24 mo patients who underwent robotic sg with oversewing of the staple line in all the cases. there was no significant difference in or time, length of hospital stay or complications in between the two groups. thus, presumably, using a robotic system overcomes many difficulties in the so patients and enables the surgeon perform the similar procedure as in mo patients with equal precision, similar time and little or no extra effort. roux - en - y gastric bypass is considered as the gold standard surgical procedure for morbid obesity by many specialists. as rygb involves two anastomoses (gastrojejunostomy [gj ] and jejunojejunostomy), robotic surgery is currently considered as an attractive technology that could help perform rygb, given its well - described advantages. there have been nine significant published series comparing outcomes of rrygb versus laparoscopic rygb (lrygb)., we report the number of patients, mean age, mean preoperative bmi, mean or time, type of gj (sutured or stapled), length of hospital stay, overall complication rate, leak rate, gj stricture rate and mortality. these results are compiled in tables 1 and 2. robotic vs. laparoscopic rygb : preoperative data robotic vs. laparoscopic rygb : peri - operative data there was a total of 3337 patients in these 9 studies with 1381 in a robotic arm and 1956 in the laparoscopic arm. the mean age in rrygb and lrygb group was 43.3 years and 42.4 years, respectively. the mean or time was 211.9 min in robotic arm versus 185.1 min in the laparoscopic arm. three studies report a significantly shorter operative time in a robotic group, while four studies report a significantly longer operative time in a robotic arm. this may be compounded by the fact that in all the studies, a sutured gj was done in the robotic arm, while a stapled gj was done in the laparoscopic arm in six out of nine studies. the average length of stay was 5 days in robotic group versus 7.1 days in the laparoscopic group. three studies found a statistically significant shorter hospital stay in the robotic arm, while one study found a significantly longer stay in the robotic arm. found a significantly lower incidence of complication in a robotic group (11.6% vs. 16.1%). the average leak rate across studies was 0.9% in rrygb versus 1.6% in lrygb, while the gj stricture rate was 3.1% in a robotic arm and 3.2% in the laparoscopic arm. of all the published studies, there is only one prospectively randomized trial by sanchez. the other studies are either comparative studies, case series, retrospective or prospective analyses. there is a surgeon skill bias at play in the majority of these studies as it is very difficult to find a surgeon equally skilled in both robotic and laparoscopic techniques. most of the surgeons and their teams become proficient in either of the two techniques. but large comparative studies and systematic reviews do offer some tendencies for robotic bariatric surgery. learning curve for lrygb has been reported to be 75 - 100 cases in order to normalize complications. buchs. analysed the learning curve for rrygb and found it to be 14 cases in order to achieve mastery for a surgeon well versed in laparoscopic surgery but not in bariatric procedures. yu. studied complications in first 100 cases of rrygb, and found no leaks and one reoperation. the published literature seems to suggest that the learning curve for robot assisted rygb is shorter than laparoscopic technique. sudan. reported the outcomes, learning curve and technique of robotic biliopancreatic diversion with duodenal switch (rbpdds). they published experience of 47 patients who underwent this procedure with a mean bmi of 45 kg / m and the mean age of 38 years. the median or time was 514 min, which decreased to 379 min in last 10 patients. the learning for rbpdds was found to be around 50 cases after which the complications and or time normalised. revisional bariatric procedures are difficult and complex situations in which use of robotics hold a great potential. with increasing numbers of bariatric procedures, more and more patients require revisional procedures for inadequate weight loss or complications arising out of previous surgery. the anatomy in these situations is distorted which along with adhesions present a challenge to the surgeons. complication rates of laparoscopy in these situations have been high with leak rates of 13.2% and mortality of 2%. there is a couple of studies available on rbp that show better outcomes with robot assistance in these challenging cases. the overall complication rate was 17% with a 90 days readmission rate of 24%. however, there was no leak, haemorrhage or mortality in the series, which is promising considering the high incidence of these complications in these situations. compared the outcomes of rbp performed by robotic (n = 11), laparoscopic (n = 21) and open (n = 28) method. they found that the robotic arm had fewer complications (0 vs. 14.3% for laparoscopy, vs. 10.7% for open), but took longer to perform (352 vs. 270 vs. 250 min, respectively). there were fewer conversions in robotic group (0 vs. 14.3% for laparoscopy) and a significantly shorter hospital stay (6 vs. 8 vs. 9 days, respectively). this review of published literature reveals that the routine use of robotics in bariatric surgery is a safe and feasible option. several studies have shown a lower complication rate with the robotic platform including leaks, haemorrhage and stricture. the advantage of robotics is perceived much more in challenging situations like rbp. however, in order to graduate to these advanced procedures, one has to move a step by step, starting with rsg and moving on to rrygb and rbp. the learning curve of rrygb has also been shown to be shorter as compared to lrygb. the entire team learns with the surgeon and develops experience about patient safety precautions, or set - up, and type of instruments needed, thus leading to better or times with better patient outcomes. robotic surgery is a team effort, and more so in bariatric surgery, where the role of an experienced bedside surgeon can not be understated, as he is responsible for stapling (if robotic staplers are not used). as the main surgeon is separated from the patient, while performing robotic surgery, the assistant surgeon has to be trained enough to help him perform difficult tasks and also to take care of any emergency situation arising during the procedure. the role of a trained scrub nurse and or technician is also very important in streamlining the conduct of the procedure and prevent any wastage of time and resources. another advantage, which comes with the use of the robotic system, is improved ergonomics and lesser operator fatigue. ergonomics in laparoscopic surgery can be very challenging with big patients and uncomfortable postures, which lead to surgeon fatigue and work related musculoskeletal symptoms. robotics provides the advantage of more degrees of freedom, which is advantageous in performing difficult dissection and sutured anastomosis. there has been a concern about cost every time use of the robotic system is considered as the direct costs are generally higher for the robotic approach in bariatric procedures like rygb. however, hagen. took into consideration the total costs including the complications and readmissions. they found that the cost of rrygb was lower as compared to lrygb when all the factors were counted for. there is also a saving due to decrease in number of laparoscopic staplers used in robotic procedures, by doing a handsewn anastomosis. at the end of the day, the big question to be answered is whether the use of robotics is going to stay or will it perish with time like many fancy technologies. looking at the basic concept of computer - assisted navigational surgery, robotics provides an enabling platform in between surgeon and the patient. it provides augmented and higher quality inputs from the patient to the surgeon, and his output is refined to a superior quality before reaching back to the target. according to us, this should not be analysed in terms of features of the present machine that is available for use, but in terms of the potential in the concept of using a digital interface to interact with patients and enhance the performance of the surgeon. with the advent of newer technologies in robotics like fluorescence, integration of images, virtual and augmented reality, telesurgery, single site platforms, natural orifice surgery and haptic feedback, we believe that it will provide an empowering tool to the surgeons, which can potentially change the way surgery is practiced today. | with the rise in a number of bariatric procedures, surgeons are facing more complex and technically demanding surgical situations. robotic digital platforms potentially provide a solution to better address these challenges. this review examines the published literature on the outcomes and complications of bariatric surgery using a robotic platform. use of robotics to perform adjustable gastric banding, sleeve gastrectomy, roux - en - y gastric bypass (rygb), biliopancreatic diversion with duodenal switch and revisional bariatric procedures (rbp) is assessed. a search on pubmed was performed for the most relevant articles in robotic bariatric surgery. a total of 23 articles was selected and reviewed in this article. the review showed that the use of robotics led to similar or lower complication rate in bariatric surgery when compared with laparoscopy. two studies found a significantly lower leak rate for robotic gastric bypass when compared to laparoscopic method. the learning curve for rygb seems to be shorter for robotic technique. three studies revealed a significantly shorter operative time, while four studies found a longer operative time for robotic technique of gastric bypass. as for the outcomes of rbp, one study found a lower complication rate in robotic arm versus laparoscopic and open arms. most authors stated that the use of robotics provides superior visualisation, more degrees of freedom and better ergonomics. the application of robotics in bariatric surgery seems to be a safe and feasible option. use of robotics may provide specific advantages in some situations, and overcome limitations of laparoscopic surgery. large and well - designed randomised clinical trials with long follow - up are needed to further define the role of digital platforms in bariatric surgery. |
ectopic molar pregnancy is a rare occurrence and consequently not often considered as a diagnostic possibility. in this article, an attempt was made to stress on the need for histopathological examination and follow up of every case of ectopic pregnancy. a 30-year - old gravida 4, para 3, pregnant woman with a 7-week history of amenorrhea attended hospital with abdominal pain. per vaginal examination revealed a tender left adnexal mass measuring 4x4 cm and on ultrasonography there was a live fetus corresponding to a 7-week and 6 days gestation with free fluid in the pelvic cavity. laparotomy, revealed a ruptured left tubal ectopic pregnancy and histopathological examination was suggestive of a molar pregnancy. clinical diagnosis of a molar pregnancy is difficult but histopathology is the gold standard for diagnosis. the incidence of partial or complete hydatidiform mole is approximately 1 in 500 to 1 in 1000 pregnancies (1). its malignant potential is similar to that of an intrauterine molar pregnancy (2). molar changes could be either partial or complete and the treatment is surgical combined with chemotherapy. follow - up is usually done by serial serum human chorionic gonadotropin (-hcg) titrations. although ultrasonography is useful in the diagnosis of uterine molar pregnancies, there is a chance of missing this diagnosis in cases of an ectopic molar pregnancy. a 30-year - old female patient, gravida 4, para 3, was admitted to north eastern indira gandhi regional institute of health and medical sciences (neigrihms), shillong, india with a 7-week history of amenorrhea followed by an episode of mild bleeding per vaginum. she also had abdominal pain 1 week prior to the presentation. on examination, her vital signs were stable with no pallor or edema. per abdominal examination revealed tenderness over the left iliac fossa, without any guarding or rigidity. per vaginal examination showed a normal - sized uterus and a tender left adnexal mass measuring 4x4 cm. her hemoglobin concentration was 8.6% gr / dl and the urine pregnancy test was positive. trans - abdominal ultrasonography confirmed the finding of a left tubo - ovarian mass denoting a live fetus corresponding to 7 weeks and 6 days of gestation with free fluid in the pelvic cavity. however, such hemodynamically stable patients could have been managed by laparoscopy in the presence of the required facility and expertise. during the operation, hemoperitonium was found with a normal uterus, an intact right - sided fallopian tube and a ruptured left tubal ectopic pregnancy. gross examination showed grey brown tissue, measuring 6x4x2 cm with moles ranging in size from 1 to 3 mm and a fetus corresponding to 6 to 7 weeks of gestation (figure 1). ruptured tube showing fetus and placental tissue with molar changes on histological examination, there were chorionic villi showing circumferential trophoblastic proliferation, hydropic changes and karyorrhexis. based on these findings, the possibility of a molar pregnancy was thought and serum -hcg level determination was asked. postoperatively, on the day of surgery, serum -hcg was 5308 miu / ml. her post - operative period was otherwise unevenful, but she was followed up by weekly serum -hcg measurements. the tests showed a decreasing trend and turned negative at the end of the 6th week. barrier contraception was advised for at least 1 year during which she was also on regular follow - ups. clinically, tubal molar pregnancy mimics normal tubal ectopic pregnancy and, therefore, makes the diagnosis difficult (3). however, provisional diagnosis is made during surgery and histopathological examination can determine the final diagnosis. conservative fertility - sparing management was found successful in a reported case of cervical molar pregnancy (5). rupture of the horn does not usually take place until the twelfth week of gestation but, when it does, there is nearly always severe bleeding which makes the condition extremely dangerous. reported cases of molar changes in ovarian pregnancy are also found in the literature (8). molar ectopic pregnancy becomes even more difficult to diagnose when it occurs in heterotopic pregnancies, where the patient may present with shock, weeks after evacuation of the intrauterine pregnancy (9). although extremely rare, an extra - uterine molar pregnancy should form part of the differential diagnoses in cases of intra - uterine pregnancy complicated by the presence of a pelvic mass, vascularity and high levels of serum -hcg (10). monitoring -hcg titers following conservative management of suspected ectopic pregnancies is important, not only to diagnose persistent ectopic gestation, but also to rule out the presence of malignant trophoblastic diseases (11). the current trend in the treatment of ectopic pregnancies is through conservative surgery and monitoring of -hcg titers to avoid missing a choriocarcinoma developing in an ectopic gestation, even though this is a very rare condition (12). mediastinal metastasis of choriocarcinomas following ectopic pregnancies cause dyspnoea, pleural effusion and thoracic pain (13). one extensive study on routine pre - evacuation ultrasound diagnosis of hydatidiform mole suggests that ultrasonography identifies less than 50% of hydatidiform moles. detection rates are, however, higher for complete compared to partial moles, and improve even further after the 14 week of gestation (14). histopathological examination of conception products remains the current gold standard for the diagnosis of gestational trophoblastic neoplasia. there is also a possibility of over - diagnosis by histological examination, especially in early ectopic tubal pregnancies, due to a more florid extra - villous trophoblastic proliferation compared with evacuated uterine products of conception (1). extra caution should be taken to strictly apply the morphological criteria of circumferential trophoblastic proliferation, hydropic changes, scalloped villi and stromal karyorrhexis for diagnosis (15). ectopic molar pregnancy is a rare condition, which can occur at any place in the pelvic cavity. invasive. however, ultrasonography might not be able to fully diagnose ectopic molar pregnancies, leaving histopathological examination of the conception products the current gold standard for the diagnosis. | introductionectopic molar pregnancy is a rare occurrence and consequently not often considered as a diagnostic possibility. in this article, an attempt was made to stress on the need for histopathological examination and follow up of every case of ectopic pregnancy. this was substantiated with the help of a case report.case presentationa 30-year - old gravida 4, para 3, pregnant woman with a 7-week history of amenorrhea attended hospital with abdominal pain. per vaginal examination revealed a tender left adnexal mass measuring 4x4 cm and on ultrasonography there was a live fetus corresponding to a 7-week and 6 days gestation with free fluid in the pelvic cavity. laparotomy, revealed a ruptured left tubal ectopic pregnancy and histopathological examination was suggestive of a molar pregnancy.conclusionalthough rare, molar changes can occur at any site of an ectopic pregnancy. clinical diagnosis of a molar pregnancy is difficult but histopathology is the gold standard for diagnosis. |
bd is a multisystemic disease that may affect any organ in different combinations ? characterized by recurrent oral aphthous ulcers, genital ulcers, uveitis, and skin lesions. involvement of the heart is called cardio - bd, which includes pericarditis, myocarditis, endocarditis, endomyocardial fibrosis, atrial fibrillation, ventricular arrhythmias, coronary arteritis, acute myocardial infarction, and dilated cardiomyopathy (1). we report a rare case of this syndrome, associated with aneurysm of the non - coronary sinuses of valsalva, resulting in symptomatic aortic valve regurgitation. a 38-year - old man was referred for investigation of a 5-day history of paroxysmal nocturnal dyspnea in may 2008. he had a three - year history of recurrent genital ulceration initially diagnosed as genital herpes, but never confirmed on culture or nucleic acid amplification testing ; sequential treatment with aciclovir over a four - month period did not alleviate his genital symptoms. and he had no history of cardiac or respiratory disease, nor any cardiac risk factors. clinical examination revealed aphthous stomatitis, genital ulceration, erythema nodosum bilaterally and a grade 3/6 systolic murmur, audible at the 2nd intercostal space on the left sternal border. hematologic examination showed that high sensitive c - reactive protein (hs - crp) was 105 mgl and erythrocyte sedimentation rate (esr) is 70 mmhr. anti nuclear antibody (ana), anti double strand dna antibody (anti ds dna) and muscle biopsy specimens for connective tissue disease were negative. chest x - ray revealed cardiomegaly with a cardiothoracic ratio of 55% and a slightly widened mediastinum. 1). the left ventricular (lv) end - diastolic was 58 mm, and the lv ejection fraction was 53%. based on these findings, the diagnosis of aneurysm of the sinus of valsalva associated with bd was made. because the patient 's condition was in the active phase, prednisolone was administered over one month until the inflammatory signs (hscrp and esr) became negative. considered that our patient presented a competent valve and only one sinus involved, surgeon repaired the affected sinus only. he was discharged without any complications on postoperative day 15, and was doing well at five - year follow - up after the operation. showing non - coronary - sinus of valsalva aneurysm aneurysms of the sinus of valsalva 's etiologies include atherosclerosis, infection such as syphilis, congenital disease such as marfan 's syndrome, trauma, and autoimmune disease such as bd. bd is a chronic, relapsing multisystem vasculitis with predominant involvement of the oral and genital mucosa (1, 2). bd has a worldwide distribution but is prevalent in japan, the middle east, and some mediterranean countries, and it often affects younger adults and is more common in men than women. james. demonstrated that valsalva sinus aneurysm was the leading causes of death in patients with bd (3). in our patient, echocardiography revealed aneurysm formation of the sinus of valsalva, and should bd is the etiology ? the patient had a history of recurrent genital ulceration, on admission, clinical examination revealed aphthous stomatitis, genital ulceration, and erythema nodosum bilaterally, which could provide clues to differentiate diagnosis. if neglected these symptoms, it maybe at a loss of initial diagnosis of genital herpes. in addition to recurrent genital ulceration, aphthous ulcers and skin lesion, a clinical diagnosis of bd should be made, because other examination showed that high crp and esr, and ana, anti dsdna and muscle biopsy specimens for connective tissue disease were negative. aneurysms of the sinus of valsalva may incur complications if untreated, such as right ventricular outflow tract obstruction, coronary artery occlusion, aortic regurgitation and congestive heart failure, so surgical treatment should be considered (4, 5). but to aim directly at etiology is the most of all, and continuous steroid and immunosuppressive agent therapy are most important to maintain the integrity to prohibit recurrence of bd. our patient was doing well at five - year follow - up after the operation. it also highlights the importance of recognizing systemic disease and maintaining a holistic approach when treating patients. | abstracta 38-year - old man with a history of recurrent genital ulceration initially diagnosed as genital herpes was admitted after presenting with paroxysmal nocturnal dyspnea. echocardiography revealed aneurysm formation of the sinus of valsalva. on diagnosis of an aneurysm of the sinus of valsalva associated with behet 's disease (bd), surgeon repaired the affected sinus only, and continuous steroid therapy maintained the integrity. |
dendrimers provide an alternative and potent means for drug delivery due to their nanometer size and the ability to incorporate various functionalities on their interior and exterior. modern chemical synthesis capabilities allow various functionalities to be incorporated on the dendrimer exterior in order to optimize performance in terms of drug binding, transport, targeting, delivery, and biocompatibility [13 ]. polyamidoamine (pamam) dendrimers, for example, have been tailored for enhanced drug solubility, retention time, targeting, and efficacy [13 ]. in addition to optimizing delivery, another issue is the reduction or elimination of cytotoxicity, which has been addressed by masking the terminal functional groups and charge. this can be accomplished by adding biologically compatible terminal groups such as carboxylate, hydroxyl, acetamide, lipid, or polyethylene glycol (peg). among these, peg is the most widely used due to its minimal or nontoxicity, nonimmunogenicity, and nonantigenicity and has been approved by the fda in oral intravenous and pulmonary pharmaceutical formulations [58 ]. it is known that peg chains adopt a variety of conformations, lengths, and packing density and that these structural presentations directly affect biocompatibility [911 ]. in some cases, peg alters dendrimer 's drug loading capacity, retention time, and thus their delivery performance [8, 12, 13 ]. therefore, the characterization of peg coating prior to animal testing is of great importance. while computational studies have been carried out to probe peg conformation on dendrimers surfaces, experimental studies are lacking due to the difficulties in obtaining high - resolution structural characterization of peg when bound to soft materials, such as dendrimers [11, 14 ]. our prior work shows that high - resolution structural characterization of simple dendrimers such as pamam can be achieved by advanced sample preparation and combined atomic force and scanning tunneling microscopy (afm and stm) imaging [15, 16 ]. encouraged by this initial success, this work reports extending our approach to pegylated pamam dendrimers. from the high - resolution images, the molecular conformation, packing density, and distribution of peg on the surface of individual dendrimers can be obtained. this knowledge of the peg presentation on dendrimers provides important insights for understanding structure - delivery performance correlation, which could guide the design, optimization, and development of the next generation of dendrimers and reduce usage of animal tests. the following materials were used as received : methoxy polyethylene glycol 1000 da (peg1000) (sigma - aldrich), triethylamine (tea) (99.5%, sigma - aldrich), pyridine (99.8%, sigma - aldrich) p - nitrophenyl chloroformate (pnpcf) (98%, sigma - aldrich), 2,5-dihydroxybenzoic acid (2,5-dhb) (sigma - aldrich), anhydrous dichloromethane (dcm) (sigma - aldrich), dimethyl sulfoxide (dmso) (acros geel), k2ptcl4 (min. 42.4% pt, alfa aesar), n - octanethiol (c8) (98%, sigma - aldrich), deuterium oxide (d, 99.96%, cambridge isotope laboratories), and phosphate buffer (10x, lief technologies). fourth generation amine terminated pamam dendrimers were purchased as 10% by weight solutions in methanol (sigma - aldrich, st. louis, mo). silica gel 60 a 230400 mesh atsm (whatman inc) and silica gel 60 f254 plastic sheets (tlc) (merck kgaa) were used for column and thin layer chromatography, respectively. ultrapure water (18 mcm, millipore milli - q) and 200 proof ethanol (gold shield chemical co.) were used for dilution and washing. (98%, air gas co.) and h2 (99.99%, praxair, inc.) au slugs (99.99%, alpha aesar premion co.) and mica (clear ruby muscovite, mica new york corp.) were used for au thin film preparation. the following materials were used as received : methoxy polyethylene glycol 1000 da (peg1000) (sigma - aldrich, st. louis, mo), triethylamine (tea) (99.5%, sigma - aldrich, st. louis, mo) p - nitrophenyl chloroformate (pnpcf) (98%, sigma - aldrich, st. louis, mo), 2,5-dihydroxybenzoic acid (2,5-dhb) (sigma - aldrich, st. louis, mo), anhydrous dichloromethane (dcm) (sigma - aldrich, st. louis, mo), dimethyl sulfoxide (dmso) (99.7%, acros, geel, belgium), k2ptcl4 (min. 42.4% pt, alfa aesar, ward hill, massachusetts), n - octanethiol (c8) (98%, sigma - aldrich, st. louis, mo), deuterium oxide (d, 99.96%, cambridge isotope laboratories, tewksbury, ma), and phosphate buffer (10x, lief technologies, grand island, ny). louis, mo). silica gel 60a 230400 mesh atsm (whatman inc, pittsburgh, pa) and silica gel 60 f254 plastic sheets (tlc) (merck kgaa, darmstadt, germany) were used for column and thin layer chromatography, respectively. ultrapure water (18mcm, milliporemilli - q, billerica, ma) and 200 proof ethanol (gold shield chemical co., hayward, ca) were used for dilution and washing (98%, air gas co., woodland, ca) and h2 (99.99%, praxair inc., sacramento, ca), 99.95%, california fine wire co., grover beach, ca) was used to make stm tips. au slugs (99.99%, alpha aesar premion co., ward hill ma) and mica (clear ruby muscovite, mica new york corp., new york, ny) were used for au thin film preparation. g4-pamam - nh2 dendrimers were pegylated according to previous reports with some modifications. briefly, peg1000 was first modified by reaction with tea and a catalyst amount of pyridine in anhydrous dcm with peg1000. to the organic solution the g4-pamam - npeg1000 was synthesized by adding an anhydrous dmso solution of g4-pamam - nh2 dropwise to a solution of peg1000 carbonate in anhydrous dmso. the reaction system was then stirred 24 hours for g4-pamam-6peg1000, or 72 hours for g4-pamam-50peg1000. the resulting g4-pamam - npeg1000 was purified by centrifugal filter (mwco = 10 kda) until thin layer chromatography (dcm / methanol = 80/20, v / v) showed no unreacted peg1000 carbonate or byproduct p - nitrophenol. the molecular weight of the modified and unmodified dendrimers was determined by matrix assisted laser desorption ionization time - of - flight mass spectrometry (maldi - tof - ms) (ultraflex, bruker). the conjugates were dissolved in deionized water at a concentration of 1.0 mg / ml. 10 l of the conjugate solution was mixed with 10 l of the dhb solution. 2 l of the sample was spotted on a maldi target plate (mtp 384, bruker daltonics, inc.). the g4-pamam - nh2, g4-pamam-6peg1000, and g4-pamam-50peg1000 dendrimers were found to have a molecular weight of 14,579, 22,080, and 75,929 da, respectively. the number of peg chains per dendrimer was determined by h nmr spectroscopy (mr-400, agilent) using deuterated solvent. the deuterated solvent peak (dmso_d6 : 2.483 ; d2o : 4.577) in h nmr was set as a reference peak. the pegylation resulted in 5.9 peg per dendrimer, referred to as g4-pamam-6peg1000, and 50.5 peg per dendrimer, referred to as g4-pamam-50peg1000. the hydrodynamic diameter (hd) of samples was measured using dynamic light scattering (dls) (zetasizer nano zs, melvern instruments). the sample (1.0 mg / ml) was dissolved in phosphate buffer solution (0.1 m, ph 7.4) to maintain the ph during the measurement. - nh2, g4-pamam-6peg1000, and g4-pamam-50peg1000 dendrimers were found to have a hd of 4.4 1.4, 5.8 2.1, and 12.2 4.4 nm, respectively. the solutions were prepared following previously established procedures, including metal ion doping to facilitate stm imaging [1517 ]. in short, k2ptcl4 was then added to obtain molar ratios of 1 : 70, or 1 : 700 dendrimer : pt. solutions were kept at room temperature for 48 hours in order to allow for sufficient pt - amine coordination within dendrimers. for the surface deposition of dendrimers, 1 cm pieces of gold films were h2-flamed and allowed to cool for 10 minutes under clean ambient conditions. then, a 60100 l drop of the dendrimer solution was deposited resulting in a droplet with a contact diameter of 0.70.9 cm. after 1.25 minutes the surface was washed with 2 ml of pure water, dried with n2, washed with 2 ml of ethanol, and dried again with n2. a 60100 l drop of 1.0 mm c8 solution was then applied to the substrate for 4 minutes, washed with 2 ml of ethanol, and dried with n2. c8 sams are incorporated in order to replace weakly adsorbed molecules, confine dendrimers laterally, and prevent mobility during scanning. this process results in a clean, high coverage submonolayer of dendrimers on the surface. afm images were acquired using a mfp3d - sa system (asylum research), which includes a closed loop capability. the probe has a typical force constant of k = 1.0 n / m as measured by the thermal noise method [16, 18, 20, 21 ]. during tapping mode imaging, the cantilever was modulated by a driving frequency of 74 khz and amplitude of 87 nm (1.0 v). during nanoshaving to displace adsorbates such as dendrimers or alkanethiolates, tips were placed in contact with the surface with increasing load beyond threshold [22, 23 ]. image processing and data analysis were performed using gwyddion (version 2.33, http://gwyddion.net/). stm images were taken using a walker - type scanner (uhv 300, rhk technologies, inc.), under ambient pressure and temperature [18, 19 ]. stm tips were prepared by etching tungsten wires electrochemically at 2.0 v in 3.0 m naoh solutions using a homemade potentiostat to monitor the etching process [18, 19 ]. all stm images were acquired in constant current mode with typical bias voltages ranging from 0.4 to 0.9 v and tunneling currents from 10 to 40 pa. the scanner was calibrated laterally using an octanethiol sam lattice constant of 0.50 nm and vertically using au(111) single atomic step (0.235 nm). image processing and data analysis were performed using xpmpro (version 2.0.0.8, rhk technologies, inc.). surface contact area measurements were carried out using imagej (version 1.47v, wayne rasband, nih, http://imagej.nih.gov/ij/index.html). the characteristic afm tapping mode images of g4-pamam-50peg1000, are shown in figures 1(a) and 1(b). the two images are of the same area but under two different damping set points during tapping mode afm imaging. in the case of g4-pamam-50peg1000, the topographic images were found to vary with the set point values. in figure 1(a), at 42% damping, each dendrimer appears as a ring. reducing the damping to 23%, that is, gentler tapping, we have varied damping (from 0% to 100%) and found that dendrimers appear as either rings as shown in figure 1(a) or ellipsoidal caps as shown in figure 1(b). we assigned the two features to pamam core and peg shell (or coating), respectively. the assignment is based on three observations. first, the damping - dependence was not present for non - pegylated dendrimers, such as g4-pamam - nh2, as revealed in figures 1(c) and 1(d). regardless of tapping conditions, the g4-pamam - nh2 dendrimers always appear as ellipsoidal caps, consistent with prior studies. secondly, the core region of the g4-pamam-50peg1000 ring structures is commensurate in size with that of the g4-pamam - nh2 core, as shown in cursor 1 of figure 1. thirdly, damping dependence in tapping mode afm imaging typically indicates variation in materials ' viscoelastic property, for example, how materials respond to periodical tapping of the afm tip [2427 ]. the distinct differences in the case of g4-pamam-50peg1000 dendrimers are consistent with a tight and elastic dendrimer core and a relatively loose and viscoelastic peg coating. the peg regions could exhibit high responses at specific damping conditions, revealing rings more evidently. the width of the rings, measured as full width at half of the maximum height, varies from 5.0 to 12.4 nm, with an average value of 6.9 2.3 nm. the measured ring width provides an approximate view regarding the extension, or conformation, of the peg molecules suggesting a variation in the peg conformation. according to afm imaging the difference between the thickest and thinnest regions of the peg coating on a single dendrimer varies by 3.4% up to 47.6%. this preliminary assessment of dendrimer morphology indicates that the peg density and extension are not uniform at the outer shell of individual dendrimers. to determine the fine structure of the peg coating, stm imaging is performed and provides a more accurate visualization of the peg presentation, as will be discussed in detail in section 3.2. to verify that the features are not due to deformation upon surface immobilization, we have also imaged dendrimers at various surface coverages. at high surface coverage, as shown in figure 2, afm topographs are again found to depend on tapping conditions. overall, the trend is similar to that at low coverage, that is, solid ellipsoidal caps are observed under most tapping conditions, while rings are observed at greater dampening. this indicates that the ring - like features are intrinsic to the dendrimer structure instead of surface deformation. one specific difference was seen under 42% damping, at which ring contrast was observed previously ; the morphology appears fragmented, analogous to flower pedals, as shown in figure 2(a). this overlapping region can extend the entire thickness of the peg coating up to the pamam core as shown in the cursor profile (red). at 23% damping, peg - coated g4 dendrimers appear as individual ellipsoidal caps with a clear depression between adjacent dendrimers, as shown in figure 2(b) and the cursor (blue) of figure 2. in the case of g4-pamam - nh2 dendrimers, these observations suggest that the peg chains could be interdigitated at close proximity, which could lead to stacking, interspersion, and merging among neighboring dendrimers. this behavior is in sharp contrast to the pamam cores, where no overlapping or coalescing was seen. these observations are important in the context of drug delivery in vivo, as aggregation due to high accumulations of dendrimers is of concern. our previous work has demonstrated that the physical height of surface immobilized dendrimers can be measured using nanoshaving, an afm based technique, in conjunction with topographic imaging [1517 ]. the surface was first surveyed to select a relatively flat 1.5 m 1.5 m region. higher force was then applied during scanning of a central 0.5 m 0.5 m region to remove the dendrimer monolayer. finally the entire area was imaged again in tapping mode to reveal both the freshly exposed surface region and the surrounding dendrimer monolayer in a single frame, shown in figure 3(a) inset. the physical height of individual g4-pamam - nh2 dendrimers relative to the bare substrate can be directly obtained from the cursor profile. as shown in figure 3(a), cursor 1 reveals the height of five individual dendrimers. the height taken from multiple experiments and a large number of g4-pamam - nh2 dendrimers was found to be 2.2 0.3 nm, which is identical to 3 previous measurements of surface immobilized g4-pamam dendrimers [1517 ]. this value is lower than 4.4 nm determined by dls which probes hydrodynamic diameter. this is not uncommon due to the deformation of the dendrimer upon surface immobilization under ambient conditions [1517, 2830 ]. the dendrimers were displaced in the upper left region, enabling accurate height measurements, as shown for two representative g4-pamam-50peg1000 in cursor 2. the average height of g4-pamam-50peg1000 measured from two experiments and multiple images is 3.4 1.2 nm, which is 1.2 nm taller than the core, g4-pamam - nh2. as indicated by the increased standard deviation relative to g4-pamam - nh2, the pegylated dendrimers have a far greater distribution of height, indicating a greater range of size and/or conformation upon surface immobilization. stm provides submolecular resolution characterization of pegylated dendrimers, revealing the morphology and structure of the peg chains. with the overall morphology of dendrimers established by afm, we could use stm to provide a more detailed look at the intramolecular structure especially at peg region. although dendrimers are not sufficiently conductive for direct stm imaging, our prior work has indicated that stm conductivity may be enhanced by coordinating metal ions into the dendrimer [1517 ]. this work demonstrates that the same approach is effective to enable stm imaging of pegylated dendrimers. individual dendrimers are clearly resolved, at the coverage of submonolayer with sufficient interparticle separation. at higher resolution shown in figure 4(b), it is apparent that the geometry of surface immobilized g4-pamam - nh2 adopts a very similar shape to the most commonly known pamam dendrimers, g4-pamam - oh, which are ellipsoidal caps [1517 ]. while these dendrimers are considered to be nearly spherical in solution, the flattening and deformation from spherical geometry are due to dendrimer - surface interaction. the dendrimer - surface contact areas, as highlighted in red, of the three dendrimers were measured as 7.7, 12.0, and 13.4 nm. intraparticular features are also visible, such as the bright protrusions on the surface of each dendrimer, which likely correspond to individual nh2 termini, analogous to oh termini visualized previously. upon pegylation, the pamam cores of individual dendrimers are still visible, but the footprint or dendrimer - surface contact area is interspersed with peg chains spreading out and filling the space between dendrimers. at higher resolution the peg are visualized more clearly, as shown in figure 4(d). unlike g4-pamam - nh2, the dendrimers are no longer ellipsoidal, as the contact area adopts a more irregular geometry (see red lines tracing the boundaries). the periphery of these dendrimers was determined using multiple cursor profiles to accurately determine the boundaries of each dendrimer. the contact area of the two pegylated dendrimers is much greater than the corresponding core particles, measuring 41.8 and 29.1 nm, respectively. these high - resolution images reveal that the peg presentation varies from dendrimer to dendrimer, which leads to a large variation in contact upon surface immobilization. as shown in figure 4(d), the majority of the peg chains extend as groups to form peg podia. the peg podia tend to fan out in regions of bare substrate and bunch up near adjacent dendrimer peg extensions. these peg podia extend from 0.5 to 4.5 nm from the core contact region, which indicate variations in peg conformation. previous work indicated several conformations adopted by peg chains attached to solid substrates [9, 10 ]. to our knowledge, results shown in figure 4 represent the first observation of the peg conformational variations in the context of dendrimers. in order to determine the effect of the packing density of the peg at the dendrimer surfaces, various peg : core ratios were prepared. the overall morphology of g4-pamam-6peg1000 closely resembles that of g4-pamam - nh2, as clearly defined ellipsoidal caps with intraparticular features and protrusions visible. the degree of spreading observed is shown in figure 4(f), which falls in between g4-pamam-50peg1000 and g4-pamam - nh2. the dendrimer - surface contact area of the two representative g4-pamam-6peg1000 shown in figure 4(f) measures 24.5 and 21.1 nm, from left to right. peg podia appear shorter than that in high peg : core ratio cases with their extension 0.52.0 nm from the pamam core. it is known that the packing density of peg chains on flat surfaces greatly impacts their conformation [9, 13 ]. our investigations indicate that this concept appears to be valid in the context of peg chains at the surface of pamam dendrimers. the observed coverage dependence of peg conformation may be understood by taking into account peg - peg, peg - solution, and peg - surface interactions. on solid flat surfaces three characteristic conformations have been described previously, known as pancake, mushroom, and brush, with the extension length of 0.5, 1.0, and 2.5 nm, respectively [810 ]. peg chains on the dendrimer exterior differ from those on flat surfaces due to the curvature and mechanical flexibility of the core. the curvature allows more space than that on flat surfaces under the same coverage, while the relatively soft core allows for greater deformation and flexibility upon surface immobilization. computational studies on g3-pamam-8peg1000 indicate that peg chains fold in close contact with the dendrimer core in solution, due primarily to interactions between the ether groups of peg and the protonated amine termini of the dendrimers extending approximately 1 nm in solution [11, 31 ]. in the case of dendrimers with lower coverage peg, such as in g4-pamam-6peg1000, the peg chains seem to follow this theoretical prediction and exhibit tightly bound podia. the extension is larger than predicted, extending from 0.5 to 2.5 nm, which indicates the presence of all three conformations described previously. at higher coverage, g4-pamam-50peg1000 the longest extensions exceed the brush conformation, which we attribute to the effect of dendrimer support and interchain interactions. considering that peg - surface interactions could offset the intramolecular interactions in solution phase, local structural characterization is critical to reveal individual dendrimers ' structures. results from stm investigations indicate that the incorporation of pt ions leads to sufficient conductivity for high - resolution stm imaging, despite pegylation, which in principle should hinder metal ion doping. in comparison to pamam dendrimers, the incorporation of metal ions follows slower kinetics. in the case of g4-pamam - oh, for example, each dendrimer was saturated by pt within 48 hrs, under 1 : 70 dendrimer : pt molar ratio, at a 1 m concentration. the resulting increase in tunneling probability allowed for high - resolution stm imaging, which could resolve individual dendrimer termini [1517 ]. under identical conditions, g4-pamam - nh2 also yielded high - resolution stm images, as shown in figures 4(b) and 5(c). in the presence of a peg coating high - resolution is still provided ; however, the apparent height, or happ, is lower, as shown in figures 5(a)5(c) and cursors 13. the average happ of g4-pamam - nh2 is 0.42 0.11 nm, whereas the happ for g4-pamam-6peg1000 and g4-pamam-50peg1000 is 0.38 0.13 nm and 0.32 0.07 nm, respectively. we infer that the metal ion concentration inside g4-pamam-50peg1000 and g4-pamam-6peg1000 dendrimers is lower than g4-pamam - nh2, leading to a lower local density of states and therefore happ. to increase the metal ion coordination within the dendrimers, the dendrimer : pt molar ratio was increased from 1 : 70 to 1 : 700, and the results are shown in figures 5(d)5(f) and cursors 46. at a higher pt ratio, the average happ of g4-pamam - nh2, g4-pamam-6peg1000, and g4-pamam-50peg1000 increased to 0.51 0.07 nm, 0.45 0.12 nm, and 0.56 0.04 nm, respectively. in the case of g4-pamam - nh2, the average happ increases only 17%, indicating that the intraparticulate pt concentration is very similar under the two concentrations. it is important to note here that a height increase was not observed, as measured by afm, for any of the dendrimers when the pt ratio was increased. thus, by increasing the pt concentration, the metal ions were able to penetrate the peg coating and coordinate with the amines within the dendrimer core to a greater extent. since the g4-pamam - nh2 dendrimer is already nearly saturated at the lower pt concentration the effect on happ is relatively small as compared to the highly pegylated dendrimer. these observations should shed light when using dendrimers as drug delivery vehicles, as the coating may change the pharmacokinetic behavior. using afm and stm, we have characterized the morphology and structure of pegylated dendrimers. afm investigation allows for the visualization of individual dendrimers on surfaces and provides accurate height measurements. in addition, afm studies reveal that the pamam core and peg shell can be visualized under tapping mode imaging to ascertain the uniformity and distribution of pegylation on individual dendrimers. further, the results indicate that peg chains among adjacent dendrimers could interdigitate, in contrast to the dendrimer cores. the peg chains at the exterior pamam cores adopt various conformations including pancake, mushroom, and brush, similar to that at the solid and flat surfaces. unique to high coverage pegylated dendrimers, a greater variation in peg structure and degree of extension is observed with the peg podia, up to 4.5 nm from the core. to the best of our knowledge, this work is among the first to reveal high - resolution information on the local structure of pegylated dendrimers. collectively, this investigation provides important insight into the structure of coated dendrimers, which shall be important to guide the design and development of better drug delivery vehicles. | dendrimers have shown great promise as drug delivery vehicles in recent years because they can be synthesized with designed size and functionalities for optimal transportation, targeting, and biocompatibility. one of the most well - known termini used for biocompatibility is polyethylene glycol (peg), whose performance is affected by its actual conformation. however, the conformation of individual peg bound to soft materials such as dendrimers has not been directly observed. using atomic force microscopy (afm) and scanning tunneling microscopy (stm), this work characterizes the structure adopted by pegylated dendrimers with the highest resolution reported to date. afm imaging enables visualization of the individual dendrimers, as well as the differentiation and characterization of the dendrimer core and peg shell. stm provides direct imaging of the peg extensions with high - resolution. collectively, this investigation provides important insight into the structure of coated dendrimers, which is crucial for the design and development of better drug delivery vehicles. |
hepatocellular carcinoma (hcc) is the second most common cause of cancer - related death worldwide. with the exception of japan, hcc in asian countries most often occurs in patients with underlying chronic hepatitis b virus (hbv) infection through a multistep process of hepatocarcinogenesis. with the development of diagnostic and operative techniques, curative hepatic resection for this fatal disease nevertheless, the high recurrence rate following curative resection hampers the long - term benefits of surgical treatment. therefore, identifying factors that contribute to hbv - associated hcc recurrence could provide potential targets for novel therapeutic strategies. recently, the expression profiling of fixed tissue hcc and nontumor tissue has been used to gain insight into hcc recurrence. the results indicated that most cases of hcc recurrence after curative therapy are not metastasis from the primary tumor, but rather de novo cancers arising within the cirrhotic liver. these findings prompted our investigation into the role of inflammation cytokines that are closed related to tumorigenesis in hcc recurrence. interleukin-6 (il-6), produced by b - cells, t - cells, macrophages, and fibroblasts, regulates chronic inflammation and, thus, creates a cellular microenvironment beneficial to cancer growth. the potential association of il-6 with the risk of hcc has been explored in previous studies. however, it is not clear whether this inflammatory cytokine is associated with hcc recurrence after curative resection in patients with chronic hbv infection. despite recommendations regarding periodic follow - up with imaging and tumor markers such as alpha - fetoprotein (afp) and fibrosis markers, these strategies have not proven efficacious in the early prevention of hcc recurrence. the currently study analyzed the relationship between preoperative serum il-6 and hbv - associated hcc recurrence after curative resection. in addition, the correlation between serum il-6 levels and the original tumor characteristics was also explored to shed potential light on the underlying etiology of hbv - associated hcc recurrence. this study was performed in accordance with national legislation and with the approval of the ethical committee of our hospital. we retrospectively collected patients data from original medical records and the cancer patients follow - up database at our hospital. serum il-6 was measured using eclia, modular - system (roche, mannheim, germany). in the current study laboratory test results obtained immediately prior to the date of surgery were selected to exclude interference from other preoperative invasive examinations. during 2008 to 2009 at our hospital, 183 consecutive patients with chronic hbv infection underwent liver resection for primary hcc. out of the 183 patients, 37 patients were excluded from this study for the following reasons : 12 patients received noncurative resection, 3 patients died in the perioperative period, 15 patients received preoperative transarterial chemoembolization, and 7 patients had malignancy other than hcc. all patients received laboratory assessment of liver function, preoperative viral serologic testing, and diagnostic imaging [including computed tomography (ct), magnetic resonance imaging (mri), or positron emission tomography - computed tomography (pet - ct) ] to evaluate tumor location and tumor characteristics. patients who had neither hilar nodal involvement nor extrahepatic metastases were treated with liver resection as the initial treatment for their primary hcc. the selection criteria and type of operative procedures were determined according to preoperative indocyanine green retention rate at 15 minutes (icgr15), as previous described. in general, patients with an icgr15 less than 35% were selected for anatomic resection. after the operation, patients received routine follow - up with physical examination, serum afp level, and ultrasonography at 3-month intervals for the first year and then every 6 months. suspected hcc recurrence was confirmed using mri, hepatic angiography, and percutaneous biopsy in some cases. additional examinations, such as chest ct, bone scan, or pet - ct, were also performed if there was any sign of extrahepatic recurrence. the end of follow - up was determined as either the time of last follow - up (january 2013) or death. case - controlled differences were assessed using student t - test, pearson chi - square test, and the fisher exact test, where appropriate (table 1). the association between serum il-6 level and greatest tumor dimension and hbsag amount were analyzed by the pearson correlation test (figures 1 and 2). exploratory stratified analysis was performed and p for interaction was calculated from the log likelihood ratio test comparing 2 nested models (table 2). the relationship between serum il-6 and the risk of hcc recurrence was explored using a smoothing plot (figure 3). a 2-piecewise linear regression model was used to examine the saturation effect of serum il-6 on the risk of hcc recurrence, according to the smoothing plot (table 3). an inflection of serum il-6 level, at which the relationship between serum il-6 levels and the risk of hcc recurrence began to diminish was determined using a trial method. the latter involved moving the trial inflection point along a predefined interval and detecting the inflection point that gave the maximum likelihood. receiver operating characteristics (roc) curve was used to define the optimal cutoff value, sensitivity, and specificity (figure 4). the overall survival (os) and recurrence - free survival (rfs) rates were calculated using the kaplan - meier method. the difference between the 2 groups was determined using the log rank test (figure 5). baseline characteristics of 146 patients with chronic hbv infection who underwent curative hepatectomy for hepatocellular carcinoma characteristics significantly associated with serum il-6 levels. (a) serum il-6 is significantly higher in patients with multiple hepatic tumors compared with patients with only solitary tumor recurrence (3.5 vs 3.0 pg / ml, p = 0.04). (b) serum il-6 level has some relevance with hbsag amount (r = 0.504, p 0.05). the relationship between serum il-6 levels and primary tumor characteristics is shown in figures 1 and 2. serum il-6 levels were significantly higher in patients with multiple tumors compared with patients with a solitary tumor (3.5 vs 3.0 pg / ml, respectively, p = 0.04, figure 1a). in addition, serum il-6 level has some relevance with hbsag amount (r = 0.504 p 0.05). in addition, there was no evidence for an interaction between preoperative serum il-6 and maximal tumor dimension, microvascular invasion, or portal vein invasion (all p > 0.05). a multivariate regression analysis was performed to estimate the independent relationship between serum il-6 level and hcc recurrence, while adjusting for potential confounders. adjusted smoothed plots suggested a nonlinear relationship between serum il-6 levels and risk of hcc recurrence (figure 3). the risk of hcc recurrence increased with increasing serum il-6 level up to the turning point of 3.7 pg / ml (or = 3.8, 95% ci 2.16.8, p 3.1 pg / ml were defined as high il-6 (n = 70). the rfs rate in the high il-6 group was significantly lower compared with the rate in the low il-6 group (figure 5a) (p < 0.01). the 1, 3, and 5-year rfs rates were 87.1%, 31.4%, and 21.4%, respectively, in the high il-6 group and 86.8%, 71.1%, and 61.8%, respectively, in the low il-6 group. the os rate in the high il-6 group was also significantly lower compared with the os rate in the low il-6 group (figure 5b) (p < 0.01). the 1, 3, and 5-year os rates were 98.6%, 34.3%, and 22.9%, respectively, in the high il-6 group and 98.7%, 73.7%, and 65.8%, respectively, in the low il-6 group. in patients with hbv - associated hcc, we determined that the preoperative serum il-6 level may serve as an independent and significant prognostic indicator of hcc recurrence after curative hepatic resection. both rfs and os in the high il-6 group were significantly lower compared with the rates in the low il-6 group. different from previous study, we also found a saturation effect when using serum il-6 to predict hcc recurrence. inflammation is recognized as an important factor in the development and progression of malignancy. as an inflammatory cytokine, il-6 could activate the nuclear factor-b and the signal transducer and activator of transcription 3, thereby contributing to hcc development. our current data demonstrated that serum il-6 levels significantly correlated with tumor recurrence in patients with hbv - associated hcc, even after they received curative resection. previous studies have demonstrated a significant correlation between hcc recurrence and unfavorable tumor factors, such as tumor size, multiple tumors, and the presence of microvascular invasion. some researchers have explained the elevation in inflammatory cytokines as 1 aspect of a paraneoplastic syndrome, and as such, may predict hcc recurrence. in the current study, we found that tumor size, multiple tumors, and portal vein invasion were associated with hcc recurrence. however, serum il-6 levels were not significantly associated with tumor size or portal vein invasion. subsequent subgroup analysis suggested that serum il-6 levels could effectively predict hcc recurrence, whether in a solitary tumor or in multiple tumors. in addition, although preoperative serum il-6 levels had some relevance with hbv amount, the association between serum il-6 levels and hcc recurrence was not significantly changed, after adjusting the hbv amount in the multivariate regression analysis. these suggest that il-6 can serve as an independent factor for hcc recurrence and not just the reflection of unfavorable primary tumor factors or hbv infection status. since our study population involved patients with chronic hbv infection, this difference may be explained as follows : serum il-6 levels are primarily affected by chronic hbv infection, liver fibrosis, and coexistent cirrhosis. previous studies have shown that hbv x protein can regulate the expression of il-6 via protein phosphatase type 2 c. a portion of hcc recurrences after curative therapy might be de novo cancers arising in cirrhotic livers, as proposed by some researchers. serum il-6 levels could be a comprehensive reflection of systemic metabolism, inflammation, and immune status. the finding of a preoperative serum il-6 saturation effect when predicting hbv - related hcc recurrence after curative resection suggests a complex link between il-6 and tumor recurrence, that is, il-6 could have strong protumorigenic activity due to its multiple effects on tumor cell proliferation and survival, angiogenesis, tumor metabolism, and inflammation. in addition, il-6, alone or in combination with other cytokines, is an architect for shaping and generating immune responses which can exert a profound influence on hcc development. in hepatoma cell lines and in rodents injected with hepatoma cells, il-6 actually inhibits instead of enhances tumor growth. only after il-6 reaches a certain concentration can assume the multifaceted role needed to reach a balance and not increase the risk of tumor recurrence. to date, few studies have obtained such a quantitative finding, although the mechanisms underlying this result need to be further studied. in addition, we also found that both rfs and os were significantly lower if preoperative serum il-6 levels exceeded 3.1 pg / ml. since few studies have defined a cutoff value for il-6 when predicting hcc recurrence, measurements of preoperative il-6 level may help in selecting patients who would benefit from additional therapy following surgery, even after curative resection. our study had several limitations including its retrospective nature, which limited our ability to detect il-6 in the tissues surrounding hcc., a complex interaction exists between tumor host immunity and inflammatory response, but the key mechanisms underlying this response are not fully understood. however, elevated serum levels of il-6 were significantly associated with an increased risk of hbv - associated hcc recurrence, even after adjusting for unfavorable primary. the causal role of il-6 in hcc recurrence can provide valuable information when selecting additional therapy following surgery. targeting the il-6 system may also prove beneficial in the early prevention of this disease, and this area may prove fertile ground for future research. | abstractthe aim of this study is to assess whether preoperative serum interleukin-6 (il-6) can predict recurrence of hepatitis b virus (hbv)-associated hepatocellular carcinoma (hcc).the association between preoperative il-6 levels and hcc recurrence following curative hepatectomy in 146 patients with chronic hbv infection was determined. patients were divided into groups based on the presence or absence of hcc recurrence. serum il-6 levels were compared between groups, and the association between serum il-6 level and greatest tumor dimension was also analyzed. receiver operating characteristics (roc) curve was used to define the optimal cutoff value for predicting recurrence - free survival (rfs) and overall survival (os) rates. the os and rfs rates were calculated using the kaplan - meier method.out of 146 patients, 80 (54.8%) patients were documented as having hcc recurrence during the follow - up period. after adjusting for potential confounders, serum il-6 levels were significantly associated with hcc recurrence, and a saturation effect existed with serum il-6 levels up to 3.7 pg / ml. in addition, patients with preoperative serum il-6 levels over 3.1 pg / ml had lower rfs and os rates (p < 0.01). there was no significant correlation between preoperative serum il-6 levels and maximal tumor dimension (r = 0.0003, p = 0.84).elevated serum levels of il-6 were significantly associated with an increased risk of hbv - associated hcc recurrence suggesting that preoperative il-6 serum level is potential biomarker for early prediction of hbv - associated hcc recurrence. |
the study was approved by the ethical committee of the hospital district of southwestern finland. fourteen patients with relapsing - remitting ms (10 women) initiating natalizumab treatment (tysabri, 300 mg iv every 4 weeks ; biogen idec, cambridge, ma) at the neurology outpatient clinic of the division of clinical neurosciences at the turku university hospital, turku, finland (december 2008 to december 2009), were prospectively recruited into the study. characteristics included the following : mean age 37.2 (range 2146) years ; disease duration from ms diagnosis 1.9 (03.75) years ; expanded disability status scale score 3.7 (17.5) ; number of relapses 4.1 (110, total) and 1.9 (05, year before) ; and disease - modifying therapy year before, -interferon (n = 6) and glatiramer acetate (n = 1). the sample size was determined by the number of patients initiating natalizumab treatment and willing to participate during the recruitment period of 1 year. heparinized blood samples (10 ml) were obtained shortly before the initiation of treatment and at 1 week and 1, 3, and 12 months of treatment. two patients discontinued the treatment (after 1 and 8 months [infusion reaction and fear of progressive multifocal leukoencephalopathy, respectively ]), and 3 patients did not show up at 1 week. one patient experienced a relapse 10 days after initiation of natalizumab treatment and received a course of methylprednisolone pulse therapy. immunofluorescence staining was performed using whole blood (ethylenediaminetetraacetic acid anticoagulated peripheral blood, 100 l) with the following antibodies : cd19-pe - cy7, cd5-apc, cd10-apc, cd19-apc, cd20-apc - cy7, cd45-apc - cy7, cd45-percp - cy5.5, cd4-apc, cd3-pe - cy7 (bd biosciences, franklin lakes, nj) ; cd49d, cd183-pe, cd196-pe, cd195-fitc, cd3-pe - cy7, cd3-percp - cy5.5 (bd pharmingen, san diego, ca). samples were processed according to euroflow standard operating procedure for sample preparation and staining (euroflow.org) and analyzed using flow cytometry (facscanto ; bd, san jose, ca). rationale for the choice of target molecules was the following : cd19 and cd20 were included as b cell determinants. cd183/cxcr3 and cd49d / vla-4 evaluation on b cells was the hypothesis - driven main objective of the study. other chemokine receptors and cell surface molecules not immediately associated with b cell cns homing (i.e., cd196/ccr6, cd195/ccr5, cd5) were included as controls. from each tube, 100,000 events were collected, and data were analyzed using facsdiva version 6.1.3 (bd). on the same day, the blood lymphocyte counts were obtained from differential white blood cell count analyzed at 0, 1, 3, and 12 months using sysmex xe2100 (sysmex, kobe, japan) automated hematology analyzer according to standard clinical laboratory procedures, and absolute counts for b cell subpopulations were calculated from lymphocyte counts with assistance of flow cytometry results. statistical analyses were performed separately for each antibody using sas system (sas institute, cary, nc) for windows 9.4. if residuals were normally distributed, time comparisons were done using mixed - model repeated - measures analysis of variance with heterogeneous compound symmetry covariance structure and followed by dunnett adjustment for pairwise comparisons. otherwise, comparisons were made using signed - rank or paired t test with bonferroni adjustment multiple comparisons. samples taken during natalizumab treatment were compared to the baseline sample. corrected 2-sided p values < 0.05 were considered statistically significant. the study was approved by the ethical committee of the hospital district of southwestern finland. fourteen patients with relapsing - remitting ms (10 women) initiating natalizumab treatment (tysabri, 300 mg iv every 4 weeks ; biogen idec, cambridge, ma) at the neurology outpatient clinic of the division of clinical neurosciences at the turku university hospital, turku, finland (december 2008 to december 2009), were prospectively recruited into the study. characteristics included the following : mean age 37.2 (range 2146) years ; disease duration from ms diagnosis 1.9 (03.75) years ; expanded disability status scale score 3.7 (17.5) ; number of relapses 4.1 (110, total) and 1.9 (05, year before) ; and disease - modifying therapy year before, -interferon (n = 6) and glatiramer acetate (n = 1). the sample size was determined by the number of patients initiating natalizumab treatment and willing to participate during the recruitment period of 1 year. heparinized blood samples (10 ml) were obtained shortly before the initiation of treatment and at 1 week and 1, 3, and 12 months of treatment. two patients discontinued the treatment (after 1 and 8 months [infusion reaction and fear of progressive multifocal leukoencephalopathy, respectively ]), and 3 patients did not show up at 1 week. one patient experienced a relapse 10 days after initiation of natalizumab treatment and received a course of methylprednisolone pulse therapy. immunofluorescence staining was performed using whole blood (ethylenediaminetetraacetic acid anticoagulated peripheral blood, 100 l) with the following antibodies : cd19-pe - cy7, cd5-apc, cd10-apc, cd19-apc, cd20-apc - cy7, cd45-apc - cy7, cd45-percp - cy5.5, cd4-apc, cd3-pe - cy7 (bd biosciences, franklin lakes, nj) ; cd49d, cd183-pe, cd196-pe, cd195-fitc, cd3-pe - cy7, cd3-percp - cy5.5 (bd pharmingen, san diego, ca). samples were processed according to euroflow standard operating procedure for sample preparation and staining (euroflow.org) and analyzed using flow cytometry (facscanto ; bd, san jose, ca). rationale for the choice of target molecules was the following : cd19 and cd20 were included as b cell determinants. cd183/cxcr3 and cd49d / vla-4 evaluation on b cells was the hypothesis - driven main objective of the study. other chemokine receptors and cell surface molecules not immediately associated with b cell cns homing (i.e., cd196/ccr6, cd195/ccr5, cd5) were included as controls. from each tube, 100,000 events were collected, and data were analyzed using facsdiva version 6.1.3 (bd). on the same day, the blood lymphocyte counts were obtained from differential white blood cell count analyzed at 0, 1, 3, and 12 months using sysmex xe2100 (sysmex, kobe, japan) automated hematology analyzer according to standard clinical laboratory procedures, and absolute counts for b cell subpopulations were calculated from lymphocyte counts with assistance of flow cytometry results. statistical analyses were performed separately for each antibody using sas system (sas institute, cary, nc) for windows 9.4. if residuals were normally distributed, time comparisons were done using mixed - model repeated - measures analysis of variance with heterogeneous compound symmetry covariance structure and followed by dunnett adjustment for pairwise comparisons. otherwise, comparisons were made using signed - rank or paired t test with bonferroni adjustment multiple comparisons. samples taken during natalizumab treatment were compared to the baseline sample. corrected 2-sided p values < 0.05 were considered statistically significant. natalizumab treatment led to increased absolute numbers of circulating b cells, and b cell subpopulations (table, figure). the increase in circulating b cells was seen already after 1 month of treatment, and it persisted throughout the study period. proportionately, the increase was greatest among cd10cd19cd20 pre b cells (median 8.3-fold) and cxcr3cd19 b cells (4.7-fold). natalizumab - induced persistent increase in the proportion of cd19cd20 b cells of all peripheral blood lymphocytes was observed already after 1 week of treatment (p = 0.004 at 1 week, p = 0.0005 at 1 month, p = 0.002 at 3 months, p = 0.008 at 12 months ; table, figure). natalizumab treatment increased the proportion of cd10cd19cd20 pre b cells during the first 3 months (p = 0.02, p = 0.01, p = 0.004, and p = 0.2, respectively ; table, figure). the proportion of vla-4cd19 cells decreased already after 1 week of natalizumab treatment (p < 0.0001 at all time points ; table, figure). there was no change in the proportion of cd5cd19 native transitional b cells (table, figure). the proportion of cxcr3cd19 cells was increased after 1 month (p = 0.014 at 1 and 3 months, p = 0.0058 at 12 months ; table, figure). natalizumab - treatment did not alter the proportion of ccr6cd19 or ccr5cd19 cells (table, figure). natalizumab - induced increases in cell counts and alterations in proportions of circulating b cells in patients with multiple sclerosis (a h) the absolute number of total lymphocytes and all investigated b cell populations and surface molecules, except ccr5 at 12 months, increases significantly and persistently in patients with multiple sclerosis during natalizumab treatment. (i) the proportion of cd19cd20 b cells of all peripheral blood lymphocytes increases in patients with multiple sclerosis already after 1 week of natalizumab treatment. (j) the proportion of cd10cd19cd20 pre b cells increases already after 1 week of natalizumab treatment. (k) the proportion of cd5cd19cd20 b cells is not altered during natalizumab treatment. (l) the proportion of vla-4cd19 cells decreases already after 1 week of natalizumab treatment. (m) the proportion of ccr5cd19 cells is not altered during natalizumab treatment (n) the proportion of ccr6cd19 cells is not altered during natalizumab treatment. (o) the proportion of cxcr3cd19 cells increased after 1 month of natalizumab treatment. (p) the proportion of cxcr3cd19 cells increased in 11 of 13 patients from baseline to 3 months during natalizumab treatment. median, lower and upper quartiles, and range (a h) or mean standard error (i o) is shown except (p), where lines represent intraindividual changes.p < 0.05, p < 0.01, p < 0.001 compared to baseline (0 months). m = month ; vla-4 = very late activation antigen 4 ; w = week. hence, blocking vla-4 using natalizumab most likely both enhances the release of b cells from lymphoid tissues and bone marrow, and prevents b cell entry from blood into tissue. this results with increased numbers of circulating b cells as shown in this study and by others. our result of the apparent partial decrease in b cell vla-4 expression following natalizumab treatment is in line with previous results. in addition to adhesion molecules, chemokine receptors and chemokines contribute to recruitment of leukocytes into sites of inflammation. not much is known, however, about the specific chemokine receptors mediating entry of b cells into the cns under inflammatory conditions. we show here for the first time that the proportion of circulating b cells expressing the chemokine receptor cxcr3 is significantly and persistently increased during natalizumab treatment. cxcr3 is expressed in a subset of circulating b cells and, of note, cxcr3 expression on b cells in the csf is higher in active ms patients than in controls. it is thus possible that the increase in the proportion of cxcr3-expressing circulating b cells following natalizumab treatment is related to the reduced migration ability of these cells into the inflamed cns. moreover, the observed reduction in the level of cxcr3-binding chemokines within the cns following natalizumab treatment might hamper the trafficking of cxcr3 b cells into cns, which further contributes to the increased proportion of these cells in the blood. natalizumab treatment did not alter the proportions of ccr5 or ccr6 b cells, highlighting the fact that natalizumab has divergent effects on various b cell populations expressing various homing determinants. in addition, natalizumab seems to influence differently the proportions of cxcr3-expressing circulating b and t cells, as cxcr3cd8 t cells were shown to decrease in circulation during natalizumab treatment. our study demonstrates the early (demonstrable already after 1 month) and persistent (up to 1 year) increase in absolute numbers of circulating cd19cd20 b cells and cd10cd19cd20 pre b cells during natalizumab treatment, which probably is caused by the rapid release of these cells from lymphoid tissues and bone marrow due to vla-4 blockage. this phenomenon is so pronounced that it leads to an increase in absolute numbers of any b cell population studied (table). however, when proportions of various b cell subpopulations are calculated, the only increase is observed in cxcr3-expressing b cells. it has been recognized that vla-4 has an important role in mediating t lymphocyte entry into the cns, but adhesion molecules controlling the b cell entry have been much less understood. our study suggests that some of the treatment effect of natalizumab might be attributable to prevented entry of disease - relevant b cells into the cns. the beneficial effect on cns inflammation of b cell vla-4 expression elimination in mice supports this hypothesis. however, the mechanistic demonstration of the role of cxcr3 in b cell entry into the inflamed cns remains to be seen. maija saraste : analysis of the data, drafting and revising the manuscript for intellectual content. tarja - leena penttil : design of the antibody panels for flow cytometry analysis, analysis of the data. laura airas : design and conceptualization of the study, critical revision of manuscript for intellectual content. maija saraste is financially supported by the university of turku doctoral programme of clinical investigation, the maud kuistila memory foundation, the finnish ms foundation, and the orion research foundation. the sponsor had no influence on the analysis and interpretation of data, in the writing of the report, or in the decision to submit the paper. m. saraste received travel funding from the turku university foundation, received research support from the university of turku doctoral programme of clinical investigation, the maud kuistila memory foundation, the finnish ms foundation, the orion research foundation. l. airas served on the scientific advisory board for teva, roche, biogen, genzyme, novartis, received travel funding and/or speaker honoraria from teva, genzyme, biogen idec, sanofi - aventis, merck, novartis, received research support from merck, novartis, biogen idec. | objective : to study the effects of natalizumab treatment on subgroups of circulating peripheral blood b cell populations.methods:we studied the proportions and absolute numbers of cd19+cd20 +, cd10 +, and cd5 + b cell populations, and determined very late activation antigen-4 and chemokine receptor cxcr3, ccr5, and ccr6 expression on b cells in the peripheral blood of 14 natalizumab - treated patients with relapsing - remitting multiple sclerosis. five blood samples per patient were obtained longitudinally before and during the first year of treatment. blood samples were analyzed by 6-color flow cytometry.results:proportions of b cells and cd10 + pre b cells were significantly increased, and very late activation antigen-4 expression on the b cell surface was significantly decreased already after 1 week of natalizumab treatment. natalizumab - induced sustained increase in the proportion and absolute number of cxcr3-expressing b cells was statistically significant after 1 month of treatment. there were no changes in the proportions of ccr5- or ccr6-expressing b cells.conclusions:the rapid and persistent increase in circulating cxcr3-expressing b cells in response to natalizumab treatment possibly reflects the relevance of this chemokine receptor in controlling migration of b cells into the cns in humans in vivo. |
the global population growth is estimated to increase from 6.8 million today to 8 billion by 2025, which will put pressure on water demand from many perspectives as water is used in the production of both food and energy (4). more people demand more food and also, with a shift in diet to more so - called westernised food, there will be an increased pressure for water ; agriculture accounts for 70% of all water use today (5). by 2030, it is estimated that the world will need to produce 50% more food and energy that means a continuous increase in demand for water. the pollution of the seas is an established fact, and ocean transport of contaminants is growing as a health concern for populations in the area (68). decision makers will have to very clearly include life quality aspects of future generations in the work as the impact of ongoing changes will be noticeable, in many cases, in the future. recently, an estimation of an increase of 30% of fresh water is needed to mitigate the causes of and adapting to climate change (5). thus, according to these estimations, the demand for water will without doubt be increased in the near future. this article will focus on effects of climate change on water security with an arctic perspective, giving some examples from different countries how arising problems are being addressed. water stress occurs when the demand for water exceeds the available amount during a certain period or when poor quality restricts its use. in 2010, a report from the world bank found that the effects of water shortages are felt strongly by 700 million people in 43 countries (9). another report from 2010 states that 80% of the world 's population is exposed to high levels of threat to water security (3). the stress is not limited to the human sphere as a majority of the flora is also threatened ; a majority of biodiversity dependent on river discharge is at risk for extinction as well as flora and fauna are dependent upon arctic lakes (3). the impact on human health is thus complex with many parts of nature being affected and interacting in an interwoven biological / physiological communication. although the situation is a cause for considerable concern, technologies and expertise are being developed that can help address these problems. but to implement effective adaptation measures, it is important to raise awareness among decision makers as well as the general public as changes in water consumption at an individual level will be crucial to tackling water scarcity. it is a challenge of pedagogical nature to show the need for individual actions and for personalised willingness to take on responsibility for mitigating changes of climate. water has traditionally been regarded as a free resource, but this can be changed. the term water footprint is a measure how much water has been used during the production process of any goods or food. recognition of the water footprint in all aspects of society is needed to change public awareness about water value, and ultimately water consumption behaviour. air temperature has increased in the arctic, warming 0.6c since the early 20th century, with seasonal as well as geographical variations. precipitation is a parameter that is difficult to measure in the arctic and complex to predict. arctic climate impact assessment (acia) suggests that a 1% increase in precipitation per decade has occurred over the last century (2). seasonal distribution of precipitation is important to consider as winter precipitation has increased since the 1970s and because arctic winter precipitation is projected to increase with continuing climate change. despite increased annual precipitation, a net summer drying effect is occurring due to decreased seasonal precipitation, increased temperatures, thawing permafrost and increased evapotranspiration. there has also been an increase in wind since the 1960s and in cyclone activity. this is favourable for northward expansion of agriculture and in natural plant and animal distribution. this will cause an increased loss of water due to evapotranspiration contributing to drier summer conditions in the future. degradation of the permafrost can result in drainage of ponds. in siberia and alaska, lakes in permafrost regions have undergone rapid change, some increasing in size and number, whereas others have decreased and in some instances disappeared. siberian rivers have, as rivers in alaska, increased in winter discharge, even in non - dammed tributaries. forecasts say that the total area of permafrost may shrink by 1012% in 2025 years with permafrost borders moving 150200 km northeast in russia (10). in the arctic, permafrost extends to up to 500 m below the ground surface, and it is generally just the top metre that thaws in the summer (8). lakes, rivers and wetlands on the arctic landscape are normally not connected with groundwater in the same way they are in temperate regions. so, when the surface is frozen in the winter, only lakes deeper than 2 m and rivers with significant flow retain liquid water. surface water is often abundant in summer, when it serves as a breeding ground for fish, birds and mammals. in winter, many mammals and birds are forced to migrate out of the arctic. many humans in the arctic rely on surface water for community use, so when conditions change and access to water is diminished, the prerequisites for human survival are affected. only 40% of yakutia 's population is supplied with running water from centralised sources and 140 operational water pipes fail to meet sanitary standards (10). the population in the arctic part of russia is also estimated to increase as huge investments in infrastructure and regional planning will occur during the next coming decades. a study from alaska shows that when access to water is limited, it causes consequences for the health care. studies have shown a 24 times higher hospitalisation rates among children 12,000 persons got sick with gastrointestinal symptoms, 61 were hospitalised. more than 50,000 persons were affected by the advice from the authorities that all water used for drinking or cooking should be boiled. the second outbreak affected the population in skellefte, in northern vsterbotten where > 6,000 got sick. the water used for drinking had been boiled since the middle of april and the final cleaning of the water occurred in september 2011. the advice about boiling caused a rapid response ; 2 days after this statement to the public, the number of new persons with symptoms declined. one cause that is under investigation is that the intake of surface water for drinking water is close to the sewage outlet and as more precipitation has occurred during the last decades, a connection is established. as in other parts of the arctic, the infrastructure of yesterday, supposed to last until tomorrow, is not sufficient for the situation of today. improved surveillance systems are needed for community source water, including waterborne and water - washed diseases to detect impacts of climate change in the arctic, and international networks need to be further developed. microbial surveillance of drinking water including water sources for indigenous peoples in the arctic should be prioritised. climate change health assessment methods have been developed in alaska (13). in greenland, water quality is secured by legislation, day - to - day running of the water supply and supervision of the water resource. the government is implementing the eu drinking water directive that also is an eu demand, if greenland wants to continue to export foodstuffs to eu (14). the directive demands water quality information from public utilities at a level not used in greenland before. so, there is a need for information material, both in the form of data sheets with analysis results and as explanations and descriptions of the analysis results. a portal, owned by greenland resources, is the authorities medium for information to the public. besides, there is a general request for a gathering and structuring of all the knowledge that is accumulated in the last 5 years about water quality, water resources, water handling and authority matters including legislation and the last 20 years water chemical analysis results. the impact of policy in one nation can have impact on the water security of other nations. there is a need for governance at all scales global, regional, national, local as well as the catchment level and a need for linkages between these scales. the arctic council has, through the sustainable development working group, established the arctic human health expert group (ahheg). this group of experts have the task to develop working plans for improvement of health for the people living in the arctic. water security is important for national security as demonstrated by the international conflicts around access to water occurring in east africa. what is required to meet the increased demand is the implementation of effective governance, financing and regulation to allow technical solutions to be effective for global water security. thus, today it is of uttermost importance to raise awareness of key issues and potential responses and have a broader public debate on sustainable resource use and management. existing values, cultural norms and organisational structures that empower the individual determine patterns of individual behaviour and organisational response to influence this is a great pedagogic challenge, but the success of implementation from governments and public authorities relies on the response from the individual. maintaining and ensuring the security of water and ability to supply demands from the water resources available are essential to humankind everywhere now and in the future and are equally important for vulnerable populations in the north. the authors have not received any funding or benefits from industry or elsewhere to conduct this study. | water is of fundamental importance for human life ; access to water of good quality is of vital concern for mankind. currently however, the situation is under severe pressure due to several stressors that have a clear impact on access to water. in the arctic, climate change is having an impact on water availability by melting glaciers, decreasing seasonal rates of precipitation, increasing evapotranspiration, and drying lakes and rivers existing in permafrost grounds. water quality is also being impacted as manmade pollutants stored in the environment are released, lowland areas are flooded with salty ocean water during storms, turbidity from permafrost - driven thaw and erosion is increased, and the growth or emergence of natural pollutants are increased. by 2030 it is estimated that the world will need to produce 50% more food and energy which means a continuous increase in demand for water. decisionmakers will have to very clearly include life quality aspects of future generations in the work as impact of ongoing changes will be noticeable, in many cases, in the future. this article will focus on effects of climate - change on water security with an arctic perspective giving some examples from different countries how arising problems are being addressed. |
accessory and cavitated uterine mass (acum) is a rare, newly recognized mullerian anomaly. it is an accessory cavity lined by functional endometrium within an otherwise normal uterine cavity, in contrast to the other mullerian anomalies in which the uterus is malformed. the cavitated mass is locally defined to myometrium (unlike diffuse adenomyosis), is encapsulated (unlike myoma), and bears uterus - like histological organization (unlike adenomyoma). the entity needs expertise to diagnose as it is a rare but treatable cause of severe dysmenorrhea and chronic pelvic pain in young females with a wide range of differential diagnosis. a 24-year - old unmarried female presented with severe dysmenorrhea and chronic pelvic pain since menarche, which aggravated 2 years prior to presentation. she was treated with non - steroidal anti - inflammatory drugs (nsaids) earlier and with oral contraceptive pills (ocp) for the last few months. previous serial usg reports revealed a 3.0 3.6 cm, solid right adnexal mass abutting the right ovary with likely ovarian origin. on repeat usg pelvis, a homogeneous isoechoic well - defined mass was noted in the right adnexa between uterus and right ovary, with central echogenicity [figure 1 ]. uterus and bilateral ovaries appeared normal and there was no fluid in pouch of douglas. a differential diagnosis of rudimentary horn with unicornuate uterus was considered. on usg upper abdomen, multiple non - obstructing right renal calculi and gall bladder (gb) calculi were noted. serum calcium, phosphate, parathyroid hormone (pth), uric acid, liver and renal function tests, urine analysis, and urine calcium were within normal limits. usg pelvis transverse images showing well - defined isoechoic uterus like mass with central echogenic endometrium in the right adnexa. the uterus appeared normal with a well - defined, rounded, non - communicating cavitated mass measuring 3 4 cm noted along the right anterior uterine wall just below the insertion of round ligament. the cavity was lined by t2-hyperintense endometrium with hemorrhagic contents within, which appeared hyperintense on t1 and hypointense on t2w images [figure 2 ]. the junctional zone of the cavity was thickened (13 mm) and endo - myometrial interface was indistinct. the main uterine cavity was normal in shape and size, and both the cornua were visualized normally [figure 3 ] which ruled out usg diagnosis of rudimentary horn. the junctional zone, endomyometrial interface, and myometrial signal intensity of the main uterine cavity were normal. no pelvic endometriotic deposits were seen and there was no evidence of hematosalpinx. based on the above findings, a diagnosis of acum was considered. (a) axial t1w, (b) fat - saturated axial t2w, and (c) coronal t2w images showing a cavitated mass attached just below the round ligament containing t1-hyper and t2-hypointense contents suggestive of blood products (a and b) and lined with t2-hyperintense endometrium (c). the junctional zone is thickened with ill - defined endo - myometrial interface (curved arrow). note thin (4 mm) junctional zone with sharp endo - myometrial interface (straight arrow) in normal uterine cavity, u axial fs t2w images (a - c) and coronal t2w images (d - f) showing normal - shaped uterine cavity with both cornua (arrows) attached normally. bilateral ovaries () are seen separate from the mass, m as hsg is best avoided in young unmarried patients, laparoscopy was done. on laparoscopy, the mass was found to be attached to the right anterior uterine wall just below the attachment of right round ligament. a transverse incision was made over the anterior wall of the mass and 10 - 12 ml of chocolate - colored fluid was drained. histopathology revealed a cavitated mass lined by functional endometrium with glands and stroma surrounded by irregularly arranged smooth muscle cells. foci of adenomyosis were also noted within the myometrium of the mass [figure 4 ]. the smooth muscle cells stained positive for desmin, estrogen receptor (er), and progesterone receptor (pr). photomicrograph (a) showing functional endometrium e, with glands and stroma lining the cavity wall and surrounded by irregularly arranged smooth muscle cells m, resembling myometrium. foci of adenomyosis (b) are seen within the myometrium of the resected specimen (arrow) american society of reproductive medicine classification of mullerian anomalies uterus - like mass (ulm) is an uncommon distinct entity described in literature which represents cavitated mass lined by endometrial glands and stroma that are surrounded by irregularly arranged smooth muscle cells, which in addition to other smooth muscle markers also show positivity for er and pr, resembling myometrium. hence, these ulms bear both macroscopic and microscopic resemblance to the uterus and can arise anywhere within and beyond the uterus at any age. the entity needs to be classified separately as the uterine cavity is otherwise normal unlike other mullerian anomalies. it characteristically presents at a younger age, usually < 30 years, with severe dysmenorrhea and chronic pelvic pain due to distention of the cavity caused by repeated bleeding. various authors have previously described such masses with different names such as juvenile cystic adenomyoma (jca), cavitated adenomyoma, accessory cavitated masses, etc. the condition is separate from cystic adenomyosis which is seen in middle - aged females due to diffusely spread adenomyotic foci in the uterus. the cysts are typically small, usually less than 5 mm, due to periodic hemorrhage in ectopic endometrium, and on histopathologic examination (hpe), they lack typical endometrial lining and uterus - like smooth muscle organization. acum, on the other hand, is seen in adolescents and resembles uterus on microscopy. the main uterine cavity and myometrium is otherwise normal ; however, myometrium of acum itself may develop adenomyosis due to increased intracystic pressure. there are three theories of development : (1) congenital anomaly theory, (2) heterotopias theory, and (3) metaplasia theory. the proposed mechanism says that the accessory mass could be caused by duplication of ductal mullerian tissue in the critical area at the level of attachment of round ligament, possibly related to gubernaculum dysfunction. the first case of ulm was reported by cozzutto in 1981. around 36 cases of acum have been reported in literature with various terminologies, of which 22 have been reported after 2010 probably due to increased awareness. beginning from 2010, the greatest number of cases (n = 9) has been reported by takeuchi., although they limited the inclusion criteria to women under 30 years of age. reported four cases in 2011, and one case each was reported by akar. in 2010 and chun. in 2011 in 2012, jain reported two cases of jca, simulating mullerian anomalies. in 2013, another case with its laparoscopic management has been reported by bedaiwy. the most common extrauterine site is ovary ; however, such masses have been seen in broad ligament, small bowel, mesentery, appendix, colon, conus medullaris, and utero - sacral ligament. the criteria for diagnosing acum are : (1) an isolated accessory cavitated mass usually located under round ligament ; (2) normal uterus, fallopian tubes, and ovaries ; (3) a surgical case with excised mass and pathological examination ; (4) an accessory cavity lined by endometrial epithelium with glands and stroma ; (5) chocolate brown colored fluid contents ; (6) no adenomyosis in the uterus (if resected), although there could be tiny foci of adenomyosis in the myometrium of the accessory cavity due to increased intracystic pressure. although most of the cases fulfill all the above mentioned criteria, there have been few exceptions. there was one case showing two acum in the same patient, one case of acum in a patient with co - existing other mullerian anomaly and one with accessory rudimentary tube attached with the mass. usg is the initial imaging modality that can identify them as solid isoechoic to predominantly cystic masses resembling endometrioma arising within the uterus, visualized separately from the ovaries. however, the most important role of hsg lies primarily in ruling out any mullerian anomaly. mri is the imaging modality of choice as it non - invasive and, hence, preferred over hsg in young unmarried females. it clearly shows the pelvic anatomy ; cavitated mass with hemorrhagic contents ; and the uterus, myometrium, and endo - myometrial interface. thin sections (3 mm) should be used as it will also help in ruling out mullerian anomaly by demonstrating both cornua clearly. in our case, visualization of normal size and shape of the uterus and both cornua ruled out mullerian anomalies. cystic degeneration in adenomyoma and fibroid will not show t2-hyperintense endometrial lining and hemorrhagic contents and are not usually seen in adolescents. the entity closely mimics obstructed cavitated rudimentary horn with unicornuate uterus and differentiation may be difficult. hsg can be done to differentiate the two, but mri is the preferred non - invasive modality. both of them show cavitated mass lined by endometrium with hemorrhagic contents within it, but contralateral tilt of the uterus, banana - shaped small uterine cavity, and a single cornua favors obstructed horn over acum which was not seen in our case. however, at times, the differentiation may not be possible on mri and laparoscopy remains the only option available for confirmation and treatment. to the best of our knowledge, except a few cases, most of the cases were misdiagnosed preoperatively as other mullerian anomalies, cystic degeneration in adenomyoma and leiomyoma, and broad ligament fibroids. awareness and adequate knowledge of the entity can help the radiologist make accurate pre - operative diagnosis of acum. acum, a rare mullerian anomaly related to dysfunction of gubernaculum, is a treatable cause of severe dysmenorrhea in young females. the mri findings of an accessory cavitated ulm located below the attachment of round ligament usually with hemorrhagic contents, an otherwise normal - shaped uterus with both cornua identified normally, without any evidence of adenomyosis, and bilateral normal tubes and ovaries should suggest the diagnosis of acum pre - operatively. | accessory and cavitated uterine mass (acum) is a rare form of developmental mullerian anomaly seen in young females, which presents as chronic recurrent pelvic pain and severe dysmenorrhea. it is an accessory cavity lying within an otherwise normal uterus. it is lined by functional endometrium and surrounded by myometrium - like smooth muscle cells ; hence, it bears striking macroscopic and microscopic resemblance to the uterus. hysterosalpingography (hsg), ultrasonography (usg), and magnetic resonance imaging (mri) form the mainstay of diagnostic imaging. the entity is often under diagnosed ; therefore, a high index of suspicion combined with hsg and mri imaging can help in making an accurate diagnosis. |
multiple sclerosis (ms) is a chronic neurological disease that affects brain and spinal cord. it is estimated that women are affected three times more than men (1). ms damages the myelin sheath involving the white matters of central nervous system. tentorial incisure (also known as the tentorial notch or incisura tentorii) refers to an extension of one of the membranes covering the cerebrum which, with the transverse fissure, separates the cerebrum from the cerebellum. they can detect subclinical lesions and provide information on the function of different parts of the nervous system (4). vestibular evoked myogenic potentials (vemps) are short - latency myogenic responses which are evoked by brief pulses of air conducted (ac) acoustic signals, bone conducted (bc) vibration or electrical stimulus. vemps are recorded via surface electrodes over surface of muscles such as sternocleidomastoid (scm) (5). cervical vestibular evoked myogenic potential (cvemp) was first described by colebatch (1992), and now has become an accepted test of vestibular functions. the cvemps are recorded from the scm or trapezius muscles (5). an auditory tone burst stimulation leads to activation of the saccular vestibular neurons, which in turn cause a modulation of tonic muscle activity of the scm muscle. the measurement of the vemps requires tonic contraction of ipsilateral scm muscle (6). the cvemp response has two main peaks, labeled p13 and n23 (7). in recent decade vemps have been recorded from the extraocular muscles (ocular or ovemp) (8, 9). in this test the responses are believed to be originated from the otoliths and they contributed to the linear vestibular the primary ovemp projection appears to be crossed and the initial negative peak occurred at about 10 ms. studies have shown infratentorial plays an important role in the transition, perception and interpretation of vestibular information and also both the vestibule - ocular and vestibulocolic pathways pass from this area. therefore, the lesions in this region can significantly impact on the balance and cvemp and ovemp. since the impact of plaque(s) in the infratentorial on the cvemp and ovemp is not investigated, the aim of this study was to compare cervical and ocular vestibular evoked myogenic potentials in multiple sclerosis patients with and without infratentorial plaque(s) and compare the findings with normal controls. in this cross- sectional study cvemp and ovemp were performed on 15 healthy female subjects with mean age of 31.139.27 years, 17 female patients with definite ms according to the mc donald criteria 2005, with infratentorial plaque(s) with mean age of 29.888.93 years and 17 female ms patients with definite ms without infratentorial plaque(s) with mean age of 30.588.02 years. mc donald criteria 2005 incorporated magnetic resonance imaging (mri) into the well - established diagnostic workup that focuses on detailed neurological history and examination and a variety of paraclinical laboratory examinations such as cerebrospinal fluid analysis (11, 12). all tests of the present study did from october to december 2013 in tehran university of medical science. subjects with abnormal audiometric results (hearing thresholds worse than 20 db hl)(13), with a history of seizures, depression, and head trauma and neck or eye movement limitation like strabismus and cervical arthritis were excluded. all patients underwent a complete clinical neurological evaluation and brain mri scanning within three weeks. then patients were divided into two groups consisting of patients with and without infratentorial plaque(s). to record cvemps, subjects were sat on a comfortable chair, turned their head opposite to the side of the stimulated ear in order to flex the scm muscle. subjects pushing with their jaw against the hand - held inflated cuff to generate a 40 millimeter of mercury cuff pressure (14). after cleaning the skin active surface electrode was placed on the upper half of each scm muscle with a reference electrode over the upper sternum and a ground electrode over central forehead(15) (figure1). cervical vemps were recorded from ipsilateral scm muscle (from the stimulated side) in response to ac 500 hz short tone burst delivered via insert earphones at 95 db nhl. for each eye the active recording electrode was placed on the infraorbital ridge 1 cm below the center of each lower eyelid and the reference was positioned about 1 - 2 cm below the active one and ground electrode was placed on the sternum (16) (fig.1). during recording, the subjects were instructed to look upward at a small fixed target > 2 m from the eyes, with a vertical visual angle of approximately 30- 35 degrees above the horizontal plane (17). contraction of contralateral extraocular muscle was monitored with degree of visual angle (18). electrodes in cvemp and ovemp ocular vemps were recorde d over the contralateral extraocular muscle (from the stimulated side) in response to ac 500 hz short tone burst delivered via insert earphones at 95 db nhl. data were analyzed using one way anova and paired t - test because the distribution of data was normal according to the kolmogrov - smirnov test and p0.05). in multiple sclerosis patients without infratentorial plaques cvemps were recorded from both sides of all patients but ovemp were recorded from both sides in 64.7% (n=11) patients and recorded from one side in 11% (n=2) patients and not recorded bilaterally in 23.5% patients (n=4). statistical analysis showed no significant differences between the mean latency and amplitude of p13, n23, n1 and p1 in right and left side (p>0.05). in multiple sclerosis patients with infratentorial plaques cvemps were recorded from both sides in 59.0% (n=10) of patients and from one side in 17% (n=3) of patients and not recorded in 23.5% (n=4) of patients. ocular vemps were recorded from both sides in 23.5% (n=4) of patients and recorded from one side in 23.5% (n=4) of patients and not recorded in 52.59% (n=9) of patients. analysis showed no significant differences between the mean latency and amplitude of p13, n23, n1 and p1 in right and left side (p>0.05). statistical analysis showed the latency of n1, p1 and p13 in multiple sclerosis with and without infratentorial plaques were significantly prolonged compared to normal controls (p0.05). the aim of the present study was to evaluate cvemp & ovemp in ms patients with and without infratentorial plaques and compare the findings with normal controls. the latency of n1-p1-p13 were significantly longer in ms patients with and without infratentorial plaque(s) compared to control subjects and latency of p13-n23-n1&p1 in ms patients with infratentorial plaques were significantly prolonged compared to patients without infratentorial plaques. prolonged latency of vemps in ms patients has been reported in previous studies (18 - 21). only latency of n23peak of ms patient without infratentorial plaque(s) was not significantly different compared to normal controls probably because of larger normal limits which has been reported in previous studies (21). are not specific for ms and can not help distinguish ms from other etiologies (18, 22, 23). delays of latency in vemps have been seen in other neurological disease that affecting brainstem such as stroke and tumors(24). overall in the present study 64.25% had some form of cvemp abnormality and 85.66% had some form of ovemp abnormality in ms patients with infratentorial plaque(s). in ms patients without infratentorial plaque(s) abnormality of cvemp & ovemp were seen in 18.26% and 45.28% of patients, respectively. data showed ocular vemps are often abnormal in patients with infratentorial plaques, because ocular vemp pathway passes through the brainstem which is in the infratentorial zone. the abnormality percentage of ovemps was higher than that of the cvemps in our study in both ms patient groups. our results showed that ovemps is more sensitive than cvemps in ms(18, 20). clinically silent lesions can explain physiologic changes that are not accompanied by physical signs or symptoms. perhaps small demyelinating lesions not detected by mri can produce slow nerve conduction velocity (18, 19, 21, 23). were seen in 73.43% and ovemp abnormalities were seen in 94.11% of ms patients with infratentorial plaque(s). most common abnormality found in ms patients with infratentorial plaque(s) was absent response and the other abnormality was latency prolongation. however severe demyelinizing lesions can cause conduction block or desynchronized conduction (19, 21). there were no statistically significant differences between the mean amplitude of cvemp and ovemp of both ms groups with normal subjects. this vemp parameter in ms patient is not a proper diagnostic criteria because other variables such as muscle contraction and stimulus intensity can affect it (18, 23, 25). amplitudes of vemps responses should not be used alone and should be interpreted together with latency values in ms patients (23). findings of the current study showed that abnormality of both cvemp and ovemp in ms patient with infratentorial plaque are more than that of ms patient without infratentorial plaque. recording both ocular and cervical vemps are appropriate electrophysiological methods assessing the function of both ascending and descending central vestibular pathways in diagnosis, monitoring disease progression and rehabilitation in ms patients. | background : multiple sclerosis (ms) is a chronic neurological disease that affects brain and spinal cord. the infratentorial region contains the cerebellum and brainstem. vestibular evoked myogenic potentials (vemps) are short - latency myogenic responses. cervical vestibular evoked myogenic potential (cvemp) is a manifestation of vestibulocolic reflex and ocular vestibular evoked myogenic potential (ovemp) contributes to the linear vestibular ocular reflex. the aim of this study was to evaluate cvemp and ovemp in ms patients with and without infratentorial plaques and compare the findings with normal controls. methods : in this cross - sectional study, latency and amplitude of cvemp and ovemp were recorded in 15 healthy females with mean age of 31.139.27 years, 17 female ms patients with infratentorial plaque(s) and mean age of 29.888.93 years, and 17 female ms patients without infratentorial plaque(s) and mean age of 30.588.02 years. all patients underwent a complete clinical neurological evaluation and brain mri scanning. simple random sampling method was used in this study and data were analyzed using one way anova through spss v22. results : the latency of n1-p1 and p13 in ms participants with and without infratentorial plaques were significantly prolonged compared to normal controls (p<0.001). additionally latency of p13- n23-n1 and p1 in ms patients with infratentorial plaques were significantly prolonged compared to patients without infratentorial plaques subjects (p<0.001). conclusion : abnormality of both cvemp and ovemp in ms patient with infratentorial plaque are more than that of ms patient without infratentorial plaque. recording both ocular and cervical vemps are appropriate electrophysiologic methods assessing the function of both ascending and descending central vestibular pathways. |
since 1984, in an attempt to maintain at least part of the splenic function when the removal of the spleen is recommended, we have performed subtotal splenectomies, preserving the superior splenic pole supplied by the splenogastric vessels. this procedure was successfully used for the treatment of 130 patients with portal hypertension, 93 patients with severe splenic trauma, 18 patients with myeloid metaplasia, nine patients with gaucher s disease, five patients with retarded growth and sexual development associated with splenomegaly, five patients with chronic lymphocytic leukemia, three patients with severe splenic pain due to intraparenchymal thrombosis, one patient with splenic hemangioma, one patient with splenic abscess, and one patient with a cystadenoma of the pancreatic tail,,,,,,,,,,,,,,. splenectomy has a very limited role in the treatment of hodgkin s lymphoma (hl) and is recommended only to control hl activity that does not respond to chemo- and radiotherapy,. since the purpose of a splenectomy is not to make the patient asplenic, a partial splenectomy may achieve the objectives without the adverse side effects of the total removal of the spleen,,. this is the first report of subtotal splenectomy preserving the inferior splenic pole without the maintenance of the splenic vascular pedicle. the treatment performed on this patient was approved by the ethical committee of the federal university of minas gerais under the protocol nr. caae 03990.203.000 - 11 and has been performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments. this work has been reported in line with the scare criteria. a 53-year - old white man with hl was submitted to chemotherapy and radiotherapy at hospital of clinics of the federal university of minas gerais, brazil and referred to the department of surgery for splenectomy. the indications for spleen removal were abdominal and breathing discomfort caused by a huge spleen due to hl refractory to adjuvant oncologic therapy. to avoid surgical induced asplenic immune depression, the abdominal cavity was entered through a left transverse laparotomy ; the splenic artery was tied in the retrogastric space. at laparotomy, a very large spleen with a tumor restricted to the superior pole was found (fig. the superior splenic vessels, including the splenogastric vessels, the superior splenic pole vessels and the splenic hilum were tied and cut. care was taken to preserve the left gastroepiploic and the inferior splenic pole vessels to maintain the vitality of the inferior splenic pole. the spleen was cut at the dividing line between the normal color of the inferior portion of the organ and the darker colored superior portion (fig. two wide flaps (anterior and posterior) of the 5 splenic capsule were retained. a continuous 3 - 0 chromic catgut suture closed the two flaps of the splenic capsule (fig. the inferior pole was returned to its normal position and sutured to the diaphragm with one stitch using 2 - 0 chromic catgut. 1surgical view of subtotal splenectomy for treatment of a man with hodgkin s lymphoma.a the very large spleen mobilized within the surgical field after the section of the splenic ligaments. observe the tumor in the superior pole () and the transition (arrow) between the inferior pole (red) supplied by the left gastroepiploic and inferior pole vessels and the rest of the devascularized spleen (dark color).b the inferior splenic pole () after subtotal splenectomy. observe the left gastroepiploic vessels (long thin arrow) inside the grater omentum, and the inferior pole vessels (short thick arrow).fig. 1 surgical view of subtotal splenectomy for treatment of a man with hodgkin s lymphoma. a the very large spleen mobilized within the surgical field after the section of the splenic ligaments. observe the tumor in the superior pole () and the transition (arrow) between the inferior pole (red) supplied by the left gastroepiploic and inferior pole vessels and the rest of the devascularized spleen (dark color). b the inferior splenic pole () after subtotal splenectomy. observe the left gastroepiploic vessels (long thin arrow) inside the grater omentum, and the inferior pole vessels (short thick arrow). histopathological analyses of the spleen confirmed the hl restricted to the superior pole with wide margins free of tumor. the patient had uneventful postoperative recovery and was discharged from the hospital on the fifth postoperative day. during the eleven - year follow - up scintigraphic images of the splenic remnant were positive in all postoperative exams, confirming the splenic vitality and the phagocytic function. the dimensions of the splenic remnant, according to ct exams, remained unchanged during the follow - up period (table 1).table 1hematological exams one week before and three months after subtotal splenectomy to treat hodgkin s g / l141 g / lhematocrit36.0%42.5% white blood cells total3.6 10/l12.4 10/l neutrophils61%78% lymphocytes31%17% eosinophils1%0% basophils1%0% monocytes6%5% platelets78 10/l478 10/l hematological exams one week before and three months after subtotal splenectomy to treat hodgkin s lymphoma. chemo- and radiotherapy are the usual treatments of hl, and most of patients survive many years under control,. however, the huge growth of the spleen, which may occur in some patients, leads to abdominal discomfort and therapeutic resistance. it is well - known that total splenectomy reduces the immune defenses and may be followed by severe sepsis associated with precocious and sudden deaths. this complication is more frequent in previously immune suppressed patients, such as those with lymphomas,. chemo- and radiotherapy worsen organic defenses and enhance mortality. since the total removal of the spleen is not necessary to treat hl, partial splenectomy should be enough to reduce the influence of splenic growth on both the symptoms and the hematologic system,. however, the early good results are transitory, given that the spleen may regrow due to the blood flow through the splenic vascular pedicle. to avoid this inconvenient follow - up, we have proposed the subtotal splenectomy, which preserves a pole of the spleen without the vascular pedicle. usually, the subtotal splenectomy maintains only the superior pole supplied by the splenogastric vessels, but in this case, the tumor was located in the superior pole and had to be removed. therefore, we decided to perform the subtotal splenectomy, preserving the inferior splenic pole supplied by the left gastroepiploic vessels. prior to the present case report, the use of this technique had never been published. thus, we decided to follow the patient a least for ten years before publishing the case to detect all complications of this procedure when in the presence of hl. its main advantage is to preserve the splenic functions in a normal size spleen without the risk of its regrowth and resistance to oncologic treatment. as limitation of this study, the lower number of patients with hl confined to a single pole must be emphasized. this procedure should not be attempted for staging purpose in hl because the disease may be present in the preserved spleen even without its macroscopic evidence. a subtotal splenectomy that preserves the inferior splenic pole is efficacious in maintaining splenic functions and preventing the adverse effects of a large spleen in the treatment of hodgkin s lymphoma confined to superior pole and producing significant abdominal symptoms and hematological effects. the treatment performed on this patient was approved by the ethical committee of the federal university of minas gerais under the protocol nr. informed consent was obtained from the patient in written for the surgical procedure and for publication of his case with picture of the splenic procedure. informed consent was obtained from the patient in written for the surgical procedure and for publication of his case with picture of the splenic procedure revision of the literature, proposal of the surgical procedure, surgeon who performed the procedure, surgeon responsible for the patient during the perioperative period and all the follow - up, author who wrote the manuscript. i accept full responsibility for the work and/or the conduct of the study, had access to the data, and controlled the decision to publish. | highlightsfirst published case of subtotal splenectomy preserving the inferior splenic pole without the maintenance of the splenic vascular pedicle.a very large spleen hodgkin s disease was successfully treated using a partial splenectomy.a successful surgical treatment on a hodgkin s lymphoma refractory to chemo and radiotherapy.the patient is still alive after more than 11 years from the subtotal splenectomy.subtotal splenectomy is efficacious to preserve the splenic functions and to prevent adverse effects of a large spleen on the treatment of hodgkin s lymphoma.subtotal splenectomy is sufficient to reduce the inconvenience of a huge spleen on patient symptoms and disorders of the hematological and immunological system. |
esophago - gastric location is the most common site of variceal bleeding in patients with portal hypertension and ectopic varices are responsible for 1 - 5% of cases of variceal bleeding. these may occur at any site along the gastrointestinal (gi) lumen including rectum, duodenum, small and the large intestine, but are also reported outside the gi lumen, in the retroperitoneum, abdominal wall, along the gall bladder wall, etc. in a nationwide survey of ectopic varices in japan, duodenal varices (dv) were reported to be the second most common cause of ectopic variceal bleeding after the rectal varices. dv, although commonly seen on angiography in patients with portal hypertension they are an uncommon cause of bleeding. they are most commonly noted in the duodenal bulb followed by the second part of the duodenum. the bleeding from duodenal varix usually occurs as a result of erosion on the varix and is usually severe because of rapid blood flow with high mortality rates. they are usually detected on endoscopy as submucosal bulge and needs further evaluation for confirmation as a duodenal varix. endoscopic ultrasound (eus) is an excellent investigational modality for evaluating gi submucosal lesions and dv varices as well as the feeding vessels can be evaluated on eus. we retrospectively evaluated patients with dv seen at our institution over past 4 years and analyzed their clinical, endoscopic and eus features as well as the outcome of treatment offered to them. we performed a retrospective analysis of patients with dv seen at our institution over the past 4 years. we included both patients who were diagnosed to have bleeding from dv and those patients in whom dv were diagnosed routinely on endoscopy performed for the evaluation of portal hypertension. patients who presented with bleeding dv underwent endoscopic therapy whilst the non - bleeders were put on beta blockers. all the patients presenting with gi bleed underwent upper gi endoscopy after resuscitation and stabilization and if there was suspicion of dv, a eus was performed to confirm the presence of dv. after confirmation of dv, all the patients underwent endoscopic injection of n - butyl-2-cyanoacrylate (1 ml undiluted injection). following successful hemostasis, the obliteration of the dv was confirmed by the absence of flow on color doppler on eus done within 4 - 7 days of endoscopic injection. an informed consent was obtained from all patients and the study protocol has been approved by the institutional ethics committee. a total of 10 patients (nine males ; mean age was 35.8 7.68 years) with dv were studied [table 1 ]. five patients had underlying cirrhosis and five had dv because of non - cirrhotic portal hypertension (four patients had extra - hepatic portal venous obstruction [ehpvo ] and one patient had non - cirrhotic portal fibrosis [ncpf ]). five patients presented with upper gi bleed, whereas in the remaining five patients dv were detected on endoscopy performed for evaluation of portal hypertension. of five patients presenting with upper gi bleed, three had the esophageal varices eradicated and two presented 1 time with bleed from dv and did not have esophagogastric varices. profile of patients with duodenal varices endoscopy revealed submucosal lesion in the duodenum nine patients, whereas in one patient an initial endoscopic diagnosis of dieulafoy 's lesion was made. the patients with duodenal submucosal lesion under went further evaluation by eus whereas patient with suspicion of dieulafoy 's lesion underwent hemoclip application. however, this patient rebled and a repeat endoscopy revealed a submucosal bulge beneath the small rent in the mucosa. subsequently performed eus demonstrated dv in the first part of the duodenum [figure 1 ]. (a) endoscopic image showing a submucosal lesion with a hemoclip ; (b) endoscopic ultrasound (eus) with color doppler showing duodenal varices with collaterals ; (c) eus with pulse doppler showing venous waveform four of these five patients with gi bleed underwent injection of n - butyl-2 cyanoacrylate with cessation of bleeding. follow - up eus after injection of glue revealed complete absence of flow in the dv. the variceal obliteration was documented by eus in all these four patients and there has been no recurrence of bleed in these four patients over a follow - up period of 4 - 46 months. the five non - bleeding dv were already on beta - blockers and the same were continued. two of these five patients succumbed to progressive liver failure with none of these five patients having gi bleed on follow - up. one of the five patients with upper gi bleed refused consent for endoscopic glue injection and was managed conservatively with usual resuscitative measures and intravenous terlipressin and improved and was discharged. dv are an uncommon cause of bleeding in spite of high angiographic presence possibly because of deeper location and small size. although they bleed infrequently, but whenever they bleed, they have higher mortality. dv usually co - exist with varices in esophagus and stomach or the varices have been eradicated earlier and bleeding 1 time from dv is very rare. the dv can occur in association with any cause of portal hypertension including cirrhosis and non - cirrhotic. a case of duodenal variceal bleeding secondary to chronic pancreatitis has also been reported. in their series of 14 patients, liu. have noted that 13 patients had underlying cirrhosis and one had ehpvo. in our 10 patients, five had underlying cirrhosis, four had ehpvo and one had ncpf as the cause of portal hypertension. as reported by earlier studies, all of our patients had dv located in the first part of duodenum. the role of endoscopic therapy in non - bleeding dv is not clear. of the five bleeders, four were treated with injection of glue (n - butyl-2 cyanoacrylate) which resulted in cessation of bleeding. others have questioned the usage of band ligation on the basis of animal studies, which suggest a higher likelihood of perforation. a case of fatal re - bleeding after band ligation of dv has also been reported. endoscopic injection of glue has been shown to be safe and effective therapeutic modality for dv but complications such as re - bleeding or thromboembolic complications have also been reported. as previously described by us, eus may help in correct diagnosis, targeted injection of sclerosant and confirmation of variceal obliteration. if re - bleeding does occur after endoscopic therapy, intervention radiological techniques provide a therapeutic opportunity to manage bleeding. balloon - occluded retrograde transvenous obliteration of varices (broto) has been utilized for management of gastric and dv and involves targeted embolization of varices using sclerosants such as ethanolamine oleate and cyanoacrylate. transjugular intrahepatic portosystemic shunt (tips) has also been used to control bleeding from dv, which rebled after broto. notably, four of our five patients presenting with bleeding dv had undergone endoscopic therapy for eradication of esophageal varices earlier and were on beta - blockers. earlier reports have indicated that endoscopic therapy of esophageal varices might predispose to occurrence of ectopic varices as this may open alternate route of drainage of portal flow. dv represent an important, but uncommon cause of bleeding in patients with portal hypertension. eus can help confirm the diagnosis and also guide glue injection and confirm variceal obliteration. | background : duodenal varices (dv) although an uncommon cause, are an important cause due to the severe nature of the bleed and associated adverse outcome.materials and methods : we retrospectively evaluated patients with dv seen at our institution over past 4 years.results:a total of 10 patients (nine males ; mean age was 35.8 7.68 years) with dv were studied. five patients had underlying cirrhosis and five had dv because of non - cirrhotic portal hypertension (four patients had extra - hepatic portal venous obstruction and one patient had non - cirrhotic portal fibrosis). five patients presented with upper gastrointestinal (gi) bleed, whereas in the remaining five patients dv were detected on endoscopy performed for evaluation of portal hypertension. endoscopy revealed submucosal lesion in nine patients, whereas in one patient an initial endoscopic diagnosis of dieulafoy 's lesion was made. however endoscopic ultrasound (eus) could clearly identify dv in all patients. of five patients presenting with upper gi bleed, three had the esophageal varices eradicated and two presented 1st time with bleed form dv and did not have esophagogastric varices. all patients with acute upper gi bleed were initially treated with intravenous terlipressin followed by glue (n - butyl cyanoacrylate) injection in 4/5 patients with one patient refusing further endoscopic therapy. the variceal obliteration was documented by eus in all these four patients and there has been no recurrence of bleed in these four patients over a follow - up period of 4 - 46 months. the five non - bleeding dv were already on beta- blockers and the same were continued. two of these five patients succumbed to progressive liver failure with none of these five patients having gi bleed on follow-up.conclusion:eus is a useful investigational modality for evaluating patients with dv and endoscopic injection of glue is an effective therapy for controlling and preventing recurrence of bleed from dv. |
trimethoprim (tmp)/sulfamethoxazole (smx) is a broad - spectrum antimicrobial combination effective in treating a variety of microorganisms and has been used in clinical practice for more than 50 years. high response rates demonstrated in clinical studies support tmp / smx as the drug of choice for serious infections such as stenotrophomonas maltophilia, pneumocystis jiroveci, and nocardia spp. since its discovery, pharmacokinetic studies of tmp / smx serum concentrations have consistently demonstrated great interindividual variability and the use of therapeutic drug monitoring was attempted to optimize clinical efficacy while minimizing adverse effects. hughes determined low peak smx concentration was associated with treatment failure in a study of 55 randomized pediatric patients with pneumocystis carinii pneumonia (pcp pneumonia) and proposed 100 to 150 g / ml as the optimal therapeutic range based on concentrations assayed from the 26 patients assigned to the tmp / smx arm combined with any levels drawn from patients who crossed between treatments. this therapeutic range was further investigated for clinical efficacy in a study of treatment for aids - associated pcp pneumonia in hiv - positive adult patients, of whom 21 were assigned to receive tmp / smx. mortality in tmp / smx - treated patients was similar to previous studies with a high rate of tmp / smx - related adverse events. additionally, peak smx concentrations > 200 g / ml demonstrated an association with severe adverse effects. despite extensive clinical experience, difficulties remain in achieving the proposed therapeutic smx peak serum concentration of 100 to 150 g / ml. the limited data surrounding a relationship between peak smx serum concentrations and clinically meaningful outcomes call into question the use of routine therapeutic drug monitoring during high - dose tmp / smx therapy. the use of tmp / smx therapy at our institution is frequently coupled with therapeutic drug monitoring in an effort to attain a targeted smx peak serum concentration. our institutional dosing algorithm has not been verified for its accuracy of attainment of the prespecified peak serum smx concentration goal of 100 to 150 g / ml. the purpose of our study is to compare the performance of a tmp / smx dosing algorithm in achieving targeted serum peak smx concentrations in hospitalized patients who received therapeutic doses of tmp / smx. this single - center, retrospective cohort study was approved by the mayo clinic institutional review board and conducted at mayo clinic in rochester, minnesota. consecutive adult patients who received therapeutic doses of tmp / smx between january 2003 and november 2011 were evaluated. patients were included if they were aged 18 years or older and underwent serum peak smx monitoring during tmp / smx therapy. intravenous or oral administration was allowed due to the nearly complete bioavailability of the oral formulations. patients were excluded if they received tmp / smx for infection prophylaxis, underwent tmp / smx desensitization, or had the serum smx plasma concentration monitored outside of their hospitalization. data collection was limited to the earliest chronologic occurrence of therapeutic tmp / smx administration with concurrent therapeutic drug monitoring for the purposes of maintaining independent data. smx serum concentration levels were determined by hplc by our institution s clinic toxicology and drug monitoring laboratory. the goal peak smx concentration range of 100 to 150 g / ml was defined per our institution s antimicrobial therapy guide. serum smx concentrations were considered peak concentrations if they were measured between 1 and 2 hours after intravenous administration or between 2 and 3 hours after administration of an oral dose at the onset of steady - state conditions. serum smx concentrations were considered modified peak if they were measured within 4 hours after intravenous administration and within 5 hours of oral administration. the peak values in the modified peak group served as surrogate peak levels in the absence of multilevel sampling and pharmacokinetic estimation. high dose or low dose according to our institution s dosing algorithm for the prespecified subgroup analysis (table i). the high - dose group received a total daily dose 15 mg / kg actual body weight of the tmp component. the low - dose group received a total daily dose 300 g / ml. many studies have attempted to establish a relationship between tmp / smx dose and resultant serum concentration without success ; however, these studies were limited by small sample size. high variability has been seen despite controlled administration and weight - specific dosing without a correlation to tmp, smx, or n - acetyl - smx. another study showed no correlation between serum creatinine and plasma concentrations. as a renally eliminated antimicrobial agent, even subclinical changes in glomerular filtration rate (gfr) serum creatinine in specific is affected by age, sex, race, and habitus. furthermore, tmp itself alters serum creatinine concentrations (therefore altering creatinine clearance) independent of changing true gfr. drug - induced inhibition of the renal tubular secretion of creatinine results in an artificial increase in serum creatinine concentrations and an underestimation of true gfr by creatinine clearance. lastly, recent evidence suggests that contemporary methods of renal replacement substantially removes tmp / smx, leading to below - target smx concentrations and a potential need for revised dosing in this population. in the peak cohort, 16.7% were within range while receiving hemodialysis, whereas 27.3% achieved the target range while receiving continuous venovenous hemofiltration. in the modified peak cohort, 20% were in range while receiving hemodialysis, whereas 22.2% were in range while receiving continuous venovenous hemofiltration. unfortunately, the numbers of patients receiving dialysis were too few to allow any inferences about being in range within dialysis subgroups. all of these factors likely contribute to the challenges of accurate renal function interpretation in these patients and the significant interindividual variability noted in our study. chin found similar attainment rates in their investigation of the influence of monitoring serum tmp / smx concentrations in patients with pcp pneumonia. tmp / smx was dosed at 20 mg / kg / d of the tmp component with an intended goal peak smx concentration range of 150 to 200 g / ml. dose adjustments were performed in the intervention arm to improve the therapeutic range attainment ; however, researchers demonstrated that only 28% of smx concentrations in the dose - adjustment group were within the therapeutic range compared with 32% without adjustment. despite the higher established target therapeutic range, the results were similar to our study s attainment of 26% within the therapeutic range. first is the potential for selection bias given the single - center, retrospective nature of our study design. the enrollment of patients consecutively during the study period and implementation of the propensity score matching method were our attempt to minimize the effects of confounding variables when comparing the low- and high - dose groups. the peak smx concentrations from both oral and intravenous administration were combined for analysis, which may lead to difficulties in interpretation. peak smx concentrations were combined from 2 different routes of administration because of oral administration results in almost complete absorption. further, there was no statistical difference in target concentration attainment when comparing the intravenous versus oral route (24% and 27%, respectively). third, therapeutic drug monitoring of serum peak smx levels are obtained at the physicians and pharmacists discretion as opposed to following a standardized algorithm ; however, the median time of 2 days of administration before concentration quantification ensured that smx levels were drawn at steady state concentrations. the potential for drug accumulation after the time at which steady state occurs may augment the already high percentage of patients in the above - target classification and make our analysis an overestimation of patients within the target range. daily processing and reporting of serum peak smx concentrations by our institution s laboratory allows dose adjustments to occur in a timely fashion if necessary ; however, routine laboratory monitoring is not available in all institutions so real - time laboratory assessment may be a challenge. to our knowledge, this study represents the largest reported sample to date of tmp / smx monitoring. this study adds to the literature on therapeutic drug monitoring of smx currently centered on pneumocystis jiroveci pneumonia treatment and provides a robust set of patients using therapeutic drug monitoring of peak smx concentrations for various infections requiring tmp / smx therapy. in addition, including a modified peak cohort allows our results to be applicable to routine clinical practice. clinical outcomes were not assessed in our study, but our results establish a foundation to support further assessment of the influence of smx concentrations on the efficacy and safety of the high doses of tmp / smx typically used as infection treatment. given the heterogeneity of the indications for using tmp / smx treatment and the low attainment rates of goal - directed therapeutic smx concentrations, further prospective, randomized studies are needed to elucidate the optimal dose of tmp / smx, further define the ideal goal therapeutic ranges for nocardia spp and stenotrophomonas maltophilia infections, and investigate the association of peak smx concentration and clinical outcomes. peak smx concentrations demonstrate wide variability, resulting in low overall attainment of intended target concentration ranges. there was no difference in attainment between the low- and high - dose cohorts. therapeutic range attainment rates were poor regardless of administration of high- or low - dose tmp / smx. higher proportions of patients had an above - target smx peak, which may be an indication that the dosing algorithm is overly aggressive in regard to obtaining the therapeutic goal. the wide therapeutic index of tmp / smx coupled with the broad range of resultant serum concentrations makes targeted therapy difficult and of questionable necessity. further investigation into the association between peak smx concentration monitoring and clinically meaningful outcomes, including treatment response and adverse effects, should be conducted in larger, prospective clinical trials with a more diverse patient population. the authors have indicated that they have no conflicts of interest regarding the content of this article. | objectivestrimethoprim (tmp)/sulfamethoxazole (smx) has consistently demonstrated great interindividual variability. therapeutic drug monitoring may be used to optimize dosing. optimal peak smx concentration has been proposed as 100 to 150 g / ml. the objective of our work was to determine the success rate of a tmp / smx dosing guideline in achieving a targeted serum peak smx concentration range.methodsour retrospective cohort study enrolled 305 adult hospitalized patients who received treatment with tmp / smx and underwent serum peak smx concentration monitoring from january 2003 to november 2011. patients receiving low - dose tmp / smx therapy (tmp 15 mg / kg / d).resultspatients were classified into peak and modified peak smx concentration cohorts based on time between tmp / smx dose and smx quantification. the association between dosing group and the outcome of the smx level within the goal range was measured using logistic regression models. the primary outcome measured was serum peak smx concentration 100 to 150 g / ml. serum peak smx concentrations were attained within range for the peak and modified peak cohort 29% and 26% of the time, respectively. the median peak smx concentration was 144 g / ml (range 25471 g / ml). the low daily dose cohort demonstrated a trend toward improvement in the odds of target peak concentration range attainment. the results were similar regardless of the method used to adjust for baseline characteristics. the pure peak and modified peak cohorts had 44% and 46% of patients with above - target smx peak concentrations, respectively.conclusionsattainment of the intended target concentration range was low with no difference in attainment between the low - dose and high - dose cohorts. higher proportions of patients had an above - target smx peak, which may indicate that the dosing algorithm is overly aggressive in obtaining the therapeutic goal. |
pegaptanib was developed in the 1990s using the selex (selective evolution of ligands by exponential enrichment) technique. the result was a 29-nucleotide aptamer, with a chemically modified rna backbone that increases nuclease resistance and a 5 terminus that includes a 40kd polyethylene glycol moiety for prolonged tissue residence [fig. 1].3 pegaptanib was shown to bind vegf 165 with high specificity (kd = 200 pm) and inhibited vegf 165 -induced responses, including cell proliferation in vitro and vascular permeability in vivo, while not affecting responses to vegf 121. pegaptanib proved to be stable in human plasma for more than 18h, while in monkeys pegaptanib administered into the vitreous was detectable in the vitreous for four weeks after a single dose.3 in rodent models, vegf 164 (the rodent equivalent of human vegf 165) acts as a potent inflammatory cytokine, mediating both ischemia - induced neovascularization and diabetes - induced breakdown of the blood - retinal barrier (brb). in these experiments, intravitreous pegaptanib was shown to significantly reduce pathological neovascularization, while leaving physiological vascularization unimpaired6 and was also able to reverse diabetes - induced brb breakdown.7 moreover, vegf 165 proved to be dispensable for mediating vegfs role in protecting retinal neurons from ischemia - induced apoptosis.8 these data suggested that intravitreous pegaptanib could provide a safe and effective treatment against both ocular neovascularization and diabetes - induced retinal vascular damage. pivotal clinical trial data have demonstrated that pegaptanib is both effective and safe for the treatment of neovascular amd. these data were derived from two randomized, double - masked studies known jointly as the v.i.s.i.o.n. (vegf inhibition study in ocular neovascularization) trials.9,10 a total of 1186 subjects with any angiographic subtypes of neovascular amd were included. patients received intravitreous injections of 0.3 mg, 1 mg or 3 mg pegaptanib or sham injections every six weeks for 48 weeks. subjects with predominantly classic lesions could also have received photodynamic therapy with verteporfin (pdt ; visudyne, novartis) at investigator discretion. after one year, the 0.3 mg dose conferred a significant clinical benefit compared to sham treatment as measured by proportions of patients losing < 15 letters of visual acuity (va) ; compared with 55% (164/296) of patients receiving sham injections, 70% (206/294) of patients receiving 0.3 mg of pegaptanib met this primary endpoint (p < 0.001). in contrast to pdt, clinical benefit was seen irrespective of angiographic amd subtype, baseline vision or lesion size and led to the clinical approval of pegaptanib for the treatment of all angiographic subtypes of neovascular amd. the 1 mg and 3 mg doses showed no additional benefit beyond the 0.3 mg dose.9 treatment with 0.3 mg pegaptanib was also efficacious as determined by mean va change, proportions of patients gaining vision and likelihood of severe vision loss. in an extension of the v.i.s.i.o.n. study, patients in the pegaptanib arms were rerandomized to continue or discontinue therapy for 48 more weeks.10 compared to patients discontinuing pegaptanib or receiving usual care, those remaining on 0.3 mg pegaptanib received additional significant clinical benefit in the second year. further subgroup analyses suggested that pegaptanib treatment was especially effective in those patients who were treated early in the course of their disease.11 pegaptanib showed an excellent safety profile. all dosages were safe, with most adverse events attributable to the injection procedure rather than to the study drug itself. in the first year, serious adverse events occurred with < 1% of intravitreous injections9 and no new safety signals have been identified in patients receiving pegaptanib for two and three years.12,13 the frequencies of serious ocular adverse events for all three years are presented in table 1.12,13 in addition, no systemic safety signals have emerged over this period. these conclusions have also been confirmed in assessments of systemic parameters following intravitreous injection of 1 mg and 3 mg pegaptanib.14 safety and efficacy of pegaptanib were assessed in a randomized, sham - controlled, double - masked, phase 2 trial enrolling 172 diabetic subjects with dme affecting the center of the fovea. intravitreous injections were administered at baseline and every six weeks thereafter. at week 36, 0.3 mg pegaptanib was significantly superior to sham injection, as measured by mean change in va (+ 4.7 letters vs. -0.4 letters, p = 0.04), proportions of patients gaining 10 letters of va (34% vs.10% ; p = 0.003), change in mean central retinal thickness (68 m decrease vs. 4 m increase ; p = 0.02) and proportions of patients requiring subsequent photocoagulation treatment (25% vs. 48%, p = 0.04).15 in addition, a retrospective subgroup analysis revealed that pegaptanib treatment led to the regression of baseline retinal neovascularization in eight of 13 patients with proliferative diabetic retinopathy (pdr) whereas no such regression occurred in three sham - treated eyes or in four untreated fellow eyes.16 early results from a small, randomized, open - label study suggest that adding pegaptanib to panretinal photocoagulation conferred significant clinical benefit in patients with pdr.17 vegf has been implicated in the pathophysiology of crvo.18 accordingly, in a trial that enrolled subjects with crvo of < 6 months duration,19 98 subjects were randomized (1:1:1) to receive intravitreous pegaptanib (0.3 mg or 1 mg) or sham injections every six weeks and panretinal photocoagulation if needed. at week 30, treatment with 0.3 mg pegaptanib was superior in terms of mean change in va, proportions of patients losing 15 letters from baseline, proportions with a final va of 35 letters and reduction in center point and central subfield thickness.19,20 encouraging findings have been reported in small case series investigating the use of pegaptanib for the treatment of neovascular glaucoma,21 retinopathy of prematurity22 and familial exudative vitreoretinopathy.23 in addition, given its positive safety profile, now validated over three years in clinical trials and two and a half years of postmarketing experience, pegaptanib is being studied as a maintenance anti - vegf inhibitor following induction with nonselective anti - vegf agents such as ranibizumab or bevacizumab, which bind all vegf isoforms24,25 and appear to be associated with an increased, albeit small, risk of stroke.26 pivotal clinical trial data have demonstrated that pegaptanib is both effective and safe for the treatment of neovascular amd. these data were derived from two randomized, double - masked studies known jointly as the v.i.s.i.o.n. (vegf inhibition study in ocular neovascularization) trials.9,10 a total of 1186 subjects with any angiographic subtypes of neovascular amd were included. patients received intravitreous injections of 0.3 mg, 1 mg or 3 mg pegaptanib or sham injections every six weeks for 48 weeks. subjects with predominantly classic lesions could also have received photodynamic therapy with verteporfin (pdt ; visudyne, novartis) at investigator discretion. after one year, the 0.3 mg dose conferred a significant clinical benefit compared to sham treatment as measured by proportions of patients losing < 15 letters of visual acuity (va) ; compared with 55% (164/296) of patients receiving sham injections, 70% (206/294) of patients receiving 0.3 mg of pegaptanib met this primary endpoint (p < 0.001). in contrast to pdt, clinical benefit was seen irrespective of angiographic amd subtype, baseline vision or lesion size and led to the clinical approval of pegaptanib for the treatment of all angiographic subtypes of neovascular amd. the 1 mg and 3 mg doses showed no additional benefit beyond the 0.3 mg dose.9 treatment with 0.3 mg pegaptanib was also efficacious as determined by mean va change, proportions of patients gaining vision and likelihood of severe vision loss. in an extension of the v.i.s.i.o.n. study, patients in the pegaptanib arms were rerandomized to continue or discontinue therapy for 48 more weeks.10 compared to patients discontinuing pegaptanib or receiving usual care, those remaining on 0.3 mg pegaptanib received additional significant clinical benefit in the second year. further subgroup analyses suggested that pegaptanib treatment was especially effective in those patients who were treated early in the course of their disease.11 pegaptanib showed an excellent safety profile. all dosages were safe, with most adverse events attributable to the injection procedure rather than to the study drug itself. in the first year, serious adverse events occurred with < 1% of intravitreous injections9 and no new safety signals have been identified in patients receiving pegaptanib for two and three years.12,13 the frequencies of serious ocular adverse events for all three years are presented in table 1.12,13 in addition, no systemic safety signals have emerged over this period. these conclusions have also been confirmed in assessments of systemic parameters following intravitreous injection of 1 mg and 3 mg pegaptanib.14 safety and efficacy of pegaptanib were assessed in a randomized, sham - controlled, double - masked, phase 2 trial enrolling 172 diabetic subjects with dme affecting the center of the fovea. intravitreous injections were administered at baseline and every six weeks thereafter. at week 36, 0.3 mg pegaptanib was significantly superior to sham injection, as measured by mean change in va (+ 4.7 letters vs. -0.4 letters, p = 0.04), proportions of patients gaining 10 letters of va (34% vs.10% ; p = 0.003), change in mean central retinal thickness (68 m decrease vs. 4 m increase ; p = 0.02) and proportions of patients requiring subsequent photocoagulation treatment (25% vs. 48%, p = 0.04).15 in addition, a retrospective subgroup analysis revealed that pegaptanib treatment led to the regression of baseline retinal neovascularization in eight of 13 patients with proliferative diabetic retinopathy (pdr) whereas no such regression occurred in three sham - treated eyes or in four untreated fellow eyes.16 early results from a small, randomized, open - label study suggest that adding pegaptanib to panretinal photocoagulation conferred significant clinical benefit in patients with pdr.17 vegf has been implicated in the pathophysiology of crvo.18 accordingly, in a trial that enrolled subjects with crvo of < 6 months duration,19 98 subjects were randomized (1:1:1) to receive intravitreous pegaptanib (0.3 mg or 1 mg) or sham injections every six weeks and panretinal photocoagulation if needed. at week 30, treatment with 0.3 mg pegaptanib was superior in terms of mean change in va, proportions of patients losing 15 letters from baseline, proportions with a final va of 35 letters and reduction in center point and central subfield thickness.19,20 encouraging findings have been reported in small case series investigating the use of pegaptanib for the treatment of neovascular glaucoma,21 retinopathy of prematurity22 and familial exudative vitreoretinopathy.23 in addition, given its positive safety profile, now validated over three years in clinical trials and two and a half years of postmarketing experience, pegaptanib is being studied as a maintenance anti - vegf inhibitor following induction with nonselective anti - vegf agents such as ranibizumab or bevacizumab, which bind all vegf isoforms24,25 and appear to be associated with an increased, albeit small, risk of stroke.26 pegaptanib is both safe and clinically effective for the treatment of all angiographic subtypes of neovascular amd. early, well - controlled trials further suggest that pegaptanib may provide therapeutic benefit for patients with dme, pdr and rvo. the roles that pegaptanib will ultimately play as part of the ophthalmologists armamentarium remain to be established. the recent results with ranibizumab demonstrating the potential for significant vision gains in amd27,28 have been impressive, but issues of safety remain to be definitively resolved;26 combinatorial regimens may ultimately prove to be most effective in balancing safety with efficacy.24 similarly, more established approaches, such as photodynamic therapy with verteporfin, may provide greater clinical benefit when combined with anti - vegf therapy,29 so that there is likely to be considerable space for empiricism in determining the best approach for a given patient. nonetheless, the overall trend is highly positive, with the anti - vegf agents affording many more options than were available only a few years ago. such successes highlight the importance of vegf in the pathogenesis of ocular vascular disorders and support the use of anti - vegf agents as foundation therapy in patients with these conditions. | pegaptanib sodium (macugentm) is a selective rna aptamer that inhibits vascular endothelial growth factor (vegf) 165, the vegf isoform primarily responsible for pathologic ocular neovascularization and vascular permeability, while sparing the physiological isoform vegf 121. after more than 10 years in development and preclinical study, pegaptanib was shown in clinical trials to be effective in treating choroidal neovascularization associated with age - related macular degeneration. its excellent ocular and systemic safety profile has also been confirmed in patients receiving up to three years of therapy. early, well - controlled studies further suggest that pegaptanib may provide therapeutic benefit for patients with diabetic macular edema, proliferative diabetic retinopathy and retinal vein occlusion. notably, pegaptanib was the first available aptamer approved for therapeutic use in humans and the first vegf inhibitor available for the treatment of ocular vascular diseases. |
fluorescent nucleotide analogues, such as 2-aminopurine (2ap) and pyrrolo - c (pyc), have been extensively used to study nucleic acid local conformational dynamics in bulk experiments. here we present a proof - of - principle approach using 2ap and pyc fluorescence at the single - molecule level. our data show that ssdna, dsdna, or rna containing both 2ap and pyc can be monitored using single - molecule fluorescence and a click chemistry immobilization method. we demonstrate that this approach can be used to monitor dna and rna in real time. this is the first reported assay using fluorescent nucleotide analogs at the single - molecule level. we anticipate that single 2ap or pyc fluorescence will have numerous applications in studies of dna and rna, including protein - induced base - flipping dynamics in protein nucleic acid complexes. |
|
over the last decades, obesity has become a global epidemic and an important public health problem in many countries. this condition is largely due to excessive consumption of saturated fats and simple sugars [2, 3 ], which, associated with sedentarism, represent the modern lifestyle. obesity is recognized as a risk factor for many disorders including type-2 diabetes and nonalcoholic fatty liver disease (nafld). nafld encompasses a spectrum of increasingly severe clinicopathological conditions ranging from fatty liver to steatohepatitis (nash) with or without hepatic fibrosis / cirrhosis. recent evidence suggests that nafld is also associated with cardiovascular and chronic kidney disease and increased risk of hepatocellular carcinoma [58 ]. it has been considered that insulin resistance and hyperinsulinemia play a key role in the pathogenesis of nalfd (first causative step). excessive deposition of fat in adipocytes and muscles determines insulin resistance with subsequent accumulation of fat in the liver, which, in turn, increases the rate of mitochondrial beta - oxidation of fatty acids and ketogenesis that can promote lipid peroxidation and accumulation of reactive oxygen species (ros) in the hepatocytes [10, 11 ]. these compounds generate a variety of cellular stimulations with subsequent inflammatory response, which has been recognized as the causal factor of nash / fibrosis (second causative step) [12, 13 ]. in spite of growing knowledge, several aspects of nafld pathogenesis are still unknown. considering the difficulty in developing human studies to evaluate the influence of nutrition in the development of nafld and associated metabolic abnormalities, experimental models constitute a reliable alternative way. different animal models of nafld / nash have been developed, but few of them replicate the entire human phenotype [12, 14 ]. these models may be classified into three basic categories : those caused by either spontaneous or induced genetic mutation ; those produced by either dietary or pharmacological manipulation ; and those involving genetic mutation and dietary or chemical challenges. the dietary manipulations used in these last two types of models usually do not resemble human dietary pattern. in the present study, we developed a model of obesity and obesity - related nafld in nongenetically modified wistar rats using a simple carbohydrate - rich diet, which resembles the current dietary pattern of humans, and followed the sequence of the pathophysiologic events and their clinical and metabolic consequences. in this context, it should be noted that, in the vast majority of studies on nafld in which animal models were employed, the description of the sequence of the pathophysiologic events and their consequences have not been addressed, as their key goal is usually the evaluation of a specific aspect such as a therapeutic intervention. furthermore, we evaluated the impact of physical training on the metabolic abnormalities associated with this disorder. sixty male wistar rats, approximately 28 days old (after weaning), were housed individually and had free access to water and rat diet. the animals were randomly separated into the following groups : experimental group (eg), fed with highly palatable diet (see below) during 5 (eg5, 6 rats), 10 (eg10, 6 rats), 20 (eg20, 6 rats), and 30 (eg30, 12 rats) weeks, and control group (cg), fed with standard rat chow during 5 (cg5, 6 rats), 10 (cg10, 6 rats), 20 (cg20, 6 rats), and 30 (cg30, 12 rats) weeks. from week 25 to week 30, 12 animals belonging to the eg30 (6 rats) and cg30 (6 rats) were submitted to physical training (see below). at the end of each experimental period, after fasting for 10 hours, the animals were sacrificed. the livers were immediately removed and fragments of about 1 mm thickness were fixed in 4% formaldehyde, dehydrated, immersed in xylene, and then embedded in paraffin for histology. all experiments were approved by the ethics committee of the universidade federal de minas gerais for the care and use of laboratory animals (cetea 53/2007) and were carried out in accordance with the regulations described in the committee 's guiding principles manual. the standard rat chow (nuvilab - cr1 nuvital - colombo, brazil) had the following nutrient composition : protein, 22% ; fat, 4% ; carbohydrate, 42% ; minerals, 10% ; phosphorus, 0.8% ; vitamins, 1% ; fiber, 8% ; water, 12.5%. the chemical analysis revealed that 100 g of this diet contained 309 kcal, 24.8 g of protein, 3.4 g of fat, 44.8 g of carbohydrates, 8.2 g of fixed mineral residue, and 18.8 g of dietary fiber. the diet known as effective in inducing obesity in rats and described as highly palatable was composed of what follows : 33% of standard rat chow compacted to powder, 33% of condensed milk (moa, nestl, brazil), 7% of sucrose (refined sugar, unio, brazil), and 27% of water. the condensed milk was nutritionally composed of carbohydrate, 56.7% ; fat, 8.3% ; protein, 6.7% ; water, 28.3%. according to the chemical analysis, 100 g of dried highly palatable diet contained 339 kcal, 16.1 g of protein, 3.4 g of fat, 61 g of carbohydrates (18% of simple carbohydrates), 5.1 g of fixed mineral residue, and 14.4 g of dietary fiber. the diet was prepared daily, weighed, fractionated in portions, and stored in the feeder for 810 hours. the remaining food in the feeder was weighed to calculate the final amount of ingested food. the water content of the drinking bottles was renewed daily. on a weekly basis, the body weight, thoracic circumference (tc) (measured between the foreleg and hind leg), and nasoanal length were measured. body mass index (bmi), that is, the ratio between body weight (g) and the square of body length (cm), was calculated. all animals were acclimatized to exercise on the motor - driven treadmill (gaustec, brazil) by running at a speed of 10 mmin at 5% inclination for 5 minutes / day, during 5 consecutive days. after exercise familiarization, trained rats were submitted to the physical training protocol, which consisted of running sessions with gradual increase in intensity across 5 weeks, 5 days / week. the speed and duration of the exercise bouts were increased until the rats were able to run at 25 mmin, 5% inclination, during 60 minutes / day. the achievement of this exercise intensity ensures that a significant endurance training effect is produced. in order to ensure that all animals were subjected to the same handling stress, untrained group was submitted to running exercise on the same days of physical training, at the same speed, but for 2 minutes only. measurement of glucose, total cholesterol, very low - density lipoprotein- (vldl-) cholesterol, low - density lipoprotein (ldl-) cholesterol, high - density lipoprotein- (hdl-) cholesterol, and triglycerides was performed as recommended by the manufacturer (bioclin, quimbasa, basic chemistry ltda, brazil) using an autoanalyzer (statplus 2300, yellow spring inst, usa). serum concentrations of leptin and insulin were determined by radioimmunoassay (rat leptin ria kit, rat insulin ria kit, linco research, usa) using a gamma - ray counter (mor - abbot, usa). the minimum detection value was 0.5 ng / ml. the determination of superoxide dismutase (sod) activity was adapted from dieterich.. briefly, fresh liver samples were homogenized in 50 mm sodium phosphate buffer (1 ml, ph 7.8, 37c) and 1 mm of diethylenetriamine pentaacetic acid (dtpa), immediately after their removal. the reaction was initiated by addition of pyrogallol acid (0.2 mm / l, 37c for 3 minutes) and the absorbance measured at 420 nm. sod activity was calculated as u / mg protein, where 1 u of the enzyme was defined as the amount required to inhibit the oxidation of pyrogallol by 50%. catalase (cat) activity was measured in the supernatant of liver homogenate as described by nelson and kiesow. briefly, 0.04 ml of h2o2, 0.06 ml of liver homogenate, and 1.9 ml of potassium phosphate buffer (50 mm, ph 7.0) were mixed to give a final concentration of 6 mm of h2o2. the decomposition of h2o2 by cat was evaluated by the change in absorbance at 240 nm. cat activity was expressed as mmol of h2o2 decomposed per minute per milligram of protein. this procedure was adopted to avoid the possibility of interference in the activity of glutathione peroxidase, once the necessary cofactors were not present in the reaction medium. histological sections were prepared from the material embedded in paraffin and stained with hematoxylin - eosin. the criteria established by brunt. were used to describe the histological lesions. according to these criteria, macrovesicular steatosis is quantified based on the percentage of involved hepatocytes (0 = absent ; 1 66%), and its zonal distribution and the presence of microvesicular steatosis are noted ; hepatocellular ballooning is evaluated for zonal location, and the estimate of its severity (mild, marked) is based on the numbers of hepatocytes showing this abnormality. hepatic expression of malondialdehyde (mda), leptin, and the leptin receptor ob - r was evaluated by immunohistochemistry in the animals sacrificed at weeks 20 and 30. from paraffin embedded tissues, sections on salinized slides (4 mm) were collected, deparaffinized, and hydrated. for immunohistochemistry, antigen reaction with ethylenediaminetetraacetic acid (edta) at ph 8.0, no steamer for 30 minutes at 98c, was conducted, followed by tris hcl ph 7.6 washing. the whole procedure was performed using polymer detection system kit (novolink polymer detection system, novocastra, usa). the primary antibodies used were anti - mda monoclonal antibody (1f83) (cosmo bio co., ltd., japan) diluted in 0.5 ml ; anti - ob (a-20) sc-84 ; and anti - ob - r (h-300) sc-8325 (santa cruz biotechnology inc., usa) at a dilution of 1 : 250 and 1 : 100, respectively. data are presented as frequencies and percentages, mean standard deviation (sd), and median and interquartile range (iqr). for each quantitative response 's variables, we developed linear regression models in which all variables with p value 0.25 at univariate analysis would be included initially. however, due to the high level of correlation between the explanatory covariates, we opted to adjust the final model with the following covariates : group, physical training, variation in bmi (bmi), and variation in the amount of ingested calories (kcal). the adequacy of the models was assessed by analysis of the residues. for the categorical variables, logistic regression models were developed, with inclusion of the variables that showed on the univariate analysis a p value 0.25, and also clinical significance. the results of the anthropometric parameters, lipid and glucose profile, hormones levels, and antioxidant enzymes activity, as well the results of their comparative analyses between eg and cg along the time of follow - up, are described in tables 1, 2, and 3. insulin (figure 1(a)) and leptin (figure 1(b)) serum levels varied inversely over time in the eg. liver histology was normal (figure 2(a)) in the cg in all times of the experiment. steatosis and hepatocellular ballooning (figures 2(b) and 2(c)) were observed only in the eg, from week 10. steatosis was macro- and microvacuolar, located predominantly in zone 3 of the liver acinus. the intensity of the macrovacuolar steatosis varied from mild (involvement of less than 33% of the hepatocytes) to severe (involvement of more than 66% of the hepatocytes) regardless of the time of the experiment. ballooning was localized in zones 2 and 3 of the acinus, ranging from mild to marked and mismatched with the time of experiment. the reaction for identifying mda (figure 2(d)) was positive and intense, of cytoplasmic localization in zone 3 of the hepatic acinus, around the central vein, in eg20 and eg30. leptin (figure 2(e)) was identified in the cytoplasm especially in zone 3 of the acinus, in eg20 and eg30. in cg rats, ob - r was expressed as a weak cytoplasmic reaction predominantly in zone 3 of the acinus, in the rats of both groups, at weeks 20 and 30. the comparison of the different variables between physical trained and untrained groups showed higher serum levels of hdl - cholesterol in the first group : medians 75 mg / dl and 52.2 mg / dl, respectively (p = 0.007). no other clinical or metabolic variable was significantly different between the groups after the physical training. table 4 shows the results of the final linear and logistic regressions models. in summary, blood glucose levels were 49% higher in eg rats than in cg rats, and the rats studied for 10 and 30 weeks had an increase of 49% and 65%, respectively, in serum glucose compared to those studied for 5 weeks. total cholesterol was 19.2 mg / dl higher in the eg in comparison with the cg. rats undergoing physical training showed an average of 27.1 mg / dl increase in hdl - cholesterol than those that did not exercise ; and each increase of 1 unit in kcal intake caused an average reduction of 0.03 mg / dl in hdl - cholesterol levels. regarding ldl - cholesterol, there was an average increase of 60.2 mg / dl for each increase of 1 unit in bmi. the first, composed by the time (categorical) and groups of rats, showed that the eg20 and eg30 had, respectively, lower insulin values of 83% and 89% compared to eg5. furthermore, the animals of eg had an average insulin levels increased by 123% compared to the cg. the second model, including time (quantitative form), groups of rats, and kcal intake, showed that, for each increase of 1 unit in time, the average value of insulin decreased by 7% and, for each increase of 1 unit in kcal intake, the average value of insulin increased by 0.2%. the eg rats had an average insulin level increased by 100% compared to those of the cg. in eg20 and eg30, the leptin values were 33% and 40% higher, respectively, compared to the rats followed for 5 weeks. the eg had a mean value of leptin increased by 267% compared to the cg, and for every increase of 1 unit in bmi the average value of leptin increased by 124.6%. the amount of sod was 24% lower in the animals followed for 30 weeks in relation to those studied for 5 weeks. in the eg, the mean values of sod were 11% lower compared to the cg ; and, for each increase of 1 unit in bmi, the mean sod values decreased by 54%. the rats studied for 20 weeks presented an average of 2.4 less cat units than those studied for 5 weeks, and in the eg an average of 1.8 less units of cat relative to the cg was observed. concerning the histological findings, it was found that, for each increase of 1 unit in the tc, the chance of expressing ballooning and steatosis increased by 50%. this study demonstrates that a diet with high amount of simple carbohydrates, which resembles the current human dietary pattern, was able to induce obesity - related nafld, here characterized histologically by hepatic steatosis and hepatocyte ballooning, clinically by increased tc and bmi associated with hyperleptinemia, and metabolically by hyperglycemia, hyperinsulinemia (with subsequent insulin return to baseline levels), hypertriglyceridemia, increased serum levels of vldl - cholesterol, depletion of antioxidants liver enzymes, and increased levels of mda, an oxidative stress marker. furthermore, rats that underwent physical training showed a significant increase in hdl - cholesterol in comparison to those that did not exercise. high - fat and methionine choline - deficient diets are widely used to produce hepatic steatosis and nash in experimental animals [12, 14, 2126 ]. however, these diets do not reflect the usual dietary pattern of humans regarding their composition. diets high in both saturated fat and simple carbohydrate have also been commonly used in genetically modified or wild - type animals in experimental models of nafld [2735 ]. animal models in which nafld was induced by simple carbohydrate - rich diets (usually fructose) are less numerous, and in most of them only hepatic steatosis was observed [28, 3644 ]. although the animal models that combine naturally occurring or induced genetic mutations associated with dietary or chemical challenges resemble the histopathology and pathophysiology of human nafld more closely, the dietary challenge is usually performed by high - fat or methionine choline - deficient diets [12, 14, 4547 ]. although each of these models is valuable, they fail to address key aspects of the process in humans. for example, few humans have diets that are deficient in methionine and choline. moreover, rodents exposed to methionine- and choline - deficient diets are not obese ; rather, they lose weight and become more insulin - sensitive. on the other hand, the diet used in our investigation was balanced in terms of its content in proteins, lipids, carbohydrates, vitamins, and minerals, in addition to being highly palatable, normocaloric, and fiber containing. furthermore, it was administered in solid consistency, as pellets, during a relatively long period of time. what has usually been described in the other animal investigations is a rapid induction of obesity due to the administration, in a short period of time, of a high - caloric high - fructose and/or high - fat diet, as liquid in troughs or via a nasogastric tube. in synthesis, we sought to feed the animals with a diet as similar as possible to a normal diet regarding its content as well as its form of administration. in our study, free access to the sucrose - rich diet and high food consumption caused obesity / abdominal obesity in the eg rats from week 10. obesity was associated with increased serum levels of glucose, triglycerides, vldl - cholesterol, and insulin, which are manifestations of insulin resistance [9, 49 ]. the hyperinsulinemia led to increased hepatic synthesis of fatty acids, triglyceride accumulation in the hepatocytes, with subsequent steatosis. the de novo hepatic lipogenesis, which is aggravated by diets with higher carbohydrate content than fat, plays an important role in glucose homeostasis and development of hypertriglyceridemia and hyperinsulinemia [50, 51 ]. for example, when the amount of ingested carbohydrate exceeds the total calorie needs, the rate of de novo hepatic lipogenesis increases by 10 times. likewise, this rate increases 27 times with the ingestion of a diet with high carbohydrate content compared to low - carbohydrate diets and fasting. a positive correlation between increase in serum levels of leptin and bmi was another finding of this study that corroborates human observations. the hyperleptinemia may be not only a consequence of hyperphagia and obesity, but also a result of the fructose component of the diet, which is in agreement with the study by vil., which demonstrated induction of hyperleptinemia by fructose. in humans, increased levels of leptin are observed in obese individuals and in patients with nafld / nash. it is suggested that this increase may reflect a state of leptin resistance at central level as well in the muscles and liver [56, 57 ]. in an attempt to understand the action of leptin in the liver and its possible role in the pathogenesis of nafld / nash, we evaluated the expression of leptin and ob - r in the hepatic parenchyma and found intense leptin reaction in eg30, whereas ob - r was observed in both groups, without difference between them. a possible role of leptin as an inducer of hepatic mitochondrial beta - oxidation has been postulated. huang. demonstrated that leptin in vivo enhances the activity of the fatty acid oxidative pathway in the liver, thus contributing to the reduction of triglycerides and vldl - cholesterol in rats without leptin resistance. on the other hand, some authors observed increased mitochondrial beta - oxidation in the liver of leptin deficient mice (ob / ob) with severe steatosis. cao. showed that leptin, in the long term, can cause hepatic fibrosis due to the increase of the local levels of oxidative stress. therefore, it is possible to hypothesize that leptin may play a protective role in the early stages of nafld ; and, at later stages, it may contribute to the development of fibrosis. further studies are necessary to clarify the biological function of leptin in the normal liver and its possible role in diet - induced nafld. early stages of nafld were present in all liver samples of the eg from week 10. at the final stage of the investigation, although more exuberant steatosis was expected, the pattern was similar to that observed at week 10. the duration of the study may not have been long enough to allow the development of more severe steatosis and the histological changes that characterize nash. as the hepatic lesions that occur in nash are associated with the expression of proinflammatory cytokines in the liver, it is possible that their investigation could have demonstrated nash at an early stage. it is also possible to speculate that the high levels of leptin could be exerting a protective effect. mda, a marker of lipid peroxidation, presented exuberant expression in the eg, whereas this reaction was negative in the cg. oxidative stress induced by lipid peroxidation is a result of oxidant / antioxidant system imbalance. cellular stimulation by ros and the subsequent inflammatory response have been described as the second hit that culminate with the development of nash [62, 63 ]. in this context, we found in eg30 a reduction in the levels of the antioxidants enzymes sod and cat. this observation suggests that during the initial phases of the experiment there was a balance between antioxidants / prooxidants constituents ; however, over time, an imbalance in favor of prooxidants was developed. the use of diets with high amounts of simple carbohydrates induces hypertriglyceridemia resulting in reduction of the antioxidants reserves [64, 65 ]. although we observed hepatocellular ballooning denoting cell injury, one limitation of our study is the fact of not detecting nash histologically. this was also a finding in several of the previous models in which nafld was induced by a simple carbohydrate - rich diet [28, 3644 ]. as stated above, it is possible that the time of the experiment was not long enough to enable the development of the histological characteristics of nash, which may require higher levels of ros and/or longer exposure to the offending agent, in addition to liver susceptibility probably related to genetically determined factors, such as preexisting defects in mitochondrial oxidative phosphorylation [66, 67 ]. in the presence of intense and sustained production, ros can cause damage to cell membranes, proteins, and dna, leading to the release of proinflammatory cytokines, activation of hepatic stellate cells, fibrogenesis, and direct liver damage. the physical training used in this study was effective in increasing hdl - cholesterol, corroborating the findings from a study in zucker rats. on the other hand, other authors found no significant effect on hdl - cholesterol in rats or mice submitted to physical training [71, 72 ]. no other metabolic parameter suffered alteration in response to physical exercise, which could have been due, at least partially, to the time not long enough of the physical training. in this context, 12 weeks of regular exercise reduced liver triglyceride content and serum levels of ldl - cholesterol in the kk / ta mice fed a high - sucrose diet. in humans, evidence suggests that regular exercise reduces the risk factors for nash [1, 8 ]. our study demonstrated that a diet enriched with sucrose induced obesity, insulin resistance, diabetes, oxidative stress, and subsequent hepatic steatosis and hepatocellular ballooning. the lack of histologically evident inflammation and fibrosis in the liver parenchyma may have been due to the insufficient time of the experiment. | the pathogenesis of nonalcoholic fatty liver disease (nafld) is not fully understood, and experimental models are an alternative to study this issue. we investigated the effects of a simple carbohydrate - rich diet on the development of obesity - related nafld and the impact of physical training on the metabolic abnormalities associated with this disorder. sixty wistar rats were randomly separated into experimental and control groups, which were fed with sucrose - enriched (18% simple carbohydrates) and standard diet, respectively. at the end of each experimental period (5, 10, 20, and 30 weeks), 6 animals from each group were sacrificed for blood tests and liver histology and immunohistochemistry. from weeks 25 to 30, 6 animals from each group underwent physical training. the experimental group animals developed obesity and nafld, characterized histopathologically by steatosis and hepatocellular ballooning, clinically by increased thoracic circumference and body mass index associated with hyperleptinemia, and metabolically by hyperglycemia, hyperinsulinemia, hypertriglyceridemia, increased levels of very low - density lipoprotein- (vldl-) cholesterol, depletion of the antioxidants liver enzymes superoxide dismutase and catalase, and increased hepatic levels of malondialdehyde, an oxidative stress marker. rats that underwent physical training showed increased high - density lipoprotein- (hdl-) cholesterol levels. in conclusion, a sucrose - rich diet induced obesity, insulin resistance, oxidative stress, and nafld in rats. |
alzheimer 's disease (ad) is the most common form of dementia, characterized by progressive cognitive impairment, cerebral atrophy, and neuronal loss, with death generally occurring four to eight years after diagnosis. two pathological hallmarks of ad, extracellular neuritic plaques primarily composed of amyloid beta (a) and intracellular neurofibrillary tangles (nfts) primarily composed of tau protein, were originally identified in 1907 by dr. while great strides have been made in understanding the mechanisms that promote aggregation of a and tau into the hallmark plaques and tangles, comparatively little progress has been achieved in halting or curing the disease. analysis of familial ad cases implicated production of a as a primary factor in progression of ad, leading to the rise of the amyloid cascade hypothesis which states that a misfolding and aggregation initiates ad pathogenesis and triggers other effects such as tau phosphorylation, aggregation, and tangle formation. the amyloid hypothesis had dominated the field for more than a decade and has driven numerous clinical studies for therapeutic interventions including several immunization studies targeting a [46 ]. however failure of several clinical trials targeting a has cast doubt on its relevance as a therapeutic target. increasing evidence indicates that tau also plays an important role in the progression of ad. tau misfolding and aggregation can take place independently of amyloid formation, and in many cases the presence of tau lesions is associated with ad without presence of a aggregates. clearance of a plaques without reducing soluble tau levels is insufficient to ameliorate cognitive decline in double transgenic mice overexpressing a and tau p301l. these results among many others indicate that oligomeric tau may be an important therapeutic target for ad. tau in its monomeric form is a microtubule - associated protein crucial for microtubule assembly [11, 12 ] and stabilization. six major tau isoforms can be generated by alternative posttranscriptional splicing of exon 2 and exon 3 on the n - terminal projection domain and of exon 10 (repeat 2) on the assembly domain (figure 1). tau contains three or four similar repeats in the microtubule - binding domain (mbd) that binds to and helps promote microtubule stability and function. for example, repeat 2 and repeat 3 contain hexapeptide motifs of phf6 and phf6, respectively (figure 1). these motifs increase the tendency to form -sheet structures that can interact with tubulins to form microtubules and also facilitate self - assembly to generate oligomeric and higher - order aggregates [14, 15 ]. tau isoforms with or without the second microtubule - binding repeat can aggregate, but only the isoforms with the second repeat can form extended oligomeric forms mediated by disulfide linkages due to the additional cysteine in the second repeat (figures 1 and 2). therefore, in this study we utilized tau isoforms containing the second repeat unit to study the role of tau aggregation in neurotoxicity. hyperphosphorylation of tau is required for the release of tau from microtubules and its mislocalization to the somatodendritic compartment enabling tau to self - associate into oligomers and higher - order aggregates. however, the hyperphosphorylation of tau is not directly related to its toxicity but rather a mechanism to regulate its interaction with tubulin to stabilize microtubules and to regulate transport along microtubules. expression of exogenous tau in mature hippocampal neurons leads to blockage of transport along microtubules and degeneration of synapses that can be rescued by phosphorylation of tau by kinase mark2 to unblock the microtubule tracks. significantly, tau in the extracellular space is reported to be less phosphorylated than intracellular tau [17, 18 ] and more toxic in its dephosphorylated state. extracellular oligomers of recombinant full - length human tau protein were shown to be neurotoxic in mice and impair memory consolidation, and similar work at other labs has shown similar effects with recombinant tau oligomers and tau oligomers composed of hyperphosphorylated tau from ad brain. thus, the hyperphosphorylation of tau associated with disease may be a causal factor in tau self - association into oligomers, but the hyperphosphorylation of tau in and of itself may not be the basis for the toxicity of extracellular tau oligomers. neurofibrillary tangles (nfts) have traditionally been correlated with neuronal loss and considered to be key intracellular indicators of ad. approaches for targeting tau aggregation have focused on inhibiting hyperphosphorylation and fibril formation, reducing total tau levels, or stabilizing microtubules. however, accumulating evidence suggests that soluble oligomeric rather than insoluble fibrillar tau species are neurotoxic and play an important role in the onset and progression of ad [2124 ]. although nfts are a hallmark feature of ad, they can exist in ad neurons for up to 20 to 30 years before postmortem confirmation and therefore are less likely to induce immediate toxicity in ad brain. in animal models of tauopathy, the presence of nfts does not correlate well with neuronal loss and memory deficits. reduction in neuronal loss and improvement in memory performance are observed despite an increase in nfts. in addition, the presence of nft pathology does not localize well with areas of neuronal loss [2931 ], synapse loss or dysfunction in the hippocampus along with microglial activation occurs well before the presence of nfts. in contrast, oligomeric tau was implicated in numerous studies as playing a key role in ad progression [3335 ] and to be a primary initiator of neurotoxicity and neurodegeneration. oligomeric tau has been identified in early stages of neuronal cytopathology in ad and closely correlates with hyperphosphorylation on microtubule - binding sites. tau oligomers can propagate endogenous tau pathology throughout the brain similarly to prions, demonstrating their neuronal toxicity. the presence and concentrations of two tau oligomers (140 kda and 170 kda) correlate with memory loss in various age rtg4510 mice. although tau is predominantly intracellular, the role of extracellular tau is gaining attention as extracellular oligomeric tau can have acute effects on long - term potentiation in hippocampal slices and can transmit pathology to healthy neurons. detection of oligomeric tau levels in human csf and blood is also a promising ad diagnostic biomarkers along with total and hyperphosphorylated tau levels. because of the important role of oligomeric tau in ad and the recognition of the importance of extracellular tau in disease, it is critical to identify the key toxic tau species in disease etiology. here we show our studies of the extracellular neurotoxicity of monomeric, dimeric, and trimeric forms of two four - repeat recombinant human tau variants to help identify the key tau species involved in the onset and progression of ad. rhtau was purified as monomers from bacterial (bl21 de3) clones with tau constructs in the pet21b and pet29a vectors. standard methods were used to grow and induce the protein with 1 mm iptg. pelleted cells were lysed with cellytic b lysis buffer, lysozyme, benzonase, and protease inhibitors according to the manufacturer 's protocol (sigma aldrich, st. cation exchange (ge healthcare life sciences) was used for the first step of purification with sp - sepharose resin for both tau constructs, and 300 mm nacl in 25 mm tris - hcl ph 7.4 was used to elute tau protein. amicon ultra centrifugal devices (millipore) were used to buffer - exchange the protein preparations into 50 mm tris - hcl ph 7.4. tau oligomers were generated by incubating tau monomers at a concentration of 5 m in 50 mm tris buffer ph 7.4 with 100 mm nacl at 37c overnight. the monomeric and oligomeric species were resolved by 6% page, eluted, and buffer - exchanged into 50 mm tris - hcl. fractions were analyzed by nonreducing sds - page to minimize degradation of oligomeric proteins and silver staining to enhance the signal and to verify the purity of tau variants. aliquots of 10 l 0.50 m purified tau variants in 50 mm tris - hcl buffer were deposited on separate mica pieces for imaging using multimode afm nanoscope iiia system (veeco / digital instruments, santa barbara, ca) which was set in tapping mode and equipped with silicon afm probes (vista probes, nanoscience instruments). height distribution analysis of the different tau samples was fit to a normal distribution probability model using gwyddion 2.20. all detectable protein molecules were assumed to be spherical and the height values approximate their diameters. sh - sy5y human neuroblastoma cell lines (american tissue culture collection) were cultivated in tissue culture flask (falcon by becton dickinson labware). cells were grown in a medium containing 44% v / v ham 's f-12 (irvinescientific), 44% v / v mem earle 's salts (irvinescientific), 10% v / v denatured fetal bovine serum (fbs) (sigma aldrich), 1% v / v mem nonessential amino acids (invitrogen), and 1% v / v antibiotic / antimycotic (invitrogen). the cells were passaged to a new flask when they were confluent in the flask. for toxicity studies, the sh - sy5y cells were seeded in a 48-well cell culture cluster plate (costar by corning incorporated) with 5 10 cells / well in 300 l fresh medium. after growth in a 37c incubator for 24 hours, the tissue culture media were replaced with fresh serum - free media for the neurotoxicity test on nondifferentiated cells. to investigate tau toxicity on cholinergic neurons, a duplicate set of the cultured cells was induced into cholinergic - like phenotype by incubation with retinoic acid at a final concentration of 10 m for 3 to 5 days [43, 4547 ]. the cultivated nondifferentiated and cholinergic - like neurons were treated with monomeric, dimeric, and trimeric variants of 1n4r and 2n4r at final concentrations of 2.26 nm, 4.50 nm, 11.15 nm, and 15.50 nm. cultures were incubated with tau species at 37c and sampled at 3, 18, 24, and 48 hour time points by harvesting 30 l / well aliquots of culture supernatant. the ldh protocol is adapted from a commercial kit (sigma aldrich) based on the generic protocol of decker and lohmann - matthes. relative absorbance values were calculated by subtracting the reference values from the values obtained at 490 nm. the relative absorbance values of all samples were normalized to those of controls which were set as 100% for each independent experiment. group mean values were analyzed by one - way anova with p < 0.05 standard and lsd post hoc significant differences test. we expressed recombinant human tau in a bacterial host system to eliminate any posttranslational phosphorylation of tau and therefore remove any potential effects that phosphorylation may have on tau aggregation or loss of function. the resulting nonphosphorylated human recombinant tau (nprhtau) monomers contain reactive cysteine groups with free thiols, facilitating the formation of intramolecular disulfide bonds to make stable nonreactive monomers and the formation of intermolecular disulfide bonds to produce tau oligomers and higher - degree aggregates (figure 2). the nonreactive monomeric, dimeric, and trimeric forms of both the 2n4r and 1n4r splice variants generate stable aggregate morphologies with defined size profiles dependent on the degree of oligomerization and length of the splice variant as evidenced by sds - page (figure 3) and afm height distribution analysis (figure 4). the oligomer heights increment for each additional monomeric tau unit is fixed within a certain isoform, which is 0.5 nm for 1n4r variants and 1.0 nm for the 2n4r variants (figure 4). the size of each respective 2n4r species is also larger than the corresponding 1n4r species (figures 3 and 4) as expected given that tau 2n4r contains the extra n - terminal insert compared with the 1n4r variants. while neither the monomeric or dimeric forms of tau from either the 1n or 2n splice variants displayed detectable toxicity, the trimeric form of both variants exerted marked toxicity toward nondifferentiated (figure 5(a)) and retinoic acid induced cholinergic - like neurons (figure 5(b)) with ldh values well above the toxic threshold of 150 at low nanomolar concentrations (11.15 nm, and 15.50 nm). the full - length 2n4r trimeric tau form displayed significantly higher toxicity than the 1n4r trimeric form toward nondifferentiated neurons (figure 5(a)), although the effect is diminished in the cholinergic - like neurons (figure 5(b)). when trimeric tau was added to nondifferentiated sh - sy5y cells, an increase in toxicity was observed with time at the highest concentrations for both the 1n4r (figure 6(a)), and 2n4r (figure 6(b)) trimeric variants. however, when trimeric tau was added to the cholinergic - like neurons, the toxicity of the 1n (figure 6(c)) and 2n (figure 6(d)) variants was relatively consistent over the first 24 hours, but increased after 48 hours. both variants of trimeric tau showed increased toxicity toward the cholinergic - like neurons compared to the nondifferentiated neurons at short incubation times (figure 7(a)) but the reverse was observed at longer incubation times (figure 7(b)). while the amyloid cascade hypothesis has dominated studies into the etiology of ad over the last decade or more, the importance of tau in the onset and progression of ad is steadily becoming more apparent. tau pathology has been observed in the absence of a deposits in children and young adult cases, and tau aggregates in the entorhinal - hippocampal regions precede the onset of a pathology [8, 9 ]. numerous studies have shown that various oligomeric forms of a are toxic to neurons and can impair cognitive performance [50, 51 ], thus implicating their potential role as valuable biomarkers for diagnosing ad [42, 52, 53 ]. similar to the important role of various soluble oligomeric a species in ad, different soluble oligomeric forms of tau may also play a critical role in ad, also causing neuronal loss and cognitive dysfunction [19, 54, 55 ]. therefore to facilitate diagnoses and therapeutic treatments for ad, it is important to identify the key tau species involved in the onset and progression of the disease. given that tau has multiple splice variants and posttranslational modification sites, we attempted to simplify the complex diversity of tau forms by focusing on two nonphosphorylated human recombinant tau isoforms, 1n4r and 2n4r. these two four - repeat (4r) isoforms of tau both have all four repeats of the microtubule - associated domains and are more prone to form the aggregates readily phosphorylated by brain protein kinases than those with only three repeats (3r) due to the presence of repeat 2 with a microtubule - affinity enhancing hexapeptide motif [14, 15 ] and an additional cysteine that forms disulfide linkages to stabilize the aggregates. the most disease - relevant tau material to use to study toxicity of extracellular tau forms would be well characterized tau oligomers purified from ad cerebrospinal fluid (csf) using methods to preserve their posttranslational modifications, including phosphorylation, glycation, ubiquitination, aggregation, and truncation. preparations from several non - ad and ad cases would be necessary to understand the significance of the results. here we performed an initial study focused specifically on unmodified tau protein oligomers and control monomer to specifically understand the relevance of oligomer structure to extracellular toxicity. we determined the toxicity of the different tau variants using both nondifferentiated and cholinergic - like neuroblastoma cell lines to determine how aggregate size and cell phenotype affected toxicity. cholinergic cells are particularly vulnerable in ad with significant neuronal loss in the nucleus basalis of meynert (nbm), that is, the hippocampus and the cortex. nbm is enriched in cholinergic cells and undergoes degeneration and a significant decrease of acetylcholine production in ad. decreased levels of acetylcholine and a number of other cortical cholinergic markers lead to clinical dementia and impairment in cognitive function, indicating that cholinergic cells are particularly vulnerable in ad. here we show that trimeric, but not monomeric or dimeric, tau is toxic to neuronal cells at low nanomolar concentrations and that the full - length 2n tau variant is more toxic than the shorter 1n variant to nondifferentiated neurons (figure 5). both trimeric tau variants cause toxicity to both nondifferentiated sh - sy5y cells and retinoic acid induced cholinergic - like neurons when tau was applied extracellularly at nanomolar levels (figure 6). however, the cultured cholinergic - like neurons show increased susceptibility to trimeric tau induced toxicity at short incubation times compared with similar nondifferentiated neurons (figure 7(a)), perhaps partially accounting for the increased vulnerability of cholinergic - like neurons in ad. since the nondifferentiated cells were equally susceptible to trimeric tau induced toxicity at longer incubation times (figure 7(b)), these results suggest that toxicity of extracellular trimeric tau is not dependent on receptors or proteins specifically associated with cholinergic cells but that toxicity might be facilitated by them. our results are consistent with a recent study showing that low molecular weight (lmw) misfolded tau species exclusive of monomeric tau can be endocytosed by neurons and transported both anterogradely and retrogradely to induce endogenous tau pathology in vivo while fibrillar tau and brain - derived filamentous tau can not be endocytosed. this suggests that tau toxicity may be spread through cells in certain brain regions by endocytosis of trimeric and larger oligomeric forms of tau and that this uptake is facilitated in cholinergic neurons. neuronal toxicity of oligomeric tau may share similar properties to that of oligomeric a where the critical feature involved in neuronal toxicity is the aggregation state of the protein more than posttranslational modifications [23, 60 ]. while there are a wide variety of tau variants that occur in vivo including different posttranslational modifications, splice variants, and aggregated species, this study begins to more systematically probe the role of selected tau variants in ad. further studies are needed to determine the contribution of splice variants and ad - specific posttranslational modifications found in extracellular tau to the toxicity of the tau variants and to how these tau variants affect other neuronal models including primary neurons or induced pluripotent stem cells. well characterized reagents that can selectively identify specific tau variants and morphologies will be useful for these further studies. | in alzheimer 's disease (ad), tau aggregates into fibrils and higher order neurofibrillary tangles, a key histopathological feature of ad. however, soluble oligomeric tau species may play a more critical role in ad progression since these tau species correlate better with neuronal loss and cognitive dysfunction. recent studies show that extracellular oligomeric tau can inhibit memory formation and synaptic function and also transmit pathology to neighboring neurons. however, the specific forms of oligomeric tau involved in toxicity are still unknown. here, we used two splice variants of recombinant human tau and generated monomeric, dimeric, and trimeric fractions of each isoform. the composition of each fraction was verified chromatographically and also by atomic force microscopy. the toxicity of each fraction toward both human neuroblastoma cells and cholinergic - like neurons was assessed. trimeric, but not monomeric or dimeric, tau oligomers of both splice variants were neurotoxic at low nanomolar concentrations. further characterization of tau oligomer species with disease - specific modifications and morphologies is necessary to identify the best targets for the development of biomarker and therapeutic development for ad and related tauopathies. |
a large percentage of individuals (28%34%) with alzheimer s disease (ad) live alone in their own homes,1,2 and it is reasonable to assume that the number of solitary - living elderly individuals with dementia will increase in the future. the longer life expectancy of humans implies the rise of ad prevalence rates.3 in sweden, the number (percentage) of people aged 60 years and older who live alone has increased from about 299,000 (23%) in 1960 to 768,000 (32%) in 2012.4 these factors imply an additional pressure on the increasing societal costs of dementia care. ad is characterized by a progressive and irreversible decline in cognition and activities of daily living (adl). even in mild ad, a pronounced impairment in the ability to carry out instrumental adl (iadl) tasks, such as shopping, housekeeping, handling finances, and traveling by bus or car, has been observed.5 thus, ad is a devastating disease, as affected individuals experience a gradual loss of independence, as well as difficulties in making well - informed decisions and evaluating potential risks.6 the community - based care of persons with dementia is anticipated to increase in the future.3 social structural changes, such as long geographical distances between adult children and their aging parents and the full - time working status of most women, imply limited informal help from family members.7 about 50% of the informal help received by ad patients has been reported to consist of surveillance, avoidance of repetitive or dangerous activities, and management of behavioral symptoms.8 lack of help in monitoring these expressions of ad may lead to safety issues for individuals who live alone. moreover, difficulties in detecting increasing impairment in their cognitive and functional abilities could negatively affect the opportunities of solitary - living individuals of receiving necessary formal help and medical care.9 living alone with dementia is also a strong risk factor for nursing home placement, in particular among male patients. a study performed by our group found that the risk of nursing home placement for solitary - living males with ad was four times greater than that recorded for those living with a spouse or another relative.2 several studies have investigated persons with dementia living alone.1014 nevertheless, different dementia diagnoses may yield different outcomes and amounts of service utilization.15,16 studies exclusively including ad patients are few, and none are recent or have lasted longer than 1 year.1,9,11 compared with participants not living alone, these studies showed that solitary - living individuals with ad were mainly females and had a lower income.1,9 however, inconsistent results regarding age9,11 and cognitive status1,9 were obtained. home - help services are often the first community - based services that are used as ad progresses. lower adl capacity was a predictor of the presence and use of a larger amount of home health care among elderly persons with various diseases, whereas conflicting results regarding cognitive ability have been observed.17 a recent ad study from our group showed that better iadl performance, living with a family member, and higher doses of cholinesterase inhibitors (cheis) postponed the usage of home - help services and predicted fewer hours of home help.18 two older cross - sectional studies reported differences in service - utilization patterns for example, the more frequent use of home - making and home - delivered meals among solitary - living ad patients than among those living with family.9,11 a long - term investigation of the extent of impairment in people with ad living alone in their own homes and analyses of whether the amount of home - help services received is related to both cognitive and functional deficits has not been published previously. this 3-year study aimed : 1) to describe the long - term cognitive and functional abilities of solitary - living individuals with ad ; 2) to compare these outcomes with those of patients living with a family member ; and 3) to identify the potential predictors of usage of community - based home - help services and nursing home placement for these two living - status groups. the swedish alzheimer treatment study (sats) is a 3-year, prospective, open, nonrandomized, multicenter study that was undertaken to investigate the long - term effectiveness of chei treatment (donepezil, rivastigmine, and galantamine) in routine clinical practice. the participants progression of ad was assessed from different clinical and societal perspectives, such as cognition, adl, and the usage of community - based services (eg, home - help services and nursing home placement). results from the sats have been reported in several previous publications.2,5,18,19 in total, 1,258 outpatients with ad were recruited from 14 memory clinics located in diverse geographical parts of sweden. among them, 1,021 individuals had mild - to - moderate ad (mini - mental state examination [mmse ] score,20 1026) at the start of chei treatment (baseline) and were included in the present study. before inclusion, all sats participants underwent a thorough clinical examination to rule out other causes of dementia. patients aged 40 years and older who received a clinical diagnosis of dementia as defined by the diagnostic and statistical manual of mental disorders, 4th edition,21 and possible or probable ad according to the criteria of the national institute of neurological and communicative disorders and stroke and the alzheimer s disease and related disorders association (nincds - adrda)22 were considered for inclusion in the sats. moreover, the participants were required to live in their own home with or without home - help services at the time of ad diagnosis, to have a responsible caregiver (generally the spouse or an adult child), and to be assessable using the mmse at the start of chei therapy. concomitant medications were documented at baseline and were allowed during the study, with the exception of memantine. the dates of eventual nursing home placement and death were recorded, as well as the date of, and reason for, any withdrawal from the sats. all patients and/or caregivers gave their written informed consent to participate in the study, which was conducted according to the provisions of the helsinki declaration and was approved by the ethics committee of lund university, lund, sweden. the sats participants were investigated in a well - structured 3-year follow - up program that evaluated cognition, iadl, basic adl abilities, and the presence of service utilization every 6 months. trained dementia nurses assessed the adl performance and recorded the amounts of services used per week (if any) in an interview with the caregiver. after inclusion and the baseline evaluations, the patients were prescribed cheis as a part of the ordinary swedish health care system, in accordance with the approved product labeling. the sats is an observational study and the choice of chei agent and dose was left entirely up to the physician s discretion and professional judgment. cognitive ability was evaluated using the mmse, with scores ranging from 030 ; a lower score indicates more impaired cognition. the instrumental activities of daily living (iadl) scale23 consists of eight items : telephone usage ; shopping ; food preparation ; housekeeping ; doing laundry ; mode of transportation ; responsibility for own medications ; and handling finances. severity was scored per item : from 1 (no impairment) to 35 (severe impairment), for a total range of 831 points. therefore, a mathematical correction of the sum of the iadl scores was performed to prevent those tasks from affecting the results. the equation used the data from the rated items to estimate a total score within the range of the total iadl scale.2 the physical self - maintenance scale (psms)23 consists of six items : toileting ; feeding ; dressing ; grooming ; physical ambulation ; and bathing. each item was scored on a range of 1 (no impairment) to 5 (severe impairment), thus allowing a total range of 630 points. home - help services mean that a professional helper comes to the individual s own home to help with daily domestic duties, such as preparing meals, cleaning, washing up, doing the laundry, shopping for necessities, and accompanying the care recipient outside the home, as well as providing help with the administration of the prescribed medications, moreover, assist with personal hygiene, toilet visits, bathing, dressing, and eating. neither more advanced medical care or therapy (which is performed by registered district nurses, physical therapists, or occupational therapists), nor transportation services, meals - on - wheels, or help with managing finances are included in these services. the amount of home - help services provided was recorded in terms of number of hours per week. nursing home placement was defined as the permanent admission to a licensed skilled nursing facility with 24-hour care (ie, rehabilitative or respite care were not included). if hospitalization occurred prior to nursing home entry, the date of hospital admission was used. the rates of cognitive and functional changes in the individuals who were admitted to nursing homes were calculated as the change in score from baseline to the last assessment before nursing home placement, divided by the number of months that elapsed between these assessments. for those who were not admitted, the rates of change were computed as the change in score from baseline to their last assessment, divided by the number of months. to facilitate comparisons of rates of change in mmse, iadl, and psms scores, change in score was converted to positive values (which indicated improvement) and negative values (which indicated worsening). the ibm statistical package for the social sciences (spss) software (version 22.0 ; ibm corporation, armonk, ny, usa) was used to perform the statistical analyses. the level of significance was defined as p 0.05 for all four regression models, indicating a good fit of the model to the data. regarding the home - help service models, the independent variables were classical risk factors, such as age at baseline, sex, and years of education ; the genetic risk factor of the presence of the apolipoprotein e (apoe) 4 allele (no / yes) ; cognitive, instrumental, and basic adl abilities ; and the number of medications and specific concomitant medications (no / yes for each group : antihypertensive / cardiac therapy, antidiabetics, nonsteroidal anti - inflammatory drugs [nsaids]/acetylsalicylic acid, lipid - lowering agents, antidepressants, antipsychotics, and anxiolytics / sedatives / hypnotics) used at baseline. in the nursing home placement models, the independent variables were age at baseline, sex, years of education, apoe genotype, mmse, iadl, and psms scores at baseline and the corresponding rates of decline per month, and the amount of home - help services (hours / week) used at the last assessment prior to nursing home entry. the swedish alzheimer treatment study (sats) is a 3-year, prospective, open, nonrandomized, multicenter study that was undertaken to investigate the long - term effectiveness of chei treatment (donepezil, rivastigmine, and galantamine) in routine clinical practice. the participants progression of ad was assessed from different clinical and societal perspectives, such as cognition, adl, and the usage of community - based services (eg, home - help services and nursing home placement). results from the sats have been reported in several previous publications.2,5,18,19 in total, 1,258 outpatients with ad were recruited from 14 memory clinics located in diverse geographical parts of sweden. among them, 1,021 individuals had mild - to - moderate ad (mini - mental state examination [mmse ] score,20 1026) at the start of chei treatment (baseline) and were included in the present study. before inclusion, all sats participants underwent a thorough clinical examination to rule out other causes of dementia. patients aged 40 years and older who received a clinical diagnosis of dementia as defined by the diagnostic and statistical manual of mental disorders, 4th edition,21 and possible or probable ad according to the criteria of the national institute of neurological and communicative disorders and stroke and the alzheimer s disease and related disorders association (nincds - adrda)22 were considered for inclusion in the sats. moreover, the participants were required to live in their own home with or without home - help services at the time of ad diagnosis, to have a responsible caregiver (generally the spouse or an adult child), and to be assessable using the mmse at the start of chei therapy. concomitant medications were documented at baseline and were allowed during the study, with the exception of memantine. the dates of eventual nursing home placement and death were recorded, as well as the date of, and reason for, any withdrawal from the sats. all patients and/or caregivers gave their written informed consent to participate in the study, which was conducted according to the provisions of the helsinki declaration and was approved by the ethics committee of lund university, lund, sweden. the sats participants were investigated in a well - structured 3-year follow - up program that evaluated cognition, iadl, basic adl abilities, and the presence of service utilization every 6 months. trained dementia nurses assessed the adl performance and recorded the amounts of services used per week (if any) in an interview with the caregiver. after inclusion and the baseline evaluations, the patients were prescribed cheis as a part of the ordinary swedish health care system, in accordance with the approved product labeling. the sats is an observational study and the choice of chei agent and dose was left entirely up to the physician s discretion and professional judgment. cognitive ability was evaluated using the mmse, with scores ranging from 030 ; a lower score indicates more impaired cognition. the instrumental activities of daily living (iadl) scale23 consists of eight items : telephone usage ; shopping ; food preparation ; housekeeping ; doing laundry ; mode of transportation ; responsibility for own medications ; and handling finances. severity was scored per item : from 1 (no impairment) to 35 (severe impairment), for a total range of 831 points. therefore, a mathematical correction of the sum of the iadl scores was performed to prevent those tasks from affecting the results. the equation used the data from the rated items to estimate a total score within the range of the total iadl scale.2 the physical self - maintenance scale (psms)23 consists of six items : toileting ; feeding ; dressing ; grooming ; physical ambulation ; and bathing. each item was scored on a range of 1 (no impairment) to 5 (severe impairment), thus allowing a total range of 630 points. home - help services mean that a professional helper comes to the individual s own home to help with daily domestic duties, such as preparing meals, cleaning, washing up, doing the laundry, shopping for necessities, and accompanying the care recipient outside the home, as well as providing help with the administration of the prescribed medications, moreover, assist with personal hygiene, toilet visits, bathing, dressing, and eating. neither more advanced medical care or therapy (which is performed by registered district nurses, physical therapists, or occupational therapists), nor transportation services, meals - on - wheels, or help with managing finances are included in these services. the amount of home - help services provided was recorded in terms of number of hours per week. nursing home placement was defined as the permanent admission to a licensed skilled nursing facility with 24-hour care (ie, rehabilitative or respite care were not included). if hospitalization occurred prior to nursing home entry, the date of hospital admission was used. the rates of cognitive and functional changes in the individuals who were admitted to nursing homes were calculated as the change in score from baseline to the last assessment before nursing home placement, divided by the number of months that elapsed between these assessments. for those who were not admitted, the rates of change were computed as the change in score from baseline to their last assessment, divided by the number of months. to facilitate comparisons of rates of change in mmse, iadl, and psms scores, change in score was converted to positive values (which indicated improvement) and negative values (which indicated worsening). the ibm statistical package for the social sciences (spss) software (version 22.0 ; ibm corporation, armonk, ny, usa) was used to perform the statistical analyses. the level of significance was defined as p 0.05 for all four regression models, indicating a good fit of the model to the data. regarding the home - help service models, the independent variables were classical risk factors, such as age at baseline, sex, and years of education ; the genetic risk factor of the presence of the apolipoprotein e (apoe) 4 allele (no / yes) ; cognitive, instrumental, and basic adl abilities ; and the number of medications and specific concomitant medications (no / yes for each group : antihypertensive / cardiac therapy, antidiabetics, nonsteroidal anti - inflammatory drugs [nsaids]/acetylsalicylic acid, lipid - lowering agents, antidepressants, antipsychotics, and anxiolytics / sedatives / hypnotics) used at baseline. in the nursing home placement models, the independent variables were age at baseline, sex, years of education, apoe genotype, mmse, iadl, and psms scores at baseline and the corresponding rates of decline per month, and the amount of home - help services (hours / week) used at the last assessment prior to nursing home entry. among the 1,021 outpatients included in the sats, 355 (35%) were living alone at the start of chei therapy (shortly after the time of ad diagnosis). the sociodemographic and clinical characteristics of the participants according to living status (solitary living or living with a family member) are shown in table 1. the individuals who lived alone were predominantly female and used more antidepressant and antipsychotic medications, but less lipid - lowering agents. they were also significantly older at the onset of ad and at the start of chei treatment (baseline). the basic adl capacity was more impaired among the solitary - living patients, and these individuals used a greater number of medications at baseline. the apoe genotype, years of education, cognitive and iadl abilities, and specific concomitant medications (antihypertensives / cardiac therapy, antidiabetics, nsaids / acetylsalicylic acid, and anxiolytics / sedatives / hypnotics) did not differ between the two groups. the iadl capacity was already markedly impaired at baseline : 50%65% of the ad patients were dependent on assistance to perform these activities (iadl score : 25). the percentage of participants with impairment in the individual iadl items was similar between the groups of patients who lived alone and those who did not, with the exception of the shopping and housekeeping tasks, for which significantly fewer solitary - living individuals depended on assistance (figure 1a). regarding basic adl, most patients were able to manage themselves independently, with the exception of physical ambulation (more than 50% of individuals needed some assistance ; psms score : 25). a significantly larger percentage of participants living alone were impaired in the adl items toileting, grooming, physical ambulation, and bathing, whereas a greater proportion of individuals living with family needed assistance with dressing (figure 1b). at the start of chei treatment, 267 (75%) of the solitary - living sats participants home - help services were used by 85 (32%) of the mild and 48 (55%) of the moderate (mmse score : 1019) ad patients (p<0.001). the mean standard deviation (sd) hours of home - help services used per week was 5.74.4 hours among the individuals living alone ; no differences were detected according to disease stage or sex. a significant difference in mean iadl score at baseline was observed between the mild and moderate ad patients : 14.64.9 points versus 19.25.2 points (p<0.001). sex, age at baseline, and number of medications used did not differ between the solitary - living patients in the two stages of ad. no significant sex - based differences were observed at the start of chei treatment regarding age, cognitive and functional abilities, and number of medications used. among the 355 participants who lived alone, 133 (37%) used home - help services at the start of chei therapy compared with 31 (5%) of those living with family (p<0.001). binary logistic regression models according to living status at the start of chei therapy suggested that several risk factors were independently associated with the presence of home - help services. the odds ratios, their 95% confidence intervals (cis), and the p - values for these factors are listed in table 2. among the solitary - living ad patients, the use of home - help services was significantly associated with lower iadl capacity and a higher number of medications at baseline. these two variables correctly classified 79.7% of the individuals living alone regarding the usage of home - help services. for those living with a family member, the usage of home - help services was related to female sex, older age, lower basic adl ability, and a greater number of medications used. these four variables correctly classified 95.7% of the patients not living alone regarding the presence of home - help services at baseline. the mean sd usage of home - help services was 5.54.8 hours / week, and no significant difference according to living status was observed. among all participants, a greater amount of home - help assistance at baseline exhibited linear associations with lower iadl (r=0.342 ; p<0.001) and basic adl (r=0.292 ; p<0.001). among individuals living alone, the amount of home - help service hours used was also correlated with iadl (r=0.409 ; p<0.001) and psms (r=0.347 ; p<0.001) scores ; however, similar significant relationships were not observed for those living with family. age, cognitive status, or number of medications used were not linearly associated with the amount of home - help service use in any of the groups. after 3 years of chei treatment, 376 participants (37%) remained in the sats : 108 (29%) lived alone in their own home ; 213 (57%) lived with a family member ; and 55 (15%) resided in nursing homes. seventy - seven of the 108 solitary - living individuals (71%) used a mean of 9.26.6 hours of home - help services per week, with no sex - based differences. the clinical characteristics and endpoints of the ad patients according to living status are shown in table 3. the remaining solitary - living participants were mainly female, were significantly older, and had a more impaired basic adl ability (but similar cognitive and iadl status) than did those living with a family member. the mean dose of chei received during the study did not differ significantly according to living status. the iadl capacity was strongly impaired after 3 years : 80%90% of the remaining individuals living alone or with family and 100% of the nursing home residents could not carry out these tasks independently (figure 2a). in addition, more than 45% of the participants needed assistance in performing the basic adl item grooming, and more than 70% required help with physical ambulation, regardless of living status. a significantly larger percentage of the solitary - living patients were impaired in the adl items toileting, grooming, and bathing compared with those not living alone (figure 2b). compared with those living with a family member, the percentage of participants living alone who were admitted to nursing homes during the study (34%) was twofold, and the mean time between the start of chei therapy and admission was ~5 months shorter among these individuals. the percentage of deceased sats patients did not differ between these two groups (table 1). regarding the solitary - living participants, nursing home placement was significantly associated with worse iadl performance or a more rapid rate of decline in iadl. these two variables correctly classified 64.6% of the individuals living alone in terms of their admission to nursing homes. for those living with a family member, nursing home placement was independently related to female sex, lower iadl capacity, faster rate of deterioration in iadl, and a greater amount of usage of home - help services at the last assessment before nursing home entry. these four variables correctly classified 82.9% of the patients not living alone regarding nursing home placement during the study. the odds ratios, their 95% cis, and the p - values for these factors are listed in table 4. among the 1,021 outpatients included in the sats, 355 (35%) were living alone at the start of chei therapy (shortly after the time of ad diagnosis). the sociodemographic and clinical characteristics of the participants according to living status (solitary living or living with a family member) are shown in table 1. the individuals who lived alone were predominantly female and used more antidepressant and antipsychotic medications, but less lipid - lowering agents. they were also significantly older at the onset of ad and at the start of chei treatment (baseline). the basic adl capacity was more impaired among the solitary - living patients, and these individuals used a greater number of medications at baseline. the apoe genotype, years of education, cognitive and iadl abilities, and specific concomitant medications (antihypertensives / cardiac therapy, antidiabetics, nsaids / acetylsalicylic acid, and anxiolytics / sedatives / hypnotics) did not differ between the two groups. the iadl capacity was already markedly impaired at baseline : 50%65% of the ad patients were dependent on assistance to perform these activities (iadl score : 25). the percentage of participants with impairment in the individual iadl items was similar between the groups of patients who lived alone and those who did not, with the exception of the shopping and housekeeping tasks, for which significantly fewer solitary - living individuals depended on assistance (figure 1a). regarding basic adl, most patients were able to manage themselves independently, with the exception of physical ambulation (more than 50% of individuals needed some assistance ; psms score : 25). a significantly larger percentage of participants living alone were impaired in the adl items toileting, grooming, physical ambulation, and bathing, whereas a greater proportion of individuals living with family needed assistance with dressing (figure 1b). at the start of chei treatment, 267 (75%) of the solitary - living sats participants were in the mild stage of ad (mmse score : 2026). home - help services were used by 85 (32%) of the mild and 48 (55%) of the moderate (mmse score : 1019) ad patients (p<0.001). the mean standard deviation (sd) hours of home - help services used per week was 5.74.4 hours among the individuals living alone ; no differences were detected according to disease stage or sex. a significant difference in mean iadl score at baseline was observed between the mild and moderate ad patients : 14.64.9 points versus 19.25.2 points (p<0.001). sex, age at baseline, and number of medications used did not differ between the solitary - living patients in the two stages of ad. no significant sex - based differences were observed at the start of chei treatment regarding age, cognitive and functional abilities, and number of medications used. among the 355 participants who lived alone, 133 (37%) used home - help services at the start of chei therapy compared with 31 (5%) of those living with family (p<0.001). binary logistic regression models according to living status at the start of chei therapy suggested that several risk factors were independently associated with the presence of home - help services. the odds ratios, their 95% confidence intervals (cis), and the p - values for these factors are listed in table 2. among the solitary - living ad patients, the use of home - help services was significantly associated with lower iadl capacity and a higher number of medications at baseline. these two variables correctly classified 79.7% of the individuals living alone regarding the usage of home - help services. for those living with a family member, the usage of home - help services was related to female sex, older age, lower basic adl ability, and a greater number of medications used. these four variables correctly classified 95.7% of the patients not living alone regarding the presence of home - help services at baseline. the mean sd usage of home - help services was 5.54.8 hours / week, and no significant difference according to living status was observed. among all participants, a greater amount of home - help assistance at baseline exhibited linear associations with lower iadl (r=0.342 ; p<0.001) and basic adl (r=0.292 ; p<0.001). among individuals living alone, the amount of home - help service hours used was also correlated with iadl (r=0.409 ; p<0.001) and psms (r=0.347 ; p<0.001) scores ; however, similar significant relationships were not observed for those living with family. age, cognitive status, or number of medications used were not linearly associated with the amount of home - help service use in any of the groups. after 3 years of chei treatment, 376 participants (37%) remained in the sats : 108 (29%) lived alone in their own home ; 213 (57%) lived with a family member ; and 55 (15%) resided in nursing homes. seventy - seven of the 108 solitary - living individuals (71%) used a mean of 9.26.6 hours of home - help services per week, with no sex - based differences. the clinical characteristics and endpoints of the ad patients according to living status are shown in table 3. the remaining solitary - living participants were mainly female, were significantly older, and had a more impaired basic adl ability (but similar cognitive and iadl status) than did those living with a family member. the mean dose of chei received during the study did not differ significantly according to living status. the iadl capacity was strongly impaired after 3 years : 80%90% of the remaining individuals living alone or with family and 100% of the nursing home residents could not carry out these tasks independently (figure 2a). in addition, more than 45% of the participants needed assistance in performing the basic adl item grooming, and more than 70% required help with. a significantly larger percentage of the solitary - living patients were impaired in the adl items toileting, grooming, and bathing compared with those not living alone (figure 2b). compared with those living with a family member, the percentage of participants living alone who were admitted to nursing homes during the study (34%) was twofold, and the mean time between the start of chei therapy and admission was ~5 months shorter among these individuals. the percentage of deceased sats patients did not differ between these two groups (table 1). regarding the solitary - living participants, nursing home placement was significantly associated with worse iadl performance or a more rapid rate of decline in iadl. these two variables correctly classified 64.6% of the individuals living alone in terms of their admission to nursing homes. for those living with a family member, nursing home placement was independently related to female sex, lower iadl capacity, faster rate of deterioration in iadl, and a greater amount of usage of home - help services at the last assessment before nursing home entry. these four variables correctly classified 82.9% of the patients not living alone regarding nursing home placement during the study. the odds ratios, their 95% cis, and the p - values for these factors are listed in table 4. in this naturalistic ad study, we found that a substantial number of patients (who were predominantly older females) lived alone with severe cognitive and functional impairments. the basic adl capacity was lower and the number of concomitant medications used was higher among the solitary - living individuals compared with those living with a family member. a significantly larger percentage of the ad patients who lived alone used home - help services at baseline ; however, no difference in the amount of home - help service usage according to living status was found. lower iadl (solitary living) or basic adl (living with family), but not cognitive ability, and a greater number of medications used were independent predictors of the presence of home - help services, whereas more impaired iadl at baseline and its faster rate of decline predicted nursing home placement. for individuals not living alone, female sex and older age were significantly associated with the usage of community - based services, and a greater number of home - help hours / week predicted nursing home placement. the amount of home - help services used did not reflect the stage of ad among the solitary - living individuals. more than one - third of the participants in the present study lived alone at baseline (approximately the time of ad diagnosis). this percentage was higher than that reported earlier by studies of ad,1,9 and it may reflect the increasing number of solitary - living people in many countries.24,25 in sweden, most of the elderly people who do not live alone live with their spouses, and only ~2% live with their adult children.26 similar trends were observed in the other northern and western european countries.24 furthermore, greater geographical distances between family members because of, for instance, work opportunities, and the fact that many women work full time outside the home, imply that the time available to give care to aging relatives has decreased.7 hence, the demand and need for support from community - based services might be expected to increase. our findings that the solitary - living ad patients had lower basic adl capacity and used more concomitant medications than did those living with a family member are alarming. in contrast, most previous studies on dementia have reported that the functional abilities of individuals living alone were more preserved,10,12,14 or that there were no differences according to living status.1,13 this observation could be an effect of swedish government policy over the last 2 decades, which is similar to that of other northern and western european countries namely, that it is best for elderly people to remain in their own homes instead of being transferred to special housing accommodations.3 therefore, those who receive care at home nowadays have a worse health status and a larger need for care. after 3 years, 46% of the remaining solitary - living individuals in this ad study needed help with bathing, 57% required help with grooming, and 75% needed help with physical ambulation. patients with dementia tend to underestimate the severity and importance of their cognitive impairment, which might lead to loss of insight and judgment. those living alone could have problems performing tasks that are critical to daily living and are unlikely to seek the help that they may need;12 therefore, they have more unmet needs, such as those pertaining to hygiene, nutrition, and avoiding falls.13 in the current study, no significant difference in cognitive ability was observed according to living status, which was in line with the results of some previous dementia studies.1,13 other studies found better cognitive performance among the solitary - living participants compared with those who did not live alone.9,10,12 cognitive status was not a predictor of the presence or the amount of home - help services used in our study. earlier studies have reported conflicting results regarding whether there is a relationship between home health care and the care recipient s cognitive impairment.17 a recent study of ad performed by our group found the alarming result that a lower cognitive ability predicted fewer hours of home - help service, which suggests that these individuals were not able to request the additional formal help that they may have needed.18 however, home - help services do not directly take into account the needs associated with cognitive decline, such as supervision, controlling behavioral symptoms, and avoiding dangerous situations, but they may meet the needs of demented persons by helping them in their functional deficiencies.27 informal help was also not sufficient to meet the needs of individuals with dementia regarding companionship and psychological distress.13 one out of four solitary - living sats patients was in the moderate stage of ad (mmse score : 1019) at baseline. the percentage was slightly lower than that reported by a community - based study of cases of dementia,12 in which 18.6% of those living alone had an mmse score < 18 (15.2% in our study). this level of cognitive deficiency may imply that these patients have difficulties in making informed / appropriate decisions and evaluating potential risks, which raises the question of safety for these individuals. lower iadl capacity was an independent predictor of the usage of home - help services for solitary - living participants with ad in the present study, whereas more impaired basic adl was a corresponding predictor for those living with family. informal caregivers might be reluctant to provide personal care because individuals with dementia can express aggressive behaviors when receiving help with grooming, for example.27 in addition, the caregivers of recipients with more impaired adl experience greater burden.14 female sex and older age also independently predicted the presence of home help for individuals not living alone. our aforementioned findings indicate that the spouse or another family member provides help with iadl for those who do not live alone ; however, for female ad patients, the risk of the usage of home - help services was three times higher. female spouses are more likely willing to perform care for a longer period when compared with male caregivers.28 in the sats, the amount of home - help services used per week showed weak - to - moderate linear associations (r=~0.350.40) with both iadl and basic adl for the solitary - living individuals, but not for those living with family. these observations suggest that the functional impairments of patients with ad living alone were addressed, to some extent, by community - based services. the current study showed that iadl and its progression rate are key variables for predicting admissions to nursing homes, which was in accordance with previous ad studies.2,29 for those not living alone, the risk of nursing home placement was almost twofold for females, which again suggests that male spouses are less willing to care for their wives. for each hour of additional home - help services used, the risk of nursing home entry was 7% greater among those living with family ; in contrast, this observation was not significant among the solitary - living patients. however, the percentage of individuals who were correctly classified was lower in that model, which indicated that admission to a nursing home for care recipients who live alone is more complex and depends on a larger number of factors. because the amount of home help does not take into account the individual s cognitive impairment, this type of service might be less important in preventing nursing home placement for solitary - living patients. the percentage of deceased sats participants during the 3-year study did not differ according to living status. other dementia studies found a similar result,11 or they reported that the mortality rate of those living alone was lower compared with individuals living with a family member.1,10 the explanations for the longer survival time observed among the solitary - living patients in these studies might include the higher frequency of females in this group and less or equal disease severity at baseline. in contrast, our ad patients who lived alone exhibited a worse basic adl performance and received more medications. furthermore, all previous studies had a shorter duration (2 years). the advantages of this 3-year, large - sample, prospective sats study are the use of well - structured, 6-month follow - up evaluations of the various aspects of disease progression in ad (such as cognitive and functional status and their less - often analyzed rates of change over time), as well as community - based service utilization. a representative ad cohort of chei - treated participants with concomitant disorders and medications from swedish memory clinics located in different geographical areas was enrolled in this study. in sweden, the welfare state assures the right to publicly - funded necessary care for all residents, with no obligation from relatives. the type and amount of community - based services required are evaluated according to the deficits of the care recipient in a similar way through the social service system, irrespective of municipality. thus, services mirror the individuals actual needs for formal care, regardless of socioeconomic status.26 the sats program represents person - centered, high - quality, regular care and communication with a particular nurse for each participant, which entails continuity and safety for the patients and their families and 100% compliance with chei therapy.30 one of the limitations of this study of individuals with ad living alone was that the volume of informal care, if any, was not recorded. however, most help provided to the elderly persons with dementia was observed to come from family members living in the same household.10,31 it was noteworthy that the areas that exhibited unmet needs most frequently were those provided by relatives.13 the sats participants were required to have a knowledgeable informant ; thus, individuals with no identified caregiver were not included. solitary - living ad patients without family might be even less likely to access needed social and medical services ; therefore, they could be at greater risk of harm.9,12 the usage of community - based services may be influenced by other reasons that do not emerge from the individual s ad (eg, somatic disorders and caregiver issues), which were not investigated in the sats. the strong predictors of service utilization identified in the multivariate statistical models in the present study are stable and consistent with earlier reports. there is no indication that these predictors would be less significant if they were mediated by other variables. to improve and extend our knowledge of solitary living in the context of ad, future studies are required to investigate the presence, type, and amount of informal care, as well as caregiver burden, among ad patients living alone furthermore, it is necessary to determine whether informal care or burden differ depending on the caregiver s relation to the patient. additional studies are required to evaluate whether solitary - living individuals with ad receive the amount of formal services that they really need according to their deficits, especially cognitive impairment. furthermore, it is essential to focus on how community - based service can best identify care recipients with dementia who are at risk of receiving an inadequate volume of service, as well as their potentially unmet needs. in conclusion, this naturalistic study showed that a substantial number of ad patients, mostly older females, live alone with severe cognitive and functional deficits. cognitive ability was not a significant predictor in the multivariate models of usage of home - help services, which suggests that formal care met the needs related to cognitive decline to a lesser extent. for patients not living alone, female sex was significantly related to community - based service utilization, and basic adl capacity was related to home - help service usage. these findings imply that male spouses are less willing to assume a caregiving role, and that family members are reluctant to provide help regarding personal care. an increased understanding of how community - based services can better accommodate the care needs of solitary - living individuals with cognitive deficits is important. | introductionmany individuals with alzheimer s disease (ad) live alone, and this figure is expected to increase. this study aimed to describe the cognitive and functional abilities of solitary - living ad patients, and the potential predictors of their usage of community - based services.methodsthis 3-year, prospective, multicenter study included 1,021 participants with mild - to - moderate ad (mini - mental state examination score, 1026) treated with a cholinesterase inhibitor in a routine clinical setting. at baseline and every 6 months, patients were assessed using cognitive, instrumental, and basic activities of daily living (adl) scales, and service utilization was recorded. logistic regression models were used to predict the usage of community - based services.resultsat the start of cholinesterase inhibitor therapy (time of ad diagnosis), 355 individuals (35%) were living alone. they were mainly female, older, had more impaired basic adl capacity, and had a larger number of concomitant medications when compared with those living with family. regarding the solitary - living patients, lower instrumental adl (iadl) ability and more medications were independent predictors of usage of home - help services, whereas more impaired iadl at baseline and faster iadl deterioration were predictors of nursing home admission. for those living with family, older age, lower basic adl, and a greater number of medications predicted home - help services, whereas a larger amount of home help predicted nursing home placement. in addition, female sex was a risk factor for both the utilization of home - help services and nursing home placement. cognitive ability was not significantly associated with the usage of community - based services.conclusiona large number of ad patients, predominantly females, live alone with severe cognitive and functional impairment. the amount of home - help services used did not reflect cognitive severity, suggesting that home help did not meet the needs related to cognitive deterioration. increased knowledge of how community - based services can better accommodate the care needs of solitary - living individuals with ad is essential. |
paragangliomas (pgls) are uncommon tumors (incidence 1 - 2 per 100,000) and based on their locations, the tumors are often given special designations. only three percent (3%) of all pgls occur within the head and neck of which the majority are located in the carotid body (carotid body tumors), temporal - bone / middle - ear (glomus jugulare), and the vagus nerves in the neck (vagal pgls). ninety percent of the head and neck pgls are sporadic, only 10% are hereditary in nature. parasympathetic extra - adrenal pgls are located predominantly in the head and neck ; and about 95% of such tumors are nonsecretory in nature. in contrast with the sympathetic pgls, the parasympathetic extra - adrenal pgls are more often familial and less likely to be malignant. the diagnosis of hereditary pgl syndrome is based on physical examination, family history, imaging studies, biochemical testing, and molecular genetic testing for the mutations, involving the subunits of succinate dehydrogenase, a mitochondrial enzyme. in this article, we describe a patient with pgl presenting as a parotid gland mass which turned out to be a diagnostic dilemma in the initial fine needle aspiration (fna) due to its unexpected location. to our knowledge, the patient was a 56-year - old woman, with a history of unrepaired tetralogy of fallot and eisenmenger 's syndrome, who was admitted to our medical center with atrial flutter / atrial fibrillation, palpitations, and possible cerebrovascular accident due to the congenital heart disease. magnetic resonance angiography (mra) evaluation of the head and neck showed an incidental right parotid gland mass. subsequent ultrasound of this area showed a 2.0 1.5 cm solid tumor located in the deep within the parotid gland, which was presumed to be a pleomorphic adenoma. cytological evaluation of the initial fna smears showed moderate cellularity consisting of atypical epithelioid cells in disorganized groups, strips, and single cells. the atypical cells showed enlarged nuclei with variably granular chromatin, occasional nucleoli, anisonucleosis, and scant delicate cytoplasm [figure 1a and b ]. rare salivary gland acinar and ductal cells were noted as small groups in the blood - tinted background. since the cell block was paucicellular, two of the papanicolaou - stained slides were re - stained for synaptophysin and keratin by immunohistochemistry (ihc). the positive immunostain of the cells for synaptophysin [figure 1c ] was compatible with a tumor of neuroendocrine origin. subsequently, a diagnosis of atypical cells present, suspicious for neuroendocrine tumor was rendered. composite photomicrographs of the tumor showing epithelioid cells arranged in a group with granular chromatins (a, fna pap stain, 40 obj.) ; pleomorphic nuclei with nucleoli (b, fna diff - quick stain, 100 obj.) ; and cells with positive staining for synaptophysin (c, fna, 100 obj.). the histological section of the tumor (d, h and e, 40 obj.) shows epithelioid or chief cells which are arranged in a pseudoalveolar pattern (zellballen) nested in a vascular stroma which were positive for synaptophysin but negative for cytokeratin. hyperchromatic spindle shaped sustentacular cells are at the periphery of the chief cell nests (arrows). they were only positive for s-100 on the basis of diagnosis of neuroendocrine tumor by fna, a total parotidectomy and neck dissection was performed. during the surgery, the 2.0 cm mass was confirmed to be in the central portion of the deep lobe of the parotid gland. on gross examination, the tumor was a red - pink, firm, well - circumscribed mass, measuring 2.2 1.5 1.4 cm. histological evaluation of the surgical specimen [figure 1d ] showed epithelioid cells arranged in an alveolar pattern in nests surrounded by capillary networks. a second type of cell was seen at the periphery of the nests which was more of a spindle shape. the nested (chief) cells were positive for chromogranin and synaptophysin, while negative for keratin and s-100. a final histological diagnosis of pgl was made based on the characteristic morphology and immunohistochemical stains. an incidental metastatic papillary thyroid carcinoma was identified in one of twenty - one dissected lymph nodes. this finding led to a subsequent ultrasound of the thyroid gland which revealed a previously unknown sub - centimeter mass with calcifications suspicious for papillary thyroid carcinoma. due to the urgent cardiac problem of the patient, most of the parotid gland tumors (80%) are benign comprising of pleomorphic adenoma and warthin 's tumor, both in solid and cystic forms. remaining entities include oncocytoma, basal cell adenoma, and ductal papilloma in the benign category. mucoepidermoid carcinoma, polymorphous low - grade adenocarcinoma, acinic cell carcinoma, adenoid cystic carcinoma, malignant mixed tumor, and squamous cell carcinoma are amongst the malignant category. pgls most commonly present as an asymptomatic palpable mass in the anterior triangle of the neck. the mass is usually slow growing and can easily be confused by the clinicians for a lymph node or other head and neck tumors. sympathetic extra - adrenal pgls are generally confined to the thorax, abdomen, and pelvis, and are typically secretory which produce catecholamines. the classic radiographic features are homogeneous or heterogeneous hyper - enhancing soft - tissue mass as shown by computed tomography (ct) scan ; multiple areas of signal void interspersed with hyperintense foci (salt - and - pepper appearance) within tumor mass as shown by magnetic resonance imaging (mri) ; and as an intense tumor blush with enlarged feeding arteries by angiography. the preferred term for tumors of the extra - adrenal paraganglia is paraganlioma, prefaced by the anatomic site of the origin. tumors arising from the paraganglia of the adrenal medulla are called pheochromocytoma. pgls are highly vascular tumors composed of two types of cells that are arranged in a pseudoalveolar pattern known as zellballen or literally cell balls in german. type i cells, the chief cells, are predominate in pgls and contain catecholamine - bound granules (positive for synaptophysin and chromogranin). type ii or sustentacular cells stain positive for s-100, devoid of granules (negative for synaptophysin and chromogranin), and are located at the periphery of the small pseudoalveolar clusters of type i cells. malignancy can not be determined by cytology or even by histological findings and is only defined when the tumor metastasizes to regional lymph nodes or more distant sites. nuclear polymorphism, neurovascular invasion, high mitotic indices, and necrosis have been described in both benign and malignant types of the tumors. on cytology, the cellularity may range from highly cellular to almost acellular, depending on the amount of contaminating red blood cells during sampling. the neoplastic cells may have a variable morphology including classically described acinar arrangements with salt - and - pepper chromatin, but can also have spindle and pleomorphic forms with dense granular chromatin. the differential diagnosis for this cytological pattern varies widely and depends on the morphological pattern of the tumor. aside from the other salivary gland lesions as previously mentioned, given the location, one may consider malignant melanoma, follicular variant of thyroid carcinoma and/or adenocarcinoma with an acinar pattern, whereas, a more spindled cell pattern could be suspected for a medullary thyroid carcinoma or even a sarcoma. a combination of history, tumor location, clinical impression, radiology findings, and confirmatory ihc will assist in identifying the majority of these tumors. fna biopsy has been performed on numerous occasions to establish a diagnosis of pgl.[1116 ] however, the exact role of fna in diagnosis of these tumors has not been currently established. the main concern in performing a pre - operative fna on suspected pgls is the risk of hemorrhage and hematoma. in this article not only are we reporting the first pgl of the parotid gland in the literature, but also would like to emphasize the cytological features of the tumor in fna aiding in the diagnosis. this case report illustrates the importance of a broad differential diagnoses when confronted with unexpected cytology in an otherwise routine parotid gland fna with emphasis on morphological evaluation and immunohistochemical confirmation. the second criterion is positivity for chromogranin - a and synaptophysin with negativity for cytokeratin by ihc. in contrast, the cells in the classical neuroendocrine tumors are positive for cytokeratin in a punctate form. third, presence of a highly - bloody fna background is a characteristic and helpful feature. it is needless to say that always malignant melanoma should be in the differential diagnoses list. a simple ihc stain with hmb45 and/or melan - a antibodies will aid to rule out the latter. the findings in this patient extend the spectrum of the pgls to the parotid and perhaps to all major salivary glands. close interaction between the pathologists, radiologists, and the surgeons is required to avoid aggressive and unnecessary surgical procedures, such as the lymph node dissection, as it was in this case. av cytopathology fellow, collected all the data, participated in cytological evaluation, and drafting of manuscript. nam performed conceptual organization, cytological - histological evaluation, drafted and reviewed the manuscript. as this is a case report without patient identifiers, approval from the institutional review board (irb) is not required at our institution. to ensure the integrity and highest quality of cytojournal publications, the review process of this manuscript was conducted under a double blind model (authors are blinded for reviewers and vice versa) through automatic online system | paragangliomas (pgls) are uncommon tumors. although pgls are known to occur in the head and neck region, especially the carotid body, middle ear, and larynx, involvement of the parotid glands has not been reported. in this article, we report the fine needle aspiration features of tumor in an unusual location, presenting as a parotid gland mass, submitted to pathology for initial diagnosis. the clinical presentation, cytomorphology, and the immunohistochemical features for the diagnosis are described. to our knowledge, this is the first case of paraganglioma of the parotid gland reported in the literature. |
the most common fracture of the orbital wall in the pediatric age group is involvement of floor. possibly, because of the greater elasticity of the orbital bones in the pediatric population, they are more prone to fracture with less force of injury. many studies have indicated that early diagnosis and surgical repair can lead to better outcome. a 2-year old male who met with an injury to the left eye from the clutch of the motorbike was brought to trauma center. he had swelling over the left eye with the continuous leak of some fluid as complained by his mother. right pupil was normal size and reactive to light, upper eyelid of the left eye was edematous and bulged out with the leaking of brain matter from the left eye [figure 1a ]. urgent noncontrast computed tomography head and orbit was done which revealed fracture of the roof of left orbit with left frontal contusion [figures 1b and 2 ]. the roof of orbit was displaced [figure 3 ]. so urgent surgical intervention was planned. blood grouping and cross matching were done and adequate amount of blood was arranged, and the patient was shifted to the operation room. rapid sequence induction of anesthesia was done with propofol 2.5 mg / kg and fentanyl 1 mcg / kg. succinylcholine 15 mg was administered intravenously (iv) anesthesia was maintained with oxygen and isoflurane with intermittent administration of injection vecuronium 0.01 mg / kg iv. bicoronal incision was placed and left frontal craniotomy was performed. after raising of the bone flap, dural tear was present in the left frontal region from which contused brain leaked out. after the opening of dura evacuation of contusion and reconstruction of the roof of left orbit roof was done. as there was dural tear in basifrontal dura beyond the left orbital roof, duroplasty was done using periosteum graft. (b) computed tomography showing left orbital roof fracture with herniation of brain into orbit computed tomography showing fractured roof of left orbit computed tomography showing fragmented orbit roof orbital fractures may occur in children who have sustained blunt injury in traffic accidents, falls, or from other orbital trauma. the orbital roof is composed almost entirely of frontal bone with a tiny contribution from the lesser wing of sphenoid and these fractures usually result from severe frontal trauma and are often accompanied by intracranial injury. incomplete ossification of bones is also an important consideration in pediatric age group. in our case, the cause of the injury was fall of the bike on the face of the patient, and this is a rare injury because the patient had left orbital roof fracture without injury to the globe of the eye. orbital roof fractures present various challenges for the neurosurgeons as well as the anesthetics. on one hand, the nondisplaced or minimally displaced orbital roof fractures generally do not require surgical intervention and can usually be managed by observation alone. on the other hand, displaced orbital roof fractures require team management surgical treatment requires management by neurosurgeons, plastic surgeons, ophthalmologists, and anesthetists as it can result in significant neurologic, ophthalmologic as well as cosmetic morbidities, various complications include proptosis, blindness, globe rupture, eye immobility, anesthesia or paresthesia of the supraorbital and supratrochlear nerves, cerebrospinal fluid leakage, intracranial injury, enophthalmos, exophthalmos, ectropion, entropion, infection, diplopia, restricted extraocular movements, blepharoptosis, orbital volume discrepancy, and those associated with the presence of foreign bodies. studies advocate early surgical intervention of orbital roof fractures to prevent meningitis and brain abscess formation but surgical approach itself presents a significant risk of intracranial infection. critical neurosurgical indications for early surgery are dural tears, intracranial hemorrhage or compound depressed fracture, in addition to ocular problems. furthermore, large basifrontal duroplasty is difficult in this region due to the thin dura and limited space. piotrowski. reported that about 80% of patients achieved good overall functional and cosmetic results with an early surgical intervention and delayed intervention led to prolonged operative time and difficult restoration of the fractured segment because of fibrosis, and markedly affected the esthetic outcome. transient bradycardia may be witnessed in the perioperative period during ocular manipulation for fracture reduction. although this finding rarely has any clinical hemodynamic significance, fatal cardiac arrhythmia has been reported in the literature. the decision to perform endotracheal intubation is not only determined by the patient 's respiratory status or the need for an operative procedure but more importantly by their glasgow coma scale at the time of presentation. small children are at an increased risk of posttraumatic seizures compared with adults, because of increased excitability of the developing brain. a lower limit of acceptability in the pediatric population has been set at a cerebral perfusion pressure of 40 mmhg. in penetrating injury of the orbital roof with brain herniation, early surgical intervention is very important as the injury can lead to septic meningitis or brain abscess. hence early craniotomy, debridement, and duroplasty are required to prevent morbidity and mortality of patient. the roof of orbit fracture may be associated with significant brain injury with an injury to the olfactory bulb. | blowout fractures are a common occurrence in traumatic brain injury patients. in pediatric age group, orbital floor fracture is a common occurrence. we report a case of 2-year - old male admitted to trauma center, with penetrating injury to the left eye by the clutch of motorbike which fell on the child. noncontrast computed tomography scan revealed fracture of the roof of left orbit with left frontal contusion sparing the left eyeball. there was also the continuous leak of brain matter from the left eye which suggested tear of dura mater. urgent left frontal craniotomy was done with the evacuation of contusion, reconstruction of orbital roof, and duroplasty under general anesthesia. |
the ability of lasers to induce hair growth was incidentally noted as early as 1967 when mester. used low - level laser therapy (lllt) to treat cancer in mice with shaved backs. since then, hypertrichosis has been recognized to be a possible side - effect of laser treatment. first described in 2002 with intense pulsed light therapy, this phenomenon has now been widely acknowledged to occur with an incidence rate ranging from 0.6% to 10% with low fluences and all laser types. it is thought to be the result of suboptimal fluences that are too low to induce thermolysis, but high enough to stimulate follicular growth. eventually, lllt has been developed for the treatment of androgenetic alopecia (aga). as opposed to other currently marketed systems, the laser comb utilizes hair parting teeth for optimal delivery of laser energy to the exposed scalp. in 2007, the hairmax laser comb (lexington international, llc) received 510 (k) clearance from the food and drug administration (fda) for the treatment of aga for men, and 2011 for women. this clearance means that the device is considered a moderate - risk medical device by the fda and is thereby solely screened for safety. the hairmax laser comb has been tested in a company - sponsored study of 110 male patients with the claim of a significant increase in mean terminal hair density when compared to a sham device. avram and rogers conducted the first independent blinded study of lllt and hair growth with seven patients and found that on average, there was a decrease in the number of vellus hairs, an increase in the number of terminal hairs, and an increase in shaft diameter. a consensus written by hair loss experts states that based on anecdotal experience, lllt, particularly 650 - 900 nm wavelengths at 5 mw, may be an effective treatment option for patients with aga. in recent times, kim. reported an increase of hair density with the use of lllt, when compared to the sham device in a 24-week, randomized, double - blind, sham - device - controlled trial. to evaluate efficacy of the 655 nm - hairmax laser comb either as monotherapy or as concomitant therapy for treatment of male and female aga, we performed a retrospective observational study of global photographic assessments of patients in an office - based setting. patients who had purchased a hairmax laser comb between july 2011 and july 2013 for treatment of aga at the center for dermatology and hair diseases prof. treb were retrieved for assessment of global photographic images performed at follow - up visits. patients on concomitant treatment had been treating with topical minoxidil or oral finasteride for at least 9 months, before starting therapy with the hairmax laser comb. patients used the hairmax laser comb at home according to instructions 3 times weekly between 8 and 15 min depending on the model purchased (advanced 7, lux 9, or professional 12). global photographs were performed at 3, 6, 12, and 24 months of treatment follow - up in a standardized manner with a stereotactic camera device of canfield scientific inc., in which the patient 's chin and forehead are fixed and on which digital camera and flash device are mounted, ensuring that view and lighting are the same at consecutive visits, thus enabling precise follow - up of the same scalp area of interest with frontal and vertex views. global photographs were evaluated by two of the authors (am and rmt), and scored as significant, moderate, or no improvement. in the case of diverging opinions, in total, 32 patients with aga were involved in the study, of which 21 were females, aged 22 - 73 (mean : 43.6 15.19 standard deviation [sd ]), and 11 were males, aged 20 - 70 (mean : 39 15.01 sd) total mean : 42 15.1 sd. the duration of hair loss in years for men and women was mean 7.1 5.2 sd. the duration of lllt in months for men and women was mean 8.7 5.2 [table 1 ]. the patient characteristics, with respect to gender, age, classification of aga according to ludwig and hamilton - norwood scales, duration of hair loss, and concomitant treatments are recorded in table 2. the results for the scoring of the global photographic assessment in relation to treatment duration with the hairmax laser comb are demonstrated in table 3. in summary, eight patients (three female, five male) showed significant improvement, 20 patients (14 female, six male) moderate improvement, and four patients (four female, zero male) no improvement [figure 1 ]. of 32 patients, the hairmax laser comb was used as monotherapy in six patients (two female, four male), and as a concomitant therapy in 26 patients (19 female, seven male). in the monotherapy group, two patients (one female, one male) showed significant improvement [figure 2 ], four patients (one female, three male) moderate improvement, and zero patients no improvement [table 3 ]. in the concomitant therapy group, six patients (two female, four male) showed significant improvement [figures 3 and 4 ], 16 patients (13 female, three male) moderate improvement, and four patients (four female, zero male) no improvement. there was no statistical significant difference between lllt monotherapy and concomitant therapy with either minoxidil and/or finasteride (p = 0.829), and regarding male or female aga (p = 0.091) [table 4 ]. improvement of alopecia in relation to the variables : age, duration of hair loss, and duration of lllt patient characteristics graphic summary of results monotherapy in a 54-year - old male (a) before treatment, and improvement after (b) 6 months, and (c) 12 months of low - level laser therapy scoring of global photographic assessment in relation to treatment duration concomitant treatment with topical 5% minoxidil in a 55-year - old male adding on low - level laser therapy (lllt) to 4 year pretreatment with 5% topical minoxidil solution (a) before, and (b) after 3 months of added lllt concomitant treatment with topical 5% minoxidil and 1 mg oral finasteride in a 34-year - old male (a) before, (b) after 9 months treatment with 1 mg oral finasteride and topical 5% minoxidil solution bid, and (c) after 3 months after adding on low - level laser therapy comparative assessment of efficacy between monotherapy and concomitant for male and female androgenetic alopecia treatment was well tolerated and no serious adverse events were reported.. currently, topical 2% and 5% minoxidil solution and 1 mg oral finasteride are the treatments with the highest levels of medical evidence, but patients who exhibit intolerance or poor response to these treatments are in need of additional treatment modalities. although low - level energy lasers have been therapeutically used in medicine for photobiostimulation in a variety of indications more than 30 years, it has only recently found the attention of the scientific community for the treatment of aga. we have chosen the 655 nm - hairmax laser comb for several reasons : first, it represents the device with the most clinical study reports regarding its efficacy, secondly, the cost of the device is affordable, and thirdly, the device is simple enough for patients to use at home. finally, the fact that the device is safe, for which it received 510 (k) clearance from the fda for the treatment of aga, was also an important consideration. our study demonstrates clinical efficacy of the device for treatment of male and female aga, both as monotherapy and as concomitant therapy, in terms of clinically relevant improvement of appearance of hair. of 32 patients, eight patients (25%) showed significant improvement, and 20 patients (62.5%) showed moderate improvement in global photographic assessments. the effect was observed as early as 3 months of treatment, and was sustained up to a maximum observation time of 24 months. the technology appears to work better for some than for others, and predictive factors which will most benefit from lllt are to be determined. it seems though, that patients with intermediate alopecia (hamilton - norwood iii and iv, and ludwig i and ii, respiratory) respond best, since effective photobiostimulation depends on a minimum of hair for effective photobiostimulation, and on a maximum of hair for the laser beam to reach the scalp without absorption or interference from existing hairs. the hypothesized mechanisms of action of lllt are increased adenosine tri - phosphate (atp) production, modulation of reactive oxygen species (ros), and induction of transcription factors. the proposed cellular chromosphere responsible for the effect of visible light is cytochrome c oxidase (cox) with absorption peaks in the near infrared, and mitochondria the likely site for the initial effects. it is believed that lllt displaces nitric oxid from cox allowing an influx of oxygen to bond to cox and progress forward in the respiratory process to atp production and ros signaling. these effects in turn lead to increased cellular proliferation, modulation in levels of cytokines, growth factors and inflammatory mediators, and increased tissue oxygenation. while the effects of these biochemical and cellular changes have broadly been studied in both animal models and clinical studies with patients, and have shown benefits in diverse conditions, such as increased healing in chronic wounds, improvements in sports injuries and carpal tunnel syndrome, pain reduction in arthritis and neuropathies, and amelioration of damage after heart attacks, stroke, nerve injury and retinal toxicity, the effects on hair growth stimulation have only recently gained the attention of the scientific community. from our own observations, we share with other authors the opinion that lllt represents a safe and potentially effective treatment option for patients with aga who do not respond or are not tolerant to standard treatment of aga. moreover, combining lllt with topical minoxidil solution and oral finasteride may act synergistic to enhance hair growth. due to the known beneficial effect on wound healing, it is conceivable that lllt as an adjunctive therapy in hair transplant surgery may also reduce postoperative shedding, reduce healing time, and increase graft patency. the scientific basis for such an approach is given, but there is a need for controlled studies with a higher number of patients to establish an increase in efficacy of combination regimens. | background : androgenetic alopecia (aga) is the most common form of hair loss in men and in women. currently, minoxidil and finasteride are the treatments with the highest levels of medical evidence, but patients who exhibit intolerance or poor response to these treatments are in need of additional treatment modalities.objective:the aim was to evaluate the efficacy and safety of low - level laser therapy (lllt) for aga, either as monotherapy or as concomitant therapy with minoxidil or finasteride, in an office - based setting.materials and methods : retrospective observational study of male and female patients with aga, treated with the 655 nm - hairmax laser comb, in an office - based setting. efficacy was assessed with global photographic imaging.results:of 32 patients (21 female, 11 male), 8 showed significant, 20 moderate, and 4 no improvement. improvement was seen both with monotherapy and with concomitant therapy. improvement was observed as early as 3 months and was sustained up to a maximum observation time of 24 months. no adverse reactions were reported.conclusions:lllt represents a potentially effective treatment for both male and female aga, either as monotherapy or concomitant therapy. combination treatments with minoxidil, finasteride, and lllt may act synergistic to enhance hair growth. |
emblica officinalis fruits were purchased from the local market and authenticated by our faculty taxonomist dr. a. s. reddy, and voucher specimen was retained in the departmental herbarium (rav # 01). the pulp was extracted, air dried, ground to powder and stored in an air tight container. a quantitative phytochemical analysis for phytosterols, saponins, polyphenols, flavanoids, total ascorbic acid and fiber was carried out using standard methods.[2831 ] colony bred adult male albino rats (charles foster ; 200 - 250 gm bw) were provided standard diet (pranav agro industries, vadodara, india), water ad libitum and were housed individually in well - ventilated animal unit (262c, humidity 62%, and 12-h light / dark cycle). the care and procedure for the present experiment were in accordance with institutional animal ethics committee (moef / cpcsea / reg.337). after 10-day adaptation period, 30 animals were randomly segregated into 5 groups of 6 animals each : normal control (nc)- normal animals without any treatment ; fluoride control (fc)- 100 ppm sodium fluoride (naf) through drinking water ; feo 2.5 - 100 ppm naf exposed animals administered with 2.5 gm % eo fruit powder in diet ; feo 5.0 - 100 ppm naf exposed animals administered with 5 gm % eo fruit powder in diet ; feo 10.0 - 100 ppm naf exposed animals administered with 10 gm % eo fruit powder in diet. composition of the experimental diet (gm %) at the end of the 4 week period, animals were fasted overnight and sacrificed under mild ether anesthesia. liver and kidney tissues were excised, and both plasma and tissues were kept frozen until analyzed. plasma glucose levels were measured by standard kits (eve 's inn diagnostics, india). hepatic glycogen was extracted with 30% potassium hydroxide, and the yield was determined by anthrone - sulfuric acid method. the hepatic hexokinase (ec 2.7.1.1) and glucose-6-phosphatase (ec 3.1.3.9) activities were determined using the methods of brandstrup., (1957) and baginsky. (1974), respectively. serum glutamate oxalocetate (sgot) and pyruvate (sgpt) transaminases, acid and alkaline phosphatases (acp, alp) levels were determined using standard kits (eve 's inn diagnostics, baroda, india). catalase (cat ; ec 1.11.1.6) and superoxide dismutase (sod ; ec 1.15.1.1) were measured according to the methods of aebi (1974) and kakkar., glutathione peroxidase (gpx ; ec 1.11.1.9) and reduced glutathione (gsh) were analyzed by the methods of flohe and gunzler (1984) and jollow. one - way analysis of variance (anova) with tukey 's significant difference post hoc test was used to compare differences among groups. emblica officinalis fruits were purchased from the local market and authenticated by our faculty taxonomist dr. a. s. reddy, and voucher specimen was retained in the departmental herbarium (rav # 01). the pulp was extracted, air dried, ground to powder and stored in an air tight container. a quantitative phytochemical analysis for phytosterols, saponins, polyphenols, flavanoids, total ascorbic acid and fiber was carried out using standard methods.[2831 ] colony bred adult male albino rats (charles foster ; 200 - 250 gm bw) were provided standard diet (pranav agro industries, vadodara, india), water ad libitum and were housed individually in well - ventilated animal unit (262c, humidity 62%, and 12-h light / dark cycle). the care and procedure for the present experiment were in accordance with institutional animal ethics committee (moef / cpcsea / reg.337). after 10-day adaptation period, 30 animals were randomly segregated into 5 groups of 6 animals each : normal control (nc)- normal animals without any treatment ; fluoride control (fc)- 100 ppm sodium fluoride (naf) through drinking water ; feo 2.5 - 100 ppm naf exposed animals administered with 2.5 gm % eo fruit powder in diet ; feo 5.0 - 100 ppm naf exposed animals administered with 5 gm % eo fruit powder in diet ; feo 10.0 - 100 ppm naf exposed animals administered with 10 gm % eo fruit powder in diet. composition of the experimental diet (gm %) at the end of the 4 week period, animals were fasted overnight and sacrificed under mild ether anesthesia. liver and kidney tissues were excised, and both plasma and tissues were kept frozen until analyzed. plasma glucose levels were measured by standard kits (eve 's inn diagnostics, india). hepatic glycogen was extracted with 30% potassium hydroxide, and the yield was determined by anthrone - sulfuric acid method. the hepatic hexokinase (ec 2.7.1.1) and glucose-6-phosphatase (ec 3.1.3.9) activities were determined using the methods of brandstrup., (1957) and baginsky. serum glutamate oxalocetate (sgot) and pyruvate (sgpt) transaminases, acid and alkaline phosphatases (acp, alp) levels were determined using standard kits (eve 's inn diagnostics, baroda, india). catalase (cat ; ec 1.11.1.6) and superoxide dismutase (sod ; ec 1.15.1.1) were measured according to the methods of aebi (1974) and kakkar., glutathione peroxidase (gpx ; ec 1.11.1.9) and reduced glutathione (gsh) were analyzed by the methods of flohe and gunzler (1984) and jollow. one - way analysis of variance (anova) with tukey 's significant difference post hoc test was used to compare differences among groups. the present study provides an evidence for the positive influence of emblica officinalis on body carbohydrate and antioxidant metabolism in fluoride intoxicated animals. the effects of e. officinalis in fluoride exposed rats were found to be dose dependent : 10 gm % dose was maximally effective compared to 2.5 and 5.0 gm % doses. significant loss in the body and liver weights were observed in fluoride exposed animals with an increase in food intake. addition of e. officinalis fruit powder to the diet increased the body and liver weights (9%, 17%, respectively) with a reduction in food intake (22%) in fluoride exposed animals. the reduction in body weight in fluoride exposed rats could be because of an unavailability of carbohydrate for energy utilization though food intake increased. it is possible that fluoride may have suppressed the hunger centers of central nervous system, resulting in increased food intake without enhancing energy assimilation, prompting a decline in body and liver weights. a reverse phenomenon may have been caused by the eo fruit powder i.e., e. officinalis fruit powder could have regulated the appetite and caused an increase in body and liver weights in fluoride exposed animals [table 2 ]. effects of emblica officinalis on food intake, body and liver weights fluoride administration is known to cause hyperglycemia, simulating diabetic conditions.[57 ] in the present context too, a significant increase in plasma glucose levels, hepatic g-6-pase activity and reduction in hepatic glycogen content and hepatic hexokinase activities were noted. an inclusion of e. officinalis fruit powder to the diet of fluoride exposed animals resulted in significantly decreased blood glucose levels and g-6-pase activity with increased hepatic glycogen content and hexokinase activity [table 3 ]. these observations clearly indicate the potential of e. officinalis to counter the effects of possibly lowered levels of insulin in fluoride intoxicated rats. while fluoride exposure significantly increased the sgot, sgpt, acp and alp levels, eo fruit powder supplementation reversed this trend in a dose - dependent manner, indicating the hepatic restoratory effect of eo fruit [table 4 ]. effects of emblica officinalis on plasma glucose, hepatic glycogen content, hepatic hexokinase and glucose-6- phosphatase effects of emblica officinalis on the activities of sgot, sgpt, acp and alp chronic fluoride toxicity is reported to enhance the oxidative stress as evidenced by a significant increase in malondialdehyde (mda) content and a reduction in body antioxidant status. an exposure to fluoride in the present context also resulted in decreased levels of antioxidants - taa, sod, cat, gsh and gpx contents. e. officinalis fruit powder addition at 10 gm % dose level exhibited significant increase in taa, gsh content and sod, cat, gpx activities when compared to fc and as well as f eo 2.5 and f eo 5 animals [tables 5 and 6 ]. effects of emblica officinalis on hepatic antioxidant profiles effects of emblica officinalis on renal antioxidant profiles the eo fruit contained 3.2 gm % fiber, 8.65 gm % phytosterol, 0.05 gm % saponins, 19.70 gm % polyphenols, 0.342 gm % flavonoids and 0.425 gm % ascorbic acid content. thus, the presently observed anti - hyperglycemic, hepato - renal protective and antioxidant effects could be due to additive / individual components ability as polyphenols, and flavonoids are known to be hepato- and gastro - protective, anti - carcinogenic, ant - idiabetic, ameliorative agents for insulin resistance by protecting pancreatic islet cells, antioxidative and anti - hyperlipemic in nature.[3941 ] dietary saponins, phytosterols and ascorbic acid play an important role as antihyperglycemic and improve glycemic index, lowering both fasting blood glucose and glycosylated hemoglobin, modulating the insulin 's action.[4244 ] thus, results of present study and our earlier report clearly suggest that the fruits of e. officinalis exhibit anti - hyperglycemic, anti - hyperlipemic, anti - peroxidative and antioxidant properties in fluoride exposed animals. it is, therefore, concluded that fruit of e. officinalis are useful in regulating fluoride induced hyperglycemia and improve the antioxidant status. | purpose of the study was to examine the antihyperglycemic and hepato - renal protective effects of emblica officinalis (eo) fruit as a food supplement in fluoride induced toxicity. eo fruit powder was incorporated into the diet (2.5, 5 and 10 gm %) of fluoride exposed animals for a duration of 30 days. fluoride exposure caused significant elevation in plasma glucose, serum glutamate oxaloacetate transaminase (sgot), serum glutamate pyruvate transaminase (sgpt), acid phosphatase (acp), alkaline phosphatase (alp) activities, hepatic glucose-6-phosphatase (g-6-pase) and decreased hepatic glycogen content, hexokinase activity and antioxidant profiles (hepatic and renal). an inclusion of eo fruit powder significantly reduced plasma glucose levels, sgot, sgpt, acp and alp activities, hepatic g-6-pase activity and increased hepatic glycogen content and hexokinase activity. hepatic and renal antioxidant status of fluoride exposed animals improved upon feeding eo fruit powder. we, therefore, conclude that e. officinalis fruit could be useful in regulating hyperglycemia and enhances antioxidant status of fluoride exposed animals. |
flax is a food and fiber crop that is grown in some regions of the world. its value will account for its great popularity as a food, medical and cosmetic applications. flax fibers are taken from the stem of the plant and are two to three times as strong as cotton. in this study, we compared brain weight and plasma sex hormone levels in young and aged mice after the administration of linum usitatissimum (flax seed) hydro alcoholic extract. in this study, 32 aged and 32 young mice were divided into 4 groups. controls remained untreated and experimental groups were fed with flax seed hydroalcoholic extract by oral gavages during 3 weeks. after 3 weeks, the brain was removed and blood samples were collected to measure sex hormone levels by elisa. data analysis was done by statistical anova test using spss version 18 (p<0.05). the results of this study shows that the brain weight of mice did not change significantly, but the sex hormone levels in the experimental groups in comparison with the control groups increased significantly (p<0.05). the hydroalcoholic extract of flax seed had no effect on the brain weight, but this extract improved the sexual hormone levels. | background : flax is a food and fiber crop that is grown in some regions of the world. its value will account for its great popularity as a food, medical and cosmetic applications. flax fibers are taken from the stem of the plant and are two to three times as strong as cotton. in this study, we compared brain weight and plasma sex hormone levels in young and aged mice after the administration of linum usitatissimum (flax seed) hydro alcoholic extract.methods:in this study, 32 aged and 32 young mice were divided into 4 groups. controls remained untreated and experimental groups were fed with flax seed hydroalcoholic extract by oral gavages during 3 weeks. after 3 weeks, the brain was removed and blood samples were collected to measure sex hormone levels by elisa. data analysis was done by statistical anova test using spss version 18 (p<0.05).results : the results of this study shows that the brain weight of mice did not change significantly, but the sex hormone levels in the experimental groups in comparison with the control groups increased significantly (p<0.05).conclusion : the hydroalcoholic extract of flax seed had no effect on the brain weight, but this extract improved the sexual hormone levels. |
animals were housed in wire cages in temperature and humiditycontrolled rooms with a 12h light / dark cycle, with food and water adlibitum. general anaesthesia was achieved by an intraperitoneal injection of 0.1% xylazine (13 mg / kg) and 0.1% ketamine (87 mg / kg). a midcrestal incision was made on the maxillary alveolar ridge in the existing edentulous area between the 1st molar and the incisors. a fullthickness flap was raised on each side of the incision and then repositioned and sutured with resorbable vycril 40 sutures (ethicon inc., johnson & johnson, nj, usa). eight experimental groups were established : study groups : periopatch was placed on the incision line immediately following surgery and was replaced every 12 h for the following 3 days. placebo patch control groups : protocol was similar as in the study groups only that a placebo patch (similar in composition to the periopatch, but without the active herbal ingredients) was applied. neither study nor placebo patches were present at the time of the new patch application. the type of patch was coded (a or b) and was not available to the researchers until the results were available, therefore, the study was designed as blind. to minimize the number of animals without compromising results, each hemimaxilla served as a sample in a group. a single type of patch was applied only on one side of each animal while in half of them, the contralateral side served as negative control and in the remaining as intact group. half of the animals were killed after 5 days and the remaining ones after 12 days. initially, each one of the eight groups consisted of 12 sites, therefore, altogether, a total of 96 samples were available. animals were killed under anaesthesia using co2 and the maxillae were excised and fixed in 4% paraformaldehyde for 7 days at room temperature. after decalcification in a 10% edta solution for 30 days, the specimens were embedded in paraffin and cut into serial sections of 4 m thickness in a coronal plane, perpendicular to the line of incision. conventional histology (haematoxylin & eosin) for measurement of epithelial gap distance : slides were stained with haematoxylin & eosin with the standard methods. epithelial gap was measured under a 40 magnification using an olympus bh2 (olympus america inc, new york, usa) light microscope. a gap zone was defined by lack of wound tissue and its width was measured at three epithelial heights within the incision line : a. deepest (close to the connective tissue), b. midway between the epithelial surfaces and c. most superficial portion of the epithelial wound. a mean of all measurements in two sections was computed. the mean standard deviation (sd) for each of the eight groups was then calculated. quantitation of collagen fibre content with picrosirius red (psr) stain under polarized light microscopy : adjacent sections were stained with picrosirius red solution (scytek kit srs250x (scytek laboratories inc., logan, usa). using polarized light microscopy and a 200 objective, the wound site was photographed and the area of the wound occupied by collagen fibres was determined as percent of the total area of the connective tissue. total connective tissue pixels adjacent to incision site were calculated as:[total photomicrograph pixels][epithelial pixels+alveolar crest pixels ] the percentage of collagen in connective tissue was calculated as : connective tissue collagen fibres pixels (red, yellow, green)100/total connective tissue pixels. macrophages stained with cd68 were counted and expressed as number of cells / mm of gingival connective tissue adjacent to the incision site. the number of ki67 positive cells was determined in the connective tissue below the epithelial area of interest for all eight groups. cells stained for ki67 were counted and expressed as number of cells / mm of gingival connective tissue adjacent to the incision site. the number of blood vessels was expressed per mm of gingival connective tissue adjacent to the incision site. statistical analysis was performed using ibm spss statistics (armonk, new york, u.s.). a twoway anova analysis was performed to examine changes between groups for each dependent parameter. animals were killed under anaesthesia using co2 and the maxillae were excised and fixed in 4% paraformaldehyde for 7 days at room temperature. after decalcification in a 10% edta solution for 30 days, the specimens were embedded in paraffin and cut into serial sections of 4 m thickness in a coronal plane, perpendicular to the line of incision. conventional histology (haematoxylin & eosin) for measurement of epithelial gap distance : slides were stained with haematoxylin & eosin with the standard methods. epithelial gap was measured under a 40 magnification using an olympus bh2 (olympus america inc, new york, usa) light microscope. a gap zone was defined by lack of wound tissue and its width was measured at three epithelial heights within the incision line : a. deepest (close to the connective tissue), b. midway between the epithelial surfaces and c. most superficial portion of the epithelial wound. a mean of all measurements in two sections was computed. the mean standard deviation (sd) for each of the eight groups quantitation of collagen fibre content with picrosirius red (psr) stain under polarized light microscopy : adjacent sections were stained with picrosirius red solution (scytek kit srs250x (scytek laboratories inc., logan, usa). using polarized light microscopy and a 200 objective, the wound site was photographed and the area of the wound occupied by collagen fibres was determined as percent of the total area of the connective tissue. total connective tissue pixels adjacent to incision site were calculated as:[total photomicrograph pixels][epithelial pixels+alveolar crest pixels ] the percentage of collagen in connective tissue was calculated as : connective tissue collagen fibres pixels (red, yellow, green)100/total connective tissue pixels. macrophages stained with cd68 were counted and expressed as number of cells / mm of gingival connective tissue adjacent to the incision site. the number of ki67 positive cells was determined in the connective tissue below the epithelial area of interest for all eight groups. cells stained for ki67 were counted and expressed as number of cells / mm of gingival connective tissue adjacent to the incision site. the number of blood vessels was expressed per mm of gingival connective tissue adjacent to the incision site. statistical analysis was performed using ibm spss statistics (armonk, new york, u.s.). a twoway anova analysis was performed to examine changes between groups for each dependent parameter. clinical healing was not evaluated, however, in most animals ; partial soft tissue healing could be appreciated by 5 days, whereas it was complete and uneventful by the end of the study at day 12. five days after the surgical procedure, the smallest epithelial gap was found in the study group. however, the difference between the three groups where surgery was performed, was not statistically significant (p = 0.701). in contrast, on day 12, the epithelial gap was significantly smaller in the study group compared to the placebo group (p = 0.073) and to the negative control group (p = 0.056) (figs 1, 2, 3). s = study group (pp) ; p, placebo patch group ; nc, negative control (no patch) group. #, p = 0.07 (versus the respective study group)., p = 0.05 (versus the respective study group). (a) alveolar crest, (b) gingival connective tissue,(c) epithelium and incision site (arrow). (a) alveolar crest, (b) gingival connective tissue, (c) epithelium and incision site (arrow). a statistically significant higher collagen content was found in the study group both at 5 and 12 days after the surgical procedure (p < 0.001) (fig. connective tissue collagen content (%, mean and sd) in the various experimental groups. s, study group (pp) ; p, placebo patch group ; nc, negative control (no patch) group. i, intact (no surgery) group., p < 0.001 (versus the respective study group). although macrophage counts were highest in the study group both at 5 and 12 days, differences between groups were not statistically significant (fig. number of connective tissue macrophages (cd68 positive cells) (/mm, mean and sd) in the various experimental groups. s, study group (pp) ; p, placebo patch group ; nc, negative control (no patch) group.. a larger number of proliferating cells was found in the study group. at 5 days, the effects of the type of patch approached statistical significance (p = 0.054) (fig. 6 + figures s4a, s4b). on day 12, although the mean number of proliferating cells was highest in the study group, differences between groups were not statistically significant. number of proliferating (ki67 positive) cells (/mm, mean and sd) in the various experimental groups. s, study group (pp) ; p, placebo patch group ; nc, negative control (no patch) group. the mean number of blood vessels was highest in the study group, however, at 5 days, differences were not statistically significant. (p = 0.354), reaching significance only at 12 days (p = 0.014) (fig. number of blood vessels (tgii positive) (/mm, mean and sd) in the various experimental groups. s, study group (pp) ; p, placebo patch group ; nc, negative control (no patch) group. i, intact (no surgery) group., p = 0.01 (versus the respective study group). our results showed that application of the topical herbal patch improved gingival healing compared to control and the placebo patch, thus, suggesting that the active herbal ingredients (centella asiatica, echinacea purpurea and sambucus nigra) play an important role in this effect. asiaticoside and madecassoside, found in centella asiatica, promote fibroblast proliferation and extracellular matrix synthesis in wound healing (lu. 2004), alleviate infiltration of inflammatory cells, enhance epithelialization resulting from fibroblasts proliferation and promote angiogenesis (liu. sambucus nigra extract was found to potently inhibit proinflammatory activities (harokopakis. certain components in echinacea species display remarkable wound healing and antiinflammatory activities (tumen. degree of epithelialization, number of blood vessels, proliferating cells and collagen deposition are the most generally evaluated parameters to demonstrate positive effects on wound healing. an animal study (ganjali. 2013) investigated if the methanolic extract of the otostegia persica can accelerate the healing process of burn wound because of its antiinflammatory and antioxidant effects. it was concluded that methanolic extract of otostegia persica exhibited significant healing activity when topically applied on rats. in another example, glucan exerted various positive effects in burn wound healing, including immunomodulatory effects, antioxidant effects (freeradical scavenging activity) and effects associated with the reduction in the inflammatory response (firat. glucan application led to higher fibroblast proliferation, angiogenesis and reepithelialization on the 7th day. in particular, reepithelialization on the 21st day was significantly better where glucan was administered. in yet another study, topical treatment with curcumin (cur) on burn wound healing in rats showed positive effects (kulac. other studies have also reported that curtreated wounds were found to heal much faster as indicated by improved rates of inflammatory cells, collagen deposition, angiogenesis, granulation tissue formation and epithelialization which were also confirmed by histopathological and biochemical examinations (akbik. previous controlled clinical studies have proven that periopatch application is useful to reduce gingival inflammation following periodontal nonsurgical treatment (grbic. 2011, samuels. 2012) and that its application, following scaling and root planing and oral hygiene instructions, together with a mouth rinse containing the herbal active ingredients may decrease gingival recession and gingival index scores with increased gingival thickness (levine. this study evaluated, for the first time, the effects of this device on the various processes essential for soft tissue surgical wound healing : reepithelialization, inflammation, angiogenesis cellular proliferation and matrix deposition. our results showed that the topical herbal patch application enhanced the epithelial bridging and improved healing. although, the effect was noted already at day 5, it only approached statistical significance on day 12. however, the placebo patch, which provided only mechanical protection, did not exert a positive healing effect. one may speculate that the study model was based on a surgical wound which is clean, therefore, resulting mainly in a reparative process with minimal inflammation. periopatch application resulted in an improved healing as evaluated by an increased number of proliferating cells. this effect only approached statistical significance by day 5 ; however, by day 12 results were statistically similar in the different groups, coinciding with the pattern of increased cellular proliferation during the healing process. increased collagen fibre quantity was appreciated in the study groups which was statistically significant both at 5 and 12 days blood vessels were significantly more numerous in the study group compared to placebo patch group at day 12. effective wound healing requires a highly organized series of events that comprise inflammation, reepithelialization, keratinocyte and fibroblast proliferation, matrix deposition, angiogenesis and wound contraction. together, these processes result in the restoration of tissue integrity and functional healing. the clinical investigation in search for therapeutic tools to improve the wound healing process has led to the development of novel treatment strategies (hackam & ford 2002) among which this herbal topical patch may be suitable for some clinical applications. in this preclinical, animal study, application of the periopatch and not the placebo patch improved wound healing in the described model. the positive effects on soft tissue wound healing were also appreciated by increased number of proliferating cells, collagen production and number of blood vessels. midcrestal incision on the maxillary alveolar ridge in the existing edentulous area between the 1st molar and the incisors. following fullthickness flaps raised and repositioned on each side of the incision, resorbable sutures were performed to replace the soft tissues. periopatch or placebo patch was placed on the incision line immediately following surgery and replaced every 12 h for the following 3 days. | abstractaimthis study evaluated the effects of a topical herbal patch (periopatch) for gingival wound healing in a rat model.materials and methodsa midcrestal incision was performed on each side of the edentulous anterior maxilla in 48, 6monthold, wistar rats. fullthickness flaps were raised, repositioned and sutured. four experimental groups were established : herbal patch, placebo patch, no patch and no patch and no surgery. patches were placed immediately after surgery and replaced every 12 h for the following 3 days. half of the animals were killed after 5 and the remaining ones after 12 days. tissue blocks were retrieved and processed for histological and immunohistochemical evaluation. epithelial gap, collagen contents, amount of macrophages, cellular proliferation and vascular contents were evaluated in the central incision area. statistical analysis consisted of twoway anova.resultsthe herbal patch group presented the smallest epithelial gap at 12 days, the highest collagen content both at 5 and 12 days, a larger number of proliferating cells at day 5 and more numerous blood vessels at day 12. macrophage number was similar in all groups.conclusionherbal patch improved wound healing in this animal model. |
patients with cleft palate often exhibit nasality, which is a distinctive feature and an important target in speech therapy and rehabilitation. to evaluate velopharyngeal function, the aerodynamic and acoustic aspects of nasalization have been studied. an aerodynamic exam can diagnose the degree of velopharyngeal closure [1, 2 ], and acoustic measurements can categorize velopharyngeal insufficiency [3, 4 ]. the abnormal resonance generated by velopharyngeal insufficiency can be evaluated quantitatively using a nasometer. on the other hand, the voice and speech of patients with cleft palates have been studied using many techniques including spectral analysis, perturbation analysis, and formant analysis. zajac and linville and lewis. reported that cleft palate speakers have larger frequency perturbations (jitter) than normal controls. however, the methods used to calculate perturbations, jitter, and shimmer are only reliable for nearly periodic voice signals and can not reliably analyze strongly aperiodic signals. recently, nonlinear dynamic methods have enabled the quantification of aperiodic and chaotic phenomena [911 ]. in our previous paper, we reported that the lyapunov exponents (les) of the vowels /a/, /e/ and /o/ for adult cleft palate patients are higher than those for normal resonance adults and that there were no correlation coefficients between les and nasalance scores (nss). these results suggested that vocal fold vibration may be less stable in adult cleft palate patients than in normal resonance subjects and that the le may be a parameter independent of resonance. subsequently, we investigated the nonlinear dynamic characteristics of cleft palate speech and voice. in the present paper, the purpose was to clarify the difference between the les for cleft palate patients with hypernasality versus without hypernasality and to investigate the relationship between their les and nss. six repaired cleft palate patients with severe hypernasality (mean age 9.2 years ; range 6 to 13, 2 boys and 4 girls) and six repaired cleft palate patients without hypernasality (mean age 8.0 years ; range 6 to 13, 4 boys and 2 girls) were enrolled. the presence of hypernasality was perceptually judged by two speech therapists from okayama university hospital. the present study, which was approved by the okayama university institutional ethical board, was carried out after obtaining informed consents from the parents of all participants. the voices were recorded through a microphone (shure bg1.1, niles, ill) on a portable solid - state recorder (marantz pmd 640, itasca, ill) with a nasometer ii headset (model 6400, kay elemetrics corp., lincoln park, nj) in a quiet room designated for speech therapy in the okayama university dental hospital. the voice samples were recorded on the compact flush medium of the recorder at a sampling rate of 44.1 khz, at 16 bits, in a.wav file format. the japanese vowels /a/ ; [a ], /i/ ; [i ], /u/ ; [], /e/ ; [e ], and /o/ ; [o ] were used as voice samples. each vowel was naturally phonated during approximately one - second three times. the voice data were processed on a personal computer (nec mate ma30y, tokyo) with a modified chaos analyzing program (ver. 1.0.4, cci corporation, fukuoka), which used the algorithm from sano and sawada. the first lyapunov exponent (le1) was computed for each one second interval, while the interval was being shifted by 100 msec. the first zero - crossing points of autocorrelation were calculated for each vowel. as a result, the delay time was estimated at 15, 32, 27, 22, and 21 points (1 point = 1/44.1 msec.) for the vowels /a/, /i/, /u/, /e/, and /o/, respectively (table 1). the fractal dimensions were computed using the grassberger - procaccia algorithm, and convergent diagrams, in which the embedding dimensions were assumed, were then constructed for each vowel. thus, the embedding dimensions were estimated at 5 for all vowels (table 1). the differences of the first zero - crossing points of autocorrelation, estimated the embedding dimensions, and the mle1s between the two groups with versus without hypernasality were analyzed statistically using the mann - whitney u test. the statistical package spss (ver.16.0) was utilized, and differences with p values of less than 0.05 were considered to be statistically significant. there were no significant differences between the first zero - crossing points and the estimated embedding dimensions of those patients with or without hypernasality for all vowels (table 1). the mle1 for /o/ in the patients with hypernasality was significantly higher than in patients without hypernasality (p = 0.015) (table 2). the nss for /i/, /u/, /e/, and /o/ in the patients with hypernasality were significantly higher than in patients without hypernasality (table 3). the correlation coefficients between the mle1 and ns for all vowels were not statistically different (table 4). although nasality can be evaluated using a spectral analysis of speech signals, voice acoustic measures of nasality are not universally used in clinical or empirical work because of ambiguity in the literature regarding the appropriate acoustic methodology, the amount of labor involved as compared with the nasometer, and so forth. however, vogel. demonstrated the potential for the wider application of acoustic investigation into nasality. several authors have described laryngeal disorders, including organic and functional disorders, in cleft palate speakers [16, 17 ]. zajac and linville and lewis. reported that cleft palate speakers have higher frequency perturbations (jitter) than normal controls. nicollas. demonstrated that neither jitters nor shimmers significantly differed with age or gender. van lierde. reported a multiparameter approach to vocal quality but stated that the nature of the vocal quality and the voice range measurement differences can not be explained from their study. therefore, we concluded that future studies on the voice of cleft palate subjects using nonlinear analysis may be beneficial in gaining further insight into the mechanics of phonation. to our knowledge, there have been no reports on the application of nonlinear dynamic analysis to cleft palate speech. our previous study demonstrated that the mle1 for /a/, in both males and females with cp, is significantly higher than in normal resonance individuals and that the mle1 for /e/ in males with cp and for /o/ in females with cp are significantly higher than in normal resonance individuals. since the mle1 is a measure of the instability of the voice signal, these results suggest that the vocal fold vibration is less stable in cp speakers than in normal resonance subjects. in addition, the correlation coefficients between the mle1 and ns for all vowels were not statistically different in both normal and cp subjects. the mle1 for /o/ in the patients with hypernasality was significantly higher than in patients without hypernasality ; in other words, the voice signal of /o/ for the patients with hypernasality was more instable than in those without hypernasality. on the other hand, the correlation coefficients between the mle1 and ns for all vowels were not statistically different in patients both with versus without hypernasality. this supported the independence of chaotic phenomenon and nasal resonance in cleft palate speech and voice, which was demonstrated in our previous paper. nicollas. reported that the large le seems to decrease with age from their studies of children between 6 and 12 years of age. it was also suggested that the large le is lower in boys than in girls overall but varies for each age. in our present study, the boys and girls were not separated because of the small sample size. the voice signal of /o/ for the patients with hypernasality was more instable than in those without hypernasality. | objectives. to clarify the difference between lyapunov exponents (les) for cleft palate (cp) patients with hypernasality versus without hypernasality and to investigate the relationship between their les and nasalance scores (nss). material and methods. six cp patients with severe hypernasality (mean age 9.2 years) and six cp patients without hypernasality (mean age 8.0 years) were enrolled. five japanese vowels were recorded at 44.1 khz, and the nss were measured simultaneously. the mean first le (mle1) from all one - second intervals was computed. results. the mle1 for /o/ in patients with hypernasality was significantly higher than that in patients without hypernasality. the correlation coefficients between the mle1 and ns for all vowels were not statistically different. conclusion. the voice signal of /o/ for the patients with hypernasality was more instable than in those without hypernasality. the chaotic phenomenon was independent of nasal resonance in cp voice. |
recurrence of c. difficile was defined as confirmed presence of c. difficile toxin via polymerase chain reaction (pcr) after complete resolution of diarrhea for a minimum of 2 weeks and a maximum of 6 months and the completion of antibiotic therapy (5, 7). rf is a statistical model used for classification and regression which works by using input variables to create an output of regression trees. the mode class of all of the classes of the individual trees is then chosen as the output and is used to determine the variables of interest. regression trees are binary trees with nodes that correspond to different values in the input variables. the rf algorithm searches for a value that best separates all instances within that node based on the outcome of interest. if the instance chosen is not able to be separated further, then it is called a terminal node. the variables used in this study were selected after an extensive review of literature and only the most common comorbidities found in patients with cdi and re - infection were included. among the numerous existing variables, 25 of the most strongly associated variables have been selected. variables which were not found to be significant have not been included in order to optimize the rf algorithm. explanatory variables used in this study a retrospective chart review was performed on patients diagnosed with cdi based on international classification of disease (icd-9) codes. the selection of the study population, selection criteria, and sampling were all performed subject to the approval of the institutional review board (irb). patients diagnosed with cdi via pcr between february 2009 and june 2013. patients with recurrence within 2 weeks or after 6 months of initial cdipatients with documented non - compliance to prescribed medical therapy patients with recurrence within 2 weeks or after 6 months of initial cdi patients with documented non - compliance to prescribed medical therapy using these criteria, data of 200 randomized patients diagnosed with cdi were collected. the prevalence of cdr within the randomly selected sample size was 15% (30 patients). rf statistical analysis and randomization was performed using the spm salford predictive modeler version 6.0 (salford system, san diego, ca). the predictive model was designed by professors leo breiman and adele cutler of the university of california, los angeles. our sample population was randomly separated into two distinct groups, a training group and a validation group. the training group was used essentially to create our learning algorithm, which comprised 2,000 regression trees. each tree comprised binary nodes or branches, which contribute their results to the variables of interest. at each node, a variable is tested (e.g., 80 mg ppi). at that node, the data entered will either fall into a branch of cdr or no recurrence. through the 2,000 regression trees the cumulative predictions created in the 2,000 trees will create the probability of the patient having a recurrence of an initial cdi. the training and testing groups, although broken into two groups, still allow for all patients in the sample selection to be run through the predictive model. as opposed to amalakuhan 's study, which used a 75% training group to 25% validation group distribution split (8, 9), we used an experimental 70%:30% distributional split. this allowed an additional 10 patients to our validation group, presumptively strengthening the end result and the predictive probability of our model. within both the training and validation groups, the predicted probability of determining the patients who had cdr was almost completely equal. the rf model using the indices as set above was run 500 times, and for each of these 500 runs, the accuracy of the predictive model was assessed by calculating the sensitivity, specificity, area under the curve (auc) for receiver operating characteristic, and precision (fig. recurrence of c. difficile was defined as confirmed presence of c. difficile toxin via polymerase chain reaction (pcr) after complete resolution of diarrhea for a minimum of 2 weeks and a maximum of 6 months and the completion of antibiotic therapy (5, 7). rf is a statistical model used for classification and regression which works by using input variables to create an output of regression trees. the mode class of all of the classes of the individual trees is then chosen as the output and is used to determine the variables of interest. regression trees are binary trees with nodes that correspond to different values in the input variables. the rf algorithm searches for a value that best separates all instances within that node based on the outcome of interest. if the instance chosen is not able to be separated further, then it is called a terminal node. the variables used in this study were selected after an extensive review of literature and only the most common comorbidities found in patients with cdi and re - infection were included. among the numerous existing variables, 25 of the most strongly associated variables have been selected. variables which were not found to be significant have not been included in order to optimize the rf algorithm. a retrospective chart review was performed on patients diagnosed with cdi based on international classification of disease (icd-9) codes. the selection of the study population, selection criteria, and sampling were all performed subject to the approval of the institutional review board (irb). patients with recurrence within 2 weeks or after 6 months of initial cdipatients with documented non - compliance to prescribed medical therapy patients with recurrence within 2 weeks or after 6 months of initial cdi patients with documented non - compliance to prescribed medical therapy the prevalence of cdr within the randomly selected sample size was 15% (30 patients). rf statistical analysis and randomization was performed using the spm salford predictive modeler version 6.0 (salford system, san diego, ca). the predictive model was designed by professors leo breiman and adele cutler of the university of california, los angeles. our sample population was randomly separated into two distinct groups, a training group and a validation group. the training group was used essentially to create our learning algorithm, which comprised 2,000 regression trees. each tree comprised binary nodes or branches, which contribute their results to the variables of interest. at each node, a variable is tested (e.g., 80 mg ppi). at that node, the data entered will either fall into a branch of cdr or no recurrence. through the 2,000 regression trees the cumulative predictions created in the 2,000 trees will create the probability of the patient having a recurrence of an initial cdi. the training and testing groups, although broken into two groups, still allow for all patients in the sample selection to be run through the predictive model. as opposed to amalakuhan 's study, which used a 75% training group to 25% validation group distribution split (8, 9), we used an experimental 70%:30% distributional split. this allowed an additional 10 patients to our validation group, presumptively strengthening the end result and the predictive probability of our model. within both the training and validation groups, the predicted probability of determining the patients who had cdr was almost completely equal. the rf model using the indices as set above was run 500 times, and for each of these 500 runs, the accuracy of the predictive model was assessed by calculating the sensitivity, specificity, area under the curve (auc) for receiver operating characteristic, and precision (fig. our population consisted of 198 patients from two sister hospitals in a community setting with a documented cdi. of those patients, 30 had cdr, giving us a recurrence rate of approximately 15%. the mean age of the patients in the recurrence group was 70.8 (sd 17), while the mean age of the population without recurrence was 68.7 (sd 17.7). the majority of the population was caucasian (88.4%) with the remainder of the population being either african american (6.6%) or other races (5.0%) (table 2). demographic and risk factor table our final model based on 500 runs of the rf produced the following results : sensitivity, 83.3% ; specificity, 63.1% ; overall correct predicted percentage, 66.1% ; and auc, 82.6% cdi is a growing concern in the health care system, and it represents one of the most difficult challenges faced by clinicians. throughout the 1990s and 2000s, the number of c. difficile - related hospital stays per 100,000 population has been steadily increasing, peaking at 114.6 in 2008 from a low of 33.2 in 1993 (10). the major problem associated with c. difficile infection is the high rate of recurrence of 20 to 35%. if a recurrence has occurred, the chances of a second recurrence further increases to 4565% (11, 12). cdr increases mortality and morbidity, length of hospital stay, health care costs, and utilization of other health care resources. it also puts additional burden on the patient 's quality of life and their families. previous studies have also documented that cdr resulted in 265 additional days of vancomycin use and 19.7 days of metronidazole use (13). although some studies have looked at the causes, there is little consensus on causes of cdr. previous studies have identified the following associated risk factors : age, horn 's index, proton pump inhibitor use, antibiotic use, alteration of colonic microflora, initial disease severity, and hospital exposure (1418). for this study, we created an rf predictive model using multiple well - known risk factors associated with cdi identified in previous studies. after 500 runs of the tree - based algorithm, the rf model performed extremely well in classifying predictors of cdr versus non - recurrent cases. the overall accuracy of our rf model was 66.1% with a sensitivity and specificity of 83.3 and 63.1%, respectively. the area under the receiver operating curve was 82.6%, which is comparable to other strong models. our study expanded on their work by using a larger amount of patients that were followed for a longer period of time of 3 years. in addition, specific important co - variables such as ppi 's chemotherapy, corticosteroids, and antibiotic use were used in our study (19). the rf has already been used successfully in other studies in determining predictors in various chronic and acute conditions. (6) previously demonstrated that the rf was excellent at predicting factors associated with readmissions for copd exacerbation. a well - documented study by adrienne chu demonstrated that the rf machine learning algorithm outperformed six other prediction models in determining the cause of gastrointestinal bleeding (20). the models that were outperformed included well - known algorithms such as the support vector machine, boosting, artificial neural network, linear discriminant analysis, and logistic regression. one of the major strengths of our study was that it contained a large number of patients who were followed for several years (20092013). we also used a large number of significant variables in this study to create the prediction model. one of the major limitations of our study was that the majority of our sample population was caucasian. the recurrent nature of infection is worrisome since repeated use of antibiotics against the same strain of bacteria may lead to resistance mechanisms. in this study, we used the rf machine learning algorithm to create a strong prediction model with high sensitivity to predict cdr. in the evolving field of medical informatics, the use of such learning algorithm models can be used in risk factor stratification for hospitalized patients. if patients at risk for cdr could be accurately identified, specific management strategies could be developed resulting in better management, decreased morbidity and mortality, better health care resource utilization, and decreased length of hospital stay. we believe that the advantages offered by the rf makes it the ideal tool for this task. | background clostridium difficile infection (cdi) is a growing problem in the community and hospital setting. its incidence has been on the rise over the past two decades, and it is quickly becoming a major concern for the health care system. high rate of recurrence is one of the major hurdles in the successful treatment of c. difficile infection. there have been few studies that have looked at patterns of recurrence. the studies currently available have shown a number of risk factors associated with c. difficile recurrence (cdr) ; however, there is little consensus on the impact of most of the identified risk factors.methodsour study was a retrospective chart review of 198 patients diagnosed with cdi via polymerase chain reaction (pcr) from january 2009 to jun 2013. in our study, we decided to use a machine learning algorithm called the random forest (rf) to analyze all of the factors proposed to be associated with cdr. this model is capable of making predictions based on a large number of variables, and has outperformed numerous other models and statistical methods.resultswe came up with a model that was able to accurately predict the cdr with a sensitivity of 83.3%, specificity of 63.1%, and area under curve of 82.6%. like other similar studies that have used the rf model, we also had very impressive results.conclusionswe hope that in the future, machine learning algorithms, such as the rf, will see a wider application. |
xylanases are enzymes that catalyze the hydrolysis of 1,4--d xylosidic linkages in xylan, the second most abundant polysaccharide in nature after cellulose, and the most abundant hemicellulose in plant cell walls [1, 2 ]. there has been a resurgence in interest in microbial xylanases due to their numerous uses in industrial applications, such as biobleaching of pulp [35 ] and most notably the conversion of lignocellulosic materials into fermentable substrates for production of economical and environmentally attractive biofuels [6, 7 ]. the complete hydrolysis of xylan involves several main - chain cleaving enzymes : endoxylanase (endo--1,4-xylanase), -xylosidase (xylan 1,4--xylosidase), and -glucuronidase (-glucosiduronase) and side - chain cleaving enzymes : -arabinofuranosidase (-l - arabinofuranosidase) and acetylxylan esterase [8, 9 ]. this enzyme hydrolyzes the bonds between xylose subunits in the polymer of xylan to produce oligosaccharides, which in turn can be converted to xylose by -xylosidase [4, 10 ]. the microbial degradation of lignocellulose is an important process because of the reliance all earth biota have on recycling of carbon and supply of both inorganic and organic carbon forms for life. the metabolic ability to recycle this carbon can be applied to creating liquid fuels, in that the sugars produced from lignocellulolysis can be converted to fuels such as ethanol and butanol. lignocellulolytic microorganisms are ubiquitous in nature and can be isolated from plant residues such as agricultural waste products, or from hot spring environments where organic carbon is available [12, 13 ]. members of the bacterial genera anoxybacillus and bacillus have been shown to secrete a variety of lignocellulolytic enzymes such as cellulases [1416 ] and xylanases [6, 1523 ]. these organisms produce extracellular enzymes to depolymerize hemicellulose, lignin, and cellulose present in the biosphere for a source of carbon and energy, and their xylanases are of great interest for industrial applications [6, 21 ]. xylanases can be used for converting lignocellulosic agricultural waste products, which are very abundant, into fermentable sugars to generate carbon neutral liquid fuels [24, 25 ], as well as decreasing the amount the biologically detrimental chlorine necessary for biobleaching processes [35 ]. a wide variety of lignocellulolytic enzymes are commercially available ; however, these enzymes are still very costly, due to low expression levels and the overall cost of growing the organisms to express these enzymes, consequentially limiting the efficiency of industrial - scale saccharification processes. the conversion of lignocellulosic feedstocks has been recognized as a major bottleneck in the process of biofuel production, due to the recalcitrant nature of plant cell walls, enzyme efficiency, and biomass quality. this drives the continued discovery of novel enzymes in order to establish a better database of enzymes and identification of more efficient enzymes. additionally, the discovery of thermostable and alkalistable enzymes is desirable in order to increase catalytic efficiency throughout industrial processes due to variable conditions and treatment temperatures. this study was performed to gain a better understanding of anoxybacillus flavithermus twxyl3, which was isolated from the alvord basin hydrothermal system in oregon, and its extracellular xylanase enzymes. a. flavithermus twxyl3 was isolated on hot springs medium (hsm) ph 7, containing (in mg l) oat spelts xylan (7500), h3bo3 (80.1), nacl (341.0), nano3 (4.0), kcl (54.7), k2hpo4 (100.0), mgcl27h2o (3.0), wolfe 's vitamin solution (10 ml l), and 100x micronutrient solution (10 ml l), with addition of 0.5% yeast extract, 100x nahco3, and 100x cacl2 prior to inoculation. xylan was pretreated with 0.1 m naoh and heated to solubilize the material prior to addition. for solid agar plates, plant material on the periphery of tinky - winky pool (65c) was suspended in 10 ml of hsm containing 7.5 g l oat spelt xylan and incubated at 65c for 1 week. colonies showing distinct clearing zones were transferred to fresh agar plates three times to ensure purification of the isolate. total genomic dna was isolated from mid - log phase cultures using the dneasy tissue extraction kit (qiagen inc., pcr - mediated amplification of the 16s rrna gene was performed using primers 8f and 1492r along with platinum taq polymerase (invitrogen corp., sequencing of the pcr products was performed using 8f, 338f, 338r, 907f, 907r, and 1492r. all dna sequences were determined by the idaho state university (isu) molecular research core facility. the 16s sequences obtained were aligned using sequences obtained from the nonredundant ncbi database (http://www.ncbi.nlm.nih.gov) and the clustalw program found in the bioedit program (version 7.0.5.3, department of microbiology, north carolina state university, raleigh, nc). sequences from the full - length 16s rrna genes from multiple closely related characterized organisms resulting from blast, along with multiple distantly related organisms, were blast - searched and used in the alignment to establish relationships among twxyl3 and phylogenetically related isolates. eighteen sequences were used in the alignment and employed in maximum - likelihood analysis utilizing the paupboot package (luobin yang, idaho state university) with 100 bootstraps. xylanase activity was measured by using remazol brilliant blue dyed xylan (rbb - xylan, sigma chemical co. ltd., st. louis, mo), which is rbb covalently coupled to 4-o - methyl - d - glucurono - d - xylan. rbb dyed xylan is a soluble chromogenic substrate that measures the breakdown of the xylan polymer by means of dye release from the substrate. the substrate was dissolved in optimal reaction buffer to 10 mg / ml in 50 mm mes ph 6 for strain twyl3 and reacted with enzyme at optimal catalytic temperature for 1 hour. the reaction was terminated with 3 volumes of 95% ethanol. after standing for approximately 5 minutes at room temperature, the precipitated substrate was removed by centrifugation at 2500 g for 5 minutes and absorbance was measured at 595 nm using a shimadzu uv-2401 pc spectrophotometer (shimadzu corp., one unit is defined as the amount of enzyme that catalyses the release of 1 absorbance unit of free rbb - xylan produced / minute / mg protein. buffer was used in place of enzyme to serve as the negative control for all enzyme experiments. protein concentration was determined using the bicinchoninic acid - copper reduction method as described by smith.. briefly, 1 ml of working reagent (bicinchoninic acid / copper sulfate mixed at a 50 : 1 ratio) was added to 100 l of sample, and the absorbance was measured at 562 nm after incubating at 37c for 30 minutes. different concentrations of bovine serum albumin (bsa) were used as a protein standard : 0, 0.4, 0.8, 1.2, 1.6, and 2.0 mg / ml. one ml of reagent was added to 100 l bsa standardand incubated at 37c for 30 minutes, and the absorbance was measured at 562 nm to establish a standard curve. cultures were grown at optimal temperature, 65c for strain twxyl3, and samples were assayed for xylanase activity every 24 hours to determine the optimal time for xylanase production. contents were centrifuged at 7,500 g for 30 min at 4c, and the clear cell - free supernatant was filtered through a 0.22 m filter, concentrated 100-fold using a 10,000 molecular weight cut off (mwco) membrane by means of a millipore amicon pressure cell (millipore corporation., enzyme preparations were assayed under standard conditions. to determine the optimum temperature of reaction, crude enzyme preparations were assayed under standard conditions ; however, the incubation temperature for the assay was varied as follows : 25c, 37c, 55c, 65c, 75c, and 80c. the influence of temperature on the catalytic activity of crude xylanases was determined by incubating enzyme preparations at temperatures ranging from 65c to 95c for times and ranging from 0 to 105 minutes without the presence of substrate. the effect of ph on the catalytic activity of crude xylanases was determined by assaying enzyme preparations at varying ph values ranging from 3 to 9 and assayed under standard conditions. 50 mm citric acid buffer was used for ph 35, 50 mm na - acetate was used for ph 55.5, 50 mm mes was used for ph 5.56.5, 50 mm sodium phosphate was used for ph 6.57.5, and 50 mm tris - hcl was used for ph 7.59. additionally, the ph of the buffers were adjusted under the standard catalytic temperature to ensure accurate ph values throughout. crude preparations were initially concentrated 100-fold using a millipore amicon pressure cell (millipore corp., partial purification of xylanase enzymes from strain twxyl3 was achieved by use of a hiprep 26/60 sephacryl s-200 high - resolution size exclusion column (amersham biosciences corp., the column was equilibrated with 50 mm sodium phosphate buffer, ph 7.2, containing 150 mm nacl. active xylanase fractions were then loaded onto a hiprep desalting column (amersham biosciences corp., piscataway, nj) equilibrated with 50 mm tris - hcl, ph 8.45. this preparation was then loaded onto a hiprep 16/10 q ff ion exchange column (amersham biosciences corp., piscataway, nj) equilibrated with 50 mm tris - hcl, ph 8.45. bound proteins were eluted with a linear gradient of 0.01.0 m nacl in 50 mm tris - hcl, ph 8.45.. a 5.0% tricine nondenaturing (nd) polyacrylamide gel electrophoresis (page) system was utilized in order to obtain enzyme profiles for extracellular fractions in their native, multimeric state. approximately 50 g of protein was loaded and electrophoresed at 30 ma / gel constant current at 4c. gels were stained for xylanase activity (described below) and/or stained overnight in coomassie brilliant blue (cbb) and destained in deionized water. gel images were then captured and digitized using versadoc 3000 imaging system (bio - rad laboratories, inc., hercules, ca). a 7.5% tricine sodium dodecyl sulfate (sds) page system was utilized in order to obtain enzyme profiles in their monomeric state. approximately 50 g of protein was denatured, loaded, and electrophoresed at 30 ma / gel constant current. zymogram analysis was performed after sds - page or nd - page as described by matsui. with some minor modifications. briefly, samples were treated as described above and loaded onto a 7.5% tricine sds - page or 5.0% tricine nd - page containing 0.15% xylan. after electrophoresis, the proteins were renatured (if applicable) in 100 mm sodium phosphate buffer (ph 6.8) containing 2% triton x-100 for 30 minutes with mild shaking. gels were then incubated in 100 mm sodium phosphate (ph 6.8) buffer for 1 hour at optimal enzyme temperature with gentle shaking. gels were stained using 0.1% congo red for 10 minutes, destaining with 1% nacl until zones of clearing became present, and fixed with 5% acetic acid. strain twxyl3 was obtained from submerged plant material on the periphery of a stagnant 55c pool in the mickey hot springs area of the alvord basin. isolation was achieved by enrichment on xylan - containing synthetic hot spring medium, followed by successive streak isolation to obtain a pure culture. twxyl3 was judged pure by 16s rrna gene sequence analysis, and consistent colony and cellular morphology. analyses of pure culture isolate dna did not show multiple 16s rrna gene sequences, indicating that the culture was pure. analysis of the 16s rrna gene showed that strain twxyl3 had high similarity to the genus anoxybacillus. phylogenetic analysis of 16s rrna from strain twxyl3, along with additional similar and dissimilar characterized strains, was utilized to construct a phylogenetic tree (figure 1). cultures were grown with 1% oat spelt xylan, and the optimal incubation time was determined for xylanase production. spectrophotometric assays show the optimal enzyme temperature and incubation time for strain twxyl3 to be 65c for approximately 6 days the specific activity of the xylanase enzymes from the crude supernatant was measured at 0.08 u / mg protein. the xylanase activities produced by strain twxyl3 were highest between 55c and 65c, with optimal activity at 65c (figure 3). although the stability of these enzymes were significantly reduced at 85c, showing 52% activity after 60 minutes and 39% activity after 105 minutes, they retained 92% activity at 75c after 60 minutes (figure 4). xylanase enzymes were optimal at ph 6 ; however, they retained 38% of their activity at ph 9 for one hour (figure 5). the specific activity of the xylanase enzymes from the crude supernatant was measured at 0.08 u / mg protein and 2.2 u / mg protein after partial purification. nd - page and zymography assays from crude extracellular preparations indicate the presence of a large - molecular - weight active xylanase complex equal to or greater than 250 kda. despite performing the experiment at 4c, activity was present even during electrophoresis, as evidenced by smeared clearing zones or tracks (figure 6). additionally, sds - page zymography assays indicated multiple xylanase activity bands ranging from 25 to 75 kda, with activity bands present at 25 kda, 32 kda, 37 kda, 60 kda, and 75 kda, also produced from strain twxyl3 (figure 6). twxyl3 is a facultative anaerobic thermophile that secretes moderately alkalistable and thermostable xylanase enzymes into the growth medium. phylogenetic analysis supports the relationship of strain twxyl3 to other characterized strains of a. flavithermus. table 1 shows general characteristics of a. flavithermus twxyl3 as well as other similar characterized strains. our isolate was able to grow on a wide variety of carbohydrates, including dairy waste as the sole carbon source. this ability to degrade an abundance of lignocellulosic materials would be advantageous for industrial - scale saccharification processes. only one other known strain of a. flavithermus has shown xylanolytic capabilities, and among the genus anoxybacillus, only the species of anoxybacillus flavithermus has shown capable of xylan and cellulose - degrading capabilities. xylanase enzymes described here have been shown to be thermostable as well as moderately alkalistable. the thermostability of these enzymes was similar to published results of a. flavithermus bc by kambourova.. an earlier study of a. flavithermus bc by the same group provided similar results on the alkalistability of a. flavithermus xylanase enzymes. partial purification of xylanase enzymes indicates that there was measurable and increased xylanase activity throughout purification of these enzymes. specific activity of xylanase enzymes from strain twxyl3 throughout enzyme purification was measured at 0.08 u / mg protein in the crude supernatant and 2.2 u / mg protein after concentration, size exclusion, and anion exchange chromatograph was employed. these data illustrate that a. flavithermus twxyl3 shows interesting xylanolytic capabilities in that it secretes a large pentameric enzyme complex into the growth media, which has never been described by this species. this complex, or xylanosome, is composed of at least 5 active protein subunits ranging from 25 kda to 75 kda, suggesting a pentameric protein complex approximately 250 kda in size (figure 6). this data is unique from the xylanase activity described for strain bc, in that they illustrated only two active xylanase enzymes at 92 kda and 80 kda. the presence of a large - molecular - weight active complex from strain twxyl3 is further supported by the elution profile from the s-200 high - resolution size exclusion column (data not shown). the active fractions are eluted in the area of a 200 kda or larger protein when compared to standards of greater than 200 kda. thermophiles typically produce family 10 (large molecular mass) and family 11 (small molecular mass) xylanases, and the profile of xylanase proteins detected in twxyl3 is consistent with this pattern. the ability of a. flavithermus twxyl3 to produce a large xylanolytic complex may serve to provide higher adaptability to degrade an assortment of complex polysaccharides or perhaps to fully degrade xylan into its monosaccharide components. thermostable xylanases from microorganisms provide great benefit in that they can retain their activities at high temperatures, while preventing potential contamination due to these high temperatures. additionally, thermostable enzymes simplify cooling problems from pretreated biomass [37, 38 ]. xylanases described here would be ideal for certain industrial applications [2, 27 ], particularly biobleaching of pulp [6, 18 ] and saccharification processes due to their adaptive capacity to withstand hostile conditions. this microorganism and its extracellular xylanases show potential in large scale - up reactors, for the conversion of agricultural waste products rich in lignocellulose, which are cheap and abundant, for use in downstream fermentation processes into high - value biofuels. | with the rising cost and finite supply of fossil energy, there is an increasing economic incentive for the development of clean, efficient, and renewable domestic energy. the activities of microorganisms offer the potential conversion of lignocellulosic materials into fermentable sugars, usable for downstream fermentation processes. strain twxyl3, a thermophilic facultative anaerobe, was discovered in the alvord basin hydrothermal system in oregon, usa. phylogenetic analysis of strain twxyl3 showed it to be 99% similar to the 16s rrna gene of anoxybacillus flavithermus wl (fj950739). a. flavithermus twxyl3 was shown to secrete a large multisubunit thermostable xylanase complex into the growth medium. xylanase induction was achieved by resuspending the isolate in a selective xylan - containing medium. extracellular xylanase activity showed a temperature optimum of 65c and retained thermostability up to 85c. extracellular xylanase activity showed a bimodal ph optimum, with maxima at ph 6 and ph 8. electrophoretic analysis of the extracellular xylanase shows 5 distinct proteins with xylanase activity. strain twxyl3 is the first xylanolytic isolate obtained from the alvord basin hydrothermal system and represents a new model system for development of processes where lignocellulosics are converted to biofuel precursors. |
the incidence of blunt cardiac rupture among hospital admissions for trauma is only approximately 0.16%2% [46 ]. however, the actual incidence may be higher because many victims may die before arrival at the hospital. with advances in traumatology, several studies have investigated the prognostic factors associated with traumatic cardiac rupture. in this study, we attempted to find factors affecting the prognosis of patients with blunt traumatic cardiac rupture. this retrospective study was reviewed and approved by the institutional ethics committee of our institution (ethical committee of sungkyunkwan university of samsung changwon hospital, approval number 2015-scmc-037 - 00). between 1999 and 2015, a total of 107,657 patients were admitted to our hospital due to trauma. ultimately, we analyzed 21 patients who were diagnosed with blunt traumatic cardiac rupture and required emergency surgery. in our analysis of these 21 patients all operations were performed via median sternotomy. in each case, cardiopulmonary bypass (cpb) or extracorporeal membrane oxygenation was prepared as a precaution. if the patient was hemodynamically unstable, 2 cardiovascular surgeons operated together to perform the median sternotomy and femoral cannulation simultaneously. after the sternotomy, surgeons opened the pericardium for prompt decompression of the heart, rapidly removed the hematoma, and attempted to find the injury site. the injury sites were primarily repaired using double - arm monofilament stitches with pledgeted, interrupted sutures. after the injury sites were primarily repaired, we weaned the patients from cpb as soon as possible. categorical variables were compared using the chi - square test or the fisher exact test. all p - values < 0.05 were considered to indicate statistical significance. this retrospective study was reviewed and approved by the institutional ethics committee of our institution (ethical committee of sungkyunkwan university of samsung changwon hospital, approval number 2015-scmc-037 - 00). between 1999 and 2015, a total of 107,657 patients were admitted to our hospital due to trauma. ultimately, we analyzed 21 patients who were diagnosed with blunt traumatic cardiac rupture and required emergency surgery. in our analysis of these 21 patients all operations were performed via median sternotomy. in each case, cardiopulmonary bypass (cpb) or extracorporeal membrane oxygenation was prepared as a precaution. if the patient was hemodynamically unstable, 2 cardiovascular surgeons operated together to perform the median sternotomy and femoral cannulation simultaneously. after the sternotomy, surgeons opened the pericardium for prompt decompression of the heart, rapidly removed the hematoma, and attempted to find the injury site. the injury sites were primarily repaired using double - arm monofilament stitches with pledgeted, interrupted sutures. after the injury sites were primarily repaired, we weaned the patients from cpb as soon as possible. categorical variables were compared using the chi - square test or the fisher exact test. all p - values < 0.05 were considered to indicate statistical significance. most blunt traumatic cardiac injuries resulted from traffic accidents (81%), and most patients had combined trauma. the combined trauma included liver laceration, spleen injury, pelvic bone fracture, spinal fracture, and fractures of the extremities (table 2). the mean injury severity score (iss) was 2817.4 (range, 16 to 97). among the 21 patients, the mean central venous pressure (cvp) and systolic blood pressure of the 3 patients who died were 28 cm h2o and 67 mm hg, respectively. in contrast, the mean cvp and systolic blood pressure of the 7 surviving patients were 26 cm h2o and 81 mm hg, respectively. three of them had left ventricle injuries, and the other had a right atrium (ra)/inferior vena cava (ivc) junction injury. among these 4 patients, therefore, they underwent a co - operation (open reduction and vessel repair) to prevent additional bleeding due to systemic heparinization. the preoperative lab findings, systolic blood pressure, and elapsed time from arrival to surgery are summarized in table 3. myocardial band (ck - mb) levels (13.49.2 ng / ml) were elevated in most patients. in contrast, the preoperative creatinine levels (1.10.3 mg / dl) were nearly normal in all patients. in addition, the mean blood transfusion amount in survivors was 6.3 units, as compared to 9 units in fatalities (p=0.900). no instances of intraoperative mortality occurred, but the in - hospital mortality rate was 24% (5 of 21). the causes of death included pneumonia (1), inadequate myocardial protection - related low cardiac output (1), and massive bleeding - related disseminated intravascular coagulation (3). all fatalities showed liver and renal failure, and 2 of them showed brain death. significant differences were found in preoperative ck - mb levels (p=0.042) and platelet counts (p=0.004) between the survivors and fatalities. in addition, the preoperative glasgow coma scale score (p=0.007), trauma and injury severity score (p=0.007), and iss were significantly worse in the fatalities than in the survivors (p=0.004). no significant differences were found between the two groups in preoperative creatinine levels (p=0.495) or elapsed time to surgery (p=0.445). similarly, no significant differences were found in injury location (p=0.437), cpr history (p= 0.372), use of cpb (p=0.182), amount of blood transfusion (p=0.900), or shock index (p=0.186) between the two groups. most patients who experience blunt traumatic cardiac rupture die before arrival to the hospital. according to one japanese study, 91% of patients with blunt traumatic cardiac rupture died within 30 minutes of the accident. we analyzed 21 patients who experienced blunt traumatic cardiac rupture and compared our results with those of previous studies. traffic accidents were the most common cause of blunt traumatic cardiac rupture (80%), and the most common site of injury was the right atrium (43%) [2,5,79 ]. when a patient arrived at the hospital, we first focused on the vital signs, peripheral circulation, presence of an open wound, neck vein distension, and facial plethora. if cardiac rupture was suspected, we performed chest computed tomography, focused assessment with sonography for trauma, or transthoracic echocardiography as soon as possible. if patients had unstable vital signs, we performed intubation and transfusion, using intravenous inotropics as needed. if patients had hemopneumothorax, we inserted a chest tube at the emergency department and then rapidly transferred the patients to the operating room. ten of the 21 patients were suspected to have cardiac tamponade because they had hypotension, high cvp, and echocardiographic signs of tamponade (the presence of pericardial effusion, diastolic collapse of the right ventricle, ivc dilatation, etc.). when we suspected cardiac tamponade, we rapidly moved the patient to the operating room rather than trying to insert a pericardial catheter in the emergency room, because it takes almost the same time to perform a pericardial catheter insertion as to prepare the operating room in our hospital. the average elapsed door - to - surgery time in patients with cardiac tamponade was 29 minutes. in contrast, when cardiac tamponade was not suspected, further evaluations were performed prior to surgery. if a patient s vital signs are unstable, we consider an emergency department thoracotomy to have several advantages, including the prompt decompression of pericardial pressure and the rapid restoration of hemodynamics. cpb was applied in 4 patients with left ventricular rupture, and in 1 patient with an ra / ivc junction injury. the overall survival rate was similar to that of a prior study, which found that 70%80% of patients who were transferred to trauma centers survived after blunt cardiac injury. they found significant differences between survivors and fatalities in preoperative creatinine levels, but no differences in preoperative ck - mb or platelet count. in contrast, we found no significant difference in preoperative creatinine levels between survivors and fatalities. in addition, our results revealed significant differences in preoperative ck - mb levels and platelet counts between the two groups. patients with impaired renal function preoperatively would be expected to have poorer postoperative outcomes than those with normal renal function. in our study, however, all patients had normal preoperative creatinine levels. this may explain why we did not identify a significant difference between survivors and fatalities. this enzyme is not specific for cardiac injury, but can reflect severe muscle injury and potentially predict rhabdomyolysis. according to a 1998 study by swaanenburg., among 38 patients with thoracic injuries, 1830 had increased ck - mb levels, increased ck - mb activity, an elevated ratio of ck - mb activity to total ck, or an elevated ratio of ck - mb mass to total ck upon admission. although elevated ck - mb levels are not specific for cardiac injury, they can be indicative of severe combined injuries and be associated with a poor prognosis. in addition, a low preoperative platelet count may also be associated with a poor prognosis. recently reported that the early - stage platelet count was independently related to mortality in blunt trauma patients. a low platelet count reflects increased platelet consumption as well as massive blood loss and hemodilution. increased platelet consumption can lead to a systemic inflammatory response or disseminated intravascular coagulation. early platelet consumption can be explained based on the fact that platelet aggregation and blood clot formation begins within 1520 seconds of a major vessel rupture. we did not find any significant difference in elapsed time from hospital arrival to surgery between fatalities and survivors. for instance, when a patient was suspected to have cardiac tamponade, surgery was promptly performed within 30 minutes. this was a case - control study, and case - control studies are prone to bias and confounding. although we were able to identify some characteristics of survivors, we were not able to clearly confirm causality. given this limitation, we attempted to identify factors associated with a poor prognosis. few prior studies have investigated blunt traumatic cardiac rupture due to the rarity of such cases. we found that elevated ck - mb levels, a low platelet count, and multi - organ traumatic injury were associated with a poor prognosis (fig. if a patient with blunt traumatic cardiac rupture exhibits these factors, clinicians should be especially attentive and respond promptly to save the patient s life. this was a case - control study, and case - control studies are prone to bias and confounding. the small, heterogeneous study population is a major limitation of this study. although we were able to identify some characteristics of survivors, we were not able to clearly confirm causality. given this limitation, we attempted to identify factors associated with a poor prognosis. few prior studies have investigated blunt traumatic cardiac rupture due to the rarity of such cases. we found that elevated ck - mb levels, a low platelet count, and multi - organ traumatic injury were associated with a poor prognosis (fig. if a patient with blunt traumatic cardiac rupture exhibits these factors, clinicians should be especially attentive and respond promptly to save the patient s life. | backgroundblunt traumatic cardiac rupture is rare. however, such cardiac ruptures carry a high mortality rate. this study reviews our experience treating blunt traumatic cardiac rupture.methodsthis retrospective study included 21 patients who experienced blunt traumatic cardiac rupture from 1999 to 2015. every patient underwent surgery. several variables were compared between survivors and fatalities.resultssixteen of the 21 patients survived, and 5 (24%) died. no instances of intraoperative mortality occurred. the most common cause of injury was a traffic accident (81%). the right atrium was the most common location of injury (43%). ten of the 21 patients were suspected to have cardiac tamponade. significant differences were found in preoperative creatine kinase myocardial band (ck - mb) levels (p=0.042) and platelet counts (p= 0.004) between the survivors and fatalities. the patients who died had higher preoperative glasgow coma scale scores (p=0.007), worse trauma and injury severity scores (p=0.007), and higher injury severity scores (p=0.004) than those who survived.conclusionwe found that elevated ck - mb levels, a low platelet count, and multi - organ traumatic injury were prognostic factors predicting poor outcomes of blunt cardiac rupture. if a patient with blunt traumatic cardiac rupture has these factors, clinicians should be especially attentive and respond promptly in order to save the patient s life. |
tumor vascularization, vital to neoplastic progression, provides nutrients and oxygen to the tumor [13 ]. proliferation of vessel - forming endothelial cells is a limiting factor for tumor growth [47 ]. accordingly, targeting tumor vessel proliferation decreases blood flow and nutrient availability, thus slowing tumor growth. tumors induce the proliferative vascular response of host blood vessels by influencing the local balance of angiogenic regulators, a rate - limiting step termed the angiogenic switch [9, 10 ]. the uncontrolled production of angiogenic stimulators and the absence of inhibitors favor vessel growth [1012 ]. normal tissue vasculature contains an endothelial lining with a surrounding sheath of pericytes / vascular smooth muscle cells (vsmcs). in contrast to healthy vessels, tumor vessels are immature, often mal - shaped, irregular, and have a tortuous structure with a leaky endothelial cell lining [13, 14 ]. the process of blood vessel maturation involves ensheathment of neovascular sprouts by -smooth - muscle - actin- (-sma-) positive pericytes. pericytes contact endothelial cells and play an active role in endothelial cell function and blood flow regulation [1517 ]. mature vessels contain a variety of contractile proteins including -sma, which is often used as a pericyte marker [15, 18, 19 ]. the instability of tumor blood vessels is associated with the absence of a smooth muscle cell sheath. abnormalities in tumor vessel shape and structure not only impair drug delivery, but also can facilitate metastatic spread [20, 21 ]. while it may seem that an increase in blood vessel quantity would provide sufficient oxygen to tumors, the abnormal vessels deliver less oxygen leading to a hypoxic tumor environment. this will further stimulate tumor growth and aberrant angiogenesis [22, 23 ]. vascular endothelial growth factor (vegf) and platelet - derived growth factor (pdgf) signaling drives angiogenesis and recruitment of perivascular cells to surround the newly formed blood vessels. vegf stimulates endothelial cell migration, proliferation, survival, permeability, and lumen formation and has become a prime target of antiangiogenic therapy. blockage of vegf signaling induces vessel normalization and inhibition of new vessel growth (16). in addition to the pruning of immature blood vessels, inhibition of vegf expression also increases pericyte cell coverage and vessel maturation [25, 26 ]. platelet - derived growth factor (pdgf) coordinates pericyte coverage of vascular sprouts through pdgf - r on vascular smooth muscle cells. greenberg. showed that, in addition to stimulating endothelial cell proliferation, vegf also inhibits neovascularization via its capacity to disrupt vascular smooth muscle cell function. vegf activation of vegf - r2 suppresses pdgf - r signaling in vsmcs through the assembly of a complex consisting of the two receptors. inhibition of vegf - r2 prevents the formation of this receptor complex and restores tissue angiogenesis. moreover, genetic deletion of tumor cell vegf also disrupts the receptor complex and consequently increases tumor vessel maturation. these findings are important as they reveal a dichotomous role for vegf signaling as a promoter of endothelial cell function and as an inhibitor of vsmcs and vessel maturation [24, 26, 28, 29 ]. vegf expression is greater in tumor cells than in normal cells [3033 ]. mukherjee. demonstrated that a 30% dietary restriction (dr) inhibits angiogenesis and reduces prostate tumor growth. we showed that dr in mice reduces microvessel density in experimental mouse and human brain tumors [35, 36 ]. they also found that a 40% dr significantly reduced vegf gene and protein expression in rat prostate tumors. these studies show that dr is a potentially viable nontoxic therapeutic approach for managing malignant brain tumor growth, for reducing tumor angiogenesis, and for increasing long - term survival in mice bearing orthotopically implanted tumors [3538 ]. however, a distinction from starvation is that dr does not cause anorexia or malnutrition [34, 3942 ]. it is important to note that the total reduction of calories, rather than the macronutritional content of the food, proves most important to producing the effects of reducing tumor growth and in limiting angiogenesis [34, 39 ]. although prior studies showed that dietary restriction is antiangiogenic when initiated early in tumor development, no prior studies have identified the mechanisms by which dietary restriction is effective in correcting vasculature. in this paper, we show that dr enhances vessel maturation and stabilization in the highly vascularized ct-2a mouse astrocytoma. in addition to reducing vegf expression, we also found that dr decreased colocalization of vegf - r2 with pdgf - r. our findings suggest that dr imparts its antiangiogenic and vessel maturating effects on the ct-2a tumor via the reduction of vegf expression promoting vsmc ensheathment of vascular sprouts. mice of the c57bl/6j strain were obtained from the jackson laboratory (bar harbor, me, usa). the mice were propagated in the animal care facility of the biology department of boston college, using animal husbandry conditions described previously. male mice (810 weeks of age) were used for the studies and were provided with food either ad libitum (al) or under restricted conditions (as described below). the animal room was maintained at 22c, and cotton nesting pads were provided for additional warmth. all animal experiments were carried out with ethical committee approval in accordance with the national institutes of health guide for the care and use of laboratory animals and were approved by the institutional care committee. the syngeneic ct-2a experimental mouse brain tumor was generated in our laboratory after implantation of 20-methylcholanthrene into the cerebral cortex of a c57bl/6 mouse according to the procedure of zimmerman [45, 46 ]. histologically, the ct-2a brain tumor is broadly classified as a poorly differentiated highly malignant anaplastic astrocytoma. the ct-2a tumor was implanted into the cerebral cortex of c57bl/6j mice using a trocar as we previously described [47, 48 ]. briefly, mice were anaesthetized with pentobarbital (vet labs, inc) intraperitoneally and their heads were shaved and swabbed with 70% ethyl alcohol under sterile conditions. small ct-2a tumor pieces (1 mm) from a c57bl/6j donor mouse were implanted into the right cerebral hemisphere of anaesthetized recipient mice as we recently described. all of the mice recovered from the surgical procedure and were returned to their cages when fully active. initiation of tumors from intact tumor pieces is preferable to initiation from cultured cells since the pieces already contain an established microenvironment that facilitates tumor growth. the mice were separated prior to the beginning of the experiment and randomly assigned to either control group that was fed al or to an experimental group that was fed a total dietary restriction (dr) of 30%. each mouse was housed singly in a plastic shoe box cage with a filter top and was given a cotton nesting pad for warmth. dr was initiated 2 days following tumor implantation and was continued for 11 days following implantation. total dr maintains a constant ratio of nutrients to energy ; that is, the average daily food intake (grams) for the al fed mice was determined every other day and the dr - fed mice were given 70% of that quantity on a daily basis. all mice received prolab chow (agaway inc.), which contains a balance of mouse nutritional ingredients and, according to the manufacturer 's specification, delivers 4.4 kcal / g gross energy. tumors were dissected from normal - appearing brain tissue, were frozen, and then were weighed. tumor samples for histology were fixed in 10% neutral buffered formalin (sigma) and embedded in paraffin. they were sectioned at 5 m, stained with haematoxylin and eosin, and examined by light microscopy. mice were anesthetized with isoflurane (halocarbon laboratories, river edge, nj, usa) and euthanized by exsanguination, involving collection of blood from the heart in heparinized tubes. the blood was centrifuged at 6,000 g for 10 min, the plasma was collected, and aliquots were stored at 80c until analysis. plasma glucose concentration was measured in a spectrophotometer using the stanbio enzymatic glucose procedure (stanbio). high - performance thin - layer chromatography was used to evaluate plasma lipids according to our standard procedures. frozen ct-2a tumor and contralateral normal brain tissues were homogenized in lysis buffer, on ice. lysates were transferred to eppendorf tubes, mixed on a rocker for 1 h at 4c, and then centrifuged for 20 min. supernatants were collected, and protein concentrations were estimated using the bio - rad detergent - compatible protein assay. approximately 25 g of total protein from each tissue sample were denatured with sds - page sample buffer and resolved with sds - page on 4% to 12% bis - tris gels (invitrogen). proteins were transferred to a polyvinylidene difluoride immobilon tm - p membrane (millipore) overnight at 4c and blocked in 5% nonfat powdered milk in tbs with tween 20 (ph 7.6) for 1 h at room temperature. the blots were then incubated with the appropriate secondary antibody for 1 h at room temperature, and bands were visualized with chemiluminescence. each membrane was stripped and reprobed for -actin as an internal loading control, and the ratio of the indicated protein to -actin was analyzed by scanning densitometry. antibodies were obtained against -sma (sigma), -actin (cell signaling), factor viii (dako), pdgf - r (santa cruz), vegf - r2 (santa cruz), and vegf (santa cruz). for the immunohistochemical studies, the tissue sections were deparaffinized, rehydrated, and washed. the tissue sections were then heat treated (95c) in antigen unmasking solution (vector laboratories, burlingame, ca, usa) for 30 min. tissue sections were blocked in goat serum (1 : 10 in pbs) for 1 h at room temperature, treated with primary antibody, followed by treatment with secondary antibody., digital images were obtained on a leica dmi6000 inverted scope equipped with the leica tcssp5 confocal system, using hcx pl apo 409/1.25 na oil and hcx pl apo 639/1.4 na oil objective lenses. leica confocal software was used to acquire images. for -sma and factor viii immunoflourscent staining, sections were incubated with a cocktail of -sma and factor viii primary antibodies (1 : 100) in blocking buffer for 1 h at room temperature, followed by a cocktail of alexafluor 585 and 488, conjugated anti - mouse and anti - rabbit, respectively, secondary antibody (1 : 200) for 45 min at room temperature. for colocalization of vegf - r2 and pdgf - r, sections were incubated with a cocktail of vegf - r2 and pdgf - r2 primary antibodies (1 : 100) in blocking buffer overnight at 4c, followed by a cocktail of alexafluor 585 and 488, conjugated anti - mouse and anti - rabbit, respectively, secondary antibody at 1 : 200 dilution for 45 min. sections were treated with vegf, pdgf - r, and factor viii primary antibodies overnight at 4c followed by treatment with a biotinylated anti - rat secondary antibody at 1 : 100 dilution (vector laboratories, inc). the sections were then treated with avidin biotin complex followed by 3,3-diaminobenzidine as substrate for staining according to the manufacturer 's protocol (vectastain elite abc kit, vector laboratories, inc.). the dr group exhibited an average body weight reduction of 22 1% and an average tumor reduction of 76 4%. average tumor wet weight was significantly lower in the dr - fed mice (51 7 mg) than in the al - fed mice (209 40 mg) ; p < 0.01, student 's t - test. blood glucose levels (mmol / l) in the al and dr mice were 8.6 0.6 and 4.4 1.0, respectively (p < 0.05, determined by two - tailed t - test). the blood glucose levels were reduced in the dr mice as we previously showed [36, 50 ]. no significant differences were detected between the al and dr mice for the distribution of major lipids including cholesteryl esters, cholesterol, triglycerides, or phosphatidylcholine (data not shown). this is a well - documented phenomenon that occurs in all mice when placed under calorie restriction and is due to increased foraging. it is well documented that general health and fitness improves significantly in mice when they are underfed with adequate nutrition [51, 52 ]. it is important to note that all tumors implanted grew in both the dr and al groups, indicating that dietary restriction did not inhibit tumor take. staining was used to evaluate the influence of dr on hemorrhagic blood vessels in ct-2a (figure 1(a)). the number of hemorrhagic vessels was noticeably less in tumors of dr - fed mice than in tumors of al - fed mice. factor viii immunohistochemistry was used to evaluate the influence of dr on the density of vascular endothelial cells. the number of factor - viii - stained endothelial cells was noticeably less in sections of tumors from dr - fed mice than from al - fed mice, indicating a reduction of microvessel density (figures 1(b) and 1(c)). confocal microscopy was used to determine the influence of dr on localization of -sma and factor viii in blood vessels of ct-2a (figure 2). -sma (red) was used as a marker for vascular smooth muscle cell (vsmc)/perictye coverage of blood vessels, and factor viii (green) was used as a marker for endothelial cells. localization of vsmcs (red) with the endothelial cell lining (green) was greater in tumor vessels of dr - fed mice than in tumor vessels of al - fed mice. western blot analysis was done to examine the effects of dr on the relative expression of -sma and factor viii in tumor blood vessels. factor viii expression was significantly lower while -sma expression was significantly higher in the ct-2a tumor when grown in dr - fed mice than when grown in al - fed mice (figure 3). the ratio of -sma to factor viii was significantly greater in the tumors of the dr mice as compared to the al mice (figure 3). an increase of this ratio in dr mice as compared to the al group indicates a reduction of endothelial cell proliferation and a simultaneous increase of pericyte / vsmc vessel coverage. immunohistochemistry was used to determine the influence of dietary restriction on local vegf expression in ct-2a. the brown vegf staining intensity and quantity was noticeably less in tumors of dr - fed mice than in tumors of al - fed mice (figure 4). these findings are consistent with previous findings in plasma indicating that dr reduces vegf expression [35, 36 ]. confocal microscopy showed that the amount of yellow staining, indicative of colocalization of pdgf - r (red) and vegf - r2 (green), was less in dr - fed mice compared to tumors of al - fed mice (figure 5(a)). western blot analysis showed that pdgf - r expression was similar in tumors of dr - fed and al - fed mice (figure 5(b)). we found for the first time that dr could enhance tumor blood vessel maturation in a malignant mouse astrocytoma. dr not only curtailed angiogenesis, but also increased vessel pericyte ensheathment in the highly vascularized ct-2a astrocytoma. dr reduced endothelial cell proliferation, as indicated by a reduction in staining for factor viii, a marker for endothelial cells. we also observed an increase of pericyte and vascular smooth muscle cell coverage of the endothelial cell lining in blood vessels, as indicated by an increase of -sma, a marker for vsmcs and vsmc - like pericytes. our findings agree with the previously documented antiangiogenic effects of dr [3436, 53 ]. immunostaining of tumor sections with vegf antibody showed an overall reduction of vegf expression in dr - treated tumors. we suggest that the observed reduction in vegf leads to the antiangiogenic and vessel maturating effects, via the vegf - vegf - r2 signaling axis. the vegf - vegf - r2 signaling axis is a primary pathway in endothelial cell proliferation. moreover, greenberg. implicated vegf in a dichotomous role. apart from acting as a promoter of endothelial cell function, vegf also acts as a negative regulator of vsmcs and consequently vessel maturation. we observed that dr reduced colocalization of vegf - r2 and pdgf - r in the ct-2a tumor. these findings suggest that dr blocks the association of vegf - r2 and pdgf - r by reducing vegf, thus preventing inhibition of the pdgf signaling axis due to colocolization of the two receptors. the leakiness of the tumor vasculature leads to elevated interstitial fluid pressure within the tumor. they also showed that penetration of large molecules into tumors is better through vessels with uniform pericyte coverage than through vessels with irregular pericyte coverage. we suggest that dr may improve drug delivery to the tumor via a similar mechanism. denny. found that restriction of a ketogenic diet improved delivery of a small drug molecule into the mouse brain. they found that brain n - butyldeoxynojirmycin (nb - dnj) content was 3.5-fold greater in the restricted ketogenic diet + nb - dnj mice than in the nb - dnj group alone suggesting that dr enhances delivery of the drug to the brain. further research on the effects of dietary restriction on the brain vasculature is necessary to elucidate the mechanism by which diet and dr enhance drug delivery to the brain. the targeting of angiogenesis has become an important strategy in current therapy [61, 62 ]. the goal of antiangiogenic therapy is to reduce microvessel density and to increase vessel stabilization [9, 6062 ]. our findings show that mature smooth - muscle - cell - covered vessels are more prominent in brain tumors under dr than in brain tumors under al feeding. this preclinical study shows that dr may be an effective nontoxic antiangiogenic therapy in brain tumors. dr may also improve drug delivery to brain tumors and may therefore be used in conjunction with drug therapy. | mature vasculature contains an endothelial cell lining with a surrounding sheath of pericytes / vascular smooth muscle cells (vsmcs). tumor vessels are immature and lack a pericyte sheath. colocalization of vascular endothelial growth factor receptor 2 (vegfr-2) and platelet - derived growth factor receptor beta (pdgf - r) reduces pericyte ensheathment of tumor vessels. we found that a 30% dietary restriction (dr) enhanced vessel maturation in the mouse ct-2a astrocytoma. dr reduced microvessel density and vegf expression in the astrocytoma, while increasing recruitment of pericytes, positive for alpha - smooth muscle actin (-sma). moreover, dr reduced colocalization of vegf - r2 and pdgf - r, but did not reduce total pdgf - r expression. these findings suggest that dr promoted vessel normalization by preventing vegf - induced inhibition of the pdgf signaling axis in pericytes. dr appears to shift the tumor vasculature from a leaky immature state to a more mature state. we suggest that vessel normalization could improve delivery of therapeutic drugs to brain tumors. |
protein folding cooperativity is defined by the nature of the finite - size thermodynamic transition exhibited upon folding : two - state transitions show a free - energy barrier between the folded and unfolded ensembles, while downhill folding is barrierless. a microcanonical analysis, where the energy is the natural variable, has proved to be better suited than its canonical counterpart to unambiguously characterize the nature of the transition. replica - exchange molecular dynamics simulations of a high - resolution coarse - grained model allow for the accurate evaluation of the density of states in order to extract precise thermodynamic information and measure its impact on structural features. the method has been applied to three helical peptides : a short helix shows sharp features of a two - state folder, while a longer helix and a three - helix bundle exhibit downhill and two - state transitions, respectively. extending the results of lattice simulations and theoretical models, we have found that it is the interplay between secondary structure and the loss of non - native tertiary contacts that determines the nature of the transition. |
|
serotonin transporter gene (slc6a4, solute carrier family 6, member 4) encodes an integral plasma membrane protein that plays a major role in the regulation of serotonin neurotransmission (1). it has been widely recognized as the target sites of selective serotonin reuptake inhibitor (ssris), which have been recognized as both anti - depressant and anti - anxiety drugs. two common polymorphisms in the promoter region of the serotonin transporter gene, i.e. 5-httlpr (polymorphisms in the promoter region of the serotonin transporter gene) have been reported, together with their functional properties. (" l ") and short (" s ") alleles confirmed by conventional polymerase chain reaction and electrophoresis, were involved in the transcriptional regulation of the serotonin transporter gene (2, 3). the short allele has been suggested to decrease transcriptional activities of serotonin transporter gene, although it is uncertain whether they act in a dominant fashion (4) or a recessive fashion (5 - 7). studies have shown that reliably measured personality dimensions are substantially influenced by genetic factors (8). among them, anxiety - related traits such as harm avoidance or neuroticism appears to be one of the most fundamental, enduring, and continuously distributed personality dimensions, which are associated with 5-httlpr (2, 9, 10). these associations, however, remain controversial, because numerous other studies yielding negative results (11 - 15). these inconsistencies could be accounted for by various factors including different measures applied, confounding effects of age and gender, and inadequate sample size. perhaps more importantly, ethnic differences in allele frequencies and population substructure may underlie those inconsistent results. in the present study, we examined whether association between 5-httlpr and harm avoidance of korean version of the temperament and character inventory (k - tci) (16) should be replicated in korean population. we also examined other personality traits in k - tci since other personality dimensions of novelty seeking, reward dependence, and persistence are reported to be independently heritable (18). we confined our sample to one college students, which was presumed to be relatively homogenous population regarding age and sociocultural backgrounds. there were 69 males and 89 females, average age of 23.83.1 (means.d.) a 10 ml venous blood sample was obtained, and genomic dna was isolated from peripheral blood leukocytes according to standard procedures. dna fragments were amplified by polymerase chain reaction using 5'-ggcgttgccgctctgaattgc (-1,416 ->-1,397) and 5'-gagggactgagctggacaacccac (-910 ->-889) primers (3). the pcr reaction mixture contained a total volume of 20 l with the following composition : 12 ng genomic dna, 4 pmoles of the each primers, 2.5 mm dntps, 5 mm of deaza dgtp, and 1 u ampli taq with the appropriate buffer. after an initial 5 min denaturation step at 95, 5 cycles were performed consisting of 40 sec at 95, 40 sec at 58, and 60 sec at 72, followed by an additional 35 cycles of 40 sec at 95, 40 sec at 61, and 60 sec at 72. the reaction was ended by incubation at 72 for 7 min. pcr products were separated by the long (524 bp) and short (484 bp) variants on 3% agarose gels with ethium bromide. we compared harm avoidance scores across the different genotypes (" ss ", " sl " and " ll ") and sex. then, we compared the scores between " ss " group and " sl"+"ll " group, since " s " allele might act as recessive fashion (5, 19). additionally, we compared another 3 dimensional scores of novelty seeking, reward dependence, and persistence. statistical package for the social sciences (spss, version 10.0, spss inc, chicago, il., u.s.a., 2000) was used. the genotypes of 5-httlpr were distributed according to the hardy - weinberg equilibrium (=0.13, p=0.94). ninety - five subjects (60.1%) were " ss " genotype, and subjects with " sl " and " ll " were 54 (34.2%) and 9 (5.7%), respectively. there were no significant differences in the scores of harm avoidance (f=0.38, p=0.69), novelty seeking (f=0.07, p=0.93), reward dependence (f=0.16, p=0.86) and persistence (f=0.24, p=0.79) using genotype and sex as independent variables (table 1). when dividing the subjects into 2 groups of " ss " (60.1%) and " sl"+"ll " (39.9%), we could not find associations between the two genotype group and personality traits, either (table 1). while the 5-httlpr genotypes frequencies (=111.04, p<0.001) and the allele frequencies (=110.21, p<0.001) in our sample were significantly different from those of lesch. (2), those frequencies are quite similar to other studies of korean (20, 21), japanese (6, 12, 13), and chinese (22). in the present study, we could not find evidence for an association between 5-httlpr and harm avoidance measured by k - tci in healthy korean subjects. it is contrary to two recent meta - analyses including more than 23 studies which have shown the association between the polymorphism and trait anxiety, despite its weak effects (14, 15). this relationship was not reported in previous two studies using korean samples (20, 21). even though the association between 5-httlpr and harm avoidance is not confined to one ethnic group (10), majority of studies in east asian populations did not show the association (20 - 23), with two possible exceptional studies in japan (6, 12). this raises the possibility that the reported associations between the 5-httlpr and harm avoidance do not exist in east asian population. we found that allele frequencies in our subjects were similar to those in other east asian subjects (6, 12, 13, 20, 21), but they were significantly different from those in caucasian subjects (2, 5, 24). it is well known that allele frequencies distribution has large effects on the power of genetic association studies (25). together with small effect size of harm avoidance (14, 15), it is certainly possible that genotype distribution of east asian samples, especially marked low frequencies of long alleles, could reduce the power of the tests, which might lead to negative results. there have been many reports suggesting dominance of long allele (5, 19). there are also reports that " ss " genotype acts in recessive fashion in east asian populations (6, 7, 26). in accordance with these, we divided the subjects into " ss " genotype group and " sl"+"ll " genotype group. there were no significant differences between the two genotype groups and 4 dimensional scores, either. it has been suggested that high frequency of short allele in the japanese population may be responsible for the interpersonal sensitivity and emotional restraints that is generally regarded as characteristic of japanese culture (6, 23). the ethnic differences of allele frequencies between asians and caucasians might partially explain personality tendencies towards greater or less cautiousness and shyness from a genetic perspective. however, in our sample, we could not find the correlation between the high scores of harm avoidance and short alleles of 5-httlpr. in terms of gender differences, we could speculate that genetic factors have different effects on personality differences between sex (27). however, we could not find previously reported gender differences (5, 11) in this study. in another korean study exclusively including female subjects, they could not find association between harm avoidance and 5-httlpr (28). though tci has been known to reflect the genetic components of personality dimensions including harm avoidance, it also includes non - genetic, environmental components (29). considering that age, sex and culture could affect on personality dimensions (30), our study has some strength in that the study subjects could be relatively homogenous regarding ethnicity, age, cultural and socioeconomic status, because we confined our sample to the students of one university in seoul, korea. the average age of the participants were 23.83.1, minimizing previously reported age effect on the tci dimensional scores (31). we also found no correlations between age and personality traits scores in our sample (result not shown). though college students do not represent entire population, we could reduce potential confounding effects of age and cultural factors on the personality traits. overall, we could not find the association between 5-httlpr and harm avoidance and other tci measures. while the allele frequencies of our sample are similar to those of other studies in east asia including korea, they were significantly different from those of lesch. (2), which support further cross - cultural replication studies with a lager sample. | there have been numerous studies on the association between 5-httlpr (polymorphisms in the promoter region of the serotonin transporter gene) and anxiety - related personality traits, with conflicting results. in this study, we administered korean version of the temperament and character inventory (k - tci) to a sample of 158 korean college students and genotyped for the 5-httlpr in order to compare the tci dimensional scores including harm avoidance according to the 5-httlpr genotype and sex. we could not find the association between 5-httlpr and harm avoidance and other tci measures. considering known allele frequencies differences of 5-httlpr among different ethnic groups, further cross - cultural studies with a larger sample would be needed. |
researchers worldwide have embraced the fact that graphene, a two - dimensional sp hybrid of carbon atoms with a honeycomb structure, is without doubt an extraordinary substance that has been extensively investigated either on its own13 or as a composite material.4,5 the intriguing mechanical, thermal, electrical, and structural properties of this material are manifested in applications such as nanocomposites, transparent conducting films, sensors, supercapacitors, nanoelectronics, batteries, photovoltaic devices, and biomedicine.610 a myriad of technologies has been introduced to fabricate graphene, including mechanical exfoliation, liquid - phase exfoliation, thermal exfoliation, electrolytic exfoliation, chemical vapor deposition, and epitaxial growth,11,12 but chemical oxidation continues to be the most popular method owing to its simplicity, economical feasibility, and scalability. initially, graphite is oxidized to form graphite oxide which is then exfoliated to graphene oxide. the graphene oxide is reduced to form the graphene structure.4 the basal planes and edges of the graphene oxide are functionalized with oxygenous groups, such as hydroxyl, epoxide, and carboxyl,13 resulting in hydrophilicity and easing the formation of a stable colloidal solution.14 recently, a number of researchers have investigated self - assembly of two - dimensional graphene oxide into three - dimensional macrostructures. various techniques have been employed to synthesize the three - dimensional macroscale architecture, such as easy one - step hydrothermal,15 noble metal - promoted,16 and divalent ion - promoted17 self - assembly of graphene oxide via hydrothermal heating of a graphene oxide and dna mixture,18 mixing of graphene oxide and polyvinyl alcohol,19 dispersion of graphene oxide in triblock copolymers,20 and curing of graphene oxide with and without the presence of resorcinol - formaldehyde suspension.21 the resulting three - dimensional graphene macroassembly has high mechanical strength, high thermal stability, a high surface area, high water content, good electrical conductivity, good electrochemical performance, good dye - loading capacity, and self - healing properties. there has been a burgeoning of biocompatibility investigations on graphene - based films in recent years, for example, a a549 mammalian cell line on graphene and graphene oxide paper,22 nih-3t3 mouse fibroblast cells on graphene - carbon nanotubes,23 l929 mouse fibroblast cells on graphene- and graphene oxide - polyaniline,24 graphene - reinforced chitosan,25 arpe-19 retinal pigment epithelium cells on graphene oxide - glucose oxidase,26 a549 human lung carcinoma epithelial cells on graphene oxide,27 nanoreduced graphene oxide functionalized noncovalently by amphiphilic pegylated polymer chains, and nanographene oxide covalently pegylated on u87 mg human glioblastoma and mcf-7 human breast cancer cell lines.28 in this work, the synthesis of graphene hydrogel using the hydrothermal processing route is reported. graphene hydrogel was synthesized using large - area graphene oxide as a precursor at various concentrations, and was characterized using field emission scanning electron microscopy, x - ray diffractometry, and fourier transform infrared spectroscopy. because there is still a knowledge gap regarding the viability of cells on graphene hydrogel, we carried out in vitro cell culture on the synthesized hydrogel using a mg63 cell line for the first time. graphite flakes were purchased from asbury graphite mills, inc (asbury, n j). sulfuric acid (h2so4, 98%), potassium permanganate (kmno4, 99.9%), hydrogen peroxide (h2o2, 30%), glutaral - dehyde (25% aqueous solution), cacodylic acid, and sodium salt trihydrate were purchased from merck (darmstadt, germany). the mg63 cell line was purchased from the american type culture collection (manassas, va). minimum essential medium, penicillin / streptomycin and fetal bovine serum were purchased from gibco (grand island, ny). mtt assay (3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide) was purchased from gibco (eugene, or). hydrogen chloride (hcl, 37%), sodium pyruvate, hexamethyldisilazane, and dimethyl sulfoxide were purchased from sigma - aldrich (st louis, mo). phosphate buffer solution was prepared from nacl, kcl, na2hpo42h2o, and kh2po4, which were purchased from sigma - aldrich. denatured ethanol (99.7% v / v) was purchased from r and m chemicals (essex, uk). graphene oxide was synthesized from graphite using a simplified hummers method.29 graphite oxide was obtained by oxidation of 3 g of graphite flakes with 400 ml of h2so4, and 18 g of kmno4. the mixing process, using a magnetic stirrer, took less than 5 minutes to complete. however, to ensure complete oxidation of the graphite, the mixture was stirred for three days. during oxidation, the color of the mixture changed from dark purplish - green to dark brown. to stop the oxidation process, h2o2 solution was added and the color of the mixture changed to bright yellow, indicating a high oxidation level of graphite. the graphite oxide formed was washed three times with 1 m of aqueous hcl solution and repeatedly with deionized water until a ph of 45 was achieved. the washing process was carried out using a simple decantation of the supernatant with a centrifugation technique. during the washing process with deionized water, the graphite oxide underwent exfoliation, which resulted in thickening of the graphene oxide solution, forming graphene oxide gel which was freeze - dried to obtain the graphene oxide solid. graphene hydrogel was fabricated according to the method described by xu with some modifications.15 ten milliliters of homogeneous graphene oxide aqueous dispersion at a concentration of 2 mg / ml, was sealed in a 16 ml teflon - lined autoclave and maintained at 180c for 44 hours. the autoclave was allowed to cool to room temperature, and the fabricated graphene hydrogel was removed using tweezers and the surface adsorbed water was removed with filter paper. graphene hydrogels at concentrations of 1.0, 0.5, and 0.1 mg / ml were also prepared using the same procedure, and were denoted as graphene hg-1, graphene hg-0.5, and graphene hg-0.1, respectively. to investigate the effect of the lateral dimension of graphene oxide, graphene oxide solution at a concentration at 2 mg / ml was sonicated for 1 hour before being processed using the procedure described above. measurement of the surface area of graphene hydrogel was done using a micromeritics asap 2010 physisorption analyzer. the sample was placed into a sample tube, connected to the analyzer, and evacuated. field emission scanning electron microscopy images were obtained on a fei nova nanosem 400 operated at 10.0 kv. the crystalline phase was determined using a phillips x - ray diffractometer employing a scanning rate of 0.033 degrees per second in a 2 range from 5 to 80 with cu k radiation (= 1.5418). prior to cell seeding on scaffolds, a cell count was performed using a haemacytometer (hirschmann laborgerate), and 500 l media with 10% heat - inactivated fetal bovine serum was added to each well for cell proliferation. mg63 cells were maintained using minimum essential medium supplemented with 10% heat - inactivated fetal bovine serum, 1% penicillin / streptomycin, and 1 mm sodium pyruvate at 37c in a humidified 5% co2 atmosphere. graphene hydrogel was incubated with the cells for one, three, five, and seven days. mtt assay was used to determine the proliferation rate of mg63 on the graphene hg-2 scaffold. after each incubation period, mtt solution of 50 l was added to each well and left for 4 hours for a cell response to take place. this was followed by addition of 500 l of dimethyl sulfoxide to dissolve the purple crystals reduced by the living cells. the optical density, at 570 nm, of 200 l of the resulting solution was measured using a spectrophotometer (varioskan flash, finland). cells incubated on graphene hydrogel for days 1, 3, 5, and 7 were examined using field emission scanning electron microscopy. prior to viewing by field emission scanning electron microscopy, cells growing on the graphene hydrogel were washed with phosphate - buffered saline, and fixed with 4% of glutaral - dehyde for 30 minutes at 4c. subsequently, the graphene hydrogel containing the cells was dehydrated through a series of graded alcohols and dried with hexamethyldisilazane at room temperature. statistical analysis was performed using one - way analysis of variance and tukey test with significance reported when p < 0.001. graphite flakes were purchased from asbury graphite mills, inc (asbury, n j). sulfuric acid (h2so4, 98%), potassium permanganate (kmno4, 99.9%), hydrogen peroxide (h2o2, 30%), glutaral - dehyde (25% aqueous solution), cacodylic acid, and sodium salt trihydrate were purchased from merck (darmstadt, germany). the mg63 cell line was purchased from the american type culture collection (manassas, va). minimum essential medium, penicillin / streptomycin and fetal bovine serum were purchased from gibco (grand island, ny). mtt assay (3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide) was purchased from gibco (eugene, or). hydrogen chloride (hcl, 37%), sodium pyruvate, hexamethyldisilazane, and dimethyl sulfoxide were purchased from sigma - aldrich (st louis, mo). phosphate buffer solution was prepared from nacl, kcl, na2hpo42h2o, and kh2po4, which were purchased from sigma - aldrich. denatured ethanol (99.7% v / v) was purchased from r and m chemicals (essex, uk). graphene oxide was synthesized from graphite using a simplified hummers method.29 graphite oxide was obtained by oxidation of 3 g of graphite flakes with 400 ml of h2so4, and 18 g of kmno4. the mixing process, using a magnetic stirrer, took less than 5 minutes to complete. however, to ensure complete oxidation of the graphite, the mixture was stirred for three days. during oxidation, the color of the mixture changed from dark purplish - green to dark brown. to stop the oxidation process, h2o2 solution was added and the color of the mixture changed to bright yellow, indicating a high oxidation level of graphite. the graphite oxide formed was washed three times with 1 m of aqueous hcl solution and repeatedly with deionized water until a ph of 45 was achieved. the washing process was carried out using a simple decantation of the supernatant with a centrifugation technique. during the washing process with deionized water, the graphite oxide underwent exfoliation, which resulted in thickening of the graphene oxide solution, forming graphene oxide gel which was freeze - dried to obtain the graphene oxide solid. graphene hydrogel was fabricated according to the method described by xu with some modifications.15 ten milliliters of homogeneous graphene oxide aqueous dispersion at a concentration of 2 mg / ml, was sealed in a 16 ml teflon - lined autoclave and maintained at 180c for 44 hours. the autoclave was allowed to cool to room temperature, and the fabricated graphene hydrogel was removed using tweezers and the surface adsorbed water was removed with filter paper. graphene hydrogels at concentrations of 1.0, 0.5, and 0.1 mg / ml were also prepared using the same procedure, and were denoted as graphene hg-1, graphene hg-0.5, and graphene hg-0.1, respectively. to investigate the effect of the lateral dimension of graphene oxide, graphene oxide solution at a concentration at 2 mg / ml was sonicated for 1 hour before being processed using the procedure described above. measurement of the surface area of graphene hydrogel was done using a micromeritics asap 2010 physisorption analyzer. the sample was placed into a sample tube, connected to the analyzer, and evacuated. field emission scanning electron microscopy images were obtained on a fei nova nanosem 400 operated at 10.0 kv. the crystalline phase was determined using a phillips x - ray diffractometer employing a scanning rate of 0.033 degrees per second in a 2 range from 5 to 80 with cu k radiation (= 1.5418). each graphene hydrogel sample was seeded with 30,000 mg63 cells per well. cells seeded directly on the 24-well plate served as the control. prior to cell seeding on scaffolds, a cell count was performed using a haemacytometer (hirschmann laborgerate), and 500 l media with 10% heat - inactivated fetal bovine serum was added to each well for cell proliferation. mg63 cells were maintained using minimum essential medium supplemented with 10% heat - inactivated fetal bovine serum, 1% penicillin / streptomycin, and 1 mm sodium pyruvate at 37c in a humidified 5% co2 atmosphere. graphene hydrogel was incubated with the cells for one, three, five, and seven days. mtt assay was used to determine the proliferation rate of mg63 on the graphene hg-2 scaffold. after each incubation period, mtt solution of 50 l was added to each well and left for 4 hours for a cell response to take place. this was followed by addition of 500 l of dimethyl sulfoxide to dissolve the purple crystals reduced by the living cells. the optical density, at 570 nm, of 200 l of the resulting solution was measured using a spectrophotometer (varioskan flash, finland). cells incubated on graphene hydrogel for days 1, 3, 5, and 7 were examined using field emission scanning electron microscopy. prior to viewing by field emission scanning electron microscopy, cells growing on the graphene hydrogel were washed with phosphate - buffered saline, and fixed with 4% of glutaral - dehyde for 30 minutes at 4c. subsequently, the graphene hydrogel containing the cells was dehydrated through a series of graded alcohols and dried with hexamethyldisilazane at room temperature. statistical analysis was performed using one - way analysis of variance and tukey test with significance reported when p < 0.001. the large lateral dimension graphite flakes, which were used to produce the large - area graphene oxide, are shown in figure 1a, and the resulting graphene oxide is shown in figure 1b. the large graphene oxide has an average area of 7000 m and a lateral dimension of up to 150 m. after being sonicated for 1 hour, the average area is significantly reduced and the lateral dimension is reduced to < 5 m, as shown in figure 1c. to prepare graphene hydrogel, graphene oxide underwent hydrothermal treatment at 180c for 24 hours. the physical appearance of the prepared graphene hydrogel is shown in figure 2, with graphene hydrogel prepared at a concentration of 2 mg / ml of graphene oxide, illustrating the largest cylindrical shape with an approximate diameter of 15 mm and height of 30 mm. the surface area of graphene hg-2 was 202.4 2.9 m / g compared with the surface area of graphite of approximately 10 m / g.30 as expected, the size of graphene hydrogel was smaller when the concentration of the graphene oxide was reduced. previously reported results demonstrated precipitation at these low concentration levels.15,31 this can be explained by the large - area graphene oxide used in this experiment. it was found that graphene oxide concentration was not the only factor affecting the size of graphene hydrogel ; it was also affected by the dimension of the graphene oxide used. the graphene hydrogel formed using graphene oxide that had been sonicated for 1 hour (with a lateral dimension of < 5 m) has a smaller size compared with the nonsonicated graphene oxide, even though the initial concentration of graphene oxide in both the syntheses was 2 mg / ml, as shown in figure 2b. field emission scanning electron microscopy images of the samples have well defined and interlinked three - dimensional graphene sheets forming a porous network that resembles a loose sponge - like structure, as shown in figure 3. the supercritical condition resulted in the graphene oxide sheets converging, overlapping, and coalescing to form cross - links, which give rise to the framework of the graphene hydrogel. the mobility of the large graphene oxide sheets in solution is strongly limited, causing these graphene oxide sheets to orientate randomly in a hydrogel. moreover, the large conjugated basal planes make the graphene oxide sheets stiff and able to form a stable network.32 the pore size of the graphene hydrogels produced from large area graphene oxide is relatively independent of the concentration of graphene oxide over the measured concentration range (0.52 mg / ml). in contrast, graphene hg-2, which was produced from the small - area graphene oxide, has a much smaller pore size than that of graphene hg-2. a plausible explanation for the well - defined large pore size leading to the well - formed cylindrical structure of graphene hg-2 is that the high concentration of large graphene oxide restricts the expansion and flexibility of graphene oxide sheets within the geometry of the autoclave, which is crucial in constructing the three - dimensional microstructure.15 on the other hand, prolonged sonication for 1 hour shattered the graphene oxide sheets (see figure 1c) which resulted in a much smaller pore size and much finer pore walls in the network of graphene hgs-2, resulting in the malformed cylindrical shape. therefore, the pore size of the network is dependent on the lateral size of the graphene oxide nanosheets. x - ray diffraction patterns for graphene hydrogel are shown in figure 4. the diffraction peaks are 26.5 for pristine graphite, 9.1 for graphene oxide, 13.5 for graphene hg-0.5, 13.7 for graphene hg-2, and 13.3 for graphene hgs-2, corresponding to a layer - to - layer distance of 3.36, 9.68, 6.55, 6.45, and 6.64, respectively. the interlayer distance for graphene oxide is significantly larger than for pristine graphite due to the intercalating oxide functional groups.33 the interlayer distance for graphene hydrogel is lower compared with graphene oxide, indicating removal of the oxide functional groups from the graphene sheets after the hydrothermal process. meanwhile, the appearance of a characteristic peak of graphite for nonsonicated graphene hydrogel, which shifted slightly to the left, suggests the existence of stacking between graphene sheets due to the recovery of a -conjugated system from the graphene oxide nanosheets upon hydrothermal reduction. their interlayer spacing was slightly higher than for graphite, which is 3.63 and 3.39, respectively, for graphene hg-0.5 and graphene hg-2. the diffraction peak and interlayer distance of graphene hg-2 is the closest to that of graphite because of its relatively high concentration. this can be explained by the small lateral size of the graphene nanosheets, as shown by a small pore size and cotton - like appearance in field emission scanning electron microscopy (figure 3b). although some layering is likely to be present due to self - assembly of the graphene oxide nanosheets through van der waals forces and hydrogen bond interactions, the graphene is disordered enough not to produce the signature stacking diffraction peak.21 the broad peaks of all the graphene hydrogel are indicative of poor ordering of graphene sheets along their stacking direction, which reflects that the three - dimensional structure is made up of a low degree of interlayer separation that mimics graphite. to verify the formation of graphene oxide and graphene hydrogel, the infrared spectra of the samples were measured and are compared in figure 5 with the spectrum taken from graphite. in the infrared spectrum for graphite (figure 5a), a peak occurs at approximately 860 cm and is attributed to the aromatic c h bonds.34 the trough - like absorption peaks located between 1240 and 1590 cm are associated with the stretching vibrations of both double and single c h bonds,24 whilst the peak centered at 1600 cm is assigned to skeletal vibrations of unoxidized graphitic domains.35 for graphene oxide, as shown in figure 5b, the characteristic vibrations include the appearance of the broad peak from 900 to 1200 cm attributed to c o stretching, a c o c peak at 1246 cm, and a c oh peak at 1400 cm.34 the disappearance of the peaks between 1440 cm and 1590 cm shows that the c = c bonds have been oxidized during the chemical oxidation process. graphene oxide exhibits a similar peak to that of graphite at 1620 cm, signifying nonexfoliated graphite. on the other hand, graphene hydrogel regained most of the graphitic features as illustrated in figure 5c, indicating the reduction of graphene oxide during the hydrothermal process. cell proliferation on the surface of graphene hydrogel was studied using an mtt assay analysis. figure 6 illustrates cell proliferation on graphene hg-2 after a culture period of 1, 3, 5, and 7 days and by measuring the optical density at a wave - length of 570 nm. on the first day of culture, cell proliferation the biocompatible graphene hydrogel could potentially stimulate interaction between cells and the material, which may result in an ideal condition for cell adhesion and regeneration. by increasing the culture time to 3 days, the cells continued to flourish on the hydrogel, although there was a drop in the proliferation rate. this could be due to the formation of confluent cellular layers on the surface that lowered the growth rate of cells.36 however, there was a tremendous decrease in cell proliferation on the fifth day, although there was an increase in cell proliferation rate on the seventh day. similarly, a decrease in cell viability was also observed by robinson s group after 2 days of treatment with nanoreduced graphene oxide28 and chang s work after 1 day of graphene oxide exposure, as a result of oxidative stress.27 the mtt results are in good agreement with the observation of cell anchorage on the surface of graphene hydrogel. figure 7 shows the field emission scanning electron microscopy results for graphene hg-2, and when compared with the original field emission scanning electron microscopy image of the original surface, the cell adherence, spreading, and growth on the surface of the hydrogel after 7 days of culture time is apparent. the images display extensive flaky layers of adhered cells with rough cellular surfaces even from the early stage of day 1, when the hydrogel was entirely covered with cells. graphene hydrogel demonstrated pronounced cell attachment where cells with flattened morphology were seen to adhere to each other, with cellular microextensions on the third and seventh days of culture as illustrated in figure 8, which is similar to the observation of bodhak.36 guided filopodia protrusions, as indicated by the arrows in figure 8, were probably caused by the enhanced cell adhesion of mg63 on graphene hydrogel.37 additionally, the morphology of the spreading mg63 cells suggests their high adaptation to the as - prepared graphene hydrogel substrate. park demonstrated similar cell morphologies in their in vitro study, which involved the culture of mc3t3-el on a highly organized zno nanoflower array.38 we successfully prepared noncollapsible cylindrical three - dimensional graphene hydrogels using hydrothermal treatment of large - area graphene oxide. the cylindrical - shaped matrix was found to be a compatible host for cells as cellular microextensions pervaded the hydrogel scaffold. the proliferation of mg63 on the hydrogel was found to be time - dependent, with a reduction in viability on the fifth day of culture. even though the cell proliferation rate decreased on the fifth day of cell culture, the rate increased on the seventh day. these aspects warrant further studies of the biocompatibility and toxicity of cells via in vitro evaluation, because the results indicated cell proliferation on the hydrogel for up to 7 days. graphene hydrogel may be a promising building block for development of smart materials for biomolecules and tissue engineering purposes. | backgroundthree - dimensional assembly of graphene hydrogel is rapidly attracting the interest of researchers because of its wide range of applications in energy storage, electronics, electrochemistry, and waste water treatment. information on the use of graphene hydrogel for biological purposes is lacking, so we conducted a preliminary study to determine the suitability of graphene hydrogel as a substrate for cell growth, which could potentially be used as building blocks for biomolecules and tissue engineering applications.methodsa three - dimensional structure of graphene hydrogel was prepared via a simple hydrothermal method using two - dimensional large - area graphene oxide nanosheets as a precursor.resultsthe concentration and lateral size of the graphene oxide nanosheets influenced the structure of the hydrogel. with larger - area graphene oxide nanosheets, the graphene hydrogel could be formed at a lower concentration. x - ray diffraction patterns revealed that the oxide functional groups on the graphene oxide nanosheets were reduced after hydrothermal treatment. the three - dimensional graphene hydrogel matrix was used as a scaffold for proliferation of a mg63 cell line.conclusionguided filopodia protrusions of mg63 on the hydrogel were observed on the third day of cell culture, demonstrating compatibility of the graphene hydrogel structure for bioapplications. |
embryonic development involves spatial and temporal patterns of cellular differentiation and the shaping of form. how do embryonic tissues organize in space and time such that a field of distinct cells emerges reliably ? this question has fascinated developmental biologists for decades. early in the last century, the existence of gradients that could signal over large distances was proposed to account for patterning (morgan, 1901). indeed, morphogen gradients, defined as graded distributions of secreted molecules that specify distinct fates for the cells in a concentration - dependent and direct manner (wolpert, 1969), have become, over the last few decades, a highly influential framework to test and understand pattern formation processes during embryonic development (figure 1a). the concept that the fate of cells depends on their spatial position, enabling an organized pattern to arise, was formalized by lewis wolpert in his positional information model (wolpert, 1969). according to this model, cells have their spatial position specified along specific directions with respect to one or more reference points and translate such positional information into specific cell behaviours, which depend, as well, on the developmental history of the cell. wolpert envisaged spatial gradients of a chemical 's concentration over a field of cells as one of the potential signals : cells that sense a low amount of chemical are more distant from the reference point (i.e. the source of the chemical) than cells that sense a higher amount. the first molecular demonstration of the concept of gradients specifying distinct fates in a direct manner took time to appear and was provided in the drosophila syncytium (driever and nsslein - volhard, 1988a, 1988b). the transcription factor bicoid was shown to be distributed along a gradient expanding from the anterior pole to more than one - half of the embryo and to regulate the expression of downstream gap genes (for a review, see ephrussi and johnston, 2004). afterwards, other signalling proteins such as dpp, wingless, spitz, hedgehog, activin and nodal have been described as morphogens in a wide variety of organisms (for reviews, see green, 2002 ; martinez arias, 2003 ; tabata and takei, 2004 ; schier and talbot, 2005 ; affolter and basler, 2007). it is worth stressing, however, that the case of bicoid is a rather unusual one. whereas the above - mentioned morphogens correspond to secreted molecules that can form gradients extracellularly, bicoid is a transcription factor that forms a gradient before cellularization in the drosophila embryo, from a localized region of transcription in the anterior pole. to check whether a gradient acts as a morphogen, it is important to unveil whether it specifies distinct fates over space in a direct manner. accordingly, experimental designs that evaluate the direct action and, hence, the requirement of the morphogen molecule at long distances have been elaborated (for a review, see tabata and takei, 2004). in addition, the shape of gradients has been altered by changing the level of the morphogen signal (shimizu and gurdon, 1999 ; ashe, 2000) to observe whether spatial shifts in the fates of cells and in the expression pattern of target genes arise (ashe and briscoe, 2006). hence, as it is expected from a morphogen, changes in bicoid concentration along its gradient elicit shifts in the expression domain of its downstream target gap genes and alter the fate of cells (driever and nsslein - volhard, 1988a ; driever, 1989a, 1989c ; driever and nsslein - volhard, 1989b ; struhl, 1989 ; st johnston and nsslein - volhard, 1992 ; rivera - pomar and jckle, 1996). although other frameworks for patterning processes have been proposed (turing, 1952), morphogen gradients have been the most influential up to now, stimulating and promoting strategies to unveil the process of embryonic patterning. hence, graded signals have been searched and evaluated for a morphogen - like role in many patterning developmental processes. although most studies on the visualization, quantification and interpretation of gradients have been developed in drosophila embryos, the relevance of morphogens in vertebrate embryonic development has also been taken into account, as exemplified by models for limb patterning (izpisa - belmonte, 1991 ; tickle, 1999 ; tabin and wolpert, 2007). indeed, morphogen gradients on vertebrate systems have become a focus of increasing interest (chen and schier, 2001 ; dubrulle and pourqui, 2004 ; dessaud, 2007 ; simeoni and gurdon, 2007 ; white, 2007). at present, the development of novel experimental and visualizing techniques has enabled refined measurements of the spatially graded distribution of molecules along tissues. accordingly, combined experimental and computational strategies that quantify and characterize the formation of gradients as well as theoretical approaches that address open issues related to the properties of gradients have become a common approach (see, for instance, kerszberg and wolpert, 1998 ; eldar, 2002, 2003, 2006 ; lander, 2002, 2007 ; jaeger, 2004 ; kruse, 2004 ; aegerter - wilmsen, 2005 ; bollenbach, 2005 ; england and cardy, 2005 ; houchmandzadeh, 2005 ; howard and ten wolde, 2005 ; melen, 2005 ; mizutani, 2005 ; shimmi, 2005 ; ibaes, 2006 ; mchale, 2006 ; umulis, 2006 ; bergmann, 2007 ; gregor, 2007a, 2007b ; kicheva, 2007). however, as we have learned more about morphogen gradients and their role in shaping the embryo, new complexities have emerged. herein, we examine these issues, highlighting those recent findings that unveil novel aspects of morphogen gradients with an emphasis on how theoretical and computational studies have contributed. moreover, we discuss how these findings emphasize the need for taking new approaches that utilize experimental and theoretical strategies to integrate both the formation and interpretation of morphogen gradients into a single framework. during the last few decades, gradients of different kinds of molecules, with a wide variety of sizes and dynamics, have been uncovered, revealing that both the morphogen and the underlying tissue over which the gradient expands determine its features as well (gurdon, 1994 ; nellen, 1996 ; entchev, 2000 ; strigini and cohen, 2000 ; teleman and cohen, 2000 ; dorfman and shilo, 2001 ; mcdowell, 2001 ; houchmandzadeh, 2002 ; gregor, 2005, 2007b ; bollenbach, 2007). the visualization of the protein gradient is the first step in detecting a morphogen. to this end, antibody staining and gfp fusion proteins, among others, have been used to provide a static image of the gradient on fixed tissue. attaining more detailed measurements has allowed quantification of morphogen gradients. specifically, imaging of functional fluorescent green protein - morphogen fusions over space has shown that bicoid in the drosophila syncytium and dpp and wingless in the fly 's wing form gradients with the same kind of decay characterized by an exponential shape. this kind of profile implies that the fraction of morphogen that decreases over space is the same all over the gradient. accordingly, a single scale characterizes the spatial decay and it can be used as a measure of its size. by fitting an exponential profile to the fluorescent data, a characteristic length of the gradient can be obtained. this procedure has shown that the bicoid gradient is much larger, with a characteristic length of 100 m, than the dpp and wingless gradients, which have a characteristic length of 20 and 6 m, respectively (houchmandzadeh, 2002 ; kicheva, 2007) (figure 1b). activity gradients have been monitored as well by measuring the amounts of downstream intracellular responses (e.g. kinase phosphorylation). this is the case of the bmp gradient, which patterns the dorsoventral axis in drosophila embryos. this gradient shows a sharp profile that decays strongly over a field of five cells and is formed within 30 min (eldar, 2002 ; mizutani, 2005). once the gradient profile has been fitted, it remains to be elucidated which dynamic yields it. mathematical and numerical modelling can be very helpful to this end (box 1 ; figure 2a and b). in addition, theoretical approaches can also enable the quantification of the dynamics taking place. for instance, an exponential gradient profile is the steady - state solution of a morphogen dynamic involving diffusion and linear degradation. taking into account that diffusion rates have dimensions of surface over time and degradation rates of the inverse of time, a dimensional analysis of this dynamic readily reveals that the characteristic length of the gradient depends on these parameters as, where d and are the diffusion and degradation rates, respectively. therefore, all those different values of d and rates that yield the same ratio d/ elicit a steady - state gradient spanning the same spatial region (figure 1c). conversely, by quantifying the characteristic length of the gradient through the data on the gradient profile, we can not infer which values of the diffusion and degradation rates underlie the morphogen dynamics. however, the transient dynamics may depend on the diffusion rate d on its own (figure 1c and d). this is the approach used by kicheva (2007) to characterize the kinetics of the dpp and wingless gradients. the authors measured the fluorescence recovery after photobleaching (frap) during a time interval of 1 h. frap experiments were modelled, taking into account both production and degradation processes, and the mathematical expression of the recovery dynamics, with their dependence on the kinetic morphogen parameters, was formulated. importantly, the recovery dynamics depend on the diffusion rate d and not just on the characteristic length (kicheva, 2007). by adjusting the mathematically derived expressions of the recovery dynamics with the measured frap data over time and space, kicheva found the value of d. moreover, as the characteristic length was also known from the gradient profile data, the degradation rate could be inferred (kicheva, 2007). note that for the sake of simplicity and clarity, herein we have sketched the approach that in the original work was much more complex and involved several parameters to be determined. assigning quantitative values to the kinetics of the dpp and wingless gradients allows pinpointing which element is responsible for the shorter spatial range of the wingless gradient : does wingless diffuse much less than dpp or does it have a much shorter half - life ? the study by kicheva (2007) showed that the short half - life of wingless (8 min) compared with the 45 min half - life of dpp yields a wingless gradient spanning much fewer cells, whereas the effective diffusion rates are rather similar between both morphogens (d0.1 m / s for dpp and (d0.5 m / s for wingless). the numerical solution for the dynamics of morphogen diffusion from a localized source of production and linear morphogen degradation shows that the morphogen gradient achieves a steady state over a broad spatial region on time periods one order of magnitude longer than the morphogen half - life (bergmann, 2007). thus, by using the above - mentioned molecular half - lives, it can be reasoned that the dpp gradient takes around 450 min to be formed, whereas wingless forms its gradient much more rapidly, in only 80 min. this is in agreement with the time of morphogen signal recovery after reversible blockage of the morphogen through temperature changes, which has also been used to infer how long a gradient takes to be formed (entchev, 2000 ; teleman and cohen, 2000). recently, in vivo optical imaging that allows the measurement of the whole gradient all along its formation has been implemented for the bicoid gradient (gregor, 1992, 2007b). the data showed that a gradient with stable nuclear concentration is formed within 90 min (gregor, 2007b). therefore, if the overall gradient is at a steady state and is formed by diffusion and linear degradation, we would expect the bicoid half - life to be around 9 min and, based on the characteristic length (100 m) of the gradient, the diffusion rate to be around 13 m / s. indeed, dextran molecules with the molecular mass of bicoid protein diffuse in drosophila embryos with a similar rate (gregor, 2005). however, this value does not agree with the bicoid diffusion rate inferred from fluorescent recovery dynamics at the cortex of drosophila embryos, raising the open issue on how to conciliate these results (box 2). recently, the formation of gradients over a field of cells has been expanded to include non - secreted molecules (gaunt, 2003 ; dubrulle and pourqui, 2004 ; ibaes, 2006). specifically, mrnas, such as the fibroblast growth factor fgf8 along the anteroposterior axis of mouse and chick embryos and the homeobox gene hoxd13 in the chick limb, have been shown to form gradients over large fields of cells (dubrulle and pourqui, 2004 ; ibaes, 2006). in the case of hoxd13, the gradient spans more than 400 m and takes several hours to be formed (figure 3b). these graded distributions of mrna necessarily elicit protein gradients (ibaes, 2006). these protein gradients could potentially specify (in the case of secreted proteins) or control (in the case of transcription factors) distinct cell fates. therefore, these novel observations raise the intriguing question of whether these gradients are acting in a morphogen - like manner (i.e. by instructing directly distinct cell fates). if future investigations support such a role, then the concept of morphogen could be extended to include non - secreted proteins. three main elements participate in the creation of a steady - state chemical gradient : the source of morphogen production, the sink and the transport of the morphogen through space. regarding the source, focus has been mainly on local homogeneous sources of production, defined by a spatial domain where production is uniform over space and constant over time. however, non - uniform sources of protein production can also exist, arising from mrna gradients, for instance, and which readily create protein gradients (dubrulle and pourqui, 2004 ; ibaes, 2006). degradation of the molecule (or in general terms, the subtraction of the morphogen) facilitates the formation of gradients. such degradation can be an active process in which specific proteins destroy the morphogen, or a passive dilution driven by cell division for rather stable proteins (ibaes, 2006). the interaction of the morphogen with other molecules, for example, ligand morphogen binding and unbinding with receptors, can be re - interpreted in terms of degradation and source - like terms and, as expected, can also shape the gradient. recent studies have shown that morphogen degradation can be controlled by the morphogen signal, setting a feedback between gradient formation and signalling, and eliciting differential degradation over space. invertebrate and vertebrate hedgehog morphogen as well as retinoic acid in zebrafish embryos has been shown to make use of these feedbacks when creating morphogen gradients (eldar, 2003 ; dessaud, 2007 ; white, 2007). hedgehog signalling induces the expression of its receptor, patched, which in turn is endocytosed, thereby degrading the ligand. in the case of retinoic acid, thus, the degradation of these morphogens is enhanced in those spatial regions of high morphogen activity. this kind of feedback between morphogen signalling and degradation (and hence, formation) can be modelled mathematically by setting the morphogen degradation as nonlinear (at least close to the source) (eldar, 2003). the steady - state profile of a dynamic involving diffusion and nonlinear degradation can be obtained analytically and corresponds to a power - law shape (it decays more abruptly close to the source and less markedly on the tails than an exponential profile) (eldar, 2003). but is this feedback relevant ? mathematical analysis of the gradient profiles when gene dosage is increased reveals that this differential degradation confers robustness to these changes (eldar, 2003), indicating that this robustness may be a desired property of the morphogen gradient. how can molecules span over large spatial regions to elicit direct responses ? according to the values known for the diffusion rates of molecules, francis crick proposed that diffusion enables the formation of gradients over fields of 50 cells within a scale of a few hours (crick, 1970). since then, diffusion has taken the leading role as the transport mechanism for gradient formation. at present, diffusion is commonly named restricted or effective diffusion, to emphasize that the diffusion rate values in the extracellular medium are much smaller than those measured in aqueous media (tabata and takei, 2004 ; strigini, 2005 ; kicheva, 2007). the difference in such rates is thought to arise partially from the properties of the extracellular medium, a crowded environment with non - uniform matrix geometries and molecular distributions that interact with the morphogen. for instance, the recently inferred that effective diffusion rate of dpp, d=0.1 m / s, is much (three orders of magnitude) smaller than what it would be expected according to its size when diffusing freely in water (kicheva, 2007). note that the procedure involved in inferring this value took all kinds of dpp transport as a single diffusive - like motion, as described above. therefore, this rate corresponds to an effective motion in which other non - directional random transports can be involved, which potentially may strongly slow down the dynamics. molecules perform a kind of random walk - like motion going in all, even opposite, directions. thus, the mean displacement of molecules does not increase linearly with time, as in ballistic motion, but much more slowly, as the root square of time. this pure diffusion is not the only passive random motion molecules can trace within a biological medium. indeed, in prokaryotes, large biological molecules such as mrnas have been shown to perform an intracellular random motion slower than diffusion and named subdiffusion, that is, the mean displacement of mrna molecules increases over time much more slowly as with <1 (t stands for the time) (golding and cox, 2006). likely elements that underlie such behaviour are the random trapping and binding of the mrna molecules with other molecules inside the crowded intracellular environment and, accordingly, smaller molecules such as proteins are expected to be less influenced (elowitz, 1999 ; golding and cox, 2006). in addition, cytoskeletal dynamics in eukaryotic cells can elicit fast random molecular motions, in between diffusion and ballistic movement, called superdiffusive motions (lau, 2003), that is, the mean squared displacement follows over time a power - law dynamic with an exponent greater than 1. theoretical analysis evaluating the effect of subdiffusive random motions on the formation of gradients has started (hornung, 2005). future work is thus expected to elucidate how the random motion of proteins occurs extracellularly and within cells to form a morphogen gradient and how the gradient profile and dynamics depend on this motion. in the last decade, driven by novel molecular data, new biological transport mechanisms for secreted morphogens that involve active processes have been proposed (for reviews, see zhu and scott, 2004 ; strigini, 2005 ; figure 3a). vesicle - mediated transport mechanisms that can take place along the extracellular space have been shown (greco, 2001 ; pankov, 2005 ; tanaka, 2005). direct long - range interactions through long cellular protrusions have been suggested as well (ramrez - weber and kornberg, 1999). in addition, transport through cells mediated by cycles of endocytosis and exocytosis (named transcytosis ') has been proposed (reviewed by vincent and dubois, 2002 ; gonzalez - gaitan, 2003). data on mosaic experiments in the fly 's wing, which set a patch of cells with impaired endocytosis near the dpp morphogen source, raised the question of whether diffusion was the main mechanism of dpp transport (entchev, 2000). during gradient formation, the amount of dpp morphogen decayed strongly behind the clone of cells (showing a so - called shadow '), which suggested that the transport of dpp requires endocytosis to reach those cells (entchev, 2000). however, a mathematical and numerical analysis challenged this view (lander, 2002). in the model that was formulated, internalization and recycling of the free ligand and of bound receptors was considered, as well as degradation of these molecules inside cells. impaired endocytosis was modelled as a reduction of the internalization rate and an increase of cell surface receptors. in this scenario, dpp became trapped through its binding with the high amount of cell surface receptors and a shadow appeared behind the clone. therefore, the appearance of shadows ' could not be used to exclude diffusion as the transport mechanism (lander, 2002). however, despite exhibiting a shadow, the morphogen profile did not agree completely with the experimental data (gonzalez - gaitan, 2003). another theoretical analysis reformulated the same model, by extending it to two dimensions and setting a different parameter - dependent source of receptors and different boundary conditions, to name some of the changes. impaired endocytosis was modelled as a reduction of the internalization rates, and the results showed that a natural strong and rapid accumulation of receptors occurred within the clone, which was essential to cause a shadow (kruse, 2004). however, no such increase could be found experimentally, nor was the ligand profile totally consistent with mosaic data, pinpointing that diffusion could not be the single mechanism of dpp transport (kruse, 2004). recent new theoretical modelling that takes into account dpp transport through both transcytosis and diffusion at the scale of each cell has been able to obtain more proper ligand profiles as observed in mosaic experiments, even when the total amount of cell surface receptors is constant, supporting transcytosis as a mechanism for dpp transport (bollenbach, 2007). in addition to their relevance in addressing the issue of how dpp is transported, all these studies exemplify how many challenges we also face from a theoretical point of view when trying to reject the plausibility of a mechanism. the study of morphogen gradients has focused on secreted molecules, partially because these molecules can move extracellularly over large distances. however, molecular gradients along a cellular tissue can arise without requiring any dynamics on the extracellular space (figure 3a). on the one hand, transport from cell to cell through gap junctions can occur (esser, 2006). on the other hand, cells can be the transport vehicle of the molecule (lecuit and cohen, 1998 ; tabata, 2001 ; teleman, 2001). in the last years, experimental and theoretical evidence in favour of cellular - based transport mechanisms has been shown (pfeiffer, 2000 ; gaunt, 2003 ; dubrulle and pourqui, 2004 ; ibaes, 2006). two mechanisms, which can both take place for the same molecular gradient, have risen. in both cases, the source corresponds to a spatial region where cells divide and have the ability to produce the molecular component (e.g. the mrna). thus, when cells become placed outside this region, they cease to produce the molecule. if over time cells move or become displaced further away from the source while degrading their molecular content, a spatial gradient is formed (gaunt, 2003 ; dubrulle and pourqui, 2004 ; ibaes, 2006). in addition, molecular gradients can also be formed by the dilution of the molecular content on cells that continuously divide and become displaced away from the source, a mechanism termed cell - lineage transport (ibaes, 2006). gradients of non - secreted molecules can in turn create graded distributions of secreted factors and other kinds of molecules. as indicated, gradients of mrna provide a graded source for protein translation, which elicits a protein gradient (dubrulle and pourqui, 2004 ; ibaes, 2006). in addition, gradients of non - secreted molecules can potentially convert a molecular uniform distribution into a morphogen or signalling gradient, by modulating its degradation or its transduction, respectively, on each cell. for instance, if the non - secreted molecule inhibits morphogen degradation, the morphogen will be less degraded in cells close to the source of the non - secreted molecule than in more distant cells. thus, differential degradation along a field of cells could induce a morphogen gradient. until now, differential degradation mediated by gradients of secreted molecules has been shown to shape and stabilize morphogen gradients. this is the case of the anterior - to - posterior gradient of retinoic acid in the developing nervous system of zebrafish embryos (white, 2007), which is shaped by a parallel gradient of the secreted factor fgf8 that suppresses the degradation of retinoic acid by inhibiting the expression of the degrading enzyme cyp26a1. the formation of a single morphogen gradient can be driven by several of the transport mechanisms described so far, altogether enhancing the long - range transport of the morphogen. for instance, the fgf8 protein gradient from the tail bud to more anterior regions in vertebrate embryos might be driven by diffusion as well as by cell - based transport mechanisms. this is a very complex system that will require both challenging experimental and theoretical strategies to be fully characterized. as diffusion sets a much faster spatiotemporal dynamic than cell division in the tail bud region, increasing the degradation rate of fgf8 to values in which tissue growth can not drive protein transport could provide information on the range and rate of fgf8 diffusion. thus, theoretical predictions on the spatial range of the gradient based on diffusive transport alone could be compared with in vivo data. in addition, setting a framework that couples both transport mechanisms at the cellular level (i.e. at this scale, diffusive transport might be seen as a slave dynamic that quickly adapts to perturbations set by proliferating cells) could evaluate how single cells sense the gradient and act on it. much work on morphogen gradients assumes that cells sense and interpret a steady morphogen concentration. accordingly, focus has been set on modelling the formation of steady - state gradients. by analytically and numerically solving the gradient dynamics and the steady - state solution, it can be seen that the transient and steady - state gradients depend distinctly on the parameter values that characterize the transport, the degradation and the source rates (figure 1c and d) and thus will respond to changes in a different manner (bergmann, 2007 ; lander, 2007). the different response transient and steady - state gradients will be relevant if we take into account that it is not always easy to know whether a morphogen gradient has reached its steady state in vivo (bergmann, 2007, 2008 ; gregor, 2007b ; bialek, 2008). as ultimately cells sense the morphogen and interpret it accordingly, it is interesting to know how cells see the gradient over time. in addition, not all cells may respond simultaneously to the gradient, but alternatively each cell (or groups of cells) may respond to the gradient at a different time, as it has been described for bmp signalling (tucker, 2008). while a gradient driven by diffusion or other molecular transport mechanism is being formed in a static field of cells, the cells are exposed to increasing levels of morphogen over time. cells located close to the source are the ones to first sense the morphogen and to experience higher morphogen levels than cells located at farther distances. once the steady state has been reached, cells sense a constant amount of morphogen, which depends on where the cell is located. but even if the gradient is in a steady state, its activity can be dynamical and transient. this is the case of the activity of sonic hedgehog (a vertebrate homologue of invertebrate hedgehog) in vertebrate neural cells, which lasts a time period proportional to the amount of morphogen (dessaud, 2007). gradients driven by cell - based transport involve a dynamic field of cells. in this case, the molecular content inside cells does not reach a steady state and cells sense a decreasing molecular amount over time, which is related to their increasing distance from the source (ibaes, 2006). therefore, the way cells sense the gradient and thus can subsequently interpret it strongly depends on the mechanism of gradient formation and signalling. three main questions are involved in gradient interpretation : which is the graded information that is interpreted ? how does this interpretation occur ? and what does this graded information specify ? over the last few decades, several groups have started addressing these questions, uncovering further complexities involved in morphogen gradients. the study of different morphogens has shown that the graded information (or signal) that is interpreted may depend on the specific morphogen gradient. thus, the graded signal can be the steady - state amount of morphogen around a cell, which might be measured by the number of bound receptors or, alternatively, by the ratio of bound to unbound receptors (dyson and gurdon, 1998 ; gurdon and bourillot, 2001 ; casali and struhl, 2004). it could also be the amount of morphogen in a transient dynamic state (bergmann, 2007). another option is that the graded signal that is interpreted is not the level of morphogen but instead it is the steepness of the gradient (lawrence, 2001 ; rogulja and irvine, 2005). alternatively, the signal that is interpreted could be the total amount of morphogen cells have been exposed to over time (ahn and joyner, 2004 ; harfe, 2004 ; mcglinn and tabin, 2006 ; tarchini and duboule, 2006 ; tabin and wolpert, 2007). moreover, the morphogen level could be transduced into a graded time period of activity that is interpreted (dessaud, 2007). commonly, the specification of distinct fates has been addressed in terms of the induction of downstream genes (for review, see ashe and briscoe, 2006). accordingly, distinct cellular responses are characterized by which targets are active (figures 1a and 4d). the graded signal coming from the morphogen is thus converted into roughly binary responses of each target, defining sharp response borders (figure 4b and d). different mechanisms ranging from positive feedback, cooperativity and zero - order ultrasensitivity have been shown to convert a graded signal into a binary response (for reviews, see ferrell, 2002 ; ashe and briscoe, 2006). theoretical approaches have been important to propose and characterize these mechanisms for switch - like behaviour by analysing the steady states of a specific cell - autonomous dynamic under an external input stimulus (box 3). on the one hand, the targets of the morphogen signal can be characterized by different levels of sensitivity (figure 4a). this sensitivity can correspond to the affinities of the target genes to morphogen signal - binding sites. each target will respond above a different threshold signal, which will depend on the affinity of the morphogen - binding site (i.e. those targets that exhibit low affinity will respond to only high levels of the signal, whereas those with high affinity will respond to lower levels of the signal ; see figure 4b). thus, the level of morphogen signal will select which targets are induced, and a pattern over space of different activated targets will be elicited (figure 4d). on the other hand, the morphogen signal can similarly activate or repress several targets, which, as a result of their interaction within a network, respond distinctly to the same signal (figure 4b and c). accordingly, for a graded signal over space, a pattern of different active targets will arise (figure 4d). in this case, although the sensitivity of the targets might be the same, the response will differ depending on the amount of signal. note that a huge landscape of different network topologies and dynamics can be envisaged that could elicit many diverse patterns. importantly, the two strategies being described can be acting at the same time on a single morphogen to direct a response. indeed, both mechanisms have been reported for the bicoid gradient. the number and affinity of bicoid - binding sites provide a different level of sensitivity to the bicoid signal (driever, 1989c ; struhl, 1989 ; gao, 1996). in addition, downstream target gap genes, activated by bicoid, repress each other and thus also interpret the gradient through their interaction (jaeger, 2004 ; jaeger and reinitz, 2006 ; bergmann, 2007). however, in addition, a bioinformatic analysis has found out that the combination of several additional activators that bind the promoter regions of bicoid target genes can be relevant to control and specify the bicoid gradient interpretation (ochoa - espinosa, 2005). distinct patterns of gene expression between cells are expected to elicit ultimately different cellular behaviours. specifically, the dpp gradient in the wing of drosophila embryos has been shown to control cell proliferation (rogulja and irvine, 2005). in addition, the fgf8 gradient in the presomitic mesoderm of chick embryos is translated into a gradient of extracellular signal - regulated kinase (erk), which promotes cell migration (delfini, 2005). can this induced cell behaviour in turn alter the morphogen gradient, setting a feedback between gradient formation and interpretation ? potentially yes, as cell dynamics can shape morphogen gradients (dubrulle and pourqui, 2004 ; ibaes, 2006). indeed, cell dynamics are essential to create the mrna fgf8 gradient (dubrulle and pourqui, 2004). thus, these cell dynamics can have an important role in shaping the protein and erk signalling gradient as well. the relevance of such feedback, according to the timescale of gradient interpretation, cellular response and gradient formation, will require a careful evaluation aided by theoretical approaches. moreover, molecular feedbacks between gradient signalling and formation (such as those eliciting enhanced degradation, as previously discussed) have been uncovered (lander, 2007), which stress, as well, the importance of evaluating the process of formation and interpretation altogether as a whole system. morphogen gradients have been an extremely useful framework to characterize pattern formation processes in developing embryos. despite their apparent simplicity, novel data on morphogen gradients are stressing and expanding the complexities that this framework involves. thus, morphogen gradients exemplify most of the complexities we have to tackle when studying embryonic development : the interplay between several and different levels of organization, time and spatial scales and components. morphogen gradients pose two advantages, that is, the thorough knowledge we have acquired in the last decades on this topic and the additional knowledge we gain each time we use theoretical and computational strategies combined with experimental approaches to decipher their features. new data have shown cell - based mechanisms for the transport of molecules that allow the formation of gradients of non - secreted molecules. if such gradients are shown to shape graded information to which cells respond, morphogens should be extended to include non - secreted molecules. in addition, these and other data have highlighted that knowing the dynamics of gradients, and not only their steady state, is becoming increasingly important. at present, we still know very little about how the dynamics of gradients participate in the overall process of gradient interpretation. to shed some light on this issue, mathematical approaches can be extremely useful by predicting the kind of response we might expect. in most cases, the shape and dynamics of morphogen gradient formation are analysed independent of gradient interpretation. however, some of the findings we have highlighted herein emphasize a very important issue that has been largely avoided : the gradient can depend on the response it elicits. as the response is directed by the gradient, a feedback between gradient and response can be present. at the molecular level, such feedback has already been taken into account : morphogen signalling can feedback to receptor or ligand production, modifying the profile of the gradient (lander, 2007). however, such feedback does not necessarily occur just at the molecular level but can also involve the cell dynamics. we have seen that morphogen gradients can induce changes in the dynamics of cells, activating their proliferative and migratory state (delfini, 2005 ; rogulja and irvine, 2005). as cell proliferation and spatiotemporal cell displacement can shape a gradient (ibaes, 2006), such a cellular response can modify the gradient in return. thus, as the responses at both the molecular and cellular levels can shape the morphogen gradient, it becomes necessary to study gradient formation and interpretation processes together (figure 5). therefore, understanding pattern formation through morphogen gradients can require integrative approaches that take both gradient formation and interpretation into account in a common framework. hence, we suggest system - level perspectives on morphogen gradients that address the problem of pattern formation from gradient formation to gradient interpretation and vice versa. moreover, by defining the morphogen system as the molecules forming the gradient, the graded signal and the interpretation dynamics, new perspectives will be gained. issues such as finding those reliable dynamics of the morphogen system, and how this reliability and performance is achieved can uncover vital insights (eldar, 2003 ; lander, 2007). by implicitly neglecting such feedback, we reduce the range of possible designs enabling morphogen reliability : the morphogen gradient itself is very reliable and such robustness is preserved during gradient interpretation ; alternatively, the process of gradient interpretation is responsible for setting a reliable response from a variable graded input. yet, a system approach will broaden the scope and another plausible answer could arise : reliability depends on the interaction between formation and interpretation dynamics. | morphogen gradients, which specify different fates for cells in a direct concentration - dependent manner, are a highly influential framework in which pattern formation processes in developmental biology can be characterized. a common analysis approach is combining experimental and theoretical strategies, thereby fostering relevant data on the dynamics and transduction of gradients. the mechanisms of morphogen transport and conversion from graded information to binary responses are some of the topics on which these combined strategies have shed light. herein, we review these data, emphasizing, on the one hand, how theoretical approaches have been helpful and, on the other hand, how these have been combined with experimental strategies. in addition, we discuss those cases in which gradient formation and gradient interpretation at the molecular and/or cellular level may influence each other within a mutual feedback loop. to understand this interplay and the features it yields, it becomes essential to take system - level approaches that combine experimental and theoretical strategies. |
the western denmark heart registry (wdhr) is a clinical database within a population - based health care system. to improve cardiac treatment quality, the danish national board of health decided in 1993 to increase the number of invasive cardiac interventions in denmark.1 in response to this initiative, the wdhr was founded on january 1, 1999 as a collaborative effort by western denmark s three major cardiac centers (aarhus university hospital - skejby, odense university hospital, and aarhus university hospital - aalborg) in order to monitor the cardiovascular treatment quality in western denmark. the remaining cardiac centers in western denmark (varde heart centre, region hospital viborg, region hospital herning, region hospital silkeborg, vejle hospital, haderslev hospital, aarhus hospital, svendborg hospital, and hospital of southwest denmark - esbjerg) joined the registry later. the participating centers own the wdhr and finance its operation through annual membership fees set according to hospital size. the wdhr serves as a regional data source to the danish heart registry, which also contains data from eastern denmark and thus is responsible for the national monitoring of cardiac intervention quality.2,3 the wdhr, however, contains several data beyond what is delivered to the danish heart registry.2,3 thus, in addition to monitoring and improving the cardiac intervention quality in western denmark, the aim of collecting data to the wdhr is to allow for clinical and health - service research on the use of and outcomes from these procedures. in this study we examined the setting, organization, content, data quality, and research potential of the wdhr. western denmark has a population of 3.3 million (55% of the total danish population ; figure 1). denmark provides an optimal environment for conducting medical database - based research because : (i) the danish national health service provides tax - supported universal health care, guaranteeing unfettered access to general practitioners and hospitals, and partial reimbursement for prescribed medications ; (ii) cardiac intervention in western denmark are performed only at participating cardiac centers ; (iii) all danish citizens can be tracked in the health care system and national registries using the unique ten digit central personal registry (cpr) number assigned to each danish citizen at birth and to residents upon immigration;4 and (iv) information on exposures, disease outcomes, and potential confounding factors can be ascertained through cpr linkage to other danish medical databases (figure 2), which store information on eg, citizen vital statistics since 1968, including date of birth, change of address, date of emigration, and exact date of death (the civil registration system),5 specific causes of death since 1943 (the registry of causes of deaths),6 characteristics of all nonpsychiatric inpatient admissions since 1977 and all outpatient clinic visits since 1995 (the national patient registry),7 prescribed medication since 1995 (the nationwide prescription database),8 and all laboratory results from patient blood samples since 1997 (the laboratory database).9 the organization behind the wdhr comprises a committee of representatives, a board, and a data management group. the committee of representatives consists of medical specialists from the cardiac centers and includes nine cardiologists, three cardiac surgeons, and three anesthesiologists. one member from each specialty group is selected for the representatives executive committee with voting rights on the board. the committee of representatives coordinates all database changes, participates in securing data quality, reports to the danish heart registry, and promotes future initiatives within the wdhr. in addition to the representatives executive committee, the board consists of one hospital management representative from each of the three major cardiac centers, among whom the chairman is chosen. the board provides oversight, maintains contracts with database suppliers, sets annual membership fees, defines the strategy and goals for the wdhr, and holds the responsibility for the budget and the data quality to the danish heart registry. the board appoints a data management group, which holds the responsibility for day - to - day management including implementing database changes, preparing annual reports, and daily communication between the committee of representatives, the board, and the database suppliers. the wdhr includes all adult (15 years) patients in western denmark referred for cardiac intervention, ie, invasive procedures (coronary angiography [cag ] or percutaneous coronary intervention [pci ]), cardiac surgery (predominantly valve surgery and coronary artery bypass grafting [cabg ]), and from 2008 also computed tomography (ct) cag. invasive cag is performed at all cardiac centers like ct cag, except at the region hospital silkeborg, aarhus hospital, and svendborg hospital. pci and cardiac surgery are performed only at the three major cardiac centers and the varde heart centre. during 2008 more than 23,000 procedures were performed.10 by january 2010, the wdhr contained patient data on approximately 120,000 cags, 52,000 pcis, 26,000 cardiac operations including 17,000 cabgs, and 3,000 ct cags.10 the wdhr is derived from an internet - based online system, running on an encrypted public net. data are entered by the physicians into a computer - based data management system using the cpr numbers. one interface provides physicians with a visual overview of the variables to be filled in. thus, for each procedure, physicians report administrative data, including dates of referral, admission, operation, and discharge ; and clinical data, including medical history, procedure data, lesion data, complications, and research study enrollments (tables 13). depending on the procedure type, quantifiable variables have been selected as performance indicators for the quality of the health care efforts compared with prespecified standards set by the danish heart registry (table 3).11,12 the purpose of the performance indicators is to : assess the actual care given and its quality in order to detect care and service processes needing improvement (process indicators, [pi ]) ; assess whether treatment outcomes meet a desired level (outcome indicators, [oi ]) ; maintain and improve quality of care ; and inform policy making or strategy at a regional and national level.12 the wdhr performance indicators are selected independently for the following interventions : cag : adverse reaction to contrast fluid (oi, standard < 1%), arrhythmia during procedure (oi, standard < 1%), and bleeding complications from arterial puncture (oi, standard < 3%) ; pci, in addition : acute cabg during procedure (oi, standard < 0.5%), 30-day mortality (oi, standard < 5%), and postintervention secondary prophylaxis with clopidogrel and statins (pi, standard 95%) ; and cardiac surgery : 30-day mortality (oi, standard < 5%), central nervous lesion or acute myocardial infarction during hospitalization (ois, standard < 5%), sternum infection (oi, standard < 3%), reintervention due to bleeding or within 6 months (ois, standard < 10%), transfusion (pi, standard yet to be defined), and postintervention secondary prophylaxis with statins (pi, standard 95%). furthermore, improvements in the quality of care are also ascertained through ways other than performance indicators. as an example, the scope of surgery among patients aged 8090 years has been expanded to include complex surgery with both valve replacement and cabg. this expansion has been justified through surveillance of outcome data by means of the wdhr. upgrades to the database platform have been performed in 2003 and 2006. the next upgrade is scheduled for 2010. to improve data quality, it is mandatory to fill in more than two - thirds of the variables. the data quality is confirmed by automatic validation rules at data entry (eg, blood pressure levels are restricted within prespecified limits) combined with systematic validation procedures (through research projects and otherwise defined by the individual departments) and random spot checks after entry (through research projects and by the data management group). data are entered by the physicians at the time of procedure and late procedure complications may, therefore, be incompletely recorded in the wdhr. for example, stent thrombosis may be incompletely registered unless the patient lives to receive revascularization treatment in connection with angiography. however, data linkage to national registries using the cpr numbers provides complete patient follow - up and ascertainment of late complications such as reinfarction, stroke, or cause of death. the proportion of registrations completed (one minus the proportion of missing data) is monitored at two levels : (i) procedure registration through independent ascertainment methods, in which the number of interventions registered in the wdhr is compared with that registered in the danish national patient registry.13 in 2008 it was 98% for cag, 98% for pci, 97% for valve surgery, and 98% for cabg;10 (ii) variable registration through historic data methods, in which the number of registered variables for each intervention is compared with the expected number calculated from the observed number of interventions.13 it is monitored and reported individually for the cardiac centers (tables 13). wdhr data are well suited for studying predictors for multiple outcomes following cardiac intervention, such as patient characteristics, comorbidity, medication use, and intra - interventional differences (eg, different types of stents or anesthesia). furthermore, the wdhr is used as a platform for randomized controlled trials with clinical driven outcome detection. in addition to the inherent variables in the wdhr, a committee of cardiac specialists has, owing to research purposes,1418 added detailed information on stent thrombosis and cause of death. as defined by the academic research consortium, the specialist committee adjudicated the incidence of definite, probable, or possible stent thrombosis by retrieving medical records and reviewing catheterization angiograms. the committee also reviewed original paper death certificates ascertained from the national registry of causes of deaths6 to classify death according to the underlying cause as cardiac or noncardiac death. cardiac death was defined as an evident cardiac death, pci - related death, unwitnessed death, and death from unknown causes. thus, using these adjudicated outcomes from 12,395 patients undergoing pci with stent implantation, jensen concluded that the minor additional risk of stent thrombosis and myocardial infarction within 15 months after implantation of drug - eluting stents (des) compared with bare - metal stents (bms) was unlikely to outweigh the benefit of des in reducing clinically necessary target lesion revascularization.14 the reduction in target lesion revascularization was also confirmed for st - segment elevation myocardial infarction patients who were treated with primary pci19 and for diabetic patients.20 furthermore, comparing effectiveness of two types of des sirolimus - eluting stents (ses) and paclitaxel - eluting stents (pes) maeng showed that pes increased the risk of target lesion revascularization by 43% compared with ses.17 in addition, kaltoft concluded that within two years of follow - up, pes increased the risk of stent thrombosis, myocardial infarction, and 1-year mortality compared with bms and ses.16 cardiovascular outcomes have also been examined for other high risk patients with eg, spontaneous coronary artery dissection,21 or unprotected left main coronary artery stenosis treated with pci.15 obtaining information on all prescription medication through record linkage to the nationwide prescription database makes the wdhr a valuable source for pharmacoepidemiological cardiovascular research. use of nonselective nsaids and cox-2-selective enzyme inhibitors has been reported to increase cardiovascular risks in patients with coronary artery disease.22,23 schmidt examined whether this risk also related to patients undergoing coronary stent implantation, and found that overall there was no evidence to support such an association.18 in patients undergoing cardiac surgery, jakobsen investigated the cardioprotective effect of sevoflurane versus propofol anesthesia and found that sevoflurane seemed superior to propofol in patients with little or no ischemic heart disease, whereas propofol seemed superior in patients with severe ischemia, cardiovascular instability, or in acute or urgent surgery.24 in another study on drug effectiveness and safety during cardiac surgery, aprotinin treatment was found to increase the use of plasma and platelet transfusion and the risk for postoperative dialysis, but not other adverse outcomes, including short - term mortality.25 the wdhr is a valuable tool for clinical epidemiological research because it provides ongoing longitudinal registration of detailed patient and procedure data, which allows for research within invasive cardiology, cardiac surgery, anesthesia, and pharmacoepidemiology. the danish national health care system enables this research because it allows complete follow - up for medical events after cardiac intervention by linkage with multiple medical databases. | background : the western denmark heart registry (wdhr) has not previously been described as a research tool in clinical epidemiology.objectives:we examined the setting, organization, content, data quality, and research potential of the wdhr.method:we collected information from members of the wdhr organization, including the committee of representatives, the board, the data management group, and physicians reporting to the database. we retrieved 2008 data from the wdhr to illustrate database variables.results:the wdhr is a clinical database within a population - based health care system. it was launched on 1 january 1999 to monitor and improve the quality of cardiac intervention in western denmark (population : 3.3 million) and to allow for clinical and health - service research. more than 200,000 interventions, with 50150 variables each, have been registered. the data quality is ensured by automatic validation rules at data entry combined with systematic validation procedures and random spot - checks after entry.conclusions:the wdhr is a valuable research tool because it provides ongoing longitudinal registration of detailed patient and procedural data. the danish national health care system enables this research because it allows complete follow - up for medical events after cardiac intervention by linkage with multiple medical databases. |
ameloblastic fibro - odontoma (afo) is defined as a benign odontogenic tumor with slow growing behavior. afo is characterized by histologic features of ameloblastic fibroma (af) with the formation of enamel and dentine. this is a case report of afo accompanied with a number of impacted deciduous teeth and its management in a 4-year old boy. examination of oral cavity revealed an extensive swelling from midline to left deciduous maxillary first molar, covered with normal mucosa. radiographic examination showed a well - defined mixed radiolucent - radiopaque lesion that extended horizontally from midline to mesial border of the left maxillary primary first molar and vertically from alveolar crest to the floor of nose. ameloblastic fibro - odontoma (afo) is defined as a mixed odontogenic tumor in which both odontogenic epithelium and ectomesenchyme are proliferated and dental hard tissue formation can be seen as its consequence. prevalence of afo is relatively rare, about 3.1% of all odontogenic tumors (1, 2). affected patients are generally between 8 to 12 years, and no tendency to gender or anatomic position was reported, although some articles report a slight tendency for posterior mandible involvement (2, 3). most cases defined as painless swelling may be detected to be the result of tooth eruption failure (4, 5). radiographic view of afo consists of a well - defined unilocular or multilocular radiolucent lesion that contains part of irregular radiopaque particles (6). because of these large mineralized parts, it is impossible to differentiate the afo from complex odontoma through radiographic examination (7). histopathologic feature of afo is characterized by cords, strands and islands of odontogenic epithelium submerged in embryonic connective tissue that simulate rudimentary dental pulp (2, 4). for treatment of afo conservative enucleation followed by curettage is recommended (8). generally, the prognosis of afo is reported as excellent (9). the purpose of this article is to describe a case of afo that affected the left maxillary region of a patient that was treated with surgical approach without any sign of alteration or recurrence after 12 months of follow - up. the parents of a 4-year - old boy referred to the pediatric dentistry, school of dentistry, tehran university of medical sciences, on june 2014 complaining of missing teeth. according to patient s mother, since she noticed the swelling, her son was visited immediately by a dentist who referred him to the dental school. the patient s past medical history was unremarkable. he had healthy parents and there was no history of systemic diseases in his family. a general physical examination showed no abnormality and his mother did nt mention any history of trauma. extra - oral examination showed a painless swelling on the left anterior maxilla, with firm consistency on the palpation, which caused little facial asymmetry. intra - oral examination revealed a vestibular, non - tender and firm consistency swelling and expansion of buccal cortical plate that was covered with normal mucosa. the panoramic radiograph and ct scan (axial section) revealed an expansile, mixed radiolucent - radiopaque lesion with well - defined corticated border. there was a radiolucent rim and scattered foci of calcified particles which contained several radiopaque bodies of varying sizes and shapes with density similar to enamel or dentin in the left anterior maxilla. the lesion extended horizontally from midline to mesial border of left maxillary primary first molar and vertically from alveolar crest to the floor of the nose (figure 1 a). excisional biopsy and careful curettage of surgical cavity and removal of impacted left primary central and lateral incisors was performed. the specimens fixed in formalin and submitted for histopathological assessment consisted of 2 pieces of bony tissue, each one having rhomboid - shape measuring 3 2 1 cm and one paper - tiny piece measuring 2 3 cm (figure 1 b). there was myxoid matrix in some spaces which contained odontogenic epithelial cells (figure 1 c). after 4 months, the patient received a nance esthetic appliance (figure 2 a). during the 12 month follow up period no sign of recurrence was detected and soft tissue healing was uneventful. complete bone healing and normal tooth eruption pattern of permanent central and lateral incisors can be seen on last follow - up radiographs (figure 2 b). afo is a benign tumor composed of odontogenic epithelium proliferation embedded in a ectomesenchymal tissue that resembles dental papilla, with dentin and enamel formation as a result of inductive properties of this tissue (8 - 10). usually, this lesion is discovered trough routine radiographs for determining the reason of failure in tooth eruption (2). afo is generally asymptomatic and expansion of involved hard tissue can be seen in clinical examination (4). this lesion is commonly found in the molar area, with significant tendency to mandible, affects mainly individuals under 20 years old (1, 4). in a review of literature, philipsen. (11) found only 1 case of afo being > 20 years old among 86 cases that they reviewed. the average age of afo cases at the time of diagnosis was 9 (ranging from 1 to 22) years, with a male / female ratio of 1.4/1. commonly, afo was found in the posterior area of mandible, with a mandibular / maxillary ratio of 2.4, while in our case report, lesion affected the anterior portion of maxilla in a 4-years - old boy. radiographically, the afo can be seen as a uni- or multilocular radiolucent lesion with a well - defined border commonly associated with a radiopaque margin (11). the ratio of radiopaque to radiolucent zones was different in each particular case ; with domination of calcified structures. the lesion sometimes mimics a complex odontoma appearance (10). surgical procedure showed a well - circumscribed tumoral mass that contains several amounts of small irregular calcified masses. because of benign behavior of this tumor conservative and careful surgical approach is appropriate (4, 6, 12). sometimes, the differentiation between afo and developing complex odontoma is impossible. however, the presence of great amount of dental hard tissue consisting of enamel, dentin, and cementum - like components organized in a haphazard pattern favors diagnosis of a complex odontoma. in addition, the differential diagnosis between afo and odontoameloblastoma is critical. in this lesion, the epithelial component is typical of ameloblastoma and the fibrous stroma shows cellular myxoid tissue adjacent to the dental calcified tissues (1). based on the amount of histologic differentiation, ameloblastic fibrodentinoma (afd) is defined by some researchers as a stage between the ameloblastic fibroma (af) and afo (13). the difference is that the afo is specified by both enamel matrix producation and osteodentin or dentin - like deposits (7, 11). in contrast to afo, af has no signs of dental hard tissues formation (2) and potential for recurrence and malignancy exists (3, 14). for evaluating the nature and behavior of lesions, age of the patient and tumor s size are the most important factors that must be considered at initial detection phase. in our case, histopathologic assessment showed typical specification of both ectomesenchymal and epithelial components which led to diagnosis of afo. recurrence of afo is rare, and most recurrences are related to incomplete surgical removal (16). a recent case of afo was treated with enucleation and impacted lower left first permanent molar was preserved and complete eruption was reported without any sign of recurrence (17). another report, confirmed that a conservative enucleation and curettage in conjunction with copious irrigation was successful to prevent recurrences (16). due to possible increased rate of recurrence, there is no consensus regards to tooth maintaining after afo removal (12). however, some clinical reports achieve success without dental management followed by tooth eruption with no sign of recurrence (17). in summary, we report a case of an afo affecting a 4-year - old boy involving the left anterior side of maxilla. in this case, | introductionameloblastic fibro - odontoma (afo) is defined as a benign odontogenic tumor with slow growing behavior. its prevalence is rare. afo is characterized by histologic features of ameloblastic fibroma (af) with the formation of enamel and dentine. case presentationthis is a case report of afo accompanied with a number of impacted deciduous teeth and its management in a 4-year old boy. examination of oral cavity revealed an extensive swelling from midline to left deciduous maxillary first molar, covered with normal mucosa. radiographic examination showed a well - defined mixed radiolucent - radiopaque lesion that extended horizontally from midline to mesial border of the left maxillary primary first molar and vertically from alveolar crest to the floor of nose. the differential diagnosis was odontoma (ameloblastic fibro - odontoma, complex odontoma). surgical enucleation and curettage was performed under general anesthesia. histopathologic sections show bone trabeculae in marrow spaces. there was myxoid matrix in some spaces which contained odontogenic epithelial cells. these findings led to diagnosis of afo. no sign of recurrence has been observed during the 12-month follow - up period.conclusionalthough afo is a rare tumor, it is more prevalent in childrens jaw. conservative surgical treatment allowed the normal development of teeth. |
pseudofolliculitis of the beard area is a very common dermatological problem in our geographical region. this could be partly because of the racial predilection as a large percentage of the population has curly hair and also may be due to local cultural customs which unlike the west do not encourage daily shaving of facial hair. twenty - four consecutive male patients presenting to a university health center over a 1 year period from january 2014 to january 2015 with a clinical diagnosis of pseudofolliculitis involving beard area and not on any active treatment for the same were included in the study. patient with other associated skin conditions which according to the investigators might affect clinical feature and/or management including, but not limited to, acne vulgaris, seborrheic dermatitis, rosacea, and other forms of folliculitis were excluded from the study. patient history with regards to shaving habits, patient hair type, morphological patterns of the skin lesions, and dermoscopic findings were recorded. dermoscopic images were shown to the patients and the condition and the principles of treatment were explained to them using the dermoscopic images. most of the patients had a usual shaving frequency of 2 or less per week. all the patients who were using razors mentioned that they tended to stretch the skin while shaving. the most common dermoscopic findings included - handle bar sign showing curved hair attached to the skin on both ends [figure 1 ], white areas (possibly indicating fibrosis) and scaling [figure 2 ], underlying linear bluish pigmentation (indicating the buried hair shaft) [figure 3 ], and linear vessels with occasional areas of hemorrhage [figure 4 ]. aerobic culture of specimens taken from the skin lesions showed positivity for staphylococcus epidermidis in eight of the case. sign showing curved hair attached to the skin on both ends white areas (possibly indicating fibrosis) and scaling underlying linear bluish pigmentation (indicating the buried hair shaft) linear vessels with occasional areas of hemorrhage there are very few studies which have tried to elucidate the dermoscopic correlates of pseudofolliculitis barbae. the first case report was from chuh and zawar, who used dermoscopy to demonstrate the ingrown hairs and also suggested that showing the dermoscopy image to the patients can help them understand the condition better and thus help in achieving better compliance and treatment results. described a unique dermoscopic feature of pseudofolliculitis barbae in the form of a solitary gray - blue, thick curved line and adjacent red lines set upon a structure - less pattern. this pattern does not correspond to known dermoscopic entities such as basal cell carcinoma and seborrheic keratosis. according to the authors, the solitary gray - blue, thick curved line corresponds to the edge of the tightly coiled cluster of ingrown hairs in the dermis and the red lines could represent aberrant vessels secondary to the inflammatory reaction. the gray and blue colors could be explained by the tyndall effect due the melanin in the pigmented hair shaft in the dermis. puhan and sahu recently reported a case of pseudofolliculitis over the back of a patient. pseudofolliculitis corporis for this condition which in this case was most probably induced by the effect of friction due to a pillow which the patient used to put behind is back while driving. our study showed that the most common pattern seen in all cases was the curved hair attached at both ends what we would like to label as the handle bar. white areas with scaling, underlying linear bluish pigmentation (indicating the buried hair shaft) similar to that described by ladizinski., and linear vessels with occasional areas of hemorrhage were the other common dermoscopic patterns seen in our cases. other studies have highlighted the predisposition of african race and curly hair to develop pseudofolliculitis. another study showed that the ala12thr polymorphism of keratin k6hf of hair follicle may be partially responsible for the phenotypic expression. the racial and genetic factors might be important for explaining the high incidence of pseudofolliculitis in the population of our study. while we did not do a formal evaluation as done by chuh and zawar to see if showing the dermoscopy images helped patient compliance, as done by us we feel that in general the patients had a clearer understand of the problem and the principles of treatment after they were shown the dermoscopy images. dermoscopy shows characteristic features and can be a useful adjunct for diagnosis in pseudofolliculitis. stretching the skin while using razors and growing the facial hair to a point where it has the length to curve might be important risk factors in the development of pseudofolliculitis. | background : pseudofolliculitis of the beard area is a very common dermatological problem in our geographical region. this could be partly because of the racial predilection as a large percentage of the population has curly hair and also may be due to local cultural customs, unlike the west do not encourage daily shaving of facial hair.objectives:we aimed to mainly study the dermoscopic features of cases presenting with pseudofolliculitis. secondary objectives included evaluating clinical patterns and possible etiological factors.methods:twenty-four consecutive male patients presenting to a university health center with a clinical diagnosis of pseudofolliculitis involving beard area were included in the study. patient history with regards to shaving habits, patient hair type, morphological patterns of the skin lesions, and dermoscopic findings were recorded.results:majority of the patients had curly hair. most of the patients had a usual shaving frequency of 2 or less per week. all the patients who were using razors mentioned that they tended to stretch the skin while shaving. the most common dermoscopic findings included - handle bar sign showing curved hair attached to the skin on both ends, white areas indicate fibrosis and scaling, underlying linear bluish pigmentation (indicating the buried hair shaft), and linear vessels with occasional areas of hemorrhage.conclusion:dermoscopy can be a useful adjunct for diagnosis and patient counseling in pseudofolliculitis. stretching the skin while using razors and growing the facial hair to a point where it has the length to curve might be important risk factors in the development of pseudofolliculitis.limitations:the lack of histopathological correlation is the main limitation in our study. |
superficial fungal infection is a global problem with an estimated 20 - 25% of the world 's population having cutaneous mycoses. it is also noteworthy that the prevalence of a particular mycosis is influenced by local socioeconomic conditions and cultural practices. thus, the choice of therapy at times is guided by the financial condition of the patient. access to low - cost essential medicines would be a crucial prerequisite for addressing this need, as it is known that in india major health - care costs are made from out - of - pocket expenses. the government of india had introduced price control on two antifungal drugs, namely griseofulvin and tolnaftate, in 1995 (drug price control order (dpco), 1995). with the rise of immunosuppressant diseases in india, for example, hiv - aids and diabetes, there has been an upsurge of superficial fungal infections (especially candidal glossitis). these superficial fungal infections are occasionally drug resistant. also, infections of nails and hair require long - term therapy adding to the cost. knowledge of changing trends in pattern of superficial fungal infection offers the governmental and social agencies to reallocate the available health resource to the benefit of mankind. it is also interesting to know to what extent the drug price influences the prescription pattern. to address the problem, the drugs assigned for treatment of these diseases in the dpco would have to be reframed or the benefit will be partial. at present, most of the antifungal drugs are outside price control, and there is wide inexplicable difference between brands in their retail prices this indicates profiteering by the companies at the cost of the patient. the behavior of drug price that is outside price control provides strong proof that poor, ignorant, choice - less patients are forced to pay out - of - pocket expenditure. although the previous drug policy formulation made clear its intent to monitor drug prices, certain operational details about which drugs to monitor, tools for monitoring, and definitions of abnormal behavior of prices needed to be more precisely defined this study was undertaken with the primary objective of evaluating how far the existing government price control of antifungal medications is reaching to the consumers by assessing the awareness and opinion of the prescribers. the secondary objectives were to assess the knowledge of antifungal medications in the national list of essential medicines (nlem) of india and to analyze the perceptions and practice with regard to evidence - based medicine. this study was also aimed at determining their perception of the study participants about efficacy, safety, and price of different antifungals and correlating them with the volume of the respective antifungal prescribed. a questionnaire - based, cross - sectional study was carried out over duration of 6 months starting from april to september 2010. clinical information regarding the various types of superficial fungal infections (namely tinea corporis / cruris, tinea capitis, tinea pedis / manuum, onychomycosis, candidiasis, pityriasis versicolor) was obtained. the study participants were asked to respond on a 10-point scale on the percentage of each infection seen, the preferred mode of therapy (whether topical, systemic, or combination of both used), topical agents, and systemic drugs preferred (with their approximate frequency of use on the same 10-point scale). also questions were designed regarding the dermatologists opinion of the efficacy, safety, and price of individual antifungal agents that influence the prescription pattern. moreover, questions were also asked to elicit their knowledge and attitude about the price control of antifungals. the questionnaire was mailed to all the members of a state branch of indian association of dermatologists, venereologists, and leprologists, containing forwarding letter along with self - addressed and self - stamped envelope. the responses reaching the investigators within 2 months from the date of mailing were finally analyzed. information regarding evidence - based antifungal prescription pattern was obtained from pubmed database of the various superficial fungal infections and was compared with the prescription pattern of the study participants and nlem, india. to determine the volume of a drug prescribed, the cumulative drug usage score (dus) was used as described in figure 1. dusa can range from 0 to 6 descriptive statistics was expressed in percentage, meanstandard deviation (sd). spss version 11 was used for statistical analysis, and p<0.05 was considered statistically significant. a total of 93 (41.33%) responses were obtained from 225 questionnaires delivered to the dermatologists. only six (6.5%) dermatologists were aware of the existing price control over griseofulvin, but none knew that tolnaftate was also price controlled. a majority of them, 78 (83.9%), were of the opinion to introduce price control, and among them, 39 (41.9%) were in favor of introducing the price control on terbinafine and 42 (45.2%) for itraconazole. the disease load of superficial fungal infection perceived to be encountered in clinical practice, expressed as disease score [dis (xi), figure 1 ], was found to be maximum for tinea corporis / cruris (dis=0.542.58), followed by pityriasis versicolor (dis=0.381.85) and candidiasis (dis=0.371.78) [table 1 ]. drug usage score of commonly prescribed anti - fungals the topically preferred antifungals were primarily azoles (dus=0.700.15) and terbinafine (dus=0.390.20), while tolnaftate (dus=0.080.12) was not preferred by the study participants (p value<0.0001, anova test). use of topical azoles was found to be significantly more than topical terbinafine (p value<0.0001, mann regarding systemic antifungals, dermatologists mostly preferred fluconazole (dus=0.620.16) and terbinafine (dus=0.400.19), while itraconazole (dus=0.170.17) and griseofulvin (dus=0.160.17) were used less frequently (p value<0.0001, anova test). furthermore, fluconazole was significantly used compared with terbinafine (p value < 0.0001, mann topical azoles were found to be significantly used than terbinafine in candidiasis (p<0.0001, mann whitney test), pityriasis versicolor (p<0.0001), and tinea corporis / cruris (p=0.0084). no significant difference between use of topical azoles and terbinafine was found in tinea capitis (p=0.5159), onychomycosis (p=0.2700), and tinea pedis / manuum (p=0.3977). however, the dus indicated that topical agents were less frequently used than systemic antifungals in these conditions. among the systemic antifungal medications, fluconazole was used more than terbinafine in candidiasis (p<0.0001), pityriasis versicolor (p<0.0001), and onychomycosis (p=0.3709), whereas terbinafine was used more frequently than fluconazole in tinea pedis (p=0.0008), corporis (p=0.0735), and capitis (p=0.2203). the perception of study participants regarding the drugs efficacy, side effects, and price, and its influence on the volume of drug use (cumulative dus) is shown in table 2. perceptions regarding the determinants that influence the drug usage and its relation to the volume of drug used (cumulative drug usage score) in practice the number of participants who does not know (noncommittal) about the efficacy (35.48%), side effects (41.93%), and price (48.38%) of tolnaftate was higher than any other antifungals studied. on the other hand, the drug was significantly higher in those who thought the price was high in case of topical azoles, and those who were noncommittal of the price for fluconazole (p<0.0001). the choice of antifungals by the dermatologists was in close harmony with the evidence - based dermatology data [table 3].[322 ] a discrepancy was observed between dpco list and list of essential medicines for fungal infections recommended by who and nlem, india [table 4 ]. comparison of prescription pattern of dermatologists and available evidence from pubmed comparison of antifungals enlisted in the dpco with nlem, india, and who model list of essential medicines the objective of having drug policies was to provide essential medicines of good quality at affordable prices. a list of essential drugs has been included in light of the prevalent public health problems in the country. the modifications in drug policy 1986 proposed in 1994 included criteria that did not consider the nature of the drug and its use, but were based on the turnover and market share of the manufacturer. drugs with an annual turnover of more than four crore rupees in which there was either a monopoly situation (one formulator having a greater than 90% share in the market) or evidence of insufficient competition were subjected to price control. these criteria although seemingly objective may not be in tune with the realities of india 's vast pharmaceutical market where such monopoly situations are generally the exception rather the rule. also, based on the same criteria that gave superiority to turnover and market share, a host of drugs whose utility was highly doubtful and some which were clearly outdated and nonessential found their way into the list, at the cost of drugs important for public health, for example, analgin, vitamin e, phenylbutazone, sulphaguanidine, and sulphadimidine. on the other hand, the drug policy based on therapeutic use and public health importance can help developing a much needed beneficial and effective price - controlled drugs. clinicians with a public demand for an effective therapy for superficial fungal infections are further challenged with treatment - resistant infections. although these superficial infections are not life threatening, chronic fungal infections of the skin and nails carry a considerable morbidity. this study highlights that the three most common superficial fungal infections are tinea corporis / cruris, candidiasis, and pityriasis versicolor. griseofulvin and tolnaftate are effective against dermatophytes with little use against candida sp., malassezia furfur this fact is evident from evidence - based medicine,[1922 ] as well the dus obtained in this study. thus, the present dpco list fails to address a large fraction of superficial fungal infections. azoles (both topical and systemic) are most widely used, and considering the wide interbrand variability in price of systemic fluconazole (range rs. 9.65 - 37.70 for one 150 mg tablet), it is desirable that there should be a ceiling on its price so that common man does not suffer unnecessary expenditure because of the ignorance of the practitioners about the price (this study shows 15 of 93 are not sure of the price of fluconazole). this ignorance about the cost of drugs has also been highlighted in a meta - analysis of 24 articles. the meta - analysis also found that the doctors acknowledge that awareness of cost information would improve their prescription pattern, but they stressed that such information was not accessible. the findings of our study also highlight this unfortunate phenomenon with only 6.5% of dermatologists aware of the existing dpco. it should never be interpreted that doctors are apathetic about the cost because it was found that 83.9% want price control to be introduced. thus, there is a gap between administrative agencies and the health - care service providers, which needs to be abridged to make the benefit of price control reach the people - in - need. knowledge about a drug has a major impact on its use as evidenced from our study, with tolnaftate having the least dus because 35.5% were unaware of efficacy, 41.9% unaware of side effects, and 48.4% unaware of price [table 2 ]. the low knowledge on this particular antifungal can be explained as an effect of hypothetical drug usage cycle with price control, that is, less promotion by pharmaceuticals leading to decrease use of medication, less focus on the upgrading the knowledge, and decreased use ; the vicious cycle continues. the impact of promotion by pharmaceutical companies on the prescription pattern has been previously studied and found to have an influence on higher prescribing frequency, higher costs, or lower prescribing quality. hence, it is evident that introducing price control is not the end point of effort to reduce the cost burden of treatment for the governmental agencies, but they should carry out regular monitoring. it should be ensured that pharmaceutical companies manufacturing those medicines do not shift such medicines in their waste basket leading to decreased availability and usage. regarding the future of price control of antifungal medications, the study participants were of the opinion that price control should be introduced for terbinafine (41.9%) and itraconazole (45.2%). their opinion was found to be in tune with the efficacy of those medications, which was evaluated in light of evidence - based medicine [table 3 ]. griseofulvin, another price - controlled drug, is used by dermatologists only in the treatment of tinea capitis, although terbinafine and itraconazole are favored. thus, the utility of the present antifungal drugs under price control is questionable and clearly outdated. there is a need to include the more frequently used, effective, and evidence - based antifungals in the dpco for the benefit of the needy. the dermatologists desired a price control over the antifungals they frequently prescribed, namely itraconazole (among azoles) and systemic and topical terbinafine (among allylamines). the nlem 2003 represents a selection of the efficacious, safe, and cost - effective medicines for the priority health - care needs of india. thus, the national list forms a sort of reference list from which the list of drugs to be placed under price control can be drawn. unfortunately, at present, it is only a guideline and a prescriptive tool and does not accurately reflect the reality of the pattern of drug production, prescription, and drug availability in the country. if the dpco has the aim of ensuring availability of drugs at reasonable prices, then it has to look beyond nlem. the reality of the pattern of prescriptions is that most of the drugs prescribed are outside the nlem [org - marg retail audit of october 2003 stated out of the top - selling 300 brands in the country, only 115 (i.e., only 38%) were drawn out of the nlem ]. the people, therefore, need regulation of prices of drugs outside this list, which means that the alternative drugs to the ones mentioned in the national list also require regulation. it is noted that azoles find its place in the nlem but not the dpco. also there is no representation of allylamines in both the nlem and dpco. from our study, we find a need to include a fair representation of the above two therapeutic groups (azoles and allylamines) in the dpco. antifungal drugs for the treatment of superficial fungal infections form a part of the dpco, and from our study, we have found a unanimous consent among dermatology practitioners for the price control of the much used itraconazole and terbinafine. the antifungal drugs included in the present day dpco, tolnaftate and griseofulvin, are seldom used nowadays. the new dpco should base itself firmly on the need to address the priority disease and health - care conditions of indians and to regulate the market through rigorous monitoring. newer drugs may be introduced, which are either more efficacious, safer, more convenient, or even more expensive, and these may needed to be brought under the monitoring and/or price control list for the benefit of the society at large. | background : superficial fungal infections are common and treatment imposes economic burden on the patients. government of india had introduced price control over griseofulvin and tolnaftate in 1995 ; however, this measure can only benefit the needy if the policy is harmonized with the health - care service provider, that is, dermatologists. the aim of this study was to evaluate the existing government mechanisms over price control of antifungal medications and its reach to the people-in-need.materials and methods : a questionnaire - based, cross - sectional study was carried out over a period of 6 months. questionnaire was mailed to members of a state branch of indian association of dermatologists, venereologists, and leprologists. responses reaching investigators within 2 months from the date of mailing were finally analyzed.results:among 93 (41.33%) respondents, only 6 (6.5%) were aware of existing price control over griseofulvin but none about tolnaftate. thirty - nine (41.9%) respondents were in favor of introducing price control on terbinafine and 42 (45.2%) for itraconazole. the topically preferred antifungals were primarily azoles and terbinafine, while among systemic antifungals, dermatologists mostly preferred fluconazole and terbinafine. the choice of antifungals by the dermatologists matched with the evidence - based dermatology data.conclusion:currently, price - controlled antifungal drugs are less commonly used by practitioners. although the dermatologists favor price control, the initiative undertaken by the government has not reached them. this shows the need to bridge the gap between policy makers and health - care service providers to help the ailing population. |
we examined hiv - positive injection drug users from manipur who had been identified as anti - hbc positive during previous serosurveys conducted by the national institute of cholera and enteric diseases (2). serum samples (stored at 80c) taken from 63 men 1825 years of age were available for the study. hbsag detection was repeated with a monoclonal antibody based hepanostika hepatitis b surface antigen (hbsag) kit (biomrieux, marcy l'etoile, france). anti - hcv antibody was detected using the ortho hcv 3.0 test (ortho - clinical diagnostics, raritan, nj, usa). we completed hbv dna isolation, pcr amplification, genotype / subgenotype / subtype identification, recombination detection, and hbv dna quantification with methods described earlier (79). we also compared nucleotide (table a1) and deduced amino acid sequences (table) with consensus sequence of amino acids of corresponding genotypes to detect substitutions (genbank accession nos. hbv, hepatitis b virus ; idu, injection drug user ; nd, not detectable by the assay. genotype - specific sites. subtype - specific sites. all those tested were hbsag negative, and only 10 (15.9%) had detectable hbv dna. anti - hcv was detected in all but 1 sample (no. 4). serum hbv dna level was detectable in 5 of 10 samples (table) ; the rest were below the detection limit of our assay. hbv / c (all subtype adr except 1 adw2) was the predominant genotype, with 4 subgenotype c1 (hbv / c1) and 3 subgenotype c2 (hbv / c2) isolates. two other isolates (nos. 1 and 3, subtype adw2) indicated a possibility of intergenotypic recombination (figure 1), but subgenotype could not be assigned for them. phylogenetic relationships among the sequences of s gene from hepatitis b virus strains isolated in this study (shown with prefix " idu ") compared with reference sequences from genbank (accession nos. are shown). percentage of bootstrap replications supporting the clusters (> 75%) are also shown at the nodes. 1 showed similarity to hbv / d as well as to hbv / a sequences from european countries. on the other hand, sequences from sample no. 3 showed similarity to hbv / c and hbv / a sequences from southeast asian countries and india. apart from the genotype - specific substitutions, deduced amino acid sequences did not have any remarkable escape mutant other than g145r in 2 isolates (table). the location of recombination events in isolates idu1 (a) and idu3 (b), determined by using the bootscanning program of simplot. possible tree topologies (a, b, and c) are shown (c). the phylogenetically informative sites and the tree topologies supported at each of those sites are indicated over each plot. in the tree topologies, q, a, and h indicate query sequences (idu1 or idu3), genotype a, and genotype h (outgroup) consensus sequences, respectively. s indicates consensus sequence of genotype d and genotype c for idu1 and idu3, respectively. possible crossover points are indicated by solid triangles. a sliding window size of 60 bp, step size of 10 bp, kimura-2 parameter, 1,000 bootstrap replicates, and neighbor - joining method were used for the analysis of recombination. the data from this study showed occult hbv infection in 15.9% of the injection drug users tested. the rate of hbv dna detection (10%45%) was considerably different in studies reported from different cohorts of injection drug users in different countries, a finding that has been attributed to coinfection with hcv or low hbv dna levels (3). apart from hiv, our study group had a high frequency of hcv infection and low hbv dna levels. undetectable hbsag, except in 2 cases with g145r substitution, may also be a result of the above - mentioned factors. although the importance of occult hbv infection is not well understood, a recent study reported occult hbv to be a significant risk factor for hcc, especially among persons who were anti - hbc positive (4). another recent study among hiv - infected patients documented death due to liver disease in 22% who were hbv coinfected, 44% who were hcv / hbv coinfected, and 15% who were hbv coinfected and had hcc (10). although we detected a 100% prevalence of anti - hbc in our serosurveys (2), only 1 was hbsag - positive. therefore, the distribution of genotypes among those who were hbsag positive could not be determined. findings of hbv / c1 (prevalent in china) appear to support the history of human migration from china to northeastern india. further, we did detect hbv / c2, which has close similarity to strains from southeast asian countries. the presence of hbv / c correlated well with drug - trafficking routes and the injection drug use epidemic. the geographic proximity of manipur to the golden triangle, needle sharing among injection drug users, and drug traders thus contributed to the spread of hbv through drug - trafficking routes, similar to hiv (1). in manipur, hiv subtypes c and thai b are prevalent (11) ; these are also prevalent in the india - myanmar and china - myanmar border regions. the presence of similar hiv subtypes among injection drug users in manipur supports the presence of similar hbv strains (e.g., hbv / c1, hbv / c2) and their cotransmission through drug - trafficking routes. in addition, circulation of recombinant hbv is common among injection drug users because of repeated exposure (12). hbv / c has been associated with advanced liver disease and poses a higher risk for hcc in asians (13) than does hbv / b. however, the clinical relevance of hbv recombinants and their pathogenesis is not well understood and needs further investigation. poor, unemployed youths in the northeastern states of india are being recruited for drug trafficking to other regions (http://www.ipcs.org). furthermore, national highways are associated with the prevalence of injection drug use in rural manipur (14). as these highways connect manipur with other parts of india, hbv / c may spread from manipur to other parts of the country through persons who travel regularly, such as truck drivers and drug traffickers. presence of hbv genotypes a and d among patients from northern and western india is well documented. recent research reported hbv / c with close similarity to southeast asian strains only from eastern india (9,15) and suggested injection drug users as a possible route of introduction (15). in addition, persons from northeastern india frequent kolkata for education, employment, medical treatment, and other purposes. studies on these mobile populations might provide further important information on the route, population at risk for infection, and changing epidemiology of these viral infections in other regions. in conclusion, hbv / c, associated with severe liver disease in southeastern asia, may be emerging in the manipur state of india through the trafficking routes of injection drugs. this genotype could spread to the general population through different modes. in light of growing information on the severity of liver disease in hbv - infected hiv / hcv patients, injection drug users should be the focus of additional education and healthcare efforts. the possibility of further spread of hiv / hbv / hcv through mobile populations to other regions of india warrants attention and further investigation. | prevalence of hepatitis b genotype c in injection drug users in the northeastern indian state of manipur, neighboring the " golden triangle, " correlates well with overland drug - trafficking routes, the injection drug use epidemic, and the spread of hiv. further spread to other regions of india through mobile populations is possible. |
. however, several precorneal factors such as lacrimal secretion (tear turn over and reflux tearing), tear protein binding, ph, shorter contact time, and other corneal constraints limit drug penetration. moreover, presence of various uptake and efflux transporters in cornea also reposted to further complicate the ocular bioavailability. therefore conventionally, the drugs intended for oral administrations have been developed in consideration of their physicochemical properties. this enables to enhance the pharmacokinetic properties, efficacy and reduces the toxicity of lead compound. in drug discovery exploitation of in silico techniques to expedite the process of lead optimization in drug discovery is rampant. among such techniques, quantitative structure property relationship (qspr) approach correlates the biological activity of a molecule with its physicochemical properties through variety of descriptors. in recent years, qspr approach has been exploited for the development of models to predict penetration of drugs across physiological barriers such as cns, blood, and intestinal. the drugs used for ophthalmic indications are arbitrarily developed from the oral or systemic indications, rather than systematically ocular specific studies. to date, very few drugs have been designed, developed, and studied for ocular specific use. however, the ocular pharmacokinetics of a drug is known to be different and complicated compared to any other indications. thus, in this context a drug intended for oral use is expected to behave differently when used empirically for the topical application. as physicochemical properties such as lipophilicity, molecular size, charge, degree of ionization, solubility, and ph, affect the rate and extent of corneal permeability. in ophthalmology these agents were initially discovered, designed, and developed for systemic infections and further extended for ophthalmic use. their broad - spectrum activity, bactericidal property, better ocular penetration, and relative safety embark its use in ophthalmology. most of the fluoroquinolones for topical use lack regress understanding of their corneal penetration, residence time, required spectrum, optimum frequency of usage, and corneal toxicity despite of their widespread use in ophthalmics. therefore, an emphasis on qspr strategy to optimize ocular pharmacokinetic properties along with antimicrobial efficacy is desirable. previously reported qspr models to predict corneal permeability for congeneric and noncongeneric drugs have been developed based upon in vitro studies. a weak correlation is reported to exist between the in vitro and in vivo studies [8, 9 ]. eventually their applicability of these models to predict in vivo corneal penetration remains unclear. in present study we developed novel qspr based in silico model to predict corneal permeability for fluoroquinolones based upon in vivo the applicability of previously reported models based upon in vitro data to predict corneal permeability for fluoroquinolone was also studied. furthermore, the generated qspr model was evaluated for its aptness using the other training sets (-blockers). pure samples of norfloxacin, ciprofloxacin hcl, gatifloxacin, and lomefloxacin hcl were generously gifted by dr. reddy labs (hyderabad, india), lupin labs (pune, india), sun pharmaceuticals (mumbai, india), and organics ltd., (hyderabad, india), respectively. gratis samples of ofloxacin, pefloxacin mesylate, and sparfloxacin were obtained from cipla ltd., (mumbai, india). moxifloxacin and levofloxacin were obtained as a generous gift from capital pharma (baddi, india). other chemicals used in the study were of analytical grade and procured from standard drug companies. a total of nine fluoroquinolones (table 1) were randomly divided into 2 groups wherein, group a consists of ofloxacin, sparfloxacin, pefloxacin mesylate, and gatifloxacin and group b consists of norfloxacin, ciprofloxacin hcl, lomefloxacin hcl, levofloxacin, and moxifloxacin. in both groups, thus, the total fluoroquinolones concentration in group a and group b were 0.4% and 0.5%, respectively. sterile boric acid (1.9% w / v) in water was used as the aqueous media and the final formulations were filtered using 0.22 filter and autoclaved further before use. study protocol and experimental procedures were approved by the institutional animal ethics committee of all india institute of medical sciences (aiims), new delhi, india. new zealand albino rabbits of either sex (1.52.0 kg) were obtained from central animal facility, aiims. animals were housed at standard laboratory conditions temperature - controlled room at 24 2c and humidity 55 15% and given food and water ad libitum. all experiments were performed in accordance to the association for research in vision and ophthalmology (arvo) statement for the use of animals in ophthalmic and vision research. the sterile cocktail formulations of group a and group b were individually instilled (50 l) on the lower fornix of rabbit eyes (n = 4) with the help of a calibrated micropipette. aqueous paracentesis was performed under the influence of topical anesthesia at 5, 15, 30, 60, 120, and 240 min after the instillation of cocktail formulation. for each time point, a volume amounting to 50 l of aqueous humor was aspirated through the corneal surface. a thermo finnigan (thermo electron corporation, usa) hplc equipped with degasser, quaternary pump, autosampler, and pda detector was employed for quantification of fluoroquinolones in samples. in the chromatographic quantification, analytical separation was performed using a c18 symmetry shield column (4.6 150 mm, 5 m, waters, usa) under a gradient flow of methanol, acetonitrile, and potassium phosphate buffer (20 mm, ph 2.5) at different ratio and time. for each spiked compound an external calibration curve was plotted and the analyte 's spectra was assessed by matching them with custom made pda spectra of inbuilt library of chromquest version 4 (thermo electron corporation, usa). samples were deproteinized with pure acetonitrile (ratio of 1 : 2 v / v), vortexed, and centrifuged at 3500 g for 10 min. the dried concentrate was reconstituted with 100 l mixture of water and acetonitrile (1 : 1), and 20 l of the obtained supernatant was injected for quantification. available literature reveals existence of two models correlating the corneal permeability of compounds with their physiochemical properties. therefore, present study evaluated the suitability of these reported models to predict in vivo corneal penetration for fluoroquinolones. the first model reported by yoshida and topliss was based upon two molecular descriptors, log p and log d to predict corneal permeability coefficient (logpc). algorithm (1) is proposed to predict corneal permeability for noncongeneric compounds (1)logpc=0.404(0.114)log p+0.141(0.090)log d 3.862(0.451), wherein logpc denotes permeability coefficient, log p expresses the difference between the octanol - water partition coefficients (log poctanol) and alkane - water partition coefficients (log palkane), and log d denotes dissociation constant as reported, log p was calculated using logpstar software in training sets of 32 diverse noncongeneric compounds including steroids and -blockers. since logpstar was currently unavailable and obsolete. log p was derived as the difference in log p(o / w) to log p(cyclohexane / water) by using shake flask method given in oecd guidelines of chemical testing (no. the other molecular descriptor log d was calculated using (2)log d(ph)=log plog (1 + 10(pkaph)).log molecular descriptors (log p and log d) were derived for the studied fluoroquinolones (norfloxacin, ciprofloxacin, lomefloxacin, ofloxacin, levofloxacin, sparfloxacin, pefloxacin, gatifloxacin, and moxifloxacin) and logpc was determined using algorithm (1). the derived logpc from algorithm (1) was correlated with that obtained from controlled in vivo experiment in rabbits. model 2 evaluated reported by fu and liang was based upon charge and molecular volume as the molecular descriptors to predict logpc. algorithm (3) was reported to predict corneal permeability for noncongeneric compounds (3)logpc=5.566qh2 + 3.027qh0.155qo, n 9.413104 v4.278 wherein logpc denotes permeability coefficient, qh is sum of the absolute values of net atomic charge of hydrogen atom, and qo, n is sum of the absolute values of the net atomic charges of oxygen and nitrogen atoms. the charge (qh, qh, qo, n) for all fluoroquinolones was calculated by using gamess software and molecular volume by drug design software developed at super computing facility, indian institute of technology, new delhi. structures of all fluoroquinolones were drawn hyperchem version 11.0 and optimized the geometry to lowest energy state. the net charge on each atom was calculated as the sum of all atoms present in the particular structure. the molecular descriptors used in algorithm (3) were derived for the studied nine fluoroquinolones to predict logpc. the derived logpc from algorithm (3) was also correlated with in vivo experimentally obtained logpc. a novel qspr model was generated using pooled molecular descriptors determined using in vitro, in vivo, and in silico approaches for fluoroquinolones. in vitro datapartition coefficient (log p) 107 and 117) using biphasic system of octanol / water at 25c and 37c. partition coefficient (log p) was determined using oecd shake flask method for chemical testing (no. 107 and 117) using biphasic system of octanol / water at 25c and 37c. in vivo datapermeability coefficients (logpc) were obtained from controlled in vivo experiment conducted in rabbits using cassette dosing (n - in - one) approach. permeability coefficients (logpc) were obtained from controlled in vivo experiment conducted in rabbits using cassette dosing (n - in - one) approach. in silico datadifferent molecular descriptors were generated using softwares like cache scientific (fujitsu version 6.1.12.33, japan), acd / chemsketch (freeware version 10), chemdraw and chem biodraw ultra from cambridge soft (trial version), calculator plugins of chem axon 's marvin version 5.2.5.1, chem axon ltd. all fluoroquinolone structures were drawn in respective workspace and standard molecular mechanics were run before geometry optimization. the descriptors like molecular weight, log p, topological polar surface area (tpsa), molar refractivity, number of h-bond donors / acceptor, dipole moment, lowest unoccupied molecular orbitals (lumo), highest unoccupied molecular orbital (humo), gap, molecular volume, connolly accessible area, connolly molecular area, principal moment, dipole moment, molecular weight, wiener index, melting point, polar surface area, number of rotatable bonds and molar refractivity, molar volume, polarizibility, parachor, index of refraction, surface tension, density, monoisotopic mass, nominal mass, average mass, apka, and charge on the each atom, that is, qn, qo, n, qh, qf and qc were extracted using different kind of softwares. different molecular descriptors were generated using softwares like cache scientific (fujitsu version 6.1.12.33, japan), acd / chemsketch (freeware version 10), chemdraw and chem biodraw ultra from cambridge soft (trial version), calculator plugins of chem axon 's marvin version 5.2.5.1, chem axon ltd. all fluoroquinolone structures were drawn in respective workspace and standard molecular mechanics were run before geometry optimization. the descriptors like molecular weight, log p, topological polar surface area (tpsa), molar refractivity, number of h-bond donors / acceptor, dipole moment, lowest unoccupied molecular orbitals (lumo), highest unoccupied molecular orbital (humo), gap, molecular volume, connolly accessible area, connolly molecular area, principal moment, dipole moment, molecular weight, wiener index, melting point, polar surface area, number of rotatable bonds and molar refractivity, molar volume, polarizibility, parachor, index of refraction, surface tension, density, monoisotopic mass, nominal mass, average mass, apka, and charge on the each atom, that is, qn, qo, n, qh, qf and qc were extracted using different kind of softwares. to ensure the suitability of newly developed qspr model, the congeneric compounds used by yoshida and topliss and fu and liang were pooled. all the congeneric compounds (-blockers, n = 15) were pooled and molecular descriptors used in newly developed qspr model were extracted. the -blockers pooled include acebutolol, alprenolol, atenolol, betaxolol, bevantolol, bufuralol, levobunolol, metoprolol, nadolol, oxprenolol, penbutolol, pindolol, propanolol, sotalol, and timolol. the logpc derived using newly developed qspr model was correlated with reported logpc for all the -blockers. two different hplc - pda method were developed and validated to elute all fluoroquinolones in group a and b. for the analysis of group a (ofloxacin, sparfloxacin, pefloxacin, and gatifloxacin) the gradient mobile phase consisted of different ratios of methanol, acetonitrile, and potassium phosphate buffer (20 mm, ph 2.5) over the period of 12 min (table 2). for the analysis of fluoroquinolones in group b (norfloxacin, ciprofloxacin, lomefloxacin, levofloxacin, and gatifloxacin) the gradient mobile phase consisted of different ratios of methanol, acetonitrile, and potassium phosphate buffer (20 mm, ph 2.5) over the period of 10 min (table 2). the representative chromatograms of all fluoroquinolones eluted in group a and group b are shown in figures 1(a) and 1(b). the validation parameters regarding the accuracy and precision were found to be within the allowable limits according to ich guidelines for hplc in bioanalysis. the mean concentration versus time plot for all fluoroquinolones (group a and b) the derived pharmacokinetics parameters like cmax, tmax, auc, logpc at 30 min and 240 min generated for all fluoroquinolones are tabulated in table 3. both molecular descriptors (logp and logd) derived for fluoroquinolones in algorithm (1) to derive logpc showed a weak spearman correlation (0.133) with that obtained from in vivo experiment (table 4). the weak correlation was observed at 30 min (r = 0.0699) and 240 min (r = 0.0137). the statistically insignificant correlation suggests that algorithm (1) is unable to appropriately predict corneal permeability for fluoroquinolones (figure 3(a)). algorithm (3) reported by fu and liang was employed to derive logpc for all studied fluoroquinolones (table 4). a very weak spearman correlation of 0.134 was observed between the logpc derived experimentally at both 30 min and 240 min with that logpc derived using algorithm (3) (figure 3(b)). the statistically insignificant correlation suggests that algorithm (3) is unable to appropriately predict corneal permeability for fluoroquinolones. a total of 72 molecular descriptors were extracted for all nine topically studied fluoroquinolones (norfloxacin, ciprofloxacin, lomefloxacin, ofloxacin, levofloxacin, sparfloxacin, pefloxacin, gatifloxacin and moxifloxacin) using in vitro, in vivo, and in silico approaches. all sets of data were subjected to multilinear regression (mlr) statistical analysis by sigma stat software (version 3.5, germany). for the generation of algorithm the in vivo data of logpc calculated for absorption phase (30 min) and elimination phase (240 min) was used. the algorithms developed with log p and apka either with gap (algorithms (4) and (5)) and or with tpsa (algorithms (6) and (7)) exhibited good correlation (4)logpc 30 min = 13.972+(1.529log p) (1.375apka)+(1.308gap),r=0.908 rsqr=0.825 adj rsqr=0.720, (5)logpc 240 min = 9.946+(1.368log p) (1.429apka)+(0.952gap)r=0.940 rsqr=0.883 adj rsqr=0.813, wherein logpc denotes logarithm of permeability coefficient, log p is partition coefficient at water 25 1c for 30 min, gap is the difference in humo and lumo energy levels, and apka is acid dissociation constant. algorithms (6) and (7) were developed using logp, tpsa, and apka as molecular descriptor at 30 min and 240 min. (6)log pc 30 min = 1.453+(1.726log p) (0.708apka)+(0.0104tpsa)r=0.934 rsqr=0.872 adj rsqr=0.796, (7)log pc 240 min = 2.726+(1.439log p) (0.672apka)+(0.00421tpsa)r=0.937 rsqr=0.877 adj rsqr=0.803, wherein logpc denotes logarithm of permeability coefficient, log p as partition coefficient at water 36 1c for 5 min, tpsa as topological polar surface area, apka is acid dissociation constant. figure 4 shows the pictorial representation of newly developed qspr model using fluoroquinolone as model group. in the four newly developed algorithms (algorithms (4), (5), (6), and (7)) log p and apka are common molecular descriptors, signifying the key descriptors affecting penetration of fluoroquinolones across the cornea. algorithms (4), (5), (6), and (7) showed a positive correlation with log p and inverse correlation with apka. tpsa and gap also showed a positive correlation with permeability coefficient in all newly developed algorithms. newly developed qspr model showed a positive spearman correlation of 0.831 and 0.887 between the newly developed algorithms (4) and (5) with already reported logpc (figure 5(a)). a positive spearman correlation of 0.881 and 0.803 between the logpc generated for -blockers using newly developed algorithms (6) and (7) and reported logpc (figure 5(b)). conventionally, antimicrobial drugs developed and approved for systemic infections are extended for ocular infections. an antimicrobial agent having good corneal penetration and efficacy is desired in preventing sight threatening infections. it is well known that less than 5% of the topically applied drug penetrates through the cornea. therefore, there is an urgent need to understand the constraints exerted by the eye for the development of an ocular specific antimicrobial agent. in present study, qspr approach has been used to comprehend the physicochemical factors affecting corneal permeability for topically applied drugs. an attempt was made in present study to evaluate the suitability of in silico models in predicting the in vivo corneal permeability of fluoroquinolones. to ascertain the obtained results, additionally, in vivo corneal permeability was determined in rabbits employing cassette dosing approach, a high throughput pharmacokinetic screening technique which has been exploited for various indication [1214 ]. so far this approach has been limited to in vitro and few in vivo models in ophthalmic drug research [1517 ]. however, for the first time, we employed cassette dosing technique to study the in vivo pharmacokinetic profile of topically applied fluoroquinolones and to derive a controlled in vivo permeability coefficient nine topically used fluoroquinolones were dissolved in two cassettes : group a with four and group b with five fluoroquinolones. being weakly basic in nature fluoroquinolones are expected to exist in ionized form at ph 4.5. therefore, ph of both formulations was maintained at 5.0 and osmolarity as 307 mosm / l using boric acid. boric acid (1.9%) has been reported to be an appropriate vehicle for the preparation of ophthalmic solutions having basic nature. in addition, it is reported to avoid any interaction between fluoroquinolones and di / monovalent cations. in the literature the first model was reported by yoshida and topliss based upon log p and log d as molecular descriptors. in this model, log p mainly correlates with the solute hydrogen bonding acidity or basicity and to lesser extend dipolarity or polarizability. the second model was reported by fu and liang was based upon charge and molecular volume as the molecular descriptors. unfortunately, both the earlier reported models were unsuitable to predict in vivo corneal permeability of fluoroquinolones. a poor correlation between the permeability coefficient derived using reported models [10, 11 ] with that derived from present in vivo study was observed. this may be due to the fact that reported models were developed based upon permeability coefficients (logpc) pooled from various in vitro studies. the in vitro conditions denote a static system rather than actual dynamic conditions which exists in eye. moreover, the involvement of various drug transporters and precorneal factors is not considered in such studies and are also believed to have major role. thus, reported models [10, 11 ] based upon in vitro corneal permeability are unable to correlate with in vivo corneal permeability for fluoroquinolones. therefore, a new in silico model based upon in vivo permeability coefficient data was felt desirable. also the in silico model should be able to correlate with parameters like ionizing property, transporter susceptibility, and lipophilicity, precorneal ph of compound. a novel qspr model was developed based upon in vivo corneal permeability along with molecular descriptors like log p, apka, gap, and tpsa. civiale and coworkers also reported that corneal permeation process can be confined at the ocular epithelium layer. studies have been reported that in corneal epithelium the drugs are expected to undergo transcellular pathway [21, 22 ]. whereas the penetrating molecules are expected in hydrophilic form as a result of ph or after hydrolysis due to enzymes (by prodrug attempt) to cross hydrophilic stroma. the dissociation constant (pka) of the compound determines the hlb (hydrophilic / lipophilic balance) in the cornea. based upon the presence of ionizable / functional groups molecules can posses more than one pka. an assumption was made in the newly developed qspr model that for fluoroquinolones apka has more implication on the availability of the species. other studies also report that corneal penetration can be enhanced by selecting the drug molecule with appropriate pka and offering optimal lipid solubility [23, 24 ]. in general, adjusting ph so that a drug is mostly in the unionized form increases its lipophilicity and thus, its transcellular permeability, and ocular absorption. another molecular descriptor gap, which is difference in energy between ehumo and elumo, has also reported to be an important stability index and related to transporters susceptibility. the ehumo measures the electron donating and elumo measures electron accepting property of the molecule. a humo and lumo energy separation has been used as a conventional measure of kinetic stability for various -electron systems. a large gap has been reported to relate with high stability for a molecule in the sense of its lower sensitivity in chemical reaction [26, 27 ]. tpsa is defined as the sum of surfaces of polar atoms in a molecule and known to correlate with transporter susceptibility. tpsa makes use of functional group based upon large database of structures that avoids the need to calculate ligand 3d structure or to decide which one is relevant biological conformation. therefore, in this analysis, tpsa has been taken into account to define the transcorneal penetration of congeneric compounds. fernandes and coworkers suggested that compounds with high tpsa are transported, while those with low tpsa are not. moreover, conjugation to compounds like gsh is reported to increase the tpsa values as a favoring transport mechanism. the algorithm developed either with tpsa or gap proved to predict the intraocular penetration appropriately as compared with other molecular descriptors tried with highest degree of correlation (r > 0.9) the applicability of the newly developed algorithms (4), (5), (6), and (7) on other sets of compounds apart from fluoroquinolones was also tested. the congeneric compound trial sets taken for this analysis belong to the category of -blockers where the ioniziability and ph - dependent changes in the lipophilicity are not much of concern. their structures predominately lacking primary amino groups or carboxylic acids (except atenolol having primary amine) therefore, ph - induced changes are not expected to play a major role. this study further evaluated the applicability of the developed algorithm on the noncongeneric compounds using similar training sets. the newly developed in silico model is based upon in vivo data and hence may predict corneal permeability for congeneric compounds other than fluoroquinolone more appropriately. the previously reported algorithms based on in vitro data failed to predict in vivo corneal permeability for fluoroquinolones. a novel qspr model consisting of four new algorithms were developed using gap, tpsa, logp, and apka as molecular descriptors to predict in vivo corneal permeability. the hypothesis generated showed high degree of applicability to predict transcorneal penetration as it was based upon the in vivo corneal permeability coefficients data. moreover, the developed model was also found to predict corneal permeability of the congeneric -blockers (r > 0.6) reported in the literature. further studies are in progress to evaluate its utility in large number of other congeneric compounds. | this study was undertaken to determine in vivo permeability coefficients for fluoroquinolones and to assess its correlation with the permeability derived using reported models in the literature. further, the aim was to develop novel qspr model to predict corneal permeability for fluoroquinolones and test its suitability on other training sets. the in vivo permeability coefficient was determined using cassette dosing (n - in - one) approach for nine fluoroquinolones (norfloxacin, ciprofloxacin, lomefloxacin, ofloxacin, levofloxacin, sparfloxacin, pefloxacin, gatifloxacin, and moxifloxacin) in rabbits. the correlation between corneal permeability derived using in vivo studies with that derived from reported models was determined. novel qspr - based model was developed using in vivo corneal permeability along with other molecular descriptors. the suitability of developed model was tested on -blockers (n = 15). the model showed better prediction of corneal permeability for fluoroquinolones (r2 > 0.9) as well as -blockers (r2 > 0.6). the newly developed qspr model based upon in vivo generated data was found suitable to predict corneal permeability for fluoroquinolones as well as other sets of compounds. |
vertical transmission of human immunodeficiency virus (hiv) is still a major challenge in the world, especially in developing countries. a report in 2012 reported about 35.3 million people are living with hiv of which 2.3 million are new infections whereas an estimated 3.3 million infected people are less than 15 years of age. worldwide, there are about 6,300 new infections and 700 hiv - related deaths daily in 2012. sub - saharan africa remains the region most heavily affected by hiv. without any intervention, the risk of a baby getting hiv infection from an infected mother ranges from 15% to 25% in the developed nations and from 25% to 35% in developing countries. hiv transmission rate and timing are estimated to be 5% to 10% during pregnancy, 10% to 15% during delivery and 5% to 20% through breast - feeding. in general mother to child transmission contributes 15 - 45% of hiv acquisition for children. the national accelerated emergency plan includes three targeted objectives, that is, reaching 90% of pregnant women with access to antenatal care services, ensuring that all pregnant women have access to delivery by a skilled attendant, and providing antiretroviral prophylaxis to at least 80% of hiv - positive pregnant women. it is estimated that 138, 906 children less than 15 years are living with hiv in 2014. there are an estimated 3,886 new infections each year due to mother - to - child transmission. however, timely interventions can reduce mother - to - child transmission to 25% [3, 6, 7 ]. a global target has also been established to be achieved by the year 2015, that is, elimination of new hiv infections among children and prolonging the lives of the mothers with hiv. according to ethiopian demographic and health survey (edhs) report, about three - quarters of reproductive aged women know that hiv can be transmitted to a baby through breastfeeding. the prevention of mother - to child - transmission (mtct) of hiv is dependent on the knowledge of the mothers of the timing of possible transmission periods. however, knowledge of women on transmission periods of hiv from mother to child varies from country to country and has not been measured in ethiopia at community level. different studies reported that sociodemographic factors like age, urban living, higher educational level, and being house wife as factors that affect mothers ' knowledge of mtct of hiv. studies conducted in southern and northwest ethiopia [10, 12, 13 ] reported that gravidity, parity, antenatal care (anc) visits, and male partner discussion are factors associated with good knowledge of mothers on mtct of hiv. maternal knowledge on mtct is a corner stone of effective implementation of the world health organization (who) recommendation of the four - pronged approach to reduce mother - to - child transmission of hiv. despite the large challenge of vertical transmission of hiv, there were also limited community - based studies on women knowledge on mother - to - child transmission of hiv. hence, this study attempts to fill the gap through assessing the level of knowledge of mtct of hiv and its associated factors at meket district, northeast ethiopia. a community - based cross - sectional study design was conducted in meket district, northeast ethiopia, from march 8 to 21, 2014. meket district is located 665 km north of addis ababa, the ethiopian capital city. the district has an estimated population size of 254,520 of which 59,939 are reproductive aged women, and an estimated 8,246 were pregnant women. sample size was determined using single population proportion formula with the assumptions of 95% level of confidence, 12% proportion of knowledgeable women on mtct of hiv, 4% of margin of error, and design effect of two. finally, considering a non - response rate of 10%, multistage stratified sampling technique was used to select the study participants. in the district, hence, in the first step, eight rural kebeles were randomly selected ; however, since they are few, all the urban kebeles were included. on the second stage, 79 pregnant women from urban kebeles and 477 pregnant women from rural kebeles were randomly selected. in the present study, pregnant woman was regarded as being knowledgeable on mtct if she correctly identified the three different modes / periods of mtct of hiv ; otherwise she was classified as nonknowledgeable. comprehensive knowledge of hiv was also measured if a pregnant woman correctly identified three modes of transmission of hiv (unsafe sexual practice, blood transfusion, and mtct) and recognized two common misconceptions. comprehensive knowledge about hiv / aids was measured after posing the following questions : (1) knowing that condom use and limiting sex partners to one uninfected partner are hiv prevention methods, (2) being aware that a healthy - looking person can have hiv, and (3) rejecting the two most common local misconceptions, that is, hiv / aids can be transmitted through mosquito bites and by supernatural means in ethiopia. five female nurses supervised by two bsc health professionals collected the data. for eligible women who were not at home during our first attempt, the interviewers revisited the participant 's home at least two times before excluding the participant. training was given to the data collectors about informed consent, techniques of interviewing, data collection procedures, and different sections of the questionnaire. supervisors and principal investigators checked the questionnaire on its completeness and consistency on the daily basis. the data were entered into epi info version 3.5.3 statistical software and then sorted, cleaned, and analyzed by using spss version 20 statistical package. descriptive statistics were done to describe the study participants in relation to relevant variables. both bivariate and multiple logistic regression analyses were carried out to see the effect of sociodemographic factors, maternal condition factors, and other factors on the knowledge of mtct of hiv and to control cofounding. odds ratios with 95% ci were computed to identify factors associated with mothers ' mtct knowledge. ethical clearance was obtained from the research and ethical review committee (rec) at the institute of public health, college of medicine and health science of university of gondar. the purpose and benefit of the study and their right to withdraw at any time were also delivered to each participant prior to the interview. confidentiality of the information was maintained throughout by using anonymity identifiers, keeping their privacy by interviewing them individually. five hundred forty - two pregnant women participated in the study (97.5% response rate). the majority (85.4%) were rural dwellers. the mean age of the study participants was 29.45 years (sd = 5.4). four hundred and sixty (84.9%) were married, 196 (36.2%) were able to read and write, and nearly four - fifths (80.1%) were homemaker (table 1). more than half (57.6%) had anc during their current pregnancy. nearly two - thirds (63.8%) had received information about hiv / aids from health care providers. half (51.8%) of the respondents received information about hiv, antenatal care (65.7%), mother - to - child transmission of hiv (40.6%), and infant feeding with their partners (21.4%) (table 2). one hundred three (19%) (95% ci : 15.5%, 22.4%) were knowledgeable on mtct of hiv. most (84.5%) heard about mother to child transmission of hiv. among those who heard mtct, more than two - thirds (70.7%) mentioned labor / delivery as a time of hiv transition from mother to child. 225 (41.5%) pregnant women identified at least two periods of mother - to - child transmission of hiv. nearly two - thirds (63.8%) had comprehensive knowledge on hiv / aids, and another equivalent proportion of women heard about pitc (table 2). in multivariable analysis, higher levels of maternal education status, having received information about hiv from health professionals, and reported discussion of mtct and anc with their partners were positively associated with knowledge of mother - to - child transmission of hiv. those women who live in the urban settings were about three more like to be knowledgeable than their rural counterparts (aor : 2.69, ci (1.48, 4.87)). those literate mothers were about three times more likely to be knowledgeable than who did not read and write (aor : 3.25, ci (1.55, 6.78)). likewise, a woman was 2.41 times more likely to be knowledgeable if she had completed primary school as compared to those who did not read and write (aor : 2.41, ci (1.04, 5.60)). pregnant women who received information on hiv from health care providers were about three times more likely to be knowledgeable than women who had not received information (aor : 3.24, ci (1.54, 6.83)). women who had discussions with their partner were more likely to be knowledgeable than those who had not (aor : 5.80, ci (2.63, 12.78)). correspondingly, mothers who discussed mtct with their partners were more likely to be knowledgeable than those who had not (aor : 2.64, ci (1.59, 4.39)) (table 3). being knowledgeable on mtct of hiv and the fact that the risk of transmission can be reduced by using antiretroviral drugs are critical in reducing mtct of hiv. this can contribute greatly towards the achievement of the millennium development goals related to hiv. this study revealed that 19% (95% ci : 15.5%, 22.4%) of respondents were knowledgeable on mtct of hiv. this result is in line with a cross - sectional study conducted at temeke district hospital, dar es salaam (15.7%). however, it is higher than that of studies done in southern ethiopia (11.5%) and gondar town (8.5%) [10, 13 ] but lower than a health institution based study in debre markos town, ethiopia (42.3%). this could be due to the difference in the study setting and accessibility of health facilities. in the present study, nearly two - thirds of pregnant women had comprehensive knowledge on hiv / aids which is higher than studies in yaound (23%), the ethiopian demographic and health survey (19%), and a study in gondar town (59.8%). knowledge of pregnant women on mtct of hiv among pregnant women was significantly varied based on their place of residence. those pregnant women residing in urban areas were more likely to be knowledgeable when compared to the rural residents. this finding is in line with studies conducted at gondar and hawassa towns in ethiopia [10, 13 ]. it might be due to the rural location and geographical inaccessibility and poor availability of nearby health services, compared with urban areas. this could also be partly explained due to the presence of media exposure amongst urbanites. educated pregnant women who were able to read and write were more likely to be knowledgeable than those who were unable to read and write. pregnant women with primary education were also more likely to be knowledgeable than those who were unable to read and write. this could be because when the women become educated their access to information is also increased. with this regard, they might have access to print media exposure. in this study, pregnant women who discussed and received information about hiv / aids from health care providers were more knowledgeable. they were found to be three times more likely to be knowledgeable than those who had not. spouse discussion on antenatal care follow - up was also positively associated with knowledge of mtct. those pregnant women who had discussions with their partners were six times more likely to be knowledgeable than those who had not discussed the issue. this might be explained due to male partners possessing better knowledge on hiv transmission and eventually transfer this information to these pregnant women if discussion is triggered. spouses having delivered information and participated in discussions about mtct of hiv with their wives (40.6%) were associated with good knowledge of the subject. accordingly, pregnant women who had discussion with their partners were more than two times more likely to have good knowledge of mtct this study tried to assess pregnant women who did not attend health care facilities for anc and hiv concerning their knowledge about mtct of hiv. however, because of financial and time constraints, this study did not include the knowledge part of prevention of mother - to - child transmission of hiv. despite many efforts, the knowledge of pregnant women on mother - to - child transmission of hiv is low. if pregnant woman resides in urban environment, she attends school, if she receives information on hiv from health care providers, and if she attends antenatal care, she is more likely to be knowledgeable on mtct of hiv. strengthening women education and by reaching previously inaccessible parts of the community, integration of hiv, prevention of mtct, and anc service, | knowledge of pregnant women on the three periods of mother - to - child transmission (mtct) of hiv has implication for child hiv acquisition. this study aims to assess the knowledge of pregnant women on mother - to - child transmission of hiv and to identify associated factors in meket district, northeast ethiopia. logistic regression models were fitted to identify associated factors. adjusted odds ratios (aor) with 95% confidence intervals (ci) were used to determine the presence and strength of association. about one - fifth (19%) of women were knowledgeable on mother - to - child transmission of hiv (95% ci : 15.5%, 22.4%). being urban resident (aor : 2.69, 95% ci : 1.48, 4.87), having primary education (aor : 2.41, 95% ci : 1.03, 5.60), reporting receiving information on hiv from health care providers (aor : 3.24, 95% ci : 1.53, 6.83), having discussion with partner about mother - to - child transmission of hiv (aor : 2.64, 95% ci : 1.59, 4.39), and attending antenatal care (aor : 5.80, 95% ci : 2.63, 12.77) were positively associated with increased maternal knowledge of mother - to - child transmission of hiv. knowledge of mother - to - child transmission of hiv among pregnant women was low. providing information, especially for rural women and their partners, is highly recommended. |
rotaviral diarrhea (rd) is the most common cause of gastroenteritis in children (1, 2). almost all children younger than 5 years old will have suffered from rd, with > 500,000 deaths, > 2 million hospitalizations, and > 25 million clinic visits each year (3, 4). the rotavirus can infect the intestinal epithelium villi cells and lead to watery diarrhea (5) ; furthermore, rd can cause intestinal dysbacteriosis, and destroy the microbial barrier, making the diarrhea more serious(6, 7). previous reports have shown that some diseases, especially intestinal diseases, are associated with the intestinal microbiota, and healthy fecal microbiota are increasingly becoming essential to the maintenance of human health (8, 9). the biodiversity of the fecal microbiota in patients with several diseases, including cow s milk protein allergy, celiac disease, inflammatory bowel disease, and ulcerative colitis, have been revealed (10 - 13). in addition, ma. discovered that there was an imbalance in the fecal microbiota in patients aged 2 to 4 years old with viral diarrhea (adenovirus, norovirus, rotavirus, and astrovirus) (14). although infants are the most susceptible group, the researchers have overlooked studies on the changes of the biodiversity of the fecal microbiota in infants with rd. thirty subjects were included in this study, fifteen of which were untreated rd infants (mean age, 90 days old ; range, 90 - 300 days old) from the children s hospital of harbin city. the rd infants were diagnosed by the children s hospital of harbin city, and the rotavirus (rv) antigens from the fecal samples were detected via specific enzyme immunoassay methods using the ridascreen kit (r - biopharm, germany), and confirmed by specific pcr reactions (15). fifteen of the subjects were healthy (h) infants (mean age, 200 days old ; range, 90 - 300 days old) chosen from volunteers in harbin city. all of the infant subjects were born in natural childbirth, on a breastfeeding diet, and their parents were healthy, without history of illness. in addition, none of the individuals ingested probiotics (including yogurt) or antibiotics within 4 weeks before the sampling. thirty fecal samples were collected from the rd infants and h infants during november of 2011 in harbin. all of the fecal samples were transferred into sterile cryotubes and stored at -80c until further analysis. approximately 200 mg (wet weight) of the thawed fecal samples were weighed in order to extract the total dna (13), using the qiaamp dna stool mini kit (qiagen, hilden, germany) in accordance with the manufacturer s instructions. the dna was amplified with the v3 universal primers ba - gc-338f and un518r for the bacteria, primers lac1 and lac2-gc for the lactobacillus, and primers bif164-gc - f and bif662-r for the bifidobacterium. all of the pcr amplification protocols, as described in previous reports, are shown in table 1 (16 - 18). the reaction of total bacteria was performed using the following conditions : 92c for 2 minutes and 30 cycles of 92c for 1 minute, 55c for 30 seconds and 72c for 1 minute, and a final extension at 6c for 72 minutes. the reaction was performed using the following conditions : 94c for 2 minutes and 35 cycles of 94c for 30 seconds, the reaction was performed using the following conditions : 95c for 5 minutes and 35 cycles of 95c for 1 minute, 62c for 20 seconds and 68c for 40seconds final extension at 6c for 7 minutes. all gc primers contained a 40 bp gc - clamp sequence at their 5 end to prevent the complete denaturation of the amplicons. the denaturing gradient gel electrophoresis (dgge) scheme was performed by using a dcode apparatus (bio - rad, richmond, ca, usa) at 60c and employing 8% polyacrylamide gel with a denaturing range of 30% 55% for the total bacteria, 30% 50% for the lactobacillus, and 45% gel electrophoresis of the total bacteria, lactobacillus, and bifidobacterium was run at 20v for 10 minutes, and again at 70v for 18 hours, 70v for 16 hour, and 85v for 16 hour, respectively (16 - 18). the gels were visualized under uv light after staining them with gene finder (0.5 g ml) and taking photographs. the bands in the gels were excised and soaked in 50 l of te buffer at 4c overnight to obtain a solution containing the dna. a pcr program was executed with the same primers without the gc - clamp, and sequenced at the beijing genomics institute (bgi, beijing, china). the sequences were identified by the blastn algorithm in the genbank database (http://www.ncbi.nlm.nih.gov/blast/). the similarities between the two groups were analyzed using the dice coefficient and the un weighted - pair group method, with the arithmetic average (upgma) clustering algorithm using quantity one software (bio - rad) (19). the biodiversity of the bacteria was calculated by the number of bands and by the shannon weaver index of biodiversity (h), according to previous reports (12, 21). all of the data analyses were performed using the spss 17.0 software (spss, inc., chicago, il, usa), and statistical significance was established at p < 0.05. thirty fecal samples were collected from the rd infants and h infants during november of 2011 in harbin. all of the fecal samples were transferred into sterile cryotubes and stored at -80c until further analysis. approximately 200 mg (wet weight) of the thawed fecal samples were weighed in order to extract the total dna (13), using the qiaamp dna stool mini kit (qiagen, hilden, germany) in accordance with the manufacturer s instructions. the dna was amplified with the v3 universal primers ba - gc-338f and un518r for the bacteria, primers lac1 and lac2-gc for the lactobacillus, and primers bif164-gc - f and bif662-r for the bifidobacterium. all of the pcr amplification protocols, as described in previous reports, are shown in table 1 (16 - 18). the reaction of total bacteria was performed using the following conditions : 92c for 2 minutes and 30 cycles of 92c for 1 minute, 55c for 30 seconds and 72c for 1 minute, and a final extension at 6c for 72 minutes. the reaction was performed using the following conditions : 94c for 2 minutes and 35 cycles of 94c for 30 seconds, the reaction was performed using the following conditions : 95c for 5 minutes and 35 cycles of 95c for 1 minute, 62c for 20 seconds and 68c for 40seconds final extension at 6c for 7 minutes. all gc primers contained a 40 bp gc - clamp sequence at their 5 end to prevent the complete denaturation of the amplicons. the denaturing gradient gel electrophoresis (dgge) scheme was performed by using a dcode apparatus (bio - rad, richmond, ca, usa) at 60c and employing 8% polyacrylamide gel with a denaturing range of 30% 55% for the total bacteria, 30% 50% for the lactobacillus, and 45% 55% for the bifidobacterium. gel electrophoresis of the total bacteria, lactobacillus, and bifidobacterium was run at 20v for 10 minutes, and again at 70v for 18 hours, 70v for 16 hour, and 85v for 16 hour, respectively (16 - 18). the gels were visualized under uv light after staining them with gene finder (0.5 g ml) and taking photographs. the bands in the gels were excised and soaked in 50 l of te buffer at 4c overnight to obtain a solution containing the dna. a pcr program was executed with the same primers without the gc - clamp, and sequenced at the beijing genomics institute (bgi, beijing, china). the sequences were identified by the blastn algorithm in the genbank database (http://www.ncbi.nlm.nih.gov/blast/). the similarities between the two groups were analyzed using the dice coefficient and the un weighted - pair group method, with the arithmetic average (upgma) clustering algorithm using quantity one software (bio - rad) (19). the biodiversity of the bacteria was calculated by the number of bands and by the shannon weaver index of biodiversity (h), according to previous reports (12, 21). all of the data analyses were performed using the spss 17.0 software (spss, inc., chicago, il, usa), and statistical significance was established at p < 0.05. the dgge images of the 30 fecal samples (fifteen rd infants and fifteen h infants) were obtained by applying pcr - dgge technology (figure 1). the 30 fecal samples were divided into two clusters using the upgma (quantity one software) ; all 15 fecal communities of the rd individuals were placed into cluster i, and separated from all 15 fecal communities of the h infants (cluster ii) (figure 2). lanes 1 15, rv infants ; lanes 15 30, h infants. lanes 1 15 : rv infants ; lanes 15 30 : h infants. the number of dgge bands, shannon - weaver, and dice similarity coefficients (both intragroup and intergroup) were calculated, and the details of the results are given in table 2. the results showed that the biodiversity of the fecal microbiota from the rd infants (mean sd = 6.6 1.92, shannon - weaver = 2.03 0.12) was significantly lower (p < 0.05) than that from the h individuals (mean sd = 8.8 0.94, shannon - weaver = 2.24 0.34). the index of similarity coefficient based on the dgge profiles ranged from 30.9% to 94.6% (average 68.54 13.33%) in the rd infants, from 46.7% to 78.9% (average 65.47 8.34%) in the h infants, and averaged 33.16 8.23% between the two groups. the upgma analysis (figure 2) also revealed that the intragroup similarities within the rd and h groups were significantly higher (p < 0.05) than those calculated between the two groups. gene sequencing technology was used to define the microbiota based on the sequence similarity to their closest neighbor in the ncbi. the results of the sequence alignment are displayed in appendix 1, and showed that escherichia coli, bacteroides vulgatus, enterococcus faecium, clostridium, e. fergusonii, c. sardiniense, and peptostreptococcus anaerobius were the dominant fecal microbiota of the rd infants. moreover, bacteroides, bifidobacterium, lactobacillus, proteobacteria bacterium, clostridium, uncultured bacterium, and e. coli were the dominant fecal microbiota of the h infants. the dgge profiles (figure 3) showed that the biodiversity of the lactobacillus group in the fecal microbiota of the rd infants (mean 2.1 bands) was significantly lower (p < 0.05) than that of the h group (mean 4.6 bands). the gene sequencing results of the bands in the dgge profiles (table 3) indicated that a significant reduction in the l. helveticus, l. acidophilus, and l. fermentum was found in the fecal microbiota of the rd infants. lanes 1 15, rd infants ; lanes 15 30 : h infants. significant differences between rd infants and h infants : p < 0.05. the dgge profiles (figure 4) showed that the fecal microbiota of the rd infants (average 2.1 bands) had a significantly lower level of biodiversity (p < 0.05) than the fecal microbiota of the h infants (average 5.3 bands). the bands were identified with gene sequencing, the details of which are shown in table 3. the results indicated that the b. infantis, b. longum, b. bifidum, and b. adolescentis in the fecal microbiota of the rd infants were significantly decreased (p < 0.05). lanes 1 15, rd infants ; lanes 15 30, h infants. the complex intestinal microbial flora harbored by individuals has long been proposed to contribute to intestinal health and disease, and the intestinal microbiota is increasingly considered to be a symbiotic partner in the maintenance of health (9). studies have shown that many diseases are associated with the intestinal microbiota, and healthy fecal microbiota have become increasingly necessary for the maintenance of human health (8, 21). as a common gastrointestinal disease via viral infection, rd has been considered to be closely related to prominent changes in the gastrointestinal microbiota (22). many factors can influence the biodiversity of the fecal microbiota, including genetics, age, gender, feeding, and region (8, 23, 24). therefore, in order to reduce the differences caused by these factors, the infants chosen for our study were within the same parameters of age range, sex ratio, area, delivery, and feeding. in addition, the infants in this study were between 90 and 300 days old, and during this period the intestinal microbiota are colonizing and forming, and more easily influenced by certain stimulations. the intestinal microbiota of infants is not less complicated when compared with the intestinal microbiota of adults, which provided better feasibility to analyze the differences in the biodiversity of the fecal microbiota between the rd infants and h infants using pcr - dgge. our results indicated that the fecal microbial communities of the rd infants were clustered together with higher similarity in the coefficients of the upgma ; these fecal microbial communities were significantly different from those present in the h infants. most bowel diseases can lead to a reduction in the biodiversity of the fecal microbiota (10, 12, 13). in our study, the biodiversity of the fecal microbiota of the rd infants was significantly decreased, and the composition had also changed. the bacteroides species are the main group in human colonic microbiota, and have a beneficial effect on the prevention of intestinal colonization (25). bacteroides was discovered in the dominant fecal microbiota of the h infants, while b. vulgatus appeared as the dominant fecal microbiota of the rd infants. therefore, we inferred that the composition of the bacteroides changed due to the rotavirus infection. lactobacillus and bifidobacterium play important roles in the intestinal microbiota, and have many benefits to human health (26, 27). lactobacillus can synthesize peptidoglycan, with functional anti - inflammatory activity (28), and bifidobacterium has a key effect on carbohydrate metabolism in the large bowel, suppressing enteritis in animal models (29). some researchers have used lactobacillus and bifidobacterium for the prevention and treatment of certain intestinal diseases (7, 30, 31). however, lactobacillus and bifidobacterium vary in genus, and a further selection of these species was necessary. therefore, the differences in these two groups of fecal microbiota between the rd infants and h infants were discussed. these results suggested that l. helveticus, l. acidophilus, l. fermentum. b. infantis, b. longum, b. bifidum, and b. adolescentis were considered to be more conducive to mediating the imbalance of the intestinal microbiota of the rd infants. enterococcus faecium, as a pathogenic bacteria, can cause serious nosocomial infections, and is found to be associated with intestinal diseases (13, 32). in addition, e. coli and clostridium have been proven to play important roles in diarrhea and inflammatory processes (33, 34). when compared with the h infants, e. faecium, e. coli, and clostridium in the fecal microbiota of the rd infants showed obvious advantages. pcr - dgge is one of the main ways to assess the biodiversity of the fecal microbiota, in which, the uncultured microorganisms can be identified by the traditional culture - based method (35). in our study, we first analyzed the biodiversity of the dominant fecal microbiota in infants, and found that the harmful microbes were increased in the fecal microbiota of the rd infants. contrarily, the beneficial microbes were reduced, especially the lactobacillus and bifidobacterium. in order to improve the understanding of the differences in the members of these two groups, the biodiversity of the lactobacillus and bifidobacterium were revealed via pcr - dgge using specific primers. however, some researchers have suggested that the dgge should not be used for quantitative biodiversity analysis (36). as a supplement, real - time pcr will be used to measure the contents of the microbiota accurately for further research, and linked with metabonomics to explore the connections between the intestinal flora and metabolomics. moreover, using the pcr - dgge techniques, we only analyzed the dominant microbiota, and the total biodiversity information of the fecal microbiota can not be measured. therefore, we speculate that there should be more differences in the biodiversity of the fecal microbiota between the rd infants and h infants, and our results have provided an important idea and reference for further studies. the next research focus of our team will be to compare the differences in the biodiversity of the fecal microbiota between the two groups using an illumina miseq platform to obtain comprehensive information. in conclusion, in this study, we showed a comprehensive view of the fecal microbiota in rd infants by using pcr - dgge and gene sequencing, which revealed the differences in the biodiversity of the dominant microbiota, lactobacillus and bifidobacterium in the fecal microbiota of rd infants and h infants. these results suggested that the intestinal microbiota of rd infants exhibited important changes, providing significant information about the relationship between rd and intestinal microbiota. i - i stands for the ith band of the i th lane in figure 1. | backgroundrotaviral diarrhea (rd) has been associated with the biodiversity of the fecal microbiota in infants ; however, the differences in the biodiversity of the fecal microbiota between infants with rd and healthy (h) infants have not been clearly elucidated.objectivesthis study aimed to reveal the changes in the biodiversity of the fecal microbiota of infants with rd.patients and methodsfor this study, 30 fecal samples from 15 rd infants and 15 h infants were collected. the biodiversity of the fecal microbiota from the two groups was compared via polymerase chain reaction - denaturing gradient gel electrophoresis (pcr - dgge) and gene sequencing.resultsthe shannon - weaver index showed that the biodiversity of the fecal microbiota from the rd infants was significantly lower (p < 0.05) than that from the h infants. all fifteen rd infants were grouped into one cluster and were separated from the h infants by the un weighted - pair group method, with the arithmetic average (upgma) clustering algorithm. in addition, when compared with the healthy infants, the communities of the dominant microbes, lactobacillus and bifidobacterium, in the fecal microbiota from the rd infants have obviously changed.conclusionswith regard to improving the understanding of the differences in the biodiversity of the fecal microbiota between rd infants and h infants, the findings of this study can provide a possible basis to reveal the relationship between rd and intestinal microbiota. |
according to who report, osteoporosis is one of the top 10 global diseases of 21 century attributed by an altered bone turnover rate due to impaired activity of osteoblast and over activity of osteoclast. antiresorptive and bone forming drugs are two foremost choices available for the treatment of osteoporosis. most of the antiresorptive therapies uncouple bone remodeling cycle causing an early increase in bone mass due to inhibition of resorption while osteoblasts continue to fill in the resorbed pits. hence, stimulating the function of osteoblast, so - called bone anabolic therapy is necessary to replace lost bone or rebuild new bone mass. in this mini - review osteoporosis therapy is likely to be long - term, the safety of any potential osteogenic agent requires serious consideration. target - based drug development, established on firm mechanistic understanding should yield molecules with better safety profiles. therefore, much stress is placed on various putative osteogenic candidate molecules and understanding of their modes of action and the context in which these molecules may become therapeutic targets. intermittent parathyroid hormone (ipth) is the only available bone anabolic therapy as it is capable of increasing bone mineral density (bmd), restoring trabecular microarchitecture and reducing fracture risk to a greater extent than the antiresorptive therapies. however, ipth has the following drawbacks : (1) fda recommended carrying a black - box warning because it is associated with an increased risk of osteogenic sarcoma in rats, (2) daily injection negatively impacts treatment adherence, and (3) it can be given only once in a lifetime for a maximum of 2 years. hence, there is a great need for new osteogenic drugs and better preparations of parathyroid hormone(pth) to offer an improved option and a competitive environment. recently, a small molecule mimic of pth, ah3960 has been developed by glaxosmithkline, which can stimulate campin vitro. the major challenge of transient activation of osteoblast pth receptor by the oral pth mimetic remains as sustained activation will lead to increased bone loss by stimulating the production of osteoblastic receptor activator of nuclear factor kappa - b ligand (rankl). amino - alcohol - based small molecule (ronacaleret) could suppress the receptor function resulting in augmented release of pth without giving rise to parathyroid gland hyperplasia. human studies have shown that ronacaleret exhibits a modest anabolic action in postmenopausal women, but the effect was less than ipth. it appears that human parathyroid glands do not have the sufficient pth store required for exerting the anabolic effect like ipth. the wnt pathway involves a large number of proteins that can regulate the production of wnt signaling molecules, their interactions with receptors on target cells and the physiological responses of target cells that result from the exposure of cells to the extracellular wnt ligands. the wnt binds to cell - surface receptors of frizzled family that interacts with a transmembrane protein called lrp 5/6 and activates dishevelled family proteins which in turn inhibits a second complex of proteins that includes axin, gsk-3 and protein adenomatous polyposis coli (apc) that otherwise promotes proteolytic degradation of -catenin, an intracellular signaling molecule and ultimately affects its interaction with tcf / lef family transcription factors to promote osteoblast specific gene expression. so, careful regulation of this pathway can leave us with handful solutions for osteoporosis as loss or gain of function mutations in lrp5 gene is associated with low and high bone mass phenotypes, respectively. several inhibitors are known to regulate this pathway at various stages such as sclerostin, dkk-1, sfrp-1 and wif-1. by neutralizing those inhibitors and increasing intracellular level of -catenin via inhibition of kinase gsk-3 monoclonal antibodies against sclerostin and dkk-1 showed marked anabolic effects in rodents. one clinical trial with human anti - dkk1 neutralizing antibody (bhq880) has been started by novartis for bone loss associated with multiple myeloma. diverse classes of compounds have proved their anabolic effect in vitro and in vivo by regulating wnt signaling as iminooxothiazolidines methyl ester inhibits sfrp-1, 2-aminopyrimidine, and naphthylpyrimidine act as wntsignalling agonists, sulfonamides with bis - phenyl sulfone core disrupts binding of wnt to sfrp-1. one more class bis - arylmaleimides acts by inhibiting gsk-3 and its preclinical observations for bone formation are promising, but it can be tumor - promoting since gsk3 suppresses hedgehog and notch pathways besides wnt pathway. as proteosomal degradation pathway leads to reduced nuclear translocation of -catenin via the canonical wnt pathway, suppressing proteosome activity is considered an effective therapeutic strategy towards osteoanabolism. we have discovered novel orally active small molecule that accelerates fracture healing in rats by stimulating bmp-2 production by osteoblast and the effect is mediated by inhibition of proteosome activity. recently, a small molecule mimic of pth, ah3960 has been developed by glaxosmithkline, which can stimulate campin vitro. the major challenge of transient activation of osteoblast pth receptor by the oral pth mimetic remains as sustained activation will lead to increased bone loss by stimulating the production of osteoblastic receptor activator of nuclear factor kappa - b ligand (rankl). amino - alcohol - based small molecule (ronacaleret) could suppress the receptor function resulting in augmented release of pth without giving rise to parathyroid gland hyperplasia. human studies have shown that ronacaleret exhibits a modest anabolic action in postmenopausal women, but the effect was less than ipth. it appears that human parathyroid glands do not have the sufficient pth store required for exerting the anabolic effect like ipth. the wnt pathway involves a large number of proteins that can regulate the production of wnt signaling molecules, their interactions with receptors on target cells and the physiological responses of target cells that result from the exposure of cells to the extracellular wnt ligands. the wnt binds to cell - surface receptors of frizzled family that interacts with a transmembrane protein called lrp 5/6 and activates dishevelled family proteins which in turn inhibits a second complex of proteins that includes axin, gsk-3 and protein adenomatous polyposis coli (apc) that otherwise promotes proteolytic degradation of -catenin, an intracellular signaling molecule and ultimately affects its interaction with tcf / lef family transcription factors to promote osteoblast specific gene expression. so, careful regulation of this pathway can leave us with handful solutions for osteoporosis as loss or gain of function mutations in lrp5 gene is associated with low and high bone mass phenotypes, respectively. several inhibitors are known to regulate this pathway at various stages such as sclerostin, dkk-1, sfrp-1 and wif-1. by neutralizing those inhibitors and increasing intracellular level of -catenin via inhibition of kinase gsk-3 one clinical trial with human anti - dkk1 neutralizing antibody (bhq880) has been started by novartis for bone loss associated with multiple myeloma. diverse classes of compounds have proved their anabolic effect in vitro and in vivo by regulating wnt signaling as iminooxothiazolidines methyl ester inhibits sfrp-1, 2-aminopyrimidine, and naphthylpyrimidine act as wntsignalling agonists, sulfonamides with bis - phenyl sulfone core disrupts binding of wnt to sfrp-1. one more class bis - arylmaleimides acts by inhibiting gsk-3 and its preclinical observations for bone formation are promising, but it can be tumor - promoting since gsk3 suppresses hedgehog and notch pathways besides wnt pathway. as proteosomal degradation pathway leads to reduced nuclear translocation of -catenin via the canonical wnt pathway, suppressing proteosome activity is considered an effective therapeutic strategy towards osteoanabolism. we have discovered novel orally active small molecule that accelerates fracture healing in rats by stimulating bmp-2 production by osteoblast and the effect is mediated by inhibition of proteosome activity. phytoestrogens are typically considered as antiresorptive. recently, our groups has isolated 6-c - b - d - glucopyranosyl-(2s,3s)-(+)-3,4,5,7-tetrahydroxyflavanol (gtdf), a novel flavonol - c - glucosidefrom stem bark of ulmuswallichiana. gtdf stimulated osteoblast proliferation, survival, and differentiation but has no effect on osteoclast formation, suggesting a pure osteogenic effect. gtdf promotes modeling - directed bone growth as it increases parameters of peak bone mass achievement, including increased longitudinal growth, bone mineral density, bone - formation rate (bfr), cortical deposition, and bone strength in growing rats. this flavonol also reduces fracture risk as it restores drill holes injury in femurs of both ovx and sham operated animals by filling new bone at a faster rate. it mediates this effect by stimulating camp production, which further enhances osteogenic gene expression. based on these preclinical data, gtdf has been licensed to kemxtree, nj, usa for developing it as an orally active rapid fracture healing compound. an ideal bone anabolic agent will be the one that is orally administered and selectively stimulates osteoblast function without affecting that of osteoclast and hence maintains normal bone remodeling. however, added to this challenge are added issues pertaining to safety such as potential for inducing osteogenic sarcoma and vascular calcification. in addition, the most desirable anabolic therapy will be the one that can effectively heal a fracture in osteopenic individuals. | osteoporosis is one of the top 10 global diseases of 21 st century. the altered bone turnover rate has been attributed to impaired activity of osteoblasts and over - activity of osteoclasts. anti - resorptive and bone forming therapies are the two choices available for the treatment of osteoporosis. in the mini - review, we will discuss the experimental therapeutics of emerging osteoanabolic strategies |
for analyses of allele frequency differentiation across populations and allele frequency distributions, we used subsets of snps from hapmap (public release # 21a) which were ascertained uniformly across the genome so that the data sets are appropriate for population genetic analysis8. all the snps in our study are therefore uniformly ascertained as divergent sites in exactly two chromosomes of the same ancestry (two each of either west african, north european or east asian ancestry) and genotyped in all hapmap samples, including 120 unrelated west african chromosomes from ibadan, nigeria (yri), 120 unrelated european american chromosomes from utah, usa (of north european ancestry ; ceu), and 180 unrelated east asian chromosomes (90 han chinese from beijing, china (chb) and 90 japanese from tokyo, japan (jpt), which we pooled for most analyses). since males carry a single copy of chromosome x, the counts for chromosome x are at most 90, 90, and 135 (our modeling adjusts appropriately for the sample size of every snp used in our analysis8). we removed all sites that were in hypermutable cpg dinucleotides, and determined the ancestral allele by requiring a match to both the chimpanzee and orangutan sequence8. first, we no longer required snp discovery in two chromosomes from the same individualfsf ; instead, we allow snps to be discovered by comparing two chromosomes, one from each of two individuals of the same ancestry, which we found generates an indistinguishable frequency distribution. second, for the autosomal snps discovered in west africans, we used data from an african american sample (na17109) who we determined had 4% european ancestry on average based on the ancestrymap software28. we restricted the snps used for analysis to sections of this individual 's genome where we were > 95% confident of african ancestry in both chromosomes based on an analysis with ancestrymap. in supp. note, we present analyses showing that this procedure generates results that are indistinguishable from what is obtained by using two chromosomes from a west african. as the african american sample (na17109) used for mining snps in hapmap was male, we could not use this individual to identify sites that were different between two west african copies of chromosome x. to fill this gap, we used four west african (yri) samples (na18517, na18507, na19240 and na19129) for which shotgun sequencing data was available in public databases to discover snps. we randomly dropped sequencing reads until we had no more than two unrelated chromosomes at each site, and then used ssahasnp29 to identify 4,884 snps on chromosome x for which we could confidently identify the ancestral allele based on comparison to both chimpanzee and orangutan, for which we were able to successfully design primers, and which passed all the other filters we applied to the snps mined from hapmap. we attempted to genotype a randomly chosen subset of 1,366 of these snps in all hapmap samples using the sequenom iplex method30. this resulted in 1,087 snps after removing snps with 95% confident of two african - origin chromosomes based on the ancestrymap software28) (supp. sequence reads, we aligned them to build 35 of the human reference sequence by ssahasnp29 with the settings qsnp>=40, qneighbor>=15, nneighbor=5, maxneighborhooddiffs=1, maxsnps / kb=15. a subset of non - overlapping sequence reads for each individual was selected at random, providing a single mosaic, haploid genome that was not biased according to the strand of dna from which a read derived. within - population sequence diversity was estimated by only analyzing bases where there were two or more individual haploid genomes, and then counting differences by selecting two haploid genomes at random. to similarly compute between - population diversity (supp. table 2), the individual haploid genomes of each population were combined so that at any base only one individual was represented. to estimate standard errors correcting for correlation between neighboring sites, we used a jackknife analysis, dividing the genome into blocks of 100,000 aligned bases, and removing each block in turn.8 to estimate allele frequency differentiation across populations, we used the fst statistic as formulated in ref. 8. briefly, when (i) a snp is discovered as polymorphic in population a, and (ii) population a has been of effectively constant size since the split from population b, the expected value of fst is e(fstauto)=(1e(a+b))/2, where a and b are scaled drift times. multiplying i by 4/3, the equivalent expression for chromosome x is e(fstx)=(1e4/3(a+b))/2, thus q = ln(12e(fstauto))/ln(12e(fstx))=3/4. to test this expectation, we simulated models of history for each pair of populations and found all values to be close to (supp. for analyses of allele frequency differentiation across populations and allele frequency distributions, we used subsets of snps from hapmap (public release # 21a) which were ascertained uniformly across the genome so that the data sets are appropriate for population genetic analysis8. all the snps in our study are therefore uniformly ascertained as divergent sites in exactly two chromosomes of the same ancestry (two each of either west african, north european or east asian ancestry) and genotyped in all hapmap samples, including 120 unrelated west african chromosomes from ibadan, nigeria (yri), 120 unrelated european american chromosomes from utah, usa (of north european ancestry ; ceu), and 180 unrelated east asian chromosomes (90 han chinese from beijing, china (chb) and 90 japanese from tokyo, japan (jpt), which we pooled for most analyses). since males carry a single copy of chromosome x, the counts for chromosome x are at most 90, 90, and 135 (our modeling adjusts appropriately for the sample size of every snp used in our analysis8). we removed all sites that were in hypermutable cpg dinucleotides, and determined the ancestral allele by requiring a match to both the chimpanzee and orangutan sequence8. first, we no longer required snp discovery in two chromosomes from the same individualfsf ; instead, we allow snps to be discovered by comparing two chromosomes, one from each of two individuals of the same ancestry, which we found generates an indistinguishable frequency distribution. second, for the autosomal snps discovered in west africans, we used data from an african american sample (na17109) who we determined had 4% european ancestry on average based on the ancestrymap software28. we restricted the snps used for analysis to sections of this individual 's genome where we were > 95% confident of african ancestry in both chromosomes based on an analysis with ancestrymap. in supp. note, we present analyses showing that this procedure generates results that are indistinguishable from what is obtained by using two chromosomes from a west african. as the african american sample (na17109) used for mining snps in hapmap was male, we could not use this individual to identify sites that were different between two west african copies of chromosome x. to fill this gap, we used four west african (yri) samples (na18517, na18507, na19240 and na19129) for which shotgun sequencing data was available in public databases to discover snps. we randomly dropped sequencing reads until we had no more than two unrelated chromosomes at each site, and then used ssahasnp29 to identify 4,884 snps on chromosome x for which we could confidently identify the ancestral allele based on comparison to both chimpanzee and orangutan, for which we were able to successfully design primers, and which passed all the other filters we applied to the snps mined from hapmap. we attempted to genotype a randomly chosen subset of 1,366 of these snps in all hapmap samples using the sequenom iplex method30. this resulted in 1,087 snps after removing snps with 95% confident of two african - origin chromosomes based on the ancestrymap software28) (supp. sequence reads, we aligned them to build 35 of the human reference sequence by ssahasnp29 with the settings qsnp>=40, qneighbor>=15, nneighbor=5, maxneighborhooddiffs=1, maxsnps / kb=15. a subset of non - overlapping sequence reads for each individual was selected at random, providing a single mosaic, haploid genome that was not biased according to the strand of dna from which a read derived. within - population sequence diversity was estimated by only analyzing bases where there were two or more individual haploid genomes, and then counting differences by selecting two haploid genomes at random. to similarly compute between - population diversity (supp. table 2), the individual haploid genomes of each population were combined so that at any base only one individual was represented. to estimate standard errors correcting for correlation between neighboring sites, we used a jackknife analysis, dividing the genome into blocks of 100,000 aligned bases, and removing each block in turn.8 to estimate allele frequency differentiation across populations, we used the fst statistic as formulated in ref. briefly, when (i) a snp is discovered as polymorphic in population a, and (ii) population a has been of effectively constant size since the split from population b, the expected value of fst is e(fstauto)=(1e(a+b))/2, where a and b are scaled drift times. multiplying i by 4/3, the equivalent expression for chromosome x is e(fstx)=(1e4/3(a+b))/2, thus q = ln(12e(fstauto))/ln(12e(fstx))=3/4. to test this expectation, we simulated models of history for each pair of populations and found all values to be close to (supp. | comparisons of chromosome x and the autosomes can illuminate differences in the histories of males and females as well as the forces of natural selection. we compared the patterns of variation in these parts of the genome using two data sets that we assembled for this study that are both genomic in scale. three independent analyses show that around the time of the dispersal of modern humans out of africa, chromosome x experienced much more genetic drift than is expected from the pattern on the autosomes. this is not predicted by known episodes of demographic history, and we found no similar patterns associated with the dispersals into east asia and europe. we conclude that a gender - biased process that reduced the female effective population size, or an episode of natural selection unusually affecting chromosome x, was associated with the founding of non - african populations. |
irritable bowel syndrome (ibs) is a functional disease with persisting gastrointestinal symptoms, mainly abdominal pain / discomfort and abnormal defecation, not accompanied by an organic disease.1 the cause of ibs is unknown, but a number of factors are thought to play a role, such as altered gastrointestinal motility, increased sensitivity of the gut, psychosocial factors, and neurotransmitter imbalances.2 according to the rome iii criteria,1 ibs is classified into four subtypes : diarrhea - predominant ibs (ibs - d), constipation - predominant ibs, mixed ibs, and unsubtyped ibs. therapies for the treatment of ibs should therefore be targeted at improving symptoms that diminish quality of life. a number of new agents with a wide range of modes of action are currently in clinical development.3,4 ramosetron, a potent and selective serotonin (5-hydroxytryptamine [5-ht])3-receptor antagonist58 has been used as a medication for gastrointestinal symptoms caused by antitumor agents, and it is also in development for use in patients suffering from ibs - d. in this article, we review the long - term efficacy and safety of ramosetron in the treatment of patients with ibs - d. 5-ht plays important physiological roles in the contraction and relaxation of smooth muscle, platelet aggregation, and neurotransmission. receptors mediating the actions of 5-ht are classified into seven major groups, termed 5-ht1 to 5-ht7, which include a total of 14 receptor subtypes.9 it is well known that colonic pain signals are transmitted to the spinal cord via primary nociceptive afferent neurons, and various neurotransmitters, eg, glutamate, substance p, neurotrophins, and 5-ht, are involved in the process. among them, 5-ht is considered one of the most important neurotransmitters of visceral nociception. intraluminal distension of the intestine, which causes abdominal pain, is known to stimulate the release of endogenous 5-ht from enterochromaffin cells, activating 5-ht3 receptors located on primary afferent neurons.10 the activation of 5-ht3 receptors stimulates the release of various neurotransmitters, such as acetylcholine, to induce the acceleration of colonic transit11 and abnormal water transport,12 which in turn leads to defecation abnormalities. furthermore, it has been reported that selective 5-ht3-receptor antagonists suppress abdominal pain induced by colonic distension, suggesting that 5-ht3 receptors are involved in visceral nociceptive transmission.13 it has been reported that 5-ht3 receptors are widely distributed within the neurons of the gastrointestinal tract, as well as in the spinal cord and brain,9 and activation of gastrointestinal 5-ht3 receptors results in intestinal secretion and peristaltic activity.14,15 the 5-ht3 receptor is unique among the various 5-ht - receptor subtypes. it is a ligand - gated cation channel that belongs to the nicotine/-aminobutyric acid - receptor superfamily, while all other 5-ht - receptor subtypes belong to the family of g - protein - coupled receptors.9 the neurotransmitter 5-ht has received much attention as one of the factors contributing to ibs pathogenesis. furthermore, 5-ht3-receptor antagonists have been reported to normalize defecation and to increase the perceptual threshold of the colon,16,17 suggesting the involvement of 5-ht3 receptors in the pathogenesis of ibs. in clinical settings, opioid - receptor agonists (eg, loperamide and trimebutine), muscarinic receptor antagonists (eg, tiquizium), and synthetic polymers (eg, polycarbophil calcium) are used widely for the treatment of ibs - d.18 in addition, several 5-ht3-receptor antagonists, including ramosetron,5 alosetron,19 and cilansetron,20 have been developed as therapeutic agents for ibs - d, and their effectiveness has now been established. these reports indicate that endogenous 5-ht and 5-ht3 receptors are involved in the pathogenesis of ibs. the inhibitory effect of 5-ht3-receptor antagonists on stress - induced abnormal defecation in rats is attributable to their ameliorating effects on stress - enhanced colonic transit, but the effects of 5-ht3-receptor antagonists on abnormal water / electrolyte transport induced by stress are poorly understood.11 ramosetron is a potent and selective 5-ht3-receptor antagonist, acting mainly in peripheral tissues.5,21 it has already been proven effective in treating ibs - d in both animal and clinical studies.16, 22, 23 ramosetron may achieve long - lasting occupancy of 5-ht3 receptors because it possesses a distinctive ability to maintain the active three - dimensional chemical conformation necessary for binding.24 in fact, it has been reported that ramosetron dissociates slowly from 5-ht3 receptors5,25 and shows long - lasting 5-ht3-receptor antagonism.8,26 in vehicle - treated rats, the colonic pain threshold was significantly decreased after 1 hour s restraint stress, whereas oral administration of ramosetron (0.3 to 3 g / kg) dose - dependently prevented this decrease in colonic pain threshold. alosetron and cilansetron (330 g / kg, orally) had similar effects, whereas loperamide (10 mg / kg, orally) had no effect on restraint stress - induced decrease in colonic pain threshold. oral administration of ramosetron (3 g / kg), alosetron (30 g / kg), or cilansetron (30 g / kg) to rats without restraint stress did not significantly affect the colonic pain threshold.12 several 5-ht3-receptor antagonists have been studied in ibs - d following observations that they slowed gastrointestinal transit. initial studies with granisetron and ondansetron found decreased postprandial sigmoid motility, delay in colonic transit, and increased stool consistency in ibs - d.27 in experimental animal models, ramosetron exhibits properties that are consistent with the expected effects of a drug in this class : inhibition of stress - induced or exogenous corticotropin - releasing hormone - induced water secretion, inhibition of stress - induced acceleration of colonic transit, and inhibition of colonic nociception.12,22 oral administration of ramosetron (3,000 g / kg, once daily for 7 days) did not affect normal defecation in dogs.12 oral administration of ramosetron (10 g / kg to 100 g / kg) dose - dependently and significantly inhibited conditioned fear stress (cfs)-induced defecation in mice.28,29 alosetron, cilansetron, and loperamide also inhibited cfs - induced defecation, but their potency was less than that of ramosetron.28,29 in normal rats without cfs, however, 5-ht3-receptor antagonists (1,000 g / kg, orally) had no effect on proximal colonic transit. ramosetron (0.3 g / kg100 g / kg, orally) showed potent inhibitory effects on abnormal defecation on restraint stress- and 5-ht (3 mg / kg, intraperitoneally)-induced diarrhea in rats and mice, and corticotropin - releasing factor (30 g / kg, intracerebroventricularly)-induced defecation in rats. furthermore, ramosetron (3 g / kg and 30 g / kg, orally) significantly prevented corticotropin - releasing factor - induced decrease in colonic fluid loss in rats.12 in a double - blind, placebo - controlled, parallel - group study of 418 patients with ibs - d, once - daily 5 g and 10 g doses of ramosetron increased the monthly responder rates of patient - reported global assessment of relief of ibs symptoms compared to placebo ; the benefit was similar in men and women.30 in a second double - blind, placebo - controlled, parallel - group study of 539 patients with ibs - d, a once - daily 5 g dose of ramosetron was effective and well tolerated in the treatment of abdominal pain, discomfort, and altered bowel habits.23 in a 12-week randomized controlled trial of 539 patients, a positive response to treatment was reported by 47% of ramosetron - treated individuals compared to 27% of patients receiving placebo (p cilansetron > ramosetron > ondansetron. while both alosetron and cilansetron have been associated with ischemic colitis, this has not been reported with either ramosetron or ondansetron. the original doses recommended may well have been excessive, and careful dose titration starting with very low doses may well avoid severe side effects in the future.41 the long - term effectiveness of ramosetron in ibs has been useful in attaining relief of abdominal pain or discomfort, and improvements in abnormal bowel habits. finally, ramosetron is associated with a low incidence of adverse events, such as abdominal distension, constipation, and hard stool, and ischemic colitis is unlikely to be caused by ramosetron. thus, ramosetron would be the candidate of first choice for treating ibs - d clinically. further studies to evaluate the long - term efficacy and safety of ramosetron are warranted in the form of randomized controlled trials. | irritable bowel syndrome (ibs) is a functional disease with persisting gastrointestinal symptoms that has been classified into four subtypes. serotonin (5-hydroxytryptamine [5-ht ]) plays important physiological roles in the contraction and relaxation of smooth muscle. intraluminal distension of the intestine is known to stimulate the release of endogenous 5-ht from enterochromaffin cells, activating 5-ht3 receptors located on primary afferent neurons and leading to increases in intestinal secretions and peristaltic activity. ramosetron, a potent and selective 5-ht3-receptor antagonist, has been in development for use in patients suffering from diarrhea - predominant ibs. in a double - blind, placebo - controlled, parallel - group study of 418 patients with diarrhea - predominant ibs - d, once - daily 5 g and 10 g doses of ramosetron increased the monthly responder rates of ibs symptoms compared to placebo. in a 12-week randomized controlled trial of 539 patients, a positive response to treatment was reported by 47% of a once - daily 5 g dose of ramosetron - treated individuals compared to 27% of patients receiving placebo (p<0.001). furthermore, the responder rate was increased in the oral administration of 5 g of ramosetron for at least 28 weeks (up to 52 weeks), and long - term efficacy for overall improvement of ibs symptoms was also demonstrated. the rate was further increased subsequently. adverse events were reported by 7% in ramosetron treatment. no serious adverse events, eg, severe constipation or ischemic colitis, were reported for long - term treatment with ramosetron. in conclusion, further studies to evaluate the long - term efficacy and safety of ramosetron are warranted in the form of randomized controlled trials. |
however, this is not a new disease and it was clinically described and treated for the first time by rhazes (865 - 925 ce). the disease was also mentioned in the canon of medicine by avicenna (9801037). we searched in scopus, web of science, and pubmed for allergic rhinitis, interactions, non - prescription, prescription, and in electronic copies of itm sources the canon and al - havi. both persian pioneers of medicine recommended non - pharmacologic management as an important phase of the therapy. their recommendations consisted of avoiding overeating and polydipsia, massage of the lower extremities, adjusting the duration and time of sleep, sleeping in the supine position, avoiding exposure of the head to cold air and taking a shower early in the morning. although some aspects of their recommendations, such as massage of the lower extremities, avoiding of overeating and adjusting of sleep pattern were approved, but further cross - sectional and prospective studies are needed to confirm other non - pharmacological treatments. | background : allergic rhinitis is the most common diseases affecting people in industrialized society. however, this is not a new disease and it was clinically described and treated for the first time by rhazes (865 - 925 ce). the disease was also mentioned in the canon of medicine by avicenna (9801037).methods : we searched in scopus, web of science, and pubmed for allergic rhinitis, interactions, non - prescription, prescription, and in electronic copies of itm sources the canon and al-havi.results:both persian pioneers of medicine recommended non - pharmacologic management as an important phase of the therapy. their recommendations consisted of avoiding overeating and polydipsia, massage of the lower extremities, adjusting the duration and time of sleep, sleeping in the supine position, avoiding exposure of the head to cold air and taking a shower early in the morning.conclusion:although some aspects of their recommendations, such as massage of the lower extremities, avoiding of overeating and adjusting of sleep pattern were approved, but further cross - sectional and prospective studies are needed to confirm other non - pharmacological treatments. |
pagetoid reticulosis (pr) is an uncommon disease clinically characterized by the presence of solitary, psoriasiform, slowly growing cutaneous plaques located on the extremities and, at histological level, by a characteristic dense inflammatory infiltrate with pagetoid spread within the dermis and the upper dermis composed of atypical lymphocytes. two clinical variants of pr may be distinguished : a localized form, also known as woringer - kolopp disease (wkd), which consists of a single lesion, usually located on the extremities, presenting a good prognosis when it can be totally removed by excision or high - dose radiation, and the generalized type or ketron - goodman disease (kgd) with disseminated lesions and a poor prognosis [1, 2 ]. in the who and eortc classification of cutaneous lymphomas in fact, wkd is classified as a relatively indolent variant of mycosis fungoides (mf), whereas kgd, which is not classified yet, is generally considered an aggressive lymphoma with bad prognosis similar to the aggressive cd8-positive cutaneous t - cell lymphoma, the cutaneous /-positive t - cell lymphoma and the tumor stage of mf. we present a case of an 84-year - old man with a 2-year history of erythematous patches located on the trunk and the upper and lower extremities in whom the diagnosis of kgd was made. in april 2008 an 84-year - old man presented with a 2-year history of asymptomatic erythematous patches located on the trunk and the upper and lower extremities. on physical examination several round to oval lesions presented regular, well - defined and unindurated borders with mild desquamation and mild infiltration, associated with itching (fig. 1). he denied any dermatologic diseases and his personal history was unremarkable except for hypertension and diabetes. 2) showed marked acanthosis of the epidermis with infiltration of atypical lymphoid cells in a pagetoid pattern. the phenotype of neoplastic cells was cd3 + (80%), cd5 + (25%), cd45 + (8590%), cd2 negative. chest x - ray, echosonography of the abdomen and bone marrow examination revealed no systemic involvement. the long clinical presentation, the typical histological examination and immunohistochemistry led to the diagnosis of kgd. the patient was treated with three cycles of inf therapy (0.5 mg / kg / day) for 2 months that led to a regression of the skin lesions with apparent complete remission until now. during 8 months of follow - up pr is a rare form of cutaneous t - cell lymphoma with a striking epidermotropism on histological examination [3, 4 ]. the term pr has been introduced by braun - falco. in 1973 to identify this clinical entity, first described by woringer and kolopp in 1939, for the resemblance of infiltrating cells characterizing this condition with paget 's cells present in the epidermotropic infiltrate of mammary paget 's disease. different authors proposed various etiopathogenetic hypotheses for this disease : at the beginning it was considered as a reactive lymphoproliferative process induced by different stimuli, including arthropod bite and with evolution towards neoplastic disease. other authors considered pr as a variant of cutaneous t - cell lymphomas [8, 9, 10 ]. the origin of the pagetoid cells has been uncertain for many years : melanocytes, histiocytes, merkel cells, true paget cells and langerhans cells were all proposed, but with the advent of phenotypical studies a t - cell lineage was finally confirmed. the classic skin lesions usually begin with asymptomatic scaly round or oval plaques that can be erythematous or yellowish with regular, well - defined and unindurated borders, associated with desquamation. the basic criterion of diagnosis is the presence of an inflammatory infiltrate composed of atypical lymphoid cells within the epidermis and the upper dermis with pagetoid distribution. the relationship between pr and mf is still unclear ; in fact different authors consider the first as a clinical variant of the second. haghighi. in 2005 suggested that pr might be classified as a cutaneous t - cell lymphoma with uncertain clinical behavior, considering it as a distinct clinicopathologic entity, separate from mf. in fact there are several clinical, histologic and immunophenotypic differences between these two entities. a more difficult distinction is that of pr by mycosis palmaris et plantaris, a rare variant of mf, characterized by acral plaques resembling those of wkd. therefore there are several features that make pr unique among the classification of cutaneous t - cell lymphomas : the acral distribution of lesions, the pronounced hyperkeratosis and acanthosis at histology, the prominent epidermotropism and the expression of e7 integrin on t - lymphocytes that binds cadherins on keratinocytes. some authors have proposed that epidermotropism of lymphoid cells is probably due to the expression of integrin e7 on the cell surface, which interacts with e - cadherin on epithelial cells. in fact expression of e7 on lymphocytes is often increased in those inflammatory conditions in which t - cells infiltrate epithelial tissues. the function of e7 is not yet fully understood, but it is likely to be important in the retention of t - cells in mucosal tissues and may also have a role in cell signaling and heterotypic communication between lymphocytes and epithelial cells. in pr three prevalent phenotypes of neoplastic cells were described : cd4 + (t - helper phenotype), cd8 + (t - cytotoxic / suppressor phenotypes) or cd4/cd8 double negative phenotype. neoplastic cells can express other cd45 isoforms (cd45ra) in the disseminated aggressive variant (kgd) but the complete cd45 family is lost from the cell surface in the benign localized variant (wkd). considering the fact that the presence of cd45 is crucial for activation of the lymphocyte - specific tyrosine kinase (p561ck), which drives lymphocyte growth and transformation, lack of this molecule may be the molecular basis for the non - aggressive nature of this clonal t - cell proliferation. in our case histological and phenotypical analysis suggested a diagnosis of kgd and, in particular, the presence of rare cd30 + cells and a component of langerhans cell type within the epidermis with a cd1a+ phenotype (30%) has also been reported.. only a few cases of kgd are described in the literature ; therefore we report this case for the rarity and for the unexpected complete regression of the skin lesions after ifn therapy. although kgd is characterized by an high rate of recurrence, during 8 months of follow - up our patient is in good condition without evidence of recurrent lesions. at this time we can not exclude the possibility of recurrences and long - term observation is necessary. | pagetoid reticulosis (pr) is a rare form of cutaneous t - cell lymphoma [mod pathol 2000;13:502510 ]. two variants of the disease are described : the localized type woringer - kolopp disease (wkd) and the disseminated type ketron - goodman disease (kgd). kgd may have disseminated lesions, high rate of recurrence and a guarded prognosis [mod pathol 2000;13:502510 ]. in patients with kgd, therefore, long - term observation is necessary. disappearance of cutaneous lesions does not mean resolution of the disease [j am acad dermatol 2002;47:183186 ]. herein we report the case of an 84-year - old man with erythematous patches of the trunk and the upper and lower extremities in whom the diagnosis of kgd was made. we describe this case for the rarity of this pathology and for the good response to therapy (ifn). |
an appendiceal origin of the lower gastrointestinal bleeding (lgib) is extremely rare.1 to obtain its proper diagnosis, though a various diagnostic modalities have been approached, like angiography,2 radionuclide scintigraphy,3 multi - detector computed tomography (mdct),4 or colonoscopy, it is still difficult to make an accurate diagnosis with further interventions. in particular, unlike some promising reports regarding the use of colonoscopy, prospective studies are needed to determine the efficacy of this approach on outcomes because it is not always effective if it has severe bleeding or a non - active bleeding status.3 the object of this study was to report a case of a massive rectal bleeding from the appendix and to discuss causes, useful diagnostic modalities, and treatment through a computer - assisted search of the english - language literature and cross - checks from other review articles. we describe a 33-year - old man who presented a painless massive amount of bright reddish and burgundy rectal bleeding for 3 consecutive days. he denied previous digestive tract related medical history as well as taking any of current medicine history, like nonsteroid anti - inflammatory drug. on admission resting tachycardia was observed, but his blood pressure was in a normal range. in the second day of admission, he was referred to the endoscopic center where we gauzed the systolic blood pressure just less than 100 mm hg and he complained dizziness. there were no other specific abnormalities, such as abnormal bowel sound, tender abdomen, or hepatosplenomegaly. the initial hemoglobin level was 12.3 g / dl which subsequently dropped to 9.9 g / dl the next day. the patient was first resuscitated with intravenous saline solution and followed by digestive endoscopies accordingly. an emergency esophagogastroduodenoscopy did not claim any specific lesion, but the colonoscopy disclosed fresh blood at the appendiceal orifice (fig. 1). interestingly, after we performed a large amount of water irrigation and removed blood contained liquids, we could not see any fresh blood, implying that the bleeding source did not seem to be around the cecum. further, following ileoscopy illustrated that the terminal ileum was not evident for any current bleeding episode from the upper level of the tract. however, getting back to the cecum, as the scope entered the appendiceal orifice and after irrigating a small amount of water, it allowed us to corroborate appendiceal intraluminal bleeding in real - time image (fig. an emergency appendectomy eliminated the bleeding source successfully. on surgery, the appendix, about 8 cm long, had grossly normal appearance except much blood filled in. an eroded focal mucosal lesion was observed at the distal portion of inner part of the vermiform appendix. although relatively rare, benign appendiceal lesions, such as ulcer or erosion, should be considered a possible cause in patient who present with lgib. colonoscopy could reveal the location as well as the characteristics of the affected lesions, whether it provides clinicians with any suspicious source that bleeding takes place. appendiceal ulcer or erosion is made up a very small portion of cause of the lgib.5,6 acute bleeding from the vermiform appendix is thought to be one of the least common causes of lgib. the causes have been reported diversely as diverticulitis,7 diverticulum,8 acute appendicitis,9,10 endometriosis,11 angiodysplasia,2,12 crohn 's disease,13,14 aortoappendiceal fistula,15 intussusceptions,16 - 19 henoch - schonlein purpura,20,21 gastrointestinal stromal tumor,22 ulcer,5 and erosion.6 our search has found 20 cases that had all presented with lgib in english - language literature. only one ulcer and one erosion were reported, whereas intussusception was relatively frequently reported. most reported cases manifest acute or chronic recurrent rectal bleeding than mimic acute appendicitis. in other words, appendiceal bleeding should be suspicious when acute of chronic recurrent lgib.2,10 like other origins of lgib, appendiceal origin bleedings also need various diagnostic modalities. because colonoscopy has replaced barium enema, in most cases since 1990s, colonoscopy has played major role in a diagnosis.17,18 currently, a prospective randomized study compared urgent colonoscopy group to standard care group in patients with hematochezia and concluded the group of standard care that put radionuclide scintigraphy first position has similar outcome from the group of urgent colonoscopy.3 however, none of 20 cases has gotten the diagnosis through scintigraphy. though radionuclide scanning has its advantage of noninvasive nature, no bowel preparation needed and easily repeated, as its variable accuracy may delay other therapeutic procedures, we also did not choose it prioritized as the patient was suspicious in hemodynamic instability.1 mesenteric artery angiography could make an appropriate documentation of the site to those who bleed faster than 0.5 ml / min.1 a study tried to embolize the vessels of appendiceal bleeding ; but it reoccurred and failed to stop bleeding.2 some of unsuccessful angiographic treatment led to fatal myocardial infarction and intestinal infarction during intra - arterial infusion of vasopressin or transcatheter embolization in some patients of lgib. in addition to this, there was a report regarding the potential danger that ileocecal arterial embolization tends to have more chances of intestinal ischemia, infarction, and stenosis than other branches of mesenteric artery embolization.23,24 indeed, only 2 cases has successfully gotten definitive diagnosis through mesenteric angiography.2,8 early diagnostic colonoscopy has an accepted role in the management of persistent or recurrent lgib. despite of its promising benefit, it is often hard to find out the exact bleeding site if colonoscopy is done in a situation of a large amount of acute bleeding. besides, it is also hard to find the site if it bleeds intermittently, slowly, or even if it stops temporarily. in our case, as it bled intermittently, we had almost failed to document the origin of bleeding until the scope entered the orifice of the vermiform appendix. since, nevertheless, endoscopic intervention can result in decreased resource utilization in terms of length of hospital stay, blood transfusion requirements, and cost, the case has also benefited to be sent to an operation with only 300 ml of blood transfusion right after the colonoscopy.25 mdct has a good accuracy for localization of acute gi bleeding. in particular, arterial phase multi - detector row ct is likely accurate for the depiction and localization of sites of bleeding in patients with acute massive gastrointestinal bleeding.4,6 thus, mdct is theoretically available to those bleeding patients who are suspicious of vascular origin, but they should not be severe in hemodynamic compromised status because it requires relatively long period of time. we did conduct merely non enhanced ct right after this colonoscopy as his vital sign was getting deteriorated and there was only one concern whether it was any tumor like condition morphologically as surgeons would like to decide on the range of surgery. the size and nature of appendix looked normal ; yet the histologic examination revealed hemorrhagic findings with several erosive lesions and surrounding inflammatory infiltrates mostly at mucosal layer without transmural inflammations. a review has revealed that the pathological finding of superficial mucosal ulcerative lesion is frequently observed among the patients who underwent appendectomy after acute appendicitis, suggesting that pathomorphologically, this kind of erosion and ulcer could be found in early stage of acute appendicitis without appendiceal hypertrophy.26 currently, a laparoscopic appendectomy tends to the treatment of choice of appendiceal bleeding as it has an advantage of minimal invasive surgery. a hemodynamic deteriorated status, an urgent colonoscopy described characteristics of the source of bleeding and also identified the location during the acute occurrence, letting effective handling in the course of simple appendectomy to be carried out. hence, it is conceivably postulated for unresolved lgib that clinicians may take time to let colonoscopy enter the vermiform appendix for diagnosing appendix origin pathologies. though the chance of appendiceal origin massive bleeding is rare, as it is vital to diagnose it at an early stage for the most favorable treatment of this disease, colonoscopy would be one of the essential tools for its accuracy, convenience, and therapeutic potentiality. | massive rectal bleeding from the appendix, considered a rare case of lower gastrointestinal bleeding, is not easily recognized by various diagnostic modalities. a multidisciplinary approach for both a diagnosis and a differential diagnosis is important because the identification of the bleeding site is crucial to proceed to a proper intervention and there are various causes of appendiceal bleeding. because early colonoscopy plays an important role in the diagnosis and management of lower gastrointestinal hemorrhage, we report a case of a life threatening massive rectal bleeding from the appendix diagnosed by colonoscopy. we also present a review of the literature. |
various decisions are made on using technology at all levels of the health system in every country which usually include coordinating complicated medical issues with matters related to patients, organizational, economic and moral factors. also, providing appropriate inputs for health policy- makers which depend on interactions, work division and cooperation among the health experts, decision makers and practitioners is of prime importance. these decisions should be based on documented principles in which all the conditions and results of the decisions are systematically explained by scientific methods (1, 2). although the concept of health technology assessment (hta) is increasingly expanding in the industrialized world, particularly in europe, and it has also been institutionalized in northern america, it has not yet been fully institutionalized in developing and asian countries due to such factors as lack of awareness, lack of epidemiologic data and lack of a relationship between research efforts (3). this study aimed to help the iranian health policy- makers to design and implement the hta program by investigating its current challenges in the country. this study was carried out in two phases : the study phase and the polling phase. in the first phase, the sources were investigated from the database of medline (via pubmed) from 2000 to november 2011 ; the scientific information database (sid) was also searched by the key term of health technology assessment up to 2011 in order to obtain the persian papers ; two persian papers were obtained. manual search was also done through contacting the informants as well as using the google search engine ; 3 papers were retrieved ; overall, 24 papers were collected. after studying the abstracts and eliminating irrelevant or repeated cases, 7 papers were finally selected. the second phase included the polling of informants, managers and experts of health technology assessment in iran. it should be noted that a minority of the participants were some members of the scientific committee of the health technology assessment (12 individuals) who participated in this phase through a structured questionnaire designed by the authors for the purpose of data collection. all challenges extracted from the phase 1 were classified in a table, and the participants were asked to state their views based on the likert scale. in addition, they were asked to state the reason for their views and solutions for the challenges as well as other challenges not mentioned in the questionnaire (in the form of open question based on the likert scale). data were analyzed by spss 16 software, and the scores given to views of the experts on the current challenges were prioritized ; and then their reasons and solutions were summarized. twenty- two hta challenges which were regarded as the most basic problems encountered by the health system s officials were specified from the 7 selected papers and were then used for designing the questionnaire and collecting data in the second phase. the findings of the second phase, which were collected through a semi - structured questionnaire and included the views of the experts on both hta and its specified challenges, suggest that the participants had relatively the same views on the mentioned challenges. informants with strongly agreeing views on the mentioned challenges regarding health technology assessment views of the experts about the challenges recognized by the hta office as demonstrated in the diagram, among the 22 mentioned challenges, the participants reached the highest consensus about the factors in the area of health system management (57.1%) ; they also strongly agreed on important factors (42.85%) such as stewardship, stakeholders, infrastructures, external pressures, lack of coordination at the policy making level and lack of systematic structure for decision- making in the health system organization. however, only 14.28% of the participants strongly agreed on such challenges as the involvement of partner organizations with unrelated tasks, dependence of hta activities on periodic meetings, being passive to new technologies, lack of experts in the field, lack of feasibility studies in the process of hta application and dependence hta on investors and importers. the department of health technology assessment, the main organization responsible for hta in iran, has introduced three main challenges in this field as follows : the lack of legal support for hta in the legal documentation of the national health system, insufficient resource allocation and the lack of academic courses for the involved experts ; the views of the experts are presented in the following diagram : the findings of this study imply that a high percentage of the expert participants had the same view on the three factors mentioned by the hta department. at the same time, they mentioned the following factors as the challenges affecting hta : lack of sufficient scientific capacity in the hta subject at universities, lack of interaction between public and private sectors regarding hta, conflict of interest, lack of a national organization for evidence quality control, limited access to databases, lack of a clear policy- making structure, lack of fundamental macro strategies for managing the health and education sector, weakness of intersectional organizations of the health system and lack of an integrated, perfect, evidence based structure in the health system of iran. considering the increasing importance of evidence based policy- making, the health system authorities and decision makers have focused on the production of scientific and comprehensive evidences. in recent decades, budget constraints and the need for the effective application of health technology have doubled the necessity for their assessment and prioritization. thus, by acknowledging the emphasis of world health organization (who) on hta and its key role in the promotion of evidence based policy- making, many countries such as iran, which follow the health reforming program, pay a particular attention to hta, the selection and application of appropriate technology within the framework of managerial and political strategies and attempt to develop hta through government support. in addition, the accurate identification of the current challenges and obstacles as well as their prioritization may lead to the advancement of the health system reforms. thus, studying the challenges of hta not only helps planning the needed reforms, it can also bring about an efficient allocation of health technologies despite resource distribution. for this purpose, such factors as health system management, stewardship, stakeholders, infrastructures, external pressures, lack of coordination at policy- making level, lack of a comprehensive system for decision- making in the health system, lack of legal support for hta in the legal documentation of the national health system, insufficient resource allocation and lack of planning for academic training of the experts involved in the program were identified as the main obstacles and have been considered in the priorities of the programs of the department of health technology assessment. although the mentioned challenges were classified into two groups, stewardship and management, we attempted to study the challenges separately regardless of their classification. in supporting the challenges investigated in this study, palesh (2010) introduced lack of need assessment in the process of technology application, lack of coordination at the policy making- level, lack of experts in the field and propaganda by importers and producers of the health technologies as the barriers to the application of the health technology assessment in iran (4). however, sivalal stated that the lack of technical and expert forces is one of the main problems in the application of health technology assessment in asian countries including iran (3). additionally, hosseini (2007) mentioned the followings as the main challenges of health technology assessment : lack of competence and expert labor force, constant specialized personnel shift from one field to another, lack of academic centers for training infrastructures of health policy making, health economics such as hta, lack of appropriate training of managers and experts in various sections, lack of experienced advisors in the field (5). similarly, although south korea has initiated hta activities since 1990, enabling human resources was one of the main challenges of the health system of this country in 2009(6). although hta has not long entered into the health arena in iran, noticeable actions have been done by the department of health technology assessment, standardization and tariff department, main of which is the establishment of the hta major at the master level. tehran university of medical sciences in collaboration with the professors in this field trains many students annually in this major. moreover, the return of hta graduates and other related majors such as health policy- making from abroad universities has contributed to the strength and improvement of iran s health technology assessment program. however, considering the current need of the health system, the emphasis has continuously been on the fact that hta academic training can guarantee the application of this interdisciplinary knowledge and may improve the objectives of hta. hence, in order to increase the current knowledge of hta, the department of health technology assessment and standardization and tariff department have taken two essential steps including holding short - term hta courses and preparing training packages to accomplish consistent and structured training courses. the key role of the policy- makers in the establishment and institutionalization of hta is undeniable and should not be underestimated. as mentioned, lack of coordination at the policy- making level in the health system was put at the second rate of importance (42.85%), and inadequate understanding of the hta process by the policy- makers was placed at the third rate of importance. sivalal has noted that there is no longer a need for convincing the policy- makers and top level decision makers about the importance of hta in asian countries including iran (3). however, hosseini (2007) stated that the followings are the main barriers and problems of hta : no serious attempt at higher levels of management, inadequate political support, lack of attitude and belief in the macro level and lack of understanding of the establishment needs in such a structure in senior executives (5). palesh (2010) has also argued that although the policy- makers agree with hta, it seems that they do not have a perfect knowledge of it (4). in a study by sampietro entitled as hta history in spain, it was revealed that the policy- makers poor awareness of hta prevents them from providing adequate and fixed resources for it (8). in a study by pichon and colleagues entitled as facilitators and barriers for international collaboration in latin america, little government support and funding and limited resources were introduced as the main problems against hta (9). (2009) found that the distribution and promotion of hta theories and methods in that country is under the influence of such challenges as coordination and cooperation of policy- makers, and they also maintained that although the policy- makers may have some knowledge of hta, they do not use it in practice (10). investigating hta history in japan, hisachi noted that health policy- making in japan is based on the traditional consensus approach and that institutionalization in health policies is fully based on the individual s opinion and depends on the opinion of the health system s leaders. thus, it appears that the application and coordination of health technology assessment are considered two hta challenges among policy- makers in japan (11). recently, it seems that health policy- makers in iran have gained a relatively positive attitude toward health technology assessment and have done the necessary efforts for its establishment ; and finally, it can be said that the formal structure of hta at the macro level has been established in the ministry of health and medical education. the second most important challenge investigated in this study was the lack of systematic and comprehensive evidence based system in the national health system. marzban (2007) found that health technology related policies at the health ministry are not the integrated parts of the overall health policies of the country (iran). he defined a national health technology assessment program with the initiation of pre - evaluation activities at the university level and then considered the complete activities of the health technology assessment in a national agency. in addition, he acknowledged the necessity of observing national strategic programs and national health system priorities in allocating technologies to develop an effective pattern. he considered designing a model for health- centered organizations and their role in supplying and demanding the evaluation necessary for health technologies (12). hamzekhanloo (2010) supported these findings and noted that such factors as the lack of systematic structure for health decision- making, dependency on investors and importers, dependency on periodic meetings and being passive to new technologies are the main barriers of application of hta (13). therefore, necessary and important efforts have been done or are in the evolution stage in the department of health technology assessment and standardization and tariff department. projects in cooperation with medical universities of the country aiming at developing a local model for the structure and process of health technology assessment is among such efforts. in addition, designing a systematic structure for the cooperation of research centers in universities of medical sciences in the country was developed by the help of one of the university professors (dr. yazdani) in order to provide structured, consistent and purposeful relationship between universities and high rank authorities of the health system. in this structure, the method of health technology assessment codification and medical guidelines (from the horizon scanning stage for health technologies to pre - assessment, quick review of health technology assessment and a complete technology review) have been explained in detail which is now in its initial stages of implementation. therefore, relying on scientific and research centers and universities of the country has made it possible to produce a list of new technologies to utilize the country 's health technology assessment for knowledge production. it seems that management practices can eliminate and solve such problems as lack of integration with national macro policies, involvement of partner organizations with unrelated tasks, lack of hta activity in academic units, lack of a local model for the arrangement of related organizations, dependency of hta activities on periodic meetings, lack of a comprehensive and systematic structure of an effective evidence, dependency on the investors and importers and being passive to new technologies and the insufficient application of a comprehensive framework in the hta system. by considering the running programs and challenges of this field, the department of health technology assessment is going to promote and advance plans for health technology assessment in the national health system. it seems that by the appropriate use of hta horizon scanning, the department of health technology assessment has been able to collect relevant data and desired priorities to localize hta in an appropriate structure and manage it properly. in conclusion, the transformation of the results reported from the hta projects into policies will help produce practical knowledge product and will also improve evidence based policy- making. the support of the relevant legislators from hta and the macro statutes of the health system including the high council of health decisions and insurance supreme council legislations will warrant the production of scientific evidence on health technology assessment. also, empowering the hta experts and technical officers will improve the hta process in the health system of iran. | background : various decisions have been made on technology application at all levels of the health system in different countries around the world. health technology assessment is considered as one of the best scientific tools at the service of policy- makers. this study attempts to investigate the current challenges of iran s health technology assessment and provide appropriate strategies to establish and institutionalize this program. methods : this study was carried out in two independent phases. in the first, electronic databases such as medline (via pub med) and scientific information database (sid) were searched to provide a list of challenges of iran s health technology assessment. the views and opinions of the experts and practitioners on hta challenges were studied through a questionnaire in the second phase which was then analyzed by spss software version 16. this has been an observational and analytical study with a thematic analysis. results : in the first phase, seven papers were retrieved ; from which, twenty- two hta challenges in iran were extracted by the researchers ; and they were used as the base for designing a structured questionnaire of the second phase. the views of the experts on the challenges of health technology assessment were categorized as follows : organizational culture, stewardship, stakeholders, health system management, infrastructures and external pressures which were mentioned in more than 60% of the cases and were also common in the views. conclusion : the identification and prioritization of hta challenges which were approved by those experts involved in the strategic planning of the department of health technology assessment will be a step forward in the promotion of an evidence- based policy- making and in the production of comprehensive scientific evidence. |
seborrheic keratosis (sk) is common benign epidermal proliferation, which can occur anywhere in the skin the exception of palms, soles, and mucosa (there was only one report of mucosal sk in the conjunctiva). sk involving the genital region is a rare entity, which can be easily misdiagnosed as genital warts. recently, dermoscopy is available as a noninvasive diagnostic procedure which can be used to diagnose sk by its typical findings. we hereby report a rare and unusual case of large sk of the genitalia which initially caused a diagnostic confusion with condyloma acuminata. the diagnosis of sk in our case was established by dermoscopy and was confirmed by histopathology. a 50-year - old woman presented with a large polypoidal growth on the vulva of 2 years duration. the lesion started as a small pigmented patch on the right vulva, which slowly increased in size to become a large polypoidal mass and in extent to involve the entire external genitalia. there was no pain or discharge, but of late the lesion became foul smelling. there was no history of sexual promiscuity in either spouse. on physical examination, a large, pigmented, polypoidal mass (of size around 15 10 cm) was seen in the external genitalia involving both labia majora, labia minora, fourchette, and mons pubis [figure 1 ]. dermoscopic examination was carried out, which showed fissures and ridges, cerebriform appearance, and comedo - like openings consistent with sk [figure 2 ]. the histopathologic examination of a biopsy sample showed hyperkeratosis, acanthosis, and multiple horn cysts, which were also consistent with sk (acanthotic type) [figure 3 ]. large polypoidal mass over the entire external genitalia dermoscopic image showing fissures and ridges and comedo - like openings histopathology showing hyperkeratosis, marked acanthosis, and multiple horn cysts (hematoxylin and eosin stain, 100) sks are common benign epidermal proliferations, which present as sharply demarcated, tan to black, round or oval, elevated, stuck on skin lesions. classically, sk tends to increase with age. flat sk, pedunculated skin - tag - like, stucco keratosis, dermatosis papulosa nigra, melanoacanthoma, and inverted follicular keratosis. polypoidal mass (as was seen in our case) has been reported in the genital region in several case reports. reported large, polypoidal sk in the genitalia in 42-year - old and 50-year - old male patients, respectively. melanoacanthoma is a variant of sk characterized by epidermal proliferation of keratinocytes and melanocytes where the melanocytes are scattered throughout the tumor lobules rather than only in the basal layer as seen in sk. we considered the diagnosis of melanoacanthoma in our case, but ruled it was out as histopathology showed melanocytes only in the basal layer (not throughout the tumor lobule). roth. reported a case of inverted follicular keratosis (a variant of sk) of the vulva. inverted follicular keratosis is considered a sk that involves the epithelium of hair follicles, that proliferates in an endophytic fashion, and that exhibits squamous differentiation in association with inflammation. the clinical diagnosis of sk may be difficult at times with only 49% accuracy in a study done by stern. diagnosis becomes more difficult in the genital region as the classical clinical features of sk (distinct keratotic and follicular plugging, stuck - on appearance, etc.) disappear because of the friction and maceration typical of this area. in our case, however, distinct keratotic and follicular pluggings were well discernible. sk may be grouped into different histological subtypes : acanthotic, hyperkeratotic (also verrucous), adenoid (reticulated), plane, clonal, bowenoid, irritated, inverted follicular keratosis, benign squamous keratosis, and melanoacanthoma. the acanthotic type, like in our case, shows marked acanthosis with predominantly basaloid cells, moderate papillomatosis and hyperkeratosis, and characteristic presence of horn cysts or pseudocysts. squamous eddies, as seen in irritated sk, are absent. because the lesions of sk may not be easily diagnosable in the genital region, dermoscopy could become a handy replacement to tedious and sometimes unacceptable biopsy / histopathologic examination. the most common dermoscopic features of cutaneous sk are comedo - like openings and milia - like cysts. other features include fissures, hairpin vessels, sharp demarcation, and moth - eaten borders. comedo - like openings, that is, keratin - filled invaginations of the epidermis, are usually not seen in the vulva, due to the friction that prevents their formation in this anatomical site. milia - like cysts, on the other hand, are histologically included in the epidermis, and therefore not eliminated by friction and maceration. in our case, comedo - like openings were plentiful, but milia - like cysts were not seen. multiple fissures (giving a cerebriform appearance) were also prominently seen in our case. our case highlights a rare presentation of sk as giant, polypoidal growth in the genital region and diagnostic utility of dermoscope in establishing the diagnosis. | genital seborrheic keratosis (sk) is a rare entity, which can be easily misdiagnosed as genital warts. dermoscopy is a useful tool to make diagnosis of sk in such cases. we report a 50-year - old woman with a large polypoidal growth on the external genitalia. dermoscopic examination showed fissures and ridges, cerebriform appearance, and comedo - like openings consistent with sk. the histopathology confirmed the diagnosis of sk. |
in recent years, near - infrared spectroscopy (nirs) is increasingly used to monitor regional cerebral oxygen saturation (rso2) during cardiac surgery. in fact, neurologic injury is still a common complication after cardiac surgery, with rates of postoperative neurocognitive decline (poncd) and stroke of up to 50% and 1 - 3%, respectively. moreover, stroke after cardiac surgery results in a 10-fold increase in mortality and in a 3-fold increase in hospital stay. in an attempt to reduce these potentially disastrous complications, nirs has been therefore advocated as a routine monitor to prevent or minimize brain injury by detecting cerebral oxygen supply - demand imbalances. actually, several experimental data are gradually accumulating to show that both preoperative values and intraoperative changes of rso2 can predict important complications and long - term outcomes after cardiac surgery, including stroke, delirium, neurocognitive decline, organ dysfunction [13, 14 ], length of hospital stay [12, 13, 15 ] and mortality. nevertheless, not everyone considers these evidences sufficient to justify the routine use of nirs monitoring in cardiac surgery [4, 16 ], that remains debated [7, 17 ] and poorly defined, with little consensus for its appropriate use. probably, one of the reasons for this is the poor agreement among different devices [3, 7, 17,18,19 ], that has been also confirmed by two recent investigations [2, 20 ]. currently, several nirs devices are commercially available for clinical use, with lack of standardization among them [2, 16, 19, 21 ]. in fact, although the various models are mostly based on spatial resolution spectroscopy [16, 22 ], they differ in numerous important aspects related to the acquisition of their cerebral oxygen saturation measurements, including the algorithms adopted, the type of light source, the wavelengths of light emitted and the distance between the various light emitters and detectors. this makes comparisons between clinical studies using different devices difficult and, therefore, rso2 thresholds for the development of hypoxia / ischemia remain elusive [23, 24 ]. particularly, since the majority of clinical data currently available have been generated using various invos devices (the first to be approved by the u.s.a. food and drug administration), it is not clear whether the thresholds identified in studies conducted with these models [11, 12,13,14, 25 ] may also apply to devices from other companies. in the present study, for the first time far as the authors know, the measurements made by both invos and equanox nirs oximeters on the forehead of adult patients during different moments of cardiac surgical procedures are directly compared, with the objectives of evaluating both the feasibility of such simultaneous measurements and the interchangeability of the two devices in clinical practice. the study protocol was approved by the local ethical committee. after informed consent, 10 patients (6 males, 4 females), mean age 65.1 15.84, scheduled for conventional cardiac surgery with or without cardiopulmonary bypass (cpb) were enrolled in the study (table 1). age, sex, type of surgery, number of measurements recorded (from each device) and number of desaturations 20% from baseline (displayed by one or both of the two devices) of the patients investigated. m = male ; f = female ; l = left ; r = right ; avr = aortic valve replacement ; cabg = coronary artery bypass graft ; opcab = off - pump coronary artery bypass ; mvr = mitral valve replacement. two different nirs monitors were applied to patients : the 2-wavelength invos 5100c (somanetics, troy, mi) and the 3-wavelength equanox 7600 (nonin medical, inc, plymouth, mn). after rubbing and cleaning the skin with an alcohol swab, 2 sensors (one left and one right) adult somasensor safb - sm (covidien, mansfield, ma) and 2 sensors (one left and one right) equanox advance sensor - adult model 8004 ca (nonin medical, inc, plymouth, mn) were placed over the forehead of the patients, as close as possible, being careful not to overlap light emitters and detectors. invos sensors were placed lower than equanox ones in five patients, and higher than equanox ones in the other five (figure 1). relative positioning of nirs sensors on the forehead of patients 1, 3, 5, 7 and 9 (panel a) and 2, 4, 6, 8 and 10 (panel b). regional cerebral oxygen saturation (rso2) measurements were collected before anesthetic induction with patients breathing ambient air (baseline values), two minutes after tracheal intubation, two minutes after cpb onset, at aortic cross - clamping, at aortic unclamping, at cpb offset (when applicable), at the end of surgery and whenever at least one of the two devices measured a bilateral or monolateral reduction in cerebral oxygen saturation equal to or greater than 20% of the baseline value. each measurement, as well as an absolute value, was also recorded as a percentage of the respective baseline value according to the formula : % of baseline = absolute valuex100/baseline value. in all patients, whilst the equanox monitor seemed not significantly influenced by the presence of the operating invos sensors, no rso2 values were displayed (and a poor signal quality error message appeared) on the invos oximeter when the equanox device was switched on. for this reason, it was not possible to record the rso2 values from the two devices simultaneously. therefore, immediately after collecting invos data, it was turned off and, simultaneously, the equanox device was turned on and its data were recorded. bland - altman analysis was used to compare the bias and limits of agreement (bias standard deviation x 1.96) between the two devices. moreover, linear regression was applied to the bland - altman plots in order to test the presence of a proportional bias. ibm spss statistics software v 19.0 (ibm, armonk, new york) was used for statistical analysis. a 2-tailed value of p < 0.05 was considered significant. a total of 140 measurements (70 left, 70 right) were collected from both devices in the 10 patients (table 1). the mean bias between invos and equanox was -5.1%, and limits of agreement were 16.37%. (figure 2a) the bland - altman plot showed the presence of a statistically significant proportional bias (n=140 ; r=0.541 ; r=0.293 ; p=0.000). when considering the dynamic changes of rso2 (expressed as percent of baseline) showed by the two devices (120 measurements), the mean bias was -1.43% and limits of agreement were 16.47 (figure 2b). also in this case, there was a significant proportional bias (n=120 ; r=0.680 ; r=0.462 ; p = 0.000). bland - altman analysis between absolute values (panel a) and changes from baseline (panel b) of rso2 measured by invostm and equanoxtm in the 10 patients. interestingly, of the 20 total episodes (considering each individual sensor) of significant (or threshold) cerebral desaturation (i.e., a reduction equal to or greater than 20% from baseline) [25, 26 ] reported by invos in four patients, mostly during heart displacement for coronary artery exposure or during episodes of hypotension over cpb, only 3 (in one patient) were also reported by equanox. all significant desaturations were promptly corrected with conventional strategies (such as administer fluids or vasopressors or raise pump flow) and no patients had complications. the results of this investigation suggest a clinically important difference between invos and equanox in measuring cerebral oxygen saturation as well as its variations during cardiac surgery, probably due to some of the characteristics in which they differ (such as the number of light emitters and detectors, the different distance between them and, consequently, a different tissue penetration of light, the number of wavelengths adopted, and a different built - in proprietary algorithm to assess oxygen saturation). in particular, in our series the bias between invos and equanox in measuring absolute values of rso2 showed a moderate correlation with the mean values from the two devices, with a tendency of invos to underestimation (or a tendency of equanox to overestimation) for the lower values. of course, it is rather difficult to determine which of the two devices provide the more true accordingly, the two devices do not seem to be interchangeable in routine clinical practice. therefore, the results of previous investigations that identified threshold absolute values of rso2 able to predict outcomes such as postoperative delirium and mortality using invos may not to be applicable to equanox. while these results are not particularly surprising, given that a poor reliability of absolute values of rso2 measured by invos had already been showed [27, 28 ], the similar differences observed also in changes from baseline given by the two devices require caution in interpreting trends given by equanox according to thresholds previously identified in studies using invos[1, 12,13,14, 25, 26 ]. in fact, although the mean inter - device bias for dynamic changes of rso2 was lower than that for the absolute values, the limits of agreement were, also in this case, wide. moreover, an even stronger proportional bias was observed, meaning that the two devices may display a different magnitude of desaturation in similar clinical situations. desaturations from invos than from equanox, although the number of episodes is not sufficient for confident statistical analysis. of course, these results do not exclude that both devices may adequately describe the variations in cerebral oxygen supply - demand balance, although device - specific thresholds are probably needed to interpret correctly these variations in clinical practice. our findings are consistent with the results of other recent investigations. in fact, even if this is the first report of a direct comparison between invos and equanox measurements at cerebral level and in a clinical context, the agreement between the two devices has been previously evaluated, both directly [2, 20 ] and indirectly [2, 19, 29 ], in healthy volunteers. reported variable sensitivity to extracranial tissue contamination among invos, equanox, and fore - sight (cas medical systems, inc, brandford, ct) devices. this may partly explain the inter - device differences in absolute values of rso2, but should not significantly affect the variations from baseline. however, fellahi. and hyttel - sorensen. demonstrated that invos and equanox, positioned simultaneously on calves or one at the time on forearms of healthy volunteers, respectively, are not comparable in measuring both absolute values and dynamic changes of peripheral rso2 after vascular occlusion tests. finally, bickler. evaluated the performance of five commercially available cerebral oximeters (including invos and equanox), applied two at the time per subject in 23 adult healthy volunteers, and found a large variation in reading bias (calculated as the difference between the instrument s reading with the weighted saturation of venous and arterial blood) between subjects, especially during hypoxia. similar differences were also found when comparing invos with other devices [18, 30 ]. this study has several limitations, the most important being the small number of patients enrolled. however, the number of paired measurements, that can be considered independent among themselves, allows us to give some significance to our findings. one of the reasons why we limited our observations to a few patients is the convinction, gained during the collection of these initial data, that different study designs may be preferable in order to investigate the differences among the various devices. in fact, direct comparison of two nirs devices seems to be somewhat difficult, since the sampled areas, though close, are not the same and interferences between the two sensors can not be excluded [20, 30 ]. regarding the latter, we report for the first time an important interference, due to which the paired measurements were not simultaneous but spaced each other by a few seconds, that is another important limitation of the present study. maybe, in other investigations not reporting such interference, the distances between sensors were greater : in fact, fellahi. applied only two sensors (one for each device) on the forehead, instead of four as in this report. a plausible explanation for invos but not equanox being markedly disturbed by the other device is the use of three wavelengths (730, 810 and 880 nm) by equanox and two wavelengths by invos, in particular two of the three used by equanox (730 and 810 nm). the present study suggests that invos and equanox are not interchangeable in measuring both absolute values and dynamic changes of cerebral rso2 during cardiac surgery. accordingly, device - specific thresholds are probably needed to guide interventions aimed to prevent postoperative brain injury as well as other adverse outcomes. since direct comparison of nirs devices in such clinical context seems to be of poor feasibility and difficult interpretation, large investigations on each device are needed in order to identify any of such specific thresholds and to allow a more extensive and better - defined use of this promising technology. | introductionseveral near - infrared spectroscopy oximeters are commercially available for clinical use, with lack of standardization among them. accordingly, cerebral oxygen saturation thresholds for hypoxia / ischemia identified in studies conducted with invostm models do not necessarily apply to other devices. in this study, the measurements made with both invostm and equanoxtm oximeters on the forehead of 10 patients during conventional cardiac surgery are directly compared, in order to evaluate the interchangeability of these two devices in clinical practice.methodscerebral oxygen saturation measurements were collected from both invostm 5100c and equanoxtm 7600 before anesthetic induction (baseline), two minutes after tracheal intubation, at cardiopulmonary bypass onset / offset, at aortic cross - clamping / unclamping, at the end of surgery and whenever at least one of the two devices measured a reduction in cerebral oxygen saturation equal to or greater than 20% of the baseline value. bland - altman analysis was used to compare the bias and limits of agreement between the two devices.resultsa total of 140 paired measurements were recorded. the mean bias between invostm and equanoxtm was -5.1%, and limits of agreement were 16.37%. considering the values as percent of baseline, the mean bias was -1.43% and limits of agreement were 16.47. a proportional bias was observed for both absolute values and changes from baseline.conclusionsinvostm and equanoxtm do not seem to be interchangeable in measuring both absolute values and dynamic changes of cerebral oxygen saturation during cardiac surgery. large investigations, with appropriate design, are needed in order to identify any device - specific threshold. |
the first glimpse of the ctd structure was through its interaction with human pin1, a unique prolyl isomerase that catalyzes cis / trans isomerization of specific phos.ser/thr-pro motifs in signaling proteins (1316). identification and characterization of this novel peptidyl - prolyl cis / trans isomerase (ppiase), pin1, led to discovery of a novel postphosphorylation regulatory mechanism, in which regulation is achieved by conformational changes of a phosphorylated ser / thr - pro peptide bond upon proline isomerization (fig. this change in the configuration of the polypeptide has a profound effect on pin1 targets and therefore modulates various signaling pathways at both transcriptional and posttranslational levels. specifically, activity of prolyl - isomerization of pin1 can interconvert the cis / trans conformation of the phos.ser/thr-pro motif of target proteins and make them better or worse substrates for conformation - specific signaling kinases (such as cyclin - dependent protein kinase, glycogen synthetase kinase 3, and mitogen - activated protein kinase) and phosphatases (such as pp2a and cdc25). recent studies also provide substantial evidence implicating pin1 in progression of malignant tumor cells (17) and development of alzheimer 's disease (18). high affinity inhibitory unnatural peptides have been developed as a good template for chemical compounds targeting pin1 for antineoplastic effects (19). the yeast homologue of pin1, ess1, interacts physiologically and genetically with the ctd (20). furthermore, hyperphosphorylated rna polymerase ii appears to be the dominant binding target in yeast extracts (21). considering the high local concentration of the phos.ser/thr-pro motif in the hyperphosphorylated ctd, it is plausible that the ctd is the major substrate of pin1 in vivo. the binding of a single ctd repeat that is phosphorylated at ser5 was reported to be 30 m (22). presumably, the ctd tail containing 2652 such repeats localizes a substantial amount of pin1. pin1 is a 163 amino acid polypeptide that can be divided into two domains based on topology and function, a c - terminal ppiase domain and an n - terminal ww domain. structure of the ww domain reveals three antiparallel -strands forming a shallow interface with the ppiase domain for substrate peptide binding (23, 24). it has long been realized that ww domains recognize proline - containing sequences but it was not clear until recently that ww domains join a group of modules that bind to protein ligands in a phosphorylation - dependent manner (25, 26) ; these domains include sh2, ptb, 14 - 3 - 3, wd40, fha, and ff domains. the modular nature of ww domain interactions leads to a classification into four distinct groups based on binding specificity (27). group i ww domains, such as dystrophin and the yes - associated protein yap65, recognize group ii, such as fe65 and forming binding proteins (fbps), bind the group iii ww domains select polyproline motifs flanked by arginine or lysine (31, 32). group iv ww domain, including human pin1 and nedd4, specifically recognize a phos.ser/thr-pro motif (22, 26, 33). the molecular detail of recognition of the ctd by pin1 was elucidated by a structure of human pin1 in complex with one doubly phosphorylated ctd repeat (22) (fig. so far, this is the only structure available for a full - length pin1 binding to its target at the recognition module ww domain. the structure is consistent with thermodynamic data, which the phosphorylated ser5 in the ctd repeat is the major binding element in recognition. loop 1 of the ww domain has been shown to be highly flexible in apo pin1 (34) but this loop is essential for specificity recognition (35). in the complex structure, this loop warps toward the substrate peptide to ensure binding and results in an exaggerated twist in the triple - stranded -sheet (22) (fig. this twist is coupled to a contraction of the ww domain ligand binding surface formed between the ww and ppiase domains. the two essential elements for peptide recognition include binding of phosphate by loop 1 residues and hydrophobic stacking of proline by tyr23 and trp34 (22). the binding of pin1 to the ctd can modulate the regulatory effect of other ctd - binding proteins. in vitro experiments showed that pin1 can influence the phosphorylation status of the ctd by inhibiting the transcription factor iif - interacting ctd phosphatase 1 (fcp1) and stimulating ctd phosphorylation by cdc2/cyclinb (36, 37). the rsp5, a ubiquitin ligase that binds to the ctd, also functions to oppose pin1 effects on rna polymerase ii (38). the biological and structural results of pin1 effects on rna polymerase ii function support a model that pin1 works in a processive manner on the ctd with the ww domain acting as a binding element restricting movement to an efficient one - dimensional walk and with the ppiase acting much like a reading head to processively isomerize the peptide bonds. the binding of pin1 prolongs the phosphorylated state of the ctd by suppressing dephosphorylation, thereby enhancing the regulatory effect of ctd binding proteins. ribbon representation of four ctd recognition modules. (a) ww domain of pin1 in complex with a short ctd peptide (1f8a) ; (b) cid domain of pcf11 in complex with a short ctd peptide (1sza) ; (c) sri domain of set2 (2a7o) ; and (d) ff domain of ca150 (2kis). recognition of the phosphorylated ctd by pin1 is mediated by its ww domain, a modular domain of around 40 residues that is essential for recognition of proline - rich motifs by the ppiase domain. a more specific recognition domain for the ctd is the ctd - interacting domain (cid) identified in multiple rna processing and termination factors in eukaryotes (39, 40) (fig. 4). superimposition of cid domains from pcf11 (light blue, 1sza), nrd1 (light pink, 3clj), and scaf8 (white, 3d9i). in yeast, the pcf11 is a yeast protein of 70 kd with a cid domain directly targeted to the ctd of rna polymerase ii, which gives us the first glance of how a cid recognizes heptad repeats of the ctd. interestingly, the cid domain of pcf11 can bind to both unphosphorylated or phos.ser2 ctd in biophysical binding assays (39). consistent with the biochemical data for such preferences, the co - crystal structure of the pcf11 cid and a ctd peptide shows no direct interaction between the phosphate group of phos.ser2 and pcf11, indicating no prerequirement of phosphorylation of the ctd for protein binding (39) (fig. 3b). the cid domain, as an eight - helical bundle, recognizes a span of two heptad repeats in the ctd with a conserved groove, whereas the phosphate group of phos.ser2 actually forms an intramolecular hydrogen bond with thr4 of the ctd and stabilizes the sharp -turn formed by ctd, presenting the side chain to the binding groove (fig. hydrogen bondings between the cid domain and the ctd peptide are distributed between the cid side chain and the main chain amide and carbonyl group of the ctd peptide. importantly, hydrophobic interaction by tyr1 of the ctd to cid might contribute greatly for the specificity for phos.ser2 over phos.ser5. meinhart and cramer (39) conclude that ser2 phosphorylation stabilizes the ctd -spiral that is incorporated into the transcription complex. ser5 phosphorylation would unwind the spiral resulting in an extended region that binds the capping enzyme. overall, the binding of pcf11 is not particularly strong but is consistent with its dynamic role involved in dismantling the elongation complex (41, 42). another cid containing protein nrd1 is an essential player in the termination pathway for rna polymerase ii - mediated transcription for snorna, snrna as well as cryptic unstable transcripts (cut). the complex of nrd1-nab3-sen1 is recruited to the transcription machinery through the ctd by the cid domain of nrd1 of the complex. 4) has a very similar overall fold and a strong conservation of residues involved in ctd peptide binding with pcf11, but nrd1 shows a different specificity profile in which a much stronger preference for phos.ser5 over phos.ser2 in the ctd sequence is detected for the cid from nrd1 by in vitro binding assays (43). using yeast - two hybrid and fluorescence anisotropy, vasiljeva showed a tenfold improvement in binding affinity for singly phosphorylated ctd double repeats at ser5 over ser2 (kd=40 m for phos.ser5 vs. 390 m for phos.ser2) and a slight improvement when the peptide is doubly phosphorylated (kd=16 m upon double phosphorylation for both ser2 and ser5 sites). specificity for phos.ser5 on the protein is essential to understand how different termination pathways are selected. a potential different phosphate binding site was proposed but more insightful information about specificity will only be available with a structure of the nrd1cid complexed with the ctd peptide. since the nrd1-dependent termination pathway is usually associated with much shorter transcripts (a few hundred base - pairs), upon which point dephosphorylation of ser5 is not complete, a logical hypothesis is that phosphorylation at ser5 favors the selection of nrd1 complex as a termination pathway in yeast. indeed, gudipati. (44) showed that reducing phosphorylation of ser5 using a mutant of kin28, a ctd ser5 kinase, will hamper nrd - dependent termination. the selectivity for phos.ser5 over phos.ser2 might be the determining factor for the selection of termination pathways. a functional model for how the phosphorylation pattern of the ctd determines the transcriptional pathways suggests that termination by the nrd1-nab3-sen1 complex is enforced when the ctd is still highly phosphorylated at ser5 (45). the structure of a complex of the cid of nrd1 with the ctd domain will help provide a molecular explanation of transcription termination. another cid containing protein human scaf8 was crystallized with different phosphorylated forms of ctd peptides (fig. 4), providing more clues about how registration of a phosphate group on the ctd is encoded in target recognition for cid domains (46). the scaf8 is implicated in splicing with a preference of phos.ser2, similar to mrna 3-processing factor pcf11. indeed, a similar conformation of beta - turn adapted by the ctd is observed in scaf8 upon peptide binding but with one major distinction : phos.ser2 is directly recognized by a basic residue, arg112, through salt bridge interaction (46). at a similar position in pcf11 the replacement of methionine by arginine in scaf8 distinguishes the phos.ser2 ctd from the unphosphorylated form and might explain a tighter interaction for scaf8 toward phosphoryl - peptide (68 m). in the study of becker. (46), an issue was raised whether phosphorylated ser7 contributes to recognition by the cid domain of scaf8. binding affinity measured by fluorescence anisotropy showed no advantage with additional ser7 phosphorylation (68 m for phos.ser2 and 90 m for doubly phosphorylated ser2 and ser7). consistent with the binding interaction measurement, the structure of the complex with the scaf8 cid presents no interaction between the phosphate group of ser7 with the protein. a wide range of enzymes participate in dynamic modifications of the ctd, including kinases and phosphatases responsible for addition and removal of phosphates. the ctd is principally phosphorylated by cyclin - dependent kinases (cdks) with their associated cyclins. specifically, ser5 phosphorylation is mainly catalyzed by cdk7/cyclin h subunits of tfiih (4749) ; ser2 phosphorylation is mainly catalyzed by p - tefb, which contains cdk9/cyclin t subunits (50, 51). intriguingly, it is suggested that cdk9 also makes a contribution to ser5 phosphorylation and the relative contribution of tfiih - associated cdk7 varies between different genes based on experimental observations (52). moreover, the ctd can also be phosphorylated at both ser2 and ser5 by cdk8 as part of the mediator complex, and preferentially phosphorylated at ser5 by mapk2/erk2 (53). recently, tfiih - associated cdk7 kinase has also been shown to phosphorylate ser7 in vivo (52, 54). even though structural information has been obtained for cdk7 (55) and cdk9/cycln t (56), how they recognize the ctd peptide and label the phosphorylation mark on ctd is still elusive. it is assumed that specificity is achieved by other associated proteins in the multiprotein complexes they are involved (cdk7 in tfiih, cdk8 in mediator, and cdk9 in p - tefb). dephosphorylation is essential for recycling rna polymerase ii, because after each round of transcription, the ctd has to be dephosphorylated in order to actively restart a new round of transcription. in humans, fcp1, which is required for general transcription and cell viability, was the first discovered ctd - specific phosphatase with a catalytic preference for phos.ser2. the fcp1 is conserved among eukaryotes and was shown to be essential for cell survival in budding and fission yeast (57, 58). the conserved region of fcp1 is composed of two domains : an n - terminal fcp homology (fcph) domain with phosphatase activity and a c - terminal breast cancer protein related c - terminal (brct) domain (59) (fig. 5). the zoom - in picture shows the pro3 binds to the hydrophobic pocket with the aromatic residues shown in stick. the active site signature motif is colored with pale green, and the insertion domain is colored with light pink. recently, a family of small ctd phosphatases (scps) with activities preferential for phos.ser5 was identified (60, 61). the scps also contain the fcph catalytic domain that includes the dxdx(t / v) motif, the signature of a superfamily of phosphotransferases and phosphohydrolases called the haloacid dehalogenase (had) superfamily (62). interestingly, outside the signature motif, scps share very little sequence similarity with the other enzymes in the had superfamily (63). in humans, scp1 has more than 20% sequence identity to fcp1 in the fcph domain but lacks the c - terminal brct domain that exists in fcp1. moreover, scp2 and scp3, which also lack the brct domain, share more than 90% similarity with scp1 in the fcph domain (60) (fig. (64) showed a central parallel sheet flanked by two helices, a two - stranded sheet, and a short 310 helix. the conserved dxdx(t / v) signature motif lines part of a central crevice, which forms the active site and coordinates the mg ion that is essential to scp1 phosphatase activity. the first aspartate in the signature motif is involved in mg - assisted phosphoryl transfer and acts as the phosphoryl acceptor. mutation of this residue (asp96 in scp1) to alanine or asparagine abolished the activity of scp1. the second aspartate (asp98 in scp1) also contributes to metal ion - binding and could possibly function as a general acid / base (64). the proposed phosphoryl transfer mechanism for the scp / fcp family involves a phosphoryl - aspartate intermediate. existence of this phosphoryl - enzyme intermediate was confirmed in a recent structural and functional study when we successfully trapped the phosphoryl - aspartate intermediate in the crystal structure of an scp1d206a mutant soaked with para - nitrophenyl phosphate (pnpp) (63). the steady - state kinetic analysis of a variety of scp1 mutants revealed the importance of asp206 in mg coordination mediated by a water molecule. moreover, snapshots of the phosphoryl transfer reaction at each stage of scp1-mediated catalysis were also captured in this study. in order to understand the discrimination of phos.ser5 over phos.ser2 as a substrate by scp1, the complex structure of a dominant negative form of human scp1 (scp1d96n) bound with ser2/ser5-phosphorylated ctd peptide the defined complex structure revealed a unique binding mode of the peptide in which ser2pro3thr4(phos.ser5) forms a -turn. the pro3 is recognized by an aromatic - rich hydrophobic pocket near the active site that further confers substrate specificity (65). notably, scp1 shows remarkable specificity toward the trans peptide - bond configuration of the two prolines in the ctd repeat, which can adopt both cis and trans configurations. such configuration switching is known to modulate the structure of the ctd and its accessibility to kinases or phosphatases (21, 22). an insertion domain formed by a three - stranded sheet directly follows the signature motif (fig. this insertion domain is unique to fcp1/scp1 family phosphatases and may assist in substrate recognition. consistent with the known specificity of scp1 toward phos.ser5 instead of phos.ser2, in the complex structure the phos.ser2 flips out of the active site, making no direct interaction with the protein. even though scp and fcp share similar phosphatase active sites, their strategy for substrate recognition might be different, as suggested by the recent crystal structure of apo schizosaccharomyces pombe fcp1 (spfcp1) (59) (fig. the minimal effective ctd substrate for spfcp1 is a single heptad ctd peptide : ser5pro6ser7tyr1(phos.ser2)pro3thr4, among which the tyr1 and pro3 flanking the phos.ser2 are critical determinants of fcp1 activity (66). the spfcp1 structure revealed that it is a y - shaped protein composed of three structural domains (59). the stem of the y is the fcph domain that contains a globular catalytic phosphatase core similar to that of scp1. one major difference is that the three - stranded sheet in scp1 (insertion domain) is accessible for substrate recognition, whereas in fcp1 it is buried by a helical insertion domain, suggesting a different binding interface between fcp and the ctd with phos.ser2 (fig. even though 2652 heptad repeats exist in the ctd primary sequence, recognition of the ctd by proteins in all the complex structures discussed above only show a spanning of one or two repeats. this is understandable since a balance between a favorable interaction of the ctd with its binding partners versus the entropy cost for binding a disordered peptide needs to be achieved. this leads to the proposed mechanism that a double repeat of the ctd sequence is the functional unit for transcription. to explore if such rule is consistent with the mrna capping enzyme cgt1, four heptad repeats each with their ser5 phosphorylated were used in a cocrystallization experiment (67). interestingly, a long span of ctd peptide consisting of 17 amino acids was modeled in the density of one of the two monomers with an extensive buried surface of 1,600 (67). three of the four phosphorylated ser5 residues were visible in this structure with both the first and third phosphate group recognized by positively charged patches on the cgt1 surface. consistent with a previous study of cgt1, the tyr1 position in the ctd sequence is essential for recognition by the protein (68). on the other hand, a single mutation of the cgt protein for the recognition interface did not show obvious deleterious effects during yeast mutation screening (67), possibly due to the extended binding surface without one interaction dominating binding. since the other monomer in the asymmetric unit shows a much smaller interface, it suggests that multiple phosphorylation sites are not a prerequisite for ligand binding. further affinity measurements with a different length and registration of the phos.ser5 would elucidate whether interaction with multiple repeats of the ctd is essential for the effective binding by cgt1. the identification of the histone methyltransferase set2 as a novel ctd binding partner bridges the ctd code to the histone code by implicating the regulatory effect of the ctd on histone modification and epigenetic control (69, 70) (fig. the nucleosome is composed of a histone octamer consisting of two copies of each of the core histones h2a, h2b, h3, and h4, around which 147 bp of dna is wrapped. such a structure is not only a strategy to compress large genomic dna, but also provides a potential solution for tight regulation of dna replication, repair, and transcription. during transcription, for example, the binding sites for a variety of transcription factors can be occluded by histones, leading to transcriptional silencing (71). access to specific loci on the nucleosomal dna is dynamically regulated by many factors including chromatin modifiers and chromatin remodelers. histones can be covalently modified by chromatin modifiers at particular loci, most of which are concentrated in the relatively unstructured n - terminal tails of histones. these modifications include acetylation, methylation, phosphorylation, ubiquitination, and sumoylation (72). the histone code, which is defined by covalent modifications, represents a fundamental regulatory mechanism of gene expression and repression (73). furthermore, the histone code can be interpreted by different modules in a modification - dependent manner to decide whether a gene is to be transcribed. a novel rpb1-binding domain of set2, called set2rpb1 interacting (sri) domain, mediates the recognition and interaction with the phosphoryl ctd (fig. lys4 of histone 3 is methylated by the proteins of the set1 family, while lys36 is methylated by proteins of the set2 family (69). both set1 and set2 associate with the ctd but at different stages of transcription : set1 binds to phosphorylated ctd enriched with ser5 at the promoter region through the mediation of the paf complex (74, 75) ; whereas the recognition of the ctd by set2 relies on the phosphorylation of ser2 in heptad repeats (76). the sri domains from both human (77) and yeast (78) set2 were determined by nmr and the binding interface mapped by phosphoryl - peptide titration. the study of affinity with different length and phosphorylation registration showed that single repeats are not sufficient for sri recognition and a strong preference for doubly phosphorylated peptide was observed. five residues were identified as essential for the effective association between set2 sri and the ctd using nmr and mutagenesis (74). one can assume the positively charged residues, lys54, arg58, and his62 of the set2 sri, are involved in phosphate binding whereas val31 and phe53 are important for hydrophobic interaction with the side chain residues of the ctd, possibly tyrosine or proline. in addition, the ff domain is a protein - protein interaction module existing in several ctd interaction proteins such as human transcription factor ca150 (79) and splicing factor prp40 (80). like the sri domain, the ff domains usually are arranged as tandem arrays in proteins and such architecture might account for interaction with the ctd with each module contributing very weakly to binding. identification of the specificity of phosphorylation states of the ctd recognized by ff domains has been challenging due to the weak binding. in vitro binding assays and nmr titration experiments did not detect interaction with a ctd peptide with the ff domain arrays derived from prp40 (81) or ca150 (82). a binding constant of 50 m was reported for the mammalian homologue of prp40, fbp11, using isothermal titration calorimetry (83) but detailed information about the interaction between molecules is yet to be elucidated. recognition of the phosphorylation states of the ctd is essential for mediation of the expression of genetic information. communication of the ctd and histone codes provides an exquisite regulatory network for the precise control of transcription at multiple levels. some ctd interacting proteins function as global transcriptional regulators non - discriminatingly. the inactivation of such molecules will lead to the shutdown of transcription machinery and eventually, cell death. for example, the deletion of the ctd ser2 phosphatase fcp1 is lethal for yeast due to the abolishment of rna polymerase ii recycling (58, 84). similar effects on yeast are observed when the ctd ser5 phosphatase ssu72 is eliminated (85). on the other hand, evidence has indicated that ctd - interacting proteins can control gene expression at an epigenetic level and regulate expression of specific genes based on timing and the developmental needs. human scps are only found in higher eukaryotes and their expression is limited to neuronal stem cells or non - neural tissues. consistent with their unique expression profile, scps are identified as a component of the neuronal chromatin remodeling complex, rest (61). the inactivation of scp activity leads to the inappropriate differentiation of neuronal stem cells (61). another example of epigenetic regulation of a ctd - interacting protein is the cdk8/cyclin c pair, which has been linked to transcriptional repression (48). histone methyltransferases set1 (75) and set2 (74) can identify the different phosphorylation stages of ctd. the phosphorylation of ser7 of ctd itself also occurs in a gene - specific fashion (12). the apparent simple primary sequence of ctd integrates genetic and epigenetic information and plays a pivotal role in transcriptional activation or repression. understanding how such coding is deciphered at the molecular level is essential to the interpretation of the central role of rna polymerase ii and its regulatory domains. the application of ctd code provides a unique opportunity to engineer the transcriptional process in an epigenetic level in tissue - specificity manner. there is no conflict of interest in the present study for any of the authors. | in eukaryotic cells, the transcription of genes is accurately orchestrated both spatially and temporally by the c - terminal domain of rna polymerase ii (ctd). the ctd provides a dynamic platform to recruit different regulators of the transcription apparatus. different posttranslational modifications are precisely applied to specific sites of the ctd to coordinate transcription process. regulators of the rna polymerase ii must identify specific sites in the ctd for cellular survival, metabolism, and development. even though the ctd is disordered in the eukaryotic rna polymerase ii crystal structures due to its intrinsic flexibility, recent advances in the complex structural analysis of the ctd with its binding partners provide essential clues for understanding how selectivity is achieved for individual site recognition. the recent discoveries of the interactions between the ctd and histone modification enzymes disclose an important role of the ctd in epigenetic control of the eukaryotic gene expression. the intersection of the ctd code with the histone code discloses an intriguing yet complicated network for eukaryotic transcriptional regulation. |
pulp necrosis and interruption of tooth development, which result in incompletely formed roots with wide open apices, reduced root length, and fragile thin dentinal walls, may be the consequences of physical trauma or endodontic infection of a tooth with an immature apex. apexification is a treatment used to seal an open apex by inducing a calcified barrier at the root. calcium hydroxide and mineral trioxide aggregate (mta) are the most widely accepted materials for apexification procedures, but none of them is able to stimulate regeneration of pulp tissue and continued root development, so a root with considerably thin walls at increased risk of fracture remains and may lead eventually to loss of the tooth. tooth loss has long been associated with accelerated aging and has considerable negative consequences such as vertical and horizontal positional changes. one of the most common traditional treatment modalities include fixed or removable prosthetic therapy, which may lead to many complications such as continuous alveolar bone resorption. the concept of osseointegration was introduced in the 1950s by per - ingvar branemark. nowadays, endosseous implants are a commonly accepted treatment option. however, osseointegration represents a direct connection between the implant and bone tissue and lacks the periodontium tissue present in natural teeth, which is regarded as an elastic isotropic material and modulate the mechanical stress of mastication. some endodontic filling materials and sealers or medicaments have the potential to discolor the tooth crown or weaken the tooth. furthermore, dental pulp contains proprioceptors and therefore provides important sensory feedback on masticatory forces, a function that may reduce the potential for tooth fracture. the creation and delivery of new tissues to be a substitute for diseased or traumatized pulp or missing teeth the success of regenerative endodontic therapy is the ability to constitute a technique that will allow clinicians to create a functional pulp tissue. the source of pulp tissue may come from stem cell therapy, which involves the delivery of autologous stem cells into root canals ; dental pulp constructs, which involves the surgical implantation of synthetic pulp tissue grow in the laboratory ; or root canal revascularization. a clinical limitation to a blood clot revascularization approach is that concentration and composition of cells trapped in the fibrin clot are unpredictable that may lead to variations in treatment outcome. the immunological and ethical concerns due to allogenic embryonic stem cells may be overwhelmed by the use of postnatal stem cells. newer studies suggest that adult stem cells may have much greater plasticity than previously thought. there are various sources of stem cells in adult tissues, such as bone marrow, blood, brain, the eye, skeletal muscle, liver, dental pulp, skin, the lining of the gastrointestinal tract, and pancreas. bone marrow derived mesenchymal stem cells have been the most studied mesenchymal stem cells. further investigations revealed that these cells have intensive capacity of differentiation into neuron - like cells, adipocytic, osteocytic, and chondrocytic cells. moreover, dpscs demonstrated a higher developmental potential and longer life span than bone marrow stromal stem cells. this has been found that the number of proliferating cells as well as the frequency of colony - forming cells was significantly higher in dpscs when compared to bone marrow stromal stem cells too. on the other hand, dpscs can be cryopreserved and used for regenerative purposes later. based upon these findings, dental pulp stem cells may be considered appropriate cell types for developing tissue engineering strategies and finding ways to culture them outside the body with high efficiency is a great priority of stem cell research. unfortunately, the stem cell population in the pulp is very small ; approximately 1% of the total cells and the effect of aging reduce the cell pool available. as an important issue concerning the therapeutic use of stem cells is the quantity of cells necessary in order to achieve the best effect, harvesting and expanding the stem cells in culture are indispensable steps for regenerative medicine. hence, the goal of the present study was to design a modified dental pulp stem cell isolation method with high in vitro expansion potential and optimize the culture conditions for their increased proliferation. sixty impacted third molars used in this study were surgically removed from 45 healthy patients (18 - 30 years of age) by an oral surgeon. informed consent was obtained from the patients after receiving approval by the institutional ethics committee of kerman university of medical sciences (code : k/88/220). before extraction, each subject was screened for systemic diseases by a health history and oral questioning. after a rinse with 0.2% chlorhexidine for 60 s a topical anesthetic gel was applied and teeth were anesthetized using lidocaine 2% with epinephrine 1/80 000 (daroupakhsh, tehran, iran). teeth that were cut during surgery or presenting a localized infection in the region were excluded from the study. the teeth were immersed in sterile phosphate buffer saline (pbs), stored on ice pack and immediately transported to the cell culture lab for sample processing. after cleaning the surface and disinfection with iodine, a horizontal groove was cut along the cementum - enamel junction using diamond fissure bur (dandz., wiesbaden, germany) with high speed handpiece and copious water supply mounted on a high - speed hand piece to split the teeth and obtain the pulp tissue under sterile condition. the teeth were randomly divided into three groups. out of 60 samples, 20 were included in group i (digestion of pulp pieces by collagenase / dispase enzyme (roche, germany) and culture of the released cells following centrifugation) ; 20 in group ii (outgrowth of the cells by culture of undigested pulp pieces) and the remaining 20 samples were in group iii (digestion of pulp pieces and fixing them under a cover slip in the medium). in groups i and iii, the fragments were digested in a solution of 1 mg / ml collagenase / dispase for 30 min at 37c and centrifuged at 500 g for 5 min. cell suspensions were seeded in 60 mm culture dishes containing minimum essential medium alpha modification (-mem) ; with 20% fetal bovine serum (fbs), 100 u / ml penicillin - g, 100 g / ml streptomycin, and 1 g / ml amphotrypsin b. groups ii and iii received a coverslip to fix the tissue and prevent it from movement in the medium. cells were cryopreserved in a freezing medium composed of 65% -mem medium, 30% fbs, and 5% dmso and vials were stored in liquid nitrogen tank until used. the student t - test was used for comparing the mean values of three independent groups. the cells were cultured on cover slips, fixed with methanol acetone and stained with hoechst 33558 (sigma) as recommended by the company and observed under fluorescent microscope (axioplan 2, zeiss) to reveal any contaminant mycoplasma. rna - easy kit (qiagen, germany), according to manufacturer 's protocol was used. rna measuring 0.5 g was treated with rnase - free dnase i (fermentas, litany) to remove residual contamination with genomic dna. total dna mixed with 0.2 g of random hexamer and heated at 70c for 5 min. the mixture was immediately chilled on ice for 5 min followed by the addition of 6.5 l of a reverse transcription mixture prepared in a total volume of 19 l containing 4 l of 5 reaction buffer, 2 l of 10 mm dntp, 0.5 l rnase inhibitor. the mixture was incubated at 25c for 5 min and then 1 l m - ml v rt was added. subsequent polymerase chain reaction (pcr) was as follows : 1 l cdna, 1.5 mm mgcl2, 200 m dntp, 0.4 m of each specific primers and 1.25 unit/25 l reaction taq dna polymerase (cinnagen, iran). amplification was undertaken by initial at 94c for 5 min, denaturation at 94c for 30 s, annealing at 55c for 30 s, extension at 72c for 30 s and final extension at 72c for 5 min. specific primer pairs [table 1 ] were designed by the primer 3 program written by the whitehead institute and oligonucleotides were synthesized by isogen. the sequences of primers designed and used for regular rt - pcr experiments pcr products were size - fractionated on a 1.5% agarose gel and visualized by ethidium - bromide straining. the intensities of the pcr products were analyzed by gene tools software (syngene, cambridge, uk). sixty impacted third molars used in this study were surgically removed from 45 healthy patients (18 - 30 years of age) by an oral surgeon. informed consent was obtained from the patients after receiving approval by the institutional ethics committee of kerman university of medical sciences (code : k/88/220). before extraction, each subject was screened for systemic diseases by a health history and oral questioning. after a rinse with 0.2% chlorhexidine for 60 s a topical anesthetic gel was applied and teeth were anesthetized using lidocaine 2% with epinephrine 1/80 000 (daroupakhsh, tehran, iran). teeth that were cut during surgery or presenting a localized infection in the region were excluded from the study. the teeth were immersed in sterile phosphate buffer saline (pbs), stored on ice pack and immediately transported to the cell culture lab for sample processing. after cleaning the surface and disinfection with iodine, a horizontal groove was cut along the cementum - enamel junction using diamond fissure bur (dandz., wiesbaden, germany) with high speed handpiece and copious water supply mounted on a high - speed hand piece to split the teeth and obtain the pulp tissue under sterile condition. 20 were included in group i (digestion of pulp pieces by collagenase / dispase enzyme (roche, germany) and culture of the released cells following centrifugation) ; 20 in group ii (outgrowth of the cells by culture of undigested pulp pieces) and the remaining 20 samples were in group iii (digestion of pulp pieces and fixing them under a cover slip in the medium). in groups i and iii, the fragments were digested in a solution of 1 mg / ml collagenase / dispase for 30 min at 37c and centrifuged at 500 g for 5 min. cell suspensions were seeded in 60 mm culture dishes containing minimum essential medium alpha modification (-mem) ; with 20% fetal bovine serum (fbs), 100 u / ml penicillin - g, 100 g / ml streptomycin, and 1 g / ml amphotrypsin b. groups ii and iii received a coverslip to fix the tissue and prevent it from movement in the medium. cells were cryopreserved in a freezing medium composed of 65% -mem medium, 30% fbs, and 5% dmso and vials were stored in liquid nitrogen tank until used. the student t - test was used for comparing the mean values of three independent groups. the cells were cultured on cover slips, fixed with methanol acetone and stained with hoechst 33558 (sigma) as recommended by the company and observed under fluorescent microscope (axioplan 2, zeiss) to reveal any contaminant mycoplasma. rna - easy kit (qiagen, germany), according to manufacturer 's protocol was used. rna measuring 0.5 g was treated with rnase - free dnase i (fermentas, litany) to remove residual contamination with genomic dna. total dna mixed with 0.2 g of random hexamer and heated at 70c for 5 min. the mixture was immediately chilled on ice for 5 min followed by the addition of 6.5 l of a reverse transcription mixture prepared in a total volume of 19 l containing 4 l of 5 reaction buffer, 2 l of 10 mm dntp, 0.5 l rnase inhibitor. the mixture was incubated at 25c for 5 min and then 1 l m - ml v rt was added. subsequent polymerase chain reaction (pcr) was as follows : 1 l cdna, 1.5 mm mgcl2, 200 m dntp, 0.4 m of each specific primers and 1.25 unit/25 l reaction taq dna polymerase (cinnagen, iran). amplification was undertaken by initial at 94c for 5 min, denaturation at 94c for 30 s, annealing at 55c for 30 s, extension at 72c for 30 s and final extension at 72c for 5 min. specific primer pairs [table 1 ] were designed by the primer 3 program written by the whitehead institute and oligonucleotides were synthesized by isogen. the sequences of primers designed and used for regular rt - pcr experiments pcr products were size - fractionated on a 1.5% agarose gel and visualized by ethidium - bromide straining. the intensities of the pcr products were analyzed by gene tools software (syngene, cambridge, uk). digestion of pulp segments with collagenase / dispase destroys pulp scaffold, the spindle like cells are observed 2 - 3 days after primary culture (figure a, 100x). undigested pulp segments show an intact edge (figure b, 100x) and yield cell later than digested tissue in the outgrowth method 10 - 12 days were needed to allow sufficient numbers of cells. surprisingly, with the improved third method, only 1 or 2 days after the passage, heterogeneous fast growing populations of stem cells appeared. in this considerably high efficacy group, the result demonstrated that the third method was more efficient (more than 60%) and the second method was less efficient (about 10%) in stem cell isolation and this differences were statistically significant (p < 0.05). to check the cells for mycoplasma contamination we used hoechst staining solution. fluorescence microscopy revealed that the nucleus of the stem cells appeared as a blue ellips, which demonstrated that the cells were not contaminated. we sought to examine the expression of nucleostemin, oct-4, jmj2c and nanog as proliferation and self - renewal regulatory factors for stem cells. based on the rt - pcr and agarose gel electrophoresis, the cells from all groups expressed all the genes [figure 2 ]. expression of stem cell markers nucleostemin, jmjd2c, nanog and oct-4, in the stem cells derived from human adult dental pulp digestion of pulp segments with collagenase / dispase destroys pulp scaffold, the spindle like cells are observed 2 - 3 days after primary culture (figure a, 100x). undigested pulp segments show an intact edge (figure b, 100x) and yield cell later than digested tissue in the outgrowth method 10 - 12 days were needed to allow sufficient numbers of cells. surprisingly, with the improved third method, only 1 or 2 days after the passage, heterogeneous fast growing populations of stem cells appeared. in this considerably high efficacy group, the result demonstrated that the third method was more efficient (more than 60%) and the second method was less efficient (about 10%) in stem cell isolation and this differences were statistically significant (p < 0.05). to check the cells for mycoplasma contamination we used hoechst staining solution. fluorescence microscopy revealed that the nucleus of the stem cells appeared as a blue ellips, which demonstrated that the cells were not contaminated. we sought to examine the expression of nucleostemin, oct-4, jmj2c and nanog as proliferation and self - renewal regulatory factors for stem cells. based on the rt - pcr and agarose gel electrophoresis, the cells from all groups expressed all the genes [figure 2 ]. expression of stem cell markers nucleostemin, jmjd2c, nanog and oct-4, in the stem cells derived from human adult dental pulp the third molar is the last tooth to develop ; it is normally in an early stage of development. studies have shown that extracted nondecayed impacted third molars are capable of producing an optimum quantity of dental pulp tissue for the isolation of dpscs. another positive point is that harvesting stem cells from this unavailing tissue after extraction causes no ethical controversy. some indirect properties such as surface proteins, rapid cell cycle, clonogenicity, or an undifferentiated state offer significant implications for accuracy of diagnosis. in this study, the expression of some genes including nucleostemin, oct-4, and nanog, which are implicated in the proliferation and self - renewal of stem cells, was studied by rt - pcr assay. it is described as a p53 binding protein in the nucleoli of cancer cells, neural and embryogenic stem cells and placenta tissue, but not in terminally differentiated cells.. however, an increase of nucleostemin expression by rt - pcr could simply be the result of the proliferation of nucleostemin - positive cells, and not the result of promoting nucleostemin expression within each cell. however, the expression of nucleostemin is reported as strong signals from the nucleoli, which is much more specific compared to p63, and therefore, may be superior as a progenitor marker. nanog is a 305 amino acid protein with a conserved homeodomain belonging to the homeobox gene family. it was first described as a key transcription regulator defining human embryonic stem cell identity and self - renewal by both activating repressors of and suppressing activators of differentiation. down - regulation of nanog induces differentiation, and over - expression of nanog induces pluripotency, as shown by the capacity for multi - lineage differentiation and perpetual self - renewal of cells expressing this gene. the oct-4 gene influences several genes expressed during early embryonic development, and thus may play a vital role in the processes of development and cell differentiation. maintaining oct-4 expression within a certain range. however, increased oct-4 expression provokes differentiation to endoderm or mesoderm and decreased oct-4 expression is related to dedifferentiation to trophectoderm. as a whole, the expression of these genes in the isolated dental pulp cells indicates a potential role for them in controlling proliferation, survival, and self - renewal. due to the expression of nucleostemin, oct-4 and nanog in the cells from all groups, our results suggest that there exists a population of stem cells in the pulp. this finding is in line with many previous reports, and it implies that the cells isolated from dental pulp are bona fide stem cell. an important issue relevant to the therapeutic use of stem cells is the quantity of cells essential to attain an optimal effect. expanding stem cells in culture is a crucial step for regenerative medicine, and a considerable attempt has been made to assess the consequences of the cultivation on stem cell behavior. the first is the enzyme digestion method and the second one is the explant outgrowth method. due to the decreased cell viability related to the enzyme treatment method, the explant outgrowth one has been suggested as the method of choice. in this experiment, the isolation method had a bright effect on population expansion and our improved third method provided the greatest in vitro expansion than the two mentioned methods and may provide the most cells for biotechnological and biomedical applications. huang. compared the enzyme digestion and outgrowth methods and found that cells isolated by enzyme digestion had a higher proliferation rate than those isolated by the other one. although our result is similar to huang. study, it seems that the cells isolated by our improved method were less damaged and were therefore healthy enough to propagate longer in vitro than the other methods. perhaps the other methods damage the cells or alternatively removed critical elements from the endogenous niche. with our improved method, only 1 to 2 days after the primary culture, heterogeneous fast growing populations of stem cells appeared. odontoblasts, whose biological function is dentinogenesis, is part of the outer surface of the dental pulp. we hypothesize that possibly, there exists more than one type of stem cells in the pulp and different methods of isolation could result in different cell types. in conclusion, the results of the current study indicates that adult dental pulp contain stem cells that can be isolated and expanded efficiently. we suggest that further work in this area may provide an increased understanding of what is happening to these cells at harvest and over time in culture. this information is important in developing cell isolation procedures that produce the best chance for establishing the dpsc cells in vitro for later use in experiments and for biotechnology or cell therapies. | background : dental pulp stem cells can be used in regenerative endodontic therapy. the aim of this study was to introduce an efficient method for dental pulp stem cells isolation.materials and methods : in this in - vitro study, 60 extracted human third molars were split and pulp tissue was extracted. dental pulp stem cells were isolated by the following three different methods : (1) digestion of pulp by collagenase / dispase enzyme and culture of the released cells ; (2) outgrowth of the cells by culture of undigested pulp pieces ; (3) digestion of pulp tissue pieces and fixing them. the cells were cultured in minimum essential medium alpha modification (mem) medium supplemented with 20% fetal bovine serum(fbs) in humid 37c incubator with 5% co 2. the markers of stem cells were studied by reverse transcriptase polymerase chain reaction (pcr). the student t - test was used for comparing the means of independent groups. p < 0.05 was considered as significant.results:the results indicated that by the first method a few cell colonies with homogenous morphology were detectable after 4 days, while in the outgrowth method more time was needed (10 - 12 days) to allow sufficient numbers of heterogeneous phenotype stem cells to migrate out of tissue. interestingly, with the improved third method, we obtained stem cells successfully with about 60% efficiency after 2 days. the results of rt - pcr suggested the expression of nanog, oct-4, and nucleostemin markers in the isolated cells from dental pulps.conclusion:this study proposes a new method with high efficacy to obtain dental pulp stem cells in a short time. |
o2 battery has been widely investigated because of its extremely high theoretical energy density amounting to 3500 wh / kg for the overall battery reaction. in the past 10 years, significant progress has been realized in understanding the complex chemistry that governs the functioning of this battery system. this has resulted in several strategies for improving the performance of li o2 batteries. one deals with the reactivity of the porous carbon - based gas diffusion electrode with the electrolyte and the li2o2 discharge product. this was mitigated by the use of non - carbon porous electrodes made of gold, titanium carbide, metallic ti4o7, to name a few, or by the alternative strategy of coating the porous carbon substrate with a non - carbon - based material. another important step forward has been establishing the relationship between the electrolyte solvent donor number (dn) and the morphology of the peroxide that forms. the high solubility of the intermediate lio2 product in high - dn electrolytes leads to a solution - mediated li2o2 growth mechanism, resulting in toroids of li2o2 that are responsible for large discharge capacities. in contrast, low - dn electrolytes lead to a surface growth mechanism of li2o2, resulting in thin li2o2 films that restrict the capacity and reversibility. johnson. have pointed out that for 1,2-dimethoxyethane (dme), having an intermediate dn, both pathways for o2 reduction occur simultaneously at a high voltage. o2 battery is mainly governed by the generation and decomposition mechanism of li2o2, which itself is a poor ionic and electronic conductor. in addition, the oxygen species involved in the oxygen reduction reaction (orr) and in the inverse oxygen evolution reaction (oer) are highly reactive with the organic environment and traces of moisture, leading to the formation of parasitic products like li2co3, lioh, and co2 having a negative impact on li recent studies have shown that trace amounts of h2o can enhance the formation of li2o2 and thereby improve the performance of li o2 batteries. the water in the electrolytes catalyzes the reaction at the cathode, typically through the presence of ruthenium and manganese nanoparticles on carbon black, to form li2o2 and lioh during discharge. the formation of lioh occurs via the reaction of li2o2 with h2o, and decomposition appears possible below 3.2 v with ruthenium - based catalysts, making lioh an interesting cyclic discharge product for li highly cyclic crystalline lioh formation was achieved by adding lithium iodide (lii) to a dme / li electrolyte in combination with a graphene oxide electrode, in the absence and presence of h2o. the soluble lii redox mediator was shown to reduce the overpotential of the charge process, suggesting an iodine - mediated decomposition mechanism. if this decomposition mechanism results in oxygen evolution, it would make a new reversible mechanism for the li o2 battery, which is currently under debate as it has been proposed to be thermodynamically unfavorable and it has been suggested that i is oxidized rather than lioh. burke. have recently reported that the lioh crystallite was formed by a four - electron reduction process with the addition of lii and h2o in the dme electrolyte upon discharge ; however, the decomposition of the lioh crystallite was primarily attributed to iodo oxygen electrochemistry rather than reversible oxygen evolution. evidently, the performance of aprotic li o2 batteries is directly determined by the reversible formation mechanism of the discharge products, being either li2o2 or lioh. therefore, studying the nature and evolution of the discharge products, preferably under realistic operando conditions, is paramount for the future design of mechanisms and materials that aim to improve performance. in a previous work, operando x - ray diffraction (xrd) was used to study the decomposition of li2o2 in a tegdme electrolyte, showing that the decomposition mechanism via a substoichiometric li2xo2 proceeds during charging, in agreement with density functional theory (dft) predictions, and that thinner platelet crystallites decompose preferentially. the decomposition of individual li2o2 grains, by operando nanobeam synchrotron xrd, showed a slow concurrent li2o2 decomposition via the more reactive (001) facets. more operando xrd studies have explored the time - dependent formation and decomposition of li2o2 crystallites by comparing the changes in the li2o2 peak area and the full width at half - maximum (fwhm), revealing the character of the li2o2 crystallites during (dis)charge. however, no detailed insight exists for the formation of the li2o2 crystallites during discharge. moreover, little is known about the operando formation and decomposition of lioh presently under debate and how the presence of the lii redox mediator and water affects the structure of the formed species. in this work, operando xrd is used to reveal the detailed structural evolution during a complete (dis)charge cycle of li2o2 and lioh in dme and dme / lii electrolytes, respectively. detailed rietveld refinement of crystalline li2o2 and lioh formation and decomposition yields a model for the growth and decomposition process, providing novel insights into these relevant battery systems. the cathodes were prepared by coating a slurry of activated carbon (kuraray chemicals) and a lithiated nafion binder on carbon paper (spectracarb). the activated carbon was mixed with a nafion binder [5% in a mixture of lower aliphatic alcohols and water (aldrich) ] with a mass ratio of 60:40 in a milling bowl, and subsequently, an amount of n - methyl-2-pyrrolidone (nmp) (sigma - aldrich, anhydrous, 99.5%) was added to adjust the viscosity of the slurry. the slurry was coated on a sheet of carbon paper, and the coated activated carbon sheets were dried at 100 c for 24 h in a vacuum oven to remove surface - adsorbed water, after which 12.7 mm disks were punched out. the final carbon loading on the carbon paper was determined to be 3.04.0 mg. two different electrolyte solutions were used, each consisting of a dme (sigma - aldrich, > 99.5%) solvent that was further dried for several days over freshly activated molecular sieves (type 4) (sigma - aldrich) and lithium bis(trifluoromethanesulfonyl)imide salt (litfsi, 99.95%, aldrich), dried in a vacuum oven at 80 c for 24 h. one electrolyte consisted of a solution of 0.5 m litfsi dissolved in dme, while the other consisted of a solution of 0.05 m lii and 0.5 m litfsi dissolved in dme. these electrolytes will be termed the dme and dme / lii electrolytes, respectively. all the electrolyte preparations were performed in an argon - filled glovebox (h2o and o2 content of < 1 ppm). on the basis of the liquid chromatogram test, there is still a large amount of water (4000 ppm) in the electrolyte during the battery test. a li o2 battery designed and constructed in house was used for the operando x - ray diffraction measurements as described in detail elsewhere. the li o2 battery, comprising the cathode, a glass microfiber separator (whatman) soaked with the electrolyte, and a lithium metal anode, was assembled in the operando xrd battery in an argon - filled glovebox. the battery was subsequently connected to o2 (linde, 99.9999%) under a pressure of 0.5 bar where it was allowed to equilibrate for 3 h before it was tested. xrd measurements were taken using a panalytical xpert pro pw3040/60 diffractometer with cu k radiation operating at 45 kv and 40 ma in a 2 range of 3165. scans (each 30 min in duration) were recorded for the batteries during a complete (dis)charge cycle with a current density of 0.3 ma / cm. refinement of the diffraction data was performed using the rietveld method as implemented in the fullprof program. to more accurately fit the zero position (effectively positioned at a different height in the cathode) of the li2o2 diffraction pattern, peaks arising from the current collector as well as carbon paper were excluded from the fits. electrodes were rinsed with dry tetrahydrofuran (thf) prior to analysis, and samples were prepared in an argon - filled glovebox, using a stainless steel holder as the substrate and double - sided carbon tape as the contact point between the electrode and holder. samples were transferred into the scanning electron microscope (jeol jsm-6010la) under anaerobic conditions, and images were taken using an accelerating voltage of 5 kv. figure 1a depicts the (dis)charge curves obtained for the dme and dme / lii electrolytes at a current density of 0.3 ma / cm. for both electrolytes, a typical discharge plateau is observed around 2.7 v. the gradual decrease, resulting from an increasing overpotential, most likely reflects the increasing thickness of the insulating discharge products increasing the electrode s resistance. for the dme and dme / lii electrolytes, capacities of 2000 and 4000 mah / g, respectively, can be obtained when discharging to the cutoff voltage of 2.2 v versus li / li. during charging (oer), the voltage profile steadily increases toward a voltage plateau at 4.4 v for the dme electrolyte, whereas a continuously increasing voltage is observed for the dme / lii electrolyte between 3.5 and 4.5 v, which has been attributed to the electrochemical oxidation of lii. (a) galvanostatic (dis)charge profiles for the operando li o2 batteries with dme and dme / lii electrolytes in a 2.24.5 v voltage window vs (b) xrd patterns of a pristine cathode and the cathodes at the end of discharge, with a 2.2 v cutoff voltage, in the dme and dme / lii electrolytes, respectively. (c and d) sem images for the cathodes measured after discharge in dme and dme / lii electrolytes, respectively, at a current density of 0.3 ma / cm. ex situ xrd measurements were taken to identify the discharge products for the two different electrolytes. figure 1b presents the xrd patterns of the cathodes discharged to a 2.2 v cutoff voltage at a current density of 0.3 ma / cm in the dme and dme / lii electrolytes. compared to the xrd pattern of the pristine electrode, new diffraction peaks appear at around 33, 35, 41, 49, and 59 for the cathode discharged in the dme electrolyte, which can be attributed to the crystalline li2o2 phase. in the cathode discharged in the dme / lii electrolyte, the diffraction peaks at 32.5, 35.6, 49, 51.5, 56, and 62 can be indexed to crystalline lioh, the formation of which is attributed to the presence of lii and h2o in the electrolyte. the morphology of the discharge products in the dme and dme / lii electrolytes is shown in the sem images in panels c and d of figure 1. figure 1c shows the two types of primary aggregates observed for li2o2 in the dme electrolyte discharged down to 2.2 v. a fraction of the li2o2 particles aggregate with several parallel plates, resulting in a loosely stacked layer - by - layer toroid - like structure, and others stack more tightly to assemble into toroids. in addition, many individual li2o2 platelets are observed, distributed throughout the remaining space on the carbon cathode surface. the diameter of the platelet layers, stacked in toroids, is 2.0 m, and the thickness is between 0.5 and 0.8 m. prior reports have described li2o2 toroids as consisting of stacked platelets with a range of shapes and sizes in ether electrolytes. experimental studies performed at different current densities in a dme electrolyte by aetukuri. suggested that this was due to varying levels of water contamination in the cells and different discharge currents. described a particle growth mechanism in which nucleation progresses via a ring - shaped primary structure, rather than via a linear or hemispherical primary structure. in our work, the trace water left in the dme electrolyte and in the o2 supplemental system may be responsible for the formation of toroidal li2o2. recently, a number of studies have explored the formation of toroidal li2o2 ; however, there appears to be no clear consensus about the crystallite growth and aggregation mechanism. figure 1d shows the discharge product morphology of the cathode discharged in the dme / lii electrolyte representing thick lioh plates. the length of the lioh plates reaches up to tens of micrometers, and the thickness is in the range of 100200 nm. these lioh plates, forming on the activated carbon surface, are distinctly different from the glassy film lioh morphology on the carbon electrode during the orr process and from the flowerlike agglomerated lioh particles formed on the reduced graphene oxide cathode in li o2 batteries. operando xrd patterns were collected for the dme electrolyte during a complete (dis)charge cycle at a current density of 0.3 ma / cm. the two - dimensional contour xrd plot in the 2 regions of 32.433.4, 34.535.5, and 58.259.2 in figure 2 shows the evolution of the li2o2 { 100 }, { 101 }, and { 110 } reflections demonstrating the gradual formation and decomposition of li2o2. the { 101 } reflection is significantly broader than the { 100 } reflection, indicating anisotropic broadening of the li2o2 reflections in the { 00l } crystal plane direction. although it is not possible to distinguish between size and strain broadening, given the limited range of the 2 data, we assume the broadening to be a consequence of size broadening because electrochemically formed li2o2 is known to form toroidal aggregates consisting of stacked li2o2 crystalline platelets, with the plate normal in the { 00l } direction. two - dimensional contour plots (left) of the operando xrd patterns showing the 2 region between 32.4 and 33.4, 34.5 and 35.5, and 58.2 and 59.2 during a complete (dis)charge cycle demonstrating li2o2 formation (by the { 100 }, { 101 }, and { 110 } li2o2 indexed reflections) and decomposition in the li o2 battery was tested by using the dme - based electrolyte at a current density of 0.3 ma / cm. the integrated and normalized areas as a function of discharge time for the { 100 } and { 101 } reflections of li2o2 (figure s2) show a linear increase in the peak area during discharge. however, during charging, it decreases via two different stages, as reported previously. during the initial stage of charging, the integrated area decays very slowly, indicating preferential oxidation of the surface species (lio2 and o2) and/or an amorphous lithium component at the lower voltages (2.83.4 v), the latter possibly comprising an amorphous li2o2 species, or both amorphous li2o2 and side products arising from electrolyte degradation such as formate, that can be oxidized at relatively low potentials without a catalyst. in the second stage, the integrated li2o2 peak areas decrease linearly, indicating the oxidation of the crystalline fraction of li2o2. assuming that the observed anisotropic broadening of the xrd reflections is solely due to the crystallite size, the xrd patterns were refined with the fullprof program using a thompson cox hastings pseudo - voigt profile function based on spherical harmonics (sph) to fit the anisotropic size broadening. the broadening of each reflection translates in an apparent crystallite size in the direction perpendicular to the planes specified by the miller indices, shown for a number of reflections in figure s3. the large apparent size in the { 100 } direction, coincident with the a lattice parameter, compared to the { 004 } reflection, coincident with the c lattice parameter, is in agreement with the reported platelet - shaped li2o2 crystallites. when the crystallites are assumed to be platelets, cylinders with a large d / t (diameter / thickness) aspect ratio, the average apparent size of the li2o2 plates in the { 00l } direction represents the thickness of the plates, and the average apparent size in the { hk0 } direction, multiplied by 3/8, represents the average diameter of the cylinders. the evolution of the aspect ratio during the complete (dis)charge cycle is shown in figure 3b. finally, by taking into account the size broadening of all observed reflections, we can determine a detailed crystallite shape, images of which are shown in figure 3a at different stages during the complete (dis)charge cycle. ((b) aspect ratio of the li2o2 crystallite shape (diameter in the a (c) li2o2 lattice parameters, resulting from rietveld refinement during the full galvanostatic (dis)charge cycle in the dme electrolyte. in each panel, the blue line represents the voltage curve during the (dis)charge cycle at a current density of 0.3 ma / cm. during the discharge process, the d / t aspect ratio, shown in figure 3b, decreases drastically, indicating that on average the platelets become more isotropic in shape. during charging, the aspect ratio increases slightly, whereas at the end of charging, it decreases again. the evolution of the average crystallite shape, shown in figure 3a, demonstrates that the decrease in the d / t aspect ratio during discharge is caused by both an increase in average crystallite thickness and a decrease in average diameter. it should be realized that the crystallite dimensions, derived from the broadening of the xrd reflections, represent average values. therefore, the observed decrease in platelet width during discharge most likely does not indicate that the crystallite diameter decreases during li2o2 formation. it suggests that during discharge the li2o2 platelets that form progressively are more isotropically shaped, having a smaller diameter, thereby decreasing the average diameter. similarly, the increasing platelet thickness and diameter during charging, during decomposition of the li2o2 crystallites, imply that thin and small platelets are decomposed first during charging, consistent with previous work. the evolution of the li2o2 lattice parameters during the full (dis)charge cycle is shown in figure 3c. the a lattice parameter is practically constant during li2o2 formation and decomposition, whereas the c lattice parameter is 7.659 0.020 at the beginning of discharge and then decreases to 7.634 0.002 near the end of the discharge process. because li2o2 platelets with a thickness on the order of nanometers show an expansion in the average c lattice parameter due to surface relaxation, the decreasing c lattice parameter during discharge is consistent with the progressive formation of thicker, more isotropic platelets, consistent with the evolution of the crystallite shape in panels a and b of figure 3. during charging, the c lattice parameter is initially constant at 7.643 0.002 before it increases slightly to 7.651 0.063 toward the end of charging. as suggested previously, the increase in c lattice parameters during charging may be caused by the decomposition of li2o2 taking place via substoichiometric li2xo2 intermediates. previously, detailed rietveld refinement of operando xrd data performed during charging revealed the decomposition mechanism. at present, the formation of li2o2 during discharge is additionally studied by operando xrd. moreover, the better signal - to - noise ratio and better time resolution obtained allow a more detailed refinement of the anisotropic broadening of the xrd reflections during a full discharge charge cycle, giving insight into the evolution of the crystallite shape. on the basis of the evolution of the apparent crystallite shape of li2o2 and the aspect ratio d / t, the li2o2 crystallites follow a distinct formation and decomposition mechanism. as is well - known, the toroidal li2o2 particles consist of arrays of plateletlike li2o2 crystallites. during discharge, the thinner li2o2 crystallites, having a more anisotropic shape, form at the initial stages, whereas progressive discharging results in more isotropically shaped li2o2 crystallites. concurrently, several li2o2 crystallites aggregate to form toroidal li2o2 particles. in the meantime, small li2o2 crystallites with a less anisotropic shape are also formed. during charging, the relatively thin li2o2 anisotropic crystallites are oxidized first, followed by the thicker and more isotropic li2o2 crystallites. figure 4 presents the two - dimensional contour plots of the operando xrd patterns in the 2 regions of 31.533.5, 34.836.8, 50.552.5, 54.956.9, and 61.263.2, collected for the dme / lii electrolyte during a complete (dis)charge cycle at a current density of 0.3 ma / cm. the evolution of the { 101 }, { 110 }, { 200 }, { 112 }, and { 211 } reflections demonstrates the formation and decomposition of lioh crystallites during discharge and charge, respectively, also supported by the linear increase (discharge) and decrease (charge) in the integrated area of the lioh { 101 }, { 110 }, and { 200 } reflections shown in figure s5. two - dimensional contour plots (left) of the operando xrd patterns showing the 2 regions between 31.5 and 33.5, 34.8 and 36.8, 50.5 and 52.5, 54.9 and 56.9, and 61.2 and 63.2, during a complete (dis)charge cycle demonstrating lioh formation ({ 101 }, { 110 }, { 200 }, { 112 }, and { 211 } reflections) and decomposition. o2 battery was tested by using the dme / lii electrolyte at a current density of 0.3 ma / cm. the xrd reflections from the crystalline lioh show considerable anisotropic broadening as clearly observed in figure 4, where the { 101 } reflection appears to be much broader than the { 110 } and { 200 } reflections. analysis of the anisotropic broadening using fullprof as described in the previous section results in platelet - shaped lioh crystallites with the platelet normal aligned with the c lattice parameter, very similar to the li2o2 crystallites. sem images of lioh (figure 1d) show large grains, suggesting layered stacks of thin crystalline lioh plates. the evolution of the crystallite shape during the complete (dis)charge cycle is shown figure 5a, and the evolution of the resulting d / t (diameter / thickness) aspect ratio is shown in figure 5b. consistent with the constant width of the xrd reflections during discharge, the aspect ratio and crystallite shape remain constant during discharge. this indicates that the average crystallite shape and size do not evolve during discharge, indicating continuous nucleation and growth of lioh crystallites with a constant crystallite size distribution. this suggests a particle - by - particle nucleation and growth process, rather than concurrent growth of lioh crystallites, where the latter would lead to an increase in average crystallite size. in contrast, figure 5a shows that during charging the average crystallite dimensions increase significantly (see also figure s6). therefore, crystallite size evolution is highly asymmetric with respect to charge and discharge, indicating at a very different growth and decomposition mechanism. because lioh decomposition should reduce the crystallite size, and with the realization that the xrd results represent average crystallite sizes, this may be explained by preferential decomposition of the smallest lioh crystallites that will increase the average crystallite size. (b) aspect ratio of the lioh crystallite shape (diameter in the a (c) lioh lattice parameters, resulting from rietveld refinement during the full galvanostatic (dis)charge cycle in the dme / lii electrolyte. in each figure, the blue line represents the voltage curve during the full galvanostatic (dis)charge cycle in the dme / lii electrolyte at a current density of 0.3 ma / cm. the evolution of the lioh lattice parameters during discharge and charge is shown in figure 5c. in contrast, the c parameter increases near the end of discharge and decreases at the early stages of charging, after which it remains relatively stable until the end of charging. the crystallite size in the c direction, parallel to the platelet normal, is on average approximately 20 nm during charge and discharge. for nanostructured metal oxides, crystallite dimensions in the nanorange typically result in expansion of the lattice parameters, attributed to an increase in the surface energy due to larger exposed surfaces. as a consequence, because the average crystallite size does not change significantly during discharge, the increase in the c lattice parameter must have an origin different from that of the crystallite size. one possibility is the presence of li or oh vacancies, where the latter appears to be more relevant as the effect of oh vacancies has been studied in mg(oh)2 and lioh. in a lioh crystal, the li ions are located around the apexes of a square that slightly fold downward along a diagonal under the o atom of the oh ion. it is therefore likely that the presence of vacancies will affect the lattice parameters anisotropically. to investigate the dependence of the lattice parameters on the presence of vacancies, dft calculations were performed on a 2 2 2 supercell of lioh by removing one hydrogen atom, lithium atom, and oh ion from the supercell, resulting in h, li, and oh vacancies, respectively (figure s7). relaxation of the supercell with a single hydrogen vacancy in the oh layer results in an increase of the a lattice parameter and a decrease in the c lattice parameter (table s1). upon relaxation of the supercell with either a li or a oh vacancy, both structures show an increase in the c lattice parameter [li, 1.12% ; oh, 2.60% (table s1) ]. however, the supercell shows a decrease in the a lattice parameter (0.79%) for a li vacancy and an increase (1.05%) for a oh vacancy. moreover, according to the dft calculations, the formation energies of li, h, and oh vacancies are 1.399, 0.317, and 1.578 ev, respectively, suggesting that the oh vacancies are relatively stable in lioh (theoretical calculation and table s1). hence, the observed increase in the lioh c lattice parameter and the slight increase in the a lattice parameter at the end of discharge seen in figure 5c may be a consequence of the formation of oh vacancies in the lioh lattice. this may be rationalized as follows ; during the initial stages of discharge, h2o will be relatively abundant, resulting in the formation of lioh crystallites with a small number of oh vacancies. at the later stage of discharge, most of the h2o can be anticipated to be consumed, most likely the origin of the formation of oh substoichiometric li(oh)1x crystallites, explaining the observed increase in the c lattice parameter. during the initial stages of charging, the c lattice parameter decreases, suggesting that the oh vacancy rich li(oh)1x material is preferentially decomposed. to investigate the cyclic formation of lioh over multiple cycles, operando xrd was performed for the battery based on the dme / lii electrolyte during three (dis)charge cycles, restricted to a capacity of 1.5 mah at a current density of 0.3 ma / cm. the electrochemical curves for three cycles are shown in figure 6a, and the two - dimensional contour plots of the operando xrd patterns in figure 6b demonstrate the cyclic formation and decomposition of lioh crystallites during three discharge charge cycles. this gives direct evidence that lioh is a cyclic discharge product in the presence of a lii mediator over multiple cycles. additionally, the linear increase (discharge) and decrease (charge) in the integrated area of the lioh { 101 } and { 110 } reflections over three cycles as shown in figure s8 also support the formation and decomposition of crystalline lioh during (dis)charge. (b) two - dimensional contour plots of the operando xrd patterns showing the 2 region between 31.5 and 33.5 and between 34.8 and 36.8, during three complete discharge charge cycles demonstrating lioh formation ({ 101 } and { 110 } reflections) and decomposition using the dme / lii electrolyte employing a capacity - restricted cycling capacity of 1.5 mah at a current density of 0.3 ma / cm. to explore the influence of h2o on the formation of lioh, the li o2 battery, combining an activated carbon electrode and the dme / lii electrolyte, was (dis)charged while the cathode was being exposed to h2o - saturated o2. the (dis)charge curve obtained is shown in figure s9, where it is compared to that obtained for the same system exposed to dry o2 (results shown in figure 5). because of the presence of h2o in the provided o2 gas, the discharge overpotential for the h2o - saturated o2 battery is lower than that of its dry o2 counterpart. conversely, the charge overpotential for the h2o - saturated o2 battery is larger, possibly because of the higher discharge capacity and associated increased resistance of the insulating lioh crystallites and/or blocking of the gas diffusion electrode. the resulting operando xrd contour plots and the results from the rietveld refinement of the lioh structure are shown in figures s10 and s11, respectively. the evolution of the lioh reflections in the presence of h2o - saturated o2 is similar to that observed for the dry o2 shown in figure 4, indicating the formation and decomposition of crystalline lioh. the main difference caused by the presence of h2o - saturated o2 is that the intensities of the lioh reflections are larger and that the { 101 } reflection becomes sharper. these results indicate that larger lioh crystallites are generated during the discharge process because of the presence of h2o - saturated o2. both the apparent crystallite size and the lattice parameters evolve in a manner similar to that observed for dry o2, also indicating that small lioh crystallites are decomposed first during the charging process. in summary, from the detailed refinement of the cyclic appearance of the xrd lioh reflections in the dme / lii electrolyte, a formation and decomposition mechanism is shown in figure 7a. on the basis of the evolution of the apparent crystallite shape and the d / t aspect ratio of lioh, the lioh crystallites follow a continuous nucleation and growth mechanism with a constant crystallite size distribution during discharge. this mechanism represents a particle - by - particle rather than concurrent nucleation and growth process, forming the platelike lioh particles (figure 7b, images a, we expect that the low concentration of water in the electrolyte induces oh substoichiometric lioh, explaining the observed increase in the c lattice parameter. during charging, the average lioh crystallite dimensions increase significantly, whereas the aspect ratio and crystallite shape remain constant, suggesting that the smallest oh deficient lioh crystallites oxidize first (figure 7b, images d f). this indicates that the crystallite size and presence of vacancies are important parameters to consider when aiming to increase the charge rate and to decrease the charge overpotential. (a) voltage profile, including a schematic illustration of the formation and decomposition mechanism of the lioh platelet - shaped crystallites during the discharge charge process, as determined from refinement of the operando xrd patterns. (b) sem images recorded at different capacity stages of lioh formation and decomposition. operando x - ray diffraction is performed to investigate the structure evolution of li2o2 and lioh during discharging and charging in the li o2 battery employing a dme or dme / lii electrolyte in combination with an activated carbon cathode. in the dme electrolyte, li2o2 forms and decomposes reversibly as platelet crystallites with the normal of the platelet in the c lattice parameter direction. during discharge, the average li2o2 crystallite shape becomes more isotropic because of the formation of more isotropic crystallites. first, amorphous species and small li2o2 crystallites are oxidized, and second, the larger crystallites are decomposed. in the dme / lii electrolyte, lii appears to act as a redox mediator resulting in the cyclic formation of crystalline lioh over multiple cycles. during discharge, platelet lioh crystallites form, with the normal of the platelet in the c lattice parameter direction. as the average crystallite size and shape do not evolve during discharge, this indicates continuous, particle - by - particle nucleation and growth. the increase in the average c lattice parameter is, on the basis of dft calculations, proposed to be a result of the formation of oh vacancies in lioh, suggested to be a consequence of the depletion of water in the dme electrolyte during lioh formation. during decomposition during charging, the smallest oh deficient lioh crystallites decompose first, indicating that the decomposition of these particles is most facile. providing h2o - saturated o2 does not change the crystallite growth mechanism significantly ; however, the amount of crystalline lioh increases, consistent with the larger electrochemical discharge capacity. | the lithium air, or li o2, battery system is a promising electrochemical energy storage system because of its very high theoretical specific energy, as required by automotive applications. fundamental research has resulted in much progress in mitigating detrimental (electro)chemical processes ; however, the detailed structural evolution of the crystalline li2o2 and lioh discharge products, held at least partially responsible for the limited reversibility and poor rate performance, is hard to measure operando under realistic electrochemical conditions. this study uses rietveld refinement of operando x - ray diffraction data during a complete discharge charge cycle to reveal the detailed structural evolution of li2o2 and lioh crystallites in 1,2-dimethoxyethane (dme) and dme / lii electrolytes, respectively. the anisotropic broadened reflections confirm and quantify the platelet crystallite shape of li2o2 and lioh and show how the average crystallite shape evolves during discharge and charge. li2o2 is shown to form via a nucleation and growth mechanism, whereas the decomposition appears to start at the smallest li2o2 crystallite sizes because of their larger exposed surface. in the presence of lii, platelet lioh crystallites are formed by a particle - by - particle nucleation and growth process, and at the end of discharge, h2o depletion is suggested to result in substoichiometric li(oh)1x, which appears to be preferentially decomposed during charging. operando x - ray diffraction proves the cyclic formation and decomposition of the lioh crystallites in the presence of lii over multiple cycles, and the structural evolution provides key information for understanding and improving these highly relevant electrochemical systems. |
among the elderly, the prevalence of anxiety and mood disorders is fairly significant. in qubec, canada, 12% of seniors exhibit symptoms of this type.1 in france, in any given month, the prevalence of depression and anxiety in older individuals varies from 8% to 11%.2 older persons affected by a mental disorder frequently suffer from insomnia.3,4 in this regard, we know that the elderly often experience sleep disturbances or poor quality sleep. in the us5,6 as well as in qubec, one - third of the elderly questioned in brazil also experience these problems.8 included in the factors known to help to maintain sleep difficulties are dysfunctional beliefs and attitudes about sleep. these cognitions involved erroneous conceptions about the causes and consequences of insomnia, or unrealistic expectations in terms of what one s nights should be like.9 attitudes related to sleep also include too many thoughts and worries at bedtime ; these invasive thoughts that are difficult to suppress constitute an intrusive mental activity.10 as well, attempts to control such thoughts produce the opposite effect, and delay sleep.11 adults struggling with psychiatric disorders have more dysfunctional beliefs about sleep than people without psychiatric illness.12 dysfunctional beliefs about sleep have been linked to anxiety and depression in particular.1316 we also know that seniors who sleep poorly have more dysfunctional beliefs about sleep than those who sleep well.17 a recent study, performed with adult participants, examined the presence of dysfunctional beliefs about sleep in five groups of people : good sleepers, primary insomnia patients, insomnia patients with anxiety, insomnia patients with depression, and insomnia patients with anxiety and depression. patients suffering from insomnia with the latter group of patients also had more dysfunctional beliefs about sleep than good sleepers.16 in turn, dysfunctional sleep - related attitudes such as thinking too much or worrying, which have been associated with sleep problems,17,18 have also been linked to anxiety in the elderly1923 and to depression.2024 ruminations and worrying are seen as part of a single variable, termed repetitive thoughts, which has been associated with anxiety and mood disorders in an adult population.25 another study, this time involving seniors, instead found that these two processes were distinct from one another,26 but they did not specifically concern sleep. so it would appear relevant to verify the links between an elderly clientele and cognitions directly related to sleep, in the study of these two categories of mental disorders, so as to provide some interesting specifications in the areas of both detection and intervention. earlier studies have involved small groups or an adult clientele, and beliefs were grouped into more general areas or separated out according to their short- or long - term consequences. dysfunctional sleep - related attitudes have also been studied in small or very old (individuals aged 85 years and older) samples, most often by examining the overall scores for worries or the most frequent types of worries, which were not, however, related to sleep. the first objective of this study is to identify the maladaptive sleep - related cognitions most often maintained by the elderly, according to the presence or absence of anxiety and mood disorders. the presence of dysfunctional sleep - related beliefs and attitudes at bedtime in asymptomatic, depressive, and anxious seniors will thus be compared. the second objective is to verify the relationships between the various dysfunctional cognitions and mental disorders. a few studies on the beliefs of the elderly have analyzed associations involving these cognitions ; however, the predictive aspect of dysfunctional sleep - related beliefs and attitudes in terms of mental disorders has not yet, to our knowledge, been evaluated for each of them. when these various beliefs and attitudes have been analyzed, it has usually been a matter of verifying the internal coherence or validity of a particular tool as such. the clarifications thus obtained will make it possible to improve detection, assessment, and intervention processes regarding anxiety or mood disorders, by pinpointing the most direct link between each of the dysfunctional cognitions and the two types of mental disorders, and not just the link to sleep problems. data for this cross - sectional study were obtained from the longitudinal qubec survey on seniors health (enqute sur la sant des ans [esa ]) conducted in 20052008.27 the aim of the esa study was to assess the physical and mental health of the french - speaking community - dwelling population aged over 65 years in the province of qubec, canada. a sampling strategy based on geographic location and the random generation of telephone numbers was used to recruit the participants (n=2,759) in this study. the responses obtained came from 90-minute - long interviews administered by health professionals at the participant s home. these health professionals had earlier been given 2 days of training on the computer - assisted questionnaire, which is similar to the diagnostic interview schedule, with its proven validity and reliability,28 and which was adapted for older persons.1,29 the interview also included items on sociodemographic data and sleep. some of the questions verified sleep - related behavior and cognitions, and these items were derived from the dysfunctional beliefs and attitudes about sleep scale developed by morin.18 the goal of the study was explained to the participants, who then signed a consent form and received financial compensation of cad $ 30. the participants were living in 16 different regions of qubec, canada ; they were all at least 65 years of age, and their mean age was 73.8 years. women represented 59.0% of the participants, and 58.1% of the seniors were under 75 years of age. nearly 54% of the participants reported that they had no spouse, and more than 35% had a postsecondary level of schooling. close to half of the participants had an annual household income of under $ 25,000. finally, the participants sleep efficiency (that is, the ratio of time spent sleeping to the time spent in bed) was found to be over 80% for 71.6% of the seniors selected for this study. sleep efficiency was evaluated based on the participant s bedtime, the time taken to fall asleep, the number and duration of awakenings, etc, and was calculated based on the total sleep time divided by the time spent in bed, multiplied by 100. the former are connected with the following statements : i need eight hours of sleep to feel refreshed and function well during the day, since i m getting older, i should go to bed earlier at night, when i find it hard to fall asleep, i should stay in bed and keep trying to sleep, it s normal not to sleep as well when we get older, and when i ve had a bad night, i should stay in bed longer in the morning to try to recover. for the purposes of the statistical analyses, these answers were then divided into two categories : that is, totally disagree, agree a bit or generally agree and very much agree or totally agree. the dysfunctional attitudes were also identified as : having a lot of worries in my mind before going to bed at night, having a lot of thoughts in my head before going to bed at night, and being worried about the idea of sleeping when i go to bed at night., a bit, moderately, a lot, and these answers were divided into two categories : that is, not at all or a bit and moderately, a lot, or extremely. the covariables under study are sex, age (over or under 75 years), marital situation (living as a couple or not), annual household income (over or under $ 25,000), schooling (postsecondary schooling or not), and sleep efficiency (evaluated at over 80% or not). in terms of anxiety and mood disorders, the participants were divided into three groups based on diagnostic and statistical manual of mental disorders (dsm)-iv - text revision (tr) diagnostic criteria. the 161 participants in the depressive group presented major depression, minor depression, or mania. the 103 participants in the anxious group met the diagnostic criteria for obsessive - compulsive disorder, generalized anxiety disorder, panic disorder, or a specific or social phobia. the 2,495 participants in the asymptomatic group did not suffer from a mood or anxiety disorder. the 28 participants presenting both an anxiety and mood disorder were excluded because they were too few in number. first of all, chi - squared tests including all of the variables and covariables were conducted to obtain an overall profile of the three groups under study, and to identify the differences between them. next, a fully adjusted model was used to evaluate the distinct probability of suffering from an anxiety or mood disorder according to the sleep - related cognitions adopted or not adopted. the statistical analysis thus enables us to take the contribution of the other variables investigated into account and to determine the distinct significant associations. the statistical analyses were performed using pasw statistics (v18.0), and the threshold of significance was set at p<0.05. data for this cross - sectional study were obtained from the longitudinal qubec survey on seniors health (enqute sur la sant des ans [esa ]) conducted in 20052008.27 the aim of the esa study was to assess the physical and mental health of the french - speaking community - dwelling population aged over 65 years in the province of qubec, canada. a sampling strategy based on geographic location and the random generation of telephone numbers was used to recruit the participants (n=2,759) in this study. the responses obtained came from 90-minute - long interviews administered by health professionals at the participant s home. these health professionals had earlier been given 2 days of training on the computer - assisted questionnaire, which is similar to the diagnostic interview schedule, with its proven validity and reliability,28 and which was adapted for older persons.1,29 the interview also included items on sociodemographic data and sleep. some of the questions verified sleep - related behavior and cognitions, and these items were derived from the dysfunctional beliefs and attitudes about sleep scale developed by morin.18 the goal of the study was explained to the participants, who then signed a consent form and received financial compensation of cad $ 30. the participants were living in 16 different regions of qubec, canada ; they were all at least 65 years of age, and their mean age was 73.8 years. women represented 59.0% of the participants, and 58.1% of the seniors were under 75 years of age. nearly 54% of the participants reported that they had no spouse, and more than 35% had a postsecondary level of schooling. close to half of the participants had an annual household income of under $ 25,000. finally, the participants sleep efficiency (that is, the ratio of time spent sleeping to the time spent in bed) was found to be over 80% for 71.6% of the seniors selected for this study. sleep efficiency was evaluated based on the participant s bedtime, the time taken to fall asleep, the number and duration of awakenings, etc, and was calculated based on the total sleep time divided by the time spent in bed, multiplied by 100. the former are connected with the following statements : i need eight hours of sleep to feel refreshed and function well during the day, since i m getting older, i should go to bed earlier at night, when i find it hard to fall asleep, i should stay in bed and keep trying to sleep, it s normal not to sleep as well when we get older, and when i ve had a bad night, i should stay in bed longer in the morning to try to recover. for the purposes of the statistical analyses, these answers were then divided into two categories : that is, totally disagree, agree a bit or generally agree and very much agree or totally agree. the dysfunctional attitudes were also identified as : having a lot of worries in my mind before going to bed at night, having a lot of thoughts in my head before going to bed at night, and being worried about the idea of sleeping when i go to bed at night., a bit, moderately, a lot, and these answers were divided into two categories : that is, not at all or a bit and moderately, a lot, or extremely. the covariables under study are sex, age (over or under 75 years), marital situation (living as a couple or not), annual household income (over or under $ 25,000), schooling (postsecondary schooling or not), and sleep efficiency (evaluated at over 80% or not). in terms of anxiety and mood disorders, the participants were divided into three groups based on diagnostic and statistical manual of mental disorders (dsm)-iv - text revision (tr) diagnostic criteria. the 161 participants in the depressive group presented major depression, minor depression, or mania. the 103 participants in the anxious group met the diagnostic criteria for obsessive - compulsive disorder, generalized anxiety disorder, panic disorder, or a specific or social phobia. the 2,495 participants in the asymptomatic group did not suffer from a mood or anxiety disorder. the 28 participants presenting both an anxiety and mood disorder were excluded because they were too few in number. first of all, chi - squared tests including all of the variables and covariables were conducted to obtain an overall profile of the three groups under study, and to identify the differences between them. next, a fully adjusted model was used to evaluate the distinct probability of suffering from an anxiety or mood disorder according to the sleep - related cognitions adopted or not adopted. the statistical analysis thus enables us to take the contribution of the other variables investigated into account and to determine the distinct significant associations. the statistical analyses were performed using pasw statistics (v18.0), and the threshold of significance was set at p<0.05. the descriptive statistics according to the presence or absence of an anxiety or mood disorder are presented in table 1, which shows the prevalence of the sleep - related cognitions. the belief i need eight hours of sleep to feel rested and to function properly the next day is by far the most popular of the beliefs, followed by it s normal not to sleep as well when we get older. these two beliefs are shared equally among all the groups, including the seniors not suffering from any mental disorder. more anxious seniors adopt the belief when i find it hard to fall asleep, i should stay in bed and keep trying to sleep than depressive or asymptomatic older persons. when i ve had a bad night, i should stay in bed longer in the morning to try to recover in higher proportions than asymptomatic older individuals, but this is the least frequent problematic belief. with regard to the three dysfunctional sleep - related attitudes, when we calculate the average proportion of seniors without a mental disorder reporting these attitudes, we find that less than one - third of the people in this group adopt such attitudes. more specifically, however, the dysfunctional attitude having a lot of thoughts in my head before going to bed at night is the most frequent in the asymptomatic seniors. this attitude (having a lot of thoughts in my head before going to bed at night) is the most frequent of the three attitudes, and occurs in 73% of the older persons with a mental disorder. finally, anxious individuals more often have the attitude being worried about the idea of sleeping when i go to bed at night than asymptomatic persons. with regard to having a lot of worries in my mind before going to bed at night, more than half of the depressive individuals adopt this attitude, compared with only nearly one - quarter of the asymptomatic or anxious individuals. the results of the regression analysis (table 2) show that, all things being equal, moreover, the beliefs i need eight hours of sleep to feel rested and to function properly the next day, since i m getting older, i should go to bed earlier at night, and when i ve had a bad night, i should stay in bed longer in the morning to try to recover do not enable one to predict the fact of belonging to one of the three groups. the probability of suffering from anxiety is greater if one holds the belief when i find it hard to fall asleep, i should stay in bed and keep trying to sleep and if one worries about the idea of sleeping at bedtime. it s normal not to sleep as well when we get older is linked to the risk of suffering from an anxiety disorder. in fact, holding this belief is associated with the likelihood of being depressive rather than anxious. having many worries at bedtime is linked to the probability of suffering from the two types of mental disorders, but not adopting this dysfunctional attitude is associated with the likelihood of being depressive rather than anxious. finally, having many thoughts at bedtime is associated with the risk of suffering from a mood disorder. also, no problems of multicollinearity were found, as the statistical tolerance level obtained was higher than 0.20. the first objective of this study was to identify the sleep - related cognitions that the elderly most often deal with according to the presence or absence of a mental disorder. the beliefs i need eight hours of sleep to feel rested and to function properly the next day and it s normal not to sleep as well when we get older are the ones most frequently held by the seniors participating in our study. overall, 56% of the participants said that they generally, very much, or totally agreed with the first belief, and 37% with the second. these beliefs were found just as often in asymptomatic older persons as in those presenting an anxiety or mood disorder. a meta - analysis published in 2004 pertaining to the sleep of 3,600 individuals from 5102 years of age has given us normative data on sleep duration and sleep latency for people of various ages.31 the average duration of sleep was approximately 6.25 hours at 65 years of age and 5.83 hours at 80 years of age. in the elderly, the average sleep latency was about 1819 minutes. studies conducted subsequently have arrived at similar results, but with sleep latencies of approximately 30 minutes for older women.3236 large individual differences were found for both the duration of sleep and the time taken to fall asleep. based on the results that they obtained, the authors of the meta - analysis concluded that, after 60 years of age, only sleep efficiency continued to decline, and that the other sleep parameters did not vary. the time taken to fall asleep increased by an average of 10 minutes between the ages of 20 and 80 years.31 believing that one absolutely must sleep 8 hours to function properly can trigger performance anxiety (especially when an individual is unable to sleep long enough) and may lead to insomnia.17 also, the total duration of sleep is not a good indicator for distinguishing between good and poor sleepers in the senior population.37 geriatric sleep experts claim that it is sleep efficiency, rather than its duration, that should be the primary objective to target in elderly individuals wishing to maintain good health and a good quality of sleep over the years.38 one might be tempted to believe that sleep problems are linked to certain developmental changes affecting the elderly rather than to a mental disorder. indeed, we know that with advancing age, the time spent in bed tends to increase, without the number of hours of actual sleep changing very much.39 believing that it is normal to not sleep well as one ages can lead to a feeling of resignation that does not encourage the individual to seek out the causes of and solutions for the sleep problems experienced. in terms of sleep - related attitudes, having a lot of thoughts in one s head at bedtime proved to be most frequent in seniors presenting a mental disorder, with 73% of them experiencing this situation moderately, a lot, or extremely. the statistical regression that we performed enabled us to more specifically associate this with depression. the main finding regarding the second objective is that once we have controlled for the other factors, we were able to specifically link two sleep - related beliefs and all the sleep - related attitudes studied to the probability of being anxious or depressive. previously conducted studies had shown that adults struggling with psychiatric disorders hold more dysfunctional cognitions about sleep than people without psychiatric illness and that older persons experiencing poor sleep have more dysfunctional cognitions about sleep than seniors who sleep well. the present study offers a significant contribution to the state of knowledge on this subject by revealing that, in general, in the elderly, having dysfunctional sleep cognitions is associated with the presence of anxiety or mood disorders, independently of the quality of sleep. insomnia was long considered merely as a symptom of anxiety or mood disorders, without existing by itself. it is now known that insomnia may precede the appearance of a mental disorder, appear at the same time, or appear afterward. this concept is adopted by the new diagnostic criteria of the dsm-5 with insomnia as a primary diagnosis even when comorbid with other mental or medical disorders. we now see that there are direct links between sleep - related cognitions and anxiety and mood disorders. longitudinal studies could be performed to more precisely determine the direction and nature of the associations that we found between the variables studied. it will then be possible to further clarify and specify the role of sleep cognitions in explanatory models for insomnia and anxiety and mood disorders. since we now know that several dysfunctional cognitions are more often manifested in seniors suffering from a mental disorder, dysfunctional beliefs and attitudes should be the focus of evaluation during interventions concerning sleep.3,14,15,40,41 more concretely, it is to the advantage of health professionals who observe that elderly individuals are reporting many thoughts or worries at bedtime, including worries about sleep, to know that these cognitions have been shown to be linked to one or both types of mental disorders. they can then further investigate the possible presence of these disorders. providing psychoeducation about sleep, in order to counter erroneous beliefs, could also be used as a quick and easy means of prevention. in terms of intervention, cognitive behavioral therapies targeted to dysfunctional cognitions have been shown to have good results in combating sleep problems,14 which often occur in people dealing with anxiety and mood disorders.3,4 few studies have explored the relationship of the various sleep - related cognitions to mental disorders, and these few studies have used small, clinical samples or have grouped the various cognitions into different areas or by calculating the total scores for them. the present study stands out positively from the other studies due to its large overall sampling size and randomly selected composition. the characteristics of this sample are comparable to those of the general population, although this is limited to the elderly population of qubec, canada. nor is any particular group underrepresented in the present study (whether this be men or individuals over 75 years of age). in our study, 41% of the participants are men ; this is quite an interesting proportion, in that it differs from that in many other studies which only include women or a higher percentage of women. as well, assignment of the participants to the groups of anxious or depressive persons was based on the dsm diagnostic criteria. despite the strengths of the present study, the results obtained should be interpreted with caution in the light of certain potential limitations. first, this cross - sectional study does not enable one to assign causality to the variables. second, the participants sleep efficiency was self - reported information, so may deviate from the real situation. third, some potentially confounding variables such as physical illnesses or the use of medications were not taken into account. | purposethe objective of this study was to identify the maladaptive sleep - related cognitions most often maintained by the elderly, according to the presence or absence of anxiety and mood disorders. the presence of dysfunctional sleep - related beliefs and attitudes at bedtime in asymptomatic, depressive, and anxious seniors was thus compared. the second objective was to verify the relationships between various dysfunctional cognitions and mental disorders.methodthe sample in this study consisted of 2,759 participants aged 65 years and over, with a mean age of 73.8 years. they were recruited through a method of random generation of telephone numbers according to a sampling strategy based on geographic location. after the goal of the study was explained to them, the participants agreed to have health professionals visit their home and to answer questions in a 1.5-hour - long structured interview (after signing a consent form).resultsdepressive and anxious seniors adopt dysfunctional sleep - related cognitions in higher proportions than asymptomatic older persons. once we had controlled for the other factors, we were able to specifically link two sleep - related beliefs and all the sleep - related attitudes studied to the probability of being anxious or depressive.conclusionthe clarifications obtained will make it possible to improve detection, assessment, and intervention processes regarding anxiety or mood disorders, by pinpointing the most direct link between each of the dysfunctional cognitions and the two types of mental disorders, and not just the link to sleep problems. |
systemic lupus erythematosus (sle) is a chronic systemic autoimmune disease that is caused by the loss of tolerance to one s own antigens and the production of autoantibodies forming immune complexes that are deposited in various organs, which induces an inflammatory response. sle development is triggered by genetic, environmental, infectious, and hormonal factors [1, 2 ]. women are more frequently affected than men (incidence ratio : 8 - 13 : 1) [14 ]. sle onset before puberty and in the elderly is uncommon [1, 510 ]. the incidence in children was estimated at 0.36 - 0.9/100,000 children / year, morbidity : 3.3 - 24/100,000 children / year. the diagnosis of sle is currently performed with the use of slicc criteria (systemic lupus international collaborating clinics). sle manifests with a broad spectrum of clinical signs, high variability of severity, and various response to implemented treatment [1, 3, 5, 1115 ]. 50 - 70% adults with sle and 37 - 82% of children [58 ]. at the early stages of sle the clinical signs of ln occur only in 25 - 40% of patients [13, 58 ] and may present as minor abnormalities in the urine (microhaematuria and/or proteinuria and/or leukocyturia) or as nephrotic syndrome, nephritic syndrome, hypertension, or renal failure [13, 710 ]. prior to the decision of treatment of ln it is recommended to perform renal biopsy [13, 16, 17 ]. nowadays, renal histological examination is classified with the use of the isn / rps scale (international society of nephrology / renal pathology society). the treatment of adults and children with active sle may be divided into two stages [1719 ] : remission induction, aiming at the fastest possible (usually 3 - 6 months) regression of symptoms [3, 1722 ] by the administration of immunosuppressive drugs : cyclophosphamide [2328 ] or mycophenolate mofetil [2931 ] combined with glucocorticosteroids [1719, 2227 ], cyclosporin a, rituximab ; new biological therapies (belimumab, epratuzumab, ocrelizumab) [3437 ], and in particular clinical situations plasmapheresis and renal replacement therapy [3, 1720 ] ; supportive treatment with the fewest drugs administered in the lowest effective doses, which maintains the remission. there are no clear guidelines as regards the duration and ways of termination of supportive treatment [3, 1721 ]. the minimal period of three years of supportive treatment is recommended in ln patients with a complete or at least partial response to treatment. drugs which may be used in the supportive treatment are azathioprine (aza) [17, 18, 27, 28 ] or mycophenolate mofetil (mmf) [17, 18, 2931 ] and then prednisone in monotherapy [17, 18 ]. moreover, long - term administration of an antimalarial drug (chloroquine) is recommended becuase it reduces the risk of renal exacerbations, permanent renal injury, thrombotic episodes, and the number of deaths [3, 17, 20, 38 ]. if ln occurs with proteinuria of over 0.5 g / day or hypertension, it is necessary to introduce the inhibitors of renin - angiotensin - aldosterone system [1720 ]. however, in spite of treatment, 10 - 20% of ln patients develop end - stage renal failure [3, 58, 17, 18 ]. the development in sle diagnosis and treatment leads to an improvement in the prognosis [13, 6, 10, 1315 ]. however, the comparison with the general population shows a 2 - 5-fold higher risk of death in sle patients. the clinical factors of poor prognosis in sle include : young age at onset, initial high activity of the disease, severe nephropathy, and central nervous system involvement [13, 5, 9, 10 ]. data collected worldwide show that the clinical course of sle in children is more severe in comparison with adults [1, 5, 10 ]. the aim of the study was to assess the clinical and morphological presentation and treatment outcomes in children with ln in a paediatric nephrology centre during 10 years. the study included 18 children (16 girls and 2 boys) with sle diagnosed at the average age of 14.4 1.86 years. the children were hospitalised due to ln in the university hospital in the years 2004 - 2014. the following elements were considered in the assessment : the age of sle onset, the type of non - renal manifestations, the age of ln onset, clinical picture of nephropathy (microhaematuria, leukocyturia, proteinuria, nephrotic syndrome, hypertension, renal failure), activity of disease, renal biopsy result, recurrences of the disease, and complications. the patient may be diagnosed with sle if at least four clinical and immunological criteria are met, including at least one clinical and one immunological criterion, or if biopsy confirms the diagnosis of ln with the presence of ana or anti - dsdna antibodies. the assessment of the activity of disease was performed with the sledai scale (sle disease activity index). the activity of disease was classified as high with the score of 25 points, moderate with 16 - 24 points, and low with 15 sledai points. biopsy was not performed before treatment in a 17.5-year - old girl with severe mental impairment and critical state. prior to obtaining renal biopsy results all the children with ln were administered prednisone (encorton) at 1.5 - 2 mg / kg / day (max. 60 mg / day) and/or pulses of intravenous methylprednisolone (mp) 10 - 15 mg / kg (max. 1000 mg / pulse), then prednisone 1 mg / kg / day with the dose reduced individually. induction therapy included cyclophosphamide (cyp) pulses in 16 children and mmf in two children. fourteen children were administered intravenous cyp according to the national institute of health - nih guidelines at a dose of 750 mg / m (max. 1000 mg / infusion) modified according to leukocytosis and gfr levels. the regimen was : once a month for six months, then once every three months. two children were administered cyp according to euro - lupus regimen, i.e. six infusions of 500 mg every two weeks. two children were administered mmf at a maximum dose of 1200 mg / m with prednisone at 1 mg / kg / day. apart from immunosuppressive drugs, the induction therapy in five children with renal failure and/or multiorgan failure and/or septicaemia was combined with renal replacement therapy : haemodialysis (hd), continuous veno - venous haemodiafiltration (cvvhdf) and plasmapheresis (pe) four children. all the children with proteinuria were administered an angiotensin - converting - enzyme inhibitor (acei) : enalapril maleate at 2.5 - 10 mg / day or angiotensin receptor blocker (arb) : losartan 25 - 50 mg / day. hypertension was treated with acei, arb or betablocker : amlodipine at 2.5 - 10 mg / day. supportive treatment included aza for 2 - 5 years or mmf for 2 years with prednisone at an individually decreased dose, then prednisone as monotherapy. at baseline all the patients underwent the following tests : complete blood count, glucose, urea levels, c3 and c4 complement component, ana and ds - dna antibody titres, creatinine, and creatinine clearance (calculated with schwartz equation). prior to the treatment all the patients underwent ophthalmological examination, chest x - ray, ecg, and abdominal ultrasound. throughout ln treatment with immunosuppressive drugs and prednisone ophthalmological examination ln remission was reported if serum creatinine normalszed appropriately for the child s age and gfr was > 90 ml / min/1.73 m, proteinuria < 0.5 g / day, ana 1 : 80. clinical data of 18 ln children, renal biopsy result, and the type of treatment are presented in table 1. the average observation period until 18 years of age was 33.4 26.13 months in 15 children and 16.3 16.19 months in the remaining three children. clinical date, renal biopsy results, and treatment in children with lupus nephritis ln lupus nephritis, n number, f female, m male, yrs years, sledai sle disease activity index, obs. observation, aki acute renal injury, ht hypertension, ns nephrotic syndrome, ins / rps international society of nephrology / renal pathology society classification, g chronic, mp iv intravenous methylprednisolone pulse, cyp cyclophosphamide pulse, nih national institute of health - nih guidelines, euro - lupus euro - lupus regimen, mmf mycophenolate mofetil, i induction, s supportive, aza azathioprine, p chloroquine during the prodromal period of sle the following non - specific clinical manifestations were reported : weakness in 10 children (55.6%), recurrent fever in 10 children (55.6%), body weight reduction in seven children (38.9%), headache in four children (22.2%), and recurrent diarrhoea in three children (16.7%). the most common initial sle clinical manifestations in the study group were : haematologic in 14 children (77.8%), musculoskeletal in 13 children (72.2%), and cutaneous in 12 children (66.7%). the involvement of vital organs was reported in eight children (44.4%) including : heart in four children (pericarditis in two children, libman - sacks endocarditis in one child, dilated cardiomyopathy in one child), central nervous system in five children (headache in three children, convulsions in two children, depressive symptoms in one child), and respiratory insufficiency in one child. the results of ana testing showed the titres from 1 : 160 to 1 : 5120 (table 1). the presence of ds - dna was reported in 11 children (61.2%), the reduction of c3 complement in 12 children (66.7%), and c4 in 14 children (77.7%). the average activity of disease at onset according to sledai was 23.2 4.98 points (fig. 1) and was assessed as high in 44.4% of children and moderate in 55.6% children. the ratio of non - renal to renal symptoms was 57% : 43% (table 1). systemic lupus erythematosus disease activity index (sledai), glomerular filtration rate (gfr) and mean proteinuria at the onset and at the end of observation of children with lupus nephritis the signs of ln were reported in the first four months (average : 79 77.6 days) since sle onset. all the children had microhaematuria and proteinuria at the average level of 92.5 66.4 mg / kg/24 h. nephrotic syndrome was diagnosed in 15 children (83.3%), hypertension in 13 children (72.2%), and acute renal injury in 15 children (83.3%). 2). clinical presentation lupus nephritis in children renal biopsy was performed in 17 children between days 7 and 64 (average 38 days) after the onset of nephropathy. renal biopsy most commonly revealed ln class iv according to isn / rps (table 1). seventeen children were administered 3 - 13 (average : 6.6 3.55) mp pulses, and one child was treated with oral prednisone. fourteen patients treated with intravenous cyp according to nih regimen were administered the average of 107.2 61.79 mg / kg / treatment (i.e 5.5 2.71 g / treatment). cyp pulse therapy lasted for the average of 9.6 7.66 months and depended on the clinical status of the patient and the activity of disease. one girl (patient 15, table 1) developed pneumonia with underlying aspergillus infection, which excluded her from further cyp treatment. she was continued on oral steroids in combination with aza. two girls (patients 8 and 11) were administered only four and three cyp pulses, respectively, before they turned 18 and were transferred to nephrological centres for adults. the highest number of cyp pulses (13) were administered over 27 months to a boy (patient 12) who, at the critical state at the beginning of the disease (septicaemia, multiorgan failure, pulmonary oedema, dilated cardiomyopathy, anuria), was treated with cvvhdf and plasmapheresis (nine procedures). a similar induction treatment regimen : cyp (500 mg / infusion), plasmapheresis (6 - 9 procedures) and renal replacement therapy (hd two children, cvvhdf two children) was implemented in four children (patient 7, 8, 10, 16). throughout cyp treatment according to nih regimen, the following complications were observed : leukopaenia in 10 children (71.4%), nausea in 10 children (71.1%), hair thinning in eight children (57.4%), menstruation disorders in four girls (30.8%), shingles in four children (28.5%), oral fungal infections in three children (21.4%), recurrent herpes in three children (21.4%), pneumonia / aspergillosis in one child (7.1%), and recurrent enterobiasis in one child (7.1%). three children (21.4%) treated according to this regimen experienced one recurrence of the disease after six months, three and five years after onset. two children treated according to euro - lupus regimen (patients 3 and 7) with 3 of intravenous cyp over three months did not develop any complications. at the end of observation period these children had the nephrotic proteinuria reduced to 0.8 - 1.0 g / day and gfr at 63 - 105 ml / min/1.73 m both patients had hypertension which was well - controlled with antihypertensive drugs. two children in induction therapy received mmf : a girl (patient 2) with membranous ln (class v according to ins / rps) and a girl (patient 10) with neurological symptoms and ln class iv - s(a). proteinuria regressed and diminished to < 0.5 g / day and renal function normalised in these children. eleven children (61.1%) were administered 250 mg of chloroquine over 1 - 2 years with no adverse effects. during supportive treatment 12 children aza was effectively substituted with mmf in one girl who had a tendency towards leucopaenia (patient 6). supportive treatment included prednisone in doses reduced individually (table 1). during chronic steroid treatment the following manifestations were observed : transient glucose intolerance in one child (5.6%), cataract in two children (11.1%), osteoporosis in four children (22.2%), and hypertension in 72.2% of children. microhaematuria and leukocyturia regression were observed in all the children and a complete ln remission in seven children (38.9%), during the first year of treatment. the average duration of observation was 32.1 23.36 months (7 months 7.3 years). during that period renal function improved in all the children (final average gfr at 90.87 12.13 ml / min/1.73 m vs. baseline average gfr 54.55 33.09 ml / min/1.73 m), including gfr normalisation in 12 children (66.7%), proteinuria regression in 66.7% of children, and proteinuria reduction in 33.3% of children down to 32.9 11.67 mg / kg / day (fig. fifteen children were transferred to nephrological centres for adults when they turned 18 years old. three girls are still being treated : patient 9 is currently receiving cyp pulses according to nih, and two other girls are undergoing supportive treatment : mmf and prednisone (patient 6), aza and prednisone (patient 4). the onset of sle in children from the study group was at the average age of 14.4 years. as regards the gender girls dominated (8 : 1), which is consistent with the literature [13, 710 ]. the initial activity of sle was moderate - high according to sledai, with the predominance of non - renal signs (57%). it is stated that in the early period the clinical signs of renal diseases occur only in 25 - 40% of sle patients [13 ], being more common in children than in adults [58 ] and their presence translates into poorer prognosis both in adults [13 ] and in children [510 ]. in the study group, nephropathy was present at onset or developed in the first four months since sle onset. all the patients had microhaematuria, and 89% children presented with a severe ln onset : nephrotic syndrome, renal failure, and hypertension. therefore, the assessment of active and chronic abnormalities conducted according to isn / rps revealed the predominance of active abnormalities (mainly class iv) in histopathological examination, which could influence treatment results. in proliferative ln it is necessary to combine immunosuppressive drugs with glucocorticoids at high doses [1720 ]. according to numerous authors, children are administered higher doses of steroids in comparison with adults [5, 6 ]. 94.4% of patients in this study group were administered pulses of methylprednisolone at onset. according to eular / era - edta guidelines, it is necessary to administer high doses of intravenous cyp in the induction of remission in proliferative ln with poor prognostic factors, i.e. severe deterioration of renal function, the presence of cellular crescents, and/or fibrinoid necrosis in renal biopsy [1620 ]. the induction therapy in 88.9% of children in this study group involved the intravenous administration of cyp and administration of mmf only in 11.1% of children. mmf is considered the first - line treatment in african americans and hispanic patients due to its more marked effectiveness, and also in young patients due to a lower risk of infertility and in patients with lupus membranous nephropathy [58, 1820, 30, 31 ]. the minimum of 25% of proteinuria reduction and normalisation of c3 and/or c4 complement components after eight weeks and serum creatinine reduction and proteinuria < 1 g / day after six months of induction therapy are considered good prognostic factors of ln. microhaematuria and leukocyturia regression were observed in all the children in our group and a complete ln remission in seven children (38.9%) during the first year of treatment. according to the literature, even half of ln patients experience the recurrence after obtaining a complete or partial remission [1, 3, 58, 18 ]. each ln exacerbation, particularly a nephritic one, can lead to permanent renal injury. therefore, it is recommended to treat all ln exacerbations as a new renal involvement. amaral. conducted an analysis and demonstrated an increased risk of renal involvement in the course of juvenile sle and an increased risk of mortality compared to patients with adult - onset symptoms. in his group, the most common class of histopathological lesions in adolescents and adults was class iv, which was consistent with the results of the present study. according to the data of institute of rheumatology in warsaw the assessment of the course of the disease in those children revealed a decreased initial activity of disease according to sledai scale, renal involvement and epilepsy were less common, while psychosis and the presence of anti - ds - dna antibodies were more common. mortality was most frequently due to generalised infections (renal failure was indicated as one in previous years). high initial activity of sle was observed in the present study group of children with ln. at the onset of the disease about one third of children required renal replacement therapy or plasmapheresis due to renal / multi - organ failure and/or septicaemia. induction therapy with intravenous cyp in the majority of children resulted in a final average gfr of 90.87 12.13 ml / min/1.73 m and proteinuria regression in 66.7% of children. microhaematuria, nephrotic syndrome, hypertension, and renal injury are frequent manifestations of lupus nephritis in children. induction therapy with intravenous cyclophosphamide is an effective treatment in the proliferative forms of lupus nephritis in children. long - term assessment of the course of lupus nephritis in polish children requires multi - centre cooperation and evaluation of new immunosuppressive agents including mmf and rituximab. | systemic lupus erythematosus (sle) in children is usually more severe than it is in adults and there is a higher incidence of renal involvement. we described 18 children (16 girls, 2 boys) with lupus nephritis (ln), whose average age was 14.4 1.81 years. disease activity was assessed according to sledai (sle disease activity index). renal biopsy was classified according to the ins / rps (international society of nephrology / renal pathology society). the patients were treated with steroids (100%) and pulses of cyclophosphamide (88.9%) or mycophenolate mofetil (11.1%), next azathioprine or mycophenolate mofetil with prednisone in reduced doses. in children with renal / multi - organ insufficiency and/or septicaemia, renal replacement therapy (27.8%), and plasmapheresis (22.2%) were used in the initial treatment. the sledai initial activity was high in 44.4% and moderate in 55.6% of children. ln manifested as : nephrotic syndrome (83.3%), microhaematuria (100%), leukocyturia (60%), hypertension (72.2%), and acute renal injury (83.3%) ; mean gfr was 54.55 33.09 ml / min/1.73 m2. in the renal biopsy, class iv ln according to ins / rps was mainly diagnosed (82%). at the end of follow - up, mean observation time 32.123.36 months : mean gfr was 90.87 12.13 ml / min/1.73 m2, proteinuria disappeared in 66.7% and decreased in 33.3% of children to the average of 1.7 g / day (range : 0.5 - 4.0 g / day), hypertension was observed in 83.4% of children. intensive immunosuppressive treatment with pulses of cyclophosphamide in early stage of ln in children is very effective. |
measurement of the outcome is critical for any decision - making and results of evaluations in all medical circumstances. the japan orthopaedic association (joa) developed and published a specific instrument to measure outcomes for patients with low back problems in 1986.1 it was called the joa score rating system for low back pain, with a full score being 29 points. since then, the instrument has been widely utilized to evaluate the functional results of many types of intervention for patients with such problems. it has been referred to not only in articles by japanese investigators2 but also in those by non- japanese - speaking investigators.3,4 one of the major criticisms of this specific instrument, however, is that it is not a patient - oriented measurement but a physician - based one. it is now widely accepted that a patient s perspective is essential for making medical decisions and for evaluating the results of interventions.5 based on the current needs for measuring outcome, the joa was urged to revise its original score rating system and to develop a new one. in 2002, a subcommittee on evaluation of back pain and cervical myelopathy was organized in the clinical outcome committee of joa, and work began on revising the original joa scoring system. as described in the previous literature concerning part 1, the original joa scoring system was revised and a new scoring system (the joa back pain evaluation questionnaire joabpeq) was developed.6 the key points of this revision were to make the original joa score more patient - oriented. for the survey in the part 1 study, we first created a preliminary questionnaire consisting of 60 items. the questionnaire was a self - administered, disease - specific measure that was created with reference to the japanese editions of the short form health survey with 36 questions (sf-36)7 and the roland - morris disability questionnaire (rdq)8 to assess health - related quality of life. from the survey, a total of 25 items were selected for tentative use on a draft of the joabpeq (table 1). table 1items (n = 25) selected for the draft of the joabpeq evaluated in this studywith regard to your health condition during the last week, please circle the item number of the answer for the following questions that best applies. if your condition varies depending on the day or time, circle the item number when your condition is at its worst.q1 - 1. to alleviate low back pain because of low back pain, you do not do any routine housework these days.1) no2) yesq1 - 3. because of low back pain, you lie down more often than usual.1) yes2) noq1 - 4. because of low back pain, you sometimes ask someone to help you when you do something.1) yes2) noq1 - 5. because of low back pain, you refrain from bending forward or kneeling down.1) yes2) noq1 - 6. because of low back pain, you have diffi culty standing up from a chair.1) yes2) noq1 - 7. your lower back aches most of the time.1) yes2) noq1 - 8. because of low back pain, turning over in bed is diffi cult.1) because of low back pain, you have diffi culty putting on socks or stockings.1) yes2) noq1 - 10. because of low back pain, you walk only short distances.1) yes2) noq1 - 11. because of low back pain, you stay seated most of the day.1) yes2) noq1 - 13. because of low back pain, you become irritated or angry at other persons more often than usual.1) yes2) noq1 - 14. because of low back pain, you go up stairs more slowly than usual.1) yes2) noq2 - 1. how is your present health condition?1) excellent2) very good3) good4) fair5) poorq2 - 2. do you have diffi culty in climbing stairs?1) i have great diffi culty.2) i have some diffi culty.3) i have no diffi culty.q2 - 3. do you have diffi culty in any one of the following motions : bending forward, kneeling, or stooping?1) i have great diffi culty.2) i have some diffi culty.3) i have no diffi culty.q2 - 4. do you have diffi culty walking more than 15 minutes?1) i have great diffi culty.2) i have some diffi culty.3) i have no diffi culty.q2 - 5. have you been unable to do your work or ordinary activities as well as you would like?1) i have not been able to do them at all.2) i have been unable to do them most of the time.3) i have sometimes been unable to do them.4) i have been able to do them most of the time.5) i have always been able to do them.q2 - 6. has your work routine been hindered because of the pain?1) greatly2) moderately3) slightly (somewhat)4) little (minimally)5) not at allq2 - 7. have you been discouraged or depressed?1) always2) frequently3) sometimes4) rarely5) neverq2 - 8. do you feel exhausted?1) always2) frequently3) sometimes4) rarely5) neverq2 - 9. do you feel happy?1) always2) almost always3) sometimes4) rarely5) neverq2 - 10. do you think you are in reasonable health?1) yes (i am healthy.)2) fairly (my health is better than average)3) not (very much)/particularly (my health is average)4) barely (my health is poor)5) not at all (my health is very poor)q2 - 11. do you feel your health will get worse?1) very much so2) a little at a time3) sometimes yes and sometimes no4) not very much5) not at all items (n = 25) selected for the draft of the joabpeq evaluated in this study the purpose of the part 2 study in this project was to evaluate the reliability of the 25 items selected for the draft joabpeq ; for this, test - retest reliability was ascertained. altogether, 460 of the 829 japanese board - certified spine surgeons were randomly selected, and each was asked to recruit two patients to evaluate the joabpeq between january and june 2004. the recruited patients were scheduled to reply to the questionnaire twice at a 2-week interval. patient criteria were as follows : (1) patients could be any age of either sex ; (2) patients had any lumbar spine disorder and were currently visiting an outpatient clinic ; (3) the severity of the symptoms was expected to be at the same level between the two interviews. exclusion criteria were the presence of : (1) other musculoskeletal diseases requiring medical treatment ; (2) psychiatric disease (e.g., dementia), potentially leading to inappropriate answers ; (3) a postoperative condition ; (4) having participated in previous surveys of the related study. each patient was asked to complete the same questionnaire twice at an interval of 2 weeks (3 days). the attending surgeon filled out the patient information on the diagnosis and the presence or absence of concomitant diseases, followed by judging the severity of symptoms using a three - step rating scale (mild, moderate, severe). symptom severity was determined subjectively by the attending surgeon, who was asked not to select a similar patient solely on the basis of severity. patients who had the same level of severity as judged by all surgeons were then selected and analyzed to verify the reliability of the questionnaire. this study was approved by the ethics committee of the japanese society for spine surgery and related research. the reliability of the questionnaire was evaluated by determining the extension of the kappa coefficients. the kappa and weighted kappa coefficients were calculated based on a formula using microsoft office excel 2003. kappa and weighted kappa coefficients of 0.4 or above were judged to be reliable.9 the 95% confidence intervals (95% ci) were calculated for all reliability coefficients using the bootstrap method. altogether, 460 of the 829 japanese board - certified spine surgeons were randomly selected, and each was asked to recruit two patients to evaluate the joabpeq between january and june 2004. the recruited patients were scheduled to reply to the questionnaire twice at a 2-week interval. patient criteria were as follows : (1) patients could be any age of either sex ; (2) patients had any lumbar spine disorder and were currently visiting an outpatient clinic ; (3) the severity of the symptoms was expected to be at the same level between the two interviews. exclusion criteria were the presence of : (1) other musculoskeletal diseases requiring medical treatment ; (2) psychiatric disease (e.g., dementia), potentially leading to inappropriate answers ; (3) a postoperative condition ; (4) having participated in previous surveys of the related study. each patient was asked to complete the same questionnaire twice at an interval of 2 weeks (3 days). the attending surgeon filled out the patient information on the diagnosis and the presence or absence of concomitant diseases, followed by judging the severity of symptoms using a three - step rating scale (mild, moderate, severe). symptom severity was determined subjectively by the attending surgeon, who was asked not to select a similar patient solely on the basis of severity. patients who had the same level of severity as judged by all surgeons were then selected and analyzed to verify the reliability of the questionnaire. this study was approved by the ethics committee of the japanese society for spine surgery and related research. the reliability of the questionnaire was evaluated by determining the extension of the kappa coefficients. the kappa and weighted kappa coefficients were calculated based on a formula using microsoft office excel 2003. kappa and weighted kappa coefficients of 0.4 or above were judged to be reliable.9 the 95% confidence intervals (95% ci) were calculated for all reliability coefficients using the bootstrap method. a total of 350 patients participated in this study and completed the questionnaire twice following the project s plan. however, 135 patients were excluded because the severity of their symptoms had changed between the two interviews or they violated the interval period. of the remaining 215 patients, 54 were ineligible because of other musculoskeletal diseases, such as knee and hip osteoarthrosis. as a result, a total of 161 patients were available for the analysis in this study : 86 men and 75 women with a mean age of 57.7 years (sd 16.3 years). the clinical diagnosis included degenerative lumbar canal stenosis in 49 patients, lumbar disc herniation in 44, spondylolisthesis in 20, spondylosis in 16, degenerative disc disease in 13, mechanical low back pain in 11, and miscellaneous in 8. the patients age varied from their twenties to their eighties, and symptom severity varied from mild to severe (table 2). neurological and physical status was evaluated for each patient using the current joa score rating system and finger - floor distance (table 3). neurological deficits varied from mild to severe, and trunk flexibility varied among the subjects as well. table 2distribution of age and severity of symptoms in the patient analyzed (n = 161)no. of patients, by severity of symptomsage (years)mildmoderateseveretotalmen20223730441940220450791176013832470618024800011total3443986women2023053045094061185094114607111197089118801102total3734475total no.717713161table 3current japanese orthopaedic association score rating system and fi nger to fl oor distance for the patients analyzed (n = 161)parameterno.slr testnormal124307035<302motor functionnormal113slight weakness (mmt : good)38severe weakness (mmt : less than good)10sensory functionnormal80slight disturbance59severe disturbance22bladder functionnormal147mild dysuria12severe dysuria2finger to floor distance (cm)-151 - 14-517 - 4-441514401524322534935447455475564465741immeasurable2total no.161slr, straight leg raising ; mmt, manual muscle testing distribution of age and severity of symptoms in the patient analyzed (n = 161) current japanese orthopaedic association score rating system and fi nger to fl oor distance for the patients analyzed (n = 161) slr, straight leg raising ; mmt, manual muscle testing face validity was checked in terms of the completion rate for filling out the questionnaire. the distribution of the answers for all question items was then checked to ensure that there were no biased answers. items remaining unanswered accounted for less than 5% in the first test, and there was no skewed distribution, such as floor and ceiling effects (table 4). table 4reproducibility of each item (n = 161)choices for answeritem12345no answerq1 - 111743172.7%26.7%0.6%q1 - 232127219.9%78.9%1.2%q1 - 37683247.2%51.6%1.2%q1 - 44211926.1%73.9%q1 - 5778447.8%52.2%q1 - 63113019.3%80.7%q1 - 7689342.2%57.8%q1 - 86595140.4%59.0%0.6%q1 - 9728944.7%55.3%q1 - 10877454.0%46.0%q1 - 1135122421.7%75.8%2.5%q1 - 1241119125.5%73.9%0.6%q1 - 133612522.4%77.6%q1 - 1411545171.4%28.0%0.6%q2 - 118596616211.2%36.6%41.0%9.9%1.2%q2 - 215925229.3%57.1%32.3%1.2%q2 - 3259338515.5%57.8%23.6%3.1%q2 - 4357055121.7%43.5%34.2%0.6%q2 - 5151285351319.3%7.5%52.8%21.7%8.1%0.6%q2 - 6133666321138.1%22.4%41.0%19.9%6.8%1.9%q2 - 712879392217.5%5.0%49.1%24.2%13.7%0.6%q2 - 882788241225.0%16.8%54.7%14.9%7.5%1.2%q2 - 98427431515.0%26.1%46.0%19.3%3.1%0.6%q2 - 10135942341218.1%36.6%26.1%21.1%7.5%0.6%q2 - 111748562811110.6%29.8%34.8%17.4%6.8%0.6% reproducibility of each item (n = 161) the test - retest reliability was confirmed by calculating the kappa and weighted kappa coefficients for each item (tables 5a, 5b). both kappa and weighted kappa were more than 0.50 in all items, except in one item with 0.48. the lower 95% ci exceeded 0.4 in all items, except in two items with 0.39. this implied that the test - retest reliability of joabpeq was acceptable as a measurement of outcome. table 5akappa coefficient with 95% ci for items q1 - 1 to q1 - 14item95% ciq1 - 10.690.600.77q1 - 20.620.510.73q1 - 30.670.600.75q1 - 40.650.560.75q1 - 50.480.390.57q1 - 60.550.430.66q1 - 70.650.570.73q1 - 80.550.470.64q1 - 90.710.640.78q1 - 100.630.550.72q1 - 110.500.390.61q1 - 120.560.460.65q1 - 130.650.550.74q1 - 140.720.640.80ci, confidence intervaltable 5bweighted kappa coefficient with 95% ci for items q2 - 1 to q2 - 11itemweighted 95% ciq2 - 10.510.430.57q2 - 20.610.520.68q2 - 30.570.490.64q2 - 40.730.680.78q2 - 50.540.470.60q2 - 60.610.550.67q2 - 70.530.460.59q2 - 80.550.480.61q2 - 90.540.460.60q2 - 100.540.470.61q2 - 110.530.460.60 kappa coefficient with 95% ci for items q1 - 1 to q1 - 14 ci, confidence interval weighted kappa coefficient with 95% ci for items q2 - 1 to q2 - 11 a total of 350 patients participated in this study and completed the questionnaire twice following the project s plan. however, 135 patients were excluded because the severity of their symptoms had changed between the two interviews or they violated the interval period. of the remaining 215 patients, 54 were ineligible because of other musculoskeletal diseases, such as knee and hip osteoarthrosis. as a result, a total of 161 patients were available for the analysis in this study : 86 men and 75 women with a mean age of 57.7 years (sd 16.3 years). the clinical diagnosis included degenerative lumbar canal stenosis in 49 patients, lumbar disc herniation in 44, spondylolisthesis in 20, spondylosis in 16, degenerative disc disease in 13, mechanical low back pain in 11, and miscellaneous in 8. the patients age varied from their twenties to their eighties, and symptom severity varied from mild to severe (table 2). neurological and physical status was evaluated for each patient using the current joa score rating system and finger - floor distance (table 3). neurological deficits varied from mild to severe, and trunk flexibility varied among the subjects as well. table 2distribution of age and severity of symptoms in the patient analyzed (n = 161)no. of patients, by severity of symptomsage (years)mildmoderateseveretotalmen20223730441940220450791176013832470618024800011total3443986women2023053045094061185094114607111197089118801102total3734475total no.717713161table 3current japanese orthopaedic association score rating system and fi nger to fl oor distance for the patients analyzed (n = 161)parameterno.slr testnormal124307035<302motor functionnormal113slight weakness (mmt : good)38severe weakness (mmt : less than good)10sensory functionnormal80slight disturbance59severe disturbance22bladder functionnormal147mild dysuria12severe dysuria2finger to floor distance (cm)-151 - 14-517 - 4-441514401524322534935447455475564465741immeasurable2total no.161slr, straight leg raising ; mmt, manual muscle testing distribution of age and severity of symptoms in the patient analyzed (n = 161) current japanese orthopaedic association score rating system and fi nger to fl oor distance for the patients analyzed (n = 161) slr, straight leg raising ; mmt, manual muscle testing face validity was checked in terms of the completion rate for filling out the questionnaire. the distribution of the answers for all question items was then checked to ensure that there were no biased answers. items remaining unanswered accounted for less than 5% in the first test, and there was no skewed distribution, such as floor and ceiling effects (table 4). table 4reproducibility of each item (n = 161)choices for answeritem12345no answerq1 - 111743172.7%26.7%0.6%q1 - 232127219.9%78.9%1.2%q1 - 37683247.2%51.6%1.2%q1 - 44211926.1%73.9%q1 - 5778447.8%52.2%q1 - 63113019.3%80.7%q1 - 7689342.2%57.8%q1 - 86595140.4%59.0%0.6%q1 - 9728944.7%55.3%q1 - 10877454.0%46.0%q1 - 1135122421.7%75.8%2.5%q1 - 1241119125.5%73.9%0.6%q1 - 133612522.4%77.6%q1 - 1411545171.4%28.0%0.6%q2 - 118596616211.2%36.6%41.0%9.9%1.2%q2 - 215925229.3%57.1%32.3%1.2%q2 - 3259338515.5%57.8%23.6%3.1%q2 - 4357055121.7%43.5%34.2%0.6%q2 - 5151285351319.3%7.5%52.8%21.7%8.1%0.6%q2 - 6133666321138.1%22.4%41.0%19.9%6.8%1.9%q2 - 712879392217.5%5.0%49.1%24.2%13.7%0.6%q2 - 882788241225.0%16.8%54.7%14.9%7.5%1.2%q2 - 98427431515.0%26.1%46.0%19.3%3.1%0.6%q2 - 10135942341218.1%36.6%26.1%21.1%7.5%0.6%q2 - 111748562811110.6%29.8%34.8%17.4%6.8%0.6% reproducibility of each item (n = 161) the test - retest reliability was confirmed by calculating the kappa and weighted kappa coefficients for each item (tables 5a, 5b). both kappa and weighted kappa were more than 0.50 in all items, except in one item with 0.48. the lower 95% ci exceeded 0.4 in all items, except in two items with 0.39. this implied that the test - retest reliability of joabpeq was acceptable as a measurement of outcome. table 5akappa coefficient with 95% ci for items q1 - 1 to q1 - 14item95% ciq1 - 10.690.600.77q1 - 20.620.510.73q1 - 30.670.600.75q1 - 40.650.560.75q1 - 50.480.390.57q1 - 60.550.430.66q1 - 70.650.570.73q1 - 80.550.470.64q1 - 90.710.640.78q1 - 100.630.550.72q1 - 110.500.390.61q1 - 120.560.460.65q1 - 130.650.550.74q1 - 140.720.640.80ci, confidence intervaltable 5bweighted kappa coefficient with 95% ci for items q2 - 1 to q2 - 11itemweighted 95% ciq2 - 10.510.430.57q2 - 20.610.520.68q2 - 30.570.490.64q2 - 40.730.680.78q2 - 50.540.470.60q2 - 60.610.550.67q2 - 70.530.460.59q2 - 80.550.480.61q2 - 90.540.460.60q2 - 100.540.470.61q2 - 110.530.460.60 kappa coefficient with 95% ci for items q1 - 1 to q1 - 14 ci, confidence interval weighted kappa coefficient with 95% ci for items q2 - 1 to q2 - 11 measurement of the outcome is generally divided into two categories : generic and disease - specific measures.5,10 sf-36 has been commonly used as representative of a measurement of generic health status.5,7,10 the rdq and the oswestry disability index are widely used as disease - specific measurements for back pain.8,11 the joa score rating system for low back pain, developed in 1986, was also a disease - specific measuring instrument for back disorders and injuries and has been widely utilized in clinical research and the decision - making process in japan. however, this is not a patient - based outcome measure reliable enough to describe the objective status of the function and quality of life (qol) of patients with low - back disorders. there has, to date, been insufficient psychometric analysis to confirm the validity and reliability of this joa score rating system. the project for developing the new questionnaire, joabpeq, was initiated to create a self - administered, disease - specific method for measuring low back pain. this instrument should include functions of the lumbar spine as well as health - related qol. the reliability of the questionnaire that includes the 25 suggested items was evaluated using psychometric analysis as part 2 of this project. kappa and weighted kappa coefficient were utilized to verify the test - retest reliability.12,13 in terms of external validity, biased data were inevitable because one criterion that was included was that the severity of the symptoms was expected to be at the same level between the two interviews. however, there was no bias on the choices of answer to each question. this implies that test - retest reliability was acceptable even if the subjects had symptoms of different severity. the older the patients were, the worse was the interpretation of each question. there were small numbers of patients of younger generations, such as those in their thirties and forties, in this study. thus, the reliability would not deteriorate even if the number of young people were to increase. in terms of english expression, there is a possibility of ambiguity in questions 12 and 111, where double negatives (two no s in the answer) may be confusing. it is necessary to reconsider and revise the english expression so it is more easily understood by native english - language users. the number of choices for the answer in all questions varied from two to five, which is also a point to be reconsidered in the future. the current study demonstrated that the 25 items had enough reliability to describe the qol in patients suffering low back disorders. however, further studies are needed to complete the project, including a factor analysis to determine the underlying cluster of the questionnaire items, a formula for calculating the severity score, and confirmation of the responsiveness to the questionnaire. the tentative joabpeq with 25 items was confirmed to be reliable enough to describe the qol of patients suffering low back disorders. | backgroundthe project to develop a new japanese orthopaedic association (joa) score rating system for low back disorders, the joa back pain evaluation questionnaire (joabpeq), is currently in progress. part 1 of the study selected 25 candidate items for use on the joabpeq. the purpose of this current part 2 of the study was to verify the reliability of the questionnaire.methodsa total of 161 patients with low - back disorders of any type participated in the study. each patient was interviewed twice at an interval of 2 weeks using the same questionnaire. the reliability of the questionnaire was evaluated by determining the extension of the kappa and weighted kappa coefficients.resultsboth kappa and weighted kappa were more than 0.50 for all but one item, which was 0.48. the lower 95% confidence interval exceeded 0.4 in all but two items, which was 0.39. this implied that the test retest reliability of joabpeq was acceptable as a measure of outcome.conclusionsthe tentative questionnaire of the joabpeq with 25 items was confirmed to be reliable enough to describe the quality of life of patients who suffer low back disorders. |
they are characterized by the presence of the following (1) hydrazone schiff bases of acyl, aroyl, and heteroaroyl compounds have an addition donor sites like c = o. this versatility has made hydrazones good polydentate chelating agents that can form a variety of complexes with various transition and inner transition metals and have attracted the attention of many researchers. a wide varieties of hydrazones and their metal complexes have been studied because of their important properties which can be used in different applications, such as, extraction of some metal ions, microdetermination of metal ions, determination of titanium in bauxite, portland cement, amphibolites granites, and different biological activities, such as antimicrobial [2, 47 ], antifungal [8, 9 ], antitumor [10, 11 ], and insecticides. for these applications, we are extending this field of compounds for synthesising novel macrocyclic hydrazones. five dissymmetric tridentate schiff base ligands containing a mixed donor set of onn and ono were prepared by the reaction of benzohydrazide with the appropriate salicylaldehyde and pyridine-2-carbaldehyde and characterized by ft - ir, h nmr, and c nmr. inoue. reported the synthesis and spectroscopic characterization of complexes of ni, cu, zn, and cd with hydrazones schiff bases derived from 6-amino-5-formyl-1,3-dimethyluracil, nicotinic and isonicotinic acids hydrazides. reported the synthesis and characterization of a macrocyclic hydrazone schiff bases prepared by condensation of 1,4-dicarbonyl phenyl dihydrazide with 2,6-diformyl-4-methyl phenol. reported [1618 ] formation of binuclear complexes for the ligands derived from 4,6-diacetylresorcinol, where the ligands were prepared by condensation of 4,6-diacetylresorcinol (dar) with oxalyldihydrazine (odh) in the molar ratios (1 : 1) and (1 : 2) to afford the corresponding hydrazone, h6la and h4 lb, ligands, respectively. otomo and nakayama. reported formation of three terdentate hydrazones, all containing the 1-phthalazino grouping in the hydrazine moiety but differing in the heterocyclic substituent in the aldehyde moiety, where the ligands were used as analytical reagents for palladium(ii), the optimal conditions for the extractive spectrophotometric determination of palladium(ii) in the presence of chloride ions being deduced. these compounds were highly selective and sensitive reagents for palladium(ii), since they were not extracted into chloroform from sulfuric acid solutions and did not react with other platinum group metals. odashima and ishii reported the synthesis and spectroscopic characterization of four new hydrazones, 2-pyridinecarbaldehyde 3-nitro-2-pyridylhydrazone, 2-pyridinecarbaldehyde 3,5-dinitro-2-pyridylhydrazone (pa-3,5-nph), 2-quinolinecarbaldehyde 5-nitro-2-pyridylhydrazone, and 6-phenanthridinecarbaldehyde 5-nitro-2-pyridylhydrazone. also useful information on the molecular design of the hydrazone reagent was obtained. a highly sensitive and practical extraction - spectrophotometric method for the determination of nickel with pa-3,5-nph developed and applied successfully to the determination of nickel in steel samples. in the context of the above applications, we have reported here the synthesis and characterization of novel macrocyclic hydrazone schiff bases and their extraction study of some transition metal cations. all the chemicals used were of analar grade and procured from sigma - aldrich and fluka. the solvents were saturated with each other before use in order to prevent volume changes of the phases during extraction. the c, h, and n were analyzed on a carlo - erba 1106 elemental analyzer. h and c - nmr spectra of ligands in cdcl3 solution were recorded on a bruker dt-400 mhz spectrometer, and chemical shifts are indicated in ppm relative to tetramethylsilane. aa 929 unicam spectrometer was used for faas measurements with an air - acetylene flame. a ph meter (metrohm 691 ph meter) all extractions experiments were performed by using a mechanical flask agitator in 50 cm stoppered glass flasks. a succinic acid (9.19 mmol) in absolute dry ethanol (60 ml) containing 2 - 3 drops of concentrated h2so4 was refluxed, continuing the heating for 2030 minutes. when the reflux time is complete, place about 5 ml chipped ice in a 50-ml beaker and mix it with 15 ml 10% aqueous na2co3 (sodium carbonate) (the ph should be above 7. if it is not, add more (10%) na2co3 dropwise until the solution is basic). then dry the ether solution in the centrifuge tube by adding several spatula - tip loads of anhydrous na2so4. adipic acid (7.92 mmol) in absolute dry ethanol (60 ml) containing 2 - 3 drops of concentrated h2so4 was refluxed, then continue the heating for 2030 minutes. when the reflux time is complete, remove the flask from the heating mantle, allow it to cool briefly. place about 5 ml chipped ice in a 50-ml beaker and mix it with 15 ml 10% aqueous na2co3 (sodium carbonate)(the ph should be above 7. if it is not, add more 10% na2co3 dropwise until the solution is basic). then dry the ether solution in the centrifuge tube by adding several spatula - tip loads of anhydrous na2so4. mixture of diethyl ester of succinic acid (2.22 g) and hydrazine hydrate (98% 2 cc) in ethanol (80 ml) was refluxed for 4 - 5 h. the reaction mixture was allowed to cool in room temperature, then the cooled solution was poured onto ice cold water. a mixture of diethyl ester of adipic acid (2.22 g) and hydrazine hydrate (98% 2 cc) in ethanol (80 ml) was refluxed for 4 - 5 h. the reaction mixture was allowed to cool in room temperature, then the cooled solution was poured onto ice cold water. the dihydrazide of adipic acid obtained was filtered and recrystallized from ethanol. the hot ethanolic solution (20 ml), of acetylacetone (2 mmol, 0.2 g), and a hot ethanolic solution (20 ml), of dihydrazide of succinic acid (2 mmol, 0.292 g), were mixed slowly with constant stirring. this mixture was refluxed at ~75c for 9 h in presence of few drops of concentrated hydrochloric acid (ph~3). the reaction mixture was allowed to cool in room temperature, then the cooled solution was poured onto ice cold water. on cooling, white - colored precipitate is separated out, filtered, washed with cold etoh, and dried under vacuum over p2o5 yield 50%. elemental analysis found % (found atomic mass 420 amu), c 51.14 h 5.64 ; n 26.53 for c18h28n8o4. the hot ethanolic solution (20 ml), of acetylacetone (2 mmol, 0.2 g), and a hot ethanolic solution(20 ml), of dihydrazide of adipic acid (2 mmol, 0.348 g), were mixed slowly with constant stirring. this mixture was refluxed at ~75c for 9 h in presence of concentrated hydrochloric acid (ph~3). the reaction mixture was allowed to cool in room temperature, then the cooled solution was poured onto ice cold water. on cooling, white - colored precipitate is separated out, filtered, washed with cold etoh, and dried under vacuum. elemental analysis found % (found atomic mass 420 amu), c 55.69 h 6.66 ; n 22.62 for c22h36n8o4. aqueous solutions containing 1.5 10 mol l metal chloride in appropriate buffer were equilibrated with equal volumes of the chloroform and dichloromethane solutions of the ligand 4 10 m by shaking in a mechanical shaker at 25c. in most cases, distribution equilibrium was attained in less than 180 min and a shaking time of 120 min. the ionic strength of the aqueous phase was 0.1 m kcl in all experiments except those in which the effect of ionic strength was studied. the copper(ii) and chrome(iii) concentrations of the aqueous phase were determined by faas and that of the organic phase from the difference by considering the mass balance. the preparation of two ligands containing nitrogen and oxygen donor atoms are shown in scheme 1. the structures of new compounds were characterized by a combination of ir, ms, h nmr, and c nmr spectral data. ligand(i)the spectrum showed a strong bands at 1715 and 1587 cm in the spectrum of the schiff base assigned to (c = o) of carbonyl and azomethine (c = n) vibrations, respectively. an intense band at 3111 cm is due to the nh - vibrations of the hydrazine group, a broad medium intense band was at 2930 cm due to methylene groups, and the band at 1068 cm is assigned to hydrazinic (n n) of the ligand [2125 ]. in the electron impact spectrum (figure 1) of the ligand, we confirm the probable formula by showing a peak at 420 amu, corresponding to macrocyclic moiety [(c18h28n8o4), calculated atomic mass 420 ]. the series of peaks in the range, that is, 37, 40, 41, 42, 44, 55, 95, 96, 97, 101, 121, 132, 150, 179, 201 amu, and so forth, may be assigned to various fragments. their intensity gives an idea of stability of fragments (figure 1). in the h nmr spectrum the ligand(i) exhibits signals at 2.24 ppm due to ch3c(6h), 2.54 due to ch2(4h), 3.55 due to ch2co(8h) and at 5.9 ppm due to nh protons (figure 3(a)).in the c nmr spectrum (figure 3(b)) of ligand(i), and indicated new resonances are 13.80, 14.58(ch3), 23.74, 34.90(ch2), 110.96, 143.99(ch2co), 151.77(c = n), 173.71(co the spectrum showed a strong bands at 1715 and 1587 cm in the spectrum of the schiff base assigned to (c = o) of carbonyl and azomethine (c = n) vibrations, respectively. an intense band at 3111 cm is due to the nh - vibrations of the hydrazine group, a broad medium intense band was at 2930 cm due to methylene groups, and the band at 1068 cm is assigned to hydrazinic (n n) of the ligand [2125 ]. in the electron impact spectrum (figure 1) of the ligand, we confirm the probable formula by showing a peak at 420 amu, corresponding to macrocyclic moiety [(c18h28n8o4), calculated atomic mass 420 ]. the series of peaks in the range, that is, 37, 40, 41, 42, 44, 55, 95, 96, 97, 101, 121, 132, 150, 179, 201 amu, and so forth, may be assigned to various fragments. their intensity gives an idea of stability of fragments (figure 1). in the h nmr spectrum the ligand(i) exhibits signals at 2.24 ppm due to ch3c(6h), 2.54 due to ch2(4h), 3.55 due to ch2co(8h) and at 5.9 ppm due to nh protons (figure 3(a)). in the c nmr spectrum (figure 3(b)) of ligand(i), and indicated new resonances are 13.80, 14.58(ch3), 23.74, 34.90(ch2), 110.96, 143.99(ch2co), 151.77(c = n), 173.71(co nh). ligand(ii)the spectrum showed strong bands at 1717 and 1581 cm in the spectrum of the schiff base assigned to (c = o) of carbonyl and azomethine (c = n) vibrations, respectively. a broad medium intense bands were at 2959 and 2873 cm due to methyl groups and band at 1136 cm is assigned to hydrazinic (n n) of the schiff base [2125].in the electron impact spectrum (figure 2) of the ligand(ii), we confirm the probable formula by showing a peak at 476 amu, corresponding to macrocyclic moiety [(c22h36n8o4), calculated atomic mass 476 ]. the series of peaks in the range, that is, 38, 39, 40, 41, 42, 43, 54, 55, 56, 96, 97, 111, 121, 138, 150, 165, 179, 201, 205, 251, 301, 302 amu, and so forth, may be assigned to various fragments. their intensity gives an idea of stability of fragments (figure 2). in the h nmr spectrum, ligand(ii) exhibits signals at 2.24 due to ch3c(12h), 3.17 ppm due to co ch2ch2(8h), 2.54 ppm due to ch2cn(4h), and 5.9 ppm due to nh protons signal (figure 4(a)). all these observations support the infrared conclusions.in the c nmr spectrum figure 4(b) of ligand, indicated new resonances are 13.82, 14.18, 14.45, 28.58, 29.88, 30.47, 60.66(ch2), 111.04, 144.08(ch2co), 152.07(n = the spectrum showed strong bands at 1717 and 1581 cm in the spectrum of the schiff base assigned to (c = o) of carbonyl and azomethine (c = n) vibrations, respectively. a broad medium intense bands were at 2959 and 2873 cm due to methyl groups and band at 1136 cm is assigned to hydrazinic (n n) of the schiff base [2125 ]. in the electron impact spectrum (figure 2) of the ligand(ii), we confirm the probable formula by showing a peak at 476 amu, corresponding to macrocyclic moiety [(c22h36n8o4), calculated atomic mass 476 ]. the series of peaks in the range, that is, 38, 39, 40, 41, 42, 43, 54, 55, 56, 96, 97, 111, 121, 138, 150, 165, 179, 201, 205, 251, 301, 302 amu, and so forth, may be assigned to various fragments. their intensity gives an idea of stability of fragments (figure 2). in the h nmr spectrum, ligand(ii) exhibits signals at 2.24 due to ch3c(12h), 3.17 ppm due to co ch2ch2(8h), 2.54 ppm due to ch2cn(4h), and 5.9 ppm due to nh protons signal (figure 4(a)). all these observations support the infrared conclusions. in the c nmr spectrum figure 4(b) of ligand, indicated new resonances are 13.82, 14.18, 14.45, 28.58, 29.88, 30.47, 60.66(ch2), 111.04, 144.08(ch2co), 152.07(n = c), and 172.60(co nh). to the best of our knowledge, the stability of a transition metal complex with a polydentate chelate ligand in organic phase depends on a range of factors including : number and type of the donor atoms present, the number and size of the chelate rings formed on complexation. in addition, the stability and selectivity of complexations strongly depend on the donor ability, dielectric constant of the solvent, and shape and size of the solvent molecules. in this research, liquid - liquid extraction experiments were performed to examine the efficiency and selectivity of hydrazones (i) and (ii) in transferring s - metal ions (li, na, and k) and d - metal ions (cu and cr) from aqueous phase into chloroform. the results show that the alkali metals ions are not extracted by hydrazones (e cr, which are in the same order of decreasing ionic radius. if only mononuclear species are extracted, under the condition in which chloride does not take part in the distribution equilibrium, the extraction process may be represented by equation (2)cu2+(w)+hnl(o)cul(o)+nh+(w), where hnl (i) represents the extractant reagent and subscripts (w) and (o) denote the aqueous and organic phases, respectively. the extraction constant of the species cul is given by (3)k ext = [cul]o[h+]wn[cu2+]w[hnl]o. when cul is the only extractable species and the metal is present in the aqueous phase predominantly as the cation cu, the metal distribution ratio (d) and the extraction constant are related by (4)logd = logkext+nph+log[h2l]o. the effect of ph on the extraction of cu and cr ions from kcl media of ionic strength (i = 0.1 m) has been studied, the logarithm of the d values obtained was plotted against the corresponding ph values (according to (4) a plot of logd against ph at constant 4 10 m of [hnl ]). a straight line with a slope of about 2 was obtained at i = 0.1 of cu and cr, as shown figures 6(a) and 6(b). the values represent the number of hydrogen ions released during the formation of metal - ligand complex and intercept log[hnl ] + logk ext. also figure 7 shows the evolution of logd when increasing the concentration of ligands at constant chloride metal concentration with two different organic solvents. as seen from the plots, there is a linear relationship between logd and log[l]org, and the slope should be equal to the number of ligand molecules per cation in the extracted species. therefore, ligands form a 1 : 2 (l : m) complex with cu for both solvents. the influence of kcl in the concentration range of 0.11.0 m on the extraction efficiency of cu was studied in solutions containing 1.5 10 m cu and cr with 4 10 m ligand in organic phase. the extraction efficiency decreases with increase in ionic strength of the aqueous medium. taking into account (5), the extraction constant (k ext) at zero ionic strength for this reaction can be correlated with the ionic strength(i) by (5)cu2+(w)+h2l(o)cul(o)+2h+(w), (6)kext0=kexth+ncu2 +, (7)kext = kext0cu2+h+n. according to the debye - huckel limiting law given (8)log=0.5zi2 i. the activity coefficient () decreases with increase in ionic strength. at the constant ph, the activity coefficient of cu decreases as the ionic strength increase, hence k ext decreases. these symmetrical compounds were obtained with yield more than 50% in some cases. two imines (schiff bases) were synthesized. this is confirmed by a precise review of the scientific background concerning this category of compounds. the results indicate that h2l(i, ii) in organic phase extracts efficiently cu and cr in aqueous phase containing 0.1 mol l kcl in the ph range of approximately 57 and 7 - 8, respectively, at 25c and 2 h stirring. | two new macrocyclic hydrazone schiff bases were synthesized by reaction of succindihydrazide and adipdihydrazide with acetylacetone. hydrazones have been characterized by elemental analyses and ir, mass, 1h nmr, and 13c nmr spectral data. hydrazones have been studied by liquid - liquid extraction towards the s - metal ions (li+, na+, and k+) and d - metal ions (cu2 + and cr3 +) from aqueous phase to organic phase. the effect of chloroform and dichloromethane as organic solvents over the metal chlorides extraction was investigated at 25 0.1c by using flame atomic absorption. we found differences between the two solvents in extraction selectivity. |
silent lacunar infarction (sli) has commonly been regarded as a benign subtype of stroke, associated with relatively mild disability. most previous studies reported a close link between fresh infarcts and post - stroke depression (psd). psd is defined as depression occurring in the context of a clinically apparent stroke, which is opposed to silent cerebral vascular disease which belongs to vascular depression. compared to vascular depression, the course of psd seems even more complex and dependent on timing of onset. the role of vascular risk factors in the etiology of psd and vascular depression is less obvious than it appears. as we known, hypertension, atrial fibrillation, smoking, diabetes, and cardiovascular disease are premorbid vascular risk factors with clear longitudinal association with cerebrovascular disease, however, previous study found strong positive association between vascular burden and frequency of depression among patients without stroke, but not among patients with stroke. these different findings in the etiologies of psd and vascular depression may suggest an independent etiologic process for each depressive syndrome. the presence of lacunar infarction (li) in subcortical regions, namely in the thalamus, basal ganglia, and deep white matter has been shown to promote depression. another study only found an association of li in deep white matter with depressive symptoms. differences in inclusion criteria, diagnostic protocols of li, and assessment of depression may contribute to such different viewpoints in the above studies. recent study has also suggested that chronic vascular burden may contribute significantly to the pathogenesis of depression. the prevalence of vascular risk factors has been empirically linked with the onset and severity of depression in both cross - sectional and longitudinal studies. conditions such as hypertension, diabetes, obesity [12, 13 ], inflammation, extent of physical activity, and serum lipid profile had been associated with depression in the general population. however, only few previous studies have examined the influence of these risk factors on depression in a population of patients diagnosed with sli. in the present study, we performed a cross - sectional study focusing on the location of sli and the related risk factors to explore the relationship between sli and depression. a cross - sectional study was performed on the patients attending to the department of neurology in 10th people s hospital at shanghai from september 2012 to november 2013, mainly with non - specific symptoms such as headache, dizziness, vertigo and limb numbness, simultaneously without any localized neurological signs. the study has been approved by the institutional review boards and all participants have provided written consent for participation. a total of 272 participants diagnosed with sli through magnetic resonance imaging (mri) were consecutively recruited in our study and attributed to depression and non - depression groups, respectively. the number of focal lesions of sli should be between three and five in each location. patients with histories of stroke, vascular dementia, heart failure with a new york heart association degree 3 or 4, myocardial infarction, atrial fibrillation, rheumatic valvular heart disease, arteritis during this study were excluded. patients with any grade of leukoaraiosis according to fazekas scale and fresh infarction identified through mri were also excluded. sli was defined as focal lesions ranging from 3 to 15 mm in diameter, with hypointensity on t1-weighted images, hyperintensity on t2-weighted images. at the time, the location of the sli was recorded as thalamus, basal ganglia, deep white matter, or brain stem. age, gender, education (less than high school / high school or college / graduate degree), smoking habits (smoking or non - smoking), alcohol intake (yes or no), history of diabetes mellitus, and coronary heart disease were recorded for each subject during enrolment. systolic and diastolic blood pressures (mmhg) were recorded according to the average levels in the last 3 months by questionnaire. each participant s height and weight were measured without shoes and heavy clothing. the body mass index (bmi) was calculated as the ratio of weight in kilograms to the height in square meters (kg / m). the participants were grouped into three categories according to their bmi value. based on who recommended bmi cutoffs for asian populations, the participants were considered as underweight to normal for bmi values 27.524 (13.1 %) 18 (30.0 %) whr [m(sd) ] 0.98 (0.08)0.96 (0.08)0.089systolic bp (mmhg) [m(sd)]137.05 (15.43)135.10 (15.90)0.400diastolic bp (mmhg) [m(sd)]77.43 (9.91)75.25 (7.00)0.135coronary artery disease39 (21.3 %) 15 (25.0 %) 0.551diabetes50 (27.9 %) 18 (30.0 %) 0.751fasting insulin (miu / l) [m(sd)]13.00 (20.93)11.34 (10.04)0.554blood lipid (mg / dl) [m(sd) ] total cholesterol4.88 (1.13)5.14 (1.09)0.120 triglycerides1.43 (0.67)1.49 (0.79)0.549 hdl - c1.25 (0.42)1.35 (0.39)0.105 ldl - c2.97 (0.94)3.12 (0.96)0.287inflammation markers [m(sd) ] crp (mg / l)7.14 (2.34)8.80 (2.19) 27.524 (13.1 %) 18 (30.0 %) whr [m(sd) ] 0.98 (0.08)0.96 (0.08)0.089systolic bp (mmhg) [m(sd)]137.05 (15.43)135.10 (15.90)0.400diastolic bp (mmhg) [m(sd)]77.43 (9.91)75.25 (7.00)0.135coronary artery disease39 (21.3 %) 15 (25.0 %) 0.551diabetes50 (27.9 %) 18 (30.0 %) 0.751fasting insulin (miu / l) [m(sd)]13.00 (20.93)11.34 (10.04)0.554blood lipid (mg / dl) [m(sd) ] total cholesterol4.88 (1.13)5.14 (1.09)0.120 triglycerides1.43 (0.67)1.49 (0.79)0.549 hdl - c1.25 (0.42)1.35 (0.39)0.105 ldl - c2.97 (0.94)3.12 (0.96)0.287inflammation markers [m(sd) ] crp (mg / l)7.14 (2.34)8.80 (2.19) < 0.001 hs - crp (mg / l)2.14 (2.76)3.53 (3.41) 0.005 il-6 (pg / ml)3.28 (1.80)4.22 (2.53) 0.002 tnf- (pg / ml)11.54 (4.56)17.02 (5.37) < 0.001 location of lacunar infarction thalamus50 (27.9 %) 19 (30.0 %) 0.879 basal ganglia60 (32.8 %) 39 (65.0 %) < 0.001 deep white matter68 (37.2 %) 18 (30.0 %) 0.395 brain stem53 (29.0 %) 15 (25.0 %) 0.612the p values < 0.05 are in bold m(sd), mean (standard deviation) baseline descriptive statistics for all subjects and by depression status the p values < 0.05 are in bold m(sd), mean (standard deviation) the kappa value was 0.923, indicating significant consistency between two physicians about the diagnosis of depression. the icc value for different locations of sli namely thalamus, basal ganglia, deep white matter, brain stem was 0.972, 0.946, 0.962 and 0.953, respectively, indicating significant consistency between two radiologists about the radiological diagnosis. women and those with high school or less than high school education showed more symptoms of depression. both overweight and obese patients and physically inactive participants displayed more symptoms of depression. those with high levels of inflammation markers including crp, hs - crp, il-6, and tnf- also showed depressive symptoms. the proportion of the patients with sli in basal ganglia was significantly higher in the depression group compared with the non - depression group. no significant statistical differences were noticed within whr, blood pressure, blood lipid levels, coronary artery disease, diabetes, fasting insulin, or other locations of sli between the depression and non - depression groups. the following variables were entered into the multivariate logistic model : gender, education, physical activity, bmi, inflammation markers, and sli in basal ganglia. the results of multivariate logistic regression were shown in fig. 1 according to the adjusted or value of each variables which were statistically significant. sli in basal ganglia was a significant independent imaging predictor of depression with an or of 3.12 (95 % ci : 1.2218.015). compared with complete lack of physical activity, mild to moderate (or : 0.21 ; 95 % ci : 0.050.82), and vigorous physically active (or : 0.28 ; 95 % ci : 0.100.80) group showed strong association with depression. compared with normal weight, overweight (or : 3.56 ; 95 % ci : 1.279.94), and obese (or : 8.94 ; 95 % ci : 2.4133.17) population displayed more depression. additionally, all inflammation markers were significantly associated with depression. those with high levels of crp (or : 4.63 ; 95 % ci : 1.8511.61), tnf- (or : 4.59 ; 95 % ci : 1.9111.06), il-6 (or : 3.38 ; 95 % ci : 1.298.90), and hs - crp (or : 1.5 ; 95 % ci : 0.583.85) exhibited more depressive symptoms compared with those of normal levels. however, gender, and education were no longer associated with depression.fig. 1adjusted or value by each variables which were statistically significant, namely sli in basal ganglia, mild to moderate / vigorous physical activity, bmi, tnf-, il-6 and crp adjusted or value by each variables which were statistically significant, namely sli in basal ganglia, mild to moderate / vigorous physical activity, bmi, tnf-, il-6 and crp in our study of 243 patients, 24.7 % of the participants were classified as depressed. after considering a set of possible confounding factors, we found multiple prevalent factors that affected depression. in particular, sli in basal ganglia and vascular risk factors including higher bmi levels, and inflammation markers, crp, tnf-, hs - crp, and il-6 can increase the risk for depression. physical activity on the other hand can protect against depression. despite the fact that li is found in 1030 % of elderly individuals with 6 % of newly affected cases annually, they are thought to be clinically silent in the majority of elderly cases. majority of the previous neuroimaging studies have reported a close link between small subcortical fresh infarcts and psd ; however, only limited studies have examined the effect of sli in depression - related disorders. the main biological mechanism of psd is the ischemic lesion interrupted the neural fiber projections ascending from the midbrain to the brainstem, which leaded to a decreased bioavailability of biogenic amines, namely serotonin (5ht), dopamine (da), norepinephrine (ne) and acetylcholine. in case of slis, the damage to small vessels supplying subcortical pathways disrupts the neurotransmitter circuitry that is involved in mood regulation in a chronic pattern. when the accumulation of the infarcts exceeds a certain threshold, patient could become more vulnerable to developing depression. some putative mechanisms suggest that lesions at various sites may result in depression through direct disruption of the cortico - striato - pallido - thalamo - cortical (csptc) circuits or their modulating systems. our findings indicate that sli in basal ganglia can increase the risk of depression, which is partly consistent with the results of the previous study. given that basal ganglia consist of many central gray matter nuclei, cortico - basal ganglia circuitry dysfunction may play a role in the neurobiology of depression. cortico - basal ganglia circuitry consists of segregated functional subcircuits and their fibers project from specific functional regions of the cortex to specific nuclei in the basal ganglia. these fibers include monoamine and glutamatergic fibers, which are involved in the mood disorder. interruption of the monoamine neurotransmitter fibers results in the fluctuation of serotonin and norepinephrine levels in the orbitofrontal pathway and the prefrontal lobe. in addition, damage in the glutamatergic routes disrupts glutamatergic transmission, which is also associated with depression. alexopoulos. proposed the theory of vascular depression to suggest that pathologies to the vessels play a unique role in the onset of depression. in this model, vascular risk factors may lead to depression only after crossing a certain threshold. in addition, this model allows for each risk factor alone or in combination to cross the threshold to induce neural circuit changes, thereby mediating depression. thus, the processes of these pathways could all contribute to depression both independently and collaboratively. by conducting univariate analysis however, on multivariable analysis, we found that some of these effects were eliminated, and other effects remained associated with depression. this finding indicates that risk factors are intertwined, thereby promoting the pathological basis of depression in sli. since, we found vascular risk factors included obesity, inflammation, and lack of physical activity adrenalaxis (hpa axis) dysregulation, which is associated with depression [25, 26 ]. abnormalities to the inflammatory system of both depressed and obese people were observed, providing possible biological explanations for the association between depression and obesity. in our study, we found that both obesity and inflammation markers were risk factors for depression. increase in physical activity is also linked to the reactivity of the hpa axis and is associated with lower levels of inflammatory markers. our finding suggests that engaging in both mild to moderate and vigorous physical activity acts as protective factor in depression, which is in line with existing research. our data on the effect of inflammation markers on depression are consistent with these findings [29, 30 ]. furthermore, pro - inflammatory cytokines may lead to a reduced hippocampal volume, which is also seen in depression. this result may indicate that treatment with the anti - inflammatory agent may result in a significant decrease in depressive symptoms. first, our data were gathered by self - reported questionnaires, which could have led to bias by patients over or underreporting physical activity, depression, past history, or educational attainment. the fact that these individuals have agreed to participate in a clinical trial may suggest different emotional and behavioral characteristics, which may impact the generalizability of our results concerning depression. however, our prevalence estimates were similar to those previously reported studies on li. second, our cross - sectional study was restricted to the participants with a baseline depression score. finally, we can not draw firm conclusions regarding the direction of causality between the progression of structural changes and depressive symptoms, because depressive symptoms were only assessed at the follow - up study. in conclusion, our findings suggest that sli in basal ganglia and vascular risk factors including bmi, inflammation markers, and physical activity is strongly associated with depression. furthermore, these risk factors are clearly intertwined, proposing a pathological basis of depression following sli. by demonstrating such mechanisms affect neural circuit function, this study opens a door for future research to further examine the mechanisms that can improve the outcome for depression. it is critical that patients with sli are screened early for depression and are provided with appropriate treatment. | most previous studies reported a close link between fresh infarcts and post - stroke depression. however, studies on the relation of depression and silent lacunar infarction (sli) are limited. this study aims to analyze the effects of sli and the vascular risk factors on depression. a total of 243 patients with sli were divided into depression and non - depression groups. the presence and location of sli were evaluated with magnetic resonance imaging. depression was assessed with the patient health questionnaire-9 and vascular risks factors were collected. we used t tests and 2 test to compare the baseline characteristics of the two groups and the multivariate logistic regression model to identify the risk factors for depression. univariate analysis results showed that the proportion of patients with sli in basal ganglia was significantly higher in the depression group (65.0 versus 32.8 % ; p < 0.001) than in the non - depression group, and multiple prevalent factors had significant differences between the two groups. however, on multivariate logistic analysis, some of these factors were eliminated, and sli in basal ganglia remained an independent predictor of depression with an odds ratio of 3.128 (p = 0.018). in addition, vascular risk factors, including high body mass index level, presence of inflammation markers (e.g., crp, tnf-, hs - crp, and il-6), and lack of physical activity, were associated with depression. our findings suggest that sli in basal ganglia is associated with a higher risk of depression. vascular risk factors, which are intertwined, may propose the pathological basis of depression in sli. |
expectations of scientific research run high. internationally, funding bodies and government agencies have placed increasing emphasis on the outcomes and impact of scientific endeavour (campbell. the promise of science lies in expectations of the benefits bioscience can bring to societies and is matched by expectations of the realisation of the significant public investment in that science. in health research, first reported as such in the medical literature in 1993 the concept of translational research has a much longer history (antoine 1991). the increasing interest, especially recently, is evident in even a cursory search of pubmed where citations including the term translational research have increased nearly 200-fold since 1993, with more than half of these citations occurring in the past 2 years. likewise, the use of the term bench to beside to describe the transformation of bioscience into therapeutic practice, seen as early as 1985 (merz 1985), has exploded across the biosciences. in addition, therein lies a conundrum for translational research in biobanking. population biobanks represent an ontologically distinct approach to knowledge generation when compared with the dominant scientific forms envisaged by translational research. population biobanks merge the promise of genomics with foundational public health science, including classical epidemiology (khoury. 2009a, b), principally in the form of population - based cohort studies (burton. 2010 ; p3 g observatory 2009). biobanking science is implicitly oriented to the population focus of its historical epidemiological forebears as well as to the individualist focus of contemporary genomic medicine. biobanking steers away from the hypothesis testing that is fundamental to much basic and applied bioscience ; i.e. genome - wide association studies (gwas) and clinical trials, respectively. instead, it embraces methods of knowledge generation which prepare us to ask questions we may not yet be able to formulate 2011 ; wallace. 2009), management (borugian. 2010 ; litton. 2003 ; peakman and elliott 2008 ; yuille. 2008) and harmonisation (fortier. 2010 ; stover. 2011) of biobanking platforms and to promote and facilitate liberal data access (p3 g consortium. part of global and local endeavours to translate raw biomedical evidence into practice, their purpose is to provide a platform composed of high quality data and samples that can later provide a firm foundation for generating new scientific knowledge to inform development of new policies, systems and interventions to enhance the public s health (davey smith. effectively translating scientific knowledge into routine practice, however, involves more than good science. it is a complex social process that necessarily involves scientists, health professionals, policy makers, funders, industry and members of the public (including research participants) ; i.e. it is about the people not just the science. moreover, the mechanisms of successful translation are not well enough understood. drawing on a range of disciplinary perspectives, including biomedical and public health science, social science and philosophy, we overview the scientific logics underpinning the creation of biobanks and describe we argue that if the future utility of population biobanking is to be optimised we must explore what we should be doing now to ensure extension of the transdisciplinary collaborations to include, for example, health policy makers so that biobanking resources are configured with translational aims in mind. this will help ensure that biobanks can best contribute to the evidence - base for health policy decision - making, health - care commissioning and the implementation of new initiatives in practice. the generation of scientific knowledge involves the asking and answering of questions within constraints imposed by contemporaneous needs, knowledge and technology. until recently, most definitive answers in health science pertained to factors with relatively large effects lind s demonstration that citrus fruit prevents scurvy (kirch 2008) ; the causal role of smoking in many diseases (world health organisation 2008) ; the impact of monogenic genetic variants causing major diseases such as huntington s chorea and cystic fibrosis (carter 1977). recent years, however, have seen a fundamental change in the nature of biomedical investigation. there is therefore a manifest focus on the aetiological architecture of the common chronic diseases that affect these societies (merikangas and risch 2003 ; pritchard and cox 2002). the aim is to understand, and ultimately intervene in, the complex causal pathways via which genes and environmental / lifestyle / social determinants act alone and in interaction to cause diseases and to influence how those diseases progress once they have developed (khoury. this new challenge demands a comprehensive exploration of gene networks, of much weaker main effects (manolio. 2008 ; merikangas and risch 2003 ; wellcome trust case control consortium 2007) and of interactions between genetic, environmental, behavioural and social factors (manolio. 2006). typically, the aim is to identify and quantify the impact of a number of small effects (genetic, socio - environmental or a combination) on a given disease or health - related trait, but to do this the effects of the determinants of interest must first be disentangled from an obscuring cacophony of aetiological noise resulting from many other causal determinants. the modern search for the risk factors of complex diseases has often been compared to finding a needle in a hay - stack (moore. 2010), but this simile should probably be extended to note that the needle itself is made of straw. the change in focus from investigating risk factors with relatively large effects to explore networks of risk factors with weak effects requires a radically different approach. this is because many of the effects are very weak : for example, although the relative risk of lung cancer in smokers versus non - smokers is of the order 9.0 (doll and hill 1952, 1964), most known associations between genetic variants and chronic diseases reflect weak effects with typical allelic odds ratios in the range of 1.11.4 (burton. 2009 ; spencer. 2009 ; zondervan and cardon 2007). critically, effects as weak as this not only provide an obvious challenge from the perspective of statistical power (burton. 2009) but, in addition, they can easily be created or concealed by confounding or reverse causality. in fact, these latter concerns led gary taubes to claim that observational epidemiology had already reached its inferential limits (taubes 1995). there is no doubt that useful scientific inferences can be generated in such settings, but the obvious route to new knowledge would involve well - designed experiments : carefully controlled experiments in the laboratory setting, or studies involving randomised allocation of intervention as in a conventional clinical trial. however, many research questions in human health are simply not amenable to an experimental approach. it is, therefore, fortunate that despite the very real concerns raised by taubes (1995), useful inferences on weak effects can sometimes be based on observational studies. although genetic variants can not be allocated randomly as part of an experiment they are allocated randomly at conception (davey smith 2006 ; davey smith. if one of your parents has two different alleles at a particular locus, you must receive one, and only one, of them (burton. 2005). furthermore, the particular allele that is actually transmitted is randomly determined in a manner that is entirely independent of the variants that are inherited at all other loci (from either parent), with the specific exception of those few loci that are in close linkage disequilibrium (ld) (clayton and mckeigue 2001 ; cordell and clayton 2005) on the same chromosome. this process forms the basis of what is often known as mendelian randomisation (mr) (davey smith 2006 ; davey smith and ebrahim 2003 ; sheehan. 2008) which has a number of profound implications : (i) genetic variants do not usually confound one another unless they are in close ld (here we ignore the inferential distortion that can arise from ancestral substructure in an imperfectly designed study ; devlin. 2001). (ii) genetic variants are not generally associated with socio - environmental determinants (and can not therefore confound them) unless a particular genetic variant has a biological mechanism that directly modifies exposure to a socio - environmental determinant of interest. in other words, which of two alleles is received at conception from one parent can not possibly be related to whether an individual later chooses to smoke unless those two alleles have a different and direct impact on their predilection to smoke. in general, therefore, inferences on genetic determinants are not confounded by environmental factors and vice versa. (clayton and mckeigue 2001 ; davey smith 2006 ; davey smith and ebrahim 2003 ; davey smith. 2005 ; sheehan. (iii) interactions between socio - environmental determinants and genes are typically more robust to confounding than are the direct effects of the socio - environmental determinants themselves. for example, in relation to the role of a gene (g) and a socio - environmental determinant (se) in causing a disease (d), serious confounding of the direct effect of se could easily arise if confounding factor c was associated both with d and with se and such confounding is extremely common because health - related behaviours tend to cluster (davey smith. 2004) : e.g. smokers often take less exercise, drink more alcohol, and take fewer vitamins. this is why it was argued that observational studies have a limited role in relation to studying weak effects (taubes 1995). but, if scientific interest focuses on the interaction between g and se (g : se)i.e. it is true that serious inferential problems will arise if the nature of the g : se interaction varies systematically with the level of c, but this is markedly less likely than the near ubiquitous clustering of health - related behaviours (davey smith. (iv) items i, ii and iii imply that weak effects associated with genetic variants or with interactions between genes and socio - environmental determinants are of considerably greater inferential value than would be the case in the absence of mr (taubes 1995). however, mendelian randomisation also provides a firm inferential foundation when scientific interest focuses on the direct effect of an environmental exposure alone. in fact this is the very purpose to which mr has classically been applied (clayton and mckeigue 2001 ; davey smith 2006 ; davey smith and ebrahim 2003 ; davey smith. specifically, if one is interested in whether factor se protects against disease d, if one can identify a genetic variant (g) that has the same impact on an individual as increased (or decreased) exposure to se, then demonstration that g is associated with d provides evidence that se is causally associated with d. this is known as an instrumental variable approach (davey smith. crucially, although this approach negates both confounding and reverse causality, a number of key assumptions that demand proper understanding of the underlying biology and mathematics must be met (didelez and sheehan 2007 ; palmer. 2008 in addition, if enough is known about the underlying biological, environmental and social determinants and if adequate resources can be invested in measuring relevant factors extremely carefully, it will sometimes be possible to control the analysis closely enough to enable inferences to be drawn that may reasonably be viewed as robust to confounding. furthermore, if such an analysis is undertaken as part of a prospective cohort study (with initial exposure assessments being made whilst participants are still healthy) reverse causality is far less likely to be a serious problem. as we learn more and more about the underlying biology and social science, our ability to address confounding in ways that use prior knowledge in concert with sophisticated analysis based on the data from very comprehensive databases will inevitably increase. if they are used cautiously and appropriately, it is therefore clear that large observational epidemiological studies can provide a useful basis for investigation of the causal architecture of complex diseases. however, it is also clear that these studies must be designed, set up and managed strategically (bbmri 2010 ; knoppers. this need was reflected in the decision to include european biobanking and biomolecular resources amongst the 36 designated priorities in the esfri roadmap that represented the european union s strategy for development of the infrastructure supporting pan - european science (european strategy forum on research infrastructures 2006). in effect, biobanks are now seen as the infrastructural equivalent of linear accelerators and telescope arrays in the physical sciences : that is, multipurpose facilities representing broad - based platforms to support the scientific community as a whole in its asking and answering of key questions across the realm of bioscience. however, if their value is to be optimised, these facilities must have a number of pivotal characteristics : they must provide access to data and biosamples relating to vast numbers of individuals (burton. control studies including thousands of cases are required even when interest focuses on the most straightforward situation : the detection of simple associations between single nucleotide polymorphisms (snps) (burton. 2005) and a disease of interest (burton. furthermore, when, as is likely, scientific emphasis moves on to focus on the study of gene socio - environment and gene gene interactions, and the exploration of causal pathways more comprehensively, tens of thousands of cases will often be required (burton. 2009). tens of thousands of participants can also be required to study a quantitative phenotype (e.g. measured blood pressure), because allelic effect sizes may be as small as 1/10th of a standard deviation, or even less (newton - cheh. finally, the use of an instrumental variable approach to address confounding increases the sample size requirement still further (clayton and mckeigue 2001). data and samples must be collected under formal standard operating procedures (fortier. 2010 ; isber 2005 ; moore. 2011), and the assessment of disease status, biomarkers, physiological processes and social and environmental factors must be both accurate and precise. when aetiological effects are already weak, measurement error can substantially reduce statistical power yet further (burton. 2003), and if errors are made in assessing confounders, real causal relationships may be obscured or artefacts created.to achieve sample sizes of the magnitude required i.e. involving enough participants that each have high quality data and samples of the nature required it will often be necessary to pool data across multiple studies (burton. this is well - exemplified by the large collaborative consortia that have been responsible for much of the recent progress in human population genomics (burton. 2007 ; frayling. 2007 ; hindorff. 2009 ; newton - cheh. 2009a, b ; saxena. 2007 ; scott. 2007 ; stacey. 2007 ; they must provide access to data and biosamples relating to vast numbers of individuals (burton. control studies including thousands of cases are required even when interest focuses on the most straightforward situation : the detection of simple associations between single nucleotide polymorphisms (snps) (burton. furthermore, when, as is likely, scientific emphasis moves on to focus on the study of gene socio - environment and gene gene interactions, and the exploration of causal pathways more comprehensively, tens of thousands of cases will often be required (burton. 2009). tens of thousands of participants can also be required to study a quantitative phenotype (e.g. measured blood pressure), because allelic effect sizes may be as small as 1/10th of a standard deviation, or even less (newton - cheh. finally, the use of an instrumental variable approach to address confounding increases the sample size requirement still further (clayton and mckeigue 2001). data and samples must be collected under formal standard operating procedures (fortier. 2011), and the assessment of disease status, biomarkers, physiological processes and social and environmental factors must be both accurate and precise. when aetiological effects are already weak, measurement error can substantially reduce statistical power yet further (burton. 2003), and if errors are made in assessing confounders, real causal relationships may be obscured or artefacts created. to achieve sample sizes of the magnitude required i.e. involving enough participants that each have high quality data and samples of the nature required it will often be necessary to pool data across multiple studies (burton. this is well - exemplified by the large collaborative consortia that have been responsible for much of the recent progress in human population genomics (burton. collectively, these various requirements have led to the development of a new field of endeavour in bioscience that may be referred to as biobanking science. the many professionals and researchers that work in this field include : laboratory scientists, clinical scientists, epidemiologists and statisticians, informaticians, ethico - legal experts and social scientists. although they each have their own specialist areas of exploratory interest and expertise within the broader field of biomedical science, they share a collective focus on optimising the design, set up, harmonisation, networking and evaluation of the range of studies that are sometimes called biobanks : organized collection[s ] of human biological material [e.g. blood, urine or extracted dna ] and associated information stored for one or more research purposes the studies that fall under this umbrella primarily represent population - based cohort studies, large case control studies and tissue repositories, but some cross - sectional studies and randomised controlled trials qualify as biobanks too (burton. crucially, although many of these studies were originally designed to support classical phenotype to genotype science (e.g. nested case control studies), they also provide a platform for exposure - based investigation including genotype to phenotype or genotype - based (burton. this latter approach uses exposure - based information (particularly, genotype data) to identify informative population - subsamples that, with consent, can be brought in for detailed additional investigation. here, the vast size of modern cohort - based biobanks sometimes viewed as being scientifically inefficient provides a great strength : even a genotype that occurs as rarely as one in one thousand people, will be represented in five hundred participants in a population - based biobank containing 500,000 participants such as uk biobank. in addition, when biobanks are effectively catalogued and harmonised (burton. 2010 ; fortier. 2010 ; p3 g observatory 2009), the available sampling frame for such studies can potentially be extended to several millions. the structures and actors within biobanking science are reflective of what is described within social studies of science as mode 2 knowledge production ; that is, a new way of thinking about the generation of knowledge in science (nowotny. mode 2 knowledge production is carried out in the context of application (research translation), brings a heterogeneity of skills and expertise to the problem solving, and is transdisciplinary in nature (nowotny. 2001). transdisciplinarity is not simply another of the proliferation of terms for multidisciplinarity, but rather points to the transgressive character of knowledge generation (nowotny. 2001) that there is a co - evolution or co - production (callon. 1992 ; callon 1999, p. 69 ; jasanoff 2004, p. 70 ; geels 2005) of knowledge that transgresses disciplinary boundaries. transdisciplinarity requires actors to engage actively in the messy and thorny work of overcoming difference and awkwardness whilst also drawing strength and value from the very existence of those differences (demir 2008, 2011). demir (2011) demonstrates how scientists achieve translation of their work across disciplinary borders by extending their own concepts and working language to incorporate new concepts ; much as in second language acquisition. through informal and formal exchanges, scientists in one discipline acquire, albeit in a limited way, the language, ideas and practices of another group (demir 2011). integration of these borrowed concepts and practices reshape the frameworks of the adopting discipline or field ; which might, for example, facilitate harmonisation and data sharing. within biobanking, there is clear evidence not only of transdisciplinary structures, but of the transdisciplinary generation of knowledge. an ongoing ethnographic study (hammersley and atkinson 2007) of the development of datashield (wolfson. 2010) by authors of this paper (m.m., p.b.) demonstrates how the intersection of ethics, informatics and statistics is shaping the structure of the ensuing technology that is datashield. the rapid progress of biobanking science over the last 5 years reflects a successful professional networking of biobanking scientists across the world that has been led by organisations, institutions and projects such as : pg (knoppers. 2008), phoebe (wolfson. 2010), bbmri (wichmann. 2011), gen2phen (2010), bioshare - eu (2011), isber (2005), and nci (moore. 2011). crucially, the work carried out by these complementary and overlapping groups has, to date, focussed primarily on designing and setting up biobanks and on exploring a variety of approaches to networking and harmonisation (borugian. 2010 ; burton. 2009 ; fortier. 2010 ; isber 2005 ; litton. 2010 ; wallace. 2009 ; wichmann. 2011 ; yuille. however, the scientific focus is now entering a new phase in which the priorities are to provide liberal, but secure, access to data and samples (pisani and abouzahr 2010 ; walport and brest 2011), to ensure that biobanks are used widely and effectively, and to streamline pooled analysis involving multiple biobanks (fortier. 2010). the success of the large transdisciplinary organisations that comprise international biobanking is in no small part due to the fact that the science underpinning the successful construction and use of biobanks is philosophically very different from that underpinning hypothesis - based science. although biobanks are undoubtedly a child of contemporary bioscience and are aimed primarily at facilitating new scientific discoveries, they are not hypothesis - driven per se. rather, they may be seen as being part of a pre - competitive endeavour on the part of many bioscientists to advance and facilitate future hypothesis - driven science. in consequence, although biobanks are costly and may take many years to mature to full value, they should not be viewed as competitors to hypothesis - based science. an essential pre - requisite if hypothesis - based research is to be as successful at disentangling the causal structures underpinning complex diseases as it has historically been at revealing the impact of much stronger determinants of health and disease. in essence, biobanks will ensure a flexible yet valid platform for the as yet unpredicted (and unpredictable) bioscience questions of tomorrow. this not only impacts on the scientific design of biobanks, but it has major ethico - legal and social implications. how, for example, can we effectively ask participants to consent to answer detailed questionnaires, provide invasive tissue samples and agree to long - term monitoring of their health when even the scientists do not know how all of the data and samples will be used in the future ? of course, one possible answer to this, seemingly rhetorical, question is to ask them. there can be little argument, but that the development of biobanking science over the first decade of the new millennium has been remarkable. although it may be of great interest and reward to the scientists involved, no part of bioscience can ever be an end in itself. society invests heavily in scientific research related to medicine because it is assumed that this will ultimately improve the health of the community and of individuals within that community (cooksey. the raison detre of biomedical research is therefore to enhance public health through primary prevention, improved diagnosis and treatment, and the enhanced long - term control of chronic diseases. such ends may be achieved via a wide range of different interventions at either the individual or population levels and biobanks can undoubtedly make a pivotal contribution to these aims. but if biobanks are to achieve optimal utility in the long term, it is critical that extensive thought is now put into how we should build on the successes of biobanking science to date, to ensure that biobanks are able to provide effective translational return in the future. the transdisciplinary collaborations must be extended to include professionals in public health, health policy making and health economics. this will facilitate the enrichment of biobank databases with population - based and hospital - generated health event data. it will also enhance the future potential for biobank - driven translational activity ; particularly, translation into population level public health. demonstrating what has been described as a shift from regimes of truth to regimes of hope in clinical and bioscience (moreira 2009 ; moreira and palladino 2005)that is, the speculative potential of new therapeutic interventions discussion of translational research begins in earnest with the nih roadmap (us) (zerhouni 2003), cooksey report (uk) (cooksey. 2006) and mrc framework for complex interventions (uk) (campbell. one is the process of applying discoveries generated during research in the laboratory, and in preclinical studies, to the development of trials and studies in humans. the second area of translation concerns research aimed at enhancing the adoption of best practices in the community (nih 2011). that is, bench to bedside and research into practice. called t1 and t2 translational research, respectively, we can think of these endeavours as the processes and practices of transforming data into knowledge and knowledge into practice. the first gap arises in the translation of basic and clinical research into ideas and products, i.e. at the bench ; the second gap relates to introducing those ideas and products into clinical practice 2006). whilst the nih areas of translation describe a transition from the bench to the community, the backyard, it is gaps in t1 translational research, from bench to bedside, that are the predominant focus of the translational research literature and funding (woolf 2008) thus, the long standing viewpoint of the biomedical lens, which more often includes the individual than the population, is maintained (murtagh and hepworth 1997 ; thomson. nonetheless, just how these translational transitions might be bridged has been the subject of much discussion, though there is a paucity of empirical research on these processes. what is clear, however, even in the seemingly most straightforward of translational processes, for example from biomarker to drug discovery to testing to adoption in routine clinical practice, is that it is not sufficient to simply throw the outputs of science over the wall (cox 2011). that is, without aim, direction, purpose and without communication on either side between scientists, clinicians and others involved in disseminating and implementing that science. there is recognition within the bioscience community that translational research presents challenges and that the translational research model as initially described does not adequately account for the range of activity within bioscience or for the embeddedness of bioscience in and with other disciplinary, professional or public groupings and settings. early appeals for the involvement of a range of disciplines envisaged an expansion to include biomedical and informatics scientists with bioscience (zerhouni 2003, 2005). more recent expectations reflect what social studies of science describe as communities of promise (martin. 2008) in which the articulation of clinical and biosciences are fundamental to the dynamics of translation and innovation and include the involvement of social, behavioural and ethico - legal disciplinary contributions (khoury 2010 ; khoury. 2009b, 2011 ; zimmern and brice 2009) as well as public and participant engagement in translational research, especially in the knowledge to practice phase (armstrong. 2006 elaborations of the nih / cooksey model have largely included disambiguation of the t2 phase. roadmap to ameliorate the myriad detours, speed traps, roadblocks, and potholes [that ] limit the movement of treatments from bench to practice i.e. the limited external validity of randomised controlled trials, the diversity of health care practice efficiency and effectiveness, limited successful collaboration between researchers, clinicians and patients and failure to address the identified needs of the community. they expand translational research to incorporate t1t3 components : where t1 represents translation to humans of basic science in the form of preclinical and animal studies ; t2 incorporates translation to patients of research through guidelines development, meta - analyses and systematic reviews ; and, in t3 the translation to practice via dissemination and implementation research (westfall. colleagues describe a t1t4 continuum to accelerate appropriate integration of human genome discoveries into health care and disease prevention (khoury. 2007). in the context of the hoary debates regarding population impact (public health) and individual outcomes (personalised medicine) of genomic discovery, burke. (2010) have most recently added a t0 pre - scientific phase in a t0t4 model to represent the context of population health needs. the t0 phase represents assessment of the population health - disease burden (burke. 2010) which prompts (whether formally or informally) t1 translational research that aims to move scientific discovery into candidate applications. evaluation of candidate applications (treatments and other health interventions) in t2 translational research assesses these applications and shapes development of evidence - based guidelines and policy. t3 translational research aims to move evidence - based recommendations and policy into health care practice via implementation, dissemination and diffusion research. phase four, t4 translational research aims to evaluate the health impact of the application in practice. and thus the cycle begins again albeit, we hope, with a modified population health - disease burden. though not addressing the t1/t2 model explicitly, the recent review by green and guyer (2011) references a disarticulation of the t1 phase. describing translation in genomics as moving from base pairs to the bedside, green and guyer (2011) add understanding of the structure of genomes, the the biology of genomes and the biology of disease to the t1 model. a molecular, cellular and somatic disease model implied by green comprise what we call the t1.1, t1.2, t1.3 components of the t1 phase (see fig. 1). added to this, we include t1.4, the understanding of the social context and determinants of disease : this may be in terms of the social construction and experience of the disease itself (cf. murtagh and hepworth 2003), understandings of the social context of disease to inform new interventions in the t2 setting (cf. as we state above, understanding of the social, behavioural and ethico - legal dynamics are fundamental to successful implementation and improvement science. also missing from current models of translation is an explicit acknowledgment of the tools and methodologies that underpin translation of basic and applied research : for example, innovative theories, tools and methods for analysing data to maintain privacy and confidentiality (wolfson. 2007) ; enhancing the processes of knowledge translation and exchange (graham and tetroe 2007 ; kitson as 2009) ; improving practice (dixon - woods. 2001) ; implementing policy guidelines and new practice in complex organisations (may 2006 ; may. we call these ttm or, t0tm, t1tm, and t2tm as appropriate to the phase of translation (see fig. 1). in terms of t2tm 2010 ; 2 derived from green and guyer 2011, 3 terms used by khoury. 2007) an expanded translational research continuum (1 term used by burke. 2010 ; 2 derived from green and guyer 2011, 3 terms used by khoury. 2007) as much as we can not simply throw the science over the wall and expect the generation of appropriate interventions, nor can we simply throw these interventions over the wall. whilst the models of translational research above have been elaborated beyond the dyadic t1 and t2 translational research, concern with the processes by which knowledge is translated into practice in the real world that is, the messy, contingent, ambiguous, peopled world have been taken up by a range of disciplines under the rubrics dissemination, implementation, and most recently, improvement science, i.e. t2tm. the important distinction between research translation and these variants of implementation / improvement science is the focus of the former on the content of the science and form of the interventions generated and of the latter on the processes of moving the resultant science and interventions across the research translation continuum into practice. key amongst these approaches is knowledge translation (kt) which is defined by the canadian institute for health research (cihr) as a dynamic and iterative process that includes synthesis, dissemination, exchange and ethically sound application of knowledge to improve the health of canadians, provide more effective health services and products and strengthen the health care system (cihr 2011). with adjustments for citizenship this is the definition used in the international literature and in the canadian context goes under the banner better research, better decisions, better health. kt has an inherently democratising orientation. kt draws upon a long history within health promotion, health education and community development of engaging communities, health care providers and policy makers with health care issues, action and change. these multiple perspectives share a common understanding of the translation of knowledge to practice as a complex dynamic social process. moreover, these are public, not simply scientific issues. as with nowotny.s (2001, 2006) call for transdisciplinary knowledge generation, the forums for discussion and development of the translation of biobanking knowledge necessarily involve the representation and participation of scientists with industry, government and health service stakeholders as well as research participants and the public. being neither the expert forums of academic conferences, select committees and health department committee meetings nor the public forums of patient groups, public meetings and demonstrations, these are, instead, what callon. translation of biobanking science demands the active involvement and intersection of perspectives of the full range of stakeholders : that is, the co - evolution of translational research. knowledge translation under the cihr definition takes place within a complex system of interactions between researchers and knowledge users which may vary in intensity, complexity and level of engagement depending on the nature of the research and the findings as well as the needs of the particular knowledge user (cihr 2011). kt offers a number of strategies of translation and exchange, the primary mode of which is a knowledge - to - action framework, which incorporate cycles of development that iterate between problem identification, knowledge synthesis, contextualising, tailoring and adapting knowledge, product and tools development, and evaluating and sustaining knowledge use (graham and tetroe 2007 ; kitson and straus 2009). practices of kt include : use of consensus conferences or expert panels, systematic reviews, narrative syntheses, meta - analyses, meta - syntheses and practice guidelines to contextualise and integrate research findings ; dissemination via briefings and educational sessions with stakeholders, including patients, practitioners and policy makers, engaging knowledge users in developing and executing dissemination / implementation plans, and media engagement ; knowledge exchange through interaction between knowledge users and researchers and results in mutual learning through the process of planning, producing, disseminating, and applying existing or new research in decision - making ; and, are consistent with ethical principles and norms, social values, as well as legal and other regulatory frameworks (kitson and straus 2009). empirical studies of kt strategies demonstrate their promise, but also their challenges (lwy 1996 ; mitton. 2009 ; mitton. 2007) and such networks demand the reshaping of some members normative cultures and beliefs. in one example, the processes were inclusive and facilitated the involvement of non - academic actors, but tended to conceal political tensions (lehoux. the resultant science was a pragmatic one whose intention was not to provide a critique or to produce unconventional knowledge (lehoux. although we must guard against an untrammelled science, an overly civilised science runs the risk of quashing innovation. limits may impede bioscientific creativity and imagination but the challenges offered by transdisciplinarity can become a driving force for creativity (nowotny 2008). as in biobanking science, the challenges of ethico - legal scholars (cambon - thomsen. 2007 ; gottweis and lauss 2010 ; hoeyer 2008 ; knoppers and chadwick 2005) related to privacy and security of data have led to development of new technologies (wolfson. 2010). studies of implementation suggest a range of challenges to moving new bioscience knowledge into practice. kitson and straus (2009) demonstrate inherent resistance in many organisations to embrace change and that most people (including professionals) operate most of the time on automatic pilot and (2007) identifies the organisational components as necessary for kt and implementation knowledge as : capabilities (support to use and diffuse knowledge, e.g. knowledge brokers, training) ; process (e.g. knowledge networks, communities of practice, integration of kt in research) ; and codification (e.g. practice guidelines, quality indicators, performance management systems). normative process theory (may 2006 ; may. 2009) suggests that interventions only become routinely embedded (implemented and integrated) in their social, organisational and professional contexts as the result of people working, individually and collectively, to do so. successfully achieving this requires an understanding of : how people make sense of the action(s) to be implemented ; their attitudes ; and their intentions. importantly, implementation requires continuous investment by people in ensembles of action that carry forward in time and space research translation is a contextual and cumulative process : one that is necessarily dynamic and interactive ; one that involves multiple actors. research translation is broadly conceived as one in which there is a contemporaneous exploration of new avenues of research occurring in the same contexts in which new interventions are being developed and applications anticipated interventions are ideally part of an iterative cycle of translation, incorporating further intervention and reintegration. implementation / improvement science is predominantly focused on the t2 (i.e. t2t4) phases of the translational research continuum. arguably, in biobanking science, the methods of kt as described here are necessary across the continuum to include t0tm and t1tm methodologies to complete and maintain the cycle of translation. what is not yet entirely clear is just how to operationalise the translation cycle. certainly knowledge generation will be collaborative, interactive and transdisciplinary. practical methodologies of translation (including kt) in biobanking will likely include collaborative multiple stakeholder networks (hybrid forums) to build on the existing transdisciplinary science networks. addressing the complexity of bioscience knowledge generation and this is arguably more so for biobanking science. whilst biobanks undoubtedly provide a fundamental resource for both clinical and public health practice their potentiating ontology that their outputs are perpetually a promise of scientific knowledge generation (borup. biobanking science therefore provides a perfect counterpoint against which to test the bounds of thinking in terms of knowledge generation and its translation. the beginnings of a robust model are to be found across the range of considerations of translational research and knowledge generation described above, both from within bioscience and without. in this paper, we described the distinctiveness of population biobanking and defined distinctions between a range of disciplinary approaches to translation in / of research. that we must imagine instead, for translational research for biobanks, a new paradigm : one that takes us from bench to bedside to backyard and beyond ; that is attentive to the social and political context of translational science ; and is cognisant of all the players in that process be they researchers, health professionals, policy makers, industry representatives or members of the public, amongst others. although the question of just how we achieve this remains open, it is essential to direct our attention to these critical issues in the current phase of biobank development. we need to explore how we can ensure that the maturing biobanks platforms are appropriately set up to optimise their ultimate value as drivers of translational change. there is a vital need to embed biobanks within health systems and to ensure involvement of policy makers, and health care providers early in the process. the depth and breadth of information that is ultimately required is so extensive that we will never have as much as we might ideally like. consequently, it is to everybody s advantage that biobank builders freely share their knowledge and expertise. the long - term management and use of data are social processes with ethico - legal implications. much of the management of the science must focus on these issues rather than on the detailed bioscience itself. this demands the development and provision of new methods and tools, and the active co - involvement of bioscientists, clinical scientists, population and public health scientists, social scientists, and experts in information management and technology, and ethico - legal issues. to optimise ultimate outcomes, it should also involve the general public, health care providers and strategists, politicians and industry. no single group can possibly do the work that is required, and no single group can truly dominate or lead. optimising | the promise of science lies in expectations of its benefits to societies and is matched by expectations of the realisation of the significant public investment in that science. in this paper, we undertake a methodological analysis of the science of biobanking and a sociological analysis of translational research in relation to biobanking. part of global and local endeavours to translate raw biomedical evidence into practice, biobanks aim to provide a platform for generating new scientific knowledge to inform development of new policies, systems and interventions to enhance the public s health. effectively translating scientific knowledge into routine practice, however, involves more than good science. although biobanks undoubtedly provide a fundamental resource for both clinical and public health practice, their potentiating ontology that their outputs are perpetually a promise of scientific knowledge generation renders translation rather less straightforward than drug discovery and treatment implementation. biobanking science, therefore, provides a perfect counterpoint against which to test the bounds of translational research. we argue that translational research is a contextual and cumulative process : one that is necessarily dynamic and interactive and involves multiple actors. we propose a new multidimensional model of translational research which enables us to imagine a new paradigm : one that takes us from bench to bedside to backyard and beyond, that is, attentive to the social and political context of translational science, and is cognisant of all the players in that process be they researchers, health professionals, policy makers, industry representatives, members of the public or research participants, amongst others. |
hypotension is a known effect of atypical antipsychotics. in addition, the prevalence of orthostatic hypotension in the elderly is estimated to be between 5% and 33% and increases with age.1 orthostatic hypotension is a common side effect of a number of medications, including antipsychotic drugs, and a major contributing factor to the occurrence of falls with adverse consequences, such as bone fractures, injuries, functional decline, dependency, and death. furthermore, the extent to which antipsychotic drugs cause hypotension differs, and low - potency conventional antipsychotics and clozapine are among the more problematic. however, there is little information on acute hypertension resulting from antipsychotic drugs. aripiprazole is a potent (high - affinity) partial dopamine d2 agonist, a serotonin 5-ht1a agonist and a 5-ht2a antagonist.2 it acts as a functional antagonist of d2 receptors under hyperdopaminergic conditions but exhibits functional agonistic properties under hypodopaminergic conditions.3 here, two cases of acute hypertension during the switch from other antipsychotics to aripiprazole are reported. her mental condition had been maintained with 2 mg / day of risperidone or 816 mg / day of perospirone for several years. hypertension (systolic blood pressure > 180 mmhg) had developed 2 years previously and had been treated with a salt reduction policy and amlodipine at 5 mg / day. as a result, her blood pressure was controlled, and amlodipine was discontinued after 1 year. due to akathisia, perospirone at 8 mg / day was changed to quetiapine at 100 mg / day or olanzapine at 5 mg / day ; however, these drugs were withdrawn because of sedation. thus, aripiprazole was initiated, but she suffered from dizziness, headache, and anacatesthesia as well as hypertension (200/110 mmhg). thus, aripiprazole was changed to risperidone at 2 mg / day, and her blood pressure immediately dropped to 130/80 mmhg. this patient was a 63-year - old man with a 9-year history of bipolar disorders. his primary symptoms included depressed mood, insomnia, appetite loss, concentration difficulty, and suicidal ideation. he was diagnosed with hypertension (systolic blood pressure > 180 mmhg) 1 year previously and treated with a salt reduction policy and nifedipine at 10 mg / day. consequently, his blood pressure was controlled, and nifedipine was discontinued after 3 months of treatment. his mental status was depressed with lithium treatment at 600 mg / day, paroxetine at 30 mg / day and olanzapine at 5 mg / day. because of persistent depressive episodes, olanzapine at 5 mg / day was switched to aripiprazole at 3 mg / day. when the dose of aripiprazole escalated to 24 mg / day, his blood pressure increased to 180/90 mmhg with headache, and he was inarticulate. although his hypertension was treated with amlodipine at 5 mg / day and propranolol at 60 mg / day, his blood pressure did not change. in the two cases presented here, hypertension after aripiprazole initiation but recovery after aripiprazole discontinuation was observed. based on these clinical courses, it was concluded that the hypertension worsened due to aripiprazole, although withdrawal effects of previous antipsychotics can not be ruled out. antipsychotics are known to cause the metabolic syndrome of insulin resistance, hyperlipidemia, and hypertension. thus, addressing blood pressure as well as glycemia and lipid levels is an important step in the management of patients taking aripiprazole. in addition, according to the product information, the most frequently reported adverse reaction in clinical trials was headache (otsuka pharmaceutical co, ltd, tokyo, japan). the dopamine receptor in vascular smooth muscle participates in vasodilatation, but the possibility that aripiprazole causes vascular smooth muscle to shrink as an antagonist under conditions in which dopamine is superabundant and high blood pressure is induced has been hypothesized. however, there is no d2 receptor in vascular smooth muscle, although there are d1 receptors. because aripiprazole has extremely low affinity for the d1 receptor, it is unlikely that the high blood pressure observed with aripiprazole was mediated through the d1 receptor. although hirose reported that aripiprazole acts as an antagonist for the 5-ht2a receptor,4 davies indicated that aripiprazole is a partial agonist for 5-ht2a.5 because the 5-ht2a receptor participates in the contraction of vascular smooth muscle, the possibility that vascular smooth muscle shrank as a result of aripiprazole acting as an agonist for 5-ht2a and inducing a rise in blood pressure has been hypothesized. the involvement of -1a adrenergic receptors can not be ruled out because aripiprazole has high affinity for -1a adrenergic receptors,6 which is related to malignant hypertension.7 in addition, nitric oxide is known to suppress blood pressure. an in vitro study using brain macrophages has suggested that aripiprazole inhibits nitric oxide production from microglial cells.8 therefore, suppression of nitric oxide by aripiprazole may result in the patient s hypertension. however, only four reports have demonstrated high blood pressure induced by aripiprazole. borras reported hypertension (220/110 mmhg) and tachycardia during aripiprazole treatment at 30 mg / day in a schizophrenic patient, which disappeared after aripiprazole discontinuation and propranolol administration.9 pitchot and ansseau indicated that the addition of 5 mg of aripiprazole to 150 mg of venlafaxine in a patient with major depressive disorder led to hypertension (200/110 mmhg) and that aripiprazole discontinuation led to normalized blood pressure within 48 hours.10 hsiao showed high blood pressure (220/110 mmhg), headache, and dizziness after treatment with 90 mg of duloxetine and 5 mg / day of aripiprazole in a depressed patient.11 moreover, the administration of nifedipine and ramipril did not have an antihypertensive effect, and blood pressures were normalized with a reduction in aripiprazole from 5 mg / day to 2.5 mg / day. in addition, bat - pitault and delorme reported hypertension (190/110 mmhg) in an adolescent patient, which was most likely induced by aripiprazole.12 although pitchot and ansseau and hsiao discussed the influence of a concomitant drug,10,11 case one in the current report received aripiprazole only, and high blood pressure developed after aripiprazole. therefore, it is not likely that the influence of the concomitant drug induced hypertension. pitchot and ansseau suggested the association with a prior history of cardiovascular disease, including coronary disease,10 and the two cases in the current report also revealed a history of hypertension. therefore, blood pressure variation must be carefully monitored when administering aripiprazole to patients with a previous history of cardiovascular disease. this report presented two cases demonstrating high blood pressure after aripiprazole initiation, although blood pressures were normalized following aripiprazole interruption. although the mechanism underlying the rise in blood pressure remains unclear, careful monitoring of blood pressure variations when administering aripiprazole to patients previously treated for high blood pressure is necessary. | aripiprazole is widely used in the treatment of schizophrenia and bipolar disorders. although antipsychotics generally have hypotensive effects, two cases were identified that demonstrated hypertension during the switch from other antipsychotics to aripiprazole. the hypertensive state of these patients recovered after switching back to other antipsychotics, and these cases suggest that aripiprazole may lead to hypertension. |
more than 60 diseases and injuries resulting in approximately 2.5 million deaths per year worldwide are linked to heavy alcohol drinking (edwards., 2011). the number of current available medications for the treatment of alcohol dependence is limited, and most treatments show only moderate efficacy. promising results in the treatment of alcohol dependence have been obtained with some existing drugs such as anti - epileptic drug topiramate, antispasmic baclofen, and nausea relieving ondansetrone (sellers., 1994 ; new therapeutic drug targets have also been launched during the last years including cannabinoid receptors, neuropeptide y, corticotropin - releasing factor, and ghrelin (kraus., 2005 ; thorsell., 2006 ; lowery and thiele, 2010 ; maccioni., 2010). recent findings from our laboratory using various animal models assessing dependence - like alcohol behaviors as well as binge - like alcohol drinking suggest that histamine h3 receptor could be a potential therapeutic target in the treatment of alcohol dependence (nuutinen., 2010, 2011a, b). many modulatory neurotransmitter systems converge on the same neurons in the brain. for example, the actions of acetylcholine, histamine, norepinephrine, and serotonin on human neocortical cells are similar : they all increase spiking by reducing spike - frequency adaptation (mccormick and williamson, 1989). it is thus not surprising that several transmitters or their respective receptor ligands can have similar effects on neural circuits and behavior. some of the important systems in drug abuse include the mesolimbic dopamine system and corticostriatal and corticoaccumbal glutamate systems (koob and volkow, 2010 ; kalivas and volkow, 2011). all these brain regions are also innervated by histamine - containing nerve fibers originating from the posterior hypothalamic tuberomamillary nucleus both in rodents and in humans (panula., 1989 ; following release, histamine is mainly inactivated by methylation in the brain to an inactive metabolite tele - methylhistamine, whereas in the peripheral organs oxidation by diamino - oxidase is predominant (haas and panula, 2003). concentrations of tele - methylhistamine have been shown to correlate well with histamine release in the brain. very few studies have directly analyzed the role of histamine in alcohol - related behaviors in humans, and animal studies have been carried out only recently. in postmortem analysis, histamine and tele - methylhistamine, the first metabolite of histamine, levels are clearly increased in patients who suffered from extensive liver cirrhosis following alcohol abuse (lozeva., 2003). the histamine levels were elevated in both patients with high alcohol consumption and those with no alcohol use. the mechanism is thus most likely related to the highly increased levels of neutral amino acids in the blood circulation, as reviewed earlier for experimental portocaval anastomosis cases (fogel., 2002). in one study on type 1 (late onset, often females, low degree of association with violence) and type 2 (early onset, often males, high degree of association with violence) alcoholics histamine levels were significantly elevated in the gray matter of type 1 alcoholics and the levels of tele - methylhistamine were elevated in type 2 alcoholics indicating that histamine turnover is altered (alakarppa., 2002). in alcohol - preferring alko alcohol (aa) rats developed in finland in 1960s using a two - bottle choice preference selection method (eriksson, 1968) several aminergic systems are abnormal. they have higher tyrosine hydroxylase activity and higher levels of dopamine and noradrenaline in striatum and limbic regions (ahtee and eriksson, 1975), higher serotonin levels in many brain areas (ahtee and eriksson, 1973), and higher histamine and tele - methylhistamine levels in many brain regions than alcohol non - preferring alko non - alcohol (ana) rats (lintunen., 2001). higher tele - methylhistamine levels indicate also higher histamine release in aa than ana rats. this high histamine content agrees well with the higher density of histamine - immunoreactive nerve fibers in many regions of the aa rat brain, including nucleus accumbens, septal nuclei, and medial preoptic nucleus. thus, histamine from the other major storage site of brain histamine, mast cells, is not responsible for the significant difference. receptor radioligand autoradiography has shown significant differences in histamine h1 receptor binding throughout the brain of aa and ana rats. the binding densities in aa rat brain were lower, possibly as a result of high histamine release induced downregulation (lintunen., 2001). receptor radioligand binding is lower in aa than ana rats in the motor cortex, nucleus accumbens, and ca1 area of the hippocampus. although similar systematic studies have not been carried out in other rat lines selected for high volunteer alcohol intake, an analysis of histamine content in the cortex of the high alcohol preference (hap) and low alcohol preference (lap) rats was not different (kitanaka., 2004). however, the histamine induced phosphoinositide hydrolysis was significantly lower in hap than lap rats (kitanaka., 2004). rat lines selected for high alcohol sensitivity (alcohol non - tolerant, ant) and low alcohol sensitivity (alcohol tolerant, at ; rusi., 1977) also show distinct differences in histaminergic markers in the brain : the ant rats have reduced histamine levels in many brain areas, including hypothalamus, septum, cortex, and hippocampus (lintunen., 2002). the alcohol sensitive ant rats also show higher h3 receptor agonist - induced guanosine 5-o-(3-[s]thio)triphosphate binding, indicative of histamine h3 receptor activation, in motor cortex, insula, and caudate - putamen (lintunen., 2002). the behavioral effects of h3 receptor ligands on these rats have not been tested, but administration of a suicide inhibitor of the histamine synthesizing enzyme histidine decarboxylase, -fluoromethylhistidine (-fmh), decreases the performance of these rats in the tilting plane test (lintunen., taken together, these results suggest that there are basal differences in the histamine system markers in these rat lines. however, no mutations in genes directly related to histamine synthesis and metabolism or histamine receptors have been identified. one of the most widely used paradigms is the two - bottle choice test where animals are given free - choice access to alcohol and non - alcoholic fluid, typically water (green and grahame, 2008). alcohol consumption in this model, however, can be influenced by other factors than pharmacological action of alcohol, such as taste and calories. thus control studies with sweet, bitter and high caloric fluids are needed. using a modified prolonged 8-week version of the two - bottle choice we found that the histamine h3 receptor knockout (h3r ko) mice consumed alcohol at concentrations 10 and 20% significantly less than the wild type animals (nuutinen. however, the food consumption in h3r ko mice was lower than in control animals leaving us with a question whether the h3r ko mice simply drink less alcohol since they need less energy ? summary of the alterations in alcohol consumption and reward followed by manipulations of the brain histaminergic system. a more newly described method for alcohol consumption is so called drinking in the dark (did) method where mice are given access to alcohol for a short period of time during their active time of the day (rhodes., 2005). the did paradigm is a measure of binge - like alcohol drinking and usually c57bl/6j mice are used in this paradigm due to their high alcohol consumption. the method is based on the finding that rodents consume more alcohol during the first couple of hours of their active period of the day (goldstein and kakihana, 1977). in line with the two - bottle choice (dependence - like drinking) study we found that the h3r ko mice drank less alcohol than control mice when given a 4-h access to 20% alcohol in the did model (nuutinen. interestingly, h3r ko mice also consumed less 10% sucrose than the wild type mice again pointing to the direction that the lower need of calories could be the underlying reason for the lower voluntary alcohol consumption in h3r ko mice. to study this in more detail we used h3r specific ligands in the did model and found that an h3r antagonist ciproxifan dose - dependently inhibited alcohol drinking and h3r agonist immepip increased alcohol consumption in wild type mice (nuutinen., 2011a). importantly, the consumption of 10% sucrose, very high in caloric content, was not modified by ciproxifan or immepip pretreatment suggesting that other reasons than a altered need for calories could underlie the change in alcohol consumption following modification of h3rs. in agreement with our mouse studies, 2011) found that an h3r antagonist jnj-39220675 (1 and 10 mg / kg) inhibits alcohol drinking to a similar extent as naltrexone (5 mg / kg) in a two - bottle choice test in selectively bred alcohol - preferring (p) rats. jnj-39220675 also decreased alcohol preference but not alcohol consumption after a 3-day alcohol deprivation period in p rats. these results suggest that the lack or inhibition of h3r leads to lower alcohol consumption both in mice and rats. alcohol drinking can be also studied using self - administration paradigms where an operant response, typically a lever press, is required for the access to drink alcohol. self - administration models are thought to gauge better the motivation to drink alcohol (green and grahame, 2008). operant alcohol self - administration using oral administration is more commonly used in rats than in mice since mice do not drink alcohol as readily as the rats do with the exception of c57bl/6j mouse strain. already a decade ago we found that h3r antagonists thioperamide and clobenprobit (table 2) dose - dependently (1, 3, 10 mg / kg for both drugs) decrease operant alcohol self - administration in alcohol - preferring aa rats (lintunen. treatment with h3r agonist r--methylhistamine or h1r antagonist mepyramine did not affect alcohol self - administration. recently researchers at johnson & johnson tested the h3r antagonist jnj-39220675 (10 and 30 mg / kg) in an operant model and found that it significantly reduced lever presses for alcohol (galici., 2011). thus, data from oral self - administration studies support the role of h3r antagonism in suppressing motivation to drink alcohol. alcohol reward and reinforcement can be also studied using pavlovian conditioning (tzschentke, 2007). this approach is advisable to use in parallel with the drinking studies in order to exclude intervening variables such as anxiety (pohorecky, 1991) or novelty seeking (cloninger., 1988) that might result in altered alcohol drinking. in our laboratory, we are routinely using an unbiased alcohol - induced conditioned place preference (cpp) model in mice originally developed and described by cunningham. (2006). in this model mice are given an alcohol injection paired with an environmental cue (cage floor material) for four to eight times over a period of 23 weeks. on alternating days with the alcohol injections mice are given vehicle injections paired with another type of floor material. after the conditioning period mice are tested in a preference test where they can choose between the two cage floor materials. place preference is indexed by a significant difference in time spent on one of the conditioning cue floors between two groups that have had different cues when conditioned to alcohol. in mice lacking the histamine synthesizing enzyme histidine decarboxylase, the alcohol - evoked cpp was found to be stronger suggesting that the lack of histamine increases the reward and reinforcement by alcohol in mice (nuutinen., 2010 ; table 1). next we used different h3r ligands and found that antagonists ciproxifan (3 mg / kg) and jnj-10181457 (5 mg / kg) totally inhibited the cpp by alcohol in wild type dba/2j mice (nuutinen., 2011b). importantly, h3r antagonist ciproxifan did not induce place preference or place aversion alone in 129/sv mice suggesting that h3r antagonism does not produce place aversion or preference per se (nuutinen., 2010). however, studies in other mouse strains and rats and using different h3r antagonists would be important to confirm that the h3r antagonists do not have addictive or aversive properties. the h3r agonist immepip (30 mg / kg ; table 2) did not modulate alcohol - induced cpp (nuutinen., 2011b). we think that this was probably due to the difficulty to increase an already strong place preference. when cpp model was applied to h3r ko mice (c57bl/6j background), we found a complete lack of alcohol - evoked cpp (nuutinen., 2011a). in agreement with the alcohol drinking studies these data suggest that inhibition or lack of h3r leads to loss of alcohol reward. stronger alcohol - induced cpp in hdc ko mice suggests that histamine could be the key neurotransmitter mediating the inhibitory effects since the lack of histamine leads to stronger cpp. the inhibitory effect of h3r antagonists may, however involve other neurotransmitter systems in addition to histamine due to the heteroreceptor function of h3rs (schlicker., 1994). interestingly, brain microdialysis studies have shown that h3r antagonists thioperamide and gsk189254 do not affect histamine release in rat nucleus accumbens or striatum, the central areas in the regulation of reward and reinforcement (giannoni. antagonist abt-239 did not modify dopamine release in striatum (fox., 2005) and jnj-39220675 treatment, which was found to inhibit alcohol drinking and self - administration in rats did not change dopamine release per se or affect alcohol - induced release of dopamine (galici.. however, many of the above - mentioned drugs as well as many other h3r antagonists do increase histamine and dopamine release e.g., in prefrontal cortex (brioni., 2011), another important area of the meso - cortico - limbic reward circuit which receives dopaminergic input from the ventral tegmental area and sends glutamatergic projections to striatum and nucleus accumbens (lasseter., 2010). in summary, these results demonstrate that h3r antagonists affect neurotransmitter release in a region - specific manner and it seems that the inhibitory effect of h3r antagonism on alcohol consumption and cpp is likely to result from the effects of these drugs on neurotransmitter release on brain areas other than striatum and nucleus accumbens. another intriguing mechanism for h3r antagonist - induced inhibition of alcohol reward is the possible modulation of postsynaptic dopamine receptor signaling in striatum and nucleus accumbens. accumulating evidence suggests that h3rs form functional receptor heteromers with dopamine d1 and d2 receptors (ferrada., 2008, 2009 ; moreno., 2011) and that specific ligands that bind to one of the receptor of the heteromer, will affect the affinity and signaling of the other. thus, it is possible that by binding to postsynaptic h3rs in striatal areas, the h3r antagonists might interfere with the enhanced dopaminergic signaling induced by alcohol. we have measured the plasma alcohol concentrations after h3r ligand administration and found no difference compared to the corresponding controls thus ruling out the possibility that h3r ligands would alter alcohol metabolism (nuutinen., 2011a). mechanisms leading to addictive behaviors are thought to be common for all drugs of abuse. in line with the inhibitory role of histamine in alcohol - induce place preference, a study using h1 receptor knockout mice found a stronger methamphetamine - induced cpp than in wild type controls (takino., 2009) and h3r antagonists thioperamide and clobenprobit reduced amphetamine self - administration in rats (munzar., 2004). in contrast to our alcohol study the cpp for methamphetamine was not different in histamine h3r ko mice compared to the control animals (okuda., 2009). however, the authors used a biased cpp design (by using one conditioning cue) and place preference was scored by comparing pre - conditioning and post - conditioning times. in our laboratory we use two distinct conditioning cues that are neutral to the mice meaning that they do not prefer either one of them initially (unbiased design). this is to prevent e.g., the anxiolytic effect of the drug used that could lead to false - positive result (cunningham., 2003). further, studies have shown that mice change their preference during the conditioning period without any reinforcing drugs, so in our paradigm place preference is scored as time spent in one of the sides of the chamber during the preference test following the conditioning days (tzschentke, 2007). studies on histamine s role in morphine dependence are few but support the inhibitory role of histamine in reward and reinforcement. morphine - induced cpp was attenuated by increasing histamine levels with l - histidine and potentiated by inhibiting histamine synthesis with -fluoromethyl histidine in mice (suzuki., 1995 ; h2 receptor antagonist zolantadine potentiated morphine - induced cpp but also induced place preference alone accompanied by an increase in dopamine turnover suggesting that it has other targets, possibly dopamine transporter, in addition to h2rs. in accordance with our data with alcohol, the morphine - induced place preference was stronger in hdc ko mice (gong., 2010). studies on psychostimulants (cocaine, methamphetamine) are not in line with the suggested inhibitory role of histamine in addictive behaviors. in contrast to other findings in hdc ko mice (gong., 2010 ; nuutinen., 2010), no difference in cocaine - induced cpp was found between the hdc ko and wild type mice (brabant. further, a pretreatment with an h3r antagonist thioperamide enhanced cocaine s effects by inducing place preference in mice with a cocaine dose that did not induce cpp alone (brabant., 2005). however, thioperamide was later found to inhibit cocaine metabolism via inhibition of liver cyp-450 enzymes (brabant., 2009). thus, the observations that h3r antagonists thioperamide and clobenpropit potentiate self - administration and discrimination of methamphetamine might be due to inhibition of methamphetamine metabolism by these imidazole - based h3r antagonists (munzar., 1998, 2004). further studies with non - imidazole - based h3r compounds and with knockout / transgenic animal models are needed to reveal the role of h3r in psychostimulant - induced reward and reinforcement. numerous studies on first generation h1r antagonists support the inhibitory role of histamine in reward (for a review see brabant., 2010). however, these drugs have many targets in addition to h1rs such as muscarinic receptors and more importantly, the dopamine transporter (shishido., 1991 ; oishi., 1994). thus, it is most probably the inhibition of dopamine uptake rather than h1r blockade that explains why h1r blockers can cause per se or increase behavioral effects typically induced by addictive substances. there is accumulating evidence from alcohol drinking and place preference studies suggesting that alcohol reward could be decreased by treatment with h3r antagonists. more studies are still needed to test the potential of h3r antagonists to prevent alcohol withdrawal symptoms or relapse. cellular and molecular mechanistic studies are also of great importance in order to more widely increase our understanding of the complex role of h3r in addictive behaviors. studies on alcohol and morphine suggest that targeting brain h3rs could be a potential means to treat drug addiction. however, due to conflicting findings with h3r antagonists in psychostimulant addiction - related behaviors, more preclinical studies are needed to really show whether h3r antagonist would be beneficial in other types of drug addictions. one of the key questions to be solved is related to the possible differential expression of h3r in different dopaminergic neurons, and analysis of direct vs. indirect effects of h3r on dopamine release. whereas it seems that histamine h3 receptor is a key element in alcohol drinking and place preference, the role of histamine in these behaviors is still unclear. the relative importance of histamine and other transmitters regulated by h3 receptor antagonism in several alcohol - related behaviors remains to be studied using specific tools. | the brain histaminergic system is one of the diffuse modulatory neurotransmitter systems which regulate neuronal activity in many brain areas. studies on both rats and mice indicate that histamine h3 receptor antagonists decrease alcohol drinking in several models, like operant alcohol administration and drinking in the dark paradigm. alcohol - induced place preference is also affected by these drugs. moreover, mice lacking h3r do not drink alcohol like their wild type littermates, and they do not show alcohol - induced place preference. although the mechanisms of these behaviors are still being investigated, we propose that h3r antagonists are promising candidates for use in human alcoholics, as these drugs are already tested for treatment of other disorders like narcolepsy and sleep disorders. |
cerebrospinal fluid is a functional system closely connected to the brain, and changes or variations in the csf may mean an alteration in the brain expressed by encephalic disorders. however, the composition of csf may also be altered by systemic diseases, such as arterial hypertension, and cerebral ventricular dilatation, changes in csf protein, and variations of the choroid plexus and other circumventricular organs (cvo) have been described in spontaneously hypertensive rats (shr) [15 ]. therefore, shr develop hydrocephalus and experimental studies explain that hydrocephalus induces alterations in csf since there are disturbances, in the hydrocephalic brain, of oxidative metabolism and neurotransmission and perhaps damage to periventricular cells, particularly when intracranial pressure is elevated. the sharp increase in systemic blood pressure only causes an acute increase in csf pressure in normotensive animals and not in hypertensive patients. the csf pressure of shr showed greater protection to the acute effects of phenylephrine than in control wistar - kyoto (wky) rats, but a permeability increase of the blood to cerebrospinal fluid barrier to sucrose in rats with chronic hypertension was detected. the blood - brain barrier (bbb) was found to be resistant to the passage of sucrose and lanthanum in both shr and wky rats, indicating that bbb integrity was maintained, however, there is a reduced brain uptake of sucrose in shr compared to wky, which is consistent with decreased brain capillary density and reduction of cerebral blood flow (cbf) in shr compared to wky. furthermore, in a previous study, increases of transthyretin (ttr) monomer and s-100 in blood have been described in shr which means a disruption of the brain barriers. the brain is one of the first target organs of high blood pressure, which is the main modifiable risk factor for stroke. hypertension causes a progressive increase in cerebral blood flow in the blood vessels of the brain that perform complex and dynamic relationships between blood pressure and brain function. on the other hand, epidemiological studies link cardiovascular risk factors such as hypertension and high plasma cholesterol to dementia. the modulation of the degradation of amyloid precursor protein by the administration of cholesterol in cell cultures and animal models of beta - amyloid overproduction has been described and a connection between inflammation, hypertension and beta - amyloid accumulation has also been reported. subsequently, as mentioned above, a previous work has reported that high blood pressure produces alterations in the circumventricular organs (cvo), ventricular dilation, variations in the protein composition of the csf, an increase in the inflammatory process in the brain, and alterations of beta - amyloid metabolism. the aim of the present work is to analyze the protein composition of the csf of the shr and its relationship with the integrity of the blood to csf barrier. thirty - six - month - old rats divided into two groups were used : a control group of 15 wistar kyoto (wky) and a hypertensive group of 15 spontaneously hypertensive rats (shr) from charles river laboratories espaa s.a. (barcelona, spain). the animals were maintained at a constant temperature of 21 2c and 55 8% relative humidity on a normal 1212-hour light - dark cycle. the systolic blood pressure (sbp) of shr and wky rats at 6 months of age was measured indirectly using the tail - cuff method in conscious rats. animals were anesthetized with chloral hydrate (400 mg / kg) and placed in a stereotaxic frame. the csf was centrifuged (4,000 g for 4 min) to remove blood contamination from the puncture point. the brains of four rats from each group were fixed with bouin fixative, embedded in paraffin, and cut in four (a, b, c, and d) parallel series of section at a thickness of 10 m. the brain areas containing the choroid plexus (cp) of the a series were stained with hematoxylin - eosin (h - e). the sections of the other series (b, c, and d) containing the cp, after deparaffinization and rehydration, tissues were treated with hot (85c) 10 mm citrate buffer, ph 6, for 20 min. sections were washed with distilled water and quenched with 3% hydrogen peroxide for 10 min at room temperature to eliminate endogenous peroxidase activity. after washing in 0.05 m tris - buffered saline (tbs) ph 7.6, the sections were incubated with anti - rat igg 1 : 200 (sigma) for two hours, then the sections were washed in tbs and stained using 3.3-diaminobenzidine (dako). the immunohistochemical slides were converted into digital images by using a leica dmrb photomicroscope with a leica dc 300 f camera (germany). image analysis was completed in image j (v. 1.43 u, nih, bethesda, the immunohistochemistry statistical study was conducted using the ibm spss statistic 19 software (one - way anova). csfs from shr and wky rats were pooled and samples were solubilized in buffer with 8 m urea, 4% chaps, 40 mm tris, 65 mm dte, 0.05% sds, and 2% ampholytes. isoelectrofocusing was performed using glass capillary tubes (1.5 mm i d and 12 cm length) and capillary tubes were filled with solution containing 3% acrylamide, 7 m urea, 0.6% triton x-100, 0.75% ampholytes ph 58, 0.22% ampholytes ph 310, and 0.22% ampholytes ph 79, 0.045% temed, and 0.08% aps were used to separate proteins in the 48 ph range. samples containing approximately 100 g total proteins were applied to the base end of the tube gel and were resolved in cathode and anode buffers of 20 mm naoh and 8.7 mm h3po4, respectively. ief was carried out in steps of 1 hr at 100 and then 300 v, followed by 17.5 hr at 1000 v and 30 minutes at 2000 v. the capillaries were then equilibrated for 15 minutes in reducing buffer containing 50 mm tris.hcl [ph 8.8 ], 30% glycerol, 6 m urea, 2% sds, and 1% dtt, followed by a blocking step for another 15 minutes in a similar buffer containing 2.5% iodoacetamide instead of dtt. the capillary gels were then transferred to the top of an 18 18 cm, 1.5-mm - thick, 10% polyacrylamide gel (sds - page) and embedded in 0.5% low - melting agarose containing a trace of bromophenol blue. sds - page was run at 15c, initially at 20 ma for 15 min and then at 50 ma per gel until the blue front reached the bottom. molecular mass markers (sigma) were loaded onto the second dimension for external calibration. the protein spots were visualized in preparative gels by staining with the colloidal coomassie stain. gels were scanned using a umax scanner (amersham biosciences) and the images were analyzed with melanie version 5.0 software (genebio, geneva, switzerland), which included spot detection, quantification, normalization, and data analysis. matching corresponding spots across different gels was performed by comparative analysis of protein spots, and each of the matched protein spots was checked manually. the intensity volumes of the individual spots were normalized to the total intensity volume of all the spots present in each gel and were subjected to kolmogorov statistical analysis to compare the normalized intensity volumes of the individual spots from the controls to those of the hypertensive group. only differentially expressed proteins were excised and subsequently identified by a mass spectrometer (ms). protein spots were manually excised from stained gels and the tryptic in - gel digestion and desalting steps were performed using 96-well zipplates (millipore, bedford, ma, usa) according to the manufacturer 's instructions. the resulting peptides were mixed with 1 l -cyano-4-hydroxycinnamic acid (chca ; 1 mg / ml) and spotted onto anchorchip plates as described by the manufacturer (bruker - daltonics, bremen, germany). peptide mass fingerprint spectra were measured on an autoflex maldi - tof (bruker - daltonics) in a positive ion reflection mode and spectra in the 900 - 3, 200 da range were recorded. the pmf data were submitted to the mascot search engine for protein identification using the mascot database. the search parameters were set according to the following criteria : rattus for taxonomy, carbamidomethyl (c) for fixed modifications, oxidation (m) for variable modifications, and 100 ppm for peptide ion mass tolerance. the wky rats (figure 1) show the typical structure of the choroid plexus, that is, the cubical morphology of the epithelial choroid plexus cells, little stroma, and small blood vessels. shr show that the flattening of the choroid plexus epithelial cells and the stroma is greater in size, where the distance between the epithelium and choroidal vessels increased. the morphology of cp becomes irregular, since continuity is lost in some areas between epithelial cells. furthermore, the morphology of the nucleus has changed from circular to ellipsoid (figure 1). the igg labeling in wky rats was very low or almost undetectable in most of the choroid plexus tissues, and only a little amount of igg located around blood vessels can be observed (figure 2). by contrast, the igg immunoreactive was clearly observed in the cp of shr ; the igg was more intensive and distributed in a large number of cerebral vessels, in the stroma and basolateral membrane of the cp (figure 2). the protein changes found were classified in three groups : group 1 correlated with the blood to csf barrier (bcsfb), group 2 correlated with -amyloid and cholesterol metabolism, and group 3 correlated with acute phase inflammatory process. the results showed different proteomic profiles between shr and wky ; -1-antitrypsin, apolipoprotein a1, albumin, immunoglobulin g, vitamin d binding protein, haptoglobin, and -1-macroglobulin were upregulated in shr and apolipoprotein e, transthyretin, -2-hs - glycoprotein, transferrin, -1-glycoprotein, kininogen, and carbonic anhidrase ii were downregulated in shr (figures 3, 4 and 5 and table 1). the 2d gel electrophoresis of the csf showed many protein variations in the csf of shr rats which are expressed by a different proteomic profile when comparing control and hypertensive rats, where some proteins are differentially expressed in the csf of shr compared to wky. six - month - old rats were chosen because, according to zicha and kune, there are the major differences between the blood pressure of shr and wky at this age. among these variations, the most noteworthy changes found in the three groups are as follows. some authors have reported that chronic hypertension in shr may cause more pronounced defects in the integrity of the blood - to - csf barrier than the blood - brain barrier (bbb) [7, 14 ]. transthyretin is found in cp and is secreted in the csf [7, 14 ]. low levels of ttr in shr compared to wky were found in this work ; these differences in the blood - to - csf barrier may explain the decrease of ttr in the csf of shr, allowing its passage from the csf to the vascular space [7, 8, 14 ]. alternatively, the carbonic - anhydrase ii (ca ii) is abundantly expressed in the brain ; it has been found by others in the cp and leaking into the csf [15, 16 ]. the ca ii level during cp development may be involved in early csf secretion and the movement of water into the cerebral ventricles, secretion, and movement of water that appear to be altered in shr since ca ii is clearly lower in the results presented here. igg immunoreactive was clearly greater in all of the cp structural components of the shr;furthermore, igg, albumin and haptoglobin are also stronger in the csf of the shr, which may be caused by damage to the bslcr allowing their passage into the csf [1719 ]. in the proteomic study of the csf of the shr and wky, albumin, igg, and the two detected isoforms of haptoglobin were higher in shr with respect to wky rats (table 1). these data support the idea that the hypertension produces an increase in some proteins derived from blood plasma due to a disruption of the bslcr. apolipoprotein e (apo e) is a molecule of the apolipoprotein family which is the main component of quilomicrones. apo a1 is the most abundant apolipoprotein in plasma, almost all of which is present in hdl (cholesterol) and is about 90% and 65% of the protein fraction in hdl2 and hdl3 (cholesterol), respectively. apo e and apo a1 together with the ttr and vitamin d binding proteins are clearly implicated in the metabolism of -amyloid and cholesterol. -1-macroglobulins are a family of glycoproteins that inhibit all four types of proteinases by a trapping mechanism. furthermore, the reaction of lecithin cholesterol acyltransferase (lcat) with high density lipoprotein (hdl) is very important in reverse cholesterol transport [22, 23 ]. a decrease of apo e in csf of the shr compared with wky was found in the results here, but the proteins binding vitamin d, apo a1, and -1-macroglobulin are higher in the hypertensive group, which could explain the relationship between hypertension, inflammation, and amyloid pathology [11, 24 ]. the cp is the main source of transferrin in the brain where it binds to the iron coming from the bloodstream. the concentration of transferrin in csf reflects brain iron availability and can serve as a biomarker in different diseases such as arterial hypertension, which has effects on the secretory capacity of the cp, resulting in lower transferrin levels in the csf of the shr with respect to wky. the -2-heremans - schmid glycoprotein (-2-hs), also known as fetuin - a, is present in the serum being synthesized by hepatocytes, but the -2-hs is also synthesized in the cp and secreted into the csf, where its principal function is to inhibit pathologic calcifications, since it is capable of forming complexes with calcium and phosphorus. the -2-hs are lower in the csf of the shr (table 1) ; this decrease could be due to damage in the cp secretions. by contrast, the vitamin d binding protein is higher in the csf of the shr. the association between the vitamin d binding protein and hypertension is not clear, but it is thought that this protein, because it is linked to the inflammatory process, could be higher since high blood pressure produces an increase of the inflammatory process as a consequence of the brain damage [27, 28 ]. three isoforms of -1-antitrypsin are also higher in the csf of the shr when compared to the csf of the control ; such an increase could be due to the three isoforms being implicated in the inflammatory processes which are present in degenerative diseases and in shr [2831 ]. kininogens are other proteins that are also implicated in inflammation, and in the present study kininogens were found to be lower in the csf of the shr than in the csf of the control groups. the study here reports many variations of the proteins participating in inflammatory processes present in shr ; therefore, these results agree with the work of other authors [27, 28 ] who have reported that hypertension in shr rats produces several glycoprotein alterations. differences in other proteins such as -1- glycoprotein were found, which have not been directly related to the development of hypertension, but which have been proposed as biomarkers of diseases with inflammatory processes [29, 33 ]. this paper reports that the effects of high blood pressure in the brain can be observed in the csf composition, where two different proteomic profiles were found between shr and wky. among the diverse proteins found, the most noteworthy are -1 antitrypsin, apolipoprotein a1, apolipoprotein e, transthyretin, albumin, -2-hs glycoprotein, transferrin, -1- glycoprotein, igg, kininogen, vitamin d binding protein, and haptoglobin therefore, one could conclude that the high blood pressure in shr produces csf variations of proteins that are connected with the blood - to - csf barrier integrity, cholesterol metabolism, and inflammatory processes, which could be a cause or consequence of choroid plexus alterations and the blood - to - csf barrier disruption. | the aim of the present work is to analyze the cerebrospinal fluid proteomic profile, trying to find possible biomarkers of the effects of hypertension of the blood to csf barrier disruption in the brain and their participation in the cholesterol and -amyloid metabolism and inflammatory processes. cerebrospinal fluid (csf) is a system linked to the brain and its composition can be altered not only by encephalic disorder, but also by systemic diseases such as arterial hypertension, which produces alterations in the choroid plexus and cerebrospinal fluid protein composition. 2d gel electrophoresis in cerebrospinal fluid extracted from the cistern magna before sacrifice of hypertensive and control rats was performed. the results showed different proteomic profiles between shr and wky, that -1-antitrypsin, apolipoprotein a1, albumin, immunoglobulin g, vitamin d binding protein, haptoglobin and -1-macroglobulin were found to be up - regulated in shr, and apolipoprotein e, transthyretin, -2-hs - glycoprotein, transferrin, -1-glycoprotein, kininogen and carbonic anhidrase ii were down - regulated in shr. the conclusion made here is that hypertension in shr produces important variations in cerebrospinal fluid proteins that could be due to a choroid plexus dysfunction and this fact supports the close connection between hypertension and blood to cerebrospinal fluid barrier disruption. |
gold nanoparticles (aunps) demonstrate great promise in biomedical applications due to their plasmonically enhanced imaging properties. when in close proximity, aunps plasmonic fields couple together, increasing their scattering cross - section due to the formation of hot spots, improving their imaging utility. in the present study, we modified the aunps surface with different peptides to target the nucleus and/or the cell as a whole, resulting in similar cellular uptake but different scattering intensities. nuclear - targeted aunps showed the greatest scattering due to the formation of denser nanoparticle clusters (i.e., increased localization). we also obtained a dynamic profile of aunp localization in living cells, indicating that nuclear localization is directly related to the number of nuclear - targeting peptides on the aunp surface. increased localization led to increased plasmonic field coupling, resulting in significantly higher scattering intensity. thus, biochemical targeting of plasmonic nanoparticles to subcellular components is expected to lead to more resolved imaging of cellular processes. |
|
sleep disorders are increasingly recognized as important factors in glucose metabolism and the development of type 2 diabetes. sleep - disordered breathing (sdb), a condition characterized by a reduction or complete cessation of airflow during sleep, has repeatedly been linked to impaired glucose tolerance and insulin resistance in clinic - based studies (1,2) and, more recently, also in population - based studies (3). another frequent sleep disorder, insomnia, which is defined as a subjective feeling of having difficulties initiating or maintaining sleep or having a feeling of nonrestorative sleep (4), has also been linked to impaired glucose metabolism (5,6). most previous work has used the homa of insulin resistance and sometimes the homa of -cell function to estimate fasting insulin resistance and secretion, respectively (6,7). these methods are clearly limited in the setting of progressive insulin resistance and may be particularly limited in older adults, in whom peripheral insulin resistance is prevalent. potentially better measures of insulin sensitivity and secretion can be derived from an oral glucose tolerance test (ogtt) (8,9). little research has been done on sleep disorders and glucose metabolism using these potentially more refined measures of insulin sensitivity and secretion. recent data indicate that both sdb and insomnia symptoms are highly prevalent in patients with type 2 diabetes (1012). fewer studies have assessed the prospective association between these sleep disorders and the incidence of type 2 diabetes (13,14), and these have mainly focused on young or middle - aged adults. accordingly, we aimed to address several gaps in the literature, as follows : 1) to focus on an elderly cohort in whom there are limited data on sleep disorders, glucose metabolism, and type 2 diabetes ; 2) to use longitudinal measures of glucose metabolism ; and 3) to consider symptoms of both sdb and insomnia, both of which are common in older populations. between 1989 and 1990, a cohort of 5,201 participants was recruited from forsyth county, north carolina ; sacramento county, california ; washington county, maryland ; and pittsburgh, pennsylvania. participants had to be 65 years of age, ambulatory and community dwelling, expected to remain in their communities for 3 years, and able to provide personal informed consent (15). in 19921993, an additional 687 predominantly african american participants were recruited, for a total of 5,888 participants. participants were contacted every 6 months, alternating between telephone interviews and visits to field centers, from 19891990 through 19981999. sociodemographics (i.e., sex, age, race, marital status, and number of years of education completed), personal habits (i.e., smoking, alcohol consumption, and physical activity), and depressive symptoms were collected by questionnaires. participants reported their usual frequency of consumption of beer, wine, and liquor, and the usual number of drinks consumed on each occasion, from which the number of drinks per week of alcoholic beverages was calculated. physical activity (in kilocalories per week) was collected using a modified minnesota leisure - time activities questionnaire (16). symptoms of depression were collected using the modified center for epidemiologic studies depression scale of 030 (17). the participants were also asked about their medical history, and reported cardiovascular events (i.e., myocardial infarction and congestive heart failure [chf ]) were verified from objective information obtained from hospital and physician records, as previously described (18). each year, participants reported whether they used over - the - counter sleeping pills at least weekly. study staff measured height, waist circumference, weight, and blood pressure at study examinations. bmi was calculated as weight (in kilograms) divided by height squared (in meters). systolic blood pressure was measured twice, and the average of the two was used in the analyses. medication use was assessed at baseline and annually from a validated medication inventory (20). participants were asked whether anyone had observed them having episodes where they stopped breathing for a while and then snorted or snored loudly, which we term observed apnea. they were also asked whether their spouse or roommate had complained about their loud snoring, labeled bothersome snoring, and whether they were usually sleepy in the daytime, labeled daytime sleepiness. in addition, the participants reported on the following three insomnia symptoms : whether they usually had difficulties falling asleep, labeled sleep initiation problems ; experienced frequent nightly awakenings, labeled sleep maintenance problems ; or usually woke up too early without being able to go back to sleep, labeled early morning awakenings. the response options on all sleep questions were yes, no, and i do nt know. the participants were asked these questions annually from 19891990 to 19931994. within a subgroup of cardiovascular health study (chs) participants who attended the sleep heart health study (shhs) (21), we validated the self - reported sdb symptoms in the chs against the objectively measured sleep variables in the shhs. we compared the median values of objectively measured sdb in the participants reporting to have sdb symptoms. in the subgroup of 1,000 participants, we found higher obstructive apnea - hypopnea index values, defined as all desaturations of 4%, among those participants reporting observed apnea (8.7 desaturations / h) compared with those without observed apnea (7.2 desaturations / h, p = 0.05), and among those reporting bothersome snoring (8.8 desaturations / h) compared with those without bothersome snoring (4.8 desaturations / h, p 4,000 participants who were 4069 years of age reported an hr for incident type 2 diabetes of 1.69 (95% ci 1.042.96) among those participants with moderate - to - severe nocturnal intermittent hypoxia. a large observational study (14) reported a relative risk of 2.25 (95% ci 1.712.40) for regular snorers compared with nonsnorers in almost 70,000 women in the nurses health study cohort. this relative risk is slightly higher than that in our sample, which may reflect the additional adjustment for waist circumference in our study or indicate that the relative risk from snoring for the development of type 2 diabetes may be lower in older adults. in accordance with our findings, a recent study (5) reported increased rates of impaired glucose tolerance in sdb patients, but not in insomnia patients. however, a recent meta - analysis (13) of 10 studies including > 100,000 participants found increased risks of the development of type 2 diabetes of 1.57 (95% ci 1.251.97) and 1.84 (95% ci 1.392.43), respectively, for sleep initiation and sleep maintenance problems. the participants in our study were all 65 years of age, and, as the amount of sleep may decrease with age, even in subjects without daytime sleepiness (29), the causes and correlates of insomnia in the elderly may differ from those in younger populations, possibly explaining differences between study findings. we observed differences in associations once specific insomnia symptoms were analyzed, with one analysis showing a negative association of fasting glucose levels with sleep maintenance symptoms. this finding, as well as prior research, points to the need to consider each aspect of insomnia separately, as the health implications of sleep onset, sleep maintenance, and early morning awakenings may differ. sleep disorders are not constant over a lifetime (30), and this is the first prospective study to account for this by allowing the sleep exposure to change in yearly increments during the follow - up. the effect of observed apnea when allowing it to change over the follow - up period appeared to be stronger compared with using the cumulative average, indicating that current or recent sleep disruption may be more important than previous / chronic symptoms in the development of type 2 diabetes. the apparently stronger association of the more recent exposure of observed apnea is a new finding and needs to be confirmed by further studies. the mechanisms that underlie our findings are largely unknown, but some have been suggested. sleep deprivation, caused by sdb or insomnia, has been shown to increase the activity of orexin neurons that may act as a link between sdb and the metabolic effects (31). sleep deprivation can also cause increased sympathetic nervous activity, increasing the released levels of cortisol and catecholamines, leading to reduced insulin sensitivity and glucose tolerance (32,33). the corresponding increase in insulin secretion may lead to -cell exhaustion and impaired secretory capacity over time, resulting in diabetes. despite its clear strengths, which include the population - based design in a high - risk older population, the wide range of covariates, the ogtt - based measures of insulin sensitivity and secretion, and the repeated measures of multiple sleep symptoms, the study also has important limitations. we used self - reported measures of sleep, which, while subjective, have the advantage of ready clinical applicability at low cost. the participants were asked whether anyone had observed them having episodes where they stopped breathing for a while and then snorted or snored loudly or complained about loud snoring. participants living alone may not have this knowledge and may have reported no rather than the option offered of although objective measures of sdb (i.e., polysomnography results) exist, subjectively reported breath cessation is among the best clinical predictors of sleep apnea (34), and self - reported snoring is a sensitive but less specific measure (35). in a sensitivity analysis, we restricted the analysis to those not living alone, and this changed our estimates minimally. however, objective polysomnography data available in a subset indicated that the symptoms analyzed discriminated between groups with and without sdb symptoms. furthermore, because misclassification between these symptoms and sleep apnea is unlikely to be related to glucose or insulin levels, our results may underestimate the true associations of sleep apnea with hyperglycemia and insulin resistance. the difference in sleep latency between those reporting sleep initiation problems and those who did not was only 2 min, but, as insomnia is defined as a subjective feeling of having difficulties falling asleep, remaining asleep, or receiving restorative sleep lasting at least 1 month and causing daytime impairment (4) ; thus, such problems are not ideally evaluated by polysomnography (36). sdb and insomnia are different conditions than short sleep duration (37), and people with insomnia symptoms could have normal or long durations of sleep (38). also, some people with short sleep duration may not have insomnia symptoms or daytime sleepiness, as individuals vary substantially in the duration of sleep that is needed for restoration (39). although we adjusted for several potential confounders in our multivariable analyses, we can not exclude the possibility of uncontrolled confounding behind the observed associations. however, any remaining confounder that is potentially able to influence our results would need to be strongly associated with both sleep symptoms and glucose metabolism, and generally be unrelated to the factors included in our models. several small interventional studies (26,40) suggest that sleep apnea therapy may improve insulin resistance, supporting a causal relationship between sdb and insulin resistance. of note, these interventional studies have in general excluded older individuals. in this population - based study of older adults, having observed apnea, bothersome snoring, and daytime sleepiness were associated with impaired glucose metabolism, insulin resistance, and risk of incident type 2 diabetes. for observed apnea, more recent exposure tended to be more strongly associated with subsequent risk of type 2 diabetes than chronic exposure. the associations persisted after adjustment for total and central adiposity, suggesting that sdb may impair glucose metabolism independent of body fat. in contrast to previous studies, we found no consistent association between the insomnia symptoms and glucose metabolism or incident type 2 diabetes. further studies are needed to determine whether insomnia symptoms affect the risk of incident type 2 diabetes differently in older adults than in younger adults. despite its clear strengths, which include the population - based design in a high - risk older population, the wide range of covariates, the ogtt - based measures of insulin sensitivity and secretion, and the repeated measures of multiple sleep symptoms, the study also has important limitations. we used self - reported measures of sleep, which, while subjective, have the advantage of ready clinical applicability at low cost. the participants were asked whether anyone had observed them having episodes where they stopped breathing for a while and then snorted or snored loudly or complained about loud snoring. participants living alone may not have this knowledge and may have reported no rather than the option offered of although objective measures of sdb (i.e., polysomnography results) exist, subjectively reported breath cessation is among the best clinical predictors of sleep apnea (34), and self - reported snoring is a sensitive but less specific measure (35). in a sensitivity analysis, we restricted the analysis to those not living alone, and this changed our estimates minimally. however, objective polysomnography data available in a subset indicated that the symptoms analyzed discriminated between groups with and without sdb symptoms. furthermore, because misclassification between these symptoms and sleep apnea is unlikely to be related to glucose or insulin levels, our results may underestimate the true associations of sleep apnea with hyperglycemia and insulin resistance. the difference in sleep latency between those reporting sleep initiation problems and those who did not was only 2 min, but, as insomnia is defined as a subjective feeling of having difficulties falling asleep, remaining asleep, or receiving restorative sleep lasting at least 1 month and causing daytime impairment (4) ; thus, such problems are not ideally evaluated by polysomnography (36). sdb and insomnia are different conditions than short sleep duration (37), and people with insomnia symptoms could have normal or long durations of sleep (38). also, some people with short sleep duration may not have insomnia symptoms or daytime sleepiness, as individuals vary substantially in the duration of sleep that is needed for restoration (39). although we adjusted for several potential confounders in our multivariable analyses, we can not exclude the possibility of uncontrolled confounding behind the observed associations. however, any remaining confounder that is potentially able to influence our results would need to be strongly associated with both sleep symptoms and glucose metabolism, and generally be unrelated to the factors included in our models. several small interventional studies (26,40) suggest that sleep apnea therapy may improve insulin resistance, supporting a causal relationship between sdb and insulin resistance. in this population - based study of older adults, having observed apnea, bothersome snoring, and daytime sleepiness were associated with impaired glucose metabolism, insulin resistance, and risk of incident type 2 diabetes. for observed apnea, more recent exposure tended to be more strongly associated with subsequent risk of type 2 diabetes than chronic exposure. the associations persisted after adjustment for total and central adiposity, suggesting that sdb may impair glucose metabolism independent of body fat. in contrast to previous studies, we found no consistent association between the insomnia symptoms and glucose metabolism or incident type 2 diabetes. further studies are needed to determine whether insomnia symptoms affect the risk of incident type 2 diabetes differently in older adults than in younger adults. | objectivewe examined the associations of symptoms of sleep - disordered breathing (sdb), which was defined as loud snoring, stopping breathing for a while during sleep, and daytime sleepiness, and insomnia with glucose metabolism and incident type 2 diabetes in older adults.research design and methodsbetween 1989 and 1993, the cardiovascular health study recruited 5,888 participants 65 years of age from four u.s. communities. participants reported sdb and insomnia symptoms yearly through 19891994. in 19891990, participants underwent an oral glucose tolerance test, from which insulin secretion and insulin sensitivity were estimated. fasting glucose levels were measured in 19891990 and again in 19921993, 19941995, 19961997, and 19981999, and medication use was ascertained yearly. we determined the cross - sectional associations of sleep symptoms with fasting glucose levels, 2-h glucose levels, insulin sensitivity, and insulin secretion using generalized estimated equations and linear regression models. we determined the associations of updated and averaged sleep symptoms with incident diabetes in cox proportional hazards models. we adjusted for sociodemographics, lifestyle factors, and medical history.resultsobserved apnea, snoring, and daytime sleepiness were associated with higher fasting glucose levels, higher 2-h glucose levels, lower insulin sensitivity, and higher insulin secretion. the risk of the development of type 2 diabetes was positively associated with observed apnea (hazard ratio [hr ] 1.84 [95% ci 1.192.86 ]), snoring (hr 1.27 [95% ci 0.951.71 ]), and daytime sleepiness (hr 1.54 [95% ci 1.132.12 ]). in contrast, we did not find consistent associations between insomnia symptoms and glucose metabolism or incident type 2 diabetes.conclusionseasily collected symptoms of sdb are strongly associated with insulin resistance and the incidence of type 2 diabetes in older adults. monitoring glucose metabolism in such patients may prove useful in identifying candidates for lifestyle or pharmacological therapy. further studies are needed to determine whether insomnia symptoms affect the risk of diabetes in younger adults. |
a 64yearold woman presented with 68 sharply demarcated, darkly pigmented macules around the anus (fig. 1) and a 3month history of intermittent rectal bleeding. the patient underwent a colonoscopy and an ulcerated 3.6 cm in diameter, polypoid, pigmented tumor of the anorectal verge was found (fig. based on the patient 's history and physical examination findings, which one of the following is the most likely diagnosis ? peutzjeghers syndrome.genital warts.neurofibromatosis type 1.acrodermatitis enteropathica.metastatic anorectal melanoma. numerous biopsies were taken from the tumor at the time of colonoscopy and pathologic results were consistent with the diagnosis of melanoma. histopathology of the operative specimen showed a primary melanoma (hmb45 and s100 stains positive) with a breslow thickness of 1.4 mm. abdominal ultrasonography and contrast ctscan of chest, abdomen, and pelvis showed no evidence of metastases. anorectal melanoma is a rare disorder, approximately accounting for 1% of all anorectal carcinomas 2. the anorectum is the third most common location for melanoma following cutaneous and ocular melanoma. primary rectal melanoma presents in the fourth decade with an increase of incidence in the fifth or sixth decade of life. | key clinical messageprimary mucosal melanoma occurs in under 2% of melanomas. anorectal melanoma is a rare disorder, approximately accounting for 1% of all anorectal carcinomas. primary anorectal melanoma presents predominantly in women, in the 4th6th decade of life. typical clinical manifestations include rectal bleeding and tenesmus. the prognosis remains poor. |
two recent national advisory committees on social security recommend major shifts in medicare financing to preserve the financial viability of the social security trust funds. this paper estimates the income redistribution consequences of the two proposals, concentrating especially on the often - ignored financing burdens imposed upon the elderly. medicare benefits and administrative costs are paid from two trust funds created under title xviii of the social security act, passed in 1965. the hospital insurance (hi) trust fund, covering hospital and other institutional benefits, is now financed mainly through payroll taxes on employers and employees. the supplementary medical insurance (smi) trust fund, which pays for physicians ' and other outpatient services, is financed through federal general revenues and through monthly premiums paid by smi participants. in fiscal year 1982, these trust funds will finance expenditures of approximately $ 33 billion and $ 15 billion, respectively, providing basic insurance coverage to over 28 million elderly and disabled beneficiaries. the old - age and survivors insurance (oasi) program and the disability insurance (di) program, together with the medicare program, form the social security system that provides financial security for workers and their families. cash benefits under oasi and di are paid from separate trust funds financed by employer - employee payroll taxes. this mode of financing creates a highly visible link between benefits received and contributions paid, giving the system the politically appealing aura of private insurance. the initial decision in 1965 to use earmarked payroll taxes to finance the hi trust fund can be viewed as a logical expansion of the social security system that was already in place. with few exceptions, hi eligibility is dependent upon eligibility for old age or disability cash benefits ; that is, past payroll tax contributions are linked to the promise of future health insurance benefits upon disability or retirement. adverse economic conditions since the 1977 social security amendments are leading toward a short - run financing crisis for the oasi trust fund. moreover, long - run demographic and medical cost trends lead to projections of financial crisis for the hi trust fund within a decade (bartlett, 1980). two recent national advisory committees have studied the overall viability of the social security system and made a number of recommendations for reform. these recommendations include the following proposals for major changes in medicare financing : the national commission on social security a bipartisan commission of private citizens which was established under the 1977 amendments to report to the president and the congress recommends in its 1981 report that, beginning in 1983, half of the hi trust fund be financed from general revenues, and that the freed hi payroll tax revenues be applied to the oasdi programs (national commission on social security : recommendations, 1981). the 1979 advisory council on social security appointed in 1978 as the fifth quadrennial advisory council to the congress and the trustees of the social security trust funds recommends in its 1980 report that the hi trust fund be financed entirely from federal general revenues, and that a portion of the freed payroll taxes be directed to oasdi, with the balance repealed (reports of the 1979 advisory council, 1980 ; and social security financing, 1980). while these proposals are not unprecedented (the 1971 and 1975 advisory councils also proposed substitution of general revenues for hi payroll taxes), they are only now being taken seriously by the administration and the congress. one important dimension for analysis of these major financing shifts is their effect upon the income distribution. the 1979 advisory council made its values quite clear in saying that a major shortcoming of the payroll tax as the sole source of funds for oasdhi benefits is that it falls more heavily on persons with relatively low incomes than does the personal income tax the primary purpose of this paper is to estimate the magnitudes of medicare financing burdens for families of various income levels, under current law and under each of the two recent proposals, demonstrating precisely how each proposal redistributes these burdens. recently, other observers of medicare have come to question whether the program has fulfilled its initial promise to the elderly (u.s. house of representatives, 1980 ; and health research group, 1980). in particular, substantial concern exists over the total amount the elderly and disabled pay through cost - sharing, unassigned physician bills, and smi premiums. the analysis in this paper widens the scope of that concern by estimating the medicare tax burdens on families headed by the elderly. these burdens, which are strikingly large especially under the proposed shifts to general revenue financing have not previously been estimated. population, through a set of micro - simulation routines to estimate the distribution of family burdens from each of the relevant taxes and premiums. we then apportioned the fiscal year 1982 projected medicare revenue requirement from each financing source among families in proportion to their estimated tax burdens. we then aggregated these total family contributions to medicare by quintile of the family income distribution. this same approach is used for each of three financing packages : that of current law, that recommended by the national commission on social security, and that recommended by the 1979 advisory council on social security the 1976 survey of income and education (sie) is the primary data source on which the tax and premium simulations are performed. the sie is a file of 151,170 household interview units, containing the records of 440,815 individuals residing in the 50 states and the district of columbia (u.s. the march questionnaire for the current population survey forms the core of the sie questionnaire, providing information on labor force status, work experience, household structure, and demographic characteristics. the sie also covers more detailed breakdowns of calendar year 1975 income by type, transfer program participation (for example, aid to families with dependent children), health insurance coverage, disability conditions, languages spoken, and educational characteristics. when survey case weights are used, the sample represents the total civilian noninstitutionalized population of the united states. these features of the sie allow the micro - simulation of tax burdens according to their appropriate income bases and they also allow construction of the family income distribution of the u.s. population. federal tax burdens are simulated using a version of the fedtax (that is, federal personal income taxes) module of the transfer income model (trim), originally developed by the urban institute (moeller, 1973 ; and sulvetta, 1976) and modified by the authors to address special issues in health care financing. in apportioning taxes (which may statutorily fall on firms and other organizations) to specific individuals or families, assumptions regarding the shifting of tax burdens (incidence assumptions) are crucial. we follow a widely accepted approach which presumes perfect competition, price flexibility, and factor mobility (pechman and okner, 1974, pp. moreover, throughout the paper we assume that the only budgetary change taking place is in the package of medicare financing sources ; that is, we employ the comparative static methodology common to many micro - simulation exercises. we assume that payroll taxes are ultimately borne by workers the employee tax borne directly and the employer tax borne in the form of lowered wages. using appropriate payroll tax rates and tax base ceilings, we performed calculations for private wage and salary earners, the self - employed, and railroad workers. although the social security system does not mandate coverage of government employees, about 70 percent of all nonfederal government workers participate in the system through voluntary state and local government buy - ins. a random 70 percent sample of the sie individuals working for state and local governments, then, were also charged payroll taxes. we also assumed that smi premiums were borne by the individual premium payor, except in the case of medicaid buy - ins for the low income elderly. thus, we assigned medicare enrollees not covered by medicaid their per capita share of the projected fy 1982 premium income to the smi trust fund. we assigned the premium sum for medicare enrollees covered by medicaid to federal general revenues. federal general revenues derive from a number of sources, although the bulk (94 percent) can be attributed to just three personal income taxes, corporate income taxes, and excise taxes. in fy 1982, the federal personal income tax will account for about 70 percent of general revenues. incidence of this tax is assumed to remain with the tax filing unit. a complex fedtax routine reorganizes sie household interview units into realistic tax filing units and determines the type of return to be filed (single, joint, or unmarried head of household). the fedtax routine then computes adjusted gross income (agi) by aggregating taxable income sources across members of the filing unit. the fedtax routine also assigns personal exemptions by examining the financial relationships in the family (such as considering money earned by dependents) and checking for additional old age and blindness exemptions. based upon irs statistics on actual returns (internal revenue service, 1978), a proportion of filing units in each income class is randomly chosen to itemize and is assigned the average itemized deduction for an itemizer in that income class. the standard deduction formula is applied to all other filing units. taxes due are determined by calculating agi, less exemptions and deductions, and referring to the appropriate tax rate schedule (x, y, or z). for certain filers, the incidence of this tax is assumed to ultimately rest with all owners of financial and real property. property income is assigned to sie individuals on the basis of the following items : interest, dividends, rent, self - employment income, and pension income, according to department of the treasury (1975) estimates regarding the proportion of each source that represents a return to capital. total corporate taxes are then assigned to individuals proportionally to their property income. the remaining 10 percent of general revenues is comprised chiefly of excise taxes, but is also comprised of estate and gift taxes, custom duties, and other miscellaneous receipts. the final steps of the methodology involve apportioning specific program revenue requirements across families by tax and premium incidence and aggregating the results by income, age, or other classification. the estimates in this paper are based upon actuarial projections of program benefits, administrative costs, and receipts for fiscal year 1982 (board of trustees of the federal hospital insurance trust fund, 1981 ; and board of trustees of the federal supplementary medical insurance trust fund, 1981). our hi and smi estimates are based upon total program costs (benefits plus administration) of about $ 33 billion and $ 15 billion, respectively. we based current law amounts upon the actuarial projections of the share contributed by each revenue source (for example, smi is estimated to depend upon general revenues for 79 percent of its financing and upon premiums for 21 percent of its financing in fy 82). general revenue financing is further divided into its three major component taxes by their estimated shares in total federal general revenues in fy 82. once we calculate the control total for each financing source, that total is distributed over all families in proportion to their simulated share of the total burden of the respective financing source. in effect, we use the micro - simulation results as weights for allocating aggregate program costs. to summarize the results, we aggregate the burdens over families classified by characteristics of interest, reporting the results as an average burden per family or the burden as a percent of family income. in this latter calculation we projected the sie 1975 income levels to 1982 to correspond to the fy 82 control totals. in classifying families by income, we order families into quintiles by total family income (that is, in five groups from the lowest 20 percent to the highest 20 percent). this approach, which is common in the literature on income distribution, avoids putting the results in dollar denominations for a particular year, thereby stating results for relative income that remain approximately correct over several years, since the relative position of a family in the income distribution is slow to change, even though money incomes change rapidly in periods of inflation. the 1976 survey of income and education (sie) is the primary data source on which the tax and premium simulations are performed. the sie is a file of 151,170 household interview units, containing the records of 440,815 individuals residing in the 50 states and the district of columbia (u.s. department of commerce, 1978). the march questionnaire for the current population survey forms the core of the sie questionnaire, providing information on labor force status, work experience, household structure, and demographic characteristics. the sie also covers more detailed breakdowns of calendar year 1975 income by type, transfer program participation (for example, aid to families with dependent children), health insurance coverage, disability conditions, languages spoken, and educational characteristics. when survey case weights are used, the sample represents the total civilian noninstitutionalized population of the united states. these features of the sie allow the micro - simulation of tax burdens according to their appropriate income bases and they also allow construction of the family income distribution of the u.s. population. federal tax burdens are simulated using a version of the fedtax (that is, federal personal income taxes) module of the transfer income model (trim), originally developed by the urban institute (moeller, 1973 ; and sulvetta, 1976) and modified by the authors to address special issues in health care financing. in apportioning taxes (which may statutorily fall on firms and other organizations) to specific individuals or families, assumptions regarding the shifting of tax burdens (incidence assumptions) are crucial. we follow a widely accepted approach which presumes perfect competition, price flexibility, and factor mobility (pechman and okner, 1974, pp. moreover, throughout the paper we assume that the only budgetary change taking place is in the package of medicare financing sources ; that is, we employ the comparative static methodology common to many micro - simulation exercises. we assume that payroll taxes are ultimately borne by workers the employee tax borne directly and the employer tax borne in the form of lowered wages. using appropriate payroll tax rates and tax base ceilings, we performed calculations for private wage and salary earners, the self - employed, and railroad workers. although the social security system does not mandate coverage of government employees, about 70 percent of all nonfederal government workers participate in the system through voluntary state and local government buy - ins. a random 70 percent sample of the sie individuals working for state and local governments, then, were also charged payroll taxes. we also assumed that smi premiums were borne by the individual premium payor, except in the case of medicaid buy - ins for the low income elderly. thus, we assigned medicare enrollees not covered by medicaid their per capita share of the projected fy 1982 premium income to the smi trust fund. we assigned the premium sum for medicare enrollees covered by medicaid to federal general revenues. federal general revenues derive from a number of sources, although the bulk (94 percent) can be attributed to just three personal income taxes, corporate income taxes, and excise taxes. in fy 1982, the federal personal income tax will account for about 70 percent of general revenues. a complex fedtax routine reorganizes sie household interview units into realistic tax filing units and determines the type of return to be filed (single, joint, or unmarried head of household). the fedtax routine then computes adjusted gross income (agi) by aggregating taxable income sources across members of the filing unit. the fedtax routine also assigns personal exemptions by examining the financial relationships in the family (such as considering money earned by dependents) and checking for additional old age and blindness exemptions. based upon irs statistics on actual returns (internal revenue service, 1978), a proportion of filing units in each income class is randomly chosen to itemize and is assigned the average itemized deduction for an itemizer in that income class. taxes due are determined by calculating agi, less exemptions and deductions, and referring to the appropriate tax rate schedule (x, y, or z). for certain filers, the incidence of this tax is assumed to ultimately rest with all owners of financial and real property. property income is assigned to sie individuals on the basis of the following items : interest, dividends, rent, self - employment income, and pension income, according to department of the treasury (1975) estimates regarding the proportion of each source that represents a return to capital. total corporate taxes are then assigned to individuals proportionally to their property income. the remaining 10 percent of general revenues is comprised chiefly of excise taxes, but is also comprised of estate and gift taxes, custom duties, and other miscellaneous receipts. the final steps of the methodology involve apportioning specific program revenue requirements across families by tax and premium incidence and aggregating the results by income, age, or other classification. the estimates in this paper are based upon actuarial projections of program benefits, administrative costs, and receipts for fiscal year 1982 (board of trustees of the federal hospital insurance trust fund, 1981 ; and board of trustees of the federal supplementary medical insurance trust fund, 1981). our hi and smi estimates are based upon total program costs (benefits plus administration) of about $ 33 billion and $ 15 billion, respectively. we based current law amounts upon the actuarial projections of the share contributed by each revenue source (for example, smi is estimated to depend upon general revenues for 79 percent of its financing and upon premiums for 21 percent of its financing in fy 82). general revenue financing is further divided into its three major component taxes by their estimated shares in total federal general revenues in fy 82. once we calculate the control total for each financing source, that total is distributed over all families in proportion to their simulated share of the total burden of the respective financing source. in effect, we use the micro - simulation results as weights for allocating aggregate program costs. to summarize the results, we aggregate the burdens over families classified by characteristics of interest, reporting the results as an average burden per family or the burden as a percent of family income. in this latter calculation we projected the sie 1975 income levels to 1982 to correspond to the fy 82 control totals. in classifying families by income, we order families into quintiles by total family income (that is, in five groups from the lowest 20 percent to the highest 20 percent). this approach, which is common in the literature on income distribution, avoids putting the results in dollar denominations for a particular year, thereby stating results for relative income that remain approximately correct over several years, since the relative position of a family in the income distribution is slow to change, even though money incomes change rapidly in periods of inflation. these tables compare the distribution of medicare financing burdens under current law, under the national commission proposal requiring 50 percent general revenue financing of the hi trust fund, and under the advisory council proposal requiring 100 percent general revenue financing of the hi trust fund. tables 3 and 4 separate the results for families headed by elderly and non - elderly persons. as table 2 shows, the average family in fiscal year 1982 will contribute $ 729, or 2.6 percent of family income, to the medicare program, should current financing provisions be continued. this rather substantial amount reflects both the continued aging of the population and health care costs which continue to rise faster than consumer income. families in the lowest income quintile contribute an average of 2.2 percent of their income, while families in the highest quintile contribute 2.7 percent of their income. comparing the distribution of financing burdens for medicare part however, estimated hi family contributions as a percent of income will not be constant across quintiles because of variations in the proportion of wages in total family income and because at very high earnings levels payroll tax base ceilings are met. the smi trust fund is currently financed by general revenues, which are progressive, and by per capita premiums, which are regressive. however, for the premium - paying elderly (shown in table 3) the smi contribution is more clearly regressive, while for the non - elderly (shown in table 4) the general revenue contribution is progressive. financing the identical medicare benefit levels under the national commission and advisory council proposals leaves the average dollar contribution of $ 729 per family unchanged, but the increased role of general revenues for hi substantially alters the distribution of costs across income classes (table 2). under the national commission alternative, costs are shifted exclusively to the highest quintile (quintile five) and all other quintiles show reduced contributions. this effect is amplified under the advisory council proposal. while families in quintile five contribute 23 percent more per dollar of income than families in quintile one under current law in fy 82, families in quintile five would contribute 60 percent more per dollar of income than families in quintile one under total general revenue financing. a surprising result emerges when we compare financing distributions for families headed by the elderly versus those headed by the non - elderly. families headed by the elderly participate equally with those headed by the non - elderly in the on - budget financing of medicare. this equality is demonstrated by equal 2.6 percent contributions of family income (tables 3 and 4). furthermore, as general revenue financing increases, the proportion of family income contributed by families headed by the elderly rises above that contributed by families headed by the non - elderly. under the advisory council proposal, the average household headed by an elderly person pays 50 percent more on every dollar of family income than does the average household headed by a non - elderly person (3.8 percent versus 2.5 percent, respectively). viewing the financing burdens on the elderly in a slightly different way, families headed by persons 65 years of age or older comprise 20 percent of all families and receive 12 percent of all family income. under current law applied to fy 82, these families will pay 12 percent of all medicare program costs, largely as a result of their premium and general revenue contributions to smi. this percentage is, coincidentally, their proportionate share of budgetary costs, but this does not include the contribution the elderly make to their own health care through cost - sharing provisions. under the national commission proposal, families headed by the elderly will pay over 14 percent of all medicare program costs, and under the advisory council proposal they will pay almost 18 percent. the increased burden on the elderly under general revenue financing results from the differing components of family income for families headed by the elderly and non - elderly, which table 5 illustrates. families headed by non - elderly persons receive a disproportionate share (96 percent) of all wage income, while families headed by elderly persons receive a disproportionate share of all property income (34 percent under the special definition of property income cited previously). approximately 68 percent of all pension income, and 38 percent of all asset income accrue to families headed by the elderly. each of these components bears a burden of corporate and personal income taxes, but not payroll taxes. what can be learned about the overall increase in financing progressivity, when the results are separated for the elderly and non - elderly ? table 3 shows that the distribution of smi costs across income classes for the elderly is regressive (due to premiums). in contrast, the distribution of hi costs is progressive, even under current financing provisions. rather than this progressivity increasing dramatically with the move to hi general revenue financing, all elderly income classes take on more of the financing burden (as a result of shifting the tax base from wages and salaries toward property income). however, the impact of the advisory council 's proposal on progressivity for families headed by the non - elderly is dramatic. (see table 4.) for this group, families in the highest quintile contribute an average of 400 percent more per dollar of income than families in the lowest quintile under full general revenue financing. two recent national advisory committees on social security recommend major changes in medicare financing which would shift hi trust fund reliance from payroll taxes to general revenues. a move toward general revenues obviously increases the progressivity of medicare financing ; our analysis quantifies the redistributive impact of the two advisory committee proposals relative to current law for fy 82. we show that financing burdens under current law are moderately progressive, with families in the lowest quintile of the income distribution contributing 2.2 percent of income and families in the highest quintile contributing 2.7 percent. the national commission proposal of 50 percent general revenue financing for hi shifts costs exclusively to the highest quintile, and lowers the burden on all other quintiles. this redistribution is furthered under the advisory council 's proposal of full general revenue financing, in which contributions as a percent of family income range from 2.0 percent in the lowest quintile to 3.2 percent in the highest quintile. under this proposal, the highest income families pay over 1.5 times the percent of income contributed by the lowest income families. when separate income redistributive impacts are estimated for families headed by the elderly, our estimates reveal surprisingly large financing burdens. under current law the average family headed by an elderly person is expected to contribute $ 449 toward medicare financing in fy 82. less than one - third of this amount is attributable to smi premiums ; the rest arises from payroll and general revenue tax contributions of the elderly that have not previously been estimated. the $ 449 contribution represents 2.6 percent of the average income of families headed by an elderly person, the same percent of income that is contributed by the average family headed by a non - elderly person. with shifts to general revenue financing of hi, the burden on the elderly rises dramatically. under full general revenue financing, families headed by the elderly pay 18 percent of all medicare costs. this averages to $ 670 per family50 percent more per dollar of income than families headed by the non - elderly. this $ 221 increase will exceed the magnitude of the smi premium under the current law. thus, ironically, the study committees ' proposals for increasingly progressive medicare financing will dramatically increase the burden on elderly families, for whose benefit the program was enacted. | two recent national advisory committees on social security recommended major shifts in medicare financing to preserve the financial viability of the social security trust funds. this paper estimates the income redistribution consequences of the two proposals, in contrast to current law, using a micro - simulation model of taxes and premiums. these estimates show that while the current medicare financing package is mildly progressive, the new proposals would substantially increase income redistribution under the program. two insights provided by separate estimates, for families headed by the elderly (persons age 65 or over) versus those headed by the non - elderly, are : 1) the surprisingly large medicare tax burdens on families headed by the elderly under the current financing package of payroll taxes, general revenues, and enrollee premiums ; and 2) the substantial increases in these burdens under proposed shifts toward increased general revenue financing. |
the prosthetic rehabilitation for maxillectomy patients aims at separation of oral and nasal cavities to allow adequate deglutition and articulation, to restore the midfacial contour and to provide acceptable esthetic results. lack of support, retention and stability are common problems associated with patients who have undergone maxillectomy. the retention of an obturator depends on various factors such as : direct and indirect retention provided by the remaining teeth, defect size, tissue undercuts available around the cavity and development of muscular control. the presence of teeth facilitate prosthetic rehabilitation, however, fabrication of prosthesis for an edentulous patient with maxillectomy defect is challenging even to the most experienced clinician. this clinical case report describes the prosthodontic management of an edentulous patient who had undergone partial maxillectomy due to mucormycosis. osseointegrated dental implants and magnet attachments were used to achieve a retentive and stable, large sized definitive obturator. a 52-year - old ex - serviceman reported to the department of oral and maxillofacial surgery with chief complaints of foul breath and ulcer since 2 months. medical history revealed that he was an uncontrolled type ii diabetic for the past 13 years. intraoral examination revealed a raw, 4 cm 2 cm aramany 's class i type of left maxillectomy defect. mandibular movements were within the normal range ; tongue function was normal and speech was inarticulate. for the interim prosthesis, irreversible hydrocolloid (plastalgin, septodont, france) impression was made and casts were prepared in type iii dental stone (kalstone, kalabhai, india). functional border molding of the tissues was carried out and the defect area was impressioned using high fusing impression compound (pinnacle, dpi, india) and light body silicone impression material (aquasil, dentsply, germany). the patient used the prosthesis for 03 months during, which multiple adjustments and relining with a resilient tissue conditioning material (gc reline soft, gc, japan) were carried out. the retention was a major concern, patient being edentulous. in the process of planning for an implant supported definitive prosthesis, radiographic evaluation revealed adequate height and width of the residual ridge with d3 type maxillary bone for implant placement. an implant supported definitive prosthesis was therefore planned, which would enhance the compromised retention for this case of edentulous maxillectomy defect. a diagnostic maxillary impression was made with an irreversible hydrocolloid using a stock metal tray. the impression was poured in type iii dental stone for designing of the definitive obturator and planning for placement of dental implants. three two stage osseointegrated dental implants (mis ; confident system) were placed in the residual right maxilla : (diameter : 3.75 mm, length : 11 mm) in the right maxillary first molar site ; (diameter : 3.75 mm, length : 13 mm) in the right maxillary canine site and (diameter : 3.75 mm, length : 11 mm) in the right maxillary incisor region [figure 2 ]. post - operative orthopantomogram was carried out to check the implants placement after achieving clinical primary stability [figure 3 ]. three implants placed in residual maxilla post - operative opg showing implants in position the second stage surgery was performed after 08 months. after the implants were checked for clinical success they were exposed and gingival formers were placed. abutments were milled and screwed ; transfer copings were placed over the implants and an open tray impression was made with medium body silicone material (aquasil, dentsply caulk, germany). magnetic keepers were placed over the abutments on the cast and wax patterns for the copings were fabricated. the modified copings were cast in nickel chrome alloy (bellabond, bego, germany). after polishing, in addition, surveying and designing procedures of master cast were carried out for the fabrication of metal denture base framework. copings of magnetic keeper cemented over implants a custom impression tray was fabricated on the metal framework using autopolymerizing resin and adjusted for proper extension in patient 's mouth. border molding was performed for the residual maxilla and the defect was recorded using the addition silicone soft putty (aquasil, denstply, germany) and definitive impression was made using light body silicone impression material (aquasil ultra lv, denstply caulk, germany). conventional prosthodontic protocols of boxing and pouring the impression with american dental association type iii dental stone were followed to fabricate a definitive cast. after adapting a layer of modeling wax (cavex outline, netherlands), the definitive cast was flasked and processed in the customary manner to fabricate a hollow bulb using heat - activated methyl methacrylate (lucitone 199 ; dentsply). the processed record base was evaluated intraorally for extensions and occlusal rim was fabricated using modeling wax. maxillomandibular jaw relations were recorded and transferred to an articulator (hanau h2 ; teledyne technologies, los angeles) using a whipmix self - centered springbow type of facebow. denture teeth (cosmo hxl, dentsply, china) were arranged and evaluated intraorally for dentolabial relation and lip support and horizontal and vertical jaw relations were verified. upon the patient 's approval for phonetics and esthetics, waxing and festooning of the gingival and palatal portions of the obturator were completed, the processed base was reinvested and the prosthesis was processed into heat - activated methyl methacrylate. after necessary adjustments, each magnet (cobalt - samarium, ambica co., india) was centered on the magnetic keeper coping with a thin (0.001 inch) cellophane separating sheet interposed to prevent acrylic resin from locking onto the abutment. a small amount of acrylic resin was added on the intaglio surface of the denture where magnets were to be secured. the denture was inserted intraorally and seated to pick up the magnets [figure 5 ]. pressure indicating paste was used to determine any undue pressure placed on the surrounding tissues. finished prosthesis with magnets in place the obturator prosthesis was inserted [figure 6 ] and phonetics and esthetics was re - evaluated. post - insertion instructions were given to the patient and follow - up was carried out every 03 weeks. the last follow - up of the patient was 6 months following the insertion of the new prosthesis. the patient had been using the new obturator prosthesis satisfactorily and no signs of failure associated with implants were detected. the retention was a major concern, patient being edentulous. in the process of planning for an implant supported definitive prosthesis, radiographic evaluation revealed adequate height and width of the residual ridge with d3 type maxillary bone for implant placement. an implant supported definitive prosthesis was therefore planned, which would enhance the compromised retention for this case of edentulous maxillectomy defect. a diagnostic maxillary impression was made with an irreversible hydrocolloid using a stock metal tray. the impression was poured in type iii dental stone for designing of the definitive obturator and planning for placement of dental implants. three two stage osseointegrated dental implants (mis ; confident system) were placed in the residual right maxilla : (diameter : 3.75 mm, length : 11 mm) in the right maxillary first molar site ; (diameter : 3.75 mm, length : 13 mm) in the right maxillary canine site and (diameter : 3.75 mm, length : 11 mm) in the right maxillary incisor region [figure 2 ]. post - operative orthopantomogram was carried out to check the implants placement after achieving clinical primary stability [figure 3 ]. three implants placed in residual maxilla post - operative opg showing implants in position the second stage surgery was performed after 08 months. after the implants were checked for clinical success they were exposed and gingival formers were placed. abutments were milled and screwed ; transfer copings were placed over the implants and an open tray impression was made with medium body silicone material (aquasil, dentsply caulk, germany). magnetic keepers were placed over the abutments on the cast and wax patterns for the copings were fabricated. the modified copings were cast in nickel chrome alloy (bellabond, bego, germany). after polishing, copings were cemented to the superior surface of the abutment with resin cement (variolink n, ivoclar, liechtenstein) [figure 4 ]. in addition, surveying and designing procedures of master cast were carried out for the fabrication of metal denture base framework. copings of magnetic keeper cemented over implants a custom impression tray was fabricated on the metal framework using autopolymerizing resin and adjusted for proper extension in patient 's mouth. border molding was performed for the residual maxilla and the defect was recorded using the addition silicone soft putty (aquasil, denstply, germany) and definitive impression was made using light body silicone impression material (aquasil ultra lv, denstply caulk, germany). conventional prosthodontic protocols of boxing and pouring the impression with american dental association type iii dental stone were followed to fabricate a definitive cast. after adapting a layer of modeling wax (cavex outline, netherlands), the definitive cast was flasked and processed in the customary manner to fabricate a hollow bulb using heat - activated methyl methacrylate (lucitone 199 ; dentsply). the processed record base was evaluated intraorally for extensions and occlusal rim was fabricated using modeling wax. maxillomandibular jaw relations were recorded and transferred to an articulator (hanau h2 ; teledyne technologies, los angeles) using a whipmix self - centered springbow type of facebow. denture teeth (cosmo hxl, dentsply, china) were arranged and evaluated intraorally for dentolabial relation and lip support and horizontal and vertical jaw relations were verified. upon the patient 's approval for phonetics and esthetics, waxing and festooning of the gingival and palatal portions of the obturator were completed, the processed base was reinvested and the prosthesis was processed into heat - activated methyl methacrylate. the completed prosthesis was fitted intraorally and remounted to equilibrate occlusion. after necessary adjustments, each magnet (cobalt - samarium, ambica co., india) was centered on the magnetic keeper coping with a thin (0.001 inch) cellophane separating sheet interposed to prevent acrylic resin from locking onto the abutment. a small amount of acrylic resin was added on the intaglio surface of the denture where magnets were to be secured. the denture was inserted intraorally and seated to pick up the magnets [figure 5 ]. pressure indicating paste was used to determine any undue pressure placed on the surrounding tissues. finished prosthesis with magnets in place the obturator prosthesis was inserted [figure 6 ] and phonetics and esthetics was re - evaluated. post - insertion instructions were given to the patient and follow - up was carried out every 03 weeks. the last follow - up of the patient was 6 months following the insertion of the new prosthesis. the patient had been using the new obturator prosthesis satisfactorily and no signs of failure associated with implants were detected. edentulous patients with maxillectomy defects present a significant challenge for prosthetic rehabilitation and the adaptive capabilities of the patient as retention is highly compromised. the only option for retaining prosthesis in such cases, besides implants, is optimum engagement of the available soft - tissue undercuts found within the defect space and the non - affected side. the ability to fully engage these undercuts is further limited by the path of insertion for the prosthesis and the restricted mouth opening. hence, the option of using endosseous implants to increase obturator retention has been introduced in the present case. the overall survival rate for implants supporting maxillofacial prosthesis although magnets may not result in adequate denture retention in every case, it is apparent that the nature of the magnetic force in controlling vertical displacement of the denture is likely to result in an improvement in retention. magnetic retention units in the form of cobalt samarium magnets can be embodied conveniently in the conventional obturators. the technique is simple to use, particularly when compared with other retention procedures, which can be both complicated and time consuming. in this patient magnets were preferred over the conventional bar and clip design because of space constraints. moreover, magnets avoid lateral stresses which are essential for long - term implant success. magnets have the disadvantages of low corrosion resistance and possible cytotoxic effects, which may limit their use in the oral cavity, but studies have revealed that no such - tissue damaging effects have been observed clinically for cobalt samarium magnets. surgical reconstruction of the palate using a free tissue transfer may provide a stable permanent partition between oral and nasal cavities. however, it gives way to gravity, distorting palatal contours and preventing access into the defect for support and retention of the prosthesis. surgically reconstructed defects may or may not improve the treatment outcome when compared with conventional prosthetic rehabilitation of the defect. zygomatic implants that provide remote anchorage have also been proposed in the rehabilitation of maxillary defects, but this option was eliminated because of the lack of available bone. meticulous oral hygiene measures and regular follow - up needs to be instituted for a patient using implant supported obturator prosthesis. it is advised that the patient wears the prosthesis at night as sinus secretions and saliva can not be managed without it. prosthetic rehabilitation is often difficult to achieve due to the absence of teeth, lack of favorable tissue undercuts and presence of non - keratinized nasal mucosa. obturator prostheses should recreate a partition between the oral and nasal cavities to restore oral function and esthetics. implants with magnetic units offer a practical method of improving the retention of obturators provided acceptable prosthetic protocols are followed for the rehabilitation. | edentulous patients with maxillectomy defects present a significant challenge for prosthetic rehabilitation and the adaptive capabilities of the patient as retention is highly compromised. hence, the option of using endosseous implants to increase obturator retention has been used. a patient of mucormycosis of the left maxilla was treated with surgical excision. after satisfactory healing, definitive implant supported magnet retained prosthesis was fabricated for the patient. implants with magnetic units offer a practical method of improving the retention of obturators provided acceptable prosthetic protocols are followed for the rehabilitation. |
the incidence of central venous catheter (cvc) malpositions ranges from 3.6 to 14%. ultrasound has reduced some of the complications during its insertion, but can not locate the catheter tip in relation to heart. only transesophageal echocardiography can accurately detect a cvc tip in relation to superior vena cava (svc) and right atrium (ra), but its availability as a bedside tool is limited to major hospitals. in our centre, we routinely perform a post - procedure chest x - ray (cxr) to confirm the tip of the catheter and we could detect some of the catheter malpositions that are illustrated below. a brief review of the literature suggesting optimal cvc tip position with the carina as the radiological landmark is worth mentioning, and some of the safe practice guidelines for cvc placement are also discussed. we are illustrating seven cases of abnormal cvc tip positions encountered over a period of 1 year. 1 : a peripherally inserted cvc (picc) getting coiled in the ipsilateral axillary vein. since aspiration did not yield blood, it was removed and reinserted through the opposite side in the icu [figure 1 ]. a picc (45 cm) with the tip found coiled in the ipsilateral axillary vein case no. 2 : a triple - lumen cvc inserted via right internal jugular vein (ijv) getting coiled there itself. aspiration did not yield blood in any of the lumens and it was therefore removed and reinserted [figure 2 ]. a triple - lumen 7 fr. right ijv cvc with the tip coiled in the lower part of the ijv itself case no. it was detected in the post - anesthesia care unit where it was removed and reinserted via right ijv [figure 3 ]. a right - sided picc (45 cm) with tip reaching the same - side ijv case no. 4 : a triple - lumen cvc inserted via right subclavian vein with the tip reaching the ipsilateral ijv. it was pulled back up to the 5-cm mark and pushed with the head turned to the same side and applying pressure to the supraclavicular area [figure 4 ]. a triple - lumen cvc inserted via right subclavian vein, with the tip reaching right ijv case no. 5 : a triple - lumen cvc inserted via right ijv going into the ipsilateral subclavian vein. it was pulled back again and reinserted confirming its correct position in a repeat cxr [figure 5 ]. a triple - lumen 7 fr. cvc inserted via right ijv whose tip was found to be in the ipsilateral subclavian vein case no. 6 : normal position. a triple - lumen cvc inserted via left ijv with the tip near the svc - ra junction. note the parallel placement of the catheter in the svc, with the tip below the carina (arrow mark) [figure 6 ]. a triple - lumen cvc was inserted into the left ijv by seldinger technique but blood could not be aspirated from the most proximal lumen. the proximal straight end of an ethylene oxide - sterilized j tip guide wire was inserted into the distal end of the triple - lumen catheter until resistance was felt - probably the site of the kink. the catheter was pulled out slowly while simultaneously pushing in the guide wire in a similar way.. 8 : one picc line inserted for chemotherapy by the cut down method probably went straight into the thoracic duct as chyle could be aspirated. the traditionally preferred position of the catheter tip is in the distal third of the svc to minimize complications such as catheter migration, extravasation of irritant agents, vascular perforation, local vein thrombosis, catheter malfunction and cranial retrograde injection. the junction of the svc and ra was considered to be located at the intersection of the right lateral margin of the svc and the superior border of the ra (cardiac silhouette). it should be recognized that the length of the catheter inserted through right ijv to position the tip properly in the svc will vary according to the height of the patient and puncture site, and is about 3 - 5 cm more when it is passed from the left ijv compared with the right. the right ijv has been the route preferred by anesthesiologists for cvc placement for various reasons, like fewer complications with a success rate of approximately 90 - 99%. catheters passed through the left ijv must traverse the left brachiocephalic vein and enter the svc perpendicularly, and their distal tip may impinge on the right lateral wall of the svc, thereby increasing the potential for vascular injury. many authors are of the opinion that a right - sided ijv catheter is better placed up in the svc or in the innominate vein, whereas a left - sided one is safer in the lower part of the svc or ra. an in vitro study has shown that an acute angle of > 40 with the wall of the svc results in a markedly increased risk of vessel perforation. all these necessitate a radiographic confirmation of the cvc tip, which can easily be accomplished with a simple cxr. the carina is radiologically identifiable in about 96% of all cxrs at the interspace between the fourth and fifth thoracic vertebrae. stonelake and bodenham in their retrospective audit of the position of the cvc tip on routine post - procedure cxrs of icu patients suggested three different zones for safe catheter placement. accordingly, zone - a represents lower svc and upper ra, zone - b represents upper svc and the area around the junction of both innominate veins, and zone - c represents the left innominate vein proximal to the svc. they found that all left - sided ijv catheter tips can be ensured of their placement being parallel to the svc wall if they are in zone - a but at a rare chance of pericardial tamponade. another risk in this area is that the azygos vein joins the svc where the cvc can pass into this venous system. they recommend that all right - sided cvcs are safe if placed in zone - b. left - sided catheters will enter this area at a steep angle and can abut the lateral wall of the svc, and hence should be advanced to lower svc (zone - a). cvc tip in zone - c has been suggested for central venous pressure monitoring and fluid therapy. they conclude that for safety reasons all right - sided catheters are placed with their tips sited above the carina and all left - sided ones below the carina. existing guidelines recommend that the cvc tip should be located in the svc outside the pericardial sac to avoid complications, but it should always be remembered that the upper limit of the pericardial reflection on the svc can not be seen on cxr., in their study of embalmed cadavers suggested that the pericardium crosses the svc below the carinal level and emphasized that the lateral wall of the svc was weaker, explaining the chance for erosion. they suggested that the cvc tip in the svc above the level of the carina is ideal and safe. in a similar study but of fresh cadavers, albrecht., confirmed that the carina is a reliable, simple anatomical landmark for safe cvc tip placement. they confirmed that the pericardial reflection on the svc was much below the carina compared with that reported by schuster. in various studies regarding catheter tip distance down from the carina wirsing., and aslamy., found that 55 and 29 mm were acceptable cut - off values to ensure extra - atrial catheter position. in a study using computed tomographic angiography of svc, the carina was found approximately midway in relation to the svc and it was suggested that keeping the catheter tip at or just below the carina assumes placement in the svc and 4 cm below the carina represents the cavoatrial junction. many authors are of the opinion that electrocardiogram - guided cvc tip placement at the svc - ra junction has an accuracy of 95 - 100% in confirmation with transesophageal echocardiography. cxr on the other hand is less accurate (parallax error is greater and more variable in a portable cxr - anteroposterior view) but offer a cheap and least sophisticated imaging technique to assess a cvc tip in relation to the carina, which is well accepted as a bedside reliable and cost - effective tool. ultrasound - guided venous puncture and fluoroscopy / c - arm - guided cvc tip placement showed a technical success rate of 98%, but they are not feasible for all major hospitals. use of transesophageal echocardiography was shown to have 100% accuracy, but confined only to tertiary hospitals. bedside cxr is still considered the gold standard for identifying catheter malpositions and complications such as pneumothorax. use of transesophageal echocardiography, fluoroscopy and c - arm can detect a catheter tip more readily and accurately compared with cxr. ecg guidance while insertion and a post - procedure cxr can ensure cvc tip placement above or a little below the carina, which can enhance patient safety. | central venous catheter (cvc) insertions are increasingly performed in surgical patients and intensive therapy. a simple and invasive procedure performed under strict sterile precautions with complications ranging from arrhythmias ; infections ; and life - threatening complications such as pericardial tamponade, cardiac perforation and even death. a post - procedure chest x - ray (cxr), though does not accurately assess the tip of the catheter in relation to the superior vena cava (svc) and right atrium (ra), can detect malpositions, safety of catheter tip, pneumothorax and kinking. we would like to share some of the malpositions we encountered in our centre, their management and a brief review of the literature on optimal catheter tip location. |
at the first medical examination, the sister was 7 years 8 months old, and the brother was 5 years 3 months old. neither sibling had any specific birth history. slit lamp microscopic examination revealed no abnormalities in the anterior segments of either eye, in either patient. the best corrected visual acuities (bcva) were 0.1 (right eye) and 0.8 (left eye) in the sister, and 0.7 (right eye) and 0.1 (left eye) in the brother. the cycloplegic refractive powers in the sister were : -15.50 diopter (dpt), cylinder (cyl) + 4.50 dpt ax 85 in the right eye and -1.00 dpt cyl. the differences in spherical equivalents between the two eyes were -12.50 diopters in the sister and -6.875 diopters in the brother. full - time right occlusion therapy was performed in both patients for three months, then four to six hours a day for two years. the sister was prescribed atropine for the left eye after six hours right - sided occlusion therapy a day for a year. three years later, the bcva in the brother 's left eye had improved from 0.1 to 0.7. the bcva in the sister 's left eye improved from 0.1 to 0.7 during the first year ; however, she showed no further improvement after that time. the refraction and the radius of the anterior corneal curvature were measured using an autorefractokeratometer (speedy - k ; nikon, tokyo, japan) and a topographer (orb - scan ; bausch & lomb, rochester, ny, usa). a - mode ultrasonography (cinescan ; quantel medical, clermont - ferrand, france) was performed. the results of a - mode ultrasonography and orb - scan are presented in table 2. this condition is often associated with amblyopia, both in the presence of and in the absence of strabismus [6, 7 ]. the prevalence of anisometropia reported in school - based and population - based studies of school - aged children is typically 5%, but this figure varies depending on the manner in which anisometropia is defined. myopic anisometropia is usually accompanied by strabismus, especially exotropia in 30 - 60% of patients. this suggests that the development of binocular vision might be affected by mild infantile exotropia. when high myopia of one eye is more than -5 to -6 diopters, or the difference in spherical equivalents of both eyes is more than 5 diopters, then anisometropia may be responsible for amblyopia., the present case is without any obvious complication and shows mirror image similarly. in the study of 78 monozygotic twins and 40 dizygotic twins, sorsby. reported that the concordances of corneal power, axial length, and vertical ocular refraction were higher in monozygotic twins than in dizygotic twins. interestingly, patients in the present study had similar axial lengths in their myopic eyes. in conclusion, we believe that severe myopic anisometropia may be genetically determined, and further investigation is recommended. | we report a case of one sister and brother with mirror image myopic anisometropia. one sister and brother complained visual disturbance. the sister was 10 years 11 months old, and brother was 8 years 4 months old. full ophthalmic examinations were performed, including slit lamp examination, intraocular pressure, keratometry, anterior chamber depth, axial length, fundus examination and the cycloplegic refraction. the cycloplegic refractive power was -15.50 dpt cyl.+4.50 dpt ax 85 (right eye), -1.00 dpt cyl.+0.50 dpt ax 90 (left eye) in the sister ; -1.75 dpt cyl.+2.25 dpt ax 90 (right eye), -9.50 dpt cyl.+4.00 dpt ax 80 (left eye) in the brother. the co - occurrence of severe myopic anisometropia in a sister and brother is extremely rare. the present case suggests that severe myopic anisometropia may be related by genetic inheritance. |
slipped capital femoral epiphysis (scfe) is a common hip disorder in adolescents, characterized by medial and posterior displacement of the proximal femoral epiphysis on the metaphysis. in contrast, some hips may slip in a posterolateral displacement, producing an apparent valgus deformity and a so - called valgus scfe. this occurs when shearing forces applied to the femoral head exceed the strength of the capital femoral physis. the exact etiology is unknown, but is believed to be secondary to multiple factors, including obesity which increases mechanical strain on the physis. the periosteal thinning and widening of the physis seen during rapid adolescent growth acceleration may also be a predisposing factor for the weakening of the physis. only small percentage of scfe (5.2%6.9%) is associated with endocrinopathies such as hypothyroidism or growth hormone deficiency [3, 4 ]. short stature, early age at presentation, and the atypical appearance of a valgus scfe have all been suggested as indicators for endocrinopathy screening [5, 6 ]. we report an interesting case of a 17-year - old normal - statured female who was diagnosed with congenital panhypopituitarism due to pituitary hypoplasia at the presentation of scfe. a 17-year - old caucasian female presented with a 3-month history of hip pain, difficulty walking, and inability to bend down. she was born full term with birth weight of 8 lbs and her early development was described as normal. her mid - parental height was 167.6 cm which is at 75th percentile (+ 0.67 sd). on physical exam, the patient was 158.1 cm tall (25th%) (figure 1), and weighed 65 kg (75th%). an anteroposterior pelvis radiograph (figure 2) showed bilateral, chronic, severe, valgus scfe, confirmed with ct scan. laboratory studies showed low free t4 (0.5 ng / dl ; normal 0.72.0), slightly elevated tsh (7.97 iu / ml ; normal 0.55.0). fsh 1.3 miu / ml, lh < 0.5 miu / ml, estradiol < 0.1 ng / dl. acth stimulation test using 1 microgram cosyntropin showed low peak cortisol (5.9 ug / dl). she was given stress dose of hydrocortisone prior to her hip surgery on hospital day 3. subsequently, complete pituitary evaluation showed undetectable igf-1 level (< 25 ng / ml), low igf - bp3 (1.7 mg / dl ; normal 3.28.7), and low peak growth hormone (< 0.1 ng / ml) on growth hormone stimulation test using arginine and clonidine. fasting insulin was normal at 15 uu / ml. her bone age (greulich and pyle) was delayed at 13 years. brain mri showed pituitary hypoplasia, with no identifiable pituitary stalk and ectopic posterior bright spot. her pelvic mri showed no identifiable uterus and tiny cystic structures bilaterally in the lower pelvis that may represent streak ovaries. she was treated with levothyroxine, hydrocortisone, growth hormone, and subsequent estrogen replacement therapy. her growth hormone dose was 0.18 mg / kg / week with igf-1 level within the normal range. repeat pelvis ultrasound after 9 months of estrogen therapy revealed a small uterus and ovaries. after 18 months of growth hormone therapy, her height increased to 164.5 cm (65th%) (figure 1). although only 5.2%6.9% of patients with scfe are associated with endocrinopathy [3, 4 ], there are some clinical characteristics that should alert clinicians to obtain an endocrinologic evaluation prior to surgical treatment including : young age at presentation, bilateral disease, and the presence of a valgus scfe. this case report highlights such importance as the patient was found to have panhypopituitarism with adrenal insufficiency, the condition in which without proper perioperative corticosteroid stress dose coverage, the patient could suffer from adrenal crisis with potential mortality or serious complications. in a review by loder. of 85 patients with scfe and known endocrinopathy, 40% were found to be hypothyroid, 25% were growth hormone deficient, and 35% had other endocrinopathies such as hypogonadism, hypopituitarism, hyperparathyroidism, growth hormone excess, and turner 's syndrome. in a review by shank and klingele, 13 cases of valgus scfe were identified among 257 scfe cases presenting to a single hospital, a 5% prevalence. of the valgus. age at presentation of scfe can offer a clue to which patients should receive an endocrine screening. typical age presentation of scfe is between 1016 years with the average 13 - 14 years for boys and 11 - 12 years for girls. patients with hypothyroidism or growth hormone deficiency associated with scfe are usually younger than 10 years of age, whereas, those patients with other endocrinopathies either presented at a typical age or were older than 16 years of age. the diagnosis of scfe relative to the time of diagnosis of the endocrine disorders was different depending on the type of endocrinopathy. most patients with hypothyroidism were diagnosed at presentation of scfe, whereas all of the growth hormone - deficient patients had the endocrinologic diagnosis made before presentation of scfe. in a report from the national cooperative growth study, blethen and rundle examined the association between scfe and growth hormone deficiency in a large cohort of 16,514 children. they found that scfe developed in 15 children before they received growth hormone and 26 children developed scfe during treatment. in our patient, we do not anticipate a slip progression during the course of growth hormone therapy, as both hips were treated with a surgical hip dislocation and osteotomy to correct the severe amount of slippage, not by traditional pinning with one single screw where a slip progression can be seen. once treated in this manner, the slip will not worsen or recur because the physis growth plate was removed during the procedure and the femoral head and neck heal together with a bone union. her bilateral hip involvement and valgus scfe presentation also favor the possibility of having associated endocrinopathy. her thyroid function test which showed low free t4 and slightly elevated tsh level may be misleading as a picture of primary hypothyroidism, which might not have prompted the extensive work up for panhypopituitarism. one should keep in mind that slightly elevated tsh level with low free t4 can be seen in central hypothyroidism as the primary hormone deficiency can be thyroid - releasing hormone, resulting in different tsh levels that can be normal, low - or slightly elevated. our patient 's lack of puberty served as an important clue to the need of a thorough endocrinologic evaluation. her low fsh and lh levels confirmed hypogonadotropic hypogonadism which led to a complete pituitary hormone evaluation. she was found to have complete growth hormone deficiency with undetectable igf-1 and growth hormone levels. moreover, she was also found to have secondary adrenal insufficiency, as part of her panhypopituitarism. this finding has significant implication in the management prior to surgery to prevent potential fatal complication from adrenal crisis. most patients with congenital hypopituitarism present at young age when short stature is noted during childhood. our patient had no medical care until her presentation of scfe which is a very unusual presenting sign for hypopituitarism. the interesting and puzzling point in this patient is that she has a normal stature despite having complete growth hormone deficiency as a result of pituitary hypoplasia which is a congenital condition. her infantile uterus and ovaries (from lack of hormone stimulation) which were nonvisualized by imaging studies at the time of diagnosis of panhypopituitarism but later grew in size and were visualized after estrogen hormone replacement also suggest that her pituitary hormone deficiencies have been present since birth this case illustrates growth without growth hormone syndrome which has been described in literature [9, 10 ]. it was postulated that other growth factors such as leptin, sex hormones, insulin may locally activate the igf system in the epiphyseal growth plate. in summary, we report an interesting case of a 17-year - old normal - statured female who was diagnosed with congenital panhypopituitarism due to pituitary hypoplasia at the presentation of slipped capital femoral epiphysis. we emphasized the importance of endocrinologic evaluation in patients with slipped capital femoral epiphysis that have signs of endocrinopathy to prevent potential complication of adrenal crisis during surgery. this case also demonstrates growth without growth hormone which resulted in a delay in diagnosis of congenital hypopituitarism in this patient. | we report an interesting case of a 17-year - old normal - statured female who was diagnosed with congenital panhypopituitarism due to pituitary hypoplasia at the presentation of bilateral slipped capital femoral epiphysis. we emphasized the importance of endocrinologic evaluation in patients with atypical slipped capital femoral epiphysis to prevent potential complication of adrenal crisis during surgery. this case also demonstrates growth without growth hormone which resulted in a delay in diagnosis of congenital hypopituitarism in this patient. |
chemokines (cks) are low molecular weight chemoattractant peptides, belonging to the cytokine family. differently from interleukins, cks act via g protein - coupled receptors (gpcrs), controlling cell migration and trafficking throughout the body, during immune response and development [3, 4 ]. cks are also critical mediators of several physiological mechanisms such as wound - healing and tissue homeostasis [3, 5 ] ; moreover, cks are expressed in the central nervous system (cns) [6, 7 ] where they not only act as mediators of development, intercellular communication, and inflammatory processes but also function as neurotransmitters or neuromodulators, mainly involved in neuroendocrine regulations. recently, it has been shown that cks play a relevant role in tumorigenesis, neoangiogenesis, tumor progression, and metastasization [9, 10 ]. evidence for autocrine / paracrine regulatory mechanisms in different normal and cancer cell types, driven by chemokine / receptors interaction on the same or a nearby cell, supports the potential role of cks in the control of physiological or tumoral endocrine functions. in particular, the chemokine (c - x - c motif) ligand 12 (cxcl12) and its receptors, cxcr4 and cxcr7, have been involved in cancer cell proliferation, migration, and invasion [1113 ]. they are classified by size (microadenoma, 10 mm) and on the basis of their ability to produce hormones, as secreting or functioning tumors (about 50% of adenomas) or as clinically nonfunctioning pituitary adenomas (nfpa) that do not release hormones or, more often, secrete clinically nonrelevant (i.e., gonadotropins) or nonbioactive hormones (-subunit of glycoproteic hormones) [14, 15 ]. almost all pituitary tumors display a benign clinical course being slow growing and show low incidence of metastasis ; however, they are frequently associated with high morbidity and mortality due to mass - related effects and paraneoplastic syndromes related to hormone hypersecretion. functioning pituitary adenoma leads to hypersecretion of hormones that results in classic clinical syndromes, mainly acromegaly (overproduction of gh), hyperprolactinemia (excess of prl), and cushing 's disease (overproduction of acth) and, more rarely, secondary hyperthyroidism (increased tsh secretion). nfpas do not secrete sufficient hormones (mainly fsh or lh) to be detectable in the blood or to cause hormonal manifestations ; in other cases only biologically inactive -subunit is released and more rarely they are classified as true nonsecreting adenomas. importantly, all pituitary adenomas may induce hypopituitarism and neurological symptoms (for example compression of the optic chiasma) due to mass effect [16, 17 ]. clinical relevance and recent advances in the comprehension of their molecular pathogenesis suggest that pituitary adenomas should be considered a more critical disease than a benign endocrine pathology. thus, a deeper evaluation of the mechanisms at the basis of their tumorigenesis and better prognostic markers to identify tumors with a high risk of recurrence are most awaited to improve pituitary adenoma clinical outcome. this review will focus on the diverse role of cxc chemokines and their receptors in normal pituitary cell functions and pituitary tumor development and progression, summarize recent progress in cxcr7 functions, and discuss the present issues and future perspectives. cks are classified, according to the number and spacing of the first two cysteine residues of a conserved cysteine motif, into four groups : (1) cxc (with a single nonconserved amino acid residue -x- between the first n - terminal c residues : cxcl1 - 17) ; (2) cc (two adjacent cysteine residues : ccl1 - 28) ; (3) xc (only one n - terminal cysteine : xcl1 - 2) ; (4) cx3c (three nonconserved amino acid residues separating the n - terminal c residues : cx3cl1) [18, 19 ]. ck receptors are typical gpcrs, all of them signaling through heterotrimeric g proteins (g, and g- subunits), with the remarkable exception of cxcr7 which is exclusively biased towards -arrestin - mediated signaling. upon ligand binding, many ck receptors may form homo- and heterodimers that activate distinct intracellular signaling pathways from individual receptors. the classification of ck receptors is based on the class of their ligands (e.g., cxc ligands bind cxc receptors). cks may also bind a small group of so - called atypical chemokine receptors (ackrs), which are unable to initiate downstream conventional g - protein - dependent signaling, resulting, from a functional point of view, in the inability to induce directional cell migration. these receptors bind distinct and complementary range of cks and likely control ck networks during development and physiopathological processes by scavenging cks. ackrs, including duffy antigen receptor for chemokines (darc, ackr1), c6 (ackr2), cxcr7 (ackr3), and ccx - ckr1 (ackr4) (for classification and nomenclature see), were proposed to serve as decoy receptors to scavenge inflammatory cks from the extracellular microenvironment, inhibiting their signaling. indeed, recent evidence supports the ability of ackrs to transport, internalize, and degrade cks, leading to the formation of ck gradients in normal and cancer tissues, responsible for the functional modulation of their signaling. cks belonging to the cxc family can be further grouped according to the presence or absence of a the tripeptide motif glu - leu - arg (elr) preceding the cxc domain (elr or elr), which affects receptor binding specificity and biological effects. notably, elr cxc chemokines (i.e., cxcl9, -10 and -11) are interferon -inducible and act as potent angiostatic factors to impair angiogenic stimuli induced by growth factors. conversely, elr cks (cxcl1, -2, -3, -5, -6, -7, -8) are proangiogenic [24, 25 ]. cxcl12 (previously known as stromal cell - derived factor-1, sdf-1) is an exception to this characterization, since it is elr but mediates tumor - promoting angiogenesis via its receptor cxcr4 [9, 24, 26 ]. common features shared by all cks are pleiotropism, promiscuity, and redundancy, with a single ck able to bind several receptors, whereas multiple cks bind the same receptor resulting in the same functional outcome. upon ligand binding, ck receptors undergo conformational change that activates the g subunits sensitive to bordetella pertussis toxin (ptx). their activation dissociates the gtp - bound g subunit from the g- dimer, and both these active components trigger intracellular signals, such as activation of phospholipase c (plc)/inositol triphosphate (ip3)-ca / diacyl glycerol (dag)/protein kinase c (pkc) and inhibition of adenylyl cyclase (ac)-camp / protein kinase a (pka). moreover, these receptors control the activity of different kinases, including extracellular regulated kinases (erk1/2), c - jun n - terminal kinase (jnk), p38, phosphatidyl inositol 3 kinase (pi3k)-akt, and the focal adhesion kinase (fak). the distinct transductional cascades regulated by ck receptors mainly depend on the g subfamily which they activate : gi inhibits ac but also activates tyrosine kinases of the src family, favoring signal integration ; gq increases plc activity, to cleave pip2 to form dag and ip3. in turn, dag activates pkc, whereas ip3 binds specific receptors on the endoplasmic reticulum inducing ca release from intracellular stores. finally, g12 controls the activity of the small g protein rhoa, via rho - gef. on the other hand, ck receptor activation of g subunits results in the activation of pi3k leading, through the phosphoinositide - dependent kinase 1 and 2 (pdk1 - 2), to akt phosphorylation and subsequent activation of its downstream signal proteins such as glycogen synthase kinase 3 (gsk3), mammalian target of rapamycin (mtor), and fak, which control migration in different types of normal and tumor cells. after stimulatory responses, the inactivation of ck receptor signaling occurs after the hydrolysis of gtp to gdp by the intrinsic gtpase activity of g subunit, followed by its reassociation with g/ in an inactive complex. moreover, receptor desensitization, internalization, and lysosomal degradation are mediated by g protein - coupled receptor kinases (grks) and arrestins. cks are constitutively secreted by leukocytes, fibroblasts, endothelial, and epithelial cells to mediate cell activation, trafficking, and homing [5, 30 ]. beside their basal expression, most cks are highly induced during inflammatory or infective processes driving different phases of immune response via a ck gradient which directs leukocyte recruitment to the site of inflammation. furthermore, cks directly activate specialized effector lymphocytes during the different steps of immune response, for example, cxcl8 (formerly named il8) recruits neutrophils, basophils, and eosinophils expressing its receptors, cxcr1 and cxcr2. adaptive immune responses are mediated by cks (cxcl9-l10-l11) secreted by macrophages activated by inf- released by natural killer and t helper 1 (th1) cells that express cxcr3, the receptor for cxcl9-l11, thus amplifying leukocyte recruitment and, finally, inflammation. cks also play a key role in embryogenesis, organogenesis, angiogenesis, and germ cell migration, especially during neural development. the constitutive expression of cks and their receptors in adult normal brain was initially identified in the immune - like competent cell populations such as microglia and astrocytes. the subsequent detection of their expression in neurons [3234 ] broadened ck role as neuromodulators / neurotransmitters in neurological processes such as thermoregulation, pain perception, and stress conditions, as well as in pituitary functions. focusing on the cxcl12/cxcr4-r7 network, it exerts a variety of functions in cns development as well as in mature brain. cxcl12 directs the migration of embryonic and adult stem cells in the developing central and peripheral nervous system [35, 36 ], controlling the formation of cerebellum, cerebral cortex, hippocampus, and dorsal root and sympathetic ganglia [25, 37, 38 ]. postnatally, cxcr4 expression, while downregulated in many brain areas, persists in the hypothalamus where it modulates the hypothalamic - pituitary system and the hypothalamic - pituitary - gonadal axis, in particular, cooperating to the regulation of neuroendocrine and reproductive systems [3941 ]. as far as cns development is concerned, the pivotal role of cxcl12/cxcr4 emerged from studies using knockout mice for either the ligand or the receptor. both models exhibited a superimposable abnormal neuron migration in the cerebellum, dentate gyrus, and dorsal root ganglia [35, 36, 42, 43 ]. furthermore, cxcl12/cxcr4 axis controls migration and homing of cajal - retzius cells [44, 45 ], postmitotic neurons, cortical interneurons [40, 4749 ], and dopaminergic neurons. cxcl12/cxcr4 regulation of stem cell positioning and migration persists in adults, in the neurogenic niches of brain and in the bone marrow, where hematopoietic progenitors cells are retained by the interaction between ligand and receptor that also promotes their survival and proliferation. interestingly, a similar homing mechanism has been demonstrated for adult neural progenitor cells (npcs) or neural stem cells (nscs). cxcr7, the second cxcl12 receptor, has a 10-fold higher binding affinity than cxcr4 but also binds cxcl11 (formerly known as ifn - inducible t cell chemoattractant, i - tac,), which, in turn, interacts with cxcr3. presently, the function of cxcr7 is still controversial. cxcr7 does not mediate cxcl12-dependent cell migration [20, 52, 54 ] and displays atypical signaling pathways, failing to induce intracellular ca mobilization and inhibition of camp production, since this receptor does not seem to be coupled to gi. based on its ability to rapidly sequester and degrade cxcl12 and thus to suppress cxcr4 activity, cxcr7 was firstly proposed to be a decoy receptor [5457 ] ; currently, this activity is considered only a part of the possible mechanisms by which cxcr7 modulates cellular functions. indeed, emerging evidence suggests that cxcr7 can promote cell motility [5860 ] and trigger intracellular signals in different human normal and cancer cell types [6164 ]. in particular, cxcr7 activates akt, map kinase (mapk), and jak / stat3 cascades, either by direct modulation, through a -arrestin - dependent pathway [20, 65 ], or after heterodimerization with cxcr4 [59, 6669 ]. preferential signaling through g - proteins or -arrestin is influenced by both cxcr4-cxcr7 dimer formation and the oligomerization state of cxcl12 [70, 71 ]. cxcr7 was recently shown to activate mtor in human renal cancer cells through the modulation of erk1/2 and p38 activities, further suggesting that it is a fully signaling receptor although independent from g proteins. however, cxcr7 knockout mice display a lethal phenotype due to a heart valve and vascular defects, a very similar scenario observed in mice with targeted disruption of the genes encoding cxcr4 and cxcl12 [67, 74 ]. in the adult rat brain, cxcr7 is expressed at high levels in vessels, pyramidal cells, and mature dentate gyrus granule cells, overlapping cxcl12 expression pattern [75, 76 ], and a functional role for cxcr7 in the control of neuronal migration to the subventricular and intermediate zone was suggested [69, 77 ]. in rat mature neurons and blood vessels, cxcr7 appears to be the preponderant cxcl12 receptor, likely contributing to cxcl12-dependent neuronal development. moreover, cxcr7 acts as scavenger on brain microvessel endothelium and it is essential for inflammatory leukocytes to infiltrate the cns. cxcr7 is also expressed in neural tube and brain of mice embryos. in rat cortex, cxcr7 is localized in gabaergic neuron precursors, and cajal - retzius cells and, unlike cxcr4, it has been identified in neurons forming the cortical plate and in the developing dentate gyrus and cerebellar external germinal layer [75, 80 ]. migrating immature cortical interneurons co - express cxcr4 (membrane surface expression) and cxcr7 (intracellular expression, mainly endosomes). cxcr7 rapidly recycles from membrane to intracellular pools of interneurons, and its trafficking mediates cxcl12 endocytosis. it is essential for the regulation of interneuron migration in the developing cerebral cortex since its removal causes an increase in extracellular cxcl12 content, which favors its binding to cxcr4 and consequently induces the endocytosis and degradation of cxcr4. thus, cxcr7 regulates cxcr4 expression and likely controls cxcl12 signaling to drive successful migration in the developing cerebral cortex. in addition, since cxcr7 and cxcr4 mutant mice displayed opposite defects in interneuron motility and positioning, cxcr4 and cxcr7 were proposed to have distinct roles and signal transduction to regulate interneuron movement. this fine tuning of cxcl12 response induced by cxcr7 occurs either directly modulating -arrestin - mediated signaling cascades or scavenging local cxcl12 availability. deletion of one of the cxcl12 receptors is sufficient to generate a migration phenotype that corresponds to the cxcl12-deficient pathway and interfering with the cxcl12-scavenging activity of cxcr7 causes loss of cxcr4 function. for example, during development, cxcl12 regulates the migration of gonadotropin - releasing hormone (gnrh) neurons, through cxcr4-mediated activation of the girk channel, but this effect is modulated by cxcr7 which controls cxcl12 content availability acting as a scavenger along the migratory path. the relevance of cxcl12 and cxcr4-r7 system in cns ontogeny and functions is even more crucial in the view of their expression in both embryonic and adult brain stem cells, a subset of undifferentiated cells characterized by self - renewal through asymmetric division, differentiation into multiple lineages, and constant proliferation that in adults acts in tissue maintenance and repair. the role of cxcl12 and cxcr4 in stemness maintenance has gained much attention also in the neuroendocrinology field due to the proposed role of stem cells in pituitary plasticity [84, 85 ]. both cxcl12 and cxcr4 are expressed in different anterior pituitary cell subtypes, as well as in nonhormonal cell types [8688 ]. the chemotactic activity of this ck could be also relevant in folliculostellate (fs) cell, non - fs nestin cell, and stem cell migration [86, 89 ]. therefore, understanding the ck - dependent mechanisms associated with candidate stem cells within pituitary might help to clarify their activity in development or in normal mature hormone - producing and tumor pituitary cells [84, 90, 91 ]. the stem cell concept applied to cancer has radically changed the research approach to tumorigenesis and treatment, since the subset of cancer cells, namely, cancer stem cells (cscs), seems responsible for tumor initiation, metastasis, and resistance to therapy. although, at present, all factors and signals that regulate cscs are not completely clarified, accumulating evidence suggests a key role of the cxcl12/cxcr4 axis in csc maintenance and growth [62, 93 ]. moreover, interactions between cscs and tumor microenvironment through secreted cks (e.g., cxcl12), possibly occurring also in pituitary adenomas, may act as chemoattractant to recruit fibroblasts, endothelial, mesenchymal, and inflammatory cells to the tumor, via cxcr4. through the release of growth factors (bfgf, egf, and vegf), cyto / chemokines, and neuroendocrine proteins (steroid hormones, prolactin, growth hormone, ghrelin, erythropoietin, catecholamines, etc.) neuronal and neuroendocrine pathways regulate fundamental functions within the cns and its interaction with the immune system. complex autocrine / paracrine signals through neuropeptides (e.g., egf and vip), neurotransmitters, cytokines (il-1, il-6), and cks occur also in pituitary regulation, differently from the classical hypothalamic input and feedback signals from the periphery [9597 ]. egf expression has been observed at all stages of pituitary development and in the adult pituitary, and the egfr pathway contributes to pituitary physiology and tumorigenesis. il-1 receptors were detected in pituitary cells, and their activation inhibits prolactin (prl) secretion from dispersed rat pituitary cells through the regulation of ac and plc activities, and ca fluxes [100103 ]. il-6 and its receptors are also expressed in the pituitary gland [104, 105 ] where their interaction regulates apoptosis and proliferation of endocrine cells in vitro. il-6 is mainly produced by the fs cells and activates a paracrine loop on the hormone - secreting cells [107, 108 ] regulating acth, prl, lh, and gh secretion [110112 ] via the modulation of ac and plc activities. interestingly, il-6 exerts opposite effects on normal and adenomatous pituitary cells : it is inhibitory for normal anterior pituitary and stimulatory for adenoma cells. il-18 was also proposed to exert paracrine effects in pig anterior pituitary being the ligand and its receptor expressed by different subsets of gh secreting cells. finally, interleukins ' regulation of the hypothalamic - pituitary - adrenal axis also involves the modulation of vasoactive intestinal peptide- (vip-) secreting pituitary cells to control, in a paracrine manner, prl release. cks can affect pituitary hormone secretion via the hypothalamic - pituitary axis or autocrine / paracrine regulation. cxcl1 is expressed in the posterior pituitary, in the paraventricular nucleus (pvn) of the hypothalamus and the median eminence. in response to stressful stimuli, this ck is released in the median eminence to reach its receptor (cxcr2) expressed in pituitary cells and induce the release of prl and gh and the inhibition of lh and fsh secretion. the generation of transgenic rats (s100-gfp rats) that express green fluorescent protein in s100-positive pituitary fs cells in the anterior pituitary led to the characterization of s100-positive cells [86, 121 ] and transcripts of cxcl10 (ifn- inducible protein 10 kda, ip-10) were identified in a subpopulation of these cells. importantly, cxcr3, the receptor for cxcl10, was shown to be expressed in corticotrophs, suggesting a possible autocrine / paracrine effect of cxcl10, released from fs cells, on acth - producing cells. cxcl12/cxcr4 is the major regulatory axis not only connecting the immune and nervous systems, but also playing a role in neuroimmune regulation of the anterior pituitary physiological functions. cxcl12 was detected in both rat pituitary and hypothalamus and its expression in hypothalamic neurons, concomitant with cxcr4 positivity at pituitary level, corroborated the hypothesis that this ck could represent a hypothalamic regulatory factor of anterior pituitary function. as a consequence, the chemokinergic regulation of anterior pituitary cells might derive from coordinate activity of cxcl12 originating from both hypothalamic neurons and systemic circulation. a regionalized constitutive expression of cxcl12 was reported in adult rat brain, particularly in arginine vasopressin- (avp-) expressing neurons where its interaction with cxcr4 leads to modulates induced plasma avp release in vivo. the expression pattern of this chemokine and its receptor in the rat hypothalamo - neurohypophyseal system was further investigated : they colocalize within avp - expressing neurons in both supraoptic (son) and paraventricular (pvn) nucleus as well as in dense core vesicles of avp - positive nerve terminals in the posterior pituitary, showing a similar distribution. since avp controls body fluid homeostasis, the interaction between cxcl12 and avp was studied in avp - deficient brattleboro rats that show low expression of both cxcl12 and cxcr4, correlated with avp protein expression level in son, pvn, and posterior pituitary. however, since cxcl12 mrna is increased, it was hypothesized that cxcl12 synthesis is present in these cells but, being costored with avp, a concomitant massive release of both peptides is responsible for their low content at both hypothalamic and posterior pituitary levels. avp and cxcl12 expression is dependent on water balance and is centrally regulated, further strengthening the role of cxcl12 in neuroendocrine functions. however, cxcl12 and cxcr4 are also coexpressed in rat pituitary cells and a further autocrine / paracrine regulation of pituitary functioning was hypothesized. complete colocalization between cxcr4 and gh was reported in normal rat pituitary, suggesting that cxcr4 is a rather specific regulator of somatotroph activity, in rats. indeed, cxcl12 stimulates gh transcription and secretion in both primary rat anterior pituitary cells and the gh - producing pituitary adenoma cell line, gh3. interestingly, rat fs cells also express cxcr4 and secrete cxcl12, which acts as a potent chemoattractant for these cells. the activation of this autocrine loop facilitates the formation of f - actin in fs cells and the subsequent directional extension of their cytoplasmic processes toward other fs cells. cxcl12/cxcr4 interaction induces invasion and interconnection of fs cells to near lobular structures likely forming a circuit that causes or maintains local cellular arrangement in the anterior pituitary. in humans, scattered expression of both cxcr4 and cxcl12 within the anterior lobe was detected by immunohistochemistry, revealing a nonhomogeneous positivity for both proteins throughout the tissue, including large negative areas, others showing few positive cells and rare zones with higher expression (figure 1). interestingly, in all these areas, cxcr4 expression resulted largely higher than its ligand, although all the cxcl12-positive cells express cxcr4, as well. cxcr4-expressing cells do not belong to specific secreting cell type, being present in gh, prl, or acth - secreting cells, while no expression was observed in human fs cells. however, some cxcr4-expressing cells do not coexpress any hormones and no colocalization of either cxcr4 or cxcl12 was observed in fs cells ; thus it was proposed that cxcl12/cxcr4 system may also label undifferentiated / progenitor cells. notably, this ck - receptor pair was undetectable in human posterior pituitary lobe, contrarily to what was observed in rats. thus, from these data it is evident that, in normal pituitary, cxcl12 is secreted by cell subpopulations that, cooperating with hypothalamic factors (including cxcl12 itself), may contribute to paracrine modulation of pituitary functioning (figure 2). consequently, alterations of the endocrine regulatory pathways due to upregulation of hypothalamic / pituitary cxcl12/cxcr4 axis might lead to the development of pituitary adenomas [127, 129 ]. the activity of cxcr7 in normal pituitary deserves further investigation ; however its expression in pituitary adenoma tissues [130, 131 ] suggests possible involvement in pituitary function regulation. beside direct cxcr4-dependent activation of erk1/2, transactivation of tyrosine kinase receptors is currently a relevant mechanism in tumor cell responses. mainly, the transactivation of epidermal growth factor receptor (egfr) family members mediates the mitogenic activity of different cks in human cancer. a cross - talk between cxcl12 and egfr and/or her2/neu phosphorylation was demonstrated in breast and ovarian cancer cells through g protein - dependent activation of kinases of the src family [132134 ]. moreover, in breast cancer, cxcr4 interacts with the egfr variant, egfr viii, a constitutively active mutant highly expressed in cancer stem cells, to regulate invasion via p38 mapk. cxcr4 signaling is negatively regulated by protein - tyrosine phosphatases (ptps), such as the src homology - containing protein - tyrosine phosphatase 1 (shp1) and the sh2 domain - containing inositol 5-phosphatases (ship), while shp2, constitutively associated with cxcr4, potentiates ck signaling [137, 138 ]. these observations are particularly relevant since they highlight possible direct antagonisms between cxcr4 and somatostatin receptors (sstr) that are powerful activators of ptps [139141 ]. this antagonistic activity could acquire clinical relevance in light of the fact that sstr agonists are the main pharmacological tool available for the treatment of pituitary adenomas [142, 143 ]. the concomitant expression of ligand - receptor pair in the same tumor cells, responsible of autocrine / paracrine activation, is one of the leading causes of clinical aggressive behavior in various cancer types [144, 145 ]. exploiting the coexpression of cks and their receptors, cancer cells and cells of the tumor microenvironment as previously described, this autocrine mechanism is maximally effective for cxcr4, the most widely expressed ck receptor in human solid and hemopoietic malignancies. the autocrine / paracrine loop of the cxcl12/cxcr4 pair has been deeply investigated in brain tumors in both in vitro and in vivo models : cxcl12 stimulates proliferation and migration of glioblastoma cells and xenografted tumors inducing erk1/2 and akt phosphorylation [147149 ]. the mitogenic activity mediated by cxcl12-cxcr4 was also reported in meningioma, in which cxcr4 activation increased dna synthesis through activation of erk1/2 in primary cultures and its expression level significantly correlated with ki-67 proliferation index of the original tumor tissue [150, 151 ], while cxcr7 was mainly localized in tumor endothelia. similar cxcr4 tumor - promoting effects were observed in breast carcinoma, suggesting cxcl12 as possible autocrine / paracrine growth factor. interestingly, in breast cancer cells the synthesis and release of cxcl12 is under the control of 17-estradiol contributing to its proliferative effects and mediating, via a src - dependent mechanism, egfr transactivation [133, 154 ]. furthermore, cxcl12 is also indirectly implicated in tumor pathogenesis, acting as chemoattractant for cxcr4-positive cells, directing tumor cell migration [155157 ] and controlling invasive and metastatic properties of cxcr4-expressing cancer cells to distant organs [158, 159 ]. the invasive behavior of cancer cells might indirectly depend on locally released cxcl2 that, via an autocrine mechanism, binds to cxcr4 impairing chemotaxis towards cxcl12-producing target organs and metastatic spread. in addition, normal cells forming tumor stroma (i.e., macrophages, lymphocytes, fibroblasts, and endothelial cells) concur to cancer development and progression through cxcl12 secretion. concentration gradient directs cancer cell motility in several tumors [10, 161 ], including aggressive solid neoplasms (breast, colon, brain ovarian, prostate, renal cell and oral squamous cell carcinomas, and melanoma). importantly, as observed in a rat mammary adenocarcinoma cell line overexpressing both receptors, cxcr4 and cxcr7 play opposing roles in breast cancer metastasis : cxcr4 mediates cancer cell invasion allowing cells to follow the cxcl12 gradient generated by metastatic targets whereas cxcr7 favors tumor growth increasing angiogenesis but impairs cell migration scavenging the chemokine. raf / mek / erk and pi3k / akt pathway dysregulation is a common alteration responsible of tumor initiation and progression. while the pathways are classically activated by growth factors, cross - talks and transactivation mechanisms with neuropeptide - cytokine - ck / gpcrs have been increasingly recognized. this cross - talk activates erk1/2, which is directly responsible for cell growth and differentiation, depending on the cellular context and represents one of the major proliferative pathways in cancer [168, 169 ]. the overexpression or constitutive activation of receptors for growth factors, cytokines, and cks potentiates the activation of ras / raf / mek / erk pathway also in pituitary adenoma. mapk phosphorylation is relevant in different pituitary cell types such as att20 cells, where it regulates crh - induced pomc transcription, gonadotrophs for gnrh signaling, gh - secreting cells for ghrh - dependent cyclin d1 expression, and gh4c1 somatotroph cell line in which the gsp oncogene impairs ras / erk1/2-dependent prl gene regulation. pi3k / akt / mtor pathway, activated by a variety of growth factors and hormones, when dysregulated, leads to aberrant growth of pituitary adenoma cells. akt is overexpressed and hyperphosphorylated in nfpa, in a mouse model of tsh - oma, and in gh3 cells in which the inhibition of pi3k / akt signaling by octreotide increases the expression of the tumor suppressor gene zac1 [176, 177 ]. similarly to cell proliferation, survival mechanisms also sustain pituitary development and tumorigenesis : in particular the balance of pro- and antiapoptotic factors, physiologically contributing to normal pituitary cell plasticity, when unbalanced, favors pituitary cell transformation. for example, in pituitary adenomas, antiapoptotic mediators, such as the bcl-2 protein family, are upregulated, while fas, a major apoptotic factor in different cell types, activates apoptosis in both normal rat lactotrophs and somatotrophs and in pituitary adenoma cell lines. several pituitary - related genes may exert a role in apoptosis of secretory pituitary cells, as the developmental factor pitx2 and the transcription factor pit-1 [183, 184 ], although their mechanisms are not yet fully understood. recent studies, however, highlighted that, when considering the complexity of regulatory pathways involved in pituitary cell survival and proliferation, it should take into account not only apoptosis but also senescence, an alternative process acting during tumor - suppressive cell fate. importantly, senescence is gaining biological significance also in pituitary adenomas, whose typical benign nature could result from protective antiproliferative mechanisms. several transformation events (e.g., dna damage, loss of tumor - suppressor gene, oncogene activation, and growth factor overexpression) induce preventive cellular senescence, characterized by cell cycle exit and subsequent irreversible proliferation arrest. thus, pituitary tumors may be more prone to activate senescence - associated pathways, maintaining their benign behavior, preventing malignant transformation, and regulating their development. interestingly, il-6 has been shown to participate in oncogene - induced senescence in pituitary gp130 overexpressing tumor cells. moreover, angiogenic and apoptotic processes cooperate in determining tumor aggressiveness, and this regulation might also be involved in the pathogenesis of pituitary transformation. the pituitary gland is highly vascularized but, unlike other solid malignancies, conflicting results are available on angiogenic factors associated with pituitary adenoma progression and recurrence [186, 187 ]. vegf was proposed as pituitary proangiogenic factor and possible therapeutic target, and the hypoxia - inducible factor- (hif-), a key molecule in hypoxic pathways triggering vessel formation, was detected in pituitary tumor tissues [189, 190 ] and may favor hemorrhage in pituitary macroadenomas. cks, particularly cxcl12 signaling via cxcr4 and cxcr7, represent candidate mediators of the above described intracellular pathways, determining proliferative, antiapoptotic, and angiogenic signals, thus possibly concurring to pituitary tumor development and aggressiveness. pituitary adenomas are common intracranial tumors of the adenohypophysis causing serious morbidity, due to excessive hormonal secretion, mass effects, and local invasion of surrounding structures. at present, the understanding of biological and molecular pathogenesis and mechanisms of progression of these tumors is largely incomplete (for review see [14, 192, 193 ]). emerging evidence reports that multiple factors might contribute to pituitary tumorigenesis, such as frequently altered gene expression, genetic (aryl hydrocarbon receptor interacting protein, aip ; multiple endocrine neoplasia syndrome type 1, men1 ; guanine nucleotide - activating alpha subunit, gnas,), and epigenetic (cyclin - dependent kinase inhibitor 2a, cdkn2a, or p16 ; fgfr2/melanoma associated antigen -mage-3 pathway) mutations, and abnormal micrornas. the improvement of this knowledge is even more helpful taking into account the peculiar properties of pituitary adenomas as compared to other malignancies : they commonly grow slowly but with local invasive behavior and occasionally develop into high aggressive tumors. this often prevents the efficacy of surgical and systemic medical treatments, the latter hampered by the lack of definite mechanisms underlying pituitary cell transformation and potential therapeutic targets. however, few studies addressed the potential role of components of this peptide family in regulating human pituitary tumorigenesis. cxcl8 mrna was identified in a small percentage of anterior pituitary adenomas [199, 200 ], altogether with the expression of cxcr2, the cxcl8 receptor that also binds other cxc cks (cxcl1, cxcl7), confirming the potentiality of autocrine stimulation in pituitary adenomas. indeed, a consistent release of cxcl8 was observed in primary cultures derived from human somatotroph adenomas, induced by stimulation with interleukin-1 and inhibited by gh releasing hormone (ghrh). thus, a further assessment of the possible role of this ck in the pathogenesis of pituitary tumors is required, likely being based on cxcl8 ability to recruit active neutrophil within the adenoma, influencing the inflammatory response or acting as mitogen for normal and transformed cells. however, the majority of studies focused on the analysis of cxcl12 and cxcr4 expression in human neoplastic pituitary tissues and their role in adenoma cell proliferation [128, 129, 203205 ]. cxcr4 mrna is expressed in almost all gh - secreting pituitary adenomas and in the great majority of nfpas, whilst cxcl12 was identified in about 2/3 of these tumors. notably, most cxcl12-positive cells also express cxcr4 strongly suggesting an autocrine / paracrine regulation of tumor cell proliferation [129, 205 ]. this hypothesis was further confirmed measuring the in vitro basal secretion of cxcl12 by human pituitary adenoma primary cultures resulting in an autocrine constitutive stimulation of dna synthesis (figure 2) and, indirectly, by the absence of cxcr4 activating mutations in gh - secreting and nfpa able to sustain adenoma cell proliferation. this observation was confirmed by a high percentage of different types of secreting pituitary adenomas showing expression of both cxcl12 and cxcr4 [129, 203, 204 ]. finally, the evaluation of cxcr4 and cxcl12 expression in invasive and noninvasive pituitary adenoma specimens, by flow cytometry and immunohistochemical staining, demonstrated that the percentage of cxcr4- and cxcl12-positive cells was significantly higher in invasive pituitary adenomas. thus, the correlation of cxcr4 and cxcl12 expression levels and tumor invasiveness was proposed to be exploited as potential early diagnostic biomarkers, one of the major challenges in diagnosis and treatment of invasive tumors. among the mechanisms that occur in pituitary tumorigenesis interestingly, while controversial findings on the role of vegf were reported [207209 ], cxcl12 has been proposed as a better defined proangiogenic and proliferative factor in pituitary adenomas. in fact, cxcl12 and cxcr4 are concomitantly upregulated in hypoxic foci within pituitary tumor tissues, and one of the main cxcl12 effects in pituitary adenomas is to mobilize cd34- (and cxcr4-) expressing endothelial progenitors and promote their homing in ischemic foci activating the proangiogenic program. moreover, in gh3 rat pituitary adenoma cells, hypoxia - activated cxcl12-cxcr4 signaling interacts with the endocrine pathways resulting in upregulation of gh synthesis and secretion and cell proliferation. thus, in pathological conditions (i.e., hypoxia), on one hand, increased cxcl12 and cxcr4 expression and signalling may promote neoangiogenesis by recruiting endothelial progenitor cells and/or inducing proliferation of endothelial cells and, on the other, directly favouring hormone hypersecretion and pituitary cell proliferation. interestingly, gh4c1 rat pituitary adenoma cell line expresses cxcr4 but not cxcl12, thus it was proposed as a suitable model to characterize the molecular pathways regulated by this receptor in pituitary adenomas, without the interference of the endogenously released ck [127, 211, 212 ]. in these cells cxcl12 exerts a powerful secretagogue and mitogenic activity, as well as promotes cell migration. interestingly, these effects are induced by different and independent intracellular mechanisms, although all of them were ptx - dependent. gh secretion is a ca - dependent event, in which increased ion concentration resulted from ip3-mediated ca release from intracellular stores. conversely, gh4c1 proliferation is induced by cxcl12 through the activation of erk1/2 through the classical mek - dependent pathway and via the activation of the cytosolic ca - dependent tyrosine kinase, pyk2, that, in turn, activates the large - conductance ca - activated k channels (bkca) [95, 127, 211, 212 ]. similarly,, the role of cxcl12/cxcr4 as potential pharmacological target in acromegalic patients has been scantily investigated. it was shown that a synthetic antagonist of cxcr4, d - arg3fc131, is able to inhibit the growth of gh3 tumor cells and trigger apoptosis both in vitro and in mice xenografts. similar results were obtained using phidianidine a, an indole alkaloid isolated from the marine opisthobranch mollusc phidiana militaris, which reduced gh4c1 proliferation, migration, and erk1/2 phosphorylation. cxcr7, the second cxcl12 receptor, was reported to be expressed in the att20 mouse corticotroph pituitary adenoma cell line, but the characterization of its possible role in pituitary adenoma development or progression will require further evaluation. studies on human pituitary adenoma cells derived from postsurgical specimens are limited, mostly due to their low proliferative activity in vitro. however, such generalized cxcr4 and cxcl12 overexpression in human pituitary adenomas, as compared to normal pituitary, strongly suggests that, in conditions of deregulation, this receptor system could be a relevant factor for pituitary adenoma development and/or progression. however, cxcl12 effects of on cell proliferation were directly evaluated in vitro on a small number of primary cultures of adenoma cell derived from ghoma, nfpa, and acth - secreting adenomas. to avoid interference with the cxcl12 released from fibroblasts a specific protocol to obtain adenoma cell cultures highly purified was used. cxcl12 induced a statistically significant increase in dna synthesis in the majority (65%) of the adenoma tested. interestingly, in few adenomas, the blockade of cxcr4 with amd3100, a known cxcr4 antagonist, caused, beside the abolishment of cxcl12-mediated increase in cell proliferation, also a reduction of basal dna synthesis. measuring cxcl12 levels in the culture medium, it was shown that these tumors retained in vitro a significant basal secretion of cxcl12 causing a constitutive, autocrine stimulation of dna synthesis. thus, these data suggest that pituitary adenoma cells over - express cxcl12 and cxcr4 as compared to normal tissue and that an autocrine activation of this pathway (figure 2), actually, occurs in vivo. overall, these observations imply that cxcl12/cxcr4 axis might play an important biological role in pituitary adenoma as potential growth and angiogenic factor for pituitary cells. the increased cxcr4 activation may result from either endocrine (increased cxcl12 levels may reach pituitary through the blood stream or being released in the portal pituitary system from hypothalamus) and/or autocrine / paracrine mechanisms (figure 2). importantly, the latter mechanism seems to be active mainly in pituitary tumors rather than in normal gland, where most of the cxcr4-expressing normal cells do not express cxcl12. chemokines are key factors in cns physiology and pathology, being relevant mediators in cancer development. the cxcl12/cxcr4-r7 signaling pathway plays a unique role in the regulation of a variety of cell types, including embryonic and cancer cells. in particular, deregulation of this chemokinergic system is strictly related to tumor initiation and progression, and the balance of its activity within the tumor microenvironment is highly complex phenomenon. multiple factors cooperate to pituitary tumor pathogenesis, but, although to date not explored in depth, a pivotal role of ck and their receptors seems to be important. several mechanisms by which cxcl12/cxcr4 modulates pituitary function and promotes adenoma cell proliferation and their target as potential therapeutic approach have been suggested. cxcl12 is overexpressed in pituitary cells where it can directly influence adenoma formation, through autocrine mechanisms resulting in constitutive cxcr4 activation. this pathway grants pituitary cells with a proliferative advantage that triggers clonal expansion of transformed cells and sustains tumor cell survival. increasing knowledge about pituitary cell origin and development might provide significant insights into deregulated pathways in pituitary tumorigenesis. finally, cxcr4 is an easily druggable target and the characterization of its role in pituitary adenomas could pave the way for novel pharmacological approaches, especially for those adenoma subtypes, (i.e., tsh and acth secreting tumors, as well as nfpa) still waiting for efficacious drugs. | chemokines are chemotactic regulators of immune surveillance in physiological and pathological conditions such as inflammation, infection, and cancer. several chemokines and cognate receptors are constitutively expressed in the central nervous system, not only in glial and endothelial cells but also in neurons, controlling neurogenesis, neurite outgrowth, and axonal guidance during development. in particular, the chemokine cxcl12 and its receptors, cxcr4 and cxcr7, form a functional network that controls plasticity in different brain areas, influencing neurotransmission, neuromodulation, and cell migration, and the dysregulation of this chemokinergic axis is involved in several neurodegenerative, neuroinflammatory, and malignant diseases. cxcr4 primarily mediates the transduction of proliferative signals, while cxcr7 seems to be mainly responsible for scavenging cxcl12. importantly, the multiple intracellular signalling generated by cxcl12 interaction with its receptors influences hypothalamic modulation of neuroendocrine functions, although a direct modulation of pituitary functioning via autocrine / paracrine mechanisms was also reported. both cxcl12 and cxcr4 are constitutively overexpressed in pituitary adenomas and their signalling induces cell survival and proliferation, as well as hormonal hypersecretion. in this review we focus on the physiological and pathological functions of immune - related cyto- and chemokines, mainly focusing on the cxcl12/cxcr4 - 7 axis, and their role in pituitary tumorigenesis. accordingly, we discuss the potential targeting of cxcr4 as novel pharmacological approach for pituitary adenomas. |
microbial fermentation ensures production of industrially important metabolites in large quantities. implication of rdna technology in microbial fermentations offers production of desired heterologous proteins at large scale. apart from the proteins, nature offers diverse classes of complex metabolites (isoprenoids) that are utilized in the food, cosmetic, and pharmaceutical industries and so forth. many of these complex metabolites are produced naturally in low quantities in plants that are difficult or expensive to cultivate. metabolic engineering, systems, and synthetic biology principles and methods allowed easy transfer of heterologous pathways from natural plant producer to a suitable microbial host such as yeast and e. coli [24 ]. e. coli was the most studied host for metabolic engineering of isoprenoid by modulating 1-deoxyxylulose-5-phosphate (dxp) and mevalonate (mva) pathways [58 ]. other studies on mva pathway deregulation in yeasts have improved the biosynthesis of different isoprenoids [913 ]. the vital role of mva pathway and eventual product (ergosterol) proportion from this pathway increased the interest for the engineering of isoprenoid pathway in yeast for the production of heterologous compounds. ergosterol synthesis was carried out by squalene synthase (erg9), and conversion of farnesylpyrophosphate (fpp) to squalene was successfully regulated by replacing the native promoter with repressible promoters [2, 15 ]. atp sulfurylase (met3) catalyzes the reduction of sulfate to sulfide, involved in methionine metabolism. addition of methionine had the ability to repress the met3 promoter in s. cerevisiae and ashbya gossypii [16, 17 ], and met3 promoter was widely used as a molecular tool for yeast genetics. heterologous expression of pathways / enzymes in s. cerevisiae is complex due to the presence of numerous native host enzymes and tight regulation of the intermediate metabolites generated by the host machinery. the non native product formation is not only affected by the host environment but also by the loss of intermediate metabolites through diffusion, degradation, or converted by competitive enzymes / pathways [19, 20 ]. in order to avoid such intermediates loss and make heterologous expression more efficient, enzymes catalyzing successive reactions are often fused in close proximity to each other by using small linkers. small linkers are the sequence codings for few amino acids, which separates the two proteins in space with a small distance allowing them to fold properly without constraints from each other. consequently, the substrate was channeled between active sites of two or more sequential enzymes of a pathway, without allowing free diffusion of the intermediates. subsequently it reducing the transit time required for the intermediates to spread the enzyme that catalyzes the next step in the reaction. several elucidations in vitro and in vivo recommended that this strategy can be used to improve the flux through a metabolic pathway [2125 ]. in the present study, we used s. cerevisiae (mtcc 3157) for heterologous expression of amorphadiene synthase (ads) for one - step conversion of fpp to amorphadiene. in order to increase the concentration and flux of fpp towards heterologous product, squalane synthase (erg9) a key enzyme in ergosterol synthesis further to avoid fpp loss through competitive pathways, enzyme fusion strategy was applied. here, we composed a chimeric fusion protein between farnesyl diphosphate synthase (fpps) of yeast and amorphadiene synthase (ads) of artemisia annua l. and was expressed in erg9-repressed yeast strains. all the reagents and media used in this study were of, analytical grade and procured either from himedia (india) or merck (india) or sigma (india). the strains used in this study were saccharomyces cerevisiae (mtcc 3157), and e. coli dh5 (mtcc 1652). the met3 promoter was amplified from genomic dna of s. cerevisiae (mtcc 3157) using the primer pairs 1 and 2 (table 1) containing restriction sites bcui and cfr42i. pcr was carried out in a total volume of 50 l with the following reagents : 1x ex taq dna polymerase buffer (stratagene), 0.2 mm dntps (pharmacia), 20 pmol of each primer, and 1 u ex taq dna polymerase (takara, japan). this pcr includes two cycles of 94c (0.5 min), 50c (1.0 min), and 72c (1.5 min) ; 29 cycles of 94c (0.5 min), 56c (1 min), and 72c (1.5 min) ; and 72c (5 min). resultant pcr fragment and pug6 plasmid (euroscarf, germany) were digested with bcui - cfr42i restriction enzymes. the vector and pcr fragments were purified with nucleospin gel and pcr clean - up kit (macherey - nagel, germany) and separated on 1% agarose gel (merck biosciences, india), and gel was further purified using nucleospin gel and pcr clean - up kit (macherey - nagel, germany). ligation of the vector and pcr products was carried as per the standard protocol given for t4 dna ligase (merck biosciences, india). the ligated plasmid mix was transformed into competent e. coli (dh5) mtcc 1652, and transformants were selected on lb medium supplemented with ampicillin (50 mg / l), and the plasmid obtained was named as pug6 met3. erg9 promoter was replaced with methionine promoter by using fusion pcr, and four fragments were separately amplified before fusing them together in pairwise by using fusion pcr and a bipartite gene targeting method (figure 1) [15, 26 ]. two fragments containing the met3 promoter and the kanmx selection cassette were amplified from plasmid pug6 met3 in two separate, but overlapping fragments using the two pairs of primers (3) a, b and (4) a, b (table 1). also 500 bp upstream region of the erg9 promoter in the genome of s. cerevisiae was amplified using primers (5) and (6). subsequently, the first 500 bp of the erg9 open reading frame (orf) region was amplified using primer pairs (7) and (8) (table 1). finally, pcr fragments were gel purified using the nucleospin gel and pcr clean - up kit (macherey - nagel, germany) and subsequently fused together in pairs using fusion pcr to obtain two fragments, first one with met3 promoter and 500 bp orf region of erg9 using primers (9) and (10) and a second fragment containing kanmx and first 500 bp upstream region of erg9 using primers (11) and (12) (table 1). subsequently, fusion pcr fragments were gel purified with the nucleospin gel and pcr cleanup kit (macherey - nagel, germany). an fpps (erg 20) gene fragment was obtained by pcr amplification as mentioned above using genomic dna of s. cerevisiae mtcc 3157 with the primer pairs (13) and (14). the fragments were digested with ecori and clai and inserted into an ecori - clai vector fragment 2 based py01ura plasmid (genecopeia usa) and the resulting plasmid is designated as py01fpps. for construction of plasmid expressing fusion protein fpps - ads, first fpps and ads were amplified separately using primer pairs (13), (14) and (15), (16) using py01fpps and prs425ads (addgene#20119) as templates. the two resulting pcr fragments were fused in the second round of pcr using primers (17) and (18). similarly, ads - fpps fragments were generated in the first round using the primer pairs (19), (20) and (21), (22) and the resulting fragments fused together in second round of pcr using primer pair (23) and (24). the resulting two pcr fragments were cut with ecori - clai and individually cloned into ecori - clai plasmid 2-based py01ura plasmid (genecopeia, usa) and the resulting plasmids were named as py01fpps - ads and py01ads - fpps, respectively. transformation of all strains of s. cerevisiae was performed by lithium acetate and peg mediated transformation by using yeastmaker transformation system 2 kit (clontech, usa). s. cerevisiae strain (mtcc 3157), was used as the parent strain for all s. cerevisiae strains used in this study. strain ycf - ad was constructed by the transformation of pesc - ura - ads plasmid (constructed by using pesc - ura and addgene#20119) in to mtcc 3157. strain ycf-002 was generated by transforming the fusion pcr fragments in to strain ycf - ad and selected on kanamycin and synthetic defined (sd)-ura drop out plates. finally strain ycf-001 obtained by exclusion of plasmid pesc - ura - ads from strain ycf-002 by selection on plates containing 5-fluoroorotic acid (5-foa). strain ycf-004, ycf-005, and ycf-006 constructed by transforming the plasmids py01fpps, py01fpps - ads, py01ads - fpps, and the transformants were selected on sd - ura drop out plates (table 2). optical density values of samples in triplicates were measured at 600 nm (od600) by using uv - spectrophotometer (thermo scientific, usa). the dry weight was analyzed by using nitrocellulose filter papers (pore size 0.45 m, whatman). the filter papers were predried in a microwave oven at 60c for 10 min. a known volume of the cell culture was filtered, and the residue was washed with distilled water and dried in an oven at 60c. an overnight culture grown in minimal medium supplemented with 1.5 mm methionine (glucose 20 g / l) was centrifuged at 5,000 rpm for 5 min to get approximately 3 g of dry cells. the cell pellet was washed with distilled water, and the cell suspension was centrifuged for another 5 min at 5,000 rpm. further cell pellet was mixed with 300 ml of 25% alcoholic koh solution and vortexed for 1 min, and the suspension was saponified for 3 h at 90c in a reflux. after cooling them to room temperature, nonsaponified sterols were extracted by adding 300 ml heptane followed by vortexing for 2 min. a vortex mixture of 10 ml heptane and 10 ml of alcoholic koh solution is used as blank. after clarification of heptane layer 0.5 ml of heptane from both sample and blank was diluted tenfolds with 4.5 ml absolute ethanol. the absorbance of all samples were read against blank at 230 and 281.5 nm, respectively [14, 28 ]. the ergosterol content was calculated as milligram ergosterol per gram dry weight using the following equation : (1)ergosterol=% ergosterols%24 (28)-dehydroergosterolergosterol (mggdw)=(od281.5290od230580)f, where f is a correction factor for dilutions and sample sizes, and 290 and 580 are e of crystalline ergosterol and 24 (28)-dehydroergosterol, respectively. hundred milliliter medium was prepared with the following composition (g / l) : galactose, 20 ; kh2po4, 14.4 ; (nh4)2so4, 7.5 ; mgso4 7h2o, 0.5 ; trace metal solution, 2 ; and vitamin solution, 1 ml and 50 l / l silicone antifoam. the ph was adjusted to 6.20 using 1 m naoh and autoclaved separately from the carbon source solution. variou concentrations of methionine (03 mm) were used to know the minimal methionine concentration for the repression of erg9 expression. flasks were further incubated in a shaking incubator (remi, india) at 30c with 150 rpm. batch fermentation was carried out in a controlled bioreactor (spectrochem, india) containing 2 l mineral medium that consists of (g / l) galactose 20 ; (nh4)2so4, 5 ; kh2po4, 3 ; mgso47h2o, 0.5 ; edta, 0.015 ; znso47h2o, 0.0045 ; coc126h2o, 0.0003 ; mnc12 4h2o, 0.001 ; cuso4 5h2o, 0.0003 ; cac122h2o, 0.0000045 ; feso47h2o, 0.0003 ; namoo4,2h2o, 0.0004 ; h3bo3, 0.001 ; ki, 0.0001 ; and 0.025 ml silicone antifoam (merck). further filter sterilized vitamin solution containing (mg / l) : biotin, 0.05 ; calcium pantothenate, 1 ; nicotinic acid, 1 ; inositol, 25 ; thiamine hcl, 1 ; pyridoxine hcl, 1 ; and para - aminobenzoic acid, 0.2 was added to the autoclaved mineral medium. finally, media were supplemented with 2 mm filter sterilized methionine. during the fermentation process, the temperature was kept constant at 30 2c, and dissolved oxygen tension (50%) was maintained with sterilized air (0.2 filter) with airflow 1 l / min and with 250 rpm agitation and the off - gas passed through a outlet port. ph was controlled between 6.20 0.5 by automatic addition of 1 m naoh and 1 m hcl. after cells reaching 1 at od600 20% (vol / vol) isopropyl myristate (merck millipore, germany) was added aseptically to the media. this isopropyl myristate layer was sampled and diluted with ethylacetate for determination of amorphadiene concentration by gas chromatography coupled mass spectrometry (gc - ms) (agilent technologies, usa). amorpha-4,11-diene and farnesol were analysed by gas chromatography with flame - ionization detector (gc / fid). samples from fermentor were centrifuged at 5000 rpm for 5 min, diluted directly into ethyl acetate, and mixed for 30 min on a vortex mixer. after phase separation 0.6 ml of the ethyl acetate, layer was transferred to a capped vial for analysis. a 1 l sample was split 1 : 20 and separated using a db - wax column (50 m 200 m 0.2 m) with hydrogen as the carrier gas with flow rate of 1.57 ml / min. the column was initially held at 150c for 3.0 min, followed by a temperature gradient of 5c per min to a temperature of 250c. amorpha-4,11-diene and farnesol peak areas were converted to concentration values from external standard calibrations using authentic compounds. different yeast strains carrying the plasmids pads, pfpps, pfpps - ads, and pads - fpps were grown in appropriate sd drop out media at 37c. after cells optical density values were reaching 2.5 at od600, they were harvested and centrifuged at 5000 rpm for 5 min, and cell pellet was resuspended in 10 ml distilled water, and proteins were extracted according to cellytic y plus kit (sigma, usa). purification was carried out in a single step using immobilized metal affinity chromatography (imac). the supernatant was applied to a 5 ml nickel cl - agarose column (merck biosciences, india), loaded with nickel. elution of adsorbed recombinant proteins was achieved with elution buffer (merck biosciences, india). sds / page was carried out in 10% resolving and 5% stacking gels according to instructions given by the manufacturer (merck biosciences, india) and the samples along with protein marker were loaded on mini - protean tetra cell (bio - rad, usa). gel, visualized and analyzed in gel doc fire reader documentation system (merck biosciences, india). the minimum concentration of methionine for expression of erg9 was determined by growing the erg9 repressed yeast cells in shake flasks supplemented with varying quantities of methionine (figure 2). when yeast cells grown in the absence of methionine, cells propagated exponentially up to 10 h and followed by a slight drop in the growth and immediately after 12 h cells followed exponential phase up to 20 h. the methionine concentration at 1 mm elongated the lag phase and a lower final biomass concentration. there was a drastic decrease in the growth of the yeast beyond 2.5 mm methionine concentration, and the consequences were observed by measuring the ergosterol content (table 3). the final ergosterol content of control yeast strain (mtcc 3157) was observed at 19.25 mg / g dw, and strain ycf-005 was given varied quantities of ergosterol at 0, 1, 2, 2.5, and 3 mm methionine as 19.22, 14.05, 13.98, and 13.75 and 3.31 mg / g dw, respectively (table 3). transformed yeast strains harbouring amorphadiene synthase (ads) was able to produce amorpha,4 - 11-diene (figure 3). strain ycf-005 analyzed for amorphadiene production by gc - ms as mentioned in materials and methods. analysis of gc - ms for ethyl acetate extracts revealed the presence of amorphadiene major peak and other sesquiterpene as a minor peak (figure 3(b)). retention time, mass spectrum of main component (19.75 and 14.21 min) were almost matching with standard (19.70 and 14.18 min) (figures 3(a), 3(c), and 3(d)). l of amorphadiene, which was approximately 2-fold higher than ad (5.65 mg / l) produced by ycf - ad respectively (figure 4). fpp conversion to farnesol in the strain ycf-004 was limited by expressing the fusion protein in yeast and to probe the effect of enzyme fusion on diversion of the flux more efficiently towards amorphadiene production. different strains expressing the native proteins and chimeric proteins ads, fpps - ads, and ads - fpps were analyzed. the strain transformed with the plasmid expressing ads - fpps produced amorphadiene (12.08 mg / l) at the same level as that for the strain expressing free ads (figure 4). more interestingly, the strain transformed with the plasmid expressing fpps - ads produced amorphadiene at an almost 2-fold higher level (25.06 mg / l) than that for the strain expressing free fpps and ads (figure 4). on sds - page the four proteins were compared across the protein molecular marker (figure 5). both fused proteins fpps - ads and ads - fpps molecular weights were approximately 105 kd which was almost equal to the sum of two individual proteins (fpps 40 kd and 63 kd). in the present study, we have improved the amorphadiene production by 4-fold in the yeast s. cerevisiae (mtcc 3157). in order to decrease the fpp flux towards ergosterol and competitive pathways, erg9 promoter was replaced with repressible methionine (met3) promoter, and strain ycf-005 growth rate was very low at 3.0 mm methionine concentration, due to low ergosterol production. the ergosterol content of the erg9 repressed strain was quite low compared with control strain (mtcc 3157). increasing concentration of methionine repressed the yeast strain and produced varied quantities of ergosterol (table 3) upon increasing methionine, there was a tight regulation of the promoter. farnesol accumulation observed in earlier studies with deletion and inhibition of erg9 gene [3032 ]. moreover farnesol at low concentration inhibits the growth of the cells by cell cycle arrest in some yeast cells. we observed that strain ycf-001 produced 12.03 mg / g dw of farnesol and final concentration 24.12 mg / l and disclosed the possibility of pooling the available fpp towards amorphadiene by enzyme fusion technology. as mentioned in earlier studies, a discrepancy of methionine was not sufficient to repress erg9 during fermentation and 2.5 mm methionine was maintained during fermentation. we used isopropyl myristate as a solvent for trapping the volatile compounds and for phase separation, and that phase was analyzed for determination amorphadiene by gc - ms. analysis of ethyl acetate extracts revealed the capability of yeast strains carrying ads gene for production of amorphadiene. the major peak in the chromatogram confirmed as a amorphadiene and other minor peak as a farnesol with corresponding standards (figures 3(a) and 3(b)) [34, 35 ]. erg9 (ycf-002) repression improved the amorphadiene production by increasing the fpp availability when compared with amorphadiene production in strain ycf - ad. strains ycf - ad and ycf-002 were cultured in the fermentor and analyzed for amorphadiene and farnesol. strain ycf - ad produced 5.65 mg / l of amorphadiene and 4.12 mg / l farnesol, as there was a 2-fold (11.02 mg / l) rise in amorphadiene production in strain ycf-002 (figure 4). to overcome the natural loss of the metabolic intermediate fpp and its conversion towards farnesol, a chimeric protein with small gly - ser - gly linker was constructed as ads - fpps and fpps - ads. l of amorphadiene which was almost close to amorphadiene produced by strain ycf-002 as ycf-005 produced 25.06 mg / l of amorphadiene and which was 2-fold higher than than the ycf-002 and subsequently 5-fold higher than ycf-001 (figure 4). strains (ycf-005) expressing fpps - ads do not produce higher amorphadiene yields compared with strains ycf-005 and ycf-002 as the active sites were likely far apart to produce a beneficial proximity effect. the fusion phenomenon of the enzyme further confirmed by isolation and purification of fpps, ads, ads - fpps, and fpps - ads enzymes with sds - page and fused proteins molecular weights (105 kd) were almost equal to the sum of the individual enzymes ads (63 kd) and fpps (40 kd) (figure 5). enzyme fusion technology will be an additive step to the metabolic engineering, and combination of metabolic engineering and enzyme fusion technology improves the flux of the intermediate metabolites in order to expand the heterologous components production. further combinatorial expression of thmgr and upregulation of upc2 alleles with fusion technology accelerate the amorphadiene production. further channeling acetyl - coa into the mevalonate pathway will make it possible to further increase the fpp production which is having tremendous significance in chemical industry as well as in medicine. | the yeast strain (saccharomyces cerevisiae) mtcc 3157 was selected for combinatorial biosynthesis of plant sesquiterpene amorpha-4,11-diene. our main objective was to overproduce amorpha 4 - 11-diene, which is a key precursor molecule of artemisinin (antimalarial drug) produced naturally in plant artemisia annua through mevalonate pathway. farnesyl diphosphate (fpp) is a common intermediate metabolite of a variety of compounds in the mevalonate pathway of yeast and leads to the production of ergosterols, dolichol and ubiquinone, and so forth. in our studies, fpp converted to amorphadiene (ad) by expressing heterologous amorphadiene synthase (ads) in yeast. first, erg9 (squalane synthase) promoter of yeast was replaced with repressible methionine (met3) promoter by using bipartite gene fusion method. further to overcome the loss of the intermediate fpp through competitive pathways in yeast, fusion protein technology was adopted and farnesyldiphosphate synthase (fpps) of yeast has been coupled with amorphadiene synthase (ads) of plant origin (artemisia annua l.) where amorphadiene production was improved by 2-fold (11.2 mg / l) and 4-fold (25.02 mg / l) in yeast strains ycf-002 and ycf-005 compared with control strain ycf - ad (5.5 mg / l), respectively. |
the annual costs of major depressive disorder (mdd) are estimated at 83.1 billion dollars in the united states, with nearly two thirds of this cost arising from functional disability. the costs of mdd are high in part because it takes so long for patients to recover from the illness. current treatment guidelines recommend that an initial treatment be tried for long enough a period to determine how much it will benefit a patient. on average, at least 4 weeks are needed to attain response, and 6 weeks to attain remission during treatment with an initial selective serotonin reuptake inhibitor (ssri) antidepressant, but remission can take 12 weeks or longer. because most patients fail to enter remission with the first antidepressant prescribed, they then commonly enter a period of serial trial - and - error, using switches in or combinations of medications and typically taking 1 year or more to hit upon a successful treatment [6, 7 ]. it is not surprising that using this hit - or - miss approach, 26% of those who fail to improve with the first treatment simply stop taking medication, frequently within the first 2 weeks, and up to 42% of patients discontinue medication within the first 30 days. all medications are thought of as equally effective, but clinicians have sought to personalize selection by targeting groups of patients with specific symptoms with medications that have different putative mechanisms of action (moas) (eg, ssris vs serotonin - norepinephrine reuptake inhibitors vs bupropion). although some data suggest that subsets of patients may be more likely to benefit from medications with particular moas, the number needed to treat (nnt) to see such differences can be so large (nnt = 27) that the value is questionable. moa is more routinely considered in clinical decision making for second - line treatment (ie, after a patient fails to benefit from initial ssri monotherapy). the sequenced treatment alternatives to relieve depression (stard) study examined medications with differing moas either singly or in combination after patients failed to respond to an initial ssri [4, 11 ]. the results from this second level of treatment showed numeric superiority for switching to medications with a different moa and slightly more so for combining treatments with different moas, although none of these differences reached statistical significance [11, 12 ]. the field is thus left with no clear evidence base about how to choose among existing medications to maximize benefit for the individual patient. some have argued that existing monotherapies are inherently inadequate and that the central challenge is to develop treatments for mdd with fewer side effects and more rapid onset of action. we need treatment paradigms for mdd that reliably match patients with the right treatment either before or early in the course of treatment to retain the patient in treatment, minimize disability and suffering, avoid treatment - emergent adverse events such as worsening suicidal ideation, and prevent the development of negative attitudes and expectations that may perpetuate poor outcome. this is the impetus for developing a personalized medicine approach based on biomarkers that could predict the likelihood of success with any given treatment. clinical care would be greatly improved if we had reliable clinical predictors of treatment outcome. most patients who are going to benefit from our current medications start to experience some improvement within the first 2 weeks of treatment, but early symptom improvement is a nonspecific predictor of benefit. most early physiologic biomarkers, such as plasma hormone levels or changes in blood pressure during treatment, lacked sensitivity and specificity as predictors. nevertheless, physiologic biomarkers could, in theory, speed recovery from mdd by matching patients with the treatment most likely to be effective for them as a result of their neurobiologic characteristics. we review here the literature supporting the use of different types of biomarkers before or during treatment to direct selection of an initial or second - line treatment in mdd. the ideal biomarker is measurable at diagnosis to assist in selection of the first treatment. however, pretreatment predictors thus far have identified indicators only of general prognosis, not which specific treatment is likely to benefit a particular patient. while some potential biomarkers (eg, genotype) presumably are stable over time, other biomarkers (eg, measures of gene expression or brain function) may emerge only during treatment [2, 15 ]. for this reason, much research now is aimed at identifying biomarkers that emerge early in the course of treatment and may indicate whether the medication that the patient is receiving is likely to lead to remission [16, 17 ]. to the extent that such biomarkers are determined by genetic factors and emerge reliably in response to a particular treatment treatment - emergent biomarkers are not helpful with the initial treatment selection ; nevertheless, if a biomarker can be used to change an ineffective treatment to another that is more likely to be effective within a few weeks of treatment initiation, this could still shorten the duration and lower the number of ineffective antidepressant treatment trials. first, the measurement of biomarkers within patients likely enhances stability, statistical reliability, and therefore predictive accuracy of the biomarker. second, the measurement of biomarkers in response to newly administered treatments may help overcome confounds inherent in pretreatment, cross - sectional measures (eg, number and severity of prior episodes, the current phase of illness), and the extent and types of prior and current treatment. examination of dynamic measures during the current treatment may detect features common across individuals responding to that treatment, regardless of confounding factors. the literature offers limited guidance as to when in the course of treatment such treatment - emergent biomarkers should be measured. for quantitative electroencephalographic (qeeg) measures, it seems that changes in the first week of treatment are predictive [16, 17 ]. for changes in gene expression or brain - derived neurotrophic factor (bdnf) levels, however, the most reliable data are for pre- to post - treatment changes, and the question of how early in treatment changes that might be predictive of outcome could be detected remains unclear. it is important to note that difficulty in identifying practical biomarkers is not unique to the treatment of depression. although there are successful biomarkers for disease processes (eg, elevated thyroid - stimulating hormone in hypothyroidism), relatively few biomarkers in clinical medicine are useful for choosing a particular medication treatment. the challenges are particularly great for identifying biomarkers for brain diseases because of the relative inaccessibility of the brain and limited understanding of the basis of basic pathophysiology of disease. at the present time, no biomarkers have sufficiently proven utility to be ready for clinical application recent meta - analyses of structural neuroimaging studies indicate that depressed patients have reduced gray matter in multiple areas, including the anterior cingulate cortex (acc), subgenual cingulate cortex, and hippocampus. the most robust evidence is for the hippocampus, for which larger volumes predicted better response after 8 weeks of pharmacotherapy in two separate samples [22, 23 ]. furthermore, in a prospective study, smaller hippocampal volumes were predictive of clinical outcome 3 years later. in another prospective study, larger hippocampal volume was associated with a lower probability of relapse in men at a 2-year follow - up. the predictive utility of structural data is not limited to the hippocampus, as gray matter density in the acc and posterior cingulate cortex was also predictive of clinical remission following 8 weeks of fluoxetine treatment. notably, of the studies cited above, only one group has examined the relationship between treatment and brain structure directly by longitudinal assessment. studies also have been limited by small sample sizes, measurement approaches that used manual delineation of the hippocampus / amygdala, or whole brain voxel - based morphometry methods sensitive to registration and partial volume confounds. the structural integrity of the fiber tracts between neural areas affected in depression is another source of information that may facilitate prediction of treatment response. although the application of diffusion tensor imaging to the study of depression in adulthood is relatively novel, evidence from studies of individuals with late - life depression indicates that this imaging technique, which tracks the diffusion properties of water through brain tissue in vivo, has predictive potential for delineating treatment responders. for example, nonresponders to 12 weeks of citalopram or escitalopram treatment showed a greater prevalence of microstructural abnormalities in white matter pathways connecting the cortex with limbic and paralimbic areas such as the anterior cingulate, as estimated using regions - of - interest and voxel - based analysis approaches. these abnormalities may be associated with poorer outcome because they impair mood regulatory interactions between prefrontal and limbic areas. the integrity of these corticolimbic pathways is adversely impacted by adverse life events as well as genetic polymorphisms (eg, 5-httlpr). although diffusion tensor imaging metrics of fiber integrity may constitute a useful predictor of treatment outcome, there are insufficient data to assess its usefulness. prior studies also have been limited to measuring scalar metrics such as fractional anisotropy, which reflects the extent to which diffusion is directionally restricted in a voxel in arbitrarily delineated white matter regions. furthermore, the automated voxel - based approaches that have been used at times, while convenient for exploratory analysis, are susceptible to registration confounds that may contribute to regional discrepancies in findings. no study to date has incorporated more refined tractography measurement approaches to better determine whether the structural connectivity of specific white matter tracts predicts treatment response. although considerable data link brain structural measurements to treatment outcome, these measures seem to be primarily indicators of general prognosis. although they may indicate the likelihood that a patient will recover, regardless of the treatment selected, they have not been examined for their usefulness in selecting a particular option from a set of potential treatments for individual patients. as an alternative to assessing the structural integrity of brain areas and networks associated with treatment outcome, assessing the functional properties of these circuits may provide a more complete picture of a patient s biological state before treatment. two types of functional mri data have demonstrated the most promise as biomarkers of treatment outcome : 1) intrinsic connectivity analyses performed while the patient is resting in the scanner with eyes closed ; and 2) task - related activations, specifically the viewing of negative emotional facial expressions. the functional connectivity between regions can be assessed by measuring spontaneous low - frequency (typically 0.010.1 hz) fluctuations in resting state blood oxygen level - dependent signal, which are phase locked between areas. the correlation in these fluctuations between cortical and limbic areas therefore serves as a functional connectivity measure that reflects functioning in these mood - regulating pathways. anand and colleagues were the first to use this technique to show that corticolimbic connectivity is decreased in depression. anand and colleagues also showed that corticolimbic connectivity increased as scores on the hamilton depression rating scale decreased during treatment, suggesting that assessment of resting state corticolimbic connectivity could be useful for predicting antidepressant treatment response. an additional method of assessing function within the neural circuitry for emotional processing is reactivity to the processing of negative facial expressions. when viewing negative facial expressions, depressed patients show exaggerated changes in activity in the limbic system, particularly the amygdala, in comparison with healthy controls. studies that have used baseline neural reactivity to emotional facial expressions as a predictor of treatment response generally have been underpowered, but encouraging signs indicate that this task [36, 37 ] and analogous tasks may be of utility for prediction. increased reactivity seems to normalize after successful antidepressant pharmacotherapy [39, 40 ] and cognitive - behavioral therapy, and may be a sufficiently consistent finding to be of eventual clinical utility. when viewing negative emotional faces, depressed patients have greater amygdala activation but also reduced coactivation of the dorsal anterior cingulate and increased coactivation in the subgenual cingulate. in a treatment study, 8 weeks of fluoxetine administration ameliorated the deficient connections between the amygdala and anterior cingulate. these changes in task - related reactivity are complementary to differences between treatment responders and nonresponders in resting state connectivity within corticolimbic circuits. fluorodeoxyglucose positron emission tomography (pet) scanning has shown some promise as a predictor of response to medication. the number of studies indicating some predictive value for fluorodeoxyglucose pet is encouraging, although results have been inconsistent and confounded by relatively small sample sizes and heterogeneity in treatment techniques, as well as in imaging methods. pet imaging with the serotonin transporter ligand [(11)c]-3-amino-4-(2-dimethylaminomethylphenylsulfanyl)-benzonitrile ], or dasb, which binds to the serotonin transporter, has not been shown to predict treatment response in mdd, although patients with depression have low dasb binding potential [46, 47 ]. dasb binding potential also is associated with the ht2a single - nucleotide polymorphism (snp) that has been associated with ssri treatment response in some studies, suggesting that this technique may be worthy of further study. qeeg signals are generated by assemblages of neurons in the cortex and deeper structures and as such provide a global measure of brain function. responders to medication differ from nonresponders in qeeg power, either in the resting state or during simple tasks. three complementary measures of brain electrical activity have shown significant promise for predicting treatment response : cordance, low - resolution brain electromagnetic tomography (loreta), and the antidepressant treatment response (atr) index. cordance is a qeeg power measure (calculated from a full scalp electrode array) that is more strongly associated with perfusion of cerebral cortex underlying each electrode than other power measures [51, 52 ]. cordance accurately characterizes brain function on the cortical convexities (eg, dorsolateral prefrontal cortex) and has demonstrated usefulness for characterizing medication response [5360 ]. loreta extends the topographic capabilities of qeeg, enabling characterization of brain activity not only on the cortical convexities but also in deeper specific cortical areas (eg, the acc and medial orbitofrontal cortex). while cordance may in fact reflect activity of areas such as the acc that is projected to the surface, loreta permits attribution of electrical activity to specific deeper structures. cordance and loreta require whole - head electrode montages to collect data, which provide a view of function over all cortical regions ; therefore, these techniques are well - suited to exploration of brain function. they share the disadvantage of requiring up to 75 min to record in a qeeg laboratory facility. the atr index is a biomarker optimized to predict medication response that is calculated from data collected from a five - electrode montage tightly focused on the frontal regions of the brain, and can be recorded in only 10 min in a general office - based setting [16, 17 ]. most studies of brain functional biomarkers are of small size and therefore are inadequate to fully assess the utility of the biomarkers. one of the largest studies performed, which examined atr, is the national multisite study biomarkers for the rapid identification of treatment effectiveness in major depression (brite - md), which evaluated neurophysiologic and genomic predictors of response and remission in mdd. brite - md enrolled 375 mdd patients and collected comprehensive clinical, neurophysiologic, and genomic data. brite - md developed one of the only predictors of differential response to two antidepressants with different putative moas (escitalopram and bupropion) using the atr index as a dichotomous predictor [16, 17 ]. a positive atr biomarker predicted response and remission to escitalopram with 74% overall accuracy, and those with a positive atr were more than 2.4 times as likely to respond to escitalopram as those with a negative atr (68% vs 28% ; p conversely, those with a negative atr who were switched to bupropion treatment were 1.9 times as likely to respond to bupropion alone as those who remained on escitalopram treatment (53% vs 28% ; p 1logistic regression model of escitalopram and bupropion responders stratified by antidepressant treatment response (atr) index values. atr values are shown for patients randomly assigned to each treatment and who responded to escitalopram or bupropion treatment. patients who responded to escitalopram tended to have higher atr values, and those who responded to bupropion tended to have lower atr values. markers represent observed values, and lines represent modeled valuesfig. 2logistic regression model of escitalopram and bupropion remitters stratified by antidepressant treatment response (atr) index values. atr values are shown for patients randomly assigned to each treatment and who remitted with escitalopram or bupropion treatment. patients who remitted with escitalopram tended to have higher atr values, and those who remitted with bupropion tended to have lower atr values. markers represent observed values, and lines represent modeled values logistic regression model of escitalopram and bupropion responders stratified by antidepressant treatment response (atr) index values. atr values are shown for patients randomly assigned to each treatment and who responded to escitalopram or bupropion treatment. patients who responded to escitalopram tended to have higher atr values, and those who responded to bupropion tended to have lower atr values. markers represent observed values, and lines represent modeled values logistic regression model of escitalopram and bupropion remitters stratified by antidepressant treatment response (atr) index values. atr values are shown for patients randomly assigned to each treatment and who remitted with escitalopram or bupropion treatment. patients who remitted with escitalopram tended to have higher atr values, and those who remitted with bupropion tended to have lower atr values. markers represent observed values, and lines represent modeled values critically, this is one of the only instances in which a biomarker has predicted differential response to two antidepressant medications with distinct moas. the nnt to see a benefit from the use of the atr index based on these results is 10 to 11, which is within the range proposed for a clinically useful measure [2, 17 ]. however, these results must be interpreted with the caveat that treatment was not assigned prospectively on the basis of atr index values. it is encouraging that another group independently replicated these findings in a naturalistic study with antidepressants selected by clinician choice. these results are encouraging and warrant further exploration of these two medications with distinct moas using a wider range of biomarkers. pharmacogenetic investigations postulate that responsiveness to or tolerability of treatment may be influenced by inherited factors. several observational studies suggest an inherited basis for antidepressant treatment outcomes. despite evidence that pharmacokinetic factors under genetic control are correlated with response and toxicity to tricyclic antidepressants, there has been little evidence to suggest that this is the case with response to or tolerance of the ssris. the current widespread use of ssris in treatment of depression has resulted in a large body of literature on ssri pharmacogenetics. most of these studies focus on candidate genes related to monoamine function, including the serotonin transporter (the molecular target for ssris), tryptophan hydroxylase-1, monoamine oxidase a, and the type 2a serotonin receptor. these studies have demonstrated only a few associations with treatment response, most of which have not been consistent. several large genome - wide association studies (gwas) used the stard pharmacogenetic sample. because the findings have been extensively reviewed previously [66, 67 ], only the most prominent findings are highlighted here. in an analysis of 763 snps in 68 candidate genes, a single snp in the type 2a serotonin receptor several research teams have specifically addressed the association between citalopram treatment response and genetic variation in the serotonin transporter using the stard sample [6870 ]. most showed no association to measures of efficacy, while one showed modest association for a particular haplotype in only a subset of the stard sample. taken together, these studies suggest an overall lack of association between this most obvious of candidate genes and citalopram response. a recent gwas of drug response, made up of 700 german inpatients from two cohorts treated with a variety of drugs, found that no snp was significant at a genome - wide level using results from individual (n = 339) or pooled (n = 361) genotyping. a set of 328 snps was carried forward and genotyped in 832 caucasians from stard for replication. while 46 snps showed p values < 0.05, none withstood multiple - test correction. garriock and colleagues [72 ] performed comprehensive gwas on the stard sample for response and remission phenotypes and identified 41 and 39 snps with principal components ancestry - adjusted p < 0.0001 in remission and response phenotypes, respectively. they found modest levels of association, although nothing at the proclaimed genome - wide significance level (p < 5 10). the strongest finding for response and remission occurred 51 kb upstream of the gene ube3c (p = 3.63 10 ; additive or, 1.68), which encodes ubiquitin protein ligase e3c, a gene found to be significantly downregulated in a stress - induced manner in primates in the adult ventromedial prefrontal cortex. more recently, 706 european individuals treated with escitalopram or nortriptyline underwent gwas, with the strongest finding in the combined sample localizing to a duplicated region of chromosome 1 (p = 3.82 10). the authors carried out drug - specific analyses and reported a genome - wide significant finding for nortriptyline - treated individuals (p = 3.56 10) within the uronyl-2-sulfotransferase gene, while they found a suggestive finding in the coding region of the interleukin-11 gene (p = 2.83 10) for escitalopram - treated individuals. there is little overlap among the three gwas, suggesting prominent heterogeneity between studies and low power within any single study. the lack of strong, clear, and consistent associations between genetic polymorphisms and treatment response is in some ways not surprising ; depression is a complex and heterogeneous disorder, and multiple additive genetic factors are likely to be associated with response. these reports do not offer a comprehensive assessment of the role of variation across the genome or of the potential for multiple additive effects [72 ]. gene expression analysis in neuropsychiatric disorders has been challenging due to the relative inaccessibility of brain tissue. direct assessment of postmortem brain samples from individuals with mdd has indicated some differences in gene expression that are correlated with disease state. these studies indicate detectable differential gene expression in at least subregions of the central nervous system. to assess expression in living humans, these studies have been extended to the assessment of gene expression via analysis of mrna from circulating mononuclear cells in whole blood [75, 76 ]. support for the analysis of gene expression in peripheral blood comes from the assessment of inter- and intraindividual differences in primate blood and brain. it was recently demonstrated that interindividual gene expression differences can be conserved in primate brains and primate peripheral blood, extending the general model for how blood sampling provides useful information on interindividual expression differences in brain subregions. limited small studies have demonstrated gene expression changes from leukocyte mrna in response to antidepressant or lithium treatment in patients with mdd or bipolar disorder. in some small studies, antidepressant treatment tended to normalize gene expression patterns, and the degree of normalization was proportional to the degree of symptom improvement [75, 78, 79 ]. these data suggest that peripheral expression signatures may be relevant to mdd and that the disease state is reflected in expression changes in the leukocyte transcriptome. however, sample sizes have been limited ; therefore, information about the reliability of these findings for predicting treatment response is unknown. rich sets of data have been generated, however, to study gene expression as quantitative traits controlled by specific dna variants in mice, humans, and other species. these data demonstrate strongly that cis - regulatory dna variants control the basal level of gene expression in a variety of tissues, including blood, and contribute to the neurologic phenotypes in the mouse. these expression quantitative trait loci are a powerful resource for complex disease gene mapping, as recently reviewed by cookson.. the promise of this technique suggests it should be pursued for development of possible biomarkers in the future. proteomic and metabolomic biomarkers of treatment response in mdd remain in very early stages of development, and none have demonstrated reliability for predicting treatment response. these potential biomarkers are attractive for further research, however, because of the relatively constrained space of biomarker targets. cerebrospinal fluid might be considered as the source most closely reflective of brain activity, but it is not easily accessible on a routine, risk - free basis that is likely to be acceptable to patients. urine, although perhaps the most easily collected in humans, is furthest removed from brain function, and the degree to which saliva is reflective of brain function is uncertain given the present state of the field. thus, plasma appears to be the rational source for proteomic and metabolomic measurements because it is easily accessible, and many small molecules from the brain reach the circulation en route to excretion ; several also are exchanged or transported across the blood brain barrier. proteomic investigations in mdd mostly have been performed on cerebrospinal fluid and specific brain regions collected at autopsy. furthermore, no clinical study has been directed at identifying protein signatures related to different treatments and responses in mdd. metabolomic reports, although limited, highlight the opportunities that metabolomic investigations have for research on mdd. mass spectrometry profiles of plasma extracts from depressed, remitted, and never - depressed older adults, revealing differences in levels of several fatty acids, glycerol, and -aminobutyric acid. focused investigations of one or a few metabolites in bipolar disorder and mdd have drawn attention to the role of neurotransmitter abnormalities (norepinephrine, dopamine, serotonin, -aminobutyric acid, glutamate / glutamine) and lipids, including arachidonic and other fatty acids. of all serum protein measures, bdnf is the most clearly implicated in the pathogenesis and treatment of mdd. the origins of serum bdnf are unclear, and in animal models, it does cross the blood brain barrier. there is strong evidence of low serum bdnf in unmedicated mdd patients and recovery of serum bdnf levels after antidepressant therapy, including in a large meta - analysis. these findings suggest that bdnf has the potential to be a biomarker of treatment response, although only a few studies have explored changes during treatment in humans [8789 ]. recent meta - analyses of structural neuroimaging studies indicate that depressed patients have reduced gray matter in multiple areas, including the anterior cingulate cortex (acc), subgenual cingulate cortex, and hippocampus. the most robust evidence is for the hippocampus, for which larger volumes predicted better response after 8 weeks of pharmacotherapy in two separate samples [22, 23 ]. furthermore, in a prospective study, smaller hippocampal volumes were predictive of clinical outcome 3 years later. in another prospective study, larger hippocampal volume was associated with a lower probability of relapse in men at a 2-year follow - up. the predictive utility of structural data is not limited to the hippocampus, as gray matter density in the acc and posterior cingulate cortex was also predictive of clinical remission following 8 weeks of fluoxetine treatment. notably, of the studies cited above, only one group has examined the relationship between treatment and brain structure directly by longitudinal assessment. studies also have been limited by small sample sizes, measurement approaches that used manual delineation of the hippocampus / amygdala, or whole brain voxel - based morphometry methods sensitive to registration and partial volume confounds. the structural integrity of the fiber tracts between neural areas affected in depression is another source of information that may facilitate prediction of treatment response. although the application of diffusion tensor imaging to the study of depression in adulthood is relatively novel, evidence from studies of individuals with late - life depression indicates that this imaging technique, which tracks the diffusion properties of water through brain tissue in vivo, has predictive potential for delineating treatment responders. for example, nonresponders to 12 weeks of citalopram or escitalopram treatment showed a greater prevalence of microstructural abnormalities in white matter pathways connecting the cortex with limbic and paralimbic areas such as the anterior cingulate, as estimated using regions - of - interest and voxel - based analysis approaches. these abnormalities may be associated with poorer outcome because they impair mood regulatory interactions between prefrontal and limbic areas. the integrity of these corticolimbic pathways is adversely impacted by adverse life events as well as genetic polymorphisms (eg, 5-httlpr). although diffusion tensor imaging metrics of fiber integrity may constitute a useful predictor of treatment outcome, there are insufficient data to assess its usefulness. prior studies also have been limited to measuring scalar metrics such as fractional anisotropy, which reflects the extent to which diffusion is directionally restricted in a voxel in arbitrarily delineated white matter regions. furthermore, the automated voxel - based approaches that have been used at times, while convenient for exploratory analysis, are susceptible to registration confounds that may contribute to regional discrepancies in findings. no study to date has incorporated more refined tractography measurement approaches to better determine whether the structural connectivity of specific white matter tracts predicts treatment response. although considerable data link brain structural measurements to treatment outcome, these measures seem to be primarily indicators of general prognosis. although they may indicate the likelihood that a patient will recover, regardless of the treatment selected, they have not been examined for their usefulness in selecting a particular option from a set of potential treatments for individual patients. as an alternative to assessing the structural integrity of brain areas and networks associated with treatment outcome, assessing the functional properties of these circuits may provide a more complete picture of a patient s biological state before treatment. two types of functional mri data have demonstrated the most promise as biomarkers of treatment outcome : 1) intrinsic connectivity analyses performed while the patient is resting in the scanner with eyes closed ; and 2) task - related activations, specifically the viewing of negative emotional facial expressions. the functional connectivity between regions can be assessed by measuring spontaneous low - frequency (typically 0.010.1 hz) fluctuations in resting state blood oxygen level - dependent signal, which are phase locked between areas. the correlation in these fluctuations between cortical and limbic areas therefore serves as a functional connectivity measure that reflects functioning in these mood - regulating pathways. anand and colleagues were the first to use this technique to show that corticolimbic connectivity is decreased in depression. anand and colleagues also showed that corticolimbic connectivity increased as scores on the hamilton depression rating scale decreased during treatment, suggesting that assessment of resting state corticolimbic connectivity could be useful for predicting antidepressant treatment response. an additional method of assessing function within the neural circuitry for emotional processing is reactivity to the processing of negative facial expressions. when viewing negative facial expressions, depressed patients show exaggerated changes in activity in the limbic system, particularly the amygdala, in comparison with healthy controls. studies that have used baseline neural reactivity to emotional facial expressions as a predictor of treatment response generally have been underpowered, but encouraging signs indicate that this task [36, 37 ] and analogous tasks may be of utility for prediction. increased reactivity seems to normalize after successful antidepressant pharmacotherapy [39, 40 ] and cognitive - behavioral therapy, and may be a sufficiently consistent finding to be of eventual clinical utility. when viewing negative emotional faces, depressed patients have greater amygdala activation but also reduced coactivation of the dorsal anterior cingulate and increased coactivation in the subgenual cingulate. in a treatment study, 8 weeks of fluoxetine administration ameliorated the deficient connections between the amygdala and anterior cingulate. these changes in task - related reactivity are complementary to differences between treatment responders and nonresponders in resting state connectivity within corticolimbic circuits. fluorodeoxyglucose positron emission tomography (pet) scanning has shown some promise as a predictor of response to medication. the number of studies indicating some predictive value for fluorodeoxyglucose pet is encouraging, although results have been inconsistent and confounded by relatively small sample sizes and heterogeneity in treatment techniques, as well as in imaging methods. pet imaging with the serotonin transporter ligand [(11)c]-3-amino-4-(2-dimethylaminomethylphenylsulfanyl)-benzonitrile ], or dasb, which binds to the serotonin transporter, has not been shown to predict treatment response in mdd, although patients with depression have low dasb binding potential [46, 47 ]. dasb binding potential also is associated with the ht2a single - nucleotide polymorphism (snp) that has been associated with ssri treatment response in some studies, suggesting that this technique may be worthy of further study. qeeg signals are generated by assemblages of neurons in the cortex and deeper structures and as such provide a global measure of brain function. responders to medication differ from nonresponders in qeeg power, either in the resting state or during simple tasks. three complementary measures of brain electrical activity have shown significant promise for predicting treatment response : cordance, low - resolution brain electromagnetic tomography (loreta), and the antidepressant treatment response (atr) index. cordance is a qeeg power measure (calculated from a full scalp electrode array) that is more strongly associated with perfusion of cerebral cortex underlying each electrode than other power measures [51, 52 ]. cordance accurately characterizes brain function on the cortical convexities (eg, dorsolateral prefrontal cortex) and has demonstrated usefulness for characterizing medication response [5360 ]. loreta extends the topographic capabilities of qeeg, enabling characterization of brain activity not only on the cortical convexities but also in deeper specific cortical areas (eg, the acc and medial orbitofrontal cortex). while cordance may in fact reflect activity of areas such as the acc that is projected to the surface, loreta permits attribution of electrical activity to specific deeper structures. cordance and loreta require whole - head electrode montages to collect data, which provide a view of function over all cortical regions ; therefore, these techniques are well - suited to exploration of brain function. they share the disadvantage of requiring up to 75 min to record in a qeeg laboratory facility. the atr index is a biomarker optimized to predict medication response that is calculated from data collected from a five - electrode montage tightly focused on the frontal regions of the brain, and can be recorded in only 10 min in a general office - based setting [16, 17 ]. most studies of brain functional biomarkers are of small size and therefore are inadequate to fully assess the utility of the biomarkers. one of the largest studies performed, which examined atr, is the national multisite study biomarkers for the rapid identification of treatment effectiveness in major depression (brite - md), which evaluated neurophysiologic and genomic predictors of response and remission in mdd. brite - md enrolled 375 mdd patients and collected comprehensive clinical, neurophysiologic, and genomic data. brite - md developed one of the only predictors of differential response to two antidepressants with different putative moas (escitalopram and bupropion) using the atr index as a dichotomous predictor [16, 17 ]. a positive atr biomarker predicted response and remission to escitalopram with 74% overall accuracy, and those with a positive atr were more than 2.4 times as likely to respond to escitalopram as those with a negative atr (68% vs 28% ; p conversely, those with a negative atr who were switched to bupropion treatment were 1.9 times as likely to respond to bupropion alone as those who remained on escitalopram treatment (53% vs 28% ; p = 0.034) (figs. 1 and 2) [17 ]. 1logistic regression model of escitalopram and bupropion responders stratified by antidepressant treatment response (atr) index values. atr values are shown for patients randomly assigned to each treatment and who responded to escitalopram or bupropion treatment. patients who responded to escitalopram tended to have higher atr values, and those who responded to bupropion tended to have lower atr values. 2logistic regression model of escitalopram and bupropion remitters stratified by antidepressant treatment response (atr) index values. atr values are shown for patients randomly assigned to each treatment and who remitted with escitalopram or bupropion treatment. patients who remitted with escitalopram tended to have higher atr values, and those who remitted with bupropion tended to have lower atr values. markers represent observed values, and lines represent modeled values logistic regression model of escitalopram and bupropion responders stratified by antidepressant treatment response (atr) index values. atr values are shown for patients randomly assigned to each treatment and who responded to escitalopram or bupropion treatment. patients who responded to escitalopram tended to have higher atr values, and those who responded to bupropion tended to have lower atr values. markers represent observed values, and lines represent modeled values logistic regression model of escitalopram and bupropion remitters stratified by antidepressant treatment response (atr) index values. atr values are shown for patients randomly assigned to each treatment and who remitted with escitalopram or bupropion treatment. patients who remitted with escitalopram tended to have higher atr values, and those who remitted with bupropion tended to have lower atr values. markers represent observed values, and lines represent modeled values critically, this is one of the only instances in which a biomarker has predicted differential response to two antidepressant medications with distinct moas. the nnt to see a benefit from the use of the atr index based on these results is 10 to 11, which is within the range proposed for a clinically useful measure [2, 17 ]. however, these results must be interpreted with the caveat that treatment was not assigned prospectively on the basis of atr index values. it is encouraging that another group independently replicated these findings in a naturalistic study with antidepressants selected by clinician choice. these results are encouraging and warrant further exploration of these two medications with distinct moas using a wider range of biomarkers. pharmacogenetic investigations postulate that responsiveness to or tolerability of treatment may be influenced by inherited factors. several observational studies suggest an inherited basis for antidepressant treatment outcomes. despite evidence that pharmacokinetic factors under genetic control are correlated with response and toxicity to tricyclic antidepressants, there has been little evidence to suggest that this is the case with response to or tolerance of the ssris. the current widespread use of ssris in treatment of depression has resulted in a large body of literature on ssri pharmacogenetics. most of these studies focus on candidate genes related to monoamine function, including the serotonin transporter (the molecular target for ssris), tryptophan hydroxylase-1, monoamine oxidase a, and the type 2a serotonin receptor. these studies have demonstrated only a few associations with treatment response, most of which have not been consistent. several large genome - wide association studies (gwas) used the stard pharmacogenetic sample. because the findings have been extensively reviewed previously [66, 67 ], only the most prominent findings are highlighted here. in an analysis of 763 snps in 68 candidate genes, a single snp in the type 2a serotonin receptor several research teams have specifically addressed the association between citalopram treatment response and genetic variation in the serotonin transporter using the stard sample [6870 ]. most showed no association to measures of efficacy, while one showed modest association for a particular haplotype in only a subset of the stard sample. taken together, these studies suggest an overall lack of association between this most obvious of candidate genes and citalopram response. a recent gwas of drug response, made up of 700 german inpatients from two cohorts treated with a variety of drugs, found that no snp was significant at a genome - wide level using results from individual (n = 339) or pooled (n = 361) genotyping. a set of 328 snps was carried forward and genotyped in 832 caucasians from stard for replication. while 46 snps showed p values < 0.05, none withstood multiple - test correction. garriock and colleagues [72 ] performed comprehensive gwas on the stard sample for response and remission phenotypes and identified 41 and 39 snps with principal components ancestry - adjusted p < 0.0001 in remission and response phenotypes, respectively. they found modest levels of association, although nothing at the proclaimed genome - wide significance level (p < 5 10). the strongest finding for response and remission occurred 51 kb upstream of the gene ube3c (p = 3.63 10 ; additive or, 1.68), which encodes ubiquitin protein ligase e3c, a gene found to be significantly downregulated in a stress - induced manner in primates in the adult ventromedial prefrontal cortex. more recently, 706 european individuals treated with escitalopram or nortriptyline underwent gwas, with the strongest finding in the combined sample localizing to a duplicated region of chromosome 1 (p = 3.82 10). the authors carried out drug - specific analyses and reported a genome - wide significant finding for nortriptyline - treated individuals (p = 3.56 10) within the uronyl-2-sulfotransferase gene, while they found a suggestive finding in the coding region of the interleukin-11 gene (p = 2.83 10) for escitalopram - treated individuals. there is little overlap among the three gwas, suggesting prominent heterogeneity between studies and low power within any single study. the lack of strong, clear, and consistent associations between genetic polymorphisms and treatment response is in some ways not surprising ; depression is a complex and heterogeneous disorder, and multiple additive genetic factors are likely to be associated with response. these reports do not offer a comprehensive assessment of the role of variation across the genome or of the potential for multiple additive effects [72 ]. gene expression analysis in neuropsychiatric disorders has been challenging due to the relative inaccessibility of brain tissue. direct assessment of postmortem brain samples from individuals with mdd has indicated some differences in gene expression that are correlated with disease state. these studies indicate detectable differential gene expression in at least subregions of the central nervous system. to assess expression in living humans, these studies have been extended to the assessment of gene expression via analysis of mrna from circulating mononuclear cells in whole blood [75, 76 ]. support for the analysis of gene expression in peripheral blood comes from the assessment of inter- and intraindividual differences in primate blood and brain. it was recently demonstrated that interindividual gene expression differences can be conserved in primate brains and primate peripheral blood, extending the general model for how blood sampling provides useful information on interindividual expression differences in brain subregions. limited small studies have demonstrated gene expression changes from leukocyte mrna in response to antidepressant or lithium treatment in patients with mdd or bipolar disorder. in some small studies, antidepressant treatment tended to normalize gene expression patterns, and the degree of normalization was proportional to the degree of symptom improvement [75, 78, 79 ]. these data suggest that peripheral expression signatures may be relevant to mdd and that the disease state is reflected in expression changes in the leukocyte transcriptome. however, sample sizes have been limited ; therefore, information about the reliability of these findings for predicting treatment response is unknown. rich sets of data have been generated, however, to study gene expression as quantitative traits controlled by specific dna variants in mice, humans, and other species. these data demonstrate strongly that cis - regulatory dna variants control the basal level of gene expression in a variety of tissues, including blood, and contribute to the neurologic phenotypes in the mouse. these expression quantitative trait loci are a powerful resource for complex disease gene mapping, as recently reviewed by cookson.. the promise of this technique suggests it should be pursued for development of possible biomarkers in the future. proteomic and metabolomic biomarkers of treatment response in mdd remain in very early stages of development, and none have demonstrated reliability for predicting treatment response. these potential biomarkers are attractive for further research, however, because of the relatively constrained space of biomarker targets. cerebrospinal fluid might be considered as the source most closely reflective of brain activity, but it is not easily accessible on a routine, risk - free basis that is likely to be acceptable to patients. urine, although perhaps the most easily collected in humans, is furthest removed from brain function, and the degree to which saliva is reflective of brain function is uncertain given the present state of the field. thus, plasma appears to be the rational source for proteomic and metabolomic measurements because it is easily accessible, and many small molecules from the brain reach the circulation en route to excretion ; several also are exchanged or transported across the blood brain barrier. proteomic investigations in mdd mostly have been performed on cerebrospinal fluid and specific brain regions collected at autopsy. furthermore, no clinical study has been directed at identifying protein signatures related to different treatments and responses in mdd. metabolomic reports, although limited, highlight the opportunities that metabolomic investigations have for research on mdd. mass spectrometry profiles of plasma extracts from depressed, remitted, and never - depressed older adults, revealing differences in levels of several fatty acids, glycerol, and -aminobutyric acid. focused investigations of one or a few metabolites in bipolar disorder and mdd have drawn attention to the role of neurotransmitter abnormalities (norepinephrine, dopamine, serotonin, -aminobutyric acid, glutamate / glutamine) and lipids, including arachidonic and other fatty acids. of all serum protein measures, bdnf is the most clearly implicated in the pathogenesis and treatment of mdd. the origins of serum bdnf are unclear, and in animal models, it does cross the blood brain barrier. there is strong evidence of low serum bdnf in unmedicated mdd patients and recovery of serum bdnf levels after antidepressant therapy, including in a large meta - analysis. these findings suggest that bdnf has the potential to be a biomarker of treatment response, although only a few studies have explored changes during treatment in humans [8789 ]. the development of biomarkers to guide treatment decision making in mdd would offer significant advantages. several putative biomarkers have been identified that provide information about the general prognosis for recovery from depression and, in some instances, about whether a specific treatment may lead to remission. these include the following : when is the optimal time in the course of treatment to measure such biomarkers to obtain maximum predictive accuracy?are these biomarkers predictive of differential response (or remission), or instead of prognosis for any treatment that the patient would receive?do the biomarkers have sufficient sensitivity, specificity, and reproducibility for predicting response and remission that they can be relied upon in clinical practice ? when is the optimal time in the course of treatment to measure such biomarkers to obtain maximum predictive accuracy ? are these biomarkers predictive of differential response (or remission), or instead of prognosis for any treatment that the patient would receive ? do the biomarkers have sufficient sensitivity, specificity, and reproducibility for predicting response and remission that they can be relied upon in clinical practice ? for some putative biomarkers, data suggest that the answers to these questions are favorable and that clinical application may be practical and useful. it is likely that no one biomarker alone will be sufficient to direct clinical treatment decisions, and that a panel of multimodal biomarkers may be necessary to obtain the degree of accuracy necessary for clinical utility. research should focus on replicating existing findings and examining groups of biomarkers in sufficiently large cohorts of patients with mdd to examine the clinical effectiveness of biomarker - guided treatment. | during the past several years, we have achieved a deeper understanding of the etiology / pathophysiology of major depressive disorder (mdd). however, this improved understanding has not translated to improved treatment outcome. treatment often results in symptomatic improvement, but not full recovery. clinical approaches are largely trial - and - error, and when the first treatment does not result in recovery for the patient, there is little proven scientific basis for choosing the next. one approach to enhancing treatment outcomes in mdd has been the use of standardized sequential treatment algorithms and measurement - based care. such treatment algorithms stand in contrast to the personalized medicine approach, in which biomarkers would guide decision making. incorporation of biomarker measurements into treatment algorithms could speed recovery from mdd by shortening or eliminating lengthy and ineffective trials. recent research results suggest several classes of physiologic biomarkers may be useful for predicting response. these include brain structural or functional findings, as well as genomic, proteomic, and metabolomic measures. recent data indicate that such measures, at baseline or early in the course of treatment, may constitute useful predictors of treatment outcome. once such biomarkers are validated, they could form the basis of new paradigms for antidepressant treatment selection. |
based on the results of molecular phylogenetic analysis, the mucorales, the core group of the traditional zygomycota, have been reclassified into the subphylum mucoromycotina of the new division, glomeromycota (1). these fungi are ubiquitous saprophytes that are scattered widely in nature, food, soil, and air (2). the mucorales are regarded as important animal and human pathogens, and they are responsible for mucormycosis (formerly known as zygomycosis) (3, 4), the third most common invasive fungal infection (5 - 7). the mucorales are increasingly recognized as opportunistic pathogens in immunocompromised or immunosuppressed patients (8, 9). mucormycosis can be caused by any of the six families of mucorales, although the members of the mucoraceae including rhizopus, mucor, absidia (lichtheimia), and rhizomucor are more frequently isolated in human infections (5, 7, 10, 11). members of the genus rhizopus are the most common isolates recovered in a clinical setting, with rhizopus arrhizus occurring the most frequently. members of the genus mucor come second to rhizopus with respect to frequency, while cunninghamella, apophysomyces, lichtheimia, saksenaea, rhizomucor, cokeromyces, and syncephalastrum each constitute a significantly lower percentage of clinical isolates (7, 12, 13). due to the infection s rapidly progressive course and unexpectedness, many mucormycosis cases are only diagnosed postmortem. the number of cases of mucormycosis has increased over the last few decades, making the fast and accurate diagnosis of these infections imperative. unfortunately for patients who are affected by mucormycosis, no routine laboratory tests are available to diagnose this disease. clinical diagnosis instead relies on histopathology and the isolation of etiologic fungi from infected tissues (2, 14). the sporangia are characterized by the inclusion of a variously shaped columella (15). the growth of the mucorales in media is rapid, with mycelia elements expanding to cover the entire plate in only a few (one to seven) days. however, culture - based identification is often difficult and time - consuming, and it relies entirely on the experience of the technician or expertise mycologist. conventional phenotypic methods usually identify isolates to only the genus level, and sometimes only as mucorales. if the diagnosis is not made early enough, dissemination often occurs (8, 16, 17). based on the above, the development and validation of a new detection system, perhaps involving polymerase chain reaction (pcr) methods, for the fast and accurate diagnosis of mucormycosis pcr - restriction fragment length polymorphism (rflp) is a rapid and highly reliable method for the identification and differentiation of important common mucorales species (16). this study aimed to identify the mucor and lichtheimia (formerly absidia) species among other genera of mucorales isolated in culture media using the pcr - rflp method. of the course of a year, 500 samples were taken from different city districts, parks, hospitals, greengrocers, food stores, laboratories, public restrooms, mosques, and cattle houses. the samples were cultured on sabouraud dextrose agar (sda ; merck kgaa, darmstadt, germany) and potato dextrose agar (pda ; merck kgaa, darmstadt, germany) supplemented with chloramphenicol. a diversity of different types of filamentous fungi and yeasts were identified in the media. finally, 120 pure cultures belonging to the mucorales were gained after the purification of the colonies. primary identification of the mucorales was performed on the basis of the macroscopic and microscopic features of the colonies. in the next step, a mixture of two genus - specific sense primers and one degenerate anti - sense primer from the 18s rrna gene region were selected to determine the two genera of lichtheimia and mucor within the mucorales. all of the pure colonies obtained were sub - cultured on 2% sda and pda and then incubated for one to seven days at 27c in stable conditions. the genomic dna was extracted and purified from each colony using the phenol - chloroform method as follows. briefly, hyphae (without sporangia) from fresh 48 hours cultures on sda or pda were suspended in a 200 l lysis buffer (100 mm tris - hcl, 10 mm edta (ph = 8), 2% triton x-100, 1% sds, 100 mm nacl) (merck kgaa, darmstadt, germany) in 2 ml eppendorf tubes and grinded well. then, the suspension (without the hyphal elements) of each tube was transferred to a new eppendorf tube. next, 200 l phenol - chloroform (1:1) was added and vortexed (or shaken by hand for 5 minutes) rigorously with 200 l of glass beads (0.5 mm in diameter) to release the dna. after centrifugation for 5 minutes at 5,000 rpm, the supernatant was mixed with an equal volume of 2-propanol and 0.1 volume of 3 m sodium acetate (ph = 5.2), vortexed, and incubated at -20c for 10 min. all of the solution was gently removed and then 100 l of 70% ethanol was gently added to the tube and centrifuged for 5 minutes at 5000 rpm. the ethanol was then removed from the tube, dried, and resuspended in 50 l of distilled deionized water, and it was kept at -20c as the purified dna until use. selected primers targeted an 830 bp sequence in the 18s fungal ribosomal gene, which excludes the amplification of human dna and other filamentous fungi. the specific sense primers were mucl1 : 5 tgatctacgtgacatatttct 3 and absl1 : 5 tga tctacacggcatcaaat 3 (bioneer, daejeon, south korea), which corresponded to the sequences of mucor sp. and absidia (lichtheimia), respectively. a degenerate anti - sense primer (mr1 : 5 agtagtttgtcttcggtcaa 3) was applied for the mucorales. the sense primers annealed to the region of the template starting at position 75, while the antisense primer annealed to the region at position 901 (18). each amplification reaction included 12.5 l of premix (containing 2.5 u taq dna polymerase, pcr buffer, 1.5 mm mgcl2, and 200 m dntp) (ampliqon, odense, denmark), 2 l (about 10 ng) of template dna, 0.5 l of each primer (3 0.5 = 1.5 l), and 9 l of distilled deionized water in a final volume of 25 l. amplification was performed on a 2700 thermocycler (applied biosystems, singapore) as follows. one cycle of 1 minute at 94c (primary denaturation), 30 cycles of 1 minute at 94c (denaturation), 1 minute at 60c (annealing), 1 minute at 72c (extension), and finally one cycle of 5 minute at 72c. negative controls (no dna template) were included in each run to detect the presence of any dna contamination in the reagents and reaction mixtures. the pcr products of 120 mucorales were individually digested with selected restriction enzymes including afiii, xmni (thermo fisher scientific, vilnius, lithuania), and acii (new england biolabs, usa), which were specified to the mucor sp. : mucor circinelloides, m. racemosus, m. ramosissimus, m. plumbeus, l. corymbifera, and l. blakesleeana. eighteen s amplified fragments of the 120 mucorales were separately digested by the three abovementioned enzymes. the amplicons were digested for 1 hour at 37c in a total volume of 25 l (containing 2 l of the enzyme, 2.5 l of related buffer, 10 l of pcr product, and 10.5 l of distilled water). the digested amplification products were subjected to electrophoresis, and the sizes of the restriction fragments were determined by comparison with a 100 bp ladder standard dna molecular weight marker (fermentas, vilnius, lithuania). the restriction site, specificity, and fragment size of each enzyme are detailed in table 1. agarose gel in a tbe buffer (90 mm tris, 90 mm boric acid, and 2 mm edta) at 100 v for 45 - 120 minutes in a 1%, 1.5%, and 2% gel was used for the electrophoresis of the extracted dna, pcr products, and rflp products, respectively. the mucor sp. typically exhibits rapid growth, producing globose sporangia on sporangiophores that are either solitary or branched. these features distinguish the mucor spp. from the other producers of globose sporangia (8). the characteristic features of some mucor and lichtheimia species are summarized in table 2 (8, 15, 19 - 23). of the course of a year, 500 samples were taken from different city districts, parks, hospitals, greengrocers, food stores, laboratories, public restrooms, mosques, and cattle houses. the samples were cultured on sabouraud dextrose agar (sda ; merck kgaa, darmstadt, germany) and potato dextrose agar (pda ; merck kgaa, darmstadt, germany) supplemented with chloramphenicol. a diversity of different types of filamentous fungi and yeasts were identified in the media. finally, 120 pure cultures belonging to the mucorales were gained after the purification of the colonies. primary identification of the mucorales was performed on the basis of the macroscopic and microscopic features of the colonies. in the next step, a mixture of two genus - specific sense primers and one degenerate anti - sense primer from the 18s rrna gene region were selected to determine the two genera of lichtheimia and mucor within the mucorales. all of the pure colonies obtained were sub - cultured on 2% sda and pda and then incubated for one to seven days at 27c in stable conditions. the genomic dna was extracted and purified from each colony using the phenol - chloroform method as follows. briefly, hyphae (without sporangia) from fresh 48 hours cultures on sda or pda were suspended in a 200 l lysis buffer (100 mm tris - hcl, 10 mm edta (ph = 8), 2% triton x-100, 1% sds, 100 mm nacl) (merck kgaa, darmstadt, germany) in 2 ml eppendorf tubes and grinded well. then, the suspension (without the hyphal elements) of each tube was transferred to a new eppendorf tube. next, 200 l phenol - chloroform (1:1) was added and vortexed (or shaken by hand for 5 minutes) rigorously with 200 l of glass beads (0.5 mm in diameter) to release the dna. after centrifugation for 5 minutes at 5,000 rpm, the supernatant was mixed with an equal volume of 2-propanol and 0.1 volume of 3 m sodium acetate (ph = 5.2), vortexed, and incubated at -20c for 10 min. all of the solution was gently removed and then 100 l of 70% ethanol was gently added to the tube and centrifuged for 5 minutes at 5000 rpm. the ethanol was then removed from the tube, dried, and resuspended in 50 l of distilled deionized water, and it was kept at -20c as the purified dna until use. selected primers targeted an 830 bp sequence in the 18s fungal ribosomal gene, which excludes the amplification of human dna and other filamentous fungi. the specific sense primers were mucl1 : 5 tgatctacgtgacatatttct 3 and absl1 : 5 tga tctacacggcatcaaat 3 (bioneer, daejeon, south korea), which corresponded to the sequences of mucor sp. and absidia (lichtheimia), respectively. a degenerate anti - sense primer (mr1 : 5 agtagtttgtcttcggtcaa 3) was applied for the mucorales. the sense primers annealed to the region of the template starting at position 75, while the antisense primer annealed to the region at position 901 (18). each amplification reaction included 12.5 l of premix (containing 2.5 u taq dna polymerase, pcr buffer, 1.5 mm mgcl2, and 200 m dntp) (ampliqon, odense, denmark), 2 l (about 10 ng) of template dna, 0.5 l of each primer (3 0.5 = 1.5 l), and 9 l of distilled deionized water in a final volume of 25 l. amplification was performed on a 2700 thermocycler (applied biosystems, singapore) as follows. one cycle of 1 minute at 94c (primary denaturation), 30 cycles of 1 minute at 94c (denaturation), 1 minute at 60c (annealing), 1 minute at 72c (extension), and finally one cycle of 5 minute at 72c. negative controls (no dna template) were included in each run to detect the presence of any dna contamination in the reagents and reaction mixtures. the pcr products of 120 mucorales were individually digested with selected restriction enzymes including afiii, xmni (thermo fisher scientific, vilnius, lithuania), and acii (new england biolabs, usa), which were specified to the mucor sp. : mucor circinelloides, m. racemosus, m. ramosissimus, m. plumbeus, l. corymbifera, and l. blakesleeana. eighteen s amplified fragments of the 120 mucorales were separately digested by the three abovementioned enzymes. the amplicons were digested for 1 hour at 37c in a total volume of 25 l (containing 2 l of the enzyme, 2.5 l of related buffer, 10 l of pcr product, and 10.5 l of distilled water). the digested amplification products were subjected to electrophoresis, and the sizes of the restriction fragments were determined by comparison with a 100 bp ladder standard dna molecular weight marker (fermentas, vilnius, lithuania). the restriction site, specificity, and fragment size of each enzyme are detailed in table 1. agarose gel in a tbe buffer (90 mm tris, 90 mm boric acid, and 2 mm edta) at 100 v for 45 - 120 minutes in a 1%, 1.5%, and 2% gel was used for the electrophoresis of the extracted dna, pcr products, and rflp products, respectively. the mucor sp. typically exhibits rapid growth, producing globose sporangia on sporangiophores that are either solitary or branched. these features distinguish the mucor spp. from the other producers of globose sporangia (8). the characteristic features of some mucor and lichtheimia species are summarized in table 2 (8, 15, 19 - 23). the genomic dna belonging to the mucorales was successfully amplified with the selected primers and a product of approximately 830 base pair (bp) was amplified for all mucorales. the pcr products were electrophoresed in 1.5% agarose gels in the presence of ethidium bromide and then visualized under uv light (figures 1 and 2). the obtained sizes of the rflp products were exactly comparable with the sizes detailed in table 1. all samples yielded a single band of approximately 830 bp in lanes 1 to 30. lanes n, negative control ; m, 100 bp molecular size marker. lanes 1 to 13, mucor sp. ; n, negative control ; m, 100 bp molecular size marker. two fragments (750 + 78) were visualized following the afiii restriction. the specific restriction pattern of m. circinelloides, m. racemosus, m. ramosissimus, and m. plumbeus was established using xmni (613 + 224). additionally, two fragments (518 + 306) were visualized following digestion with acii, which represented the specific pattern for lichtheimia corymbifera and l. blakesleeana (figures 3 and 4). lanes 12, 11, 10, 9, 8, 2 and 13, m. circinelloides, m. racemosus, m. ramosissimus or m. plumbeus ; lanes 3, 1, 7, 6, 5, 4, and 14, l. corymbifera or l. blakesleeana ; n, negative control ; m, 100 bp molecular size marker. a, colony of m. plumbeus ; b, microscopic morphology of m. plumbeus ; globos sporangia with spinolus walls and pyriform columella ; c, colony of m. circinelloides ; d, microscopic morphology of m. circinelloides with globos sporangia and spherical columella ; e, colony of l. corymbifera ; f, microscopic morphology of l. corymbifera with pyriform sporangia and flask like apophysis ; g, colony of l. blackesleenana ; h, microscopic morphology of l. blackesleenana with pyriform sporangia and flask like apophysis ; i, colony of m. ramosissimus ; j, microscopic morphology of m. ramosissimus with globos sporangia and round columella ; k, colony of m. racemosus ; l, microscopic morphology of m. racemosus with globos, light brown and encrusted walls sporangia, and ellipsoidal columella. the discrimination of these species was conducted based on the macroscopic and microscopic features as well as the growth ability in different temperatures (figure 4)., namely m. circinelloides (9.17%), m. racemosus (5.83%), m. plumbeus (10.83%), and m. ramosissimus (3.33%). twelve colonies (10%) were identified as lichtheimia, which belonged to l. corymbifera (9.17%) and l. blakesleeana (0.83%). the identification of zygomycetes is mainly based on macroscopic and microscopic characteristics, which is a difficult and time - consuming process that sometimes needs the expertise of a reference laboratory (14). additionally, the precise identification of the mucorales down to a species level may hold great importance for further research on antifungal effectiveness (18, 24, 25). molecular techniques have showed enormous potential for rapidly and accurately identifying the ecological agents of mucormycosis, which helps in conducting epidemiologic investigations. molecular detection assays for the mucorales are, however, not yet widely available (18, 26). different regions of the rrna operon have most frequently been the targets for the detection of zygomycetes, with previously reported pcrs for zygomycosis. several prior reports have described the utilization of universal fungal primers from the 18s, 28s, or its rrna gene regions for pcr amplification followed by the sequencing or hybridization of the product to specific probes (2, 13, 27, 28). pcr - rflp is a reliable and easy to perform technique that can be used in epidemiological and research studies. pcr - rflp - based methods target the 18s ribosomal gene of zygomycetes on dna extracted from human specimens and may therefore provide clinicians with a rapid and definitive diagnosis of mucormycosis (29). in the present study, a pcr - rflp method based on the 18s ribosomal gene of zygomycetes, which had been previously developed by machouart. the identification of this region by pcr amplification with selective primers has proved to be reliable for the identification of zygomycetes (18). (30) developed a pcr - based method targeting the 18s rrna gene for the identification of mucormycosis and aspergillosis agents in paraffin wax embedded tissue. (31) identified l. corymbifera among other fungi with pcr - rflp using the its region as a target sequence and the acii restriction enzyme. in our study, afiii was used for mucor identification to the genus level and, after that, the xmni restriction enzyme was applied to distinguish m. circinelloides, m. racemosus, m. ramosissimus, and m. plumbeus. digestion with afiii, xmni, and acii generated two fragments of 750 + 87, 613 + 224, and 518 + 306 bp, respectively. therefore, following rflp, the differentiation of the four abovementioned species was performed based on comparing the macroscopic, microscopic, and other features. (19) identified m. circinelloides as a cause of primary zygomycosis using a sequence analysis of the its region as well as phenotyping methods. the mucor species are considered to be a distant third behind the rhizopus species and absidia corymbifera in terms of causing zygomycosis. these include the thermotolerant species m. racemosus, which either does not grow or else grows poorly at 37c. the presence of fungal species has been considered to be an environmental microbiological indicator, and some of the fungi have been found to cause fungal infection (26). a considerable number of mucormycosis cases have been associated with m. circinelloides, which appears to be the most common cause of the disease. however, no mycosis cases associated with m. plumbeus have yet been reported (32). in this study, the genera of mucor and lichtheimia were represented in 29.17% and 10% of the 120 pure mucorales cultures, respectively. alvarez. (33) studied 190 isolates morphologically identified as zygomycetes using sequencing of the its region of the rdna, which revealed that m. circinelloides, l. corymbifera, and m. indicus represented approximately 9.5%, 5.3%, and 2.6% of these isolates, respectively. among the absidia species, the most important species associated with mucormycosis, it was proposed that three absidia species, namely a. corymbifera, a. blakesleeana, and a. hyalospora, should be reclassified as a separate family, the lichteimiaceae fam., and the three species renamed as l. corymbifera, l. blakesleeana, and l. hylospora. l. blakesleeana was subsequently reduced to a synonym of l. hyalospora (34, 35). in dannaoui (24) study, almost all of the pcr results for m. circinelloides were negative. however, in the present study, pcr amplification of all the pure cultures using specific primers was carried out successfully, and the obtained bands were fully sharp. finally, our findings revealed that molecular methods can be used for the rapid detection and differentiation of species that are responsible for infection, and they can hence help in conducting epidemiologic investigations. in contrast to other methods, a pcr - based approach has the potential to be time efficient, highly specific, and endowed with a good sensitivity (36). in summary, the present study maintains that the diagnosis of zygomycetes to a species level based on macroscopic and microscopic features is very difficult. at the same time therefore, it seems that more research is needed to modify the present molecular approaches. in a future study, we intend to design a pcr - rflp method that needs to lower specific primers and enzymes in order to identify the genera and species belonging to zygomycetes. | backgroundthe mucorales are an important opportunistic fungi that can cause mucormycosis in immunocompromised patients. the fast and precise diagnosis of mucormycosis is very important because, if the diagnosis is not made early enough, dissemination often occurs. it is now well established that molecular methods such as polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) are feasible and reliable tools for the early and accurate diagnosis of mucormycosis agents.objectivesthe present study was conducted to evaluate the validity of pcr - rflp for the identification of mucorales and some important mucor and lichtheimia species in pure cultures of zygomycetes.materials and methodsspecific sense and anti - sense primers were used to amplify the mucorales, mucor, and lichtheimia dna. the pcr products were digested by afiii, xmni, and acii restriction enzymes, and the resultant restriction pattern was analyzed.resultson the basis of the molecular and morphological data, we identified mucor plumbeus (10.83%), m. circinelloides (9.17%), lichtheimia corymbifera (9.17%), m. racemosus (5.83%), m. ramosissimus (3.33%), and l. blakesleeana (0.83%).conclusionsit seems that pcr - rflp is a suitable technique for the identification of mucorales at the species level. |
to date, most allosteric drugs have been discovered through high - throughput screening. but growing databases of biomolecular structure and sequence data, in conjunction with increases in computing power and improvements in predictive algorithms, are enabling the rational de novo design of allosteric drugs. given the large number of published algorithms for predicting allosteric mechanisms, it can be difficult to select the most appropriate method for a given target. this review serves as an introduction for those who wish to use computational techniques to develop allosteric drugs. after a broad overview of allosteric drug discovery, first, we discuss bioinformatics and molecular - dynamics methods to identify allosterically important sequence positions. second, we summarize the computational methods to predict druggable pockets at these functionally relevant sites. finally, we describe how markov state models and topological analyses can tie these single sequence sites to global protein function and dynamics. allosteric drugs offer a number of advantages that make them desirable as drug candidates. allosteric effectors, by definition, alter protein activity by binding to a site distinct from the orthosteric pocket. one example of an allosteric system is fructose 1,6-bisphosphatase (shown in figure 2). because allosteric sites are typically less evolutionarily conserved, allosteric drugs can be highly selective, even among other members of the same protein family. in some cases, allosteric sites are so unique among proteins that an effector is said to have absolute subtype specificity. for example, they can be active only in the presence of the endogenous ligand, thus restricting their effect to certain tissues at certain times, which may slow desensitization. allosteric effectors are generally saturable, meaning that they have a maximal effect that does not necessarily correspond to complete inhibition or activation. for example, if the maximal effect is an 80% reduction in signaling, overdosing will not fully eliminate an essential signal. other advantages can include noncompetitive inhibition (i.e., drug activity can not be overwhelmed by high concentrations of the endogenous ligand) and pathway- or substrate - specific modulation, which reduces unwanted activity by specifically targeting a single protein function. for example, if a protein is involved in multiple pathways, an allosteric effector may impact the activity of each pathway differently depending on the systems - biology context. if a protein acts on multiple substrates, the impact on activity may depend on the biological context. despite many potential advantages of allosteric therapeutics, it has been challenging to identify predictive approaches to discovering allosteric drugs. in recent decades, the pharmaceutical industry has favored more traditional targets for three primary reasons : the relative ease of assay development around orthosteric sites ; access to high - throughput, high - resolution x - ray crystallography ; and advances in ligand- and receptor - based computational methods to optimize ligand - binding affinity at a substrate - competitive site. this structure - based approach is thought to significantly reduce the time and cost of hit - to - lead and lead - to - drug development by reducing the number of compounds that need be synthesized. comparing computer - aided drug discovery (cadd) and high - throughput screening (hts) reported that the two methods had hit rates of 35 and 0.021%, respectively. in contrast, allosteric drugs are uniquely challenging from a rational drug - design perspective. because experimental assays typically measure orthosteric function rather than ligand binding at the allosteric site, efficient development of allosteric drugs requires that the complex structure activity relationships (sars) governing both binding affinity and allosteric activity be considered simultaneously. further, allosteric sites are less likely to be evolutionarily conserved. while this enables increased subtype specificity, it also increases the chances of evolved resistance and can complicate testing in evolutionarily distant animal models. additionally, allosteric effectors are particularly susceptible to mode switching, where relatively minor chemical changes can drastically affect ligand efficacy. structurally similar drug metabolites, therefore, may have varying and unpredictable distributions and allosteric effects. optimizing allosteric modes of action requires methods that are very different from those used in orthosteric drug discovery. while drug designers may desire to target a single protein function, an allosteric effector may also alter other functions, hindering a full mechanistic understanding of the pharmacology. also, the benefits of spatiotemporal specificity are lost if the distribution of the endogenous ligand changes with progression of the disease state. finally, assessment of the limited number of known allosteric pockets indicates that they are generally shallow and present flat sars. these structural features similarly challenge existing rational drug - discovery paradigms and the general practice of developing selective compounds by optimizing affinity. despite these challenges, allosteric drug discovery has gained momentum recently due to a number of developments. first, several allosteric drugs across a broad range of pharmacological target classes have been rationally designed, encouraging pursuit of others, as evidenced by the number of allosteric drugs currently in clinical trials. the recent elucidation of new membrane protein crystal structures for gpcrs and ion channels have assisted in the structure - based design approach to these successes. finally, advances in our understanding of allosteric mechanisms have supported development of additional rational design strategies (see below). our understanding of allosteric mechanisms has advanced considerably since the initial conception of monod, wyman, and changeux. this revised view supports newly established and emerging computational advances that comprehensively map conformational landscapes and predict communication between allosteric and orthosteric sites. for example, the physical mechanisms of allostery generally alter the entropic and enthalpic factors that define the conformational landscape and, therefore, govern protein function. the observed correlation between allosteric modulation and protein structural dynamics is varied : major conformational rearrangements occur in some cases, as compared with subtle shifts in conformational populations in others. an excellent metaphor for these phenomena is kornev and taylor s classification of domino versus violin models of allosteric signal transduction (figure 1). further, allosteric signals are transmitted through a range of structural motifs, from rigid core regions to flexible linkers. allostery may occur through essential residues along a single allosteric path or through many weak pathways connecting one site to another, acting in concert. as such, it is not surprising that many of the allostery - prediction methods discussed in this review (some of which do not use structure / geometry information at all) in practice may identify noncontiguous groups of residues as being allosterically linked. such predictions should not immediately be assumed to be wrong but rather may indicate a non-domino model of allostery. when a small molecule binds to the allosteric site of a protein, information is transferred through the protein molecule to its active site. the first mechanism, here defined as the domino model, is a sequential set of events propagating linearly from the allosteric site to the active site. binding of the effector triggers local structural changes that sequentially propagate via a single pathway to the active site. it was suggested that this mechanism is applicable for the pdz domain family, g protein - coupled receptors, the chymotrypsin class of serine proteases, and hemoglobin. the second mechanism, defined here conceptually as a violin model, is based on vibration pattern changes inside the protein. in a violin its pitch can be changed by a slight movement of the violin player s finger on the fingerboard. information about the finger movement is, thus, transferred throughout the whole body of the violin with no specific pathway for the signal transduction. by analogy, protein allosteric site is a fingerboard of the protein and a small signaling molecule is the player s finger. if a protein is in a particular vibration mode, it is possible to suggest that binding a small effector molecule to a specific site can change this mode. the signal, thus, will be spread throughout the whole protein including its active site. the domino model is a reliable way to transfer information in a macro world, but on a molecular level, with significant thermal motions of the protein, this mechanism will be prone to random triggering of the domino chain reaction, creating noise in the signaling system. thermal motions in the case of the violin model in fact, the permanent motion of the molecule is a prerequisite for this mechanism. reproduced with permission from ref (45). recent work has also revealed that protein allostery is not merely a transition between two discrete protein conformations, as initially thought, but rather a shift in the equilibrium populations of many conformations, induced by effector binding. it is becoming increasingly clear that the kinetics of these transitions define the mechanisms of allostery. empowered with these new understandings and advances in molecular simulation (in terms of speed of calculation and improved methodologies), the era of allosteric drug discovery is now on the cusp of radical advancement. orthosteric and allosteric pockets (yellow and red, respectively) are bound to an endogenous ligand and an allosteric effector, respectively. note that the allosteric site is distant from the orthosteric site such that there is no overlap between the bound poses of the allosteric and orthosteric ligands. despite the distance between them, the allosteric effector measurably modifies the enzymatic activity at the orthosteric site. so - called tried - and - true design principles are still being developed. however, a few general principles have begun to emerge. for example, many argue that it is insufficient to design a ligand that merely binds to an allosteric site ; rather, the effector must make contact with certain key binding - pocket atoms to have the desired effect. these key atoms can often be identified through mutagenesis experiments and crystallographic studies of other allosteric ligands. a promising set of design principles is encapsulated in the allo - network strategy, a rational approach that adopts two simultaneous but orthogonal approaches to ligand design. on the protein - structure level, the primary focus is to target a single protein function or an interaction with a single partner. on the signaling - pathway level, the allo - network strategy suggests targeting less - connected upstream proteins instead of the more direct, though potentially highly connected, signaling proteins themselves. when applied to early stage design, the allo - network method is predicted to increase the likelihood that a given allosteric effector will proceed through the drug - approval process. several published examples for recently approved allosteric drugs serve to illustrate the current state of the art for emerging allosteric drug design principles. they also represent the significant advances that have been made to utilize structure - based methods for challenging druggable sites such as protein protein interfaces and for membrane proteins such as ion channels. the available details of the discovery and optimization of these compounds do not include the methods discussed in this review ; however, they highlight where these predictive techniques could contribute to the allosteric design process. in 2011, gilmartin. of glaxosmithkline reported the discovery of a pharmacokinetically optimized allosteric mek inhibitor, gsk1120212. the first generation inhibitor was discovered by high throughput screening, and the subsequent ternary crystal structure showed the allosteric pocket to be adjacent to the orthosteric atp - bound site. by 2012 there were 14 allosteric mek1/2 inhibitors in clinical trials, because it was recognized that an inhibitor developed for this allosteric pocket afforded two very unique opportunities to avoid adverse clinical effects : the high doses required to compete against 1 mm cellular atp concentrations and inhibition of closely related atp - binding sites in other kinases. the unique efficacy properties of gsk1120212 highlight both the opportunity and challenge of allosteric drug design. report that, although some other mek allosteric drugs demonstrate inhibition of the erk1/2 pathway in vitro, this has not translated into efficacy in patients. gsk1120212 has since been approved in the united states under the name trametinib for treatment of metastatic melanoma caused by the v600e mutation. in 2012, these inhibitors produce an allosteric effect by binding at an interdomain interface and stabilizing a preexisting autoinhibited state of the protein. the original discovery of the allosteric site was accomplished using a fragment - based hts technique, followed by optimization using x - ray crystallography and structure - based sar. the authors discuss their experience with a few confounding factors in the allosteric design process, namely the need to use the full - length protein in their screening construct to observe the exerted allosteric effect, and the subsequent directed evolution study of resistance mutations that could occur at the allosteric site. hackos. of genentech published on the discovery of positive allosteric modulators (pams) for glun2a - containing nmda receptors in 2016. pams are allosteric ligands which increase the effect of the endogenous signaling molecule and do not cause a change in its absence. the authors note that the validation of this allosteric site was reinforced by its similarity to an analogous allosteric site in ampa receptors, but that the nmda receptor site has elements of asymmetry that the ampa receptor site did not. in comparing two similar compounds, gne-6901 and gne-8324, the authors make comments that indicate evidence of mode switching or a shallow sar landscape, and they further characterize the details of the allosteric mechanism using mutagenesis experiments. in summary these examples demonstrate allosteric drug discovery can be successful at protein sites often considered to be undruggable. it is apparent that these successes can be further built upon through computational methods that allow for rational rather than serendipitous hts discovery of new allosteric binding sites and a deeper understanding of allosteric mechanisms that overcome design challenges such as mode switching. protein - sequence analysis is a useful tool to detect and characterize allosteric pathways and pockets. here, we classify sequence - based methods into two groups : (1) single site methods, which produce a list of individual functional sequence positions ; (2) coupled site methods, which produce a list of groups comprised of two or more sequence positions that appear to be functionally linked based on their coevolution. these challenges include how to select and aggregate clean, relevant sequences as input ; interpret the output ; and integrate sequence - analysis results with other forms of data. determining the biological meaning of a strong signal is also problematic. while many analysis methods identify evolutionarily important residues, the specific biological role of these residues can not be inferred without additional knowledge. for example, it is difficult to determine, based on sequence alone, whether an evolutionarily significant residue plays an allosteric role, or whether its role is related to another essential process (e.g., substrate binding, maintaining protein structure, etc.). most techniques require many sequences to establish statistical significance. to obtain the required number of sequences, researchers often lower the stringency of their search parameters, resulting in alignments that contain sequences with lower similarity or incomplete coverage of the original query. while some analysis methods manage to detect meaningful coevolution over a wide range of multiple sequence alignment (msa) conservation and noise levels, others are more susceptible to messy data. for a more complete discussion of these topics and how they affect coevolution analysis methods, readers are directed to an excellent recent review by de juan. by our definition, single - site evolutionary analysis methods return a list of predicted functional sequence positions but do not suggest specific linkages between sites. once a researcher has constructed an msa, the conservation or phylogenetic relevance of each column can be used to infer the evolutionary importance of each sequence position. this importance is sometimes a hallmark of thermodynamically critical residues that participate in allostery. though single - site methods only return a list of single high - scoring sequence positions, the inner workings of some single - site methods are based on the aggregate or correlated behaviors of multiple sequence positions (e.g., to determine baseline residue probabilities within a multiple - sequence alignment or construct a phylogenetic tree). single - site methods for detecting allostery are advantageous because they lack much of the noise often associated with correlation analysis. these analyses are also appealing because of their simplicity : there are usually fewer parameters to set, and the results can be visualized directly by highlighting key residues on a three - dimensional (3d) protein structure. shannon entropy, one of the simplest nontrivial sequence - analysis metrics, was used widely in early works to identify conserved sequence positions for drug - design or mutagenesis experiments. similar in form to thermodynamic entropy from statistical mechanics, shannon entropy measures the population diversity of residues at a single msa position. it is also central to mutual information (mi), a popular coupled - pair metric. the mi of two sequence positions is defined as the sum of the individual position entropies, minus the entropy of the positions considered jointly. while we do not cover the mathematical details of these methods here, interested readers are directed to previous articles on these topics. shannon entropy does not consider amino acid similarity (e.g., in the shannon entropy framework, a leucine - to - isoleucine mutation is considered mathematically equivalent to a leucine - to - arginine mutation). other entropy measures, such as the relative shannon entropy (also called the kullback leibler divergence (kld)) and the von neumann entropy, attempt to overcome this limitation and, as a result, may be more useful in the search for allosteric sites. relative shannon entropy / kld accounts for some measure of the protein s chemical environment by considering each mutation with respect to the background amino acid frequencies calculated from the msa. this analysis may be particularly useful when searching for allosteric sites in proteins that reside in membranes or other noncytosolic compartments, where background residue probabilities or mutational preferences may be biased due to different biochemical contexts. in contrast, von neumann entropy, a concept borrowed from quantum statistical mechanics, is calculated using amino acid similarity matrices. identifying an optimal amino acid similarity metric is nontrivial and may well depend on the nature of the system (e.g., in a well - packed protein, residue size may be a sensitive metric, whereas surface - site comparison may require the user to prioritize charge). in a recent publication describing these types of entropy, johansson and toh explored how the two metrics can be mixed to detect enzyme active sites with maximum sensitivity. zhang. constructed a variety of new analysis methods in 2008 by combining shannon or von neumann entropy, phylogenetic tree structure, and a novel gap - treatment approach. in benchmarking their method, they compared their results to evolutionary trace and consurf (discussed in greater detail below). two of their hybrid approaches outperformed all other techniques in detecting significant residues across a variety of proteins : the improved zoom method, which incorporates a tree breakdown of subalignments, and the physiochemical similarity zoom method, which extends the improved zoom method with von neumann entropy and tree - branch - size normalization. lichtarge, bourne, and cohen pioneered the evolutionary trace (et) method. the approach has become quite popular, largely because the algorithm is intuitive and its results are readily visualizable. a number of sequences and constructs a phylogenetic tree, and then monitors the conservation of sequence positions at major tree branching points. by slicing the tree at different similarity cutoffs, the evolutionary significance of these sequence positions is implied by their conservation in the sequences beyond the next branch. in their first paper, the authors demonstrated that et can detect functionally important sites in sh2, sh3, and dna - binding domains. work has since been published on et validation, parameter optimization, and best - use practices. in a method often referred to as difference - et, the user runs et on two related proteins and considers differences in the high - ranking residues and their scores. the sequence positions with strongly varying scores may suggest specificity determinants or differences in allosteric and/or orthosteric mechanisms. notably, difference - et has been used in the study of gpcr specificity. to better account for varying rates of evolution in different subtrees and correlated mutations, in 2004 mihalek. this work also introduces the zoom et method (not related to improved zoom, above), which adds higher weight to sequences that are more similar to the protein of interest. in the introductory work, they used real - valued and zoom et to detect the functional residues in a kinase domain, and then compared the performance of both methods to regular (integer - valued) et and entropy. given unpruned sequence data sets, the real - valued et and zoom et methods outperformed the others by a significant margin. in contrast, integer - valued et prevailed in most respects when pruned data was available. an automated web server is available to perform real - valued et calculations, generate reports, and visualize results (http://mammoth.bcm.tmc.edu/etserver.html). in 2008, merkl. introduced a method called h2r that serves as a segue between single - site and coupled - site approaches. h2r generates a mutual - information matrix for an msa, and then discards all but the strongest detected coupled pairs. for each sequence position k, the method returns conn(k), the number of top - ranked pairs that include k. initial work proved that h2r can successfully detect functionally significant residues across a range of proteins. more recently, h2rs, an improved version of h2r, has been released. this method modifies the original by using von neumann instead of shannon entropy and performing more detailed checks for statistical significance. h2rs is available as a web server and a stand - alone application at http://www - bioinf.uni - regensburg.de/. second - order sequence analysis detects residue pairs that mutate in concert more frequently than would be expected given random genetic events. coevolving residue pairs are assumed to be functionally linked, often because they serve essential roles in allostery or structural integrity. the immediate output of second - order allostery analysis is a list of residue pairs with associated correlation strengths. combining these individual pairwise correlations into a single picture of the entire protein is a separate task. on the most basic level, the strongest correlations that include a residue or site of interest can suggest thermodynamic coupling to other sites, possibly related to allostery. more complex analyses use hierarchical clustering or principal component analysis to analyze these linkages and uncover strongly linked networks of coevolving residues. several simple yet reliable residue - coupling analyses have maintained a presence in the literature over the past decades. these basic approaches are advantageous because they are easier to understand and have been shown to score consistently well in a wide range of tests. however, they may fail to detect correlations in more complex cases. though more complex methods exist, many of these basic methods still appear as analysis options in coevolution - detection software packages and web servers. in this review, mutual information (mi) is one of the most straightforward and long - lived coupling metrics. the mi between two sequence positions is defined as the sum of the shannon entropies of both positions, minus their joint entropy. due to its simplicity and favorable mathematical properties, mi analysis is the basis for a number of more complex coevolution methods. for example, uncorrelated pairs of high - entropy sequence positions are likely to have a higher mi than uncorrelated pairs of low - entropy positions. to compensate for this and other shortcomings, further, methods to estimate baseline values for correlation (e.g., resampling or sequence shuffling) can improve mi analysis. another relatively direct coevolution metric, the mclachlan - based substitution correlation (mcbasc), looks for similar patterns of variation in the columns of an msa, weighting for residue similarity using the mclachlan scoring matrix. analogous methods can be constructed using different substitution matrices, but mcbasc continues to be a popular choice in the literature. in 2002, kass and horovitz analyzed the groel complex using a chi - squared test to detect significant residue coevolution in an msa. the analysis suggested intra- and interchain contact pairs and has continued to appear in the literature under the name method developed by lockless and ranganathan is perhaps the most widely used sequence - based method for allostery prediction. sca draws an analogy to statistical physics by calculating a coupling energy between each sequence - position pair. the original sca method computes a conservation value for each sequence position i in an msa, applies one of several types of perturbation to another position j (depending on the sca version), and finally recalculates the conservation at position i for the sequences that satisfy the perturbation. by calculating the change in individual and joint conservation over a variety of perturbations, sca establishes a coupling energy that indicates the evolutionary coupling of positions i and j. the output of the sca method is an n n matrix of coupling energies, where n is the number of sequence positions in the alignment. in early work, the researchers manually identified strongly coupled residue pairs that included one functional member (per experiment). more recent versions of sca have grouped this matrix into meaningful clusters of coevolving residues using hierarchical or spectral clustering. refinements of sca have achieved improved statistical properties by resampling the original distribution. in a 2011 paper, sca was effectively used to engineer a light - sensitive lov2 domain onto the surface of dhfr at a location that sca had identified as energetically linked to the enzyme active site. some variants of the resulting protein chimera were found to have acquired light - dependent activity. further work has used sca to design artificial ww domains. in 2011, an sca analysis of antigen 85c from mycobacterium tuberculosis suggested new sites that potentially could be exploited in drug design. a number of projects have also demonstrated how sca can be used to target mutations that affect protein function. inspired by earlier work on the sequence correlation entropy (sce) method, dima and thirumalai published an sca variant in 2006. this variant controls for specific protein composition by calculating the background probability that a given amino acid will be present at a random sequence position. this probability is determined by considering only the sequences being analyzed, as opposed to all sequences in the swiss - prot database. further, they borrowed a coupled two - way clustering procedure from gene - sequence analysis to define the sectors. in validating this method, the authors analyzed the pdz, gpcr, and lectin families of proteins and were able to quantitatively predict functional residues, which were in agreement with experimental findings. method in which correlation is established by excluding certain sequences from an msa and monitoring how entropies change. another popular perturbation - based method was published in 2004 by dekker. this method, explicit likelihood of subset covariation (elsc), relies on similar principles but returns correlation scores in the form of probabilities rather than statistical energies. elsc was shown to be superior to sca in contact prediction when tested on a range of protein families. it has since been implemented on web servers and has been a popular benchmark method in the literature. in 2009, weigt. proposed a mutual - information - based method called direct coupling analysis (dca) that disentangles directly interacting residues from large networks of indirectly coupled sequence positions. while this method is typically used in structure prediction to identify spatially adjacent sequence positions, it may find application in the study of short - range allosteric interactions. a more efficient implementation of the dca method, known as mean field both introductory papers show that dca is a robust predictor of both intra- and interprotein contacts and that it can hint at the existence of unobserved protein conformations. related work has shown that dca can be used in conjunction with structural models to generate predictive models of protein complexes, determine the sequence positions that contribute to protein - interaction specificity, and describe the conformational ensembles of proteins in crystallographic or near - crystallographic states. a web server and software package are available to perform dca analysis at http://dca.rice.edu/portal/dca/home. psicov is another popular contact - detection method that may find productive use in the study of allostery. mathematically, psicov relies on an estimated inverse of the msa covariance matrix, which acts as a matrix of correlations between all sequence - position pairs that inherently controls for the variations in all other positions. the code has been published online at http://bioinfadmin.cs.ucl.ac.uk / downloads / psicov/. recurrence quantification analysis (rqa), another second - order sequence - analysis technique, is best used when much is already known about the mechanism under investigation (e.g., physiochemical amino acid properties such as charge or hydrophobicity are known to drive the allostery). rqa itself is a general method in nonlinear dynamics : in the context of protein sequences, it considers a scalar - value vector that represents some property of a given sequence. in introductory work by zbilut., the method was used to properly classify 56 tem-1/-lactamase mutants with impaired function based on their hydrophobicity profiles. further rqa work used hydrophobicity scores to classify proteins as allosteric or nonallosteric, study p53 mutants, and reveal interaction partners in viral - envelope proteins. in 2005, colafranceschi. investigated the effect of choosing different physicochemical amino acid descriptors and changing the numerical parameters of the rqa algorithm. more recently, a comparison method based on rqa measurements, known as cross - rqa, effectively detected protein allostery. interested readers are directed to a review by zbilut - webber, which provides examples of rqa applied to a range of computational biology problems. some work has been done to competitively benchmark the performance of these methods. in 2004, fodor and aldrich compared omes, mi, sca, and mcbasc in a variety of tests. in short, the study found that performance is largely dependent on the way that different methods determine background residue probabilities and handle positional conservation. a follow - up study investigated how effectively coevolution analysis finds thermodynamically linked residue pairs. in general, spatially contiguous linked pairs were detected, but long - range couplings did not agree with experiments. in 2010, brown and brown introduced a new pair - scoring method, called z - scored - product normalized mutual information (znmi), and compared it to the accuracy and reproducibility of mi, two versions of sca, omes, and elsc. the authors presented a thorough meta analysis of method performance and the impact of input - parameter selection. though none of the tools tested was particularly powerful, znmi was the most robust prediction tool. brown and brown also found that the use of multiple subalignments produced more accurate and reproducible results. a comparative analysis of sca and dca revealed that the top 35 sectons found via spectral clustering of the dca matrix corresponded to pairs, triplets, and quadruplets of spatially contiguous residues. in contrast, a similar analysis of the sca matrix produced spatially adjacent clusters of many residues each. these different results validate the stated goals of each method : dca aims to find contacting pairs, whereas sca aims to find potentially distant groups that are thermodynamically linked in a certain function. in 2014, pel. investigated seven coevolution analysis methods to find the hallmark covarying pairs in gpcr alignments. they considered three variants of mi, mclachlan based substitution correlation, sca, elsc, and omes. omes and elsc were the most robust methods for finding the residues responsible for subfamily divergence. their study tests omes, two variants of mi, sca, psicov, and di, and finds that psicov and di are best at identifying contacting residues. omes and mip excel at removing false positives from the lists of predicted contacts. while the authors focused on detecting inter- and intramolecular contacts, their analysis also provided useful insights to guide the productive use of each method. for example, all methods benefit from repeatedly shuffling the msa and rerunning the analyses in order to provide a baseline and remove false positives. finally, the authors found that the consensus of di and psicov provides a more robust prediction of contacting residues than any single prediction method alone. the software used to perform this analysis is available through the prody evol program (http://prody.csb.pitt.edu/evol/). in the course of introducing new types of mi analysis (dbzpx2, dgbzpx2, and nbzpx2) and evaluating the effectiveness of msa simulation (a topic beyond the scope of this paper), ackerman. in 2012 new methods (the zpx2 family, dca, and log(r) (not discussed here)) were significantly superior to the old methods (omes, mcbasc, elsc, and sca). contact map webviewer (cmweb) automatically constructs an msa and visualizes a variety of coevolution analyses : mutual information, sca, elsc, omes, and an early method presented by gbel. the same server can also compare the results of these methods to user - uploaded data (e.g., results the user obtained using some other type of analysis). the cmweb server can be accessed at http://cmweb.enzim.hu/. the coevolution analysis of protein residues server hosted by the gerstein lab (http://coevolution.gersteinlab.org/coevolution/) can perform a large number of the coupled - site analyses presented in this review, including sca, elsc, mi, and mcbasc - type methods employing different scoring matrices. the server can also validate the results of these methods in predicting residue distances in a crystal structure. mistic (mutual information server to infer coevolution) is an automated web server that accepts user - submitted msas or collects them from pfam. mistic uses a corrected form of mi to infer coevolving pairs and offers several analysis methods that combine structure and coevolution. it can be accessed at http://mistic.leloir.org.ar/. caps (coevolution analysis using protein sequences) is a unique algorithm that combines phylogenetic, 3d, and msa data to predict coupled sequence positions. versions 1 and 2 are hosted on web servers at http://bioinf.gen.tcd.ie/caps/ and http://caps.tcd.ie/, respectively. the interprotein - correlated mutations server (i - coms, http://i-coms.leloir.org.ar/index.php) focuses on detecting contacts at protein protein interfaces, though it can also return intrachain correlations. the server automatically builds alignments ; performs mi, dca, or psicov analysis ; generates visualizations of the results ; and allows users to download data taken from various points in the data - collection and analysis workflow. in 2012, they employed an automated workflow to control for various types of noise in sequence alignments, using the msa sequence profile to establish prior knowledge about the protein. while the authors only studied a few mi variants, they stressed that their profile - based method could be extended to more complex analysis techniques. their approach, correlated mutation analysis tool (cmat), is available on a web server at http://binfolab12.kaist.ac.kr / cmat/. access to consurf, a single - site detection method similar to et, is available at http://consurf.tau.ac.il/. the prody python package, referred to above, can compute a variety of coevolution metrics. in 2014, released the latest version of the powerful bio3d r package for protein structure and sequence analysis. while it focuses on structural analysis, the package can compute shannon entropy and offers useful functions to create and manipulate sequence alignments. also in 2014, li. published the cormut software package for r, which computes mi, a metric called the jaccard index, and the conditional selection pressure metric ka / ks.table 1 summarizes the selected coevolution web servers / software packages and their capabilities discussed here. allosteric effectors communicate with orthosteric pockets by altering protein dynamics, either through large - scale structural changes or through more subtle changes in correlated residue motions. a proper understanding of the allosteric mechanism is impossible unless one fully appreciates the underlying dynamic conformational flexibility and energetic landscape. computational methods to characterize receptor flexibility include molecular dynamics (md) and monte carlo simulations. briefly, md simulations represent molecular systems as beads (e.g., atoms) connected by springs (e.g., bonds). newton s equations of motion are numerically integrated to propagate the dynamics of this classically formulated system. simulation time is typically discretized into steps of 1 or 2 fs, as required to accurately simulate the fastest atomic motions (i.e., hydrogen bond stretching). at each step, the potential energy of the system is calculated by considering the energies associated with bonded atoms (e.g., due to bond stiffness, angle bending, torsion rotation, etc.) and nonbonded atom pairs (e.g., due to electrostatic and van der waals forces). the forces on each atom, calculated from the negative gradient of the potential energy, are then used to update the atomic positions at each step. in a related method, called (amd), the underlying potential energy landscape is modified by raising the energy wells. these modifications facilitate transitions between states that do not normally occur on the time scales of traditional md simulations. interested readers are directed to recent reviews that describe md simulations in the context of drug discovery. in contrast, monte carlo based methods take a stochastic approach to conformational sampling. at each monte carlo step, a markov - chain procedure is used to generate a slightly modified system conformation. this new conformation is then accepted or rejected at random, biased by the relative potential energy of the new conformation as compared to that of the previous step (the so - called as these simulations are stochastic, they do not typically explore conformational space via the same time - dependent path traced in an md simulation. indeed, a key limitation of the monte carlo method is that the time information connecting the states is lost. nevertheless, monte carlo simulations are widely used because they tend to more efficiently sample system conformations that are statistically representative of the equilibrium state. as mentioned above, allosteric signals can be transmitted through large - scale conformational changes or subtle shifts in the correlated motions / interactions of individual residues. accessing the time scales required to observe many large - scale conformational changes is presently computationally intractable using unbiased simulation - based methods, but these simulations are well - suited to the study of allosteric signals that are transmitted via fast, local fluctuations (i.e., nanosecond - scale changes in the coordinated motions of adjacent residues). distilling the dynamics sampled by these simulation - based methods into a simple network representation of protein motions often facilitates allosteric analysis. rather than tracking the position of every atom, each protein constituent (e.g., amino acid) is represented as a single node (located, for example, at the residue center of mass). each pair of nodes is connected by an edge whose length is inversely proportional to the degree of interdependence between their motions, such that nodes connected by short edges are highly interdependent. different metrics of interdependence have been used, including metrics based on correlated motions (e.g., mutual information, fluctuations in atomic positions, etc.) or the number of specific noncovalent interactions. once a network representation of protein dynamics has been constructed, various network - analysis techniques (described below) can identify important pathways of communication between distant residues that may contribute to allostery. interested readers are directed to a recent review by atilgan. for more detailed information. a number of simulation - analysis techniques consider the interdependence of individual residues along an allosteric path or paths. in 2008, bradley. analyzed molecular dynamics simulations of escherichia coli nikr, a transcriptional repressor of the nikabcde nickel permease, using a novel network - space clustering approach. residue interdependence were considered, based on fluctuations in residue motions and the number of polar contacts between residue - pair members. first identified sets of residues whose motions and/or contact counts were correlated with residues in both allosteric and orthosteric pockets. (upgma), a hierarchical agglomerative approach that groups residue sets according to the degree of similarity in their correlation patterns. the authors ultimately identified residue sets likely to mediate communication between the nikr allosteric ni - binding pocket and the orthosteric dna - binding pocket. others have pursued orthogonal methods to represent and analyze protein dynamics in silico. in 2009, mcclendon. introduced mutinf, a novel md - analysis technique for identifying statistically significant correlated motions. unlike other techniques, mutinf uses an internal coordinate scheme. rather than considering the positional coordinates of residue atoms directly, it quantifies correlated motions using a mutual - information metric derived from residue torsion angles. this approach makes mutinf particularly well - suited to study allosteric signals transmitted through the gearlike correlated motions of side - chain rotamers. using multiple short simulations, the authors were able to identify statistically significant correlations. applying the technique to interleukin-2 provided a viable theory of allosteric transmission involving a population - shift - mediated signal transmitted between the allosteric and orthosteric pockets via a hydrophobic core. leibler divergence metric to improve the sensitivity of mutinf analysis. a paper by van wart., published in 2012, studied imidazole glycerol phosphate synthase (igps), an important enzyme in the histidine biosynthetic pathway of plants, fungi, and microbes. following a molecular dynamics simulation of the enzyme, they built a representative network of residue interactions as inferred by correlated motions. the edges connecting physically distant protein residues were ignored to emphasize correlations resulting from immediate physical interactions. the single shortest path (in network space) between the allosteric and orthosteric sites was then identified. two of the residues along this path had been shown previously by experiment to be involved in allostery. van wart. later expanded on their work by creating the freely available weighted implementation of suboptimal paths (wisp) program. wisp can identify not only the single optimal path connecting allosteric and orthosteric sites, but also multiple other near - optimal paths. while allosteric signaling may occur through a single optimal path in some cases, for many proteins it is likely the summed (or perhaps synergistic) effect of signaling through multiple near - optimal pathways. while several efficient algorithms exist to calculate the single optimal path between two nodes in a network space (e.g., the floyd warshall algorithm, dijkstra s algorithm, etc.), calculating near - optimal pathways is far more computation intensive. first, the edges between physically distant nodes are removed regardless of the interdependence of their motions, as in van wart s original paper. second, all nodes that can not possibly participate in optimal or near - optimal pathways of allosteric communication are deleted. for each node, dijkstra s algorithm is used to calculate the shortest path connecting the source node, the node being considered (ni), and the sink node. if this shortest path is still too long (in network space) to be an optimal or near - optimal pathway, no other path passing through ni can be optimal or near - optimal. therefore, ni is deleted from the network. after thus greatly simplifying the network, it becomes computationally tractable to calculate notable pathways of allosteric communication between source and sink residues using a recursive, bidirectional approach. in 2014, levine. introduced a novel analysis framework, called n - body information theory (nbit), that uses multivariate mutual information to measure residue interdependence. this technique is unique in that it considers not only the interdependence (mutual information) between two residues, but also the mutual information between groups of up to n residues. specifically, a metric called coordination information is used to measure the degree to which the correlated motions of a set of residues are shared with another residue not in the set (i.e., the contribution of a site to all possible n - body correlations with another site). the authors use this technique to analyze md simulations of the bacterial transporter leut and identify many of the same residues previously found through experiment. residue interdependence to consider how highly interconnected (and often rigid) communities of residues interact with one another. in this view, allostery is achieved when largely isolated communities of highly interconnected residue nodes (small - world networks) engage in long - range interactions. studied the allosteric mechanism of prfar binding to the igps heterodimer. after simulating the system in both the absence and presence of the allosteric modulator, they calculated the mutual information between the positional vectors of all residue residue pairs. ignoring the correlations between nodes that were not frequently physically adjacent (5.0 for at least 75% of the simulation), the authors next used the girvan newman algorithm to identify communities of highly interconnected nodes. this analysis provides a powerful illustration of how an allosteric modulator might manipulate entire protein modules to transmit a signal. supported by nmr experiments, the authors ultimately concluded that prfar binding decreases the correlated motions at sidel of the heterodimer and induces conformational changes in sider that ultimately impact the hydrogen - bond network near the active site. sethi. used a similar technique in 2008 to study allostery in trna : protein complexes. the use of accelerated md (amd) simulations in this same mutual - information / community - analysis workflow has also proved fruitful. amd simulations are particularly helpful when the allosteric mechanism being studied occurs on time scales that are longer than those accessible through traditional md. for example, in 2012, gasper. used a mutual - information / community - analysis technique to study -thrombin. one occurs on slower time scales that might not have been accessible were it not for the amd. others have used amd to similarly study allosteric effects in the m2 muscarinic receptor. in 2014, blacklock and verkhivker used a similar technique to analyze md trajectories of the hsp90 chaperone in various functional states. to verify the existence of communities in this system, they first calculated force constants for each residue, corresponding to the energy cost of residue displacement over the course of the equilibrium simulation. as residues with high force constants are typically rigid, community boundaries (e.g., the boundary between a rigid module and a flexible interdomain hinge site) often correspond to locations where these constants change abruptly. in fact, the hot spot regions did correspond to residues known experimentally to be important hinge sites or sites of dimerization. to further characterize this community - based organization, the authors next used protein - structure network analysis to build a network representation of hsp90 dynamics. they calculated cross - correlation matrices from the md simulations and identified residues with high degrees of centrality (the number of interacting residues) and betweenness (the frequency with which a given node lies along the shortest path in network space between two other nodes). based on this analysis, the authors concluded that hsp allosteric communication is mediated by highly stable central nodes, surrounded by residues with high degrees of betweenness that may shield the more critical residues from the random brownian / thermal motions common to all proteins. one straightforward approach is to consider any identified pocket other than the orthosteric to be allosteric. however, coupling these algorithms with techniques that account for pocket dynamics is often useful. some allosteric pocket conformations are extremely rare in the absence of the allosteric effector itself. cryptic pockets are not readily evident in static apo- or ligand - bound crystal structures, but they may be predictively sampled with molecular dynamics simulations. computational methods for pocket detection can be classified as geometry, knowledge, and energy based. we describe these three types of methods in sections 3.3.2, 3.3.3, and 3.3.4. geometry - based methods identify pockets by considering only the positions of the receptor atoms themselves. these methods are well - suited to situations where speed of computation is critical (e.g., when pocket detection is applied to conformations extracted from entire md trajectories) or where pockets are particularly well - defined. on the other hand, accuracy in pocket detection suffers when pockets are shallow, partially collapsed, or highly flexible. and pocket ranking by simple geometric metrics (e.g., volume) does not always correlate strongly with ligand binding affinities or druggability because geometry - based methods do not consider the chemical properties of a given pocket. they can be classified into three subcategories : sphere based, -shape based, and grid based. sphere - based methods, such as pass, phecom, pocasa, and surfnet, first cover protein surfaces with spheres. each sphere is evaluated and eliminated if judged unlikely to occupy a surface cavity. in contrast, methods such as apropos, cast, castp, and fpocket use -shape schemes to identify protein pockets. in brief, an -shape is like a convex hull, except that it potentially follows the surface of the source points more closely than a convex hull. the degree to which it deviates from the convex hull is controlled by the value (for more details, see edelsbrunner.). apropos compares multiple -shape representations of a protein at different values of. pockets are identified by subtracting higher - resolution in contrast, cast generates a voronoi diagram based on protein - atom locations, removes any voronoi edges and vertices that fall completely outside the receptor, and identifies pockets as collections of empty triangles (for details, see ref (211)). fpocket uses a voronoi tessellation to calculate receptor -spheres (i.e., spheres that include four protein atoms on their surface but no protein atoms in their interior). when clustered, these spheres tend to congregate at potential pocket sites. grid - based geometric methods for pocket detection include ghecom, ligsite, ligsite, pocket, pocket - picker, pocketfinder, q - sitefinder, and povme / povme pocket i d. these techniques consider points spaced along a grid that encompasses the protein receptor. each point is evaluated for the likelihood of pocket occupancy, and high - scoring points are clustered to identify binding pockets, whether orthosteric or allosteric. they include the presence of steric clashes with the protein, detected protein solvent protein events, buriedness indices, predicted methyl probe interaction energies, etc. as a representative example of the geometry - based class, consider povme / povme pocket i d, a grid - based pocket - finding algorithm. povme pocket i d identifies surface and internal cavities by first creating a low - resolution 3d grid of equidistant points that encompasses the entire protein. points are removed if they are physically near any protein heavy atom or fall outside the convex hull defined by the protein -carbons. the volumes corresponding to the remaining low - resolution points, which tend to encompass protein pockets, are then replaced with smaller, higher - resolution 3d grids, and the same point - eliminating process is repeated. finally, any remaining high - resolution points that have fewer than a user - defined number of neighbors are eliminated iteratively until no such points remain, and stretches of contiguous points are grouped together into distinct pockets. the locations of these identified pockets can be fed into the povme program, which calculates pocket metrics such as volume and shape. the latest version of povme can efficiently analyze entire md trajectories, allowing the user to monitor pocket changes over time and identify sampled conformations that are geometrically distinct. this approach is useful for identifying cryptic pockets that only occasionally manifest themselves over the course of an md simulation. knowledge - based algorithms draw on large structural and genomic databases to determine binding - pocket locations based on sequence and overall structure rather than pocket shape. algorithms such as 3dligandsite, findsite, and pocketome infer these locations by querying existing databases for ligand - bound proteins that are structurally similar to the target protein. these algorithms work particularly well when the target protein has a highly conserved binding site. other methods, such as frpred, use sequence conservation, in conjunction with supporting methods like surface - residue - prediction algorithms, to identify surface residues that are likely biologically important. finally, some hybrid methods, such as the evolutionary - trace method, conseq, and concavity, combine sequence and structural homology to identify likely binding pockets. the section single - site evolutionary analysis methods describes methods like these in further detail. energy - based methods identify binding sites by evaluating whether or not a given protein region interacts favorably with docked small organic probes. this additional information does come at a cost ; energy - based methods are more computationally demanding and so do not scale well, limiting their applicability when analyzing large - scale structural data sets or md trajectories. methods such as sitemap and sitehound use single probes (typically methane or water molecules) to assess the likelihood of small - molecule / protein binding. in contrast, methods such as ftmap, grid, and mcss consider multiple chemically diverse probes and so identify not only pockets, but also druggable hot spots that are more likely to function as orthosteric or allosteric binding sites. ftmap is the computational equivalent of the multiple solvent crystal structures (mscs) technique. rather than superimposing multiple crystal structures obtained by soaking a protein in six to eight different organic solvents, ftmap computationally docks 16 distinct organic probes into a user - provided protein model. the docked positions of these probes are then clustered, and the clusters are ranked by their boltzmann - averaged energies. in an alternate implementation called ftsite, adjacent, mutually accessible clusters are combined into sites that are then ranked by the number of nonbonded contacts between the protein and the corresponding probes. both these techniques can be applied to multiple structures, whether derived from x - ray crystallography or simulation, to potentially identify cryptic sites that are not always evident when single structures are considered. for example, ivetac. used it to detect five potentially druggable sites on 1ar and 2ar. it has also been used to evaluate the druggability of p53 cryptic pockets, which were subsequently used to prospectively discover novel reactivation compounds. over the past 10 years, markov state models (msms) have been used increasingly to analyze molecular dynamics simulations, suggesting that they are already promising tools to study allostery in a drug - discovery context. in brief, a markov state model is a stochastic kinetic model that describes the probability of transitioning between discrete states at a fixed time interval. these models are required to have the markovian property (i.e., that the probability of transitioning between discrete states is independent of previous transitions). by clustering protein structures extracted from an md trajectory, it is possible to identify discrete conformational states for use in msms. transitions between conformational clusters observed over the course of an md trajectory are tallied, and the msm is then built from the transition probabilities between these distinct clusters. as they are built solely on these transition probabilities, msms can draw upon multiple trajectories, enabling efficient sampling of the entire conformational space through many independent simulations carried out in parallel. msms can be built with the software package msmbuilder, available at http://msmbuilder.org / latest/. emma, available at http://www.emma-project.org/latest/, is another useful building tool. because independent trajectories are aggregated as a postprocessing step, the simulations can be carried out on a variety of computational resources, including independent desktop machines, local clusters, or high - performance computing resources. used tens of thousands of trajectories carried out on google s exascale cloud computing resources. by subsequently knitting together the simulation data within a msm framework, the researchers elucidated the activation pathway of gpcr 2ar. msm / md analysis provides access to the thermodynamic, kinetic, and structural characteristics of the protein conformational ensemble (i.e., a robust description of the free - energy landscape of the protein). the thermodynamics of the various conformational states can be calculated from the equilibrium distribution. it is also possible to resolve the transition kinetics between individual states, the concerted or principal protein motions, metastable states, and the transition pathways between discrete states. lastly, the md trajectories also provide representative receptor snapshots for use in structure - based drug design. md - based msms were originally developed to study protein folding, but they can also be used to study molecular phenomena that are directly applicable to allostery and drug discovery, including cryptic site identification, protein ligand interactions, and protein function. msms have been used to study binding - site conformational heterogeneity, revealing conformations that are not readily evident in any crystal structure. in 2012, bowman and co - workers used msms to identify and validate cryptic allosteric sites in tem-1 -lactamase, interleukin-2, and rnase h. similarly, in a recent study of gpcr conformational transitions, kohlhoff. identified intermediate conformations that they used successfully in a subsequent virtual - screening campaign. shukla and co - workers also identified a key conformational intermediate in the src kinase activation pathway that could be used as a target for drug discovery. while traditional molecular dynamics simulations have been used to identify cryptic allosteric sites and elucidate binding - site conformational diversity, markov state models can characterize the probability and dynamics of these conformations, permitting rational design against dynamic pockets. protein binding that are critical to both allosteric and orthosteric structure - based drug discovery. used msms derived from multiple independent md simulations to accurately determine the kon and binding free energy of benzamidine to trypsin. used msms in conjunction with metadynamics, a variant of molecular dynamics, to determine the koff for the same system. while this approach is currently too computationally demanding for virtual screening, it has identified transitory sites important for binding and shed new light on the interactions that govern ligand - binding kinetics. msms also provide useful insights into how a protein conformational ensemble begets function and transmits allosteric signals. most studies have focused on the transition between two functional states. in this context, msms have been used to study src kinase, the 2 adrenergic receptor (2ar), and bacterial response regulator ntrc. recently used this same technique to study allostery in the cyclic - nucleotide binding domain (cbd) of protein kinase a. by building and simulating models of the cbd, with and without bound camp, the study provided insight into how ligand binding modulates the protein conformational ensemble. as it is challenging to determine the impact of an effector molecule on the conformational ensemble, most msm studies to date have not examined allostery directly. this is best shown in our study of the pka cbd, where the effector molecule camp significantly modulates the kinetics of the transition from the active to the inactive states of the protein, while simultaneously leaving the reverse transition between the inactive and active states unmodified. this modulation seems to be regulated by transient interactions between the effector molecule and the protein. second, recent msm studies suggest that there is not one but many pathways between functional states. studies of 2ar, ntrc, and the pka cbd each revealed multiple transition pathways that arose from transient interactions within the system, suggesting a probabilistic model of allostery in addition to one that describes allostery in terms of concerted pathways. studies like these can provide useful insights applicable to structure - based drug discovery targeting transitional conformational states. ligand interactions and allostery, but building these models is computationally demanding, limiting their use as screening tools. this weakness aside, msms do provide a strong foundation for rational drug discovery and enhanced understanding of allosteric mechanisms. like msms, energy - landscape theories were originally developed to study protein folding. but they too can be applied to the study of allosteric mechanisms and protein dynamical modes. per statistical mechanics, the underlying free - energy landscape of a system determines the probability of observing a particular configuration. any topological analysis aimed at understanding allostery must be based on a thermodynamic understanding of the impact that effector binding has on this energy landscape. it is helpful to view allosteric binding as an event that perturbs the conformational exchange, or folding pathways, of a protein. the principles of statistical mechanics applied to polymers in solution have provided much insight into the protein - folding process. as proteins fold, the number of native contacts increases, and the entropy of the polymer decreases. folding is impossible when the required conformational transitions are occluded by large free - energy barriers or wells. for example, a large local minimum along the folding pathway could force a protein to undergo a glass transition, leading to a kinetically trapped state. (i.e., the folding pathway must be funnel shaped and relatively smooth). in terms of allostery and energy - landscape theory, a positive allosteric modulator can be seen as a compound that increases the likelihood of the binding state by deepening the binding - state well or decreasing the depth of competing wells. on the other hand, a negative allosteric modulator may shift the location of the binding - site well, shallow out the well, or increase the depth of competing wells. using these guiding principles, heuristics can be designed to identify each of the above scenarios. have developed a heuristic to pick out locally frustrated residues. while the overall folding process obeys the principle of minimum frustration, this does not preclude the possibility of having small local barriers that must be overcome to fold. to detect these local frustrations, the authors systematically perturbed the amino acid sequence and compared the perturbed total energy with that of the native state. this comparison provides the effective stabilization energy associated with each amino acid pair. if a given native - state interaction is highly stabilizing (i.e., the interaction energy is favorable compared to mutants), it is said to be minimally frustrated. on the other hand, if a pair of residues is sufficiently destabilizing (i.e., the interaction energy is weak compared with that of the mutants), it is frustrated. frustrated residues can be thought of as weak points in the global structure, contributing to barriers that may introduce slow degrees of freedom. as such jenik. have implemented this heuristic as a web server http://www.frustratometer.tk/. weinkam. used a dual - topology go model to survey the free - energy landscape of the calmodulin - gfp ca sensor protein, the maltose binding protein, and the csl transcription factor. they introduced a truncated gaussian distance term to the soft - sphere atom overlap term implemented in modeller, resulting in either one basin corresponding to the bound / unbound distances or two corresponding to both, depending on the pairwise distance and cutoff. subsequent md simulations of the resulting model were analyzed using their pseudocorrelation map algorithm. they found that their model reproduces allosteric motions and sheds insight into the macroscopic mechanism. protein dynamics and subsequent perturbations from binding events can also be studied using normal - mode analysis (nma). nma assumes that the potential energy landscape in the vicinity of a minimized atomic structure is approximately harmonic. this simplifying assumption allows for diagonalization of the hessian matrix. solving the eigenvalue problem produces the eigenvectors (movement direction) and eigenvalues (vibrational frequencies). nma is known to reproduce the slow degrees of freedom of protein motion well. applying additional constraints to simulate the impact of an effector on binding - site residues can yield new fundamental modes that may provide insight into the allosteric mechanism. ming and wall applied normal - mode analysis to investigate the effect of tri - n - acetyl - d - glucosamine upon lysozyme. they assumed that greater perturbation to the conformational distribution corresponds to increased likelihood that a binding event will occur at a regulatory or active site. the degree of perturbation is monitored by comparing the distributions predicted by nma of the protein with and without the ligand bound, via the kullback leibler divergence. in this work, ming and wall generated many arbitrary poses and investigated the allosteric potential, defined by the kld. the use of normal - mode analysis removes the need to integrate the equations of motion. however, for the harmonic approximations to be accurate, the starting structure needs to be in a local minima. an initial molecular mechanics minimization can ensure that proteins of interest are near what might be seen in their native environments (e.g., a gpcr embedded in a lipid bilayer with heterogeneous composition). however, alternate options include simplified interaction hamiltonians such as those offered by elastic network models (enms). the complexity and computational cost of simulating detailed atomic potentials inspired development of simpler enms in which uniform harmonic potentials are used to model all interactions. a popular enm is the gaussian network model (gnm), wherein neighboring residues are connected by virtual springs to create a network / graph of interactions. here the interatomic potential energy, u, of the system can be expressed as1where is the uniform force constant of the harmonic springs, r is the n - dimensional column vector of the instantaneous fluctuations of specific atoms, and is the n n kirchoff (connectivity) matrix of residue interactions given by2where rc is a residue cutoff distance. ming and wall have developed a backbone - enhanced elastic network model (benm) in which the interactions between connected residues are scaled by an additional factor. using an objective function defined by the kld of the marginal distribution of all - atom and c atomic coordinates, the authors showed that benm can reproduce the atomistic mean - squared displacement for bovine pancreatic trypsin inhibitor (bpti). to consider the effects of allostery, the authors again used the kld of local conformational distributions before and after ligand binding. to locate allosteric binding sites, su. all neighboring residues (represented by their corresponding c atoms) were connected by virtual harmonic springs of equivalent strength. a spherical probe then sampled the protein surface to locate the potential effector interaction points. additional springs were attached between the effector point and the local residues in the protein effector model. the free - energy difference (g) between the protein regions with large g values were assumed to be important for the allosteric mechanism. using this method, su. studied the hsp70 and the glua2 ampa receptors. used a similar coarse - grained network - interaction model to predict the location of allosteric sites. to identify potential pockets for effector / substrate binding, the authors generated a residue interaction graph (rig), with residues as nodes and interatomic contacts as edges. local closeness, defined as the number of total neighboring residues weighted by 1/r, where r is the inter - residue distance. regions with high local closeness were likely to be in pockets and, thus, were putative binding sites. the extent to which each binding site was coupled to the intrinsic protein motions was then explored by estimating the strain (so - called binding leverage) on ligand a ligand that bound to a site with high binding leverage could restrict protein dynamics. the binding leverage describes the extent to which changes in binding sites and protein conformational degrees of freedom are coupled ; it does not specifically predict allosterically linked sites. to predict allostery, mitternacht and berezovsky introduced leverage coupling, which selects for sites that are strongly coupled to the same degree of freedom. the mode associated with the most binding leverage is considered most relevant, based on the assumption that there is one dominant motion promoting allostery. over the past decade, advances in computing power and predictive algorithms coupled with the increased availability of structural and biochemical data have revealed new opportunities for rational design of allosteric drugs. the emergence of novel computational approaches to describe and predict allosteric phenomena across a range of scales, from the coordinated atomic movements in a single receptor molecule to complex allosteric signaling networks, is ushering in a new era wherein computational methods can be used to prospectively predict, discover, and characterize allosteric sites and effector molecules. within the context of a drug - discovery program, such approaches hold the potential for developing drugs with increased specificity and selectivity, as well as the ability to gain new and more comprehensive understanding of old targets. the convergence of advances in (i) theoretical msm - based frameworks and msm building software, (ii) community md codes that can achieve > 100 ns / day sampling for realistic sized systems on single gaming / commodity gpu processors, and (iii) pocket and druggable site - detection algorithms now make it possible for researchers even in industrial settings, with fast - paced timelines and stringent quality standards, to apply these approaches to drug targets already in their arsenals. the application of these methods to kinases and gpcrs seems particularly worthwhile, given the existence of assays and structural data, and the challenges faced by existing drug candidates in the clinic. | allosteric drug development holds promise for delivering medicines that are more selective and less toxic than those that target orthosteric sites. to date, the discovery of allosteric binding sites and lead compounds has been mostly serendipitous, achieved through high - throughput screening. over the past decade, structural data has become more readily available for larger protein systems and more membrane protein classes (e.g., gpcrs and ion channels), which are common allosteric drug targets. in parallel, improved simulation methods now provide better atomistic understanding of the protein dynamics and cooperative motions that are critical to allosteric mechanisms. as a result of these advances, the field of predictive allosteric drug development is now on the cusp of a new era of rational structure - based computational methods. here, we review algorithms that predict allosteric sites based on sequence data and molecular dynamics simulations, describe tools that assess the druggability of these pockets, and discuss how markov state models and topology analyses provide insight into the relationship between protein dynamics and allosteric drug binding. in each section, we first provide an overview of the various method classes before describing relevant algorithms and software packages. |
to create the building blocks that make up the synthetic promoters oligonucleotide pairs, each with a 5 phosphate, were annealed by being boiled and then slowly cooled to room temperature (see supplementary information for building block sequences). 15 l of 50 m double stranded building blocks were then ligated with 200u of t4 dna ligase (new england biolabs) for 2 hours at 16c. the ligation products were then purified using a microcon ym-100 column from millipore (billerica, ma) to reduce the number of short promoters. 15 ng of purified ligation product were then ligated into the bamh1 site of the integrating reporter plasmid pjg102 (20 ng) and transformed into e. coli. transformants were scraped into luria broth plus carbinecillan, grown overnight and then maxipreped using the genelute hp plasmid maxiprep kit from sigma (st. 130 g of the maxiprep was digested with bgli, bamh1, sal1 and ecor1 (200u each) and transformed into yeast as described in 22. colonies growing on medium lacking uracil were picked into 96 well plates and trp colonies were then identified by replica plating onto medium lacking tryptophan. we observed that some building blocks were represented slightly more than others, even though they were added at equal molar concentrations. the relative abundance of each building block in each library scaled similarly to the melting temperature of the building block. | transcription factor binding sites (tfbs) are being discovered at a rapid pace1, 2. we must now begin to turn our attention towards understanding how these sites work in combination to influence gene expression. quantitative models that accurately predict gene expression from promoter sequence3 - 5 will be a crucial part of solving this problem. here we present such a model based on the analysis of synthetic promoter libraries in yeast. thermodynamic models based only on the equilibrium binding of transcription factors to dna and to each other captured a large fraction of the variation in expression in every library. thermodynamic analysis of these libraries uncovered several phenomena in our system, including cooperativity and the effects of weak binding sites. when applied to the genome, a model of repression by mig1, which was trained on synthetic promoters, predicts a number of mig1 regulated genes that lack significant mig1 binding sites in their promoters. the success of the thermodynamic approach suggests that the information encoded by combinations of cis - regulatory sites is interpreted primarily through simple protein - dna and protein - protein interactions with complicated biochemical reactions, such as nucleosome modifications, being down stream events. quantitative analyses of synthetic promoter libraries will be an important tool in unraveling the rules underlying combinatorial cis - regulation. |
mast cells are the key effector cell of the biological response to anaphylaxis with the release of various mediators of inflammation. the frequency of anaphylaxis is approximately 502000 episodes/100,000 persons and has a lifetime prevalence of 0.052.0%. recent studies have shown that there is an increase in incidence and prevalence of anaphylaxis over the last 20 years. adrenaline is the life saving and first line of drug to be used for the treatment of anaphylaxis. several studies conducted previously reveals that there is a lack of knowledge regarding dose and route of administration of adrenaline and confusion in selecting the first line drug for treating the emergency condition among health care professionals. the aims and objectives of this study were to assess the knowledge of interns, medical students, and nursing students regarding anaphylaxis and to ascertain the knowledge regarding dose, route of administration, and concentration of the drug(s) used for its management. this cross - sectional study was conducted in a tertiary care teaching hospital after obtaining permission from the institutional ethical committee. health care providers (interns, final year nursing students and mbbs phase - ii) a questionnaire was developed comprised of ten questions, regarding knowledge about anaphylaxis and the drugs used in its management (appendix 1). knowledge regarding anaphylaxis was ascertained based on the number of questions each participant answered correctly. the response to the individual questions for the subjects in each group was analyzed separately. descriptive statistics was analyzed using epi - data analysis version v2.2.2.178 software (epidata association from denmark). the results were analyzed using the chi - square test, and p < 0.05 was considered as statistically significant. a total of 265 subjects participated in this study, of which 99 were 2 year medical students, 101 medical interns, and 65 were nursing students. of 265 subjects, 175 answered correctly the first question (# 1) regarding to which type of hypersensitivity reaction anaphylaxis belongs. one hundred and fifty - one (56.9%) subjects answered correctly the second question (# 2), indicating that they would select adrenaline as the first line of drug for anaphylaxis. among 151 subjects 40 (26.4%) answered the correct dose of adrenaline of which 25 (16.5%) of subjects selected that the preferred method of administration was intramuscular injection [figure 1 ], 14 (9.2%) selected subcutaneous injection, only eight (5.2%) selected intravenous injection. total percentage of correct response for each question the response to the first two questions (# 1, 2) was almost similar (65%, 69%) among interns and mbbs - ii students, respectively, when compared to the nursing students (37%). for the next three questions (# 3, 4, 5) regarding the dose, route and site of administration, medical students had better knowledge (27%, 47%, and 40%) than interns (16%, 19%, and 17%) and nursing students (11%, 18%, and 6%) respectively. the responses to the questions (# 6, 7, 8) related to the concentration of adrenaline for the intravenous, intramuscular and subcutaneous route, were answered incorrectly by all three groups [figure 2 ]. percentage of correct response in each group there was a statistical significant difference between medical students, interns and nursing students in response to questions (# 2, 4, 5) related to the first drug of choice, the route, and the site of administration of drug (p < 0.001) for the treatment of anaphylaxis, showing that medical students had more knowledge in these areas [table 1 ]. anaphylaxis, an acute life - threatening emergency condition, requires immediate treatment in order to prevent further progression and to prevent complications. the main purpose of this study was to assess the existing knowledge of interns, nursing students, and mbbs phase ii students regarding anaphylaxis and its medical management. it was observed that none of the subjects answered all the questions correctly. when the response to the individual questions were analyzed, 65.6% of subjects answered correctly to the question related to anaphylaxis (i.e., question numbers 1 and 2) and the response rate was poor in areas related to the medical management of anaphylaxis. previous studies have shown that 90.1% of medical professionals prefer adrenaline as the first line drug, with 38.3% preferring intramuscular route and 51.7% preferring intravenous adrenaline. our study has shown that the majority of subjects (56.9%) preferred adrenaline as the first line drug for the treatment of anaphylaxis. of 151 subjects, 16.5% preferred intramuscular injection as the most appropriate route of administration. this shows that the level of knowledge in our study was lower when compared to previous study. among the study subjects, medical students had better knowledge of anaphylaxis as regards the type of hypersensitivity reaction and as to which drug is used for first line treatment. another study has shown that 80 (73.3%) of participants correctly opted to use adrenaline as first - line treatment for anaphylaxis. in that study,, our study revealed that 67 (67.6%) medical students, 61 (60.3%) of interns and 23 (35.3%) of nursing students chose adrenaline (p < 0.001). in one prior study, the reason for not choosing adrenaline as first line drug by junior doctors was probably due to their concern with its potential adverse effect. another study comparing two district hospitals has shown that there was a lack of knowledge in a significant number of senior and junior doctors regarding the dose, route, and concentration of adrenaline. our study also showed similar results. in our study, of the 151 subjects who had answered adrenaline as the first line drug, only 40 knew the correct dose of adrenaline, out of which 25 subjects selected intramuscular injection as the preferred route of administration. the standard pediatric dose is 0.01 mg / kg, but the majority of the participants were unable to answer the correct dose. there was a lack of knowledge about the pediatric dose, the route and the concentration of adrenaline. the main limitation of our study was that it was a single - centered study with a small sample size and included only interns, medical, and nursing students. there is a need for the development of interventional strategies to fill the knowledge gap for the ideal anaphylaxis management. knowledge regarding anaphylaxis and its management is a basic requirement that every health care providers must acquire for the appropriate treatment of all patients. in our study, there was a lack of knowledge regarding the medical management of anaphylaxis in interns, mbbs phase ii students, and nursing students. proper initial training and periodic review and reinforcement of the steps in the treatment of anaphylaxis is necessary for all health care providers to achieve better patient care. | objectives : this study was conducted to assess the level of knowledge of health care providers regarding anaphylaxis and its management at a tertiary care teaching hospital.materials and methods : a pretested structured questionnaire was administered to interns, mbbs phase ii students, and nursing students. the subjects were asked to answer the questionnaire, which included questions regarding anaphylaxis and its management.results:of 265 subjects, 151 (56.9%) of subjects answered correctly that adrenaline is the first line of drug for the treatment of anaphylaxis. among 151 subjects, 40 (26.4%) answered the correct dose of adrenaline, of which 25 (16.5%) subjects selected intramuscular injection as the most appropriate route of administration. medical students ' performance was better than interns and nursing students on questions regarding dose, route, and site of adrenaline administration.conclusion:knowledge regarding the management of anaphylaxis was inadequate in almost all the health care providers who were included in the study. improved education and training of health care providers are necessary for better management of anaphylaxis. |
the presentations at the session demonstrated that current species recognition in lichen forming - fungi vastly underestimates the true number of species. based on phylogenetic and population studies, many cases were presented showing that numerous distinct lineages are hidden under a single species name. the issues raised can be grouped under the following headings : naming cryptic species, numbers of cryptic species, recognition of cryptic species, supporting species separations, and phylogeographic correlations. collectively, these presentations provide a synopsis of the current state of knowledge of cryptic speciation in lichen - forming fungi. the recognition and naming of cryptic species from cryptic lineages was discussed and approaches and options were suggested. hawksworth (2010) examined different groups as foraminifera, plant - pathogenic fungi, insects, and plants. the main species concepts were reviewed, and a pragmatic concept was proposed, defining a species as groups of individuals separated by inheritable discontinuities and which it is useful to give a species name to (hawksworth 1996, 2010). the term cryptic species was circumscribed as populations which are phylogenetically distinct and able to reproduce themselves, by sexual means or otherwise, but which are distinguished by molecular or other features that are either not evident macroscopically or generally overlooked (hawksworth 2010). an increasing number of lichen - forming species are used as biomonitors or bioindicators of pollutants, environmental disturbance, or ecological continuity. consequently there was the issue of how to proceed when cryptic species or lineages are found in taxa used in such studies where identifications need to be made quickly during field assessments and access to a modern molecular laboratory is impractical. an acceptable way of referring to such groups of species was commended by hawksworth (2010). the term complex or aggregate was supported as used when the populations are closely related, i.e. have a recent shared common ancestor. this practice is already familiar to and regularly used by botanists, citizen scientists, and ecologists dealing with complexes in plants, for example the rubus fruticosus aggr. and the taraxacum officinale aggr. in some situations, however, the option of recognizing subspecies was suggested as perhaps the most appropriate solution, for example in paraphyletic populations (fig. 1 and 2) such as that of parmelina pastillifera and p. tiliacea s. str. 1). in contrast, in cases where the cryptic taxa are not closely related but a result of convergence, i.e. they do not either occupy the same clade or have a recent common ancestor, it has to be recognized that the complex approach could give a misleading impression of affinity, as in parmelina cryptotiliacea (nez zapata. there is a growing body of evidence that the approach to current species recognition in lichenized fungi, which is largely based on morphology and chemistry, vastly underestimates the number of phylogenetic species. phylogenetic studies repeatedly indicate that numerous distinct lineages can be hidden under a single species name (arguello. 2007, baloch & grube 2009, grube & kroken 2000, kroken & taylor 2001, molina. re - examination of morphology against the background of a molecular phylogeny often reveals, sometimes subtle, and previously overlooked or viewed as unimportant, morphological and/or chemical characters, supporting the distinction of these clades at species level (arguello. 2008). however, there are also cases of cryptic species in which no morphological characters have yet been identified to distinguish distinct lineages. in several cases, phylogenetic studies identified distinct lineages that occur in different geographic regions, such as continents. the large and increasing number of cryptic lineages detected in fungi means that the recognition of these lineages as separate taxa is a major issue of current fungal taxonomy (crespo & prez - ortega 2009, hawksworth 2001). however, cryptic species in lichen - forming fungi may be compared to fungi with other biologies where morphological characters are almost absent, thus the pertinence of using this concept in lichens was discussed (hawksworth 2010, prez - ortega & printzen 2010). unlike many microscopic fungi, some groups of lichens form distinctive macroscopic structures, frequently with a foliose or fruticose form, and with easily observable phenotypical differences. despite these structures, the plasticity of morphological and chemical characters in these fungi results in a relatively high number of lichens, species or genera, being difficult for identification, often accompanied by a frequent lack of generative characters (divakar. 2010b) or the frequency of homoplasy and convergence of characters (grube & hawksworth 2007, muggia 2010, muggia. 2010, parnmen. although only relatively few lichens have yet been identified as comprising cryptic species using molecular data (grube & kroken 2000, kroken & taylor 2001, crespo. 2010a), assemblages of morphologically similar species where identification remains dubious due to variability or ambiguity of key characters used to distinguish those taxa are common. thus, morphological identification of a lichen - forming species, sometimes even a genus, can be difficult. therefore, cryptic taxa have been recognised historically in lichens, although not necessarily by that term. the recognition and characterization of cryptic species is a burgeoning and exciting activity in current systematics, and a major challenge for mycologists of all kinds, not least lichenologists (hawksworth 2010). suggestions for when to formally recognise species within cryptic lineages that are found in molecular studies were discussed (muggia 2010, prez - ortega & printzen 2010), and a consensus of the session was to recognise species formally when the phylogeny was unequivocal and other evidence supported their separation, whether ultramicroscopic, new morphological, ecological (muggia 2010) or geographical (parnmen. recent molecular phylogenies have supported some species separations that were previously based on subtle characters : for example, parmelina carporrhizans and p. quercina (argello. it is also frequently found that distantly related major lineages show a surprising degree of morphological convergence. for example, parmelina and austroparmelina were recently separated as independent genera based on geography and phylogeny. however, all species of austroparmelina were previously included in concept of the genus parmelina (crespo. also there are examples in microlichens, as in capnodiales where the morphologically similar genera racodium and cystocoleus belong to independent lineages in recent phylogenetic studies (muggia. a number of lichen - forming species were historically thought to have wide distributions, including cosmopolitan and pantropical species. however, while that may be so for some species, molecular analyses have repeatedly demonstrated that many lineages can be hidden under a similar morphology. several examples were discussed in the symposium (divakar 2010, muggia 2010, parnmen. divakar.. (2010) also found a correlation between reproductive modes and distribution patterns. in fertile species, cryptic lineages were frequently found, and geographically disjunct populations were discovered to represent different lineages (divakar. several examples of this type were presented, including melanelixia glabra and parmelina quercina, two species distributed in areas with winter rain (mediterranean climate) in north africa, europe and north america (argello., cryptic lineages have also been found, but in this case the lineages can include specimens from different geographical regions ; examples include flavoparmelia caperata, parmotrema reticulatum, and p. tinctorum (divakar. 2005, 2010). | this contribution provides a synopsis of the presentations and discussions during the sig session on cryptic speciation in lichen - forming fungi held during imc9. in several cases, a re - examination of morphology against the background of molecular phylogenetic evidence revealed, sometimes subtle, morphological and/or chemical characters, supporting the distinction of particular clades at species level. however, there are also examples of cryptic species in which no morphological characters could be identified to distinguish between lineages. several cases were presented in which distinct lineages are correlated with biogeographical patterns. when and how to name cryptic species was debated, and the use of terms such as complex or aggregate commended where the taxa formed part of a single lineage. |
the cystic fibrosis (cf) respiratory tract is inhabited by complex polymicrobial communities [14 ]. the sinonasal site has been proposed as a gateway and reservoir for subsequent pulmonary infection with the major cf pathogens like pseudomonas aeruginosa [5, 6 ]. to colonise and infect the lungs, the bacteria must first colonise the oropharynx and then, on occasion, pass this barrier. here, we report on the adherence of p. aeruginosa to oropharyngeal epithelial cells, namely buccal epithelial cells that were collected from cf patients during the initial and chronic phase of p. aeruginosa lung colonisation, and from p. aeruginosa - negative patients. based on an assay with radioactively labelled bacteria published in the late 1970s [7 ], we established a low - cost, nonradioactive assay of p. aeruginosa adherence to buccal epithelial cells that may be useful for patient monitoring or as a biomarker for clinical studies. |
|
a range of ii - vi semiconductor nanoheterostructures has been synthesized, including spherical core - shell particles, seeded nanorods, and seeded tetrapods. these heterostructures allow for sophisticated manipulation of photons and carriers at the nanoscale and exhibit many interesting phenomena, including extremely high extinction coefficients, polarized emission and high quantum yields. the synthesis of multicomponent nanostructures requires precise control over the composition, phase, shape, size, and connectivity of each component. control over these various factors relies largely on the ability to independently modulate the rate of nucleation and growth. one strategy to achieve independent control over nucleation and growth is to separate these two processes into separate synthetic steps. here, we will show how small seeds of cdse generated under reaction conditions optimized for nucleation and growth of spherical nanocrystals can then be transferred to a second flask where the growth of cds occurs under reaction conditions optimized for anisotropic growth of rod - shaped arms. by tuning the crystal structure of the cdse seed from wurtzite to zinc - blende, we will demonstrate how the morphology of cdse / cds heterostructures grown under similar conditions can be changed from a nanorod to a tetrapod, highlighting the precise control over phase, shape, and size afforded by state - of - the - art nanoparticle synthesis methods. nanostructures of the cadmium chalcogenides have served as a useful model - system for the development of new synthetic techniques, as this material system has been intensively explored ; although the synthesis of a particular nanostructure is shown in this video protocol, the same techniques are applicable to the synthesis of numerous other nanostructures. small differences in the techniques and reagents employed in nanoparticle syntheses have been shown to create dramatic differences in the final product. for instance, the temperature ramp rate and impurities present during the synthesis have been shown to dramatically impact the size and shape of the nanocrystals. with identification of the specific factors to which the synthetic procedures are highly sensitive, the reproducibility of nanocrystal syntheses continues to improve. this detailed video protocol is intended to help new practitioners in the field avoid many common pitfalls associated with the synthesis of nanoparticles. please use all appropriate safety practices when performing a nanocrystal reaction including the use of engineering controls (fume hood, glovebox) and personal protective equipment (safety glasses, gloves, lab coat, full - length pants, closed - toe shoes). preparation of cadmium (ii) myristate cadmium myristate can be synthesized in either an ex situ or in situ method, achieving similar results. ex situ preparation of cadmium myristate dissolve 0.240 g sodium hydroxide and 1.370 g myristic acid in 240 ml methanol.separately, dissolve 0.617 g cadmium nitrate tetrahydrate in 40 ml methanol.add the cadmium nitrate solution drop - wise (~1 drop / sec) to the stirring (800 rpm) sodium myristate solution using an addition funnel.filter the solution. g myristic acid in 5 ml 1-octadecene (ode) in a 50 ml 3-neck round bottom flask with a stir bar.heat the solution to 250 c under inert gas while stirring (800 rpm) until the solution becomes a pale yellow color. carefully swirl the solution as necessary to remove excess cdo from the sidewalls of the flask. leaving this solution at elevated temperature beyond this point will cause it to become an undesired black color.cool the solution to room temperature for use in subsequent reactions. ex situ preparation of cadmium myristate dissolve 0.240 g sodium hydroxide and 1.370 g myristic acid in 240 ml methanol.separately, dissolve 0.617 g cadmium nitrate tetrahydrate in 40 ml methanol.add the cadmium nitrate solution drop - wise (~1 drop / sec) to the stirring (800 rpm) sodium myristate solution using an addition funnel.filter the solution. dissolve 0.240 g sodium hydroxide and 1.370 g myristic acid in 240 ml methanol. separately, dissolve 0.617 g cadmium nitrate tetrahydrate in 40 ml methanol. add the cadmium nitrate solution drop - wise (~1 drop / sec) to the stirring (800 rpm) sodium myristate solution using an addition funnel. combine 39 mg cadmium oxide (cdo) with 0.137 g myristic acid in 5 ml 1-octadecene (ode) in a 50 ml 3-neck round bottom flask with a stir bar.heat the solution to 250 c under inert gas while stirring (800 rpm) until the solution becomes a pale yellow color. carefully swirl the solution as necessary to remove excess cdo from the sidewalls of the flask. leaving this solution at elevated temperature beyond this point will cause it to become an undesired black color.cool the solution to room temperature for use in subsequent reactions. combine 39 mg cadmium oxide (cdo) with 0.137 g myristic acid in 5 ml 1-octadecene (ode) in a 50 ml 3-neck round bottom flask with a stir bar. heat the solution to 250 c under inert gas while stirring (800 rpm) until the solution becomes a pale yellow color. carefully swirl the solution as necessary to remove excess cdo from the sidewalls of the flask. leaving this solution at elevated temperature beyond this point will cause it to become an undesired black color preparation of top : se precursor combine 58 mg selenium powder with 0.360 g tri - n - octylphosphine (top) under an inert atmosphere.sonicate until the selenium powder is fully dissolved, yielding an optically clear solution. alternatively, the solution can also be heated to 100 c in order to fully dissolve the selenium. use proper glassware or a glove box to prevent exposure of the solution to air during sonication or heating. combine 58 mg selenium powder with 0.360 g tri - n - octylphosphine (top) under an inert atmosphere. alternatively, the solution can also be heated to 100 c in order to fully dissolve the selenium. use proper glassware or a glove box to prevent exposure of the solution to air during sonication or heating. preparation of top : s precursor combine 0.160 g elemental sulfur with 1.853 g top.heat to 50 c under an inert atmosphere until the solution is optically clear. cool to room temperature for future use. combine 0.160 g elemental sulfur with 1.853 g top. synthesis of wurtzite cdse (w - cdse) nanocrystals combine 3.0 g trioctylphosphine oxide (topo), 280 mg n - octadecylphosphonic acid (odpa), and 60 mg cdo with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction and potential need for rapid cooling. assemble all glass - to - glass joints with high temperature vacuum grease.degas the mixture at 150 c under vacuum for 1 hr while stirring (800 rpm).heat the solution to 300 c under inert gas to form an optically clear solution. allow the solution to become optically clear again.add 1.5 g top drop - wise to the solution and raise the temperature to 370 c.rapidly inject top : se solution using a syringe with a large diameter (14 g) needle. the rapid injection will create a sharp nucleation event, promoting a narrow size distribution.let the reaction proceed for the desired duration, as the size of the w - cdse nanocrystal can be tuned by adjusting the reaction time. immediately cooling after the injection will yield nanocrystals of ~2 - 2.5 nm in diameter whereas reacting the solution for 3 and 5 min will yield ~3 nm and ~4 nm diameter nanocrystals, respectively.remove the heating mantle and rapidly cool the flask using a stream of compressed air. care should be taken when rapidly cooling a flask from elevated temperatures as the thermal shock may break the glassware. for this reason, the use of a water bath for rapid cooling is strongly discouraged.add 10 ml of anhydrous methanol to the solution when the temperature is below 60 c to flocculate the nanocrystals. add anhydrous methanol until the solution becomes turbid and centrifuge.repeat a similar cleaning procedure (step 2.1.9) using a different solvent / nonsolvent pair : hexane / isopropanol. this helps prevent situations in which the nanocrystals and precursors precipitate simultaneously.disperse the cleaned precipitate in a small volume (a few milliliters) of anhydrous toluene. the use of a small volume of solvent here will avoid the need to concentrate the particles as an additional step prior to their use in the seeded growth of cds.confirm the wurtzite crystal structure of the cdse nanocrystals by x - ray diffraction this step is strongly encouraged due to the polymorphism of cdse and the strong dependence on the structure of the cdse seed for the resulting heterostructures.dilute a small aliquot of the w - cdse stock solution by a known dilution factor and acquire a uv - vis absorption spectrum.determine the w - cdse nanocrystal diameter and extinction coefficient based upon the first exciton absorbance according to the following formulas : d = (1.612210)- (2.657510)+ (1.624210) - (0.4277) + 41.57 = 5857(d) where d is the diameter (nm) of the w - cdse nanocrystal, is the wavelength (nm) of the first excitonic absorption peak, and is the extinction coefficient (l / molcm) of nanocrystals at the first exciton.determine the concentration of the w - cdse nanocrystal stock solution using the absorbance at the first excitonic absorption peak in accordance with beer - lambert s law and the appropriate dilution factor.to prepare w - cdse for the growth of seeded rods, combine 0.5 g top with a volume of the w - cdse nanocrystal stock solution corresponding to 10 mol of w - cdse nanocrystals. the use of a small volume of toluene for the w - cdse stock solution in a prior step (2.1.11) should lead to only a small amount of toluene, on the order of microliters, in the seed solution used for the injection. the injection of larger volumes of volatile organic solvents, such as toluene, at temperatures substantially above their boiling point poses a safety hazard and will adversely affect the nanocrystal product due to large drops in reaction temperatures. combine 3.0 g trioctylphosphine oxide (topo), 280 mg n - octadecylphosphonic acid (odpa), and 60 mg cdo with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction and potential need for rapid cooling. degas the mixture at 150 c under vacuum for 1 hr while stirring (800 rpm). heat the solution to 300 c under inert gas to form an optically clear solution. add 1.5 g top drop - wise to the solution and raise the temperature to 370 c. rapidly inject top : se solution using a syringe with a large diameter (14 g) needle. the rapid injection will create a sharp nucleation event, promoting a narrow size distribution. let the reaction proceed for the desired duration, as the size of the w - cdse nanocrystal can be tuned by adjusting the reaction time. immediately cooling after the injection will yield nanocrystals of ~2 - 2.5 nm in diameter whereas reacting the solution for 3 and 5 min will yield ~3 nm and ~4 nm diameter nanocrystals, respectively. remove the heating mantle and rapidly cool the flask using a stream of compressed air. care should be taken when rapidly cooling a flask from elevated temperatures as the thermal shock may break the glassware. for this reason, the use of a water bath for rapid cooling is strongly discouraged. add 10 ml of anhydrous methanol to the solution when the temperature is below 60 c to flocculate the nanocrystals. repeat a similar cleaning procedure (step 2.1.9) using a different solvent / nonsolvent pair : hexane / isopropanol. disperse the cleaned precipitate in a small volume (a few milliliters) of anhydrous toluene. the use of a small volume of solvent here will avoid the need to concentrate the particles as an additional step prior to their use in the seeded growth of cds. this step is strongly encouraged due to the polymorphism of cdse and the strong dependence on the structure of the cdse seed for the resulting heterostructures. dilute a small aliquot of the w - cdse stock solution by a known dilution factor and acquire a uv - vis absorption spectrum. determine the w - cdse nanocrystal diameter and extinction coefficient based upon the first exciton absorbance according to the following formulas : d = (1.612210)- (2.657510)+ (1.624210) - (0.4277) + 41.57 = 5857(d) where d is the diameter (nm) of the w - cdse nanocrystal, is the wavelength (nm) of the first excitonic absorption peak, and is the extinction coefficient (l / molcm) of nanocrystals at the first exciton. determine the concentration of the w - cdse nanocrystal stock solution using the absorbance at the first excitonic absorption peak in accordance with beer - lambert s law and the appropriate dilution factor. to prepare w - cdse for the growth of seeded rods, combine 0.5 g top with a volume of the w - cdse nanocrystal stock solution corresponding to 10 mol of w - cdse nanocrystals. the use of a small volume of toluene for the w - cdse stock solution in a prior step (2.1.11) should lead to only a small amount of toluene, on the order of microliters, in the seed solution used for the injection. the injection of larger volumes of volatile organic solvents, such as toluene, at temperatures substantially above their boiling point poses a safety hazard and will adversely affect the nanocrystal product due to large drops in reaction temperatures. synthesis of zinc - blende cdse (zb - cdse) nanocrystals combine 0.17 g cadmium myristate and 37 ml ode with a stir bar in a 50 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. assemble all glass - to - glass joints with high temperature vacuum grease.degas the solution under vacuum at 90 c for 1 hr while stirring (800 rpm). subsequently, cool the solution to room temperature under inert gas.briefly remove the rubber septum and add 33 mg selenium dioxide powder to the flask. replace the septum. degas the solution under vacuum at 50 c for 15 min.heat to 240 c at a ramp rate of approximately 10 c / min under inert gas. as the temperature rises, the solution will begin to change color, progressing from yellow to red.add a previously degassed solution of 1 ml oleic acid and 1 ml oleylamine in 4 ml ode drop - wise when the solution reaches 240 c.react the solution for 30 min at 240 c. the size of the zb - cdse nanocrystals can be tuned by modifying the reaction time. take aliquots for absorption and photoluminescence spectra to monitor particle growth if desired.remove the heating mantle and cool to room temperature. transfer the crude solution to an inert atmosphere glove box and split the reaction mixture into 20 ml fractions in centrifuge vials.add 10 ml anhydrous acetone to each vial and centrifuge solutions to isolate the nanocrystals.pour off the supernatant and redisperse the precipitate in anhydrous toluene. add acetone until the solution becomes turbid and centrifuge.repeat a similar cleaning procedure (step 2.2.9) using a different solvent / nonsolvent pair : chloroform / methanol. this helps prevent situations in which the nanocrystals and precursors precipitate simultaneously.disperse the cleaned precipitate in a small volume (a few milliliters) of anhydrous chloroform. the use of a small volume of solvent here will avoid the need to concentrate the particles as an additional step prior to their use in the seeded growth of cds.after cleaning the particles, confirm the zinc - blende crystal structure of the cdse nanocrystals by x - ray diffraction this step is strongly encouraged due to the polymorphism of cdse and the strong dependence on the structure of the cdse seed for the resulting heterostructures.dilute a small aliquot of the zb - cdse stock solution by a known dilution factor and acquire a uv - vis absorption spectrum.determine the zb - cdse nanocrystal diameter and extinction coefficient based upon the first exciton absorbance according to the following formulas : = 19300 (d) where d is the diameter (nm) of the zb - cdse nanocrystal, eg the band gap energy (ev) corresponding to the first excitonic absorption peak, and is the extinction coefficient (l / molcm) of nanocrystals at 340 nm.determine the concentration of the zb - cdse nanocrystal stock solution using the absorbance at 340 nm in accordance with beer - lambert s law and the appropriate dilution factor.combine 0.5 g top with a volume of the zb - cdse nanocrystal stock solution corresponding to 10 mol of zb - cdse nanocrystals to prepare zb - cdse injection for the growth of seeded tetrapods. the use of a small volume of chloroform for the zb - cdse stock solution in a prior step (2.2.11) should lead to only a small amount of chloroform, on the order of microliters, in the seed solution used for the injection. the injection of larger volumes of volatile organic solvents, such as chloroform, at temperatures substantially above their boiling point poses a safety hazard and will adversely affect the nanocrystal product due to large drops in reaction temperatures. combine 0.17 g cadmium myristate and 37 ml ode with a stir bar in a 50 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. degas the solution under vacuum at 90 c for 1 hr while stirring (800 rpm). remove the rubber septum and add 33 mg selenium dioxide powder to the flask. replace the septum. heat to 240 c at a ramp rate of approximately 10 c / min under inert gas. as the temperature rises, the solution will begin to change color, progressing from yellow to red. add a previously degassed solution of 1 ml oleic acid and 1 ml oleylamine in 4 ml ode drop - wise when the solution reaches 240 c. the size of the zb - cdse nanocrystals can be tuned by modifying the reaction time. transfer the crude solution to an inert atmosphere glove box and split the reaction mixture into 20 ml fractions in centrifuge vials. add 10 ml anhydrous acetone to each vial and centrifuge solutions to isolate the nanocrystals. pour off the supernatant and redisperse the precipitate in anhydrous toluene. add acetone until the solution becomes turbid and centrifuge. repeat a similar cleaning procedure (step 2.2.9) using a different solvent / nonsolvent pair : chloroform / methanol. disperse the cleaned precipitate in a small volume (a few milliliters) of anhydrous chloroform. the use of a small volume of solvent here will avoid the need to concentrate the particles as an additional step prior to their use in the seeded growth of cds. after cleaning the particles, confirm the zinc - blende crystal structure of the cdse nanocrystals by x - ray diffraction. this step is strongly encouraged due to the polymorphism of cdse and the strong dependence on the structure of the cdse seed for the resulting heterostructures. dilute a small aliquot of the zb - cdse stock solution by a known dilution factor and acquire a uv - vis absorption spectrum. determine the zb - cdse nanocrystal diameter and extinction coefficient based upon the first exciton absorbance according to the following formulas : = 19300 (d) where d is the diameter (nm) of the zb - cdse nanocrystal, eg the band gap energy (ev) corresponding to the first excitonic absorption peak, and is the extinction coefficient (l / molcm) of nanocrystals at 340 nm. determine the concentration of the zb - cdse nanocrystal stock solution using the absorbance at 340 nm in accordance with beer - lambert s law and the appropriate dilution factor. combine 0.5 g top with a volume of the zb - cdse nanocrystal stock solution corresponding to 10 mol of zb - cdse nanocrystals to prepare zb - cdse injection for the growth of seeded tetrapods. the use of a small volume of chloroform for the zb - cdse stock solution in a prior step (2.2.11) should lead to only a small amount of chloroform, on the order of microliters, in the seed solution used for the injection. the injection of larger volumes of volatile organic solvents, such as chloroform, at temperatures substantially above their boiling point poses a safety hazard and will adversely affect the nanocrystal product due to large drops in reaction temperatures. synthesis of cdse / cds seeded nanorods combine 207 mg cdo, 1.08 g odpa, 3.35 g topo, and 15 mg propylphosphonic acid (ppa) with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. assemble all glass - to - glass joints with high temperature vacuum grease.degas the solution under vacuum at 120 c for 30 min while stirring (800 rpm).heat the solution to 320 c under inert gas to form an optically clear solution. degas the solution under vacuum for 1 hr at 120 c.after degassing and complexing the reaction solution, heat the mixture to 340 c under inert gas. inject 1.5 g top drop - wise and let the temperature recover to 340c.rapidly inject 0.65 g top : s using a syringe with a large diameter (14 g) needle.20 seconds after the top : s injection, rapidly inject w - cdse solution (10 mol w - cdse nanocrystals in 0.5 g top) using a syringe with a large diameter (14 g) needle.adjust the reaction temperature to 320 c. after 10 min at 320 c, remove the heating mantle and cool the solution.add ~10 ml anhydrous toluene to the flask when the temperature is around 100 c to prevent solidification of the topo.transfer the crude solution to a centrifuge vial. the purification of the crude solution of seeded rods can be performed in an inert atmosphere glovebox or ambient conditions, if desired, as the overgrowth of cds enhances the environmental stability of the nanocrystals. add an equal volume of anhydrous ethanol to flocculate the nanocrystals and centrifuge.pour off the supernatant and redispersed the precipitate in hexane / octylamine (8:1 by volume). redisperse precipitate in anhydrous toluene.occasionally, solutions of seeded rods will form a gel during the cleaning process. if this occurs, add a few drops of octylamine to dissolve the gel and continue the cleaning procedure. note : the length of the nanorods can be tuned by changing the concentration of injected cdse seeds ; higher seed concentrations lead to shorter rods. adjusting the top : s concentration will vary the rod diameter and length ; higher top : s concentration produces longer, thinner rods. combine 207 mg cdo, 1.08 g odpa, 3.35 g topo, and 15 mg propylphosphonic acid (ppa) with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. assemble all glass - to - glass joints with high temperature vacuum grease. degas the solution under vacuum at 120 c for 30 min while stirring (800 rpm). heat the solution to 320 c under inert gas to form an optically clear solution. after degassing and complexing the reaction solution, heat the mixture to 340 c under inert gas. rapidly inject 0.65 g top : s using a syringe with a large diameter (14 g) needle. 20 seconds after the top : s injection, rapidly inject w - cdse solution (10 mol w - cdse nanocrystals in 0.5 g top) using a syringe with a large diameter (14 g) needle. adjust the reaction temperature to 320 c. after 10 min at 320 c, add ~10 ml anhydrous toluene to the flask when the temperature is around 100 c to prevent solidification of the topo. the purification of the crude solution of seeded rods can be performed in an inert atmosphere glovebox or ambient conditions, if desired, as the overgrowth of cds enhances the environmental stability of the nanocrystals. pour off the supernatant and redispersed the precipitate in hexane / octylamine (8:1 by volume). if this occurs, add a few drops of octylamine to dissolve the gel and continue the cleaning procedure. note : the length of the nanorods can be tuned by changing the concentration of injected cdse seeds ; higher seed concentrations lead to shorter rods. adjusting the top : s concentration will vary the rod diameter and length ; higher top : s concentration produces longer, thinner rods. synthesis of cdse / cds seeded tetrapods combine 207 mg cdo, 1.08 g odpa, 3.35 g topo, and 50 mg ppa with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. assemble all glass - to - glass joints with high temperature vacuum grease.degas the solution under vacuum at 120 c for 1 hr while stirring (800 rpm).heat the solution to 280 c under inert gas to form an optically clear solution. carefully swirl the solution to remove excess cdo from the sidewalls of the flask. degas the solution under vacuum for 1 hr at 120 c.after degassing and complexing the reaction solution, heat the mixture to 300 c under inert gas. inject 1.5 g top drop - wise and let the temperature recover to its initial value.rapidly inject 0.65 g top : s using a syringe with a large diameter (14 g) needle.40 seconds after the top : s injection, rapidly inject zb - cdse solution (10 mol zb - cdse nanocrystals in 0.5 g top) using a syringe with a large diameter (14 g) needle.raise the reaction temperature to 315 c at a rate of 1 c / min. after 20 min at 315 c, remove the heating mantle and cool.add anhydrous toluene to the flask when the temperature is around 100 c to prevent solidification of the topo.transfer the crude solution to a centrifuge vial. the purification of the crude solution of seeded tetrapods can be performed in an inert atmosphere glovebox or ambient conditions, if desired, as the overgrowth of cds enhances the environmental stability of the nanocrystals. add anhydrous acetone until the solution becomes turbid and centrifuge.pour off the supernatant and redisperse the precipitate in hexane / octylamine (8:1 by volume). add anhydrous acetone until the solution becomes turbid and centrifuge.repeat the purification of the tetrapods twice more using toluene and acetone as the solvent and nonsolvent, respectively. store the tetrapods in toluene.separate tetrapods from undesired nanorod byproducts by centrifuging toluene solutions at 12,000 x g for 30 min to develop a concentration gradient due to the mass difference between rods and tetrapods. carefully remove and discard the upper layers, which contain mainly rods. note : the length of the tetrapod arms can be tuned by changing the injection seed concentration ; higher seed concentrations produce shorter arms. the growth time can be used to adjust the arm diameter ; longer growth times increase the diameter of the arms. see reference for details. the yield of tetrapods can be varied by using different amounts of ppa in the initial reaction mixture. combine 207 mg cdo, 1.08 g odpa, 3.35 g topo, and 50 mg ppa with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. degas the solution under vacuum at 120 c for 1 hr while stirring (800 rpm). heat the solution to 280 c under inert gas to form an optically clear solution. after degassing and complexing the reaction solution, heat the mixture to 300 c under inert gas. inject 1.5 g top drop - wise and let the temperature recover to its initial value. rapidly inject 0.65 g top : s using a syringe with a large diameter (14 g) needle. 40 seconds after the top : s injection, rapidly inject zb - cdse solution (10 mol zb - cdse nanocrystals in 0.5 g top) using a syringe with a large diameter (14 g) needle. raise the reaction temperature to 315 c at a rate of 1 c / min. add anhydrous toluene to the flask when the temperature is around 100 c to prevent solidification of the topo. the purification of the crude solution of seeded tetrapods can be performed in an inert atmosphere glovebox or ambient conditions, if desired, as the overgrowth of cds enhances the environmental stability of the nanocrystals. pour off the supernatant and redisperse the precipitate in hexane / octylamine (8:1 by volume). repeat the purification of the tetrapods twice more using toluene and acetone as the solvent and nonsolvent, respectively. store the tetrapods in toluene. separate tetrapods from undesired nanorod byproducts by centrifuging toluene solutions at 12,000 x g for 30 min to develop a concentration gradient due to the mass difference between rods and tetrapods. carefully remove and discard the upper layers, which contain mainly rods. note : the length of the tetrapod arms can be tuned by changing the injection seed concentration ; higher seed concentrations produce shorter arms. the growth time can be used to adjust the arm diameter ; longer growth times increase the diameter of the arms. see reference for details. the yield of tetrapods can be varied by using different amounts of ppa in the initial reaction mixture. preparation of cadmium (ii) myristate cadmium myristate can be synthesized in either an ex situ or in situ method, achieving similar results. ex situ preparation of cadmium myristate dissolve 0.240 g sodium hydroxide and 1.370 g myristic acid in 240 ml methanol.separately, dissolve 0.617 g cadmium nitrate tetrahydrate in 40 ml methanol.add the cadmium nitrate solution drop - wise (~1 drop / sec) to the stirring (800 rpm) sodium myristate solution using an addition funnel.filter the solution. g myristic acid in 5 ml 1-octadecene (ode) in a 50 ml 3-neck round bottom flask with a stir bar.heat the solution to 250 c under inert gas while stirring (800 rpm) until the solution becomes a pale yellow color. carefully swirl the solution as necessary to remove excess cdo from the sidewalls of the flask. leaving this solution at elevated temperature beyond this point will cause it to become an undesired black color.cool the solution to room temperature for use in subsequent reactions. ex situ preparation of cadmium myristate dissolve 0.240 g sodium hydroxide and 1.370 g myristic acid in 240 ml methanol.separately, dissolve 0.617 g cadmium nitrate tetrahydrate in 40 ml methanol.add the cadmium nitrate solution drop - wise (~1 drop / sec) to the stirring (800 rpm) sodium myristate solution using an addition funnel.filter the solution. dissolve 0.240 g sodium hydroxide and 1.370 g myristic acid in 240 ml methanol. separately, dissolve 0.617 g cadmium nitrate tetrahydrate in 40 ml methanol. add the cadmium nitrate solution drop - wise (~1 drop / sec) to the stirring (800 rpm) sodium myristate solution using an addition funnel. combine 39 mg cadmium oxide (cdo) with 0.137 g myristic acid in 5 ml 1-octadecene (ode) in a 50 ml 3-neck round bottom flask with a stir bar.heat the solution to 250 c under inert gas while stirring (800 rpm) until the solution becomes a pale yellow color. carefully swirl the solution as necessary to remove excess cdo from the sidewalls of the flask. leaving this solution at elevated temperature beyond this point will cause it to become an undesired black color.cool the solution to room temperature for use in subsequent reactions. combine 39 mg cadmium oxide (cdo) with 0.137 g myristic acid in 5 ml 1-octadecene (ode) in a 50 ml 3-neck round bottom flask with a stir bar. heat the solution to 250 c under inert gas while stirring (800 rpm) until the solution becomes a pale yellow color. carefully swirl the solution as necessary to remove excess cdo from the sidewalls of the flask. leaving this solution at elevated temperature beyond this point will cause it to become an undesired black color. preparation of top : se precursor combine 58 mg selenium powder with 0.360 g tri - n - octylphosphine (top) under an inert atmosphere.sonicate until the selenium powder is fully dissolved, yielding an optically clear solution. alternatively, the solution can also be heated to 100 c in order to fully dissolve the selenium. use proper glassware or a glove box to prevent exposure of the solution to air during sonication or heating. combine 58 mg selenium powder with 0.360 g tri - n - octylphosphine (top) under an inert atmosphere. alternatively, the solution can also be heated to 100 c in order to fully dissolve the selenium. use proper glassware or a glove box to prevent exposure of the solution to air during sonication or heating. preparation of top : s precursor combine 0.160 g elemental sulfur with 1.853 g top.heat to 50 c under an inert atmosphere until the solution is optically clear. cool to room temperature for future use. combine 0.160 g elemental sulfur with 1.853 g top. synthesis of wurtzite cdse (w - cdse) nanocrystals combine 3.0 g trioctylphosphine oxide (topo), 280 mg n - octadecylphosphonic acid (odpa), and 60 mg cdo with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction and potential need for rapid cooling. assemble all glass - to - glass joints with high temperature vacuum grease.degas the mixture at 150 c under vacuum for 1 hr while stirring (800 rpm).heat the solution to 300 c under inert gas to form an optically clear solution. carefully swirl the solution to remove excess cdo from the sidewalls of the flask. allow the solution to become optically clear again.add 1.5 g top drop - wise to the solution and raise the temperature to 370 c.rapidly inject top : se solution using a syringe with a large diameter (14 g) needle. the rapid injection will create a sharp nucleation event, promoting a narrow size distribution.let the reaction proceed for the desired duration, as the size of the w - cdse nanocrystal can be tuned by adjusting the reaction time. immediately cooling after the injection will yield nanocrystals of ~2 - 2.5 nm in diameter whereas reacting the solution for 3 and 5 min will yield ~3 nm and ~4 nm diameter nanocrystals, respectively.remove the heating mantle and rapidly cool the flask using a stream of compressed air. care should be taken when rapidly cooling a flask from elevated temperatures as the thermal shock may break the glassware. for this reason, the use of a water bath for rapid cooling is strongly discouraged.add 10 ml of anhydrous methanol to the solution when the temperature is below 60 c to flocculate the nanocrystals. transfer the solution to a vial under inert gas and centrifuge.decant the solution. discard the supernatant and redisperse the precipitate in anhydrous toluene. add anhydrous methanol until the solution becomes turbid and centrifuge.repeat a similar cleaning procedure (step 2.1.9) using a different solvent / nonsolvent pair : hexane / isopropanol. this helps prevent situations in which the nanocrystals and precursors precipitate simultaneously.disperse the cleaned precipitate in a small volume (a few milliliters) of anhydrous toluene. the use of a small volume of solvent here will avoid the need to concentrate the particles as an additional step prior to their use in the seeded growth of cds.confirm the wurtzite crystal structure of the cdse nanocrystals by x - ray diffraction this step is strongly encouraged due to the polymorphism of cdse and the strong dependence on the structure of the cdse seed for the resulting heterostructures.dilute a small aliquot of the w - cdse stock solution by a known dilution factor and acquire a uv - vis absorption spectrum.determine the w - cdse nanocrystal diameter and extinction coefficient based upon the first exciton absorbance according to the following formulas : d = (1.612210)- (2.657510)+ (1.624210) - (0.4277) + 41.57 = 5857(d) where d is the diameter (nm) of the w - cdse nanocrystal, is the wavelength (nm) of the first excitonic absorption peak, and is the extinction coefficient (l / molcm) of nanocrystals at the first exciton.determine the concentration of the w - cdse nanocrystal stock solution using the absorbance at the first excitonic absorption peak in accordance with beer - lambert s law and the appropriate dilution factor.to prepare w - cdse for the growth of seeded rods, combine 0.5 g top with a volume of the w - cdse nanocrystal stock solution corresponding to 10 mol of w - cdse nanocrystals. the use of a small volume of toluene for the w - cdse stock solution in a prior step (2.1.11) should lead to only a small amount of toluene, on the order of microliters, in the seed solution used for the injection. the injection of larger volumes of volatile organic solvents, such as toluene, at temperatures substantially above their boiling point poses a safety hazard and will adversely affect the nanocrystal product due to large drops in reaction temperatures. combine 3.0 g trioctylphosphine oxide (topo), 280 mg n - octadecylphosphonic acid (odpa), and 60 mg cdo with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction and potential need for rapid cooling. degas the mixture at 150 c under vacuum for 1 hr while stirring (800 rpm). heat the solution to 300 c under inert gas to form an optically clear solution. add 1.5 g top drop - wise to the solution and raise the temperature to 370 c. rapidly inject top : se solution using a syringe with a large diameter (14 g) needle. the rapid injection will create a sharp nucleation event, promoting a narrow size distribution. let the reaction proceed for the desired duration, as the size of the w - cdse nanocrystal can be tuned by adjusting the reaction time. immediately cooling after the injection will yield nanocrystals of ~2 - 2.5 nm in diameter whereas reacting the solution for 3 and 5 min will yield ~3 nm and ~4 nm diameter nanocrystals, respectively. remove the heating mantle and rapidly cool the flask using a stream of compressed air. care should be taken when rapidly cooling a flask from elevated temperatures as the thermal shock may break the glassware. for this reason, the use of a water bath for rapid cooling is strongly discouraged. add 10 ml of anhydrous methanol to the solution when the temperature is below 60 c to flocculate the nanocrystals. discard the supernatant and redisperse the precipitate in anhydrous toluene. add anhydrous methanol until the solution becomes turbid and centrifuge. repeat a similar cleaning procedure (step 2.1.9) using a different solvent / nonsolvent pair : hexane / isopropanol. disperse the cleaned precipitate in a small volume (a few milliliters) of anhydrous toluene. the use of a small volume of solvent here will avoid the need to concentrate the particles as an additional step prior to their use in the seeded growth of cds. this step is strongly encouraged due to the polymorphism of cdse and the strong dependence on the structure of the cdse seed for the resulting heterostructures. dilute a small aliquot of the w - cdse stock solution by a known dilution factor and acquire a uv - vis absorption spectrum. determine the w - cdse nanocrystal diameter and extinction coefficient based upon the first exciton absorbance according to the following formulas : d = (1.612210)- (2.657510)+ (1.624210) - (0.4277) + 41.57 = 5857(d) where d is the diameter (nm) of the w - cdse nanocrystal, is the wavelength (nm) of the first excitonic absorption peak, and is the extinction coefficient (l / molcm) of nanocrystals at the first exciton. determine the concentration of the w - cdse nanocrystal stock solution using the absorbance at the first excitonic absorption peak in accordance with beer - lambert s law and the appropriate dilution factor. to prepare w - cdse for the growth of seeded rods, combine 0.5 g top with a volume of the w - cdse nanocrystal stock solution corresponding to 10 mol of w - cdse nanocrystals. sonicate briefly if needed to redisperse the w - cdse nanocrystals in top. the use of a small volume of toluene for the w - cdse stock solution in a prior step (2.1.11) should lead to only a small amount of toluene, on the order of microliters, in the seed solution used for the injection. the injection of larger volumes of volatile organic solvents, such as toluene, at temperatures substantially above their boiling point poses a safety hazard and will adversely affect the nanocrystal product due to large drops in reaction temperatures. synthesis of zinc - blende cdse (zb - cdse) nanocrystals combine 0.17 g cadmium myristate and 37 ml ode with a stir bar in a 50 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. assemble all glass - to - glass joints with high temperature vacuum grease.degas the solution under vacuum at 90 c for 1 hr while stirring (800 rpm). subsequently, cool the solution to room temperature under inert gas.briefly remove the rubber septum and add 33 mg selenium dioxide powder to the flask. replace the septum. degas the solution under vacuum at 50 c for 15 min.heat to 240 c at a ramp rate of approximately 10 c / min under inert gas. as the temperature rises, the solution will begin to change color, progressing from yellow to red.add a previously degassed solution of 1 ml oleic acid and 1 ml oleylamine in 4 ml ode drop - wise when the solution reaches 240 c.react the solution for 30 min at 240 c. the size of the zb - cdse nanocrystals can be tuned by modifying the reaction time. take aliquots for absorption and photoluminescence spectra to monitor particle growth if desired.remove the heating mantle and cool to room temperature. transfer the crude solution to an inert atmosphere glove box and split the reaction mixture into 20 ml fractions in centrifuge vials.add 10 ml anhydrous acetone to each vial and centrifuge solutions to isolate the nanocrystals.pour off the supernatant and redisperse the precipitate in anhydrous toluene. add acetone until the solution becomes turbid and centrifuge.repeat a similar cleaning procedure (step 2.2.9) using a different solvent / nonsolvent pair : chloroform / methanol. this helps prevent situations in which the nanocrystals and precursors precipitate simultaneously.disperse the cleaned precipitate in a small volume (a few milliliters) of anhydrous chloroform. the use of a small volume of solvent here will avoid the need to concentrate the particles as an additional step prior to their use in the seeded growth of cds.after cleaning the particles, confirm the zinc - blende crystal structure of the cdse nanocrystals by x - ray diffraction this step is strongly encouraged due to the polymorphism of cdse and the strong dependence on the structure of the cdse seed for the resulting heterostructures.dilute a small aliquot of the zb - cdse stock solution by a known dilution factor and acquire a uv - vis absorption spectrum.determine the zb - cdse nanocrystal diameter and extinction coefficient based upon the first exciton absorbance according to the following formulas : = 19300 (d) where d is the diameter (nm) of the zb - cdse nanocrystal, eg the band gap energy (ev) corresponding to the first excitonic absorption peak, and is the extinction coefficient (l / molcm) of nanocrystals at 340 nm.determine the concentration of the zb - cdse nanocrystal stock solution using the absorbance at 340 nm in accordance with beer - lambert s law and the appropriate dilution factor.combine 0.5 g top with a volume of the zb - cdse nanocrystal stock solution corresponding to 10 mol of zb - cdse nanocrystals to prepare zb - cdse injection for the growth of seeded tetrapods. the use of a small volume of chloroform for the zb - cdse stock solution in a prior step (2.2.11) should lead to only a small amount of chloroform, on the order of microliters, in the seed solution used for the injection. the injection of larger volumes of volatile organic solvents, such as chloroform, at temperatures substantially above their boiling point poses a safety hazard and will adversely affect the nanocrystal product due to large drops in reaction temperatures. combine 0.17 g cadmium myristate and 37 ml ode with a stir bar in a 50 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. degas the solution under vacuum at 90 c for 1 hr while stirring (800 rpm). subsequently, cool the solution to room temperature under inert gas. briefly remove the rubber septum and add 33 mg selenium dioxide powder to the flask. heat to 240 c at a ramp rate of approximately 10 c / min under inert gas. as the temperature rises, the solution will begin to change color, progressing from yellow to red. add a previously degassed solution of 1 ml oleic acid and 1 ml oleylamine in 4 ml ode drop - wise when the solution reaches 240 c. the size of the zb - cdse nanocrystals can be tuned by modifying the reaction time. transfer the crude solution to an inert atmosphere glove box and split the reaction mixture into 20 ml fractions in centrifuge vials. add 10 ml anhydrous acetone to each vial and centrifuge solutions to isolate the nanocrystals. pour off the supernatant and redisperse the precipitate in anhydrous toluene. add acetone until the solution becomes turbid and centrifuge. repeat a similar cleaning procedure (step 2.2.9) using a different solvent / nonsolvent pair : chloroform / methanol. this helps prevent situations in which the nanocrystals and precursors precipitate simultaneously. disperse the cleaned precipitate in a small volume (a few milliliters) of anhydrous chloroform. the use of a small volume of solvent here will avoid the need to concentrate the particles as an additional step prior to their use in the seeded growth of cds. after cleaning the particles, confirm the zinc - blende crystal structure of the cdse nanocrystals by x - ray diffraction. this step is strongly encouraged due to the polymorphism of cdse and the strong dependence on the structure of the cdse seed for the resulting heterostructures. dilute a small aliquot of the zb - cdse stock solution by a known dilution factor and acquire a uv - vis absorption spectrum. determine the zb - cdse nanocrystal diameter and extinction coefficient based upon the first exciton absorbance according to the following formulas : = 19300 (d) where d is the diameter (nm) of the zb - cdse nanocrystal, eg the band gap energy (ev) corresponding to the first excitonic absorption peak, and is the extinction coefficient (l / molcm) of nanocrystals at 340 nm. determine the concentration of the zb - cdse nanocrystal stock solution using the absorbance at 340 nm in accordance with beer - lambert s law and the appropriate dilution factor. combine 0.5 g top with a volume of the zb - cdse nanocrystal stock solution corresponding to 10 mol of zb - cdse nanocrystals to prepare zb - cdse injection for the growth of seeded tetrapods. the use of a small volume of chloroform for the zb - cdse stock solution in a prior step (2.2.11) should lead to only a small amount of chloroform, on the order of microliters, in the seed solution used for the injection. the injection of larger volumes of volatile organic solvents, such as chloroform, at temperatures substantially above their boiling point poses a safety hazard and will adversely affect the nanocrystal product due to large drops in reaction temperatures. synthesis of cdse / cds seeded nanorods combine 207 mg cdo, 1.08 g odpa, 3.35 g topo, and 15 mg propylphosphonic acid (ppa) with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. assemble all glass - to - glass joints with high temperature vacuum grease.degas the solution under vacuum at 120 c for 30 min while stirring (800 rpm).heat the solution to 320 c under inert gas to form an optically clear solution. carefully swirl the solution to remove excess cdo from the sidewalls of the flask. degas the solution under vacuum for 1 hr at 120 c.after degassing and complexing the reaction solution, heat the mixture to 340 c under inert gas. inject 1.5 g top drop - wise and let the temperature recover to 340c.rapidly inject 0.65 g top : s using a syringe with a large diameter (14 g) needle.20 seconds after the top : s injection, rapidly inject w - cdse solution (10 mol w - cdse nanocrystals in 0.5 g top) using a syringe with a large diameter (14 g) needle.adjust the reaction temperature to 320 c. after 10 min at 320 c, remove the heating mantle and cool the solution.add ~10 ml anhydrous toluene to the flask when the temperature is around 100 c to prevent solidification of the topo.transfer the crude solution to a centrifuge vial. the purification of the crude solution of seeded rods can be performed in an inert atmosphere glovebox or ambient conditions, if desired, as the overgrowth of cds enhances the environmental stability of the nanocrystals. add an equal volume of anhydrous ethanol to flocculate the nanocrystals and centrifuge.pour off the supernatant and redispersed the precipitate in hexane / octylamine (8:1 by volume). redisperse precipitate in anhydrous toluene.occasionally, solutions of seeded rods will form a gel during the cleaning process. if this occurs, add a few drops of octylamine to dissolve the gel and continue the cleaning procedure. note : the length of the nanorods can be tuned by changing the concentration of injected cdse seeds ; higher seed concentrations lead to shorter rods. adjusting the top : s concentration will vary the rod diameter and length ; higher top : s concentration produces longer, thinner rods. combine 207 mg cdo, 1.08 g odpa, 3.35 g topo, and 15 mg propylphosphonic acid (ppa) with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. degas the solution under vacuum at 120 c for 30 min while stirring (800 rpm). heat the solution to 320 c under inert gas to form an optically clear solution. carefully swirl the solution to remove excess cdo from the sidewalls of the flask. allow the solution to become optically clear again. after degassing and complexing the reaction solution, heat the mixture to 340 c under inert gas. rapidly inject 0.65 g top : s using a syringe with a large diameter (14 g) needle. 20 seconds after the top : s injection, rapidly inject w - cdse solution (10 mol w - cdse nanocrystals in 0.5 g top) using a syringe with a large diameter (14 g) needle. adjust the reaction temperature to 320 c. after 10 min at 320 c, remove the heating mantle and cool the solution. add ~10 ml anhydrous toluene to the flask when the temperature is around 100 c to prevent solidification of the topo. the purification of the crude solution of seeded rods can be performed in an inert atmosphere glovebox or ambient conditions, if desired, as the overgrowth of cds enhances the environmental stability of the nanocrystals. pour off the supernatant and redispersed the precipitate in hexane / octylamine (8:1 by volume). if this occurs, add a few drops of octylamine to dissolve the gel and continue the cleaning procedure. note : the length of the nanorods can be tuned by changing the concentration of injected cdse seeds ; higher seed concentrations lead to shorter rods. adjusting the top : s concentration will vary the rod diameter and length ; higher top : s concentration produces longer, thinner rods. synthesis of cdse / cds seeded tetrapods combine 207 mg cdo, 1.08 g odpa, 3.35 g topo, and 50 mg ppa with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. assemble all glass - to - glass joints with high temperature vacuum grease.degas the solution under vacuum at 120 c for 1 hr while stirring (800 rpm).heat the solution to 280 c under inert gas to form an optically clear solution. carefully swirl the solution to remove excess cdo from the sidewalls of the flask. allow the solution to become optically clear again.cool the solution to 120 c. degas the solution under vacuum for 1 hr at 120 c.after degassing and complexing the reaction solution, heat the mixture to 300 c under inert gas. inject 1.5 g top drop - wise and let the temperature recover to its initial value.rapidly inject 0.65 g top : s using a syringe with a large diameter (14 g) needle.40 seconds after the top : s injection, rapidly inject zb - cdse solution (10 mol zb - cdse nanocrystals in 0.5 g top) using a syringe with a large diameter (14 g) needle.raise the reaction temperature to 315 c at a rate of 1 c / min. after 20 min at 315 c, remove the heating mantle and cool.add anhydrous toluene to the flask when the temperature is around 100 c to prevent solidification of the topo.transfer the crude solution to a centrifuge vial. the purification of the crude solution of seeded tetrapods can be performed in an inert atmosphere glovebox or ambient conditions, if desired, as the overgrowth of cds enhances the environmental stability of the nanocrystals. add anhydrous acetone until the solution becomes turbid and centrifuge.pour off the supernatant and redisperse the precipitate in hexane / octylamine (8:1 by volume). add anhydrous acetone until the solution becomes turbid and centrifuge.repeat the purification of the tetrapods twice more using toluene and acetone as the solvent and nonsolvent, respectively. store the tetrapods in toluene.separate tetrapods from undesired nanorod byproducts by centrifuging toluene solutions at 12,000 x g for 30 min to develop a concentration gradient due to the mass difference between rods and tetrapods. note : the length of the tetrapod arms can be tuned by changing the injection seed concentration ; higher seed concentrations produce shorter arms. the growth time can be used to adjust the arm diameter ; longer growth times increase the diameter of the arms. see reference for details. the yield of tetrapods can be varied by using different amounts of ppa in the initial reaction mixture. combine 207 mg cdo, 1.08 g odpa, 3.35 g topo, and 50 mg ppa with a stir bar in a 25 ml 3-neck round bottom flask equipped with a thermocouple (inserted in a custom glass adapter or punctured through a rubber septum), a reflux condenser, and a rubber septum. inspect all glassware for defects prior to use due to the high temperature of reaction. degas the solution under vacuum at 120 c for 1 hr while stirring (800 rpm). heat the solution to 280 c under inert gas to form an optically clear solution. after degassing and complexing the reaction solution, heat the mixture to 300 c under inert gas. inject 1.5 g top drop - wise and let the temperature recover to its initial value. rapidly inject 0.65 g top : s using a syringe with a large diameter (14 g) needle. 40 seconds after the top : s injection, rapidly inject zb - cdse solution (10 mol zb - cdse nanocrystals in 0.5 g top) using a syringe with a large diameter (14 g) needle. raise the reaction temperature to 315 c at a rate of 1 c / min. add anhydrous toluene to the flask when the temperature is around 100 c to prevent solidification of the topo. the purification of the crude solution of seeded tetrapods can be performed in an inert atmosphere glovebox or ambient conditions, if desired, as the overgrowth of cds enhances the environmental stability of the nanocrystals. pour off the supernatant and redisperse the precipitate in hexane / octylamine (8:1 by volume). repeat the purification of the tetrapods twice more using toluene and acetone as the solvent and nonsolvent, respectively. store the tetrapods in toluene. separate tetrapods from undesired nanorod byproducts by centrifuging toluene solutions at 12,000 x g for 30 min to develop a concentration gradient due to the mass difference between rods and tetrapods. carefully remove and discard the upper layers, which contain mainly rods. note : the length of the tetrapod arms can be tuned by changing the injection seed concentration ; higher seed concentrations produce shorter arms. the growth time can be used to adjust the arm diameter ; longer growth times increase the diameter of the arms. see reference for details. the yield of tetrapods can be varied by using different amounts of ppa in the initial reaction mixture. absorption spectra, photoluminescence (pl) spectra, x - ray diffraction (xrd) patterns, and transmission electron microscopy (tem) images were collected for the seeds (figure 1) and the final heterostructures (figure 2). the absorption and pl spectra (a, b) absorption (black) and pl (red) spectra with inset of tem images of wurtzite and zinc - blende cdse nanocrystals, respectively. (c, d) x - ray diffraction patterns of wurtzite and zinc - blende cdse nanocrystals with the line patterns of corresponding bulk materials provided for reference. (a, b) tem images of cdse / cds nanorods and cdse / cds tetrapods, respectively. (e, f) absorption (black) and pl (red) spectra of cdse / cds nanorods and tetrapods. the optical spectra for the w - cdse and zb - cdse seeds exhibit clear excitonic absorption (figures 1a and 1b) as the seeds are highly monodisperse ; the energy of the first exciton corresponds to diameters of 3.3 nm and 3.6 nm for w - cdse and zb - cdse, respectively. the seeds also exhibit strong photoluminescence, with quantum yields ranging from approximately 3 - 30%, depending on the method of preparation of the sample ; for instance, a greater number of cleaning steps tends to remove the surface ligands and lead to lower quantum yields. the narrow full width at half - maximum of the pl peak (31 nm and 33 nm for the w - cdse and zb - cdse nanocrystals, respectively) is consistent with size distributions of 5 - 10%. the x - ray diffraction patterns collected for the seeds (figures 1c and 1d) confirm that they are of the desired phase. the wurtzite phase has clear reflections at 41.1 and 53.8 that are absent for the zinc - blende phase. the differences in the crystal structure of the cdse seeds lead to dramatically different morphologies of the final heterostructure (figures 2a and 2b). w - cds nucleates and grows from the (001) and (00) facets of the w - cdse, leading to a final rod - shaped particle since there is uniaxial growth. in contrast, w - cds nucleates and grows off the { 111 } facets of zb - cdse. of the eight { 111 } facets, four exhibit lower coordinative saturation than the others ; as a result, we observe more rapid growth of w - cds off of these four facets, which leads to a tetrapod morphology. the seeded rods and tetrapods display high crystallinity, corresponding to wurtzite cds as confirmed by xrd (figures 2c and 2d). because the cds portion of the heterostructures is much larger compared to the cdse seed, the absorption due to the seeds is a small percentage of the overall absorption. as a result, the heterostructures absorb weakly at wavelengths longer than 500 nm, where the majority of absorption is due to the cdse seed (figures 2e and 2f). at wavelengths shorter than 500 nm, absorption is dramatically enhanced since the larger bandgap cds begins to absorb significantly. the extinction coefficients for the seeds are on the order of 10 mcm, while the rods and tetrapods have significantly enhanced extinction coefficients of 10 mcm and 10 mcm, respectively. for both the rods and tetrapods, the first excitonic transition for the heterostructures is red - shifted compared to the bare seeds (figures 2e and 2f) since the electrons and holes are spread out over a larger particle. depending on the particular size of the components of the heterostructure and the resulting band structure, the hole tends to be somewhat confined to the seed while the electron is more free to move throughout the entire particle. as a result, recombination occurs away from the particle surface, leading to quantum yields for rods above 75% and for tetrapods between 35 - 70%, which are significantly higher than that of the bare cdse seeds. furthermore, the inorganic passivation from the cds on the cdse seeds provides enhanced environmental stability. we have demonstrated a method for controlling the final morphology of a nanoscale heterostructure via control over the crystal structure of the seed. this same seeded - growth approach has already been applied to a wide range of structures, and we expect that the types of heterostructures that can be synthesized by this approach will continue to expand. | we demonstrate a method for the synthesis of multicomponent nanostructures consisting of cds and cdse with rod and tetrapod morphologies. a seeded synthesis strategy is used in which spherical seeds of cdse are prepared first using a hot - injection technique. by controlling the crystal structure of the seed to be either wurtzite or zinc - blende, the subsequent hot - injection growth of cds off of the seed results in either a rod - shaped or tetrapod - shaped nanocrystal, respectively. the phase and morphology of the synthesized nanocrystals are confirmed using x - ray diffraction and transmission electron microscopy, demonstrating that the nanocrystals are phase - pure and have a consistent morphology. the extinction coefficient and quantum yield of the synthesized nanocrystals are calculated using uv - vis absorption spectroscopy and photoluminescence spectroscopy. the rods and tetrapods exhibit extinction coefficients and quantum yields that are higher than that of the bare seeds. this synthesis demonstrates the precise arrangement of materials that can be achieved at the nanoscale by using a seeded synthetic approach. |
the smile design theory can be broken down into four parts : facial esthetics, gingival esthetics, microesthetics and macroesthetics. gingival esthetics involves health of the gingiva, shape of the interdental papilla and the presence or absence of black triangles. microesthetic features involve the anatomy of the anterior teeth, incisal translucency, characterization and lobe development. golden proportion is based on the theory that a relationship exists between the beauty in nature and mathematics. it states that the width of maxillary lateral incisor, when viewed from front, should be in golden proportion to the width of maxillary central incisor. thus, the width of maxillary lateral incisor should be 62% the width of maxillary central incisor and the width of maxillary canine should be 62% the width of resulting lateral incisor. golden percentage proportion given by snow states that the width of maxillary central incisor should be 25% the intercanine distance, when measured from distal of canine on one side to the distal of canine on the contralateral side in the frontal view. width of maxillary lateral incisors and canines should be 15 and 10%, respectively, of the intercanine distance [figure 1 ]. golden proportion : calculating the width of maxillary anterior teeth using the golden proportion preston in 1993 studied the existence of golden proportion in natural dentition and found that only 17% of the maxillary lateral incisors width was in golden proportion with the width of maxillary central incisors and none of the canines width were in golden proportion to the width of maxillary lateral incisor. he proposed preston 's proportion, that is, the width of maxillary lateral incisor should be 66% the width of central incisors and the width of maxillary canines should be 55% the width of maxillary central incisors in the frontal view [figure 2 ]. preston 's proportion : calculating the width of maxillary anterior teeth using preston 's proportion ward[68 ] in 2000 proposed recurring esthetic dental (red) proportion based on the different heights of the maxillary anterior teeth, which had not been considered in any of the proportions mentioned above. tooth height and desired recurring esthetic dental proportion golden proportion is one of the red proportions for fifteen male subjects and 15 female subjects in each age group of 1823 years, 2429 years and 3035 years were selected for this study (total 90). restorations in anterior teeth malalignment of anterior teeth congenital or acquired facial and dental defects history of orthodontic treatment photographs of the subjects were taken from the frontal view with nikon d200 camera, 135 mm lens with a tripod, at a distance of 1 m, and by the same and single investigator throughout the study. the width and height of maxillary central incisors, lateral incisors and canines were measured using the scale tool provided in the software [figure 3 ]. (a) subject with well - aligned dentition, measuring the (b) height and (c) width of maxillary central incisors using the adobe photoshop cs4 extended software magnification was calculated by finding out the ratio between the actual height of central incisors measured on the subject 's cast and height of the central incisors measured using the photograph. once the magnification was calculated, the actual height of the central incisors was found out. depending on the maximum and minimum values for the height of central incisors, central incisors were divided into three categories small, medium and tall. then, the following ratios were computed : 1) ra1 (ratio of the width of maxillary lateral incisors to central incisors), 2) ra2 (ratio of the width of maxillary canines to lateral incisors), 3) ra3 (ratio of the height of maxillary lateral incisors to central incisors), and 4) ra4 (ratio of the height of canines to lateral incisors) [figure 3 ]. restorations in anterior teeth malalignment of anterior teeth congenital or acquired facial and dental defects history of orthodontic treatment photographs of the subjects were taken from the frontal view with nikon d200 camera, 135 mm lens with a tripod, at a distance of 1 m, and by the same and single investigator throughout the study. the width and height of maxillary central incisors, lateral incisors and canines were measured using the scale tool provided in the software [figure 3 ]. (a) subject with well - aligned dentition, measuring the (b) height and (c) width of maxillary central incisors using the adobe photoshop cs4 extended software magnification was calculated by finding out the ratio between the actual height of central incisors measured on the subject 's cast and height of the central incisors measured using the photograph. once the magnification was calculated, the actual height of the central incisors was found out. depending on the maximum and minimum values for the height of central incisors, central incisors were divided into three categories small, medium and tall. then, the following ratios were computed : 1) ra1 (ratio of the width of maxillary lateral incisors to central incisors), 2) ra2 (ratio of the width of maxillary canines to lateral incisors), 3) ra3 (ratio of the height of maxillary lateral incisors to central incisors), and 4) ra4 (ratio of the height of canines to lateral incisors) [figure 3 ]. we can see from table 2 that the mean ra1 (lateral incisor to central incisor width ratio) for small category teeth was 73% (proposed ratio 80%), for medium teeth was 72% (proposed 76%) and for tall teeth was 71% (proposed 62%). similarly, the mean ra2 (canine to lateral incisor width ratio) for teeth of all the three categories was found to be different as compared to that proposed by ward in red proportion. comparison of mean values of ratio of the various tooth also, the mean ra1 (lateral incisor to central incisor width ratio) for small category teeth was not similar to ra2 (canine to lateral incisor width ratio) and similar results were obtained for medium- and tall-sized teeth. the average lateral to central incisor height ratio was found to be 84% in tall-sized teeth and 84% for small- and medium-sized teeth. golden proportion was given by levin[1911 ] based on the principle that there exists a relationship between the beauty in nature and mathematics and the same principle was applied in designing the width of maxillary anterior teeth. preston in 1993 studied the existence of golden proportion in natural dentition with pleasant smiles and found that golden proportion was hardly seen in the natural dentition and proposes his own preston 's proportion. stephen rosenstiel and ward in 2000 in their web - based study were the first to consider the importance of length of teeth in determining the width of maxillary anterior teeth. in case of tall central incisors, lesser width of lateral incisors and canines is desired for an esthetic smile so that the width proportion is less, while in case of small-sized central incisor teeth, greater width of lateral incisors and canines is desired so that the width proportion is more. golden proportion of 62% is one of the red proportions for tall-sized teeth. the study was conducted to evaluate the existence of red proportion proposed by rosenstiel and ward in a small section of indian population with pleasant smiles. the teeth were divided into three categories, and it was found that in none of the three categories the maxillary lateral incisor to central incisor width ratio was similar to that proposed, and the maxillary lateral incisor to central incisor width ratio was also not similar to maxillary canine and lateral incisor width ratio, the two ratios were not seen recurring. the reason for such a finding could be that the proportions proposed by ward and rosenstiel in 2000 were basically computer and software based and no efforts were made to check if these proportions really exist in the natural dentition. the results obtained were similar to that obtained in the study done by shreenivasan in 2008. the study was conducted on 56 subjects and red proportion was not seen in the natural dentition. it was also concluded that the width of maxillary anterior teeth follows more closely the golden percentage proportion given by snow in 1999. none of the proportions mentioned in the literature describe about the relative height of lateral incisors and canines to be used along with the widths during the smile designing. in this study, relative heights of lateral incisors and canines were also determined to estimate the height of lateral incisor and canine in cases of esthetic reconstruction. the term medium has been used for the second category of central incisors instead of normal as proposed by ward, as the tall-sized teeth may be normal for subjects with long faces. as a general rule, while designing smile, neither of the proportions can be taken as a sole criterion to determine the width of maxillary anterior teeth. heights of the lateral incisors and canines can be roughly determined (not mentioned in any proportions) using results obtained from this study. again, these need to be modified according to age, sex, personality and profession as the width of maxillary anterior teeth. major limitation of this study was the small sample size and further studies need to be undertaken with a large sample size. second limitation is the lack of definitive sizes according to which the central incisors were divided into three categories that is small, medium and tall, which is not mentioned in the original article proposed by ward. in this study, the central incisors were divided accordingly based on the highest and lowest values for the height (central incisors) obtained. within the limitations of the study, red proportion was not seen in the natural dentition. medium-sized teeth was found to be 88% and for tall-sized teeth was found to be 84%. medium-sized teeth was found to be 106% and for tall-sized teeth was found to be 105%. | background : different proportions are described in the literature for smile designing, such as golden proportion, golden percentage, preston 's proportion, and recently, recurring esthetic dental (red) proportion.aims and objectives : to evaluate the existence of red proportion in natural dentition. to determine the relative height of maxillary lateral incisor and canine occurring in natural dentition so that it can be used in any of the above proportions.materials and methods : fifteen male subjects and 15 female subjects in each of the different age groups of 1823 years, 2429 years and 3035 years were selected for this study (total 90). photographs of the subjects were taken using nikon d200 camera with 135 mm lens and analyzed using adobe photoshop cs4 extended software. the height and width of maxillary central incisors, lateral incisors and canines were found out using the measuring tool provided in the software.results:average width ratio and height ratio of maxillary lateral incisor to central incisor and maxillary canine to lateral incisor were calculated to check the existence of red proportion in natural dentition. average lateral incisor to central incisor height ratio for small- and medium-sized teeth was found to be 88% and for tall-sized teeth was found to be 84%. average canine to lateral incisor height ratio for small- and medium-sized teeth was found to be 106% and for tall-sized teeth was found to be 105%.conclusions : within the limitations of the study, red proportion was not seen in natural dentition. |
according to the korean society for the study of obesity, about 30% of the korean population is classified as overweight or obese, which has been linked to the development of various malignant diseases, including colorectal cancer and breast cancer. according to data from the korea central cancer registry in 2008, the onset of prostate cancer has been sharply increasing since 1999. in 2008, a ratio of 26.1 new cases of prostate cancer per 100,000 persons was reported, and by virtue of developments in diagnostic methods such as prostate - specific antigen (psa) and transrectal ultrasonography, the onset rate is rapidly increasing. a recent epidemiologic study reported that obesity may be protective against the development of early stage prostate cancer. on the contrary, other studies have shown that obesity may be associated with an increased risk of advanced disease and death from prostate cancer.. reported higher rates of positive surgical resection margins and biochemical recurrence in obese patients with localized prostate cancer undergoing radical prostatectomy than in normal - weight patients. that report is considered to be a representative example of an association between obesity and localized prostate cancer. as aforementioned, most studies on the relationship between body mass index (bmi) and the prognosis of prostate cancer patients have focused on localized prostate cancer. to our knowledge, studies are lacking on the relation between bmi and castration - resistant prostate cancer (crpc). thus, we proposed to analyze the prognostic value of bmi in korean patients with crpc. a retrospective study was conducted of 55 patients who were diagnosed with prostate cancer and who received hormonal therapy for local or distant metastasis. all patients received docetaxel chemotherapy owing to the development of crpc between january 2003 and december 2009 at our institution. this study was approved by the institutional review board of seoul national university bundang hospital. crpc was defined as cases of an increased psa level despite a serum testosterone level in the castrate range, a psa level that increased 3 consecutive times despite interruption of administrating antiandrogen agents for 4 to 8 weeks or despite secondary hormonal treatment owing to advancement of the metastatic lesion, or the new development of a measurable metastatic lesion as assessed by imaging or an increase in size. bmi was calculated by dividing body weight (kg) by the square of height (m), which was measured before docetaxel treatment. according to the world health organization asian - pacific obesity guidelines, patients with a normal or lower bmi (0.05) (table 1). of 55 patients, 16 patients had died at the time of last follow - up of the current analysis, and the median follow - up among surviving patients was 24.7 months (95% ci, 19.9 to 29.4 months). the median survival times were 17.8 months (95% ci, 12.3 to 23.2 months) for men with a normal bmi and 33.2 months (95% ci, 27.9 to 38.6 months) for overweight men. in the normal - weight group, 14 patients died of prostate cancer. in the overweight group, only 2 patients died of prostate cancer, thus showing a higher prostate cancer - specific death rate in the normal bmi group than in the overweight group (p=0.001) (fig. 1). in the univariate analysis for predicting prostate cancer - specific survival rates, bmi (p=0.005 ; hr, 0.121), logpsa (p=0.044 ; hr, 2.878), and alkaline phosphatase level (p=0.039 ; hr, 8.582) were significant factors for prediction. in the multivariate analysis, bmi (p=0.005 ; hr, 0.55), logpsa (p=0.008 ; hr, 7.836), gleason score (p=0.018 ; hr, 6.434), hemoglobin (p=0.006 ; hr, 0.096), alkaline phosphatase level (p=0.005 ; hr, 114.1), and metastasis to the internal organs (p=0.028 ; hr, 5.195) were significant factors for prediction (table 2). according to the medical check - up data in 2008 from the national health insurance corporation, 3.24 million persons had a bmi>25 kg / m, comprising 32.8% of a total of 9.88 million people who received the exam. high bmi is a problem not only of korea, which is experiencing rapid industrialization, but also of most industrialized countries, including europe and america. in the united states (us), about 48 to 66 billion us dollars the severity of obesity is its association with various systemic diseases, such as hypertension, diabetes, circulatory diseases, and eye diseases, as reported in many studies [11 - 13 ]. in this study, high bmi was observed to positively affect the patients with crpc who received docetaxel treatment. in the multivariate analysis, improvement in the cancer - specific survival rate was observed in the group of patients with bmi23 kg / m. in addition, logpsa, gleason score, hemoglobin level, alkaline phosphatase level, and metastasis to internal organs were reported as significant prognostic factors. the above results contradict those of a previous study that reported an adverse clinical effect of obesity on localized prostate cancer. magheli. reported worse pathological results of obese patients compared with normal - weight patients in a study of 1,877 patients who underwent radical prostatectomy. irani. reported that obesity not only raised the onset of prostate cancer with an odds ratio of 2.47 but significantly increased the prevalence rate in the resection area in the case of radical prostatectomy. according to rodriguez.. adams. reported a linear relationship between bmi increase and the prostate cancer - specific death rate. according to the study conducted by freedland. using shared equal access regional cancer hospital data targeting a total of 1,106 patients, obesity raised biochemical recurrence rates after radical prostatectomy. of a total of 1,226 patients with crpc, the overall survival rate and cancer - specific survival rate of overweight and obese patients were higher than those of the normal - weight patients, which agrees with the results of the present study. moreover, a similar correlation was reported between obesity and biochemical failure in 939 patients treated with external beam radiotherapy. on the basis of this study, we examined the correlation between obesity and the survival rate of patients with crpc who received docetaxel treatment. many studies have been reported on the correlation between bmi and prostate cancer in korean men. however, most studies have focused on the effects of bmi on the prognosis of localized prostate cancer. to our knowledge, there have been no studies of the relation between bmi and crpc in korean men. in contrast with previously published studies on men with an earlier stage of disease, our results revealed a protective effect of an elevated bmi in patients with crpc. a hypothesis that thin people are vulnerable to cancer cachexia, thus resulting in a poor prognosis, has been suggested. cancer cachexia is considered a poor response to rapid progression and treatment of cancer. in the present study, normal - weight patients showed lower hemoglobin levels and ecog performance status and higher psa levels than did overweight patients, even though the difference was not significant. in comparison, high - bmi patients are considered to accumulate more protein and calories than thin patients and, accordingly, are more efficient in enduring the cancer - cachetic - producing effect. some studies have suggested that energy restriction appears to decrease cellular proliferation by ceasing progression through the cell cycle and enhancing apoptosis of cancer cells. in previous studies, various hypotheses have been presented to explain the correlation between prostate cancer and obesity [22 - 24 ]. first, obesity, especially abdominal obesity, is associated with insulin resistance and hyperinsulinemia, which contributes to a high serum insulin level and insulin - like growth factor - i level facilitating the development of cancer. moreover, obesity - associated high leptin levels adversely affect the survival of prostate cancer patients. recently, adiponectin, a major adipose cytokine that decreases in circulation in obesity and ameliorates obesity, was identified as an inhibitor of prostate cancer cell growth. the results of the present study showed that the survival rate was significantly high in the crpc group having a bmi23 kg / m. as a retrospective study, a limitation of the present study is the sample size of 55, which is small compared with other studies. despite this limitation, the present study is the first such study in this field in korea. in the future, prospective and large - scale multi - institutional studies on the pathology of the correlation are expected to be conducted. the findings from the current study suggest that bmi as well as other prognostic factors are independent prognostic factors in patients with crpc who receive docetaxel treatment. with higher bmi, the cancer - specific survival rate was observed to improve more, in contrast with the correlation in earlier stages of prostate cancer. in addition, logpsa, gleason score, hemoglobin level, alkaline phosphatase level, and metastasis to internal organs were significant prognostic factors. a large - scale, prospective study will be needed to elucidate the exact association between bmi and crpc. | purposewe investigated the correlation between body mass index (bmi) and the prognosis of castration - resistant prostate cancer (crpc) in patients who received docetaxel treatment.materials and methodsa retrospective study was conducted of 55 patients who were diagnosed with crpc and received docetaxel treatment between 2003 and 2009 at our institution. patients with a normal or lower bmi (0.05). in the univariate analysis for predicting survival rates, bmi (p=0.005 ; hazard ratio [hr ], 0.121), logpsa (p=0.044 ; hr, 2.878), and alkaline phosphatase level (p=0.039 ; hr, 8.582) were significant factors for prediction. in the multivariate analysis, bmi (p=0.005 ; hr, 0.55), logpsa (p=0.008 ; hr, 7.836), gleason score (p=0.018 ; hr, 6.434), hemoglobin (p=0.006 ; hr, 0.096), alkaline phosphatase level (p=0.005 ; hr, 114.1), and metastasis to the internal organs (p=0.028 ; hr, 5.195) were significant factors for prediction.conclusionsbetter effects on the cancer - specific survival rate were observed in cases with higher bmi. |
in being responsible for about 350,000 new cases and 150,000 deaths yearly in france, cancer is a major health problem and its surveillance the utmost public health concern. regarding surveillance, francim, the french network of cancer registries, is responsible for exhaustive collections of cancer cases in 10 to 14 french dpartements (depending on the cancer type) corresponding to 15% to 20% of the french population. however, estimating epidemiological indicators at the scale of whole dpartements over the country is necessary not only to reveal etiological factors and geographical or social discrepancies but also to plan the needs in terms of medical resources (prevention, treatment, and surveillance). over the previous ten years or so, francim and the department of biostatistics of the hospices civils de lyon have been providing national estimations of cancer incidence [1, 2 ]. their usual approach to produce these estimations is to use registry incidence data together with cpidc mortality data (centre d'epidmiologie sur les causes mdicales de dcs). the principle is to calculate a mean ratio between incidence and mortality in an area covered by cancer registries then use that ratio with national mortality data to derive an estimation of national incidence. while the mean ratio estimated in a registry area can be reasonably considered as representative of the ratio for the whole country, the same is not true at the level of a single dpartement because this ratio may be highly variable between dpartements and because identical incidence values do not necessarily lead to identical mortalities. indeed, a great number of factors are able to affect patient survival and generate heterogeneity of the ratio between dpartements : differences in patient management (diagnostic or therapeutic procedures), prevention or screening policies, or compliance of the population with these policies. therefore, because incidence and mortality can not be used to provide dpartement - specific incidence estimations, a new approach should be sought for. one interesting source of data with a nationwide coverage has been recently used together with registry data to estimate dpartement - specific cancer incidence : the hospital database of the programme de mdicalisation des systmes d'information mdicale (pmsi) [46 ]. this medicoadministrative database is held to help manage health institutions and provide budget estimates. a previous work has discussed the problem of using hospital stays from pmsi data to estimate dpartement - specific incidence of breast cancer. however, the constant improvement of the quality of patient identification in pmsi data using a single - patient identifier makes it possible now to use patient - specific rather than stay - specific data in the present paper, our objective was to estimate dpartement - specific incidence of colon - rectum, breast, kidney, and ovary cancers for 2007 using mean ratios of pmsi - extracted cases to registry - extracted (incident) cases. the french agence technique de l'information sur l'hospitalisation (atih) made available its data on all short stays in all health institutions over france for 20022007. in our analyses, we kept the variables related to personal characteristics (sex, age, and code of the residence area), hospital stay (stay number and principal diagnosis according to the international classification of diseases (icd-10), and medical procedures according to the catalogue des actes mdicaux (cdam) until 2004 and to the new classification commune des actes mdicaux (ccam) from 2004 to 2007, plus an anonymous alphanumerical patient identifier [11, 12 ] to allow chaining of hospital stays of the same patient in successive institutions. that identifier is systematically generated by procedure foin (fonction d'occultation des informations nominatives) in all french health institutions since 2001. the corresponding cim 10 codes were c18 to c21 for colon - rectum cancer, c50 for breast cancer, c56 and c57.0 to c57.4 for ovary cancer, and c64 to c66 plus c68 for kidney cancer. the second algorithm extracted stays with cancer as principal diagnosis and with surgical procedures for cancer. using cdam and ccam codes, the latter extraction considered 95 procedures for colon - rectum cancer, 31 for breast cancer, 114 for ovary cancer, and 44 for kidney cancer. after each type of extraction, hospital stays were ordered by their serial numbers to spot the first stay of each patient, then only these stays were kept for analysis. these stays were then counted over each dpartement by age group : ten groups for colon - rectum cancer (1544, 4549, 5054,, 8084, and 85 yrs), eleven groups for kidney cancer in women (1539, 4044, 4549,, 8084, and 85 yrs), and thirteen groups for each of breast cancer, ovary cancer, and kidney cancer in men (1529, 3034, 3539,, 8084, 85 yrs). francim network made available the data on incident cancer cases registered in 2004 (the most recent and checked data set when the present study was initiated). cancer sites were determined according to the international classification of diseases for oncology, third version (icd - o-3) and corresponded to invasive tumors. these codes were : c18 to c21 for colon - rectum cancers, c50 for breast cancer, c56 and c57.0 to c57.4 for ovary cancer (excluding morphological codes 8442/3, 8451/3, 8461/3, 8462/3, 8472/3, and 8473/3), and c64 to c66 plus c68 for kidney cancer. the cancer registries used were those of eleven dpartements : calvados, cte d'or, doubs, hrault, isre, loire - atlantique, bas - rhin, haut - rhin, sane - et - loire, somme, and tarn. incidents cases of cancers were counted by the same age group as for hospital stays. our approach was to model, in function of age, the pmsi cases / incident cases ratio ; that is, the ratio of the number of patients with hospital stays for cancer present in the pmsi database to the number of incident cases present in the registries. this ratio was obtained from dpartements where the two sources of information exist (i.e., dpartements with a registry). it was then applied to pmsi data of dpartements without registry, in order to estimate cancer incidence in these areas. this ratio was obtained from registry and pmsi data of year 2004 ; it was then applied to pmsi data for 2007 to derive dpartement - specific incidence for 2007. it is a calibration method where incidence, as obtained from cancer registries, is considered as reference or true more precisely, the ratio is modelled as a function of age (effects smoothed using cubic regression spline) and dpartement (considered as random effect). further, to estimate the pmsi cases / incident cases ratio, a data quality criterion was required : that the chaining rate be greater or equal to 95%. this chaining rate was defined as the ratio of the number of stays with personal identifier to the total number of stays. the analysis was carried out for the four cancer sites in women but only for colon - rectum cancer and kidney cancer in men. whenever the number of cancer cases was small, it was not possible to take into account between - dpartement variability in areas with registries. we had then to sum up data from several dpartements and calculate the pmsi cases / incident cases ratio per age group over the entire zone. the overall national incidence was calculated by summing all dpartement estimations. for validation, we compared these national incidence values to francim values previously obtained by modeling the incidence / mortality ratio [1, 2, 13 ]. validation was carried out through three steps. in step 1, the pmsi cases / incident cases ratio was calculated over all ages using each algorithm per cancer site - sex combination and dpartement. indeed, dpartement - specific estimations stemming from this approach are invalid unless the ratio is homogeneous between dpartements (always > 1 or always < 1). in step 2, the observed ratio for a given age group and dpartement was graphically compared to the modelled mean ratio over all dpartements with registries (figure 1). however, to be applicable to all dpartements, the modelled mean ratio should not suffer a dpartement effect. in the presence of this effect, the observed ratios per age groups tend to be systematically higher or lower than the mean ratio whereas in its absence, the observed ratios are distributed around the mean ratio. for cancer sites with high incidence (breast, colon - rectum), step 3 was a cross - validation. the incidence in a given dpartement with registry is estimated from pmsi data together with the pmsi cases / incident cases ratio obtained by a model from which the data of that dpartement were excluded. a comparison between the number of observed cases and the number of predicted cases yields a prediction error (pe). under hypothesis h0 of a correct prediction, the pe obeys a rule whose degree of freedom is equal to the number of age groups. a 5% -risk was adopted to set the critical value for rejecting h0. for cancer with low incidence (ovary, kidney), cross - validation could not be used, because it was difficult to determine the statistical distribution of the pe and so only graphical validation was done. in addition, a comparison between the total numbers of observed and predicted cases was carried out (with one degree of freedom). a relative error (re) was calculated as the difference between the observed and predicted cases divided by the number of observed cases. the results were mapped as standardized incidence ratios (sir) using software mapinfo (version 7.0). in 2004, the pmsi database was including 20,721,587 hospital stays of which 718,044 stays had cancer as principal diagnosis. the chaining rate of those stays was 96.4%. in 2007, there were 21,201,102 stays of which 721,823 had cancer as principal diagnosis and the chaining rate was 99%. to illustrate our validation procedure the analyses relative to breast cancer were plainly detailed whereas those relative to the other cancer sites were less detailed. six registries were selected to estimate the incidence of breast cancer (table 1). four dpartements with registries were excluded because, in 2004, their chaining rate was too low ; it ranged between 49.7% and 94.9%. table 1 shows the total number of cases by cancer site and case - extraction algorithm as well as the three steps of estimate validation : homogeneity of the pmsi cases / incident cases ratio through dpartements with ratio < 1, the dpartement effect, and the cross - validation. regarding the homogeneity of the ratio, the results show that algorithm 2 was inadequate. indeed, whereas with algorithm 1 the number of pmsi cases was always higher than the incident cases in all dpartements, with algorithm 2, the former number was sometimes higher (2 dpartements) and sometimes lower (4 dpartements) than the latter. regarding the dpartement effect, figure 1 presents, for each dpartement with registries and for algorithm 1, the observed ratio by age group as well as the modelled mean ratio over all dpartements with registries. the absence of heterogeneity in that ratio between dpartements is illustrated by the fact that there was no dpartement in which the ratio per age group was systematically higher or lower than the modelled mean ratio (though dpartement calvados tend to be systematically higher than the modelled mean ratio). it can be therefore concluded that there is no dpartement effect for breast cancer with algorithm 1 (the variance of the random effect was small : 0.023). regarding the cross - validation, table 2 presents the detailed results for breast cancer. with algorithm 1, the differences between the observed and the predicted number of cases per age group (pes) were small whereas with algorithm 2, two dpartements displayed large differences especially concerning the last age group. furthermore, the difference between the total observed and the total predicted cases () was small with algorithm 1 : thus, this algorithm 1 may be reliably used for breast cancer estimates. table 3 shows the national estimations obtained by adding the estimations obtained from all dpartements by algorithm 1 as well as the national estimations elaborated by francim through the use of the incidence / mortality ratio [1, 2, 13 ]. comparing these two estimations the world age - standardized incidence rate (wasr) was 98.6 cases per 100,000 and varied between dpartements from 71.4 to 127.1 (table 4). to estimate dpartement - specific incidence of colon - rectum cancer, we used data from eight registries. data from three dpartements with registries were excluded because the chaining rate in 2004 was too poor (72.6% to 94.9%). irrespective of sex, the pmsi cases / incident cases ratios obtained with algorithm 1 were homogeneous (the variance of the random effect was small : 0.024), which was not the case with algorithm 2 for which there was a dpartement effect in both gender. in addition, contrary to algorithm 1, cross - validation invalidated the estimations made with algorithm 2 in two dpartements. thus, we present only estimations made with algorithm 1. the national incidence for 2007 the estimated national wasr was 38 cases per 100,000 in men and 24.8 in women. at the national level, our estimations were in high agreement with those of francim (40.8 cases per 100,000 in men and 24.8 cases per 100,000 in women). among dpartements, the wasr ranged from 23.1 to 48.9 in men and from 17.4 to 31.3 in women. three dpartements with registries were excluded because the chaining rate was too poor (80% to 93.5%). the pmsi cases / incident cases ratio carried out with algorithm 1 yielded homogeneous ratio between dpartements, and no dpartement effect was observed. however, as already mentioned in section methods, cross - validation could not be carried out to validate estimate from algorithm 1 and thus, because of difficult formal validations of the dpartement - specific estimations, we only present national estimations based on this algorithm 1. the national incidence was 4,637 cases, which corresponds to a wasr of 8.6 cases per 100,000. thus, eight dpartement registries were considered for men (one registry excluded because of a 92.5% chaining rate) and five registries for women (four registries excluded because of chaining rates ranging between 89.7% and 94.4%). here too, only a graphical validation of the estimations could be carried out and, because of difficult validations of dpartement - specific estimations, only national estimations are given. as for ovary cancer and irrespective of sex, algorithm 1 performed better than algorithm 2. in 2007, the national incidence of kidney cancer was estimated at 6,775 in men and 3,273 in women ; the national wasr was 13.3 per 100,000 in men but much lower (5.2 per 100,000) in women. dpartement - specific estimations for colon - rectum and breast cancer are shown in table 4 and sir maps of these cancers are shown in figures 2, 3, 4. these maps were not constructed for ovary and kidney cancers because of difficult formal validations of dpartement - specific incidence. however, for colon - rectum cancer in men, the southwest was a low incidence area. one well - marked low - incidence area for breast cancer was the southwest quadrant of france. to estimate the incidence of the four cancers in each dpartement, case extraction from pmsi database used two algorithms. algorithm 1 targeted all hospitalized cancer patients ; that is, those whose principal diagnosis is cancer because of positive laboratory tests, metastasis staging, cancer - related procedures, or sudden potentially fatal progression (exacerbation or relapse). this is common in incidence estimations based on hospital data [1517 ] and was confirmed here : the number found in pmsi data was higher than incident cases found in the registries (truer with algorithm 1 than with algorithm 2). nevertheless, the pmsi cases / incident cases ratio obtained with algorithm 1 seemed somehow stable between dpartements, which allowed estimations of dpartement - specific incidence. in contrast, algorithm 2 that used initial surgical procedures was more selective ; it extracted a closer number of pmsi patients to the number of incident cases than algorithm 1. thus, the pmsi cases / incident cases ratio was more heterogeneous between dpartements (at different degrees according to the cancer site). besides, cross - validation revealed that incidence estimations in some dpartements with registries were not valid. indeed, with algorithm 2, the critical value of the prediction error was crossed for colon - rectum cancer in both sexes and for breast cancer in women. in sum, the simpler and less selective algorithm 1 was more adequate than algorithm 2 to estimate dpartement - specific incidence. at the national level, our estimations were in agreement with francim projections, except for breast cancer (our estimations were lower). this was expected because estimations using incidence / mortality ratios do not take into account the recent trend towards a slow decline of breast cancer incidence in france and in other countries [19, 20 ]. our estimation made in 2007 at 50,578 new yearly cases in france seemed thus more realistic than the 52,492 cases stemming from francim projections. this comparison is interesting because it shows that in average, over all dpartements, our approach leads to reliable estimations. finally, our graphical validation can not constitute a formal validation because, in borderline situations, one can not claim a dpartement effect. the graphical method would be only as a tool to detect important departures from the model assumptions. pmsi data concern only hospitalized patients ; thus, our method does not apply to cancers such as skin melanomas or basocellular cancers, which are usually treated early without hospitalization. besides, the method supposed identical treatment choices in all dpartements ; which motivated the choice of the four cancer sites. in two successive articles on colon and rectum cancers [22, 23 ], phelip. have shown that surgical resection was performed in 90% of cases without significant geographical variation between dpartements. a high variability in treatment choices leads to problems with case - extraction from the pmsi database. for example, in aged men, prostate cancer can be treated by surgery, radiotherapy, or even hormone therapy alone (without hospitalization) and, in bladder cancer, the surgical treatment depends on the stage. if surgery is avoided, the lack of surgery for cancer in the pmsi database leads to missingness of pmsi cancer cases. in addition, our method lays fundamentally on the hypothesis that within a given age group, the pmsi cases / incident cases ratio is constant between dpartements whereas several factors may affect that rate. indeed, in a previous work, an insufficient chaining led to consider the number of stays rather than the number of patients. consequently, the between - dpartement variability in the mean number of stays per patient essentially due to very different hospitalization policies and coding practices prevented correct estimations. in 2002, the chaining rate was quite low (92%) but improved up to 2004 (nearly 96%) because of the implementation of a the use of a single - patient identifier allows keeping a single record per patient whatever the number of hospital stays and insures a better homogeneity of pmsi data. variability may also stem from various coding habits in different health institutions because of ignorance or misinterpretation of coding rules. a wide interinstitution variability of the pmsi cases / incident cases ratio may lead to a wide between - dpartement variability, especially between dpartements with few health institutions. besides, the pmsi cases / incident cases ratio reflects the fact that for a given incidence level, the prevalence may vary between dpartements. indeed, different rates of cancer - specific survivals between dpartements affect hospital prevalence ; thus, the number of pmsi cases. in fact, survival in a given dpartement may vary with the presence / absence of systematic screening, the existence or not of a reference health institution, and the educational and socioeconomic levels of the population. if survival is high because of complete cures, hospital prevalence and pmsi cases will decrease, which will underestimate incidence, but if survival is high but associated with more procedures, hospital prevalence and pmsi cases will increase, which will overestimate dpartement - specific incidence. the impact of different survival rates between dpartements on hospital prevalence is complex to seize and undoubtedly dependent on the cancer site under study. another implicit hypothesis in our method is a constant pmsi cases / incident cases ratio from 2004 to 2007. this is plausible because data quality of both sources over that short period was deemed constant despite improvements in cancer therapies that would have changed the prevalence of cancer. another effect of time is the change in the national standards of coding pmsi data. for example, coding palliative care as cancer has been replaced by a specific icd-10 code (z51.5). more recently, in 2009, the rules for the choice of the principal diagnosis have changed ; the impact of that change should be evaluated. nevertheless, that impact would be limited within the context of the four cancers under study here. improvements of the present method are possible. a better followup of the same patients over several years would exclude a number of prevalent cases. ideally, if all prevalent cases were excluded, the ratio would be interpreted as the proportion of hospitalized incident cases and would be no more affected by different prevalence in different dpartements. another improvement would be to add data from the health insurance (affections longue dure (ald30) database of caisses d'assurance maladie) ; a feasibility study of that possibility is underway. using an adequate method, it seems now possible to estimate dpartement - specific incidence of some cancers for a given year. nevertheless, this validation is only partial because dpartement - specific estimations will still suffer the basic assumption of similar coding practices in all hospitals. | objective. use of cancer cases from registries and pmsi claims database to estimate dpartement - specific incidence of four major cancers. methods. case extraction used principal diagnosis then surgery codes. pmsi cases / registry cases ratios for 2004 were modelled then dpartement - specific incidence for 2007 estimated using these ratios and 2007 pmsi cases. results. for 2007, only colon - rectum and breast cancer estimations were satisfactorily validated for infranational incidence not ovary and kidney cancers. for breast, the estimated national incidence was 50,578 cases and the incidence rate 98.6 cases per 100,000 person per year. for colon - rectum, incidence was 21,172 in men versus 18,327 in women and the incidence rate 38 per 100,000 versus 24.8. for ovary, the estimated incidence was 4,637 and the rate 8.6 per 100,000. for kidney, incidence was 6,775 in men versus 3,273 in women and the rate 13.3 per 100.000 versus 5.2. conclusion. incidence estimation using pmsi patient identifiers proved encouraging though still dependent on the assumption of uniform cancer treatments and coding. |
the most common manifestation of primary epstein - barr virus (ebv) infection is acute infectious mononucleosis, a self - limited clinical syndrome that most frequently affects adolescents and young adults. serology is one of the cardinal means of diagnosing ebv infection as antibody search for viral capsid antigen (vca), nuclear antigen (ebna), and early antigen (ea) makes it possible to define the status of the infection [1, 2 ]. the three parameters of vca igg, vca igm, and ebna-1 igg generally make it simple to distinguish acute and past infection in immunocompetent patients. the presence of vca igg and vca igm in the absence of ebna-1 igg is indicative of acute infection, whereas the presence of vca igg and ebna-1 igg in the absence of vca igm is typical of past infection. however, the presence of an isolated vca igg pattern may appear in about 8% of all subjects with at least one ebv infection marker and may be difficult to interpret because it can be found in patients with prior infection as well as in those with acute infection. in fact, in some cases, vca igm may appear 1 - 2 weeks after vca igg, or for a very short time, or at such a low concentration as to be missed by conventional laboratory tests ; furthermore, vca igm may persist for a long time after acute infection and still be detected after 80 weeks together with ebna-1 igg. the picture is made even more complicated by the fact that 5% of patients produce no ebna igg after ebv infection [5, 6 ] and, even when it is actually produced, it may be lost over time especially in the case of immunosuppression [5, 7, 8 ]. in such cases, in addition to following up the patient in order to evaluate possible variations in antibody titres, it is useful to perform further laboratory tests such as immunoblotting for various specific igg antibodies, a vca igg avidity test, or searches for heterophile antibodies or viral genome using molecular biology techniques. tests such as a viral genome search or immunoblotting are particularly useful for defining the status of infection [1012 ]. in particular, immunoblotting using recombinant antigens such as p72 (ebna-1), p18 (vca), p23 (vca), p54 (ea), p138 (ea), and gp350/250 (ma = membrane antigen) can detect anti - vca p18 antibodies which, as they are produced late during the course of ebv infection, are considered substitutes for ebna-1 igg. unfortunately, economic and organisational problems still limit the widespread use of this and molecular biology techniques. one possible alternative is to look for an additional serological marker that can be easily detected by means of elisa cases, such as anti - early antigen (ea) antibodies. these consist of a diffuse (d) and restricted component (r) that reflect the two different patterns originally observed using immunofluorescence. about 70%85% of patients with acute ebv infection are anti - ea(d) antibody positive for up to three months after symptom onset [7, 14 ]. however, high titres of these antibodies are present during ebv reactivation and in patients with nasopharyngeal carcinoma, and they can also be found in 20%30% of healthy subjects with a history of ebv infection [17, 18 ]. consequently, a search for anti - ea(d) antibodies alone does not make it possible to identify any stage of the disease, but its combination with other parameters may be useful for making a laboratory diagnosis of acute ebv infection. a recent study showed a pattern of vca igg positive and vca igm, ebna-1 igg, and anti - ea(d) igg negative (and heterophile antibody negative) as associated with past infection, while a pattern of vca igg and anti - ea(d) igg positive but vca igm and ebna-1 igg negative has a still unclear meaning. the aim of this study was to evaluate the usefulness of an elisa for anti - ea(d) antibodies in subjects with isolated vca igg (vca igg positive and vca igm and ebna-1 igg negative) at elisa screening, typed as being indicative of a past or acute infection on the basis of immunoblotting. one hundred and thirty serum samples were selected with an isolated vca igg pattern (vca igm and ebna-1 igg negative, but vca igg positive) at elisa screening. the samples came from 69 females and 61 males (mean age 32.9 years, range 388) with suspected ebv infection and were sent by general practitioners to the microbiology unit of legnano hospital to be searched for specific antibodies. in our unit, elisa routine screening includes the simultaneous search of vca igg, vca igm, and ebna-1 igg (eti - vca - g, eti - ebv - m reverse, eti - ebna - g, diasorin, saluggia, italy) and in case of isolated vca igg, an ebv immunoblotting (recomblot ebv igg, mikrogen, neuried, germany) is performed. on the basis of the presence or absence of anti - p18 at immunoblotting, all samples were divided into 102 cases with past and 28 with acute infection (table 1). they were also tested for the presence of heterophile antibodies (monoslide, diesse, siena, italy) and anti - ea(d) antibodies, using an elisa (eti - ea - g, diasorin, saluggia, italy). recombinant polypeptide antigen (47 kda) used in elisa is correlated to the recombinant p54 antigen of immunoblotting. thirty - seven samples (28.5%) were positive and 93 (71.5%) negative for anti - ea(d). among the cases classified by immunoblotting as indicating acute or past ebv infection, 25 (89.3%) and 12 (11.8%) were respectively positive for anti - ea(d) (table 2). this difference was statistically significant (p <.01). among the 28 cases with acute infection at immunoblotting, 16 (57.1%) had heterophile antibodies and, of these, 15 (93.8%) were positive for anti - ea(d) antibodies. table 3 shows the correlation between anti - ea(d) positivity and individual antibody specificity at immunoblotting. the differences were statistically significant in the case of p54, p72, p138, and p18 (p <.01). the presence of an isolated vca igg serological pattern is not easy to interpret because it can be found in patients with prior ebv infection who have lost or never shown ebna-1 igg as well as in those with acute infection in whom vca igm appears late or disappears early. however, it is important to be able to interpret this pattern correctly when a laboratory needs to quickly respond to questions of the clinicians. without having to wait for a second sample in the hope of a change in the antibody pattern, it would seem to be useful to use a further marker in addition to the three routine tests (vca - igg, igm and ebna-1 igg). given that immunoblotting or a search for virus genome can create organisational and economic problems, an easily automated test such as an elisa, whose costs are comparable with those of other screening tests, could be a viable alternative. anti - ea(d) antibodies could make a useful marker because they are normally present during the acute phase, even though they are not always produced and sometimes remain for a long time after the primary infection (their presence has been reported in 20%30% of patients with past infections) [17, 18 ]. we found them in about 12% of our patients with an isolated vca igg pattern and a past infection identified by means of immunoblotting, but in 90% of those with an acute infection. compared to more recent studies in literature, if our study is concordant in indicating, in this group of patients, the absence of anti - ea(d) igg as mark of past infection, on the other hand the presence of anti - ea(d) igg correlates with an acute infection. in conclusion, the results of our search for anti - ea(d) antibodies correctly identified nearly 90% of acute (presence of anti - ea(d)) or past ebv infections (absence of anti - ea(d)), which indicate that, in laboratory routine, it can be helpful in diagnosing immunocompetent patients with an isolated vca igg pattern when other more sophisticated tests are not available. | the presence of an isolated viral capsid antigen (vca) igg pattern in serum is not easy to interpret without the aid of further tests, such as specific immunoblotting or a virus genome search, that often give rise to organisational and economic problems. however, one alternative is to use an enzyme - linked immunosorbent assay (elisa) to detect anti - early antigen (ea) antibodies, which can be found in about 85% of subjects with acute epstein - barr virus (ebv) infections. the purpose of this work was to search for anti - ea(d) antibodies in 130 samples with an isolated vca igg pattern at elisa screening and classified as being indicative of past (102 cases) or acute (28 cases) infection on the basis of the immunoblotting results. thirty - seven samples (28.5%) were positive for anti - ea(d), of which 25 (89.3%) had been classified by immunoblotting as indicating acute and 12 (11.8%) past ebv infection. this difference was statistically significant (p <.01). the results of our search for anti - ea(d) antibodies correctly identified nearly 90% of acute (presence) or past ebv infections (absence). when other tests are not available, the search for anti - ea antibodies may therefore be helpful in diagnosing patients with an isolated vca igg pattern at screening tests. |
excessive accumulation of fat in the liver, that is, intrahepatic triglyceride (ihtg), is associated with increased prevalence rates of and risk for dyslipidemia, diabetes, and cardiovascular disease [13 ]. data from epidemiological as well as metabolic studies indicate that increased ihtg content is accompanied by insulin resistance and dysregulation of lipid metabolism [46 ]. exercise is known to improve metabolic function [7, 8 ] ; however its effects on ihtg remain elusive [9, 10 ]. data from studies in humans are scarce and not entirely consistent. in this paper, the results from a number of animal studies are briefly reviewed in an attempt to highlight putative factors that may modulate the effect of exercise on ihtg content. many studies have evaluated the effect of aerobic exercise training on ihtg content in rodents ; their design varies in terms of sex, strain, background diet, training duration, the prandial status, and the time of assessment after the last bout of exercise (table 1) [1237 ]. results are largely heterogeneous, but a crude analysis of the data suggests that endurance training decreases ihtg (median : 16%, range : 92% to + 97%, n = 50 studies ; table 1). most frequently [14, 16, 18, 20, 26, 31, 35 ] but not always [15, 17, 34, 37 ], exercise has been shown to be more effective in reducing liver fat or attenuating its accretion in animals fed high - fat rather than standard, low - fat diets (median decrease : 25% and 14%, resp. this is consistent with data from human studies, in which exercise training appears to be more potent in reducing ihtg in subjects with increased baseline ihtg, for example, subjects with nafld, type ii diabetes, or the elderly. the reasons why exercise is more effective in reducing ihtg on high - fat than low - fat diets are not entirely clear but are likely related to the hepatosteatotic effect of high - fat feeding. fat is mainly stored as microvesicles (1 m) [18, 38 ]. endurance training has been shown to completely prevent the high - fat diet - induced hepatic steatosis [18, 38 ], that is, the hepatocyte surface area occupied by the lipid vacuoles, solely by reducing the number of lipid vacuoles in all sizes between 1 and 10 m (i.e., macrovesicles), without affecting the number of vacuoles of surface area < 1 m (i.e., microvesicles). hence exercise may have less of an effect when on low - fat diets, not only because of lower total ihtg content, but also because most of this fat (75%) is stored in microvesicles, not macrovesicles. a more pronounced ihtg - depleting effect of exercise has also been observed under other conditions that favor the development of fatty liver, such as overfeeding, ovariectomy, ethanol ingestion, or tumor - bearing. apart from the fat content of the background diet, the type of dietary carbohydrate, protein, and fat (i.e., saturated or unsaturated fatty acids), as well as the feeding pattern (ad libitum or paired) do not appear to affect, at least not in a major way, the exercise - induced change in ihtg content. the collective of available data in animals highlights a number of other putative factors that may modulate the effect of exercise on liver fat ; however, none of these factors has been formally tested using rigorous experimental designs. concurrent weight loss or attenuated weight gain is not likely critical for the exercise - induced depletion of ihtg to manifest, albeit they may lead to greater reductions in liver fat when compared to no weight loss or similar weight gain (median decrease : 27.5% and 14%, resp. however, just like in humans, loss of visceral adipose tissue mass with exercise training is not necessarily coupled with a corresponding decrease in liver fat [16, 18, 28, 37 ]. likewise, human studies have shown that exercise - induced reductions in ihtg content can occur in the absence of changes in total body fat or even visceral adipose tissue. exercise may be more effective in reducing ihtg content in males than in females (median decrease : 25% and 14%, resp., figure 1(c)), in fasted (6 h) than in fed animals (median decrease : 31% and 11%, resp., figure 1(d)), and after longer (8 wk) than shorter interventions (median decrease : 24% and 14%, resp. ; figure 1(e)). the time elapsed from the last bout of exercise (24 h or 36 h) may also mediate the observed changes in ihtg (median decrease : 24% and 13.5%, resp., figure 1(f)), suggesting that even acute exercise could affect liver fat. however, relevant information is scarce and inconclusive. a single bout of aerobic exercise (3060 min) did not affect ihtg content, measured immediately after exercise, in female rats but caused a 30% decrease in male rats of the same strain, under both standard and high - fat feeding conditions. this is in line with data from exercise training studies in animals raising the possibility that males may be more sensitive to the ihtg - reducing effect of exercise than females (figure 1(c)), as well as with recent observations in humans. studies in which male rats were exercised until exhaustion provide conflicting results, some observed a mild or marked [46, 47 ] increase in hepatic steatosis whereas others found a decrease of 3060% at the end of exercise. if regular exercise reduces liver fat, cessation of exercise should lead to an increase in ihtg content. only a few animal studies have evaluated the effect of detraining on liver fat accumulation, and all have demonstrated that cessation of regular exercise (after 616 weeks of training) for a short (2 - 3 days) or a long (6 weeks) period of time is not associated with any significant changes in ihtg content compared with the trained state (i.e., before discontinuation of exercise) when animals are fed a standard low - fat diet [28, 36, 49, 50 ]. furthermore, detraining for 27 days does not alter the total number of hepatocyte lipid vacuoles and their size, even though it does activate precursors and processes in the liver known to initiate steatosis (e.g., decreased mitochondrial oxidative capacity, increased expression of de novo lipogenesis proteins, and increased malonyl coa levels). it is possible that this lack of an effect of detraining relates to the lesser potency of exercise in reducing liver fat content in animals fed standard low - fat diets (figure 1), so that changes after detraining are similarly less pronounced. for instance, two [28, 36 ] out of three studies that reported no effect of detraining on liver fat also failed to observe a training - induced decrease in ihtg content, suggesting that training and detraining have no effect on liver fat accumulation under low - fat feeding conditions. whereas one study did observe a training - induced decrease in liver fat in rats fed a low - fat diet but found no changes after detraining, implying that the ihtg - depleting effect of regular exercise is long - lived and is not readily reversed by detraining. still, compared with sedentary, never - exercised counterparts, detrained animals appear to be relatively protected from mild hepatic steatosis induced by 2 weeks of high - fat feeding, but not from the development of frank fatty liver 6 weeks after ovariectomy, even though cessation of exercise training in ovariectomized rats resulted in a nearly 40% increase in ihtg content compared with ovariectomized rats who did not stop exercising. it is thus possible that the relevant molecular and biochemical adaptations to exercise are readily reversed when the exercise routine is interrupted (< 1 week), however, changes in ihtg manifest later in time and only when strong triggering factors for liver fat accretion coexist, such as high - fat feeding or ovariectomy. support for this notion is provided by an earlier study, where detraining resulted in a striking increase in ihtg content only when animals were subjected to starvation and refeeding. the effect of exercise on ihtg content has recently attracted much scientific interest in light of the apparent detrimental metabolic effects of excessive liver fat accumulation. although the results from a few studies in human subjects are promising, as exercise appears to reduce ihtg, the importance of the factors highlighted herein on the basis of studies in animals has never been evaluated in man. future studies should at least control for in order to avoid confounding or directly investigate the role of these factors in affecting the exercise - induced changes in liver fat content. | an increase in intrahepatic triglyceride (ihtg) content is the hallmark of nonalcoholic fatty liver disease (nafld) and is strongly associated with insulin resistance and dyslipidemia. although regular aerobic exercise improves metabolic function, its role in regulating fat accumulation in the liver is incompletely understood, and human data are scarce. results from exercise training studies in animals highlight a number of potential factors that could possibly mediate the effect of exercise on liver fat, but none of them has been formally tested in man. the effect of exercise on ihtg content strongly depends on the background diet, so that exercise is more effective in reducing ihtg under conditions that favor liver fat accretion (e.g., when animals are fed high - fat diets). concurrent loss of body weight or visceral fat does not appear to mediate the effect of exercise on ihtg, whereas sex (males versus females), prandial status (fasted versus fed), and duration of training, as well as the time elapsed from the last bout of exercise could all be affecting the observed exercise - induced changes in ihtg content. the potential importance of these factors remains obscure, thus providing a wide array of opportunities for future research on the effects of exercise (and diet) on liver fat accumulation. |
the number of flies transported by means of ventilation air into a broiler house in denmark was counted from july 22, 2003, to july 28, 2003, and the campylobacter carriage rate of flies captured in the environment of the broiler house was estimated. the study period was chosen because flies generally peak in activity and abundance in july to august in denmark. in addition, chickens in the broiler house and the animals in the area around the broiler house (5 sheep, 4 horses, and 1 dog with 10 puppies) were tested for carriage of campylobacter. dna from all c. jejuni isolates was analyzed by pulsed - field gel electrophoresis (pfge) to determine if strains from different animals were similar. the broiler house (80 m x 15 m) was located at universal transverse mercator grid zone 32, east 564,137 m, north 6,294,759 m (http://mac.usgs.gov/mac/isb/pubs/factsheets/fs07701.html). the facility was negative - pressure ventilated through a total of 84 wall valves for air intake (16.5 cm x 52.5 cm) and 12 round chimneys (diameter 62 cm) for active air outlet through the roof. the house was emptied, and the chickens (n = 28,235) were slaughtered on july 29, 2003. reports of local weather data from the danish meteorological institute (www.dmi.dk) for that week were a maximum day temperature of 25.4c, a minimum night temperature of 11.9c, and days with bright sunshine with no wind or rain. flies were collected in polyester nets equipped at two wall inlets (one net at each end of the house) in the dynamic air flow measured (7) at a pressure of 21 pa of influx ventilation air (speed 3.6 m / s, volume 1,213 m / h per inlet valve). after the nets were harvested, flies were visually sorted from other insects and counted. the flies, identified primarily to the order diptera and the families muscidae and calliphoridae, were counted ; the count showed that 917 standard deviation (sd) (843.5990.5) flies ([a + b]/2 x 84, with a and b representing the number of flies in the two nets) had entered the broiler house per day through the ventilation system, or approximately 1 fly per 2,700 m of ventilation air (1,213 m / h x 84 x 24 h/917). for this specific broiler house, this amount equals approximately 30,000 flies per broiler cycle in the summer season. to estimate the possibility of roof inlets as entrance route for flies into houses with an air inlet in the roof, the result showed 167 flies per day entered through this one chimney, or an average of 4.5 flies per 2,700 m air. the flies captured in the ventilation system were used for counting only, since they were dead and dried out at the time of harvest. to determine the prevalence of campylobacter in flies around the broiler house, a total of 96 flies were captured singly within a distance of 50 m from the house by rackets equipped with small disposable plastic bags. after species or genus was determined, each fly was transferred with a pair of tweezers to live storage in a sterile plastic tube with 1 ml of saline. the tubes were kept in an insulated container, which was transported to the laboratory within 24 hours after capture. for campylobacter detection, each fly the pellet was resuspended in 2 ml of bolton broth (cm0983 with sr0183 and sr0048) (oxoid, basingstoke, uk) and vortexed before incubation for enrichment at 37c for 24 h. after enrichment, the tube was again centrifuged, and 100 l of the sample from each of 49 tubes was streaked onto modified cefoperazone charcoal deoxycholate agar (mccda) (blood - free agar base supplemented with cm739 + sr155) (oxoid). these plates were incubated at 42c for 48 h in a microaerobic atmosphere (6% o2, 6% co2, 4% h2 in n2). the tubes from the remaining 47 samples were subjected to dna analysis by a nested polymerase chain reaction (pcr) (8). the results of conventional culture showed that, of 49 flies tested, c. jejuni was isolated from 4 (8.2%) (figure 1a) ; when a nested pcr was used, 33 (70.2%) of the 47 flies were campylobacter - positive (figure 1b). the species distribution according to the nested pcr when species - specific primers were used showed that, of 47 samples, 56.4% were positive with c. jejuni primers, 18.0% were positive with c. coli primers, and 25.6% were positive with campylobacter species primers. coinfection with c. jejuni and c. coli or campylobacter spp. was found in six flies the reason for dividing the flies into two equal portions, one for conventional culture and the other for pcr, was to avoid reducing the assumed low number of campylobacter on each fly. campylobacter - positive and -negative by a) campylobacter bacteriologic culture, and b) nested polymerase chain reaction. cloacal or rectal swab samples from 20 broilers, 5 sheep, and 4 horses were cultured on mccda agar, as described above. rectal swabs from 11 dogs were streaked onto cefoperazone amphoricin teicoplanin (cat) agar plates (blood - free agar base with cm739 and sr174) (oxoid), and incubated at 42c for 96 h. subsequently, the swabs were tested for campylobacter by our laboratory 's routine pcr for feces (9). c. jejuni was isolated from 20 broilers and 4 sheep and c. upsaliensis from 11 dogs. a total of 28 c. jejuni isolates from 20 broilers, 4 flies, and 4 sheep were fingerprinted with pfge with two different restriction enzymes, smai and kpni. with both enzymes, 27 of the isolates had an identical pfge pattern (s6), whereas a single broiler isolate had a slightly different, but closely related pattern (s7), which probably was derived from the more prevalent pattern. twenty - seven of 28 isolates from three animal sources, broilers, sheep, and flies, and from both inside and outside the broiler house, belonged to the same clone. dendrogram of pulsed - field gel electrophoresis types with smai of campylobacter jejuni isolates from chickens in a danish broiler house and from animals outside (flies and sheep). under experimental conditions (10), flies are able to transmit campylobacter among chickens. moreover, a high prevalence of campylobacter - infected flies captured in a broiler house has been found (11). however, no study has yet been able to demonstrate a significant role of flies captured in the houses for transmitting infection from flock to flock (5). our results suggest that the potential of flies to transmit infection depends upon a current supply to the broiler house of campylobacter - infected flies from the outside. furthermore, the number of flies entering the broiler house must increase as the need for ventilation air increases as a consequence of the growth of chickens. thus, the risk of introducing campylobacter to the house increases with the age of the chickens. this study has demonstrated that flies pose a threat of campylobacter infection, from which chickens currently are unprotected from april to october, when insects are in season in the northern hemisphere. we found that in july hundreds of flies per day passed through the ventilation system into a broiler house and that 8.2% of flies captured in the environment had the potential to transmit c. jejuni from outside animals to chickens in the broiler house. these results warrant further research on how to combat the summer peak of campylobacter in broilers to improve the safety of the human food supply. | a total of 8.2% of flies caught outside a broiler house in denmark had the potential to transmit campylobacter jejuni to chickens, and hundreds of flies per day passed through the ventilation system into the broiler house. our study suggests that flies may be an important source of campylobacter infection of broiler flocks in summer. |
female nod / ltj and bdc2.5-nod, wild - type c57bl/6, h-2 c57bl/6, and mhc ii c57bl/6 were purchased from the jackson laboratory (bar harbor, me). all mice were maintained in a pathogen - free room at city of hope research animal facilities (duarte, ca). flow cytometry staining and analysis, cd11c enrichment, and cd4 t - cell depletion were performed as described (3335). phycoerythrin (pe)labeled bdc2.5-mimotope tetramer (i - a ahhpiwarmda) and control - tetramer (i - a pvskmrmatpllmqa) were obtained from nih tetramer facility (atlanta, ga). analysis of insulitis and -cell surface area was performed as previously described (33). comparison of t1d development was evaluated using the log - rank test, and comparison of means was evaluated using unpaired two - tailed student t tests with prism version 5 (graphpad, san diego, ca). flow cytometry staining and analysis, cd11c enrichment, and cd4 t - cell depletion were performed as described (3335). phycoerythrin (pe)labeled bdc2.5-mimotope tetramer (i - a ahhpiwarmda) and control - tetramer (i - a pvskmrmatpllmqa) were obtained from nih tetramer facility (atlanta, ga). analysis of insulitis and -cell surface area was performed as previously described (33). comparison of t1d development was evaluated using the log - rank test, and comparison of means was evaluated using unpaired two - tailed student t tests with prism version 5 (graphpad, san diego, ca). it was reported that induction of chimerism with bm cells from mhc - mismatched nonautoimmune donors prevented t1d development (28,3034). however, it was not clear whether those chimeric recipients had mixed or complete chimerism, because in those reports chimerism was measured with peripheral blood mononuclear cells, and the mixed chimerism could consist of residual host - type t - cells without de novo developed host - type t - cells. to identify the true mixed chimerism, de novo developed donor- and host - type cd4cd8 thymocytes, as well as b220igm or mac1/gr1 bm resident cells, needed to be measured. therefore, we used a recently reported radiation - free and graft versus host disease (gvhd) preventative anti - cd3/cd8-based condition regimen (3336) to induce mixed or complete chimerism by transplanting graded numbers of donor cells. accordingly, 6-week - old nod mice (h-2k, i - a, cd45.1) were injected with anti - cd3 and anti - cd8 (5 g / g each) on days 10 and 5. on day 0, the conditioned mice were intravenously injected with graded numbers (550 10) of bm and cd4 t - depleted spleen cells from mhc - mismatched c57bl/6 (h-2k, i - a, cd45.2) donors. the recipients were checked for chimerism with blood mononuclear cells and monitored weekly for t1d development for up to 100 days after hct. thereafter, the pancreas, spleen, bm, and thymus of the recipients and control mice were harvested for evaluation of insulitis and confirmation of chimerism status. because we have reported that blood chimerism levels become stable in nod recipients conditioned with the radiation - free anti - cd3-based regimen 60 days after hct (34), and this notion was confirmed with representative recipients in the current study (supplementary fig. 1 and supplementary table 1) we found that the development of mixed and complete chimerism was associated with donor cell dose. in general, recipients given > 25 10 mhc - mismatched donor cells all developed complete chimerism, and the majority of recipients given 0.5, fig. 2. mixed and complete chimerism with mhc - mismatched bm transplants both prevented t1d in nod mice. wild - type nod mice were conditioned with anti - cd3/cd8 (5 g each) on days 10 and 5. on day 0, the conditioned mice were transplanted with graded doses of cd4 tcd splenocytes and whole bm from wild - type c57bl/6 donors to induce chimerism (25 10 mhc - mismatched donor cells all developed complete chimerism, and the majority of recipients given 0.5, fig. 2. mixed and complete chimerism with mhc - mismatched bm transplants both prevented t1d in nod mice. wild - type nod mice were conditioned with anti - cd3/cd8 (5 g each) on days 10 and 5. on day 0, the conditioned mice were transplanted with graded doses of cd4 tcd splenocytes and whole bm from wild - type c57bl/6 donors to induce chimerism (< 20 10 each for the mixed, 50 10 each for the complete chimeras). diabetes development was monitored weekly by both urine and blood glucose for up to 100 days. thereafter, the recipient pancreas, spleen, bm, and thymus were harvested for evaluation of insulitis and chimerism status. c : one representative spleen cell facs profile of eight recipients examined with anti - h-2k in each group. for dc patterns, d : one representative facs profile of four recipients in each group examined with anti - cd45.2 and anti - cd45.1 for donor- or host - type b220igm or mac1/gr1 cells in the bm. e : representative facs profile of four recipients in each group examined with anti - h-2k and anti - h-2k for donor- and host - type thymocytes. furthermore, we confirmed the status of chimerism by examining the spleen, bm, and thymus of the recipients. we observed that, in the mixed chimeras, more than one - third of the t - cells, b - cells, macrophages, and granulocytes in the spleen were host - type. in contrast, in the complete chimeras, less than 1% of the t- and b - cells were host - type, although 20% of the macrophage and granulocytes were host - type (fig. we should point out that those h-2 cells may not be true host - type cells, because we found that 10% of the mac-1/gr-1 cells in the spleen of c57bl/6 mice are h-2 (supplementary fig. 3 and supplementary table 2). the mixed chimeric recipients had both donor- and host - type b220igm immature b - cells and mac1gr1 myeloid cells in the bm, whereas the complete chimeras had only donor - type cells (fig. consistently, the mixed chimeric recipients had both donor- and host - type cd4cd8 thymocytes, and the complete chimeric recipients had only donor - type but no host - type thymocytes (fig. furthermore, after enrichment of cd11c cells from thymus, we observed donor cd11c dendritic cells (dcs) in the thymus of both mixed and complete chimeric recipients (fig. this result is consistent with a previous report showing that donor - type dcs engraft in the thymus in the chimeric recipients as judged by immunohistochemistry (ihc) staining (37). percent donor- and host - type cells in spleen of mixed and complete chimeras given mhc - mismatched bm transplants data are means se ; n = 4. donor - type cells were defined as h-2k, and host - type cells were defined as h-2k. taken together, these results indicate that induction of mixed chimerism with mhc - mismatched bm transplants is as efficient as induction of complete chimerism in prevention of insulitis and t1d. (29) that induction of mixed chimerism in lethally irradiated nod recipients with bm cells from mhc - matched h-2 donors prevents t1d, but it was not clear whether those chimeric recipients were true mixed chimeras with de novo developed host - type t - cells. to clarify this issue, we performed a similar experiment by transplanting h-2 c57bl/6 (h-2k, i - a, cd45.2) donor t - cell depleted (tcd) bm cells (10 10) into lethally irradiated nod (h-2k, i - a, cd45.1) recipients. in addition, we induced chimerism in anti - cd3/cd8-conditioned nod recipients by transplanting bm and cd4 t - depleted spleen cells (50 10 each) from h-2 c57bl/6 donors. the control nod mice were provided anti - cd3/cd8 conditioning only. the recipients and control mice were monitored for t1d development and checked for chimerism as described above. (29), the total body irradiation (tbi)-conditioned nod recipients given tcd bm cells from mhc - matched h-2g7 c57bl/6 donors appeared to have so called mixed chimerism, as judged by the presence of both donor- and host - type t- and b - cells among blood mononuclear cells (data not shown), and no recipients developed t1d by 100 days after hct, although 61% (11/18) of control nod given conditioning only developed t1d (p < 0.01, fig. 2a). the anti - cd3/cd8-conditioned nod recipients from bm and cd4 t - depleted spleen cells also showed mixed chimerism among blood mononuclear cells (data not shown), but 17% (2/12) of them developed t1d by 100 days after hct, although there was still a significant difference compared with nod mice given conditioning only (p < 0.05, fig. 2a). to further analyze the difference between the tbi - conditioned and the anti - cd3/cd8-conditioned chimeras, the pancreata of the chimeric recipients and control mice were evaluated for insulitis and their spleen, bm, and thymus were measured for chimerism. we found that, although the tbi - conditioned chimeric animals had little insulitis, the anti - cd3/cd8-conditioned chimeras had severe insulitis (p < 0.01, fig. 2b) and marked reduction of -cell surface as compared with the tbi - conditioned recipients (p < 0.01, fig. these results indicate that insulitis is eliminated in tbi - conditioned but not in anti - cd3-conditioned chimeras. wild - type nod mice were conditioned with anti - cd3/cd8 on days 10 and 5. on day 0, the conditioned mice were transplanted with cd4-tcd splenocytes and bm (50 10 each) from mhc - matched h2- c57bl/6 mice to induce mixed chimerism. to induce mixed chimerism with tbi conditioning, wild - type nod diabetes development was monitored weekly by both urine and blood glucose for up to 100 days after hct. thereafter, the recipient pancreas, spleen, bm, and thymus were harvested for evaluation of insulitis and chimerism status. a : diabetes development curve after hct (n = 12 for anti - cd3-conditioned chimeric recipients ; n = 18 for conditioning alone : n = 6 for tbi - conditioned chimeric recipients). b : percent insulitis (n = 4 for anti - cd3-conditioned chimeric recipients ; n = 6 for tbi - conditioned chimeric recipients and conditioning alone). c : percent -cell surface area as compared with total pancreatic tissue surface area (n = 46). d : representative facs profiles showing spleen chimerism pattern 100 days after hct (n = 12). for dc patterns, spleens were digested with collagenase d and enriched using cd11c microbeads. e : representative facs profiles showing donor- or host - type b220igm or mac1/gr1 cells in the bm (n = 4). furthermore, we found that, although there were both donor- and host - type t - cells, b - cells, and macrophage / granulocytes among the spleen cells of tbi - conditioned or anti - cd3/cd8-conditioned chimeras, the donor - type cells were dominant in the former, which was consistent with the report of beilhack. (29), but the host - type cells were dominant in the latter (fig. in addition the immature b220igm b - cells and mac-1/gr-1 myeloid cells in the bm were almost all donor - type in the tbi - conditioned recipients, although there were both donor- and host - type cells in the anti - cd3/cd8-conditioned chimeras (fig. consistently, although there were both donor- and host - type thymocytes in the tbi - conditioned chimeras, there were only donor - type but no host - type cd4cd8 thymocytes in the tbi - conditioned chimeras. in contrast, both donor- and host - type cd4cd8 thymocytes were present among the thymocytes of anti - cd3/cd8-conditioned chimeras (fig. finally, there was only donor - type cd11c dcs in the thymus of tbi - conditioned chimeras, although there were both donor- and host - type cd11c dcs in the anti - cd3/cd8 conditioned chimeras (fig. percent donor- and host - type cells in spleen of chimeras given mhc - matched bm transplants data are means se ; n = 4. donor - type cells were defined as cd45.2, and host - type cells were defined as cd45.2. taken together, the so - called mixed chimerism in lethally irradiated tbi - conditioned chimeras consists of radiation - resistant residual host - type but no de novo developed host - type hematological cells, and they are actually complete chimeras. in contrast, the mixed chimerism in anti - cd3/cd8-conditioned recipients consists of both residual and de novo developed host - type hematological cells, and they are truly mixed chimeras. these results indicate that induction of mixed chimerism with mhc - matched donor bm transplants can not prevent insulitis, although induction of complete chimerism can. we next tested whether mhc - mismatched but not mhc - matched bm transplants were able to restore thymic negative selection of autoreactive t - cells in the mixed chimeric nod mice, using t - cell receptor (tcr) transgenic bdc2.5-nod mice (38). in addition, we tested whether donor cell expression of mismatched mhc ii molecules was also required. accordingly, anti - cd3-conditioned bdc2.5-nod (h-2k, i - a, cd45.1) mice were induced to develop mixed chimerism by injecting whole bm cells (50 10) from mhc - mismatched wild - type or mhc ii c57bl/6 (h-2k, i - a, cd45.2) or mhc - matched h-2 c57bl/6 (h-2k, i - a, cd45.2) donors. the chimerism was evaluated by fluorescence - activated cell sorting (facs) analysis of blood mononuclear cells as described above (data not shown), and the recipients were monitored for t1d development. we found that although 75% (9/12) of control bdc2.5-nod mice given anti - cd3 conditioning only developed t1d, none (0/12) of the mixed chimeric recipients with mhc - mismatched bm showed t1d 160 days after hct (p < 0.01, fig. 3a). in addition, although the control mice had severe insulitis, the mixed chimeras with mhc - mismatched wild - type bm showed no insulitis (p < 0.01), although they showed mild peri - insulitis (fig. it is of interest that induction of mixed chimerism with mhc - mismatched mhc ii or mhc - matched h-2 donor bm cells not only failed to prevent but markedly augmented t1d development, as compared with the control bdc2.5-nod mice (p < 0.01, fig. the mixed chimerism status in the different group was confirmed by flow cytometry analysis of the recipient spleen cells (fig. these results indicate that induction of mixed chimerism with mhc - mismatched, but not mhc - matched, donor bm cells can prevent t1d development in transgenic autoimmune bdc2.5-nod mice, and the expression of mhc ii molecules by the mhc - mismatched donor cells is required for disease prevention. mixed chimerism with mhc - mismatched wild - type bm prevented t1d in transgenic bdc2.5-nod mice. transgenic bdc2.5-nod mice were conditioned anti - cd3 (5 g) on day 7. on day 0, the conditioned mice were transplanted with bm cells (50 10) from mhc - mismatched wild - type, mhc - mismatched mhc ii or mhc - matched h-2 c57bl/6 donors to induce mixed chimerism. diabetes development was monitored weekly by both urine and blood glucose. a : diabetes development curve after hct (n = 12 for mice given conditioning alone or recipients given bm cells from mhc - mismatched wild - type donors ; n = 7 for recipients given mhc - mismatched mhc ii donor bm cells ; n = 8 for recipients given mhc - matched bm cells). b : percent insulitis for recipients given mhc mismatched wild - type bm versus conditioning alone 120 days after transplantation (n = 4). we next tested whether there was a deletion of de novo developed host - type autoreactive t - cells in the thymus of the mixed chimeras given mhc - mismatched wild - type bm cells. we first compared the percentage of donor- and host - type thymocytes at cd4cd8, cd4cd8, and cd4cd8 stages (fig. bdc2.5-nod mice are a cd4 t transgenic mouse line (38), thus, we did not evaluate cd4cd8 thymocytes. we found that host - type thymocytes were present among cd4cd8, cd4cd8, and cd4cd8 in anti - cd3-conditioned control bdc2.5-nod mice without hct as well as in the mixed chimeras given mhc - mismatched mhc ii or mhc matched h-2 donor bm cells. in contrast, the host - type thymocytes in the mixed chimeras given mhc - mismatched donor bm cells were mainly present among cd4cd8 and cd4cd8 thymocytes, and they were nearly undetectable among total cd4cd8 thymocytes (fig. after cd45.1 host - type cells were gated on, a small percentage of cd4cd8 cells were detected in those mixed chimeric recipients, although it was 15-fold lower, as compared with control bdc2.5 mice or the mixed chimeras given mhc - mismatched mhc ii or mhc - matched donor bm cells (p < 0.01, fig. interestingly, the reduction of the percentage of cd4cd8 subset among host - type thymocytes in the mixed chimeras given mhc - mismatched wild - type donor bm cells was associated a more than 20-fold increase of cd4cd8 subsets (p < 0.01, fig. these results indicate that host - type cd4cd8 thymocytes in the mixed chimeras given mhc - mismatched donor bm cells are prevented to develop into cd4cd8 stage. mixed chimerism with mhc - mismatched wild - type bm transplants mediated thymic deletion of de novo developed autoreactive t - cells. transgenic bdc2.5-nod mice were conditioned anti - cd3 (5 g) on day 7. on day 0, the conditioned mice were transplanted with bm cells (50 10) to induce mixed chimerism. mice were analyzed for clonal deletion of autoreactive t - cells at time of diabetes development, 3060 days after hct. a : representative facs profiles showing clonal deletion of autoreactive t - cells in the thymus. cd45.1 host - type thymocytes were gated on and shown in cd4 versus cd8, and cd4cd8 cells were then gated and shown in histogram of bdc2.5-tetramer (solid line) versus control - tetramer (shaded area). host - type cd45.1cd4 splenocytes were gated on and shown in histogram of bdc2.5-tetramer (solid line) versus control - tetramer (shaded area) (n = 4). c f : yield of host - type tetramer cells among cd4cd8, cd4cd8, and cd4cd8 thymocytes as well as cd4 splenocytes (n = 4). deletion of transgenic autoreactive thymocytes has been reported to take place at cd4cd8 stage (39,40). thus we tested whether this is the case in the mixed chimeric bdc2.5-nod recipients, using i - a - mimotope - tetramer (bdc2.5-tetramer) to identify the autoreactive bdc2.5 t - cells, as previously described (41). we found that 50% of the host - type cd4cd8 thymocytes in the control bdc2.5 mice given anti - cd3-conditioning only and the mixed chimeras given mismatched mhc ii or mhc - matched donor bm cells were bdc2.5-tetramer and that there was no significant difference among the three groups (fig. in contrast, the bdc2.5-tetramer cells among the host - type cd4cd8 thymocytes in the mixed chimeras given mhc - mismatched wild - type donor bm cells were reduced by approximately fivefold as compared with control bdc2.5-nod mice (p < 0.01, fig. the yield of cd4cd8 bdc2.5-tetramer thymocytes in the former group was also reduced approximately fivefold as compared with the latter (p < 0.01, fig. in addition, we found that, although the majority of the residual host - type cd4cd8 or cd4 thymocytes and cd4 splenic cells in the mixed chimeras given mhc - mismatched wild - type donor bm cells were bdc2.5-tetramer, which was similar to the control bdc2.5 mice as judged by the percentage of bdc2.5-tetramer cells (fig. 4b and data not shown), the yield of the cd4cd8 and cd4cd8 bdc2.5-tetramer thymocytes as well as the splenic cd4bdc2.5-tetramer cells in those mixed chimeras was markedly reduced as compared with the control bdc2.5-nod mice (p < 0.01, fig. 4d f). in contrast, induction of mixed chimerism with mhc - mismatched mhc ii or mhc - matched donor bm cells did not result in any reduction of the bdc2.5-tetramer thymocytes or splenic cd4 t - cells as compared with control bdc2.5-nod mice (fig. these results indicate that induction of mixed chimerism with mhc - mismatched wild - type donor bm cells results in deletion of the de novo developed host - type autoreactive bdc2.5 transgenic t at cd4cd8 stage, and the deletion requires donor cell expression of mismatched mhc ii molecules. first was our noting that induction of mixed chimerism with mhc - mismatched bm transplants from nonautoimmune donors is as effective as induction of complete chimerism in reversal of autoimmunity, elimination of insulitis, and prevention of t1d. second, induction of mixed chimerism with mhc - matched bm transplants failed to reverse autoimmunity, eliminate insulitis, or prevent t1d development, although induction of complete chimerism with the matched bm transplants did. finally, induction of mixed chimerism with mhc - mismatched but not mhc - matched bm transplant results in thymic deletion of de novo developed host - type autoreactive t - cells, and the deletion requires donor cell expression of mhc ii molecules. by measuring the chimerism of the de novo developed thymocytes, we clearly demonstrated that induction of mixed and complete chimerism with mhc - mismatched bm transplants was equally effective in reversal of autoimmunity in nod mice. previous reports stated that induction of so - called mixed chimerism in lethal or sublethally irradiated nod recipients with bm cells from nonautoimmune donors prevented t1d (28,3032). in those reports, so called mixed chimerism was defined by coexistence of donor- and host - type lymphocytes in the periphery of the chimeras, but it was not clear whether the host - type lymphocytes were de novo developed after hct or residual host - type mature lymphocytes survived after tbi - conditioning. in the current study, we confirmed the mixed or complete chimerism by the presence or absence of de novo developed host - type cd4cd8 thymocytes as well as bm cells. we observed that, although a low level (i.e., 1%) of host - type cd4 or cd8 lymphocytes were present in the periphery and thymus of the complete chimeras, there were no detectable cd4cd8 thymocytes in the complete chimeras. in contrast, both donor- and host - type cd4cd8 thymocytes were present in the thymus, and immature b- and myeloid cells were present in the bm of the mixed chimeras. we found that, even in the true mixed chimeric recipients with mhc - mismatched bm, insulitis was eliminated and t1d was prevented. therefore, when mhc - mismatched donor bm transplantation is used, induction of mixed chimerism is sufficient for the cure of t1d autoimmunity. we believe this is of clinical significance since it has been reported that mixed chimeras with mhc - mismatched bm transplants provide superior immune function against infection (42,43). our studies also demonstrated that induction of mixed chimerism with mhc - matched bm transplants from nonautoimmune donors did not reverse autoimmunity or eliminate insulitis, although induction of complete chimerism did. (29), we observed that induction of chimerism in lethally irradiated nod mice with tcd bm from mhc - matched h-2 c57bl/6 donors resulted in so - called mixed chimerism. however, we found that those chimeras did not have host - type cd4cd8 thymocytes or host - type bm resident b220igm or mac1/gr1 cells, indicating that the host - type t- or b - lymphocytes were not de novo developed. therefore, those so - called mixed chimeras were in fact complete chimeras. in contrast, we found that the true mixed chimeras with mhc - matched bm transplants had both donor- and host - type cd4cd8 thymocytes as well as b220igm and mac1/gr1 bm cells, and all of them had severe insulitis and reduced -cell quantity, indicating that induction of mixed chimerism with mhc - matched donor bm cells is not able to reverse t1d autoimmunity. using approaches similar to those that have been used to evaluate thymic deletion of autoreactive t - cells mediated by hematopoietic cell - derived antigen - presenting cells (apcs) in previous publications (18,44,45), we demonstrated that induction of mixed chimerism with mhc - mismatched but not mhc - matched donor bm cells resulted in thymic deletion of de novo developed host - type autoreactive t - cells and that the deletion requires donor cell expression of mhc ii molecules. we observed that de novo developed host - type autoreactive thymocytes in the mixed chimeric bdc2.5-nod transgenic mice given mhc mismatch but not matched c57bl/6 bm cells were deleted before the cd4cd8 thymocyte stage when they started to express tcr, and the deletion required donor cell expression of mismatched mhc ii molecules. this indicates that autoreactive t - cell interaction with donor - type apc via tcr - mismatched - mhc ii complex play an important role in thymic negative selection of autoreactive t - cells in the mixed chimeras. it was reported that the protection against t1d in (bdc2.5-nod x c57bl/6) f1 mice (h-2) was not associated with thymic deletion of the transgenic autoreactive t - cells but rather associated with positive selection of nonautoreactive t - cells expressing transgenic tcr coupling with endogenous vs (19). however, in the mixed chimeric bdc2.5 nod mice, we found a marked reduction of nod host - type thymocytes that express autoreactive tcr (fig. 4), but no expansion of transgenic v4 coupling with endogenous vs (supplementary fig. positive selection of nonautoreactive host - type t - cells by mismatched mhc ii is unlikely to play a major role in reversal of autoimmunity in the mixed chimeric recipients. it was reported that mhc ii - positive hematopoietic cells can not mediate positive selection of cd4 t - lymphocytes (46). it is not surprising that tolerization mechanisms in mixed chimeras are different from f1 mice. in the chimeras, the mhc ii (i - a) molecules are expressed by donor - type apc but not host - type thymic epithelial cells. the strong signals from tcr interaction with allo - mhc ii may induce host - type thymocytes to go through apoptosis and result in deletion. in contrast, in f1 mice, the mhc ii (i - a) molecules are expressed by both thymic epithelial cells and apcs, in which they may be able to positively select nonautoreactive thymocytes with endogenous v and unable to mediate negative selection of autoreactive transgenic thymocytes. we should also emphasize the association between failure in thymic deletion of the de novo developed host - type autoreactive t - cells and the failure in elimination of insulitis or prevention of t1d in the mixed chimeric recipients given mhc - matched h-2 donor bm transplants. this indicates that re - establishing central tolerance in autoimmune t1d recipients is critical for prevention or reversal of autoimmunity. however, the significant delay of t1d onset in the mixed chimeric recipients given mhc - matched h-2 donor bm transplants also indicates that peripheral tolerance mechanisms provided by nonautoimmune h-2 donor cells play a significant role in regulating t1d development, although it is not sufficient to fully prevent autoimmunity. it was reported that non mhc - associated loci from diabetes resistant mice mediated peripheral tolerance in autoimmune nod mice (16,47). in summary, we have identified the mechanisms wherein induction of mixed chimerism re - establishes the critical central tolerance in nod mice. however, caution needs to be considered with regards to whether similar mechanisms operate in humans because of the far greater heterogeneity of this disease in humans (48). we recently reported that induction of mixed chimerism with mhc mismatched donor bm transplants under the radiation - free and gvhd preventative anti - cd3-based conditioning regimen can reverse new - onset t1d by augmenting residual -cell expansion (33) as well as provide immune tolerance to donor islets (49). in addition, allogeneic donor t - cells in transplants have been shown not to cause gvhd in humans with mixed chimerism (50). therefore, induction of mixed chimerism under the radiation - free anti - cd3-based conditioning regimen may represent a curative therapy for severe t1d. | objectiveinduction of mixed or complete chimerism via hematopoietic cell transplantation (hct) from nonautoimmune donors could prevent or reverse type 1 diabetes (t1d). in clinical settings, hla - matched hct is preferred to facilitate engraftment and reduce the risk for graft versus host disease (gvhd). yet autoimmune t1d susceptibility is associated with certain hla types. therefore, we tested whether induction of mixed chimerism with major histocompatibility complex (mhc)-matched donors could reverse autoimmunity in the nod mouse model of t1d.research design and methodsprediabetic wild - type or transgenic bdc2.5 nod mice were conditioned with a radiation - free gvhd preventative anti - cd3/cd8 conditioning regimen and transplanted with bone marrow (bm) from mhc - matched or mismatched donors to induce mixed or complete chimerism. t1d development and thymic deletion of host - type autoreactive t - cells in the chimeric recipients were evaluated.resultsinduction of mixed chimerism with mhc - matched nonautoimmune donor bm transplants did not prevent t1d in wild - type nod mice, although induction of complete chimerism did prevent the disease. however, induction of either mixed or complete chimerism with mhc - mismatched bm transplants prevented t1d in such mice. furthermore, induction of mixed chimerism in transgenic bdc2.5-nod mice with mhc - matched or -mismatched mhc ii/ bm transplants failed to induce thymic deletion of de novo developed host - type autoreactive t - cells, whereas induction of mixed chimerism with mismatched bm transplants did.conclusionsinduction of mixed chimerism with mhc - mismatched, but not matched, donor bm transplants re - establishes thymic deletion of host - type autoreactive t - cells and prevents t1d, with donor antigen - presenting cell expression of mismatched mhc ii molecules being required. |
-stacking in radical dimers, some of which are illustrated in chart 1 in the form of the constituent monomers, is responsible for the formation of a very interesting class of chemical compounds which display favored packing geometries as described by the maximum multicenter overlap principle between neighboring molecules. this preferred orientation is primarily due to the energy lowering of the singly occupied molecular orbital (somo) of the radical as it overlaps with its neighbor. somo stabilization can be rationalized by the simple molecular orbital (mo) diagram shown in chart 2a in which the bonding highest occupied molecular orbital (homo) is doubly occupied. for example, for the prototypical phenalenyl (phy, 1) dimer 12, the efficient overlap provides the driving force for the stabilization of the dimer which is responsible for contact distances significantly shorter and interaction energies larger than those for typical van der waals (vdw) interactions. the term pancake bonding has been suggested for this type of bonding. a major motivation in making and understanding these -stacking pancake interactions originates in the quest to make new molecular materials with high electrical conductivity and for spintronics. a crucial condition for the suitability of -stacked molecules for such purposes is a strong overlap and thus a strong interaction and a short intermolecular bonding distance between the stacked subsystems. high electrical conductivities have been achieved for systems with various derivatives of 1, 2, and other -stacking materials. however, there is a strong need to push the limits of pancake interactions to even shorter distances and stronger interactions in order to offer new opportunities for materials design. a13 form single - bonded pancake dimers ; 4 forms double - bonded pancake dimers. 13 form single - bonded pancake dimers ; 4 forms double - bonded pancake dimers. therefore, is there a possibility to create even stronger pancake bonds and more attractive interactions ? in fact, the answer is yes as the dimer orbital diagrams, shown in chart 2b or 2c, demonstrate. they are based on a monomer with a triplet or a singlet diradicaloid ground state with a low - lying triplet state in the latter case in combination with an antiaromatic electron count (8) and antiaromatic character. if such a situation exists, a double pancake bonding could arise as a four electron / multicenter (4e / mc) bonding interaction with a formal bond order pmo of 2 since two bonding orbitals are doubly occupied. in general we compute the bond order pmo at the mo diagram level as1where nbind is the number of electrons in the bonding orbitals and nanti is the number of electrons in antibonding orbitals. athe formal bond order according to eq 1 is 1 for 12, 22, and 32 (single - bonded pancake) and 2 for 42 (double - bonded pancake). the formal bond order according to eq 1 is 1 for 12, 22, and 32 (single - bonded pancake) and 2 for 42 (double - bonded pancake). the (4e / mc) bond would lead to a significant improvement in terms of the interaction strength in contrast to the formal bond order of 1 for 12 as indicated by chart 2. antiaromatic compounds are usually characterized by low stability which makes the search for appropriate candidates for the double pancake bond difficult. a good example is given in the cambridge structural database, csd, in the form of the phenyl derivative and the 4-chlorophenyl derivative of 1,3,2,4,6-dithiatriazine, 4, where the phenyl and 4-chlorophenyl have been replaced by h. it will be compared to an analogous stable 7-electrons radical, 1,2,4,6-thiatriazine,3, that forms a traditional 2e / mc bonded pancake bond. 1,3,2,4,6-dithiatriazine (4) is a neutral molecule with 8-electrons which forms a very short pancake bonded dimer according to its crystal structure. astates are designated as s for singlet, t for triplet, and q for quintet. states are designated as s for singlet, t for triplet, and q for quintet. can the 1,3,2,4,6-dithiatriazine dimer really be viewed as an example for the double pancake bond, and, if so, what can we learn from it for the construction of other and possibly better examples ? to answer these questions from a theoretical point of view in a thorough way one has to go well beyond the simple mo schemes presented so far. it is crucial to understand the subtle interplay of two kinds of electron correlation effects which make these -stacking interactions so challenging to understand and design. on one side there is the quasi - degeneracy of the homo and lumo calling for multireference methods for an adequate description whereas on the other side dynamical correlation effects are essential for the description of vdw interactions. it is the purpose of this contribution to resolve the question of the energetic feasibility of a double pancake bond using the high - level multireference average quadratic coupled cluster, mr - aqcc, theory. this level of theory provides an excellent approach to the simultaneous treatment of static and dynamic electron correlation. it has been successfully used previously in interpreting the bonding characteristics of the phenalenyl dimer and the tcne anion dimer, two prototypical examples of pancake bonding. the multireference starting point assures that the multiradical character is included in the theory from the outset, and the approximate coupled cluster level assures that the millions of configurations necessary for the dispersion interaction are well accounted for. complete active space self - consistent field (casscf) and multireference averaged coupled cluster mr - aqcc/6 - 311++g(2d,2p) calculations including full geometry optimizations were carried out on the dimers 32 and 42. the electronic state configurations of these two dimers with c2v symmetry are illustrated in figure 1. the casscf(2,2) (32) and casscf(4,4) (42) calculations have been performed using the bonding and antibonding orbitals of the somos in 3 and 4 as the active orbital space for 32 and 42 dimers, respectively. molecular orbitals (mos) created by the casscf method were used in the mr - aqcc calculations including gradients with the same active orbital spaces as used in the casscf calculations. the total space of configuration state functions (csfs) was constructed by applying single and double excitations from valence orbitals to all virtual orbitals for all reference csfs and imposing generalized interacting space restrictions. the 1s core orbitals of the c, n, and s atoms and 2s and 2p orbitals of the s atoms were frozen throughout all mr - aqcc calculations (additionally, eight low - lying occupied orbitals were frozen in 42). the analysis of the radical character of the complexes was performed by analyzing (i) the natural orbitals (nos) of the one - particle mr - aqcc density matrix and (ii) the effectively unpaired density using the nonlinear formula of head - gordon. the columbus suite of programs was used for the mr - aqcc and casscf computations. in addition to the single state casscf(4,4) approach for the singlet and quintet states, state averaged casscf calculations have been performed on the triplet state dominated by two main configurations : 1 = |a1b1a2b2| and 2= |b1a1b2a2|. density functional theory (dft) was used to supplement the mr - aqcc calculations for three candidate molecules that are promising for double pancake bonding. illustration of the bonding and antibonding combinations of the two and four somos for 32 (a) and 42 (b), respectively. figures 2 and s1 compare the crystallographic data for the two experimentally observed derivatives of the double bonded pancake dimer 42. the phenyl and chlorophenyl substitution has little effect on the geometry of the dithiatriazine core validating the use of 42 as a good model for these experimentally observed systems. structures of two substituted dithiatriazine (hcn3s2)2 dimers indicate close similarity in their structures. these dimers were excised from their respective crystal structures : the phenyl derivative (52) and the 4-chlorophenyl derivative (62) are derivatives of 1,3,2,4,6-dithiatriazine, 4. for the cationic dimers the coulomb energy was estimated by using the following formula based on the approximate qi atomic charges. we use qi values based on electrostatic potentials (esp) following the hu lu yang charge fitting method (hly scheme) in eq 2(28)2 in which c is taken as the reference coulomb energy at d = 10.0. the interaction energy eint(d) of the dimer with intermolecular separation d between the monomers is computed at the mr - aqcc level, as the energy of the complex with reference to the energy at a separation of d = 10.0 where the overlap is sufficiently close to zero:3further computational details are given in the supporting information section. the separation of the vdw and the attractive somo somo interaction is essential for the analysis of the interaction energy, eint(d). somo interaction (esomo somo) and the van der waals (evdw) term4the vdw term includes dispersion, pauli repulsion, and electrostatic interactions. evdw is approximated by the interaction energy einths.5computed for the high - spin (hs) state taken at the same distance d since in this case bonding and antibonding interactions derived from the somo orbitals approximately cancel and pmo = 0 (eq 1). according to chart 3, for 42 the singlet (s), triplet (t), and quintet (q) states contain double, single, and no pancake bond character with formal bonders pmo equal to 2, 1, and 0, respectively (eq 1). the singlet states of 12, 22, and 32 all possess a bond order p of 1. the somo somo interaction term for both the single and double pancake bond, respectively, is then approximated as follows:6 ls labels the respective low spin state which is only singlet for 12, 22, and 32 but can be singlet or triplet for 42. the high - spin state is triplet in the former case and quintet in the latter. a version of this approximation restricted to ls = singlet and hs = triplet has been used by mota. for the analysis of the interaction energy of pancake bonded dimers of 1 and 2 and has been recently validated for both of these systems within the context of the mr - aqcc level of theory. one result, relevant for this study, was that the vdw term becomes repulsive at the short contacts typical for pancake bonds. according to this analysis, the pancake contacts shorter than the typical vdw distance result from the large negative (bonding) esomo somo pancake interaction. total energy minimization of the dimer structures at the mr - aqcc level followed by rigid scans as a function of the shortest sulfursulfur distance (ds s) were performed for the -stacking pancake dimers 32 and 42. the resulting interaction energies are presented in figure 3a and 3b, while the derived esomo somo pancake bonding energy terms based on eq 6 are shown figure 3c. potential energy scans for (a) the singlet and triplet states of 32 and (b) the singlet, triplet, and quintet states of 42. somo interaction energies are represented in (c) and are defined in the inset according to eq 6. computations refer to c2v symmetry using an mr - aqcc/6 - 311++g(2d,2p) level of theory. the fully optimized geometries and the respective interaction energies are discussed first ; key data are collected in table 1. the singlet minimum of the single pancake bonded 32 shows an interaction energy of 7.0 kcal / mol at ds s = 2.870. this distance is much shorter than the vdw distance of 3.60 and is clearly indicative of pancake bonding. the experimentally observed contact for the dimers of the diphenyl substituted 3 in the crystal is 2.677 (csd refcode cuvtao). the agreement between computation and experiment is good, given the missing steric repulsions due to the phenyls in the model compound used and due to intermolecular interactions in the crystal also not included in the calculations. the interaction energy for the triplet state of 32 at the equilibrium geometry of the singlet (ds s = 2.870) is repulsive with + 11.8 kcal / mol, a value which is used to approximate evdw at this distance according to eq 5. somo binding energy of 32 is 18.8 kcal / mol at the equilibrium geometry computed from eq 6 and represents a significant attraction. on the other hand, the modest attraction of 1.8 kcal / mol at the minimum distance ds s of 4.0 for the triplet state of 32 corresponds well to what is expected of pure vdw interactions in terms of both the location and depth of the minimum. data for 12 are from ref (19) and for 22 from ref (3). s, t, and q stand for singlet, triplet, and quintet states, respectively. c contacts for 12 and 22 and s s contacts for the rest of the dimers computed high - spin state using the singlet ground state geometry of the dimer. turning to the double pancake case of 42, the singlet minimum shows a much larger interaction energy of 27.7 kcal / mol at a remarkably short contact distance of ds s = 2.571 (table 1). this distance is considerably shorter (by 0.3) than in the radical dimer 32 discussed above and by more than 1 shorter than the vdw distance of 3.60. s distance for the dimers of the phenyl substituted 4 in the crystal is 2.529 (average of two values from csd, refcode dessid). the value in the isostructural 4-chlorophenyl derivative dimer is 2.522 (average of two values from csd, refcode paflaj) which is still much longer than the typical single s the agreement between computation and experiment is very good, and again the differences are largely attributable to steric repulsions due to the two phenyls (not present in the computations) and to intermolecular interactions in the crystal. the vdw interaction energy computed from eq 5 using the quintet at the equilibrium geometry of the singlet is repulsive with + 62.5 kcal / mol. somo interaction for the singlet with such a short distance must more than overcome this repulsive term. somo pancake bonding energy according to eq 6 with the intermolecular distance ds s is shown in figure 3c. at the equilibrium geometry of the singlet of 42 it reaches the amazingly large attractive value of 90.2 kcal / mol. for comparison, according to figure 3b and table 1 the modest attraction of 1.8 kcal / mol at the minimum d = 4.1 of the quintet corresponds well to what is expected of purely vdw interactions. the triplet interaction energy curve for 42 in figure 3b shows an intermediate behavior between that of the singlet and quintet with a minimum at 3.6 and an interaction energy of 2.9 kcal / mol. the triplet state is used as a tool to connect the single- and double - bonded pancake interactions in 42. the bare somo somo pancake bonding energy term for the triplet of 42 (figure 3c) coincides remarkably well with that of the typical pancake bonded dimer of 32. as has been discussed in connection with chart 3, in the triplet state of 42 only one pancake bond is left over as compared to the singlet, and therefore it agrees well with the singlet of 32, which also represents one pancake bond. the dissociation limit of the 42 dimer yields three degenerate states (s, t, and q). they arise from the coupling of the two triplet monomers as discussed in the supporting information section s.iv. there is also a lower energy singlet of the monomer that shows signs of a second order jahn teller symmetry breaking. the extent and character of unpaired density of the complexes were analyzed by the natural orbitals (nos) of the one - particle mr - aqcc density matrix and the effectively unpaired electron density, which provides a measure for the separation of an electron pair into different spatial regions. the total number of effectively unpaired electrons (nu) is computed with the following formula:7where ni refers to the i - th natural orbital occupancy and n to the number of natural orbitals. we have selected the nonlinear formula given in ref (32) since it reduces the relative contributions of the ni values that are close to 0 or 2 diminishing the contributions from dynamical correlation and thus highlighting only the truly open - shell contributions of the radical centers. the total number of effectively unpaired electrons, nu, is displayed in figure 4a as a function of the ss contact distance (ds s) for the different multiplicities of 42 and the singlet state of 32. at large separations nu values around 4.28 e are obtained for 42 exceeding the expected 4.0 e because at the mr - aqcc level, in addition to the two unpaired electrons on each of the two monomers, dynamical correlations provide a slight excess over 4.0 e. as the contact distance is reduced, the singlet nu is dramatically reduced as the electrons start to pair. at the equilibrium d = 2.571 the pairing is still incomplete where nu = 0.57 e indicates a remaining limited polyradical character. the triplet nu values of 32 are not shown ; they are essentially constant at 2.4 e, representing the two unpaired electrons plus some contributions from dynamical correlation. at large separations the singlet state of 32 has the same number of unpaired electrons as the triplet, which, however, in the former case is substantially reduced as the two - electron pancake bond is being formed. at the equilibrium geometry (d = 2.870) the nu = 0.93 e value indicates a still existent significant diradicaloid character, typical for such single pancake bonds. the qualitative difference compared to the single - bonded pancake is that the double - bonded pancake bond is substantially shorter, and the multiradical character is reduced. the triplet state of 42 retains a high value of multiradical character of nu near 3.5 e at its minimum of d = 3.6 indicating that it is located intermediate between the quintet and singlet in terms of electron pairing. figure 4b displays the natural orbital occupation numbers (noons) for the relevant frontier orbitals of the dimers 32 and 42 shown in figure 1. all noon values are evolving toward 2.0 and 0.0 at a similar pace as d is reduced. however, at the respective equilibrium distance of each molecule these values differ significantly since the ds s distance is considerably smaller for the double - bonded 42 pancake as compared to the single - bonded 32 pancake. (a) total number of effectively unpaired electrons (nu) of 32 and 42 and (b) occupation numbers of the frontier nos of the singlet states of 32 and 42 as a function of the separation distance (ds s). the unpaired electron densities, shown in figure 5, indicate this difference also : the radical character of the double - bonded 42 pancake is much smaller as compared to the single - bonded 32 case. effectively unpaired electron density (isovalue 0.002 au) and atomic contributions for the singlets of 32 and 42. nu is the number of effectively unpaired electrons given in parentheses indicating stronger electron pairing in 42 compared to 32. extending the simple integer bond order pmo defined in eq 1, we computed a more detailed bond order pno based on the two and four frontier orbital noons for 32 and 42, respectively,8where nebo is the number of electrons in bonding orbitals, neabo is the number of electrons in the antibonding orbitals based on the natural orbital occupancies for the two frontier orbitals for 32 and four frontier orbitals for 42, respectively. this reflects a major difference in the occupancies, which mirror the much stronger and shorter pancake bonds in the -stacking dimer 42 compared to those in the radical dimer 32. based on these insights we have designed three new double pancake bonded dimers each with an even number of -electrons. these systems that might exhibit double pancake bonding were obtained by substituting se for s in 4 and substituting s for ch in 4, respectively, arriving in both cases at isoelectronic 8-electron rings. a further example is based on the c5h5 ring that has a triplet ground state with d5h symmetry and exhibits an antiaromatic electron count. computational results at the mr - aqcc and ub3lyp levels indicate that these systems exhibit very short intermolecular -stacking contacts as expected from double pancake bonding. the optimized geometry of a hypothetical double pancake bonded dimer using ub3lyp/6 - 311++g(2d,2p) is shown in figure 6. the udft geometry optimization (including ub3lyp and um06 - 2x) on the (se2n3ch)2 dimer (72) using the 6 - 311++g(2d,2p) basis set provided strong evidence for double pancake bonding in this dimer. the udft methods produced a c2v symmetry optimized geometry for the (se2n3ch)2 dimer with intermolecular se se distances of 2.770 (ub3lyp) and 2.685 (um06 - 2x). these contact values are strikingly shorter by 1.030 than the vdw distance for sese (3.800). the rest of the intermolecular distances in the (se2n3ch)2 dimer are similar to those of the (s2n3ch)2 dimer, 42. the (se2n3ch)2 dimer also has a large interaction energy of 27.0 kcal / mol (ub3lyp/6 - 311++g(2d,2p)) resulting from the perfect somo somo overlap, indicating that this unique se - bearing dimer displays strong double pancake bonding and therefore would be a good candidate for further analysis and perhaps synthesis. the total interaction energy is comparable to that in 42 : 27.0 indicating the overall strength of the double pancake bonding and its ability to more than overcome vdw (pauli) repulsion at these extremely short contact -stacking distances. optimized geometry of the se analogue of 42 with ub3lyp/6 - 311++g(2d,2p). two low - lying local minima of the hypothetical double pancake bonded dimer, (s3n3)2 (82 and 92), were obtained by ub3lyp/6 - 311++g(2d,2p) and are shown in figure 7. the 82 configuration with pecfect overlap was further considered by rigid scan calculations at the mr - aqcc(4,4)/6 - 311++g(2d,2p) level starting with the ub3lyp/6 - 311++g(2d,2p) dimer optimized geometry. as shown in figure 8, the total energy curve (eint) indicated that there is a metastable minimum with a significant barrier to dissociation into two s3n3 fragments, which arises from strong cation the minimum of this corrected interaction energy of the dimer is 40.7 kcal / mol at about d = 2.7. furthermore, the somo somo interaction of 82 has been investigated by subtracting the interaction of the highest spin state (quintet) from the interaction of the singlet state as shown in figure 8b. somo component in the intermolecular interactions, which is very similar to the behavior of 42 providing a tremendeous driving force toward establishing a double bonded stacking pancake. in the 82 case the ss contact was computed to be 0.812 shorter than the vdw distance after subtracting a large coulomb repulsion term that was approximated using esp based approximate point charges. the total interaction energy after subtraction of the coulomb repulsion is even larger than that for 42 : 27.7 kcal / mol. the respective esomosomo value (87.5 kcal / mol) and the short contacts indicate that the somo somo bonding interaction is very strong, and potential energy scans of the singlet and quintet of the (s3n3)2 dimer with d3h symmetry (82) as a function of the ss distance (ds s) computed at the mr - aqcc(4,4)/6 - 311++g(2d,2p) level. c5h5 has the right electron count to be a candidate for double pancake bonding. we turned to the perfluoro derivative of c5h5, because we anticipated that the use of -electron withdrawing groups will facilitate pancake bond formation. the optimized geometry of the hypothetical double pancake bonded -dimer, (c5f5)2 (102), using ub3lyp/6 - 311+g(d) is shown in figure 9. the dimer of 102 represents the first five - member ring forming a double pancake bonded system with two perfectly degenerate somo thermodynamically, 102 is unfavorable because of (i) the strong coulomb repulsion and (ii) the dimer is much more favorable by means of cycloaddition. we suspect that the latter mechanism is a main reason why pancake bonded systems with rings consisting of mostly c(sp) have not yet been charaterized. energy minimization of the singlet ground state of the dimer of the perfluoro derivative of c5h5 (10, c5f5) showed a well - defined local minimum with overall positive interaction energy due to the large coulomb repulsion. these three examples indicate that it should be possible to find further systems that exhibit double pancake bonding. it has been established for the first time through high - accuracy quantum mechanical modeling that the -stacking dimer of 42 can be understood as a double pancake bonded molecular aggregate. this finding enriches the toolkit of chemical interactions in a sensitive area connecting the weak vdw interactions to electron pair chemical bonds. the search for shorter and stronger pancake bonding may lead to intermolecular contacts that might breach into the range of extremely stretched single bonds in terms of bond distance and binding energy. the best candidates for utilizing this new double pancake bonding mechanism will be likely found among -electron rich molecules with their highest two occupied orbitals being of -type concomitant with either a singlet ground state with a low - lying triplet state and diradicaloid character or -electron rich molecules with a triplet ground state. | the concept of a double - bonded pancake bonding mechanism is introduced to explain the extremely short stacking contacts in dimers of dithiatriazines. while ordinary single pancake bonds occur between radicals and already display significantly shorter interatomic distances in comparison to van der waals (vdw) contacts, the double - bonded pancake dimer is based on diradicaloid or antiaromatic molecules and exhibits even shorter and stronger intermolecular bonds that breach into the range of extremely stretched single bonds in terms of bond distances and binding energies. these properties give rise to promising possibilities in the design of new materials with high electrical conductivity and for the field of spintronics. the analysis of the double pancake bond is based on cutting edge electron correlation theory combining multireference (nondynamical) effects and dispersion (dynamical) contributions in a balanced way providing accurate interaction energies and distributions of unpaired spins. it is also shown that the present examples do not stand isolated but that similar mechanisms operate in several analogous nonradical molecular systems to form double - bonded -stacking pancake dimers. we report on the amazing properties of a new type of stacking interaction mechanism between conjugated molecules in the form of a double pancake bond which breaks the record for short intermolecular distances and provides formidable strength for some stacking interactions. |
west nile virus (wnv) is not restricted by international borders and involves all continents, revealing adaptation of the virus with different ecological zones. mosquitoes and birds, as vector and reservoir respectively, play an important role in the virus circulation. several studies have defined the potential importance of environmental factors on the wnv - vector - host interaction, the virus replication and on the population / habitat of the vector / reservoir (bolling. climate variation, as an environmental factor, has two different effects on ecological processes : (i) direct effects on virus / hosts / vectors, for example, by selecting the variants sensitive, or controlling the physiology of organism such as metabolic processes and reproduction (gubler. 2001, reiter 2001), and (ii) indirect effect on the habitats, the ecosystems and the relationships among the organisms (stenseth. effect of climatic factors on human wnv infection has been studied by analyzing a spectrum of weather factors for different states in the united states, and demonstrated a relation between these factors and incidence of human wnv cases (soverow. climate variations have changed the geographic and seasonal patterns of wnv with shifting toward new geographic areas and occurring earlier in the transmission season. demonstrated that temperature, housing density, urban / suburban land use, and physiographic region are important variables associated with the geographic distributions of wnv in georgia. in addition, the models according climate and landscape change were used to predict the future expansion of wnv in north america (gibbs. environmental factors such as elevation range, physiographic region, and percentage of vegetation cover have been evaluated to determine human wnv risk in chicago (ruiz. kenya, mosquito larval presence was associated with lower elevations, greater wetness, short distances to water, and land use (bian. temperature is the most important extrinsic factor affecting the population and dynamic of virus / vector / hosts. humidity is another factor, which has a direct effect on the survival of mosquitoes, by increasing vector flight and host - seeking behaviors rain provides the breeding sites for mosquitoes and helps create a humid environment, which prolongs the life of vectors. however, response to precipitation depends on the geographic location, season and the mosquito species (reiter 2001, ruiz. normalized difference vegetation index (ndvi) is a simple numerical indicator that can be used to assess vegetation density. as plants respond quickly to climate variations, ndvi is related to the climatic variations such as increase or decrease of precipitation, temperature and sunshine level (stow. the first evidence of wn virus circulation in iran, a country with climatic and environmental diversity, goes back in 1970s when existence of wnv antibodies among healthy human population has been demonstrated (saidi s. 1976). after a several decades gap, in a study carried out among 1054 animal sera collected from different provinces, in 20082009 the study showed a highly heterogeneous prevalence in different provinces, so that a higher prevalence was detected in the southwestern areas while lower prevalence was in the northern areas (ahmadnejad. according to the last checklist, iranian mosquitoes include 64 species and 3 subspecies classified in 7 genera and 12 unverified species. the most important vector of wnv, culex spp, includes 19 species (azari - hamidian 2007). although, there are many studies on iranian mosquito fauna, there is no information about wnv vectors in the country. this study addressed the dynamic and the spatial patterns of wnv transmission by analyzing the geographical and ecology parameters affect the wnv circulation in the infected areas in iran. iran is bordered by the gulf of oman, the persian gulf, and the caspian sea. it has arid or semiarid climates mostly characterized by low rainfall and high potential evapotranspiration and its location cause it to receive less than a third of the world average precipitation. the complex physical conditions of iran including topography and landscape have created a diverse climate pattern, so that it led to the formation of different ecological zones with various species of plants and animals (heshmati 2007). furthermore, the climate is influenced by caspian sea in north, coastal areas of south of the country, mediterranean area and red sea. alborz and zagros mountains also play an important role in determining the nonuniform spatial and temporal distribution of precipitation in the whole country. temperature in iran is intense function of altitude, latitude and moisture content of the atmosphere. the summer is extremely hot with temperatures in the interior ; over 55 c has been recorded in some places. humidity prevents temperature fluctuations in the north and south of the country (alijani 1995). the rainy period in most of the country is from november to may followed by dry period between may and october with rare precipitation. the average annual rainfall of the country is about 240 mm with maximum amounts in the caspian sea plains. the sera (n= 1054) were collected from 260 stables located within 27 of 30 provinces in the country. diagnosis of wnv antibodies in the sera was performed by using plaque reduction neutralization test (prnt) (fig. antibodies to wnv were detected in 249 (23.7%) of the samples (ahmadnejad. 2011). the studied ndvi indicators for the sampling stables we analyzed three climatic factors such as rainfall, temperature and relative humidity, which are very important factors to affect the mosquito breeding activities. mean monthly temperature, precipitation and relative humidity data of 10-year period (19962005) from 103 stations were obtained from iran meteorological organization (irimo). numerical layers of sampling places and meteo - stations were inputted into arcmap 9.3 software. the stations and their nearest sampling places were defined by thiessen method (fortes. 2005). normalized difference vegetation index (ndvi) is a simple numerical indicator that can be used to analyze remote sensing measurements and assess vegetation density and whether the target being observed contains live green vegetation or not (brown. 2008). ndvi time series data were acquired by advanced very high resolution radiomete (avhrr) sensor onboard the national oceanic and atmospheric administrationr satellite (noaa). the images have been extracted from http://www.class.ngdc.noaa.gov based on avhrr level 1b and resolution of 1.1 km. as satellite images can not be directly combined with other geographic information system, so geometric correction is necessary to bring the images from ground or slant range geometry into a map reference, and for this purpose, we used envi 4.3 software. composites were used to calculate ndvi values using erdas 8.7 software and using near infrared (nir) and red bands as follows : ndvi = nirrednir+red ndvi raster files were imported into a geographic information system (gis, esri1, arcgistm 9.3). buffers of 5 and 510 km around each sampled point were created with the gis software and mean ndvi was extracted within each circular buffer. three ndvi indicators were used for analysis, annual mean ndvi, seasonal ndvi differences, which is normalized differences of average ndvi for successive seasons in a 5 km radius area around each stable and, local ndvi differences, which is normalized differences of average ndvi between two areas : a 5 km radius area centered on each stable and the 510 km surrounding area (fig. 1). seasonal ndvi differences, which is normalized differences of average ndvi for successive seasons in a 5 km radius area around each stable and, local ndvi differences, which is normalized differences of average ndvi between two areas : a 5 km radius area centered on each stable and the 510 km surrounding area (fig. 1). dispersal of adult mosquitoes is an important factor in the spatial scale of transmission of vector - borne pathogens. the buffers of 5 and 510 km were chosen based on estimates of dispersal distances of culex mosquitoes and their blood - sucking activities on which birds (infected) at the first and then other hosts, such as equines. we assume that to bite a bird, the maximum estimated dispersal of a female mosquito is about 2.5 km and similarly in another host (2.52=5 km). the second buffer area was chosen by the same radius of 5 km buffer. moreover, ndvi contrast between two buffers could be an indicator of localized mosquitoes as well as birds (venkatesan and rasgon 2010, hamer. iranian wetlands possess a great diversity and provide a habitat for more than 140 migratory and sedentary bird species. among 42 kinds of wetlands in the world characterized by the ramsar convention, all, except one, are found in iran, indicating an immense variety of iranian wetlands. due to the extension of the country, there are a large number of wetlands with a broad range of size : area between a few to 500000 hectares (bagherzadeh - karimi and rouhani - rankouhi 2007). for this study, we collected the data of 60 important wetlands area, of which 22 are ramsar sites. 2). to define proximity to the wetlands, the shape files of wetlands and sampling sites of animals was imported into arcmap version 9.3. using the euclidean distance function, from the spatial analyst extension, nearest wetland and its distance to each sampling place was calculated. important studied wetlands and sampling sites univariate analyses were performed in order to test the relationship between the outcome variable and each explanatory variable. finally, logistic regression analyses were performed in order to identify which variables were involved in the stables seropositivity. explanatory variables used in logistic regression modeling included annual average temperature, relative humidity and precipitation, distance to the nearest wetland, annual average ndvi, normalized seasonal differences of ndvi, normalized local differences of ndvi and the type of stable (farm or club) (table 1). normalized seasonal differences of ndvi for two successive seasons s1 and s2 and for stable s was calculated as : (ndvis, s2ndvis, s1)(1/n) (ndvi,s2ndvi,s1), where ndvix, y is the average ndvi value observed in a 5 km radius area around stable x during season y, and n is the number of stables. multivariate logistic model of the presence of anti - wnv seropositive animals in iranian stables, 20082009 classes bounds based on distribution quantiles normalized local differences of ndvi were calculated between two areas ; a 5 km radius area centered on the stable and the 510 km surrounding area. for stable x and season y, value was calculated as : (ndvix, y,05km ndvix, y,510km)(1/n) (ndvix,,05km ndvix,,510 km), where ndvix, y, z is the average ndvi value observed around stable x during season y in area z, and n is the number of stables. as the previous study showed a high effect of the type of stables on the seropositivity (ahmadnejad. accuracy (percent of testing sites correctly classified), sensitivity (percent of positive testing sites correctly classified), and specificity (percent of negative testing sites correctly classified) were computed for the model. in addition, the area under the receiver operating characteristic curve (auc roc) was calculated as indices of the fit of the model. all the statistical analyses were conducted using r 2.10.1, and maps were produced with a geographic information system (esri1, arcgistm 9.0). iran is bordered by the gulf of oman, the persian gulf, and the caspian sea. it has arid or semiarid climates mostly characterized by low rainfall and high potential evapotranspiration and its location cause it to receive less than a third of the world average precipitation. the complex physical conditions of iran including topography and landscape have created a diverse climate pattern, so that it led to the formation of different ecological zones with various species of plants and animals (heshmati 2007). furthermore, the climate is influenced by caspian sea in north, coastal areas of south of the country, mediterranean area and red sea. alborz and zagros mountains also play an important role in determining the nonuniform spatial and temporal distribution of precipitation in the whole country. temperature in iran is intense function of altitude, latitude and moisture content of the atmosphere. the summer is extremely hot with temperatures in the interior ; over 55 c has been recorded in some places. humidity prevents temperature fluctuations in the north and south of the country (alijani 1995). the rainy period in most of the country is from november to may followed by dry period between may and october with rare precipitation. the average annual rainfall of the country is about 240 mm with maximum amounts in the caspian sea plains. the sera (n= 1054) were collected from 260 stables located within 27 of 30 provinces in the country. diagnosis of wnv antibodies in the sera was performed by using plaque reduction neutralization test (prnt) (fig. antibodies to wnv were detected in 249 (23.7%) of the samples (ahmadnejad. 2011). the sera (n= 1054) were collected from 260 stables located within 27 of 30 provinces in the country. diagnosis of wnv antibodies in the sera was performed by using plaque reduction neutralization test (prnt) (fig. antibodies to wnv were detected in 249 (23.7%) of the samples (ahmadnejad. 2011). we analyzed three climatic factors such as rainfall, temperature and relative humidity, which are very important factors to affect the mosquito breeding activities. mean monthly temperature, precipitation and relative humidity data of 10-year period (19962005) from 103 stations were obtained from iran meteorological organization (irimo). numerical layers of sampling places and meteo - stations were inputted into arcmap 9.3 software. the stations and their nearest sampling places were defined by thiessen method (fortes. 2005). normalized difference vegetation index (ndvi) is a simple numerical indicator that can be used to analyze remote sensing measurements and assess vegetation density and whether the target being observed contains live green vegetation or not (brown. 2008). ndvi time series data were acquired by advanced very high resolution radiomete (avhrr) sensor onboard the national oceanic and atmospheric administrationr satellite (noaa). the images have been extracted from http://www.class.ngdc.noaa.gov based on avhrr level 1b and resolution of 1.1 km. as satellite images can not be directly combined with other geographic information system, so geometric correction is necessary to bring the images from ground or slant range geometry into a map reference, and for this purpose, we used envi 4.3 software. composites were used to calculate ndvi values using erdas 8.7 software and using near infrared (nir) and red bands as follows : ndvi = nirrednir+red ndvi raster files were imported into a geographic information system (gis, esri1, arcgistm 9.3). buffers of 5 and 510 km around each sampled point were created with the gis software and mean ndvi was extracted within each circular buffer. three ndvi indicators were used for analysis, annual mean ndvi, seasonal ndvi differences, which is normalized differences of average ndvi for successive seasons in a 5 km radius area around each stable and, local ndvi differences, which is normalized differences of average ndvi between two areas : a 5 km radius area centered on each stable and the 510 km surrounding area (fig. 1). seasonal ndvi differences, which is normalized differences of average ndvi for successive seasons in a 5 km radius area around each stable and, local ndvi differences, which is normalized differences of average ndvi between two areas : a 5 km radius area centered on each stable and the 510 km surrounding area (fig. 1). dispersal of adult mosquitoes is an important factor in the spatial scale of transmission of vector - borne pathogens. the buffers of 5 and 510 km were chosen based on estimates of dispersal distances of culex mosquitoes and their blood - sucking activities on which birds (infected) at the first and then other hosts, such as equines. we assume that to bite a bird, the maximum estimated dispersal of a female mosquito is about 2.5 km and similarly in another host (2.52=5 km). the second buffer area was chosen by the same radius of 5 km buffer. moreover, ndvi contrast between two buffers could be an indicator of localized mosquitoes as well as birds (venkatesan and rasgon 2010, hamer. we analyzed three climatic factors such as rainfall, temperature and relative humidity, which are very important factors to affect the mosquito breeding activities. mean monthly temperature, precipitation and relative humidity data of 10-year period (19962005) from 103 stations were obtained from iran meteorological organization (irimo). numerical layers of sampling places and meteo - stations were inputted into arcmap 9.3 software. the stations and their nearest sampling places were defined by thiessen method (fortes. 2005). normalized difference vegetation index (ndvi) is a simple numerical indicator that can be used to analyze remote sensing measurements and assess vegetation density and whether the target being observed contains live green vegetation or not (brown. 2008). ndvi time series data were acquired by advanced very high resolution radiomete (avhrr) sensor onboard the national oceanic and atmospheric administrationr satellite (noaa). the images have been extracted from http://www.class.ngdc.noaa.gov based on avhrr level 1b and resolution of 1.1 km. as satellite images can not be directly combined with other geographic information system, so geometric correction is necessary to bring the images from ground or slant range geometry into a map reference, and for this purpose, we used envi 4.3 software. composites were used to calculate ndvi values using erdas 8.7 software and using near infrared (nir) and red bands as follows : ndvi = nirrednir+red ndvi raster files were imported into a geographic information system (gis, esri1, arcgistm 9.3). buffers of 5 and 510 km around each sampled point were created with the gis software and mean ndvi was extracted within each circular buffer. three ndvi indicators were used for analysis, annual mean ndvi, seasonal ndvi differences, which is normalized differences of average ndvi for successive seasons in a 5 km radius area around each stable and, local ndvi differences, which is normalized differences of average ndvi between two areas : a 5 km radius area centered on each stable and the 510 km surrounding area (fig. 1). seasonal ndvi differences, which is normalized differences of average ndvi for successive seasons in a 5 km radius area around each stable and, local ndvi differences, which is normalized differences of average ndvi between two areas : a 5 km radius area centered on each stable and the 510 km surrounding area (fig. 1). dispersal of adult mosquitoes is an important factor in the spatial scale of transmission of vector - borne pathogens. the buffers of 5 and 510 km were chosen based on estimates of dispersal distances of culex mosquitoes and their blood - sucking activities on which birds (infected) at the first and then other hosts, such as equines. we assume that to bite a bird, the maximum estimated dispersal of a female mosquito is about 2.5 km and similarly in another host (2.52=5 km). the second buffer area was chosen by the same radius of 5 km buffer. moreover, ndvi contrast between two buffers could be an indicator of localized mosquitoes as well as birds (venkatesan and rasgon 2010, hamer. iranian wetlands possess a great diversity and provide a habitat for more than 140 migratory and sedentary bird species. among 42 kinds of wetlands in the world characterized by the ramsar convention, all, except one, are found in iran, indicating an immense variety of iranian wetlands. due to the extension of the country, there are a large number of wetlands with a broad range of size : area between a few to 500000 hectares (bagherzadeh - karimi and rouhani - rankouhi 2007). the data on wetlands was acquired from iran environment protection organization. for this study, we collected the data of 60 important wetlands area, of which 22 are ramsar sites. 2). to define proximity to the wetlands, the shape files of wetlands and sampling sites of animals was imported into arcmap version 9.3. using the euclidean distance function, from the spatial analyst extension, nearest wetland and its distance to each sampling place was calculated. univariate analyses were performed in order to test the relationship between the outcome variable and each explanatory variable. finally, logistic regression analyses were performed in order to identify which variables were involved in the stables seropositivity. explanatory variables used in logistic regression modeling included annual average temperature, relative humidity and precipitation, distance to the nearest wetland, annual average ndvi, normalized seasonal differences of ndvi, normalized local differences of ndvi and the type of stable (farm or club) (table 1). normalized seasonal differences of ndvi for two successive seasons s1 and s2 and for stable s was calculated as : (ndvis, s2ndvis, s1)(1/n) (ndvi,s2ndvi,s1), where ndvix, y is the average ndvi value observed in a 5 km radius area around stable x during season y, and n is the number of stables. multivariate logistic model of the presence of anti - wnv seropositive animals in iranian stables, 20082009 classes bounds based on distribution quantiles normalized local differences of ndvi were calculated between two areas ; a 5 km radius area centered on the stable and the 510 km surrounding area. for stable x and season y, value was calculated as : (ndvix, y,05km ndvix, y,510km)(1/n) (ndvix,,05km ndvix,,510 km), where ndvix, y, z is the average ndvi value observed around stable x during season y in area z, and n is the number of stables. as the previous study showed a high effect of the type of stables on the seropositivity (ahmadnejad. accuracy (percent of testing sites correctly classified), sensitivity (percent of positive testing sites correctly classified), and specificity (percent of negative testing sites correctly classified) were computed for the model. in addition, the area under the receiver operating characteristic curve (auc roc) was calculated as indices of the fit of the model. all the statistical analyses were conducted using r 2.10.1, and maps were produced with a geographic information system (esri1, arcgistm 9.0). the stables with at least one positive animal considered as positive stable and 108 of 260 stables (41.5%) were positive for wnv infection. in the training set, on univariate analysis, all the variables were associated with the presence of wnv antibody (p < 0.05). the odds ratio and 95% confidence intervals were calculated for seropositivity and all risk factors. multivariate logistic regression analyses revealed a strong relation between wnv antibody prevalence and annual mean temperature, distance to the nearest wetland, seasonal ndvi differences and local ndvi differences variables (table 1). the average minimum and maximum annual temperature were 5 c and 27.7 c, respectively. annual mean temperature for infected and uninfected places was 19.97 c (95% ci 18.9720.97) and 15.58 (95% ci 15.0416.11), respectively. annual mean humidity for infected places was 44.57% (95% ci 42.0747.06) and for uninfected places was 47.94% (95% ci 45.9849.89). the average minimum and maximum annual precipitation were 50.8 mm and 1759.1 mm, respectively. annual mean precipitation for infected places was 258.74 mm (95% ci 210.58306.91) and for uninfected places was 299.18 mm (95% ci 266.83331.53). the risk of being wnv seropositive increased for stables located in the area with higher temperature, as 5 c increase in mean annual temperature was associated with a statistically significant 100% higher prevalence of wnv infection. annual mean temperature and geographical distribution of wnv infected and uninfected stables in iran no significant association was observed between type of stable, annual mean humidity, precipitation, annual mean ndvi and seropositivity. it is notable that type of stable is different from their location, as the former more is indicating the management of the stable and the latter indicating geographic location. there was a significant negative correlation between distance to the nearest wetland and seropositivity of stables. the risk of being wnv seropositive for stables increased (27%) with 10 km decrease of distance from the nearest wetland area (fig. 4). distribution of positive stables (thick line) and of negative stables (thin line) according to the distance to the nearest wetland a logistic regression model showed an association between seasonal / local ndvi and seropositivity. a higher significant difference between ndvi of spring and summer within a 5 km radius area around the stable increased the seropositivity four times higher. the difference of ndvi between two areas, a 5 km radius area centered on the stable and the 510 km surrounding area, in spring for infected stables was four times higher that of uninfected stables. 5 shows annual mean ndvi in spring and distribution of the stables according to the normalized local ndvi differences. annual mean ndvi in spring in iran and the geographic distribution of wnv infected and uninfected stables the roc analysis resulted in an auc of 0.838, indicating the model had relatively good discrimination ability. computing sensitivity and specificity of this prediction for various probability cut - offs clearly showed that at a decision threshold of 0.4. corresponding positive and negative predictive values were 76.4 % and 82.5 %, respectively (fig. 6). receiver operating curve of the multivariate logistic model of the presence of anti - wnv seropositive animals in iranian stables, 20082009 the evidence presented here reveals the geographic factors associated with wnv circulation in iran, which is reported for the first time in the country. four studied factors, temperature, distance to wetlands, local and regional differences ndvi were correlated to the wnv infection in equine. positive anomalies of the temperature in some southwestern province appear to have facilitated the mosquito abundance and, consequently, wnv infection in equine. we observe a north - south gradient of seropositivity following the gradient of annual average temperature. annual mean temperature above 22 c was notable in which all, except three, of the stables by this temperature were seropositive. these results are consistent with previous observations made in egypt (taylor. 1956). in southern provinces of the country, where the climate is arid, the infection reaches a high level. in northern provinces, the situation is quite different : warm, wet summers are common, but droughts occasionally occur in late summer and early fall ; and outbreaks of wnv can occur at that time. temperature in iran gets warmer from west to east and from north to south. increase of temperature from west to east is due to concentration of the mountains at western part of the country while increase from north to south is because of approaching the equator and increasing of the solar radiation angle. overall, northern and mountainous parts of the country have higher annual fluctuating and southern areas have relative stability (alijani 1995). temperature influences the mosquito life cycle, its reproduction rates, development of eggs within the mosquito (gonotrophic cycle), the vector host contact rate and consequently, virus transmission. although, patz and. (2000) suggested that higher temperatures may increase or reduce survival rate, depending on the vector, its behavior, ecology, and many other factors. thus, the probability of transmission may or may not be increased by higher temperatures (taylor. 2000), but it has been shown that even a small increase in temperatures can have a significant impact on transmission of wnv by mosquitoes (kilpatrick. effect of high temperature on increasing of mosquito abundance and vector competency, has also been experimentally proven (dohm. 2002). wnv is endemic in people living in the semi - arid regions, where the weather most of the year is decidedly hot and dry. cases has been regularly reported in subdesertic areas around the mediterranean basin : (i) along the nile valley (egypt, 1950, 1994) (ii) along the syrian - african rift (israel 1951, 19982000, jordan 2003), (iii) in the timimoun oasis in the central sahara (algeria 1994) (taylor. 1956, murgue.. the warmer condition of these area, along with directly effects on vector and host, cause the standing water with high rich organic materials attracting the mosquito and birds, consequently increase the interaction and circulation of wnv between them (epstein and defiippo 2001). beside the vectors, temperature often plays a significant role in bird life cycles, availability of food and habitat and also in the distribution of migratory birds (greenberg and marra 2005). humidity increases vector flight and host - seeking behaviors and precipitation is necessary for the formation of mosquito breeding habitats (shaman. however, we could not find a significant relation between wnv infection and annual mean humidity / rainfall. evidences on relationship between wnv / mosquito abundance and precipitation and humidity are variable, some indicate a weak, some strong correlations (soverow. 2009, wan norafikah. seropositivity was negatively correlated to the distance to wetlands, so, near to wetland can increase infection of the animals to the virus. this is consistent with the previous studies, which showed wnv infection is more strictly linked to the wetlands with abundant bird populations, especially migratory birds. wetlands provide suitable breeding habitat for mosquitoes and birds and consider as a natural foci of wnv infections in palearctic. outbreaks in temperate area, especially in europe, often have occurred in or near wetlands (hubalek and halouzka 1999, jourdain. 2007). in 1998, wnv was isolated from horses suffering from neurologic disease and residing in a large wetland area in italy. in camargue (france), wetland variations identified as important risk factors in wnv spillover in horses. moreover, proximity to wetland increase mosquito abundance, as the first three stages of their life is aquatic dependent. iranian wetlands serve as wintering or staging area for migratory birds coming from wnv endemic area and using the west siberian - caspian - east african and central siberian - indus - south asian flyways (undp 2004). the strongest association was detected between seropositivity and ndvi, at seasonal and, especially, local differences. while this relation could not be found with annual mean value of ndvi. the local ndvi s contrast during spring is a major risk factor of the transmission of west - nile virus in iran. during the early drought season, the stable seropositivity is increasing with the contrast between the local and regional ndvi environment of the stable. this so - called oasis effect is associated to the attractiveness of the local ndvi environment for wnv s vectors (mosquitoes and birds). this oasis effect disappeared in autumn, and the local ndvi s contrast becomes protector (negative impact). this oasis effect is consistent with the seasonal production of vegetation in spring, which is more important compared to the national average (contrast spring - summer). the higher level of seropositivity of the stables can be related to the attraction of many birds to the resources around these stables (bock. 2008). the extreme climatic situation of the southwestern provinces of iran encourages birds to congregate around shrinking water sites, encouraging viral circulation among birds and mosquitoes, while heat accelerates viral maturation. droughts and heat wave were found to induce wnv amplification by bringing the hosts and the vectors together. in opposition with the dogma that increasing precipitation predicts mosquito abundance, some authors hypothesize that wild populations should generate outbreaks under drought conditions. standing water pools become richer in the organic material that culex vectors needs to thrive and the mosquito predators, such as amphibians and dragonflies, are fewer in number (epstein 2004). these findings are consistent with the hypothesis that spring= nesting (in an oasis, the birds will nest closer to the horses) and autumn = dispersal of juveniles (juveniles are going further if they leave from an oasis). these findings are also consistent with the fact that viral circulation is related to the presence of chicks, sedentary and still bare skin in altricial species (marra. this suitable condition increases the main food supply, such as arthropods, for most migratory birds. several studies have used ndvi for assessments of wnv infection foci and its vector habitat. seasonal difference in ndvi was one the best predictive factors for determining mosquito distribution abundance in the model studied by jacob (jacob. 2009). they found that the mean ndvi in biweekly periods with reported cases was significantly higher than the mean ndvi in periods without cases (ward 2009). climatic condition of iran varies throughout the country, resulting in a complex hydrological and vegetative landscape, with arid and semiarid areas in the center, southeast and southwest and temperate rain forest in the north. although areas with high wnv infection rates, such as khuzestan, have a dry climate, but their water sources are mainly from rivers originated from mountains and precipitations, which play an important role in producing oasis areas in these areas. although these results provide a new understanding of some ecological parameters effects on wnv circulation in iran, additional work is needed. arboviruses circulation is multifactorial and studies are needed to evaluate various mosquito species for their potential to transmit wnv in iran. there are many studies on mosquito fauna in iran, however there is no specific information about wnv vectors. wnv has been identified in numerous mosquito species, including members of the genera culex, aedes and ochlerotatus, but mosquitoes belonging to the culex species are the main vectors for wnv. culex pipiens, the main vector of wnv in us, has spread in different ecological zones of iran and its distribution is very similar to its climatic distribution in north, south america and africa. there are some doubtful records of this mosquito in iran ; however, based on the record of this species in pakistan, it seems that cx. if we consider iranian wnv vector within culex spp, it is speculated that other than several species may be involved in wnv circulation in south and southwestern parts of iran, where there is a high circulation of the virus. however, vector competency studies should be conducted on various species of mosquitoes in order to determine the ability of the mosquito species to transmit wnv and detection of the virus from mosquitoes. another study was conducted to determine wnv antibody and genome in different species of wild water birds captured from wetlands in iran. samples were collected from 26 different species, 15% of which were serologically positive, while no wnv viral rna - positive samples were found in this study. the majority of positive birds were common coot (fulica atra) (fereidouni. 2011). they did not find any positive samples from khuzestan province where the most important region for the virus circulation is. moreover, they had a few samples (n=4) from this province, all of which were birds other than common coot, maybe due to lower abundance of common coot (fulica atra) in this area. the area identified with high risk for wnv circulation may be used for entomological or epidemiological surveillance. the model indicated that local ndvi s contrast during spring is a major risk factor of the transmission of west - nile virus in iran. this so - called oasis effect consistent with the seasonal production of vegetation in spring, and is associated to the attractiveness of the local ndvi environment for wnv vectors and hosts. the reservoir hosts and vectors are the keys of circulation of the virus and will be the focus of the future work. | background : geographic distribution of west nile virus (wnv) is heterogeneous in iran by a high circulation in the southern - western areas. the objective of our study was to determine environmental and climatic factors associated with the risk of wnv equine seropositivity in iran.methods:serological data were obtained from a serosurvey conducted in equine population in 260 districts in iran. the climate and environmental parameters included in the models were distance to the nearest wetland area, type of stable, normalized difference vegetation index (ndvi), annual mean temperature, humidity and precipitation.results:the important risk factors included annual mean temperature, distance to wetlands, local and seasonal ndvi differences. the effect of local ndvi differences in spring was particularly notable. this was a normalized difference of average ndvi between two areas : a 5 km radius area centered on the stable and the 510 km surrounding area.conclusion:the model indicated that local ndvi s contrast during spring is a major risk factor of the transmission of west - nile virus in iran. this so - called oasis effect consistent with the seasonal production of vegetation in spring, and is associated to the attractiveness of the local ndvi environment for wnv vectors and hosts. |
hemizygous and homozygous deletions on the long arm of chromosome 13 are the most common genetic aberrations in b - cell chronic lymphocytic leukemia (cll) and monoclonal b - cell lymphocytosis (mbl), occurring in approximately 50 percent of cases. the reported deletions are usually large and heterogeneous in size and typically include a minimally deleted region (mdr) on 13q14.3 (~130 kilobases). the mdr is telomeric to the retinoblastoma gene (rb1) and includes dleu1 and dleu2 as well as two notable micro - rnas, mir15a and mir16 - 1. loss at 13q14 as a single large abnormality can indicate a more favorable cll clinical course ; however, a higher percentage of cells with 13q14 loss and increased size of 13q14 deletions have been associated with shorter time - to - treatment. deletions at 13q14 are postulated to result in loss of tumor - suppressor activity, but the variable size of the 13q14 deletion suggests more than one tumor - suppressor gene is likely present. further work has shown that down - regulation of mir15a and mir16 - 1 in cll coupled with a cll like phenotype in mouse models deficient for the dleu2/mir-15a / mir16 - 1 cluster indicate mir15a and mir16 - 1 may be important regulators in cll pathogenesis. somatic alterations of 13q14 have been reported in solid tumors, suggesting a possible role in the carcinogenesis of select non - hematological malignancies. sporadic observation of 13q14 events has been reported in other solid tumors, but not with the consistency observed in cll or retinoblastoma. for example, pan - cancer analyses of the cancer genome atlas (tcga) data show evidence for 13q14 loss in bladder, breast, colon, glioblastoma, head / neck, kidney, lung, ovarian, and endometrial tumors. other studies have reported 13q14 loss with high prostate tumor grade and stage as well as increased proliferation and invasiveness of untransformed prostate cells after down regulation of mir-15a and mir16 - 1. loss of heterozygosity (loh) data from breast cancer studies described a region including 13q12.214.3 can be commonly deleted in breast cancer. moreover, it has been suggested that 13q14 allelic imbalance may be associated with breast cancer mortality more than 5 years after diagnosis, but further studies are needed to confirm this finding. additional association evidence indicates that adp - ribosylation factor - like tumor suppressor gene 1 (arlts1, also called adp - ribosylation factor - like 11 arl11) located on 13q14.3 approximately 400 kb centromeric to mir15a and mir16 - 1 may function as a tumor suppressor gene for lung cancer, familial breast cancer, melanoma, ovarian cancer, prostate cancer, and colorectal cancer. overall, the many reports of 13q14 deletions in solid cancers point towards a possible role as a contributing driver event, but further studies are needed to confirm the reported frequencies and more importantly, establish the functional implications of 13q14 deletion beyond cll and mbl. genetic mosaicism is the coexistence of clonal cellular populations harboring two or more distinct genotypes in an individual. in previous studies of detectable clonal mosaicism, an increased frequency of large - structural events detected in a fraction of circulating cells was noted in pre - diagnostic samples of individuals who later developed a lymphoid malignancy. one of the most common sites for large structural deletions of more than 2 mb in size included at least 300 kb of the 13q14.3 mdr region, the region commonly deleted in cll. in this context, it is notable that mosaic 13q14.3 loss was observed in a fraction of dna samples collected from individuals diagnosed with solid tumors or who were cancer free. since the screening detection algorithm for snp microarrays conducted as part of cancer gwas is stable for events greater than 2 mb in size, the aim of this analysis was to re - examine our large gwas data set of more than 80,000 individuals to identify additional, smaller 13q14.3 events as well. in addition, we wanted to determine if there is a possible relationship between 13q14.3 events in blood dna and risk for solid tumor. the division of cancer epidemiology and genetics and the cancer genome research (cgr) laboratory in the nci have conducted a series of genome - wide association studies with commercial snp microarrays (illumina hap300, hap240, hap550, hap610, hap660, hap 1, omni express, omni 1, omni 2.5, and omni 5). the study set included 82,483 participants (46,254 non - hematological cancer cases and 36,229 cancer - free controls) with blood or buccal dna, previously known as total gwas set (tgs) i and ii, actually scanned in the cgr. the institutional review board of the participating study centers and the nih approved the study protocols and informed consent was received for each study participant. b - allele frequency (baf) and log r ratio (lrr) are two metrics used to assess 13q14.3 mosaic loss in our study population. baf is a measure of allelic imbalance used to determine stretches of heterozygous snps that deviate from the expected value of 0.5. lrr provides information on copy number in which lrr values greater than 0 are evidence for allelic gains, lrr values less than 0 indicate allelic loss, and lrr values not deviating from 0 indicate copy neutral events. baf and lrr values were estimated using methods previously described and normalized and corrected using a framework from our previous work. based on copy number status, mean heterozygous baf bands were used to calculate the percentage of cells in the cellular population that contained copy number alterations at 13q14.3. this copy number alteration detection method has been previously validated with additional laboratory techniques for autosomes (e.g., single tandem repeat, multiplex ligation - dependent probe amplification, and fluorescent in situ hybridization) and is described in greater detail in the methods and supplementary material of the original analysis. stretches of homozygosity were detected as genomic stretches across 13q14.3 with no baf band for heterozygous snps. two segmentation algorithms were used to scan genotypes of the non - hematological cancer population for mosaic alterations at the 13q14.3 locus : a lrr - based approach and a baf - based approach. both approaches scanned the sample population and surveyed a window around the cll mdr region on chromosome 13q14.3 between bases 49,139,793 and 50,269,706 (grch36). the lrr - based approach isolated individuals with evidence of 13q14.3 loss by finding individuals with mdr windows that had mean lrr values significantly less than mean lrr values on chromosome 1 (used as the reference) by applying t - tests with unequal variance and a p - value < 1.010 as the significance threshold. a mean difference of 0.05 was used as a filter to ensure statistically significant 13q14.3 lrr values displayed meaningful differences from the chromosome 1 reference lrr. the baf - based approach detected individuals with allelic imbalances at 13q14.3 by selecting individuals with mdr windows that had heterozygous bdev means (bdev=|baf-0.5| for heterozygous baf bands) that significantly differed from bdev means on chromosome 1 (p - value < 1.010). a mean bdev difference of 0.005 was required in statistically significant regions to ensure meaningful differences in bdev were detected. results from the two approaches were merged and manually reviewed to confirm a copy number alteration at the 13q14.3 mdr. copy number status was assigned and the percentage of cells with altered 13q14.3 nuclei was estimated from heterozygous baf bands. for individuals with 13q14.3 events that extended beyond the investigated chromosome 13 window, mosaic event breakpoint regions were mapped to within 100 kb from the best estimate of 13q14.3 deletion start and end points using the snp intensity data. the 100 kb window was chosen as a conservative estimate of the true breakpoint since start and stop coordinates for events were defined based on the nearest array tagging snps ; an estimate which is affected by snp density and the quality of lrr and baf data around these snps. the 60 detected 13q14.3 mosaic deletions resulted in a total of 120 breakpoint regions, roughly 200 kb in size. 1,000 permutations of 120 randomly selected 200 kb regions on chromosome 13 were selected to estimate the underlying distribution of chromosome 13 structural elements flanking the 13q14.3 region. to generate these breakpoints, 60 random events were selected from a gaussian distribution that reflected observed event length (=10.80 mb, =16.90 mb) and were constrained to overlap the 393 kb minimally deleted region. the first and last illumina microarray snps within simulated events were used to define the estimated breakpoints, and 100 kb windows were calculated to model the underlying distribution of observed event breakpoints. university of california santa cruz (ucsc) and encyclopedia of dna elements (encode) data tracks were downloaded from the ucsc ftp data portal (ftp://hgdownload.cse.ucsc.edu/) to investigate local dna characteristics in breakpoint regions as well as randomly selected regions. features of interest included gene - rich regions (refseq genes, cpg islands), indicators of open chromatin (orchid, dnasei hs peaks, faire - seq peaks), recombination rate (decode sex - averaged), and repetitive elements (sines, lines, ltrs, and segmental duplications). comparisons between observed breakpoints and random breakpoints were made using mean differences and mean counts of feature elements. univariate analyses were performed characterizing the relationship of age group (< 50, 5054, 5559, 6064, 6569, 7074, and 75 years), gender (male, female), estimated ancestry (% european, % african, and % asian ancestry estimated by snp genotypes), and non - hematologic cancer (disease - free controls, solid tumor cases overall and substrata of cases by solid tumor type) with 13q14.3 loss. an additional multivariable analysis that included age group, gender, estimated ancestry, and non - hematologic cancer as well as adjustment for contributing study (indicator variables) strata specific analyses were performed within strata of non - hematological cancer type to investigate whether 13q14.3 deletion was associated with specific non - hematological cancers. to investigate differences in frequency between 13q14.3 alterations in our population and cll prevalence in the us population, age and sex - specific limited duration prevalence measures from the november 2011 submission of surveillance epidemiology and end all statistical analyses were performed in r version 2.15.1 (r foundation for statistical computing). the division of cancer epidemiology and genetics and the cancer genome research (cgr) laboratory in the nci have conducted a series of genome - wide association studies with commercial snp microarrays (illumina hap300, hap240, hap550, hap610, hap660, hap 1, omni express, omni 1, omni 2.5, and omni 5). the study set included 82,483 participants (46,254 non - hematological cancer cases and 36,229 cancer - free controls) with blood or buccal dna, previously known as total gwas set (tgs) i and ii, actually scanned in the cgr. the institutional review board of the participating study centers and the nih approved the study protocols and informed consent was received for each study participant. b - allele frequency (baf) and log r ratio (lrr) are two metrics used to assess 13q14.3 mosaic loss in our study population. baf is a measure of allelic imbalance used to determine stretches of heterozygous snps that deviate from the expected value of 0.5. lrr provides information on copy number in which lrr values greater than 0 are evidence for allelic gains, lrr values less than 0 indicate allelic loss, and lrr values not deviating from 0 indicate copy neutral events. baf and lrr values were estimated using methods previously described and normalized and corrected using a framework from our previous work. based on copy number status, mean heterozygous baf bands were used to calculate the percentage of cells in the cellular population that contained copy number alterations at 13q14.3. this copy number alteration detection method has been previously validated with additional laboratory techniques for autosomes (e.g., single tandem repeat, multiplex ligation - dependent probe amplification, and fluorescent in situ hybridization) and is described in greater detail in the methods and supplementary material of the original analysis. stretches of homozygosity were detected as genomic stretches across 13q14.3 with no baf band for heterozygous snps. two segmentation algorithms were used to scan genotypes of the non - hematological cancer population for mosaic alterations at the 13q14.3 locus : a lrr - based approach and a baf - based approach. both approaches scanned the sample population and surveyed a window around the cll mdr region on chromosome 13q14.3 between bases 49,139,793 and 50,269,706 (grch36). the lrr - based approach isolated individuals with evidence of 13q14.3 loss by finding individuals with mdr windows that had mean lrr values significantly less than mean lrr values on chromosome 1 (used as the reference) by applying t - tests with unequal variance and a p - value < 1.010 as the significance threshold. a mean difference of 0.05 was used as a filter to ensure statistically significant 13q14.3 lrr values displayed meaningful differences from the chromosome 1 reference lrr. the baf - based approach detected individuals with allelic imbalances at 13q14.3 by selecting individuals with mdr windows that had heterozygous bdev means (bdev=|baf-0.5| for heterozygous baf bands) that significantly differed from bdev means on chromosome 1 (p - value < 1.010). a mean bdev difference of 0.005 was required in statistically significant regions to ensure meaningful differences in bdev were detected. results from the two approaches were merged and manually reviewed to confirm a copy number alteration at the 13q14.3 mdr. copy number status was assigned and the percentage of cells with altered 13q14.3 nuclei was estimated from heterozygous baf bands. for individuals with 13q14.3 events that extended beyond the investigated chromosome 13 window, boundaries were adjusted to include the entire 13q event. mosaic event breakpoint regions were mapped to within 100 kb from the best estimate of 13q14.3 deletion start and end points using the snp intensity data. the 100 kb window was chosen as a conservative estimate of the true breakpoint since start and stop coordinates for events were defined based on the nearest array tagging snps ; an estimate which is affected by snp density and the quality of lrr and baf data around these snps. the 60 detected 13q14.3 mosaic deletions resulted in a total of 120 breakpoint regions, roughly 200 kb in size. 1,000 permutations of 120 randomly selected 200 kb regions on chromosome 13 were selected to estimate the underlying distribution of chromosome 13 structural elements flanking the 13q14.3 region. to generate these breakpoints, 60 random events were selected from a gaussian distribution that reflected observed event length (=10.80 mb, =16.90 mb) and were constrained to overlap the 393 kb minimally deleted region. the first and last illumina microarray snps within simulated events were used to define the estimated breakpoints, and 100 kb windows were calculated to model the underlying distribution of observed event breakpoints. university of california santa cruz (ucsc) and encyclopedia of dna elements (encode) data tracks were downloaded from the ucsc ftp data portal (ftp://hgdownload.cse.ucsc.edu/) to investigate local dna characteristics in breakpoint regions as well as randomly selected regions. features of interest included gene - rich regions (refseq genes, cpg islands), indicators of open chromatin (orchid, dnasei hs peaks, faire - seq peaks), recombination rate (decode sex - averaged), and repetitive elements (sines, lines, ltrs, and segmental duplications). comparisons between observed breakpoints and random breakpoints were made using mean differences and mean counts of feature elements. univariate analyses were performed characterizing the relationship of age group (< 50, 5054, 5559, 6064, 6569, 7074, and 75 years), gender (male, female), estimated ancestry (% european, % african, and % asian ancestry estimated by snp genotypes), and non - hematologic cancer (disease - free controls, solid tumor cases overall and substrata of cases by solid tumor type) with 13q14.3 loss. an additional multivariable analysis that included age group, gender, estimated ancestry, and non - hematologic cancer as well as adjustment for contributing study (indicator variables) strata specific analyses were performed within strata of non - hematological cancer type to investigate whether 13q14.3 deletion was associated with specific non - hematological cancers. to investigate differences in frequency between 13q14.3 alterations in our population and cll prevalence in the us population, age and sex - specific limited duration prevalence measures from the november 2011 submission of surveillance epidemiology and end all statistical analyses were performed in r version 2.15.1 (r foundation for statistical computing). in a combined analysis of 82,483 non - hematologic cancer cases and disease free controls dna drawn from peripheral leukocytes (81%) and buccal samples (19%), we detected 60 individuals (0.073%, 95% ci=0.0540.091%) with 13q14.3 mosaic loss between 19.7 and 90.1%. the distribution of events across strata of gender, age group, ancestry, and non - hematologic cancer status is displayed in table 1. non - hematological cancer cases and controls in our analysis had a frequency of 13q14.3 mosaic loss of 0.084 (95% ci=0.0660.115) and 0.069 (95% ci= 0.0380.089) percent, respectively. the majority of the detected 13q14.3 mosaic losses were in dna derived from blood, however, 3 mosaic 13q14.3 deletions were observed in buccal dna. in addition to the 60 individuals detected with mosaic loss at 13q14.3, our analysis detected one lung cancer case with a copy neutral uniparental disomy that spanned the 13q14.3 region. stretches of homozygosity within the 13q14.3 region were also observed in 13 individuals, which included 6 controls, 2 endometrial cancer cases, 3 lung cancer cases, 1 ovary cancer case, and 1 pancreatic cancer case. individuals with mosaic 13q14.3 deletions showed no preference for developing additional mosaic autosomal events in other chromosomal locations as compared to others with non-13q14.3 mosaic events (p=0.17). detected 13q14.3 mosaic losses are plotted in figure 1 and vary in size and estimated breakpoint locations. the median mosaic loss was 1.9 mb (interquartile range : 1.117.1 mb) in size with the smallest mosaic loss 246 kb and the largest greater than 75 mb in size. overall, smaller mosaic 13q14 events are more common than larger events (figure 2a), which parallels what has been seen for large structural mosaic events across the autosomes. common breakpoint regions on the centromeric side included clusters at 29.132.0 mb, 40.143.7 mb, and 49.349.6 mb ; while breakpoints on the telomeric side primarily clustered around 50.352.9 mb (grch36). at a minimum, mosaic 13q14.3 losses detected in peripheral blood or buccal dna cover a region on chromosome 13 spanning an approximately 393 kb region from base pairs 49,590,000 to 49,983,100 (grch36). this region includes dleu1 and dleu2, the st13p4 pseudogene, and is approximately 70 kb telomeric to the location of mir15a and mir16 - 1. the variable size of the detected 13q14.3 mosaic losses resulted in deletions of other known tumor suppressor genes. when we examined the mapping of the deletions, we observed inclusion of brca2 in 10% of individuals, rb1 in 40%, mir15a in 87%, mir16 - 1 in 87%, dleu1 in 95%, dleu2 in 98%, and dleu7 in 97%. in an analysis of average lrr values, an indicator of allelic copy number, the majority of individuals with 13q14.3 mosaic losses affect only one allele (figure 2a). there was, however, one control individual with evidence for mosaic loss of both alleles at the 13q14.3 locus (lrr=1.58). overall, the observed mosaic proportion, a measurement of the percentage of cells containing 13q14 loss, was between 19.7 to 90.1 percent, with a mean of 41.4 percent (figure 2a). as expected, we observed an association between lrr and mosaic proportion in our data, indicating that despite the small size of many 13q14.3 mosaic losses, we were able to calculate highly correlated measures of mosaic percentage (p=8.1610, adj r=0.52) (figure 2b). no significant associations were observed between the size of 13q14.3 deletion and either lrr or mosaic percentage (p= 0.097 and 0.211, respectively). analysis of the 13q14.3 deletion breakpoints using select bioinformatic data tracks from the ucsc browser and encode indicates substantial clustering of active elements in the region of 13q14.3 loss breakpoints. in comparison to a random sampling of similar - sized regions on other autosomes, we observed a statistically significant enrichment for regions rich in genes and regulatory elements (figure 3). for instance, refseq genes and cpg islands were significantly enriched at 13q14.3 breakpoints (p<0.002, figure 3a), indicating 13q14.3 breakpoint regions often occur near genes or promoters of genes. indicators of open chromatin, oh radical cleavage intensity database (orchid), dnasei hypersensitivity peaks (dnase hs), and formaldehyde - assisted isolation of regulatory elements peaks (faire - seq), were also significantly enriched (p<0.002, figure 3b). there was no evidence indicating an association between recombination rate and location of 13q14.3 mosaic breakpoints (p=0.39, figure 3c). the distribution of repetitive elements such as short interspersed nuclear elements (sine), long interspersed nuclear elements (line), long terminal repeats (ltr), and segmental duplications suggests clustering in 13q14.3 breakpoint regions (figure 3d). in particular, sines are significantly enriched for (p<0.002), while ltrs are less common in these regions (p=0.002). a marginally significant enrichment for segmental duplications mosaic loss of 13q14 was slightly more common in males compared to females (0.09 versus 0.05, respectively, p=0.051). an unadjusted positive association was also observed between mosaic 13q14.3 loss and 5-year age group (< 50, 5054, 5559, 6064, 6569, 7074, 75 +, p=1.810), ranging from 0.02% for individuals less than 50 and increases up to a frequency of 0.18% for individuals 75 and older. an unadjusted association with ancestry was also detected (p - value=0.0004) with mosaic loss of 13q14.3 most commonly observed in individuals of european ancestry, but less commonly in individuals of african ancestry. overall, no significant difference in 13q14.3 loss was observed between non - hematological cancers (0.08%) and controls (0.06%) (p - value=0.19). in exploratory multivariable models including study, gender, 5-year age group, ancestry, and non - hematologic cancer status, a positive association was only observed for age (p - value=0.028). the increased odds for a 13q14.3 mosaic deletion for 75 years or older compared to those less than age 50 years was 8.70 (95% ci=1.6545.78). in the multivariable analysis, there were no associations of overall solid tumor (p - value=0.89) or specific tumor subtype with 13q14.3 mosaic loss. to investigate whether detection of 13q14 deletion could be detecting early, undiagnosed cases of cll, age and gender specific frequencies of 13q14.3 mosaic loss in our dataset were compared to seer population - based cll prevalence data (table 2). assuming 50 percent of all cll cases have 13q14.3 loss, expected age and gender stratified counts of 13q14.3 loss were estimated for our sample set based on seer limited - duration prevalence data (0 to < 34 years) and us census data. results indicate that although on average slightly more instances of 13q14.3 mosaic loss are observed among non - hematologic cancer cases and controls, this does not significantly depart from the 13q14.3 losses attributable to undiagnosed cll that would be expected in a population of this size, age, and gender distribution (p=0.46). our analysis of 13q14.3 mosaic losses in dna isolated from blood or buccal cell samples revealed an overall frequency of 0.073 percent (95% ci=0.0560.094) based on detection of 13q14.3 mosaicism in 60 individuals out of 82,483 who were included in non - hematologic cancer gwas. no significant difference in frequency of 13q14.3 mosaic loss was detected between non - hematologic cancer cases and controls. we show that the prevalence of mosaic 13q14.3 loss increases with age, a phenomenon observed for all large mosaic events. the size of 13q14.3 mosaic losses can vary, but almost always included a minimally deleted region on chromosome 13, from 49,590,000 to 49,983,100 (grch36). in more than 85% of instances, mosaic losses included the mir15a, mir16 - 1, dleu1, dleu2, and dleu7 loci. we did not identify a clearly defined set of breakpoints, suggesting that events may not be mapped to specific basepairs but instead to regions of open chromatin. an enrichment of genes, promoter sites, and enhancers around 13q14.3 breakpoints indicates cellular mechanisms related to transcription and gene expression may be important in breakpoint formation. regions of open chromatin around enhancers and gene rich regions may also expose more of the dna backbone to environmental mutagens and could result in higher probabilities for mutational events. the enrichment of sines in 13q14.3 breakpoint regions, as well as a marginally significant enrichment of segmental duplications, suggest genomic repeat regions could play a role in initiation of events leading to 13q14.3 mosaic losses. it is less clear what functional role these repetitive elements could contribute to the initiation of somatic 13q14.3 loss, but transposon activity and mismatch repair may be two important mechanisms to investigate further. while these findings do not conclusively demonstrate a specific cellular mechanism responsible for the detected 13q14.3 mosaic losses, it does suggest transcription coupled repair, exposure to dna mutagens, and transposon activity may be important mechanisms capable of initiating dna breaks leading to mosaic 13q14.3 deletions. in an unadjusted analysis, we observed 13q14.3 mosaic loss were associated with age (5-year age group), continental ancestry, and endometrial cancer, but with small numbers these latter observations are most likely a false positives. in fact, only the 5-year age group association was observed in the adjusted multivariable analysis. the association between mosaicism and age has been observed in previous studies reporting on overall autosomal mosaicism. notably, 13q14 deletion events are among the most common large structural somatic events observed in detectable mosaicism. the increasing frequency of mbl and cll with age, makes it challenging to delineate whether detected 13q14.3 mosaic losses are early biomarkers for potential mbl and cll risk or if such deletions are sentinel events that frequently appear when genomic maintenance capacities begin to deteriorate with age. additionally, many of the contributing cancer genome - wide association studies did not screen for mbl / cll, thus, there is a substantive possibility that some undiagnosed cases may have existed in our dataset. our study does not provide sufficient evidence that mosaic 13q14.3 deletions in blood or buccal dna are significantly associated with solid tumors, despite the literature reports of sporadic observations of 13q14.3 deletion events in a spectrum of cancers. publically available tcga data on the cbioportal suggests 13q14.3 deletions are present in up to 11% of prostate tumors, 7% of bladder tumors, 4% of endometrial tumors, and 3% of ovary and colorectal tumors. we surmise that many of these may be passengers and not necessarily drivers of the solid tumors. however, it is important to note that our study on dna obtained from blood and buccal cells does not provide information about the frequency of 13q14.3 loss in other tissues, which may be a more relevant prognostic feature for tumors that develop in those tissues. in addition, even in our large survey of cancer gwas, we had limited power to investigate the association between 13q14.3 mosaic loss and solid tumors. our study raises an important question regarding the implications of harboring a mosaic 13q14.3 deletion. the most likely possibility is that individuals with mosaic 13q14.3 deletions are instances of early undetected mbl / cll. the commonly deleted region in our analysis is nearly identical to that seen in mbl / cll and the frequency estimate we observe for 13q14.3 deletions (0.07%) is statistically indistinguishable from the expected age and sex prevalence of cll, assuming 50 percent of cll cases have a 13q14.3 deletion. additionally, deletions of 13q14.3 as the sole abnormality are generally associated with indolent clinical disease and often appear early in early - stage cll. alternatively, it is plausible that these 13q14.3 deletions are somatic changes in b or t cell populations that serve as sentinel events that frequently appear when genomic maintenance capacities begin to deteriorate with age. the last, and least likely possibility, is that these are inherited events passed from parents to offspring through the germline. the range of allelic proportions for heterozygous snps spanning these events (20 to 90%) substantially deviates from the 50% expectation, making this interpretation very unlikely. further large studies are required to capture a sufficiently large enough set of mosaic 13q14.3 deletions in a prospective manner so as to accurately assess cancer risk. | loss of 13q14.3 is a chromosomal event found in approximately 50 percent of b - cell chronic lymphocytic leukemia (cll) and monoclonal b - cell lymphocytosis (mbl) cases. surveys of somatic alterations in solid tumors have shown sporadic 13q14.3 loss in many different tumor types, but not at high frequency in any specific tumor type. in our recent survey of the single nucleotide polymorphism (snp) microarray data from 127,000 cancer free or solid tumor cases, we observed mosaic 13q14.3 loss as a common autosomal somatic large structural events (> 2 mb in size) in blood and buccal - derived dna. herein, we examined this region more closely investigating structural mosaic events < 2 mb using snp microarray data in 46,254 non - hematologic cancer cases and 36,229 controls. we detected 60 individuals with 13q14.3 mosaic loss, one mosaic copy neutral uniparental disomy, and 13 individuals with homozygosity. while 13q14.3 loss size was variable, the minimally deleted region (mdr) (chr13:49,590,000 - 49,983,100 ; grch36) was comparable to what is classically reported in mbl and cll. breakpoint analysis of the estimated boundaries reveals enrichment for genes and open chromatin. the frequency of 13q14.3 loss significantly increases with increasing age (p - value=0.028), but was not significantly different between non - hematological cancer cases and controls (0.084% versus 0.058% ; p - value=0.19). these findings suggest mosaic 13q14.3 losses accumulate with age. individuals with detected mosaic 13q14.3 deletions may be early, undetected cases of mbl or cll, but not necessarily all will develop mbl and cll. |
neonatal hypoxic - ischemic encephalopathy (nhie) is a neurologic disorder that can cause disturbances in global development of children.1 2 it is the most prevalent neurologic disorder in the neonatal period, and the deleterious effects of hypoxia and ischemia can affect the central nervous system of newborns.1 3 4 this neurologic disorder occurs in 33% of newborns with neonatal asphyxia.5 language is a communication device that involves the use of verbal and nonverbal symbols. language, in relation to the evolution of overall process of communication, is closely related to global development aspects, such as cognition and social skills.6 7 8 in relation to language disorders, some factors are frequently associated : inadequate environmental stimulus, particular and individual rhythm of global development, emotional conditions, social maturity, hereditary factors, diseases, and sequelae before, during, and after birth affecting the neurologic system and other complications.1 6 8 9 absence of language within expected chronological limits or a slow and difficult acquisition process can indicate global development disorders of children. no language acquisition by about 2 years old can mean difficulties of language development.6 10 11 a study showed that a difference of at least 12 months between the linguistic age and chronological age of children may indicate difficulties in language acquisition and development.12 language skills of children can be perceived and understood even before its oral manifestations, based on some underlying mechanisms to normal language development. the analysis of communication in this period includes the observation of prelinguistic, cognitive, and social development.6 13 studies have been conducted with the aim of development of tests for early identification of children at high risk for development disorders.14 15 16 this early detection and intervention of cognitive, linguistic, and social disorders is essential to prevent and minimize losses.10 16 this study intends to demonstrate the necessity that language be investigated in young children, because in the early period of child development, language is expressed, principally, by prelinguistic manifestations.8 the literature presents several studies relating language and neonatal intercurrences but still has few studies that relate newborn linguistic aspects and brazilian children with nhie, especially in early period of development. the aim of this study was observe if children with nhie have language acquisition and development disorders. research data obtained from a large cross - sectional field study were collected individually in an ambulatory of high brain function of the pediatric neurology service in a children 's hospital for advanced treatment, located in the city of porto alegre, rio grande do sul, brazil, over 2 years. all participants ' parents or caregivers signed the informed consent, according to the source institution ethics in research committee approval of the 607/10 project number. these subjects were referred by a pediatric neurologist at the moment of discharge from a neonatal intensive care unit, where the newborns were admitted due to the neonatal neurologic complications that caused brain hypoxia or ischemia. the patient follow - up initially consisted of anamnesis, medical consultation, and assessment of global neurodevelopment measured by the brunet - lezine scale (psychomotor development in early infancy).17 this test was administered by a pediatric neurologist. it has the aim of measuring the global neurodevelopment, observing the following main areas : posture and gross motor adaptation, fine motor skills, language skills, and social skills. the scale developed by brunet and lezine was translated to portuguese and adapted to brazil ; although it has been internationally validated, it has not been validated in a brazilian population. this scale was adopted for this study because it was a routinely used with all patients in this ambulatory setting and because the scale exposes good clinical results in nhie patients ' follow - up. the scale was used until patients were 24 months old, totaling 15 tests (monthly between 1 to 10 months and then at 12, 15, 18, 21, and 24 months). each level is composed of 10 items (6 tests observed in the neurologic examination and 4 questions directed to the caregivers). because patients were seen regularly according to the specific necessity of each case, data were tabulated monthly, according to the number of patients assessed at that specific age. it is important to highlight that the age considered in this examination is the corrected age of patient. data were analyzed and verified by the pearson correlation coefficient (r) and fisher exact test, using the descriptive statistics. the maximum level accepted was 5% (p 0.05) and the spss 13.0, inc. characterization data of this study sample were obtained by the pediatric neurologist in the first consultation (table 1). thirty - eight (54.28%) of the subjects had gestational age less than 37 weeks, considered as preterm according to the literature.18 abbreviation : sd, standard deviation. the studied sample obtained mean results of 84.63% in the language domain, 86.50% in social skills, 73.38% in psychomotor performance, and 74.35% in posture. table 2 reveals the results of pearson correlation test, which found no statistical significance among the variables with respect to the language domain. using the data, the executed tasks in the language domain and the sex of participants fischer exact test verified that the language variable was not significantly related to the sex of children, although it visually demonstrated a trend toward better performance in girls. it was further investigated whether linguistic performance paralleled the growth and the neurodevelopment of participants by crossing the variables of percentage of children who performed the language domain tasks versus age in months. pearson correlation analysis found the higher the age of children, the lower the percentage of executed tasks in the language domain (r = 0.566 ; p = 0.028). 1, a dispersion diagram, shows the percentage of children who performed the language domain tasks by age (in months). a negative dispersion was observed. variable dispersion : percentage of children who performed the language domain tasks versus age in months. this can affect neurodevelopment,19 20 21 22 increasing the risk of morbidity, mortality, and prolonged hospitalization23 and interfering with brain maturation processes. it can lead to structural and anatomical disorders, occasionally resulting in functional, cognitive, and behavioral disabilities.21 the literature also notes that children hospitalized for long periods are often deprived of environmental stimulation and maternal contact.19 however, there are no studies in the brazilian literature about the relation between delay in language acquisition in children with nhie. in this context, it is believed that the delay in language acquisition may be influenced by these factors. a meta - analysis demonstrated that premature infants have significantly lower scores on functional language tests compared with children born at term, and these difficulties tend to persist throughout the child 's development until early adolescence.24 this study lacks the nonsubjective language measurement, because the study covers structural and instrumental aspects. this finding contradicts one study,24 which showed significantly lower scores in functional language tests in preterm subjects. however, there is no denying the influence of prematurity on child development when combined with nhie. it can increase the negative impact of this intercurrence in the acquisition and development of language. the apgar score is an important instrument of neonatal assessment that includes five components : heart rate, respiratory effort, muscle tone, reflex irritability, and color. each aspect is scored 0, 1, or 2 and is assessed at 1 and 5 minutes after birth. according to the american academy of pediatrics and the american college of obstetricians and gynecologists,25 an apgar score of 7 to 10 is considered normal, and to determine risk factors to neurologic disorders, it is necessary to relate this score with other health complications.26 these study data do not support the current literature, which describes that apgar score below 7 can be associated with nhie.27 the most significant data come from larger samples. a better performance was seen in girls, showing that boys are frequently more affected in language disorders.28 29 in the present study, no task was significantly related to this variable. however, it is important to observe that until 10 months, with exception of language task at 7 months (vocalizing several well - defined syllables), in which boys showed better performance in relation to girls, the performance of both sexes was quite similar. from this period, the performance of girls was clearly better than boys in this domain ; table 3 presents the list of language tasks. researchers have suggested that organic, structural, and hormonal disorders may be the cause of this difference between gender.28 30 it is also highlighted that the interference of differentiated attitude by adults in relation to boys ' and girls ' language acquisition is an environmental factor that can contribute to this difference.31 it is believed that statistically significant differences in languages tests between boys and girls should appear in longitudinal studies ; with increasing age, it is possible to observe the environmental interferences with more evidence. as shown in fig. 1, by the pearson correlation, with increasing age, children start to present worse performance in language tests. this finding corroborates a study that assesses psychomotor development by brunet - lezine scale. in this study, the development quotients in each area tended to decrease during the consultations,32 revealing a progressively unsatisfactory development throughout the period. the present study found statistical significance in relation to participants ' language and age, indicating that children with nhie tended to have delayed language skills, with more evidence shown with advancing age. in this context, the observation of the findings related to the language of children with nhie indicates that deficits may become evident only with advancing age and stages of child neurodevelopment. no relation between participants ' language and sex was observed, although a trend toward better performance on language tasks by girls was noted. also, it is necessary to validate the brunet - lezine scale in brazil, to standardize and provide greater reliability in the findings. in this context, disorder traces can be early identified, favoring diagnosis and interventions in children 's early neurodevelopment. more scientific research is necessary in this area, with larger samples, to better understand the various processes related to language acquisition and development in these patients. this study reinforces the importance of observing infant manifestations and intensifying investigations on this topic, seeking precise understanding of the processes involved. the essential function of the speech therapist allied with the hospital team is highlighted, following these patients from birth through adolescence. | introduction neonatal hypoxic - ischemic encephalopathy (nhie) is a common neurologic injury, and it may compromise the child 's language and cognition. understanding the process of language acquisition becomes possible with concise knowledge about children 's global development. objective the aim of this study was to observe if language acquisition and development are impaired in children with nhie. methods seventy children with nhie from 1 to 24 months old were analyzed in a pediatric neurology service of hospital of porto alegre, south of brazil using the brunet - lezine scale. statistical analysis used spss 13.0 software. results twenty - four (60%) of the subjects were boys, with mean gestational age of 35.8 weeks (standard deviation of 4.6) and mean apgar score of 6.0 at 1 minute and 7.1 at 5 minutes. the variables age versus language showed significant inverse correlation (r = 0.566 ; p = 0.028). as the subjects aged, language tasks became more specific and dependent on the subject 's direct action, rather than the subjective interpretation of their guardian. this correlation seems to be closely associated with scale configuration and with consequences of neurologic disorder, evincing the delays in language development. conclusion this study achieved the goals proposed and highlights the necessity of greater attention by professionals to language skills during the initial period of child development. |
mosquitoes were sampled in rural areas interspersed with fragments of secondary forest at agronomy center for the vale do ribeira (fig. 1). three localities equidistant by 1 km were selected to install one mmi, one cdc with co 2 and lurex3 [cdc with co 2 and lactic acid (cdc - a) ] and one cdc - lt. mosquito collections were carried out monthly, from 15:00 pm until 21:00 pm, from december 2010-november 2011. a 3 x 3 latin square design was used to control environmental variations relative to the localities were traps were installed. accordingly, each trap was placed in a specific locality in day 1 and in the following two days they were rotated in a way that each trap sampled all three localities in three consecutive days. the sampling effort of each trap per month was 18-h (6 h / per day in 3 consecutive days). specimens were identified employing morphological keys proposed by lane (1953) for the genus limatus, galindo. (1954) for the genus uranotaenia, correa and ramalho (1956) for the subgenus phoniomyia of wyeomyia, consoli and loureno - de - oliveira (1994) for the aedini, forattini (2002) for the genus anopheles and for the spissipes section of culex (melanoconion). fig. 1 : location of the municipality of pariquera au, vale do ribeira, state of so paulo, brazil. the cdc - lt possessed a motor powered by a 6-v battery, a head connected to a collecting metal chamber and a 3-w incandescent bulb. the cdc - a was operated by a similar system, with no incandescent bulb, but with co 2 and latic acid as attractive. a cartridge of the lurex3 (american biophysics corporation) provided the lactic acid. each cartridge contained 4.88 g of lactic acid incorporated to 13.8 g of a gel matrix. this mixture was stored inside a plastic tube, allowing the release of approximately 230 mg / day of lactic acid (hoel. the co 2 was provided by a metal cylinder with four and a half pounds (white martins), with an adjustable valve (swagelok) that released 450 - 500 ml of co 2 per minute. the mmi used a mixture of propane and butane, which through its combustion releases co 2, heat and water vapour (hoel. the statistical analyses were performed in the program r 2.12, using the packages mvabund, venneuler and biodiversity r and the software spss v.13.0. levene, shapiro - wilk and kolmogorov - smirnov tests were performed to explore the normality of abundance data. indices of diversity were employed to address and compare the performance of the traps. the rnyi diversity index (henderson 2006) that generalizes total richness (= 0), diversity (shannon - weiner = 1 ; simpson - yule = 2) and dominance (berger - parker = inf) indices was employed to explore differences in species diversity among traps. the kruskal - wallis (kw) test (p > 0.05) was used to assess differences among the rnyi diversity indices estimated by each trap and the bonferroni test was utilised to perform multiple comparisons among the traps. additionally, the similarity of species captured by the traps was estimated using the jaccard and sorensen index. the veen diagram was constructed to illustrate the similarities and differences among the traps, because it shows both exclusive and shared species obtained by the traps. to assess potential associations among mosquito species and traps we employed the pearson chi - square test (). the nonparametric test of second order jackknife was used to estimate the expected species richness for each trap. multivariate analyses of abundance values were employed to address both the effect of the traps and effect of the localities in the frequency of individuals of a species sampled by each trap. for the multivariate analyses, we employed a generalised linear model (glm) implemented in the mvabund package of statistics program r 2.12 (wang. the mvabund package uses a hypothesis test based on resampling to address potential factors associated with variables (blint. (2012), models based on distance do not clarify the effect of sampling units. six thousand three hundred and ninety one mosquitoes were captured with a 216-h sampling effort. the remaining 6,055 specimens were identified in 70 species or taxonomic units of 12 genera (table i). table ispecies and taxonomic units abundance per sampling trap in rural areas in the tropical atlantic rainforest, southeastern brazilspecies and taxonomic unitcdc - lt (n)cdc - a (n)mmi (n)total (n)anophelinae anopheles costai fonseca & silva ramos081927 anopheles bellator dyar & knab0101 anopheles cruzii dyar & knab0112 anopheles galvaoi causey, deane & deane1001 anopheles triannulatus (neiva & pinto)1001aedeomyiini aedeomyia squamipennis (lynch arribalzaga)2103aedini ochlerotatus fulvus (wiedemann)01910 ochlerotatus hastatus / oligopistus dyar0516 ochlerotatus scapularis (rondani)12501275788 ochlerotatus serratus (theobaldi)28283113424 ochlerotatus serratus / nubilus 713334174 ochlerotatus argyrothorax bonne - wepster & bonne01910 stegomyia albopicta (skuse)0011 psorophora cingulata (fabricius)1124 psorophora albigenu (peryass)78186264 psorophora albipes (theobald)2712194 psorophora ferox (von humboldt)2423478culicini culex amazonensis (lutz)921122 culex chidesteri dyar93012 culex eduardoi casal & garcia2002 culex nigripalpus theobald943670200 culex quinquefasciatus say0022 culex spp66345105 culex spp coronator complex63110 culex akritos forattini & sallum3003 culex bastagarius dyar & knab7007 culex faurani duret2114 culex ocossa dyar & knab1001 culex pedroi sirivanakarn & belkin3104 culex ribeirensis forattini & sallum43286285803 culex sacchettae sirivanakarn & jakob10077216393 culex spp atratus group4307 culex spp pilosus group3137 culex spp melanoconion section263029 culex spissipes (theobald)1001 culex vaxus dyar100010 culex zeteki dyar4004mansoniini coquillettidia albicosta (peryass)1012 coquillettidia chrysonotum (peryass)43167518728 coquillettidia hermanoi (lane & coutinho)0011 coquillettidia venezuelensis (theobald)28125090 mansonia humeralis dyar & knab0101 mansonia indubitans dyar & shannon0176582 mansonia titillans (walker)202375118 mansonia wilsoni (barreto & coutinho)0033sabethini limatus durhami theobald14259545818 limatus flavisetosus de oliveira castro121323345 runchomyia reversa lane & cerqueira061016 runchomyia theobaldi (lane & cerqueira)0202 sabethes ignotus harbach0011 wyeomyia felicia / pampeithes (dyar & nunez tovar)033437 wyeomyia bonnei (lane & cerqueira)0101 wyeomyia davisi (lane & cerqueira)0189 wyeomyia flabellata (lane & cerqueira)0011 wyeomyia incaudata root0055 wyeomyia pallidoventer (theobald)0044 wyeomyia pilicauda root0134 wyeomyia confusa (lutz)222169193 wyeomyia aporonoma dyar & knab003030 wyeomyia coenonus / tarsata 0011 wyeomyia howardi / luteoventralis 0022 wyeomyia melanocephala dyar & knab0112 wyeomyia personata lutz1001 wyeomyia roucouyana / chalcocephala 0011uranotaeniini uranotaenia apicalis theobald5005 uranotaenia calosomata dyar & knab7007 uranotaenia geometrica theobald2002 uranotaenia lowii theobald2002 uranotaenia mathesoni lane250126 uranotaenia pulcherrima lynch arriblzaga1001 total abundance9901,9143,1516,055 total species / taxonomic units42414670cdc - a : cdc with co 2 and lactic acid ; cdc - lt : cdc light trap ; mmi : mosquito magnet independence. cdc - a : cdc with co 2 and lactic acid ; cdc - lt : cdc light trap ; mmi : mosquito magnet independence. results of the normality tests showed that the abundance data has a non - normal distribution. accordingly, levene s test obtained value p = 0.001, whereas in both kolmogorov - sminorv and shapiro - wilk tests was p = 0.000. the pearson -square statistics showed potential association between cdc - lt and the tribe culicini. species from this tribe represented 78.9% of total mosquitoes captured by the trap (= 2760.04 ; p deviance)trap ochlerotatus scapularis 11.590.055cdc - a coquillettidia chrysonotum 16.090.008mmi culex (cux.) spp melanoconion section17.170.005cdc - lt limatus durhami 42.710.001mmi limatus flavisetosus 41.200.001mmi mansonia indubitans 12.820.036mmi phlegethontius albigenu 13.570.027mmi uranotaenia calosomata 13.990.019cdc - lt wyeomyia felicia / pampithes 25.940.001mmi wyeomyia confusa 38.970.001mmi wyeomyia aporonoma 36.050.001mmicdc - a : cdc with co 2 and lactic acid ; cdc - lt : cdc light trap ; mmi : mosquito magnet independence ; pr : probability. cdc - a : cdc with co 2 and lactic acid ; cdc - lt : cdc light trap ; mmi : mosquito magnet independence ; pr : probability. results of the analyses carried out in the present study indicated that the mmi is the most efficient trap to capture mosquito species present in rural areas located in the deforested areas within the domain of tropical rainforests. these studies demonstrate that any model of mm trap is capable of removing large numbers of mosquito specimens from the environment, especially individuals from species with a great potential to become pest in environments impacted by human activities. this is the case of some species such as ochlerotatus scapularis, culex ribeirensis and coquillettidia chrysonotum. these mosquitoes were abundant and had potential to become pests in both rural and urban environments (forattini. several models of mm were developed to effectively removing synanthropic mosquitoes from urban and rural environments (cilek & hallmon 2005). however, mm traps were also employed for surveillance of mosquito species with potential to transmit the west nile virus in the united kingdom (hutchinson. the same trap was utilised to sample ceratopogonidae insects in agricultural areas and thus to monitor the circulation of the schmallenberg virus. infections by the schmallenberg virus can cause congenital malformations and stillbirths in cattle and goats (rasmussen., studies employing mm traps showed that it was efficient for collecting anopheles nuneztovari mosquitoes in a malaria - endemic area in the amazon basin (rubio - palis. results of the statistical tests indicated a significant difference regarding to diversity indexes obtained with both cdc - a and mmi in comparison to those with cdc - lt. this can be explained by similarity between cdc - a and mmi, which was likely caused by the use of kairomones that promoted the capture of the same species. (1987, 1993b) used carbon dioxide in cdc - lt to study the population dynamics, feeding behaviour and ecological characteristics of mosquito communities in a gradient of environments in the vale do ribeira. additionally, the species showed capacity to invade, establish and disperse in domiciliary environments (forattini. 1987). as a result of the study, cdc - a and cdc - lt were similar regarding to species richness, but distinct in addressing both species composition and abundance. these species can feed on mammals, including humans and other vertebrates and thus seems to be capable of participating in the transmission cycle of pathogens from rural to urban environments (forattini. it is noteworthy that only cdc - lt captured specimens of the genus uranotaenia, corroborating the results of xue. species of the genus uranotaenia are not anthropophilic and therefore were not attracted to kairomones employees in cdc - a and mmi. these chemicals were developed to attract insects that feed on humans and domestic animals and therefore they are not suitable to sample zoophilic species, for instance, uranotaenia species that mostly feed upon amphibian blood (cupp. 2004) that can be reservoirs of the eastern equine encephalitis virus in north america (graham. laporta and sallum (2011) investigated the potential of using carbon dioxide and octenol combined and separated as attractive in cdc - lt in a preserved atlantic forest area, in canania, sp. as a result, authors showed that the addition of co 2 in the cdc - lt increased both abundance and richness of mosquitoes sampled by cdc - lt. contrasting, either octenol only or a combination octenol and co 2 did not improve the results of cdc - lt. it is possible that the low concentration of octenol employed in the traps did not contribute to a synergistic effect with co 2. similar studies carried out in florida, united states of america, to investigate the attractiveness of chemicals on mosquitoes showed that the performance of cdc - lt increased with the addition of co 2 (kline. moreover, the lactic acid added to the cdc - lt increased the potential of the trap to capture culex nigripalpus, an important vector - borne species in north america. thus, mmi and cdc - a seems to be important traps for surveillance to the mosquito species. it is noteworthy that for the control of sucking species or synanthropic vector with potential role of pathogens to humans, the use of mmi, with carbon dioxide and lactic acid, is the most suitable. however, to realisation of collections in places with difficult access or stratification studies, for example, their use may be impaired. accordingly cdc - a, which uses the same attractive may be an option to replace the mmi, as it can be more easily handled and compared to mmi relative for the ability to collection of the number and composition of the assembly of mosquitoes present in the focus of research. these studies encouraging for further studies employed mm trap for surveillance of mosquito species involved in the parasite transmission to humans and ecological studies. results of the bonferroni test to verify the statistical significance for the indices obtained in the rnyi diversity index trap rnyi diversitycdc - lt / cdc - acdc - lt / mmicdc - a / mmi0 (= total richness)p = 0.020 p = 0.0004 p = 0.731 (= shannon - weiner index)p = 0.007 p = 0.0001 p = 0.692 (= simpson - yule index)p = 0.006 p = 0.0001 p = 0.75inf (= berger - parker index)p = 0.014 p = 0.0001 p = 0.56 a : significant result to the value of p < 0.05 ; cdc - a : cdc with co2 and lactic acid ; cdc - lt : cdc light trap ; mmi : mosquito magnet independence. a : significant result to the value of p < 0.05 ; cdc - a : cdc with co2 and lactic acid ; cdc - lt : cdc light trap ; mmi : mosquito magnet independence. species unique to each traps and shared between themspecies and taxonomic units exclusively captured by the trapcdc - ltcdc - ammi anopheles galvaoi anopheles triannulatus culex eduardoi culex akritos culex bastagarius culex ocossa culex spissipes culex vaxus culex zeteki uranotaenia apicalis uranotaenia calosomata uranotaenia geometrica uranotaenia lowii uranotaenia pulcherrima wyeomyia personata anopheles bellator mansonia humeralis runchomyia theobaldi wyeomyia bonnei stegomyia albopicta coquillettidia chrysonotum coquillettidia hermanoi culex quinquefasciatus mansonia wilsoni sabethes ignotus wyeomyia flabellata wyeomyia incaudata wyeomyia pallidoventer wyeomyia aporonoma wyeomyia coenonus / tarsata wyeomyia howardi / luteoventralis wyeomyia roucouyana / chalcocephala species and taxonomic units shared between traps cdc - lt and cdc - acdc - lt and mmicdc - a and mmi aedeomyia squamipennis culex chidesteri culex (melanoconion) atratus group culex (melanoconion) spp melanoconion section coquillettidia albicosta uranotaenia mathesoni ochlerotatus fulvus ochlerotatus hastatus / oligopistus ochlerotatus argyrothorax anopheles costai anopheles cruzii mansonia indubitans psorophora albigenu runchomyia reversa wyeomyia felicia / pampithes wyeomyia davisi wyeomyia pilicauda wyeomyia melanocephala shared among all traps ochlerotatus scapularis ochlerotatus serratus ochlerotatus serratus / nubilus coquillettidia chrysonotum coquillettidia venezuelensis culex amazonensis culex nigripalpus culex (culex) coronator complex culex faurani culex ribeirensis culex sacchettae culex (culex) pilosus group limatus durhami limatus flavisetosus mansonia titilans psorophora abipes psorophora cingulata psorophora ferox wyeomyia confusa a : significant result to the value of p < 0.05 ; cdc - a : cdc with co2 and lactic acid ; cdc - lt : cdc light trap ; mmi : mosquito magnet independence. a : significant result to the value of p < 0.05 ; cdc - a : cdc with co2 and lactic acid ; cdc - lt : cdc light trap ; mmi : mosquito magnet independence. | in several countries, surveillance of insect vectors is accomplished with automatic traps. this study addressed the performance of mosquito magnet independence (mmi) in comparison with those of cdc with co2 and lactic acid (cdc - a) and cdc light trap (cdc - lt). the collection sites were in a rural region located in a fragment of secondary tropical atlantic rainforest, southeastern brazil. limatus durhami and limatus flavisetosus were the dominant species in the mmi, whereas ochlerotatus scapularis was most abundant in cdc - a. culex ribeirensis and culex sacchettae were dominant species in the cdc - lt. comparisons among traps were based on diversity indices. results from the diversity analyses showed that the mmi captured a higher abundance of mosquitoes and that the species richness estimated with it was higher than with cdc - lt. contrasting, difference between mmi and cdc - a was not statistically significant. consequently, the latter trap seems to be both an alternative for the mmi and complementary to it for ecological studies and entomological surveillance. |
in herpes simplex encephalitis (hse), the gray matter of the temporal and frontal lobes is predominantly destroyed by many foci of hemorrhage and necrosis. the lesions usually begin either unilaterally or bilaterally in the medial temporal cortex with bilateral spread along limbic pathways to the orbital frontal lobe and insular cortex. parietal, occipital, brainstem, internal capsule, and cingulate gyrus involvement often occurs with further spread, but the basal ganglia and lobar white matter are relatively spared. here, we report a case of hse with basal ganglia and white matter involvement evident on mri during the acute stage, which presented with unusual and severe progression. when there was no response to medical management of hse, we had to use surgical decompression. pathological findings of hse during the acute stage indicated involvement of the white matter. to our knowledge, this is the first report which shows both mr and pathological findings in the white matter during the acute stage of hse. a previously healthy 51-year old male presented with the sudden onset of generalized tonic clonic convulsion. after two hours he was admitted to our hospital. the convulsion had terminated spontaneously after thirty minutes. on admission, he had no headache, was not vomiting, and had a low - grade fever of 37.4c. there were no obvious motor or sensory abnormalities, and his reflexes were equal bilaterally in both the upper and lower limbs. mri on admission (three hours after onset) was normal on t1, t2, diffusion - weighted (dw) and fluid - attenuated inversion recovery (flair) images. one hour after admission, clonic convulsion in his right arm emerged without impaired consciousness. the focal seizure could not be controlled by diazepam, phenytoin and midazolam infusion. this refractory focal seizure persisted until day 3 without other neurological focal signs, and a second mri on day 2 was normal on t1, t2, dw, flair, and gadolinium - enhanced t1 images. electroencephalography (eeg) on day 2 showed left parietal focal slow activity without epileptiform discharge. titers for common viruses (hivs, epstein - barr, cytomegalovirus, herpes zoster, and herpes simplex), bacteria, and toxoplasmosis were negative. tests for autoantibodies (antinuclear, anti - deoxyribonucleic acid, and anti - ribonucleoprotein antibodies), lupus erythematosus factor, syphilis serology, p - and canca were all negative. cerebrospinal fluid (csf) examination on day 3 showed no abnormality, and no herpes simplex virus (hsv) dna was demonstrated by polymerase chain reaction (pcr). cytology and culture of the csf for bacteria, tuberculous bacillus, and fungi were negative. axial dw and flair images on day 4 revealed high - intensity areas in the left frontal cortex (figure 1a). the clonic seizure in the right arm changed to myoclonic status in the mouth, diaphragm, and right arm. additionally, respiratory failure necessitated artificial ventilation under anesthesia. continuous propofol infusion did not suppress the myoclonic status migrating around the four limbs, from the right arm to the right leg, the right leg to the left arm, and the left arm to the left leg, every other day. after the myoclonus in the left leg disappeared, myoclonic status persisted in the diaphragm alone. high - dose barbiturate therapy instead of propofol did not resolve this intractable myoclonic status in the diaphragm. eeg on day 7 revealed a burst - suppression pattern observed during barbiturate coma. axial dw and flair images on day 9 revealed high - intensity areas ; bilaterally widespread in frontoparietal cortex, medial temporal lobe, insula, and putamen with left - sided predominance, additionally in the frontal orbital lobes bilaterally, in the left caudate nucleus, and the thalamus (figure 1b). on lumbar puncture, csf pressure was 400 mm h2o, cell count was 16/mm (56% mononuclear cells), csf protein concentration and glucose were normal at 27 and 98 mg / dl (blood glucose 115 mg / dl), respectively, and the pcr result was positive for hsv-1 dna. a diagnosis of hse was made, and acyclovir was administered on day 9, but did not suppress the emergence of the diaphragmatic myoclonic status. fever increased to high - grade, and coma persisted, so artificial ventilation did not require sedation. axial dw and flair images on day 16, compared with the previous mri, demonstrated more widespread lesions indicating frontoparietal involvement, progression of left thalamic high - intensity areas, and swelling sufficient to cause midline shift to the right and distortion of the lateral ventricle (figure 1c). axial fluid - attenuated inversion recovery (flair) images : (a) on day 4, showing high signal intensity in the left frontal cortex, and (b) on day 9, showing high signal intensity in the frontoparietal cortex bilaterally, medial temporal lobe, insula, and putamen with left - sided predominance, and in the frontal orbital lobe bilaterally, left caudate nucleus, and thalamus. the high - intensity areas in the gray matter shown on day 9 increased : (c) on day 16, except in the basal ganglia (caudate nucleus, putamen), especially in the left thalamus, which caused midline shift to the right, and (d) on day 23, extending to the white matter, causing an increased midline shift to the right and cerebral edema. axial fluid - attenuated inversion recovery (flair) images : (a) on day 4, showing high signal intensity in the left frontal cortex, and (b) on day 9, showing high signal intensity in the frontoparietal cortex bilaterally, medial temporal lobe, insula, and putamen with left - sided predominance, and in the frontal orbital lobe bilaterally, left caudate nucleus, and thalamus. the high - intensity areas in the gray matter shown on day 9 increased : (c) on day 16, except in the basal ganglia (caudate nucleus, putamen), especially in the left thalamus, which caused midline shift to the right, and (d) on day 23, extending to the white matter, causing an increased midline shift to the right and cerebral edema. cerebral edema worsened, and adjunctive immunosuppressive (steroid pulse therapy and intravenous immunoglobulin) and high - dose anti - edematous therapies were added. csf examination on day 20 revealed a 37/m cell count (65% mononuclear cells) and protein concentration of 340 mg / dl. axial dw and flair images on day 23 showed high - intensity areas in the white matter adjacent to the affected gray matter, and cerebral edema worsened catastrophically (figure 1d). one hour after the mri was performed (on day 23), sudden hypotension and mydriasis emerged, which suggested cerebral herniation. surgical decompression resolved the cerebral herniation, and rescued our patient from death. despite this, coma, diaphragmatic myoclonic status, and histological examination detected perivascular infiltration of lymphocytes and destruction of basic structure (figure 2a, b). obvious edema, demyelination and axonal reduction were not seen (figure 2c, d). figure 2microscopic findings of the biopsied tissue in the left frontal lobe (a, b, c, d). (a) and (b, arrows) : perivascular infiltration of lymphocytes and destruction of basic structure, which confirmed non specific inflammatory change, hematoxylin - eosin stain, 10 and 40, respectively. (c) : no obvious demyelination, kluver - barrera stain, 10. (d) : no definite axonal reduction or swelling, bodian stain, 10. microscopic findings of the biopsied tissue in the left frontal lobe (a, b, c, d). (a) and (b, arrows) : perivascular infiltration of lymphocytes and destruction of basic structure, which confirmed non specific inflammatory change, hematoxylin - eosin stain, 10 and 40, respectively. (d) : no definite axonal reduction or swelling, bodian stain, 10. subsequently, axial dw and flair images on day 30 displayed the extensive white matter lesions extending into the lower midbrain and pons despite surgical decompression (figure 3a). resolution of high - grade fever coincided with amelioration of diaphragmatic myoclonic status, while coma and decorticate states persisted. at four months after onset, this patient remained in a comatose and decerebrate state under artificial ventilation. two years after onset, an axial flair image showed cerebral atrophy, severe ventricular dilatation and multiple cystic changes (3b). figure 3axial flair images : (a) after surgical decompression showing high signal intensity in the frontotemporoparietal lobes bilaterally, left occipital lobe, basal ganglia bilaterally, left midbrain, and pons, and (b) two years after onset showing cerebral atrophy, severe ventricular dilatation, and cystic change in the frontal lobes, with left - sided predominancy, and in the left thalamus. axial flair images : (a) after surgical decompression showing high signal intensity in the frontotemporoparietal lobes bilaterally, left occipital lobe, basal ganglia bilaterally, left midbrain, and pons, and (b) two years after onset showing cerebral atrophy, severe ventricular dilatation, and cystic change in the frontal lobes, with left - sided predominancy, and in the left thalamus. typically, mri abnormalities in hse are seen in the temporal and frontal lobes, and the basal ganglia and white matter are relatively spared. early diagnosis of hse is difficult because of the finding of a normal mri or a purely extra - temporal involvement. clinical diagnosis is suggested by the febrile patient with focal neurologic signs, and the most important factor in the diagnosis of hse is the consideration of this diagnostic possibility. hence, if hse is suspected, treatment should be started before a definitive diagnosis is made. early administration of antiviral therapy is the only parameter that can be modified to improve the prognosis of the patient with hse. in our case, mri and csf examinations were normal until day 3, and the initial abnormal dw and flair images on day 4 revealed purely extra - temporal involvement, which delayed antiviral therapy. first, the initial lesion was seen in the left frontal cortex, and extended to have an unusual distribution into the basal ganglia, i.e., from purely extra - temporal involvement, which are usually spared in hse. additionally, mri on days 9 and 16 showed thalamic involvement. in infectious encephalitis, bilateral involvement of the basal ganglia and thalamus is characteristic of flavivirus encephalitis, like japanese encephalitis. therefore this case suggested that mr findings, which displayed purely extra - temporal involvement in the early stage and subsequently basal ganglia and thalamic involvement, did not rule out hse conclusively. second, mri revealed the extensive white matter involvement adjacent to the affected gray matter, in parallel with monophasic clinical worsening. this white matter involvement appeared on day 23, during the acute stage. in this report, acute stage means the stage of the illness where the symptoms are the most severe before recovery. this acute white matter involvement revealed high - intensity areas on dw and flair images, and especially markedly high intensities on dw images. several reports have described white matter lesions that appeared several weeks or months after the onset of illness, not during the acute stage like the present case but during the subacute or chronic stage. the delayed white matter lesions appeared with or without deterioration of conditions after the discontinuation of the acute stage, which developed independently of the affected gray matter lesions. there have been no reports regarding intensities on dw images in delayed white matter involvement. the mechanism underlying the delayed white matter lesions has not been elucidated, and an immune - mediated complication, such as edema or demyelination, is suspected. besides, another two mechanisms are possible : the occurrence of late - onset symptoms of the initial viral infection, and recurrence of viral replication (as a result of incomplete treatment of the initial hse or by selection of clones of an acyclovir - resistant virus). one autopsy study of hse with delayed white matter involvement showed diffuse edema, without demyelination or viral inclusion. another biopsy study of hse with delayed white matter involvement revealed cell - mediated demyelination without reactivation of the hsv infection. in the present case, the acute white matter involvement appeared adjacent to the affected gray matter with high intensities on dw images. the speculated mechanism of the acute white matter involvement was direct invasion of hsv different from that with the delayed change. on the other hand, it was postulated at the autopsy that focal perivascular myelin destruction in the white matter, without recovery, was dependent on the immune response. that is to say, the speculated mechanism underlying either the delayed or acute white matter involvement of hse has been controversial. microscopic findings of the biopsied tissue obtained in acute white matter involvement demonstrated perivascular infiltration and destruction of basal structure, which confirmed non specific inflammatory changes. a brain biopsy was carried out on day 23, after acyclovir administration, which demonstrated some of the neurons to be immunohistochemically positive for hsv-1 antigen. thus we could not conclude that the acute white matter involvement was not a result of direct invasion of hsv. obvious edema, demyelination, axonal reduction, and swelling, which could suggest the mechanism underlying the white matter involvement of hse during the acute stage, were not seen. there was a discrepancy between nonspecific pathological findings and the unusual clinical course of the present hse, including mr findings. hence, it is still unclear from the histology whether the acute white matter involvement is because of direct invasion of hse, like the affected gray matter, or secondary inflammatory change or both, but combination therapy with antiviral therapy and immunosuppressive therapy did not control the condition. although the white matter involvement had not extended into the medulla oblongata on mri, prolonged respiratory failure necessitated artificial ventilation. therefore, it was possible that the respiratory centers located in the medulla oblongata were injured despite there being no corresponding involvement on mri. the present case resulted in neurologic deterioration because of cerebral edema and herniation despite antiviral, immunosuppressive, and anti - edematous therapies. emergency decompressive craniectomy prevented death as a result of cerebral herniation, but lead to severe neurological sequelae. matthew. (reported by adamo and deshaies, 2008) discussed cases of infectious encephalitis including hse, which resulted in excellent recovery after surgical decompression. the reason that surgical decompression did not lead to improvement in the present case may be attributed to the devastating white matter involvement, sufficient to extend into the brainstem and cause injury to the respiratory center even after surgical decompression. if extensive progression into the white matter could have been prevented, the sequelae would not have been as severe as in the present case. therefore, further investigation of the mechanism underlying the white matter involvement of hse during the acute stage is needed. | we report a 51-year old male with herpes simplex encephalitis (hse) showing unusual progression and magnetic resonance (mr) findings. the initial neurological manifestation of intractable focal seizure with low - grade fever persisted for three days, and rapidly coma, myoclonic status, and respiratory failure with high - grade fever emerged thereafter. the polymerase chain reaction (pcr) result of cerebrospinal fluid (csf) was positive for hsv-1 dna. in the early stage, mr images (mri) were normal. on subsequent mr diffusion - weighted (dw) and fluid - attenuated inversion recovery (flair) images, high - intensity areas first appeared in the left frontal cortex, which was purely extra - temporal involvement, and extended into the basal ganglia, then the white matter, which are relatively spared in hse. antiviral therapy and immunosuppressive therapy did not suppress the progression of hse, and finally severe cerebral edema developed into cerebral herniation, which required emergency decompressive craniectomy. histological examination of a biopsy specimen of the white matter detected perivascular infiltration and destruction of basic structure, which confirmed non specific inflammatory change without obvious edema or demyelination. the present case shows both mr and pathological findings in the white matter in the acute stage of hse. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.