article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
world health organization (who) guidelines for pharmacological management of cancer pain consider that opioid analgesics are an established therapy for moderate - to - severe cancer pain.1 the european association of palliative care (eapc) recommends the use of morphine, oxycodone (oxy), and hydromorphone as first - line options for therapy with a strong opioid.2,3 in a recent study assessing the effectiveness of four strong opioids (morphine, buprenorphine, oxy, and fentanyl) in cancer patients, the efficacy and tolerability profiles of these drugs were found to be broadly similar, although some variability in response among different opioids was seen.4 in particular, a series of systematic reviews on the use of opioids in cancer pain reported that oxy, a semisynthetic opioid analgesic, has an efficacy and tolerability that are similar to morphine.5,6 the clinical use of opioids is limited by the occurrence of problematic adverse effects. the most common adverse event is opioid - induced bowel dysfunction, which includes constipation, hard dry stools, incomplete evacuation, bloating, abdominal cramping, and increased gastric reflux. bowel dysfunction occurs in ~90% of cancer patients receiving opioid therapy;7 the frequency of the above - mentioned symptoms ranges from 26% to 49% in patients receiving oxy.811 both the european society of medical oncology and the eapc recommend routine use of laxatives in patients with advanced cancer receiving opioids.2,12 a fixed combination of oral prolonged - release oxycodone and naloxone (oxn) in a 2:1 ratio has been developed in the attempt to minimize the adverse gastrointestinal effects of opioids.13 naloxone is an opioid receptor antagonist with very low bioavailability (77%). the bfi score at baseline suggested the absence of overt bowel dysfunction prior to opioid prescription, although one - quarter of patients were already on laxatives. api decreased markedly from baseline to t60 (figure 2) from 7.31.6 to 4.22.3 in oxy recipients and from 7.31.4 to 4.31.7 in oxn recipients (p, not significant). the apid from baseline to t60 was 3.12.3 and 3.01.8 in the oxy and oxn groups, respectively (p, not significant). average dn4 scores decreased over 60 days of treatment, from 5.01.2 to 3.31.7 in the oxy group and from 4.71.4 to 2.72.2 in the oxn group. the proportion of patients with dn4 4 also decreased significantly in both groups at t60 (52.8% of those treated with oxy and 43.8% of oxn recipients ; both p 5% at 60 days was low and comparable between groups (2.7% and 1.4% in oxy and oxn recipients, respectively). there were also no significant differences between the oxy and oxn groups in qol assessments during the study (table 2), with the exception of the sf12 pcs score, which increased by 7.0 points in the oxn group and 3.2 points in the oxy group (p 5% at 60 days was low and comparable between groups (2.7% and 1.4% in oxy and oxn recipients, respectively). there were also no significant differences between the oxy and oxn groups in qol assessments during the study (table 2), with the exception of the sf12 pcs score, which increased by 7.0 points in the oxn group and 3.2 points in the oxy group (p 50) at baseline were similar in the oxy and oxn groups but significantly diverged during the study ; bowel function worsened with oxy therapy but improved with oxn, as also suggested by differences in laxative use between groups. this study utilized a composite endpoint to fully assess the benefit of oxy and oxn. a combined efficacy tolerability endpoint (in our study, the proportion of patients with 30% reduction in pain intensity and a bfi score < 51) is rather unusual but in our opinion summarizes well the two main goals of effective treatment for cancer pain, namely achieving good analgesia and avoiding or reducing the severity of typical opioid - related side effects, such as oic. the better performance of oxn on a combined endpoint can thus be considered to be a good overall summary of the study findings. the results of our propensity analysis are concordant with the results of other studies assessing efficacy and tolerability of oxn in cancer patients.2125 in a retrospective study of 206 ambulatory patients with uncontrolled pain, cuomo found that oxn was highly effective and without adverse effects on bowel function, and equally efficacious and well tolerated in both opioid - nave and experienced patients, as well as in younger and older patients.21 in that study, however, patients previously treated with oxy were not included. a small nonrandomized, open - label study documented clinically relevant improvement in pain intensity and bowel function, as well as increased patient satisfaction, after treatment with oxn.22 a previous rct compared the efficacy and safety of oxy and oxn in a very selected cohort of opioid - pretreated cancer patients with controlled pain and oic at baseline : patients who were switched from other opioids to oxn experienced a similar analgesic effect as well as clinically relevant improvement in bowel function compared with patients switched to oxy.24 however, additional randomized studies are needed to compare different opioids in unselected patients with cancer pain. this study has several limitations related to the methodology used to control for the unbalance between groups, which should be taken into account when judging the internal and external validity of the results. first, the assumption that sufficient variance has been considered in the propensity model should be effectively demonstrated. to optimize the propensity model, data collection was based on the current literature1017 and expert recommendations,38,39 and most of the relevant variables were included in the propensity model. unlike randomization, propensity analysis can only remove overt (known) bias ; however, hidden (unmeasured) biases remain, and therefore, the results generated using propensity matching should be interpreted with caution. the validity of the results will depend on the quality and amount of information on the efficacy and safety of the treatments under evaluation. in addition, the characteristics of the sample population are also important : propensity analysis allows limited extrapolations to different patient groups and settings with a distribution of covariates that differs from the one used for score generation. for instance, our population showed a high (77.4%) prevalence of np at study entry, which is a rather distinctive finding. the high rate of np found in our study may be related to the systematic screening with the dn4 at baseline and the inclusion of mixed nociceptive pain and np ; a similar rate has also been recently reported.21 the problem of external validity (generalizability) of the results is consistent, and other relevant determinants involved in physician and patient decisions about whether or not to prescribe and use a treatment are often not fully considered. despite these cautions and inherent limitations, use of a propensity model may improve understanding of the actual value of the results from observational studies. despite the above - mentioned limitations and the single - center nature of this study, the patient population is nonetheless representative of those with moderate - to - severe cancer pain requiring treatment with who step iii opioids, and may provide useful guidance for daily management of these patients. the results of this study confirm previous data, suggesting that the analgesic properties of oxn are similar to oxy, with less oic, and extend these findings to patients with cancer pain. in fact, effective analgesia was documented using low and stable dosages, in addition to a good safety profile and a reduced prevalence of nausea and vomiting with oxn vs oxy. in addition, these results provide important information about the proportion of patients achieving good or inadequate overall responses to analgesic therapy. this is applicable to all opioids and suggests the need to investigate the causes of opioid noneffectiveness and strategies to overcome this problem. areas for future research include how the response to opioids is related to the agent used, the clinical condition of the patient, or other variables (eg, dosages, genetic profile, epigenetic mechanisms). an ongoing study is investigating potential correlations between the response to oxn and clinical characteristics such as the type of pain, psychological structure, comorbidities, and cotreatments to better understand the determinants and degree of analgesic response. | backgroundworld health organization step iii opioids are required to relieve moderate - to - severe cancer pain ; constipation is one of the most frequent opioid - induced side effects. a fixed combination, prolonged - release oxycodone / naloxone (oxn), was developed with the aim of reducing opioid - related gastrointestinal side effects. the objective of this study was to compare the efficacy and safety of prolonged - release oxycodone (oxy) alone to oxn in opioid - nave cancer patients with moderate - to - severe pain.methodspropensity analysis was utilized in this observational study, which evaluated the efficacy, safety, and quality of life.resultsout of the 210 patients recruited, 146 were matched using propensity scores and included in the comparative analysis. in both groups, pain intensity decreased by 3 points after 60 days, indicating comparable analgesic efficacy. responder rates were similar between groups. analgesia was achieved and maintained with similarly low and stable dosages over time (12.020.4 mg / d for oxy and 11.522.0 mg / d for oxn). bowel function index (bfi) and laxative use per week improved from baseline at 30 days and 60 days in oxn recipients (16, p<0.0001 and 3.5, p=0.02, respectively) ; bfi worsened in the oxy group. the overall incidence of drug - related adverse events was 28.9% in the oxy group and 8.2% in the oxn group (p<0.01) ; nausea and vomiting were two to five times less frequent with oxn. quality of life improved to a significantly greater extent in patients receiving oxn compared to oxy (increase in short form-36 physical component score of 7.1 points vs 3.2 points, respectively ; p<0.001).conclusionin patients with chronic cancer pain, oxn provided analgesic effectiveness that is similar to oxy, with early and sustained benefits in tolerability. the relationship between responsiveness to oxn and clinical characteristics is currently being investigated. |
the chronic disease management network (cdm - net) project developed, implemented, and evaluated a broadband - based network of health services known as the chronic disease management service (cdms) for managing chronic disease, using type 2 diabetes mellitus (t2 dm) as the test disease. a number of electronic systems are currently being used to enhance diabetes care including diabetes registers, clinical decision support systems, and web - based management programs. in order to find studies that evaluated information technology - based interventions that assist gps to care for patients with diabetes, it was necessary to search the international literature, which could indicate that there is a pressing need to use the technology available for use in general practice in australia to provide the best care for patients. t2 dm is a chronic progressive disease associated with high morbidity and mortality rates and currently affects an estimated 1.7 million australians [2, 3 ]. t2 dm accounts for 85% to 90% of all diagnosed cases of diabetes with lifestyle factors such as inactivity, obesity, and calorie - dense diets contribute to the increasing prevalence of t2 dm. key diabetes management targets include achieving and maintaining hba1c levels at less than 7%, normal lipids, preventing diabetes complications, appropriate self - care and optimal quality of life. management is generally undertaken by general practitioners (gps) supported by an interdisciplinary health care team. in australia, most chronic disease management undertaken by gps is underwritten by medicare australia, and for eligible allied health services such as chiropractors, diabetes educators, dietitians, podiatrists, and others, and under certain conditions, can claim under medicare items 10950 to 10970. gps receive financial incentives to use structured chronic disease care plans through medicare enhanced primary care (epc) item numbers for general practitioner management plans (gpmps item 721) and are encouraged to collaborate with allied health providers and other health care professionals when developing team care arrangements (tcas item 723) [4, 7 ]. while a steady increase in the number of gpmps and tcas has been reported, less than 14% of patients with chronic disease have a gpmp and/or a tca. in addition, medicare claims data suggest only one in five of these plans is regularly followed up and reviewed at the recommended frequency even though research suggests that patients with chronic disease may be hospitalised less frequently if they receive optimal care. conversely, improved outcomes for patients with diabetes have been reported when gpmps and tcas are used [11, 12 ], partly because of the structured and systematic approach to care. barriers identified by gps for not using gpmps include time constraints and difficulty communicating with other health providers. some barriers such as communication could be reduced by effectively using information technology (it), particularly since the introduction of it into general practice in australia in 1999. nonetheless, greater integration of it into general practice and allied health care providers is still needed [15, 16 ]. the cdm - net project was a collaborative project developed and evaluated during 20072009 involving 12 australian and international organisations including an external provider, precedence health care. there were two parts to the project : first the development and formative evaluation of the chronic disease management system (cdms) to facilitate gps ' use of gpmps and tcas and collaboration between gps, and other health professionals ; the second, to evaluate the clinical utility and health professionals ' acceptance of the system. there was no charge to the gps for the use of the cdms. at the completion of the project, a business arrangement was proposed by precedence health care for the participating gps to consider and/or take up for future use of cdms. cdms is a secure broadband - based web - based interactive software service that complies with commonwealth and state requirements and the national ehealth transition authority standards and guidelines. cdms interfaces to electronic health records, e - referral and messaging services, and hospitals. the communications infrastructure required by cdms is provided by existing public broadband networks and provides three innovative services : (1) continuous, real - time chronic disease care surveillance, (2) a mechanism to track process (gpmps, tcas, medications, and investigations) (3) an automated open broadband infrastructure. the system delivers collaborative chronic disease management via the internet utilising electronic applications including : remote monitoring ; patients upload information such as blood glucose results to the internet or the health professionals 's computer, email communication among gps, other health professionals, and patients, internet - delivered health education information, interactive electronic medical records, available to both health professionals and patients. during the planning and development process for gpmps and tcas, relevant patient information is encrypted using a public key infrastructure certificate installed on gps ' computers and sent electronically to the external provider precedence health care. once registered as a cdms user, users are provided with a personalised secure log - in and password to enable access to the cdms website. when using cdms, the process commences when a gp assesses a patient and forwards a referral to precedence health care. all steps are completed electronically ; cdms creates a gpmp which is returned to the gp for approval. once approved and returned to precedence health care, the option to create a tca the gpmp is then forwarded electronically to allied health professionals who are generally known to the gp for agreement to participate. for this work, eligible allied health professionals can claim payment using medicare items 10950 to 10970, or are paid by the patients for services. the relevant documentation is electronically generated, signed, and distributed to the care team and patient. cdms tracks the gpmp and tca and patient outcomes such as medications, biomedical measurements, and appointments. when reviews are due, cdms automatically generates and electronically forwards an alert to the gp, summarises the relevant information, and automatically creates a draft gpmp review for the gp to approve. to measure the uptake and adherence to cdms gpmps and tcas, clinical health, quality of life indicators, and patients ' biomedical parameters. to test the broadband - based network (cdms) in general practice in the barwon south west region victoria.to assess the adherence of both health providers and patients to gpmps and tcas generated through cdms. to measure the uptake and adherence to cdms gpmps and tcas, clinical health, quality of life indicators, and patients ' biomedical parameters. to test the broadband - based network (cdms) in general practice in the barwon south west region victoria. to assess the adherence of both health providers and patients to gpmps and tcas generated through cdms. a single cohort before and after study, initially with a nine - month intervention period, with two participant groups : gps and patients with t2 dm the study period was extended with an additional 6 months, resulting in a fourth data collection after the initial nine - month intervention period. patients were recruited by their gps from august 2008 and ceased in february 2009. agree to participate in and support the study and attend three workshops.have either medical director 3 or best practice medical software. diagnosis of type 2 diabetes.age range 1875 years.access and ability to use a mobile phone, the internet, or a landline telephone.living independently.provide informed consent to share their health information electronically with precedence health care and the interdisciplinary care team. access and ability to use a mobile phone, the internet, or a landline telephone. provide informed consent to share their health information electronically with precedence health care and the interdisciplinary care team. the majority of data were collected at three time points during eleven months ; time 1 : at the commencement of the intervention period, time 2 : approximately half way between time 1 and time 3, and time 3 : at the completion of the intervention period (t3). a fourth dataset was collected after the intervention period, during the 6-month extension to the project, and it included metabolic parameters. gp data were collected using field notes, information compiled at three interactive information workshops, and individual interviews. patient data were collected using (a) questionnaires, including the kessler psychological distress scale-10, and the control preference scale at time1 and time 3 ; (b) cdms - generated gpmps and tcas at times 1, 2, 3 and 4 ; (c) barwon health. outcome indicators included the following : the number of gpmps created the number of gpmp reviews conducted (because of the limited study period, only the first 6-monthly reviews could be conducted) the number of services carried out as recommended by best - practice guidelines, and the number of investigations completed for the patient cohort : (1) biomedical (e.g., hba1c, lipids),(2) allied health services,(3) home medicines reviews,(4) use of services at barwon health. biomedical (e.g., hba1c, lipids), allied health services, home medicines reviews, use of services at barwon health. the follow up ratio for gpmps and tcas was calculated for before and after, but was limited to the data were analysed according to the framework method and verified independently by two investigators. when there was a difference of opinion, the investigators discussed the issues to reach agreement. ethics approval was obtained from barwon health research ethics advisory committee and monash university standing committee on ethics in research involving humans, and noted by the deakin university human research ethics committee. no gps withdrew during the intervention period ; 14 patients did not provide all the required data as the study progressed, hence the final patient data set comprised 99 patients at time 1, 93 at time 2, 80 at time 3 and 80 at time 4 (table 1). at time 1, the 99 cohort comprised 61 males and 38 females with an age range of 31 to 83 years ; 83% were australian born and 64% lived at home with their spouses. for the 99, the duration of their diabetes ranged from a new diagnosis to 34 years, and 78% were registered with the national diabetes services scheme. according to practice management data for the two years prior and the one year after the introduction of cdms, the number of gpmps (item 721) and tcas (item 723) claimed by participating gps during the intervention period increased (table 2). because of the limited study period, only the first 6-monthly gpmp (item 725) and tca (item 727) were tracked. nonetheless, this suggests that the use of cdms has an influence on increasing the number of followups (items 725, 727), and also suggests that considerable improvement can still be achieved by most gps who participated in this study. duration of diabetes diagnosis ranged from a new diagnosis to 34 years, with 78% registered with the national diabetes services scheme. self - monitoring was associated with a longer duration of diabetes, lower mean hba1c, older age, lower mean cholesterol, having a gpmp prior to the introduction of the broadband - based service, cdms (table 3). the trend suggests that females were more likely than males to monitor their blood glucose and write their results in a record book. the kessler psychological distress scale-10 was measured at times 1, 2, and 3. there was very little change in total scale scores for patients over time and gender, but those patients who reported having a disability (n = 20) had slightly higher distress scores at each time point than those who did not report a disability (n = 71). the control preference scale was measured at times 1 and 3, to assess patient 's preferred level of involvement in medical decision - making. forty - one (41%) patients at time 1, and 31 (31%) patients at time 3 indicated they preferred to share responsibility for decision - making with their gp. however, 17 (17%) patients at time 1 and 21 at time 3 (26%) indicated they preferred the doctor to make the final decision. there was no significant change in patients ' self - reported medical decision - making preference style between times 1 and 3. not all patients had measurements recorded at more than one time point, and therefore data are for the subsets of patients. mean hba1c decreased from 7.41% (time 1) to 7.05% (time 4) (n = 23) ; low - density lipoprotein decreased from 2.24 (time 1) to 1.96 (time 4) (n = 17) ; triglycerides from 2.21 (time 1) to 1.89 (time 4) (n = 19) and total cholesterol from 4.31 (time 1) to 4.04 (time 4) (n = 19) (table 4). at time 1, blood pressure was recorded for every patient in the study, hba1c, hdl, ldl, triglycerides, and total cholesterol were recorded for more than half the sample and microalbumin was recorded for just under a third of the sample. patients aged > 66 years were prescribed a greater number of medicines (range 023 medicines) compared to patients aged < 65 years (range 018 medicines). the relationship between the number of prescribed medicines and gender or income was not significant. duration of diabetes was longer for patients prescribed one or more diabetes medicines (oral hypoglycaemic agents (ohas), insulin, lipid lowering agent, and antihypertensive agent) than patients not prescribed one of these medicines. there were no changes to recorded prescribed medications or dose regimens at times 2, 3, or 4. seventy - one patients were prescribed oral hypoglycaemic agents. among the 66 patients with hba1c recorded at time 4, those prescribed an oral hypoglycaemic agent (n = 46) had significantly higher hba1c than patients not prescribed an oral hypoglycaemic agent (n = 20). during the cdms intervention, six types of services were used by this patient cohort available through barwon health : allied or community health visits, emergency department, of the 99 patients, 42 did not use any of the above barwon health services, 26 used one service, 13 used two services, two used three services, six used four services, eight used five services and two patients used all six services. patients aged 66 years were more likely to use one or more barwon health services than those aged 65 years. there was a trend indicating patients who used at least one barwon health service had a longer duration of diabetes and lower hba1c at time 1 than those who did not use a barwon health service (table 5). two patients had extremely high numbers of attendances (177 and 230). excluding the two extreme cases, barwon health attendances per patient ranged between zero to 125. all participants were asked about the advantages and disadvantages, and their satisfaction of the cdm - net care planning system. the qualitative results indicated that, while there was positive critical feedback of cdms in the early development stages, overall feedback about cdms use and the impact of the system to diabetes management was positive. most health professionals felt that sharing patients ' health information electronically was helpful and made a difference to the care they provided, thus interdisciplinary communication was enhanced. regarding their satisfaction with the implementation and use of cdms, health professionals, including gps, identified advantages and disadvantages. advantages included improved communication between health professionals, individual providers able to electronically update the gpmp and tca, saves paperwork, faxing, and time ; disadvantages included that the current version of cdms is not user friendly, it is tedious to update documents, and it is something else to take up a good bit of time. these responses reflected individuals ' involvement in the study and are reported more extensively elsewhere. results suggest that cdms had a strong influence on increasing the follow - up ratios for gpmps and tcas, with findings suggesting considerable improvement can still be achieved by most gps who participated in this study table 6. gps using cdms endeavoured to overcome some of the major barriers to the uptake and use of gpmps and tcas including difficulty finding time to develop and review gpmps and tcas, the challenges of interdisciplinary communication, the lack of effective followup and review, and support for patient self - management. in the first instance, gps reported challenges with cdms to the research team, who in turn, reported this information to precedence health care. these challenges were usually addressed in the ongoing developmental work that continued throughout the intervention period. cdms satisfied key technical issues by encrypting patient information using a public key infrastructure certificate installed on gps ' computers. while this project only considered the outcomes using gpmps and tcas in one chronic disease, t2 dm, in one region of victoria, the results suggest an increase in the number of gpmps and tcas developed, increased communication among the health providers, followup and review of gpmps and tcas, and the use of guideline - based services associated with t2 dm management. prescribed medicines (type, dose, or dose interval) did not change during the study, which is interesting given the trend towards improved metabolic status during the study [4, 7 ]. one explanation could be that the level of change in biomedical parameters did not provide sufficient evidence for gps to consider changing medication. another reason could be that the change in biomedical parameters could be attributed to lifestyle change, or to participating in this study. pharmacy attendances decreased during the intervention period but the reason for this is not clear ; patients may have changed the frequency and/or location of when / where they collected prescribed medicines. allied health service use increased during the study. while the number of reported diabetes educator attendances increased at t2 during the intervention period, less than 50% of the sample reported attending a diabetes educator. reasons for this may be that some patients did not require the services of a diabetes educator during the study ; alternatively, the relatively low rate of reported diabetes educator attendances could reflect a lack of diabetes educator resources in the barwon south west region. during the intervention period, 19 diabetes educators worked in the barwon south west region to provide services for the 10,074 individuals diagnosed with diabetes. the average waiting time for an appointment with a diabetes educator was two weeks in the hospital diabetes service but waiting times to access diabetes educators in the community were not available. the allocation of five visits per year to allied health professionals might not be enough, especially for high risk patients and those with complex care needs, as well as for women during pregnancy. the results suggest that information technologies, particularly when focused on improved processes of care, better collaboration, and increased practice productivity, may make a significant difference to gps ' use of gpmps and tcas in the treatment of patients diagnosed with a chronic illness. the study was undertaken in a real - life clinical setting in which gps, practice nurses, and allied health professionals were engaged in chronic disease management prior to implementing cdms. cdms - generated gpmps and tcas contained comprehensive diabetes - related clinical information including metabolic parameters, prescribed medicines, and medical complications. without a comparison group, it is not clear whether changes in allied health service use were due to gpmp and/or tca use, to cdms or to other unrelated factors. low recruitment to the cdm - net (research) component may have been due to gps not having the appropriate software, a reluctance to change from a paper base system to a broad - based service, or that practice staff had expressed concern about their ongoing employment if the cdms system was utilised in the practice. more research that compares cdms gpmps and tcas to gpmps and tcas developed not using cdms is necessary to evaluate the impact of cdms on allied health service use. replication or continuation of the study is desirable to enable the impact of cdms on diabetes outcomes to be determined. in particular, the study should include gps and patients from other divisions of general practice, and female and solo gps. cdms was associated with small, nonsignificant reduction in lipid levels (low - density lipoprotein, triglycerides, and total cholesterol) and mean hba1c. there was no change to recorded prescribed medicines or quality of life, but the use of allied health services appeared to increase during the intervention period. despite an initial lack of satisfaction with certain aspects of cdms 's functionality identified by allied health professionals, overall satisfaction with the utility of it - enabled interventions may lie in their ability to facilitate communication among health care providers, and between health care providers and patients. further research is needed to delineate the contribution of cdms and it - enabled interventions to chronic disease management within the australian context of gpmps and tcas. | background. in australia most chronic disease management is funded by medicare australia through general practitioner management plans (gpmps) and team care arrangements (tcas). identified barriers may be reduced effectively using a broadband - based network known as the chronic disease management service (cdms). aims. to measure the uptake and adherence to cdms, test cdms, and assess the adherence of health providers and patients to gpmps and tcas generated through cdms. methods. a single cohort before and after study. results. gpmps and tcas increased. there was no change to prescribed medicines or psychological quality of life. attendance at allied health professionals increased, but decreased at pharmacies. overall satisfaction with cdms was high among gps, allied health professionals, and patients. conclusion. this study demonstrates proof of concept, but replication or continuation of the study is desirable to enable the impact of cdms on diabetes outcomes to be determined. |
the complex but extremely ordered structure of the sarcomere is the elemental force - producing machinery of striated muscles. recent studies of sarcomere assembly [1, 2 ], protein turnover [1, 3 ], and signalling cascades [4, 5 ] provide new insights into the spectrum of intermolecular interactions that support sarcomere structure and function. there is increasing evidence that many of sarcomere properties involve the giant protein titin [2, 610 ]. the titin molecule is more than one micrometer long and in situ spans half the sarcomere, with the n - terminus in the z - line and the c - terminus in the m - line (figure 1(a)) [1113 ]. different isoforms (mw ~ 3.03.7 mda) vary in the size and structure of the elastic i - band part of the molecule, which connects the end of the thick filament to the z - line, as well as in the z- and m - line regions. the size and structure of the thick filament part of titin is conserved, which is consistent with the conserved structure of thick filaments in vertebrates. sequence shows that titin consists mainly of about 300 domains similar to immunoglobulins (ig, i - set) and fibronectins (fn, type-3). the elastic i - band part consists mainly of ig domains arranged in tandem. near the n2-line in the i - band, this arrangement is interrupted by unique sequences that bridge the proximal and distal (to the z - line) tandem - ig segments. in contrast, the thick filament part of titin is formed by both ig and fn3 domains. purified titin molecules visualized by metal shadowing appear in electron micrographs as strings about one micrometer in length and four nanometers in diameter [1518 ]. in negatively stained samples, a distinct beads - on - the - string appearance can be seen, showing the chain of ig and fn3-like domains [19, 20 ]. sequence shows that the titin ig and fn3 domains are arranged in long - range patterns or super - repeats. two types of super - repeats are found in the constitutively expressed thick filament region [1921 ] : seven consecutive copies of the seven - domain or small superrepeat occupy the n - terminal part of this region ; these are followed by eleven copies of the eleven - domain large superrepeat. in the i - band region, only the differentially expressed ig - segments have super - repeats : in human soleus isoform, the n - terminal three copies of a six - domain superrepeat are followed by three copies of a ten - domain superrepeat [22, 23 ]. in both a- and i - band regions, the super - repeats show increased sequence conservation between domains at comparable positions in the super - repeats. the two super - repeats of ig and fn3 domains in a - band titin (figure 1(b)) closely reflect the underlying periodic structure of the thick filament. the size of the large superrepeat (~45 nm) is same as the myosin and c - protein periodicities of the filament, while the number of the large super - repeats (eleven) is the same as the number of binding sites for c - protein and related molecules. a single ig domain in each large superrepeat binds c - protein and this defines the ~43 nm interval of c - protein localization in the c - zone. interactions between titin and myosin are probably grouped in three clusters of fn3 domains, defining a period of ~15 nm in titin - myosin interactions. atomic structures of recombinant titin fragments, supported by homology modelling [25, 26 ], indicate that the ig and fn3 domains are unlikely to be similarly oriented along a titin molecule but bend and twist relative to each other. the likelihood of periodic interactions with other thick filament proteins requires titin domains spaced by 43 nm to be in the same orientation. this indicates that in the a - band the orientation of ig and fn3 domains in the super - repeats is periodically repeated. there are only two main possibilities for such periodic architecture : either planar and zigzag - like or three - dimensional and helical. homology modelling [26, 27 ] and crystallography studies [28, 29 ] show that small, two- or three - domain recombinant fragments have rather flat conformations, in which the long axes of the molecules bend in a single plane. however, longer segments may well have a tendency to bend three - dimensionally, as suggested by modelling of the periodic differentially expressed i - band ig - segment. a tendency of the relaxed titin molecule to adopt a helical conformation is likely to be controlled by a preferred inter - domain orientation [25, 30, 32 ] and may reflect a long - distance directional regularity in the bending and twisting angles. the existing atomic structures of titin fragments appear to be consistent with this possibility, although the number of these is still too small to discern a long - distance pattern. another important question concerning titin interactions with other thick filament proteins is the significance of the fact that super - repeats in the a - band titin, although very similar, are not identical. average sequence identity, even for domains at comparable positions, is below 40%, and only about 60% of their surface is conserved. it is unclear at present how these small differences affect periodic interactions of titin with c - protein and myosin, both of which provide identical sites for interaction with super - repeats. it may be noted, however, that if there are dissimilar titin - myosin and titin - c - protein interactions in different super - repeats, this would agree with predictions of nonequivalency of the ~43 nm repeats in thick filament structure suggested by x - ray diffraction studies of muscle. providing elasticity to sarcomeres is one of the major functions of titin [3539 ]. this role derives from the ability of titin to increase the length under applied force and then to shorten to the original length when the force is removed. the mechanism of extensibility is known to be multiphase : overall shape changes that occur under small applied forces are followed at higher forces by hierarchical unfolding of the polypeptide [4043 ]. while the physiological relevance of relatively large sarcomere lengths that lead to titin unfolding can be disputed, there is no doubt that conformational changes must occur in the molecule during both passive extension and active contraction of muscle. it is generally thought that they are entropic in nature and occur according to rod - coil transitions seen in individual titin molecules in vitro (e.g.,). however, the likely bundled state of titin molecules in the sarcomere is not usually taken into account [4448 ]. in the following, we present some estimates related to titin flexibility in vitro and in situ. electron and atomic force microscopy (afm) of purified titin molecules illustrate a tendency to coil up in the absence of applied extensional force (figure 2(a)) [15, 16, 31, 49 ] or to straighten when a small pulling force is applied [17, 18, 31, 38, 50 ]. the persistence length (lp) of monomeric titin is estimated to be 919 nm [31, 49, 51, 52 ]. a somewhat smaller range of values, 210 nm, was suggested by afm and optical tweezer mechanical experiments on single molecules [43, 5355 ], and a tendency of the protein to unfolding was discussed [53, 55 ]. the estimates of lp are likely to mainly reflect average flexibility of the ig / fn3 parts of the molecule, since the unique sequences and other structures are a small proportion of the molecule. in a multidomain protein, taking average interdomain distance s to be about 4.0 nm and the average persistence length lp to be about 13.5 nm, the average inter - domain angle can be approximately estimated from the relationship (s) = 2s / lp, from which a value of ~44 can be obtained. this value (i.e., 180 44 = 136) is close to the average inter - domain angle in the nmr and crystal structures of titin fragments, ~140 [25, 26, 2830, 32, 57, 58 ]. this suggests that the inter - domain angles and shapes of titin constructs reflect the equilibrium - relaxed conformation of the native titin molecule. in this conformation, the inter - domain angles and twists are likely to be different from those in situ, at least in the case of a - band titin, which is extended and stressed by the interactions with myosin and c - protein in the thick filament backbone. only slightly higher lp values (1540 nm) were estimated for individual titin molecules from mechanical experiments on muscle fibres and myofibrils. the difference between the in vitro and in situ results is smaller than might be expected since, in the sarcomere, the extensible i - band parts of titin are known to be bundled [4448 ]. inspection of the bundled and unbundled parts of i - band titin seen in electron microscope images (figure 2(b)) clearly illustrates different bending properties. as was estimated earlier for an analogous case, the persistence length of a bundle scales with the square of the number of subfilaments in the bundle, that is, lp ~ n2. in the case of titin, this means that a bundle of six molecules will make lp at least 500 nm, that is, 36 times larger than lp for a single molecule, taken as 13.5 nm. even for smaller bundles, composed of only two - three molecules, the expected lp value is in the region of ~55120 nm. the two lp values, 55120 nm and 500 nm, reflect the expected stiffness of the two ig - tandem segments of i - band titin that are separated by the unique n2-pevk region : the proximal n - terminal segment, attached to the z - line, and the bundled distal c - terminal segment, attached to the tip of the thick filament, known as the end - filament [4448 ]. the fact that the lp values from mechanical experiments on muscle fibres and myofibrils closely correspond to the in vitro lp value of the monomeric molecule is unlikely to correctly reflect titin 's state and flexibility in situ. alternatively, this may indicate dissociation of end - filaments during experiments, possibly due to their fragility, or may reflect the specificity of conformational changes in situ, related, for instance, to helicity (see above) and/or the confined environment in the sarcomere. how the arrangement of titin in the sarcomere accommodates the different symmetries of thick and thin filament lattices, and of the m- and z - line regions, is a major unresolved problem in sarcomere structure. the number of six molecules bound to each half of thick filament [39, 47 ] correlates well with the threefold rotational symmetry of the filament, its three - stranded substructure [44, 62, 63 ], and with the hexagonal lattice of the m - line region [61, 64 ]. however, titin extension through the i - band, and especially its interaction with thin filaments near and within z - line region, suggests a rearrangement to fit to the twofold rotational symmetry of thin filaments and the tetragonal lattice of the z - line. one of the factors that may affect this rearrangement is self - association (see also above). titin self - association in the i - band is suggested by electron microscope studies of muscle and separate thick filaments, which show the ~100 nm stalk - like structures called end - filaments, referred to above, projecting from the ends of thick filaments [4446 ]. it is also supported by in vitro observations of self - association of the titin segment from this region. this includes the entire distal (with respect to the z - line) tandem - ig segment of i - band titin, from the thick filament tip up to the pevk - n2 region. at this point the relatively high negative charge on the pevk (n2b) region(s) of titin would favour branching of the end - filaments, unless the charge is neutralised by interactions either with cations (e.g., ca ions [65, 66 ]) or with other cytoplasmic components. it should also be noted that the n2-pevk - region is the site where thin filaments appear to rearrange from hexagonal to tetragonal packing, which then becomes especially ordered near and within the z - line. however, structural studies have so far failed to provide an unambiguous answer for the number of the branched subfilaments. three alternatives end - filament branching schemes are possible : (1) into two subfilaments, each containing three titin molecules ; (2) into three subfilaments with two titin molecules in each ; and (3) into six subfilaments, each a single titin molecule. in the first case, such a division would give 1 : 1 ratio of titin to thin filaments, which would imply interaction of each thin filament with a single bundle of three titin molecules near and within the z - line region. this would satisfy tetragonal z - line symmetry ; however, there would be no agreement with the twofold symmetry of thin filament. splitting the end - filament into a larger number of subfilaments thus, some asymmetry has to be assumed to exist in the titin arrangement and interactions in either the i - band or within the z - line. this scheme suggests splitting of end - filament into six individual titin molecules with only four of these molecules interacting side - by - side with two thin filaments of the same sarcomere and extending throughout the z - line. the remaining two titins would attach to the tips of two incoming thin filaments of the adjacent sarcomere. this arrangement gives a 2 : 1 ratio of side - by - side interactions between titin molecules and thin filaments and is in agreement with both thin filament and z - line symmetries. it would also provide the required mechanical balance in z - line region and appears to be in a good agreement with structural data. another possibility relates to involvement of small titin isoforms, for example, novex-3, which are present in skeletal and cardiac muscles in varying amounts in parallel with the main full - length isoforms, but which span only half the i - band, between the z - line and n2-line [14, 69 ]. this location potentially helps to resolve the problem of correlation of the number of titin molecules with the thin filaments and z - line symmetries. however, the low amount of novex-3 expressed by muscles is apparently not compatible with this role of the protein. also, involvement of additional isoforms would not eliminate the asymmetry in titin interactions in the i - band but will only shift the site of asymmetry from the z - line to the n2-line region of sarcomere where the different titin isoforms meet. although an enormous amount has been learnt about the properties of the titin molecule, both in vitro and in situ, integrating this information to give a comprehensive picture is not straightforward. this is mainly because in no part of the sarcomere a- or i - band, z- or m - line is the disposition of the components known in molecular detail. much therefore remains to be learnt about sarcomere structure and titin layout and function, and how these are compromised in disease. | the giant protein titin is thought to play major roles in the assembly and function of muscle sarcomeres. structural details, such as widths of z- and m - lines and periodicities in the thick filaments, correlate with the substructure in the respective regions of the titin molecule. sarcomere rest length, its operating range of lengths, and passive elastic properties are also directly controlled by the properties of titin. here we review some recent titin data and discuss its implications for sarcomere architecture and elasticity. |
cis - diamminedichloroplatinum (cisplatin) is one of the most potent anticancer drugs and is widely used as the front - line therapy for the treatment of tumors of head, neck, lungs, and genitourinary tract. however, the clinical application of cisplatin is limited by its serious adverse effects, particularly irreversible nephrotoxicity [2, 3 ], which occurred in about one - third of patients with cisplatin treatment. nephrotoxicity induced by cisplatin has been ascribed to several mechanisms, including inflammation, oxidative stress, and apoptosis [5, 6 ]. hydrogen sulfide (h2s) is the third gasotransmitter besides nitric oxide (no) and carbon monoxide (co) and attracted more and more attention because of its pleiotropic physiological effects. endogenous h2s is generated mainly from l - cysteine by two key enzymes named cystathionine -synthase (cbs) and cystathionine -lyase (cse). recently, emphasis has been placed on investigating whether h2s pathway is involved in different physiological or pathological processes by endogenous or exogenous perturbation. exogenous h2s donor is reported to have renoprotective effects in prolonged warm renal ischemia - reperfusion injury, obstructive nephropathy, and gentamicin - induced renal injury. the dysregulation of endogenous cbs or cse also contributes to kidney ischemia - reperfusion injury and diabetic nephropathy. by reviewing the literatures, there one study showed that the inhibition of endogenous h2s production by dl - propargylglycine (pag) could reduce renal damage induced by cisplatin through the restriction of inflammation in wistar rats. oppositely, ahangarpour. demonstrated that exogenous h2s donor sodium hydrosulfide (nahs) was protective via antioxidant property in cisplatin - treated rats. to address these controversies, we employed morpholin-4-ium 4-methoxyphenyl (morpholino) phosphinodithioate (gyy4137), a novel slow releasing h2s donor, to investigate the role of exogenous h2s in cisplatin - induced nephrotoxicity and the underlying mechanisms. gyy4137 was purchased from cayman chemical company (ann arbor, mi, usa), which was dissolved in 1 : 1 mixture of dimethyl sulfoxide (dmso) and polyethylene glycol (peg). male c57bl/6 mice (jackson laboratory) aged 810 weeks old were maintained on a standard rodent chow with free access to food and water and were kept on a 12 h (light) : 12 h (dark) cycle. the animals were divided into three groups : control (ctr ; n = 5), cisplatin alone (cp ; n = 10), and cisplatin plus gyy4137 (cp + gyy4137, n = 10). cisplatin was freshly prepared in ultrapure water at a concentration of 2 mg / ml and used to treat the mice by a single intraperitoneal (i.p.) injection (20 mg / kg), in both cp and cp + gyy4137 groups. the mice were pretreated for 72 h with a mixture of dmso and peg (ctr and cp groups) or gyy4137 (cp + gyy4137 group) at a dose of 21 mg / kg / d via a microosmotic pump (durect corporation, cupertino, ca, usa). to figure out the effect of gyy4137 alone on kidney morphology and function, another experiment was designed by the application of gyy4137 or vehicle to the mice for 6 days (n = 5 in each group). all protocols employing mice were conducted in accordance with the principles and guidance of sun yat - sen university institutional animal care and use committee. blood urinary nitrogen (bun) was determined to assess renal function. for histology, kidneys were fixed in 4% paraformaldehyde and stained with periodic acid - schiff (pas). the tissue damage was indicated by tubular lysis, dilation, disruption, necrosis, and cast formation. the degree of tissue damage was scored according to the percentage of damaged tubules as previously described : 0, no damage ; 1, 75%. the plasma tnf- level was determined by an enzyme immunoassay kit (catalog number 559732, bd opteia, bd biosciences, san jose, ca, usa) according to the manufacturer 's instructions. the measurement of plasma thiobarbituric acid - reactive substances (tbars) was based on the formation of malondialdehyde by using a commercially available tbars assay kit (catalog number 10009055, cayman chemical) according to the manufacturer 's instructions. protein lysates were denatured at 100c for 10 min, separated by sds - polyacrylamide gel electrophoresis, and transferred onto pvdf membranes. the bolts were blocked with 5% nonfat dry milk for 1 h and then probed with primary antibodies directed to cbs (santa cruz), cse (abcam), or -actin (sigma - aldrich) overnight at 4c, washed three times with tris - buffered saline (tbs) containing 0.1% v / v tween-20, and incubated for 1 h at room temperature (rt) with secondary antibodies (goat anti - rabbit igg and goat anti - mouse igg, santa cruz). the immunoreactive bands were visualized using chemiluminescent reagent (thermo scientific) and exposed to x - ray film. total rna was isolated using trizol (invitrogen) and first - strand cdnas were synthesized from 4 g of total rnas in a 20 l reaction using superscript (invitrogen). the first - strand cdnas served as the template for quantitative pcr (qpcr) performed in the applied biosystems 7900 real time pcr system using sybr green pcr reagent. oligonucleotides were designed using primer3 software (available at http://frodo.wi.mit.edu/primer3/) and the sequences are shown in table 1. cycling conditions were 95c for 10 min, followed by 40 repeats of 95c for 15 s, and 60c for 1 min. the statistical analysis was performed using anova followed by bonferroni 's test or unpaired student 's t - test with spss 13 statistical software. to evaluate the effects of gyy4137 on renal function in cisplatin - treated mice, we measured bun level and found that bun was robustly elevated in cisplatin - treated mice (cp : 87.4 3.3 versus ctr : 14.8 0.4 mg / dl, p < 0.01). however, gyy4137 administration resulted in a greater elevation of bun (104.6 6.6 mg / dl, p < 0.01, versus cp group) (figure 1(c)). microscopically, the mice treated with cisplatin displayed severe pathological changes, characterized by the distortion of the overall renal morphology, dilation of renal tubules, and appearance of protein casts. remarkably, these histological changes were more severe in gyy4137-pretreated animals (figures 1(a) and 1(b)). these data suggested that this h2s donor played a detrimental role in cisplatin - induced nephrotoxicity. it is well known that the activation of inflammation was involved in the pathogenesis of cisplatin nephrotoxicity. particularly, tumor necrosis factor- (tnf-) has shown a central role in mediating cisplatin - induced inflammation. as shown by the data, renal tnf- mrna was increased by 9.2-fold in cisplatin group as compared to the control mice, while gyy4137 pretreatment resulted in a much higher renal tnf- mrna expression than cisplatin alone group (figure 2(b)). consistent with the regulation of tnf- in kidney, gyy4137 also promoted circulating tnf- level after cisplatin treatment (figure 2(a)). meanwhile, the expressions of renal interleukin-6 (il-6) and il-1 mrna showed similar patterns as renal tnf- regulation (figures 2(c) and 2(d)). oxidative stress is another important factor responsible for cisplatin nephrotoxicity besides inflammation [18, 19 ]. the level of plasma tbars, a marker of oxidative stress, was increased from 4.1 1.0 (control group) to 7.2 1.3 (cisplatin alone group), while the tbars level was further increased to 13.3 2.1 in gyy4137 plus cisplatin group (figure 3(a)). moreover, we found that the cisplatin - induced oxidative stress was associated with the downregulation of antioxidative enzymes superoxide dismutase 1 (sod1), sod2, and sod3, among which sod3 was further decreased by gyy4137. these findings indicated that gyy4137 pretreatment aggravated cisplatin - induced oxidative stress possibly via a suppression of sod3 following a challenge of cisplatin. apoptotic pathway is also reported to be a molecular mechanism of cisplatin - induced nephrotoxicity, and the bak and caspase activation served as potential key elements [20, 21 ]. here we measured renal mrna expression of caspase-3, bak, and bax in mice from different groups. we found the enhanced mrna expressions of caspase-3 and bak after cisplatin treatment were further increased in gyy4137-pretreated animals (figures 4(a) and 4(b)). in contrast, the induction of bax showed no difference between cisplatin alone group and gyy4137 plus cisplatin group (figure 4(c)). overall, these data suggested that gyy4137 could aggravate apoptotic response in cisplatin nephrotoxicity. to demonstrate whether gyy4137 affected the expression of endogenous h2s - producing enzymes, we detected the mrna and/or protein levels of cbs and cse in the kidney. both cbs (figures 5(a)5(c)) and cse (figure 5(d)) were significantly decreased after cisplatin treatment, which was unaffected by gyy4137. thus the reduction of cbs and cse might act as a protective mechanism against cisplatin - induced renal injury. to exclude the effect of the drug alone on renal structure and function, we set up the gyy4137 alone group and measured plasma creatinine and observed the morphological changes. the plasma creatinine level in gyy4137 group was not significantly different from that in ctr group (gyy4137 : 0.392 0.023 versus ctr : 0.357 0.030 mg / dl, microscopically, the mice treated with gyy4137 did not display any pathological changes (figures 6(a) and 6(b)). hydrogen sulfide (h2s) has been known as a toxic gas with rotten egg smell for a long period of time. it shows its toxicity possibly via inhibiting mitochondrial cytochrome c oxidase (cco) and oxidative phosphorylation and thus decreasing the production of adenosine triphosphate (atp). its physiological relevance was firstly reported by abe and kimura where endogenous h2s serves as a neuromodulator in the brain and facilitates the hippocampal long - term potentiation by enhancing nmda receptor - mediated responses. in addition, h2s also displays important functions in cardiovascular system, kidney, liver, gastrointestinal, and endocrine systems [2327 ]. in this regard, h2s has been widely acknowledged as the third gasotransmitter besides no and co. in kidney, h2s promotes urinary sodium excretion via both tubular and vascular mechanisms. h2s can also inhibit renin - angiotensin system (ras) by decreasing reactive oxygen species (ros) generation or cyclic adenosine monophosphate (camp) generation. meanwhile, h2s modulates renal oxidative stress response through upregulating antioxidant haem oxygenase-1 (ho-1) in human mesangial cells and acts as an oxygen sensor in renal medulla. therefore, aberrant regulation of renal h2s might contribute to the pathogenesis of kidney diseases and thus modulation of endogenous or exogenous h2s could be potentially effective for treating renal diseases. watanabe. reported that homozygous cbs mutants have about 40 times plasma homocysteine levels as normal and a majority of them died within 5 weeks after birth. mutant mice lacking cse displayed pronounced hypertension in line with diminished endothelium - dependent vasorelaxation. the aortic h2s production was decreased by half in spontaneously hypertensive rats (shrs) compared to normotensive rats and exogenous nahs supplement attenuated hypertensive vascular collagen remodeling. endogenous h2s production was decreased during obstructive nephropathy and nahs treatment attenuated unilateral ureteral obstruction- (uuo-) induced renal fibrosis [9, 35 ]. moreover, recent report demonstrated that suppressed cse / h2s pathway contributed to the pathogenesis of streptozotocin- (stz-) induced dn. 's results proved that h2s alleviated stz - induced dn via attenuating oxidative stress and inflammation and inhibiting renin - angiotensin system activity. considering the anti - inflammatory and antioxidant effects of h2s, we tend to expect protective effects of h2s in kidney diseases. however, the facts are not that simple as expected. inhibition of endogenous h2s formation by pag (an irreversible inhibitor of cse) could attenuate both cisplatin- and gentamicin - induced nephrotoxicities in rat models [13, 3840 ], which suggested that endogenous h2s may aggravate kidney injury. in contrast, exogenous h2s donors, including nahs and sodium thiosulfate (sts), were reported to protect against both cisplatin- and gentamicin - induced nephrotoxicities [10, 14, 41 ]. in consideration of these conflicting results, the role of h2s in kidney injury is hard to conclude and thus deserves further evaluation. in the present study, we employed a novel h2s donor, gyy4137, to study its role in cisplatin - induced nephrotoxicity. our results showed that gyy4137 further exacerbated cisplatin - induced renal injury by aggravating inflammation, oxidative stress, and apoptosis in the kidney. renal, circulatory, and urinary tumor necrosis factor- (tnf-) and other proinflammatory cytokines including interleukin 1 (il-1) were known to be upregulated by cisplatin injection [17, 42, 43 ]. tnf- seemed to play a central role in the activation of inflammatory cascade since that inhibition of tnf- via genetic or pharmacological approach strikingly attenuated cisplatin nephrotoxicity. our results showed a significant increase of circulating tnf- and renal tnf- mrna expression after cisplatin administration. these increments of inflammatory cytokines were further increased in cisplatin plus gyy4137 group, which indicated that gyy4137, a h2s donor, exacerbated the inflammatory response induced by cisplatin. antioxidants are shown to be protective against cisplatin treatment both in cultured renal tubular cells [19, 44 ] and in animal models [45, 46 ]. our results also showed an elevation of plasma tbars level accompanied by significantly decreased renal expressions of sod1, sod2, and sod3. similar to gyy4137 effects on inflammation, this h2s donor aggravated oxidative stress in cisplatin - treated animals in line with a further reduction of sod3. in agreement with promoted inflammation and oxidative stress, gyy4137 further enhanced the mrna expressions of caspase-3 and bak, suggesting that apoptotic response was also deteriorated. considering the aggravated effect of this h2s donor on cisplatin - induced renal injury, we detected the expression of endogenous h2s - producing enzymes in the kidney. the mrna expressions of cbs and cse were significantly decreased after cisplatin treatment, which was not affected by gyy4137. the previous study demonstrated the consistent results that gyy4137 increased the levels of h2s but had little effect on h2s - synthesizing activity. the apparent downregulation of cbs and cse probably would result in reduced h2s production, which might be a protective mechanism against cisplatin injury. in agreement with our findings, previous study showed that inhibition of endogenous h2s formation ameliorated the injury after cisplatin administration. gyy4137 is a novel slow - releasing h2s donor while the conventional donors such as nahs release h2s instantaneously in aqueous solution. reported that nahs ameliorated the kidney dysfunction and damage in cisplatin - induced nephrotoxicity in sprague - dawley rats, which disagreed with our results. we think the difference of the species (mouse and rat) and/or h2s donors might result in the discrepancies. bolus intravenous or intraperitoneal administration of gyy4137 to anesthetized rats increased plasma h2s concentration at 30 minutes and remained elevated during the 180-minute time course, while nahs delivery to rats did not elevate plasma h2s levels. thus it is reasonable to expect that plasma h2s was increased and remained at a steady level in the current experiment with the use of microosmotic pump for gyy4137 delivery. in summary, this study firstly examined the role of a novel exogenous h2s donor gyy4137 in a mouse model of cisplatin nephrotoxicity. following cisplatin administration, the mice showed severe renal injury accompanied with increased oxidative stress, inflammation, and apoptotic response, which was further aggravated by gyy4137, suggesting a detrimental role of exogenous h2s in cisplatin - induced kidney injury in mouse. | accumulating evidence demonstrated that hydrogen sulfide (h2s) is highly involved in inflammation, oxidative stress, and apoptosis and contributes to the pathogenesis of kidney diseases. however, the role of h2s in cisplatin nephrotoxicity is still debatable. here we investigated the effect of gyy4137, a novel slow - releasing h2s donor, on cisplatin nephrotoxicity in mice. male c57bl/6 mice were pretreated with gyy4137 for 72 h prior to cisplatin injection. after cisplatin treatment for 72 h, mice developed obvious renal dysfunction and kidney injury as evidenced by elevated blood urea nitrogen (bun) and histological damage. consistently, these mice also showed increased proinflammatory cytokines such as tnf-, il-6, and il-1 in circulation and/or kidney tissues. meanwhile, circulating thiobarbituric aid - reactive substances (tbars) and renal apoptotic indices including caspase-3, bak, and bax were all elevated. however, application of gyy4137 further aggravated renal dysfunction and kidney structural injury in line with promoted inflammation, oxidative stress, and apoptotic response following cisplatin treatment. taken together, our results suggested that gyy4137 exacerbated cisplatin - induced nephrotoxicity in mice possibly through promoting inflammation, oxidative stress, and apoptotic response. |
amliorer la scurit des patients grce des normes contemporaines et dtailles pour une pratique scuritaire de lanesthsie qui augmentent, amliorent et appuient les normes semblables dj publies par divers pays et procurent une ressource aux pays qui doivent encore laborer de telles normes. linitiative mondiale une chirurgie plus sre pour sauver des vies du groupe de travail pour la scurit en anesthsie de lorganisation mondiale de la sant a mis jour les normes internationales pour une pratique scuritaire de lanesthsie de 1992 (1992 international standards for the safe practice of anaesthesia) par un processus itratif de revue de la littrature, de consultation, de dbat, de rcriture et de perfectionnement. ces normes abordent de faon dtaille les questions dorganisation, de soutien, de pratique et dinfrastructure lies aux soins en anesthsie. elles se fondent sur le principe fondamental de la scurit en anesthsie, soit la prsence ininterrompue dun professionnel de lanesthsie vigilant et adquatement form. dans les faits, lutilisation de loxymtrie de pouls pendant lanesthsie est dsormais considre comme obligatoire, tout en reconnaissant que, dans les cas durgence, un compromis peut tre invitable. lors du congrs mondial des anesthsiologistes de 2008, plusieurs avant - projets ont t prsents afin dtre discuts, certains points ont t perfectionns, et les normes rvises ont t adoptes par la fdration mondiale des socits danesthsiologistes (fmsa). ces normes rvises ont t publies sur le site internet de la fmsa avec un appel aux commentaires, et quelques rvisions mineures y ont encore t apportes. les normes internationales pour une pratique scuritaire de lanesthsie de 2010 ont t avalises par le conseil de direction de la fmsa en mars 2010. tout en tant applicables universellement, les normes de 2010 sadressent principalement aux rgions du monde disposant de ressources limites. elles sont particulirement conues lintention des rgions qui doivent encore formuler ou adopter leurs propres normes afin de favoriser des devenirs de patients optimaux partout o lanesthsie est pratique dans le monde. anesthesiology as a profession was the pioneer and persists as the leader in improving quality of care and, hence, patient outcome through the development and application of published standards of practice, guidelines, and protocols. as a precursor to contributing the anesthesia care component to the second global challenge of the world health organization (who), safe surgery saves lives,1 a who working group updated the 1992 international standards for the safe practice of anaesthesia of the world federation of societies of anaesthesiologists (wfsa).2 that update is presented in the journal owing to a cooperative developmental process that can serve both as a quality improvement template within and beyond anesthesiology and as a resource for all anesthesia professionals in all types of anesthetizing settings throughout the world. the importance of surgery to worldwide public health has become increasingly apparent in recent years.3 that importance has increased with the advent of an epidemiological shift ; longstanding leading causes of the global burden of disease, such as malnutrition and infectious diseases are still important, but conditions amenable to surgical treatment, such as childbirth complications, cancer, and trauma (notably road traffic accidents) have become relatively more prominent. this trend is likely to increase. over 230 million surgical procedures are carried out annually around the world, which is twice the number of births. surgical procedures are unevenly distributed, and the standard of care associated with them is inconsistent. safe surgery is dependent on safe anesthesia, and variation in the standard of anesthesia care is particularly marked.4,5 in most high - income countries, anesthesia has become extremely safe. rates of mortality attributable to anesthesia are typically less than 1 in 50,000 procedures.6 unfortunately, the rate is often at least ten times higher in other parts of the world 79 improvements in anesthesia safety in high - income countries can be attributed to a number of contributing factors. one obvious factor in many such countries has been the adoption of standards for intraoperative safety monitoring10 based on the original precedent - setting harvard standards for minimal monitoring11 from the mid 1980 s. improved monitoring provides early warning of adverse events or developments and thus time for remediation and prevention of patient harm. monitoring standards are useful, not only in establishing best practices but also in adding authoritative support to political arguments over the proportion of limited healthcare resources that ought to be directed towards anesthesia. to retain their value and authority, standards should be revised on a regular basis. at the beginning of the 1990 s, an independent group of anesthesiologists (the international taskforce on anaesthesia safety) set itself a mission : to enhance the safety of anaesthesia by promotion of international standards for anaesthesia practice. the intent was not to supersede safety standards already published by various countries ; rather, the goal was to augment, enhance, and support published standards while providing a model and resource for countries that had yet to formulate or adopt such standards. the resulting document included two sections, general standards and perianesthetic care and monitoring standards. the former section covered, in detail, certain essential characteristics, such as professional status, organization, and training ; it also dealt with general matters, such as records, peer review, personnel requirements, and appropriate workloads. the latter section was notable for its novel formulation of different levels of resource availability, which acknowledged the wide variability of available medical resources around the world. these standards were endorsed and adopted as the world standards by the wfsa at its world congress of anaesthesiologists at the hague in 1992.2 in 2002, the world health assembly adopted a resolution urging countries to strengthen the safety of healthcare and monitoring systems, and in 2004, the world alliance for patient safety was established within who. a number of developments have followed, including the global initiative for emergency and essential surgical care in 2005 and two global patient safety challenges. the second of these challenges, safe surgery saves lives, which was initiated in 2007, addressed safety in surgical care.1 this program is perhaps best known for the who surgical safety checklist that is the widely publicized leading component of the comprehensive parent document, the who guidelines for safe surgery.12 four of the who safe surgery saves lives working groups were given the task of addressing ten objectives. as members of the safe anesthesia working group, the authors of this paper were asked to focus on those objectives related to safer anesthesia. in effect, we realized that what was required were comprehensive guidelines for safe anesthesia. we further recognized the value of the foundational work undertaken by the international taskforce nearly 20 years earlier, and we appreciated the advantages of building on this work rather than simply trying to repeat it. it became clear that there was still a substantial need for such standards and that revision of the 1992 international standards was overdue. therefore, we have revised and updated the international standards for a safe practice of anaesthesia (standards) in parallel with contributing to the who guidelines for safe surgery, and the revised version is published in this issue. the formulation of the 1992 standards has been fully described.13 in brief, following inception by drs. gravenstein and the securing of funding, membership on the international taskforce on anesthesia safety was offered, by invitation, to a group of ten independent individuals with strong credentials in their national anesthesia patient safety movements who were from countries that had or were formulating anesthesia safety standards. the members collected copies of all of the available anesthesia standards documents from around the world. extensive debate on the scope and content of the standards (taking into account the applicability of the standards to a wide range of settings and resources) was carried on via correspondence and facsimile transmission and at twice yearly face - to - face meetings. the standards were written on the basis of all of this input through a long iterative process of drafting and refinement. at the hague in june 1992, they were presented to the tenth world congress of anaesthesiologists in two plenary sessions dedicated to this purpose. at this congress, the general assembly of the wfsa adopted the standards document as their official world standards and commended it to its member societies. the document and a series of supporting background articles were published subsequently in the european journal of anaesthesiology.14 on the basis of their credentials in relation to patient safety, the authors of this current paper were invited to the safe surgery saves lives international consultation led by dr. the purpose of this meeting was to address the following two questions : what are the minimum standards of surgical care that can be applied universally across countries of different economic standards and different healthcare settings that will have the greatest impact on improving the safety of surgical care?what measurement systems can be implemented to monitor the progress and improvement of surgical safety resulting from these standards ? what are the minimum standards of surgical care that can be applied universally across countries of different economic standards and different healthcare settings that will have the greatest impact on improving the safety of surgical care ? what measurement systems can be implemented to monitor the progress and improvement of surgical safety resulting from these standards ? discussion of these objectives occurred through a series of moderated panels, each focused on a particular element of the wider issue. at the end of this consultation meeting, four working groups were established, including the safe anesthesia working group (the group). subsequent work was done by the individual members of the group, communicating through email, telephone, and face - to - face meetings as opportunities arose. three further formal face - to - face meetings of the wider group took place. in relation to the standards, evidence on individual aspects of anesthesia care (notably pulse oximetry) was sought from a number of sources with the aim of identifying all relevant publications and data sources. we carried out systematic searches of the literature using medline and pubmed ; we checked the references of retrieved publications, and we used personal communication. we consulted with colleagues in our own and other countries, particularly seeking to obtain the views of those from areas not represented within the group. as part of the overall process of developing the checklist, key issues were debated extensively with a broader group of international experts that convened in geneva at who headquarters in january 2008. the revised standards were drafted iteratively on the basis of the information that emerged from this process. the overall structure of the original 1992 standards was retained, but the terminology was aligned with that of the who. the who guidelines for safe surgery have been validated through the pilot study of the checklist.15 the recommendations in the revised standards are aligned with those in the guidelines, although the exact phrasing differs. importantly, while both documents are intended primarily as stimuli, models, and resources for quality improvement efforts in resource - constrained areas of the world, the principles and practices outlined are universally applicable and relevant in every surgical and anesthetizing setting anywhere, even the most technologically advanced ultra - sophisticated operating theatres in teaching hospitals of major world capitals. these revised standards were presented and discussed at a plenary session of the world congress of anaesthesiologists in cape town in march 2008 and at two general assemblies of the wfsa held at this congress. further refinements were made on the basis of feedback from these presentations, and a final revision was endorsed by the wfsa at its third general assembly held in cape town on march 7, 2008. the 2008 international standards for a safe practice of anaesthesia were posted on the website of the wfsa. this further revised edition was presented to the executive committee of the wfsa in london in march 2010. the executive committee endorsed the edition and further accepted the necessity of an ongoing process of revision. it was agreed that the 2010 revised standards with an accompanying description of their development should be submitted for open access publication in a peer - reviewed journal with the view to facilitating the dissemination of the standards and promoting feedback though the journal s correspondence columns. it was further agreed that the endorsement (or otherwise) of future revisions should be made by the executive committee of wfsa. since this committee meets every two years, the next clear opportunity for revision of the standards will be in 2012 at the world congress of anaesthesiologists in buenos aeries. the international standards for a safe practice of anesthesia 2010 are divided into two sections, general standards and perianesthetic care and monitoring standards. in keeping with the particularly effective approach of the original standards, there are three graduated levels of practice recommendations, and these levels are aligned with three increasing levels of applicable infrastructure. the 2010 standards specify the practices and resources required as a minimum for the provision of anesthesia for an elective surgical procedure, and they explicitly acknowledge that compromise may be unavoidable in an emergency. they are grounded in the most fundamental principle of safety in anesthesia, i.e., the continuous presence of a vigilant anesthesia professional during anesthesia. this requirement may seem obvious to many in 2010, but it was actually controversial when first introduced, and we have anecdotal observational evidence that the point still needs to be made. the 2010 standards specify further that providers of anesthesia care should be appropriately trained and accredited. the wfsa views anesthesia as a medical practice but recognizes the reality that many anesthetics are provided by non - medical personnel (even in a number of high - income countries). nonetheless, leadership, training, direction, and supervision by medical personnel are specified. this parallels the situation found in other specialties, such as radiology, pathology, and cardiology. for example, a trained technician may well be capable of obtaining radiographs or echocardiographic views, and even of interpreting these. yet, the need for broadly based medical expertise to direct radiological services or to deal with the implications of echocardiographic findings to patient management is not controversial. in the same way, there are clearly many aspects of anesthesia care that can be provided safely by appropriately trained non - medical health personnel. however, the prescription of optimum anesthesia, the complexity and variety of patients co - morbidities, the management of crises (which can develop quickly and without warning), and the broader issues of the appropriateness of the overall surgical management of certain patients are all areas for which formal medical training is required. working together as a team, politically and perioperatively, allows the optimum configuration to be developed by medical and non - medical providers in different hospitals. perhaps the most controversial aspect of the 2010 standards is the elevation of pulse oximetry to the highest level of recommendation, making its use, in effect, a mandatory standard of care. this was a carefully considered decision, and the rationale for it has been explained previously.16 we have surveyed wfsa member societies, and we have yet to find a national society that has minimal standards for anesthesia that does not specify pulse oximetry as mandatory. however, there is a discrepancy between the standards of some national societies and the actual availability of pulse oximetry in their regions. the extent of this substantial oximetry gap has recently been estimated.17 after proof of the concept through pilot studies in four countries,18 a major project is underway to address this gap through the provision of a package that includes appropriately designed and relatively affordable oximeters and training for the personnel who will use the oximeters. in combination with this initiative, the 2010 standards have the potential to stimulate a major step forward in the care of anesthetized patients in some of the least - resourced areas of the world. there are obvious limitations in the process that was used to develop the 2010 standards. however, elements of the 2010 standards are a reflection of expert consensus based on many years of collective clinical experience. there have been epidemiologic trends and, from the usa, observed decreases in the frequency and severity of malpractice lawsuits for anesthesia injury accidents, which suggests improved anesthesia outcome associated with observing safety standards.19 there are no randomized trials to support the contention that the continuous presence of a trained anesthesiologist is essential for safe anesthesia. neither is there a need for such trials.20,21 there is limited evidence from randomized trials regarding the value of pulse oximetry in anesthesia, but while this evidence is inconclusive, there can be few aspects of medical practice about which expert consensus is more unified or more supported in actual clinical practice.22 there has been little if any criticism of the original 1992 standards since their publication, and the publication of the 2010 standards in a widely accessible indexed medical journal provides a clear mechanism for discussion of any points thought to be contentious. the international standards for a safe practice of anesthesia 2010 have been developed through an extensive process of literature review and international consultation. they were built on the thorough and carefully planned groundwork by the 1990 s task force. the first edition of the standards stood the test of over 15 years of use. the establishment of a process for revision and iterative endorsement is an important step forward to ensure the ongoing relevance of the standards to anesthesia practice throughout the world and to maintain a continuous stimulus for quality improvement in anesthesia care. while they are universally applicable, these standards primarily target lesser - resourced areas. they are designed particularly for regions that have yet to formulate or adopt their own standards so as to promote optimum patient outcomes in every anesthetizing location in the world. | purpose to enhance patient safety through contemporaneous and comprehensive standards for a safe practice of anesthesia that augment, enhance, and support similar standards already published by various countries and that provide a resource for countries that have yet to formulate such standards.standards development the safe anesthesia working group of the world health organization s safe surgery saves lives global initiative updated the 1992 international standards for the safe practice of anaesthesia (standards) through an iterative process of literature review, consultation, debate, drafting, and refinement. these standards address, in detail, the organization, support, practices, and infrastructure for anesthesia care. the standards are grounded in the fundamental principle of safety in anesthesia, i.e., the continuous presence of an appropriately trained, vigilant anesthesia professional. in effect, the use of pulse oximetry during anesthesia is now considered mandatory, with acknowledgement that compromise may be unavoidable in emergencies. at the world congress of anaesthesiologists in 2008, drafts were presented for comment, further refinements were made, and the revised standards were adopted by the world federation of societies of anaesthesiologists (wfsa). these revised standards were posted on the wfsa website for further feedback, and minor revisions followed. the international standards for a safe practice of anesthesia 2010 were endorsed by the executive committee of the wfsa in march 2010. ongoing periodic revision is planned.conclusion while they are universally applicable, the 2010 standards primarily target lesser - resourced areas. they are designed particularly for regions that have yet to formulate or adopt their own standards so as to promote optimum patient outcomes in every anesthetizing location in the world. |
spondyloarthritis (spa) is a group of rheumatic diseases characterized by inflammatory back pain, peripheral oligoarthritis, enthesitis, and/or extraarticular manifestations1. ankylosing spondylitis (as) and psoriatic arthritis (psa) are the most frequently seen spa subtypes in rheumatology units2,3,4. foot involvement in spa is not uncommon and enthesitis, erosive changes, or ankylosis are the main symptoms5, 6. this involvement may affect foot functions negatively, similar to rheumatoid arthritis (ra)7. in rheumatology units, the functional states of patients with spa are usually evaluated using bath ankylosing spondylitis functional index (basfi) or other similar scales globally. however, these assessments may underestimate the foot - related functional limitations in these patients. the foot and ankle outcome score (faos) is a scale measuring the foot - related functional limitations in the disorders affecting the foot7,8,9,10. it consists of 5 subscales : pain, symptoms, activities of daily living (adl), function in sport and recreation (sport - rec), and foot and ankle - related quality of life (qol). the turkish version of faos is a valid and reliable instrument to assess foot and ankle related problems11. the aim of this study was to assess specifically the functional limitations caused by foot involvement in patients with spa. patients with as and psa aged 1870 years, with foot pain for more than 4 weeks who underwent anteroposterior (ap) and lateral (l) feet radiography were included into the study. they met the modified new york criteria for as and moll - wright criteria for psa12, 13. patients who had flatfoot, previous foot surgery, or any other foot disorder unrelated to spa, and who had a systemic disease such as diabetes or hyperthyroidism were excluded. ethical approval for this study was obtained from the ethical committee of the university where the study was conducted. the clinical findings of foot involvement were assessed by observing for swelling, redness, or tenderness. to obtain a numerical value, a (cfs) was calculated by giving 1 point for every finding on one foot [swelling : 1 point, redness : 1 point, tenderness : 1 point ; the maximum cfs score was 6 for the two feet ]. the radiologic involvement of the foot was evaluated by the spondyloarthropathy tarsal radiographic index (spa - tri), which is a valid and reliable radiologic index developed specifically for the assessment of foot involvement in spa, and is suitable for use with two or more x - ray projections. it has five points ; 0 : normal, 1 : osteopenia or suspicious findings, 2 : definite joint space narrowing, bony erosions, periosteal whiskering, enthesophytes, 3 : paraarticular enthesophytes / incomplete bridging, 4 : bony ankylosis / joint space fusion or complete bridging. the maximum spa - tri score for the two feet (total spa - tri score) is 5614. foot x - ray images were evaluated by a radiologist who had no information about the clinical status of subjects. talonavicular, calcaneocuboid, intercuneiform, cuneonavicular, and subtalar joints, and the calcaneal attachments of the achilles tendon and plantar fascia (7 places) were assessed using the spa - tri. the foot - related functional status of patients was determined by the turkish version of the faos. faos is calculated by a specific equation, and 100 indicates no problems while 0 indicates extreme problems8. since the pain assessment was achieved in detail by faos, no other pain assessment scale was needed. c - reactive protein (crp) and erythrocyte sedimentation rate (esr) were used as serum markers for disease activity. thirty patients with spa (14 as, 16 psa) with a mean age of 49 years (range 2670 years) completed the study. the mean faos subscale scores were as follows : pain=58.70 21.75, symptoms=64.88 26.05, adl=66.27 22.56, sport - rec=44.33 26.42, and qol=42.08 24.99. pain subscale scores correlated positively with adl, sport - rec, and qol subscale scores. symptoms subscale score also positively correlated with adl, sport - rec, and qol subscale scores (table 1table 1.positive correlation between pain and symptoms subscale scores with other faos subscale scoresadl sport - rec qolsymptomsr0.749 0.693 0.552painr0.875 0.872 0.629faos : the foot and ankle outcome score, adl : function in daily living, sport - rec : functions in sport and recreation, qol : quality of life. pain and symptoms subscale scores positively correlated with each other (r : 0.679, p<0.001). faos : the foot and ankle outcome score, adl : function in daily living, sport - rec : functions in sport and recreation, qol : quality of life. this value demonstrated that although patients had foot pain, they did not have prominent physical examination findings. the mean crp and esr were 1.1 (0.18.5) mg / dl and 32 (7100) mm / h, respectively, showing low disease activity. there were no relationships between faos subscale scores and cfs or serum markers (crp/ esr). the mean spa - tri score was 7.7 (024) and no correlation was found between faos subscale scores and radiologic score. foot disorders may affect mobility and life quality significantly. as frequently involves the foot ; the achilles tendon is the second most common site of enthesitis after the chondro - sternal junction, and the ankle is the second most common site for peripheral joint disease after the knee6. the involvement of the ankle and small joints of the foot is also frequent in psa15. these effects of as or psa on the foot may lead to functional limitations. the functional states and quality of life of patients with spa are usually evaluated using questionnaires such as basfi, health assessment questionnaire for spondyloarthropathies (haq - s), ankylosing spondylitis quality of life questionnaire (asqol), or psa - specific quality of life questionnaire (psaqol)16,17,18,19. however, these questionnaires evaluate the functional activities in a global manner without considering the specific cause of the limitation. therefore, the functional cost of foot involvement can not be assessed clearly with these indices leading to underestimation. faos is a 42-item questionnaire developed for the assessment of functional limitations after ankle ligament reconstruction, but it was also used in other disorders affecting the foot such as hallux valgus and rheumatoid arthritis7,8,9. it has 5 subscales ; pain, symptoms, adl, sport - rec, and qol. pain subscale include 9 questions evaluating the frequency and severity of pain in certain situations such as walking on flat surface or at night while in bed. symptoms subscale has 7 questions assessing the stiffness, swelling, and movement properties of the foot / ankle. the adl and sport - rec subscales evaluate the degree of difficulty experienced due to foot / ankle disorders in functional activities. the fifth subscale, qol, focuses on the awareness of the foot / ankle problem8, 11. pain and symptoms subscale scores significantly and positively correlated with each other and with adl, sport - rec, and qol subscale scores. pain and symptoms such as stiffness or range of motion loss, plain radiography is a routinely used imaging technique in the evaluation of radiologic involvement in rheumatic diseases. spa - tri is the radiologic index developed specifically for the assessment of foot involvement in spa. in this study the mean spa - tri score was 7, a very low score when compared with the maximum score of 56. it could be speculated that although patients had symptoms, radiography did not show the involvement clearly, and therefore, no statistically significant results were obtained. the magnetic resonance imaging technique is quite successful in demonstrating very early changes at the feet even in patients with asymptomatic as and psa20, 21. therefore, this should be the preferred technique for future studies. in this study, the relationships between the faos subscale scores and cfs and serum markers were also assessed. the foot is composed of small joints and their examination is relatively difficult than that of the large joints. the inflammatory changes producing pain in these small joints may not always lead to swelling, redness, or tenderness. these reasons may explain the lack of a relationship between cfs and faos subscale scores. in our study, crp and esr values were distributed in a wide range (0.18.5 mg / dl and 7100 mm / h, respectively) showing that foot involvement may not be directly affected from the disease activity. this hypothesis remains to be clarified with studies having a larger sample size. in conclusion, rheumatic pain, resulting from the inflammatory changes in the joints and related structures, is a very important clinical problem disturbing the mood, sleep, and quality of life of patients22,23,24. it is the most common presenting symptom of rheumatic diseases of the foot and may precede clinical and radiologic findings25. this study demonstrated that foot pain in patients with spa might result in significant foot - related functional limitation. therefore, foot involvement and its functional results should be evaluated separately regardless of the global functional state and disease activity of the patient. to improve pain and function physical therapy modalities or orthosis more studies about the foot involvement at the early and late stages of the disease are needed and the possible treatment approaches must be investigated. | [purpose ] spondyloarthritis is a major inflammatory disease followed - up in the rheumatology clinics, foot involvement in spodyloarthritis is common. the functional states of patients with spondyloarthritis are usually evaluated globally. the aim of this study was to assess the foot involvement - related functional limitations in patients with spondyloarthritis. [subjects and methods ] patients with ankylosing spondylitis and psoriatic arthritis with foot pain more than 4 weeks who underwent anteroposterior and lateral feet radiography were enrolled into the study. a clinical findings score was calculated by assigning 1 point for every finding of swelling, redness, and tenderness. c - reactive protein and erythrocyte sedimentation rate were used as serum markers for disease activity. foot radiograms were evaluated using the spondyloarthropathy tarsal radiographic index and the foot - related functional state of patients was determined by the turkish version of the foot and ankle outcome score. [results ] there were no relationships between foot and ankle outcome score subscales and clinical findings score, serum markers, or radiologic score. pain and symptoms subscale scores were result positively correlated with activity of daily living, sport and recreation, and quality of life subscale scores. [conclusion ] pain and symptoms are the main determinants of foot - related functional limitations in spondyloarthritis. |
the budding yeast saccharomyces cerevisiae with its unparalleled genetic tractability has undoubtedly become the model of choice for large - scale studies on transcription, protein protein, and genetic interactions (suter., 2006). nevertheless, we are far from understanding biochemistry of all yeast gene products and their interactions (pena - castillo and hughes, 2007). one of the major advances brought about by yeast functional genomics was the development of libraries of heterozygous and homozygous deletion strains (winzeler., 1999 ; giaever., 2002), a key feature of such libraries is the insertion of unique sequences (bar codes) for the identification of each strain, allowing competitive growth experiments and rapid quantification using hybridization (microarrays ; shoemaker., 1996), or sequencing methods (smith., the genome - wide application of deletant libraries to screen chemical compounds is called chemogenomics (or reverse chemical genetics ; roemer., 2011), which is based on growth of homozygous and/or heterozygous deletants in presence versus absence of a chemical compound can uncover functions of the gene in allowing growth in the presence of the compound (e.g., in a detoxification mechanism). when heterozygous libraries are used, there is also an opportunity to find the compound targets through drug - induced haploinsufficiency : with one gene copy deleted and the product of the other targeted by the bioactive molecule, resulting in a measurable growth deficiency (giaever., 2004 ; similarly, the gene dosage can also be increased by the use of plasmids and screening the transformed strains for resistance against a given chemical (rine., 1983). integration of different gene dosage techniques further increases the sensitivity and specificity of such chemogenomics approaches to define drug targets (hoon., 2008). importantly, it has been shown that there is a good correlation between the results obtained by independent groups employing different methodologies used (hughes., 2004 ; early studies suggested that 1720% of the yeast genes are essential under standard laboratory conditions (winzeler. despite the importance of the essential gene complement in defining certain core molecular processes (e.g., translation, transcription, and dna replication), it fails to capture the gene functions associated with non - standard conditions (e.g., stress response)., 2002 ; lum., 2004 ; parsons., 2004, 2006 ; hillenmeyer., 2008) and data integration (parsons., 2004, 2010a, b) have been shifting the paradigm of gene essentiality toward a condition - dependent view that is more resonant with the natural lifestyle of yeasts. (2008) showing that 95% of the yeast mutants had their fitness compromised in at least one environmental / chemical condition. here we highlight recent discoveries in chemogenomics with special attention given to the evolution of chemical tolerance systems in fungi. results from chemogenomics screens can be computationally represented and analyzed using matrix and graph - based (network) approaches (sharom., 2004 ; parsons., 2006 ; wuster and madan babu, 2008). a chemical genetic network can be simply defined as a set of nodes (genes and chemicals) connected by directed edges (chemical genetic interactions ; figure 1). because a chemical genetic interaction reflects the importance of a gene in the natural resistance against a given compound, highly connected genes in this network are called multidrug - resistance genes (mdrs). using different analytical methods, several groups have shown that mdrs are clearly over - represented in transmembrane transporters and endosomal sorting complexes (escrt and retromer), implying that vesicular trafficking, and efflux pumps are major detoxification routes (parsons., 2006 ; hillenmeyer., 2008 ; jo., 2008 ; ruotolo., 2008 ; venancio., homozygous, heterozygous, and overexpression mutant libraries are grown in the presence and absence of a chemical. the growth of each mutant is then measured using hybridization or sequencing methods ; (b) chemogenomics data can be represented as a heatmap or modeled as a network (black solid and dashed edges for susceptibility and resistance, respectively) and genes with similar chemical genetic profiles are subsequently linked (dark - green edges). only interactions reflecting increased susceptibility were used ; (c) network representation of 34 integrated chemogenomic datasets (i.e., cpnet ; venancio., 2010b). color codes : scp - hubs (orange), chemicals (green), and other genes (purple). see the text for details on the scp - hubs definition. using this framework, venancio. assembled the chemical - phenotype network (cpnet), integrating data from 34 distinct chemogenomic datasets, comprising 5233 orfs and 425 chemicals connected by 54,769 links. in addition to studying genes individually, it is likely that chemical tolerance involves epistatic (genetic) interactions between different genes. one way this issue can be approached is by using a network linking genes with significantly similar chemogenomic profiles (i.e., the shared chemical - phenotype network, scpnet ; venancio., 2010b). the scpnet comprises 4631 genes and 40,102 edges, for which the significance was computed by simulating degree - preserving random cpnets and purging non - significant interactions (p > 0.001). in this context it should be noted that the degree distribution of these networks differs from many of the classical biological networks like the transcription network, the protein interaction network, or genetic interaction networks, which show power law like degree distributions. instead these networks are rather distinctive among biological networks in showing distinctive degree distributions whose tails might be approximated by exponential functions. hubs of these networks (venancio., 2010b). although network reconstructions from correlation data have some potential pitfalls (gomez., 2009), support for the scpnet was obtained from large - scale protein and genetic interaction networks (venancio., 2010b). by analyzing genetic interactions among yeast genes conferring resistance to the methyl methanesulfonate (mms ; dna - damaging chemical), st onge. in contrast to almost all the biological networks studied so far, the scpnet is highly assortative (newman, 2003), showing a strong hub interconnectivity with might play some role in natural tolerance against chemical stress (venancio. mdrs are strikingly under - represented among scp - hubs, suggesting that the scp - hubs counter chemical stress by a distinct mechanism (venancio., 2010b). it emerges that scp - hubs tend to have upstream tata boxes, favoring transcription driven by the saga complex (basehoar., 2004 ; huisinga and pugh, 2004). in contrast, mdrs tend to be tata - less, typically dominated by the tfiid transcriptional complex (basehoar., 2004 ; huisinga and pugh, 2004). it has been shown that the presence of upstream tata boxes increases the variability in gene expression (i.e., noise), which can confer fitness advantages in drastically changing environmental conditions (blake., 2006 ; tirosh., scp - hubs typically show significant divergence in their transcriptional output in long - term laboratory evolution experiments under sub - optimal conditions (ferea., 1999). further, scp - hubs are enriched in fast - evolving genes, which might be restricted to the saccharomycotina clade, and appear to be under positive selection. rapid divergence and variability both at the level of the protein sequence and transcription regulation suggest the scp - hubs as the evolvability (i.e., flexibility to change due to low selection pressure) component allowing the system to cope with rapidly changing conditions (venancio., 2010b). genes required for growth under stress are generally not the ones induced by it (birrell., 2002 ; tai., 2007), probably because proteins required for rapid chemical tolerance must be immediately available upon exposure to harsh conditions. stress - induced genes can be involved in the acquisition of resistance to impending severe stress that otherwise would kill the previously unexposed cells (gasch., 2000 ; further, responses to a primary stress can cross - protect against distinct secondary stress conditions (berry., this phenomenon can result from similar downstream effects of various stresses or an evolutionary signature of a transcriptional preparation for successive harsh environmental conditions, as demonstrated for yeast (berry and gasch, 2008) and bacteria (tagkopoulos. it was observed that scp - hubs are over - represented in stress - induced genes, which along with their high evolvability let us to hypothesize a critical role in adaptive processes conferring stress tolerance (venancio., 2010b). interestingly, mdrs are also over - represented among phenotypic capacitors the genes that buffer phenotypic variation (levy and siegal, 2008), indicating that morphological robustness is a key feature of mdr. taken these observations together, the gene complement involved in stress response is partitioned in two major components : mdrs, which are more conserved, less - noisy in expression, and providing phenotypic capacitance. scp - hubs constitute a more variable system with noisy expression that could work by probing the changing environmental conditions with different counter - strategies. interestingly, among the previously uncharacterized scp - hubs are several distinct enzymatic domains, such as gcn5-like acetyltransferases (ygr111w and yor012w), ntn, and c n hydrolases (yil165c), among several others (venancio., 2010b). the detoxification potential of such enzymatic activities has been recently shown by the identification of the sam - dependent methyltransferase crg1 as a key player in chemical stress response and lipid homeostasis. follow - up experiments showed that crg1 methylates cantharidin in vitro (lissina., 2011). interestingly, crg1 has a relevant number of links in the scpnet, probably being part of the cooperative architecture discussed above. thus, some scp - hubs potentially neutralize deleterious compounds and the dense interactions between them indicate a cooperative resistance mechanism composed by serial or parallel biochemical reactions. the general lack of transcriptional alterations of mdrs by the chemicals to they confer resistance raises questions regarding the regulation of their protein products (gasch., 2000 ; integration of the chemogenomics with phosphorylation and ubiquitination data showed that mdrs are preferentially ubiquitinated and phosphorylated when compared to other genes in the network (ptacek. this analysis allowed the prediction of unexpected stress - related functions for a poorly characterized e1-enzyme (ykl027w ; burroughs., 2009 ; venancio., 2009), proteasomal chaperones (poc1, poc2, poc3, poc4 ; le tallec., 2007), the outer - membrane mitochondrial deubiquitinating enzyme ubp16 (kinner and kolling, 2003), and the predicted desumoylating enzyme wss1 (iyer., 2004 ; additional analysis suggest the ub - system as a regulator of peroxisome recycling (i.e., pexophagy and de novo peroxisomal biogenesis), an organelle with paramount importance in chemical tolerance (figure 2 ; eckert and johnsson, 2003 ; smith and aitchison, 2009 ; venancio., 2009, 2010b). (a) important components linked to hog pathway kinases (blue) and its upstream regulator ssk1 (green) ; (b) critical peroxisomal component linked to the ub pathway genes pex4, pex10, and pex12 (blue). interactions were obtained from a previous publication integrating chemogenomics data (venancio., 2010b). in a similar vein, with regards to phosphorylation, the scpnet revealed that the high osmolarity glycerol (hog) pathway (hog1, ssk2, and pbs2) is the most important kinase cascade in chemical stress tolerance (figure 2 ; eckert and johnsson, 2003 ; smith and aitchison, 2009 ; venancio. the hog pathway is triggered by increased environmental osmolarity and raises glycerol concentration to control the intracellular osmotic pressure (brewster., 1993). although its association and the toleration of certain harsh conditions has been long demonstrated (e.g., oxidative stress ; pahlman., 2001), chemogenomic data vastly expands the role of glycerol as a general chemoprotectant (venancio., 2010b). chemogenomics data has also revealed the enigmatic haspin - like kinases alk2 as a key player in chemical resistance. orthologs of this kinase in plants and animals have been shown to mediate histone h3 phosphorylation (wang., 2010). it would be interesting to investigate if alk2-mediated phosphorylation of histone h3 or other chromatin proteins have some role in chemical stress tolerance. finally, if interpreted in the context of recent advances in deciphering and annotating kinase - substrate pairs (mok., 2011 ; sharifpoor., 2011), chemogenomics datasets might uncover other novel biochemical pathways involved in stress resistance. one interesting and frequently under - appreciated aspect of chemogenomics is its potential to suggest functions for unknown proteins, biochemical pathways, and protein complexes. this is especially important because many proteins involved in stress response are under positive selection and/or are lineage - specific, hindering homology - based function prediction. in line with this observation, venancio and aravind (2010) described a novel tail - anchored cysteine - rich transmembrane (tm) domain (cystm), present in some scp - hubs (ydl012c and ydr210w) and conserved in fast - evolving stress resistance proteins from other eukaryotes. structural analysis suggest that cystm proteins might regulate redox potential or access to metal ions by means of the conserved cysteines found in their tm segments (venancio and aravind, 2010). eukaryotic genomes are characterized by several closely related paralogs that are typically thought of as being functionally fungible. just as chemogenomics data allowed an alternative perspective on gene essentiality, it is also promising to affect our understanding of the apparent redundancy among close paralogs. one notable example is provided by the closely related paralogous rab gtpases ypt31 and ypt32, both of which interact with the myosin v motor to mediate polarized secretion (lipatova., 2008). however, they show a striking dissimilarity in their chemogenomics profiles ypt31 is connected to 39 chemicals, while the ypt32 is connected to only a single compound (venancio., 2010b). this suggests that ypt31 is probably dedicated for the polarized secretion in relation to chemical resistance. likewise, one of the main mdrs emerging from major chemogenomics studies conducted to date (hillenmeyer., 2008) its close paralog tax4 is not a mdr and show little relevance in chemical stress tolerance., 2008), irs4 might represent a specialized stress - related component of the autophagic processes. pairs of paralogous kinases such as ssk22 and ssk2 and alk1 and alk2 also display strongly discrepant chemogenomic profiles, suggesting a similar differentiation of arguably redundant paralogs for stress - related as opposed to other regulatory contexts (venancio., 2010b). further, integration of protein protein interaction data and curation of subcellular protein complexes (pu., 2009) with chemogenomic profiles may as well provide clues on the roles of major complexes in stress tolerance (venancio. such work shows that the primary subcellular complexes directly targeted by particular substances can be confidently identified in several instances. for example, rna - degrading exosome emerged as the major target of 5-fluorouracil while the ribosomal subunits emerged as the primary target of neomycin (lum., 2004 ; parsons., 2004 ; tor, 2006 ; kammler., 2008 ; venancio., 2010a). surprisingly, most of the chemical protein complex linkages appear to be the result of indirect functional interactions, indicating that particular subcellular complexes might have a role as general buffers against chemical stress. such buffering systems appeared to be enriched in chromatin and vesicular trafficking (particularly vesicle tethering) complexes. interestingly, some vesicular transport and chromatin complexes have been also shown to be involved in acquisition of both direct and cross - tolerance against stress (alejandro - osorio., 2009 ; zakrzewska., 2011). specifically, the histone deacetylase rpd3 was found to have a critical role in the induction and repression of environmental stress response genes under multiple stress conditions (alejandro - osorio., 2009). hence, the stabilization of particular transcriptional programs at the chromatin - level and consignment of deleterious chemicals to specific routes of the intracellular trafficking apparatus are likely to constitute general strategies to counter chemical stress. nevertheless, when contrasting transcriptional changes in response to stress across four yeast species, it has been show that a great part of the differences in individual genes are either compensated by changes in functionally related genes or reflect transitions between stress - inducible and constitutive activities maintaining the phenotypic outcome in the different species (tirosh., 2011). in addition to the gene - centered studies presented above, chemogenomics data have also been extensively employed in the study of the mechanism - of - action (moa) of various bioactive substances (hughes., 2004 ; roemer., 2011), under the premise that by clustering substances with similar chemical genetics profiles one can understand their moa (brown., 2006). conceptually, by looking at the chemogenomics data as a bipartite network of genes and chemicals, it is just a matter of looking at the same data in the opposite direction (figure 1). 2004) found that three therapeutically distinct substances that impair the growth of erg24 heterozygous deletants share a common structural core, demonstrating the cells may have similar physiological responses against chemically related bioactive molecules. (2004) identified the sin-1, the first metabolic derivative of the vasodilator molsidomine, as a potent inhibitor of the lanosterol synthase erg7p, a finding of potential pharmacological interest. lee. found that similar dna - damaging substances can damage dna not only in cognate ways but also by clearly distinct mechanisms. in addition, they have found 34 uncharacterized genes as novel dna damage repair candidates. hence, new genetic interactions between well - characterized dna repair genes, indicating that the wiring of this system is still incomplete (lee., 2005). by studying 75 compounds and 7 natural extracts, parsons. found that compounds with similar chemical genetic profiles triggered analogous cellular effects (e.g., staurosporine and caspofungin, affecting cell - wall homeostasis). through computational analysis and follow - up chemical characterization, they were able to identify the active component of crude extracts, emphasizing the pharmaceutical potential of chemogenomic screenings (parsons., 2006). taken together, such results clearly demonstrate the pharmacological potential of chemogenomics (roemer., 2011). more recently, chemogenomic approaches were also used to elucidate the moa of elesclomol and curcumin, showing that chemogenomic screens can be equally useful in studying therapeutics from either modern and traditional medicine (minear., 2011 ; blackman., 2012). we herein review some recent advances in chemogenomics with a particular emphasis on how the integration of multiple datasets with other sources of biological information can help to discover previously unknown biochemical mechanisms, with potential applications in pharmacology and medicine. the results discussed here suggest that scpnet interactions might be used to complement protein protein and genetic interaction networks and could thus foster future analysis of double mutants using yeast synthetic genetic array (tong., 2004) combined with exposure to specific bioactive molecules (boucher., 2009 ; roemer., 2011) have found that the combination of data from s. cerevisiae and schizosaccharomyces pombe improves moa prediction accuracy. further, they were able to identify a novel dna - damaging substance with preserved moa in human cells (kapitzky., 2010). the extension of chemogenomics screens to pathogenic organisms such as candida albicans (xu. suggests that these approaches might come to bear on effective drug development. taken together with our own observations, this indicates that chemogenomic screens may benefit from an evolutionary - oriented framework. therefore, yeast chemogenomics serves as a benchmark and model for the development of similar screens for other organisms. comparison of the major genes emerging from chemogenomics results across several species promises to be fruitful area for future studies. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | large - scale chemical genetics screens (chemogenomics) in yeast have been widely used to find drug targets, understand the mechanism - of - action of compounds, and unravel the biochemistry of drug resistance. chemogenomics is based on the comparison of growth of gene deletants in the presence and absence of a chemical substance. such studies showed that more than 90% of the yeast genes are required for growth in the presence of at least one chemical. analysis of these data, using computational approaches, has revealed non - trivial features of the natural chemical tolerance systems. as a result two non - overlapping sets of genes are seen to respectively impart robustness and evolvability in the context of natural chemical resistance. the former is composed of multidrug - resistance genes, whereas the latter comprises genes sharing chemical genetic profiles with many others. recent publications showing the potential applications chemogenomics in studying the pharmacological basis of various drugs are discussed, as well as the expansion of chemogenomics to other organisms. finally, integration of chemogenomics with sensitive sequence analysis and ubiquitination / phosphorylation data led to the discovery of a new conserved domain and important post - translational modification pathways involved in stress resistance. |
inorganic hollow spheres of nanometer to micrometer dimensions represent an important class of materials, and are attended for wide potential applications, such as catalysts, fillers, coatings, and lightweight structural materials owing to their low density, large specific area, and surface permeability [2 - 5 ]. especially, noble metal hollow spheres have attracted lots of attention for their remarkable optical properties. only, previous efforts to prepare noble metal hollow spheres have been focused on polymer - surfactant compels micelles and using template methods. the nanometer silver hollow spheres are difficult to be obtained and should be removed of the core, resulting in breaking of shell by these methods. moreover, the functional metal hollow spheres can not be obtained. in the design of multicompositional materials with spatially defined arrangements of the different components, block copolypeptides may be highly useful as structure - directing agents for nanoparticle assembly. it is well - known that noble metals like gold and silver are capable of existing in the unoxidized state at the nanoscale and offer a unique surface chemistry that allows them to be used as platforms for self - assembly layers of organic molecules [11 - 14 ]. so, it is expected to prepare the nanometer noble metal hollow spheres by crystal self - assemble method under functional organic molecules assistant, which is easy to prepare and control. the silver hollow spheres are formed by the self - assemble of silver nanoparticles assisted functional molecules of eu(tta)3 2h2o. the eu(iii) organometallic compounds of eu(tta)3 2h2o as the dispersion and bridge of silver nanoparticle results in the self - assemble of them, along a certain axis in thexy - plane and the curl and extension of eu(iii) organometallic in a mixed solvent microenvironments for confining the 3d growth of silver hollow spheres. in other way, the fluorescence of silver hollow spheres is further observed, which is expected to apply in optical materials. eu(tta)3 2h2o (htta : trifluorothenoyl - acetone) were synthesized according to the literature and the structure is shown in scheme 1 and is confirmed by ir analysis, such as the c = o group at 1,614.5 cm, cf3 group at 1,357.4 cm, c = c group at 1,541.8 cm, and the eu o at 638.9 and 579.8 cm. illustration of formation of silver hollow spheres by the two - step route silver hollow spheres were prepared according to the process as shown in scheme 1. the first step is to synthesize the ag colloidal solution in the presence of eu(tta)3 2h2o complex according to the literature. the morphology and size of silver nanoparticles and the surface plasma on resonant absorption peak are determined to be sphere with an average size of 21.5 and 425.2 nm by transmission electron microscope (tem) and uv vis absorption spectrum, respectively. in the second step, the silver colloidal tfh solution with a concentration of 6.34 10 m was obtain and added to be 1 mmol free eu(tta)3 after this, centrifuging (3,000 rpm) gave a brown acetone / water precipitate, and supernatant solution containing excess eu(tta)3 morphology and size of the sample was obtained by using tem, scanning electron microscopy (sem), and scanning near - field optical microscopy (snom). eu(tta)3 2h2o (htta : trifluorothenoyl - acetone) were synthesized according to the literature and the structure is shown in scheme 1 and is confirmed by ir analysis, such as the c = o group at 1,614.5 cm, cf3 group at 1,357.4 cm, c = c group at 1,541.8 cm, and the eu o at 638.9 and 579.8 cm. the first step is to synthesize the ag colloidal solution in the presence of eu(tta)3 2h2o complex according to the literature. the morphology and size of silver nanoparticles and the surface plasma on resonant absorption peak are determined to be sphere with an average size of 21.5 and 425.2 nm by transmission electron microscope (tem) and uv vis absorption spectrum, respectively. in the second step, the silver colloidal tfh solution with a concentration of 6.34 10 m was obtain and added to be 1 mmol free eu(tta)3 after this, centrifuging (3,000 rpm) gave a brown acetone / water precipitate, and supernatant solution containing excess eu(tta)3 morphology and size of the sample was obtained by using tem, scanning electron microscopy (sem), and scanning near - field optical microscopy (snom). the silver / eu(tta)3 2h2o composite nanoparticles were prepared by the interaction between ag nanoparticles and thiophene chromophores group of eu(tta)3 2h2o, and the cf3 groups of eu(tta)3 2h2o extend away from the ag nanoparticle to provide solubility of the nanoparticles, which has been discussed in previous work. so it is not discussed in detail here. it is further found that if the concentration of silver / eu(tta)3 2h2o composite nanoparticles is kept at more than 6.34 10 m and 1 mmol free eu(tta)3 2h2o is present in the solution, silver hollow spheres are formed by self - assemble of silver / eu(tta)3 2h2o composite nanoparticles as shown in scheme 1. 2h2o is as bridge of silver / eu(tta)3 2h2o composite nanoparticles by the interaction between ag nanoparticles and thiophene chromophores, too. the formation of silver hollow spheres is determined by the tem images as shown in fig. 1a have pale regions in the central parts in contrast to darks, indicating them to be hollow structure. figure 1a further shows the size range from 0.6 to 1.5 m and the average size is 0.9 m. compared with the silver hollow spheres previously produced in template synthesis, the size is smaller. the shell of dark edges consists of the silver nanoparticles capped eu(tta)3 2h2o complex for assembling, and the pale regions exclude the possibility alone silver nanoparticles capped eu(tta)3 2h2o complex and free eu(tta)3 2h2o complex as shown in fig. it also further clearly shows that uniformity shell structure of silver hollow spheres is with the shell thickness ranging from 40 to 100 nm. from the size of isolated silver nanoparticles (21.5 nm), we can determine that the shell is formed by 25 layers of silver nanoparticles aggregate. 1c, which shows growing parallel to (111), (200), and (220) planes of cubic silver, indicating the hollow spheres containing crystal ag. (a) tem images of the silver hollow spheres, (b) hrtem images of the silver hollow spheres, and (c) ed pattern of the silver hollow spheres the uv vis absorption spectrum of the silver hollow spheres and pure eu(tta)3 2h2o in thf solution are compared in fig. 2. as is well - known, the peak at 423.2 nm is the surface plasmon resonant absorption of silver nanoparticles as shown in curve b of fig. the surface plasmon resonant absorption can not be observed in previous work because the silver hollow spheres are submicrometer and do not consist of silver nanoparticles. at the same time, an observation of the two curves a and b shows the almost same absorption peak (343.9 and 345.7 nm) of tta, which is different from previous work. 2h2o do not form j - aggregate and only acts as bridge between silver nanoparticles. the result further confirms that the formation of silver hollow spheres by self - assemble of ag nanoparticles assisted with eu(tta)3 2h2o. (a) the uv absorption of pure eu(tta)3 2h2o complexes and (b) silver hollow spheres in thf solution to further confirm the formation of silver hollow spheres, the typical surface morphology of snom is shown in fig. figure 3a suggests that the silver hollow spheres are an average diameter of 0.9 m, which is consistent with the result of tem images. the typical transmission image of snom of the silver hollow spheres is further characterized in fig. 3b, indicating that the in - laser at 457 nm is almost absorbed for plasmon resonant absorption of silver nanoparticles. (b) the snom transmittance image of silver hollow spheres the surface properties of silver hollow spheres are further shown in the sem images (fig. it shows that the spheres are indeed hollow at magnification and suggests that the silver hollow spheres consist entirely of uniform silver nanoparticles in the diameter of 21.5 nm. figure 4b also indicates that the outer surface of these silver hollow spheres is not perfectly smooth. from sem observation 4a), the present silver hollow spheres are much more difficult to break, resulting from that the silver shells are much more robust compared with the metal hollow spheres produced previously in other synthesis routes [20 - 22 ]. (a) sem images of the silver hollow spheres and (b) hrfsem images of the silver hollow spheres the fluorescent properties of silver hollow spheres are also investigated as shown in fig. 5, along with pure eu(tta)3 the left curves show the similar excitation peak of 342.0 nm for silver hollow sphere and eu(tta)3 2h2o complex solution, which is consistent with previous work. the emission spectra of silver hollow sphere and eu(tta)3 2h2o complex solution are shown in right curves of fig. 5, too. the similar emission spectra provide the typical red luminescent peaks at 592.0 and 613.0 nm, which is attributed to d0f01 transitions of eu(iii) ion, by excitation at 342.0 nm. however, the emission strength of silver hollow sphere solution is slightly lower than that of pure eu(tta)3 2h2o complexes solution. these fluorescent spectra provide value information about interactions of silver nanoparticles aggregate to silver hollow sphere. these results show that the silver hollow sphere is expected to be a new kind of fluorescent material. in conclusion, silver hollow spheres have been successfully synthesized using two - step approach. this radiation synthetic pathway provides an important example of well - ordered and functional silver hollow spheres with designed morphology. the unique silver shell structure obtained here may be promising candidates for both fundamental research and application, and it is believed that assembling synthesis based on functional molecules represents a novel route to prepare functional inorganic hollow sphere, which is a topic of intense interest. moreover, the silver hollow spheres have high luminescent property at 614.3 nm, which is to be applied in optical materials. this work was supported by the national natural science foundation of china (no : 50025309, and no : 90201016), youthful science foundation of shanxi province (no : p20072185 and no : p20072194), and youthful science foundation of north university. the authors are grateful for the financial support and express their thanks to hui zhao for helpful discussions and wan qun hu for ir measurements. | the preparation of luminescent silver hollow spheres using eu(iii) compound based on trifluorothenoyl - acetone is described. the structure and size of silver hollow spheres were determined by tem images. the result shows the formation of hollow structure and average size of the silver hollow spheres (0.9 m). the silver hollow spheres were further characterized by uv absorption spectrum, snom and sem images, suggesting them to be formed by self - assemble of some isolated silver nanoparticles. the luminescent properties of them were also investigated and they are shown to be high emission strength ; moreover, they offer the distinct advantage of a lower packing density compared with other commercial luminescent products. |
abstractthe bcl-2/bcl - xl inhibitor navitoclax has shown promise for the treatment of cancer but on - target toxicities have limited its utility. recently, the generation of selective bcl-2 family inhibitors has enabled a careful dissection of bcl-2 biology, and early work indicates that these molecules have improved therapeutic profiles for the treatment of cancer. |
|
when people originally from a lower altitude descend to sea level or lower altitude after high - altitude / hypoxia acclimatization, then they lose hypoxia tolerance and physiological adjustments. in addition, they experience changes in hemoglobin and hormone levels over time, and this is known as high - altitude deacclimatization (hada). this physiological process has been documented in explorers, athletes, military personnel, and workers in high - altitude mines. following recent dramatic economic growth in plateau regions of china, such as tibet, qinghai, and xinjiang, tens of millions of lower altitude individuals temporarily migrated to high - altitude regions for work, and then they returned to lower altitudes after they finished their work each year. when the workers returned to lower altitudes, most of them were in the process of hada and suffered from physical discomfort and symptoms. a previous study has shown that individuals suffering from hada experienced symptoms such as sleepiness, insomnia, unresponsiveness, memory loss, fidgetiness, headache, throat pain or discomfort, coughing, sputum, chest tightness, becoming flustered, increased appetite, decreased appetite, diarrhea, abdominal distention, abdominal pain, lumbago, and arthralgia. these symptoms are characteristic and are usually referred to as hada syndrome (hadas), which affects the quality of life of these individuals [7, 8 ]. our previous and other studies showed that hadas subjects suffered a series of clinical symptoms, which could last for many years [6, 911 ]. therefore, hadas has been a public health issue in china and in other countries. in our previous study, we found that subjects who suffered from hadas experienced hypoxia / reoxygenation (h / r). the subjects lived in hypoxic conditions and then quickly returned to normoxic environments, and the levels of pao2 and so2 in hadas subjects rapidly increased from 81.58 hpa and 87.31% to 125.84 hpa and 96.78%, respectively. evidence from studies showed that h / r induced oxidative stress and production of reactive oxygen species (ros) [12, 13 ] and resulted in damage to tissue or cells. superoxide dismutase (sod) plays an important role in removal of excess free radicals in humans experiencing oxidative stress [15, 16 ]. malondialdehyde (mda) is a product of lipid peroxidation, which occurs when unsaturated lipids are exposed to oxygen [15, 16 ]. elevation of mda levels leads to increased oxidative stress and oxidative - mediated damage [15, 16 ]. zhou. showed that serum sod levels were elevated and mda levels were decreased when subjects returned to lower altitudes upon short - term exposure to high altitudes. research has shown that h / r could increase generation of proinflammatory mediators, such as tumor necrosis factor- (tnf-) and interleukin- (il-) 17a, and suppress levels of anti - inflammatory factor il-10, and then it induced apoptosis and damage to cells and tissues [21, 22 ]. in our previous study, we showed that a systemic inflammatory response and myocardial injury were observed in hadas subjects 3 d after returning to a lower altitude. however, serum levels of il-17a, il-10, and tnf- in hadas subjects as well as correlations between these factors and occurrence rate and progression of hadas are not clear. in this study, we evaluated the hadas score and measured serum levels of sod, mda, il-17a, tnf-, and il-10 in hadas and control groups. we then analyzed the correlation of serum levels of sod, mda, il-17a, tnf-, and il-10 with hadas occurrence and severity. sixty - seven healthy male subjects (25.1 7.6 years old) from chongqing (180 m) had worked in lhasa (3650 m) for about 8 months and then returned to chongqing by airplane. after they returned, all subjects had been diagnosed with mild - to - moderate hadas according to relevant diagnostic and scoring criteria, and they were evaluated for hadas at 3 d (baseline), 50 d, and 100 d. they were considered the hadas group. in addition, 41 healthy male subjects (24.8 8.1 years old) who had always lived in chongqing served as the control group. the 2 groups were not significantly different in age (p > 0.05) (table 1). this study was approved by the medical ethical committee of the second affiliated hospital, third military medical university. briefly, adult individuals who were less than 60 years old returned to a lower altitude from a higher altitude where they had worked for 412 months. they suffered from 3 or more of the following symptoms : fatigue, sleepiness, insomnia, unresponsiveness, memory loss, fidgetiness, headache, and throat pain or discomfort. the principal exclusion criteria included symptoms directly attributable to primary diseases affecting the cardiovascular, respiratory, nervous, urinary, and hematological systems, cancer or leukemia, and a recent history of influenza, upper respiratory tract infection, infectious diarrhea, or similar symptoms. hadas symptom scores (hadas scores) were evaluated according to the scoring criteria for hadas. scores from 6 to 15 indicated a mild reaction, and scores from 16 to 25 indicated a moderate reaction. morning fasting venous blood (3 ml) was collected, centrifuged at 4000 r / min for 10 min to separate serum, and stored at 80c before assay. human serum il-17a, tnf-, and il-10 elisa kits were purchased from r&d systems (abingdon, uk). serum il-17a, tnf-, and il-10 levels were detected according to the manufacturer 's instructions. sod and mda assay kits were purchased from the nanjing jiancheng bioengineering institute (nanjing, china). briefly, the serum of subjects was mixed with the reagents and incubated for 40 min at 37c. after the reaction, absorbance at 560 the samples were then mixed with trichloroacetic acid and incubated for 40 min at 95c. all data are presented as the arithmetic mean values (sd) or mean (se, 95% ci). the changes in hadas scores and levels of serum factors between hadas and control group were examined across the study time course with a linear mixed effects modeling approach, and age and times were considered as covariates. correlations of scores, sod, mda, il-17a, il-10, tnf-, and ages of hadas subjects at baseline were analyzed using pearson 's correlation test. the effect of cytokine with hadas occurrence and severity was analyzed via covariance adjusted logistic regression analysis, respectively, and age was considered as covariance. based on logistic regression analysis, significant variables associated with hadas occurrence were incorporated into a multivariate logistic regression model. receiver operating characteristic (roc) curve analysis was used to determine the value of serum il-17a and il-10 levels and in predicting hadas. the hadas scores were evaluated by physicians on the 3rd, 50th, and 100th days upon returning to low - altitude areas following 6 months of exposure to high altitudes and are shown in figure 1. the scores of subjects were 13.59 (0.41, 12.7714.40) at baseline, 5.72 (0.25, 5.226.22) at the 50th day, and 3.06 (0.19, 2.693.43) at the 100th day, respectively. the differences in mean scores between baseline and the 50th day and 100th day were 7.87 (0.18, 7.418.32) (p 0.05). serum il-17a level was negatively correlated with il-10 and tnf- levels (r = 0.33, p = 0.003 ; r = 0.33, p = 0.003, resp.). however, serum il-17a level was not correlated with serum sod or mda or age of hadas subjects (p > 0.05). it is interesting that serum il-10 level was negatively correlated with tnf- level and subject ages (r = 0.45, p 0.05). correlations of il-17a, tnf-, and il-10 with hadas occurrence and severity were analyzed via logistic regression. these data showed that serum il-17a level was associated with hadas severity (p 726.41 pg / ml predicted hadas with sensitivity of 83.8% and specificity of 93.9% [auc = 0.941 0.025 (se), 95% ci : 0.8920.991, p < 0.001 ]. a serum il-10 level < 48.76 pg / ml predicted hadas with specificity of 89.2% and sensitivity of 93.9% [auc = 0.973 0.022 (se), 95% ci : 0.0001.000, p < it is interesting that combining il-17a and il-10 levels provided an additional benefit for predicting hadas with specificity of 97.3% and sensitivity of 97.0% [auc = 0.984 0.016 (se), 95% ci : 0.0001.000, p < 0.001 ]. the findings indicated that the combination of serum il-17a and il-10 levels was a better diagnostic predictor of hadas than serum il-17a or il-10 levels alone. our data showed that the hadas group had a significantly higher serum level of il-17a compared with the control group at baseline and the 50th day and serum levels of il-17a and hadas score decreased over time in the hadas group. furthermore, serum levels of mda and tnf- were significantly higher and sod and il-10 levels were lower in the hadas group than in the control group at baseline. serum levels of il-17a, il-10, and tnf- were significantly correlated with hadas score. serum il-17a was correlated with hadas severity, and serum levels of il-17a and il-10 were significantly correlated with hadas occurrence rate. thus, serum levels of il-17a and il-10 could be novel diagnostic predictors of hadas. sod is an antioxidant that reduces oxidative stress and protects tissues from damage induced by ros. suppression of serum sod and elevation of mda levels was observed in hadas subjects at baseline. serum sod and mda levels were not significantly different between the hadas and control groups at the 50th and 100th days. this suggests that the levels of oxidative stress in hadas subjects returned to normal levels. in addition, serum levels of sod and mda in hadas subjects were not correlated with hadas scores, severity, or occurrence rate at baseline. this could be because baseline serum levels of sod and mda reflected the very early stages of oxidative stress and antioxidant status in hadas subjects, and they were indirectly involved in the appearance of symptoms. h / r - mediated oxidative stress could induce release of mediators of inflammation and activate many signaling pathways, which result in cellular apoptosis and tissue damage [21, 2529 ]. in our study, levels of proinflammatory mediators, tnf- and il-17a, were elevated, and levels of anti - inflammatory factor il-10 were reduced at baseline in the hadas group. this data suggests that an h / r - induced inflammatory response was involved in the occurrence of hadas. moreover, serum levels of il-17a decreased over time in the hadas group and were not different between hadas and control groups at 100 d. similar to serum levels of sod and mda, serum levels of il-10 and tnf- were not significantly different from the control group at the 50th and 100th days. these data suggest that the h / r - induced inflammatory response decreased with time. cytokine il-17a is a member of the il-17 family, and it is the hallmark cytokine of th17 cells. serum levels of il-17a are elevated in several chronic inflammatory diseases [3032 ], and il-17a plays an important role in regulating inflammatory mediators and the inflammatory response. the mechanism of il-17a in inflammation involves mediating recruitment of neutrophils to sites of inflammation and activating a number of proinflammatory chemokines and matrix metalloproteases. recently, the role of il-17a in h / r or ischemia / reperfusion (i / r) has been explored. barry and colleagues showed that elevation of il-17a played a fundamental role in inflammation and apoptotic response in myocardial i / r injury. similarly, another study demonstrated that levels of serum il-17a were increased by neutrophils and cd4 t cells produced following experimental i / r injury in mice. friedrich and colleagues showed that il-17a strongly induced tnf- expression in inflammatory bowel disease. xue and colleagues showed that increased il-17a not only enhanced production of proinflammatory cytokines but also impaired production of anti - inflammatory factors such as il-10, resulting in renal tissue injury after i / r.. demonstrated that il-17a played a critical role in intestinal, renal, and liver injury after i / r, and il-17a knockout or inactivation significantly alleviated intestinal i / r injury and subsequent liver and kidney dysfunction. based on the above research, we speculated that il-17a may play a more important role than other inflammatory mediators, such as il-10 and tnf-, in the occurrence of hadas. the diagnostic and scoring criteria of hadas included the essential diagnostic criteria, auxiliary diagnostic criteria, and symptom scores of hadas. twenty - one symptoms had to be evaluated in scoring of hadas symptoms by physicians and researchers. furthermore, symptom severity of hadas subjects was based on subjective feelings, which resulted in some error for hadas symptom scores. the present findings showed that serum levels of il-17a, tnf-, and il-10 were significantly correlated with the hadas score. it is interesting that il-17a level was significantly associated not only with severity of hadas, but also with hadas occurrence based on multivariate logistical regression analysis. serum level of il-10 also correlated with occurrence of hadas, and there was no correlation between il-10 level and hadas severity. this indicated that the serum level of il-17a was a better independent predictor of hadas than il-10. in addition, roc indicated that the combination of serum levels for il-17a and il-10 was a better predictor of hadas occurrence than serum levels of il-17a or il-10 alone. these data suggest that a combination of serum levels for il-17a and il-10 may be a novel diagnostic predictor of hadas. first, all of the subjects were male, and the majority of subjects were an average of 25 years old. second, the spans between evaluation time points were too long to evaluate some parameters such as sod, mda, il-10, and tnf-, which had already returned to normal levels in the hadas group. h / r - mediated oxidative stress and an inflammatory response are involved in occurrence of hadas, and il-17a level could be a novel predictive index of hadas. | high - altitude deacclimatization syndrome (hadas) is emerging as a severe public health issue that threatens the quality of life of individuals who return to lower altitude from high altitude. in this study, we measured serum levels of sod, mda, il-17a, il-10, tnf-, and hadas score in hadas subjects at baseline and 50th and 100th days and to evaluate the relationship between interleukins, including il-17a, and hadas. our data showed that and the serum il-17a levels and hadas score decreased over time in the hadas group, and serum il-17a levels were significantly higher in the hadas group at baseline and 50th day compared with controls (p < 0.05). furthermore, baseline serum levels of mda and tnf- were significantly higher, while sod and il-10 levels were lower in hadas subjects compared with controls (p < 0.05). it is interesting that serum levels of il-17a were clearly interrelated with hadas incidence and severity (p < 0.05). roc curve analysis showed that combined serum il-17a and il-10 levels were a better predictor of hadas incidence than serum levels of il-17a or il-10 alone. these data suggest that serum levels of il-17a are a novel predictive index of hadas. |
new electronic devices and equipment lead to increased convenience in our lives. however, there is concern about possible hazards of the electromagnetic fields that these devices and equipment produce and their effects on human health. electromagnetic fields have the properties of both electric and magnetic fields (mfs), which have considerably different properties and possibly different ways of influencing the human body. electric fields are easily shielded or weakened by conducting objects, even human skin, but mfs are not so easily blocked. therefore, most recent studies have focused on the health effects of mfs because mfs are not readily shielded and are easier to measure than electric fields. in 1979, wertheimer and leeper first reported that increased development of childhood cancer was associated with proximity of the home to electrical power lines. since then, many groups have studied the biological effects of mfs. among the spectrum of mfs, the extremely low - frequency (elf) mfs range from 3 to 3000 hz and include the 50- and 60-hz frequencies used in power lines and electric appliances, classified as possibly carcinogenic to humans (group 2b) by the international agency for research on cancer. the international commission on non - ionizing radiation protection (icnirp) issued guidelines for limiting exposure to electromagnetic fields in 2010, and these guidelines for the general public restricted mf exposure to 2 g at 60 hz for any length of time to limit current density to prevent effects on nervous system function. however, many epidemiologic studies have suggested a more stringent 2 mg as the highest acceptable level for long - term exposure. the guidelines by swedish board for technical accreditation for computer monitors also restrict computer monitors to produce elf - mf of no more than 2 mg at 30 cm. furthermore, savitz suggested an association between arrhythmia - related cardiovascular disease and elf - mfs, which is consistent with the previous study by sastre in addition to heart diseases, elf - mfs are also associated with breast cancer. several studies have reported that elf - mfs increase the risk of breast cancer. moreover, more than 20 studies of the effects of elf - mfs on cognitive dysfunction and dementia, including a recent 2014 study, reported a positive association between elf - mf exposure and cognitive dysfunction. despite increasing attention to the elf - mf and its association with diseases, many electrical apparatuses are used and becoming essential for treatment and diagnosis of diseases in hospitals, but not much attention has been given to the potential risk from the elf - mfs produced. lee and roh reported how much anesthesiologists are exposed to elf - mfs during surgery by, respectively, spot measurements and repetitive measurements, similar to the present study. riminesi measured elf - mfs from infant warming systems and incubators in neonatal intensive care units and reported high elf - mfs above 2 mg. hanada measured mfs higher than the icnirp exposure guidelines in some hospital areas. with the technological advances of the late 20th century, the concept of surgery through a scope, that is, laparoscopic surgery and minimally invasive surgery, became a reality. currently, the advantages of laparoscopic surgery and minimally invasive surgery, including shorter hospital stays, decreased postoperative pain, and a rapid return to preoperative activity, are well accepted. despite the benefits of laparoscopic surgery, there are drawbacks. the da vinci surgical system (intuitive surgical, mountain view, ca) has emerged as an alternative tool to overcome the disadvantages of conventional laparoscopic surgery, such as 2-dimensional visualization and limited degrees of motion and freedom. in addition, robotic surgery systems eliminate physiologic tremors and the fulcrum effect and provide excellent ergonomics and improved dexterity. computerized enhanced robotic surgery using the da vinci surgical system has been used successfully in cardiac surgery, urology, general surgery, orthopedics, maxillofacial surgery, ophthalmology, neurosurgery, gynecology, and even in surgical gynecologic oncology. with its increasing practical uses and significant potential promise, many studies have been published regarding costs and benefits of robotic versus conventional laparoscopic surgery in several centers with surgical robotic systems. most surgeons are already exposed to elf - mfs from monitors, computers, and medical apparatuses that are placed in limited spaces. moreover, laparoscopic and robotic surgeries, which provide benefits in terms of surgical outcome, require more devices than other surgeries and hence produce more elf - mfs, increasing the exposure hazard to hospital staff in operating rooms, especially to surgeons. surprisingly, there are no reports regarding how much elf - mf surgeons are exposed to during laparoscopic and robotic surgeries. because surgeons may be in operating rooms for a long time every day, the exposure time is also considerably long, which increases the potential hazards of elf - mfs to surgeons. to our knowledge, this is the first study to measure elf - mfs at the position of the surgeon 's heart during laparoscopic and robotic surgeries using a robotic surgical system. our objectives were to compare the elf - mfs during laparoscopic and robotic surgery and to identify the source of elf - mfs in the operating room. exposure levels of surgeons to elf - mfs in 20 laparoscopic surgeries and 20 robotic surgeries at the yonsei university health system in seoul, korea, were measured from july to october in 2014. for robotic surgeries, the da vinci surgical system was used. to represent the whole robotic surgery and at the same time to fairly compare laparoscopic and robotic surgery, 2 types of surgery from the colorectal and hepato - biliary - pancreatic surgery divisions each surgery from both divisions uses almost the same equipment in laparoscopic and robotic surgery, except the robot system is used only in the robotic surgeries. low anterior resection was chosen in the colorectal surgery division, and cholecystectomy was chosen in the hepato - biliary - pancreatic surgery division. all subjects were informed of the purpose and procedure of the experiments and provided written consent before joining the study. the yonsei university health system institutional review board approved the study protocol (project no. 4 - 2014 - 0398). to measure elf - mf exposure levels of the surgeons, an emdex lite (enertech consultants, campbell, ca), a portable device to periodically measure elf - mf intensity, was fitted in position over each surgeon 's heart during each surgery (figure 1a). the emdex lite can measure elf - mfs between 40 and 1000 hz ranging from 0.1 to 700.0 mg with a resolution of 0.1 mg and accuracy of 2%. the elf - mf intensity was sampled and stored inside the device every 4 seconds from the start to finish of each surgery. the data were then retrieved by connecting the measuring device to a personal computer and analyzed by emcalc 2000 (enertech consultants) analysis and graphical software. (a) the emdex lite was fitted over each surgeon 's heart during surgery. (b) the surgeon at the master console of the da vinci surgical system. (d) the operating table and surgeon during laparoscopic surgery. the mean and standard deviation of elf - mf intensity during each surgery were calculated. the proportions of exposure levels 2 mg in each surgery were also calculated. the mann whitney u test was used to compare the mean exposures to elf - mfs of the surgeons. the u value calculated by mann whitney u test for each group is the difference between the possible minimum rank that the group can take [n(n + 1)/2 ] and the sum of the ranks in the group, where n is the group sample size. the smaller the u value is, the less likely it has occurred by chance. the null hypothesis was that the mean exposures to elf - mfs of surgeons were the same in laparoscopic and robotic surgeries. we did not accept the null hypothesis for a u value 127 (the critical value for total surgeries) and a u value 23 (the critical value for surgeries for each division), each corresponding to p < 0.05. all reported p values were 2-sided, and p values < 0.05 were considered statistically significant. all statistical analyses were performed using the statistical package for the social sciences software (version 20, ibm spss statistics ; ibm corp, armonk, ny). exposure levels of surgeons to elf - mfs in 20 laparoscopic surgeries and 20 robotic surgeries at the yonsei university health system in seoul, korea, were measured from july to october in 2014. for robotic surgeries, the da vinci surgical system was used. to represent the whole robotic surgery and at the same time to fairly compare laparoscopic and robotic surgery, 2 types of surgery from the colorectal and hepato - biliary - pancreatic surgery divisions each surgery from both divisions uses almost the same equipment in laparoscopic and robotic surgery, except the robot system is used only in the robotic surgeries. low anterior resection was chosen in the colorectal surgery division, and cholecystectomy was chosen in the hepato - biliary - pancreatic surgery division. all subjects were informed of the purpose and procedure of the experiments and provided written consent before joining the study. the yonsei university health system institutional review board approved the study protocol (project no. 4 - 2014 - 0398). to measure elf - mf exposure levels of the surgeons, an emdex lite (enertech consultants, campbell, ca), a portable device to periodically measure elf - mf intensity, was fitted in position over each surgeon 's heart during each surgery (figure 1a). the emdex lite can measure elf - mfs between 40 and 1000 hz ranging from 0.1 to 700.0 mg with a resolution of 0.1 mg and accuracy of 2%. the elf - mf intensity was sampled and stored inside the device every 4 seconds from the start to finish of each surgery. the data were then retrieved by connecting the measuring device to a personal computer and analyzed by emcalc 2000 (enertech consultants) analysis and graphical software. (a) the emdex lite was fitted over each surgeon 's heart during surgery. (b) the surgeon at the master console of the da vinci surgical system. the mean and standard deviation of elf - mf intensity during each surgery were calculated. the proportions of exposure levels 2 mg in each surgery were also calculated. the mann whitney u test was used to compare the mean exposures to elf - mfs of the surgeons. the u value calculated by mann whitney u test for each group is the difference between the possible minimum rank that the group can take [n(n + 1)/2 ] and the sum of the ranks in the group, where n is the group sample size. the smaller the u value is, the less likely it has occurred by chance. the null hypothesis was that the mean exposures to elf - mfs of surgeons were the same in laparoscopic and robotic surgeries. we did not accept the null hypothesis for a u value 127 (the critical value for total surgeries) and a u value 23 (the critical value for surgeries for each division), each corresponding to p < 0.05. all reported p values were 2-sided, and p values < 0.05 were considered statistically significant. all statistical analyses were performed using the statistical package for the social sciences software (version 20, ibm spss statistics ; ibm corp, armonk, ny). tables 1 and 2 present the data including exposure levels of elf - mfs in the laparoscopic and robotic surgeries, respectively. table 3 shows comparisons of the mean elf - mf exposures of surgeons in the laparoscopic and robotic surgeries. in the 20 laparoscopic and 20 robotic surgeries, the mean elf - mf exposure was 0.6 0.1 mg for the laparoscopic surgeries and 0.3 0.0 mg for the robotic surgeries (significantly lower with mann = 0, p < 0.001). in 8 laparoscopic surgeries and 1 robotic surgery, in addition, the proportions of exposure levels 1 mg and < 2 mg were 2.4% for laparoscopic and 0.1% for robotic surgeries. the proportions of exposure levels < 1 mg were 97.5% for laparoscopic and 99.9% for robotic surgeries. exposure levels of surgeons to extremely low - frequency magnetic fields during laparoscopic surgeries exposure levels of surgeons to extremely low - frequency magnetic fields during robotic surgeries comparisons of the mean extremely low - frequency magnetic field exposures of surgeons during the laparoscopic and robotic surgeries in the colorectal surgery division, the mean elf - mf exposures during the 10 laparoscopic surgeries (ranging 2.96.3 hours in duration) and the 10 robotic surgeries (ranging 1.93.4 hours in duration) were 0.6 0.1 and 0.3 0.0 mg, respectively (significantly different with mann whitney u 0.001) (table 3). in the hepato - biliary - pancreatic surgery division, the mean elf - mf exposures during the 10 laparoscopic surgeries (ranging 1.12.0 hours in duration) and the 10 robotic surgeries (ranging 0.71.3 hours in duration) were 0.7 0.1 and 0.3 0.0 mg, respectively (significantly different with mann whitney u considerable attention has been focused on the association of elf - mfs with human diseases, especially on their potential hazards regarding cancer in children, heart diseases, breast cancer, and cognitive dysfunction. the guidelines for the wide spectrum of frequency have been established for short - term exposure by the icnirp and the world health organization. the most stringent elf - mf level for weak long - term exposure suggested by many epidemiological studies is 2 mg. in one study, the mean elf - mf exposure of anesthesiologists during surgery in a standing position was 5.8 5.2 mg with 70% of them exposed to levels of 2 mg. another study done by ubeda reported spot measurements ranging from a minimum of 0.3 0.1 mg in nurses to a maximum of 3.9 1.3 mg in physiotherapists, with exposure levels of surgeons, physicians, and radiologists included in this range. our group has also assessed the daily exposure of endodontic personnel to elf - mfs ; the mean elf - mf exposure of 10 personnel in an endodontic section during working hours was 0.3 0.4 mg. in our study, the total mean exposures to elf - mfs were 0.6 0.1 mg (n = 20) for laparoscopic surgeries and 0.3 0.0 mg (n = 20) for robotic surgeries. the proportions of exposure levels 2 mg were 0.11% for laparoscopic surgeries and 0.01% for robotic surgeries. laparoscopic and robotic surgeries showed elf - mfs comparably lower than 2 mg, which was considered a safe limit in many studies. moreover, the mean mf exposures of the surgeons in the laparoscopic and robotic surgeries were lower than the mean mf exposure level of 1.1 mg in homes in north america. therefore, it can be considered safe for patients who spend a considerably short time in the operating room. however, because surgeons and hospital staff spend considerably more time in operating rooms, it would be prudent for them to avoid elf - mf exposure elsewhere. the elf - mf exposures during robotic surgeries were significantly lower than those during laparoscopic surgeries (p < 0.001), because of the distance of the master console from the operating table. we reported in previous studies that the mean elf - mf exposures of anesthesiologists were 5.8 5.2 mg with 70% of them exposed to levels of 2 mg. we can infer from this study that a large portion of the elf - mfs originate from the surgical operating table, which is close not only to the surgical equipment but also to the anesthesia and monitoring equipment. the levels of exposure to elf - mfs from robotic surgeries showed a consistent value of 0.3 mg regardless of the different surgery divisions because the position of the measuring device to the master console is consistent for each robot system. moreover, the mean distance between the master console of the robot system and the operating table was 440 55 cm. at a distance of 90 to 120 cm from an electric appliance, the mf is at background level ; therefore, 440 cm is enough distance so that the mf is at background level at the master console. in addition, the master console monitor uses lcd screens, which produce a very weak mf due to the low current and power. therefore, the surgeon 's head during robotic surgery could be exposed to only a weak mf. the elf - mfs from the operating table and nearby equipment did not reach the master console where the surgeon sat, and we found that elf - mfs from the master console of the robot system were 0.3 mg at the position of the surgeon 's heart (figure 1c and d). in figure 1b, the operator is sitting close to the master console with his head close to the monitor. although 0.3 mg is considered a low elf - mf exposure level, the surgeon sits at the monitor for a fairly long period of time, and not much is known about the cumulative effect of low - intensity elf - mfs. we measured elf - mfs over the surgeon 's heart because previous studies reported harmful effects of elf - mfs on the heart. although the effects of elf - mfs on other diseases such as breast cancer and diseases associated with the brain are also well known, it was most convenient for surgeons to attach the measuring devices over the heart, where it was also least likely to interfere with the surgeon 's ability to operate. until now, it has not been clearly understood what level of weak and long - term elf - mf is harmful to humans. many studies have been conducted not only in animals but also in human cells to determine the toxic effects of elf - mfs, the function of electrons in dna, and their association with the response to mfs. however, more research is needed to clarify the exact pathogenesis of how weak long - term elf - mfs affect human health, not only at the dna level but also directly at the cell level. with the advancement of technology, many devices have been developed for diagnosis and treatment of diseases. they have become essential tools for physicians, and as a result, hospitals now have a high density of technologically advanced instruments. these instruments produce elf - mfs that could be harmful to surgeons and medical staff who regularly spend long periods of time in the operating room. although laparoscopic and robotic surgeries that require more electronic devices than other surgeries would produce more elf - mfs, there have been no previous studies regarding elf - mfs in these types of surgery. to our knowledge, this is the first study to provide basic reference data of elf - mfs in robotic surgery compared with conventional laparoscopic surgery. in conclusion, the exposure of surgeons to elf - mfs in robotic surgery was significantly lower than that in laparoscopic surgery because of the distance of the master console from the operating table. although the elf - mf level of laparoscopic surgery was still considerably lower than 2 mg, which is the most stringent level considered safe in many studies, we should not overlook the effects of long - term exposure of elf - mfs during many surgeries over the course of a surgeon 's career. second, we do not know the exact sources of elf - mfs during laparoscopic and robotic surgeries, but this study focuses on the elf - mf exposure of surgeons, not on the individual devices and equipment that produce the elf - mfs. future studies on the sources of elf - mfs in the operating room might be promising. manufacturers, physicians, and associated administrators should not overlook elf - mf exposure and its long - term effects on humans, even though the mf intensity is weak. | abstractthe development of new medical electronic devices and equipment has increased the use of electrical apparatuses in surgery. many studies have reported the association of long - term exposure to extremely low - frequency magnetic fields (elf - mfs) with diseases or cancer. robotic surgery has emerged as an alternative tool to overcome the disadvantages of conventional laparoscopic surgery. however, there has been no report regarding how much elf - mf surgeons are exposed to during laparoscopic and robotic surgeries. in this observational study, we aimed to measure and compare the elf - mfs that surgeons are exposed to during laparoscopic and robotic surgery.the intensities of the elf - mfs surgeons are exposed to were measured every 4 seconds for 20 cases of laparoscopic surgery and 20 cases of robotic surgery using portable elf - mf measuring devices with logging capability.the mean elf - mf exposures were 0.6 0.1 mg for laparoscopic surgeries and 0.3 0.0 mg for robotic surgeries (significantly lower with p < 0.001 by mann whitney u test).our results show that the elf - mf exposure levels of surgeons in both robotic and conventional laparoscopic surgery were lower than 2 mg, which is the most stringent level considered safe in many studies. however, we should not overlook the effects of long - term elf - mf exposure during many surgeries in the course of a surgeon 's career. |
obstructive sleep apnea (osa) is a major public health issue characterized by repetitive episodes of partial or total occlusion of the upper airway during sleep, causing exaggerated effort to breathe against the occluded airway, sleep fragmentation, and intermittent hypoxia.1 the effects of osa during sleep (especially intermittent hypoxia) elicit a number of intermediate mechanisms, including sympathetic activation, endothelial dysfunction, oxidative stress, inflammation, and metabolic dysfunction, which can contribute to increased cardiovascular risk.2 osa is a common condition in the general population,3 particularly in patients with cardiovascular disease.2 for instance, in patients with hypertension, the frequency of osa is ~50%.4 among patients with resistant hypertension (rh), the prevalence of osa varies from 64% to 83%5,6 depending on the cutoff used for osa definition. other than a common condition in patients with hypertension, there is a growing evidence indicating that osa is associated with increased arterial stiffness,7 heart remodeling,7 and impaired blood pressure (bp) control in patients with hypertension.8 in this review, we discussed the effectiveness of the main treatment for osa, namely continuous positive airway pressure (cpap), in lowering bp in patients with osa. particularly, we performed a critical analysis of the literature evaluating the impact of cpap on bp in several subgroups of patients. we finally discussed perspectives in this important research area, including the urgent need to identify feasible predictors of bp response to cpap. a few studies that were designed to evaluate the cardiovascular impact of treating osa independent of the effects on bp are instructive to the field. for instance, we performed a randomized study to evaluate the impact of cpap on early markers of atherosclerosis and arterial stiffness in normotensive patients with severe osa.9 patients with severe osa were optimally treated with cpap (compliance ~6 hours / night) for 4 months, resulting in a significant decrease in catecholamines, c - reactive protein, pulse - wave velocity, and carotid intimamedia thickness.9 in contrast, bp did not change significantly, suggesting that the protective effects of osa treatment on preventing cardiovascular disease10 are not necessarily mediated through bp reduction. faccenda explored the impact of cpap on patients under no medications that had a baseline bp close to the normal range.11 the authors found very modest effects of cpap on bp that was limited to a modest decrease in diastolic bp. taken together, these studies clearly showed that the impact of osa treatment with cpap on patients who have normal bp at study entry seems to be very limited or nonexistent. despite this fundamental concept, several randomized studies designed to evaluate the impact of the treatment of osa on bp included normotensive patients at study entry.1214 consequently, the meta - analysis evaluating the impact of cpap on bp was clearly influenced by such heterogeneity.1214 therefore, the modest effects of cpap on bp drop (~2 mmhg) may partially be explained by including normotensive patients or hypertensive patients who had well - controlled bp at the start of the study due to a number of different antihypertensive medications. prehypertension (defined as a systolic bp of 120139 mmhg and diastolic bp of 8089 mmhg) and masked hypertension (defined by normal office bp and abnormal 24-hour ambulatory bp) are precursors of sustained hypertension and cardiovascular events.15,16 of note, masked hypertension is frequently observed in patients with osa.17,18 based on these concepts, it is reasonable to speculate that patients with prehypertension and/or masked hypertension who also have osa may benefit from cpap treatment. to test this hypothesis, we performed a randomized study to evaluate the impact of cpap on patients with severe osa with diagnostic criteria for prehypertension and/or masked hypertension, based on the office and 24-hour ambulatory bp monitoring, respectively.19 patients were randomized to no treatment or cpap for 3 months. in contrast, patients randomized to cpap presented 5 mmhg reduction in office systolic bp and 4 mmhg reduction in diastolic bp. we observed a significant reduction in the frequency of prehypertension (from 94% to 55% ; p=0.02) and masked hypertension (from 39% to 5% ; p=0.04) only in the cpap group.19 a recent study confirmed the impact of cpap on bp in osa patients with prehypertension.20 these results suggested that early identification and treatment of osa in apparently healthy, normotensive individual may prevent the development of hypertension. this hypothesis was explored by a multicentric study conducted in spain.21 a prospective cohort study of 1,889 participants without hypertension who were referred to a sleep center was used to calculate hazard ratios (hrs) of incident hypertension in participants without osa (controls) and with untreated osa and in those treated with cpap therapy. compared to controls, the adjusted hrs for incident hypertension were greater in patients with osa ineligible for cpap therapy (hr : 1.33), in those who declined cpap therapy (hr : 1.96), and in those nonadherent to cpap therapy (hr : 1.78), whereas the hr was lower in patients with osa who were treated with cpap therapy (0.71).21 as previously discussed, the impact of osa treatment on bp is mitigated by the inclusion of normotensive patients or those who had controlled bp at study entry. moreover, as highlighted by at least one recent meta - analysis,14 several studies mixed normotensive and hypertensive patients. in this scenario, it is impressive that there are not too many randomized studies comprising 100% of hypertension patients with osa. these studies2227 (detailed in a recent review28) found a modest reduction in bp only in half of the studies. ppin highlighted that the effects of antihypertensive drugs, such as valsartan, were greater than those of cpap, although when used in combination with cpap, the two treatments appeared to have significant additive effects on bp. in hypertensive patients with coronary artery disease, a recent randomized study showed that bp in the cpap group decreased by 8 mmhg.29 as a consequence, hypertension control (defined as resting bp 4 hours / night (1.4 mmhg, 95% ci : 2.5 to 0.4, p=0.008). several studies explored the impact of osa treatment with cpap on patients with rh. after impressive results derived from nonrandomized investigations (observing 10 mmhg drop after cpap),31 six randomized trials came up so far.3237 all but one study found significant reductions in bp. a recent meta - analysis including only randomized studies found that the pooled changes after cpap treatment for 24-hour ambulatory systolic bp and diastolic bp were 4.78 mmhg (95% ci : 7.95 to 1.61) and 2.95 mmhg (95% ci : 5.37 to 0.53) in favor of the cpap group.38 these results suggest that among patients with osa, those who also have rh are the best responders in terms of bp drop after cpap treatment. osa is commonly observed in patients with hypertension, especially in the subgroup of rh. however, osa is still underdiagnosed in patients with cardiovascular disease, including hypertension.39 as discussed in this review, the overall impact of cpap on bp is modest (table 1), but even small reductions in bp may have impact on preventing cardiovascular events.40 based on our previous comments, despite several studies already evaluated bp response to cpap, there is still room for new studies addressing this effect on patients with uncontrolled hypertension. another opportunity in this research area is the observed high variability of bp response to cpap treatment. it is well known that good cpap adherence is associated with greater bp response. however, even good cpap users may have small effects on bp. in this regard, there is an increasing interest in exploring biomarkers to identify those who will respond favorably to cpap. this personalized medicine approach was recently explored in a subset of patients with osa and rh enrolled in the hiparco study.34 the authors measured microrna (mirna) expression in plasma samples using an 84-mirna array in patients with rh and osa at baseline and after 3 months of adherent cpap use (at least 4 hours / night).41 two subgroups of patients were studied : osa responders (> 4.5 mmhg) and nonresponders (4.5 mmhg). three mirnas provided a discriminatory predictive model for such a favorable bp response to cpap (mir-378a-3p, mir-486 - 5p, and mir-100 - 5p). additionally, cpap treatment significantly altered a total of 47 plasma mirnas and decreased aldosterone - to - renin ratios in the responder group (p=0.016) but not in the nonresponder group.41 further studies are needed to elucidate the mechanisms mediating the relationship between these mirnas and other potential biomarkers in response to cpap. | obstructive sleep apnea (osa) is an extremely common comorbid condition in patients with hypertension, with a prevalence of ~50%. there is growing evidence suggesting that osa is a secondary cause of hypertension, associated with both poor blood pressure (bp) control and target organ damage in patients with hypertension. the application of continuous positive airway pressure (cpap) during sleep is the gold standard treatment of moderate- to - severe osa and very effective in abolishing obstructive respiratory events. however, several meta - analyses showed that the overall impact of cpap on bp is modest (~2 mmhg). there are several potential reasons for this disappointing finding, including the heterogeneity of patients studied (normotensive patients, controlled, and uncontrolled patients with hypertension), non - ideal cpap compliance, clinical presentation (there is some evidence that the positive impact of cpap on lowering bp is more evident in sleepy patients), and the multifactorial nature of hypertension. in this review, we performed a critical analysis of the literature evaluating the impact of cpap on bp in several subgroups of patients. we finally discussed perspectives in this important research area, including the urgent need to identify predictors of bp response to cpap and the importance of precision medicine in this scenario. |
the auricle, which is the part of the ear exposed to the outside, is important both functionally and esthetically.1 - 3) the skin of the auricle has little subcutaneous tissue, with the anterior surface having less subcutaneous tissue than the posterior surface, as well as being closely attached to the cartilage. these structures are subject to frostbite, despite the presence of a relatively abundant superficial blood supply. moreover, auricular hematoma, which compresses the sensory nerves, can result in pain in response to mild inflammation. there are many clinical conditions that can occur in the auricle region, for instance, auricular anomaly, laceration, frostbite, otohematoma, perichondritis, herpeszoster otiticus and, occasionally, auricular masses. auricular tumors, including basal cell carcinoma, squamous cell carcinoma, malignant melanoma and metastatic lesions have been assessed clinically,4) mostly in case reports. however, there is little detailed information on auricular masses in general, such as keloids, osteomas and hemangiomas. to address this shortcoming, we retrospectively assessed the clinical characteristics of auricular masses in 63 patients, including their site, size, causes, histopathology, treatment methods and treatment results. we retrospectively identified 63 patients who visited the department of otorhinolaryngology from may 1970 to november 2009, were diagnosed with auricular masses and underwent mass excision. we assessed the site, cause, size, patho - logy results, treatment methods and treatment results in these patients. site was assorted as the lobule, tragus, concha, crus of helix, triangular fossa, crus of antihelix, antihelix, antitragus, scapha and others. in patients who showed auricular mass recurrence after treatment, we assessed the interval from removal to recurrence, as well as the pathology, site and pattern of change in size. of the 65 patients, 30 (47.6%) were male and 33 (52.3%) were female. patients ranged in age from 1 - 80 years (mean, 33.5 years). 33 patients (52.3%) developed auricular masses in the right ear, 27 (42.8%) in the left ear and 3 (4.7%) in both ears. the most common site was the lobule (n=28, 44.4%), followed by the tragus (n=13, 20.6%), crus of the helix (n=7, 11.1%), triangular fossa (n=4, 6.3%), crus of the antihelix (n=2, 3.1%), antitragus (n=2, 3.1%), scapha (n=1, 1.5%) and others (n=6, 9.5%)(table 1). of the 63 patients, 49 (77.7%) had auricular masses of unknown origin, whereas the causes were congenital in 8 patients (12.6%) and trauma in 6 (9.5%)(table 2). the masses had a meansd width of 15.44.32 mm, a meansd height of 12.97.65 mm and a meansd depth of 10.27.01 mm. of the 63 biopsied masses, 16 (25.3%) were epidermal cysts, 8 (12.6) were hypertrophic scar, 6 (9.5%) were accessory ear, 6 (9.5%) were fibrous tissue, five each (7.9%) were chronic inflammation and nevus, 4 (6.3%) were keloid, 3 (4.7%) were hemangioma, 2 (3.1%) each were seborrheic keratosis and skin tag and one each (1%) was leiomyoma, pilomatricoma, relapsing polychondritis, pyogenic granuloma and lymph node (table 3). among 63 cases of auricular mass, one case of hypertrophic scar was treated with biopsy and local steroid injection and one case of relapsing polychondritis was treated with biopsy, local steroid injection and systemic steroid. the one case in which a simple excision was not enough with a keloid patient. in this case, a local skin flap was needed in addition to the excision. following treatment, four patients (6% ; one male and three females) experienced recurrence. pathology examination showed that the masses in three of these patients were hypertrophic scars and one was an epidermal cyst. recurrence was observed in the lobule in two patients, and in the crus of the helix and the triangular fossa in one each. the average width, height and depth were 30 mm, 27 mm and 17 mm, respectively, prior to recurrence, and 19 mm, 17 mm and 10 mm, respectively, after recurrence (table 4). of the 65 patients, 30 (47.6%) were male and 33 (52.3%) were female. patients ranged in age from 1 - 80 years (mean, 33.5 years). 33 patients (52.3%) developed auricular masses in the right ear, 27 (42.8%) in the left ear and 3 (4.7%) in both ears. the most common site was the lobule (n=28, 44.4%), followed by the tragus (n=13, 20.6%), crus of the helix (n=7, 11.1%), triangular fossa (n=4, 6.3%), crus of the antihelix (n=2, 3.1%), antitragus (n=2, 3.1%), scapha (n=1, 1.5%) and others (n=6, 9.5%)(table 1). of the 63 patients, 49 (77.7%) had auricular masses of unknown origin, whereas the causes were congenital in 8 patients (12.6%) and trauma in 6 (9.5%)(table 2). the masses had a meansd width of 15.44.32 mm, a meansd height of 12.97.65 mm and a meansd depth of 10.27.01 mm. of the 63 biopsied masses, 16 (25.3%) were epidermal cysts, 8 (12.6) were hypertrophic scar, 6 (9.5%) were accessory ear, 6 (9.5%) were fibrous tissue, five each (7.9%) were chronic inflammation and nevus, 4 (6.3%) were keloid, 3 (4.7%) were hemangioma, 2 (3.1%) each were seborrheic keratosis and skin tag and one each (1%) was leiomyoma, pilomatricoma, relapsing polychondritis, pyogenic granuloma and lymph node (table 3). one case of hypertrophic scar was treated with biopsy and local steroid injection and one case of relapsing polychondritis was treated with biopsy, local steroid injection and systemic steroid. the one case in which a simple excision was not enough with a keloid patient. in this case, a local skin flap was needed in addition to the excision. following treatment, four patients (6% ; one male and three females) experienced recurrence. pathology examination showed that the masses in three of these patients were hypertrophic scars and one was an epidermal cyst. recurrence was observed in the lobule in two patients, and in the crus of the helix and the triangular fossa in one each. the average width, height and depth were 30 mm, 27 mm and 17 mm, respectively, prior to recurrence, and 19 mm, 17 mm and 10 mm, respectively, after recurrence (table 4). the auricle is a complex skeletal system formed by thin and fine skin tissues, such that many types of techniques and approaches are used to treat auricular masses. many auricular masses, however, are difficult to diagnose by physical examination and fine needle aspiration,5) with most requiring diagnosis by biopsy after surgical excision. moreover, there have been few reports on auricle masses, making it difficult to obtain information. we therefore investigated the clinical aspects of auricular masses in 65 patients who underwent auricular surgery over the past 41 years. the ear lobule was the most common site of auricular masses, followed by the tragus, crus of the helix, triangular fossa, concha - crus of the antihelix and antitragus - scapha. frequent development in the lobule may be related to its being the area of the auricle with the greatest abundance of soft tissue, as well as due to the wearing of earrings and other jewelry, which may induce scars or inflammation. these cysts have been reported in the posterior surface of the lobule, mastoid skin, inferior area of the cartilagenous external auditory canal (eac) and posterior skin. epider - mal cysts manifest as soft, non - tender masses and, when ac - companied by inflammation, are difficult to distinguish from otofuruncles.6) cysts must be excised completely and dissected carefully during surgery so not to rupture the cystic wall. in contrast, the recurrence rate of keloid treated by surgery only is high (45 - 100%), making it important to differentiate keloids from hypertrophic scars in deciding treatment methods. generally, keloids show a pattern of infiltration beyond primary scars, whereas hypertrophic scars are limited.7,8) in addition, hypertrophic scars form within 4 weeks after injury, whereas keloids form later, an average of 30.4 months after injury.9,10) moreover, hypertrophic scars decrease in size within 1 year, whereas keloids maintain their size for longer than 1 year.11) hypertrophic scars are treated by surgery only, whereas keloids are treated by surgery followed by local injection of steroids, which decreases the expression of genes encoding collagen.12) due to their recurrence, long - term follow - up in patients with keloids is important. the average interval to recurrence has been reported to range from 5.5 - 12.9 months,13) suggesting that patients be followed - up for longer than 1 year. of our three patients with keloid recurrence, two were at 21 months and one at 10 years, suggesting the need for even longer follow - up. hemangiomas, observed in three of our patients, are congenital tumors observed most commonly in infants and usually involves the face and neck together with the auricle. capillary hemangiomas are masses composed of large capillary vessels without severe large protrusions, with large blood vessels supplying the blood in the center, from which capillary vessels branch and form a port - wine stain or spider hemangiectasia. cavernous hemangiomas are composed of endothelial cells, are filled with blood and appear as protrusions or masses.14) these tumors cause problems in appearance. in most patients, these masses not treated until they show a maximum decrease in size, after which they are treated by cryotherapy, radiotherapy, electrotherapy, sclerosing therapy, tattooing and other methods.15) basal cell carcinomas, observed in two of our patients, constitute approximately 20% of the tumors occurring in the eac and temporal bone. these skin cancers are relatively common, especially in elderly individuals, and are more prevalent in males than in females. despite being malignant histologically, these tumors show a benign progression, with metastasis being very rare. in most cases, these tumors are painless and nodular, with an ulcerative central area.16) although most do not show distinct borders of subcutaneous infiltration, the borders of these tumors are grossly distinct, the tumors grow slowly and distant and local metastases are rare. among the methods used to treat basal cell carcinoma are surgical excision, curettage, electrotherapy, radiotherapy, cryotherapy, laser therapy, chemical therapy, local application of cytotoxic agents and intralesion injection. treatments are chosen after considering functional aspects and cosmetic efficacy, together with complete removal of the lesion, based on patient clinical characteristics, including the extent of infiltration, histological lesion type, patient sex and age, reactions to previous treatment methods and remission rate.17) both of our patients with basal cell carcinoma underwent surgical excision, with no recurrences for up to 2 years after surgery. only one of our patients was diagnosed with perichondritis, which, nevertheless, should be diagnosed differentially from basal cell carcinoma. hence, patients with masses expected to be benign should undergo physical examination and biopsy of the lesion.18) although auricular masses are frequently encountered in outpatient clinics, few studies have investigated these conditions. hence, it is difficult to obtain information on these lesions and to design treatment plans. we found that most of the masses in the auricle were benign tumors, requiring appropriate surgery only, with good treatment outcomes and without recurrence. in rare cases, some auricular masses may be malignant tumors, requiring close observation and optimal treatment methods. | background and objectivesauricular masses are growths on the outer ear that have not been well characterized clinically. we assessed the clinical nature and treatment of auricular benign masses in patients at our institution.subjects and methodswe retrospectively identified 63 patients with auricular benign masses who underwent excision and biopsy from may 1970 to april 2011. we determined the site, cause, size, pathology and postoperative results of these auricular masses.resultsauricular benign masses occurred most commonly on the lobule (44.4%), followed by the tragus (20.6%), crus of helix (11.1%), triangular fossa (6.3%), crus of antihelix - antitragus (3.1%) and scapha (1.5%). pathologically, the most common type of auricular mass was epidermal cysts (25.3%), followed by hypertrophic scar (12.6%), fibrous tissue - accessory ear (9.5%), chronic inflammation - nevus (7.9%), keloid (6.3%), hemangioma (4.7%), and skin tag - seborrheic keratosis (3.1%).conclusionsthe most common site of auricular benign masses is the lobule and most common pathology is an epidermal cyst. |
reported complications after pbt are radiation - induced cataract and raised intraocular pressure (iop). filtering glaucoma surgery has generally been avoided because of fears of seeding. a 37-year - old man presented with a self - discovered, pigmented lesion on his right iris. four years later, the pigmented lesion was diagnosed as an iris melanoma, because of documented growth. the iop could not be controlled despite maximal medical therapy and selective laser trabeculoplasty (slt). finally, baerveldt implant surgery was performed, resulting in an iop lowering to 10 mmhg and stabilization of the glaucomatous visual field loss. our case demonstrates that baerveldt implant surgery is a reasonable therapy for glaucoma following successful radiotherapy of iris melanoma. iris melanoma comprises 3% to 10% of all uveal melanomas and is the most common primary malignancy of the iris.1,2 it tends to have a ten - year metastasis rate of 3% to 6%.13 possible therapies for iris melanoma include iridectomy, iridocyclectomy, plaque brachytherapy, proton beam therapy (pbt), and enucleation. pbt is generally selected if the tumor is too extensive for surgical excision or if such surgery is rejected because the surgical iris coloboma is expected to cause unacceptable photophobia or cosmetic deficit. trabecular scarring may play a role in the latter.4 secondary glaucoma occurs in 7% of eyes with untreated iris melanoma and in 30% of patients with microscopically - confirmed iris melanoma, occurring mostly because of tumor infiltration of the trabecular meshwork with outflow obstruction.5,6 traditionally, filtering glaucoma surgery has been avoided in patients with iris melanoma because of fears that such aqueous drainage might encourage subconjunctival or intraorbital tumor seeding.2,3 nevertheless, insights into the biology of uveal melanomas and outcome studies after pbt encouraged us to treat a patient with a baerveldt tube implantation because of rapidly deteriorating vision and uncontrollable glaucoma. a 37-year - old man discovered a pigmented iris lesion in his right eye. the best - corrected visual acuity (bcva) was 6/6. ophthalmologic examination showed a pigmented iris lesion between the 5.30 and 6.30 oclock meridians with a basal diameter of 3.5 mm and a thickness of 1.4 mm. initially, the tumor showed no growth ; however, four years after presentation, the iris lesion had changed to a diffuse tumor, extending from the 4.30 to 6.30 oclock meridians with seeding onto the iris surface from the 3.30 to 7.00 oclock meridians. gonioscopy showed pigment deposition in the iridocorneal angle between the 1.00 and 10.00 oclock meridians. the entire anterior segment was treated with pbt (53.1 gy, administered in four fractions over four days). one month later (figures 1b and 1c) the patient developed secondary glaucoma with iop levels fluctuating between 20 and 43 mmhg, despite maximal medical therapy. slt was performed, placing 25 shots with a total energy of 15 mj in the nasal quadrant. meanwhile, the optic disc cupping had become pathological and glaucomatous visual field loss had progressed from mild loss to very extensive loss within two months. since the patient was keen to preserve the remaining vision in this eye, despite advice about a possible risk of extraocular spread, we finally placed a baerveldt tube in the anterior chamber (figure 1d and figure 2). after one year of follow - up, the iop was stable at 10 mmhg with the additional use of dorzolamide and timolol. the patient declined systemic screening for metastasis ; however, he remains under intensive ophthalmic surveillance. secondary glaucoma after pbt for iris melanoma can be difficult to control with medical therapy.7 we report successful lowering of the iop in such a case by using a baerveldt glaucoma implant., drainage surgery is avoided after treatment of iris melanoma, probably because of concerns that tumor cells might seed through the drainage fistula and metastasize to other parts of the body. insights from genetic studies on uveal melanomas suggest, however, that these tumors metastasize almost exclusively if they show loss of chromosome 38 or class ii gene expression profile.9 there is growing evidence that metastasis starts at a very early stage, before the patient even presents to the ophthalmologist.10 for these reasons, there are now considerable doubts that glaucoma drainage surgery would enhance risks of metastasis spread to the rest of the body by providing an exit route from the eye. another concern is that the iris melanoma can recur and seed through the tube into the subconjunctival and orbital tissues. we consider these risks to be small, firstly, because local tumor recurrence is rare after pbt and, secondly, because the tumor was located far from the internal opening of the tube (figure 1d). in any case, the patient is being monitored closely so that appropriate treatment can be administered without delay in case of re - growth of the tumor. further studies with more patients and long - term follow - up are indicated to evaluate the safety and efficacy of the baerveldt glaucoma implant for the treatment of secondary glaucoma after pbt for iris melanoma. | background : proton beam therapy (pbt) is effective in the treatment of iris melanoma. reported complications after pbt are radiation - induced cataract and raised intraocular pressure (iop). filtering glaucoma surgery has generally been avoided because of fears of seeding.case report : a 37-year - old man presented with a self - discovered, pigmented lesion on his right iris. four years later, the pigmented lesion was diagnosed as an iris melanoma, because of documented growth. the patient was treated with pbt but developed secondary glaucoma one month later. the iop could not be controlled despite maximal medical therapy and selective laser trabeculoplasty (slt). finally, baerveldt implant surgery was performed, resulting in an iop lowering to 10 mmhg and stabilization of the glaucomatous visual field loss.conclusion:our case demonstrates that baerveldt implant surgery is a reasonable therapy for glaucoma following successful radiotherapy of iris melanoma. |
bacterial strains : in this study, we used 67 l. monocytogenes strains [15, 31, 34, 35 ]. these strains were isolated from skin of beef cattle from a japanese farm (five strains), japanese patients with listeriosis (seven strains) and meat produced in japan (37 strains) or imported to japan from other countries (18 strains) (table 1table 1.genetic classification of l. monocytogenes strains used in this studystrainsourcecountryserotypemlstrflppfgeiapsigbactamlst typebpacc. # iap typebpacc. # acta typexbaiclai (baniii)pstiiap - rflp typeapaiascipulsotypeegd - erabbitengland1/2a407al5919750662al5919771561al59197411x1c1p111113e1skin of beef cattlejapan1/2a407ab2945750662lc158691 34561lc158758 187x1c2p22161323e2skin of beef cattlejapan1/2a407ab2945760662lc158692 34561lc158759187x1c2p2216132h3patientjapan1/2a395ab3656801662lc15869312561lc158760 6710x2c3p33107376p1porkjapan1/2c413ab3656662657lc15869436561lc15876116x1c4p14410478p1porkjapan1/2c413ab3656672662lc1586951561lc15876212x1c4p14n.d.n.d.n.d.173b3beefjapan1/2a413ab3656472662lc1586961561lc15876312x1c4p14n.d.n.d.n.d.23c1chickenjapan1/2c413ab3656693662lc1586971561lc158764689x3c5p45217576p2porkjapan1/2a389ab3656494662lc15869812561lc1587652115x4c6p5664678p5porkjapan1/2a389ab3656524662lc15869912561lc1587662115x4c6p5674789c5chickenjapan1/2a389ab3656504662lc15870012561lc1587672115x4c6p56n.d.n.d.n.d.yc35p1porkireland1/2a389ab3656954662lc15870112561lc1587682115x4c6p56n.d.n.d.n.d.80c1chickenjapan1/2a395ab3656555662lc1587021561lc158769116x5c7p6712168h1patientjapan1/2a395ab3656825662lc1587031561lc158770116x5c7p67n.d.n.d.n.d.hm1patientjapan1/2a395ab3656535662lc1587041561lc158771116x5c7p6711159hm2patientjapan1/2a395ab3656565662lc1587051561lc158772116x5c7p67n.d.n.d.n.d.265c1chickenjapan1/2a395ab3656576662lc15870612561lc1587732713x6c8p7819810268c1chickenjapan1/2a401ab3656587662lc1587071561lc158774114x7c9p8917311104p5retail porkjapan1/2a395ab5177458662lc1587081561lc15877513x7c9p81017212221c1chickenjapan1/2a395ab3656598662lc1587091561lc15877613x7c9p810n.d.n.d.n.d.yc39b1beefu.s.a.1/2a395ab3656998662lc1587101561lc15877713x7c9p81018513223c3chickenjapan1/2a407ab3656629662lc1587111561lc1587781811x8c10p911n.d.n.d.n.d.yc35p6porkireland1/2a407ab3657029662lc1587121561lc1587791811x8c10p911n.d.n.d.n.d.yc35p8porkireland1/2a407ab3657709662lc1587131561lc1587801811x8c10p911n.d.n.d.n.d.yc35p12porkireland1/2a407ab3657019662lc1587141561lc1587811811x8c10p9115141412hpatientjapan1/2a401ab36566310662lc1587151561lc15878215x10c12p1112131115186c1chickenjapan1/2a401ab36566410662lc1587161561lc15878315x10c12p1112n.d.n.d.n.d.188c3chickenjapan1/2a401ab36566510662lc1587171561lc15878415x10c12p1112141216yc4p12porkdenmark1/2a389ab36570311662lc1587181561lc158785188x11c13p1213n.d.n.d.n.d.yc51p12porkdenmark1/2a389ab36570411662lc1587191561lc158786188x11c13p12133617yc51p13porkdenmark1/2a389ab36578011662lc1587201561lc158787188x11c13p1213n.d.n.d.n.d.72c1chickenjapan1/2b389ab36567012662lc1587225561lc1587891221x13c15p141525211874c1chickenjapan1/2b389ab36572112662lc1587235561lc1587901221x13c15p1415n.d.n.d.n.d.42c1chickenjapan4b389ab36571912662lc1587212561lc1587881624x12c14p1314n.d.n.d.n.d.82b1beefjapan4b389ab36572612662lc1587242561lc1587911624x12c14p1314n.d.n.d.n.d.338b2beefjapan4b389ab45759712662lc1587252561lc1587921624x12c14p1314n.d.n.d.n.d.468b1beefjapan4b389ab36572512662lc1587262561lc1587931624x12c14p1314332519yc20c9chickenchina1/2b395ab36578413662lc1587385561lc158805317x15c17p1619202427yc36c2chickencanada1/2b395ab36574213662lc1587395561lc158806317x15c17p1619n.d.n.d.n.d.yc50c3chickenchina3b395ab36578613662lc1587405561lc158807317x15c17p1619n.d.n.d.n.d.1e1skin of beef cattlejapan1/2b395ab29457013662lc15872737561lc158794318x15c17p1716212020100p3porkjapan1/2b395ab36576213662lc1587333561lc158800819x16c18p1718261824112p3porkjapan4b395ab36573713662lc1587343561lc158801819x16c18p1718n.d.n.d.n.d.114p3porkjapan1/2b395ab36574413662lc1587353561lc158802819x16c18p1718n.d.n.d.n.d.66c3chickenjapan1/2b395ab36575613662lc1587285561lc158795922x14c16p1517n.d.n.d.n.d.69c3chickenjapan1/2b395ab36576413662lc1587295561lc158796922x14c16p151730232179c1chickenjapan1/2b395ab36567513662lc1587305561lc158797922x14c16p151730222291c3chickenjapan1/2b395ab36574713662lc1587315561lc158798922x14c16p151729222393c1chickenjapan1/2b395ab36574813662lc1587325561lc158799922x14c16p1517n.d.n.d.n.d.116c1chickenjapan1/2b395ab36573513662lc1587365561lc158803922x14c16p1517302225yc20c12chickenchina1/2b395ab36575213662lc1587375561lc158804 922x14c16p151727192663p1porkjapan1/2b404ab36567614662lc1587415561lc1588081420x17c19p1820242628h2patientjapan4b389ab36569115662lc1587422561lc158809228x18c20p192122302911hpatientjapan4b389ab36570716662lc15874335561lc158810226x1820p1922n.d.n.d.n.d.229c1chickenjapan4b389ab36570816662lc1587442561lc158811227x18c20p1922232930393p1porkjapan4b389ab45760316662lc1587452561lc158812227x18c20p1922n.d.n.d.n.d.499c5retail chickenjapan4b389ab51776416662lc1587462561lc158813227x19c20p19232328311e3skin of beef cattlejapan1/2a401ab29457220662lc1587471561lc15881414x1c25p24248932yc13c10chickenu.s.a.1/2a401ab36571120662lc1587481561lc15881514x1c25p2424n.d.n.d.n.d.yc13c11chickenu.s.a.1/2a401ab36571020662lc1587491561lc15881614x1c25p24249933yc17p13porkireland1/2a401ab36571220662lc1587501561lc15881714x10c12p1125151134yc21p8porkcanada1/2a407ab36571421662lc1587511561lc1588182112x23c26p2526n.d.n.d.n.d.yc21p12porkcanada1/2a407ab36571321662lc1587521561lc1588192112x23c26p2526n.d.n.d.n.d.yc21p14porkcanada1/2a407ab36578821662lc1587531561lc1588202112x23c26p2526n.d.n.d.n.d.2e1skin of beef cattlejapan1/2b401ab29457422662lc1587547561lc1588211023x24c27p2627282735241c1retail chickenjapan4b407ab51777624662lc1587552561lc1588226925x25c28p2728313136505c7chickenjapan4b371ab45760725662lc1587566561lc1588231129x26c29p2829n.d.n.d.n.d.508c6retail chickenjapan4b371ab51776925662lc1587576561lc1588241129x26c29p2829323237a) n.d. : not done.). serotypes of these strains included 1/2a (34 isolates), 1/2b (16 isolates), 1/2c (three isolates), 3b (one isolate) and 4b (13 isolates). rflp analysis : genomic dna from l. monocytogenes was extracted and purified as previously described [24, 25, 31, 33 ]. for rflp analysis, genomic dna was digested with restriction enzymes xbai, clai (baniii) or psti according to the manufacturer s instructions (takara bio, otsu, japan). the reactants were separated on 0.8% agarose gels. dna fragments were stained with ethidium bromide (nacalai tesque, kyoto, japan) and visualized using an ultraviolet transilluminator (uvp, upland, ca, u.s.a.). rflp patterns with less than five differences were considered to be of the same genotype. sequence analysis : each strain was incubated in brain heart infusion broth (bd, franklin lakes, nj, u.s.a.) at 37c for 18 hr. after incubation, bacterial cells were harvested by centrifugation, washed with sterilized milliq water and suspended in 400 l te solution (10 mm tris - hcl ph 8.0 and 1 mm edta ph 8.0). the bacterial suspensions were boiled for 15 min to lyse the cells, followed by centrifugation at 15,000 g for 10 min at 4c to remove denatured proteins and bacterial membranes. the supernatant containing dna was obtained and stored at 80c until use. in addition, dna for the iap sequencing was extracted and purified as previously described [24, 25, 31, 33 ]. to determine the nucleotide sequence, partial iap, sigb and acta were amplified using specific primer pairs, si3a / si4b [24, 25, 31, 34, 36 ], lmsigb15/lmsigb16 and massf / massr [12, 41 ], respectively (table 2table 2.primers used in this studytarget geneprimer namesequence (5 to 3)iapsi3aactggtttcgttaacggtaaasi4btttagtgtaaccagagcaatcsigblmsigb15aatatattaatgaaaagcaggtglmsigb16ataaattatttgattcaactgccactamassf gctgatttaagagatagaggaacmassrtttatgtggtaatttgctgtc). the size of iap, sigb and acta amplicons (810, 841 and 827 bp, respectively) were confirmed by 1.0% agarose gel electrophoresis. cycle sequencing using iap amplicons was performed with hitachi dna sequencer 5500 (hitachi, tokyo, japan) as previously described [24, 25, 31, 33 ]. sequence analyses of sigb and acta were carried out at eurofins genomics (tokyo, japan). the comparative sequences of iap, sigb and acta in the reference strain, egd - e, were located at 1,1161,522 (407 bp), 41702 (662 bp) and 1,3571,917 (561 bp) positions, respectively. the sequence data were edited and aligned using dnasis pro (hitachi software, ver. phylogenetic analyses were conducted using mega, version 7.0 and the unweighted - pair group method with arithmetic mean (upgma). all sequence data were registered at the dna data bank of japan (mishima, japan) ; accession numbers are indicated in table 1. unfortunately, the strains belonging to iap group c described in the previous report were not tested for mlst, because their partial acta was not amplified using a massf / massr primer pair. in addition to 68 strains used in this study, 211 strains registered in the food microbe tracker database (www.pathogentracker.net) maintained by cornell university were analyzed in silico for the classification of nucleotide sequences of sigb (179 strains) and acta (194 strains) (supplementary table 1). serotypes included 1/2a (57 strains), 1/2b (35 strains), 1/2c (seven strains), 3a (four strains), 3b (six strains), 3c (one strain), 4a (19 strains), 4b (50 strains) and 4c (10 strains). additionally, 20 and two strains, whose serotypes were designated as unspecified and untypeable, respectively. pfge analysis : molecular subtyping of l. monocytogenes strains by pfge was performed based on standardized laboratory protocol, pulsenet (https://www.cdc.gov/listeria). bacterial suspensions solidified with seakem gold agarose (lonza, rockland, ny, u.s.a.) were lysed, washed and digested with the restriction enzymes, apai and asci (new england biolab japan, tokyo, japan). diversity index : simpson s index of diversity (sid) was recommended to evaluate the discriminative ability of genotyping methods [17, 30 ]. the sid and the 95% confidence intervals (ci) are presented in the following equations : where n is the total number of sample strains, s is the total number of different types described, nj is the number of strains belonging to the jth type, and j is the frequency nj / n. classification by sequence of iap and rflp analysis of l. monocytogenes genome combined subtyping method : to establish the dna sequence - based subtyping method, we first performed iap - rflp assay using 67 l. monocytogenes isolates and egd - e (table 1). the target sequence was located at the nucleotide position of iap in l. monocytogenes, from 1,116 to 1,522 bp in the reference strain, egd - e. so far, 26 iap types have been designated to 0 through 25 based on a comparison of nucleotide sequences (supplementary table 2) [15, 34, 35 ]. rflp patterns of l. monocytogenes genomes digested with xbai, clai or psti were classified into 26 (x1 to x26), 29 (c1 to c29) and 28 (p1 to p28) patterns, respectively (supplementary fig. all strains were classified into 22, 25 and 23 types according to genomic rflp analyses, digested with xbai, clai and psti, respectively (table 1). rflp analysis was repeated more than three times for each isolate, and its pattern did not change depending on the year of experiment or researcher. five rflp patterns, x1, x7, x10, x18 and x20, contained multiple iap types determined by the iap sequences, and iap types 9, 12, 13, 16 and 20 were found to have more than two rflp patterns using xbai. strains assigned to pattern x1 were further classified into three (p1, p2 and p24) and four (c1, c2, c4 and c25) patterns by psti and clai, respectively (table 1 and supplementary fig. consequently, l. monocytogenes strains used in this study were classified into 29 iap - rflp types as a result of a combination of nucleotide sequencing for partial iap and rflp analyses digested with xbai, clai and psti. sid of this iap - rflp method was 0.967 (95% ci : 0.955/0.979). mlst analysis usingiap, sigb and acta : in order to develop a dna sequence - based subtyping method that can refer to the data of iap - based rflp analyses, we focused on two genes, sigb and acta, in addition to iap. to investigate the characteristics of sigb and acta, the nucleotide sequences of these genes in strains registered in the food microbe tracker database were compared to the egd - e sequence in silico. next, we evaluated whether the method developed in the present study showed a high discriminatory ability in the classification of l. monocytogenes. the nucleotide sequences for partial sigb, approximately 660 bp in length, were determined and used for genetic classification of 247 strains, which consisted of 68 strains used in this study and 179 food microbe tracker strains (table 1 and supplementary table 1). the number and type of point mutations in partial sigb are presented in table 3table 3.sequence typing based on partial sigbmutationtype12345678910111213141516171819202122232425262728293031323334353637ac0222222222002212222222222222222220202ag05555565531066555555556555101010105551505tc0444444444004455644455435498984330404tg0001000000000000000000000011110000000ca0000000000000010000000000011110000000ct07775676660166566867777797131314136661706ga0555455444005444445544454466664440505gt0000000001001111111111111122221220101at0111111112001121111111111133331110101ta0333333332002222222222222233332220303cg0101111110000000000000000033330000101gc0111111111001111111111111111111110101total029283026283027272511282727272828272828282827302754535553262626230029atcg01111121111121111910121211121311111112121210121122212221111010111011cgat01212129111210101101121111111113121312121213141222222322111212113012at0444444444003343333333333366663330404cg0212222221001111111111111144441110202size (bp)662662662662662662662662662662662662662662662662662662662662662662662662662662662662662662662662662662662657662. thirty - seven sigb types were determined using sigb sequences (table 1 and supplementary table 3). in total, 112 point mutations were found in partial sigb of 246 strains as compared with that of egd - e. there were no insertions, however, deletion of five nucleotides was found in 76p1. in addition to 76p1, nonsense mutation in sigb was detected in 1e1. in comparison, partial acta, 562 bp in length, was analyzed using the nucleotide sequences of 262 isolates, including 68 strains used in this study and 194 food microbe tracker strains. in silico assay was used for classification into 69 acta types (table 4table 4.sequence typing based on partial actamutationtype123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566676869ac033333333333334230000000000000000000002223221212222222255655552322003ag018191919191919181919171818191819202220231121201112200161617171816161618161615171615161623222424232323161716172318tc078777698767888781112200100101002111107775666666776766667777768888117tg011111111111111110000000100000000010001112211211211121222222221122011ca033333333333333330000000001010000100003333333333334343344444443333003ct077108777777877777002000000101110000101999889888910978998101010101011111291111007ga010111010101010101010109101099111111010120100111100101112101311131210101210121012111110101010101011101011101110gt033333333333333330000000001010001000002223333343222233333433333233003at010100000010000000000000000000020000011122222221111222220221110110000ta022332311332222320000000000000000000001123323332212222323323332232003cg011121111111111110000000000000000000001111112111111101200000002122101gc012221121221222221111100100101001111001211111111112111111111111111112total057606361575759565959565758605658537661271564613656612545659586257595958555953575558575968677370697070605863616758atcg029313030302932303029283030322831313440251131301324310262627272825242626252725262625252636363938373736272928293529cgat023242624232323232323242223232222113111010423210221201242526242726272625252724252328262527272827272829282428271123at032432311342222320000000000000020000012245545553323444543544442342003cg023342232332333331111100100101001111002322223222223212311111113233213size (bp)561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561561). in total, 152 point mutations were identified, compared with egd - e sequence. no insertions or deletions were observed. the 67 strains isolated in japan and 194 food microbe tracker strains were classified into 17 and 65 acta types, respectively (table 1 and supplementary table 1). consequently, all strains used in this study were divided into 29 mlst types using iap, sigb and acta sequences (table 1 and fig. 1). strains assigned to certain iap types (0, 2, 12 and 16) and iap type 13 were further classified into two and four mlst types, respectively (table 1). the phylogenic tree of mlst types indicated that strains were roughly clustered in two groups (mlst clusters a and b). mlst clusters a and b were consistent with lineages ii and i, respectively. pfge analysis using apai and asci : to compare the mlst classification with that of pfge, 38 strains were selected. pfge patterns obtained using pulsenet protocol with restriction enzymes, asci and apai, could be distinguished into 32 types. finally, the 38 strains were separated into 37 pulsotypes (table 1 and supplementary fig. the analyses of both pfge patterns represented two major clusters (pfge clusters a and b) associated with their lineages as well as the results from mlst. compared with the egd - e sequence, the iap target region sequence was used for classification into 26 types and three groups based on total point mutations. the iap mutation leads to the reduction of virulence, but systemic infections are caused. it is thought that the virulence - promoting function of iap protein (p60) has been due to its cell wall hydrolysis ability. the iap contains a c - terminal endopeptidase domain, two n - terminal lysin motif (lysm) domains and a single n - terminal src homology 3 (sh3)-like domain. group a contained less than nine places of mutations, including 14 iap types (011, 20 and 21). eight iap types (1216, 22, 24 and 25), which contained 2225 places of mutations, belonged to group b. group c (four iap types ; 1719 and 23) contained more than 50 places of mutation (supplementary table 2). as described previously [15, 34 ], groups a and b were suggested to correspond to lineages ii and i, respectively [20, 21, 37 ]. unfortunately, no isolate was classified into lineage iii, which is supposed to consist of serotype 4a according to rasmussen.. in contrast, we preserved images of rflp patterns of genomic dna obtained from l. monocytogenes isolated since 1998. l. monocytogenes strains, including egd - e, were classified into 26, 29 and 28 types using whole genomic rflp analyses digested with xbai, clai and psti, respectively. the classification based on partial iap sequences agreed with the rflp - based classification. these results support our previous suggestion that iap - rflp subtyping is useful for detailed differentiation of isolates for epidemiological purposes [24, 25, 31, 36 ]. however, certain drawbacks remain in rflp analysis of genomic dna with regard to distinction of rflp patterns and inter - laboratory sharing of data. pfge classification is a valuable investigation tool to recognize common sources of food - borne outbreaks. however, pfge is hard to determine the evolutionary relatedness of isolates, because pfge patterns are influenced by changes in the accessory genome, including transient bacteriophages. several techniques for genetic classification of l. monocytogenes using dna sequences have been developed. repetitive - sequence - based pcr (rep - pcr) targets noncoding short repetitive sequences. multiple - locus variable - number tandem repeat analysis (mlva) is a size analysis of amplified regions of dna containing variable numbers of tandem repeats. this method requires normalization of sizing discrepancies for accurate and standardized mlva on capillary electrophoresis. in comparison with dna size - based subtyping methods including pfge and rflp, the dna sequence - based subtyping approach, such as mlst, is an informative tool for epidemiology and studies involving evolutionary relationships between strains. the data obtained from our mlst can be used to compare with or refer to previous information. traditional mlst is based on several housekeeping genes, because these are non - susceptible to horizontal gene transfer and selection. l. monocytogenes mlst database (http://bigsdb.web.pasteur.fr/listeria) maintained by the pasteur institute (paris, france) is based on seven housekeeping genes : abcz, bgla, cat, dape, dat, ldh and lhka [26, 40 ]. however, the evolution of virulence genes, which represent well - characterized pathogenicity of l. monocytogenes, is considered important. previous mlst studies were performed using i) three housekeeping genes (reca, prs and sigb), two virulence genes (acta and inla) and two intergenic regions (hly - mpl and plca - hly), ii) four housekeeping genes (betl, dat, reca and sigb) and three virulence genes (acta, inla and inlb) and iii) five housekeeping genes (gap, prs, purm, ribc and sigb) and two virulence genes (acta and inla). these suggest that the nucleotide sequences of sigb, acta and inla are useful for genetic classification. it was reported that there are 19 different mutations leading to premature stop codons in inla and these mutations occur commonly in l. monocytogenes lineages i and ii. therefore, we chose sigb and acta in addition to iap for mlst analysis in this study. the sigb sequence resulted in classification into 37 types and three groups by total point mutations as compared to that of egd - e as well as iap the number of point mutations in groups a (sigb types 1, 11, 12, 34 and 36), b (sigb types 210, 1326, 3133, 35 and 37) and c (sigb types 2730) was less than two, 2530 and more than 50, respectively (table 3). although a partial sequence of sigb derived from 67 isolates did not show diversity in comparison with iap ; the iap types 0, 2, 12 and 13 could be classified into two or three groups via sigb type. this suggests that the nucleotide sequence of sigb might be relatively conserved in l. monocytogenes regardless of the geographical distribution. nonetheless, the acta sequences were classified into 69 types (table 4). these types were further divided into two groups by total point mutations as compared to that of egd - e. group a (acta types 0, 1838, 67 and 68) contained less than seven places of mutation, whereas group b (acta types 217, 3966 and 69) contained more than 50 places of mutation. acta can be used as an evolutional indicator as it appears to have undergone positive selection. the target sequence of acta was located at the c - terminal region of acta protein. this region consists of the membrane anchor domain and the cell wall penetration domain. acta is a natively unfolded protein, and the n - terminal region and central domain of acta are responsible for its virulence. mutations in this region are unrelated to the virulence function for intracellular motility of l. monocytogenes. therefore, they are likely to identify the genetic character of gene sequence, because several acta mutations are found in a single strain alone. in total, 194 strains registered in food microbe tracker were classified into 65 acta types, whereas 67 strains isolated in our laboratory were divided into 17 acta types. the number of acta types was less than that of iap type in our isolates. additional studies may be necessary to verify the diversity in acta among strains, including the strains belonging to iap group c, derived from different sources, such as patients, environment and food. taken together, we conclude that the sigb and acta are useful for genetic classification to detect certain characteristic mutations. the discriminatory ability of mlst using iap, sigb and acta is the same as that of iap - rflp method. strains belonging to iap - rflp types 4 and 22 were further classified into two mlst types (table 1). in contrast, the iap - rflp types 22 (except for 11h) and 23, 24 and 25 were integrated into the results from mlst. strains of 229c1 (iap - rflp type 22 and mlst type 27) and 499c5 (iap - rflp type 23 and mlst type 27) shared the same pfge patterns digested with apai. it is difficult to ascertain the reason for this discrepancy in the present data. these results suggest that mlst and iap - rflp method have potential applications in epidemiology of l. monocytogenes to trace the source of human infection. although pfge provides greater discrimination power than that of mlst, clustering and lineage distinction were consistent with the results from pfge (fig. mlst profiles of 68 l. monocytogenes strains were based on partial sequences of iap, sigb and acta. phylogenic analysis was performed using unweighted - pair group method analysis with arithmetic mean (upgma). the distances were calculated using the number of differences method based on the number of nucleotide differences per target sequence. the pfge patterns of 104p5 and 268c1 with regard to apai as well as 12h and yc17p13 with regard to asci were similar ; however, a clear distinction was obtained in mlst results for these strains. the differences between 104p5 and 268c1 included two substitutions, a to g and t to c, in iap, whereas only one substitution (g to a) in iap differentiated 12h and yc17p13. this suggests that mlst analysis is suitable to detect single nucleotide polymorphisms. in the future, mlst analyses using whole genome sequence technology have global applications in subtyping of l. monocytogenes [9, 16, 23 ]. mlst profiles of 68 l. monocytogenes strains were based on partial sequences of iap, sigb and acta. phylogenic analysis was performed using unweighted - pair group method analysis with arithmetic mean (upgma). the distances were calculated using the number of differences method based on the number of nucleotide differences per target sequence. the sequences of three genes in almost all the test strains were consistent with those of food microbe tracker strains. the types of sigb and acta, which were not seen in the food microbe tracker strains, have a single base substitution or nonsense mutation. unfortunately, the iap target sequences of many food microbe tracker strains are unspecified. therefore, the specific character of the japanese isolates could not be determined in this study. however, the strains that share the same type of genes with the foreign isolates derived from listeriosis patients are frequently isolated in japan. in addition, almost 60% of food supply in japan depends on imports from other countries. consequently, there is an urgent need to develop effective countermeasures against l. monocytogenes infection, even though occurrences of human listeriosis in japan are limited to sporadic infections. simultaneous surveillance for l. monocytogenes contamination in food and environment along with listeriosis epidemiology is vital for maintenance of food hygiene. the results from this study include the strains isolated from imported meat ; therefore, our mlst scheme can provide valuable epidemiological information during outbreaks caused by strains that have entered japan from other countries. | pulse field gel electrophoresis (pfge) is widely used for listeriosis surveillance. although this technique is effective for epidemiology, the data among laboratories are inconsistent. we previously reported a method for listeria monocytogenes subtyping combined with sequence analysis of partial iap and whole genome restriction fragment length polymorphism (rflp) using xbai, clai (baniii) and psti. however, distinguishing subtypes was challenging, because the output comprised complicated fragment patterns. in this study, we aimed to establish a simple genotyping method that does not depend on visual observation, rather it focuses on multi - locus sequence typing (mlst) using three genes, iap, sigb and acta. sixty - eight strains of l. monocytogenes including egd - e as a reference strain were investigated to ensure consistency with previous data on the genetic characterization. all strains were grouped into 29 types by both analyses. although there are some differences in classification, major clades included the same strains. simpson s indices of diversity (sid) by mlst and iap - rflp - based typing were 0.967 (95% confidence interval [ci ] : 0.955/0.978) and 0.967 (95% ci : 0.955/0.979), respectively. the discriminatory power of both methods can be considered almost identical. compared with the results of 38 selected strains, the strains within the mlst clusters in this study coincided with those obtained using pfge. thus, the mlst strategy could help differentiate among l. monocytogenes isolates during epidemiological studies. |
patients in the intensive care unit (icu) often have several organ abnormalities and physiological disarrangements that require highly complex and timely diagnostic tests and therapies.1 the first few hours after icu admission, where a patient s condition is stabilized and treatment plans are formulated, are crucial to patient outcome.2 ideally, the critical care unit has to be organized in such a way that optimal treatment is available to all patients day and night. however, the availability and quality of personnel and technology are often different during day time hours as compared with off hours. several authors have studied the difference in outcome between patients admitted during day time hours as compared with off hours in icu and the results were contradictory.35 the current study was undertaken to investigate the demographic characteristics and outcomes of patients admitted in icu during off hours in a moroccan tertiary hospital with uniform staffing and ready access to diagnostic and therapeutic options. this prospective cohort study was carried out in a moroccan icu. the consent and approval of the study all patients admitted to the icu between april 1 and september 30, 2012, were included. patients were excluded if they were younger than 16 years of age or if they were admitted for less than 8 hours. only the first icu admission was taken into account for patients who were readmitted to the icu. day time hours were defined as the hours between 8 am and 8 pm on weekdays and between 9 am and 6 pm during the weekend. off hours were defined as the hours between 8 pm and 8 am on the weekdays and between 6 pm and 9 am during the weekend. intensivists are present during the day time and make rounds at the bedside at least twice a day. each day a multidisciplinary meeting is held in which all patients are discussed. during off hours, an intensivist guard is available for consultation 24 hours a day, seven days a week, and has no other responsibilities apart from icu related patient care. the nurse to patient ratio is about 1:2 during the day time and during the night time. demographic, clinic, acute physiology and chronic health evaluation (apache ii) score,6 time of admission, length of stay (los), and icu mortality are among the data collected. the statistical data were collected prospectively from icu databases and analyzed with spss version 10 (ibm corporation, armonk, ny, usa). symmetrical variables were reported as the mean standard deviation and the means were compared using student s t - test. logistic regression analysis was used to identify risk factors associated with icu mortality at various days and times of admission. intensivists are present during the day time and make rounds at the bedside at least twice a day. each day a multidisciplinary meeting is held in which all patients are discussed. during off hours, an intensivist guard is available for consultation 24 hours a day, seven days a week, and has no other responsibilities apart from icu related patient care. the nurse to patient ratio is about 1:2 during the day time and during the night time. demographic, clinic, acute physiology and chronic health evaluation (apache ii) score,6 time of admission, length of stay (los), and icu mortality are among the data collected. the statistical data were collected prospectively from icu databases and analyzed with spss version 10 (ibm corporation, armonk, ny, usa). symmetrical variables were reported as the mean standard deviation and the means were compared using student s t - test. logistic regression analysis was used to identify risk factors associated with icu mortality at various days and times of admission. a total of 195 patients were included in the study ; 125 (63.6%) were admitted during the day time and 70 (36.4%) were admitted during off hours. the sex ratio was 1 female:2 males and the mean apache ii score was 14.73. the rest were admitted from other services of medicine and surgery from the same hospital and 38% of patients had a medical history. with regards to the reason for admission, 38% of patients were admitted for traumatism and 29% for surgery, in particular neurosurgery, gastrointestinal surgery, and trauma surgery. also, 33.6% of patients had medical pathology and 64% of patients had mechanical ventilation. baseline characteristics were not equal for the group of patients admitted during the day time as compared with those admitted during off hours (table 1). the difference was most marked for the sex of patients and pathology reason for admission, most of the patients admitted during the off hours were male (75% versus 58%, p=0.01). more patients were admitted after traumatism during the off hours than during the day time (64% versus 24%, p=0.001). there was no significant difference in icu mortality for time of icu admission (51% versus 37%, day time versus night time, respectively, p=0.05). in univariate and multivariate analyses, and controlling for factors associated with mortality, such as age, sex, apache ii, los, trauma, and time of admission, no statistically significant difference in icu mortality only mechanical ventilation was a significant predictive factor for intensive care mortality (table 2). our study demonstrates that the demographic characteristics were similar for patients admitted during the day time as compared with those admitted during off hours, except for the frequency of male patients and higher trauma during off hours. it is not surprising that a significantly larger number of patients who are admitted at night or during weekends are made up of trauma patients because of the frequency of road accidents in our region and risk behaviors among young males. although nights and weekends are frequently considered the off hours, with lower staffing levels and availability of services or resources, there are higher risks of mortality and poor outcome. we found no significant differences in icu mortality and los associated with the day and time of icu admission. although our findings show no difference in mortality between patients admitted on day time hours compared to off hours, it was found that mortality remains high whatever the time of admission. we can explain this by the initial severity of the patients at admission and the selection of the most severe patients because our department is the only adult icu in the region and has a limited capacity. also, the frequency of traumatic pathology related to the road accidents is a real health problem in our context. this has allowed us to take some measures for the prevention of road accidents through outreach of the media and the general public, and especially to intensify the initial management of patients before admission to intensive care by the most experienced emergency staff. our study has limitations concerning the small sample of patients and the study was carried out in only one center which receives a lot of young male trauma patients, who are generally accepted at night. this is due to decreased vigilance, risky behaviors, and the bad condition of roads leading to a considerable increase in traffic accidents. in our analysis we have not taken into account holidays or vacations that may significantly affect the result. significant heterogeneity in results has been found in several large studies that evaluated night time admission in icu, all in retrospective cohorts and all defined off hours differently.711 uusaro have shown increased mortality of patients admitted in 80 icus during weekends when compared to weekdays.5 another multicenter retrospective study carried out in canada during 2008 by laupland has shown increased mortality for patients admitted at night compared to those admitted during the day but without increasing mortality during the weekend.9 other studies have shown conflicting results.12 the study by luyt, conducted in 23 icus over 3 years in 2007, did not show a significant difference in the mortality for patients admitted during off hours when compared to those admitted during the day time.7 differences in mortality can be explained by differences in disease severity and differences in the definitions of day and hours of admission may also explain the difference in results between studies. a recent meta - analysis has studied this problem1 and it included ten cohort studies ; eight evaluated night admissions and six studies evaluated weekend admission that demonstrated that a night admission was not associated with an increased mortality. however, patients admitted over the weekend have a significant increase in the risk of death. this meta - analysis has a number of limitations, most importantly, different definitions were used for both night time and weekend hours, the description of the organization was not well described in all studies, and different severity adjustment tools were used. our study found no difference in mortality whatever the time of admission, with the same staff and the same organization. we can conclude that off hours care is not necessarily inadequate. for icu managers, it is important to know how to maintain adequate quality of care around the clock. however, mortality is high no matter the time of admission and this is due to the selection of severely ill patients, especially victims of road accidents. this should encourage us to develop more mobile emergency care, more experienced staff in the emergency department, and in particular, raise awareness of public and political leaders to prevent traffic accidents. | backgroundthe first few hours after intensive care unit (icu) admission, where a patient s condition is stabilized and treatment plans are formulated, are crucial to patient outcome. although admission of patients who are unstable to icu occurs 24 hours a day, not all units maintain the same level of staffing during off hours. we evaluated whether icu admission during off hours affects mortality in a moroccan icu with the same level of staffing.methodsthis prospective study was carried out at an icu in a moroccan hospital during 6 months. demographic, clinic, acute physiology and chronic health evaluation score, length of stay, time of admission (day time or off hours), and icu mortality data were collected. the mortality in the icu was the end point of the study. logistic regression analysis was used to identify risk factors associated with icu mortality at various day and time of admission.resultsa total of 195 patients were included in the study ; 125 (63.6%) were admitted during the day time and 70 (36.4%) were admitted during off hours. most of the patients admitted during the off hours were male (75% versus 58% during the day time, p=0.01). patients admitted in off hours after traumatism were more frequent than those admitted during the day time (64% versus 24%, p=0.001). there was no significant difference in icu mortality for time of icu admission (p=0.05).conclusionwe can conclude that off hours care is not necessarily inadequate. for icu managers, it is important to know how to maintain adequate quality of care around the clock. |
cardiac stress testing is the basic screening tool for ischemic coronary artery disease (cad). in the event of abnormal distribution of myocardial blood flow (or positive result indicative of functionally significant ischemia), coronary angiography is performed as the current gold standard in the diagnosis of ischemic cad. this is particularly the case for patients presenting with suggestive chest pain and intermediate pre - test probability of significant cad. coronary angiography generally allows the clinician to draw definitive conclusions and guide management of ischemic coronary syndromes. nevertheless, there are a significant number of patients who, despite suggestive clinical symptoms and myocardial perfusion imaging (mpi) evidence of ischemia, have angiographically normal coronary arteries. data from the women 's ischemic syndrome evaluation study indicate that, of the over 500,000 people who undergo left heart catheterization every year, approximately 48% of women and 17% of men have no intraluminal lesions or 200/110 mmhg) ; arrhythmias such as paroxysmal atrial fibrillation (paf) ; and left bundle branch block (lbbb). our primary outcome was the combined endpoint of definite or suspected death from heart disease (including sudden cardiac death), non - fatal myocardial infarction and fatal or non - fatal stroke, assessed in the entire cohort (major adverse cardiovascular endpoints). secondary outcomes included examination of the number of subsequent hospitalizations for chest pain, number of emergency room visits for chest pain, development of clinical heart failure and the number of individuals requiring repeat cardiac catheterization. in addition, we assessed both the primary and secondary outcomes separately for men and women as well as for individual ethnic groups [table 1 ]. also, the outcomes were correlated with known cardiovascular disease risk factors. we also examined the magnitude of the relationship of clinical endpoints to the frequency of individual baseline risk factors (including smoking status, history of hypertension, diabetes, sex, cardiovascular medications, hdl and ldl cholesterol concentrations). the controls were screened randomly from a list of all patients undergoing nuclear stressing over the same 4-year period. specifically, every 7 patient - chart was selected (contingent that they met none of the exclusion criteria) for the control group until a number needed for statistical power was reached. this approach allowed us to determine the outcome differences of those stratified to the syndrome - x population, while still preserving the randomized allocation. all data are expressed as mean standard deviation (sd). a p - value < 0.05 was considered statistically significant. statistical analysis involved the comparison of primary and secondary outcomes between the abnormal stress test cohort and the control cohort, respectively, by use of the z - test of proportions test. statistical analysis involved the comparison of primary and secondary outcomes between the abnormal stress test cohort and the control cohort, respectively, by use of the z - test of proportions test. a total of 53 patients were found to have positive nuclear stress testing and negative coronary angiography. however, only 47 individuals were eligible for the study, and the mean duration of follow - up was 19.1 8.4 months (range 9 - 47 months), which yielded a total of 898 patient - months of follow - up. the mean age of the study population was 51.0 3.4 years (range 30 - 74 years) and the mean bmi was 33.0 1.4 kg / m. in this cohort, 42 (85.7%) had hypertension, 28 (57.1%) were smokers and 18 (38.2%) had diabetes diagnosed prior to the index angiogram. the ethnicity of the study population is delineated in [table 1 ] along with various other baseline characteristics. a total of 37 patients with negative nuclear stress testing and, thus, no subsequent coronary angiography were identified via the screening method described above. from the 37 individuals selected, the mean duration of follow - up was 29.3 6.8 months (range 1 - 47 months), yielding 1,084 patient - months. the mean age of the study population was 51.7 2.9 years (range 30 - 74 years) and the mean bmi was 28.7 1.3 kg / m. in this cohort, 17 (47.2%) had hypertension, 15 (40.5%) were smokers and 6 (16.7%) had diabetes diagnosed prior to the index angiogram [table 1 ]. baseline demographics of the cases and controls the number of patients with adverse outcomes in the control group was 8 (21.6%). however, in the case group, the patients with adverse outcomes numbered 26 (53%). the difference between the two groups is statistically significant with a p - value of 0.0063. the number of males with adverse outcomes was 13 (27.7%) and 3 (8.1%) in the case and control groups, respectively. the overall number of adverse outcomes in the control and case cohorts was 11 and 45, respectively. furthermore, the number of cardiac - related hospitalizations was 4 and 35 in the control and case groups, respectively [figure 1 ]. clinical cardiovascular outcomes of both cohorts within the positive - nuclear stress (case) group, 22 (46.8%) patients had recurrent chest pain necessitating emergency room visitation as compared to only 9 (24.3%) patients from the normal nuclear stress group during the same follow - up period. however, only individuals (2 or 4.3%) from the positive stress cohort went on to undergo repeat cardiac catheterization for recurrent chest pain. incident chf was seen in 9 (19.1%) patients of the case cohort and 2 (5.4%) of the control group (different patients from those with repeat catheterization) in the period of follow - up. when the study population is reviewed for the development of acute coronary syndrome(s) (acs), only 2 (4.3%) patients required hospitalization for a documented acs event. no patients from the control population went on to develop a documented ischemic event. in the case population, 1 patient suffered from a cerebrovascular event and 3 individuals developed a cardiac arrhythmia, respectively. our results show that, in a male - predominant cohort of chest pain patients, ischemia on mpi despite subsequent negative coronary angiography is associated with a long - term higher risk of adverse cardiovascular events as compared with chest pain patients without ischemia on mpi. these results consistently hold true across all pre - defined markers of cardiovascular outcomes, except when sudden cardiac death is considered (no deaths). there is no significant deviation in this trend accounting for gender, race and ethnicity. however, it must be stated that this trend reaches statistical significance only when either the combined primary and secondary endpoints (p = 0.005) or the secondary endpoint alone are evaluated. a level of statistical significance is not reached when the major adverse cardiovascular outcomes (mace) alone are examined. nevertheless, the case cohort does continue to demonstrate the same trend of increased incidence when mace alone is assessed (despite not reaching statistical significance). the significant increase in cardiovascular morbidity demonstrated by the investigators appears to contradict a significant body of literature, indicating that the syndrome confers no additional additive risk of adverse cardiac events. but, as previously stated, the parameters considered in our population differs from the majority of previous populations studied. this includes the fact that a majority of prior studies have focused on outcome data in middle - aged caucasian women.21 we acknowledge that some of the additional risk seen in this population may be attributed to baseline cardiovascular risk factors, including the cad equivalent diabetes, which may account for some of the differences shown. however, despite the increased prevalence of diabetes and hypertension in our patients with adverse outcomes, the number did not reach statistical significance. in fact, only tobacco was found to confer a statistically significant association with long - term outcomes on matching the cohorts., found that, in a retrospective analysis of 48 older male veterans undergoing coronary angiography, following abnormal stress testing, a statistically significant number of patients studied were at some level of increased risk for adverse cardiac outcomes.23 when estimating the ramifications of these findings, it is important to note that, individuals with chest pain and normal coronary arteriogram have been observed to represent 10 - 27% of those undergoing coronary arteriography after clinical suspicion of angina.2425 these figures represent a large number of individuals from the population in light of the prevalence of ischemic disease. in our institution, just over 8% were found to meet the inclusion described above (as well as meet no exclusion criteria), which was not without precedence, as other investigators have found population incidences as low as 3% (most studies employed a combination of at least three inclusion criteria, namely (effort induced) angina pectoris, positive exercise test result and a normal coronary angiogram).3 once individual cv outcomes are sub - analyzed, not surprisingly, a significant increase in the incidence of recurrent chest pain admissions is demonstrated. it is reasonable to argue that the higher volume of chest pain visits may be explained by the clinical history employed for qualification in this study in addition to the psychological impact of having a positive stress test. but, the increase in adverse outcomes post - index catheterization suggests that reasonable consideration should be given to future complaints of chest pain in this population. as stated above, when matched for clinical outcomes, patients with baseline hypertension and diabetes mellitus appeared to be at higher risk for future adverse events as compared to those free of these co - morbidities. furthermore, because diabetics are in constant state of increased systemic inflammation along with increased vascular endothelial dysfunction and diffuse small vessel disease, we argue that diabetics are predisposed to angiographically silent microvascular ischemia.2627 this postulation has been suggested by other investigators as well and our data also supports this. it is also important to note that the prevalence of tobacco (an agent known to increase both inflammation and endothelial dysfunction leading to a pro - atherogenic state) use was significantly higher in the study group. these findings led us to argue that the underlying pathogenesis of this syndrome involves subendocardial ischemia. it is because of this subendocardial ischemia that we suggest the use of calcium channel - blockers coupled with the judicious use of anti - platelet therapy.2728 treatments that improve endothelial function, such as angiotensin - converting enzyme inhibitors, estrogen, statins and lifestyle modifications, may be promising additions to treatment regimens for csx. however, due to the largely unknown pathogenesis of this syndrome and the lack of quality outcome data, we suggest large, randomized prospective trials aimed at answering these therapeutic questions (with the additional use of mri and nmr to help define the microvasculature circulation). although a number of investigators have argued that csx is a disease limited almost exclusively to women, our findings imply otherwise. in fact, recent reviews suggest that over 43% of individuals proposed to meet criteria for syndrome x are male sex.3 the veterans association (va) study demonstrated an increase in adverse events among their all - male, predominantly, white cohort.23 in our selection of patients, we found that over 50% of individuals meeting criteria for syndrome however, potentially more interesting is that the population studied was significantly more ethnically diverse and may better represent entire csx cohort as a whole, an analysis called for by the va investigators. nevertheless, given the diverse nature of the patient population studied, it is reasonable to, at minimum, reject the hypothesis that male sex confers near immunity to the disease. aspirin is a standard therapy in patients considered to have underlying ischemia without significant contraindication (data currently suggests contraindication to its use in patients who are believed to have been ruled - out for ischemic disease over concern for its non - steroidal anti - inflammatory properties). however, even after anti - platelet use is considered, there is no significant correlation with outcomes. in fact, all anti - platelet, vasodilator, calcium - channel and neurohormonal - modulating agents were used equally or significantly more frequently in the case cohort, suggesting that the observed outcomes were not due to non - treatment with these medications. we could not routinely screen for medication compliance given the retrospective nature of this study. however, since the study cohorts were both gender- and age - matched (on review, there was a predominance of males who underwent stress testing at many institutions) after meeting inclusion criteria, this approach should still lead to an unbiased estimate of the effects of a clinical presentation consistent with csx - like disease. first, the inherent limitations of a retrospective study must be acknowledged, including missing data and the inability to control for all confounders. second, because of the limited size of the study population, statistical power could not be reached when evaluating several of the secondary endpoints, including arrhythmia and chf admissions. however, as described above, the study did reach statistical power to sufficiently evaluate its primary endpoint. finally, limitations in data collection hindered determination of the effect of medications such as calcium - channel blockers on disease outcome. in summary, our study demonstrated that chest pain patients with a positive stress test and negative coronary angiograms are still at a higher risk of subsequent adverse cardiovascular events when compared to those with a negative stress test. these may be more appropriately labelled as false - negative coronary angiograms rather than this appears to be gender - neutral and more likely to be seen in those patients with multiple cardiovascular disease risk factors, including tobacco use, hypertension and diabetes. rather than dismissing these patients as having non - cardiac chest pain, aggressive preventive strategies might be useful in attenuating the morbidity and costs associated with this condition. | background : patients presenting with chest pain and evidence of functional ischemia by myocardial perfusion imaging (mpi), but lacking commensurate angiographic disease pose a diagnostic and therapeutic dilemma. they are often dismissed as having false - positive mpi. moreover, a majority of the available long - term outcome data for it has been derived from homogenous female populations. in this study, we sought to evaluate the long - term outcomes of this presentation in a multiethnic male - predominant cohort.materials and methods : we retrospectively identified 47 patients who presented to our institution between 2002 and 2005 with chest pain and evidence of ischemia on mpi, but with no significant angiographic disease on subsequent cardiac catheterization (cases). the occurrence of adverse cardiovascular outcomes (chest pain, congestive heart failure, acute myocardial infarction and stroke) post - index coronary angiogram was tracked. similar data was collected for 37 patients who also presented with chest pain, but normal mpi over the same period (controls). overall average follow - up was over 22 months.results:fifty-three percent (26/47) of the cases had one or more of the adverse outcomes as compared with 22% (8/37) of controls (p < 0.01). of these, 13 (50.0%) and 3 (37.5%) were males, respectively.conclusions:ischemia on mpi is predictive of long - term adverse cardiovascular outcomes despite normal (false - negative) coronary angiography. this appears to be gender - neutral. |
dental erosion is a common problem in modern societies, owing to the increased consumption of acidic drinks, such as soft drinks, sport drinks, fruit juices, and fruit teas, which in turn have a high potential to provoke dental demineralization. up to now, most clinical reports are generally related with a later intervention, in which the non - carious lesions as erosion, especially in cervical area of the tooth, present dentin exposure, hypersensitivity, and more complex restorative needs. erosion is a superficial demineralization process that softens the surface with subsequent wear until reaching dentin. is normally associated with other non - carious lesions such as abrasion, its sole cause in dental substrates is difficult to establish, since erosion consists of lesions from multiple etiologies, which may result in the need for a restorative procedure. although enamel is considered a simple and safe substrate for bonding, there is lack of research regarding this property to eroded tooth. as erosion provokes alterations on this substrate, details of these modifications on bonding turn the investigations necessary. as these substrates will be subsequently restored, mostly using adhesive materials, this interaction needs to be clarified. thus, this investigation aimed to test the impact of different coke drinks on adhesion to previouslyeroded enamel surfaces. the null hypotheses are that (1) different coke drinks do not provoke differences on adhesion to enamel, and (2) their association with toothbrushing does not have any impact on the adhesion process either. this experiment was conducted considering two factors : erosive challenges by soft drinks (in four levels : none / artificial saliva, rc, lc, and zc) and toothbrushing effect (in two levels : none or following erosive challenge). the response variable was based on bond strength. fifty - six enamel specimens (4x4x2 mm) were obtained from freshly - extracted bovine incisors, which were previously stored in 0.1% thymol solution at room temperature. one specimen was cut from each crown using an isomet low - speed saw cutting machine (buehler, lake bluff, il, usa) and two diamond disks (extec corp., enfield, ct, usa), which were separated by a 4 mm thickness spacer. the enamel surface was flat with watercooled carborundum discs (# 320, 600, and 1200 of al2o3 papers ; buehler, lake bluff, il, usa), resulting in enamel removal of about 100 m depth. this series was completed with polishing using felt paper made wet by diamond spray (1 m ; buehler, lake bluff, il, usa). in order to standardize the enamel surfaces, they were selected using a micro - hardness test by performing five indentations in different regions of the block (knoop diamond, 25 g, 5 s, hmv-2000 ; shimadzu corporation, tokyo, japan). enamel blocks with a knoop hardness number ranging from 320 to 385 khn were selected. selected specimens were randomly assigned into seven groups (n=8) according to immersion media and toothbrushing association or not as presented in figure 2. composition of artificial saliva and coke beverages based on manufacturer information, except for ph and tritability, which were assessed by the authors groups tested according to erosive / abrasive challenges after the erosive / abrasive challenge, each specimen was carefully cleaned under a deionized water flow for 2 minutes. ltda, petrpolis, rj, brazil) for 15 s, which was washed out for a 30 s. a gentle air - stream was used to promote water evaporation, which was completed with absorbent paper. two thin coats of an etch - and - rinse dentin bonding system (adper single bond 2- 3 m espe, st. paul, mn, usa) were subsequently dispensed with a disposable microbrush and gently air - dried for 2 - 5 s to allow solvent evaporation and followed by light curing for 10 s with a 1,000 mw / cm power density led unit (radi cal - sdi, bayswater, victoria, australia). thus, the enamel surface was restored with two layers of 2 mm thickness increments of a nano - filled a2 shade resin composite (filtek z350 - 3 m espe, st. paul, mn, usa) and light - activated for 20 s. after 24 hours of water immersion in 37c, each restored enamel specimen was longitudinally sectioned in directions across the bonded interface using an isomet 1000 digital saw (buehler ltd., lake bluff, il, usa) to obtain specimens with an interface area of approximately 1 mm. each beam was attached to a modified bencor multi - t testing apparatus (danville engineering co., danville, ca, usa) with a cyanoacrylate resin (super bonder flex gel - loctite, henckel ltda, itapevi, sp, brazil) and submitted to test under tension in a universal testing machine (emic, so jos dos pinhais, pr, brazil) operating at a crosshead speed of 0.5 mm/ min. after testing, the cross - sectional area at the site of fracture was measured with a digital caliper (mitutoyo digimatic caliper series / code 500 - 144, mitutoyo sul americana, rj, brazil) to calculate bond strength in mega pascal (mpa). data analysis was accomplished by the graph pad / prisma statistical package (graphpad instat for windows version 4.0, san diego, ca, usa). the assumptions of equality of variances and normal distribution of errors were checked for all the variables tested. since the assumptions were satisfied, two - way analysis of variance (anova) and bonferroni post hoc tests were carried out for statistical comparisons and the significance was preset to 5%. after bonding tests, each interface was analyzed with a stereomicroscopy 40x and was categorized according to failure as : adhesive failure (failure between the enamel and bonding layer), cohesive failure in enamel (when failure occurred predominantly in enamel) or in resin (when failure occurred predominantly in resin) or mixed failure (when two or more types were observed simultaneously). for each group, two additional specimens were prepared with half of the surface protected with nail varnish in order to maintain a control surface. after the challenges, nail varnish was removed with acetone and the specimens were restored in similar conditions as described above. however, rhodamine b (sigma - aldrich brasil, so paulo, sp, brazil) was added to adper single bond 2 in 0.16 mg / ml as a fluorescent ingredient to be detected in clsm. following, the specimens were cut in the middle to obtain two halves containing control and exposed specimens to analyze the interfaces with the confocal microscope (leica tcs spe, leica microsystems cms, mannheim, germany) using the microscope 's software (leica application suite advanced fluorescence, leica microsystems cms, mannheim, germany). the quality of the interfaces was analyzed by examining both halves of each specimen with 40x (each 1.0- 1.0 mm, 1,024 pixels and 0.976 m in resolution). this experiment was conducted considering two factors : erosive challenges by soft drinks (in four levels : none / artificial saliva, rc, lc, and zc) and toothbrushing effect (in two levels : none or following erosive challenge). the response variable was based on bond strength. fifty - six enamel specimens (4x4x2 mm) were obtained from freshly - extracted bovine incisors, which were previously stored in 0.1% thymol solution at room temperature. one specimen was cut from each crown using an isomet low - speed saw cutting machine (buehler, lake bluff, il, usa) and two diamond disks (extec corp., enfield, ct, usa), which were separated by a 4 mm thickness spacer. the enamel surface was flat with watercooled carborundum discs (# 320, 600, and 1200 of al2o3 papers ; buehler, lake bluff, il, usa), resulting in enamel removal of about 100 m depth. this series was completed with polishing using felt paper made wet by diamond spray (1 m ; buehler, lake bluff, il, usa). in order to standardize the enamel surfaces, they were selected using a micro - hardness test by performing five indentations in different regions of the block (knoop diamond, 25 g, 5 s, hmv-2000 ; shimadzu corporation, tokyo, japan). enamel blocks with a knoop hardness number ranging from 320 to 385 khn were selected. selected specimens were randomly assigned into seven groups (n=8) according to immersion media and toothbrushing association or not as presented in figure 2. composition of artificial saliva and coke beverages based on manufacturer information, except for ph and tritability, which were assessed by the authors groups tested according to erosive / abrasive challenges after the erosive / abrasive challenge, each specimen was carefully cleaned under a deionized water flow for 2 minutes. ltda, petrpolis, rj, brazil) for 15 s, which was washed out for a 30 s. a gentle air - stream was used to promote water evaporation, which was completed with absorbent paper. two thin coats of an etch - and - rinse dentin bonding system (adper single bond 2- 3 m espe, st. paul, mn, usa) were subsequently dispensed with a disposable microbrush and gently air - dried for 2 - 5 s to allow solvent evaporation and followed by light curing for 10 s with a 1,000 mw / cm power density led unit (radi cal - sdi, bayswater, victoria, australia). thus, the enamel surface was restored with two layers of 2 mm thickness increments of a nano - filled a2 shade resin composite (filtek z350 - 3 m espe, st. after 24 hours of water immersion in 37c, each restored enamel specimen was longitudinally sectioned in directions across the bonded interface using an isomet 1000 digital saw (buehler ltd., lake bluff, il, usa) to obtain specimens with an interface area of approximately 1 mm. each beam was attached to a modified bencor multi - t testing apparatus (danville engineering co., danville, ca, usa) with a cyanoacrylate resin (super bonder flex gel - loctite, henckel ltda, itapevi, sp, brazil) and submitted to test under tension in a universal testing machine (emic, so jos dos pinhais, pr, brazil) operating at a crosshead speed of 0.5 mm/ min. after testing, the cross - sectional area at the site of fracture was measured with a digital caliper (mitutoyo digimatic caliper series / code 500 - 144, mitutoyo sul americana, rj, brazil) to calculate bond strength in mega pascal (mpa). data analysis was accomplished by the graph pad / prisma statistical package (graphpad instat for windows version 4.0, san diego, ca, usa). the assumptions of equality of variances and normal distribution of errors were checked for all the variables tested. since the assumptions were satisfied, two - way analysis of variance (anova) and bonferroni post hoc tests were carried out for statistical comparisons and the significance was preset to 5%. after bonding tests, each interface was analyzed with a stereomicroscopy 40x and was categorized according to failure as : adhesive failure (failure between the enamel and bonding layer), cohesive failure in enamel (when failure occurred predominantly in enamel) or in resin (when failure occurred predominantly in resin) or mixed failure (when two or more types were observed simultaneously). for each group, two additional specimens were prepared with half of the surface protected with nail varnish in order to maintain a control surface. after the challenges, nail varnish was removed with acetone and the specimens were restored in similar conditions as described above. however, rhodamine b (sigma - aldrich brasil, so paulo, sp, brazil) was added to adper single bond 2 in 0.16 mg / ml as a fluorescent ingredient to be detected in clsm. following, the specimens were cut in the middle to obtain two halves containing control and exposed specimens to analyze the interfaces with the confocal microscope (leica tcs spe, leica microsystems cms, mannheim, germany) using the microscope 's software (leica application suite advanced fluorescence, leica microsystems cms, mannheim, germany). the quality of the interfaces was analyzed by examining both halves of each specimen with 40x (each 1.0- 1.0 mm, 1,024 pixels and 0.976 m in resolution). bond strength means and standard deviations are summarized in table 1 and figure 3. means and standard deviations (mpa) of eroded / abraded enamel specimens restored with resin composite uppercase letters show significant differences among the erosive challenges for each abrasion condition (columns) (p0.05). the control group (neither eroded nor abraded) showed significantly greater bond strength compared to all other situations (p0.05). in the comparison of bond strength of specimens submitted to erosion to each coke drink to their respective association with abrasion, description of distribution of the failure modes for each tested group is presented in table 2. it could be observed that the sum of mixed and adhesive failures was evident in all conditions. cohesive failure in resin was only present in groups eroded by zc (3.70%). cohesive failure in enamel was also present for all conditions, except for rc associated with abrasion. failure mode distribution according to challenge (%) ero - rc = eroded with regular coke ; ero - lc = eroded with light coke ; ero - zc = eroded with zero coke ; no = not abraded and ab = abraded ; rc = regular coke ; lc = light coke ; zc = zero coke under clsm observation, a control pattern in specimens (not challenged) is illustrated in figure 4, which showed a uniform and regular tag formation, with homogeneous thickness and regular extension into enamel. on the other hand, distinct performance was revealed comparatively regarding each coke drink that was used. tags are presented in homogeneous extent rc (ero - rc and eroab - rc specimens) caused superficial and heterogeneous tag formation (figures 5a, b). however, for eroab - rc specimens, even also poorly visible, tags were more regular than for ero - rc specimens. a similar result was shown for ero - lc, in which the adhesive impregnation was more superficial compared to control (figures 6a, b). for eroab - lc, the adhesive layer showed to be more regular than only eroded specimens. interface aspect of bonding system to enamel surface eroded by regular coke (rc). hybrid layer is based on superficial tags formation interface aspect of bonding system to enamel surface eroded by regular coke (rc) followed by toothbrushing. hybrid layer is irregular and superficial, but it is more evident than only eroded surface interface aspect of bonding system to enamel surface eroded by light coke (lc). tags are thin and irregular interface aspect of bonding system to enamel surface eroded by light coke (lc) followed by toothbrushing. hybrid layer is also superficial, but much more regular than only eroded surface only zc allowed similar tag formation compared to the control group, regardless of the abrasion. the interface characteristics of these groups (ero - zc and eroab - zc) can be observed in figure 7a, b. interface aspect of bonding system to enamel surface eroded by zero coke (zc). tags present homogeneous pattern interface aspect of bonding system to enamel surface eroded by zero coke (zc) followed by toothbrushing. poor evidence is reported on the adhesion to enamel previously eroded by different soft drinks. while enamel is a dental substrate that allows the formation of regular and strong adhesion, changes in this substrate might affect the bond strength, failure mode, and the tag formation. based on the results of this study, the first null hypothesis was rejected while the second null hypothesis was accepted. data attested the potential of cola - based drinks, as coke types, to reduce bond strength in enamel compared with the control condition. as coke drinks are based on phosphoric acid content (ph 2.6 - 3.0), they showed to be potentially erosive, which was previously stated. according to figure 1, all tested drinks presented similar ph. rc and lc present the same titratable acidity, which were higher than presented by zc. titratable acidity is related to the amount of base required to allow a solution with neutral ph, which exhibits relevant influence on demineralization. thus, it can be expected that there will be higher compromising by rc and lc. by means of bond strength, this performance was not confirmed as all drinks negatively influenced adhesion with no difference among them. however, in light of the failure mode interpretation, we can observe a similar pattern of failure mode between rc and lc, with a predominant occurrence of mixed and adhesive failures, which differed from zc (table 2). this less - erosive potential was attributed to the presence of the amino acid phenylalanine, which is provided by the hydrolysis of aspartame in the presence of saliva. as the present study was conducted under the in vitro experimental model, there was no influence of saliva, which in turn may be responsible for the lack of differences between rc and lc. the performance of zc reveals that it was the only group that presented cohesive failure in resin. likely, this beverage might provoke irregularities of surface, which intensity was favorable to bond. a rougher surface is attributed to playing a relevant role in the adhesion mechanism, as it contributes to promoting more intense interlocking to enamel. however, the fragile enamel surface can be lost if the erosive challenge continues. this softened zone is also more susceptible to mechanical forces, such as abrasion.control group, associated with toothbrushing, presented no difference in relation to respective solely eroded group. when rc was associated with toothbrushing (eroab - rc), cohesive failure in enamel was not evident, suggesting that the eroded surface was removed by abrasion. for lc and zc, it might be prudent to speculate that the toothbrushing has a minor impact on the enamel loss, due to the low erosive demineralization provoked by these drinks. despite the fact that some studies have shown that toothbrushing seems to have some effects on acid - softened hard tissues, the abrasion of the eroded enamel surface did not have a major impact on bond strength and failure mode in the present study. clsm images are in accordance with the speculated interpretation of overall results (figures 4 to 7b). except for zc, however, enamel eroded with rc showed more irregular interface than the lc - eroded surface. for eroded/ abraded enamel specimens, the hybrid layer was more evident than for only eroded enamel, except for zc, which was similar to the control group. we suggest that the toothbrushing abrasion partially removed the fragile enamel layer, especially in the case of rc, allowing better hybrid layer formation, even though the bond strength remained as low as that for only the eroded enamel. practitioners should be aware when they restore enamel erosion lesions of patients with resin - based materials, as this property seems to be somehow negatively affected. however, once more it is important to state that this investigated potential did not consider the influence of saliva and its components present in the oral environment, which could alter the results. clinical investigations have shown some concern about eroded - tooth restoration ; however, most of them regard the adhesion failures in dentin. in the present study, we focused on early treatment strategies for dental erosion which has not reached dentin. clinically, the findings of the present study are relevant for restoring enamel erosive lesions in a facial surface of anterior teeth, which in turn might compromise the aesthetic. the early adhesive restoration could also prevent the progression of enamel erosion in anterior teeth. thus, the results of the present study highlight the bonding mechanism when enamel is involved in early stages of erosive demineralization. furthermore, the study also showed the importance of combining different analyses to better understand the adhesion process in enamel. based on the results of this study, we can conclude that all coke drinks reduced the bond strength no matter the type. qualitative aspects provided more detailed information, showing different failure mode and tag formation according to the type of coke drink. further investigation is required to evaluate the impact of the type of coke drink on the adhesion to enamel and also to dentin over time, using higher erosive challenges and different bonding systems. | objectivethis study aimed to assess the impact of in vitro erosion provoked by different cola - based drinks (coke types), associated or not with toothbrushing, to bonding to enamel.material and methodsfifty - six bovine enamel specimens were prepared and randomly assigned into seven groups (n=8) : c- control (neither eroded nor abraded), ero - rc : 3x/1-minute immersion in regular coke (rc), ero - lc : 3x/1-minute immersion in light coke (lc), ero - zc : 3x/1-minute immersion in zero coke (zc) and three other eroded groups, subsequently abraded for 1-minute toothbrushing (eroab - rc, eroab - lc and eroab - zc, respectively). after challenges, they were stored overnight in artificial saliva for a total of 24 hours and restored with adper single bond 2/filtek z350. buildup coronal surfaces were cut in 1 mm2 -specimens and subjected to a microtensile test. data were statistically analyzed by two - way anova / bonferroni tests (=0.05). failure modes were assessed by optical microscopy (x40). the interface of the restorations were observed using confocal laser scanning microscopy (clsm).resultsall tested cola - based drinks significantly reduced the bond strength, which was also observed in the analyses of interfaces. toothbrushing did not have any impact on the bond strength. clsm showed that except for zero coke, all eroded specimens resulted in irregular hybrid layer formation.conclusionsall cola - based drinks reduced the bond strength. different patterns of hybrid layers were obtained revealing their impact, except for zc. |
laryngotracheal separation (lts) is the most immediately life - threatening airway injury caused by any of various injuries to the neck including automobile accidents, attempted hanging, and direct blows to the anterior neck [1, 2 ]. because lts is very so rare, emergency physicians and otolaryngologists have limited experience with it and there is no consensus on its management. therefore, lts is a diagnostic and therapeutic challenge in airway injuries. a high index of suspicion and immediate reconstruction with restoration of the laryngotracheal framework and mucosal integrity enables patients to recover a patent airway, functional voice, and normal swallowing. the patient had attempted to hang himself from a height of three stories and was immediately rescued by an eyewitness. on arrival, the patient had a hoarse voice but no other symptoms or signs of airway distress. transverse linear abrasion by a clothes - line was visible on the anterior aspect of the neck at the location of the larynx, and subcutaneous emphysema without any penetrating wounds of the skin was detectible by palpation over an extensive area of the neck and upper chest wall. cervical and chest x - rays revealed cervical and upper thoracic emphysema but no other abnormality. multi - detector computed tomography (mdct) including multiplanar reconstruction images revealed a complete laryngotracheal separation without fractures of the thyroid and cricoid cartilage. tracheotomy at the suspected site of separation was performed urgently, after which the patient was transferred to the operating room. the neck was explored through a transverse incision formed by extending a tracheotomy incision laterally. the patient had complete transection between the cricoid cartilage and the first tracheal ring, and stretching of the left recurrent laryngeal nerve was observed (fig. 2). however, the thyroid cartilage, cricoid cartilage, esophagus, and great vessels were intact. before anastomosis, release techniques such as suprahyoid release were not used in this patient because of the absence of tracheal cartilage loss. right side tracheal wall was dissected to avoid damage to the right recurrent laryngeal nerve with great care because stretching injury of left recurrent laryngeal nerve was suspected strongly. neck extension was eliminated with removal of shoulder roll and the trachea was anastomosed to the cricoid cartilage using interrupted 4 - 0 vicryl sutures. each suture was passed from extraluminal side to intraluminal side submucosally, with the knot placed extraluminally to minimize the risk of infection, granuloma, and stricture formation. following complete closure, the wound was flooded with saline and a valsalva maneuver was performed after the deflation of the cuff of the endotracheal tube to assure an air - tight closure. the strap muscles were re - approximated in the midline over suction drains, followed by closure of the platysma and skin. to lessen the tension over anastomosis in the postoperative period, the head was kept in flextion position with a nylon suture from the chin to the anterior chest wall. the endotracheal tube was removed on day 3 in the intensive care unit, and left vocal cord paralysis was observed upon flexible laryngoscopy. neck computed tomography (ct) scan taken at 10 days after the operation demonstrated complete resolution of subcutaneous emphysema and appropriate reconstruction of laryngotrachea (fig. the patient was discharged 2 weeks later without a tracheostomy and was lost to follow - up. airway trauma may be life - threatening, immediately or within several hours after acute injury. although laryngotracheal injuries represent less than 1% of all traumatic injuries, they account for more than 75% of immediate mortality. motor vehicle accidents are the most common cause of blunt trauma to the airway, with hanging as a method of attempting suicide increasing in incidence [3, 4 ]. laryngeal injuries were observed in 35% to 45% of victims of hanging at autopsy. because laryngotracheal separation caused by hanging usually results in early death at the scene, the true incidence is unknown [2, 3, 5 ]. typical lts occurs with clothes - line type injuries, as in the present case. sudden neck extension, fixation of the larynx, and anteroposterior compression of tracheal rings creates shearing forces tearing the cricotracheal membrane. direct upward pressure by hanging elevates the larynx superiorly and, as a result, larynx, and trachea are separated. admitted patients with laryngotracheal injury exhibit characteristic signs including hoarseness, dyspnea, subcutaneous crepitus, and skin abrasions over the anterior neck, but their presence vary according to the degree and extent of injury. respiratory distress may be absent, as in the present case, if the separation between the cricoid cartilage and the ends of trachea is not large, allowing adjacent soft tissue around the trachea to form a pseudo - airway and make ventilation possible. sudden airway obstruction may occur by trial of endotracheal intubation, neck extension or coughing [2, 5, 7 ]. fiberoptic laryngoscopy of the upper airway may be helpful for evaluating the site and extent of injury. however, in the case of highly suspected lts, fiberoptic laryngoscopy should be performed cautiously and with the preparation of a tracheotomy. irritation by instrumentation may induce effortful cough and disrupt this unstable airway, resulting in abrupt dyspnea. cephalocaudal separation between cricoid and trachea, abrupt change in position, diameter, and shape of the airway and an extraluminal position of the distal endotracheal tube are the suggestive ct findings of lts. as shown in this case, sagittal reconstructive image may be useful to evaluate the integrity of laryngotrachea. tracheotomy is recommended as the method of choice to secure the airway by many authors, because endotracheal intubation may pass into a false track at the site of tracheal separation and obstruct the airway completely [2, 4, 9 ]. cricothyroidotomy is not recommended after blunt laryngotracheal injuries, as this may further injure the laryngotrachea. tracheotomy at the suspected site of separation may be performed rapidly without further tracheal cartilage injury, as in the present case. after airway is secured, definite surgical repair should be considered as early as possible. early repair within 48 hours shows improved outcomes with respect to airway and voice and also lower incidence of subglottic stenosis [10, 11 ]. in conclusion, a high index of suspicion, adequate imaging, prompt airway establishment, and early surgical repair are the most vital factors in managing the patient with lts (fig. | laryngotracheal separation (lts) is the most immediately life - threatening airway injury. lts is so rare that very few otolaryngologists have experience with it. lts is one of the diagnostic and therapeutic challenges in airway diseases and its management remains to be established. we experienced a patient with complete lts after attempted hanging. a high index of suspicion, adequate imaging, prompt airway establishment and early surgical repair are the most vital factors in managing a patient with lts. |
klippel trenaunay syndrome (kts) is a rare congenital malformation first described in 1900 by maurice klippel and paul trenaunay. kts is characterized by the triad of capillary malformations, atypical venous malformations and varicosities, and bony and/or soft tissue hypertrophy. kts is estimated to affect 1 in 100 000 people worldwide with no predilection to race or sex. an 18-year - old man presented for consideration of exenteration of the rectum and giant venous malformations extending out the sciatic notch. he had experienced multiple significant episodes of haematochezia with associated anaemia (haemoglobin of 4.5 g / dl) and lethargy. this is on a background of kts complicated by a right leg amputation, bleeding skin lesions and chronic haematochezia. a non - obstructive pedunculated malformation was present near the ileocaecal valve occupying 50% of the lumen with the majority of malformations present in the rectum as a diffuse - dilated venous plexus (fig. 1). n - of-1 random allocation was performed to inject the rectum with 5 ml of phenol in almond oil to the left and 20 ml of 75% ethanol to the right - sided vessels just beyond the anorectal junction. the patient returned at 6 months for a flexible sigmoidoscopy to assess the rectal venous malformations. at the time of presentation the flexible sigmoidoscopy again identified the previous venous malformations with an obvious but subjective reduction in the right - sided lesions (ethanol - injected lesions) more so than the left (fig. 2). a further 20 ml of 75% ethanol was injected into the left - sided lesions as well as 10 ml of 75% ethanol into the right - sided lesions. the rate of venous malformations in patients with kts is 70%. however, case studies suggest that the rate of problematic haematochezia associated with kts is quite low [1, 3 ]. surgical management of rectal haemangiomas is dependent on the extent of the anatomy of the haemangioma. proctocolectomy with coloanal anastomosis is an option that allows for preserved anal function with control of bleeding. however, extension of the haemangioma to the perianal and perineal region may require abdominoperineal resection with a permanent colostomy. parashette and cuffari describe the case of a child with kts complicated by haematochezia where endoscopic sclerotherapy with 75% ethanol was successful. ethanol has been used in sclerotherapy for many years and is tolerated in most cases. however, systemic toxic side - effects of ethanol have been reported in the literature. minor side - effects of percutaneous ethanol include skin blistering, ulceration and scar formation, while major side - effects include pulmonary embolism, cardiovascular collapse and death. wong. have described cardiovascular collapse in the case of an 11-year - old child with kts that underwent ethanol sclerotherapy. yakes and baker have described desaturation, bradycardia and cardiopulmonary collapse in three adults who underwent ethanol sclerotherapy. retrospective study has suggested that the only factor significantly associated with a systemic adverse event is the ethanol dose / weight ratio per intervention. suggest a maximal ethanol dose / weight ratio of 0.2 ml / kg in the treatment of venous malformations with ethanol as a sclerosant. this case offers further support for 75% ethanol as a sclerosant in the management of rectal venous malformations and their use in an adult population. it is important to note that the options for treatment of rectal venous malformations include surgery and/or endoscopic sclerotherapy, and that each of these options is associated with its own complications. evidence does not exist in support of one mode of therapy over the other and the treatment option should be based on an individual assessment. | klippel trenaunay syndrome (kts) is a rare congenital disorder characterized by the triad of capillary malformations, atypical venous malformations and varicosities and bony and/or soft tissue hypertrophy. we present the case of an 18-year - old man with kts affected by haematochezia secondary to rectal venous malformations that was managed with endoscopic sclerotherapy. in this case, we compared the use of ethanol to phenol as a sclerosant. |
transition / transversion (ts : tv) biases observed in genome comparisons are potentially the result of mutational and/or selective evolutionary processes that influence the alteration of the two fundamental types of nitrogenous bases (i.e., purines and pyrimidines) that comprise dna. it has long been observed that (purine / pyrimidine) conserving substitutions (i.e., transitions) are generally more common in comparative studies of dna sequence than (purine / pyrimidine) altering substitutions (i.e., transversions) despite the fact that potential transversions theoretically outnumber potential transitions by two to one. this unexpected transitional bias observed in comparative genomic studies is traditionally attributed to mutational bias, whereby transitions are either more likely to occur or less likely to be repaired than transversions. spontaneous base substitution patterns were first explained by tendencies of potential tautomeric shifts involving atypical complementary base pairing (topal and fresco 1976), however, this idea now appears largely discredited by empirical data (vonborstel 1994). other mutational biases driven by spontaneous or oxidative deamination of cytosine or 5-methylcytosine and uv light induced mutagenesis at dipyrimidine sites (cc or ct) seem to more realistically explain the predominance of one type of transition (c : g > t : a). however, certain transversions (c : g > a : t) also commonly result from oxidative damage resulting in guanine conversion to 8-oxo - guanine (friedberg. the reduction of all substitution events by 89% in escherichia coli grown in an anaerobic environment is a powerful testament to the role of oxidative damage in driving these mutational biases (sakai. mutational biases can also be caused by functional constraints on the organization of the genome as well as by patterns of its damage or repair. molecular evolutionists have long observed that mutational biases are influenced by the structure of the genetic code because the possible transitions at 4-fold degenerate (silent) sites are about twice as common as transversions (yang 2006). this idea is well supported by observations that transitional bias is significantly larger in vertebrate mitochondrial genes that are highly evolutionarily conserved (kumar 1996), that transitional bias is somewhat reduced when comparing total coding with noncoding regions in drosophila (moriyama and powell 1996), and that ribosomal rna genes (i.e., srdna) and pseudogenes both lack a consistent transitional bias (vawter and brown 1993 ; keller. recent advances in high - throughput sequencing have led to the direct analysis of genome - wide mutation accumulation spectra in several model organisms including saccharomyces cerevisiae, arabidopsis thaliana, drosophila melanogaster, and caenorhabditis elegans (lynch. these studies are consistent with a possible role of oxidative damage in driving mutational biases, demonstrating a predominance of both c : g > t : a transition (all studies) and c : g > a : t transversion (all but arabidopsis). however, surprisingly, although ts : tv ratios are variable in yeast, fly, and worm (about 1.2:1, 1:1, 1:2, respectively), only arabidopsis is highly transitionally biased (2.4:1). even in this one case, the transitional bias is caused by the predominance of only one type of transition, the deamination of cytosine. these major inconsistencies observed between the frequency of mutation accumulation and existing natural patterns of molecular variation are leading some to challenge one of the most primary assumptions of molecular evolution ; that sequence comparisons of natural molecular variation can accurately represent underlying neutrally evolving mutational processes (lynch. if true, this is potentially problematic as this central tenet of molecular evolution also forms the theoretical basis underlying current methods of modern phylogenetic reconstruction. if the biases observed during mutation accumulation are not responsible for the patterns typically observed in sequence polymorphism, such as the transitional bias usually observed even in noncoding dna, then what is ? 2009) suggest that their findings may indicate some unknown level of natural selection operating to purge transversions from the c. elegans genome. additionally, rosenberg. (2003) have demonstrated that transitional bias is spatially uniform across mammalian genomes after controlling for local differences in cpg hypermutability. this would suggest that if selection was responsible for transitional bias (outside of cpg), it must also act uniformly across most of the genome. (2008) also note evidence of a possible mechanism in natural populations countering a strong mutational pressure to increase at content (i.e., gc - biased gene conversion). because increased at content is a strong driver of nucleosome positioning, facilitating nucleosome exclusion (field. 2009), it may also be that purifying selection to preserve the packaging of dna into chromatin could be acting uniformly across the nuclear genome. chromatin also plays an active role in gene regulation as well as a general role in genome packaging and therefore its molecular evolution may play an equally important role in gene regulatory evolution (babbitt 2010 ; babbitt. 2010). this is further supported by the observation that primary chromatin structure and organization (i.e., nucleosome positioning) has recently been demonstrated to be largely sequence dependent (ioshikhes. 2007, 2008 ; kaplan. 2009), subject to natural selection (babbitt and kim 2008 ; babbitt. 2010), and to affect the overall rates of base substitution (warnecke. 2008). in this study, we use a structurally based model of the deformation energy (de) required by given dna sequences to deform to the molecular structure of the nucleosome core (tolstorukov. 2007, 2008) to ascertain whether the pattern of base substitution between the genomes of three very closely related species of saccharomyces yeasts can be explained by natural selection acting to functionally conserve a genome - wide signature of primary chromatin organization (i.e., nucleosome formation). we also compare this with results obtained from both neutral simulation as well as mutation accumulation lines in yeast. because the energy model is derived from explicitly mechanistic (i.e., energetic) first principles, it is sensitive to many potential features of dna sequence that allow or inhibit local nucleosome formation. these properties include local at content associated with translational positioning of the nucleosome (field. 2009) as well as well - known 1011 bp dinucleotide frequencies favored by the rotational phasing of dna on the nucleosome surface (ioshikhes. 2007), and the a / t asymmetry across the dyad or center of sequence bound to the nucleosome core. across the entire genome, we find that when substitution events occur at the dyad position on the energy model, the average change in deformation energy (de) imposed by the 12 possible types of substitution is very strongly inversely associated with their respective frequency throughout the yeast genomes (r = 0.951, p < 0.004). upon further investigation of this association at all possible 147 sites on the threading template of the de model, while utilizing a substantial subset (= 10%) of the genome, we find that this strong inverse association between a given substitution type s energetic impact upon nucleosome formation (i.e., de) and it genomic frequency occurs whenever substitutions fall nearest to crucial low de sites in the model ; sites typically nearest the surface of the nucleosome core (with roughly 1011 bp periodicity ; fig. it was previously demonstrated that the long axis deformability in dinucleotides (i.e., roll and slide) near the surface of the nucleosome core is critical to nucleosome formation / exclusion (tolstorukov. this negative association between de and mutation frequency also persists strongly in noncoding regions of the yeast genome (r = 0.940, p < 0.001 at dyad) indicating that this pattern is not driven by any mutational bias imposed by the genetic code. at model sites demonstrating this strong inverse association pyrimidine transversions have, on average, roughly twice the energetic impact on nucleosome formation than do purine purine or pyrimidine pyrimidine transitions (fig if these observed patterns were the product of purifying selection acting to maintain nucleosome formation associated with local chromatin organization, we would also predict that it should be absent in mutation accumulation lines. (2008) to obtain a list of transitions and transversions accumulating under conditions of neutral genetic drift. we successfully located 147 bp background sequences from the saccharomyces genome database for all but one of these mutations and computed their energetic impacts on nucleosome formation (i.e., de ; table 1). we found no significant correlations between de and mutational frequency, supporting the idea that mutations in these lines may be accumulating without any regard to their energetic effects on nucleosome formation. we also found no significant difference in de between transitions and transversions in the mutation accumulation study (t = 0.271, p = 0.782), thus contrasting the effect observed in the yeast genome (fig. this result appears to also compare favorably with results obtained by neutral simulations where observed (transitions / transversions) in the yeast genomes have significantly (lower / higher) energetic impacts on nucleosome formation than when placed in the randomly reshuffled settings of existing local dna (ts : t = 10.334, p < 0.001 and tv : t = 8.192, p < 0.001 ; fig this result strongly indicates a role of selection in driving different energetic impacts on nucleosome formation for the two substitutional classes. the lack of any significant difference between transitions and transversions in the mutation accumulation lines may also simply reflect poor statistical power in this relatively small sample size (n = 12 ts and n = 18 tv). to address this potential problem with our interpretation, we bootstrapped our original t - test on the comparative genomic data using 10,000 replications of identically sized samples (with replacement). at a sample size matching that of lynch. (2008), we found that only 34% of our bootstrap t - tests indicate a significant difference in de when comparing transition with transversion events (table 2). given the parameters of our genomic data, we estimate that a sample size of about 80 neutrally accumulated substitutions would provide adequate statistical power (i.e., over 95% rejection of null). we performed a similar bootstrap analysis regarding the relatively small mean difference in de observed between transition and transversion events in the lynch., we found that less than 1% of our bootstrap t - tests would be predicted to demonstrate a mean difference this small (table 2). taken together, these results of our bootstrap t - test indicate that although the apparent lack of significant difference we observed in the data set of lynch. (2008) may be due to the relatively small sample size, the mean difference we observe is probably not. therefore, the mutation accumulation line investigation of the energetic impacts of these two classes of substitutions on nucleosome formation seems generally supportive of the idea that during yeast evolution, purifying selection may have purged many substitutions that significantly altered chromatin organization, and these purged substitutions would be predicted to be largely dominated by transversion events. energetic impacts of substitution events under conditions of neutral mutation accumulation (from lynch. 2008) bootstrap t - test of whole genome comparing mean de of transition with transversion events using small sample sizes similar to those obtained mutation accumulation line studies note.sample size of lynch. the association between the frequency of each substitution type and their average energetic impact on dna deformation to the molecular structure of the nucleosome core (de). (a) strongest inverse association (shown in orange and red) is observed when mutations are present at the most deformable sites in the energy model nearest the nucleosome surface (white triangles indicate low energy positions in human satellite sequence cocrystallized with histone octamer in the best resolved nucleosome core particle structure, i.e., fig. (b) also shown are the inverse correlation between substitution frequency and de at the dyad or center position on the nucleosome (position = 0, r = 0.951, p < 0.004 ; strand specificity is ignored in the figure). the relationship between various classes of mutation and their average energetic impact on dna deformation to the molecular structure of the nucleosome core (de). (a) comparison of the average de for transitions (ts) and transversions (tv) observed in the saccharomyces genomes (left), the same substitutions placed in randomly reshuffled sequence backgrounds (center), and substitutions observed in mutation accumulation lines (right ; data from lynch. (b) the relationship between size of insertion and deletion events and their average energetic impact on the ability of dna to deform to the molecular structure of the nucleosome core (de) in both saccharomyces genome and randomly reshuffled backgrounds. energetic impact on indels on de is lowest at 1012 bp size, which tends to maintain the existing rotational phasing of dna on the nucleosome core. we also analyzed the energetic impacts of insertion / deletion events (i.e., indels) on nucleosome formation. as one would expect due to the greater impact of indels on both dna sequence as well their greater ability to shift the rotational phasing of dna on the surface of nucleosome core, we found that indels tend to have much larger average de than substitutions (y axis ; fig. the 1011 bp phasing is also evidenced by the dramatic drop in de in indels with similar size (i.e., 1011 bp in length ; fig. we also find a signature of potential purifying selection on indels acting to maintain existing local levels of de. as with substitutions, the average de for indels observed in the yeast genomes was significantly lower than those observed in neutrally evolving random simulation (t = 5.038, p < 0.001). this observation supports a previous suggestion that indels may be quite important in the evolution of dynamic chromatin structure of regulatory regions (babbitt. overall, our findings indicate a significant role for the functional conservation of chromatin organization in the molecular evolution of eukaryotic genomes. our results are supportive of genome - wide purifying selection acting to preserve chromatin organization in yeasts by purging many naturally occurring purine pyrimidine transversions. we believe this selective bias for substitutions that minimally affect de may help explain current inconsistencies observed between comparative estimates of substitution frequency and rates of mutation accumulation observed in recent high - throughput sequencing studies of model organisms. more specifically, the reduced energetic impact of transitions compared with transversions on sites that are crucial in nucleosome formation may have significantly contributed to the transitional bias observed in comparative studies of yeast genomes. because the positioning of nucleosome on dna is usually translationally dynamic (i.e., nucleosomes are able to slide to some degree on most sequences), any purely neutral accumulation of mutation is probably unlikely outside of highly bottlenecked inbred populations because the movement of nucleosomes on dna sequence will potentially place all sites on the surface of the sliding histone cores. additionally, the apparent accumulation of transitions that are less energetically disruptive to chromatin than those observed in random simulation as well as the apparent accumulation of substitutions without regard to energetic impact on nucleosome in a well - designed mutation accumulation line, lends further support to this role of purifying selection in maintaining chromatin organization. it has been recently suggested that chromatin evolution is a primarily neutral process (tirosh. 2010). this conclusion was based upon a lack of empirical correspondence between gene expression divergences in hybridized yeast and divergences in experimentally mapped nucleosome positions. however, recent studies demonstrate a significant role of chromatin structure in explaining expression divergences between duplicated genes (li. 2010) and the evolution of gene regulation (tsankov. 2010) in yeast. here, we have presented another molecular evolutionary analysis that would also seem to contradict the recent hybridization findings. (2010) may be premature, especially if chromatin s role in gene expression is not simply a matter of occupancy but is more biophysically complex and dynamic. the propensity of nucleosomes to move translationally (i.e., slide) along dna dictates that the majority of nucleosome positioning is statistical rather than static. therefore, occupancy may be expected to be a poor predictor of the functioning of dynamic chromatin around many promoters (babbitt 2010 ; he. indeed, a fundamental challenge in our work was presented by the fact that any given mutations affect on de could not be modeled exactly because its position on the nucleosome core could not be predicted exactly, which is why we resort to analyzing the effect of each mutation on all possible sites of the nucleosome model template (as shown in fig. at any rate, further investigation of the role of natural selection in governing chromatin organization will be needed before its importance in gene regulatory evolution can be truly specified. the further development of molecular evolutionary inference tests to infer natural selection acting upon chromatin, in addition to comparative studies conducted both within and between populations will eventually help in attaining this goal. lastly, the relationship between transition bias and nucleosome formation that we describe here may have particular relevance to the genomic occurrence of cpg islands, which appear in conjunction with increased transition bias at the evolutionary time of mammalian radiation (arndt and hwa 2004). it has been known that cpg islands, regions associated with promoters and transcription start sites of noncoding rnas and dominated by a high density of unmethylated cg dinucleotides (illingworth. 2008 ; gibney and nolan 2010), also demonstrate unusually high local rates of transition (rosenberg. more recently, it has been demonstrated that these methylation states of cpg are also associated with the compaction and stabilization of nucleosomes (singh 2009 ; choy. 2010), the rotational setting of dna on the surface of the nucleosome core (hebert and crollius 2010), and the interaction of nucleosomes with the sequences of alu insertions (salih. additionally, hypermethylation of cpg islands is also associated with abnormal gene regulation in most cancers (claes., this line of evidence strongly suggests that the evolutionary conservation of molecular dynamics of nucleosomes functioning in normal regulation of mammalian genomes, which depend heavily on cpg - mediated gene regulation, may also result in even higher localized regions of transition bias. in future population genomics studies in humans, it will be interesting to see if genome - wide substitution patterns indicative of potentially altered nucleosome dynamics (e.g., elevated transversion rates) can be directly linked to the incidence of age or environmentally associated disease. we utilized the multiple alignments of s. cerevisiae, s. paradoxus, s. mikatae, and s. bayanus previously published by kellis. (2003). to ensure accurate homology, we restricted our analysis to only the first three species, then we reconstructed ancestral sequences to each node on the phylogeny using the basml program implemented in paml (yang 2006). strand specificity was inferred from pairwise comparison of each extant species to its ancestral sequence. flanking sequences to each mutation event (substitution, insertion, and deletion) were recovered for each of the extant species and used to construct a 147 bp sequence used in the de analysis with the mutation placed at the dyad or centered within a hypothetical nucleosome position. thus, for a mutation event at site m on a given sequence, flanking sequences upstream and downstream of substitutions were defined (m 73 m 1) and (m + 1 m + 73), respectively. flanking sequences upstream of indels (insertions and deletions) were defined (m 73 m 1), whereas downstream flanking sequences were defined either as (m m+ 73 + d) where d = deletion length or (m m + 73 i) where i = insertion length. the energy required for the given sequences to deform to the molecular structure of the nucleosome core (i.e., de) was computed using the computational model implemented by nuscore software (tolstorukov. de of base pair steps in a given 147 bp dna sequence is theoretically forced to deform according to a spatial path of nucleosome - bound dna. the deformation of adjacent base pairings of nucleotides (i.e., dinucleotides) is defined spatially by six possible base pair step orientations (three translational variables : slide, shift, and rise and three rotational variables : roll, tilt, and twist ; see schlick 2010, p. 154). the dna structure from nucleosome core particle resolved by x - ray crystallography was used as a structural template (davey. (2007) demonstrated that sequence deformation to the nucleosome core structure depends largely upon the long axis deformations, roll, and slide. the equation for de is given below : where in=ini0(mn) is the imposed deviation of the ith dinucleotide step parameter in at the nth step of the nucleosome template from the rest state value i0(mn) of the step mn. the fij(mn) are dna stiffness constants that depend upon the sequence and l is the number of base pair steps in the nucleosome template (see olson. the energetic impact of a given mutation event is defined here as the absolute difference in de or (de) caused by the mutational change on the sequence of the extant species or de was computed and averaged for each of the 12 substitution types observed across the three yeast genomes and then correlated to the overall substitution counts to assess the association between the mutational frequency and the energetic impact of various substitution types (result in fig. to assess to what degree the results were model driven, the average de for each substitution type was also determined through a neutral simulation. 1, + 1 + 73) were randomized with a simple card shuffling algorithm, thus preserving local at content while removing any sequence - based contextual information associated with each given mutation. a shuffled background for each mutation was used to compute a new set of de values for comparison to real genome. the average de of transitions and transversions in the simulations was compared with those in yeast genomes with t - test (result in fig. the average de of indels in random simulation and yeast genomes was also compared similarly (result in fig. most importantly, to assess whether the relationship between substitution frequency and subsequent energetic impacts of substitutions on nucleosome formation was driven by the sites most critical for deformation of sequences to the structure of the nucleosome core (i.e., sites nearest the core surface), the de of each substitution event observed on chromosome 4 (chr d), the largest in the yeast genome, was analyzed at all possible 147 sites on the energy model. here, de was calculated for a given mutation positioned at each site on the nucleosome structural template (i.e., flanking sequences for substitutions are (m 73 i m + 73 i) where i = { 73, 72, 71 71, 72, 73}. a correlational curve of the positional energetic impacts of substitutions was produced by correlating the average de of the 12 substitution types to their genomic frequencies at all 147 sites on the nucleosome structural template of the de model (results in fig. this analysis was quite computationally expensive, and because the resulting correlational curve was stabilized after analyzing only about 100 genes, we stopped after completion of chr 4, the largest chromosome in the yeast genome. | one prominent pattern of mutational frequency, long appreciated in comparative genomics, is the bias of purine / pyrimidine conserving substitutions (transitions) over purine / pyrimidine altering substitutions (transversions). traditionally, this transitional bias has been thought to be driven by the underlying rates of dna mutation and/or repair. however, recent sequencing studies of mutation accumulation lines in model organisms demonstrate that substitutions generally do not accumulate at rates that would indicate a transitional bias. these observations have called into question a very basic assumption of molecular evolution ; that naturally occurring patterns of molecular variation in noncoding regions accurately reflect the underlying processes of randomly accumulating neutral mutation in nuclear genomes. here, in saccharomyces yeasts, we report a very strong inverse association (r = 0.951, p < 0.004) between the genome - wide frequency of substitutions and their average energetic effect on nucleosome formation, as predicted by a structurally based energy model of dna deformation around the nucleosome core. we find that transitions occurring at sites positioned nearest the nucleosome surface, which are believed to function most importantly in nucleosome formation, alter the deformation energy of dna to the nucleosome core by only a fraction of the energy changes typical of most transversions. when we examined the same substitutions set against random background sequences as well as an existing study reporting substitutions arising in mutation accumulation lines of saccharomyces cerevisiae, we failed to find a similar relationship. these results support the idea that natural selection acting to functionally conserve chromatin organization may contribute significantly to genome - wide transitional bias, even in noncoding regions. because nucleosome core structure is highly conserved across eukaryotes, our observations may also help to further explain locally elevated transition bias at cpg islands, which are known to destabilize nucleosomes at vertebrate promoters. |
the increasing availability of the prostate - specific antigen (psa) screening test has led to earlier diagnosis of prostate cancer as well as to the promotion of more active treatment. radical prostatectomy is one of the most common surgical methods for radical treatment of localized prostate cancer. laparoscopic radical prostatectomy (lrp) is a less invasive method of treatment that leads to less bleeding and rapid return to daily activities and also results in the same oncologic outcomes compared with open radical prostatectomy (orp). however, the long learning curve and difficult surgical technique of lrp has hindered the generalization of its use. compared with lrp, robot - assisted laparoscopic radical prostatectomy (ralp) enables a three - dimensional image with 10-fold magnification, wristed instrumentation, and prevention of biological tremor, leading to easier technique and a shorter learning curve. therefore, ralp is now being used as an effective treatment option for radical prostatectomy. many studies in korea have reported excellent oncologic and functional outcomes following early experiences with ralp. however, those studies were conducted in large oncology centers where many surgical cases were performed in a short period of time, thus allowing for focused training. the learning curve and the surgical outcomes may differ between a secondary training hospital and a larger hospital owing to different surgical teams (including the assistant), different facilities, equipment, and the fact that the surgeon can not perform multiple operations in a short period of time. currently, a significant number of smaller oncology centers are also performing ralp, and with future improvements in surgical techniques and the reduction in costs, it is believed that ralp will become more widely used in secondary training hospitals. in the present study, we investigated the learning curve and the outcomes of ralp performed by a relatively lower volume surgeon at a secondary training hospital. the medical records of 100 patients who underwent ralp performed by a single surgeon between march 2010 and january 2013 were reviewed retrospectively to investigate the preoperative and postoperative clinical courses and the short - term surgical outcomes. all except one of the 100 patients were diagnosed by transrectal ultrasonography - guided needle biopsy and underwent abdomen and pelvis computed tomography or magnetic resonance imaging for staging. preoperative parameters including age, preoperative psa, and prostate volume ; intraoperative parameters such as the estimated blood loss (ebl), total console time, time of each step of the surgery, and intraoperative complications ; and postoperative parameters including the transfusion rate, cardiopulmonary complications, and the oncologic and functional outcomes were compared and analyzed. the first 10 cases of ralp were grouped into period 1, cases 11 to 40 into period 2, cases 41 to 70 into period 3, and cases 71 to 100 into period 4, and the interval between surgeries, the duration of each step of the surgery, the total console time, the transfusion volume, and the incidence of complications were investigated in each period. considering that the surgeon lacked previous experience in lrp and had insufficient time to train to use the robot, the first 10 cases performed were categorized as " extremely early cases " and were thus put into period 1. the console time was defined as the time from the start of incision to the vesicourethral (vu) anastomosis based on the video recordings of the surgeries. step 1 of the surgery was defined to be from the start of incision to the ligation of the dorsal vein complex, step 2 as the division of the bladder neck (bn) and dissection of the seminal vesicle (sv), step 3 as the lateral dissection including the neurovascular bundle preservation, step 4 as the dissection of the apex and urethra, and step 5 as the vu anastomosis. all operations were performed by using the da vinci surgical robot system (intuitive surgical, sunnyvale, ca, usa) with 4 robotic arms, and a transperitoneal approach was used for all patients. the placement of one camera port and three ports for the robot instrument were installed as in previously reported studies. all surgeries were performed by the same surgeon. the surgeon had experience in around 150 cases of open retropubic prostatectomy but did not have experience in lrp. the dorsal vein complex was ligated for all cases, and lymph node dissection was performed in 37 cases. the time taken for lymph node dissection for the first 70 cases, the anterior approach was used for the division of the bn and sv dissection, whereas for the remaining 30 cases, the posterior approach was used in which incisions were made at the posterior base followed by dissection of the sv and the vas deferens through the incisions before division of the bn. the decision to undergo neurovascular bundle preservation was made depending on the patient 's preoperative international index of erectile function (iief) and the oncologic status as evidenced by the patient 's preoperative iief and magnetic resonance imaging results. in 72 of 84 cases, excluding 16 cases with preoperative serum psa higher than 20 ng / ml, nerve sparing was performed by use of the interfascial technique (unilateral in 30 cases, bilateral preservation in 42 cases). after the prostate was resected, saline containing 200 ml of indigo carmine was infused through the rectal tube to dilate the rectum and to inspect for rectal injury. double - armed 3 - 0 monocryl sutures were used for continuous suturing from a 6 o'clock to a 12 o'clock direction to complete the vu anastomosis. the baseline characteristics and changes in the time of the operation steps were analyzed by using the kruskal - wallis test and chi - square test. all analyses were performed by using ibm spss ver. 18.0 (ibm co., armonk, ny, usa). the baseline characteristics and changes in the time of the operation steps were analyzed by using the kruskal - wallis test and chi - square test. all analyses were performed by using ibm spss ver. 18.0 (ibm co., armonk, ny, usa). there were no significant differences in baseline characteristics among the patients in periods 1 to 4 (table 1). the interval between the surgeries was 14.211.4, 12.111.3, 10.36.8, and 8.38.4 days for periods 1, 2, 3, and 4, respectively (p=0.272). the mean console time was 371 minutes for period 1 (table 2), which was reduced steeply to 270 minutes for period 2, and then reduced slowly to 195 minutes for period 4. the console time first reached under 3 hours after 75 operations. comparing the time of the surgical steps between periods 2, 3, and 4, when the basic operation of the robot was learned, the time taken for step 1 was reduced from 4923.5 to 26.23.9 minutes (p=0.029). the time for step 2 decreased from 55.216.4 minutes in period 2 to 39.07.5 minutes in period 3, but there was no significant difference in the time for step 2 between periods 3 and 4 (p=0.038). the time taken for step 3 was 57.47.0 minutes in period 2 and 32.46.0 minutes in period 4 (p=0.008) ; and the time taken for step 5 was reduced significantly from 26.48.6 minutes in period 2 to 10.62.4 minutes in period 4 (p=0.009). however, the decrease in the time for step 5 was not significant (p=0.095). a posterior approach was used after the initial 70 cases and allowed easier dissection of the sv and more accurate bn division compared with the anterior approach, but the mean time was not significantly different from that for the anterior approach. of the 73 pathologic stage t2 patients, 20 showed a positive surgical margin (psm). the margin - positive rate was 42.9% (3/7), 20% (4/20), 33.3% (8/24), and 22.7% (5/22) for periods 1, 2, 3, and 4, respectively, showing no statistical significance (p=0.308). the mean intraoperative ebl decreased significantly from 725452.6 ml in period 1 to 285.1188.9 ml in period 4 (p<0.001). seventeen cases required transfusion (clavien - dindo classification grade ii), which was reduced from 5/10 (50%) in period 1 to 1/30 (3.3%) in period 4 (table 3). there were no major complications (clavien - dindo classification grade iii or iv) during the surgery, such as large bowel or rectal injuries. a soft diet was started from day 2.11.5 postoperatively, and no cases of mechanical ileus developed. using the definition of urinary continence recovery of needing to use one or fewer pads per day, of the 89 patients who could be followed up for more than 1 year after the operation or had recovery of continence at the last follow - up visit, 61 (68.5%) had recovered their continence, and only 4 (4.5%) were incontinent for 1 or more years. the rate of continence recovery at 3 months postoperatively in periods 1, 2, 3, and 4 was 3/9 (33.3%), 4/23 (17.4%), 12/28 (42.9%), and 11/29 (37.9%), respectively. the rate of recovery of continence at 6 months was 5/9 (55.5%), 11/23 (47.8%), 18/28 (64.3%), and 27/29 (93.1%), respectively. the number of patients who were incontinent after 1 year postoperatively was 1, 1, and 3 patients in periods 1, 2, and 3, respectively, whereas no patients from period 4 remained urinary incontinent for more than 1 year (p=0.049) (table 4). among the patients who had erectile function (iief of 18 or more) preoperatively and underwent neurovascular bundle preservation, 6 of the 11 patients (54.4%) aged 65 years and under were able to masturbate or have sexual intercourse at 6 months postoperatively and 5 of the 11 patients (45.4%) aged 65 years and over were able to do so. the results of the present study showed that the total console time decreased with the accumulation of surgical experience. the console time decreased to under 3 hours after the performance of 75 cases. in terms of the surgical steps, the time for all steps excluding the vu anastomosis decreased with experience. for example, park. analyzed 200 cases of ralp performed in 24 months and reported that the total operation time, including the robot installation and the console time, was 215 minutes. patel. analyzed 200 cases of rarp performed over 18 months and reported the operation time to be 141 minutes. the console time excluding the robot installation time was 225 minutes in the present study, which was relatively longer than that reported in other studies. this is believed to be due to a longer learning curve in the present study, as there were 2.9 cases per month in our study, whereas the mean number of cases per month in the other studies ranged from 8.3 to 11.1. it was reported that the operative time of ralp is not significantly different from that of orp and that ralp and orp produce similar perioperative outcomes. however, the studies from which these conclusions were drawn were comparisons in which the learning curve period was excluded. the operative time of ralp in the early stages of experience has been reported to vary between 247 and 540 minutes, although another study reported that with the accumulation of experience of the surgeon, the operative time decreased to be similar to that of orp or even shorter. the learning curve and the process of shortening and stabilizing the operation time and skill are necessary for all surgeons, and several studies have reported breakpoints at which there was a rapid decrease in the operation time. sim. reported that the robot installation time and the operation time decreased rapidly after the first 9 of the initial 17 cases of ralp. in another study, lee. analyzed 307 ralp cases performed over 36 months in 6-month units and showed that the mean operation time decreased rapidly for the first 6 months and then decreased gradually but without statistical significance. in the present study, the mean console time decreased rapidly after the first 10 cases, at the first breakpoint, and then reduced consistently afterwards. the console time decreased once more with statistical significance during cases 71 to 100 (second breakpoint). as far as we know, this is the first study to investigate the learning curve for each step of the surgery. the time taken for steps 1 to 4 decreased significantly with the accumulation of surgical experience, but the time for step 5 decreased progressively but was not statistically significant. the extra console time, that is, the time for other activities excluding the 5 steps from the total console time, was longest for period 1 and was reduced significantly to reach a plateau after period 1. this is because for the first 10 cases, the surgeon had not overcome the learning curve and had insufficient understanding of the surgical plane and hesitated during the procedure. furthermore, the surgical team, including the first assistant, had insufficient experience and cooperation. the significant reduction of the extra console time is thought to be due to the first breakpoint. step 1 is technically less difficult, and hence the time for this step is easily reduced with the accumulation of experience. for step 2, the accumulation of experience led to reduced violation of the surgical plane during the bn dissection. to reduce the time for step 2 even further, the surgeon performed the division of the bn and the sv dissection by a posterior approach from the 71st case onward. although this clarified the anatomical borders and made the surgical process easier, it did not lead to a shortening of the operation time. the longest operation step in period 4 was the division of the bn and the sv dissection (step 2) and the vu anastomosis step (step 5). the time taken for step 2 decreased significantly, but the extent of the decrease in time of steps 2 and 5 was smaller than for the other steps. the operations were successfully performed without major complications despite the fact that relatively smaller numbers of operations were performed. however, the irregular interval between each operation and the lower number of operations still remain limiting factors for low - volume surgeons compared with large - volume surgeons in a tertiary medical center. we think that the only way for lower volume surgeons to overcome this limitation is to improve their techniques by use of laboratory practice, feedback from video self - review, and learning from video recordings of other surgeons and to work harder than larger volume surgeons. several studies have reported that ebl decreases significantly with surgical experience. on the other hand, jaffe. reported that ebl was maintained without an association with surgical experience. in our study, ebl was 725 ml for the first 10 cases and was steadily reduced to 285 ml for the last 30 cases. it is believed that the shortened operation time and the decreased surgical plane violation led to the decrease in bleeding. the recovery of urinary continence after ralp is reported to be greater than 90% at 1 year after the operation, and the incidence of urinary continence recovery is relatively higher than with orp.the incidence of continence recovery at 1 year postoperatively was 95.4% in the present study, and the urinary continence recovery rate at 3, 6, and 9 months after the operation increased with experience. we suspect that less unnecessary handling of the pelvic muscle during the procedure, less damage to the surrounding tissues, and a better process of securing sufficient urethral length during apex dissection may be reasons for this. although several studies have reported a lower psm rate in ralp than in orp, this has not been established with a high level of certainty. jaffe. reported that although 7 of the initial 12 cases (58%) had a psm, this was reduced significantly to 10 of 89 (9%) in the later cases. a study done in korea by lee. also reported that the psm rate was reduced from 20.8% in the first year to 9.5% later. in the present study, the mean psm rate in t2 stage patients was 27.4%, although a decrease in the psm rate was not observed with the accumulation of surgical experience. we think that one of the causes of such results is the relatively small number of operations performed and the tendency of the surgeon to dissect close to the prostate during posterior dissection of the prostate owing to concerns of causing rectal injury. further research and efforts to reduce the psm rate may be needed in the future. first, it was not possible to analyze the effect of prostate volume and clinical stage on the variation in the operative time owing to the small sample size. this study was not a multicenter study ; thus, its generalizability to the learning curve of all surgeons at secondary hospitals is limited. also, the number of operations performed in the same period of time varied, which may have affected the acquiring of surgical techniques and hence the outcomes of the present study. a smaller number of surgical cases with long and irregular intervals between surgeries could lead to a longer learning curve in secondary hospitals. most surgical steps were significantly shortened with the accumulation of experience, but the time for vu anastomosis was not shortened significantly. although the console time was relatively long, the intraoperative and perioperative complications and the functional outcomes were excellent. | purposeto investigate the learning curve and outcomes of robot - assisted laparoscopic radical prostatectomy (ralp) performed by a relatively lower volume surgeon at a secondary training hospital.materials and methodsthe medical records and the surgery video recordings of 100 patients who underwent ralp by a single surgeon between march 2010 and january 2013 were reviewed. the first 10 cases were grouped into period 1, cases 11 to 40 into period 2, cases 41 to 70 into period 3, and cases 71 to 100 into period 4. the interval between the operations, the operative time for each step of the surgery, the total console time, and the operative outcomes were investigated.resultsthe mean interval between surgeries was 10.69.3 days. the console time decreased progressively after the first 10 cases and reached under 3 hours after 75 cases. the time taken to begin dissection of the dorsal vein complex, for the division of the bladder neck, for lateral dissection with neurovascular bundle preservation, and for apex dissection decreased significantly with experience, although the time for vesicourethral anastomosis did not. the margin - positive rate of stage t2 patients was 27.4% (20/73), and the transfusion rate was 50% in period 1 patients and 3.3% in period 4 patients. no major complications occurred.conclusionsit is difficult to shorten the learning curve of surgeons in secondary training hospitals owing to the smaller number of cases and the irregular surgical intervals. although the operation time was relatively longer, the surgical outcome and complication rates were comparable with those of surgeons at larger hospitals. |
since the discovery of a three - coordinate terminal nickel imido, (dtbpe)ni = nar (dtbpe = bu2pch2ch2pbu2, ar = 2,6-pr2c6h3, scheme 1a) in 2001, this class of complexes remains relatively scarce, and their reactivity remains underexplored. the low coordination geometry offered by the strong -donating and sterically encumbered chelating bisphosphine ligand allows for optimal and bond formation in a trigonal planar environment without causing electron electron repulsion between the electron - rich late transition metal and the -loaded imido ligand. three - coordinate nickel(ii) imidos can also be prepared with other sterically demanding groups on the imido nitrogen, such as mesityl, 1-adamantyl (ad), and dmp (dmp = 2,6-dimesitylphenyl, scheme 1a). the use of a bulky scaffold such as dmp allows the isolation of a three - coordinate ni(iii) imido by virtue of a one - electron oxidation process (scheme 1b). warren and co - workers have also found that -diketiminate ligands can stabilize ni(iii) complexes possessing the terminal imido ligand (scheme 1c), while limberg has recently expanded this approach to a diazenido ligand using a more sterically encumbered chelating ligand (scheme 1d). other examples of kinetically stabilized ni(ii) imidos have been reported using a sterically encumbering and chelating bis - n - heterocyclic carbene ligand (3,3-methylenebis(1-tert - butyl-4,5-dimethylimidazoliylidene, scheme 1e). hillhouse reported examples of linear, two - coordinate imidos using an impressively sterically demanding n - heterocyclic carbene as well as a bulky dmp group on the imido nitrogen (scheme 1f). apart from their fascinating coordination and electronic properties, terminal imido complexes of nickel are also highly reactive and effect h atom - abstraction, engage in c h bond activation chemistry such as ethylene amination, the amination of allylic groups such as 1,4-cyclohexadiene, and even activation of stronger c h bonds in substrates such as indane, ethylbenzene, and toluene. h bond activation proceeds via hydrogen atom abstraction and alkyl radical formation, followed by recombination of the latter with a second equivalent of ni - imido to form primary and secondary nickel(ii) amides. the radical nature of some ni(iii) imidos is also manifested in radical recombination to form diphenoquinonediimine - type scaffolds. lastly, nickel complexes with a terminal imido ligand can also engage in nitrene group transfer to unsaturated molecules such as alkenes, organic azides, co, and cnr. surprisingly, the reactivity of nickel imidos toward other unsaturated substrates including cumulenes, has not been reported despite the rich chemistry from the similar species (dtbpe)ni = cph2 and (dtbpe)ni = p[dmp ]. in this study, we describe reaction chemistry of the first nickel(ii) complexes having a terminally bound imido ligand, (dtbpe)ni = nr (r = 2,6-pr2c6h3, 2,3,6-me3c6h2 (mes), and ad) with various small unsaturated molecules. these ni(ii) imidos can abstract an h atom from a reductant such as hsnbu3, but are also basic enough to heterolytically activate the c h bond of a terminal alkyne. other substrates, such as carbon dioxide, isocyanate, aldehyde, and ketene functional groups, engage in [2 + 2 ] cycloaddition, and sometimes insertion chemistry, across the ni = n bond to form stable and crystalline 4- and 6-membered ring nickel metallacycles. n coupling of anilide with an acetylide to form a transient ynamine, which rearranges to the keteneimine. theoretical studies, employing both density functional theory and higher - level ab initio simulations, were applied to understand the bonding and reactivity of the nickel - imido ligand. unless otherwise stated, all operations were performed in an mbraun lab master drybox under an atmosphere of purified nitrogen or using high - vacuum and standard schlenk techniques under an argon atmosphere. hexanes, petroleum ether, benzene, and toluene were dried by passage through activated alumina and q-5 columns. benzene - d6, deuterated tetrahydrofuran (thf - d8), and cd2cl2 were purchased, degassed, and dried over cah2 or activated 4 molecular sieves and vacuum transferred. celite, alumina, and 4 molecular sieves were activated under vacuum overnight at a temperature above 180 c. anhydrous solvents such as thf and diethyl ether were purchased from acros organics or fischer, stirred over sodium metal, and filtered through activated alumina.. all other chemicals were used as received. o = c = cph2, [(dtbpe)ni(-cl)]2, (dtbpe)ni(cod), (dtbpe)ni{nh(2,6-pr2c6h3) }, (dtbpe)ni = n(2,6-pr2c6h3) (1), (dtbpe)ni = n(mes) (2), meso radical, mesn = nmes, (dtbpe)nicl2, and (dtbpe)ni = n(1-ad) (3) were prepared according to the literature. for complex 1 an alternative, and optimized, procedure is reported below. infrared data (fluorolube mulls or solution, caf2 plates or in nujol mulls, kbr plates) were measured by using a nicolet 670-ft - ir instrument. h, c, f, and p nmr spectra were recorded on bruker 500 and 400 mhz nmr spectrometers. h and c nmr are reported with reference to solvent resonances (residual c6d5h in c6d6, 7.16 and 128.0 ppm ; residual chdcl2 in cd2cl2, 5.32 and 53.8 ppm ; residual proteo thf in thf - d8, 1.73 and 3.58 ppm, and 65.6 and 23.5 ppm). f nmr spectra were reported with respect to external ccl3f (0 ppm). p nmr spectra were reported with respect to external 85% h3po4 (0 ppm). x - ray diffraction data were collected on a siemens platform goniometer with a charged coupled device (ccd) detector. structures were solved by direct or patterson methods using the shelxtl (version 5.1) program library (g. sheldrick, bruker analytical x - ray systems, madison, wi). a mixture of (dtbpe)ni{nh(2,6- pr2c6h3) } (55 mg, 0.1 mmol) and meso (28 mg, 0.1 mmol) in 10 ml of c6h6 was placed in a 20 ml scintillation vial and stirred for 12 h. after removal of volatiles under reduced pressure, the residual solids were extracted with hexanes. the hexanes solution was concentrated, filtered through a plug of celite, and cooled to 35 c to generate pure green crystals of 1 (50 mg, 90%). a mixture of 1 (82.8 mg, 0.15 mmol), hsnbu3 (43.6 mg, 0.15 mmol), and c6h6 (10 ml) was placed in a schlenk tube and heated at 75 c for 12 h. the mixture gradually turned color from emerald green to dark red. after the mixture cooled to room temperature, the volatiles were removed under reduced pressure, and the solids were extracted with toluene. after filtration, crystallization occurred by cooling a concentrated toluene solution stored at 35 c over a period of 12 d. red crystals were separated by filtration and dried under reduced pressure to yield analytically pure product, (dtbpe)ni{nh(2,6- pr2c6h3) } (68 mg, 82%). was dissolved 1 (90 mg, 0.163 mmol) in 15 ml of et2o, and the green solution was cooled to 35 c. to the cold solution was added dropwise 5 ml of an et2o solution containing hccph (17 mg, 0.167 mmol), which caused darkening of the solution over a period of 2 h after reaching room temperature. the reaction mixture was allowed to stir for an additional 3 h at room temperature. the dark red solution was filtered, concentrated, and cooled to 35 c overnight to afford (dtbpe)ni{nh(2,6-pr2c6h3)}(ccph) (4) in two crops as dark red crystals / powder, which was filtered, washed with cold petroleum ether, and dried under reduced pressure (96 mg, 0.147 mmol, 90% yield). h nmr (22 c, 500.1 mhz, cd2cl2) : 6.95 (m, aryl, 3 h), 6.80 (d, aryl, 2 h), 6.49 (m, aryl, 3 h), 4.01 (sept, ch(ch3)2, 2 h), 1.96 (br, nh, 1 h), 1.88 (m, ch2, 2 h), 1.73 (m, ch2, 2 h), 1.56 (d, bu, 36 h, jhp = 13 hz), 1.29 (d, ch(ch3)2, 6 h), 1.16 (d, ch(ch3)2, 6 h). c{h } nmr (22 c, 125.8 mhz, cd2cl2) : 158.21 (s, aryl), 139.12 (s, aryl), 131.04 (s, aryl), 129.59 (s, aryl), 127.49 (s, aryl), 124.35 (s, aryl), 121.83 (s, aryl), 114.41 (s, aryl), 113.85 (d, niccph, jcptrans = 21 hz), 106.80 (dd, niccph, jcptrans = 96 hz, jcpcis = 41 hz), 36.75 (s, ch(ch3)2), 36.62 (s, ch(ch3)2), 36.11 (s, c(ch3)3), 36.04 (s, c(ch3)3), 30.91 (s, c(ch3)3), 30.70 (s, c(ch3)3), 28.36 (s, ch(ch3)2), 25.04 (s, ch(ch3)2), 24.68 (t, ch2ch2, jcp = 15 hz), 22.74 (s, ch(ch3)2), 21.22 (t, ch2ch2, jcp = 15 hz). p{h } nmr (22 c, 202.4 mhz, cd2cl2) : 82.80 (d, jpp = 26 hz), 68.84 (d,, jpp = 26 hz). calcd for c38h64nnip2 : c, 69.73 ; h, 9.70 ; n, 2.14. found : c, 68.83 ; h, 9.63 ; n, 2.00%. a 25 ml round - bottom flask was charged with 2 (83 mg, 0.163 mmol) and 12 ml of et2o, and then it was cooled to 35 c. a similarly cold 2 ml solution of hccph (17 mg, 0.163 mmol) was added dropwise to the nickel solution causing a color change to red - orange. after it was stirred for 45 min at room temperature, the solution was filtered and then cooled to 35 c overnight to give dark red crystals of 5 (84 mg, 0.132 mmol, 81%). c6d6) : 7.23 (t, c6h5, 2 h), 7.19 (s, ch2me3, 2 h), 7.14 (d, c6h5, 2 h), 6.93 (t, c6h5, 1 h), 2.82 (s, ch3, 6 h), 2.49 (s, ch3, 3 h), 1.44 (d, (ch3)3, 18 h), 1.35 (d, (ch3)3, 18 h), 1.13 (d, ch2, 4 h). c{h } nmr (22 c, 125.8 mhz, c6d6) : 156.7 (t, niccph, jcp = 4.2 hz), 130.3 (s, ar), 128.4 (s, ar), 127.6 (s, ar), 127.4 (s, ar), 127.1 (s, ar), 126.6 (s, ar), 123.6 (s, ar), 121.3 (s, ar), 112.0 (dd, niccph, jcp = 2, 23 hz), 35.8, 34.5 (m, c(ch3)3, jpc = 16.3 hz), 35.3 (m, c(ch3)3, jpc = 9.6 hz), 29.9 (d, (ch3)3, jpc = 3 hz), 29.7 (d, (ch3)3, jpc = 3.8 hz), 23.7 (t, ch2, jpc = 15 hz), 20.5 (s, ch3), 19.6 (s, ch3). the nh resonance could not be located. p{h } nmr (22 c, 202.4 mhz, c6d6) : 81.0 (d, jpp = 25.2), 67.8 (d, jpp = 25.2). ir (nujol, kbr) : 2092(s cc), 1591(m), 1294(w), 1236(s), 1178(m), 1151(m), 1020(m), 851(s), 812(w), 785(w), 755(s), 722(s), 693(m), 683(m), 603(w), 500(m), 454(w) cm. anal. calcd for c35h57ninp2 : c, 68.64 ; h, 9.38 ; n, 2.29. found : c, 68.56 ; h, 9.49 ; n, 2.20%. a 25 ml round - bottom flask was charged with 3 (31 mg, 0.0589 mmol) and 10 ml of et2o, and then it was cooled to 35 a similarly cold 2 ml solution of hccph (6 mg, 0.0589 mmol) was added dropwise to the nickel solution causing a color change to orange - yellow. after it was stirred for 90 min at room temperature, the solution was filtered, concentrated to 3 ml, and cooled to 35 c overnight to give dark orange crystals of 6 (32 mg, 0.051 mmol, 86%). h nmr (22 c, 500 mhz, c6d6) : 7.47 (d, ph, 2 h), 7.26 (t, ph, 2 h), 7.03 (t, ph, 1 h), 2.03 (s, c10h15, 6 h), 1.96 (s, c10h15, 3 h), 1.38 (d, c10h15, 3 h), 1.36 (d, c10h15, 3 h), 1.33 (m, ch2, 4 h), 1.25 (d, (ch3)3, 18 h), 1.10 (d, (ch3)3, 18 h), c{h } nmr (22 c, 125.8 mhz, c6d6) : 132.6 (s, ph), 131.6 (s, ph), 129.6 (s, ar), 127.1 (s, ph), 114.7 (d, niccph, jcp = 21 hz), 100.6 (dd, niccph, jcp = 91, 34 hz), 43.6 (t, ad, jpc = 6.8 hz), 38.4 (s, ad), 35.4 (m, c(ch3)3), 32.5, (s, ad), 30.6 (d, (ch3)3, jpc = 6.3 hz), 30.2 (d, (ch3)3, jpc = 6.3 hz), 23.9 (m, ch2). the nh resonance could not be located. p{h } nmr (22 c, 202.4 mhz, c6d6) : 98.8 (d, jpp = 47.1 hz), 90.2 (d, jpp = 47.1 hz). ir (nujol, kbr) : 2153(s cc), 1589(s), 1307(w), 1260(w), 1179(s), 1095(m), 1067(w), 1019(m), 935(w), 850(w), 813(s), 755(s), 695(m), 673(m), 658(w) cm. a 25 ml round - bottom flask was charged with 4 (78 mg, 0.0141 mmol), attached to an adapter, and evacuated. carbon monoxide (1 atm) was introduced into the vessel at 78 c. examination of the reaction mixture by p nmr spectroscopy revealed clean formation of (dtbpe)ni(co)2 along with one major organic product (observed by h nmr spectroscopy). after 30 min, the gas was evacuated, the flask was opened in air, and the solvent was removed under reduced pressure. the phch = c = n(2,6-pr2c6h3) residue was passed through a short column of silica with hexanes / etoac (4:1) as the eluent to provide a viscous oil (19 mg, 0.68 mmol, 48%). h nmr (22 c, 500.1 mhz, cd2cl2) : 6.97 (s, aryl, 3 h), 5.65 (s, ch), 3.65 (sept, ch(ch3)2, 2 h), 1.70 (d, ch(ch3)2, 12 h). c{h } nmr (22 c, 125.8 mhz, cd2cl2) : 178.2 (s, ccn), 141.2 (s, aryl), 134.1 (s, aryl), 127.3 (s, aryl), 124.6 (s, aryl), 56.2 (s, ccn), 28.2 (s, ch(ch3)2), 23.5 (s, ch(ch3)2). gc / ms (m / z) : 214 (m), 176, 130, 91. in a vial was dissolved 1 (100 mg, 0.181 mmol) in 10 ml of et2o, and to the green solution was added dropwise o = c = cph2 in 5 ml of et2o, causing a rapid color change from green to an intense orange - red. after 10 min red precipitate began to form, and after allowing the reaction to stir for an additional 40 min, the mixture was cooled to 35 c for 20 min, filtered, and the solids washed with cold et2o. the red solid was dried under reduced pressure to afford crude (dtbpe)ni{o, c : oc = n(2,6-pr2c6h3)cph2 } (127 mg, 0.172 mmol, 95% yield). analytically pure 7 was obtained by dissolving the solids in a minimum of ch2cl2, filtering, layering carefully with excess et2o, and cooling the solution to 35 c for 1 d. large dark red blocks of 7 were collected via filtration, washed with cold et2o, and dried under vacuum (95 mg, 0.127 mmol, 70% yield). h nmr (22 c, 500.1 mhz, cd2cl2) : 8.37 (d, aryl, 4 h), 7.24 (t, aryl, 4 h), 7.13 (t, aryl, 2 h), 6.85 (d, aryl, 2 h), 6.74 (t, aryl, 1 h), 2.87 (sept, ch(ch3)2, 2 h), 1.80 (m, ch2, 2 h), 1.48 (m, ch2, 2 h), 1.44 (d, bu, 18 h, jhp = 15 hz), 1.08 (d, bu, 18 h, jhp = 13 hz), 0.99 (br, ch(ch3)2, 6 h), 0.86 (br, ch(ch3)2, 6 h). c{h } nmr (22 c, 125.8 mhz, cd2cl2) : 175.7 (s, oc = n(2,6-pr2c6h3)), 150.2 (s, aryl), 145.2 (s, aryl), 140.5 (s, aryl), 130.6 (s, aryl), 127.4 (s, aryl), 124.0 (s, aryl), 121.5 (s, aryl), 120.6 (s, aryl), 35.79 (cph2), 35.69 (s, ch(ch3)2), 35.47 (br, c(ch3)3), 30.63 (s, c(ch3)3), 30.40 (s, c(ch3)3), 28.15 (s, ch(ch3)2), 25.24 (m, ch2ch2, jcp = 13 hz), 23.50 (br, ch(ch3)2), 18.05 (br, ch2ch2). p{h } nmr (22 c, 202.4 mhz, cd2cl2) : 77.49 (d, jpp = 13 hz), 66.21 (d, jpp = 13 hz). ir (caf2, fluorolube mull) : 3047 (w), 2987 (w), 2953 (w), 2899 (w), 1603 (s, cn), 1577 (s), 1482 (m), 1468 (m), 1429 (m), 1391 (w), 1357 (w) cm. calcd for c44h67nnip2o : c, 70.78 ; h, 9.04 ; n, 1.88. found : c, 70.38 ; h, 9.33 ; n, 1.92%. a 25 ml round - bottom flask was charged with 2 (48 mg, 0.094 mmol) and 5 ml of et2o, and then it was cooled to 35 c. a similarly cold solution of diphenylketene (18 mg, 0.094 mmol) in 4 ml of et2o was added dropwise to 2, causing a color change to red - orange. the solution was filtered after 1.5 h of stirring at room temperature, then concentrated to ca. 4 ml and cooled to give orange crystals of 8 (51 mg, 0.068 mmol, 72%). h nmr (22 c, 500 mhz, cd2cl2) : 8.22 (d, ph, 4 h), 7.13 (t, ph, 4 h), 7.06 (t, ph, 2 h), 6.58 (s, ch2me3, 2 h), 2.07 (s, ch3, 3 h), 1.79 (s, ch3, 6 h), 1.34 (m, ch2, 4 h), 1.23 (d, (ch3)3, 18 h), 1.01 (d, (ch3)3, 18 h). c{h } nmr (22 c, 125.8 mhz, cd2cl2) : 170.2 (s, co), 133.8 (s, ar), 130.3 (s, ar), 129.8 (s, ar), 127.3 (s, ar), 127.2 (s, ar), 123.7 (s, ar), 122.6 (s, ar), 121.3 (s, ar), 38.1 (t, cph2, jpc = 15 hz), 35.4 (m, c(ch3)3), 30.4 (d, (ch3)3, jpc = 4.6 hz), 30.1 (d, (ch3)3, jpc = 3.7 hz), 22.7 (m, ch2), 22.1 (s, ch3), 18.0 (s, ch3). p{h } nmr (22 c, 202.4 mhz, cd2cl2) : 78.5 (d, jpp = 12.4 hz), 66.9 (d, jpp = 12.4 hz). ir (nujol, kbr) : 1594(m), 1564(s, cn), 1266(m), 1232(w), 1180(m), 1022(m), 859(w), 837(m), 799(w), 786(w), 738(w) 716(m), 694(s), 673(m), 651(w) cm. calcd for c40h61ninop2 : c, 69.37 ; h, 8.88 ; n, 2.02. found : c, 68.87 ; h, 8.22 ; n, 2.01%. a 25 ml round - bottom flask was charged with 3 (95 mg, 0.180 mmol) and 7 ml of et2o, and then it was cooled to 35 c. a similarly cold solution of diphenylketene (35 mg, 0.180 mmol) in 2 ml of et2o was added dropwise to 3, causing little visible color change. the solution was filtered after 1.5 h of stirring at room temperature, then concentrated to ca. 4 ml and cooled to give dark red blocks of 9 (87 mg, 0.139 mmol, 77%). h nmr (22 c, 500 mhz, c6d6) : 8.55 (d, ph, 4 h), 7.24 (t, ph, 4 h), 7.10 (t, ph, 2 h), 2.38 (s, c10h15, 6 h), 2.18 (s, c10h15, 3 h), 1.85 (d, c10h15, 3 h), 1.78 (d, c10h15, 3 h), 1.16 (d, (ch3)3, 18 h), 1.13 (m, ch2, 4 h), 0.88 (d, (ch3)3, 18 h), c{h } nmr (22 c, 125.8 mhz, c6d6) : 179 (br, co), 141.6 (s, ph), 131 (s, ph), 127.0 (s, ph), 126.3 (s, ph), 48.6 (t, ad, jpc = 6.2 hz), 38.6 (s, ad), 36.4 (t, cph2, jpc = 12 hz), 35.2 (m, c(ch3)3), 32.4, (s, ad), 30.2 (d, (ch3)3, jpc = 6.5 hz), 29.3 (d, (ch3)3, jpc = 6.7 hz), 22.1 (m, ch2). p{h } nmr (22 c, 202.4 mhz, c6d6) : 77.5 (d, jpp = 19.8 hz), 62.4 (d, jpp = 19.8 hz). ir (caf2, fluorolube) : 1559(s), 1469(s), 1444(m), 1385(w), 1361(s) cm. in a vial was dissolved 1 (80 mg, 0.145 mmol) in 8 ml of toluene, and the green solution was cooled to 35 c. to the cold solution was added dropwise 3 ml of a toluene solution containing o = c = nch2ph (21 mg, 0.158 mmol) causing darkening of the solution over a period of 2 h at room temperature and with precipitation of green solid. the reaction mixture was allowed to stir for an additional 3 h at room temperature. the dark solution was concentrated, cooled to 35 c overnight, and then filtered ; the green solids were washed with cold et2o and dried under vacuum to afford crude (dtbpe)ni{o, c : oc = nch2phn(2,6-pr2c6h3) } (10) (89 mg, 131 mmol, 90% yield). the solids were dissolved in a minimum of ch2cl2, filtered, layered carefully with excess et2o, and cooled to 35 c for 2 d. large dark green blocks of 10 were collected via filtration, washed with et2o, and dried under vacuum (76 mg, 0.110 mmol, 76% yield). h nmr (22 c, 500.1 mhz, cd2cl2) : 7.21 (d, aryl, 2 h), 7.14 (t, aryl, 2 h), 7.01 (t, aryl, 1 h), 6.93 (s, aryl, 3 h), 4.26 (sept, ch(ch3)2, 2 h), 4.10 (s, ch2ph, 2 h), 1.65 (m, ch2ch2, 4 h), 1.58 (d, bu, 18 h, jhp = 13 hz), 1.24 (d, ch(ch3)2, 12 h), 1.23 (d, bu, 18 h, jhp = 13 hz). c{h } nmr (22 c, 125.8 mhz, cd2cl2) : 173.4 (s, oc = nch2ph), 147.2 (br, aryl), 146.8 (s, aryl), 128.5 (s, aryl), 127.5 (s, aryl), 124.8 (s, aryl), 123.3 (s, aryl), 122.6 (s, aryl), 47.23 (s, ch2ph), 36.01 (d, c(ch3)3, jcp = 15 hz), 35.51 (d, c(ch3)3, jcp = 15 hz), 30.97 (s, ch(ch3)2), 30.40 (s, c(ch3)3), 29.23 (s, ch(ch3)2), 26.28 (s, ch(ch3)2), 24.24 (m, ch2ch2), 23.28 (s, ch(ch3)2), 21.05 (m, ch2ch2). p{h } nmr (22 c, 202.4 mhz, cd2cl2) : 86.01 (d, jpp = 27 hz), 83.31 (d, jpp = 27 hz). calcd for c38h64n2nip2o : c, 66.57 ; h, 9.41 ; n, 4.09. found : c, 66.17 ; h, 9.49 ; n, 3.71%. in a vial was dissolved 1 (138 mg, 0.250 mmol) in 10 ml of toluene, and the solution was cooled to 35 c. to the green solution was added dropwise a similarly cold solution of phhc = o (32 mg, 0.300 mmol) in 3 ml of toluene. the solution was stirred for 7 h at room temperature, during which time the color gradually changed from green to brown to finally a dark navy blue color. the dark solution was filtered, dried under vacuum, extracted with 50 ml of et2o, filtered, concentrated, and cooled to 35 c for 2 d to afford large blue needles and powder of (dtbpe)ni{o, c : ochphn(2,6-pr2c6h3) } (11) (137 mg, 0.207 mmol, 83% yield), which was filtered and washed with cold petroleum ether. h nmr (22 c, 500.1 mhz, c6d6) : 8.15 (d, aryl, 2 h), 7.39 (d, aryl, 1 h), 7.33 (t, aryl, 1 h), 7.18 (m, aryl, 2 h), 7.01 (d, aryl, 1 h), 6.63 (d, aryl, 1 h), 4.27 (sept, ch(ch3)2, 2 h), 1.94 (d, ch(ch3)2, 3 h), 1.88 (d, ch(ch3)2, 3 h), 1.57 (d, bu, 9 h, jhp = 13 hz), 1.45 (d, bu, 9 h, jhp = 12 hz), 1.30 (d, bu, 9 h, jhp = 12 hz), 1.27 (d, ch(ch3)2, 3 h), 1.09 (br, ch2, 2 h), 0.88 (br, ch2, 2 h), 0.73 (d, bu, 9 h, jhp = 12 hz), 0.47 (d, ch(ch3)2, 3 h). note : the ochph proton could not be located in the h nmr spectrum. c{h } nmr (22 c, 125.8 mhz, c6d6) : 157.4 (s), 152.8 (s), 148.9 (s, aryl), 147.6 (s, aryl), 127.5 (s, aryl), 126.5 (s, aryl), 124.3 (s, aryl), 122.8 (s, aryl), 122.6 (s, aryl), 114.3 (s, aryl), 35.32 (d, c(ch3)3, jcp = 6 hz), 35.17 (d, c(ch3)3, jcp = 6 hz), 34.78 (d, c(ch3)3, jcp = 13 hz), 34.37 (d, c(ch3)3, jcp < 3 hz), 31.02 (br), 30.47 (br), 30.24 (br), 29.92 (br), 29.79 (br), 27.46 (s, ch(ch3)2), 26.84 (s, ch(ch3)2), 25.50 (s, ch(ch3)2), 23.84 (s, ch(ch3)2), 23.59 (m, ch2ch2), 19.59 (m, ch2ch2). p{h } nmr (22 c, 202.4 mhz, c6d6) : 75.45 (d, jpp = 6 hz), 69.29 (d, jpp = 7 hz). calcd for c37h63nnip2o : c, 67.48 ; h, 9.64 ; n, 2.13. found : c, 67.22 ; h, 9.78 ; n, 2.10%. in a schlenk flask equipped with a stir bar was dissolved 1 (126 mg, 0.228 mmol) in et2o, and the solution was degassed and cooled to 78 c. to the cold green solution was added excess co2 (25 c, 1 atm) for several minutes, and the solution was allowed to slowly reach room temperature. upon reaching 0 c the solution changed slowly to a pale yellow, and a pale yellow precipitate formed upon reaching room temperature. the solution was allowed to stir for an additional 2 h at room temperature, the solvent was removed under reduced pressure, and the flask was taken into the box. the solids were filtered and washed with cold et2o / petroleum ether (2:1), and the solids were dried under vacuum to afford crude (dtbpe)ni{o, c : oc(o)n(2,6-pr2c6h3) } (12) as a pale yellow solid (128 mg, 0.214 mmol, 94% yield). analytically pure complex 12 can be obtained by dissolving the crude product in a minimum of ch2cl2, filtering the golden brown solution, layering the filtrate carefully with excess et2o, and cooling the solution to 35 c for 2 d (2 crops, 71 mg, 0.119 mmol, 52% yield). h nmr (22 c, 500.1 mhz, cd2cl2) : 6.97 (m, aryl, 3 h), 4.00 (sept, ch(ch3)2, 2 h), 1.70 (m, ch2, 4 h), 1.65 (d, bu, 18 h, jhp = 13 hz), 1.25 (d, ch(ch3)2, 6 h), 1.21 (d, bu, 18 h, jhp = 13 hz), 1.18 (d, ch(ch3)2, 6 h). c{h } nmr (22 c, 125.8 mhz, cd2cl2) : 170.5 (br, co2), 147.1 (s, aryl), 144.2 (s, aryl), 124.3 (s, aryl), 122.6 (s, aryl), 36.91 (d, c(ch3)3, jcp = 16 hz), 35.65 (d, c(ch3)3, jcp = 16 hz), 30.35 (s, c(ch3)3), 29.48 (s, ch(ch3)2), 25.82 (s, ch(ch3)2), 24.24 (m, ch2ch2, jcp = 12 hz), 22.86 (s, ch(ch3)2), 21.23 (m, ch2ch2, jcp = 11 hz). p{h } nmr (22 c, 202.4 mhz, cd2cl2) : 89.71 (d, jpp = 28 hz), 85.67 (d, jpp = 28 hz). ir (caf2, fluorolube) : 2955 (w), 1617 (s, co), 1588 (m), 1468 (m), 1431 (m), 1371 (w), 1360 (w), 1321 (w) cm. elemental analysis and single - crystal x - ray diffraction methods were consistent with complex (dtbpe)ni{-oc(o)n(2,6-(chme2)2c6h3) } retaining one molecule of ch2cl2. calcd for c32h53cl2nnip2 : c, 56.41 ; h, 8.73 ; n, 2.06. found : c, 57.72 ; h, 8.53 ; n, 2.05%. a 50 ml round - bottom flask was charged with 3 (80 mg, 0.152 mmol), attached to an adapter, and evacuated. petroleum ether (10 ml) was vacuum transferred into the flask, and 1 atm co2 was introduced. the solution became slightly red then lightened to a pale yellow, and a small amount of precipitate formed. after 30 min the co2 was removed, and the solution was dried under reduced pressure. the solids were extracted with 10 ml of et2o, filtered, and cooled to 35 c to provide yellow crystals of 13 (58 mg, 0.094 mmol, 62%). h nmr (22 c, 500 mhz, cd2cl2) : 2.29 (d, c10h15, 3 h), 2.01 (s, c10h15, 6 h), 1.68 (d, c10h15, 3 h), 1.64 (d, c10h15, 3 h), 1.54 (d, (ch3)3, 36 h), 1.52 (d, ch2, 4 h). c{h } nmr (22 c, 125.8 mhz, cd2cl2) : 157.9 (s, co2), 40.9 (s, ad), 38.4 (s, ad), 37.6 (t, c(ch3)3, jpc = 6.0 hz), 31.8, (s, ad), 31.1 (d, (ch3)3, jpc = 6.2 hz), 23.1 (m, ch2). p{h } nmr (22 c, 202.4 mhz, cd2cl2) : 87.7 (s). ir (caf2, fluorolube) : 1667(s, co), 1624(s, co), 1481(w), 1465(s), 1377(s), 1352(s) cm. a schlenk tube was charged with 2 (76 mg, 0.149 mmol) and 6 ml of benzene. the solution was degassed and heated to 80 c for 16 h. the tube was then opened in air, and the solvent was removed under reduced pressure. azomesitylene was purified on a silica gel column with 5:1 hexanes / etoac as eluent to give red crystals (16 mg, 0.060 mmol, 40%). h nmr (22 c, 500 mhz, cdcl3) : 6.95 (s, c6me3h2, 2 h), 2.40 (s, c6me3h2, 6 h), 2.32 (s, c6me3h2, 3 h). c{h } nmr (22 c, 125.8 mhz, cdcl3) : 130.3 (s, mes), 129.8 (s, mes), 128.2 (s, mes), 127.6 (s, mes), 22.4 (s, ch3), 21.7 (s, ch3).. computational studies of complex 1 utilized density functional theory (specifically, oniom(m06/6 - 311+g(d):uff) ; geometry optimizations started from the reported crystal structure, using the gaussian 09 code. at this optimized geometry, multiconfiguration self - consistent field (mcscf) computations were performed utilizing the complete active space (cas) formalism within the gamess code. complex (dtbpe)ni = n(2,6-pr2c6h3) (1) is a green crystalline species that possesses a ni n formal bond order of two and should therefore react similar to the carbene complex (dtbpe)ni = cph2 or phosphinidene (dtbpe)ni = p(dmp). likewise, the imido relatives (dtbpe)ni = n(mes) (2, turquoise) and (dtbpe)ni = n(1-ad) (3, red) can also be prepared, and their chemistry can be similarly explored. complexes 2 and 3 are obtained by a different route than 1, using the corresponding organic azide and ni(0) precursor (scheme 1). complex 1 is synthesized via a one - electron oxidation of the three - coordinate ni(i) complex (dtbpe)ni{nh(2,6-pr2c6h3) } with the weak oxidant [c7h7][pf6 ] followed by deprotonation with na{n(sime3)2 } (scheme 2). although this protocol is reliable, with each reaction being high yielding, it has two disadvantages : (i) it is a stepwise process to remove overall an h atom, and (ii) the synthesis of (dtbpe)ni{nh(2,6-pr2c6h3) } involves the use of the precursor [(dtbpe)ni(-cl)]2, a complex prepared in moderate yield from one - electron reduction of (dtbpe)nicl2 with kc8 (scheme 2). the use of a ni(i) precursor is required given that attempts to transmetallate and dehydrohalogenate (dtbpe)nicl2 with 2 equiv of li{nh(2,6-pr2c6h3) } resulted in complicated mixtures that contained traces of 1 and other species such as (dtbpe)ni{nh(2,6-pr2c6h3)}. to improve the overall yield of [(dtbpe)ni(-cl)]2, we reported a comproportionation reaction using easy - to - prepare ni(0) and ni(ii) complexes, namely, (dtbpe)ni(cod) and (dtbpe)nicl2. complex [(dtbpe)ni(-cl)]2 can be prepared quantitatively from these two reagents (scheme 2) akin to sigman s reported n - heterocyclic carbene complex of ni(i). notably, the synthesis of [(dtbpe)ni(-cl)]2 from this reaction does not require isolation or purification of the ni(ii) and ni(0) starting materials since it can be produced by simply adding premixed solutions of ni(cod)2 with dtbpe and nicl2 with dtbpe over several hours. likewise, to obviate the need for separate oxidation and deprotonation steps, a h atom - abstraction reaction with the radical meso (mes = 2,4,6-bu3c6h2) was used for the direct preparation of 1. smith and hillhouse have applied this strategy to prepare cobalt imido and other nickel imido derivatives, respectively. consequently, a more convenient route to multigram quantities of imido 1 is shown in scheme 3 via a comproportionation reaction to form [(dtbpe)ni(-cl)]2, followed by transmetalation with li{nh(2,6-pr2c6h3) } to yield (dtbpe)ni{nh(2,6-pr2c6h3) } in 92% yield, and then the protocol was completed by h atom abstraction with meso. separation of 1 from the homes byproduct can be achieved by fractional crystallization to provide 1 in 90% yield (scheme 2). preliminary reactivity studies confirmed that the imido ligand in 1 can be readily carbonylated with co to form o = c = n(2,6-pr2c6h3) or with cnch2ph to form the asymmetric carbodiimido phch2n = c = n(2,6-pr2c6h3). similar reactions have been explored with 2 and 3. in both reactions, the -isocyanate or -carbodiimido intermediate could be isolated. in addition, [2 + 2 ] cycloaddition of ethylene across the ni = n bond in 1 has been shown to be a crucial step in the formation of aziridines, via an elusive azametallacyclobutane intermediate. the 2001 report by mindiola and hillhouse of complex 1 foreshadowed a tremendous upsurge in interest in late transition - metal multiply bonded complexes. the original crystallographic report has several hallmarks of a complex engineered to have sufficient stability to permit solid - state analysis a bulky bidentate supporting ligand, a sterically hindering imido n substituent, and hints of further stabilization of the -loaded imido nitrogen via resonance with the aryl substituent (cf. however, as detailed above, these features belie a remarkable diversity of reactivity for complex 1 encompassing both even- and odd - electron processes as well as reactions involving homolytic (radical) and heterolytic (acid / base) transformations. a previous computational study in 2008, inspired by the original experimental reports by mindiola and hillhouse, indicated that subtle changes to the ligands and substituents markedly affect the computed kinetics and thermodynamics for highly desirable reactions such as c h bond activation. to this end, the electronic structure of 1 was scrutinized anew using theoretical methods not feasible on such a large complex when the earlier reports were published. the pr and bu substituents on the imidoaryl and dtbpe ligands, respectively, were modeled with the universal force field, while the remainder of the complex was described at the m06/6 - 311+g(d) level of theory. as expected, good agreement with the reported crystal data was obtained (coordinates in supporting information), and tests with other functionals pure (bp86) and hybrid (b3lyp)gave similar results. the density functional theory - optimized geometry was then used as the basis to analyze the electronic structure of 1 with mcscf techniques employing the cas approximation with active spaces ranging from two - orbital / two - electron (cas(2,2)) to 14-orbital/14-electron (cas(14,14)). the salient features of the frontier natural orbitals are similar among the various cas calculations ; therefore, focus is given to the pertinent orbitals of the latter, largest active space mcscf simulations. nimido and orbitals that lie within the plane defined by the nip2n coordination plane (figure 1). the ca(14,14) calculations assign a substantial population to the latter orbital, 0.24 e, and thus the correlating has a natural orbital occupation number (noon) of 1.76 e. these orbitals noons are those computed to deviate most significantly from the archetypal values of 2 and 0 e, and thus the mcscf calculations are indicative of significant -biradical character to the ni - imido moiety, consistent with the ability of 1 to abstract an h atom from hsn(bu)3. additionally, the -biradical nature of 1 implies a formal bond order of less than three despite the nearly linear coordination of the imido functionality, which obviously assists the [2 + 2 ] cycloaddition and 1,3-dipolar addition chemistry of complex 1 and its congeners. computed frontier orbitals (and) of complex 1 in the plane defined by the n and the two p atoms. illustration of the and orbitals in 1 perpendicular to the plane defined by the n and two p. hydrogen atoms omitted from figure for clarity. the in - plane nin / orbitals just discussed may be contrasted to the perpendicular orbitals (figure 2). the orbital (figure 2, left ; noon = 1.97 e) is heavily polarized toward the imido n with small ni character but delocalized onto the imido aryl ring, { 2,6-pr2c6h3}. electron correlation is not of the bond / antibond variety (cf. figure 1) but with an orbital that has an additional radial node (figure 2, right ; noon = 0.03 e). the additional radial node in the right diagram in figure 2 is clear ; note that like its bonding counterpart, there is delocalization of electron density onto the imido 2,6-pr2c6h3 ring for both members of this correlating pair of orbitals. these mcscf orbitals imply that in this plane the ni n -bond may be best viewed more as a nimido lone pair, with potentially high nucleophilic or basic reactivity. as with the biradical character, the bonding analysis suggests a further diminution of the nickel nitrogen bond order below the ideal value of three that a cursory glance at its linear coordination mode might imply. computed natural orbitals showing delocalization of -electron density from imido nitrogen of 1 onto the 2,6-pr2c6h3 ring : noon = 1.94 (left) and 0.06 e (right). the final pair of orbitals of interest from the mcscf computations are plotted below (figure 3). these orbitals highlight the substantial interaction between the imido n and the -ring of the aryl substituent. much of the experimental emphasis on late metal imidos has focused on the steric protection of the metal the present computations suggest the great potential to synthetically tune the reactivity of these and related late metal aryl - imido moieties via the introduction of electron - donating and -withdrawing groups onto the meta and para aryl ring positions. as such, with reduced metal nitrogen bond orders and synthetic tunability, one may easily envisage derivatives of 1 providing improved routes to c h bond amination that can complement known metal - catalyzed routes to c the observation that the frontier symmetry orbitals displayed in figures 13 are heavily composed of nimido character suggests that these systems should be quite basic. because the three - coordinate anilide cation [(dtbpe)ni = nh(2,6-pr2c6h3)][pf6 ] can be deprotonated by nan(sime3)2, the pka of the anilide can be coarsely estimated to be less than 30. we thus examined phenylacetylene as a substrate because its pka is slightly less than 30 in dimethyl sulfoxide. accordingly, treatment of the imidos 13 with hccph in et2o results in rapid and clean formation of analytically pure phenylacetylidene amides, as red crystals of (dtbpe)ni{nh(2,6-pr2c6h3)}(ccph) (4), (dtbpe)ni{nh(mes)}(ccph) (5), and orange crystals of (dtbpe)ni(nh{1-ad})(ccph) (6), in 81%, 90%, and 86% isolated yields, respectively (scheme 4). these results imply that the anilide in [(dtbpe)ni = nh(2,6-pr2c6h3)][pf6 ] has a pka from 29 to 35. since the imidos 2 and 3 are not prepared by amide deprotonation we do not know their basicity ; however, complex 2 most likely has a similar pkb to 1. for example, the h and c nmr spectra of complex 4 reveals the amide (nh, 1.93 ppm) and acetylide moieties (ccph, 107 and 114 ppm), respectively. the acetylide -c reveals diagnostic jcp = 96 and 41 hz, respectively, for trans and cis coupling to dtbpe, which are much greater than the coupling observed for the acetylide -c jcp = 21 hz to the trans phosphorus. because of the lack of c2 symmetry, the p nmr spectrum shows a pair of doublets for the dtbpe ligand with the respective jpp values listed in table 1. infrared spectra of 5 and 6 further confirm a terminal acetylide ligand with cc = 2091 and 2153 cm, respectively. x - ray crystallographic analysis of a single crystal of 4 grown from a saturated et2o solution cooled to 35 c reveals a square - planar ni(ii) complex with cis acetylide and anilide ligands (figure 4). n bond length in 4 is significantly longer at 1.933(3) than that observed in [(dtbpe)ni = n(h)(2,6-pr2c6h3)][pf6 ] (1.768(14)) because of the now filled ni d - orbital (of b2 symmetry) in an ideal square planar and c2 symmetric environment. the lone pair on the anilide nitrogen in 4 can no longer donate to the metal, hence, the pyramidalization. solid - state structural diagram of complex 4 (thermal ellipsoids at 50% probability). one chemically equivalent but crystallographically independent molecule along with two et2o molecules confined in the asymmetric unit were omitted for clarity. the coupling of amines with alkynes is a relatively difficult, yet synthetically desirable, process for the construction of versatile synthetic precursors. complexes 46 could be considered analogous to intermediates in a reaction coupling these two organic fragments. accordingly, reaction of 4 with co (78 c, 1 atm) completely converted this nickel species to the known biscarbonyl complex (dtbpe)ni(co)2 based on p nmr spectroscopy. the mass spectrum of the major organic was consistent with the reductive elimination of the alkyne and amide ligands (scheme 4). ynamines, especially those containing a secondary amine as in the case of phccnhar, are known to tautomerize to keteneimines spontaneously. the h nmr spectrum of this new organic product revealed a diagnostic vinylic singlet at 5.62 consistent with the rearranged keteneimine phch = c = nar being produced. it has been shown that nickel complexes supporting a terminal imido ligand can engage in some cycloaddition chemistry, and in some cases, the imido can be completely transferred to ethylene, co, and cnr. iron and cobalt imidos have been also shown to be reactive with these substrates. consequently, we examined the reactivity of 46 with other unsaturated, small molecules. accordingly, diphenylketene (o = c = cph2) smoothly reacted to afford the oxy metallacyclobutane species (dtbpe)ni{o, c : oc(cph2)=n(r) } shown in scheme 5 (r = 2,6-pr2c6h3 (7), mes (8), 1-ad (9)). formation of 79 is nearly quantitative, although isolated yields can range from 95 to 72%. the p nmr spectra reveal two inequivalent phosphorus nuclei with their corresponding jpp values between 13 and 20 hz (table 1). because the lowest unoccupied molecular orbital of o = c = cph2 is augmented mostly with o c character, one would expect [2 + 2]-cycloaddition to take place by o = c addition across the ni = n to form an aza oxy metallacyclobutane. indeed, the c nmr spectra of 79 show a highly deshielded resonance at 170 ppm in accord with a carbon atom possessing electron - withdrawing groups (table 1). to determine unambiguously the type of metallacycle formed, a single - crystal x - ray diffraction study of 7 was performed. to our surprise, the solid - state structure of 7 revealed a square planar oxy nickel cyclobutane species, whereby the imido had virtually undergone insertion into the electrophilic carbon of the ketene (figure 5). n = 1.280(2) is consistent with a double bond, while all metrical parameters in the metallacycle suggest single bonds in the nioc2 ring. formation of 79 implies that cycloaddition across the ni = n took place, though it can not be distinguished whether initial o = c versus c = c bond addition took place based on these data. o, c - cycloaddition of the ketene group across ni = n to form metallacycle a is the preferred pathway given the frontier orbitals of o = c = cph2. from a, two routes can take place : (i) homo or heterolytic ni n bond cleavage and rotation about the c o bond or (ii) retrocycloaddition to form a nickel oxo b and keteneimine rn = c = cph2, which can add across the c = c bond to form the nioc2 ring. the propensity of a terminal nickel alternatively, ketene can add via the c c bond to form the azametallacyclobutane c, which, analogously to a, can undergo two similar pathways, namely, ni n bond rupture or retrocycloaddition (via the nickel carbene d), to ultimately form the ni solid - state structural diagram of complexes 7 (left) and 10 (right) with thermal ellipsoids at 50% probability. one et2o molecule in the asymmetric unit was omitted from the structure of 10. to isolate an aza oxy metallacyclobutane species such as a, the reactivity of 1 with the less sterically hindered isocyanate o = c = nch2ph was investigated. accordingly, it was found that the o, c - cycloaddition product (dtbpe)ni{o, c : oc = nch2phn(2,6-pr2c6h3) } (10) could be isolated in 90% yield as green - colored crystals (scheme 5). salient spectroscopic data for 10 are shown in table 1, with the most notable feature being the c = n resonance at 173.4 ppm in the c nmr spectrum. like complexes 49, compound 10 also lacks c2 symmetry but has a stronger jpp value of 27 hz when compared to complex 7, as a result of the phosphines of the dtbpe ligand not being pushed back due to the sterically congested cph2 group. therefore, one would expect less of a distortion from a square planar geometry. a solid - state structure of 10 confirms formation of a rare example of an aza oxy nickel cyclobutane square planar complex with an elongated ni n bond (1.939(6)) as compared to the imido precursor 1 (figure 5). examples of n, o - bound ureates resulting from isocyanate cycloaddition across early transition metals having a terminal imido ligand have been reported. the ni o bond length (1.864(5). similar cycloaddition chemistry of 1 was observed with benzaldehyde, which gave the aza oxy nickel cyclobutane complex (dtbpe)ni{o, c : ochphn(2,6-pr2c6h3) } (11) in 83% yield. overall, the nmr spectroscopic features of 11 are similar to those of complex 10, and the solid - state structure confirms a square planar aza oxy nickel cyclobutane scaffold with ni n = 1.924(4) and ni o = 1.842(3) distances that compare favorably to those of 10 (figure 6). solid - state structural diagram (thermal ellipsoids at 50% probability) of complexes 11 (left) and 12 (right). one et2o molecule for 11 and one ch2cl2 molecule for 12, found in the asymmetric unit, are excluded for clarity. exposure of a cold et2o solution of 1 to 1 atm co2 resulted in the gradual precipitation of a pale yellow solid containing (dtbpe)ni{o, c : oc(o)n(2,6-pr2c6h3) } (12) (scheme 5). the reaction is quantitative by p nmr spectroscopy, and yellow solids of 12 can be isolated in 94% yield. in addition to displaying two inequivalent phosphine resonances (jpp = 28 hz) akin to the other nickel metallacycles, the most salient spectroscopic feature in 12 is the presence of a broad c nmr resonance at 170.5 ppm in accord with a [2 + 2]-cycloadded co2 carbon. likewise, co = 1617 cm in the infrared region corroborates the presence of this carbonyl functionality. a solid - state structure of 12 is shown in figure 6 and again depicts a square planar nickel complex possessing a metallalactam or carbamate framework due to [2 + 2 ] cycloaddition of co2 across the ni = n bond with distances of ni o = 1.9334(15) and ni n = 1.8912(13). from the metrical parameters, the terminal oxygen (c = o(2) = 1.229(2)) is part of a carbonyl functionality, while the other half of the co2 has been reduced to a single bond, c o(1) = 1.340(2) as part of the metallacycle. when exploring the chemistry of the more electron - rich imido complex 3, a different outcome is observed. treating 3 with a bed of co2 resulted in quick formation of the yellow complex (dtbpe)ni{o, o:(oc(o))2n(1-ad) } (13) in 62% isolated yield (scheme 5). formation of 13 most likely involves a [2 + 2]-cycloaddition intermediate (dtbpe)ni{o, c : oc(o)n(1-ad) }, like 12, followed by co2 insertion into the more electron - rich and less - hindered ni the reactivity of co2 with 3 mirrors that of (dtbpe)ni = cph2, which resulted in six - membered ring formation observed in (dtbpe)ni{o, o:(oc(o))2cph2)}. nmr spectra of 13 are indicative of a c2v - symmetric complex, while the ir spectrum shows two carbonyl stretches co = 1667 and 1624 cm. attempts to prepare the (dtbpe)ni{o, c : oc(o)n(1-ad) } using 1 equiv of co2 resulted in formation of 13 along with unreacted starting material. for example, electron - rich ti = n bonds tend to undergo metathesis with co2 to form the titanium oxo, while aryl - substituted imido complexes such as cpti = n{2,6-me2c6h3}{mec(nipr)2 } can undergo cyloaddition of 1 equiv of co2 to form the n, o - bound carbamate, which can further react with another equivalent of co2 to form the azadicarboxylate ligand [(oc(o))2n(2,6-me2c6h3) ]. lastly, we explored the thermal stability of imido 2 because it is known that (2,2-bipyridine)niet2 reacts with excess mesitylazide to give azomesitylene (mesn = nmes). (2,2-bipyridine)ni = nmes is a key species en route to the formation of the azomesitylene, a hypothesis that partially prompted the synthesis of 1. hence, heating a benzene solution of 3 revealed formation of azomesitylene, which can be isolated as red crystals in 40% yield (scheme 5). the thermolysis of 3 demonstrates that the nitrene fragments from a nickel imido can couple to give azoarenes and provides some support to the idea of an imido intermediate in the formal coupling of mesitylazide by (2,2-bipyridine)niet2. this thermolysis is also related to the report that fe2(co)9 can decompose phenylazide to azobenzene. in this work we presented three synthetic pathways to mononuclear nickel imido complexes having aliphatic or aromatic groups and reported reactivity involving the ni = n motif. a reinvestigation utilizing high - level ab initio quantum chemistry techniques is given for the original ni - imido complex reported in 2001. the computational analysis of 1, coupled with the newly disclosed reactivity studies reported herein, paint a picture of this late metal imido complex as being able to effect both one- (i.e., radical) and two - electron (e.g., deprotonation of terminal alkynes) transformations given the biradical and highly nimido - localized nature of the frontier orbitals of 1. moreover, delocalization of these same frontier orbitals from the / orbitals of the ninimido active site to the aryl imido substituent suggests considerable potential to tune the reactivity of 1 and other late metal imido complexes among these disparate reactivity manifolds through judicious manipulation of the chemical environment about the active site. in addition to c h activation reactions (both homolytically and presumably heterolytically), we include examples of cycloaddition chemistry of 1 with various electrophiles including some cumulenes. taking advantage of the acidic c h bond in hccph, it is shown that imido group in 1 can couple to acetylide to ultimately form a keteneimine. the imido moiety can also engage in cycloaddition and subsequent insertion or isomerization pathways to form unusual nickel metallacycles. while 1 seems to only cycloadd small molecules such as ketenes, isocyanates, aldehydes, and co2, more electron - rich alkyl the delocalization of the frontier orbitals between nin and nar / orbitals is also consistent with the greater reactivity of 3 than 1. in contrast, reducing steric bulk on the arylimido group can allow for reductive coupling. | the three - coordinate imidos (dtbpe)ni = nr (dtbpe = tbu2pch2ch2ptbu2, r = 2,6-ipr2c6h3, 2,4,6-me3c6h2 (mes), and 1-adamantyl (ad)), which contain a legitimate ni n double bond as well as basic imido nitrogen based on theoretical analysis, readily deprotonate hccph to form the amide acetylide species (dtbpe)ni{nh(ar)}(ccph). in the case of r = 2,6-ipr2c6h3, reductive carbonylation results in formation of the (dtbpe)ni(co)2 along with the n c coupled product keteneimine phch = c = n(2,6- ipr2c6h3). given the ability of the ni = n bond to have biradical character as suggested by theoretical analysis, h atom abstraction can also occur in (dtbpe)ni = n{2,6-ipr2c6h3 } when this species is treated with hsn(nbu)3. likewise, the microscopic reverse reaction conversion of the ni(i) anilide (dtbpe)ni{nh(2,6-ipr2c6h3) } to the imido (dtbpe)ni = n{2,6-ipr2c6h3}is promoted when using the radical meso (mes = 2,4,6-tbu3c6h2). reactivity studies involving the imido complexes, in particular (dtbpe)ni = n{2,6-ipr2c6h3 }, are also reported with small, unsaturated molecules such as diphenylketene, benzylisocyanate, benzaldehyde, and carbon dioxide, including the formation of c n and n n bonds by coupling reactions. in addition to nmr spectroscopic data and combustion analysis, we also report structural studies for all the cycloaddition reactions involving the imido (dtbpe)ni = n{2,6-ipr2c6h3}. |
it represents about 7% of all soft tissue sarcomas and when it affects the skin, this tumor may be subdivided into two main categories : primary and secondary. primary cutaneous leiomyosarcoma (pcl) of the skin is a rare soft tissue tumor that accounts for about 23% of all superficial soft tissue sarcomas. a 77-year - old male, a farmer and a chronic tobacco chewer, presented with a sacral mass since 3 months. to begin with, he developed a small nodule in the sacral region 8 months back and was operated for the same. after the operation, there was an ulcerative lesion that increased in size to develop into the present sacral mass. clinical examination revealed a mass in the sacral region measuring 7 cm 5 cm 5 cm with ulceration of the skin measuring 3 cm 2 cm. his hemoglobin, complete blood count, liver and kidney function tests were normal and he was nonreactive for human immunodeficiency virus and hepatitis b surface antigen. grossly, a specimen of an excised mass covered with skin measuring 10 cm 8 cm 6.5 cm was received. the skin showed brownish discoloration and ulceration of 3 cm 2 cm [figure 1a ]. the cut surface revealed a nodular grayish - white, soft fleshy tumor measuring 7 cm 5 cm 5 cm [figure 1b ]. microscopically, the tumor comprised of fascicles of spindle cells with focal areas of hemorrhage and necrosis. the mitotic activity was 20/10 high - power fields, with the presence of atypical mitosis [figure 2b ]. the surgical cut margins except the base were free of tumor. a specimen of an excised mass covered with skin measuring 10 cm 8 cm 6.5 cm. the skin showed brownish discoloration and ulceration of 3 cm 2 cm (a). cut surface revealed a nodular grayish - white, soft, fleshy tumor measuring 7 cm 5 cm 5 cm (b) microscopically, the tumor comprised of fascicles of spindle cells with cigar - shaped nuclei (hematoxylin and eosin stain ; 100) the tumor showed marked nuclear pleomorphism with tumor giant cells, mitosis and presence of inflammatory infiltrate (hematoxylin and eosin stain ; 400) the tumor cells were immunoreactive for smooth muscle actin (sma) while being negative for s-100, desmin, ck-7 and cd34 figure 3. the tumor cells were immunoreactive for smooth muscle actin (ihc, 400) grossly, a specimen of an excised mass covered with skin measuring 10 cm 8 cm 6.5 cm was received. the skin showed brownish discoloration and ulceration of 3 cm 2 cm [figure 1a ]. the cut surface revealed a nodular grayish - white, soft fleshy tumor measuring 7 cm 5 cm 5 cm [figure 1b ]. microscopically, the tumor comprised of fascicles of spindle cells with focal areas of hemorrhage and necrosis. the mitotic activity was 20/10 high - power fields, with the presence of atypical mitosis [figure 2b ]. the surgical cut margins except the base were free of tumor. a specimen of an excised mass covered with skin measuring 10 cm 8 cm 6.5 cm. the skin showed brownish discoloration and ulceration of 3 cm 2 cm (a). cut surface revealed a nodular grayish - white, soft, fleshy tumor measuring 7 cm 5 cm 5 cm (b) microscopically, the tumor comprised of fascicles of spindle cells with cigar - shaped nuclei (hematoxylin and eosin stain ; 100) the tumor showed marked nuclear pleomorphism with tumor giant cells, mitosis and presence of inflammatory infiltrate (hematoxylin and eosin stain ; 400) the tumor cells were immunoreactive for smooth muscle actin (sma) while being negative for s-100, desmin, ck-7 and cd34 figure 3. grossly, a specimen of an excised mass covered with skin measuring 10 cm 8 cm 6.5 cm was received. the skin showed brownish discoloration and ulceration of 3 cm 2 cm [figure 1a ]. the cut surface revealed a nodular grayish - white, soft fleshy tumor measuring 7 cm 5 cm 5 cm [figure 1b ]. microscopically, the tumor comprised of fascicles of spindle cells with focal areas of hemorrhage and necrosis. the mitotic activity was 20/10 high - power fields, with the presence of atypical mitosis [figure 2b ]. the surgical cut margins except the base were free of tumor. a specimen of an excised mass covered with skin measuring 10 cm 8 cm 6.5 cm. the skin showed brownish discoloration and ulceration of 3 cm 2 cm (a). cut surface revealed a nodular grayish - white, soft, fleshy tumor measuring 7 cm 5 cm 5 cm (b) microscopically, the tumor comprised of fascicles of spindle cells with cigar - shaped nuclei (hematoxylin and eosin stain ; 100) the tumor showed marked nuclear pleomorphism with tumor giant cells, mitosis and presence of inflammatory infiltrate (hematoxylin and eosin stain ; 400) the tumor cells were immunoreactive for smooth muscle actin (sma) while being negative for s-100, desmin, ck-7 and cd34 figure 3. pcl arises between the ages of 50 and 70 years, with a male to female ratio of 2:1 to 3:1. this tumor shows a greater predilection for the lower limbs ; 5075% of the lesions appear on the lower limbs, 2030% on the upper limbs and 1015% on the trunk. the cause of pcl is unknown, but the most common predisposing factors suggested are physical trauma and exposure to radiation.[24 ] cutaneous leiomyosarcomas are divided into two subtypes depending on the location of the tumor. the superficial dermal form of leiomyosarcoma is thought to arise from the arrector pili muscle whereas the deep subcutaneous type is thought to arise from the smooth muscle of the vascular wall. they clinically present with solitary, well - circumscribed nodules ranging from 0.4 to 6 cm. the skin over the dermal type is usually erythematous or brownish in color and, in the subcutaneous form, has a normal appearance. in general, dermal tumors appear adhered to the epidermis with frequent ulceration of skin with or without crusts, while subcutaneous tumors are mobile. our patient was a 77-year - old male who presented with a sacral mass of 7 cm 5 cm 5 cm, with brownish discoloration and ulceration of the skin. as he was a farmer by occupation, there is possibility of trauma, which might have gone unnoticed in his case. histologically, they consist of fascicles of spindle - shaped cells bearing cigar shaped generally accepted features of malignancy include the presence of mitoses of 2/ 10 high - power fields, high cellularity, significant nuclear atypia and tumor giant cells. kaddu has described two different growth patterns : a nodular pattern that is quite cellular with nuclear atypia, many mitoses and a diffuse pattern that is less cellular with well - differentiated smooth muscle cells and less mitoses. unusual morphological variants of cutaneous leiomyosarcoma that have been described include epithelioid, granular cell, desmoplastic, inflammatory and myxoid leiomyosarcoma. in poorly differentiated tumors cutaneous leiomyosarcoma may show different immunophenotypes thus emphasizing the importance of using a large panel of antibodies (sma, hhf-35, desmin, vimentin, cytokeratins and s-100 protein) in immunohistologic diagnosis. the histological findings in this case were that of a poorly differentiated inflammatory leiomyosarcoma with high mitotic activity and necrosis. the tumor also had a diffuse inflammatory component because of which the histological diagnosis of malignant fibrous histiocytoma was favored. the benign and malignant tumors that have to be differentiated from pcl are schwannoma, plexiform neurofibroma, dermatofibroma, leiomyoma, fibroacanthoma, malignant melanoma, spindle cell synovial sarcoma, spindle cell carcinoma and malignant fibrous histiocytoma. the most effective treatment for pcl is wide excision, with a 35 cm lateral margin and a depth that includes subcutaneous tissue and fascia. local excision without adequate margins leads to recurrence and increases the risk for metastatic and fatal disease. while superficial dermal leiomyosarcoma have been reported to show local recurrence rates of 3050% and rarely metastasize, subcutaneous leiomyosarcoma recur up to 70%, and the metastatic rate has been reported in 3040% of the cases. it is important to ascertain that excision is complete by pathologic examination because the quality of the surgical treatment influences the prognosis. jensen. had identified several poor prognostic factors, namely tumor size more than 5 cm, deep location with fascia involvement, high malignancy grade and acral distribution. all the above poor prognostic factors were present in this case and thus the patient came back with a local recurrence after 8 months. | primary cutaneous leiomyosarcoma of the skin is a rare soft tissue neoplasm, accounting for about 23% of all superficial soft tissue sarcomas. it arises between the ages of 50 and 70 years, and shows a greater predilection for the lower extremities. clinically, it presents with solitary, well - circumscribed nodule and, microscopically, consists of fascicles of spindle - shaped cells with cigar shaped nuclei. local recurrence is known in this tumor. we document a case of primary cutaneous leiomyosarcoma in a 77-year - old man and discuss the histological features and immunohistochemical profile of this uncommon neoplasm. |
although it is a relatively new modality, magnetic resonance imaging (mri) has emerged as a prominent noninvasive and nonradioactive imaging tool in diagnostic medicine and biomedical research. in general, the mri signal intensity (si) is a function of the water proton density of tissues under examination and the relative longitudinal and transverse relaxation times, t1 and t2, of the protons in the tissues. in some cases, image contrast can be directly produced by the inherent variation of proton density in different tissues by altering the various image acquisition parameters. in other cases, it is necessary to administer a contrast agent (ca) to improve the quality of the image and aid in diagnosis. the use of a contrast agent also makes it possible to visualize certain pathological regions externally, such as organs or cells of the human body via target - specific delivery of the agent. the majority of existing mri cas can be divided into two different types based on which relaxation time they alter to a greater extent, t1-weighted and t2-weighted agents. the most widely used cas in clinical imaging are the paramagnetic gd - chelates that can produce t1-weighted or positive contrast enhancement. the principal drawback of such cas is their limited relaxivity because the observed relaxivity values are usually a few percent of the theoretically attainable values predicted by the solomon bloembergen rather high tissue concentrations (0.10.3 mm) are required for these cas to be effective when used with mr scanners of low magnetic fields from 0.3 to 3.0 t. the paramagnetic relaxation enhancement has two separate components (i.e., inner - sphere and outer - sphere relaxation contributions). the mechanism of inner - sphere relaxation in small molecular gd - chelates requires that at least one water molecule be directly coordinated to the paramagnetic metal center and be able to undergo a rapid exchange with the water molecules in the outer sphere. although increasing the number of coordination water molecules can lead to a significant increase of the inner - sphere relaxivity, the thermodynamic stability and/or kinetic inertness of the gd - chelates will decrease as a result. the consequence is to make the complexes more susceptible to displacement by proteins, biological ligands, or endogenous metal ions, often resulting in the toxicity of the cas. therefore, all of the current clinical gd - chelates contain strictly one coordinated water molecule. furthermore, because of nuclear magnetic relaxation dispersion with increasing larmor frequency, the relaxivity of such cas decreases drastically with increasing magnetic field strength to render them less effective on high - field scanners. recently, the use of high - field scanners (4.7 to 9.0 t) has become increasingly prevalent because they provide greater spatial resolution, a shortened data acquisition time, and an improved signal - to - noise ratio. another drawback of these cas is that as small molecules, the gd - chelates act largely as extracellular agents because they are unable to penetrate cells without attaching to a cell - targeting vector. however, high - relaxivity and cell - penetrating superparamagnetic iron oxides (spios) have been developed as effective t2-weighted contrast agents for both clinical diagnosis and cellular imaging. however, the negative contrast enhancement produced by spios is far less desirable than that produced by the small - molecule t1 agents. for example, it is often difficult to differentiate between the darkened spots produced by the accumulation of a t2 ca and signals caused by bleeding, calcification, metal deposits, or other artifacts from the background. in addition, the high magnetic susceptibility of the t2 cas often induces a distortion of the magnetic field on neighboring normal tissues, which complicates the interpretation of mr radiograms. it should be noted that because of the strong magnetic coupling in spios, water coordination to the metal centers in such cas is not necessary. instead, the field inhomogeneity induced by the presence of the tiny magnetic particles can cause a rapid dephasing in the transverse plane, which in turn accelerates the t2 relaxation as well as the t1 relaxation, albeit to a much smaller extent for the latter. the use of nanoparticulate coordination polymers as contrast agents in different imaging modalities represents an important new direction in the development of next - generation contrast agents. of particular relevance to the design of t1-weighted mr cas is the ability to tailor the porosity, water coordination, and thermodynamic / kinetic stability in such crystalline polymers through the proper selection of the metal centers and ligands. in this article, we describe the synthesis, characterization, and mr imaging studies of biocompatible nanoparticles (nps) of a coordination polymer, kgd(h2o)2[fe(cn)6]h2o. we have demonstrated that these nps exhibit extremely large t1 relaxivity because of the presence of two water molecules coordinated to the gd(iii) center. furthermore, such nps also possesses unprecedentedly high thermodynamic stability and kinetic inertness due to the maximum ligand field stabilization energy (lfse) found in the [fe(cn)6 ] ligand, coupled with the considerable lattice energy of the extended 3d solid - state structure. we have also shown that such nps have no cytotoxicity and can be readily internalized by cells to act as effective cellular mr probes. equimolar aqueous solutions of gd(no3)3 (0.25 mmol, 20 ml) and k4[fe(cn)6 ] (0.25 mmol, 20 ml) were mixed at room temperature under vigorous stirring. the solution turned pale yellow and cloudy after continuous stirring at room temperature for ca. the reaction product was dialyzed using a regenerated cellulose tubular membrane (mwco = 12 00014 000) against distilled water for 8 h, followed by lyophilization. the solid material obtained from this process was redispersed in water by sonication to form a slurry and lyophilized one more time to increase its crystallinity. the bulk material was collected, washed with water and acetone, and dried in vacuum. an aqueous solution of gd(no3)3 (1 mm, 10 ml) containing 50 mg of sodium citrate was added dropwise to an aqueous mixture of k4[fe(cn)6 ] (1 mm, 10 ml) and pvp (111 mg, mw = 8000) under vigorous stirring for ca. 3 h. the reaction product was dialyzed using a regenerated cellulose tubular membrane (mwco is 12 00014 000) against distilled water for 2 days. metal analysis was carried out using inductively coupled plasma optical emission spectroscopy (icp - oes) with a perkinelmer optima 3200 system. a sample of 60 mg of kgd(h2o)2[fe(cn)6]h2o bulk material was first decomposed at 620 c for ca. 6 h to obtain an amorphous oxide powder that was then extracted with 5 ml of concentrated hno3. after dilution in a volumetric flask, the solution was analyzed by icp - oes for potassium, gadolinium, and iron. homogenous aqueous dispersions of nps with measured concentrations of the gd ions in the range of 5.0 10 to 3.5 10 mm were used for t1 and t2 relaxivity measurements at 25 c using a 60 mhz bruker minispec relaxometer and a 7.0 t bruker biospec small animal mri system (bruker, inc., billerica, ma). for relaxivity measurements at 1.4 t, t1 and t2 relaxiviy values were obtained from the minispec relaxometer using conventional inversion recovery (t1) and multiecho spin echo (t2) acquisitions. for relaxivity measurements at 7.0 t, an inversion recovery gradient echo sequence with te = 4 ms was used for t1 relaxiviy measurements. t2 measurements were performed using a spin - echo sequence of tr of 10 000 ms and a te of 10.6340 ms. the t1-weighted mr images were acquired using the 7.0 t scanner with a matrix size of 128 128, a field of view of 3.0 3.0 cm, a slice thickness of 0.5 mm, a te of 9.4 ms, and a tr of 13.91500 ms. data analysis was performed by fitting to relaxivity curves with self - written programs. leaching experiments were performed to verify the stability of nps under physiologically relevant conditions. about 200 mg nps were sealed in a membrane dialysis bag (mwco = 3000). this dialysis bag was gently stirred in 25 ml solutions of distilled water at ph 7 or 1 for 24 h to reach equilibrium. the leaching experiment was also conducted in saline solution or in a solution containing a biologically relevant divalent metal ion (i.e., zn, ca, or mg) at a concentration of 100 ppm for each ion with the ph value adjusted to 7.4. the resulting solutions were analyzed for free cn ions by a fluorometric method using the cyanide test kit from lamotte co. (chestertown, md ; code 7387 - 01). the calibration curve was established using the standard kcn solutions with concentrations at the ppm level. the quantitative determination of the leached gd ions was carried out by the icp - oes method. hela cells were seeded in a 96-well plate at a density of 1 10 cells per well with the dmem low - glucose medium and incubated for 12 h at 37 c in an atmosphere of 5% co2 and 95% air to allow cells to attach to the surface. cells in each well were then treated with 100 l of fresh medium containing varying concentrations of the nps and then incubated for 24 or 48 h. control wells contained the same medium without nps. the cells were incubated in media containing 0.1 mg / ml 3-[4,5-dimethylthialzol-2-yl]-2,5-diphenyltetrazolium bromide (i.e., the mtt dye) for 3 h. after the mtt solution was removed, the precipitated violet crystals were dissolved in 200 l of dmso. the assay was run in triplicate, and the results were presented as percent viable cells. to conjugate the fluorescent dye molecules to the surfaces of nps, we used a slightly modified synthetic procedure derived from the above - mentioned process for preparing pvp - citrate - coated kgd(h2o)2[fe(cn)6]h2o nps. specifically, 200 mg of pvp (mw = 40000) was added to an aqueous solution of k4[fe(cn)6 ] (1 mm, 50 ml) under stirring, followed by the addition of a 50 ml gd(no3)3 solution (1 mm) containing 100 mg of citric acid. the product was resuspended in 2 ml of aqueous pvp solution (100 mg pvp / ml). ethylenediamine (1.5 equiv) and 1-ethyl-3-(3-(dimethylamino)propyl)-carbodiimide (edc, 1.2 equiv) reagents were then added to it under vigorous stirring. the resultant mixture was stirred for 24 h before the excess ethylenediamine was removed by dialysis against distilled water for 2 days. next, 5 ml of carboxyfluorescein (0.35 mg / ml) was allowed to react with 1.2 equiv of edc (1.5 mg) for 24 h. the ethylenediamine - coated nps were then added to 2 ml of the above reaction mixture and stirred for ca. 24 h. finally, the product was dialyzed for 2 days to remove unconjugated dye molecules. the fluorescence spectrum of the dye - conjugated nps clearly showed the presence of dye molecules that are covalently bound to the surfaces of nps. confocal scanning microscopy was used to visualize the cellular uptake of the fluorescence dye - labeled nps in hela cells. the cells were first seeded in an 8-well chamber slide at a density of approximately 1.5 10 cells per well and incubated at 37 c for 24 h in a complete medium without antibiotics. the cells were then incubated with the fluorescent dye - labeled nps for 3 h at the same temperature. after the cells were washed with the pbs buffer solution three times to remove free nps, the cellular uptake of nps was directly imaged on the living cells under the confocal microscope with the 488 nm excitation wavelength. approximately 1 10 pc3 cells were placed in t25 flasks and incubated for 48 h. the cells were then rinsed with serum - free medium and incubated with varying concentrations of nps for 6 h. the treated cells were washed with pbs three times and harvested by trypsinisation. mr imaging of cell pellets was performed on a bruker 9.4-t mri scanner at 37 c using a conventional gradient echo acquisition with an inversion recovery preparation. the other acquisition parameters were field of view = 3.0 3.0 cm, matrix = 128 128, and slice thickness = 3.0 mm. intracellular gd and fe concentrations were determined from the cell lysate using icp - ms. after incubation with nps, cells were washed three times with pbs and centrifuged. cells were then lysed with concentrated nitric acid and diluted to determine the gd concentration using icp - ms. the direct combination of a soluble gd(iii) salt with k4[fe(cn)6 ] in aqueous solution resulted in the formation of a pale - yellow precipitate with the metallic ratio k / gd / fe from the elemental analysis being close to unity and a singlet ir stretching band at 2070 cm, suggesting the formation of a single - phase coordination polymer. however, because of poor crystallinity, the powder x - ray diffraction (xrd) patterns of this product could not be indexed. refluxing of the reaction in water or an organic solvent (e.g., ethanol and dmf) to increase crystallinity caused the product to decompose into a mixture that invariably contained prussian blue (pb) and other unidentified components. although the single - crystal structure of a coordination polymer formed from these two starting materials was reported in 1996, there are few synthesis details except for the mention that single crystals were obtained from the diffusion method in a u tube for 6 months given in the structural report. we were able to shorten the crystal - growth time to 45 days using 1 m nitric acid as the crystallization medium with a similar diffusion method, but the yield we obtained for the intended compound was less than 1% whereas the major product formed was pb powder. to develop a suitable synthesis method that could later be adopted for preparing nps of this coordination polymer, we explored a variety of preparative techniques including hydro(solvo)thermal synthesis and mechanical milling. the best method we have found is an unusual low - temperature solid - state crystallization process. this method entails the mixing of an equimolar quantity of aqueous gd(no3)3 and k4[fe(cn)6 ] solutions at millimolar concentrations, followed by stirring the solution at room temperature for 8 h. the product was dialyzed in water to remove potassium and nitrate ions. the solution was then frozen while water was removed under vacuum to afford a light - yellow powder. this synthesis process resembles the hydrothermal reaction for crystal growth in that the supersaturating condition suitable for crystallization is slowly induced at low temperatures. the advantage of such an approach is that the heating of the reaction is avoided to prevent the reaction product from decomposing into prussian blue. the x - ray powder diffraction (xrd) patterns of this bulk sample were well indexed on the basis of an orthorhombic unit cell with the same lattice parameters as those obtained from the single - crystal structure analysis (supporting information). therefore, atomic parameters of the latter structure were used as the starting model in the rietveld refinement. the final refinement in space group pnma gave a = 12.6098(4), b = 13.6161(4), c = 7.2490(3), v = 1244.63(7), and calc = 2.4351(1) g / cm (figure s1). the structure of kgd(h2o)2[fe(cn)6]h2o consists of fe octahedra and gd biface - capped trigonal prisms joined in a 3d framework by cn groups (figure 1). the fe atom is coordinated by six c atoms of the cn groups whereas the gd atom is coordinated by six n atoms and additionally by two o atoms of water molecules o1 and o2 (table 1). the cavities in the framework are filled up by the k ion and water of crystallization (o3), showing site - occupancy disorder in the same cavity. both k and o3 are slightly shifted from each other by 0.4 so that k distances to nearby o and n atoms are in the range of 2.85 to 2.99, whereas the o3 water molecule forms two h bonds with o1 and o2 (table 1). thermal gravimetric analysis (tga) on the bulk sample showed a two - step loss of water (i.e., the first step of weight loss was found in the range from room temperature to about 100 c, corresponding to the loss of one water molecule, and the second step of weight loss was found in the range from 100 to 160 c, corresponding to the loss of two water molecules (figure s2)). this observation is consistent with the existence of one zeolitic and two coordinative water molecules per formula as revealed by the powder x - ray structure determination. furthermore, the fourier transform infrared (ft - ir) spectra of the bulk sample of kgd(h2o)2[fe(cn)6]h2o showed a strong characteristic cn stretching vibration at 2070 cm, attributable to the fe(ii)-cn unit - cell packing diagram of kgd(h2o)2[fe(cn)6]h2o (left) with the k ion and zeolitic water molecule omitted for clarity. the coordination environment of the gd ion (middle and right) showing two water molecules directly bound to the metal center. the reaction of gd(no3)3 in a sodium citrate solution with k4[fe(cn)6 ] in an aqueous solution containing polyvinylpyrrolidone (pvp) under similar conditions to the above preparation led to the formation of stable pvp - citrate - coated kgd(h2o)2[fe(cn)6]h2o nps (pvp - c - kgdfecn nps). we found that the concurrent use of sodium citrate as a capping agent and pvp as a coating polymer is necessary for controlling the size and stabilizing the nps in aqueous solution and in the solid state. when either sodium citrate or pvp was used alone, the nps would aggregate and separate from the solution after the aqueous dispersion was left to stand at room temperature for a few days. the ft - ir spectra of the nps after 24 h of dialysis to remove unbound citrate and pvp contained the characteristic ir vibrations attributable to the citrate anion and pvp in addition to the cn stretching vibration at 2070 cm, confirming the presence of both the capping agent and the coating polymer on the surface (figure s3). the elemental analysis of the sample digested with nitric acid showed the expected k / gd / fe to be 1:1:1. furthermore, the xrd patterns of the pvp - c - kgdfecn nps match well with those of the bulk sample (figure s4). the morphology and the size of the nps were examined by transmission electronic microscopy (tem). as shown in figure 2, the tem image of pvp - c - kgdfecn nps energy - dispersive x - ray analysis (edxa) showed that the nanomaterial contains gadolinium, potassium, and iron (figure s5 of the si). the efficiency of a ca is measured by its ability to enhance the proton relaxation of water and is commonly expressed as proton relaxivity. the latter is defined as the longitudinal or transverse relaxation rate increase of the water protons by unity concentration of the agent in mm. to evaluate the efficacy of our nps as mri contrast agents, we performed a series of proton t1 and t2 relaxation measurements in order to determine their longitudinal and transverse relaxivity values, r1 and r2, at both low (1.4 t) and high (7.0 t) magnetic field strengths. the 1.4 t relaxometry results were obtained on a bruker minispec 60 mhz relaxometer, and the 7.0 t results were obtained on a bruker biospec 7.0-t mri scanner. experimentally, the change in relaxation rate with increasing concentration of ca was measured, and the numeric value of the relaxivity, r1 or r2, was then extracted from the plot of 1/t1 (or 1/t2) vs the concentration of gd ions in nps using the following equationwhere 1/ti, d (i = 1, 2) is the diamagnetic contribution to the relaxation rate and [gd ] is the concentration of gd ions in nps. the relaxation rate of pure water is taken as the diamagnetic contribution in all of the experiments. all of the data are reported on a per gd ion basis at two different magnetic fields in table 2 and compared to commercial contrast agent magnevist (i.e., gd - dtpa) and several known nanoparticle - based gd(iii) mr contrast agents. as shown in figure 3, the resulting values for these nps are r1 = 17 mms and r2 = 24 mm s at 7.0 t and r1 = 35 mm s and r2 = 38 mm s at 1.4 t, respectively. for comparison, the relaxivity values of gd - dtpa are r1 = 3.4 mm s and r2 = 3.7 mm s at 1.4 t (table 2). if the citrate - coating layer on the surfaces of the nps would impede water exchange between the bulk and coordinated h2o molecules, we intentionally prepared the nps under the same synthesis conditions with pvp as the only coating layer of the nps. as shown in figure s6, there is a slight increase in the r1 value from 35 to 37 mm s for the pvp - coated nps, whereas the simultaneous change in the r2 value for such nps from 38 to 47 mm s appears to be more significant. these results suggest that the presence of the citrate coating layer on the surfaces of the nps may block the access of the bulk water to the sites of the coordinated h2o because the slight increase in the r1 relaxivity may well be due to the increased outer - sphere contribution as a result of a higher r2 value in the pvp - coated nps. however, the opposite may be said about the tight, covalently bound citrate coating layer ; that is, its presence on the surfaces of the nps can act as a magnetic shield to reduce to the effectiveness of the localized tiny magnetic fields generated by the nps, which in turn would induce the r2 relaxation of the bulk water protons. it is conceivable that the gd(iii) ions on the surface of the nps have a higher ability to induce the relaxation of the bulk water protons than the contribution to gd(iii) inside the nps. we therefore prepared pvp - c - kgdfecn nps with four different sizes by controlling the nucleation rate and coating. it is interesting that both r1 and r2 relaxivities decrease with increasing particle size at almost the same rate. plots of 1/ti (i = 1, 2) vs the gd concentration at magnetic field strengths of 1.4 t (left) and 7.0 t (right) for pvp - c - kgdfecn nps. these observed values of r1 relaxivity would place the current nps among the best nanoparticle - based t1-weighted cas that contain the gd ion. besides the extremely high r1 relaxivity, the small r2/r1 ratios of ca. 1.4 at 7.0 t and 1.1 at 1.4 t indicate that these nps are suitable as a t1-weighted agent to enhance the longitudinal relaxation of the water protons. in contrast, metal oxide - based nps, particularly iron oxide nps, have a tendency to exhibit superparamagnetic behavior with an exceedingly large r2/r1 ratio (i.e., r2/r1 > 10). as a result, plots of r1 (left) and r2 (right) vs the hydrodynamic particle size for pvp - c - kgdfecn nps. according to sbm theory, the mechanism of inner - sphere relaxation in small molecular gd - chelates can be understood from the following equationwhere q is the number of water molecules directly coordinated to the gd center, [c ] is the molar concentration of the contrast agent in mm, t1 m is the longitudinal relaxation time of the bound water, and m is the mean residence lifetime of the coordinated water molecule. if t1 m and m are fixed, then increasing the number of water molecules bound to the gd center from one to two will result in a doubling of the inner - sphere t1 relaxivity. however, the decreased thermodynamic stability and/or kinetic inertness will render the complex highly susceptible to displacement by proteins, biological ligands, or endogenous zn, ca, and mg ions. it is tempting to conjecture that the presence of two water molecules directly coordinated to the gd(iii) center as well as the zeolitic water in the structural cavities plays an important role in contributing to the inner - sphere longitudinal relaxation of the water protons. furthermore, the structural rigidity resulting from the 3d extended polymeric network and the reduced tumbling rate of such particulate ca also favor high relaxivity. recently, perrier and coworkers reported the synthesis and nmr relaxivity studies of nps based on a similar coordination polymer with the formula gd(h2o)2[fe(cn)6]h2o, where gd contains two coordinated water molecules as well, although the cytotoxicity and cellular penetrating ability of these nps remained to be seen. as expected, the pegylated nps of the coordination polymer also exhibit high t1-weighted relaxivity with a low r2/r1 ratio (table s1). however, the [fe(cn)6 ] anion in gd(h2o)2[fe(cn)6]h2o contains the low - spin fe(iii) center with s = /2, which may be magnetically coupled with the gd(iii) center with s = = /2 to give rise to a significant contribution of the outer - sphere relaxation to the overall t1-weighted relaxivity, thus making the distinction of the coordinated water molecules to the inner - sphere longitudinal relaxation from the outer - sphere relaxation impossible. however, because the [fe(cn)6 ] anion in our kgd(h2o)2[fe(cn)6]h2o contains the low - spin fe(ii) center with s = 0, the gd(iii) ions can be viewed as isolated paramagnetic centers, thus rendering the description of their t1-weighted relaxivity using the sbm model meaningful. to further confirm the efficacy and evaluate their performance as effective mr contrast agents, we obtained both t1- and t2-weighted mri phantom images of pvp - c - kgdfecn nps in aqueous solution with various concentrations on a 7.0 t scanner (figure 5). the t1-weighted images rapidly become brighter with increasing concentration of nps, and the t2-weighted images respond to the increase in the concentration by slightly darkening the contrast. these results suggest that the current nps can act as an effective t1-weighted ca at the high magnetic field. t1-weighted (left) and t2-weighted (right) mr phantom images of pvp - c - kgdfecn nps with various gd concentrations using a 7.0 t scanner. the ability of nps to cross the cell membrane is a critical prerequisite for cellular mr imaging applications to be realized. we studied the cellular uptake of our nps in hela cells using the fluorescent confocal microscopic imaging technique. for live cell imaging, cells were incubated with the carboxyfluorescein (cbf) dye - labeled nps (figure s7 in the si), washed with pbs, and directly imaged under a laser scanning confocal microscope without fixation. the advantage of using cbf attached to the nps as the fluorescent probe is that because of its high anionic negative charge, the cbf dye molecule itself is membrane - impermeable. the images of confocal microscopy showed the presence of bright - green fluorescent signals inside the cells that were incubated with the dye - labeled nps for 3 h. the untreated hela cells were used as the negative control. figure 6 shows the typical confocal fluorescent images of hela cells treated with the dye - labeled nps and the control cells. the uniform fluorescence emission in the perinuclear region of the cell indicates an untargeted cytoplasmic distribution of nps (i.e., there is no specific binding of nps to any small organelle in the region). these observations are consistent with the notion that the internalization of such nps is most likely to occur via endocytosis. confocal microscopic fluorescence image of hela cells incubated with dye - conjugated nps for 3 h (top left), the bright - field image of the cells from panel a (top right), the fluorescent image of untreated hela cells as the negative control (bottom left), and the bright - field image of the cells from panel c (bottom right). a quantification of the cellular uptake of kgdfecn nps was performed on the hela cell lysate using inductively coupled plasma mass spectrometry (icp - ms). as shown in figure 7, there is clear correlation between the cellular fluorescence signals and the increase in both intracellular gd and fe concentrations. however, the cellular uptake of gd - dtpa is greatly diminished (i.e., reduced approximately 30-fold) compared to that of kgdfecn nps as revealed by the much lower gd concentration in the cell lysate treated with gd - dtpa. this is because as a small molecule, gd - dtpa penetrates the cell membrane mainly by the process of passive diffusion. gadolinium and iron concentrations of np - treated (0.25 mm) vs gd - dtpa - treated hela (0.25 mm) cells (5 h incubation) along with untreated hela cells as the control. viability of hela cells after incubation with pvp - c - kgdfecn nps for 24 and 48 h. the cytotoxicity of the nps in hela cells was evaluated using the mtt assay with various concentrations of the nps and two different incubation times to study both the dose response and time effect. as shown in figure 8, more than 90% of the cells were still viable after 48 h of incubation with 1.00 mm pvp - c - kgdfecn nps, indicating the nontoxic nature of such nps. we attribute the low cytotoxicity of the nps to the proper surface coating and the high structural integrity of the coordination polymer itself. to further confirm the stability of such nps against the leaching of toxic cn and gd ions, we carried out a series of leaching experiments under physiologically relevant conditions. specifically, the solution concentrations of the cn and gd ions leached out of the nps were determined using a static method in which the nps that were sealed in a membrane dialysis bag were allowed to equilibrate with different media that are physiologically relevant. the resulting solutions were then analyzed for free cn and gd ions by a fluorometric method based on the konig reaction and icp - ms analysis, respectively. figure 9 shows the concentrations of the cn ions released from the nps under different conditions. the highest cyanide concentration was found in an extremely acidic, albeit physiologically less relevant, solution of ph 1 to be approximately 3.5 ppm, and the cyanide concentration released from the nps was found to be 0.8 ppm in a saline solution and 0.5 ppm in distilled water and other media containing a biologically relevant divalent metal ion at ph 7.4. in comparison, the maximum allowable level of cyanide in drinking water is 0.2 ppm as set by the environmental protection agency (epa). it should be noted that in cigarette smokers, the cyanide concentration in blood can be as high as 3565 ppm right after a cigarette is smoked. however, under all of the tested conditions, the concentrations of the gd ions released from the nps were all below 1 ppm (or < 6 m), except in the acidic solution of ph 1 where the concentration of the gd ions was found to be approximately 3 ppm (i.e., 20 m, figure 10). these results suggest that the pvp - c - kgdfecn nps are stable against dissociation to release both gd and cn ions under thermodynamic equilibrium conditions and kinetically inert to metal substitution reactions. this remarkable stability of the coordination polymer stems from the fact that as a ligand, the hexacyanoferrate(ii) anion, [fe(cn)6 ], possesses the highest - possible ligand field stabilization energy (lfse) for any complex containing the low - spin fe(ii) center and that the formation of an extended 3d coordination network structure results in high lattice energy for the coordination polymer. consequently, both the cn group and the gd ion are completely locked in their corresponding lattice positions and can not be released from the structure by self - dissociation or ion exchange, confirming that the nps are extremely stable and resistant to the displacement of gadolinium in the presence of the biologically relevant divalent metal ions. in sharp contrast, some small - molecule - based cas are susceptible to in vivo transmetalation reactions with endogenous zn and ca to release gd ions. the latter was linked to the development of nephrogenic systemic fibrosis (nsf) in some renally impaired patients, which prompted the u.s. food and drug administration (fda) in 2007 to issue a public health advisory regarding the use of gadolinium - containing cas. currently, the manufacturers of such cas are required by the fda to include new boxed warnings and new warning sections in the labels to describe the possible link between the use of such cas and the development of nsf gadolinium - releasing test for different conditions. to determine whether the internalized pvp - c - kgdfecn nps could enhance the t1-weighted mri contrast of cells, we incubated pc3 cells with various concentrations of pvp - c - kgdfecn nps and examined the t1-weighted image for each sample at 37 c using a spin - echo saturation recovery sequence on a bruker 9.4-t mri scanner. as shown in figure 11, there is a considerable change in image brightness in the pellets of the pc3 cells incubated with the nps. in particular, the cells treated with the nps at a concentration equivalent to 0.25 mm gd ions prior to imaging exhibited a strong mri signal brightening effect. these results demonstrate that pvp - c - kgdfecn nps have the potential to be used as an effective t1-weighted ca for cellular imaging at a high magnetic field. t1-weighted mri phantoms of pc3 cells incubated in pbs buffer (left), 0.13 mm nps (central), and 0.25 mm nps (right) for 6 h. the images were collected using a bruker 9.4-t scanner. we have developed a simple one - step method for preparing extremely stable and biocompatible nps of the gadolinium ferrocyanide coordination polymer. furthermore, we have demonstrated that such nps exhibit extremely high t1-weighted relaxivity, suggesting the potential of this coordination - polymer structural platform in the development of new - generation t1-weighted cellular mr probes for biological receptors or markers within the cell to study molecular events as well as for in vivo mr imaging in biomedical research and clinical applications. | a simple one - step method for preparing biocompatible nanoparticles of gadolinium ferrocyanide coordination polymer kgd(h2o)2[fe(cn)6]h2o is reported. the crystal structure of this coordination polymer is determined by x - ray powder diffraction using the bulk materials. the stability, cytotoxicity, cellular uptake, and mr phantom and cellular imaging studies suggest that this coordination - polymer structural platform offers a unique opportunity for developing the next generation of t1-weighted contrast agents with high relaxivity as cellular mr probes for biological receptors or markers. such high - relaxivity mr probes may hold potential in the study of molecular events and may be used for in vivo mr imaging in biomedical research and clinical applications. |
status epilepticus (se) is an emergency neurological condition defined as a continuous seizure of more than 5 minutes.1 its prevalence varies between 10 and 41 cases per 100,000 population outside of thailand.2 in thailand, se occurred in 5.10 cases per 100,000 population with a mortality rate of 0.6 per 100,000 population.3 causes of se are different between countries. a report from taiwan showed that central nervous system infection and previous strokes are the two most common causes of se,4 while antiepileptic drug (aed) withdrawal and alcohol - related causes were leading causes of se in western countries.5 factors associated with poor outcomes of se were related to comorbid complications such as metabolic disorders, cerebrovascular disease, and hypoxemia as shown in systematic reviews.6,7 a report from thailand did not find any significant predictors for se.2 unlike in western countries, there are limited data on predictors of se outcomes in thailand and other asian countries. here, the study was aimed to determine whether any factors associated with initial laboratory findings or treatment of se had influences on outcomes at discharge. this study retrospectively reviewed charts of adult patients who were at least 15 years old and diagnosed as se at khon kaen hospital from october 1, 2010 to september 30, 2012. khon kaen hospital is the tertiary care hospital located in the northeastern part of thailand. patients were categorized into two groups by type of discharge status and neurological outcomes ; good or poor outcomes. good outcomes were defined by improvement at discharge and absence of neurological deficits, while poor outcomes were defined by : not being improved at discharge ; being discharged against advice ; death ; or presence of a neurological deficit. descriptive statistics were used to detect significant differences between patients with good and poor outcomes. univariate logistic regression analysis was applied to calculate the crude odds ratios (ors) of individual variables for having poor outcomes. all variables with p<0.20 in univariate analysis were included in subsequent multivariate logistic regression analysis. the study protocol was approved by an institutional review committee, khon kaen university (he 561217). the mean age (standard deviation [sd ]) of all patients was 53.28 years (15.92). epilepsy (24.64%) and hypertension (23.22%) were the two most common comorbid diseases. generalized tonic clonic seizure was the most common type of se (179 patients ; 94.71%). acute stroke was the most common cause of se in 33 patients (15.64%). the mean (sd) numbers of aeds used were 2.05 (1.56) and the mean (sd) length of stay was 5.12 days (6.75). there were 104 patients (49.29%) who developed complications after se and the most common complication was aspiration pneumonia (53 patients ; 25.12%). at discharge, there were 120 patients (56.87%) who had good outcomes, while 91 patients (43.13%) had poor outcomes categorized by : death (29 patients ; 13.74%) ; not improved or discharged against advice (55 patients ; 26.07%) ; and presence of neurological deficits (7 patients ; 3.32%). most clinical factors at initial presentation were comparable between those who had good and poor outcomes at discharge (tables 2 and 3). those who had poor outcomes had more se occurrences in hospital (30.77% versus 3.33%), a lower glasgow coma scale (7.97 versus 9.78), higher plasma glucose (203.11 versus 159.26 mg / dl), lower serum albumin (2.73 versus 3.52 u / l), and higher total bilirubin (1.84 versus 1.04 mg / dl) than those with good outcomes. the serum electrolytes, except for potassium and phosphate levels, were also statistically different between those who had good and poor outcomes (table 3). in the final model of multivariate analysis, only plasma glucose was significantly associated with poor outcomes with an adjusted or of 1.012 (95% confidence interval of 1.003 and 1.021). regarding treatment and treatment outcomes, those with poor outcomes had a higher proportion of recurrent se (42.86% versus 10.83%) and longer duration of respirator use (4.18 versus 1.83 days) as shown in table 4. this study showed two important findings : poor discharge status of se in a tertiary care hospital was 43.13% and the discharge status of se patients was associated with initial plasma glucose levels. an increase of 1 mg / dl of plasma glucose increased the risk of having poor discharge status by 1.2%. a previous study from singapore also showed that in se patients with a hyperglycemia equal to or more than 7 mmol / l (126 mg / dl), these levels were associated with poor outcomes of se.8 in animal models, hyperglycemia causes hippocampal damage and also aggravates seizures.9,10 therefore, glucose control may be important in se patients, particularly in asian populations. two studies from switzerland did not have findings similar to this study.11,12 hyperglycemia was, however, shown to be associated with poor outcome in acute ischemic stroke.13 some factors such as serum albumin or aspartate aminotransferase were significantly different between the good and poor se outcomes by univariate logistic analysis or descriptive statistics. both factors, however, were not statistically significant in the multivariate logistic regression analysis. these results implied that only plasma glucose was an independent factor or predictor for se outcome. the population of this study may be different from other previous studies in terms of causes of se. in the current study, acute stroke, alcohol related causes, and septic encephalopathy accounted for 41.23% of the entire subjects. unlike in western populations the previous study from thailand found that the mortality rate of se was 35%,2 while refractory se may have a mortality rate of 50%.14,15 the poor outcome rate of this study was 43.13%. the poor discharge statuses were one of the following : death ; not improved or discharged against advice ; or presence of a neurological deficit. the strengths of this study were the quite - large sample size and different causes of se as compared with previous studies.11,12 there are some limitations. retrospective data collection may not have complete data, particularly laboratory findings such as hba1c levels or history of previous medications that may affect plasma glucose levels such as steroid use. also noted was that the population in this study was mostly not refractory se ; only three and two patients had received midazolam and propofol, respectively. the results of this study may apply only to asian populations or other countries in southeast asia. | backgroundstatus epilepticus (se) is a serious neurological condition and has high a mortality rate. data on importance of factors associated with poor outcomes in asian or thai populations are limited.methodsadult patients diagnosed as se at khon kaen hospital, thailand from october 1, 2010 to september 30, 2012 were enrolled. patients were categorized as good or poor outcomes at discharge. good outcomes were defined by improvement at discharge and absence of neurological deficits, while poor outcomes were defined by : not being improved at discharge ; being discharged against advice ; death ; or presence of a neurological deficit. clinical factors were compared between both groups.resultsduring the study period, there were 211 patients diagnosed as se. of those, 130 patients were male (61.61%). the mean age of all patients was 53.28 years. acute stroke was the most common cause of se in 33 patients (15.64%). at discharge, there were 91 patients (43.13%) who had poor outcomes. only initial plasma glucose levels were significantly associated with poor outcomes with an adjusted odds ratio of 1.012 (95% confidence interval of 1.003 and 1.021).conclusioninitial plasma glucose is associated with poor discharge status in patients with se. |
severe cough or hyperventilation can increase the thoracic pressure, leading to an abrupt increase in alveolar pressure and consequent rupture of alveoli. subsequently, the air that leaks out may reach the mediastinum via the pulmonary hilum and bronchovascular interstitium. therefore, pneumomediastinum is a pathology that involves the presence of free gas in the mediastinum due to different reasons.1 spontaneous pneumomediastinum occurs in patients with interstitial lung disease and several other respiratory diseases. it generally appears in advanced stages of respiratory failure, and pneumothorax can occur if the air leakage due to increased thoracic pressure expands the mediastinum. here we report a case involving an 83-year - old man with interstitial lung disease who developed atypical pneumomediastinum caused by gas replacement of diminished fat due to generalized weight loss, with no mediastinal enlargement. the pneumomediastinum observed in this case could not be explained by air leakage within the thorax, resembling the vacuum phenomenon caused by intervertebral disc degeneration, wherein gas accumulates in spaces created by decreased tissue volume in intervertebral discs and synovial joints.1 the patient reported here died 2 years ago, and it was difficult to contact the bereaved relatives ; therefore, documented informed consent was waived by the ethics committee of yokohama minamikyosai hopital. all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the tenets of the 1964 helsinki declaration and subsequent amended versions. an 83-year - old man presented with worsening symptoms of respiratory difficulty since he was diagnosed with chronic eosinophilic pneumonia by another physician 5 months ago. at that time, computed tomography (ct) showed ground glass opacities and peripheral reticular opacities (figure 1), while bronchoscopy revealed a 20% increase in eosinophils in his bronchoalveolar fluid. he was placed under observation with no particular treatment for 5 months, during which his symptoms only worsened ; he eventually visited our institute for further examination. on examination, chest auscultation revealed crackles at both lung bases, and blood tests for inflammatory markers showed normal findings. chest ct performed at the current examination showed a rapid decrease in mediastinal fat when compared with the scan obtained 5 months back, with the space created by the diminished fat replaced by gas density (figure 2). the amount of subcutaneous fat also showed a decrease, indicating that the mediastinal fat loss was a part of generalized weight loss. reticular structures considered to be fat remnants were observed with the regions of gas density, and there was no mediastinal enlargement, pneumothorax, or pneumopericardium. widespread ground glass opacities and reticular opacities suggestive of interstitial pneumonia were observed below the pleura of both lungs. no specific treatment was provided for the pneumomediastinum, and, considering the patient s age, home oxygen therapy without steroid administration was initiated for the interstitial pneumonia. a routine follow - up ct performed 10 months after discharge showed some increase in subcutaneous mediastinal fat and disappearance of the gas density in mediastinum (figure 3). pneumomediastinum is etiologically categorized into spontaneous and secondary types.2 the pathophysiology of spontaneous pneumomediastinum involves a three - step process : alveolar rupture, air dissection along the bronchovascular sheaths, and spread of pulmonary interstitial emphysema into the mediastinum.3 secondary pneumomediastinum, on the other hand, can be iatrogenic or involve damage to the esophagus resulting from trauma, tracheobronchial damage, or infection by gas - producing bacteria. while secondary pneumomediastinum can be life threatening, the spontaneous type is associated with a good prognosis.4 spontaneous pneumomediastinum has been reported to occur in patients with idiopathic interstitial fibrosis, other interstitial lung diseases, and connective tissue disorders.5,6 increased thoracic pressure caused by cough or labored breathing may cause the alveoli to rupture. one report suggested that the use of corticosteroids for the treatment of underlying diseases weakens the interstitial lung tissues,7 while another suggested that spontaneous pneumomediastinum occurs if steroid or immunosuppressant therapy is not administered to patients on worsening of their condition.8 all these reports focused on air leaks as the underlying pathology. however, we hypothesize that factors other than air leaks can cause pneumomediastinum on the basis of the findings from the present case. first, pneumomediastinum caused by air leaks is accompanied by mediastinal enlargement, which was not observed when ct scans obtained at a 5-month interval were compared. furthermore, pneumatosis around the hilum of the lungs, which suggests the presence of air leaks, was not observed. finally, the fat observed on previous ct scans was completely replaced by gas, and the shrunken space after fat loss was restored to the original form by gas accumulation, which is not observed in case of air leaks. the vacuum phenomenon, which is characterized by the accumulation of gas in synovial joints or intervertebral discs, is a known pathology. although the vacuum phenomenon is most frequently associated with degenerative joint disease, it is also associated with other pathologies ; however, there is no consensus on its etiology.9 bone fracture, necrosis, metastasis, abscess, and osteomyelitis are some of the described causes. the gas that accumulates in intervertebral discs contains at least 90% nitrogen, along with oxygen, carbon dioxide, and trace amounts of other gases. unlike oxygen, nitrogen that elutes from dead spaces is not metabolized inside the body ; rather, it accumulates in tissues as gas.10 we believe that the mediastinal gas collection in the present case was caused by the same pathology that causes the vacuum phenomenon. in healthy individuals, the lung volume increases when mediastinal fat decreases, and this leads to remodeling of the mediastinum and prevents gas accumulation.11 however, in interstitial pneumonia, restrictive disorders reduce the plasticity of the lungs, which inhibits remodeling in response to increased lung volume. we surmise that nitrogen elutes into the mediastinum when it is subjected to negative pressure during inspiration. spontaneous pneumomediastinum is mentioned as a complication of anorexia nervosa and other nonspecified eating disorders in several case reports.12 in all these reports, it was diagnosed when mediastinal gas accumulation was incidentally observed on radiographs or ct scans obtained at an arbitrary time point. none of the patients underwent surgical therapy, and all showed an improvement with conservative treatment. in an animal experiment, calorie restriction caused a decrease in the number of alveoli and thinning of the alveolar walls.13 these consequences increase the risk of alveolar rupture and spontaneous pneumomediastinum in malnourished patients with anorexia. however, patients with eating disorders and our patient share a common factor associated with pneumomediastinum : weight loss. among previous cases on spontaneous pneumomediastinum associated with eating disorders, some may have actually involved rapid disappearance of mediastinal fat followed by gas replacement, such as that observed in our case. in conclusion, we reported a case of spontaneous pneumomediastinum resembling the vacuum phenomenon in an elderly patient with interstitial lung disease. the findings from this case suggest that spontaneous pneumomediastinum is not always associated with air leaks and mediastinal enlargement. some cases, such as the present one, may be associated with a decrease in mediastinal fat in a given space, which is restored by gas accumulation. this pathology resembles the accumulation of nitrogen in intervertebral discs and vertebral bodies, that is, the vacuum phenomenon, in degenerative joint disease. therefore, further examination or treatment is not necessary. because this entity is different from spontaneous pneumomediastinum, we propose the term mediastinal vacuum phenomenon and consider it to be a form of secondary pneumomediastinum. gas density in the mediastinum accompanying weight loss is observed not only in interstitial lung disease but also in anorexia ; therefore, the possibility of a mediastinal vacuum phenomenon should be considered. | we report a case involving an 83-year - old man with interstitial lung disease who developed atypical pneumomediastinum caused by gas replacement of diminished fat. the patient presented with a complaint of worsening symptoms of respiratory difficulty since a diagnosis of chronic eosinophilic pneumonia 5 months back. he had been under observation with no particular treatment for 5 months. computed tomography performed on admission revealed pneumomediastinum. when the current scan was compared with that obtained 5 months ago, it was evident that the fat surrounding the mediastinum had been replaced by gas density. there was no mediastinal enlargement, pneumothorax, or pneumopericardium. because the patient was elderly, home oxygen therapy was initiated for the interstitial pneumonia with no steroid therapy. computed tomography performed 10 months after discharge showed the reappearance of mediastinal fat and no evidence of gas density. this case is unique because the pneumomediastinum was distinct from spontaneous pneumomediastinum caused by alveolar air leaks and resembled the vacuum phenomenon caused by intervertebral disc degeneration. |
thrombotic microangiopathy (tma) encompasses a spectrum of diseases characterized by microangiopathic hemolytic anemia, thrombocytopenia and acute renal failure. various treatment options have been tried for this condition, with varying degrees of treatment response. here, we describe a case of gemcitabine - induced tma with atypical presentation treated with rituximab. a 74-year - old caucasian female was referred to our nephrology clinic for an evaluation of worsening renal function. her past medical history was significant for multiple sclerosis, gastroesophageal reflux disease and ovarian cancer. following surgery, she had been treated with platinum - based chemotherapy with cisplatin, which was completed in 2012. in 2013, she had a relapse of the disease (clinically as well as an elevation in tumor marker ca-125), for which platinum - based chemotherapy was repeated using carboplatin and doxorubicin. she was resistant to this treatment following which gemcitabine monotherapy was initiated in 2013. after the fifth cycle of gemcitabine therapy (cumulative dose of 9,460 mg), her creatinine level started increasing (to 7.3 mg / dl from a baseline of 1.1 mg / dl). she denied any history of smoking, drug abuse or alcohol use. on physical examination, her vital signs were stable, with a temperature of 98 f, a blood pressure of 162/100 mm hg, a pulse rate of 78 beats / min and a respiratory rate of 18 breaths / min. her urine dipstick revealed 4 + proteinuria, and her urine protein - to - creatinine ratio was 2.4 g / g creatinine. renal ultrasound was unremarkable. in view of the drop in hemoglobin level, elevated lactate dehydrogenase (ldh), schistocytes in the peripheral smear, new - onset hypertension and acute kidney injury, the possibility of tma was considered. a complement study showed a c3 level of 113 mg / dl (range 82185) and a c4 level of 19 mg / dl (range 1553). antinuclear antibodies, anti - dsdna, hepatitis panel, hiv, anti - scl-70, antineutrophil cytoplasmic antibody and anticardiolipin ab were negative. a renal biopsy was performed, which showed glomeruli with mesangial lysis and endothelial cell swelling. electron microscopy showed capillary loops with swollen endothelium, occlusion of the lumen with cells, cell debris and electron - dense material (possibly fibrin). there was focal duplication of the basement membrane and diffuse effacement of epithelial cell foot cytoplasm (fig. 1, 2). since gemcitabine has been considered as a cause of tma and there were no other etiologies for tma in this patient, the final diagnosis was tma secondary to gemcitabine. treatment with plasma exchange was started, but the creatinine level remained unchanged even after 5 daily sessions. the creatinine level at 2 months after treatment with rituximab was 2 mg / dl. there was no change in ldh (in fact, ldh increased over time likely due to the cancer). a repeat peripheral smear after 1.5 months of treatment with rituximab did not demonstrate schistocytes. the patient did not receive any further doses of gemcitabine. since the ovarian cancer continued to progress relentlessly, the patient decided to go on hospice care. gemcitabine is a pyrimidine antimetabolite that was introduced in 1987 for the treatment of solid tumors. the standard treatment of tma varies from simple drug discontinuation and supportive care to the use of plasmapheresis, steroids or hemodialysis. despite the use of aggressive treatment the pathogenesis of tma is believed to be endothelial damage, which leads to platelet aggregation, fibrin formation and thrombus deposition. the role of immune complexes has been described in the pathogenesis of tma : formed as a result of the underlying disease process, they trigger aggregation and deposition of platelets around areas of toxin - related endothelial damage in the kidney microvasculature. these cytokines might inhibit vascular endothelial cell growth factor (vegf) in glomerular endothelial cells. other postulated mechanisms include generation of the adamts13 inhibitor and abnormal immune response to the von willebrand factor - cleaving protease [9, 10 ]. in our case, the absence of immunofluorescence in renal biopsy makes an immune complex theory less likely. similarly, normal adamts13 and antibody to adamts13 do not support the involvement of adamts13. hence, direct endothelial damage from the drug leading to platelet aggregation, fibrin formation and thrombus formation is the most likely possibility. there are multiple reports of drug - induced tma (especially mitomycin c) and the role of direct endothelial injury described in the literature. some of the histopatholgical findings seen in our case might support this view. in an animal study on rats treated with mitomycin, subsequently, at 1 week of exposure to mitomycin, many glomerular capillary lumens were reduced or obliterated by platelets, mononuclear cells and swollen endothelium. in addition, at 1 month, there was extensive obliteration of foot process of the visceral epithelium, mesangial interposition in the basement membrane (splitting of the basement membrane) and mononuclear inflammation of the interstitium. in our case, there were similar histopathological findings (electron microscopy), which might favor the role of direct endothelial injury with gemcitabine. this might also prove the role of progressive damage to glomeruli following the initial insult with gemcitabine. the onset of clinically evident disease is often delayed, frequently occurring months after chemotherapy has been discontinued. the initial insult might have happened way earlier, and changes in biochemical parameters might have occurred once the injury is well established. the cumulative effect of glomerular endothelial damage might also play a role in the development of clinically evident tma. our case is unique due to absence of marked hemolysis and thrombocytopenia, as previous cases presented with all the classical features including thrombocytopenia and hemolysis. in this case, although hemolysis was evidenced by the presence of schistocytes and a mild elevation in ldh, other features like a dramatic drop in hemoglobin level, a low haptoglobin level and elevated unconjugated hyperbilirubinemia were absent. moreover, thrombocytopenia was also absent. in this context, it is notable that drug - induced tma may occur in the absence of other systemic features including microangiopathic hemolytic anemia or thrombocytopenia. hence, in the absence of clinical suspicion, these cases might be missed, resulting in inadvertent outcomes. affected patients typically present with slowly progressive renal failure, new or exacerbated hypertension and relatively bland urine sediment. rituximab is a monoclonal antibody that selectively targets cd20-positive b cells and has been used in the treatment of tma resulting from gemcitabine. in our case, the exact mechanism by which rituximab improves tma is not fully elucidated and there are different theories about how the use of rituximab may result in the improvement in tma. rituximab might act as an immune modulator in controlling the disease, especially in scenarios where immune complexes or antibodies to adamts13 might be playing a role in the pathogenesis. there might be a mechanism similar to that seen in patients treated with rituximab for rheumatoid arthritis. the depletion of b cells may reduce the production of b - cell - dependent cytokines that drive endothelial dysfunction [13, 14, 15 ]. in our case, this might be the most likely mechanism for improvement in renal function with rituximab treatment although the contribution of plasma exchange in the form of a late response could not be completely ruled out. the standard definition for refractory disease in disorders like thrombotic thrombocytopenic purpura (non - response to 7 daily plasma exchange treatments) may not be applicable to all tmas (moreover, our patient had only received 5 days of plasma exchange therapy). although a randomized, controlled trial of rituximab in gci - tma may be difficult due to the rarity of this complication, more case reports like ours with a salutary effect may underscore the possibility of using rituximab as a first - line or alternative treatment strategy for patients with tma secondary to gemcitabine. these are patients who already have a poor prognosis, and the development of renal failure may further increase the risk of mortality. hence, it is essential to early identify renal toxicity and initiate appropriate intervention, including the discontinuation of gemcitabine therapy, thereby improving survival even if only for a few weeks or months. | gemcitabine is a potent and widely used anticancer drug. we report a case of gemcitabine - induced thrombotic microangiopathy (gci - tma), a known but not widely recognized complication of gemcitabine use, and our experience of treating gci - tma with rituximab. a 74-year - old woman was referred to our clinic for an evaluation of worsening renal function. she has recently been treated for ovarian cancer (diagnosed in 2011) with surgery (tumor debulking and bilateral salpingo - oophorectomy) along with cisplatin chemotherapy in 2012, followed by carboplatin / doxorubicin in 2013 and recent therapy for resistant disease with gemcitabine. laboratory tests showed anemia, normal platelets and elevated lactate dehydrogenase. a peripheral smear revealed numerous schistocytes, and a kidney biopsy showed acute as well as chronic tma. the patient continued on gemcitabine therapy, and treatment with plasma exchange was started. since there was no response to treatment even after 5 sessions of plasma exchange, one dose of rituximab was given, which was associated with a drop in the creatinine level to 2 mg / dl. the pathogenesis of renal injury could be the effect of direct injury to the endothelium mediated by cytokines. usual treatment includes withdrawing the drug and initiation of treatment with plasmapheresis with or without steroids. in cases resistant to plasmapheresis, treatment with rituximab can be tried. the mechanism of action of rituximab might be due to the reduced production of b - cell - dependent cytokines that drive endothelial dysfunction by depleting b cells. patients receiving gemcitabine chemotherapy should be monitored for the development of tma, and early treatment with plasma exchange along with rituximab might benefit these patients who already have a bad prognosis. |
resonance raman (rr) spectroscopy has long been applied to monitoring the molecular dynamics of hemoglobin (hb).[13 ] this highly symmetric and chromophoric heme prosthetic group provides strong resonance enhancement, especially when in resonance with the intense electronic transitions centered at approximately 400 nm (soret or b band), 525 nm (qv or band), and 575 nm (q0 or band)[4, 5 ] (figure 1). comparison between average uv / vis electronic absorption spectra collected from ten different oxygenated and deoxygenated rbcs in the spectral regions of 300650 nm. figure shows the allowed electronic transitions based on the gouterman four - orbital model along with the laser lines used in this experiment (color coded) and the symmetry terms of the bands that are enhanced at the three major electronic transitions. when the laser wavelength interacts with heme groups in resonance with electronic transitions of the soret band, the a - term scattering mechanism dominates. in a - term scattering, also known as franck non - fc dependence of the electronic transition moment on the vibrational coordinate is possible through b - term and c - term enhancement. when the excitation is in resonance with the weaker q0 band at approximately 575 nm, b - term scattering dominates, which involves vibronic coupling between two allowed excited electronic transitions. early studies on metalloporphyrins in solution showed that both q0 and qv bands are predominantly governed by the strong herzberg teller coupling of antisymmetric a2 g modes,[8, 9 ] providing evidence of vibronic coupling. enhancement with 514.5 and 532 nm excitation laser lines, which are in close proximity to the vibronic qv band of the visible spectrum of hemoporphyrins, enables the c - term enhancement mechanism to dominate, which occurs between forbidden electronic transitions that are prohibited at the equilibrium geometry of the molecule. as is the case for q0, rr spectra obtained by exciting into the qv contain polarized, depolarized, and anomalous polarized bands and lead to additional enhancement of non - fundamental modes.[8, 12 ] the overtones and combination bands in the rr spectra of some metalloporphyrins have previously been reported based on polarization measurements.- the use of 514.5 nm excitation gave the strongest enhancement of non - fundamental bands in porphyrins compared to other excitation lines, because of c - term scattering. previously, the observation of overtones and combination modes in the rr spectra were attributed to strong electron nuclear coupling in such species.[17, 18 ] strong intermolecular coupling was explained by multichromophore interactions that occur in a protein reaction center. such interactions were invoked for bacteriochlorophyll where the structural arrangement of the chromophores enables enhancement in the vicinity of the qv transition. a quantitative description of the scattering processes with transform theory was suggested, in which electron nuclear coupling strengths are proportional to the intensity ratio of the overtone and fundamental region. it was further postulated that heme proteins such as hb fall into the category of weak coupling compounds, because the electronic transitions of these compounds are distributed over several nuclei.[7, 17 ] strekas and spiro reported that, although rr spectra sometimes display intense overtone progressions, these are not apparent in the rr spectra of hb. it is important to note that these early reports were based on what was known from solution - phase studies. here, we report the appearance of overtone and combination bands for hb in red blood cells (rbcs) and crystalline deposits, but not in solutions. this suggests that the structural arrangement of hb inside single rbcs (highly aligned) may be responsible for a significant increase in the non - fundamental modes in the vibronic qv side band. we demonstrate that by incorporating the non - fundamental region into a partial least - squares discriminant analysis (pls - da) model improves the diagnostic capability of the raman technique for malaria compared to analyzing the fundamental region alone. moreover, the bands associated with oxyhb in malaria - infected rbcs can be identified more readily in the non - fundamental region because of the intense overlapping hemozoin bands, which obscure the oxyhb bands in the fundamental region. the most interesting observation drawn from the comparison of the spectra presented in figure 2 is the extraordinary spectral profile in the higher spectral region (32002300 cm) when applying 514.5 nm excitation. rr spectra of rbcs in this region obtained with the use of 413.1 and 514.5 nm excitation show bands that are non - typical for protein aliphatic and aromatic stretching vibrations. these modes appear hyper - enhanced when using 514.5 nm excitation and many are more intense than their associated fundamentals. moreover, this region clearly differs amongst spectra obtained of oxyhb and deoxyhb inside rbcs. the most crucial observation is that the most intense bands in the higher wavenumber region, corresponding to the first overtone bands, are directly correlated to the most intense bands in the fundamental region. comparison between average rr spectra collected from ten different oxygenated and deoxygenated rbcs, obtained by using 413.1, 514.5, and 632.8 nm laser wavelengths in the spectral regions of 33002200 cm and 1700600 cm. the intensity of the bands in the 33002200 cm have not been scaled or normalized and appear on the same scale as the fundamental region. the bands in the region of 31002800 cm for rr spectra of both oxyhb and deoxyhb obtained with 632.8 nm excitation do not differ in wavenumber values and are typical for ch, ch2, and ch3 groups of proteins. exciting rbcs with 413.1 nm radiation revealed two intense oxidation - state marker bands at 1377 and 1358 cm in the oxyhb spectrum, whereas in the deoxyhb spectrum, only one band with higher intensity (ca. these fundamental marker bands of the oxidation state (4) have overtones, which mimic the behavior of their fundamental counterparts. the rr band at 2720 cm was previously assigned to an overtone of the 4 mode (2 4) for cytochrome c, measured with 413.1 nm excitation. therefore, overtones observed at 2710 cm, with a shoulder at 2750 cm, can be used as marker bands for oxygenated rbcs (low spin, fe). the observation of the single overtone at 2710 cm with higher intensity corresponds to deoxygenated rbcs (high spin, fe). the fact that both ferric and ferrous bands appear in the spectra of oxyhb rbcs indicates that the cell was either only partially oxygenated or some laser induced photodissociation of the oxyhb was occurring. nonetheless, this highlights the sensitivity of the overtones to oxidation induced perturbation of the heme core. the excitation of live rbcs with the 514.5 nm laser wavelength results in highly intense numerous overtones compared to 413.1 and 632.8 nm. parallel (i||) and perpendicular (i) polarization components enabled the vibrational assignment of the overtones and combination modes of the most intense fundamental bands (figure 3). in the fundamental region of oxyhb and deoxyhb rbcs, the strongest bands are present in the spectral region of 17001200 cm and, therefore, the overtones or combinations appear in the 32002300 cm region. detailed assignments are shown in table s1 (in the supporting information) based on previous studies on model porphyrin compounds.[3, 18, 20, 2226 ] the average rr spectra collected from ten different oxygenated and deoxygenated functional rbcs, obtained with 514.5 nm laser excitation in the 3300250 cm spectral region. the top (dark blue, red) and bottom (light blue, pink) spectra represent the parallel (i||) and perpendicular (i) polarization components, respectively. the assigned symmetry species for the non - fundamental modes are based on the work by kitagawa. by symmetry, all overtones are assigned to a1 g modes. in terms of the intensities of the bands in the spectral region of 32002200 cm of rbcs, the parallel (i||) polarization component exhibits a much higher intensity than the perpendicular (i) polarization components, indicating the bands observed in the higher region are polarized and are, therefore, assigned to overtones or combination bands of the same symmetry modes, simplifying the band assignment. the bands characteristic of oxyhb that appear at 1639, 1605, 1587, 1547, and 1473 cm originate from 10, 19, 37, 11, and 3 porphyrin stretching modes, respectively. the band at around 1640 cm, assigned to 10, may be treated as a marker for oxyhb. the in - plane translocation of the fe atom in oxyhb causes the intensity of 10 to increase and is typical for low - spin hb derivatives. the overtone of this marker band for oxyhb band is observed at 3277 cm and is not observed in the overtone region of deoxyhb. the band at 1587 cm, assigned to 37, is more intense for oxyhb and shifts to 1583 cm in deoxyhb. the shift of approximately 4 cm in the fundamental region increases to a shift of 17 cm between overtones of these two bands for the oxyhb and deoxyhb spectra. moreover, the intensity of the overtone of the 37 for oxyhb observed at 3172 cm has a much higher intensity than the corresponding band in deoxyhb observed at around 3155 cm. furthermore, the intensity of the overtone at 3172 cm decreases with increasing laser power. interestingly this photodissociation could be directly followed by rr spectroscopy in the overtone region as clearly as the fundamental region. the hyper - enhanced overtone region enables the generation of raman images of single cells (figure s1). in this case, a 532 nm laser confocal - imaging microscope was used to generate the images, as our 514.5 nm microscope system is not set up for imaging and, hence, the overtones are not quite as intense as they would be at 514.5 nm. nonetheless, most of the overtone bands still have very strong intensity, enabling high - contrast images to be generated. this is the first example of a raman image based on the integrated intensity from an overtone band for any cell. to determine if the intense overtones are observed in other heme species, we investigated the solid - state spectra of a number of heme derivatives including hb ao, hematin, ferric octaethylporphyrins, and methylporphyrin complexes (figure s2). like rbcs, these molecules also show a rich non - fundamental spectrum when exciting with 514.5 nm excitation, indicating that this phenomena is observed for all solid - state hemes. however, the non - fundamental region for standard compounds of hemoglobin ao has a lower intensity of the overtone and combination bands compared to functional rbcs. the qualitative ratios (iovertone / ifundamental) for an average oxyhb spectrum obtained from ten different functional rbcs for the main modes 10, 37, 4, and 19 are equal to 0.16, 0.53, 0.95, and 0.5, respectively. the intensity ratios (iovertone / ifundamental) for a solid sample of hb, which was submerged in distilled water and measured with the use of the same immersive objective as rbcs, are equal to 0.14, 0.48, 0.84, and 0.33. extensive enhancement of the totally symmetric modes was observed with 830 nm excitation in the spectrum of fe(oep)cl (oep = octaethylporphyrin), well away from the soret band (400 nm) where these modes are normally enhanced. the enhancement of totally symmetric modes in the near - ir region was attributed to excitonic interactions occurring in the heme array. it is important to note that even very saturated solutions of hb and heme derivatives do not show enhanced non - fundamental modes. these modes are only observed in rbcs (where the concentration of hb is on the order of 22 mm), in crystals, and in amorphous heme aggregates. this indicates that there is an extra enhancement mechanism at play in the case of rbcs, which is evident when measuring the parallel polarized light component. this mechanism may be understood in terms of aggregated enhanced raman scattering (aers) where molecular excitons result from the resonance interaction between the excited states of loosely bound molecular aggregates. aers has previously been used to explain the dramatic enhancement of fundamental modes observed in the rr spectra of porphyrins, cyano dyes, hb in rbcs, and hemozoin (malaria pigment).[33, 34 ] akins coined the term aers to describe unusual scattering in small aggregates of covalently linked porphyrin arrays and cyanine dyes absorbed onto surfaces. he proposed a theoretical description and experimentally demonstrated that an increase in the number of aggregated chromophores produces near - resonance of both the a and b terms in the polarizability tensor. previously, it has been demonstrated that the orientation of the rbc dictates the type of enhancement pattern observed in the rr spectrum. it appears that the rbc behaves like a light polarizer, preferentially scattering perpendicular and parallel light depending on the orientation of the cell. moreover, we have shown that the uv / vis spectra of rbcs exhibit shifting and broadening of the soret band, which is also indicative of excitonic interactions. the fact that the enhancement of both fundamentals and overtones is far more dramatic in a single cell than in an isolated crystal of hb points to a high degree of alignment and ordering in the rbc conducive to an excitonic mechanism. the incorporation of the non - fundamental region into a pls - da model allowed us to improve the malaria diagnostic capability of the raman technique. figure 4 presents cross - validation errors for the pls - da model performed on functional rbcs containing malaria trophozoites and non - infected rbcs (control), using the whole (figure 4 a) and the fundamental region (figure 4 b). the importance of the non - fundamental region on the discrimination is evident in the variable importance in projection (vip) scores. a vip score close to or greater than 1 is considered to be important in the given model. as can be seen in figure 4 c, the hyper - intense non - fundamental region has a strong impact on the model, with vip values higher than those of the fundamental modes, with the exception of the strong 16001500 cm bands that are mainly associated with porphyrin c = c stretching modes. cross - validation errors for the pls - da performed on the evaluation of the discrimination capability between the control (non - infected rbcs) and malaria (infected rbcs) samples, using the whole (a) and the fundamental (b) regions. variable importance in projection for the pls - da performed on the whole region (c). a comparison of the rr spectra of hemozoin, the control, and p. falciparum - infected rbcs demonstrates another application of the non - fundamental region. figure s3 shows that, in the case of malaria - parasite - infected rbcs, the fundamental region of the spectrum is dominated by hemozoin bands, which almost totally obscure the oxyhb bands, whereas the non - fundamental region of the spectrum is dominated by oxyhb bands. consequently, it is possible to obtain information about the relative contribution of hemozoin and oxyhb. it has been reported that the malaria infection leads to a decreased 2,3-biphosphoglycerate (2,3-bpg) concentration, which, in turn, lowers the concentration of oxyhb in bulk - infected rbcs. our method allows the detection of a relative amount of hemozoin and oxyhb in individual rbcs infected with p. falciparum. the intensity and richness of the hb spectrum at 514.5 nm, both in the fundamental and non - fundamental regions, has the potential to improve the diagnostic and monitoring capability of raman - based medical devices, particularly in diseases such as malaria and other hemopathies because the number of extra bands and their intensity will provide a more detailed molecular fingerprint. fresh blood (20 l) from healthy volunteers was diluted with cold saline solution (10 ml) and measured as previously described. to prepare the deoxygenated rbcs, the 3d7 strain of plasmodium falciparum was used in this study and cultured, essentially, as previously described. trophozoite - stage parasites were enriched from cultures by percoll purification, as described previously. the power of the laser at the sample position for all raman measurements was 0.5 mw, and the beam was slightly defocused on the rbcs to prevent localized heating, which prevented photo / thermal degradation of heme aggregates in rbcs.[32, 38 ] raman measurements of the rbcs were recorded by using a renishaw system 2000 instrument with 632.8, 413.1, and 514.5 nm excitation laser lines. the spectra were recorded in the region of 3500100 cm with spectral resolution of 1 cm. each spectrum was recorded from a different rbc and one scan was acquired for each cell with a laser exposure time of 10 s. the spectra of oxyhb and deoxyhb from live rbcs were averaged from 20 individual raman spectra obtained from 20 different cells. polarization measurements were performed by using 514.5 nm excitation with a polarizer filter for the parallel component and a combination of a polarizer filter and half - wave plate for the perpendicular component. for single measurements, a water - immersive olympus (60/0.90 na) objective was used. the average uv / vis electronic absorption spectra of oxyhb and deoxyhb were recorded from the 44 m cell surface area of ten single functional rbcs in the spectral region of 300650 nm by using a uv / vis spectrophotometer (msp 210 microscope spectrometry system, j & m analytische mess- und regeltechnik gmbh) and a 60 immersion objective. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors | in general, the first overtone modes produce weak bands that appear at approximately twice the wavenumber value of the fundamental transitions in vibrational spectra. here, we report the existence of a series of enhanced non - fundamental bands in resonance raman (rr) spectra recorded for hemoglobin (hb) inside the highly concentrated heme environment of the red blood cell (rbc) by exciting with a 514.5 nm laser line. such bands are most intense when detecting parallel - polarized light. the enhancement is explained through excitonic theory invoking a type c scattering mechanism and bands have been assigned to overtone and combination bands based on symmetry arguments and polarization measurements. by using malaria diagnosis as an example, we demonstrate that combining the non - fundamental and fundamental regions of the rr spectrum improves the sensitivity and diagnostic capability of the technique. the discovery will have considerable implications for the ongoing development of raman spectroscopy for blood disease diagnoses and monitoring heme perturbation in response to environmental stimuli. |
activation of the coagulation system is an important part of the systemic inflammatory response during infection. lipopolysaccharide (lps), a complex outer membrane glycolipid of gram - negative bacteria, triggers an array of cellular activations through a variety of mechanisms involving diverse intracellular signalling [13 ]. in patients with gram - negative sepsis bacterial lps induces the expression of tissue factor (tf) on monocytes and endothelial cells, leading to disseminated intravascular coagulation [4, 5 ]. binding of lps to toll - like receptor (tlr) activates several intracellular signalling cascades that include nuclear factor - kappa b (nf-b), c - jun n - terminal kinase (jnk), and p38 mitogen - activated protein kinase (mapk) [6, 7 ]. the roles of nf-b, jnk, and p38 mapk in activation of coagulation in vivo are not completely known. therefore the present study was designed to investigate the effects of bay117082, sp600125, and sb203580, specific and potent inhibitors of nf-b, jnk, and p38 mapk, in the procoagulant response to lps in healthy subjects measured by thrombelastography (teg). after receiving written informed consent, venous blood from eleven healthy volunteers was collected in one - tenth volume of citrate (3.8%, becton dickinson, heidelberg, germany) and immediately used for the experiments. blood samples were incubated with 1, 10, or 100 m bay117082, sp600125, sb203580, or vehicle for 1 h. thereafter, 100 g / ml escherichia coli lps (serotype 0111 : b4, sigma - aldrich, germany) was added for further 15 min in elisa experiments or further 4 h in teg experiments. whole blood clotting time (ct) and maximal clot firmness (mcf) were determined as described. in short, citrated whole blood samples containing lps and a specific inhibitor, as stated in the respective experiments, were recalcified with calcium chloride and subjected to rotational thrombelastography (roteg 5, pentapharm, munich, germany), a modification of the original thrombelastography method. following incubation period reaction was stopped by lyse / fix buffer (bd phosflow, bd, san jode, usa). after a wash with phosphate - buffered saline, protein lysates were prepared using the lysis buffer included in the pathscan inflammation multi - target sandwich elisa kit (cell signaling, danvers, usa). the lysates were subjected to elisa analysis for the phosphorylated forms of nf-b p65, p38 mapk, and jnk in duplicate using the elisa kit according to the manufacturer 's instructions. the normality distribution was tested using kolmogorov - smirnov test showing that all variables were normally distributed. the results were evaluated using one - way analysis of variance (anova). statistical significance was set at p < 0.05. after testing homogeneity of variance by levene test, the tukey hsd post hoc test was selected for all analyses. all analyses were done using paswstatistics 18.0 (spss inc., chicago, il, usa). stimulation of blood with 100 g / ml lps induced rapid phosphorylation of nf-b and p38 mapk within 15 min. nf-b phosphorylation increased 2-fold (217 33%) and p38 mapk phosphorylation increased 1.5-fold (145 4%) (figures 1(a) and 1(b)). in contrast, jnk showed no alteration in phosphorylation after incubation with lps (figure 1(c)). preincubation with the p38 mapk inhibitor sb203580 and nf-b inhibitor bay117082 completely blocked the lps - activated phosphorylation of p38 mapk and nf-b, respectively. the jnk inhibitor sp600125 diminished jnk phosphorylation almost by half (figure 1). the inhibition effect after lps stimulation of all three inhibitors showed similar effects : bay117082 reduced nf-b phosphorylation from 217% to 129% (41%), sb203580 reduced p38 mapk phosphorylation from 145% to 105% (28%), and sp600125 reduced jnk phosphorylation from 110% to 61% (44%), respectively. during incubation of whole blood with 100 g / ml lps over a period of 4 hours, we observed a reduction of ct from 579 76 sec to 145 25 sec (figure 2). preincubation with the p38 mapk inhibitor sb203580 inhibited lps - induced coagulation (figure 2(b)). preincubation with 1 m sb203580 increased ct from 145 25 to 330 114 sec, 10 m sb203580 to 329 69 sec, and 100 m sb203580 to 512 12 sec, respectively. in contrast to the marked effects of sb203580, administration of bay117082, a selective nf-b inhibitor, and sp600125, a selective jnk inhibitor, showed no significant effect on ct (figure 2(a)). preincubation with 100 m bay117082 and 100 m sp600125 increased ct from 145 25 sec to 191 44 sec and from 145 25 sec to 218 26 sec, respectively. we recently demonstrated that inhibition of lps - induced p38 mapk activation in neonatal and adult blood was associated with a strong reduction in release of cytokines, whereas pharmacological inhibition of nf-b showed no effect. in the present study we investigated the role of p38 mapk, nf-b, and jnk for activation of hemostasis measured by teg. for the determination of coagulation in whole blood samples, we used teg as reported previously. although fast and simple, teg is able to analyse and dissect single steps of the dynamic process of blood coagulation differentially, beginning from activation of clotting factors through fibrin formation, platelet aggregation, and, finally, clot lysis. the sensitivity of this method is high, as shown by concentration response curve for tf, because exogenously applied tf shortened clotting time at concentrations as low as 100 fm. this concentration is 60 times smaller than the tf concentration evoked by lps in the present study. we used lps at a concentration of 100 g / ml to stimulate coagulation cascade. this concentration was chosen according to a concentration response curve which was constructed under identical experimental conditions. the 50% effective concentration (ec50) of the lps effect in that study was 18 g / ml, and this value corresponds well to the concentration range of other whole blood studies [1416 ]. therefore we decided to maximally stimulate coagulation using the fivefold concentration in the present study. the relevance of the chosen lps concentration is underlined by the fact that the lps content of erythrocytes from septic patients has been demonstrated by our group to be 77 26 g / ml. furthermore, the procoagulant effects of lps was demonstrated to be mediated by de novo synthesis of tf, since cycloheximide and active site - inhibited factor viia, respectively, completely inhibited the lps - induced shortening of ct. stimulation of blood with lps induced rapid phosphorylation of p38 mapk and nf-b within 15 min, whereas jnk were not altered. several authors have implicated nf-b and p38 mapk to be critical mediators of the release of inflammatory cytokines and regulate the expression of a variety of genes involved in the acute - phase response such as tnf-, il-6, and other inducible enzymes [18, 19 ]. preincubation with the p38 mapk inhibitor sb203580 and nf-b inhibitor bay117082 blocked the lps - activated phosphorylation of p38 mapk and nf-b to control values, respectively. the jnk inhibitor sp600125 diminished jnk phosphorylation almost by half. concerning inhibition effect after lps stimulation, sp600125 showed similar properties compared to sb203580 and bay117082. incubation with lps was associated with induction of coagulation cascade, as reflected by strong reduction of ct. since tissue factor is essential for activation of the coagulation cascade [20, 21 ] and p38 mapk inhibition reduces lps - induced tissue factor, the anticoagulatory activity of sb203580 may be due to suppression of the lps - induced tissue factor upregulation. furthermore, reduced proinflammatory response through p38 mapk inhibition might have an additional inhibitory effect on activation of hemostasis [10, 2325 ]. in contrast to the marked effects of sb203580 on ct, the inhibitor did not affect maximal clot firmness (mcf) (not depicted), which is dependent on fibrinogen polymerization, platelet number, and function, confirming the expected effect of sb203580 on tissue factor inhibition. although lps strongly activates nf-b, administration of bay117082, a selective nf-b inhibitor, showed no significant effect on ct. in line, we recently demonstrated that inhibition of nf-b had no significant effect on lps - induced early cytokine expression in neonatal and adult whole blood. many of the downstream targets of the jnk pathway are transcription factors including c - jun, atf-2, and elk-1 which regulate transcription of proinflammatory mediators, like tf. however, in the present study jnk pathway was not activated by lps, and selective inhibition of jnk showed no effect on lps - induced coagulation. these results are in line with recently flow cytometric analysis of human monocytes showing no significant changes in phosphorylation of jnk after lps stimulation. according to our knowledge all other studies, which showed lps - mediated activation of jnk pathway, we suggest that nf-b and jnk activation play a minor role in lps - mediated early systemic inflammatory response and early activation of coagulation. in conclusion we purport that p38 mapk is crucially involved in early activation of coagulation during lps stimulation. to confirm procoagulatory properties of p38 mapk during inflammation further in vivo studies using specific inhibitors are necessary. | during gram - negative sepsis, lipopolysaccharide (lps) activates toll - like receptor (tlr) 4 and induces complex responses of immune system and coagulation. however, the underlying lps signalling mechanism on coagulation activation remains complex. to determine the role of the intracellular signalling factors p38 mitogen - activated protein kinase (mapk), nuclear factor - kappa b (nf-b), and c - jun n - terminal kinase (jnk) in the procoagulant response to lps, coagulation process of human whole blood exposed to specific inhibitors was measured by thrombelastography. samples were stimulated with lps (100 g / ml) after preincubation with bay117082 (specific nf-b inhibitor), sp600125 (specific jnk inhibitor), sb203580 (specific p38 mapk inhibitor), or vehicle. sb203580 strongly inhibited lps - induced coagulation activation, whereas bay117082 and sp600125 showed no significant effect. activation of p38 mapk, nf-b, and jnk and respective inhibitory effects were confirmed by multi - target sandwich elisa. in conclusion, activation of p38 mapk is crucial for early lps - induced activation of coagulation. |
in malaria holoendemic areas, where malaria is stable and intense throughout the year, morbidity and mortality from plasmodium falciparummalaria occur primarily in children aged 624 months and decrease significantly after 24 months of age. age - related protection from p. falciparum infection and disease in these areas is thought to be related to acquisition of cellular and humoral immunity to pre - erythrocytic and blood - stage p. falciparum antigens. t lymphocyte cytokine production to p. falciparum pre - erythrocytic and blood - stage antigens, particularly ifn- and il-10 production, appears to be important in induction and maintenance of immunity to p. falciparum in naturally exposed populations. the pre - erythrocytic antigen liver - stage antigen-1 (lsa-1) is recognized by cytotoxic t lymphocytes (ctl) in animal models and humans naturally exposed to malaria. in vitro studies in areas of stable and unstable malaria transmission have shown that lsa-1 evokes strong ifn- and il-10 responses, and these responses correlate with protection from infection [5 - 9 ]. development of cellular immunity to blood - stage antigen merozoite - surface protein-1 (msp-1) in experimental and human malaria involves mainly cd4 t cell ifn- responses [2,10 - 12 ]. in some rodent malaria models, th1 cells producing ifn- and il-2 are important for controlling infection in its early phases, while th2 cells producing il-4 and il-10, together with antibodies, are important for parasite clearance in the later phases of infection. our prior studies and those of other groups have documented that ifn- and il-10 responses to lsa-1 are present in older children (> 5 years) and adults in malaria endemic areas [5 - 8 ]. however, the frequency of these responses in children aged 04 years is not well described. an understanding of the development of ifn- and il-10 responses to lsa-1 and msp-1 in children with natural exposure to malaria from birth to 4 years of age is important because this age group is the target group for malaria vaccine development. studies of t cell cytokine responses in young children have been hampered by the difficulty in obtaining venipuncture blood samples from these children and in obtaining adequate numbers of mononuclear cells for testing of responses. finger - prick blood sampling was successfully used in this study with lower cell concentrations to conduct a cross - sectional study of ifn- and il-10 responses to lsa-1 and msp-1 in children aged 148 months in a malaria holoendemic area of western kenya. blood samples for cytokine testing were collected from a total of 48 children aged 148 months in the location of kanyawegi, western kenya, an area of intense, perennial malaria transmission. written informed consent was obtained from the parents or guardians of all children who participated in the study. ethical approval was obtained from the ethical review committee at the kenya medical research institute and the human investigations institutional review board at case western reserve university and university hospitals of cleveland, cleveland, oh. approximately 0.51 ml volume of blood was collected from each individual by finger - prick method. the finger to be pricked the first drop of blood was wiped using dry gauze and the finger was then squeezed gently to get 0.51 ml of blood in a microtainer containing the anticoagulant edta (bd microtainer, becton dickson, franklin lakes, usa). blood samples were then transported to the case western reserve university laboratory at the center for vector biology and control research, kemri, kisian, kenya. thick and thin blood smears were stained using 5% giemsa solution and examined for plasmodium species by two microscopists. parasite density/l of blood was calculated by counting the number of parasites per 200 white blood cells and multiplying by 40, assuming an average white blood cell count of 8000/l. peripheral blood mononuclear cells (pbmc) were separated from the whole blood by ficoll - hypaque density gradient centrifugation. the final pellet was suspended in 0.5 ml of rpmi 1640 medium (gibco, invitrogen, paisley, scotland, uk) supplemented with 5% heat inactivated human ab serum, 50 mg / ml gentamicin, 10 mm hepes and 2 mm glutamine. cells were plated in duplicate at a final concentration of 1 10cells / ml, 200 l / well, on 96 well u - bottom microtiter plates (microtest, becton dickson). cell culture supernatants were removed after 72 hours and tested for the presence of ifn- and il-10. 96 well elisa microtiter plates (immulon4 hbx, thermo labsysytems, east forge parkway, franklin, usa) were coated with 50 l / well of primary antibody and incubated at 4c overnight. the plates were washed twice using 1x pbs with 0.05% tween 20 (pbs - t), blocked with 50 l /well of 3% bsa and incubated at 37c for 1 hour. plates were then washed twice, and samples, standards and blanks added at 50 l /well. plates were incubated at 37c for 2 hours, washed twice and 50 l / well of biotinylated secondary antibody was added. plates were incubated at room temperature for 45 minutes, washed twice and 50 l / well of streptavidin alkaline phosphatase (jackson immunoresearch, west grove, pa) at a 1:2000 dilution was added. louis, mo) was added. optical density (o.d.) of the standards and samples were read at 405 nm when the highest standard reached an o.d. between 1.0 and 1.4 nm. values were compared to standards with known concentrations of ifn- and il-10 and sample concentrations extrapolated from a standard curve. values of baseline (unstimulated) culture supernatants were subtracted from those of peptide / mitogen - stimulated culture supernatants. the frequencies and levels of cytokine responses to lsa-1 and msp-1 were tested using the previously described msp-1 peptide aa20 to 39, amino acid (aa) sequence vthesyqelvkklealedav lsa-1 peptide t3 (aa 1813 to 1835), aa sequence nenlddldegieksseelseeki. these peptides have been demonstrated to elicit t cell cytokine responses from individuals in malaria endemic populations. peptides were synthesized and purified by high - performance liquid chromatography (hplc) to > 95% purity (sigma genosys, st. louis, mo) and used at a concentration of 10 g / ml. phytohaemagglutinin (pha) at 5 g / ml and phorbol-12-meristate-13-acetate plus ionomycin (pma - i) at 20 ng / ml and 1 g / ml, respectively, were used as positive mitogen controls. only individuals with cytokine concentrations of 20 pg / ml to pha or pma - i were analysed for peptide - induced cytokine responses. individuals with peptide - induced cytokine concentrations of 20 pg / ml were considered positive responders for that peptide while those with cytokine concentrations 20 pg / ml were considered non - responders to that peptide. frequencies of cytokine responses were compared across age groups (012, 1324, 2536 and 3748 months old) by chi - square analysis for trend. log - transformed cytokine levels were compared across age groups by analysis of variance (anova). for the purpose of log transformation, all stimulated supernatants with no production of cytokine above media were given a value of 1 pg/l. stata 7.0 (stata corporation, texas, usa) was used for all statistical analysis. blood samples for cytokine testing were collected from a total of 48 children aged 148 months in the location of kanyawegi, western kenya, an area of intense, perennial malaria transmission. written informed consent was obtained from the parents or guardians of all children who participated in the study. ethical approval was obtained from the ethical review committee at the kenya medical research institute and the human investigations institutional review board at case western reserve university and university hospitals of cleveland, cleveland, oh. approximately 0.51 ml volume of blood was collected from each individual by finger - prick method. the finger to be pricked was cleaned with 70% alcohol and pricked using a sterile lancet. the first drop of blood was wiped using dry gauze and the finger was then squeezed gently to get 0.51 ml of blood in a microtainer containing the anticoagulant edta (bd microtainer, becton dickson, franklin lakes, usa). blood samples were then transported to the case western reserve university laboratory at the center for vector biology and control research, kemri, kisian, kenya. thick and thin blood smears were stained using 5% giemsa solution and examined for plasmodium species by two microscopists. parasite density/l of blood was calculated by counting the number of parasites per 200 white blood cells and multiplying by 40, assuming an average white blood cell count of 8000/l. peripheral blood mononuclear cells (pbmc) were separated from the whole blood by ficoll - hypaque density gradient centrifugation. the final pellet was suspended in 0.5 ml of rpmi 1640 medium (gibco, invitrogen, paisley, scotland, uk) supplemented with 5% heat inactivated human ab serum, 50 mg / ml gentamicin, 10 mm hepes and 2 mm glutamine. cells were plated in duplicate at a final concentration of 1 10cells / ml, 200 l / well, on 96 well u - bottom microtiter plates (microtest, becton dickson). cell culture supernatants were removed after 72 hours and tested for the presence of ifn- and il-10. 96 well elisa microtiter plates (immulon4 hbx, thermo labsysytems, east forge parkway, franklin, usa) were coated with 50 l / well of primary antibody and incubated at 4c overnight. the plates were washed twice using 1x pbs with 0.05% tween 20 (pbs - t), blocked with 50 l /well of 3% bsa and incubated at 37c for 1 hour. plates were then washed twice, and samples, standards and blanks added at 50 l /well. plates were incubated at 37c for 2 hours, washed twice and 50 l / well of biotinylated secondary antibody was added. plates were incubated at room temperature for 45 minutes, washed twice and 50 l / well of streptavidin alkaline phosphatase (jackson immunoresearch, west grove, pa) at a 1:2000 dilution was added. louis, mo) was added. optical density (o.d.) of the standards and samples were read at 405 nm when the highest standard reached an o.d. between 1.0 and 1.4 nm. values were compared to standards with known concentrations of ifn- and il-10 and sample concentrations extrapolated from a standard curve. values of baseline (unstimulated) culture supernatants were subtracted from those of peptide / mitogen - stimulated culture supernatants. the frequencies and levels of cytokine responses to lsa-1 and msp-1 were tested using the previously described msp-1 peptide aa20 to 39, amino acid (aa) sequence vthesyqelvkklealedav lsa-1 peptide t3 (aa 1813 to 1835), aa sequence nenlddldegieksseelseeki. these peptides have been demonstrated to elicit t cell cytokine responses from individuals in malaria endemic populations. peptides were synthesized and purified by high - performance liquid chromatography (hplc) to > 95% purity (sigma genosys, st. louis, mo) and used at a concentration of 10 g / ml. phytohaemagglutinin (pha) at 5 g / ml and phorbol-12-meristate-13-acetate plus ionomycin (pma - i) at 20 ng / ml and 1 g / ml, respectively, were used as positive mitogen controls. only individuals with cytokine concentrations of 20 pg / ml to pha or pma - i were analysed for peptide - induced cytokine responses. individuals with peptide - induced cytokine concentrations of 20 pg / ml were considered positive responders for that peptide while those with cytokine concentrations 20 pg / ml were considered non - responders to that peptide. frequencies of cytokine responses were compared across age groups (012, 1324, 2536 and 3748 months old) by chi - square analysis for trend. log - transformed cytokine levels were compared across age groups by analysis of variance (anova). for the purpose of log transformation, all stimulated supernatants with no production of cytokine above media were given a value of 1 pg/l. stata 7.0 (stata corporation, texas, usa) was used for all statistical analysis. frequency and density of parasitemia did not differ significantly across age groups (table 1). presence of parasitemia did not correlate with ifn- or il-10 responses or levels to either lsa-1 or msp-1 (tables 2 and 3), and levels of parasitemia did not correlate with cytokine levels to any peptide (spearman 's rho 0.04 0.15, all p values > 0.1). p 0.1). p 90% in the present study). the authors speculated that the low frequency of pha - stimulated ifn- responses might be due to down - regulation of these responses by acute p. falciparum infection. the high frequencies of pha - stimulated ifn- responses in the children in this study, most of whom were infected with p. falciparum, suggest that p. falciparum infection does not down - regulate mitogen stimulation of t cells, even in young children. previous studies and the present study have not documented any difference in frequency or levels of ifn- responses to lsa-1 in individuals with or without parasitemia, demonstrating that p. falciparum infection also does not suppress these responses in young children. in previous studies in a highland area with highly seasonal malaria, it has been documented that il-10 responses to lsa-1 were similar in children and adults and decreased dramatically in the absence of high transmission. a recent study in a malaria endemic area of gabon also documented similar il-10 responses to lsa-1 in children and adults. taken together, these findings suggest that il-10 responses to lsa-1 are not dependent on age or chronic, repeated exposure but may be transient and related to recent infection, among other factors. the il-10 responses in this population of children were low - level and infrequent, but these responses were from samples taken at a single time point and may have been low for sampling or testing reasons. given the protection from infection seen with il-10 responses to lsa-1 in adults and older children in malaria endemic populations, it will be important to assess whether il-10 responses in young children in this area are truly low, whether strong il-10 responses can be induced by vaccines with high concentrations of antigen or specific adjuvants, and whether these responses are protective in this younger age group. the similar frequencies and levels of il-10 responses to lsa-1 in children with and without parasitemia suggest that active p. falciparum infection does not suppress or increase these responses. ifn- responses to the blood - stage antigen msp-1 showed the same age - related pattern as those to lsa-1. if the protection from malaria infection and disease associated with ifn- responses to msp-1 in rodent malaria models is confirmed in human populations, future studies will need to investigate whether age, repeated exposure or both are necessary for induction of these responses. the present study establishes that frequencies and levels of ifn- responses to lsa-1 and msp-1 are low in the first 2 years of life but increase to close to adult levels by the age of 4 years, while il-10 responses to these antigens appear unrelated to age, in children in a malaria holoendemic area of kenya. prospective cohort studies of children from birth to age 4 years in malaria endemic areas are required to determine how ifn- and il-10 responses to lsa-1 and msp-1 relate to prior infection, the longevity of these responses, and their relation to protection from infection and disease. all authors had a part in revision of the final manuscript and approved the final manuscript. this work is published with the permission of the office of the director of the kenya medical research institute. we thank livingstone wanyama, jackson abuya, and justus opondo for sample collection and inspection of blood smears. | backgroundin areas of high - level, year - round malaria transmission, morbidity and mortality due to malaria decrease after the first two to three years of life. this reduction may be related to the development of cellular immunity to specific antigens expressed in the different life - cycle stages of plasmodium falciparum.methodsa cross sectional study was conducted to evaluate t cell cytokine responses to the p. falciparum pre - erythrocytic antigen liver - stage antigen-1 (lsa-1) and the blood - stage antigen merozoite - surface protein-1 (msp-1) in children under five years of age residing in a malaria holoendemic region of western kenya. interferon- (ifn-) and interleukin-10 (il-10) responses to the lsa-1 t3 peptide (aa 18131835) and the msp-1 aa2039 peptide were tested in 48 children.resultsthe proportion of children producing ifn- to lsa-1 and to msp-1 increased with age : in the 012, 1324, 2536 and 3748 month age groups, zero, 11.1, 36.4 and 40% of children had ifn- responses to lsa-1 (p = 0.019), and 10, 10, 27.7 and 40% of children had ifn- responses to msp-1 (p = 0.07), respectively. in contrast, the proportion of children producing il-10 to lsa-1 and msp-1 was similar in all age groups.conclusionthe data suggest that development of ifn- responses to lsa-1 and msp-1 requires increased age and/or repeated exposure, whereas il-10 responses to these antigens may occur at any age and with limited exposure. the data also demonstrate that by the age of 4 years, children in a malaria holoendemic area develop frequencies of ifn- responses to lsa-1 and msp-1 similar to those seen in adults in the area. |
in patients with mandibular retrognathism, it is difficult to establish a satisfactory esthetic profile,12 improve the respiratory function,34 and achieve stable treatment outcomes25 with orthodontic treatment alone. surgical mandibular advancement with bilateral sagittal split osteotomy (bsso) or distraction osteogenesis (do) is generally required for effective treatment,6 and both osteotomy techniques have exhibited equal effectiveness and good outcomes.7 however, progressive condylar resorption (pcr) sometimes occurs as a serious complication of surgical mandibular advancement.8 although the precise underlying mechanism remains unclear, overloading of the condyle during or after surgery is considered one of the main etiologies for pcr.910 moreover, kobayashi.11 reported that clicking in the temporomandibular joint (tmj) and malformation of the condyles can be risk factors for pcr. here we report a case involving a young female patient with severe mandibular retrognathism and bilateral condylar deformities caused by severe mandibular hypogrowth after the first phase of orthodontic treatment. bilateral pcr was suspected, and surgical mandibular advancement was associated with a high risk of further condylar resorption. accordingly, we performed le fort i osteotomy with two genioplasty procedures, avoiding surgical mandibular advancement to prevent excessive loading of the condyles. good esthetic and functional outcomes were achieved, with maintenance of a satisfactory facial profile at 30 months after treatment completion. a girl aged 9 years and 9 months was referred to the outpatient clinic of our university hospital from the plastic surgery unit at another hospital. she had been diagnosed with left - sided unilateral cleft lip and palate (uclp) and had undergone cheiloplasty at 4 months of age. compared with the average height of japanese girls of the same age (133.5 6.2 cm) her medical history revealed epileptic seizures at 9 years of age and a congenital ventricular septal defect. an increased lower facial height, facial asymmetry, and circumoral muscle strain on lip closure were observed. she was in the mixed dentition stage and exhibited an anterior crossbite, with an overjet of 1.5 mm and an angle class iii molar relationship on both sides (figure 2). surgical scars were present on the distal side of the maxillary left central incisor, which was mesially rotated by 90. the maxillary and mandibular arches were narrow, with moderate crowding in the mandibular incisor region. clinical examination and a panoramic radiograph revealed the congenital absence of the maxillary left lateral incisor and all second premolars (figure 3). an alveolar bone defect was observed between the maxillary left lateral incisor and the deciduous canine. lateral and posteroanterior cephalograms showed digitate impressions on the surface of the skull and a deviated nasal septum. cephalometric analysis (table 1) showed a skeletal class ii relationship (a point - nasion - b point angle, anb ; 9.0) with mandibular retrusion (sellanasion - b point angle, snb ; 67.0). in addition, the mandibular body was short compared with the japanese norms.12 the mandibular plane (mp) angle was steep and the ramus plane (rp) was rotated clockwise (mp frankfort [fh ] plane, 39.0 ; rp fh, 90.5). the maxillary and mandibular incisors were lingually inclined and extruded (upper incisor axis to fh, u1fh, 99.0 ; angle between axial inclination of mandibular central incisor and mp, l1mp, 85.5 ; perpendicular distance of u1 to nasal floor, u1/nf, 32.5 mm ; perpendicular distance of l1 to mp, l1/mp, 44.5 mm). on the basis of her small stature and medical history of seizures, a ventricular septal defect, and uclp, we suspected a syndrome. however, a plastic surgeon ruled out any syndrome. therefore, we diagnosed the patient with angle class iii malocclusion, a skeletal class ii jaw relationship, an anterior crossbite, moderate mandibular incisor crowding, and left - sided uclp. the treatment objectives were as follows : correction of the anterior crossbite, expansion of the maxillary alveolar cleft before bone grafting, and achievement of dental alignment and leveling for adequate intercuspation. orthognathic surgery was planned as the second phase of treatment if the maxilla and/or mandible failed to show ideal growth after permanent tooth eruption and growth completion. first, the narrow maxillary arch was expanded using a quadhelix device before bone grafting at 10 years of age. alveolar bone grafting was performed at 10 years and 3 months of age to close the left - sided uclp and ensure continuity of the alveolar bone. after successful bone grafting, the maxillary crossbite and maxillary incisor angulation were corrected using a lingual arch at 11 years and 3 months of age. patients with clp usually exhibit skeletal class iii malocclusion with maxillary deficiency because of the cleft itself and fibrous scar tissue formation caused by reconstructive surgery. however, in our patient, at the completion of maxillary and mandibular growth, we recognized downward and backward rotation of the mandible caused by the lack of forward growth and excessive vertical growth of the maxilla from the cephalometric superimposition (figure 4). furthermore, the mandibular notch had become significantly deeper relative to the initial position (figure 4c). as a result, the facial profile appeared significantly retrognathic compared with the initial profile (figure 5). moreover, an excessive overjet and an anterior open bite were observed (figure 6). the snb angle had decreased by 6.5 and the anb and mp - fh angles had increased by 5.5 and 10.0, respectively (table 1). in addition, bilateral finger - shaped condyles with anterior bone surface resorption were observed (figures 7 and 8). we reassessed the patient at the beginning of the second phase of treatment and diagnosed suspected bilateral pcr on the basis of the growth pattern and imaging findings. the treatment objectives in the second phase were as follows : correction of the retrognathic facial profile from esthetic and functional perspectives, correction of the anterior open bite and excessive overjet, and achievement of an acceptable occlusion. to achieve the abovementioned treatment objectives, surgical orthodontic treatment with double - jaw surgery (le fort i intrusion osteotomy and mandibular ramus osteotomy) was considered necessary to advance the mandible. bsso and do are the most common procedures for surgical mandibular advancement and generally result in good treatment outcomes. however, we suspected bilateral pcr in our patient and preferred to avoid mandibular advancement osteotomy to prevent any further condylar resorption. therefore, we planned le fort i osteotomy with genioplasty to avoid ingravescence of pcr and achieve counterclockwise rotation of the mandible. we planned two genioplasty procedures to achieve an esthetic facial profile through advancement and vertical reduction of the chin. the maxilla must be positioned posteriorly in cases of maxillary impaction to achieve autorotation of the mandible. to eliminate the risk of forward repositioning of the maxilla by posterior interference, we reluctantly decided to extract the impacted second molar to create enough space for setback osteotomy. in the second phase of treatment, at 15 years and 6 months of age, preadjusted edgewise appliances with 0.018-inch slots were placed in the maxilla and mandible and leveling of both arches was initiated. the patient also had to wear a high - pull headgear appliance at least 10 hours per day for intrusion of the maxillary molars and prevention of clockwise mandibular rotation caused by molar extrusion. after 18 months of presurgical orthodontic treatment, we observed discontinuation of mandibular growth and active condylar erosion by superimposition of serial cephalometric tomograms obtained in the last 6 months. therefore, le fort i intrusion osteotomy was performed with advancement genioplasty and extraction of the maxillary second molar. the maxilla was impacted by 7.0 mm in the incisor region and 5.0 mm in the first molar region, and the chin was advanced by 11.0 mm because of counterclockwise rotation of the mandible led by maxillary impaction and advancement genioplasty. during postsurgical orthodontic treatment, a second genioplasty procedure was performed with 8.0-mm advancement and 6.0-mm vertical reduction of the chin, along with rhinocheiloplasty. subsequently, a vacuum - formed retainer for the maxillary arch and a vacuum - formed retainer and a lingually bonded retainer for the mandibular arch were provided for retention. the patient s post - treatment records showed significant resolution of both skeletal disharmony and malocclusion (figures 9, 10, 11). cephalometric evaluation showed an increased snb angle (64.0) and a decreased mp - fh angle (34.0), although the skeletal jaw relationship was still class ii (anb, 11.0 ; table 1). the maxilla was impacted by 7.0 mm in the incisor region and 5.0 mm in the first molar region, while the pogonion was advanced by 18.0 mm through mandibular counter - clockwise rotation and the two advancement genioplasty procedures (figure 12). morphological changes in the bilateral condyles were not observed on computed tomography (figure 13). in addition, hyoid bone advancement and an increased pharyngeal airway volume were observed (figure 14). at the 30-month follow - up examination, we observed a satisfactory facial profile and a slightly decreased overbite (figure 15). there were minimal changes in the dentition and negligible clockwise rotation of the mandible (figure 12). we described the effective treatment of severe mandibular retrognathism with suspected pcr using le fort osteotomy and two genioplasty procedures, thus eliminating the need for surgical mandibular advancement. the treatment was mainly aimed toward achieving satisfactory esthetics and respiratory function and long - term stability. to achieve improved esthetics and simultaneously avoid condylar overloading, le fort i osteotomy for superior repositioning of the maxilla and advancement genioplasty for counterclockwise rotation of the mandible and anterior projection of the chin were performed. do and bsso are two commonly used procedures for the treatment of mandibular retrognathism from esthetic and functional perspectives.67 however, these procedures occasionally result in pcr, particularly in patients who undergo long - span mandibular advancement with continuous overloading in the tmj region.81113 although the precise etiology of pcr remains unclear, tmj stress or overloading is considered one of the main causes.91014 unfortunately, despite the presence of severe mandibular retrognathism, our patient developed finger - shaped condyles on both sides after the first phase of orthodontic treatment, probably because of bone surface absorption. condylar malformation is also suggested as a risk factor for pcr.11 because our patient had suspected pcr and was at a high risk of further resorption with surgical mandibular advancement, we decided to perform le fort i osteotomy with two advancement genioplasty procedures and avoided mandibular surgery, which would improve the facial profile without stressing the tmj at the end of mandibular growth. some studies have reported a relationship between le fort i osteotomy with superior repositioning and condylar resorption. hoppenreijs.15 reported that the incidence of condylar resorption was 9% with le fort i intrusion osteotomy only, and this was lower than the incidence with bimaxillary osteotomies in patients with an anterior open bite. they suggested that intermaxillary fixation (imf) with rigid internal fixation should be avoided to minimize condylar changes. therefore, we used compression bandages around the head and neck as an alternative to imf after le fort i osteotomy. consequently, no significant changes in the condylar morphology were observed at 24 months after surgery. to assess the respiratory function, we evaluated the pharyngeal area by superimposition of pre - treatment and post - treatment cephalograms (figure 14a) and the airway volume using the dolphin 3d software (dolphin imaging and management solutions, chatsworth, ca, usa) for airway analysis (figure 14b). severe mandibular retrognathism is often accompanied by pharyngeal airway obstruction,3 probably because of downward displacement of the tongue. therefore, advancement genioplasty can achieve extensive anterior retraction of the suprahyoid musculature and decrease the signs and symptoms of obstructive sleep apnea syndrome, including the apnea hypopnea index.1617 moreover, the posterior airway space significantly increases after advancement genioplasty.1819 our patient also snored during her sleep before treatment, and we believe that her treatment has minimized any future risks of obstructive sleep apnea. with regard to long - term stability, the maxillary, chin, and jaw positions appeared stable at the 30-month follow - up examination in our patient. le fort i osteotomy with superior repositioning of the maxilla and advancement genioplasty are considered more stable than other procedures.20 in fact, these procedures have been successfully used for effective correction of juvenile idiopathic / rheumatoid patients.21 we suggest that maxillary impaction surgery with advancement genioplasty offers a good prognosis without ingravescence of pcr. at the 30-month follow - up examination for our patient, we observed a slight decrease in the overbite caused by a moderate relapse in the mandibular dentition. we will continue careful follow - ups for her, considering that surgically treated patients are generally at a high risk of relapse because of condylar remodeling or other skeletal changes.2 in the present report, we showed that le fort i osteotomy with two advancement genioplasty procedures was effective for the treatment of severe mandibular retrognathism with suspected pcr and eliminated the need for surgical mandibular advancement using bsso or do, which increases the risk of pcr in some patients. the findings from our case suggest that this surgical treatment is effective for the correction of occlusion and esthetics in patients with severe mandibular retrognathism and condylar deformities, thus decreasing the risk of pcr observed with surgical mandibular advancement. | we report a case involving a young female patient with severe mandibular retrognathism accompanied by mandibular condylar deformity that was effectively treated with le fort i osteotomy and two genioplasty procedures. at 9 years and 9 months of age, she was diagnosed with angle class iii malocclusion, a skeletal class ii jaw relationship, an anterior crossbite, congenital absence of some teeth, and a left - sided cleft lip and palate. although the anterior crossbite and narrow maxillary arch were corrected by interceptive orthodontic treatment, severe mandibular hypogrowth resulted in unexpectedly severe mandibular retrognathism after growth completion. moreover, bilateral condylar deformities were observed, and we suspected progressive condylar resorption (pcr). there was a high risk of further condylar resorption with mandibular advancement surgery ; therefore, le fort i osteotomy with two genioplasty procedures was performed to achieve counterclockwise rotation of the mandible and avoid ingravescence of the condylar deformities. the total duration of active treatment was 42 months. the maxilla was impacted by 7.0 mm and 5.0 mm in the incisor and molar regions, respectively, while the pogonion was advanced by 18.0 mm. this significantly resolved both skeletal disharmony and malocclusion. furthermore, the hyoid bone was advanced, the pharyngeal airway space was increased, and the morphology of the mandibular condyle was maintained. at the 30-month follow - up examination, the patient exhibited a satisfactory facial profile. the findings from our case suggest that severe mandibular retrognathism with condylar deformities can be effectively treated without surgical mandibular advancement, thus decreasing the risk of pcr. |
very recent studies in iran displayed the prevalence of the obesity, hypertension, and hypercholesterolemia are 30.9%, 23%, and 41.6%, respectively. the statin group of drugs is widely used to treat hypercholesterolemia in patients at cvd risk. statins inhibit the rate - limiting enzyme in cholesterol biosynthesis, hydroxymethylglutaryl - coenzyme a (hmg - coa) reductase, and reduce serum low - density lipoprotein cholesterol (ldl - c) levels substantially. further to their conventional lipid - modulating effects, statins possess so - called pleiotropic properties, which comprise improvement of endothelial function, antioxidant properties, anti - inflammatory properties, plaque stabilization, and inhibition platelet aggregation and thrombus formation. it has been reported that statins treatment may be associated with an improved vitamin d status, but this is not a consistent finding. there is emerging evidence suggesting that a decreased vitamin d concentration might rise the possibility of several conditions including cancers and cvd. if statins do have an impact on vitamin d concentration this could be a reasonable elucidation of the described results of diminished risk of fracture ; moreover, reduced risk of malignant illnesses in patients on this class of drugs. thus, the present randomized controlled study set out to investigate the effects of treatment with simvastatin on serum vitamin d in a group of dyslipidemic patients who were suitable for statin therapy. a total of 102 male and female patients, age (2088 old), who were not formerly receiving lipid - lowering drugs, registered from the clinics of ghaem hospital, a teaching hospital located in mashhad, iran, between june 2010 and august 2012. the study was a randomized placebo - controlled cross - over trial ; in this study, each patient took simvastatin or a placebo and next crossed over to the substitute. cardiovascular risk factors were defined as age more than 65 years old, receiving antihypertensive medication or systolic blood pressure of more than 140 mmhg or diastolic blood pressure of more than 90 mmhg, fasting blood glucose (fbg) greater than or equal to 126 mg / dl, positive family history of cvd, smoking, male sex, body mass index (bmi) more than or equal to 30 kg / m. history of malignancy, recent history of infections, connective tissue disorders, treatment with immunomodulatory drugs (e.g., corticosteroids), liver or renal disease, leukocytosis (white blood cell count > 10,000/l), thrombocytosis (platelet count > 450,000 10/l), and anemia (hematocrit 10,000/l), thrombocytosis (platelet count > 450,000 10/l), and anemia (hematocrit 0.05) when we compared the baseline data of biochemical and anthropometric factors before the first treatment period with those before the second treatment period. moreover, no significant difference was found for age, sex, presence of hyperlipidemia, bmi, presence of hypertension, presence of diabetes, and smoking status between the two groups [table 1 ]. comparison of baseline characteristics of subjects statin therapy did not have a significant effect on serum levels of vitamin d in either the statin - placebo or the placebo - statin group [p = 0.90, table 2 ]. bivariate correlations were assessed between baseline values of vitamin d and other evaluated biochemical parameters (total cholesterol, ldl - c, high - density lipoprotein cholesterol [hdl - c ], triglycerides [tgs ], fbg, and hs - crp), as well as between changes in vitamin d and other parameters during each study period. no significant correlation was found between baseline values of vitamin d and evaluated biochemical parameters (p > 0.05) [table 3 ]. furthermore, significant correlations were observed between serum vitamin d and the following parameters : fbg (statin - placebo group, second period ; p 0.05) [table 3 ]. furthermore, significant correlations were observed between serum vitamin d and the following parameters : fbg (statin - placebo group, second period ; p < 0.01), tgs (placebo - statin group, second period ; p < 0.05 and statin - placebo first period ; p < 0.01), ldl - c (placebo - statin group, first period ; p < 0.05), and hdl - c (statin - placebo group, first period ; p < 0.05) [table 4 ]. effect of simvastatin versus placebo on vitamin d status correlation between baseline biochemical parameters and vitamin d in placebo - statin group and statin - placebo group correlation between changes in biochemical parameters in two periods of placebo - statin group and statin - placebo the aim of this study was to investigate the impact of simvastatin therapy on serum vitamin d levels in dyslipidemic patients. our results showed that simvastatin therapy for 4 weeks (40 mg / day) does not alter serum vitamin d levels. previous investigations on the impact of statin therapy on circulating vitamin d levels have been inconsistent. while atorvastatin and rosuvastatin have been shown to raise 25(oh) vitamin d levels, there are reports with opposite findings showing that hmg - coa reductase inhibitors do not affect serum vitamin d concentrations. it is not well known how statins might affect vitamin d concentration, and numerous potential mechanisms have been put forward. the first and by far the most plausible mechanism regards to the common metabolic fate of statins and vitamin d. both 25(oh) vitamin d, and statins are metabolized in the liver by cyp3a4. therefore, the occupation of the active site of this enzyme by statins may account for the elevated 25(oh) vitamin d levels reported in some trials. indicated that rosuvastatin (40 mg / day) as monotherapy and rosuvastatin (10 mg / day) plus fenofibrate (200 mg / day) or omega-3 fatty acids (2 g / day) cause substantial elevations in the 25(oh) vitamin d levels (53%, 64%, and 61%, respectively). moreover, in study by thabit., they found that simvastatin and atorvastatin, at any dose for duration of more than 1 year, have no additive effect on 25(oh)d level. unlike rosuvastatin and atorvastatin, no considerable change in vitamin d concentration has been reported in patients that used fluvastatin. a new randomized controlled trial could not prove an effect of 12 months simvastatin therapy (40 mg / day) on vitamin d concentration. the physicochemical characteristics of different statins may also play a role in their differential effects on vitamin d metabolism. first, the study design did not allow adequate time for a new steady - state level of vitamin d, did not control or report vitamin d intake, did not analyze for seasonal effects, and the 25(oh) vitamin d assay was not the ms / ms gold standard. the main strength of the present study was being based on a robust placebo - controlled and cross - over design as well as being conducted in a target population, not under concomitant lipid - lowering therapy. therefore, many of the confounding factors that may generally affect lipid alterations were eliminated from the present trial. we found that statin had no significant effect on serum vitamin d status in dyslipidemic patients. further research might explore the effects of long - term statin therapy on vitamin d status. | background : hydroxymethylglutaryl - coenzyme a reductase inhibitors (statins) are antihyperlipidemic drugs with an established efficacy in stabilizing atherosclerotic plaques and preventing atherogenesis and reducing cardiovascular events. the purpose of this study was to determine the effect of simvastatin on serum vitamin d status in dyslipidemic patients as vitamin d status has an impact on monocyte / macrophage function and may also contribute to cardiovascular risk.methods:selected individuals (n = 102) were treated with simvastatin (40 mg / day), or matching placebo in a randomized, double - blind, placebo - controlled, crossover trial. each treatment period (with simvastatin or placebo) lasted for 30 days and was separated by a 2-week washout phase. serum vitamin d concentration was assessed pre- and post-treatment.results:seventy-seven completed the trial, noncompliance with the study protocol and drug intolerance or relocation were the causes for drop - out. no significant carry - over effect was observed for the assessed parameters. there was a reduction in the serum levels of low - density lipoprotein cholesterol (p 0.05).conclusions : short - term treatment with simvastatin (40 mg / day) does not have a significant affect on serum levels of vitamin d. |
extensive evidence from studies employing a variety of mammalian species indicates that memory is organized in multiple brain systems that differ in terms of the type of memory they mediate (for reviews see squire., 1993 ; packard and knowlton, 2002 ; white and mcdonald, 2002 ; squire, 2004). neurobiological evidence that the brain contains multiple memory systems has led to the proposal of several dual - memory theories designed to define the psychological operating principles that distinguish different forms of memory (for review see kesner, 1998). each of these theories was derived primarily from a comparison of the pattern of spared and impaired learning and memory functions observed following damage to the hippocampal system. in addition, the operating principles described in many dual - memory theories, particularly those derived from the animal literature, are heavily influenced by the classical debate between cognitive for example, the memory functions of the mammalian hippocampal system have been described as essentially neo - tolmanian in nature, while the types of learning spared following hippocampal system damage are often readily interpreted by hullian - like s - r or habit learning theories (e.g., hirsh, 1974 ; o'keefe and nadel, 1978 ; mishkin and petri, 1984). in rats, evidence for the multiple memory systems hypothesis is found in experiments comparing the effects of manipulations of the hippocampal system and caudate - putamen (i.e., dorsal striatum). in studies using pairs of tasks with similar motivational, sensory, and motoric processes, lesions of the rat hippocampal system and dorsal striatum result in a double dissociation of task acquisition (packard., 1989 ; packard and mcgaugh, 1992 ; mcdonald and white, 1993 ; kesner., 1993). for example, lesions of the fimbria - fornix impair acquisition of win - shift behavior in the radial maze, a learning task that requires rats to remember which maze arms have been visited within a daily training session (packard., 1989). however, fornix lesions facilitate acquisition of a simultaneous visual discrimination win - stay radial maze task, in which food baited maze arms are signaled by a light cue (packard., 1989). in contrast, lesions of the dorsal striatum impair acquisition of the win - stay radial maze task, but have no effect on acquisition of win - shift behavior (packard., 1989 ; another early experiment in rats demonstrating a double dissociation between the mnemonic functions of the hippocampal system and dorsal striatum used two versions of a two - platform water maze task. in this task, two rubber balls protruding above the water serve as cues. one ball (correct) is on a rectangular platform that can be mounted to escape the water, and the other ball (incorrect) is mounted on a thin rod and thus does not provide escape. the two balls also differ in visual appearance (i.e., vertical versus horizontal black / white stripes). in a cognitive version of the task, the correct platform is located in the same location on every trial, but the visual appearance of the ball varies. thus, this version of the task requires rats to learn to approach the correct ball on the basis of spatial location, and not visual pattern. in the s - r habit version of the task, the correct platform is located in different spatial locations across trials, but the visual pattern is consistent. thus, this task can be acquired by learning an approach response to the visual cue (i.e., pattern discrimination). lesions of the fornix, but not the dorsal striatum, impair acquisition of the cognitive task ; whereas lesions of the dorsal striatum, and not hippocampus, impair acquisition of the habit task (packard and mcgaugh, 1992). a further example of the differential roles of the hippocampus and dorsal striatum in memory involves the use of a plus - maze task that served as a battleground for the debate between cognitive and s - r learning theorists during the late 1940's early 1950 's (for review see restle, 1957). the plus - maze apparatus allows an animal to approach a goal box (e.g., east or west) from one of two start boxes (e.g., north or south). in a dual - solution version of the task, rats are trained to start from the same start box (e.g., south) and obtain food in a consistently baited goal box (e.g., west). in describing the manner in which rats acquire this task, cognitive learning theorists argued that rats learn the spatial location of the food reward (i.e., place learning). however, stimulus - response learning theorists argued that rats instead learn to make a specific body turn at the choice point (i.e., response learning). the use of these two possible learning mechanisms can be assessed in a probe trial administered after training, in which rats are started from the opposite start box (e.g., north). on the probe trial, rats that approach the spatial location that contained food during training are designated place learners, whereas rats that make the same body turn that was reinforced during training are designated response learners. although intact rats can use both types of learning in performing the task (depending in part on intra- and extra - maze environmental conditions ; for review see restle, 1957), the multiple memory systems hypothesis raises the possibility that these two types of learning may have distinct neural substrates. this hypothesis was addressed in a plus - maze study designed to differentiate the role of the hippocampus and the dorsal striatum in memory (packard and mcgaugh, 1996). rats were trained in a daily session from the same start box to obtain food from a consistently baited goal box. following a week of daily training the animals prior to the probe trial, rats received intra - dorsal striatal or intra - hippocampal injections of either vehicle saline or the local anesthetic lidocaine, a compound that produces a localized and reversible neural inactivation via a blockade of voltage - gated sodium channels. rats receiving vehicle injections into the hippocampus or dorsal striatum were predominantly place learners on the probe trial. intra - hippocampal, but not intra - striatal injections of lidocaine blocked expression of place learning. thus, the functional integrity of the hippocampus, but not dorsal striatum is necessary for expression of place learning. in order to assess whether the dorsal striatum might be selectively involved in response learning, we took advantage of previous findings indicating that with extended training in the plus - maze intact rats switch from the use of place learning to response learning (for review restle, 1957). accordingly, we trained the rats for an additional week and then administered a second probe trial. rats receiving vehicle injections into either the hippocampus or dorsal striatum were predominantly response learners on the second probe trial, confirming previous reports of a shift from the use of place information to response learning with extended training. intra - hippocampal injections of lidocaine had no effect on the expression of response learning. in contrast, rats receiving intra - striatal lidocaine displayed place learning (i.e., a blockade of the use of response learning observed in control rats). these findings provide further evidence for the differential roles of the hippocampus and the dorsal striatum in memory. they also suggest that, in this dual - solution task, place learning is acquired earlier than response learning and that with extended training the control of learned behavior shifts from the hippocampus to the dorsal striatum. finally, in addition to lesion studies, double dissociations between the roles of the hippocampus and the dorsal striatum in memory have also been observed following post - training intracerebral drug injections (e.g., packard and white, 1991 ; packard., 1994 ; packard and teather, 1997, 1998). for example, post - training intra - hippocampal injections of dopaminergic agonists selectively enhance memory in a win - shift radial maze task, while similar injections into the dorsal striatum selectively enhance memory in a win - stay radial maze task (packard and white, 1991). moreover, post - training intra - hippocampal injections of the glutamatergic nmda receptor antagonist ap5 selectively impair memory in a hidden platform water maze task, while similar injections into the dorsal striatum selectively impair memory in a visible platform water maze task (packard and teather, 1997). in both the hippocampus and the dorsal striatum, the effects of the post - training treatments are time - dependent ; injections delayed 2 h post - training have no effect on memory. the time - dependent nature of these post - training injections strongly implicates these brain regions in the modulation of memory processes (mcgaugh, 1966), and the task - dependent nature of the treatments indicate selective roles for the hippocampus and dorsal striatum in different types of memory. finally, when taken together, double dissociations between the mnemonic functions of the hippocampus and the dorsal striatum in cognitive and habit memory have also been demonstrated in other mammalian species, including monkeys (e.g., teng., 2000 ; fernandez - ruiz., 2001) and humans (e.g., martone., 1984 ; heindel., 1988 ; butters., 1994 ; knowlton., in view of the numerous studies supporting a multiple systems view of memory organization in the mammalian brain, there has been an increasing interest in examining various factors that might influence the relative use of these different systems. in this context we have conducted several experiments assessing the effects of emotional arousal produced by acute stress or drug - induced anxiety on the use of cognitive and habit memory systems. for example, in one study (kim., 2001), rats were exposed to a pre - training stress regimen (restraint stress and intermittent tail - shock) and trained in a dual - solution water maze task in which a visible escape platform is always located in the same spatial location. training in this task appears to involve a parallel activation (mcdonald and white, 1994) of hippocampus - dependent cognitive memory (swim to the same spatial location) and dorsal striatal - dependent habit memory (swim to the visible cue). on a probe trial given after task acquisition, the use of these two learning strategies is assessed by moving the visibly cued platform to a new spatial location and observing whether rats continue to swim to the old location or, alternatively, continue to approach the visible cue. rats that were administered the pre - training stress - regimen acquired the task at a normal rate. however, on a probe trial 24 h after training, the previously stressed rats displayed a predominant use of habit learning, approaching the cued platform in its new location and showing significantly fewer visits to the old spatial location (kim. these findings suggest that, in a task in which both hippocampus - dependent and dorsal striatal - dependent learning is adequate for acquisition, acute stress may bias rats toward the use of striatal - dependent habit memory. we have expanded on these findings by examining the effects of drug - induced anxiety on the relative use of multiple memory systems. accordingly, we selected doses of the -2 adrenoreceptor antagonists yohimbine and rs 79948197 that have been shown to possess anxiogenic properties in rats (e.g., handley and mithani, 1984 ; guy and gardner, 1985 ; white and birkle, 2001). using a water maze version of the dual - solution plus - maze task described earlier, we observed that pre - training peripheral injections of either drug produced a robust use of response learning relative to place learning (packard and wingard, 2004). a similar bias toward the use of response learning in the dual - solution water maze task is also observed if the drugs are injected prior to memory retrieval (i.e., prior to the probe trial), and importantly the effects of pre - training or pre - retrieval injections of rs 79948197 are not due to state - dependency (elliot and packard, 2008). in addition, pre - training exposure to an ecologically valid stressor (trimethlythiazoline, a component of fox feces odor) also biases rats toward the use of dorsal - striatal response learning in the dual - solution water plus - maze task (packard and carlin, unpublished data). taken together, experiments involving the administration of acute stress or anxiogenic drug injections in lower animals suggest that, at least in some learning situations, robust levels of emotional arousal may bias the brain toward the use of a habit memory system. interestingly, lower levels of trait anxiety have been recently shown to correlate positively with place recognition memory and with a preference for the use of hippocampus - dependent place learning in rats (hawley., 2011). the studies reviewed above suggest that acute stress or peripheral anxiogenic drug injections may influence the relative use of multiple memory systems. however, they do not directly identify the neuroanatomical structure(s) that confer the ability of emotional arousal to favor habit learning and memory. in this context there are at least two lines of evidence from animal studies that support the hypothesis that the bla may mediate a modulatory influence of emotional arousal on different memory systems. first, this brain structure has been historically linked to emotional behavior in mammals (e.g., kluver and bucy, 1939), and in rats intra - bla injection of various drugs induces an anxiogenic behavioral and physiological profile (e.g., nagy., 1979 ; scheel - kruger and petersen, 1982 ; sanders and shekhar, 1991). second, decades of research has implicated the bla as a critical brain site for the memory modulatory effects of drugs that influence several transmitter systems, including those activated by emotional arousal (for review see mcgaugh, 2004). according to the hypothesis that the bla functions as a general memory modulatory system, efferent projections of the bla influence the consolidation of memory in other brain structures. consistent with this idea, extensive evidence indicates that the bla modulates memory processes occurring in both the hippocampus and the dorsal striatum (packard., 1994, 1996 ; packard and teather, 1998 ; roozendaal and mcgaugh, 1996, 1997). in order to examine whether the bias toward habit memory produced by peripheral anxiogenic drug administration may involve the bla, rats trained in the dual - solution plus - maze tasks received injections of rs 79948197 directly into this brain structure. on the later drug - free probe trial, these rats showed a significant use of response learning relative to control rats (packard and wingard, 2004). this finding indicates that intra - bla injections of rs 79948197 mimic the effects of peripheral administration of the drug. moreover, we subsequently demonstrated that the dose of rs 79948197 that produces this memory modulatory influence is also anxiogenic when injected into the bla (wingard and packard, 2008). one question raised by these findings in the dual - solution plus - maze task concerns whether intra - bla injections bias rats toward the use of habit learning by directly facilitating striatal - dependent response learning, or in a perhaps more indirect manner by impairing hippocampus - dependent place learning. in order to address this question, we trained rats in single - solution versions of the water plus - maze task that required rats to use either response or place learning. in the single - solution plus - maze tasks, the start points used varied between north and south. in the response task, the spatial location of the escape platform varied equally across trials (east or west) and the same body turn response (e.g., left) was consistently reinforced. in the place task, the escape platform was always located in the same spatial location (e.g., west) and the body turn responses (left and right) were equally reinforced. separate groups of rats trained in these tasks and receiving post - training intra - bla injections of an anxiogenic dose of rs 79948197 displayed enhanced acquisition of the response learning task and impaired acquisition of the place learning task (wingard and packard, 2008). this behavioral profile is consistent with the hypothesis that the facilitation of response learning produced by the drug results from an impairing effect on hippocampus - dependent place learning. indeed, we have previously observed that post - training neural inactivation of the dorsal hippocampus also enhances response learning and impairs place learning. an interfering competitive action of the hippocampus during training in the single - solution response task presumably occurs because the spatial location of the escape platform varies across trials (schroeder., 2002 ; chang and gold, 2003 ; for a review on competition between multiple memory systems see poldrack and packard, 2003). in a final recent set of experiments, we examined whether the bla is critical for the ability of rs 79948197 to both enhance response learning and impair place learning when the drug is administered peripherally. separate groups of rats trained in either the single - solution response or place tasks received post - training peripheral injection of an anxiogenic dose of rs 79948197 and concurrent intra - bla injections of the local anesthetic bupivacaine. in this study, both the enhancing and the impairing effect of peripheral administration of rs 79948197 on response and place learning, respectively, were blocked by neural inactivation of the bla (packard and gabriele, 2009). these findings provide compelling evidence for a critical role for the bla in mediating the influence of emotional arousal on different types of memory. in summary, lower animal studies indicate that peripheral or intra - bla administration of an anxiogenic drug(s) can bias rats toward the use of dorsal - striatal habit memory and that the influence of the bla on the relative use of multiple memory systems appears to modulate the degree of interference between cognitive and habit memory. in the remaining discussion, we consider the extent to which stress may affect hippocampal and dorsal striatal morphology, whether emotional arousal may also influence the relative use of multiple memory systems in humans, and briefly describe possible implications of this hypothesis for understanding the role of learning and memory processes in various psychopathologies. when an organism senses a threat, stress hormones are released via the hpa axis and bear a significant and unequal impact upon various brain structures related to learning and memory (for review see mcgaugh, 2002). among these brain structures, the hippocampus and dorsal striatum appear to be differentially affected by stress. in rats, chronic stress causes atrophy of hippocampal neurons of the ca3 region (watanabe., 1992 ; magarios and mcewen, 1995) and hypertrophy in the dorsal striatum (dias - ferreira., 2009). also, in a longitudinal mri study, rats subjected to 21 days of chronic restraint stress displayed a 3% reduction in hippocampal gray matter volume, an effect that was not observed in non - stressed controls (lee. numerous studies have shown that people who have been exposed to trauma and developed post - traumatic stress disorder (ptsd) generally have smaller hippocampi than those who did not develop ptsd (gilbertson., 2002 ; bremner., 2003 ; lindauer., 2004 ; in addition, there is evidence that people with ptsd or obsessive - compulsive disorder (ocd) have enlarged caudate nuclei (looi., 2009 ; radua., it is unclear whether chronic stress affects the relative size of these brain structures or if smaller hippocampi and larger caudate nuclei precede the development of these anxiety disorders. indeed, the nature of the relationship between hippocampal gray matter volume and ptsd has attracted considerable debate (bremner, 2001 ; pitman, 2001). in favor of a causal relationship, there is evidence that stressful life events can negatively affect hippocampal morphology in humans. using a longitudinal mri paradigm, researchers measured hippocampal gray matter volume at two time points, separated by a three month interval. the number of stressful life events experienced during the three - month interval was positively correlated with a reduction in gray matter volume of the right hippocampus (papagni., 2011), suggesting that the relationship between ptsd and hippocampal volume may be causal. interestingly, a single stressful experience may be sufficient to affect the morphology of the hippocampal formation. several studies have shown that acute stress suppresses neurogenesis of progenitor cells in the dentate gyrus of rodents (galea., 1996 ; gould., 1997 ; tanaput., 2001) and non - human primates (gould., 1998). moreover, in humans hydrocortisone administration decreased activation of the hippocampus in the retrieval phase of a declarative memory task (oei., 2007). it is less clear whether acute or chronic stress affects the function of the dorsal striatum. however, evidence from human neuroimaging studies suggests that the dorsal striatum may play a role in the processing of negative stimuli. in healthy subjects, the dorsal striatum responds intensely when viewing unpleasant pictures, relative to positive or neutral pictures (carretie., in addition, in anxious subjects, dorsal striatal activation increases when reading negative words as opposed to positive or neutral ones (roiser., 2008). lastly, subjects with huntington 's disease (a disease associated with deterioration of the dorsal striatum) are impaired in their ability to recognize negative facial expressions (gray., 1997 ; johnson., 2007) as described earlier, numerous studies in rats suggest a dynamic impact of emotional arousal on hippocampus - dependent and dorsal striatal - dependent memory systems. specifically, acute stress and/or anxiety appears to bias rats to solve dual solution tasks by employing an s - r habit learning strategy, at the expense of the competing cognitive memory system (packard and wingard, 2004 ; wingard and packard, 2008). to the extent that the influence of emotional arousal on the hippocampus and dorsal striatum is similar in rodents and humans, it is possible that the effect of stress on the relative use of memory systems observed in rodents may also be observed in humans. indeed, recent studies building on the earlier research in lower animals indicate that both acute and chronic stress may also bias human subjects to implement an s - r habit learning strategy to solve a dual solution task. for example, schwabe. (2007) trained subjects to locate a over 12 trials, subjects could locate the win - card by using a spatial strategy (i.e., the card is always in the same spatial location) or a stimulus - response strategy (i.e., the card is always next to the plant). on the 13th trial, the plant was moved to a different location which allowed the experimenters to assess the type of learning strategy used. prior to training, subjects were exposed to an acute stressor consisting of giving a speech and performing mental math in front of an audience. subjects in this stressed condition implemented an s - r strategy to locate the win - card significantly more often than controls. interestingly, high salivary cortisol at the time of learning predicted habit behavior in stressed and non - stressed conditions. in a subsequent study, subjects with higher scores on a chronic stress questionnaire implemented an s - r strategy in a 2-d dual solution task significantly more often than subjects with lower scores (schwabe., 2008a). therefore, similar to the effects of acute stress, chronic stress also appears to favor habit learning, at the expense of spatial learning, in humans. consistent with these findings, another study assessed the effect of emotional arousal on retention of the striatal - dependent weather prediction task (steidl., 2011). for each trial in this task, subjects are asked to predict the weather based on a random set of cards depicting different abstract shapes. each possible combination of cards has a predetermined probability of signifying rain or sunshine, and after each prediction subjects are given feedback as to whether their prediction was correct or incorrect. in this particular study, in order to manipulate the level of emotional arousal, subjects were presented with either arousing or neutral pictures during acquisition of the task. in a retention test given 1.5 months after training, subjects who had viewed the arousing pictures exhibited sustained memory for the task, whereas subjects who had viewed the neutral pictures exhibited considerable memory decay. previous studies using fmri or enlisting subjects with selective damage to the basal ganglia have indicated that the striatum has a central role in the initial acquisition of the weather prediction task (knowlton., therefore, it could be interpreted that heightened emotional arousal may have further enhanced the role of the striatum during training, thus strengthening the memory and improving performance in the retention test. however, it should be noted that the hippocampus is implicated in later performance of the weather prediction task (knowlton., 1994, 1996), suggesting that a hippocampus - dependent learning system may have also had a role in the enhanced retention (steidl., interestingly, some research has shown that stress promotes habit behavior in instrumental learning tasks as well. in one study (schwabe and wolf, 2009), human subjects were exposed to the socially - evaluated cold pressor test or a non - stressed control condition and then trained on two instrumental tasks, each associated with a distinct food outcome. after training, one of the food outcomes was devalued by feeding the subject with the food until satiation. in a subsequent extinction test, subjects exposed to pre - training stress continued performing the same instrumental response despite it being associated with the devalued food outcome (i.e., pre - training stress prompted habitual behavior). subjects unexposed to stress decreased the instrumental behavior associated with the devalued food outcome, suggesting the use of a more cognitive, goal - directed learning system. in a separate fmri study, it was observed that habit behavior in the food devaluation paradigm was associated with increased activation of the dorsal striatum, while goal - directed behavior was associated with increased activation of the ventromedial prefrontal cortex (tricomi., 2009). therefore, stress - induced habit behavior in this task may also represent a shift to a dorsal striatal - dominant activation pattern. while behavioral stressors appear to bias humans toward the use of a habit memory system at the expense of the competing cognitive system, studies investigating the role of the human stress hormone cortisol seem to yield opposite results. for example, one study observed that low basal cortisol levels were associated with the use of an s - r habit strategy, whereas higher levels were associated with the use of a spatial strategy in a dual solution virtual maze task (bohbot. however, subjects ' cortisol levels did not correlate with their scores on the perceived stress questionnaire, suggesting that sample cortisol levels in this study may not have reflected actual feelings of stress. the effect of stress on the hippocampus is typically described as following an inverted u - shape, with high and low levels of stress leading to impairments and a middle level being optimal for hippocampus function. considering that no subjects reported high stress, the authors suggest that the higher cortisol readings in this study may actually represent the middle of this inverted - u, thus favoring the use of a hippocampus - dependent memory system. another study investigating the effect of cortisol showed that orally administered hydrocortisone biased women to solve a dual solution task using a spatial strategy, at the expense of the habit system (schwabe. interestingly, exogenous cortisol treatment was also associated with poorer performance in both spatial and response learners. to explain these results in the context of earlier work, the authors hypothesize that under low cortisol levels the hippocampus controls behavioral output. under moderate levels, hippocampus function declines and the dorsal striatum seizes control, and under high levels hippocampus and dorsal striatum function decline, but the balance between systems is restored and the hippocampus regains control. it is interesting to note a contrast between this explanation and the one proposed by bohbot. (2008b) suggest that the hippocampus gains control at low and high cortisol levels, bohbot. the different methods used in these studies (e.g., behavioral tasks ; monitoring endogenous cortisol vs. manipulating exogenous cortisol) may in part account for this discrepancy. in this context, it is worth noting that human fmri studies have established a negative correlation between cortisol levels and hippocampus activity (oei., 2007). aside from a potential u - effect, there may be another explanation for the seemingly opposite effects of cortisol. using the instrumental food - devaluation paradigm discussed earlier, researchers found that only concurrent administration of the 2-noradrenergic receptor antagonist yohimbine and hydrocortisone promoted habit behavior in humans, whereas administration of hydrocortisone alone resulted in goal - directed, cognitive behavior (schwabe., 2010). therefore, it appears that increases in both cortisol and norepinephrine may be required to induce a habit bias in dual solution tasks. this finding may explain why a behavioral stressor like the socially - evaluated cold pressor test, which increases plasma norepinephrine (blandini., 1992) and salivary cortisol (schwabe., 2008), can induce a habit bias (schwabe and wolf, 2009), whereas a pharmacological increase in cortisol alone does not (schwabe. in summary, both chronic and acute stress appears to bias humans to solve dual solution tasks with a habit memory system, consistent with the research in lower animals. however, when manipulating and monitoring cortisol levels, a more complex picture emerges, and the effect of stress on the relative use of memory systems may follow a u - shaped curve or depend on an interaction between both cortisol and norepinephrine. extensive research indicates that in some learning situations the hippocampus and dorsal striatum vie for control of behavioral output (for review see poldrack and packard, 2003). for example, in rats, lesions, or neural inactivation of the hippocampus can lead to enhanced acquisition of striatal - dependent habit tasks (e.g., packard., 1989 ; packard and mcgaugh, 1992 ; schroeder., 2002). in view of evidence that high levels of stress can impair hippocampus - dependent learning in rats, it has been suggested that the stress or anxiety - induced shift to habit learning may result from the hippocampus relinquishing control and releasing the habit memory system from competition (wingard and packard, 2008). consistent with this idea, numerous human studies have shown that high levels of stress at the time of encoding or retrieval impair performance in hippocampus - dependent memory tasks (schwabe., 2009 ; merz., 2010 ; schwabe and wolf, 2010 ; thomas., 2010). therefore, in dual solution tasks, it is possible that stressed individuals are more proficient in solving the task with their unimpaired habit system and thus, in order to preserve performance levels, implement an s - r strategy as opposed to a cognitive strategy. consistent with this interpretation, subjects with lower scores in episodic memory tasks were more likely to be response learners in a dual solution virtual maze task (bohbot., 2011). it is important to note that stressed human subjects may be generally unaware of alternative strategy options (e.g., spatial) for solving a given dual solution task (schwabe., 2007 ; schwabe and wolf, 2009). therefore, it is unlikely that stressed individuals make a conscious decision to abstain from cognitive solutions and opt for a habit learning strategy. rather, stressed human subjects may rely on their habit system, simply because the available cognitive solutions go unnoticed. as mentioned earlier, stressful life events are associated with reduced gray matter volume of the right hippocampus in humans (papagni., 2011). this finding may be relevant for understanding the effect of stress on memory systems, particularly as the relative size of the hippocampus and dorsal striatum may predict the learning strategy used. in one study (bohbot., 2007), researchers utilized a virtual eight - arm radial maze that could be solved by associating distal cues (e.g., mountains, trees, etc.) with the location of the correct maze arms (i.e., a spatial strategy) or by memorizing the sequence of left and right arrow presses on the keyboard that lead to the correct maze arms (i.e., an s - r strategy). to determine which strategy a subject used, mri scans revealed that greater density in the hippocampus was positively correlated with the number of errors in the final probe trial (suggesting the use of a spatial strategy) and that greater density in the dorsal striatum was negatively correlated with the number of errors in the probe trial (suggesting the use of an s - r strategy). chronic stress may potentially exert its influence on multiple memory systems by affecting the relative volume of the hippocampus and dorsal striatum. whether the more modest morphological changes induced by acute stress could underlie the habit bias remains to be determined. as previously described, several studies in lower animals indicate that the effects of emotional arousal on memory depend on the integrity of the bla (for review see mcgaugh, 2004) and also implicate this brain region in orchestrating the use of multiple memory systems during periods of high emotional arousal (e.g., packard and wingard, 2004 ; wingard and packard, 2008 ; packard and gabriele, 2009). interestingly, human fmri studies reveal that the degree of amygdala activation during encoding positively correlates with the recall of emotion - laden memories (hamann., 1999 ; however, to our knowledge, no studies have investigated the relationship between amygdala activation and the relativeuse of memory systems in humans. finally, human case studies reveal that acute or chronic anxiety may underlie the development and persistence of several psychopathologies with habit - like behavioral features, including for example ocd, post - traumatic stress disorder, and drug addiction. for instance, in ocd, the exaggerated fear of germs or infection may cause a person to solve the problem habitually, thus leading to excessive hand washing (jones and menzies, 1998). in post - traumatic stress, a significantly traumatic experience can lead to the development of non - context - specific cued recall of the memory. in this way, some aspects of ptsd may be analogous to the previously described studies showing a stress - induced facilitation of s - r habit (or, cued) learning and concomitant disregard for the spatial context of the learning environment (schwabe. in addition, several studies have evidenced a relationship between acute stressors and relapse into habit - like drug seeking behavior in lower animals (shaham and stewart, 1995 ; shepard., 2004 ; buffalari and see, 2009) and humans (kosten., moreover, there is increasing evidence that the dorsal striatum plays an important role in the expression of drug - seeking behaviors in animals (ito., 2002 ; fuchs., 2006 ; see., 2007) and humans (garavan., thus, one might speculate that anxiety and/or stress may influence relapse in drug addiction by favoring the use of habit memory to guide the expression of maladaptive behaviors. further research examining the relationship between the neural bases of emotional arousal and the relative use of multiple memory systems may prove useful for understanding various human psychopathologies. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | emotional arousal induced by stress and/or anxiety can exert complex effects on learning and memory processes in mammals. recent studies have begun to link study of the influence of emotional arousal on memory with earlier research indicating that memory is organized in multiple systems in the brain that differ in terms of the type of memory they mediate. specifically, these studies have examined whether emotional arousal may have a differential effect on the cognitive and stimulus - response habit memory processes sub - served by the hippocampus and dorsal striatum, respectively. evidence indicates that stress or the peripheral injection of anxiogenic drugs can bias animals and humans toward the use of striatal - dependent habit memory in dual - solution tasks in which both hippocampal and striatal - based strategies can provide an adequate solution. a bias toward the use of habit memory can also be produced by intra - basolateral amygdala (bla) administration of anxiogenic drugs, consistent with the well documented role of efferent projections of this brain region in mediating the modulatory influence of emotional arousal on memory. in some learning situations, the bias toward the use of habit memory produced by emotional arousal appears to result from an impairing effect on hippocampus - dependent cognitive memory. further research examining the neural mechanisms linking emotion and the relative use of multiple memory systems should prove useful in view of the potential role for maladaptive habitual behaviors in various human psychopathologies. |
mouse embryos form five pairs of mammary rudiments (mrs). their formation is preceded by the formation of three wnt10b - expressing mammary streaks in the axilla, inguen, and in between forelimb and hindlimb these streaks fuse into one continuous mammary line (ml) on each flank by e11.5, on which mrs develop in asynchronous fashion and not in numerical sequence, with mr1 in the axilla ; mr2, mr3 and mr4 on the flank ; and mr5 in the inguen. the hedgehog (hh) pathway was among the first signaling cascades tested for a role in murine mammogenesis, but is not required for it [2, 3 ]. nonetheless, extratoes (xt) mice, which harbor a spontaneous, functional null - mutation for the transcription factor gli3, exhibit multiple defects in prenatal mammary development [47 ]. given the role of gli3 in hh signaling, we provide a brief overview of hh signaling and gli transcription factors, followed by their functions in mammogenesis in mouse embryos. mammals possess three orthologues of the drosophila segment polarity gene hedgehog ; sonic hedgehog (shh), indian hedgehog (ihh), and desert hedgehog (dhh) [8, 9 ]. while embryonic expression and function of dhh is restricted to spermatogenesis and schwann cells, shh and ihh are widely expressed and encode secreted morphogens with well - known roles for shh in neural tube, limb and somite development and for ihh in chondrogenesis [10, 11 ]. in canonical hh signaling, hh molecules bind their twelve - transmembrane receptor patched1 (ptch1) or ptch2. ptch then derepresses the seven - transmembrane protein smoothened (smo), which becomes activated. through intracellular signaling complexes -whose components have not been studied in embryonic mammary development and are thus not described here- smo activation converges on the gli family of krppel - type zinc - finger transcription factors, comprising gli1, gli2 and gli3. gli1 is expressed when hh signaling is active, and encodes the transcriptional activator gli1. gli2 and gli3 can be expressed in the absence of hh signaling, in which case their protein products are cleaved to render transcriptional repressors (gli2, gli3). gli2 requires less active hh signaling than gli3 to remain uncleaved and function as a transcriptional activator (gli2, gli3). among gli transcriptional targets are gli1 and ptch1, which provide regulatory feedback loops for hh signaling [12, 13 ]. they need further exploration, but certainly point to three additional, non - canonical signaling scenarios : 1) signaling involving hh pathway components independently of gli - mediated transcription, such as shh - mediated erk activation in mammary epithelial cells without smo - activation ; 2) direct interaction of hh signalling components with other molecular pathways ; potentially relevant for mammogenesis is the role of wnt signaling in expression and function of gli proteins, and 3) non - contiguous or atypical interaction of core hh pathway components with each other. studies of the role of hh signaling components in mammogenesis began in the late 1960 s, when d.r. johnson identified and characterized a mouse strain which he named extra - toes (xt), after the prominent polydactyly in all four paws of heterozygotes. in e13 embryos homozygous for this spontaneous, semi - dominant mutation, he also found a reduced number of mrs between the forelimb and hindlimb. because his wild type control had a supernumerary mr near mr3 the number of nipples visible in xt / xt mice at this stage is reduced from four to two pairs, the most anterior and posterior ones persisting. note that johnson was mistaken in three aspects : 1) what he referred to as nipples were in fact mammary buds, which precede nipple formation ; 2) had he taken a proper control, he would have concluded that only one mr (mr3) was missing on the flank ; 3) had he known that wild - types also form mrs behind the forelimb (mr1) and hindlimb (mr5), he would have noticed an absence of mr5 in xt / xt embryos [57, 18 ]. arose a spontaneous mouse mutant, named xt because it phenocopies johnson s xt mutant. xt mice carry a 51.5 kb deletion downstream of nucleotide 1670 of gli3, including the dna - binding zinc fingers and thus abolishing both gli3 and gli3 functions [1921 ], without loss of other known functional sequences. these renamed gli3 mice represent a good model for the human greig cephalopolysyndactyly syndrome (gcps), which can be a sporadic or inherited trait, caused by heterozygous loss - of - function mutations of the gli3 gene. the syndrome is characterized by polysyndactyly of hands and feet, hypertelorism, and skull abnormalities including craniosynostosis at variable penetrance [19, 22][omim 165240, 175700 ], the latter seen in mice only when homozygous mutant. while no mammary phenotypes have been reported for gcps patients and gli3 mouse mutants, gli3 embryos fail to induce mr3 and mr5 [57, 18 ]. moreover,. 1 t with 1l), resembling mrs of wild - type male embryos, and also exhibits impaired branching morphogenesis ; while mr1 is hardly affected. the xt mutation thus exemplifies that all mammary glands are different and can develop inter - independently. the question then arises via which molecular mechanisms and tissue - interactions gli3 regulates formation and development of mr2-5.fig. 1expression patterns of gli1, gli2 and gli3, and models of tissue- and molecular interactions involving gli3 in mammary development. a q cross - sections of wild - type embryos and (r w) gli3 embryos at e11.5-e13.5 hybridized with s - labeled rna - probes for gli1, gli2 and gli3. insets in t and u present wild - type mr2 from l respectively m at the same magnification. x cartoon of a lateral view of a mouse embryo. between e10.5 and e11.5 gli3 is expressed in the limb buds and all somites (outlined in gray and numbered). gray shades represent overlapping in expression with fgf10, the intensity positively correlating with level of fgf10 expression. note the proximity of the overlapping somitic expression to mr3 and mr2, and overlapping limb mesenchymal expression to mr1, mr2, mr4 and mr5. mr1 and mr5 are hidden behind the limbs. z model for gli3-mediated repression of gli1 in the me (bud shape) and contiguous mm (darker shade of gray surrounding mammary bud), based on expression data in panels a w and in [5, 6 ]. in the absence of gli3, gli1 is misexpressed in the mm of mr1, mr2 and mr4, indicating gli3 normally represses gli1 expression. whether this occurs tissue - autonomously (intact block arrow) or via tissue interactions (broken block - arrow) remains unclear. abbreviations : li : liver, r : rib primordium, st : stomach, wt : wild - type expression patterns of gli1, gli2 and gli3, and models of tissue- and molecular interactions involving gli3 in mammary development. a q cross - sections of wild - type embryos and (r w) gli3 embryos at e11.5-e13.5 hybridized with s - labeled rna - probes for gli1, gli2 and gli3. insets in t and u present wild - type mr2 from l respectively m at the same magnification. x cartoon of a lateral view of a mouse embryo. between e10.5 and e11.5 gli3 is expressed in the limb buds and all somites (outlined in gray and numbered). gray shades represent overlapping in expression with fgf10, the intensity positively correlating with level of fgf10 expression. note the proximity of the overlapping somitic expression to mr3 and mr2, and overlapping limb mesenchymal expression to mr1, mr2, mr4 and mr5. mr1 and mr5 are hidden behind the limbs. z model for gli3-mediated repression of gli1 in the me (bud shape) and contiguous mm (darker shade of gray surrounding mammary bud), based on expression data in panels a w and in [5, 6 ]. in the absence of gli3, gli1 is misexpressed in the mm of mr1, mr2 and mr4, indicating gli3 normally represses gli1 expression. whether this occurs tissue - autonomously (intact block arrow) or via abbreviations : li : liver, r : rib primordium, st : stomach, wt : wild - type prior to and at the time of ml and mr formation, gli3 is not expressed in the surface ectoderm, from which the mrs derive, but is expressed in the limb mesenchyme, and in the somites in the region between fore- and hindlimbs (fig. 1c). given the earlier implications of somitic involvement in the establishment of the mammary streak along the flank and in mr induction [1, 7 ], the somitic gli3 expression was of interest. indeed, the ventral elongation of the somites including expression of gli3 in all thoracic and lumbar somites, and fibroblast growth factor (fgf)10 in thoracic somites # 12 to # 18, determines the position of the ml on the dorso - ventral body axis. the absence of mr3 in gli3 embryos is due to reduction of somitic fgf10 expression, in particular the relatively high fgf10 expression in somite # 15 underlying mr3. as mr2 is located above somite # 12, reduced somitic fgf10 expression may be involved in impaired development of mr2 as well. it is most likely that somitic gli3 indirectly activates somitic fgf10 independent of shh signaling (and references therein). somitic fgf10 may reach and activate the ectodermal fgfr2b via diffusion and/or transportation by dermal precursor cells that delaminate from the somites. this cascade leads to ectodermal cell elongation, wnt10b marker expression, and canonical wnt signaling as required for ml and mr formation, but only at the level of mr3, and possibly mr2. these insights finally gave some molecular explanation for the capacity of the dermal mesenchyme to induce mr formation as recognized four decades earlier [2527 ]. however, at the level of mr4 and mr5, fgf10 is not expressed in the somites. given that null mutants for either gli3 or fgf10 fail to induce mr5 and both genes are expressed in the adjacent limb mesenchyme (fig. 1x), it is tempting to speculate that an epistatic interaction between these molecules may also exist in the limb mesenchyme and be required for induction of mr5. the compromised induction of mr2 and mr4 in the absence of gli3 can perhaps be attributed to gli3-independent residual expression of fgf10 and other genes in the thoracic somites and limb mesenchyme. the cellular functions of gli3 during early mammary growth and morphogenesis are fourfold, and the same in all mrs : downregulation of 1) cell proliferation and 2) cell apoptosis in epithelial cells of the ml and mrs ; 3) mediation of ectodermal cell recruitment into mrs, which contributes to mr growth until at least e14.5 ; 4) hypertrophy of the basal / peripheral cells of the me, which provides a large proportion of the growth between e12.5 and e13.5. while similar regulatory functions for gli3 have been identified in other cell types (references in), it remains to be investigated how gli3 mediates so many distinct effects in the same cell population ; and whether these epithelial effects rely on gli3 expression prior to mammary induction, on cell - autonomous gli3 function in the me, or via tissue - interactions with and gli3 expression in the mm (fig. at e11.5, the somites also express gli2, but not gli1 (fig. expression of gli genes in the surface ectoderm or mammary tissues is arguable at e12.5, except for notable gli3 expression in mr5 (fig. 1d k) as confirmed by rna - profiling. by e13.5, gli3 and gli2 are convincingly expressed in overlap in the ectoderm, mammary epithelium (me) and mammary mesenchyme (mm) (fig. 1m, n, p, q), the latter confirmed for gli3 by rna - profiling and immunohistochemistry. thus, the initial growth defects of gli3 mr2 and mr4 at e11.5 could subsequently be compounded by the lack of gli3 in any of the tissue compartments. although gli2 and gli3 overlap in expression, homozygous gli2-null mutants have no mammary induction defect [6, 28 ]. neither have gli1-null, gli2 or gli2 mutants which express gli1 from the endogenous gli2 promoter however, removing one gli3 allele in gli2 embryos abolishes induction of mr3 and mr5 as in gli3 embryos. moreover, gli1 is misexpressed in the mm of mr2 in e13.5 gli3 embryos (fig. 1 t). the high gli1 expression in mr1 and mr4 at e13.5 (fig. 1r, v) may also reflect misexpression in the mm, similar to such misexpression reported at e14.5. together, these data indicate that gli3 acts as gli3 during mr formation (fig. 1y, z), and is the only gli family member with functional relevance for embryonic mammary development, by repressing gli1 transcription, and antagonizing gli2 function. moreover, these data indicate that canonical hh signaling needs to be in an off - state to allow mammogenesis, at least at the positions of mr3 and mr5. the above - described repressor function of gli3 and absence of shh, ihh, gli1 and ptc1 expression in the surface ectoderm or dermal mesenchyme at the time of ml and mr induction (our unpublished data and fig. 1a), explain why shh and ihh mutant mice have no mammary induction defect [2, 3 ]. all together, these data indicate hh signaling is not required for induction of any of the five mrs. while normally, shh, ihh and ptc1 are expressed in the me from e12.5 onward and in postnatal stages, the normal outgrowth of transplanted e12.5 shh and ihh me in cleared wild - type mammary fat pads or under the kidney capsule, indicates that epithelial hh signaling or mesenchymal shh is not either required during later embryonic and postnatal stages. interestingly, activating components of the hh signaling cascade become expressed in the surface ectoderm and me only after the formation of mr, but prior to hair follicle formation. we therefore propose that the off - state of hh signaling is a discriminatory factor for the choice of a skin appendage between mammary and either hair or non - mammary fate, and that therefore mrs must develop prior to hair follicle formation, i.e. prior to activation of hh signaling in the trunk ectoderm [29, 30 ]. such a decisive role for hh signaling appendage fate requires further investigation, but seems to be confirmed by the glandular appearance of hair follicles when hh signaling in the skin is ablated in k14cre;smo embryos. gli3 function is critical for embryonic development of mr2 - 5 ; in particular gli - mediated repression of canonical hh signaling is critical for induction of mr3 and mr5. its variable requirement for the five mrs in mouse gives perhaps some insight in mechanisms underlying the variation in number of mammary glands among mammalian species. for example, mr3 requires somitic gli3 as the earliest known effector in a cascade involving fgf10/fgfr2b and subsequent wnt signaling (fig. 1y), but other tissue - interactions and perhaps molecular mechanisms act downstream of gli3 in early development of other mrs, and remain to be elucidated. examples of additional interesting avenues for investigation pertain to possible interactions with other important mesenchymal factors in mr3 formation (e.g. nrg3, tbx3, or raldh2 that mediates retinoic acid signaling) [3234 ] (fig. 1y) ; whether the sustained protrusion of mr2 in gli3 embryos bears any mechanistic similarity to the protrusion of mrs in wild - type males ; and whether gli3 is involved in non - canonical hh signaling in mammogenesis. given the many molecular similarities between embryonic mammary development and mammary / breast tumors [35, 36 ], it is of interest whether gli3 plays a role in breast cancer. it is noteworthy that gli(1) was discovered as an oncogene, and like gli2 and shh, is upregulated in various cancers. hh signaling is considered a therapeutic target for breast cancer, as gli(1) upregulation predicts a poor prognosis for estrogen receptor negative or triple negative breast cancers [3739 ]. yet, gli3 is seldom reported in association with cancer. in absolute number and relative gli1, only few somatic mutations in gli3 have been found in breast cancer samples [cosmic database, sanger institute ]. it would be of interest to determine whether these gli3 mutations relate to gli1 upregulation, and whether they have any diagnostic or prognostic value. | the first mouse mutation associated with a heritable defect in embryonic mammary gland development was extratoes. it represents a functional null - mutation of the gene encoding gli3, which is best known as a transcription factor mediating canonical hedgehog (hh) signaling. here we review the roles of hh and gli proteins in murine embryonic mammary development. we propose that an off - state for hh signaling, mediated by gli3-repressor, is determinant for induction of a mammary instead of hair follicle fate in the trunk surface ectoderm. |
this article treats the rapid - equilibrium kinetics of the forward and reverse reactions of the enzyme - catalyzed a + b = p + q together and emphasizes the importance of reporting the values of the full set of equilibrium constants. a computer is used to derive rate equations for three mechanisms and to estimate the kinetic parameters with the minimum number of velocity measurements. the concept that n kinetic parameters can be calculated from n velocity measurements was introduced by duggleby(1) in connection with his discussion of the statistics of the determination of the kinetic parameters. before that, frieden,(2) in an article about malate dehydrogenase, showed that it was possible to determine four kinetic parameters with four velocity measurements. a recent paper(3) showed how this can be done for a + b products, and another paper(4) showed how this can be done with five mechanisms for a + b + c products. the current article shows that there are advantages in treating the forward and reverse reactions at the same time by making calculations on ordered a + b = ordered p + q, ordered a + b = random p + q, and random a + b = random p + q. three programs are used to estimate the kinetic parameters using the minimum number of velocity measurements. the most general program of these three programs is the one to use first when the mechanism is studied for the first time and the kinetic parameters are unknown. this article shows the effects of experimental errors in velocity measurements on the values of the kinetic parameters and on the apparent equilibrium constant calculated using the haldane relation. various mechanisms for a + b = p + q have been discussed a great deal. the objective here is to discuss the estimation of the rapid - equilibrium kinetic parameters of the forward and reverse reactions at the same time using mathematica. mulquiney and kuchel(7) have written a program in mathematica to derive steady - state rate equations for enzyme - catalyzed reactions and have given these rate equations for about 30 reactions. the rapid - equilibrium mechanism is the third reaction is rate - determining, and the other four reactions remain at equilibrium. the values of the four dissociation constants are assigned arbitrarily so that numerical calculations can be made. the total concentration of enzymatic sites is given by there are nine reactants, four equilibrium equations, and five components (a, b, p, q, and e). linear algebra(8) shows that the number of reactants n in an equilibrium calculation must be equal to the number of components c plus the number of independent reactions r:n = c + r. in this case, the number of reactants is given by 9 = 5 + 4. it is convenient to solve the five equations that have to be satisfied at equilibrium using solve in mathematica, maple, or matlab to obtain expressions for [eab ] and [epq ] at equilibrium. the calculations described here were made using solve[eqs, vars, elims ] in mathematica. the following rapid - equilibrium rate equation is obtained this rate equation can be written in various ways, but this is the way mathematica writes it. this method of deriving a rapid - equilibrium rate equation has three advantages : (1) the rate equation is obtained in computer - readable form so that it does not need to be typed. (3) this method can be applied to much more complicated mechanisms,(4) without having to make lengthy derivations by hand. equation 7 in a computer with specified values of the six kinetic parameters can be treated like an experimental system in the sense that substituting a quadruplet of substrate concentrations ([a],[b],[p],[q ]) yields a reaction velocity. when the velocity is equal to zero, the haldane relation for the apparent equilibrium constant is obtained. in 2008, alberty(3) showed that solve in mathematica can be used to obtain the kinetic parameters with the minimum number of velocity measurements. the use of solve to estimate kinetic parameters by solving n simultaneous polynomial equations has been tested by arbitrarily specifying values of the kinetic parameters and calculating velocities. the following values of kinetic parameters are used in this section : vfexp = 1, vrexp = 0.5, kia = 5, kb = 20, kiq = 10, and kp = 15. in making these calculations, it is not necessary to assign units to these kinetic parameters. since there are six kinetic parameters, it is necessary to measure six velocities to estimate the kinetic parameters with the minimum number of velocities. to illustrate this calculation, the choices of substrate concentrations have been discussed in two previous articles and are reviewed in the. the velocities calculated using eq 7 are 1(100,100,0,0) = 0.8264, 2(1,100,0,0) = 0.4545, 3(100,1,0,0) = 0.04545, 4(0,0,100,100) = 0.4292, 5(0,0,100,1) = 0.01887, and 6(0,0,1,100) = 0.02857. a program calckinparsordabordpqfr has been written in mathematica to calculate vfexp, vrexp, kia, kb, kiq, and kp from six experimental velocities for ordered a + b = ordered p + q. the program s name indicates that it calculates the kinetic parameters for the forward reaction ordered a + b = ordered p + q. this program, given in the, simply provides an orderly way to put six velocities with the corresponding versions of eq 7 into solve. this yields correct values of the six kinetic parameters, but it is necessary to take experimental errors in the measurements of velocities into account. this is done by multiplying the six velocities by 1.05, one at a time. the values of these parameters can be used to calculate k using the haldane relation. the use of 5 % experimental errors in velocities may be optimistic ; however, the errors in the table can be doubled or tripled, and replicate measurements can be used. the first velocity determination { 100,100,0,0 } is targeted on vfexp, and the 5 % error in 1 yields vfexp = 1.06. the second velocity determination { 1,100,0,0 } is targeted on kia, and the 5 % error in 2 yields kia = 4.45. the third velocity determination { 100,1,0,0 } is targeted on kb, and the 5 % error in 3 yields kb = 18.74. the fourth velocity determination { 0,0,100,100 } is targeted on vrexp, and the 5 % error in 4 yields vrexp = 0.53. the fifth velocity determination { 0,0,1,100 } is targeted on kiq, and the 5 % error in 5 yields kiq = 9.07. the sixth velocity determination { 0,0,100,1 } is targeted on kp, and the 5 % error in 6 yields kp = 14.04. more accurate values of kinetic parameters can be obtained by measuring velocities over a wider range of substrate concentrations. for example, for ordered a + b = ordered p + q, { 200,200,0,0 }, { 0.1,200,0,0 }, { 200,0.1,0,0 }, { 0,0,200,200 }, { 0,0,0.1,200 }, and { 0,0,200,0.1 } can be used. the recommendations for choices of substrate concentrations are very general : high [a ], [b ], [p ], and [q ] means as high as practical, and low [a ], [b ], [p ], and [q ] means as low as practical, considering the analytical method. when low substrate concentrations are used, rates are low and more difficult to determine, but the enzyme concentration can be increased. when the enzyme concentration is increased 10-fold for a measurement, the velocities have to be divided by a factor of 10 before comparing them with velocities at lower enzyme concentrations. the mechanism is the values of the dissociation constants are assigned arbitrarily so that numerical calculations can be made. the total concentration of enzymatic sites is given by there are ten reactants, five equilibrium equations, and five components (a, b, p, q, and e), so that n = c + r is 10 = 5 + 5. the six equations that have to be satisfied can be solved to obtain expressions for [eab ] and [epq ] at equilibrium. it is not necessary to include the reaction ep + q = epq because when reactions 1214 are at equilibrium this reaction is also at equilibrium. when this is done in mathematica, the following rapid - equilibrium rate equation is obtained to test the calculation of seven kinetic parameters from seven measured velocities, the following values of the kinetic parameters are chosen : vfexp = 1, vrexp = 0.5, kia = 5, kb = 20, kip = 25, kiq = 10, and kp = 25. velocities are calculated at seven quadruplets of substrate concentrations{[a ], [b ], [p ], [q ] } : { 100, 100, 0, 0 }, { 1, 100, 0, 0 }, { 100, 1, 0, 0 }, { 0,0, 100, 100 }, { 0,0,1,100 }, { 0, 0, 100,1 }, and { 0,0,5,5 } using eq 16. the last quadruplet is new and was recommended in a previous article.(3) the use of eq 16 yields 1(100,100,0,0) = 0.8264, 2(1,100,0,0) = 0.4545, 3(100,1,0,0) = 0.04545, 4(0,0,100,100) = 0.4082, 5(0,0,1,100) = 0.04827, 6(0,0,100,1) = 0.05780, and 7(0,0,5,5) = 0.4464. equation 16 is used to write a program calckinparsordabrandpqfr to estimate the seven kinetic parameters. the program name indicates that it calculates the kinetic parameters for the forward reaction ordered a + b = random p + q. this program has the same basic structure as calckinparsordabordpqfr. this program yields correct values for the seven kinetic parameters, and the effects of 5% errors in the measured velocities, one at a time, are shown in table 2. this table gives values for kq calculated using the following thermodynamic cycle when there are no experimental errors, kiqkp = kipkq yields when a reaction with this mechanism is studied experimentally, the value of kq should be reported because it is a thermodynamic equilibrium constant. another investigator may use a mechanism with kq in the mechanism and report the value of kq. the same haldane relation (see eq 8) applies, and the effects on k of 5% errors in the measured velocities are shown in table 2. the total concentration of enzymatic sites is given by there are eleven reactants, six equilibrium equations, and five components (a, b, p, q, and e), so that n = c + r is 11 = 5 + 6. it is convenient to solve the seven equations that have to be satisfied using solve to obtain expressions for [eab ] and [epq ] at equilibrium. when this is done, the following rapid - equilibrium rate equation is obtained this rate equation involves eight kinetic parameters, and so eight velocities have to be measured. the following velocities were calculated using eq 27 : 1(100,100,0,0) = 0.8043, 2(1,100,0,0) = 0.1807, 3(100,1,0,0) = 0.04539, 4(5,5,0,0) = 0.1034, 5(0,0,100,100) = 0.4082, 6(0,0,1,100) = 0.02847, 7(0,0,100,1) = 0.05780, and 8(0,0,5,5) = 0.04464. a computer program calckinparsrandabpqfr was written to estimate eight kinetic parameters from eight measured velocities. the program name indicates that it calculates the kinetic parameters for the forward reaction random a + b = random p + q. kq was calculated using the thermodynamic cycle in eq 17, and ka was calculated using the following thermodynamic cycle. since kiakb = kakib, it is possible to calculate ka when there are no experimental errors table 3 gives the values of ten kinetic parameters and values of the apparent equilibrium constants calculated using the haldane relation. table 3 shows the effect of experimental errors on the value of ka. the haldane relation in eq 8 was used to calculate apparent equilibrium constants when there are 5% errors in the velocities, one at a time. calculated using thermodynamic cycle 17. calculated using thermodynamic cycle 28. when a mechanism is being studied for the first time, the limiting velocities and michaelis constants are not known. as recommended earlier,(3) when the kinetics of a + b = p + q is studied for the first time, there is an advantage in using a more general program first since the mechanism is unknown. when the general program yields reasonable values, that shows that the more general program applies. when the general program yields unreasonable values, that shows that the simpler mechanism applies. for ordered a + b = ordered p + q, six velocities had to be measured (see table 1), but to use the more general program calckinparsrandabpqfr, two more velocities are needed. these velocities can be measured at { 5,5,0,0 } and { 0,0,5,5}. these velocities calculated for ordered a + b = ordered p + q are 4(5,5,0,0) = 0.1034 and 8(0,0,5,5) = 0.05000. when these velocities are put in calckinparsrandabpqfr, all of the kip and kib values are unreasonable, and this shows that using the most general program can identify the mechanism and yield correct values for the kinetic parameters in the actual mechanism. notice that the effects of 5% errors in measured velocities on kip and kib are highly variable as well as being unreasonable ; this is another sign that the velocity data are not from a random a + b = random p + q mechanism but are from an ordered a + b = ordered p + q mechanism. seven velocities were calculated earlier using the rate equation for ordered a + b = random p + q. to apply calckinparsrandabpqfr, it is necessary to have eight velocities. the following velocity was calculated : (5,5,0,0) = 0.1111. including this velocity makes it possible to calculate eight kinetic parameters. when these velocities are put in calckinparsrandabpqfr, the results in table 5 are obtained. the values for kib are unreasonable and very sensitive to 5% errors, so e + b = eb is not in the mechanism. it is of interest to consider the eight velocities for the three mechanisms that are given in table 6. there are some small differences between the columns that are not really significant, but ordered a + b = ordered p + q and ordered a + b = random p + q differ mainly at { 0,0,100,1 }, where there is a 3-fold difference in velocities. the main difference between ordered a + b = random p + q and random a + b = random p + q is at { 1,100,0,0 }, where there is a 2.5-fold difference in velocities. in general, rapid - equilibrium rate equations are simpler than steady - state rate equations, and so they are the place to start when an enzyme - catalyzed reaction is studied for the first time. if more kinetic parameters are required to fit the kinetic data, steady - state rate equations can be used and even arbitrary terms can be added. when rate equations are polynomial, solve can be used to determine the kinetic parameters. the choice of substrate concentrations for the determination of the rapid - equilibrium kinetic parameters with the minimal number of velocity measurements has been discussed earlier(3) by using partial derivatives of the velocity with respect to substrate concentrations. these choices, which have been described in this article, emphasize using the highest and lowest practical concentration. the highest concentrations provide information about vfexp and vrexp, and the lowest concentrations provide information about the michaelis constants. the accuracy of the measurements at low concentrations of substrates is very dependent on the equipment for the measurements of velocities. when the values of kinetic parameters have been determined with one minimal set of measured velocities, it is recommended that the calculation be repeated with a second set of substrate concentrations to be sure the same values (within experimental errors) are obtained. this article has emphasized the use of a more general mathematica program to determine kinetic parameters when an enzyme - catalyzed reaction is being studied for the first time. the calculations described here show that a program written to estimate the kinetic parameters for random a + b = random p + q can be used to identify the mechanism and to determine correct kinetic parameters when the mechanism is actually ordered a + b = ordered p + q or ordered a + b = random p + q. the kinetic parameters discussed in this paper are usually functions of ph, and when the velocities are measured at a small number of phs, the pks of the enzymatic site and the enzymesubstrate complexes can be determined.(9) some enzyme - catalyzed reactions require metal ions so that the kinetic parameters depend on the free concentration of the metal ion. | this article deals with the rapid - equilibrium kinetics of the forward and reverse reactions together for the ordered and random enzyme - catalyzed a + b = p + q and emphasizes the importance of reporting the values of the full set of equilibrium constants. equilibrium constants that are not in the rate equation can be calculated for random mechanisms using thermodynamic cycles. this treatment is based on the use of a computer to derive rate equations for three mechanisms and to estimate the kinetic parameters with the minimum number of velocity measurements. the most general of these three programs is the one to use first when the mechanism for a + b = p + q is studied for the first time. this article shows the effects of experimental errors in velocity measurements on the values of the kinetic parameters and on the apparent equilibrium constant calculated using the haldane relation. |
spinal cord injury (sci) impairs a patient 's motor, sensory, or autonomic system, and sci - related costs incurred by health care systems often burden society. respiratory failure, cardiovascular dysfunction, thromboembolism, and autonomic dysreflexia are the common complications of sci. furthermore, recent studies have reported a higher risk of developing insulin resistance, glucose intolerance, and lipid abnormalities in sci patients than in able - bodied people. supporting a patient severely affected by sci can cost up to us$1 million in the first year. during the past decades up to 250,000 people worldwide sustain a sci every year, and their life expectancy continues to increase. peripheral arterial disease (pad) is one of the most lethal diseases but is frequently neglected. even without previous ischemic stroke or myocardial infarction, patients with pad are at an equal risk of death as are patients with cardiovascular disease (cvd) or previous coronary or cerebrovascular disease. a meta - analysis suggested that pad affects more than 202 million people worldwide. resting pain, claudication, and atypical leg discomfort are the symptoms of pad ; however, up to 50% of patients with pad are asymptomatic. the confirmed risk factors of pad include diabetes mellitus (dm), smoking, hypertension (htn), and dyslipidemia. patients with sci are at a greater risk of cvd and a relevant higher risk of death than able - bodied persons. recent studies have advocated cvd as the leading cause of mortality in patients with sci. several studies have proposed subclinical atherosclerotic markers for patients with sci including the carotid intima - media thickness and ankle - brachial index. the relationship between sci and pad requires further large - scale investigation because pad is an atherosclerotic process affecting the noncoronary arterial system. our retrospective nationwide cohort study investigated the relationship between sci and pad by using data from a national health insurance database. data used in this study were obtained from the taiwan national health insurance research database (nhird). the national health insurance (nhi) program is a government - run, single - payer insurance system that was established in 1995 in taiwan. this nhi program covers over 99% of the 23.74 million residents of taiwan (http://www.nhi.gov.tw). the national health research institute (nhri) audits and releases the nhird data for use in health service studies. in accordance with the personal information protection act, all patient reimbursement data are deidentified and linked to a patient identification number before being released for academic research. for this study, we used a subset of the nhird containing health care data including files of inpatient claims and the registry of beneficiaries. all clinical diagnoses were recorded according to the international classification of diseases, ninth revision, clinical modification [icd-9-cm ] codes. in our national health insurance (nhi) program, all insurance claims are under scrutiny of medical reimbursement specialists and anonymous peer reviews. the definition of sci and pad was based on icd-9-cm codes determined by clinical physicians after strict inspections in the reimbursement process based on laboratory, imaging, and pathological data. moreover, there are even severe penalties for physicians if inappropriate icd-9-cm codes were documented in clinical records. therefore, the diagnoses or definition of sci, and pad are accurate and reliable. the study was exempted from full review by the research ethics committee of china medical university and hospital (cmuh104-rec2 - 105). we selected adult patients with a first diagnosis of sci (icd-9-cm codes 806 and 952) from 2000 to 2010 as the sci cohort. cervical spine (c - spine) (icd-9-cm codes 806.0, 806.1, 952.0, 952.00, 952.01, 952.02, 952.03, 952.04, 952.05, 952.06, 952.07, 952.08, and 952.09) ; 2. thoracic spine (t - spine) (icd-9-cm codes 806.2, 806.21, 806.26, 806.3, 952.1, 952.11, and 952.16) ; 3. lumbar, sacral, or coccygeal spine (l - s - co spine) (icd-9-cm codes 806.4, 806.5, 806.6, 806.7, 806.8, 806.9, 952.2, 952.3, 952.4, 952.8, and 952.9) ; 4. multiple spine sci (any 2 or more than 2 lesions in the c - spine, t - spine, and l - s - co spine). the exclusion criteria were an age younger than 20 years, incomplete age or sex information, and a history of pad (icd-9-cm codes 440.2, 440.3, 440.8, 440.9, 443, 444.22, 444.8, 447.8, and 447.9) at the baseline. a non - sci cohort was randomly selected from the nhi beneficiaries aged 20 years and older and frequency - matched for age (every 5 years), sex, index year, and comorbidities, including diabetes, hypertension, hyperlipidemia, chronic obstructive pulmonary disease (copd), heart failure, obesity, cad, stroke, and asthma with the sci cohort at a 4:1 ratio, and was subjected to the same exclusion criteria. the main outcome was based on the admission claims data of pad diagnoses during follow - up. each patient was followed up from the index date to the date of pad occurrence, withdrawal from the nhi, or december 31, 2011. baseline comorbidities including dm (icd-9-cm codes 250), htn (icd-9-cm codes 401405), hyperlipidemia (icd-9-cm codes 272), copd (icd-9-cm codes 491, 492, and 496), heart failure (icd-9-cm codes 428), obesity (icd-9-cm code 278), coronary artery disease (cad) (icd-9-cm codes 410414), stroke (icd-9-cm codes 430438), and asthma (icd-9-cm code 493) were identified according to diagnoses in hospitalization records before the index date. the chi - squared test was used to examine and compare the distributions of the categorical variables of the sci and the non - sci cohort. the student 's t test was used to examine the mean ages and mean follow - up times of the cohorts. we estimated the cumulative incidence by using the kaplan meier method, and the log - rank test was used to compare the cumulative incidence curves of the sci and non - sci cohorts. the overall sex-, age-, and comorbidity - specific incidence densities of pad were measured for each cohort. univariable and multivariable cox proportional hazards regression models were used to examine the association between sci and the risk of pad, which is expressed as a hazard ratio (hr) with a 95% confidence interval (ci). we selected the comorbidities as variables in multivariable analysis because they were statistically significant in the univariable model. we further tested the interaction between sex and sci, age and sci, and between comorbidity and sci by including a cross - product term in the model. we used the scaled schoenfeld residuals for testing the proportional hazard model assumption. because the proportional hazard model assumption was violated (p = 0.005), we stratified the follow - up duration to deal with the violation of proportional hazard assumption. further analysis was performed to assess the variations in the association of pad at different levels of sci. data management and descriptive analyses were performed using the sas 9.2 statistical package (sas institute inc., the chi - squared test was used to examine and compare the distributions of the categorical variables of the sci and the non - sci cohort. the student 's t test was used to examine the mean ages and mean follow - up times of the cohorts. we estimated the cumulative incidence by using the kaplan meier method, and the log - rank test was used to compare the cumulative incidence curves of the sci and non - sci cohorts. the overall sex-, age-, and comorbidity - specific incidence densities of pad were measured for each cohort. univariable and multivariable cox proportional hazards regression models were used to examine the association between sci and the risk of pad, which is expressed as a hazard ratio (hr) with a 95% confidence interval (ci). we selected the comorbidities as variables in multivariable analysis because they were statistically significant in the univariable model. we further tested the interaction between sex and sci, age and sci, and between comorbidity and sci by including a cross - product term in the model. we used the scaled schoenfeld residuals for testing the proportional hazard model assumption. because the proportional hazard model assumption was violated (p = 0.005), we stratified the follow - up duration to deal with the violation of proportional hazard assumption. further analysis was performed to assess the variations in the association of pad at different levels of sci. data management and descriptive analyses were performed using the sas 9.2 statistical package (sas institute inc this study included 42,673 with sci and 170,389 patients without sci. in our study, men constituted the majority (63.2% versus 36.8%), and almost 71.7% of the patients were more than 50 years old. the mean age of the sci cohort was 52.4 18.2 years and that of the non - sci cohort was 52.1 18.4 years. the sci cohort and non- sci cohort were well matched for comorbidities, except for obesity. during the mean follow - up of 5.66 years for the sci cohort and 6.03 years for the non - sci cohort, the cumulative incidence of pad was significantly higher for patients in the sci cohort than for those in the non - sci cohort (log - rank test p 65 years), although this group had the highest incidence of pad. the pad incidence rate was greater in patients with comorbidities than in patients without comorbidity in both the cohorts. a significantly higher risk of pad was observed in sci patients without comorbidities (hr = 1.87 ; 95% ci = 1.502.33) than in the non - sci patients without comorbidities, respectively. in the first year of follow - up, the sci cohort had a higher risk of pad than the non - sci cohort (adjusted hr = 1.98, 95% ci = 1.532.57). moreover, the risk of pad in the sci cohort was still significantly higher than that in the non - sci cohort after 5 years of follow - up (adjusted hr = 1.36, 95% ci = 1.121.65). meier curve for the cumulative incidence of pad in the sci and non - sci cohorts during the 12-year follow - up. incidence ratio and hr of pad according to sci status stratified by demographic factors and comorbidities the results of the univariable and multivariable cox proportional hazards regression models for analyzing the risk of variables contributing to pad are summarized in table 2. the adjusted hr of pad was increased 1.42-fold for men relative to women (95% ci = 1.291.73) and increased 1.06-fold (95% the risk of pad was greater in patients with comorbidities, namely dm (adjusted hr = 3.11, 95% ci = 2.803.44), htn (adjusted hr = 1.50, 95% ci = 1.341.68), hyperlipidemia (adjusted hr = 1.49, 95% ci = 1.291.73), heart failure (adjusted hr = 1.81, 95% ci = 1.542.12), obesity (adjusted hr = 2.33, 95% ci = 1.045.21), cad (adjusted hr = 1.16, 95% ci = 1.021.31), and stroke (adjusted hr = 1.57, 95% ci = 1.351.82). hr of pad in association with sex, age, and comorbidities in univariable and multivariable cox regression models table 3 lists the relative risk and hr of pad associated with different levels of sci lesion. compared with the non - sci cohort, patients with l - s - co - spine injury were at a 56% (adjusted hr = 1.56, 95% ci = 1.331.84) higher risk of pad, respectively. patients with multiple sci lesions had a 2.11-fold higher risk of pad than the non - sci cohort (95% ci = 1.592.79). this study was conducted in a region with a high prevalence of pad. in our study, comorbidities were significantly more prevalent in the sci group than in the non - sci group. after adjustment for sex, age, and the aforementioned comorbidities, the sci group exhibited a 1.37-fold higher risk of pad than the non - sci group. the overall incidence of pad was 29% higher in the sci cohort than in the non - sci cohort. during the 12-year follow - up, a significantly higher risk of pad was noted within the first year. in our study, l - s - co - spine and multiple spine sci were significantly associated with an increased risk of pad. a historical prospective study among patients surviving at least 20 years with sci stated that the risk of all cvd increased with severity of sci. the cvd in this study defined by icd/9 codes 390 to 448 ; furthermore, the number of patients with pad in our study might have been underestimated because pad is commonly underdiagnosed. hence, the true impact of sci on pad might be stronger than that reported here. first, the patients with sci in our study had a significantly higher incidence of comorbidities than did the non - sci patients (table 4). moreover, htn, dm, and hyperlipidemia were observed to be the major risk factors for pad. thus, patients with these comorbidities possibly exhibited a higher risk of pad than did patients without comorbidities. second, previous research has reported a susceptibility of patients with sci to metabolic disorders including carbohydrate and dyslipidemia. lee reported that a quarter of the sci population presented with metabolic syndromes and insulin resistance. the impact of sci on the metabolism provides evidence of the association between sci and subsequent pad. third, impaired control of vessels and altered vascular reactivity in patients with sci possibly contribute to atherosclerosis in the lower extremities. fourth, a sedentary lifestyle and subsequent loss of lean body mass, and fluctuations in the blood pressure are possible mechanisms underlying pad observed in sci patients. demographic characteristics and comorbidities in study patients according to sci status the strengths of this study are that it is the first cohort study focusing on pad in sci patients with uniform data collection and a sufficiently large sample size to enable meaningful analyses. nevertheless, some limitations must be noted. first, the diagnoses recorded in the nhird are not validated for academic purposes. moreover, the nhird diagnoses were documented using icd-9-cm codes, and data on environmental risk factors influencing pad such as smoking habits and family history could not be obtained. second, despite the controls and adjustment for interfering factors, we probably did not completely control for the confounding effects of preexisting comorbidities of pad, potentially leading to an inaccurate estimation of the relationship between sci and pad risk. third, details of severity of pad could not be obtained ; thus, further survey in our study was limited. fourth, we have tried to minimize the basic difference between the sci and non - sci cohorts ; however, the confounding variables of smoking, blood pressure, and cholesterol level were not available in our database. thus, the effect of residual confounding could not be completely excluded. in conclusion, patients with sci are associated with an increased risk of pad, regardless of preexisting comorbidities. our findings improve physicians awareness of the risk of pad in patients with sci and facilitate developing strategies to prevent, detect, and manage pad in patients with sci. | abstractthe aim of this study was to elucidate the relationship between spinal cord injury (sci) and the risk of peripheral arterial disease (pad) in a cohort study with a large representative sample.the national health insurance database was used to select patients who were diagnosed from 2000 to 2010. patients with a history of pad were excluded. the sci group comprised 42,673 patients diagnosed with sci, and we enrolled 170,389 matched controls (non - sci group). we used a cox proportional hazards regression model to analyze the adjusted risk of pad between the case and control patients.patients with sci exhibited a significantly higher risk (hazard ratio [hr ] = 1.37 ; 95% confidence interval [ci ] = 1.221.53) of pad than patients without sci. patients with diabetes were at the highest risk of developing pad (adjusted hr = 3.11, 95% ci = 2.803.44). among patients without comorbidity, sci patients exhibited a significantly higher risk of pad than non - sci patients. furthermore, lumbar, sacral, or coccygeal spine, and multiple spine sci were significantly associated with an increased risk of pad (hr = 1.56, 95% ci = 1.331.84, hr = 2.11, 95% ci = 1.592.79, respectively).sci is associated with an increased risk of pad. future studies should focus on modifying risk factors to reduce pad risk among patients with sci. |
cerebral insults such as a traumatic brain injury (tbi), stroke, or status epilepticus (se) can lead to detrimental outcomes for patients who suffer from one of these events. all of these insults have been shown to cause acute cell death, disruption of the blood brain barrier, reduced neurological functional performance and altered cellular signaling within the injured tissue. one signaling pathway that has been shown to be activated after all of these cerebral insults is the janus kinase 2 and signal transducer and activator of transcription 3 (jak2-stat3) signaling pathway. this pathway activates numerous genes responsible for many cellular functions that may play a critical role in both neural injury and repair ; however, the precise contribution of jak2-stat3 activation after tbi, stroke, and se remains incompletely understood. when the jak2-stat3 pathway is activated after cerebral insults, it leads to the increased expression of genes associated with cell proliferation, differentiation and survival. activation of this pathway occurs when a hormone, growth factor or cytokine binds to a receptor which then phosphorylates jak2. jak2 in turn phosphorylates stat3, which then dimerizes and translocates to the nucleus where it binds to the promotor region of genes containing gamma - activated sequences. in the adult nervous system, this pathway is mostly dormant unless the central nervous system suffers a stressor or insult. the insult, whether a tbi, stroke, or se, leads to release of hormones, growth factors and cytokines which result in activation of this pathway. this review will examine the effects of jak2-stat3 activation in each of these injury models and how altering this pathway after these cerebral insults effects neurological recovery in preclinical models. traumatic brain injury (tbi) is a major public health problem and is the leading cause of morbidity and mortality in individuals under the age of 45. tbi causes a host of health issues including cognitive and motor defects as well as posttraumatic epilepsy. these adverse outcomes significantly decrease the quality of life for individuals who suffer tbi and new therapies are needed. one approach is to identify and disrupt the cellular and molecular changes that contribute to these adverse outcomes. the jak2-stat3 pathway has been shown to become activated after tbi in several different experimental models. although there are several differences in the method of experimental tbi, the current findings all show that there is an increase in the phosphorylation of jak2 and/or stat3 within the injured tissue as early as 3 h after injury. several groups have also shown that many known stat3 genes have increased expression after experimental tbi, however, the effect of jak2-stat3 pathway modulation on outcome is variable. 2011 has been able to partially block jak2 and stat3 phosphorylation 3 h after a tbi with administration of the jak2 inhibitor ag490. they also determined that neurological recovery was worsened with the administration of ag490 after a tbi. this same group also found that giving human recombinant erythropoietin (rhepo) after a tbi increased jak2 and stat3 phosphorylation and decreased apoptosis of cortical cells in peri - injured cortex cells of rats after an experimental tbi. when they added both rhepo and the jak2 inhibitor ag490 they found that pjak2 and pstat3 levels were reduced and that the mrna levels of several apoptosis related genes were increased while they did not see a difference in tunel staining. their findings suggest that activation of the jak2-stat3 pathway after a tbi is advantageous for neuronal recovery. while several groups have investigated inhibitory neurotransmitter receptor regulation, specifically gaba(a) receptor regulation, after a tbi, raible. has found a correlation between pstat3 levels and gabaar 1 after an experimental tbi, suggesting that activation of this pathway may lead to altered inhibitory signaling. since one of the sequelae of a tbi is the subsequent development of epilepsy, preventing this alteration of inhibitory signaling after injury could inhibit the development of post traumatic epilepsy. within developed countries, stroke is the leading cause of death and disability and beyond the immediate 46 h after an acute ischemic stroke, there is no known therapy that improves outcomes for this illness. numerous pathological events such as necrosis, apoptosis, edema, and altered cellular signaling occur after cerebral ischemia as well as after subdural hematomas. as with tbi, several groups have shown that the jak2-stat3 pathway is activated in in vitro and in vivo experimental models of stroke. while all of the research to this point has shown that there is an increase in phosphorylation of jak2 and/or stat3 after stroke, there are conflicting data whether this pathway activation leads to improved neurological recovery. several groups have found that treating animals with hypoxic preconditioning, rhepo, or other novel compounds increased the activation of the jak2-stat3 pathway and improved neurological recovery after experimental stroke. furthermore, some investigators have blocked jak2-stat3 phosphorylation with ag490 or wp1066 (an analog of ag490) and found that cell death markers or functional performance were worsened. these findings suggest that treatments that activate the jak2-stat3 pathway after experimental stroke may lead to improved functional performance and/or decreased cell death. on the contrary, satriotomo. found that administration of the jak2 inhibitor ag490 or a stat3 sirna after experimental cerebral ischemia decreased infarction volume, neuronal damage, apoptosis, and gfap - positive cells. these results suggest that activation of the jak2-stat3 pathway leads to decreased cerebral recovery and that blocking this pathway leads to better neurological outcomes. the jury thus remains out and further studies are required to determine the functional effects of jak2-stat3 pathway activation following cerebral ischemia. status epilepticus (se) is clinically defined as the occurrence of a single unremitting seizure with a duration longer than 1530 min or frequent clinical seizures without interictal return to baseline lasting at least 1530 min. se is a common life - threatening neurological disorder that is seen most commonly in the pediatric population. individuals who have had se may experience morbidities including cognitive impairment, epilepsy, and recurrent se. pilocarpine or kainic acid induced se in rodents is a common model used by researchers to study the mechanisms underlying epilepsy development or epileptogenesis. these se models mimic human se and result in rodents that have similar morbidities as humans. as with both tbi and stroke, several studies have found that the jak2-stat3 pathway is activated in the hippocampus as early as 1 h after experimental se and that several known stat3 regulated genes are activated. two reports have shown jak2-stat3 activation can be blocked pharmacologically (by wp1066 or pyridone 6) and prevent some stat3-related genes from being activated. these stat3 regulated genes are involved in gabaar subunit regulation, cell survival, cell proliferation, and cell cycling. grabenstatter. found that when stat3 phosphorylation was blocked during se, the severity of the subsequent epilepsy was reduced in the rat pilocarpine model. this may suggest that jak2-stat3 activation after se at least partially contributes to the subsequent development of epilepsy. this same study also found that after administration of wp1066, there was no difference in fjb staining ; suggesting that cell death was not altered by blocking jak2-stat3 activation after insult. multiple types of cerebral insults, including tbi, stroke and se, have been shown to activate the jak2-stat3 pathway and increase expression of stat3 related genes involved in cellular proliferation, differentiation, survival and inhibitory neurotransmission (fig. 1). some have reported worsened neurological recovery when blocking this pathway, while others have demonstrated advantageous effects. further investigation is needed to determine if it is feasible to selectively block only certain genes downstream of the jak2-stat3 pathway to prevent the deleterious effects associated with activation of this pathway while maintaining the beneficial neuroprotective effects of jak2-stat3 pathway activation. traumatic brain injury (tbi), stroke, and status epilepticus (se) injury models have shown that the jak2-stat3 pathway becomes activated which is indicated either by the increased phosphorylation of jak2 and/or stat3. when jak2-stat3 becomes phosphorylated it results in the increased expression of stat3 related genes involved in cell proliferation, cellular differentiation, cell survival, and inhibitory neurotransmission. | the jak2-stat3 signaling pathway has been shown to regulate the expression of genes involved in cell survival, cell proliferation, cell - cycle progression, and angiogenesis in development and after cerebral insults. until recently, little has been known about the effects of this pathway activation after cerebral insults and if blocking this pathway leads to better recovery. this review exams the role of this pathway after 3 cerebral insults (traumatic brain injury, stroke, and status epilepticus). |
beedis (or bidis) are the commonest smoked form of tobacco in india. according to the global adult tobacco survey, 34.6% of adults are current tobacco users. a greater proportion of males (47.9%) use tobacco compared to females (20.3%). among females, while only 2.9% smoke any form of tobacco and 1.9% specifically smoke beedis, a majority are chewers. cross - tobacco use refers to the use of tobacco in the form other than for what it was primarily intended. a review of the literature shows no data on cross tobacco use (e.g., chewing what is primarily meant for smoking). the authors report what to our knowledge is the first case of cross - tobacco use (chewing beedies meant for smoking) in a female patient with schizophrenia. a 22-year - old single lady was brought to the centre for addiction medicine with a request for help for tobacco cessation. she had been on treatment for schizophrenia for the last 6 years which had responded well to treatment and she was on maintenance with risperidone 4 mg / day and trihexyphenidyl 2 mg / day. only following 4 years of regular follow - up, following pressure from family, she reported the use of beedies in the form of chewing. her father was a habitual beedi smoker and her mother used areca nut and betel leaf with tobacco. the patient had begun chewing beedies at the age of 15 years, after having observed her father smoking beedies, which she was often sent out to procure. she said she had begun chewing as she could not smoke (female smoking is not socially acceptable in most sections). initially, she would chew the stubs her father had dropped around, but later began procuring beedies for her own use. while buying the beedies, she would say it was for her father. the patient had developed a dependent pattern of tobacco use since the age of 18 years. on average, she was chewing up to one pack, which contains 24 beedis. at the time of her consultation for tobacco cessation, the positive symptoms of schizophrenia were well controlled, and she had minimal negative symptoms. the diagnosis of nicotine dependence syndrome along with undifferentiated schizophrenia was considered. despite significant improvement in her psychotic symptoms and occupational work function, treatment for tobacco dependence was challenging since patient reported very severe intense craving early in the morning and a wavering motivation for abstinence. a trial of nicotine gum 4 mg up to 12 mg per day and behavioral counseling was not useful to contain her tobacco use. she has stopped chewing beedies since the last 8 months and is not using any other form of tobacco. tobacco has been used in smokeless (chewing) and smoking forms throughout the world. chewing tobacco products there is a gender difference in the preference for different forms of tobacco in india. while males smoke beedies or cigarettes, females who use tobacco are generally chewers. in the reported case, unusual form of cross - tobacco use there are no data available on this form of cross - tobacco use in the published literature. in the reported case, she was also biologically predisposed to tobacco use, with both her parents likely to have been dependent on tobacco, the father a chronic beedi smoker and the mother likely to have been dependent on both tobacco and areca nut. in addition to a vulnerability to dependence, the presence of schizophrenia is yet another risk factor, and nicotine use in the form of tobacco is well known. unusual patterns of tobacco use, especially in psychotic patients are known, but not published. clinicians should be sensitive to unusual patterns of use, as highlighted by this case. | while tobacco use occurs in many forms all over the world, there is little information on cross - tobacco use. authors report an unusual case of tobacco use in the form of chewing beedies which are normally smoked (cross - tobacco use). a 22-year - old single female, diagnosed with schizophrenia for the last 6 years, started chewing beedies from the age of 15 years and was using it in a dependent pattern since 7 years. after 3 years of treatment for her schizophrenia, patient 's family pressured her to seek tobacco cessation treatment. initial treatment with nicotine gum replacement and behavioral counseling did not prove useful. subsequently she was treated with bupropion 300 mg / day and able to successfully abstain. cross - tobacco use is relatively rare, and merits further study, especially in the mentally ill population. |
cavernous hemangioma constitutes 5 - 10% of vascular malformations occurring in the entire central nervous system (cns). intraventricular location constituting 2.5 - 10.8% of cerebral cavernous hemangioma is uncommon because most of them are usually found in the parenchyme of cns4). so far, the intraventricular cavernous hemangioma has been reported to be less than 90 cases to our best knowledge. those located in the third ventricle account for approximately half of all intraventricular cavernous hemangiomas. in particular, cavernoma at the foramen of monro which have been reported to be about 13 cases are very rare and may be difficult to differentiate from other brain tumors1,4). herein, we present an additional case of cavernous hemangioma located in the foramen of monro of the third ventricle and review the relevant literatures. a 30-year - old female patient who was pregnant presented with intermittent non - throbbing headache for a month before admission. she complained the projectile vomiting and fever without consciousness disturbance which were observed shortly after normal vaginal delivery. she was referred to department of neurology under the impression of meningitis. on physical examinations, computed tomogram (ct) showed enlargement of both lateral ventricles which may be caused by 3 cm sized multi - lobular calcified mass with slightly peripheral rim enhancement at the foramen of monro in the third ventricle. magnetic resonance image (mri) revealed a relatively well - delineated mass at the foramen of monro with heterogeneous signal intensity on both t1 and t2 weighted images. the surrounding rim of low signal intensity around mass was not delineated definitely on t2-weighted image. a peri - lesional edema in the left thalamus was observed on the flair image and only minimal peripheral rim enhancement around mass was found on enhanced t1-weighted image (fig. operative findings showed that the mass with xanthochromic and lobular surface obstructing the foramen of monro was located in the third ventricle. the left posterior margin of the mass was close contact to the thalamus while resection. immunostaining for smooth muscle actin (sma) was positive in the vessel wall (fig. after operation, the patient 's symptoms including vomiting and headache were recovered gradually (fig. cavernous hemangiomas known as cavernous malformations, cavernous angiomas or cavernomas are a kind of vascular malformation which is angiographically occult unlike arteriovenous malformations. these benign lesions are composed of sinusoidal vascular channels which are lined with a single layer endothelium predisposing to hemorrhage and have perilesional surrounding gliosis2). hemorrhages at different stages due to repeated bleeding, occlusion and thrombosis in the vascular channels are found within the lesion. progressive pseudotumorous evolutions are induced by repeated bleeding which occur in the immediate vicinity of cavernous hemangioma, leading to hemosiderin deposits and gliosis2). most of them occur in the intra - axial and supratentorial regions and they are typically located in the subcortical deep white matters, basal ganglia, brain stem and cerebellum. however, they have rarely seen in the intraventricular or extra - axial locations4). kivelev.4) summarized intraventricular cavernomas of 89 cases including their own cases and reported that 34 cases (38%) of them were located in the third ventricle. third ventricular cavernomas can be classified into suprachiasmatic, foramen of monro, lateral wall, and floor regions depending on the location3). those located at the foramen of monro may have particular clinical interests because of hydrocephalus due to foraminal obstruction and have been reported to be only 13 cases so far1,4,5). it is notable that our case can be additional one as foramen of monro cavernomas of third ventricle. clinical symptoms of intraventricular cavernomas may be elicited by mass and increased intracranial hypertension due to acute bleeding or obstruction of cerebrospinal fluid pathway. in our case, headache and vomiting resulted from increased intracranial pressure due to obstructive hydrocephalus induced by cavernoma located at the foramen of monro. fourteen intraventricular cavernomas located at the foramen of monro including our case are summarized in the table 1. there were 5 males and 9 females whose age distribution is ranged from 11 years to 64 years. the clinical findings were symptoms associated with hydrocephalus in most cases, hemorrhages in 3 cases, focal neurological deficits in 5 cases. in all patients, surgical removal was performed completely without significant neurological deficits using the microsurgery or / and endoscopic surgery through the trans - callosal or trans - cortical approaches. most of them often showed calcification on computed tomogram (ct) and heterogenous signal intensities and mild enhancement on magnetic resonance image (mri). typical ct findings of cavernous hemangiomas in the third ventricle show moderately hyper - dense lobular lesions with mild contrast enhancement. unlike arteriovenous malformations, they are angiographically occult because cavernous hemangiomas usually do not have feeding or draining vessels obviously. therefore, mri has been useful in diagnosis of clinically silent and angiographically occult cavernomas. common mri features include a hyper to iso - intense center correlated to the hemorrhages at different stage on t1-weighted images and a surrounding hemosiderin rim of low intensity caused by calcification or fibrosis on t2-weighted images. also, it has been reported that typical perilesional hemosiderotic rim might be thinner or absent and core of lesion could be less heterogenous in the intraventricular cavernomas compared with intraparenchymal cavernomas4). our case showing heterogenous signal intensities in the center of lesion and unclear hemosiderin rim might be confused with other brain tumor lesions. it is considered that additional gradient echo sequences which can detect the hemorrhages in different stages can help differentiate from hemorrhagic form of cavernous hemangioma. anaplastic astrocytomas, glioblastomas and oligodendrogliomas showing heterogeneous signals on mri may mimic cavernous hemangiomas because of intratumoral necrosis, hemorrhage or calcification. however, tumor is usually non - hemorrhagic and surrounded by prominent perilesional edema. cystic and hemorrhagic metastases, which may occur with melanoma, adenocarcinoma has multiple lesions. furthermore, the third ventricle is a very uncommon site for metastasis or other primary brain tumors. colloid cysts and germinoma may occur at this location but can be excluded by their different appearance on mri. compared with usual radiological findings of cavernomas, our case was not considered as typical cavernoma with peripheral hemosiderin rim and heterogenous internal signal intensities despite normal cerebral angiogram initially. therefore, vascular lesions such as arteriovenous malformation, venous angioma, tumorous lesions such as glioma, central neurocytoma, subependymal giant cell astrocytoma, colloid cyst, craniopharyngioma, metastasis, meningioma, teratoma, germinoma should be differentiated through full sequences of mri, angiogram, biopsy and microsurgery4). in our case, this lesion was initially interpretated as tumor such as central neurocytoma, but confirmed as cavernoma through the microsurgery. with regard to the management of cavernous hemangiomas, only a few reports suggested the effectiveness of radiotherapy. however, proliferation and recurrence have been described in several cases treated conservatively or with radiotherapy alone. therefore, surgical treatment is considered curative if they are readily accessible although management in asymptomatic patients remains controversial. we present a very rare case of intraventricular cavernous hemangioma located at the foramen of monro that may mimic tumor lesions. | intraventricular cavernous hemangiomas are uncommon. among them, those occurred at the foramen of monro in the third ventricle may be of particular interest because of its rarity, development of hydrocephalus, being differentiated from other brain lesions. we present a rare case of intraventricular cavernous hemangioma at foramen of monro which was resected through microsurgery and also review the relevant literatures. |
in south africa, integration of services policy was enacted in 1996 with the aim of increasing health service utilization by increasing the accessibility of all services at primary healthcare level. however, the problem with the policy arises in the implementation of integrated primary healthcare as there is no agreed upon understanding of what this phenomenon means in the south african context. analyse integration of primary healthcare services and ultimately develop a model for the integration of primary healthcare services. it emerged that there were three core categories that were used by the participants as discriminatory dimensions of integrated primary healthcare in south africa. these core categories were (a) comprehensive health care, (b) supermarket approach and (c) one stop shop. | introductionin south africa, integration of services policy was enacted in 1996 with the aim of increasing health service utilization by increasing the accessibility of all services at primary healthcare level. however, the problem with the policy arises in the implementation of integrated primary healthcare as there is no agreed upon understanding of what this phenomenon means in the south african context.aimsanalyse integration of primary healthcare services and ultimately develop a model for the integration of primary healthcare services.resultsit emerged that there were three core categories that were used by the participants as discriminatory dimensions of integrated primary healthcare in south africa. these core categories were (a) comprehensive health care, (b) supermarket approach and (c) one stop shop.conclusionthe phenomenon, integrated primary healthcare meant different things in different contexts. |
obesity increases the risk of metabolic disorders, such as high blood pressure, type 2 diabetes, and fatty liver1,2,3. it can also reduce skeletal muscle mass and exert a negative effect on normal muscle function4, 5. mammalian target of rapamycin (mtor), a serine / threonine protein kinase regulating the functions and activities of various cells in the skeletal muscle, consists of 2 distinct protein complexes : mtorc1 and mtorc26. mtorc1, a master regulator of protein synthesis and cell growth, contains the scaffold protein raptor, whereas glucose mtorc2, a regulator or akt activity, contains rictor. akt, which transduces important signals for regulating cell metabolism and cell growth, is activated by rictor. the activated akt, in turn, induces protein synthesis and muscle fiber hypertrophy via the s6 kinase 1 (s6k1) pathway9,10,11. however, the overactivation of the raptor - s6k1 signaling pathway causes obesity by promoting fat deposition in the muscle, liver, and white adipose tissue12. in spite of the raptor - s6k1 activity, an over - nutrition condition such as obesity leads to muscle wasting and functional damage because of the low efficacy of protein anabolism13. the reduction in rictor - akt activity causes a reduction in muscle mass by promoting protein catabolism7 ; and further, it causes metabolic imbalance leading to increase in oxidative stress, inflammatory responses, and the risk of cardiovascular diseases and obesity12. many studies have reported that both acute and regular resistance exercises promoted protein synthesis and muscle hypertrophy by activating the mtor pathway14,15,16. yet, there is very limited research that investigated the change in the mtor signaling pathway according to regular aerobic exercise, though aerobic exercise is the most effective type of exercise for treating obesity. moreover, it is notable that aerobic excise can inhibit mtorc1 by inducing adenosine monophosphate - activated protein kinase (ampk) activity that promotes oxidative metabolism17, 18. this suggests that aerobic exercise can reduce muscle hypertrophy, and therefore, induce a different pattern of change in the mtor signaling pathway compared to resistance exercise. thus, although exercise is an important factor that induces muscle protein synthesis and muscle hypertrophy by enhancing the positive effect of the mtor signaling pathway, most of the preceding researches have been limited to resistance exercise. in particular, there has been insufficient research that involves obesity models to investigate the effect of regular aerobic exercise training on the rictor - akt and mtor - raptor - s6k1 signaling pathways. therefore, the present research studied the effect of 8 weeks of regular treadmill exercise on the skeletal muscle rictor - akt and mtor - raptor - s6k1 signaling pathways in high - fat diet - induced obese mice. forty male c57bl/6 mice (4 weeks old) were housed in cages and fed freely with standard rat chow and water (samtako, inc. four mice were housed in each cage and maintained under standardized conditions in an animal facility (laboratory of animals, college of medicine, dong - a university), at a room temperature of 22 2 c, 60 5% relative humidity, and a 12 h light / dark cycle. animal experiments were approved by dong - a university medical school institutional animal care and use committee (diacuc-1321), and all procedures were conducted in accordance with committee guidelines. after 1 week of adaptation maintenance, mice were randomly divided into2 groups to induce obesity by high - fat diet for 8 weeks : a normal diet (nd) group (6% fat ; samtako, inc., korea, n = 20), and a high fat diet (hf) group (45% fat ; research diets inc. dietary and body weight were measured every week at the same time (11:00) during the entire experimental period. after inducing obesity, mice were randomly subdivided into the nd, nd, and training (ndt), hf, hf, and training (hft) groups (10 mice per group). exercise protocol was adapted for 5 days in order to perform the treadmill exercise. exercise for mice in the training groups was conducted on a treadmill for 40 min once a day, 5 times a week, for 8 weeks. exercise intensity consisted of 5 m / min (5 min), 10 m / min (30 min), and 5 m / min (5 min) at 0% slope for weeks 1 to 4 (low intensity). during weeks 5 to 8, exercise intensity was increased to 5 m / min (5 min), 14 m / min (30 min), and 5 m / min (5 min) at the same slope (moderate intensity). tissues were collected at 48 h after the completion of training in order to rule out temporary exercise effects. the feed supply was discontinued 12 h prior to sampling with water continuously supplied. muscles were removed to collect the soleus muscle (10 g) and stored in a deep freezer (nihow freezer, japan) at 80 c until analysis. to extract protein from the soleus muscle, tissues were crushed after adding a solution containing 150 mm nacl, 5 mm edta, 50 mm tri - hcl (ph 8.0), 1%-np 40, 1 mm aprotinin, 0.1 mm leupeptin, and 1 mm pepstatin. the solution was centrifuged for 30 min at 16,600 g. supernatants were collected and assayed for protein content prior to storage at 80 c. protein samples were mixed with laemmli sample buffer (lsb) and placed in a boiling water bath for 5 min. proteins were resolved by 10, 12, or 15% sds - polyacrylamide gel electrophoresis (sds - page ; each loaded with same amount in g of total protein per lane), and transferred to nitrocellulose membranes. thereafter, protein membranes were incubated with the following primary antibodies : akt (1:1000 ; cell signaling), mtor (1:1000 ; cell signaling), raptor (1:1000 ; cell signaling), rictor (1:1000 ; cell signaling) and s6k1 (1:1000 ; cell signaling) for 1 hour, and washed 3 times (15 min each) in a pbs solution containing 0.1% tween 20. the washed membrane was then treated with secondary antibody (goat - anti - mouse [or rabbit ] igg) conjugated with horseradish peroxidase (hrp). the relative strengths of bands were quantitated by imagequanttm las-4000 (ge healthcare, swe). all data were analyzed using spss software version 21.0 for windows (spss inc., body weight and mtor signaling pathway (mtor, raptor, s6k1, rictor, akt) were analyzed by one - way anova. the body weight of mice at 8 weeks of exercise training was significantly higher in the hf (49.1 0.8 g) group than that in the nd (38.1 1.5 g) and ndt (31.7 1.3 g) groups (p < 0.05). in addition, body weight in the hft (42.4 1.1 g) group was significantly lower than that in the hf group (p < 0.05) ; body weight in the ndt group was also significantly different from that in the nd and hft groups (p < 0.05). the mtor, raptor / mtorc1, s6k1, rictor / mtorc2, and akt levels for the 4 groups after 8 weeks of exercise training are shown in table 1table 1.changes in mtor signaling pathway factors in skeletal muscle after 8 weeks of exercise training. mtor levels were significantly higher in the hf group than that in the nd and ndt groups (p < 0.05). raptor / mtorc1 and s6k1 levels were significantly higher in the hf group than in all the other groups (p < 0.05). akt levels were significantly lower in the hf group than that in the ndt group (p < 0.05). in contrast, rictor / mtorc2 levels were not significantly different among all the groups. an obese individual may suffer deterioration of muscle function owing to the reduction of muscle mass caused by imbalance in protein synthesis and degradation19. it is, therefore, important to maintain or increase skeletal muscle mass through mechanical stimulus such as exercise. russell20 reported that skeletal muscle mass is regulated by the synergy between the growth and loss of muscle and is closely associated with the mtor signaling pathway. mtor has been reported to be regulated by repetitive muscle contraction and, as a mediator of the adaptation induced by exercise, to promote the growth and hypertrophy of muscle fiber by being involved in protein synthesis21. richard - bulteau.22 reported that mtor expression decreased in damaged skeletal muscle but increased during the initial period of exercise, and that mtor played an important role in muscle growth. in the present study, the hf group showed significantly higher mtor levels compared to the nd and ndt groups. this result was because of high - fat diet - induced obesity, which suggests that regular aerobic exercise could not induce mtor activity. of interest, li.23 reported the tendency of the mtor signaling pathway to be overactivated in the skeletal muscle of obese individuals. our results are also supported by those of mller.24, who reported that resistance exercise could induce mtorc1 activation in skeletal muscle but endurance exercise exerted no significant effect. it has been reported that raptor, a component of mtor complex, plays an important role in regulating protein synthesis, mitochondrial biosynthesis, and oxidative metabolism in muscle7, and that repetitive muscle contractions could induce skeletal muscle growth by increasing raptor activity25. on the contrary, detective raptor in muscle could reduce oxidative metabolism in mitochondria and cause early death26. in the present study, the hf group showed a significantly higher raptor levels compared to the other 3 groups (the nd, ndt, and hft groups). this result is in accordance with those of preceding researches which showed significantly higher level of raptor in the muscles of high fat - fed obese rats27, which proved that aerobic exercise could decrease raptor activity18. it can be interpreted from our results that raptor activity was abnormally overactivated by high - fat diet - induced obesity rather than by skeletal muscle synthesis, but that aerobic exercise positively contributed to normalizing the raptor signaling pathway. this interpretation is supported by the suggestion that chronic raptor activation or abnormal raptor signaling might rather weaken the skeletal muscle response to growth signals in obesity models28, 29 and also by the suggestion from laplante and sabatini7 that no increase of muscle mass, in spite of high level of raptor activity in obesity models, is because of protein catabolism. s6k1, which is involved in the mechanism of raptor downstream signaling, integrates various external signals for controlling cell growth and metabolism to induce protein synthesis and muscle growth30. pagano.31 reported an increase in s6k1 during recovery after moderate- or high - intensity endurance exercise. in the present study, the hf group showed a significantly higher s6k1 levels than the other 3 groups, similar to that of raptor. considering the high level of raptor shown by the hf group, it can be interpreted from our results that obesity is the main contributor to s6k1 activity, but that aerobic exercise suppressed the obesity - induced overactivation of s6k1. this interpretation is supported by previous studies, which reported that the activation of the raptor - s6k1 signaling pathway was associated not only with protein synthesis but also with obesity32, 33. liao and xu32, who investigated mtor / s6k1 signaling in high - fat diet - induced obese rats, also demonstrated the remarkable increase of s6k1 in their muscles. in addition, khamzina.27 suggested that high - fat diet - induced increase in mtorc1 activity is because of increased s6k1 phosphorylation, whereas williamson.18 suggested that the decrease in raptor activity caused by aerobic exercise is because of the decrease in s6k1. rictor plays an important role in maintaining the life and size of cells by being involved in the long - term activation of akt / protein kinase b34, 35, and its interaction with akt is associated with the regulation of carbohydrate metabolism in cells36. the role of exercise - induced rictor activation is not yet clearly known, though it has been reported that aerobic exercise - induced mtorc2 activity promoted metabolism8. in the present study, while there was no significant difference in rictor, akt level was found to be significantly lower in the hf group than in the ndt group. preceding studies have reported that akt was closely associated with the regulation of mtor and s6k1 levels, and that increase in akt expression contributed to improving high - fat diet - induced obesity37, 38 and increased anabolism in muscles39. it can be interpreted from our results that akt expression was suppressed by obesity in the hf group, but that akt expression increased in the ndt group as an efficacy of regular aerobic exercise. altogether, the results suggest that risk of obesity may be associated with the overactivation of the mtor - raptor - s6k1 signaling pathway and a decrease in akt levels. we also found that performing aerobic exercise may be associated with the downregulation of the mtor - raptor - s6k1 pathway and an increase in akt levels. whereas a reduction in the concentration of proteins related to mtor signaling according to aerobic exercise may not reflect its negative effects on metabolism and protein synthesis in the skeletal muscle | [purpose ] the aim of this study was to investigate the effects of regular treadmill exercise on skeletal muscle rictor - akt and mtor - raptor - s6k1 signaling pathway in high - fat diet - induced obese mice. [subjects and methods ] four- week - old c57bl/6 mice were adopted and classified into normal diet group (nd, n = 10), normal diet and training group (ndt, n = 10), high - fat diet group (hf, n = 10), and high - fat diet and training group (hft, n = 10). the exercise program consisted of a treadmill exercise provided at low intensity for 14 weeks, and moderate intensity for 58 weeks. [results ] the western blot method was used to measure the expression of mtor, raptor, s6k1, rictor, and akt proteins in the soleus muscle. mtor levels were significantly higher in the hf group than in the nd and ndt groups. raptor / mtorc1 and s6k1 levels were significantly higher in the hf group than in all the other groups. akt levels were significantly lower in the hf group than in the ndt group. the risk of obesity may be associated with the overactivation of the mtor - raptor - s6k1 signaling pathway and a decrease in akt levels. [conclusion ] this study also indicates that performing aerobic exercise may be associated with the downregulation of the mtor - raptor - s6k1 pathway. |
determinar si las caractersticas iniciales de los patrones individuales de la refraccin perifrica guardan relacin con los cambios subsiguientes de la refraccin, durante un periodo de un ao. se reuni a 54 sujetos con miopa y emetropa (edad media : 24,9 5,1 aos ; mediana : 24 aos) con visin normal, sometindoles a una refraccin subjetiva no ciclopjica. se midi tambin la refraccin perifrica a intervalos de 5 grados, sobre los 60 grados centrales del campo visual horizontal, al igual que la longitud axial. al cabo de un ao, se repitieron las mediciones de la refraccin subjetiva y de la longitud axial a los 43 sujetos que se hallaban disponibles para la realizacin del examen. en consonancia con los estudios previos, los grandes miopes tendieron a reflejar una hiperopa perifrica relativa superior. sin embargo, se produjo una variacin considerable entre los sujetos, en cuanto al patrn del error refractivo perifrico relativo (rpre) a cualquier grado de la refraccin axial. dentro del grupo, los cambios medios de la refraccin axial y la longitud axial al cabo de un ao no difirieron significativamente de cero. no se produjo correlacin entre los cambios de estos parmetros en los sujetos, y cualquier caracterstica del rpre. no se hall evidencia alguna que apoyara la hiptesis de que el patrn del rpre es predictivo de un cambio refractivo subsiguiente en este grupo de edad. early measurements of the distribution of ametropia usually showed that a relatively broad distribution in early life became markedly narrower and peaked near emmetropia by the age of about 8 years.1, 2 although the distribution became more skewed beyond this age, most young adults remained near - emmetropic e.g. weale. however, in contrast to these earlier results, recent decades have seen a marked, progressive increase in myopia through childhood in some parts of the world, particularly asia e.g. lin. this has led to a search for the factors that may influence the development and progression of myopia, in the hope that strategies to inhibit or retard progression may be introduced. various possible causative factors have been proposed, including genetics (for review), near work (for review), outdoor activities, lighting, and concentration of vitamin d in the blood. a further possibility is peripheral refraction. comparisons of the patterns of relative peripheral refractive error (rpre) of human eyes indicate that, on average and in contrast to emmetropes and hyperopes, myopes have a relatively hyperopic defocus in the periphery e.g. mutti. largely on the basis of the study of late - onset myopia in trainee pilots by hoogerheide. it has been postulated that these differences arise because relative peripheral hyperopia has a causative effect for the development of axial myopia.12, 13, 14 this suggestion is apparently supported by animal studies, which show that the emmetropisation process is visually guided and may involve both central15, 16 and local effects,17, 18, 19 and that peripheral refraction can guide emmetropisation even in the absence of an axial image. these ideas have led to trials in humans of contact and spectacle lenses designed to reduce peripheral hyperopia, in the hope that this might in turn reduce the rate of myopia progression : a minimal, but significant reduction in progression has been found.21, 22, 23 on the other hand, some authors have suggested that the findings of hoogerheide. may have been misinterpreted and that the different patterns of relative peripheral refractive error (rpre) associated with different refractive groups are the result of the ametropia rather than its cause. in view of these contradictory opinions, the aim of the present study was to measure the initial peripheral refractive errors along the horizontal meridian in a group of young adults, and their axial refractive error at baseline and twelve months later. it was hoped that this would allow the relationship, if any, between an individual 's initial peripheral refractive parameters and any changes in central refractive error over a one - year time interval to be determined, so that any parameter holding promise of offering a predictive effect for myopisation could be identified. in particular, the hypothesis that a hyperopic rpre is a precursor to myopic change could be tested. while usually progression of myopia has ceased by early adulthood it was expected that, in a population consisting of undergraduates and postgraduates undergoing intensive studies, some cases of late - onset myopia or myopia progression might occur e.g.11, 27, 28, 29, 30, 31, 32, 33 the age of the subjects ranged between 19 and 38 years (mean : 24.9 5.1 years ; median 24 years). all subjects were free of any ocular pathology and could achieve a visual acuity of 6/6 partially or better when corrected. there were 32 myopes (spherical equivalent from 9.63 d to 0.63 d ; mean 3.46 2.35 d ; median 1.38 d) and 22 emmetropes (spherical equivalent from 0.50 d to + 0.50 d ; mean 0.03 0.36 d ; median 0.19 d). the mean ages of the myopes and emmetropes were 25.3 5.5 and 24.5 4.5 years, respectively. eleven (20%) patients could not be followed up after one year, because they had left the manchester area or could not be contacted, leaving 25 of the original myopes and 18 of the emmetropes. the mean ages of these remaining myopes and emmetropes were 25.4 5.9 years and 24.7 4.7 years, respectively. the initial refractions were 0.01 0.37 d in these emmetropes and 3.38 2.08 d in the myopes. written informed consent was obtained from all participants after the nature of the study and possible consequences of the study had been explained. the project protocol was approved by the senate committee on the ethics of research on human beings of the university of manchester. axial length was also measured, since it was expected that any refractive change with time might also involve change in this parameter.27, 29, 33 subjective refraction was performed to an accuracy of 0.25 ds and 0.25 dc to obtain maximum plus giving best visual acuity. the cylindrical component, if existent, was found using a cross - cylinder. to refine the spherical component at the end of the routine, the duochrome test was used. for peripheral refraction an open - field autorefractor shin - nippon srw 5000 (ajinomoto trading inc. this has been shown to be repeatable for central and peripheral refraction.34, 35 participants fixated on targets (maltese crosses) along the horizontal meridian that were placed at 5 m in 5 steps from 30 nasal to 30 temporal retina. subjects were asked to turn their head to fixate each target and five consecutive measurements were taken. relative peripheral refraction was computed as the difference between mean spherical equivalent in primary gaze and mean spherical equivalent in each peripheral gaze. altman comparison of the subjective results for central refraction with those from the autorefractor showed close similarity (mean difference standard deviation in mean sphere 0.23 for axial length measurement the lenstar 900 (haag - streit, koeniz, switzerland) was used. it has been shown that the lenstar is a reliable instrument for axial length measurements.36, 37, 38, 39 the instrument was aligned using the image of the patient 's eye on the computer monitor. blinking or loss of fixation were detected automatically by the instrument and in this case the measurements were repeated. the instrument takes 16 consecutive scans per measurement without the need for realignment and five measurements were taken as recommended by the manufacturer. the axial length measurements were performed only on 48 subjects (which included 30 myopes and 18 emmetropes). after a year (march 2011) the same patients, when available, were seen again for subjective refraction and axial length measurement. subjective refraction and autorefractor refractions in terms of sphere (s), cylinder (c) and axis () were converted into vector components by the following formulas:(1)m = s+c2(2)j180=ccos (2)2(3)j45=csin (2)2 each of the three components was fitted against the retinal eccentricity, x degrees, with a second - order polynomial function using originpro 8 (originlab corporation, northampton, ma, usa). data affected by the optic disc were disregarded for the fitting. the polynomial fit formula was:(4)f(x)=ax2+bx+c the formula approximates the rpre data as the sum of a parabola centred on the axis, where in the case of m a positive coefficient a represents relative peripheral hyperopia, and a straight line, where a non - zero linear coefficient b means that the fit is no longer symmetrical about the visual axis. (4) can be transformed to represent a shifted parabola of the form(5)f(x)=a(x+b)2+cwhere b = b/2a and c = (c b)/4a. the extreme value of the parabola then lies at x = b, y = c. field angles are taken as negative for the nasal retina. if relative values are used differences between the myopes and emmetropes were assessed using one - way analysis of variance. refractive error change was characterised as the difference between second visit spherical equivalent and first visit spherical equivalent (one - year visit minus baseline) using subjective refraction data. therefore negative values describe a change towards minus, i.e., progression of myopia. for axial length measurements, a positive difference between subjective refraction and autorefractor refractions in terms of sphere (s), cylinder (c) and axis () were converted into vector components by the following formulas:(1)m = s+c2(2)j180=ccos (2)2(3)j45=csin (2)2 each of the three components was fitted against the retinal eccentricity, x degrees, with a second - order polynomial function using originpro 8 (originlab corporation, northampton, ma, usa). data affected by the optic disc were disregarded for the fitting. the polynomial fit formula was:(4)f(x)=ax2+bx+c the formula approximates the rpre data as the sum of a parabola centred on the axis, where in the case of m a positive coefficient a represents relative peripheral hyperopia, and a straight line, where a non - zero linear coefficient b means that the fit is no longer symmetrical about the visual axis (4) can be transformed to represent a shifted parabola of the form(5)f(x)=a(x+b)2+cwhere b = b/2a and c = (c b)/4a. the extreme value of the parabola then lies at x = b, y = c. field angles are taken as negative for the nasal retina. differences between the myopes and emmetropes were assessed using one - way analysis of variance. refractive error change was characterised as the difference between second visit spherical equivalent and first visit spherical equivalent (one - year visit minus baseline) using subjective refraction data. therefore negative values describe a change towards minus, i.e., progression of myopia. for axial length measurements, a positive difference between 1 shows the values of the coefficients a and b (formula (4)) plotted as a function of the axial mean sphere m for each subject. however, although there is a weak trend towards relative hyperopia in the periphery (positive a) as the axial myopia increases, the slope of the regression line is not significant. the nasal / temporal asymmetry, as indicated by coefficient b, appears to change significantly with the central refraction (p < 0.001). as found by earlier authors, the j180 and j45 components of the rpre showed no systematic dependence on the axial mean spherical error m (see regression line data in table 1) and data were therefore pooled across all subjects. j180 became increasingly negative in the peripheral field and j45 changed almost linearly with field angle from negative values on the nasal retina to positive values on the temporal retina (fig. as expected, e.g. atchison., axial length increased with increasing myopia (regression line fit : axial length (mm) = 0.39x + 23.68, p were 0.04 0.29 d in myopes (range 1.00 d to + 0.50 d), 0.12 0.37 d in emmetropes (range 0.75 d to + 0.75 d), and 0.03 0.33 d (95% confidence limits 0.13 and + 0.07 d) in all eyes. axial length changed by + 0.01 0.07 mm in myopes (range 0.14 mm to 0.12 mm), + 0.02 0.07 mm in emmetropes (range 0.10 mm to 0.13 mm), and 0.02 0.07 mm in all eyes. changes in refractive error and axial length did not differ significantly from zero in either myopes or emmetropes, or differ significantly between myopes and emmetropes (f(1,41) = 2.35 ; p = 0.13 ; f(1,35) = 0.03, p = 0.87, respectively). altman plots of the changes in spherical equivalent as a function of the mean of the baseline and one - year values of axial m for each of the 43 subjects who completed the study, and for the change in axial length as a function of the mean axial length. in both cases the data give no evidence for any systematic changes in either the myopes or the emmetropes. 4 is broadly explicable in terms of the limited reliability of subjective refraction for a single refractionist, around 0.25 d, e.g. zadnik., and of the lenstar 's estimates of axial length (standard deviation of intersessional difference in lengths 0.03 mm, verkicharla.). 1 shows the values of the coefficients a and b (formula (4)) plotted as a function of the axial mean sphere m for each subject. however, although there is a weak trend towards relative hyperopia in the periphery (positive a) as the axial myopia increases, the slope of the regression line is not significant. the nasal / temporal asymmetry, as indicated by coefficient b, appears to change significantly with the central refraction (p < 0.001). as found by earlier authors, the j180 and j45 components of the rpre showed no systematic dependence on the axial mean spherical error m (see regression line data in table 1) and data were therefore pooled across all subjects. j180 became increasingly negative in the peripheral field and j45 changed almost linearly with field angle from negative values on the nasal retina to positive values on the temporal retina (fig. as expected, e.g. atchison., axial length increased with increasing myopia (regression line fit : axial length (mm) = 0.39x + 23.68, p 1 shows the values of the coefficients a and b (formula (4)) plotted as a function of the axial mean sphere m for each subject. however, although there is a weak trend towards relative hyperopia in the periphery (positive a) as the axial myopia increases, the slope of the regression line is not significant. the nasal / temporal asymmetry, as indicated by coefficient b, appears to change significantly with the central refraction (p < 0.001). as found by earlier authors, the j180 and j45 components of the rpre showed no systematic dependence on the axial mean spherical error m (see regression line data in table 1) and data were therefore pooled across all subjects. j180 became increasingly negative in the peripheral field and j45 changed almost linearly with field angle from negative values on the nasal retina to positive values on the temporal retina (fig. as expected, e.g. atchison., axial length increased with increasing myopia (regression line fit : axial length (mm) = 0.39x + 23.68, p the mean subjective refractive error changes within one year were 0.04 0.29 d in myopes (range 1.00 d to + 0.50 d), 0.12 0.37 d in emmetropes (range 0.75 d to + 0.75 d), and 0.03 0.33 d (95% confidence limits 0.13 and + 0.07 d) in all eyes. axial length changed by + 0.01 0.07 mm in myopes (range 0.14 mm to 0.12 mm), + 0.02 0.07 mm in emmetropes (range 0.10 mm to 0.13 mm), and 0.02 0.07 mm in all eyes. changes in refractive error and axial length did not differ significantly from zero in either myopes or emmetropes, or differ significantly between myopes and emmetropes (f(1,41) = 2.35 ; p = 0.13 ; f(1,35) = 0.03, p = 0.87, respectively). 4 shows bland altman plots of the changes in spherical equivalent as a function of the mean of the baseline and one - year values of axial m for each of the 43 subjects who completed the study, and for the change in axial length as a function of the mean axial length. in both cases the data give no evidence for any systematic changes in either the myopes or the emmetropes. 4 is broadly explicable in terms of the limited reliability of subjective refraction for a single refractionist, around 0.25 d, e.g. zadnik., and of the lenstar 's estimates of axial length (standard deviation of intersessional difference in lengths 0.03 mm, verkicharla. the study failed to find any evidence of refractive or axial length change in the group as a whole, or in the emmetropic and myopic subgroups. table 2 shows the results of various longitudinal studies of refractive changes occurring in student groups broadly similar to our own. most show a myopic change of about 0.10.2 d / year, which tends to be higher in subjects who are initially myopic. the only exception is the study of onal. where cycloplegic autorefraction showed no significant change, although subjective non - cycloplegic refraction showed an average 0.17 d / year myopic change. it is possible that our negative findings were influenced by the characteristics of our subject group and their pattern of activity : in particular, the mean age of our group (about 25 years) was somewhat older than those in the earlier studies. more subjects, a longer follow - up period and, possibly, the use of cycloplegia might have led to the observation of significant mean refractive change over time. nevertheless all of our data show considerable scatter and therefore it is possible that significant changes might have occurred in a few individuals, so that more detailed examination of the data is justified. the data on baseline mean sphere component, m of the relative peripheral refraction appear to be in reasonable accord with earlier data when analysed in a similar way. 5 shows our linear fits for the coefficients a and b for the mean - sphere rpre in comparison with those derived from fits of averaged data over the central 60 of field from three earlier studies.49, 50, 51 all the studies suggest that there is a general trend towards relative peripheral hyperopia (i.e. a positive coefficient a) in high myopes, and that there may be systematic changes in the asymmetry of the rpre as the ametropia varies, with the peripheral hyperopia increasing more rapidly with field angle on the temporal retina. the same studies also agree that differences in the peripheral j180 and j45 values across refractive groups are small (fig. 6) with the observed behaviour suggesting slight misalignment between the visual and optical axes. although the data from earlier studies in fig. 5 represent averages over groups of subjects (each data point representing a total of about 20 eyes for millodot, groups of 732 for atchison., and groups of 10 for calver.), it is evident that, as found in the early work of ferree., considerable inter - subject differences occurred within the groups. in a search for any indication that mean sphere rpre was in any way predictive of the very small changes in axial m observed over one year, the refractive changes recorded in the present study were plotted against the fitting coefficients a and b for baseline peripheral m (fig. the hypothesis that a hyperopic rpre (i.e. a + ve value of a) would make an individual more susceptible to myopic change is not confirmed. similarly, it does not appear that departures of the rpre from symmetry about the line of sight (coefficient b) are predictive of myopic change. the apparent absence of significant refractive or axial length changes is supported by comparing the individual changes in the two parameters. since most myopic change is likely to be due to an increase in axial length,27, 29 with an increase in length of around 1/3 mm producing an increase in myopia of about 1 d, a plot of the change in refraction against the change in axial length should have a negative slope of about 3 d / mm. 8), again suggesting that the minor differences observed arose mainly from the limited reliability of the measurements. in fact, as already noted, the changes in mean sphere refraction observed over one year are comparable with those to be expected on the basis of studies of the reliability of the results of subjective refraction. it should be emphasised that our failure to find any link between the pattern of rpre and subsequent refractive change applies only to the young adult group studied. clearly it would be of interest to carry out a similar study on children, for whom not only may progression rates be much higher but also the causes of the myopic change may differ from those in young adults. for the young - adult age - group studied, although baseline measurements of rpre were in accord with many earlier studies in showing that the rpre tended to become more hyperopic with increasing myopia, measurements of changes in axial refraction over a period of one year showed no correlation with any aspect of the rpre. this may suggest that a hyperopic rpre is a result of axial elongation rather than its cause. | purposeto determine whether the initial characteristics of individual patterns of peripheral refraction relate to subsequent changes in refraction over a one - year period.methods54 myopic and emmetropic subjects (mean age : 24.9 5.1 years ; median 24 years) with normal vision were recruited and underwent conventional non - cycloplegic subjective refraction. peripheral refraction was also measured at 5 intervals over the central 60 of horizontal visual field, together with axial length. after one year, measurements of subjective refraction and axial length were repeated on the 43 subjects who were still available for examination.resultsin agreement with earlier studies, higher myopes tended to show greater relative peripheral hyperopia. there was, however, considerable inter - subject variation in the pattern of relative peripheral refractive error (rpre) at any level of axial refraction. across the group, mean one - year changes in axial refraction and axial length did not differ significantly from zero. there was no correlation between changes in these parameters for individual subjects and any characteristic of their rpre.conclusionno evidence was found to support the hypothesis that the pattern of rpre is predictive of subsequent refractive change in this age group. |
the disrupted in schizophrenia 1 (disc1) gene is a 414.3 kb gene located on chromosomal region 1q42.2, and consists of 13 exons. disc1 was originally identified as a candidate gene for schizophrenia in a large scottish family, in which a balanced translocation involving chromosomes 1 and 11 was strongly linked to schizophrenia, schizoaffective disorder, bipolar affective disorder, and recurrent, major depression. in this family, carriers of the translocation were found to have reduced p300 amplitude, which is observed in some patients with schizophrenia. subsequent association studies identified numerous polymorphisms in the disc1 gene associated with schizophrenia and affective disorders, although different, polymorphisms / haplotypes in various regions of the gene were implicated in these studies. in the adult mouse brain, disc1 is expressed widely, including in the olfactory bulb, cortex, hippocampus, hypothalamus, cerebellum, and brain stem. during development, disc1 protein is detected at all stages, from embryonic day 10 (elo) to 6 months old, with two significant peaks of protein expression of one of the disc1 isoforms at e13.5 and postnatal day 35. interestingly, these time points correspond to periods of active neurogenesis and puberty in the mouse. these results suggest, that disc1 may play a critical role in brain development, lending support to the neurodevelopmental hypothesis of schizophrenia. disc1 encodes an 854-amino acid (aa) protein, which shows no homology to other known proteins and little homology between species. this amino - acid sequence predicts that the protein disc1 may act as a scaffolding protein with multiple binding motifs, facilitating formation of protein complexes. the n -terminus (aa 1 - 347) contains nuclear localization signals, whereas the c - terminus (aa 348 - 854) appears to be important, for microtubule and centrosomal targeting,17 - 19 although no centrosomal localization has been detected so far for the native protein. although the precise function of disc1 in the brain is unknown, a number of disc1 -interacting partners have been identified, including fasciculation and elongation protein zeta-1 (fez1), nuclear distribution element - like (nudel), and lissencephaly 1 (lis1), which are known to play a role in neuronal development and functioning. altered interactions between disc1 and its binding partners are currently being investigated in order to understand more accurately the biology of disc1 as a schizophrenia susceptibility gene. in an effort to understand the cellular function of disc1, yeast - two hybrid studies have been used to identify molecular interactors of disc1. it, was found that, disc1 has numerous binding partners, including nudel, fez1, activating transcription factor (att ') 4/5, and microtubule - associated protein 1 a (mapi a). nudel is a component of a pathway involved in cytoplasmic dynein movement, and is involved in neurofilament assembly, neuronal migration, and development of neurite morphology. overexpression of truncated disc1 protein inhibits neurite outgrowth in pci 2 cells, suggesting that the disc1-nudel complex may be involved in neuronal outgrowth. the hypothetical peptide product, resulting from the scottish translocation removes the interaction domain for nudel. recently, it has been shown that nudel oligopeptidase activity is under tight, regulation through binding to disc1, since a mutation very close to the disc1-binding site of nudel abolishes this activity. interestingly, nudel cleaves a number of neuropeptides in vitro, some of which have previously been implicated in the pathophysiology of schizophrenia, including neurotensin (nt). nt receptor agonists may be potential antipsychotics ; thus, inhibition of nudel could lead to increase in local concentration of nt, which may have an antipsychotic effect. altered subcellular distribution of disc1 has been reported in patients with psychosis and alcohol / substance abuse, with increased ratios of nuclear to cytoplasmic disc1 protein levels in patients. cell culture studies in cortical neurons have found evidence that disc1 may colocalize with mitochondrial markers, and that its subcellular targeting is independent of the nudel - binding site. hayashi have also demonstrated that disc1 and nudel bind in a neurodevelopmentally regulated manner and form a trimolecular complex with another protein, lis1. lis1 is involved in neuronal migration and corticogenesis. although the function of this complex is currently unknown, it. another interacting partner of disc1 is fez1, which is a mammalian homologue of the caenorhabditis elegans unc-76 protein, involved in axonal outgrowth and fasciculation. miyoshi demonstrated that disc1 participates in neurite extension through its c - terminal interaction with fez1. the chromosomal location for fez1 was previously implicated in a schizophrenia linkage analysis, although results from different, populations vary in significance. a modest association between schizophrenia and fez1 polymorphisms has been detected in a subset of japanese patients. in our laboratory, we have tested the hypothesis that, altered expression of disc1, and/or its molecular partners nudel, fez1, and lis1 may underlie its pathogenic role in schizophrenia and explain its genetic association. we examined the expression of disc1 and these selected binding partners in postmortem human brain. we found no difference in the expression of disc1 mrna in schizophrenia, and no association with previously identified risk snps (all f values 0.2). disc1 immunoreactivity was significantly, albeit modestly (by approximately 20%), increased in the hippocampus of patients with schizophrenia : f(1,73)=3.6, p=0.05. however, the expression of nudel, fez1, and lis1 mrna was each significantly reduced in schizophrenic tissue in both the dorsolateral prefrontal cortex and hippocampus and the expression of each gene showed association with a high risk disc1 polymorphism (all p values < 0.05). these data implicate genetically linked abnormalities in the disc1 molecular pathway in the pathophysiology of schizophrenia. given its role in brain development and plasticity via. its interaction with a. number of different proteins, disc1 remains a. candidate gene for schizophrenia, and an understanding of its exact mechanistic role in neuronal pathways may shed more light on the disease. schizophrenia is a devastating neuropsychiatrie disorder, the genetics of which has been under extensive investigation for several decades. despite being an exceedingly complex disease in terms of both etiology and pathogenesis, recent research is finally shedding light on schizophrenia susceptibility genes. prominent, among them are the genes comt, dtnbp1, grm3, disc1, nrg1, akt1, gad1, rgs4, and drd2. disc1 and its binding partners fez1, nudel, and lis1 are involved in cytoplasmic dynein movement, neurofilament assembly, neuronal migration, and neurite morphology, and may play a role in the neurodevelopmental deficits observed in schizophrenia. although the precise neurobiological cause of schizophrenia continues to be unknown, the abundance of evidence regarding susceptibility genes for schizophrenia can not be dismissed. identification of the molecular and cellular mechanisms that link susceptibility genes to the neurobiological functioning of the brain continues to be a major focus of research. as evidence for may be determined that these genes operate in a convergent molecular pathway affecting neural development and synaptic plasticity. the disruption of multiple genes within this pathway may lead to the development of schizophrenia. | the disrupted in schizophrenia 1 (disc1) gene has been identified as a schizophrenia susceptibility gene based on linkage and single nucleotide polymorphism (snp) association studies and clinical data, suggesting that risk snps impact on hippocampal structure and function. we hypothesized that altered expression of disc1 andlor its molecular partners (nuclear distribution element - like [nudel ], fasciculation and elongation protein zeta-1 [fez1 ], and lissencephaly 1 [l1s1 ]) may underlie its pathogenic role in schizophrenia and explain its genetic association. we examined the expression of disc1 and its binding partners in the hippocampus and dorsolateral prefrontal cortex of postmortem human brains of schizophrenic patients and controls. we found no difference in the expression of disc1 mrna in schizophrenia, and no association with previously identified risk snps, however, the expression of nudel, fez1, and lis1 vas significantly reduced in tissue from schizophrenic subjects, and the expression of each showed association with high - risk disc1 polymorphisms. these data suggest involvement of genetically linked abnormalities in the disc1 molecular pathway in the pathophysiology of schizophrenia. |
studies have implicated active oxygen species (aos) in the pathogenesis of various lung diseases. many chemical and physical agents in the environment are potent generators of aos, including ozone, hyperoxia, mineral dusts, paraquat, etc. these agents produce aos by different mechanisms, but frequently the lung is the primary target of toxicity, and exposure results in damage to lung tissue to varying degrees. the lung has developed defenses to aos - mediated damage, which include antioxidant enzymes, the superoxide dismutases [copper - zinc (cuznsod) and manganese - containing (mnsod) ], catalase, and glutathione peroxidase (gpx). in this review, antioxidant defenses to environmental stresses in the lung as well as in isolated pulmonary cells following exposure to a number of different oxidants, are summarized. each oxidant appears to induce a different pattern of antioxidant enzyme response in the lung, although some common trends, i.e., induction of mnsod following oxidants inducing inflammation or pulmonary fibrosis, in responses to oxidants occur. responses may vary between the different cell types in the lung as a function of cell - cycle or other factors. increases in mnsod mrna or immunoreactive protein in response to certain oxidants may serve as a biomarker of aos - mediated damage in the lung.imagesfigure 3. |
|
almost every type of animal cell has the capacity to synthesize heparan sulfate (hs). the hs polysaccharide is composed of alternating hexuronic acid and d - glucosamine units and is substituted with sulfate groups in various positions. the sulfated saccharide domains provide numerous docking sites for protein ligands and are abundantly expressed at cell surfaces and in the extracellular matrix as part of proteoglycans (pgs). two main types of cell surface bound pg core proteins have been identified : the glycosylphosphatidyl inositol linked glypicans and the transmembrane syndecans ; both types are thought to be expressed in high copy numbers (up to 10 per cell ; bernfield., 1992). the diverse ligands include growth factors / morphogens and their receptors, enzymes, enzyme inhibitors, cell adhesion molecules, chemokines, various extracellular matrix proteins, and microbial proteins (bernfield., 1999). interactions with hs contribute to or modify the various protein functions, which are of particular interest in relation to growth factor / morphogen translocation and signaling (fig. thus, hspgs are essential for normal embryonic development but are also implicated in homeostasis as well as in pathological processes of growing and adult individuals (hacker., 2005). proposed roles of hspgs in growth factor / morphogen signaling. locally produced and secreted protein ligands (e.g., growth factors) (1) are captured by hs chains and accumulate at the cell surface (2). hs chains promote stable interactions between growth factors and receptors and, thus, modulate the quality of receptor signaling (such as amplitude and kinetics of activation / inactivation ; 4). hspgs may also regulate the turnover of receptors and participate in the internalization of receptor complexes (5). shedding of hspg ectodomains (kreuger., 2004) or degradation of hs chains by heparanase (vlodavsky and friedmann, 2001) may release hs - bound ligands from the cell surface (6). the hexuronic acid moieties are of two kinds : d - glucuronic acid (glca) and l - iduronic acid (idoa). the extreme structural diversity typical of hs species is a result of the variable distribution of these residues as well as of sulfate substituents along the chain. because this diversity appears to be strictly regulated, it is currently believed to enable selective interaction with proteins in a topologically and temporally controlled manner (esko and lindahl, 2001). the aim of this present review is to reassess this concept in view of recent findings. nascent hs chains evolve by the stepwise addition of alternating glca and n - acetylglucosamine (glcnac) residues to acceptor linkage region oligosaccharides, which are substituted on pg core proteins. these chains are subsequently modified through several consecutive steps, including n - deacetylation and n - sulfation of glcnac residues, c5 epimerization of glca to idoa, and o - sulfation in various positions (esko and lindahl, 2001). 2, is generally incomplete, such that the final products display a domain - type arrangement of more or less modified saccharide sequences. because of the substrate specificities of the enzymes involved (at least in part), idoa and o - sulfate residues are accumulated in domains of contiguous n - sulfated (ns) disaccharide units (ns domains), are less abundant in regions of mixed n - substitution, and are essentially lacking in contiguous n - acetylated sequences. heparin, which is produced by connective tissue type mast cells, is the result of extensive biosynthetic polymer modification and may be conceived as an extended, highly n- and o - sulfated idoa - rich ns domain. hs chains are synthesized while attached to core protein serine residues through a glca - gal - gal - xyl linkage region. the linear hs chain is thereafter polymerized through the action of glcnac- and glca - transferases belonging to the ext family and further modified by partial n - deacetylation / n - sulfation (n - deacetylase / n - sulfotransferase) to yield ns disaccharide units. consecutive stretches of such units (ns domains) are hotspots for further modifications : a c5 epimerase converts glca to idoa followed by variable o - sulfation at c-3 and c-6 (red circles) of glcn and at c-2 (yellow circles) of idoa (and some glca) units. completed chains may be further edited by endo-6-o - sulfatases (ai., 2003). protein ligands interact with single ns domains (e.g., fgfs) or with ns domains separated by n - acetylated disaccharide residues (sas domains ; illustrated here for vegf - a165 [robinson., the bottom model depicts a molecular phenotype of c5 epimerase hs that lacks idoa and idoa 2-o - sulfation but is more extensively n- and 6-o - sulfated than the corresponding wild - type product. the 2-o - sulfotransferase hs is similar to the c5 epimerase polysaccharide except for the presence of idoa (merry., hs from c5 epimerase or 2-o - sulfotransferase cells may still interact more or less efficiently with many protein ligands (see knockout clues from embryology). blue boxes, ns domains containing glca and/or idoa ; yellow boxes, ns domains containing glca but no idoa. analysis of hs from different mammalian tissues revealed the tissue - specific composition of samples, pointing to strict regulation of biosynthetic polymer modification (maccarana. anion exchange chromatograms of products obtained by chemical or enzymatic degradation of mouse hs thus differed for samples from different tissues but were virtually superimposable for corresponding samples from different individuals. moreover, immunohistochemical analysis showed selective, reproducible distribution of distinct hs epitopes within a given tissue (van kuppevelt., 1998). these findings could reflect differences in saccharide domain composition, sequence, and/or overall organization, which are potentially required to selectively bind different protein ligands. early evidence for specificity was the antithrombin - binding sequence, which is responsible for the clinically exploited blood anticoagulant activity of heparin (lindahl., 1980). each one of the sulfate substituents of this glcnac6s - glca - glcns3s - idoa - glcns pentasaccharide structure is essential for high affinity interaction with antithrombin and, thus, for anticoagulant activity. notably, this sequence contains the rare glucosamine 3-o - sulfate group in addition to the more common 2-o - sulfate of idoa and n- and 6-o - sulfate groups of glcn residues. another unusual structure based on a 3-o - sulfated n - unsubstituted glcn3s unit mediates the apparently specific binding of herpes simplex gd protein to the cell surface hs during viral infection (shukla., 1999). what about the multitude of other heparin - binding proteins that depend on the interaction with endogenous hs ligands for biological activity ? we previously proposed that the common sulfate substituents could also be arranged in a sequence - specific manner to provide selective protein binding (salmivirta., 1996). such epitopes would be masked in the highly sulfated heparin molecule, thus explaining the apparently nonselective protein binding to this polysaccharide. however, although recent binding studies with selected proteins have shown that a particular kind of sulfate group (e.g., 6-o - sulfates) might contribute more to interaction than others (ashikari - hada., 2004), there is yet no clear evidence of distinct sequence specificity based on the distribution of common sulfate residues (powell., 2004). different members of the fgf family share binding sites on the hs chain, and their affinities for hs - related oligosaccharides generally correlate with the overall degree of saccharide sulfation (jemth., 2002 ; kreuger., 2005 ; however, see ashikari - hada., 2004 regarding preferential binding of variously o - sulfated oligosaccharides). our recent experiments suggest that a relatively nonspecific charge interaction may also prevail in the formation of fgf hs fgf receptor complexes (fig. 2). using a variety of oligo- and polysaccharide probes, we found that the complex formation of fgf1 or fgf2 with their various receptors was increasingly promoted by saccharide sequences of increasing overall sulfate content in an apparently nonspecific fashion. heparin oligosaccharides were generally the most efficient complex promoters, whereas less sulfated hs species were less efficient (jastrebova., 2006). these findings suggest that the dependence of fgf signaling on hs fine structure may be less critical than previously anticipated. however, we note studies claiming that ns oligosaccharide fractions derived from authentic hs contained receptor - activating as well as nonactivating species (pye., 1998 ; guimond and turnbull, 1999). receptor combinations remain to be examined, and we can not exclude elements of selectivity here that are currently unrecognized. the role of vegf as a key regulator of vascular development is well documented (carmeliet., 1996). the interaction of the long splice variant vegf - a165 with hs is essential for proper signaling, as recently demonstrated in variously designed cell culture systems (ashikari - hada., 2005 ; jakobsson. studies aimed at defining the structural features of hs that are required for vegf - a165 binding implicated all common sulfate groups (n, 2-o, and 6-o), although with different emphasis on their relative importance (ashikari - hada., 2005 ; robinson., 2006). moreover, the pleiotropic hepatocyte growth factor binds a variety of glycosaminoglycan structures without any clear preference (catlow., 2003). mice that were genetically deficient in enzymes involved in hs biosynthesis provided novel insight into the question of specificity in hs protein interactions. phenotype analysis revealed developmental events that require the involvement of hs, and structural analysis of the corresponding polysaccharides could, in some cases, pinpoint molecular features that are of critical importance to such events. equally important, however, is to identify hs - dependent events that remain unperturbed in spite of deranged hs structure. embryos lacking glca / glcnac transferase 1 (ext1), which generates the initial (glca - glcnac)n polysaccharide chain (fig. 2), failed to undergo proper gastrulation in accord with the recognized need for hs in early patterning events (lin., 2000). in contrast, the targeted disruption of genes encoding selected enzymes involved in the later stages of hs biosynthesis resulted in strikingly varied phenotypes. these mice displayed variously perturbed hs structures and a variety of developmental abnormalities but also displayed features assumed to be hs dependent that were surprisingly normal. for example, brain - selective, conditional ext1 knockout, which was aimed at identifying hs - dependent processes in cerebral development, resulted in multiple brain defects, as predicted from the established involvement of various hs - dependent growth factors (in particular fgf8 ; inatani., yet, mice lacking the c5 epimerase catalyzing the conversion of glca to idoa residues (li., 2003) or the 2-o - sulfotransferase required for idoa 2-o sulfation (bullock., 1998 ; merry., 2001) showed no obvious brain phenotype irrespective of the severely deranged hs structures. moreover, assessment of the cardiovascular system pointed to vegf signaling that is compatible with adequate vasculogenesis and angiogenesis. the elevated n- and 6-o - sulfation, which is characteristic of these mutated hs species, apparently sufficed to satisfy the requirement for hs in important vegf and fgf signaling events (fig. 2). also, other organ systems, such as the gastrointestinal tract, which is known to require hs for growth factor / morphogen signaling in development, appeared normal in the c5 epimerase and 2-o - sulfotransferase knockout mice. certain other events failed, however, as indicated by the kidney agenesis, the skeletal malformations, and other problems leading to early postnatal death of the animals. interestingly, the kidney agenesis was not observed in n - deacetylase / n - sulfotransferase-1null mice, which were deficient in the early n - deacetylation / n - sulfation step (ringvall., 2000) ; the overall poorly modified but idoa - containing hs that resulted apparently functioned at a critical stage of kidney induction. moreover, the lung phenotype caused by c5 epimerase deficiency (hs lacking idoa and idoa2s residues) was not seen in mice lacking 2-o - sulfotransferase (hs containing idoa but no idoa2s units ; fig. redundant o - sulfation was also observed in drosophila melanogaster 2-o- or 6-o - sulfotransferase null mutants that were able to complete development with apparently normal fgf signaling and morphology (kamimura, k., and h. nakato, personal communication). lack of both enzymes, on the other hand, led to impaired fgf signaling and multiple patterning deficiencies. we conclude that several functionally important hs protein interactions depend primarily on charge distribution, whereas others may require the presence of specific saccharide components. in this perspective, what is the functional purpose of the strict regulation of polymer modification in hs biosynthesis ? the rationale for stringent hs biosynthesis may relate primarily to the domain organization of hs chains. variously designed interaction studies implicate saccharide sequences of up to 12-mer size (in some cases even longer) for efficient interaction with proteins (schlessinger., contiguous ns domains of > 8-mer size are generally rare in hs. instead, composite binding sites involving short ns domains separated by n - acetylated disaccharide units (n - sulfated / acetylated / sulfated [sas ] domains) can mediate interactions with monomeric (e.g., endostatin ; kreuger., 2002) as well as oligomeric (e.g., interferon- [lortat - jacob., 1995 ], interleukin-8 [spillmann., 1998 ], and platelet factor 4 [stringer and gallagher, 1997 ]) protein ligands. also, vegf - a165 occurs as a dimer that interacts with sas domains in hs chains (fig. 2 ; robinson., 2006). given the size of saccharide domains that are implicated in complex formation with growth factors and their receptors, we predict that sas - type structures may be involved or even required in various signaling complexes. in fact, the differential complex formation of endogenous hs in mouse embryos with defined / given fgf fgf receptor pairs (allen and rapraeger, 2003) may well reflect selective domain spacing rather than precisely tailored saccharide sequences. we propose that polymer modification in hs biosynthesis is primarily regulated with regard to domain distribution and degree of sulfation (i.e., the distribution of n - substituents and the levels of 2-o- and 6-o - sulfation). such regulation would presumably suffice to explain the observed consistent differences in composition between hs species from different cellular or tissue sources (maccarana. the resultant clusters of negative charge will determine interactions with proteins that may be relatively nonselective with sharing / overlap of saccharide target sequences between different protein ligands. given the excessive number of possible saccharide epitopes, specific sequences based on common constituents that provide somewhat stronger binding of a particular protein ligand than other sequences may well be preferentially formed in the course of such regulated polymer modification. more selective interactions would require either sequences containing rare components or precise spacing of two (or more) sulfated domains (sas arrangement). notably, there is no method readily available to reveal the detailed distribution of various domains along a native hs chain, although some progress has been reported based on selective lyase degradation of the polymer (murphy., 2004). in addition, we still do not understand the regulatory mechanisms in hs biosynthesis that determine domain generation or localization. nascent hs chains evolve by the stepwise addition of alternating glca and n - acetylglucosamine (glcnac) residues to acceptor linkage region oligosaccharides, which are substituted on pg core proteins. these chains are subsequently modified through several consecutive steps, including n - deacetylation and n - sulfation of glcnac residues, c5 epimerization of glca to idoa, and o - sulfation in various positions (esko and lindahl, 2001). 2, is generally incomplete, such that the final products display a domain - type arrangement of more or less modified saccharide sequences. because of the substrate specificities of the enzymes involved (at least in part), idoa and o - sulfate residues are accumulated in domains of contiguous n - sulfated (ns) disaccharide units (ns domains), are less abundant in regions of mixed n - substitution, and are essentially lacking in contiguous n - acetylated sequences. heparin, which is produced by connective tissue type mast cells, is the result of extensive biosynthetic polymer modification and may be conceived as an extended, highly n- and o - sulfated idoa - rich ns domain. hs chains are synthesized while attached to core protein serine residues through a glca - gal - gal - xyl linkage region. the linear hs chain is thereafter polymerized through the action of glcnac- and glca - transferases belonging to the ext family and further modified by partial n - deacetylation / n - sulfation (n - deacetylase / n - sulfotransferase) to yield ns disaccharide units. consecutive stretches of such units (ns domains) are hotspots for further modifications : a c5 epimerase converts glca to idoa followed by variable o - sulfation at c-3 and c-6 (red circles) of glcn and at c-2 (yellow circles) of idoa (and some glca) units. completed chains may be further edited by endo-6-o - sulfatases (ai., 2003). protein ligands interact with single ns domains (e.g., fgfs) or with ns domains separated by n - acetylated disaccharide residues (sas domains ; illustrated here for vegf - a165 [robinson., the bottom model depicts a molecular phenotype of c5 epimerase hs that lacks idoa and idoa 2-o - sulfation but is more extensively n- and 6-o - sulfated than the corresponding wild - type product. the 2-o - sulfotransferase hs is similar to the c5 epimerase polysaccharide except for the presence of idoa (merry., 2001). hs from c5 epimerase or 2-o - sulfotransferase cells may still interact more or less efficiently with many protein ligands (see knockout clues from embryology). blue boxes, ns domains containing glca and/or idoa ; yellow boxes, ns domains containing glca but no idoa. analysis of hs from different mammalian tissues revealed the tissue - specific composition of samples, pointing to strict regulation of biosynthetic polymer modification (maccarana. anion exchange chromatograms of products obtained by chemical or enzymatic degradation of mouse hs thus differed for samples from different tissues but were virtually superimposable for corresponding samples from different individuals. moreover, immunohistochemical analysis showed selective, reproducible distribution of distinct hs epitopes within a given tissue (van kuppevelt., 1998). these findings could reflect differences in saccharide domain composition, sequence, and/or overall organization, which are potentially required to selectively bind different protein ligands. early evidence for specificity was the antithrombin - binding sequence, which is responsible for the clinically exploited blood anticoagulant activity of heparin (lindahl., 1980). each one of the sulfate substituents of this glcnac6s - glca - glcns3s - idoa - glcns pentasaccharide structure is essential for high affinity interaction with antithrombin and, thus, for anticoagulant activity. notably, this sequence contains the rare glucosamine 3-o - sulfate group in addition to the more common 2-o - sulfate of idoa and n- and 6-o - sulfate groups of glcn residues. another unusual structure based on a 3-o - sulfated n - unsubstituted glcn3s unit mediates the apparently specific binding of herpes simplex gd protein to the cell surface hs during viral infection (shukla., 1999). what about the multitude of other heparin - binding proteins that depend on the interaction with endogenous hs ligands for biological activity ? we previously proposed that the common sulfate substituents could also be arranged in a sequence - specific manner to provide selective protein binding (salmivirta., 1996). such epitopes would be masked in the highly sulfated heparin molecule, thus explaining the apparently nonselective protein binding to this polysaccharide. however, although recent binding studies with selected proteins have shown that a particular kind of sulfate group (e.g., 6-o - sulfates) might contribute more to interaction than others (ashikari - hada., 2004), there is yet no clear evidence of distinct sequence specificity based on the distribution of common sulfate residues (powell., 2004). different members of the fgf family share binding sites on the hs chain, and their affinities for hs - related oligosaccharides generally correlate with the overall degree of saccharide sulfation (jemth., 2002 ; kreuger., 2005 ; however, see ashikari - hada. our recent experiments suggest that a relatively nonspecific charge interaction may also prevail in the formation of fgf hs fgf receptor complexes (fig. 2). using a variety of oligo- and polysaccharide probes, we found that the complex formation of fgf1 or fgf2 with their various receptors was increasingly promoted by saccharide sequences of increasing overall sulfate content in an apparently nonspecific fashion. heparin oligosaccharides were generally the most efficient complex promoters, whereas less sulfated hs species were less efficient (jastrebova., 2006). these findings suggest that the dependence of fgf signaling on hs fine structure may be less critical than previously anticipated. however, we note studies claiming that ns oligosaccharide fractions derived from authentic hs contained receptor - activating as well as nonactivating species (pye., 1998 ; guimond and turnbull, 1999). of course, many ligand receptor combinations remain to be examined, and we can not exclude elements of selectivity here that are currently unrecognized. the role of vegf as a key regulator of vascular development is well documented (carmeliet., 1996). the interaction of the long splice variant vegf - a165 with hs is essential for proper signaling, as recently demonstrated in variously designed cell culture systems (ashikari - hada. studies aimed at defining the structural features of hs that are required for vegf - a165 binding implicated all common sulfate groups (n, 2-o, and 6-o), although with different emphasis on their relative importance (ashikari - hada., 2005 ; robinson., 2006). moreover, the pleiotropic hepatocyte growth factor binds a variety of glycosaminoglycan structures without any clear preference (catlow., 2003). mice that were genetically deficient in enzymes involved in hs biosynthesis provided novel insight into the question of specificity in hs protein interactions. phenotype analysis revealed developmental events that require the involvement of hs, and structural analysis of the corresponding polysaccharides could, in some cases, pinpoint molecular features that are of critical importance to such events. equally important, however, is to identify hs - dependent events that remain unperturbed in spite of deranged hs structure. embryos lacking glca / glcnac transferase 1 (ext1), which generates the initial (glca - glcnac)n polysaccharide chain (fig. 2), failed to undergo proper gastrulation in accord with the recognized need for hs in early patterning events (lin., 2000). in contrast, the targeted disruption of genes encoding selected enzymes involved in the later stages of hs biosynthesis resulted in strikingly varied phenotypes. these mice displayed variously perturbed hs structures and a variety of developmental abnormalities but also displayed features assumed to be hs dependent that were surprisingly normal. for example, brain - selective, conditional ext1 knockout, which was aimed at identifying hs - dependent processes in cerebral development, resulted in multiple brain defects, as predicted from the established involvement of various hs - dependent growth factors (in particular fgf8 ; inatani., yet, mice lacking the c5 epimerase catalyzing the conversion of glca to idoa residues (li., 2003) or the 2-o - sulfotransferase required for idoa 2-o sulfation (bullock., 1998 ; merry., 2001) showed no obvious brain phenotype irrespective of the severely deranged hs structures. moreover, assessment of the cardiovascular system pointed to vegf signaling that is compatible with adequate vasculogenesis and angiogenesis. the elevated n- and 6-o - sulfation, which is characteristic of these mutated hs species, apparently sufficed to satisfy the requirement for hs in important vegf and fgf signaling events (fig. 2). also, other organ systems, such as the gastrointestinal tract, which is known to require hs for growth factor / morphogen signaling in development, appeared normal in the c5 epimerase and 2-o - sulfotransferase knockout mice. certain other events failed, however, as indicated by the kidney agenesis, the skeletal malformations, and other problems leading to early postnatal death of the animals. interestingly, the kidney agenesis was not observed in n - deacetylase / n - sulfotransferase-1null mice, which were deficient in the early n - deacetylation / n - sulfation step (ringvall., 2000) ; the overall poorly modified but idoa - containing hs that resulted apparently functioned at a critical stage of kidney induction. moreover, the lung phenotype caused by c5 epimerase deficiency (hs lacking idoa and idoa2s residues) was not seen in mice lacking 2-o - sulfotransferase (hs containing idoa but no idoa2s units ; fig. redundant o - sulfation was also observed in drosophila melanogaster 2-o- or 6-o - sulfotransferase null mutants that were able to complete development with apparently normal fgf signaling and morphology (kamimura, k., and h. nakato, personal communication). lack of both enzymes, on the other hand, led to impaired fgf signaling and multiple patterning deficiencies. we conclude that several functionally important hs protein interactions depend primarily on charge distribution, whereas others may require the presence of specific saccharide components. in this perspective, what is the functional purpose of the strict regulation of polymer modification in hs biosynthesis ? the rationale for stringent hs biosynthesis may relate primarily to the domain organization of hs chains. variously designed interaction studies implicate saccharide sequences of up to 12-mer size (in some cases even longer) for efficient interaction with proteins (schlessinger., contiguous ns domains of > 8-mer size are generally rare in hs. instead, composite binding sites involving short ns domains separated by n - acetylated disaccharide units (n - sulfated / acetylated / sulfated [sas ] domains) can mediate interactions with monomeric (e.g., endostatin ; kreuger., 2002) as well as oligomeric (e.g., interferon- [lortat - jacob., 1995 ], interleukin-8 [spillmann., 1998 ], and platelet factor 4 [stringer and gallagher, 1997 ]) protein ligands. also, vegf - a165 occurs as a dimer that interacts with sas domains in hs chains (fig. 2 ; robinson., 2006). given the size of saccharide domains that are implicated in complex formation with growth factors and their receptors, we predict that sas - type structures may be involved or even required in various signaling complexes. in fact, the differential complex formation of endogenous hs in mouse embryos with defined / given fgf fgf receptor pairs (allen and rapraeger, 2003) may well reflect selective domain spacing rather than precisely tailored saccharide sequences. we propose that polymer modification in hs biosynthesis is primarily regulated with regard to domain distribution and degree of sulfation (i.e., the distribution of n - substituents and the levels of 2-o- and 6-o - sulfation). such regulation would presumably suffice to explain the observed consistent differences in composition between hs species from different cellular or tissue sources (maccarana. the resultant clusters of negative charge will determine interactions with proteins that may be relatively nonselective with sharing / overlap of saccharide target sequences between different protein ligands. given the excessive number of possible saccharide epitopes, specific sequences based on common constituents that provide somewhat stronger binding of a particular protein ligand than other sequences may well be preferentially formed in the course of such regulated polymer modification. more selective interactions would require either sequences containing rare components or precise spacing of two (or more) sulfated domains (sas arrangement). notably, there is no method readily available to reveal the detailed distribution of various domains along a native hs chain, although some progress has been reported based on selective lyase degradation of the polymer (murphy., 2004). in addition, we still do not understand the regulatory mechanisms in hs biosynthesis that determine domain generation or localization. | proteoglycan (pg) coreceptors carry heparan sulfate (hs) chains that mediate interactions with growth factors, morphogens, and receptors. thus, pgs modulate fundamental processes such as cell survival, division, adhesion, migration, and differentiation. this review summarizes recent biochemical and genetic information that sheds new light on the nature of hs protein binding. unexpectedly, many interactions appear to depend more on the overall organization of hs domains than on their fine structure. |
this is the third international meeting dealing with major genes in small ruminants. the first was held in armidale (nsw, australia) in 1980, just after the discovery of the booroola gene by b. bindon and l. piper. the discovery of a gene having such a large effect on ovulation rate and prolificacy in sheep was totally unsuspected at this time and a number of research teams all over the world concentrated their efforts to study its effects and identify the causal mutation. about 20 years were finally needed to obtain this information, which opened a new approach to the physiological regulation of reproduction.the second meeting was organised in 1990 in toulouse along the same lines. although its main concern was the booroola gene, other major genes influencing ovulation in sheep were also considered. indeed, an increasing amount of evidence demonstrated that, on the contrary to the current opinion in quantitative genetics laboratories before 1980, prolificacy is not always controlled by a very large number of genes each exhibiting a very small effect, but may also be influenced by genes with large effects, generalising the booroola situation to other populations.since then, mixed inheritance was also found for other production traits such as body conformation, seasonality or milk composition. however, the major evolution has been the inexpensive large - scale access to molecular genetic information, using pcr, microsatellites and snp technologies. qtl detection experiments are performed in all domestic species, including sheep and goats, and the identification of genes having an average effect on the performance trait variability is now possible. the utilisation of these polymorphisms should also be a great help for a better management of populations, either through the selection of breeders or through the preservation of genetic diversity.this third meeting on major genes and qtl in sheep and goats was a unique occasion for the researchers involved in this area of animal science to present their latest results, exchange their experiences and progress in the organisation of scientific co - operation. |
|
multiple myeloma (mm) is a clonal b - cell disorder in which malignant plasma cells (pcs) accumulate in the bone marrow, resulting in lytic bone lesions and excessive amounts of monoclonal proteins. although therapeutic interventions have been developed, and the overall survival has been improved over the last decade, almost all patients with mm, who survive initial treatment will develop drug resistance and relapse. the potential therapeutic targets in human mm are investigated by differentially profiling of purified mm and normal pcs using two - dimensional (2d) gel electrophoresis. a total of 43 differentially expressed proteins are identified and six of them are confirmed with western blotting, including profilin-1, glutathione peroxidase 1, annexin a1, proteasome subunit alpha type-5, proteasome activator subunit-2, and proteasome subunit beta type-10. extensive proteomic studies have also been carried out for studying the response of myeloma cells to drug treatment. however, few studies have reported the identification of markers for mm diagnosis. a recent study by rajpal. identified a biomarker panel from serum that predicts the response to thalidomide - based therapy in newly diagnosed myeloma patients. by using a combination of immunodepletion and 2d - dige, differentially expressed proteins between responders and nonresponders were detected including zinc - a2-glycoprotein, vitamin d - binding protein, serum amyloid a (saa), 2-microglobulin (bmg), and haptoglobin developed a method for assessing the quality of surface - enhanced laser desorption / ionization time - of - flight (seldi - tof) data based on a correlation matrix. lytic of bone disease study to efficiently identify low - quality spectra prior to postanalysis. the results demonstrate the potential application of this method in the identification of biomarkers for myeloma associated lytic bone disease. recently, we applied the seldi - tof ms and matrix - assisted laser desorption / ionization tof (maldi - tof) ms to identify serum biomarkers of mm. the limitations of seldi - tof analysis include low resolution and the intrinsic limitation of maldi - tof as a quantitative tool. furthermore, it is difficult to further identify proteins on chips or weak cation exchange beads. therefore, the combination of protein fractionation and liquid chromatography - tandem mass spectrometry (lc - ms / ms) with high - resolution mass spectrometer is an alternative method for protein profiling and biomarker discovery. one challenge to identify these candidate biomarkers from serum or plasma is that there is an extensive dynamic concentration range of proteins in bio - fluids. serum albumin is the major carrier and transporter at a concentration of about 45 mg / ml. however, most of the important indicators changing in physiological states may be present at < 1 pg / ml. methods have been developed to deplete the high abundance proteins derived from serum / plasma, such as immunodepletion, organic precipitation, affinity purification and solid phase extraction. peptide ligand library affinity chromatography is a novel method for capturing and identifying the low abundance proteins. in this method, a solid - phase combinatorial library of hexapeptides is coupled, via a short spacer, on poly (hydroxymethecrylate) beads, by a modified merrifield approach. the hexapeptide ligands are synthesized from natural amino acids, so the library contains millions of linear hexapeptide that are able to interact with a very large number of proteins present in a complex proteome. have reported a large - scale proteomic study of human serum using peptide library beads and mass spectrometry. analysis of the elution from this combinatorial library resulted in the identification of 1559 proteins including a large number of low abundance proteins. in the present work, we applied the peptide ligand library beads (pllbs)-based affinity method to the differential analysis of myeloma serum samples versus serum samples of healthy individuals. using a label - free semi - quantitative approach, we found that expression levels of 22 proteins significantly differed between serum samples from healthy control and mm patients. all the patients with mm from the mm research center at the beijing chao - yang hospital (beijing, china) were diagnosed according to the durie - salmon staging system. the healthy controls were obtained from the medical examination center of the beijing chao - yang hospital. the research protocol was approved by the ethics committee of beijing chao - yang hospital. serum samples were obtained from the peripheral blood by centrifuging at 4000 r / min for 10 min at 4c, and stored at 80c until analyzed. a 300 l sample of the pooled serum samples was centrifuged to eliminate particles in suspension. eight milligram of the pllb resin (peptide international, lexington, ky) was suspended in 100 l of 50% methanol for 10 min and was washed three times with phosphate - buffered saline (pbs) solution (ph = 7.4). the pooled serum samples were incubated with the pllb resin at room temperature (2225c) on a soft shaker for 2 h. after removing the unbound fraction, the pllb resin was washed three times with pbs solution. proteins were eluted from the beads by incubating with lds sample buffer (invitrogen, grand island, ny, usa) at 100c for 5 min. proteins were separated on a 412% gradient tris - glycine sodium dodecyl sulfate (sds)-gel (invitrogen, usa), and the gel bands were stained with colloidal coomassie blue (invitrogen). each lane was cut into 15 slices and each gel slice was reduced with 10 mmol / l dtt and alkylated with 100 mmol / l iodoacetamide. then in - gel digestion was carried out with the sequence grade modified trypsin (promega) in 50 mmol / l ammonium bicarbonate at 37c overnight. the peptides were extracted twice with 1% trifluoroacetic acid in 50% acetonitrile aqueous solution for 30 min. for lc - ms / ms analysis, each digestion product was separated by a 60 min gradient elution at a flow rate of 0.25 l / min with the dionex 3000 nano - hplc system, which was directly interfaced with the thermo ltq - orbitrap mass spectrometer. the analytical column was a home - made fused silica capillary column (75 m i d, 100 mm length ; upchurch, usa) packed with c-18 resin (300 a, 5 m, varian, usa). mobile phase a consisted of 0.1% formic acid, and mobile phase b consisted of 100% acetonitrile and 0.1% formic acid. the ltq - orbitrap mass spectrometer was operated in the data - dependent acquisition mode using the xcalibur 2.0.7 software (thermo fisher scientific inc., usa) and there was a single full - scan mass spectrum in the obritrap (4001800 m / z, 30,000 resolution), followed by 6 data - dependent ms / ms scans in the ion trap at 35% normalized collision energy. the ms / ms spectra from each lc - ms / ms run were searched against ipi human database by sequest in proteindiscover. the following search parameters were used in all of the sequest searches : maximum of 2 missed trypsin cleavages, cysteine carbamidomethylation as a fixed modification, methionine oxidation and n / q deamination as the variable modification. the maximum error tolerance was 20 ppm for ms and 0.8 da for ms / ms. the filter is score 1.9 versus 1 charges, 2.2 versus 2 charges, 2.75 versus 3 charges, and at least 1 peptide every protein. quantitation of protein expression by spectra counts for each identified proteins was carried out using an in - house developed perl script. significance was regarded only when the ratio of spectra counts between two groups were more than 2 or < 0.5. extracted ion currents for selected peptides were also used to quantify the protein concentrations from different samples. sixty microgram of protein from the pooled serum of 8 patients with mm and eight healthy controls was separated in nupage novex 412% bis - tris gradient gels (invitrogen) and transferred to a nitrocellulose membranes (millipore, billerica, ma, usa) for 30 min using 1 nupage transfer buffer. nitrocellulose membranes were blocked overnight at 4c in blocking buffer (5% skim milk, 0.1% tween 20, 0.01 mol / l pbs). after washes with washing buffer (0.1% tween, 0.01 mol / l pbs), the membranes were incubated with primary antibodies in the blocking buffer for 120 min. antiantibodies antibodies made against specific to integrin alpha-1 and isoform-1 of multimerin-1 (abcam, cambridge, ma, usa) were used at 1:1000 and 1:2000 dilution, respectively. after washing, the membrane was incubated with second antibodies (goat anti - mouse / hrp conjugate, santa cruz, paso robles, ca, usa) for integrin alpha-1 and isoform-1 of multimerin-1 and detected with the pierce chemiluminescent (ecl) kit (thermo, waltham, ma, usa). levels of proteins were then quantified by image quant tl activation wizard software, usa. all the patients with mm from the mm research center at the beijing chao - yang hospital (beijing, china) were diagnosed according to the durie - salmon staging system. the healthy controls were obtained from the medical examination center of the beijing chao - yang hospital. the research protocol was approved by the ethics committee of beijing chao - yang hospital. serum samples were obtained from the peripheral blood by centrifuging at 4000 r / min for 10 min at 4c, and stored at 80c until analyzed. a 300 l sample of the pooled serum samples was centrifuged to eliminate particles in suspension. eight milligram of the pllb resin (peptide international, lexington, ky) was suspended in 100 l of 50% methanol for 10 min and was washed three times with phosphate - buffered saline (pbs) solution (ph = 7.4). the pooled serum samples were incubated with the pllb resin at room temperature (2225c) on a soft shaker for 2 h. after removing the unbound fraction, the pllb resin was washed three times with pbs solution. proteins were eluted from the beads by incubating with lds sample buffer (invitrogen, grand island, ny, usa) at 100c for 5 min. proteins were separated on a 412% gradient tris - glycine sodium dodecyl sulfate (sds)-gel (invitrogen, usa), and the gel bands were stained with colloidal coomassie blue (invitrogen). each lane was cut into 15 slices and each gel slice was reduced with 10 mmol / l dtt and alkylated with 100 mmol / l iodoacetamide. then in - gel digestion was carried out with the sequence grade modified trypsin (promega) in 50 mmol / l ammonium bicarbonate at 37c overnight. the peptides were extracted twice with 1% trifluoroacetic acid in 50% acetonitrile aqueous solution for 30 min. for lc - ms / ms analysis, each digestion product was separated by a 60 min gradient elution at a flow rate of 0.25 l / min with the dionex 3000 nano - hplc system, which was directly interfaced with the thermo ltq - orbitrap mass spectrometer. the analytical column was a home - made fused silica capillary column (75 m i d, 100 mm length ; upchurch, usa) packed with c-18 resin (300 a, 5 m, varian, usa). mobile phase a consisted of 0.1% formic acid, and mobile phase b consisted of 100% acetonitrile and 0.1% formic acid. the ltq - orbitrap mass spectrometer was operated in the data - dependent acquisition mode using the xcalibur 2.0.7 software (thermo fisher scientific inc., usa) and there was a single full - scan mass spectrum in the obritrap (4001800 m / z, 30,000 resolution), followed by 6 data - dependent ms / ms scans in the ion trap at 35% normalized collision energy. the ms / ms spectra from each lc - ms / ms run were searched against ipi human database by sequest in proteindiscover. the following search parameters were used in all of the sequest searches : maximum of 2 missed trypsin cleavages, cysteine carbamidomethylation as a fixed modification, methionine oxidation and n / q deamination as the variable modification. the maximum error tolerance was 20 ppm for ms and 0.8 da for ms / ms. the filter is score 1.9 versus 1 charges, 2.2 versus 2 charges, 2.75 versus 3 charges, and at least 1 peptide every protein. quantitation of protein expression by spectra counts for each identified proteins was carried out using an in - house developed perl script. significance was regarded only when the ratio of spectra counts between two groups were more than 2 or < 0.5. extracted ion currents for selected peptides were also used to quantify the protein concentrations from different samples. sixty microgram of protein from the pooled serum of 8 patients with mm and eight healthy controls was separated in nupage novex 412% bis - tris gradient gels (invitrogen) and transferred to a nitrocellulose membranes (millipore, billerica, ma, usa) for 30 min using 1 nupage transfer buffer. nitrocellulose membranes were blocked overnight at 4c in blocking buffer (5% skim milk, 0.1% tween 20, 0.01 mol / l pbs). after washes with washing buffer (0.1% tween, 0.01 mol / l pbs), the membranes were incubated with primary antibodies in the blocking buffer for 120 min. antiantibodies antibodies made against specific to integrin alpha-1 and isoform-1 of multimerin-1 (abcam, cambridge, ma, usa) were used at 1:1000 and 1:2000 dilution, respectively. after washing, the membrane was incubated with second antibodies (goat anti - mouse / hrp conjugate, santa cruz, paso robles, ca, usa) for integrin alpha-1 and isoform-1 of multimerin-1 and detected with the pierce chemiluminescent (ecl) kit (thermo, waltham, ma, usa). levels of proteins were then quantified by image quant tl activation wizard software, usa. the patients in our study were newly diagnosed with mm and their serum samples were collected prior to any treatment. bmg is a prognostic factor, and albumin is relevant to the patients health status. concentrations of bmg and serum albumin for mm patients bmg : 2-microglobulin ; mm : multiple myeloma. as shown in figure 1, separation of 2 l of pooled serum is displayed in lanes 1 and 2, indicating that major proteins that is albumin, are overwhelming and make low abundance proteins less visible on the gel. two elutaions from pllbs are shown in lanes 3 and 4, indicating the enrichment of low - abundance proteins and the drastically reduced levels of the most abundant proteins present in the serum. lane 1 and lane 2 : 2 l of the pooled serum ; lane 3 and lane 4 : the elutions from the peptide ligand library beads. identification of proteins by 1d - gel - lc - ms / ms : gel bands were excised and digested with trypsin. the tryptic peptides from each gel band were analyzed by lc - ms / ms. based on the searching criteria for protein hits, 849 and 789 proteins were identified from samples of healthy controls and patients with mm, respectively. the false positive rate for proteins identified with mascot, as calculated by the decoy database search, although the number of proteins identified is not as high as what has been reported, our results are more reliable since the ms measurement was carried out with a ltq - obritrap mass spectrometer with the mass measurement error less than 10 ppm. the studies carried out with ltq usually use 3 da as the mass measurement error, which greatly increases the false positive rate. using pllb treatment, we were able to identify some low abundance proteins and proteins that are seldom implicated in mm, such as integrin alpha-11 and isoform-1 of multimerin-1. the ms / ms spectra of selected tryptic peptides fvlvqenrptltdivelr from isoform-1 of multimerin-1 and iqnlglfpihgmmmk from integrin alpha-11 are displayed in figure 2a and b, respectively, in which all major fragment ions match the b and y ions of the peptides from these two proteins. (a) the mass spectrometry (ms)/ms spectra of selected tryptic peptides fvlvqenrptltdivelr from isoform-1 of multimerin-1 ; (b) the ms / ms spectra of selected tryptic peptides iqnlglfpihgmmmk from integrin alpha-11. spectral count was used to quantify the expression levels of proteins in the selected gel bands, as well as the whole lane. spectra count uses the number of spectra that has been assigned to a specific protein, to quantify the relative abundance of protein from two samples, and it has been widely applied to biological systems. using two - fold or more changes as a determinant, we identified the expression of 10 proteins down - regulated and that of 12 proteins up - regulated in patients with mm compared to healthy controls. we also used an alternative approach, the extracted ion current, to confirm the quantitation results from the spectra counts. these up- and differentially expressed serum proteins between patients with mm and healthy controls by pllb affinity combining with one - dimensional sds - page gel - lc - ms / ms mm : multiple myeloma ; pllb : peptide ligand library beads ; ms : mass spectrometry ; lc : liquid chromatography ; sds - page : sodium dodecyl sulphate - polyacrylamide gel electrophoresis. two of the differentially expressed proteins were selected for immunodetection in undepleted plasma using specific antibodies to integrin alpha-11 and isoform-1 of multimerin-1 and the differential serum levels were confirmed by western blotting analysis [figure 3 ]. the immunoblotting analysis showed decreased integrin alpha-11 in the serum of mm patients with a mean band intensity of (2425 562) (mean optical density units) versus controls at (1177 560) (p < 0.01, student 's t - test, two - tailed). isoform-1 of multimerin-1 appeared to be down - regulated in mm patients at (3019 641) versus controls at (11,988 846) p < 0.01). results from western blotting were consistent with those from spectral counts, showing that both proteins were down - regulated in the mm patients (integrin alpha-11, 116 spectral counts and isoform-1 of multimerin-1, 13 spectral counts) versus healthy controls (integrin alpha-11, 384 spectral counts and isoform-1 of multimerin-1, 44 spectral counts). the relative abundance profiles, as determined by western blotting analysis, were therefore consistent with the quantitative spectral counts data obtained for these two proteins. lane 1, lane 2 and lane 3 were the three healthy people 's serum ; lane 4, lane 5 and lane 6 were the three patient 's serum. the patients in our study were newly diagnosed with mm and their serum samples were collected prior to any treatment. bmg is a prognostic factor, and albumin is relevant to the patients health status. concentrations of bmg and serum albumin for mm patients bmg : 2-microglobulin ; mm : multiple myeloma. as shown in figure 1, separation of 2 l of pooled serum is displayed in lanes 1 and 2, indicating that major proteins that is albumin, are overwhelming and make low abundance proteins less visible on the gel. two elutaions from pllbs are shown in lanes 3 and 4, indicating the enrichment of low - abundance proteins and the drastically reduced levels of the most abundant proteins present in the serum. lane 1 and lane 2 : 2 l of the pooled serum ; lane 3 and lane 4 : the elutions from the peptide ligand library beads. identification of proteins by 1d - gel - lc - ms / ms : gel bands were excised and digested with trypsin. the tryptic peptides from each gel band were analyzed by lc - ms / ms. based on the searching criteria for protein hits, 849 and 789 proteins were identified from samples of healthy controls and patients with mm, respectively. the false positive rate for proteins identified with mascot, as calculated by the decoy database search, was estimated to be 2%. although the number of proteins identified is not as high as what has been reported, our results are more reliable since the ms measurement was carried out with a ltq - obritrap mass spectrometer with the mass measurement error less than 10 ppm. the studies carried out with ltq usually use 3 da as the mass measurement error, which greatly increases the false positive rate. using pllb treatment, we were able to identify some low abundance proteins and proteins that are seldom implicated in mm, such as integrin alpha-11 and isoform-1 of multimerin-1. the ms / ms spectra of selected tryptic peptides fvlvqenrptltdivelr from isoform-1 of multimerin-1 and iqnlglfpihgmmmk from integrin alpha-11 are displayed in figure 2a and b, respectively, in which all major fragment ions match the b and y ions of the peptides from these two proteins. (a) the mass spectrometry (ms)/ms spectra of selected tryptic peptides fvlvqenrptltdivelr from isoform-1 of multimerin-1 ; (b) the ms / ms spectra of selected tryptic peptides iqnlglfpihgmmmk from integrin alpha-11. spectral count was used to quantify the expression levels of proteins in the selected gel bands, as well as the whole lane. spectra count uses the number of spectra that has been assigned to a specific protein, to quantify the relative abundance of protein from two samples, and it has been widely applied to biological systems. using two - fold or more changes as a determinant, we identified the expression of 10 proteins down - regulated and that of 12 proteins up - regulated in patients with mm compared to healthy controls. we also used an alternative approach, the extracted ion current, to confirm the quantitation results from the spectra counts. these up- and differentially expressed serum proteins between patients with mm and healthy controls by pllb affinity combining with one - dimensional sds - page gel - lc - ms / ms mm : multiple myeloma ; pllb : peptide ligand library beads ; ms : mass spectrometry ; lc : liquid chromatography ; sds - page : sodium dodecyl sulphate - polyacrylamide gel electrophoresis. two of the differentially expressed proteins were selected for immunodetection in undepleted plasma using specific antibodies to integrin alpha-11 and isoform-1 of multimerin-1 and the differential serum levels were confirmed by western blotting analysis [figure 3 ]. the immunoblotting analysis showed decreased integrin alpha-11 in the serum of mm patients with a mean band intensity of (2425 562) (mean optical density units) versus controls at (1177 560) (p < 0.01, student 's t - test, two - tailed). isoform-1 of multimerin-1 appeared to be down - regulated in mm patients at (3019 641) versus controls at (11,988 846) p < 0.01). results from western blotting were consistent with those from spectral counts, showing that both proteins were down - regulated in the mm patients (integrin alpha-11, 116 spectral counts and isoform-1 of multimerin-1, 13 spectral counts) versus healthy controls (integrin alpha-11, 384 spectral counts and isoform-1 of multimerin-1, 44 spectral counts). the relative abundance profiles, as determined by western blotting analysis, were therefore consistent with the quantitative spectral counts data obtained for these two proteins. lane 1, lane 2 and lane 3 were the three healthy people 's serum ; lane 4, lane 5 and lane 6 were the three patient 's serum. in the present study, we employed a novel method of peptide ligand library affinity chromatography combining with 1d - gel - lc - ms / ms analysis to identify proteins differentially expressed in the sera of mm patients compared to those of healthy controls. it has been amply documented that the pllbs are an efficient means to reduce high abundance proteins for the identification of low - abundance proteins. analysis of serum samples treated with pllb in triplicate resulted in the identical 1d - sds images in our experiments and in the literature. of the 22 proteins differently expressed in our series, the expression level of apolipoprotein a - i is lower in the sera of mm patients than in sera of healthy individuals. apolipoprotein a - i is the major apolipoprotein of high - density lipoprotein, and it promotes efflux of cholesterol from cells. it has been found that expression of apolipoprotein a - i is decreased in ovarian cancer. the expression of insulin - like growth factor - binding protein 2 precursor, that regulates the function of insulin is higher in the mm patients. it has been reported that insulin - like growth factor - binding protein 2 is elevated in non - hodgkin 's lymphoma. a recent study indicates that the expression level of saa is higher in serum from mm patients who were nonresponders to thalidomide - based therapy. vitamin d - binding protein, that is a member of a multigene family including alpha - fetoprotein and albumin, reversibly binds and transports vitamin d and its metabolites to target cells. our study shows that the expression of vitamin d - binding protein is decreased in mm patients. plasma kallikrein participates in the surface - dependent activation of blood coagulation, fibrinolysis, kinin generation, and inflammation. the expression level of plasma kallikrein was found to be elevated in mm patients in the present study. we also found two novel proteins, integrin alpha-11 subunit and isoform-1 of multimerin-1 integrin alpha-11 was found to be overexpressed in nonsmall cell lung carcinoma (nsclc) and in esophageal squamous cell carcinoma. the integrin alpha-11 subunit binds the integrin beta-1 subunit to form a heterodimer, and 11 1 integrin is one of the four receptors for interstitial collagen to modulate the growth of nsclc cells. the expression of the integrin alpha-11 subunit is lower in mm patients compare to the normal individuals. normally, multimerin-1 is not detectable in plasma. using both proteomic analysis and western blot, we found that the expression of isoform-1 of multimerin-1 is decreased in mm patients. it would be useful to compare the changes in protein concentration before and after therapy, however, we currently do not have enough data for this evaluation. our results demonstrate that pllb affinity chromatography combining with 1d - gel - lc - ms / ms analysis is a useful method to identify proteins differently expressed in the sera of mm patients. the changes of protein expression are mainly associated with the complement and coagulation cascade, lipid metabolism, and extracellular matrix remodeling, which concomitantly take part in the pathogenesis of mm. | background : multiple myeloma (mm) is a malignant tumor, which takes the second place in malignant blood disease. the clinical symptoms are complicated that make more difficult to diagnose and therapy. lots of researches focus on the proteins about mm in order to solve those problems. we used proteomic methods to find potential biomarkers in mm patients.methods:we applied the peptide ligand library beads (pllbs) to deplete high abundance proteins in serum for finding potential pathogenic factors and biomarkers of mm. using 1d - gel - liquid chromatography - tandem mass spectrometry (lc - ms / ms), we identified 789 and 849 unique serum proteins in mm patients and in healthy controls, respectively.results:twenty-two proteins were found differentially expressed between the two groups including serum amyloid a protein, vitamin d - binding protein isoform-1 precursor, plasma kallikrein, and apolipoprotein a - i. changes of integrin alpha-11 and isoform-1 of multimerin-1 were validated with western blotting. the linkage of the differentially expressed proteins and the pathogenesis pathways of mm were discussed.conclusions:pllb combined with 1d - gel - lc - ms / ms analysis is an efficient method to identify differentially expressed proteins in serum from patients with mm. |
although infrequent (1% to 4% in the first year), infective endocarditis may occur after aortic valve replacement.13 when present, prosthetic valve endocarditis is a severe problem that is associated with considerable morbidity, especially related to peripheral embolism, perivalvular abscess, and sepsis.49 acute coronary syndromes are uncommon in prosthetic valve endocarditis, with a prevalence of between 1% and 3%.10 the most likely mechanisms responsible for myocardial ischemia are the presence of preexisting coronary artery disease and coronary emboli from aortic vegetations. other less frequent mechanisms have been described, such as obstruction of the coronary ostium due to large vegetation and severe aortic insufficiency.1014 external coronary artery compression due to infective endocarditis is also a described mechanism, but is a rare occurrence with only few cases reported in medical literature.11,1421 we report a 46-year - old patient who presented with acute myocardial infarction caused by an aortic root abscess, which resulted in the external compression of the left main coronary artery. a 46-year - old man presented at instituto de cardiologia do distrito federal, brasilia, brazil with a history of dyspnea and fatigue exacerbated by a recent hospitalization related to pulmonary edema. diagnosis was confirmed by echocardiography, which revealed the presence of a bicuspid aortic valve with mixed lesion, predominantly stenotic. the operation and his postoperative recovery were uneventful, and the patient was discharged home on the sixth day after the procedure in good condition. he was prescribed the following medications to take at home : enalapril 5 mg twice daily, carvedilol 6.25 mg twice daily, furosemide 20 mg daily, and ferrous sulfate 300 mg daily (orally). approximately 1 month later, the patient returned, complaining of a high - grade fever and chills for a few days. he was admitted to the emergency department with acute onset chest pain, dyspnea, and vomiting. on physical exam, he was lethargic, febrile, pale, and hemodynamically unstable, with cold extremities and faint pulses. admitting electrocardiogram revealed normal sinus rhythm, signs of left ventricle hypertrophy, and st depression on posterior and lateral leads (figure 1). the cardiologist on call interpreted the patient as having non - st elevation acute coronary syndrome, and treated him with aspirin, clopidogrel, morphine, and heparin. an emergent coronary angiogram (figure 2a) revealed a long, complex lesion on the left main coronary artery (80% lumen obstruction) with tapering contor, suggesting extrinsic compression. due to ongoing myocardial ischemia and hemodynamic compromise, an intra - aortic balloon pump was inserted. before the blood cultures results were available, broad - spectrum anti biotics (vancomycin, rifampicin, and imipenem) and also an anti - fungal drug (amphotericin b) were initiated empirically. transesophageal echocardiog - raphy showed vegetations attached to the prosthesis, aortic root abscess, and an aortic - to - right - atrium fistula. left ventricle ejection fraction was 36%, and there were wall motion abnormalities on lateral and anterior walls. chest computed tomography (figure 2b) suggested that left main compression was due to aortic root abscess or hematoma. urgent reoperative aortic valve replacement was indicated. the operation was performed with the aid of hypothermic cardiopulmonary bypass with aortic and bicaval cannulation. myocardial protection was achieved with cold blood cardioplegia delivered through the coronary ostium and coronary sinus. an oblique aortic arteriotomy revealed a large anterior aortic root abscess, which had invaded the left and right coronary cuspids. the bioprosthesis was removed, and the abscess was evacuated ; complete debridement of all infected material was also performed. the aortic - to - right atrium fistula was closed with an autologous pericardium patch. additionally, a coronary artery bypass grafting with a reversed saphenous vein graft to left anterior descending artery was performed. prolonged cardiopulmonary bypass and mediastinal bleeding were problems in the operating room, requiring vigorous transfusion and delayed chest closure on the next day. postoperatively, the patient had acute renal failure requiring hemodialysis, sepsis, transient liver failure, prolonged mechanical ventilation, and complete atrioventricular block requiring permanent pacemaker. antibiotic therapy, as previously mentioned, was initiated empirically with vancomycin, rifampicin, imipenem, and amphotericin b. rifampicin was discontinued on the second day of use due to mild liver failure. vancomycin was replaced by teicoplanin shortly after the operation due to acute renal failure, and it was used until the 30th postoperative day. then, it was replaced by fluconazole, which was continued for a year thereafter. a month after the operation, the left ventricular function had improved (ejection fraction of 58%) with a mildly dilated ventricle and a normal aortic valve function. the patient was discharged home 6 weeks after surgery in good condition, with no signs of active infection. at 36-month follow - up, the patient is currently in new york heart association functional class i with no recurrent infection, and the ventricular function is normal. the left main is widely patent and the saphenous vein graft is occluded on control chest computed tomography (figure 3). the present case describes a rare complication of prosthetic valve endocarditis, an aortic root abscess causing external coronary artery compression and acute myocardial infarction. this mechanism of myocardial infarction has already been described.11,1421 the most likely mechanisms responsible for myocardial infarction during infective endocarditis are preexisting coronary artery disease and coronary artery emboli from vegetations. prosthetic valve endocarditis is associated with elevated hospital mortality (approximately 40%)22 and morbidity dependent on the infecting pathogen, duration of illness prior to therapy, and underlying comorbidities.23 mansur presented a total of 386 complications in 223 episodes of endocarditis (74% complication rate), being 100 occurrences of cardiac complications (severe heart failure, valve injury, pericarditis, acute myocardial infarction, conduction abnormalities, fistulous communication, perivalvular abscess, and others), 72 neurologic complications (cerebral embolism, mycotic aneurysms, meningitis, stroke, intracranial hemorrhage, cerebral abscess, and others), 46 septic complications (infection unresponsive to treatment, persistent fever, disseminated intravascular coagulation, and others), 27 renal complications (renal failure, nephrotic syndrome), 16 extracranial systemic arterial complications, 26 septic pulmonary embolisms, three splenic infarctions or abscesses, and some other complications associated with infective endocarditis. clinical presentation of acute coronary syndromes in patients with endocarditis is similar to those with coronary artery disease. as systems attempt to meet stringent door - to - balloon initiatives, it becomes imperative that a detailed history and physical exam be performed in this narrow time window in order to avoid unnecessary tests and/or therapeutic regimens. for instance, the diagnostic work - up of a patient with a clinical history of high - grade fever and chills within a month after a straightforward aortic valve replacement with known absence of coronary artery disease includes, firstly, a transesophageal echocardiography.17 it has a sensitivity and a specificity for abscess detection of 87% and 95%, respectively.25 coronary angiogram in this particular patient was indicated based on a misdiagnosis of coronary artery disease. although the angiographic appearance is typical (complex and long lesion that often disappears on diastole), coronary angiogram should be avoided because it may cause dislodgment of septic fragments, which fortunately did not occur in this particular case. the isolation of the causative organism of prosthetic valve endocarditis is essential, and antibiotic therapy should be delayed pending the blood culture results in cases of patients who are hemodynamically stable with an indolent clinical course. however, patients presenting hemodynamic instability or acute disease should receive empiric broad - spectrum antibiotic therapy promptly.26 therapy should be subsequently adjusted according to the culture results. the american heart association (aha) and the european society of cardiology (esc) guidelines recommend that prosthetic valve endocarditis should be treated for at least 6 weeks with adequate bactericidal agent. presence of acute coronary syndrome in the setting of prosthetic valve endocarditis carries an elevated morbidity and mortality rates.27 although uncommon, external compression of coronary artery should be considered in the differential diagnosis of these patients, and adequate diagnostic work - up and treatment should be indicated.11 treatment with anti - platelet agents increased the risk of cerebral bleeding and certainly complicated the operative treatment in this patient.28 although the patient was a very high - risk surgical candidate, the urgent operation was justified due to patient s age and treatable heart problems, despite the presence of active infection, aortic root invasion, and abscess. the root abscess perforated the membranous septum, causing aortic to right atrium fistula, and there was a huge invasion of the left coronary cuspid around the left main coronary artery, which caused its extrinsic compression and myocardial ischemia. the treatment of prosthetic endocarditis was standard : extensive debridement, patch closure of fistula, and aortic root replacement with cryopreserved homograft.29 coronary artery bypass to left anterior descending was also performed in order to guarantee an adequate myocardial blood flow shortly after the operation. the adequate coronary button re - implant and obstruction relief established good coronary perfusion, and the saphenous vein graft has occluded due to competitive flow. we experienced a rare complication of prosthetic valve endocarditis : external coronary artery compression due to aortic root abscess. although uncommon, this mechanism should be considered in the differential diagnosis of patients presenting acute coronary syndrome in the setting of prosthetic valve endocarditis, and adequate diagnostic work - up and treatment should be indicated. | a 46-year - old man with bicuspid aortic valve and severe calcific aortic stenosis was submitted to aortic valve replacement with a stented bioprosthesis. he developed staphylococcus epidermidis prosthetic valve endocarditis a month later, presenting in the emergency room with acute myocardial infarction. the mechanism of myocardial ischemia was a large aortic root abscess causing left main extrinsic compression. he was urgently taken to the operating room, and an aortic root replacement with cryopreserved homograft was performed, associated with autologous pericardium patch closure of aortic to right atrium fistula and coronary artery bypass grafting of the left anterior descending. after a difficult postoperative period with multiple problems, he was eventually discharged home. at 36-month follow - up, he is asymptomatic with no recurrent infection, and the left main coronary artery is widely patent on control chest computed tomography. |
an 8-year - old male siberian tiger at the budapest zoological and botanical garden had episodes of coughing in october 2001. because the coughing did not stop in 6 to 7 days, an expectorant (bisolvon ; boehringer ingelheim vetmed gmbh. his condition showed a temporary improvement ; however, after a few weeks, the animal started coughing again, and his appetite decreased. amoxicillin plus clavulanic acid (amoksiklav ; lek animal health, ljubljana, slovenia) and ketoprophen (ketofen, merial, lyons, france) therapy was given for 7 days. in addition, in may 2002, the animal s respiratory rate became elevated, he became dyspneic and emaciated, and his daily activity substantially decreased. further antibacterial treatment was administered (cefatroxil, cefa - cure ; intervet, boxmeer, the netherlands) during that month without clinical effect. at that point, the animal was anesthetized, and tracheoscopy was performed with a flexible 56-cm bronchoscope (olympus b3r ; tokyo, japan (figure 1). therefore, several tracheal washings were taken for microbiologic tests by using a commercially available tracheal suction set (medinorm medizintechnik gmbh, quierschied, germany (figure 1). a chest radiograph showed a severe and extensive bronchointerstitial pattern with cavernous lesions in both lungs. obtaining a tracheal washing of the siberian tiger by bronchoscopy. nine days after the specimens were taken, cultures for mycobacteria showed growth in the broth - based mgit 960 system (becton - dickinson microbiology systems, sparks, md). the acid - fast organism that was isolated was identified as mtbc by the accuprobe tb assay (gen - probe inc., san diego, ca). since the tiger had stopped eating and his condition had dramatically deteriorated, the animal was euthanized and necropsy was performed. hematoxylin and eosin stained histologic sections of the lung segments showed an extensive multifocal infiltration of lymphocytes, histiocytes, and some scattered multinuclear giant cells within the framework of proliferated connective tissue and collagen fibers of the cavernous lesions. ziehl - neelsen staining showed an intracellular accumulation of acid - fast bacteria in several alveolar macrophages and epithelioid cells. their skin test results were negative, and clinical or radiologic signs of tuberculosis were not detected. colony morphology of the isolated mtbc strain showed dysgonic growth on lj medium and microaerophilic growth on lebek medium. the strain was susceptible to pza (100 g / ml) and thiophen-2-carboxylic acid hydrazide (tch ; 1 g / ml) and negative for niacin accumulation and nitrate reduction (911). the genome of the isolate was analyzed for specific mutations in the pnca, oxyr, and gyrb genes by automated dna sequencing, polymerase chain reaction restriction fragment length polymorphism (pcr - rflp) technique, and spoligotyping as described previously (5,1216). susceptibility of the isolate to pza was linked with a wild - type pnca sequence. specific g - to - a mutation at position 285 in the oxyr gene and the g - to - a mutation at position 756 in the gyrb gene. however, spoligotyping showed a pattern with the absence of spacer sequences 3943 and 316 (figure 2), and t to g mutation at position 1,311 in the gyrb gene, characteristic of m. bovis subsp. on the basis of these phenotypic and genetic characteristics, the strain was identified as m. bovis subsp. spoligotype patterns of the isolate obtained from the siberian tiger : lane 1 ; spacer sequences 316 and 3943 are absent) ; lane 2, control strain mycobacterium tuberculosis h37rv atcc 27294 ; lane 3, control strain m. bovis atcc 19210 ; lane 4, m. bovis bcg atcc 27289. colony morphology of the isolated mtbc strain showed dysgonic growth on lj medium and microaerophilic growth on lebek medium. the strain was susceptible to pza (100 g / ml) and thiophen-2-carboxylic acid hydrazide (tch ; 1 g / ml) and negative for niacin accumulation and nitrate reduction (911). the genome of the isolate was analyzed for specific mutations in the pnca, oxyr, and gyrb genes by automated dna sequencing, polymerase chain reaction restriction fragment length polymorphism (pcr - rflp) technique, and spoligotyping as described previously (5,1216). susceptibility of the isolate to pza was linked with a wild - type pnca sequence. in addition, the isolate contained the m. bovis specific g - to - a mutation at position 285 in the oxyr gene and the g - to - a mutation at position 756 in the gyrb gene. however, spoligotyping showed a pattern with the absence of spacer sequences 3943 and 316 (figure 2), and t to g mutation at position 1,311 in the gyrb gene, characteristic of m. bovis subsp. on the basis of these phenotypic and genetic characteristics, the strain was identified as m. bovis subsp. spoligotype patterns of the isolate obtained from the siberian tiger : lane 1 ; spacer sequences 316 and 3943 are absent) ; lane 2, control strain mycobacterium tuberculosis h37rv atcc 27294 ; lane 3, control strain m. bovis atcc 19210 ; lane 4, m. bovis bcg atcc 27289. mtbc comprises these closely related organisms : m. tuberculosis ; m. africanum ; m. bovis ; the vaccine strain, m. bovis bacillus calmette - gurin ; and three rarely seen members, m. microti, m. canettii, and the recently described seal bacillus, m. pinnipedii (1720). differentiation within mtbc is necessary for individual patient treatment (i.e., inclusion or exclusion of pza) and for epidemiologic purposes, especially in areas of the world where tuberculosis has reached epidemic proportions or wherever the transmission of m. bovis between animals, animal products, and humans is a problem (10). the host range of m. bovis is wide, including many animal species and humans. carnivores such as large felines may acquire the infection through the alimentary tract by eating infected meat (4). reports of tuberculosis in large captive or free - living felines are not common (2126), however. to our knowledge, this case is the first in which tuberculosis attributable to m. bovis subsp. the rapid and accurate in vivo diagnosis of tuberculosis is indispensable in endangered captive animals such as the siberian tiger, not only because of the declining population of this species but also to prevent the transmission of the disease to other animals. although nasal or throat swabs are used most often, we found tracheal washing by bronchoscopy was easy to perform, rapid, and more adequate than swabs (provided a larger sample volume from the lower airways) for obtaining clinical specimen for mycobacterial or other microbiologic tests. the rapid diagnosis of tuberculosis is essential for adequate antituberculosis treatment to be started as early as possible. however, when an endangered animal is involved, early diagnosis of the disease might help control it in time to save the animal, especially with the help of a rapid in vivo diagnostic method such as tracheal washing through bronchoscopy. tracheal washing can also be the method of choice to bacteriologically monitor the efficacy of therapy. in this case, the poor appetite and condition of the animal did not allow survival long enough for delivery of antituberculosis treatment. the source of infection could not be conclusively identified retrospectively ; infected goat meat (a usual diet of the animal) is a likely possibility because the tuberculosis - related control measures are not as strict with goats as with cattle in hungary (annual tuberculin skin testing of goats is not mandatory, for example) (28). this report indicates that routine differentiation within the mtbc is indispensable for understanding the epidemiology of tuberculosis and for determining the prevalence, transmission, and clinical importance of the different members of the complex. | we report the first case of pulmonary tuberculosis caused by mycobacterium bovis subsp. caprae in a captive siberian tiger, an endangered feline. the pathogen was isolated from a tracheal aspirate obtained by bronchoscopy. this procedure provided a reliable in vivo diagnostic method in conjunction with conventional and molecular tests for the detection of mycobacteria. |
a 48-year - old man presented with visual dimness in his right eye, which had developed over the two weeks prior to the visit to the ophthalmology clinic. his medical, family, and social history was unremarkable. his visual acuity (va) was 20/50 in the right eye (od) and 20/20 in the left eye (os). dilated fundus examination showed few vitreous cells and numerous yellow, placoid lesions in both eyes (ou) (fig. 1 a and b). fluorescein angiography demonstrated early irregular hypofluorescence with late staining in the areas of the yellow placoid lesions (fig., va decreased to 20/30 and yellow, placoid lesions increased to involve the macula. he was started on a regimen of 60 mg (1.2 mg/ kg of his body weight) of prednisone daily. one week after prednisone treatment, his right va increased to 20/30 and the retinal lesions improved. however, the left va deteriorated to 20/40, and the placoid lesions were aggravated. we discovered that the patient did not follow our recommendation for serologic work - up. the serologic tests were ordered again, and his blood sample was sent for laboratory work - up. prednisone was tapered down to 50 mg daily, and he returned 1 week later with improved va of 20/20 and completely resolved chorioretinal lesions in the od. serologic testing was positive for venereal disease research laboratory antigen and negative for hiv titers. he had no other syphilitic manifestations. in order to avoid a possible rebound reaction to prednisone withdrawal, prednisone was rapidly tapered to 30 mg daily, and the patient was referred to an infectious disease specialist for antibiotic therapy. he returned 1 week later with improved va of 20/20 in the od and 20/30 in the os. a serologic fluorescent treponemal antigen absorption test was positive for ig g and ig m. however, the patient was not taking any antibiotics yet, because he refused to follow the internist 's recommendation of admission to the hospital and commencement of an antibiotic prescription. prednisone was tapered to 10 mg, and he was sent for medical consultation again. however, new multiple focal chorioretinal lesions were noted outside the inferior retinal vascular arcades of the os. after medical examination, including a cerebrospinal fluid (csf) study, he was started on ceftriaxone, 2.0 g intravenously for 14 days, and returned with resolution of the focal chorioretinitis. the most common posterior segment involvement of ocular syphilis is chorioretinitis.3 to denote a variation of posterior segment involvement, gass1 coined the term " syphilitic posterior placoid chorioretinitis ". the findings show large, placoid, yellowish lesions with faded centers at the level of the retinal pigment epithelium in the macular and juxtapapillary areas, which show similar angiographic patterns, specifically early hypofluorescence and late staining. it has been supposed that this particular finding might be a direct result of the modification of the host immune response to syphilis by the hiv virus. tran.4 suggested that syphilitic uveitis in hiv - infected patients seems to have a more severe course. moreover, zamani and garfinkel2 reported the relationship between oral prednisone and the appearance of asppc. in their case, they suggested that its clinical appearance might be modulated by the immune status of the patient and that if corticosteroids are given without systemic treatment for syphilitic manifestations at the same time or shortly thereafter, the number of treponemes may increase and new lesions may appear. however, the results from our case do not support their suggestions. in our case, the patient took only oral prednisone without simultaneous coverage by the proper antibiotics, because he refused to follow the internist 's recommendation. at initial presentation, his right eye had improved during the prednisone therapy, while the left eye was aggravated. this implies that his chorioretinitis had a clinical course unresponsive to the use of prednisone. instead, its clinical course was more like that of apmppe. chorioretinitis recurred after tapering the dosage of prednisone but was resolved after treatment with antibiotics. however, chorioretinitis at different stages had the same clinical course (onset - aggravation - resolution), regardless of treatment with prednisone. it suggests that asppc has its own clinical course and is not influenced by systemic steroid use. another possibility is that the anti - inflammatory effect of prednisone had appeared late in treatment because the chorioretinitis of both eyes resolved at the end of the prednisone treatment. however, the latter is less likely because one eye improved and the other was aggravated during the same treatment period. our case had an atypical course for this disease, and it was not consistent with the hypothesis that a particular fundus finding of asppc may be the direct result of a patient 's altered immune response to syphilis, especially induced by corticosteroid therapy started before the initiation of antimicrobial therapy. | a 48-year - old man presented with visual dimness in the right eye that had developed 2 weeks previously. dilated fundus examination showed few vitreous cells and numerous yellow, placoid lesions in both eyes. his right eye had more severe serous retinal detachment involving the macula. fluorescein angiography demonstrated early irregular hypofluorescence with late staining in the areas of the yellow placoid lesions. he started a regimen of 60 mg of oral prednisone daily. two weeks later, a serologic fluorescent treponemal antigen absorption test was positive for ig g and ig m. he was referred to an infectious disease specialist for antibiotic therapy. a week later, he returned, having stayed on prednisone only and not having taken the internist 's antibiotic prescription. meanwhile, the chorioretinitis in his right eye, which had initially been at a more advanced stage, was resolved with the use of steroids. the chorioretinitis in his left eye, which was aggravated at an earlier stage, ultimately recovered. our case had atypical courses such that one eye improved and the other worsened during the same steroid treatment period. this result was inconsistent with that of previous reports showing that oral steroid influences the clinical course of acute syphilitic posterior placoid chorioretinitis. |
gastric cancer is the most prevalent malignant tumor and the second leading cause of cancer - related death in korea1). the benefit of systemic chemotherapy for treating advanced gastric cancer in the palliative setting has long been known. when compared with the best supportive care alone, combination chemotherapy yields a significant advantage for the management of advanced gastric cancer2, 3). however, most of the previous clinical trials have excluded patients with impaired hepatic function. gastric cancer patients with severe liver dysfunction secondary to hepatic metastases have limited treatment options. capecitabine is an oral prodrug that is metabolized to 5-fluorouracil (5-fu), and it has clinical activity that mimics infused 5-fu. capecitabine is readily absorbed from the gastrointestinal tract and it is activated through a series of enzymatic reactions that occur first in the liver and subsequently in most tissues, including the tumor tissue, to create the active drug 5-fu. a previous study demonstrated no clinically significant influence on the pharmacokinetic parameters of capecitabine or its metabolites in the setting of hepatic dysfunction4). third - generation platinum oxaliplatin has been well tolerated by the patients with all levels of hepatic failure, and that liver dysfunction caused no apparent alteration in the clearance of platinum species from the plasma. however, the safety of these combination chemotherapies for patients suffering with severe liver dysfunction has not been established. we report here on a case of gastric cancer with advanced liver metastases and severe hepatic dysfunction that was treated with xelox chemotherapy. a 62-year - old man was admitted due to his recent jaundice and abdominal distention. he was diagnosed about 2 years ago with gastric adenocarcinoma and he underwent radical subtotal gastrectomy. a physical examination showed his height to be 170 cm and the body weight was 68 kg. his sclera was deep icteric, but he showed neither hepatomegaly nor right upper quadrant tenderness. the laboratory tests on admission showed an elevated level of serum total bilirubin to 10.9 mg / dl (normal level : 0.3~1.2 mg / dl), a direct bilirubine of 8.5 mg / dl (normal level : 0~0.2 mg / dl), alanine aminotransferase of 374 u / l (normal level : 10~40 u / l), alkaline phosphatase of 480 u / l (normal level : 20~100 u / l) and lactate dehydrogenase of 2,133 u / l (normal level : 208~378 an abdominal and pelvic ct scan was performed to verify the biliary obstruction and metastatic lesions in the abdominal cavity, including the liver and biliary system. ct scan of the abdomen showed multiple metastatic nodules in the liver with no evidence of biliary tree obstruction (figure 1). the diagnosis of the patient was confirmed to be recurrent gastric cancer with advanced liver metastases and severe hepatic dysfunction. his performance status was estimated to be ecog 2. given his poor liver function, the patient was treated with oxaliplatin (130 mg / m) on day 1 and capecitabine (1,000 mg / m orally twice daily) on days 1~14 of a 21-day cycle. after the first cycle of chemotherapy, his total bilirubin dropped to 4.5 mg / dl. after two cycles of chemotherapy, his total bilirubin and alkaline phosphatase decreased to near normal levels at 2.1 mg / dl and 116 u / l, respectively. no treatment - related grade 3 or above toxicities he continued to well tolerate chemotherapy with excellent performance and normalization of all the liver enzymes (table 1 and figure 2). he displayed a major radiological response on the follow - up ct scans (figure 3) ; he has received 5 cycles of xelox with ongoing clinical benefit. advanced cancer in the setting of hepatic dysfunction poses a dilemma for physicians, as many cancer chemotherapeutic agents undergo hepatic metabolism. most cytotoxic drugs have a narrow therapeutic index and the administration of chemotherapy to patients with liver impairment results in complicated safety issues. the treatment of patients with severe liver dysfunction secondary to metastatic gastric cancer is controversial. these patients have a limited performance status and they are at an increased risk for chemotherapy - related complications. the benefits of systemic chemotherapy for advanced gastric cancer in the palliative setting are known. several randomized trials have demonstrated that 5-fu - based chemotherapy is superior to the best supportive care in terms of survival and preservation of the quality of life3, 6). unfortunately, most clinical trials have excluded patients with impaired hepatic function ; much of what is known about individual chemotherapeutic agents in the setting of liver failure is based on small, retrospective studies. very few agents have undergone formal phase i testing in a liver dysfunction group of patients, and empirical guidelines are frequently used in clinical practice. furthermore, there is no standardized system for defining liver dysfunction in patients suffering with cancer. the serum total bilirubin level is the most commonly used marker to assess the need for chemotherapy dose adjustments, but this represents a simplified strategy. thus, there are many potential hazards that are involved in administering cancer chemotherapy to patients with impaired hepatic impairment. the organ dysfunction working group of the national cancer institute performed a phase i and pharmacokinetic trial of oxaliplatin for patients who displayed a wide range of liver function abnormalities5). that study demonstrated that oxaliplatin was well tolerated at its recommended dose and schedule of 130 mg / m every 21 days for patients with all levels of liver dysfunction, and there was no apparent alteration in the clearance of either the total or ultrafilterable platinum species from the plasma, even in patients with severe hepatic functional abnormalities. unfortunately, they did not report the median or range for the total bilirubin level in the severe liver dysfunction group. capecitabine is a novel oral fluoropyrimidine carbamate that is preferentially converted to the cytotoxic moiety 5-fu in target tumor tissue via a series of three metabolic steps. it is catabolized by dihydropyrimidine dehydrogenase, which is the initial, rate - limiting enzyme in 5-fu catabolism. a study of 14 patients with normal liver function and 13 patients with abnormalities on their liver function tests due to liver metastases demonstrated no clinically significant influence on the pharmacokinetic parameters of capecitabine or its metabolites in the setting of hepatic dysfunction (mean bilirubin : 12 mg / dl, range : 0.9~28.3 mg / dl)4). in another report, a woman with metastatic breast cancer and severe liver dysfunction (total bilirubin : 12 mg / dl) achieved a partial response after seven cycles of capecitabine at 2,500 mg / m / d in two divided doses for 2 weeks and this was followed by 1 week of rest7). park and colleagues8) have recently conducted a phase ii trial of oxalipatin - capecitabine (xelox) for patients with nonresectable advanced gastric cancer. of the 20 evaluable patients, one achieved a complete response and 11 achieved partial responses for an overall response rate of 60%. the median progression - free survival was 7.5 month and overall survival was not reached during the study period. metastatic gastric cancer patients with severe liver dysfunction have a poor median survival that is estimated in weeks. we treated a patient with severe liver dysfunction secondary to metastatic gastric cancer with the xelox regimen. the patient had extensive liver disease and a high bilirubin level (total bilirubin : 12.9 mg / dl). the patient obtained major clinical benefit as demonstrated by the improvement of his performance status and the resolution of jaundice within 3 weeks from treatment initiation. laboratory testing demonstrated gradual improvement in the liver function as early as 3 weeks after the administration of the first cycle of xelox chemotherapy. no increased toxicities were noted during the first four cycles of treatment. he has received the 5th cycle of xelox with ongoing clinical benefit. this report supports the safety of xelox for treating patients with severe liver dysfunction secondary to liver metastasis. this regimen was associated with significant clinical benefit and it should be considered when treating patients suffering with metastatic gastric cancer together with severe liver dysfunction. | gastric cancer patients with severe liver dysfunction secondary to hepatic metastases have limited treatment options. most cytotoxic drugs have a narrow therapeutic index. although both capecitabine and oxaliplatin have been well tolerated as single agents for patients with severe hepatic dysfunction, the combination of these drugs has not been investigated. we report here on a case of successful treatment of a patient suffering with severe liver dysfunction and metastatic gastric cancer ; the patient was treated with a combination of capecitabine and oxaliplatin (xelox). the initial bilirubin level of the patient was 10.9 mg / dl. after two cycles of treatment, his bilirubin level decreased to 2.1 mg / dl. he has experienced an excellent radiological response and he has received six cycles of xelox chemotherapy. xelox chemotherapy is feasible and it can be associated with positive outcomes for the patients suffering with metastatic gastric cancer and severe liver dysfunction. |
werner syndrome (ws) is an autosomal recessive disease that first captured wide attention due to its prominent premature aging (or progeroid) features. ws is also of considerable biomedical science interest in light of the pairing of these progeroid features with constitutional genomic instability and an elevated risk of many clinically important, age - dependent human diseases. the progeroid features of ws were first well - described by otto werner (werner, 1985), who described a north german family of four siblings, ages 31 40, with short stature, prematurely gray hair, bilateral cataracts, atrophy of the extremities, hyperkeratosis and scleroderma - like changes together with foot and ankle skin ulceration. he noted one of the siblings, a 36 yr old male, gave the impression of extreme senility. these observations were published as part of werner s doctoral thesis prior to his embarking on a career in a small north sea village. werner never again returned to study his syndrome (pehmoeller, 2001). the term werner s syndrome was first used in a subsequent report of an additional patient who resembled the family members seen by werner (oppenheimer and kugel, 1934). this case report together with a more comprehensive study by thannhauser of five additional patients (thannhauser, 1945) provided a detailed description of ws. rediscovered by colleagues at the university of washington who described three japanese - american sisters with ws (one of whom is shown in figure 1). their analysis established the autosomal recessive inheritance of ws and delineated key differences between ws and normal aging (epstein. the most consistent and earliest noted findings are premature graying and loss of hair together with bilateral cataracts, short stature and progressive, scleroderma - like skin changes (table 1)(epstein., 1966 ; goto, 1997 ; tollefsbol and cohen, 1984). hair graying and loss begin in the second decade with the scalp and eyebrows, as do bilateral ocular cataracts. the short stature of ws patients reflects the absence of a pubertal growth spurt. short stature together with progressive limb thinning, atrophy and a stocky trunk give many patients a. the scleroderma - like skin changes of ws (thannhauser, 1945) consist of a mix of atrophic and proliferative changes : epidermal atrophy that includes skin appendages in conjunction with focal hyperkeratosis and basal hypermelanosis. dermal subcutaneous atrophy is often found with dermal fibrosis underlying atrophic skin (epstein., 1966 ; goto, 1997 ; hatamochi, 2001 ; thannhauser, 1945). tight, white and shiny appearance, with a progressive sharpening of facial features to give a beaked or bird - like appearance (see figure 3 in (goto, 2001)). the lower extremities, especially the feet, may be markedly deformed with ulceration and calcification of soft tissue and tendons (hatamochi, 2001). many of these changes are readily apparent in patient photos taken in early adulthood and later in life (figure 1). the progressive development of phenotype makes the diagnosis of ws challenging, especially in young adults. however cardinal features are often present early, and can be used together with molecular confirmation to confirm or exclude a diagnosis (table 1)(hisama., 2014). 1996) and other members of the recq helicase gene family led to recognition of deeper links between ws and two additional genodermatoses : bloom syndrome (bs)(ellis., 1995) and rothmund - thomson syndrome (rts)(kitao., 1999). butterfly rash across the bridge of the nose and cheeks that may involve hands and forearms (bloom, 1954). many patients display cellular and humoral immune deficits ; an elevated risk of otitis media, pneumonia and diabetes mellitus with reduced fertility. cancer is the leading cause of premature death (bloom, 1954 ; german, 1979, 1993, 1997). rothmund - thomson syndrome (rts) was first described as a familial occurrence of skin changes with bilateral juvenile cataracts (rothmund, 1868 ; taylor, 1957 ; thomson, 1936). a characteristic sun - sensitive rash with redness, swelling and blistering appears in the first year of life, and may involve the buttocks and extremities while sparing the chest, back and abdomen. the rash may further develop variable pigmentation, telangiectasia and focal atrophy. developmental abnormalities include dysplastic, malformed or absent bones, often in the hand or thumbs ; delayed bone formation or bone density loss ; and malformed, missing or extra teeth. cataracts have been documented in only a minority of contemporary rts patients (larizza., 2010 ; wang., 2001 cancer risk is largely limited to osteosarcoma (siitonen., 2009 ; wang., 2003). additional diseases associated with recql4 mutations are rapadilino and baller - gerold (bgs) syndromes. rapadilino syndrome patients have joint dislocations and patellar hypoplasia or aplasia, but lack skin changes. bgs patients have craniosynostosis with radial aplasia, and rts - like skin changes (siitonen., 2003 ; many ws patients prematurely develop age - dependent diseases such as myocardial infarction and stroke ; cancer ; osteoporosis ; diabetes mellitus ; and hypogonadism. cardio - vascular disease and cancer are leading causes of premature death (goto, 1997 ; goto., 2013). the elevated risk of neoplasia is quite selective : two - thirds of neoplasms in ws patients were of 6, not obviously related, tumor types : thyroid epithelial carcinomas, melanomas, meningiomas, soft tissue sarcomas, hematologic neoplasia, chiefly leukemias, and osteosarcoma (lauper., 2013 ; lauper and monnat jr, 2013 ; monnat jr, 2013). multiple neoplasms were common : 22% of 189 patients in our series had 1 to 4 concurrent or sequential neoplasms, often of unusual types or at unusual sites. for example, melanomas were almost exclusively less common variants : acral lentiginous melanomas arising on the palms, soles or in nail beds ; and mucosal melanomas arising in the nasal cavity or esophagus. thyroid neoplasms, in similar fashion, were disproportionately less common follicular carcinomas (lauper., 2013). the excess risk of these specific neoplasms, estimated using a combination of standardized incidence ratio (sir), proportional incidence ratio (spir) analyses, ranged from nearly 60-fold for melanoma to 1.5-fold for leukemia and pre - leukemic disorders (lauper. this spectrum of neoplasia overlaps with, but is distinct from, the neoplasms observed in bs and rts (german, 1997 ; monnat, 2001 ; siitonen., bs is unusual among heritable cancer predispositions as many different tumor types are involved (german, 1997 ; monnat, 2001). the cancer risk in the rts - associated recql4 syndromes is, conversely, restricted largely to osteosarcoma and lymphoma (siitonen., 2009 ; wang., 2003 ; wang., 2001) all of the human recq helicases hydrolyze atp, unwind double - stranded dna and possess good dna strand annealing activity. wrn alone possesses an additional, 3 ' to 5 ' exonuclease activity. despite their common biochemical activities, the three disease - associated recq helicases have differing substrate preferences and different sets of protein partners (reviewed in (bachrati and hickson, 2003 ; brosh jr, 2013 ; croteau., 2014 ; sidorova and monnat jr, 2015)). these biochemical data together with functional and cellular data begin to indicate how these seemingly similar proteins fill different physiologic niches in human cells and, by extension, how the loss of function of one recq protein may lead to distinct cellular and organismal phenotypes. for example, recql4 and to a lesser extent recql bind replication origins and contribute to dna replication initiation (thangavel., 2009 ; xu., 2009). single molecule dna replication track analyses we and others have performed revealed roles for blm, wrn and recql in replication fork rate maintenance and fork restart (berti., 2013 ; sidorova., 2013 ; sidorova., recql4 has an interesting additional role in mtdna maintenance : it is co - imported with tp53, and appears to limit mtdna damage in a replication - dependent manner (croteau., 2012 ; de., 2012 telomeric dna poses a dual challenge to the dna replication machinery as it is composed of repeated (the human telomeric repeat sequence is ttaggg), gc - rich dna organized into a unique chromatin g - rich lagging strands may form g4 dna quadruplex structures (maizels and gray, 2013) which are a good biochemical substrates for wrn and blm. only wrn helicase activity is required for complete replication of telomeric g - rich lagging strands, whereas cells lacking recql, recql4 or blm also show telomere breakage and loss. it is unclear whether these effects are via a common mechanism (barefield and karlseder, 2012 ; crabbe., 2007 ; crabbe., 2004 ; ghosh., 2012 ; popuri., in contrast, wrn and blm both participate in the recombination - mediated alternative lengthening of telomeres (alt) pathway used by many tumor cells to gain replicative immortality (mendez - bermudez., 2012). one phenomenon that is not yet well - understood is the sensitivity of wrn+ cells to telomere - homologous dna oligonucleotides (t - oligos). the ability to respond to t - oligos may depend upon wrn exonuclease activity, and may have therapeutic potential in light of protective or deleterious responses in different cell types (eller. all five of the human recq helicases also participate in dna double strand break repair by non - homologous dna end joining (nhej) or homology - dependent recombination (hdr or hr). wrn and recql4 participate in base excision repair, and recql5 may play an additional role in ssdna break repair (reviewed in (brosh jr, 2013 ; croteau. previous analyses had suggested a role for the wrn and blm recq helicases in transcription (johnson., 2010 ; kyng., 2003). in order to better understand this role, we analyzed gene and mirna expression in mutation - typed ws and bs primary fibroblasts and in isogenic control primary fibroblasts depleted of the wrn or blm protein. these analyses identified 3,000 genes and dozens of mirnas whose expression was significantly altered by the loss of wrn and blm function. among the subset (25%) of genes altered in both ws and bs cells, a surprisingly high fraction (> 90%) had expression altered in the same direction (nguyen. many wrn- and blm - responsive downregulated genes contained g quadruplex (g4) dna motifs in their 5 ' ends, providing strong evidence that g4 dna structures are physiologic as well as biochemical substrates for wrn and blm. the genes and mirnas altered in ws and/or bs cells play important roles in pathways that drive cell growth, proliferation, death and survival. bs patient cells had gene expression patterns predicted to alter dna replication recombination and repair, as well as immune function and tumorigenic / dna damage signaling. these make good sense in light of our understanding of the biochemical, cellular and organismal phenotype of bs (nguyen., 2014)(tang, robles et. one remarkable and as yet not fully understood finding in ws cells was coordinate upregulation of nearly all of the cytoplasmic trna synthestase (ars) and synthetase - associated interacting protein (aimp) genes (kim., 2011 ; park., 2010 ; wallen and antonellis, 2013 ; yao and fox, 2013). the mechanism of ars / aimp upregulation is not yet understood but may include myc, which can alter and in turn be modulated by arss (shi., 2014) while driving expression of wrn and telomerase (grandori., 2003). ars and aimp overexpression in ws could perturb protein homeostasis by altering global protein turnover and/or translational fidelity (lee., 2014 ; wolff., altered trna charging could affect the balance between mitochondrial and nuclear protein synthesis to promote mitochondrial dysfunction and oxidative stress (jovaisaite and auwerx, 2015). it could also drive disease pathogenesis via the growing list of ars / aimp non - canonical functions that modulate disease - related metabolic, developmental, angiogenic, tumorigenic, immune and inflammatory pathways (paul and schimmel, 2013 ; son., 2014). all of these areas are ripe for further exploration using a combination of new genomic and proteomic approaches. the biochemical and cellular specializations of the individual recq helicases outlined above begin to indicate how the loss of function of a single recq protein may lead to specific recq deficiency syndromes and their associated disease risks. as noted above, recq - deficient cells display cell proliferation defects in conjunction with genomic instability (dhillon., 2007 ; mao., 2010 ; martin., 1970 ; sharma., 2007 ;, 2013 ; thangavel., 2009 ; warren., 1981). these cellular defects in turn are likely part of the explanation for why bs and rts patients are often small though proportionately developed. blm or recql4 loss can both interfere with dna replication and impair cell production throughout development. despite this, development appears largely normal in both syndromes and responds by proportionately scaling output (the fetus) to reflect inadequate substrate (cells). this proportional dwarfing is particularly striking in bs, where patients are born and often remain at or below the 5th percentile for height and weight (keller., 1999). the progressive development of progeroid features in ws only after development is largely complete may reflect the starkly different outcome of replication arrest, which leads to high levels of cell death in bs though not in ws cells (mao., wrn loss, in contrast, has a more profound effect on transcription than does blm loss, and thus may have a correspondingly more prominent role in transcription and tissue maintenance (see above). disrupted dna metabolism in ws patient cells could drive the progressive accumulation of mutant and senescent cells in many tissues, with acquisition of a senescence - associated secretory phenotype that could in turn promote the elevated risk of many clinically important age - associated diseases (campisi, 2013). cellular senescence in the recq helicase syndromes may have one modest silver lining : it is an effective, albeit non - specific, tumor - suppressive mechanism (adda di fagagna, 2008 ; collado and serrano, 2010). altered recq expression, as opposed to mutation, may be frequent in many tumor types (lao., 2013). however the previous suggestion that these changes may be largely methylation - driven (agrelo., 2006) has not been consistent enough in our hands to serve as a reliable marker for altered wrn expression in tumors (lao., 2013)(bosch, luo, in preparation). more systematic collection of patient data, longitudinal study of patients, and the collection and distribution of well - characterized clinical samples should all aid our understanding of the recq deficiency syndromes. we also have a growing range of options to capture and analyze patient - derived cells and cell lines, including improved short term primary culture, organoid culture and the generation of cell lines and ips cells (cheung., 2014 ; martin., 1970 ; shimamoto., 2014 ; these analyses and materials have the potential to identify genetic and environmental modifiers of disease progression and acquired disease risk. they also emphasize how new insights into disease pathogenesis from rare heritable diseases may improve our understanding of skin biology while identifying potential new therapies. one example comes from another skin disease, recessive dystrophic epidemolysis bullosa (rdeb). rdeb results from col7a1 mutations leading to loss of type vii collagen, a marked reduction in anchoring fibrils and extreme skin fragility with loss and scaring (tolar and wagner). the potential for genetic therapies of eb and a handful of other heritable diseases was emphasized over two decades ago by the identification of patients who had undergone spontaneous reversion of causative mutations with partial or full correction of disease - specific defects in skin, blood, lymphoid or liver (hirschhorn 2003). a deeper understanding of the role of type vii collagen in skin (tolar and wagner) had led to a diversity of therapeutic approaches : complementation (genegraft 2014) or targeted correction of causative col7a1 mutations in epidermal cells (sebastiano., 2014) ; use of patient - derived, mutation - reverted keratinocytes (tolar., 2014) ; and the repair in trans of anchoring fibrils using allogeneic fibroblasts (venugopal., 2013), mutation - corrected, ips - derived fibroblasts (wenzel., 2014) or bone marrow transplantation (tolar and wagner ; wagner., 2010). repair in trans may be a viable option for dealing with the scleroderma - like skin changes seen in ws, as might aminoglycoside suppression of wrn missense mutations, a strategy that has been used in rdeb (cogan., 2014). another unusual example of where we may find new clues to treating heritable or acquired skin disease as well as age - associated changes comes from comparative genetics, more specifically the african spiny mice acomys kempi and acomys percivali. acomys mice have the remarkable ability to shed and then regenerate without scaring large segments of skin, and may have evolved this ability to escape predators (seifert., 2012). while scarless wound healing also occurs in humans, it is largely restricted to the fetus (yates., acomys mice, in contrast, are able to continuously regenerate skin without scaring in the face of injury, inflammation and infection. understanding the mechanistic basis for this remarkable example of epimorphic regeneration may identify new ways to maintain or rejuvenate skin, and to help individuals with injuries that lead to disfiguring scaring. finding these and turning them to good use will require imagination, together with a willingness to look and think a bit beyond our usual comfort zone. | the growing diversity of heritable skin diseases, a practical challenge to clinicians and dermatonosologists alike, has nonetheless served as a rich source of insight into skin biology and disease mechanisms. i summarize below some key insights from the recent gene - driven phase of research on werner syndrome, a heritable adult progeroid syndrome with prominent dermatologic features, constitutional genomic instability and an elevated risk of cancer. i also indicate how new insights into skin biology, disease and aging may come from unexpected sources. |
some ectoparasites of hedgehogs such as ticks and fleas have zoonotic importance (khaldi. hedgehogs may act as reservoir hosts for some diseases for instance salmonellosis, leptospirosis and pulmonary capilloriois (mccarthy and moore 2000, riley and chomel 2005, marie. ticks and fleas are blood feeding arthropods that act as vector for transmitting many bacterial, viral, rickettsial and parasitic infection among both domestic and wild animals as well as between animals and humans (mullen and ocanner 2002). ticks are the most important ectoparasites affecting wild - life as they transmit many important diseases in the wildlife, among the livestock and humans (mclean 2008, castellaw. ticks are vectors carrying a number of diseases named tick - borne diseases including lyme disease, rocky mountain spotted fever, tick - borne meningoencephalitis, babesiosis and crimean - congo hemorrhagic fever (cchf) (service 2012). also several flaviviruses are transmitted by ixodes ticks, that cause encephalitis and haemorrhagic fever among humans (capinera 2010). ticks are common in eurasia and africa and are usually found in similar habitat to that of hedgehogs (causey. hedgehogs are a frequent host of hard tick i. hexagonus (gern. an enzootic transmission cycle of b. burgdorferi involving hedgehogs and i. hexagenus, another tick vector, has been described in urban environment (gern. fleas such as ticks transmit many diseases to humans and animals, viral, bacterial, rickettsial and protozoal diseases, in addition some helminths are transmitted by fleas (boris 2008). fleas can transmit yersinia pestis, rickettsia typhy, r. felis, bartonella henselae, myxoma virus and some helminthic diseases, such as hymenolepis nana and dipylidium caninum (tapeworms). rodents are predominant host and 74 % of fleas feed on rodents (otranto and wall 2008, capinera 2010). the aim of our study was to detect the infestation rates of east hedgehogs (erinaceus concolor) with ticks and fleas in van province, eastern region of turkey. hadgehogs were captured between june and sebtember 2013 with the aid of spotlight nightly walks through parts of the study area. in order to estimate flea and tick infestation of hedgehogs, we immobilized the ectoparasites by polluting the body with a insecticide including trichlorphon (neguvon-bayer). immobilized fleas were removed from the hedgehogs by gently shaking the animal over a sheet of paper and then all the fleas counted. we collected all ticks from hedgehogs and conserved them in 70 % ethanol for post identification. hadgehogs were captured between june and sebtember 2013 with the aid of spotlight nightly walks through parts of the study area. in order to estimate flea and tick infestation of hedgehogs, we immobilized the ectoparasites by polluting the body with a insecticide including trichlorphon (neguvon-bayer). immobilized fleas were removed from the hedgehogs by gently shaking the animal over a sheet of paper and then all the fleas counted. we collected all ticks from hedgehogs and conserved them in 70 % ethanol for post identification. throughout the investigation, 60 ixodid ticks and 125 fleas in total were collected from 21 hedgehogs, collected seven hedgehoges each locality, from three different localities. all the collected ticks belonged to rhipicephalus turanicus species and all fleas belonged to archaeopsylla erinacei species (fig. 1, fig. 2). other ectoparasites, apart from this kind of species, were not observed in this investigation. table 1 and table 2 shows localities where hedgehogs were obtained and the numbers and gender distribution of the fleas and ticks that were collected from these hedgehogs. a) dorsal view of male rhipicephalus turanicus, b) spiracular plate of male rhipicephalus turanicus, c) dorsal view of female rhipicephalus turanicus, d) spiracular plate of female rhipicephalus turanicus a) female archaepsylla erinacei, b) male archaepsylla erinacei, c), d) adult ticks on the hedgehog locality names and numbers of hedgehogs numbers and gender distribution of fleas and ticks obtained from hedgehogs one of the most important arbovirus transmitted by ticks is crimean - congo hemorrhagic fever viruse (cchfv) believed to be survived mainly by hyalomma ixodid ticks in the nature. ticks and fleas are important vectors of several patogens and majority of this patogens are zoonotic. but cchfv has been isolated in nature among at least 30 tick species including i. ricinus, r. sanguineus, r. turanicus, r. bursa and dermacentor spp. adult of r. turanicus normally infest cattle, sheep and dogs in mediterranean region but it can also effect humans (chochlakis. its immature forms generally infest hedgehogs, gerbils and murid rodents (estrada - pea. rhipicephalus turanicus is a vector of q - fever and north asian tick typhus caused by rickettsia sibirica (ioffe - uspensky. some studies performed on hedgehogs ticks, prevalence of r. turanicus infestation was detected respectively 67.70 % in urmia city and 5.26 % tabriz city of iran (gorgani - firouzjaee. 2014), and 77.80 % tokat city, central anatolia region of turkey (bursali. rate of the tick infestation in present study (66.66%) was detected approximately similar to studies of gorgani - firouzjaee. it is also hosted by cats and dogs other than hedgehogs and it may be transferred from hedgehogs through direct contact. human cases with fleabite eruption reported in some countries (pomycal 1985, naimer. prevalence of a. erinacei in hedgehogs was detected 55.90 % in iran, neighboring country of turkey (gorgani - firouzjaee. we detected ticks (r. turanicus) and fleas (a. erinacei) in hedgehogs at fairly high rates. many ticks and fleas species may harbor on hedgehogs and transmit some tick - borne and flea - borne patogens. therefore, hedgehogs sharing the same habitates with humans in especially urban and suburban regions may be transmission of some tick - borne and flea - borne diseases from hedgehogs to humans. at least, hedgehogs ticks and fleas | background : ixodid ticks (acari : ixodidae) and fleas (siphonaptera) are the major vectors of pathogens threatening animals and human healths. the aim of our study was to detect the infestation rates of east hedgehogs (erinaceus concolor) with ticks and fleas in van province, eastern region of turkey.methods:we examined fleas and ticks infestation patterns in 21 hedgehogs, collected from three suburbs with the greater of number gardens. in order to estimate flea and tick infestation of hedgehogs, we immobilized the ectoparasites by treatment the body with a insecticide trichlorphon (neguvon-bayer).results : on the hedgehogs, 60 ixodid ticks and 125 fleas were detected. all of the ixodid ticks were rhipicephalus turanicus and all of the fleas were archaeopsylla erinacei. infestation rate for ticks and fleas was detected 66.66 % and 100 %, respectively.conclusion:we detected ticks (r. turanicus) and fleas (a. erinacei) in hedgehogs at fairly high rates. since many ticks and fleas species may harbor on hedgehogs and transmit some tick - borne and flea - borne patogens, this results are the important in terms of veterinary and public health. |
india has the world 's highest burden of tuberculosis (tb). in india, the multidrug - resistant tb (mdr - tb) prevalence among all patients with tb combined is estimated to be 4.1%. a crude estimate derived from these data is that 4500 6000 hiv - infected persons develop mdr - tb annually in india. diagnosis of any form of tb, including drug - resistant (dr) tb, is more challenging in the presence of hiv disease and together they result in higher case fatality rates. poly - drug resistant tb indicates resistance to two or more anti - tb drugs but not to both isoniazid (inh) and rifampicin (r) simultaneously. treatment of dr - tb in patients on antiretroviral therapy (art) is complex due to the drug interactions. dr - tb in hiv - infected children is difficult to diagnose and rarely reported. a 3-year - old hiv - infected boy was referred for further management in january 2005. mother was diagnosed as tuberculous pleural effusion with hiv infection with acid fast bacillus (afb) seen on sputum examination and was on ofloxacin (o), inh (h), and rifampicin (r) for the same. he had cervical adenopathy (non - tender, non - matted) and other systems were normal. investigations showed positive mantoux test (20 22 mm) and chest x - ray was suggestive of primary complex. his venereal disease research laboratory (vdrl) test, hbsag, and anti - hepatitis c were negative. he was started on anti - tuberculous therapy (att) consisting of 2 hrze + 10 hr (z = pyrazinamide, e = ethambutol). he was asymptomatic till june 2007, when we had mild molluscum contagiosum. in february 2009, at the age of 7 years, he was hospitalized with right lower zone pneumonia and his sputum was positive for afb. his sputum culture grew mycobacterium tuberculous (mtb) complex after 6 weeks and sensitivity after another 2 weeks showed resistance to streptomycin (s) and h. he was then shifted to rezo in may 2009 and art was started in the same period in view of decreasing cd4 count, consisting of zidovudine (azt), lamivudine (3tc), and nevirapine (nvp at 400 mg / m / day). ofloxacin was stopped in august 2009 and he was advised rez for another 6 months. in india, mdr - tb is estimated to account for 2.3% [95% confidence intervals (ci) : 1.8 2.8 ] of new cases and 17.2% (95% ci : 14.9 19.5) of previously treated tb cases. those at highest risk of dr - tb are in whom prior treatment had failed, cases of relapse, defaulters, and contacts of mdr - tb. drug resistance is rarely acquired in the pediatric population due to the paucibacillary nature of the disease and originates mainly in the adults who are treatment failures or defaulters. thus, the main method of resistance in children is primary transmission of the resistant bacilli. our patient had been treated for pulmonary tb in 2005 for 1 year but again developed tb in 2009, which is suggestive of a relapse. hiv co - infection is considered important in the development of dr - tb by increasing the rates of malabsorption of anti - tb drugs, thus causing treatment failures. the diagnosis of dr - tb is established by laboratory methods (drug susceptibility tests or dst) which, however, are not available in most resource - limited settings and are difficult to do in children. treatment of poly - resistant tb varies as per drug resistance pattern and consists of three to four sensitive drugs for six to eighteen months duration. for h and s resistance, as in our patient, the suggested regimen is rze for 69 months, and fluoroquinolone can be added in patients with extensive disease to strengthen the regimen. thus, children who had been treated for tb in the past should be screened for drug resistance by dst. this has also been reiterated in our series of children with mdr - tb and partial over extensively drug - resistant (xdr) tb in whom we found that over 50% of patients had been treated for tb in the past. dr - tb in hiv - infected children should be considered if the child has been treated with att in the past or there is contact with adults on second - line att therapy. poly - resistant tb is rare in children, especially in hiv - infected children. | drug - resistant tuberculosis (dr - tb) has been reported in india, but has been rarely documented in children. hiv co - infection has led to resurgence of tuberculosis (tb), making treatment even more difficult due to complex drug interactions. poly - resistant tb is rare in children, especially in hiv - infected children. we report an hiv - infected child who developed poly - resistant tb (resistance to streptomycin and isoniazid) after 3 years of completion of anti - tuberculosis treatment (att). his mother had also received att 3 years back. we conclude that dr - tb in hiv - infected children should be considered if the child had been treated with att in the past or there is contact with adults on second - line att therapy. |
at the towards other earths ii meeting held in porto portugal in 2014 september, one theme emerged that bares directly on the subject of this paper. intrinsic stellar activity (sa) has become the main limiting factor for planet searches in both transit and radial velocity (rv) data. sa includes stellar oscillations, granulation, spots and faculae / plagues and long - term magnetic activity cycles (see, e.g., saar & donahue 1997 ; santos. the presence of active regions on the stellar surface can show periodicities and amplitudes similar to those induced by real planetary signals.. currently the best rv precision is at the m s level but new spectrographs are under development like espresso and expres that aim to improve rv precision by a factor of approximately 10 over the current best spectrographs, harps and harps - n. clearly, the success of these developments hinges on our ability to distinguish true planetary signals from sa - induced signals. at the same time xavier dumusque challenged the community to a large - scale blind test using simulated rv data at the 0.7 m s level of precision, to understand the limitations of present solutions to deal with stellar signals and to select the best approach. the rv challenge data were generated using a modification of the soap code, which is described in boisse, bonfils & santos (2012) and dumusque, boisse & santos (2014). this paper describes a new approach to rv analysis using apodized keplerian (ak) models to distinguish between planetary and sa - induced rv signals. the methodology is developed in the next section using the initial challenge test data set for which the signals present were known in advance. this is followed by our analysis and results for the first five rv challenge data sets. the first step in the new approach employs ak models in which the semi - amplitude of the kepler rv model is multiplied by a symmetrical gaussian of unknown width and with an unknown centre of the apodizing window ta. the same model is used to fit both the planetary and sa - induced rv signals. since a true planetary signal spans the duration of the data, the apodization time,, will be large while sa - induced signals generally vary on shorter time - scales. one exception to this is the rapidly rotating (p = 0.59 d) active m4 dwarf gj 1243 which exhibits a starspot signal that remains stable over the entire baseline of the kepler mission (davenport, hebb & hawley 2015). as an additional check on the validity of planetary candidate signals, we employed a control diagnostic periodogram which is explained in section 2.4. in addition to the rv measurements, each of the 15 challenge data sets includes simultaneous observation of three sa diagnostics. two of these come from additional information on the spectral line shape that are extracted from the cross - correlation function (ccf), the average shape of all spectral lines of the star. these two shape parameters are the ccf width (full width at half - maximum, fwhm) and bisector span (bis). the third diagnostic log (rhk) is based on the ca ii h&k line flux that is sensitive to active regions on the stellar surface. a preliminary analysis of the first five data sets plus test data indicated a strong correlation between rv and the log (rhk) diagnostic and slightly reduced correlation with the fwhm diagnostic. for the data sets analysed in this study, the correlation with the bis diagnostic the general model for m ak signals also included a linear regression term between rv and the sa diagnostic log (rhk) as well as an extra gaussian noise term with unknown standard deviation s. the correlation term is expected to be particularly useful in removing sa signals associated with the star 's long - term magnetic cycle (dumusque. it is also expected to partially remove sa associated with the rotation of active regions (spots and plagues). for an m signal ak model, the predicted rv is given by (1)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{eqnarray } y(t_i) & = & v + \sum _ { j=1}^m \big [k_j \exp \big[-\frac{(t_i - t_{ja})^2}{2 \tau _ j^2}\big ] \nonumber \\ & & \times (\cos \lbrace \theta (t_i+\chi p_j)+\omega _ j\rbrace + e_j \cos \omega _ j) \big ] \nonumber \\ & & + \, the model also includes an extra gaussian white noise term with unknown standard deviation s which can account for stellar jitter. the equation involves 7 m + 3 unknown parameters v = a constant velocity; = the log (rhk) correlation parameter;kj = velocity semi - amplitude for the jth signal;j = apodization time constant for the jth signal;tja = centre of apodizing window for the jth signal;pj = the period for the jth signal;ej = the eccentricity for the jth signal;j = the longitude of periastron for the jth signal;j = the fraction of the period, prior to the start of data taking, that periastron occurred at. for a planetary signal, jpj = the number of days prior to ti = 0 that the star was at periastron, for an orbital period of pj days. the time ti = 0 corresponds to the unweighted average of the observation times.s = standard deviation of extra gaussian noise term. v = a constant velocity ; = the log (rhk) correlation parameter ; kj = velocity semi - amplitude for the jth signal ; j = apodization time constant for the jth signal ; tja = centre of apodizing window for the jth signal ; pj = the period for the jth signal ; ej = the eccentricity for the jth signal ; j = the longitude of periastron for the jth signal ; j = the fraction of the period, prior to the start of data taking, that periastron occurred at. for a planetary signal, jpj = the number of days prior to ti = 0 that the star was at periastron, for an orbital period of pj days. the item (ti + jpj) = the true anomaly, the angle of the star in its orbit relative to periastron at time ti. as described in more detail in gregory (2011), we employed a re - parametrization of and to improve the markov chain monte carlo (mcmc) convergence speed motivated by the work of ford (2006). the two new parameters are = 2 + and = 2. parameter is well determined for all eccentricities. although is not well determined for low eccentricities, it is at least orthogonal to the parameter. we use a uniform prior for in the interval 0 to 4 and uniform prior for in the interval 2 to + 2. this ensures that a prior that is wraparound continuous in (,) maps into a wraparound continuous distribution in (,). to account for the jacobian of this re - parametrization, it is necessary to multiply the bayesian integrals by a factor of (4), where np = the number of periods in the model the ak models were explored using an automated fusion mcmc algorithm (fmcmc), a general purpose tool for non - linear model fitting and regression analysis (gregory 2011, 2013). fmcmc is a special version of the metropolis mcmc algorithm that incorporates parallel tempering, genetic crossover operations and an automatic simulated annealing. each of these features facilitates the detection of a global minimum in chi - squared in a highly multi - modal environment. by combining all three the fmcmc is controlled by a unique adaptive control system that automates the tuning of the mcmc proposal distributions for efficient exploration of the model parameter space even when the parameters are highly correlated. the ak models combined with the fmcmc algorithm constitute a multi - signal ak periodogram. a more detailed description of fmcmc is available in chapter 1 of the supplement to bayesian logical data analysis for the physical sciences, a free supplement available in the resources section of the cambridge university press website for my textbook bayesian logical data analysis for the physical sciences : a comparative approach with mathematica support. a mathematica implementation of fmcmc is also available from the resource section. chapter 1 also includes a comparison of three marginal likelihood estimators used for bayesian model comparison and concludes in favour of the nested restricted monte carlo (nrmc) estimator which is used in this work. the supplement includes a detailed discussion of the priors adopted by this author for exoplanet rv analysis. two different frequency priors were discussed : (a) \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ p(f|i) = 1/\sqrt{f } \times 0.5/(\sqrt{f_h } -\sqrt{f_l})$\end{document } and (b) p(f|i) = 1/f 1/ln (fh / fl), where fh and fl are the prior upper and lower frequency bounds, respectively. in this work, (a) was used primarily for parameter estimation purposes which helps in the detection of shorter period signals while the scale - invariant form (b) was adopted for model comparison purposes which utilized nrmc method for marginal likelihood estimation. a new eccentricity prior was utilized in this work intermediate between kipping 's low - period (p 0.01 for the highest peak in the gls periodogram of the residuals, and the fmcmc results for the next more complicated model indicate that there is no well - defined solution for an additional signal. in the interest of space, we jump to our final five ak signal model results. the upper - left panel is a plot of the log10[prior likelihood ] versus iteration for the five - signal ak periodogram of the test data. the upper right shows log10[prior likelihood ] versus period showing the five periods detected. the middle left shows the values of the five unknown period parameter versus iteration number. the lower - left panel shows the span of the apodization window within the overall data window for each signal (grey trace for map values of and ta, black for a representative set of samples which is mainly hidden below the grey). the lower and upper boundaries of the jth apodization windows are defined by tja j and tja + j, respectively. the lower - right panel is a plot of the apodization time constant,, versus apodization window centre time, ta. based on the span of the apodization window, all of the signals, with the exception of p = 16 d, are consistent with sa. as a check on the planetary interpretation of the 16 d signal, fig. 3 indicates that p() for the control trace is within 0.03 of zero for a period of 16 d. at this point in the analysis, the peak in the gls periodogram of the five - signal ak fit residuals at p = 0.95 d was down to p() = 0.045. the upper - left panel is a plot of the log10[prior likelihood ] versus iteration for the five - signal ak periodogram of the test data. the upper right shows log10[prior likelihood ] versus period showing the five periods detected. the middle left shows the values of the five unknown period parameter versus iteration number. the lower left shows the apodization window for each signal (grey trace for map values of and ta, black for a representative set of samples which is hidden below the grey). the lower right is a plot of the apodization time constant,, versus apodization window centre time, ta, where the symbols refer to the different signal periods specified in the top panels. to obtain the best p = 16 d parameter estimates, the m ak model terms in equation (1) were replaced by four aks plus one ordinary keplerian to model the 16 d planetary signal, and the data refit. the starting fmcmc parameter values were taken from the best - fitting five ak signal model. 7 shows a sample of resulting 16 d parameter correlation plots, which in a bayesian analysis reflect our current state of knowledge for the 16 d planetary signal in the test data set. parameter correlation plots for the p = 16 d planetary signal in the test data set based on a model consisting of four aks plus one ordinary keplerian. the p and k values have been normalized by dividing by their true values to convert to ratios. since the true eccentricity = 0, the relevant phase for comparison is our re - parametrized phase term = 2 +. in our analysis, the phase is referenced to the mean observation time. this was converted to a phase referenced to the time of the first sample and added to an additional /2 to compare with the xavier dumusque 's definition of phase which refers to a sine function while ours refers to a cosine function. it is not too meaningful to draw any conclusions about parameter biases on the basis of this one data set. later in section 4, we compare the k and p parameter estimates derived from the m ak model fits to the k ak plus (m k) kepler model fits for the six data sets analysed (including the test data). it is clear that ak model estimates of the k parameter are significantly biased to larger values compared to their known true values. as a result, our final parameter estimates for candidate planets were based on the k ak plus (m k) kepler model fits, where k is the number of signals attributed to sa. ideally, we would like to see the bayesian marginals span the true values of p, k and phase slightly better than indicated by fig. 7. this might be an indication that the true scatter is underestimated possibly as a result of correlated noise in the residuals. one way of exploring the residuals is to compute the autocorrelation function, (j), (3)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation } \rho (j) = \frac{\sum _ { \rm overlap } [(x_{i}-\overline{x})\ (x_{i+j}-\overline{x})]}{\sqrt{\sum _ { \rm overlap } (x_{i}-\overline{x})^2 } \times \sqrt{\sum _ { \rm overlap } (x_{i+j}-\overline{x})^2 } }, \end{equation}\end{document}where xi is the ith residual, j is the lag and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \overline{x}$\end{document } is the mean of the samples in the overlap region. the top row of fig. 8 shows the autocorrelation function of the (rhk corrected) rv test data and the raw log (rhk) diagnostic. note that the highest peak in the autocorrelation function for the log (rhk) diagnostic corresponds roughly with the star 's true rotation period of 25.05 d (vertical dashed line). the left - hand panel in the second row shows the autocorrelation function for the rv residuals for the four ak plus one kepler model including the log (rhk) regression. clearly, after removing a model consisting of five signals and the log (rhk) regression, the autocorrelation of the residuals is looking much closer to white noise but there is still evidence for a small positive autocorrelation for a lag of 1 d. the remaining panel shows a plot of the number of such sample pairs as a function of the lag. because the data are not uniformly sampled, for each lag all sample pairs that differed in time by this lag 0.1 d were utilized. the top row shows the autocorrelation function of the (rhk corrected) rv test data and the raw log (rhk) diagnostic. the left - hand panel in the second row shows the autocorrelation function of the rv residuals after removing a model consisting of four ak signals plus one kepler signal and the log (rhk) regression. the bottom panel shows a plot of the number of such sample pairs as a function of the lag. in this section, we summarize the steps in the methodology and illustrate its success in modelling the both long - term and short - term sa - induced rv variations. remove the best linear regression fit from the raw rv data to obtain the rv (rhk corrected) data, using the sa diagnostic log (rhk) as the independent regression variable.compute the gls periodogram of rv (rhk corrected) and p - value levels corresponding to 0.1, 0.01, 0.001. the highest peak in this periodogram is used as the initial estimate for the period of the ak model signal.remove the best linear regression fit from the raw fwhm data to obtain the control fwhm (rhk corrected) data, using the log (rhk) diagnostic as the independent regression variable.compute the gls periodogram of control fwhm (rhk corrected).compute the differential gls periodogram for selected period regions, showing on the same plot the periodogram of rv (rhk corrected) in black, the periodogram of the control fwhm (rhk corrected) plotted negatively and shown in dark grey, and the their sum shown in grey. planetary candidate signals for which the grey trace and black trace are significantly different (i.e. the dark grey trace has a p() more negative than 0.05) indicate that the signal is possibly sa in origin.fit the model described by equation (1) to the raw rv data, in our case using the fmcmc algorithm. use the highest peak in the gls periodogram of the rhk - corrected rv data as the initial estimate for the period of the ak model signal, regardless of whether the differential gls periodogram indicates it is sa in origin. we are using the aks to model both types of signals.compute the gls and differential periodograms of the fit residuals.repeat the last two steps by including an additional ak signal with an initial period estimated from the largest peak in the gls periodogram of the previous fit residuals.repeat the previous step until the p - value of the highest peak in the residuals is greater than 0.01 and the fmcmc fit indicates that there is no well - defined solution for an additional signal.examine the span of the apodization window for the map parameter values and representative samples for each signal extracted. the lower and upper boundaries of the jth apodization windows were chosen to be tja j and tja + j, respectively.if the apodization window spans the data duration, and p() for the dark grey trace in the differential periodogram of the residuals is less negative than 0.05, then treat the signal as a candidate planetary signal. if the apodization window spans the data duration and p() for the dark grey trace is more negative than 0.05, then treat the signal as a possible candidate planetary signal. if the apodization window does not span the data duration, classify it as a sa signal.maintain a list of the order in which the signals were extracted and the signal designation as p for planetary candidate, p ? for possible planetary candidate and sa for stellar activity signal.suppose there are m signals in total, k of which are sa signals and (m k) are planetary candidates or possible planetary. fit a model with k ak signals and (m k) ordinary keplerian signals together with the rhk(ti) term of equation (1) to derive final parameter estimates for the planetary and possible planetary candidates.compute bayes factors as a further test of the validity of any planetary candidate. remove the best linear regression fit from the raw rv data to obtain the rv (rhk corrected) data, using the sa diagnostic log (rhk) as the independent regression variable. compute the gls periodogram of rv (rhk corrected) and p - value levels corresponding to 0.1, 0.01, 0.001. the highest peak in this periodogram is used as the initial estimate for the period of the ak model signal. remove the best linear regression fit from the raw fwhm data to obtain the control fwhm (rhk corrected) data, using the log (rhk) diagnostic as the independent regression variable. compute the gls periodogram of control fwhm (rhk corrected). compute the differential gls periodogram for selected period regions, showing on the same plot the periodogram of rv (rhk corrected) in black, the periodogram of the control fwhm (rhk corrected) plotted negatively and shown in dark grey, and the their sum shown in grey. planetary candidate signals for which the grey trace and black trace are significantly different (i.e. the dark grey trace has a p() more negative than 0.05) indicate that the signal is possibly sa in origin. fit the model described by equation (1) to the raw rv data, in our case using the fmcmc algorithm. use the highest peak in the gls periodogram of the rhk - corrected rv data as the initial estimate for the period of the ak model signal, regardless of whether the differential gls periodogram indicates it is sa in origin. compute the gls and differential periodograms of the fit residuals. repeat the last two steps by including an additional ak signal with an initial period estimated from the largest peak in the gls periodogram of the previous fit residuals. repeat the previous step until the p - value of the highest peak in the residuals is greater than 0.01 and the fmcmc fit indicates that there is no well - defined solution for an additional signal. examine the span of the apodization window for the map parameter values and representative samples for each signal extracted. the lower and upper boundaries of the jth apodization windows were chosen to be tja j and tja + j, respectively. if the apodization window spans the data duration, and p() for the dark grey trace in the differential periodogram of the residuals is less negative than 0.05, then treat the signal as a candidate planetary signal. if the apodization window spans the data duration and p() for the dark grey trace is more negative than 0.05, then treat the signal as a possible candidate planetary signal. if the apodization window does not span the data duration, classify it as a sa signal. maintain a list of the order in which the signals were extracted and the signal designation as p for planetary candidate, p ? for possible planetary candidate and sa for stellar activity signal. suppose there are m signals in total, k of which are sa signals and (m k) are planetary candidates or possible planetary. fit a model with k ak signals and (m k) ordinary keplerian signals together with the rhk(ti) term of equation (1) to derive final parameter estimates for the planetary and possible planetary candidates. this is discussed further starting in section 3.2. in the upper - left panel of fig. 9, the (open circles) represent the raw rv test data minus the map fit for the 16 d planet which we designate as rv1plancorr. the dots show how much of the rv1plancorr can be accounted for by a correlation with the sa diagnostic log (rhk), based on a weighted least - squares linear regression fit using log (rhk) as the independent regression variable. the starred points show the difference between the open circles and the dots. removing the correlation with log (rhk) reduced the standard deviation of rv1plancorr from 8.38 to 2.29 m s. clearly, the log (rhk) regression fit tracks the long - term sa very well. close inspection of the seasonal panels indicates that the regression fit only provides a first - order tracking of the short - term variations in rv arising from individual active regions (spots and plagues). the open circles in the upper - left panel show the raw rv test data minus the map fit for the 16 d planet. the dots show how much of this remainder can be accounted for by a correlation with the sa diagnostic log (rhk). the other panels show expanded versions, one for each observing season. in the upper - left panel of fig. the dots show the map fit of the full model consisting of four aks plus one ordinary keplerian (to model the 16 d planetary signal), together with the linear regression term using log (rhk) as the independent regression variable. the starred points show the difference between the open circles and the dots. employing the full model reduced the standard deviation of from 8.55 to 1.35 m s. the other panels show expanded versions, one for each observing season. clearly, the full model provides a much better fit to the rv data including the short - term variations arising from individual active regions. the open circles in the upper - left panel show the raw rv test data. the dotted points show how much of each rv measurement can be accounted for by the full model (equation 1) fit. the procedures outlined in section 2 were applied to the first five rv challenge data sets and the results are given below. table 1 shows the order in which the signals emerged in successive ak models together with the signal designation as planetary (p) or stellar activity (sa) in the final column. order of signals extracted from rv 1 together with approximate parameter values and designation of signal type as planetary (p) or stellar activity (sa). comparison of the raw rv and fwhm and log (rhk) diagnostics indicated that there was a clear correlation between the three. the raw rv 1 data had a standard deviation of 5.6 m s. after removing the best linear regression fit with log (rhk) as the independent variable, the standard deviation was reduced to 3.0 m s. the panels on the left of fig. 11 show the rv data and fwhm (control) with the best linear regression fits to log (rhk) removed (rhk corrected). note that for each ak model fit, the correlation parameter between rv and the sa diagnostic log (rhk) was included as a fit parameter according to equation (1). 12 shows the differential gls periodogram for the rv 1 data (rhk corrected) for selected period ranges. the strongest signal at p = 33 d has no significant counterpart in the control. the rv 1 data and fwhm (control) after removing the best linear regression fits to log (rhk) (rhk corrected) together with their gls periodograms on the right. the differential gls periodogram for the rv 1 data (rhk corrected) for selected period ranges. the lower - left panel shows the span of the apodization window within the overall data window for each signal (grey trace for map values of and ta, black for a representative set of samples which is mainly hidden below the grey). the lower and upper boundaries of the jth apodization window are defined by tja j and tja + j, respectively. it is clear from this that there are three planetary candidates with periods of 9.89, 23.4, 33.3 d whose apodization windows span the duration of the data. the upper - left panel is a plot of the log10[prior likelihood ] versus iteration for the six signal ak periodogram of the rv 1 data. the upper right shows log10[prior likelihood ] versus period showing the six periods detected. the middle left shows the values of the six unknown period parameters versus iteration number. the lower left shows the apodization window for each signal (grey trace for map values of and ta, black for a representative set of samples which is mainly hidden below the grey). the lower right is a plot of the apodization time constant,, versus apodization window centre time, ta, where the symbols refer to the different signal periods specified in the top panels. the weighted rms residual = 1.44 m s for the six ak signal model. the standard deviation of the extra gaussian white noise term s = 1.26 m s. the mean measurement uncertainty was 0.674 m s. fig. 14 shows the rv 1 six - signal ak model residuals [i.e. m = 6 in equation (1) ], its gls periodogram (top right) and the differential periodogram for selected period ranges. the dashed line representing the p - value = 0.01 is not seen as it is just above the top of the graph. these results are consistent with the conclusion that the p = 9.89, 33.35, 23.4 d signals are bona fide planetary candidates. the panels show the rv 1 six - signal ak model residuals (top left), its gls periodogram (top right) and the differential periodogram for selected period ranges. table 2 shows the true parameters of the five planetary signals that were employed in the rv 1 simulation. clearly, the three planetary signals with k > 1 were recovered in our analysis but there is no clear evidence for the two weaker planetary signals at p = 112 and 273 d in the gls residuals of fig. 14. the true p, k, e parameters of the five planetary signals that were employed in the rv 1 simulation. the top row of fig. 15 shows the autocorrelation function of the raw rv data and the log (rhk) diagnostic. in this particular case, the highest peak in the autocorrelation function for the log (rhk) diagnostic corresponds closely with the star 's rotation period of 25.05 d. sa signals frequently occur at the rotation period and harmonics. the second row shows the autocorrelation function for the rv data with just the ln(rhk) regression removed (rhk corrected) and the six ak model residuals. in this case, after the six ak signals and log (rhk) regression are removed, the autocorrelation of the residuals is looking close to white noise. the top row shows the autocorrelation function of the raw rv 1 data and the log (rhk) diagnostic. the second row shows the autocorrelation function for the rv data with log (rhk) regression removed (rhk corrected) and the six ak model residuals. table 3 gives the final parameter estimates for the three planetary candidates derived from a model consisting of three aks for the sa signals and three keplerians for the planetary candidates. this analysis yielded the same set of periods found in the six ak model fit. the quoted eccentricity values are for the mode while for the other parameters we quote the median. the errors on semi - major axis, a, and msin i do not include the uncertainty in the mass of the host star. the last row gives the date of the periastron passage that occurs just prior to our reference date jdb = 55855.666 d which is the unweighted mean observation time for rv 1. rv 1 parameter estimates and 68 per cent credible boundaries for three planetary candidates discussed in the text. the quoted eccentricity values are for the mode while for the other parameters we quote the median. the errors on semi - major axis, a, and msin i do not include the uncertainty in the mass of the host star. see the note on periastron passage in the text. to test the significance of the three planetary candidates, we computed bayes factors comparing the following four models : (a) zero keplerian signals with only the log (rhk) regression removed, (b) one 33.35 d keplerian signal plus the log (rhk) regression, (c) two (33.35 and 9.89 d) keplerian signals plus log (rhk) regression, and (d) three (33.35, 9.89, 23.4 d) keplerian signals plus log (rhk) regression. relative to model (d), the bayes factors are \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation } 3.8 \times 10^{-66}:7.2 \times 10^{-45}:1.6 \times 10^{-26}:1.0. \end{equation } \end{document}the bayes factors were computed from model marginal likelihoods based on the nrmc method (gregory & fischer 2010 ; gregory 2011, 2013, and in more detail in section 1.6 of the supplement to bayesian logical data analysis for the physical sciences, available in the resources section of the cambridge university press website for my textbook bayesian logical data analysis for the physical sciences : a comparative approach with mathematica support). comparison of the raw rv and fwhm and log (rhk) diagnostics indicated that there was a clear correlation between the three. the raw rv 2 data had a standard deviation of 8.58 m s. after removing the best linear regression fit with log (rhk) as the independent variable, the standard deviation was reduced to 3.95 m s. the two rows of fig. 16 show the rhk - corrected rv and fwhm control together with their gls periodogram on the right. 17 shows the differential periodogram for the rhk - corrected rv data for selected period ranges. the strongest signal at p = 10.64 d has no significant counterpart in the control. the rv 2 data and fwhm (control) after removing the best linear regression fits to log (rhk) together with their gls periodograms on the right. the differential gls periodogram for the rhk - corrected rv 2 data for selected period ranges. the lower - left panel shows the span of the apodization window within the overall data window for each signal (grey trace for map values of and ta, black for a representative set of samples which is mainly hidden below the grey). it is clear from this that there are three planetary candidates with periods of 3.77, 10.64 and 75.56 d whose apodization windows span the duration of the data. 18 although the apodization time constant of 800 d for the 10.64 d signal makes it a borderline p candidate. also, the presence of sa activity at a period of 11.32 d, in the close vicinity of the 10.64 d signal, perhaps called into question a planetary interpretation of the 10.64 d signal. for the competition, the upper - left panel is a plot of the log10[prior likelihood ] versus iteration for the eight - signal ak periodogram of the rv 2 data. the upper right shows log10[prior likelihood ] versus period showing the eight periods detected. the middle left shows the values of the eight unknown period parameters versus iteration number. the lower left shows the apodization window for each signal (grey trace for map values of and ta, black for a representative set of samples which is mainly hidden below the grey). the lower right is a plot of the apodization time constant,, versus apodization window centre time, ta. the weighted rms residual = 1.42 m s for the eight ak signal model. the standard deviation of the extra gaussian white noise term s = 1.25 m s. the mean measurement uncertainty was 0.674 m s. fig. 19 shows the rv 2 eight - signal ak model residuals (i.e. m = 8 in equation 1), its gls periodogram (top right) and the differential periodogram for selected period ranges. the highest spectral peak in the residuals has a p - value just 1 were recovered in our analysis but there is no clear evidence for the two weaker planetary signals at p = 5.79 and 20.16 d in the gls residuals of fig. 19. the true p, k, e parameters of the five planetary signals that were employed in the rv 2 simulation. the same set of periods was obtained using a model consisting of five ak signals and three keplerian signals. final parameter estimates for the three planetary candidates were derived from this latter model and are given in table 6. the quoted eccentricity values are for the mode while for the other parameters we quote the median. the errors on semi - major axis, a, and msin i do not include the uncertainty in the mass of the host star. the last row gives the date of the periastron passage that occurs just prior to our reference date jdb = 55855.6693 d which is the unweighted mean observation time for rv 2. rv 2 parameter estimates and 68 per cent credible boundaries for three planetary candidates discussed in the text. the errors on semi - major axis, a, and msin i do not include the uncertainty in the mass of the host star. to test the significance of the first two planetary candidates, we computed bayes factors comparing the following models : (a) zero keplerian signals with only the log (rhk) regression removed, (b) one 3.77 d keplerian signal plus the log (rhk) regression, (c) two (3.77 and 10.64 d) keplerian signals plus log (rhk) regression. the bayes factors relative to model (c) are \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation } 5.6 \times 10^{-60}:9.3 \times 10^{-37}:1.0. \end{equation } \end{document}the three - planet model was compared to the two - planet model by comparing the two models : (a) three aks (p = 8.33, 12.5, 24.8 d) plus two keplerians (3.77, 10.64 d) plus the log (rhk) regression to (b) three aks (p = 8.33, 12.5, 24.8 d) plus three keplerians (3.77, 10.64, 75.7 d) plus the log (rhk) regression. the bayes factor relative to model (b) is 3.4 10:1.0. comparison of the raw rv and fwhm and log (rhk) diagnostics indicated that there was a clear correlation between the three. the raw rv 3 data had a standard deviation of 10.85 m s. after removing the best linear regression fit with log (rhk) as the independent variable, the standard deviation was reduced to 5.49 m s. the two rows of fig. 20 show the rhk - corrected rv data and fwhm control together with their gls periodogram on the right. 21 shows the differential periodogram for the rhk - corrected rv data for selected period ranges. the strongest signal at p = 48.8 d has no significant counterpart in the control. strong yearly and daily aliases of the 48.8 d signal are also evident. the rv 3 data and fwhm (control) after removing the log (rhk) diagnostics (rhk corrected) together with their gls periodograms on the right. the differential gls periodogram for the rhk - corrected rv 3 data for selected period ranges. table 7 lists (in order of extraction) the signals, their nominal parameter values and designation of signal type as planetary (p) or stellar activity (sa) based on the mcmc parameter estimates. the weighted rms residual = 1.79 m s for the six ak signal model. the standard deviation of the extra gaussian white noise term s = 1.66 m s. the mean measurement uncertainty was 0.674 m s. three signals (p = 17, 48.8 and 1100 d) were initially classified as planetary although there was a noticeable signature (p() > 0.05) of the 17 d signal in the fwhm control trace which resulted in a probable p classification. order of signals extracted from rv 3 together with approximate parameter values and designation of signal type as planetary (p) or stellar activity (sa). 22, after signals at 12.5, 17, 48.8 and 333 d were first removed. the same set of periods was obtained using a model consisting of three ak signals plus three keplerian signals and the log (rhk) regression term. the one difference from the six ak signal fit is that now the signal near p 1100 d has a low - eccentricity tail extending to approximately double that period. to test the significance of the first two planetary candidates, we computed bayes factors comparing the following models : (a) zero keplerian signals with only the log (rhk) regression removed, (b) one 48 d keplerian signal plus the log (rhk) regression, (c) two (48 and 17 d) keplerian signals plus log (rhk) regression. the bayes factors relative to model (c) are \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation } 2.7 \times 10^{-101}:1.2 \times 10^{-54}:1.0. \end{equation } \end{document}the three - planet model was compared to the two - planet model by comparing the two models : (a) two aks (p = 12.5, 333 d) plus two keplerians (48, 17 d) plus the log (rhk) regression to (b) two aks (p = 12.5, 333 d) plus three keplerians (48, 17, 1100 d) plus the log (rhk) regression. the bayes factor relative to model (b) is 1.3 10 : 1.0. final parameter estimates for the planetary candidates were derived from this three ak signals plus three keplerian signals plus log (rhk) regression model. the last row gives the date of the periastron passage that occurs just prior to our reference date jdb = 55855.6693 d which is the unweighted mean observation time for rv 3. rv 3 parameter estimates and 68 per cent credible boundaries for three planetary candidates discussed in the text. the quoted eccentricity values are for the mode while for the other parameters we quote the median. the errors on semi - major axis, a, and msin i do not include the uncertainty in the mass of the host star. table 9 shows the true p, m, k, e parameters of the seven planetary signals that were employed in the rv 3 simulation. the true p, m, k, e parameters of the seven planetary signals that were employed in the rv 3 simulation. clearly, two planetary signals with k > 1 were recovered in our analysis and the p/2 harmonic of the p = 2315 d signal. there is evidence for a signal at p 590 d in the rhk - corrected data (fig. it does not survive the removal of the larger 1200 d signal, possibly because it is essential a harmonic of the 1200 d signal. 24 shows the residuals, their gls and differential gls periodogram, for a model consisting of three ak signals plus three keplerian signals plus log (rhk) regression. the highest residual is at p = 1.036d and has a p - value 0.001. weak features are in evidence close to p = 1.1188 and 26.3 d but nothing close to 201 d. the top - left panel shows the rv 3 residuals for a model consisting of three ak signals, three keplerian signals plus the log (rhk) regression. the other panels show the gls periodogram (top right) and the differential periodogram for selected period ranges. a portion of the differential gls periodogram illustrating the 1200 d signal for the rv 3 data after the 12.5, 17, 48.8 and 333 d signals plus the log (rhk) regression were removed. figure for rv 3 data shows the eccentricity versus period parameters for the six signals obtained using a model consisting of three ak signals, three keplerian signals plus log (rhk) regression. comparison of the raw rv and fwhm and log (rhk) diagnostics indicated that there was a clear correlation between the three. the raw rv 4 data had a standard deviation of 8.30 m s. after removing the best linear regression fit with log (rhk) as the independent variable, the standard deviation was reduced to 3.32 m s. the two rows of fig. 25 show that the rhk - corrected rv data and fwhm control together with their gls periodogram on the right. 26 shows the differential periodogram for the rhk - corrected rv data for selected period ranges. the rv 4 data and fwhm (control) after removing the best linear regression fits to log (rhk) together with their gls periodograms on the right. the differential gls periodogram for the rhk - corrected rv 4 data for selected period ranges. the lower - left panel shows the span of the apodization window within the overall data window for each signal (grey trace for map values of and ta, black for a representative set of samples which is mainly hidden below the grey). the map apodization window for the p = 11.75 signal clearly spans the duration of the data and on this basis alone it would be classified as a planetary candidate. 28) has a p() = 0.06 at the 11.75 d period, which is the main reason it was classified as (p ?). also, the proximity of the sa signals at 11.33 suggested that the 11.75 d signal might be another sa component. the upper - left panel is a plot of the log10[prior likelihood ] versus iteration for the eight - signal ak periodogram of the rv 4 data. the upper right shows log10[prior likelihood ] versus period showing the eight periods detected. the middle left shows the values of the eight unknown period parameters versus iteration number. the lower left shows the apodization window for each signal (grey trace for map values of and ta, black for a representative set of samples which is mainly hidden below the grey). the lower right is a plot of the apodization time constant,, versus apodization window centre time, ta. the rv 4 residuals, their gls periodogram and differential periodogram for the eight ak signal model. based on the apodization window, the p = 0.943 d signal was also initially classified as a possibly planetary (p ?). bayesian model comparison (see below) indicates that the p = 0.943 d signal is not significant. the weighted rms residual = 1.52 m s for the eight ak signal model. the standard deviation of the extra gaussian white noise term s = 1.36 m s. the mean measurement uncertainty was 0.674 m s. table 10 lists (in order of extraction) the signals, their nominal parameter values and designation of signal type as planetary (p), (p ?) or stellar activity (sa) based on the mcmc parameter estimates. (p = 11.75 and 0.943 d) which as mentioned above were initially classified as possibly planetary candidates. order of signals extracted from rv 4 together with approximate parameter values and designation of signal type as planetary (p) or stellar activity (sa). to test the significance of the possible p = 0.943 d planetary candidate, we computed the bayes factor comparing the following models : (a) six ak signals plus the log (rhk) regression, and (b) six ak signals plus one keplerian (0.943 d) plus the log (rhk) regression. the bayes factor of (a) relative to model (b) is 64 : 1.0 which clearly indicates that the 0.943 d signal is not significant. that left one possible planetary candidate at p = 11.75 d. when the results of the challenge were announced, it turned out that rv 4 data set contained no planetary signal. comparison of the raw rv and fwhm and log (rhk) diagnostics indicated that there was a strong correlation between the three. the raw rv 5 data had a standard deviation of 8.92 m s. after removing the best linear regression fit with log (rhk) as the independent variable, the standard deviation was reduced to 2.59 m s. the two rows of fig. 29 show the rhk - corrected rv data and fwhm control together with their gls periodogram on the right. 30 shows the differential periodogram for the rv data (rhk corrected) for selected period ranges. the rv 5 data and fwhm (control) after removing the best linear regression fits to log (rhk) together with their gls periodograms on the right. the differential gls periodogram for the rhk - corrected rv 5 data for selected period ranges. the upper - left panel is a plot of the log10[prior likelihood ] versus iteration for the six - signal ak periodogram of the rv 5 data. the upper right shows log10[prior likelihood ] versus period indicating multiple six period solutions. the middle - left panel which plots period versus mcmc iteration indicates that the 0.9613, 15.3, 21.2, 40, 179.7, 335 d solution is dominant. the lower left shows the span of the apodization window within the overall data window for each signal (grey trace for map values of and ta, black for a representative set of samples). the lower right is a plot of the apodization time constant,, versus apodization window centre time, ta. the upper - left panel is a plot of the log10[prior likelihood ] versus iteration for the six - signal ak periodogram of the rv 5 data. the upper right shows log10[prior likelihood ] versus period indicating multiple six period solutions. the lower left shows the apodization window for each signal (grey trace for map values of and ta, black for a representative set of samples which is mainly hidden below the grey). the lower right is a plot of the apodization time constant,, versus apodization window centre time, ta. table 11 lists (in order of extraction) the signals, their nominal parameter values and designation of signal type as planetary (p) or stellar activity (sa) based on the mcmc parameter estimates. the weighted rms residual = 1.18 m s for the six ak signal model. the standard deviation of the extra gaussian white noise term s = 0.98 m s. only one signal (p = 0.9610 d) was initially classified as a possible an examination of the apodization window span (lower - left panel in fig. order of signals extracted from rv 5 together with approximate parameter values and designation of signal type as planetary (p) or stellar activity (sa). to test the significance of a possible p = 0.9610 d planetary candidate, we computed the bayes factor comparing the following models : (a) five ak signals plus the log (rhk) regression, and (b) five ak signals plus one keplerian (0.961 d) plus the log (rhk) regression. the periods of the five apodized planets are the first five listed in table 11. the bayes factor of (a) relative to model (b) is 7.9 10 : 1.0 which clearly indicates that the 0.961 d signal is not significant. on the basis of this analysis, we can not make a good case for any planetary signal in this data set. what can we learn looking back at our analysis from knowledge of the true planetary signals used in the simulation ? table 12 shows the true p, m, k, e parameters of the six planetary signals that were employed in the rv 5 simulation. the 0.961 d signal is consistent with a sidereal alias of 26.4237 d which is close to the value of the true 26.2 d period. if our signal at 179 d is a consequence of the true 173 d signal, then it is apparent that for a true amplitude of 0.59 m s the apodizing model is failing to discern this as a planetary signal. the weighted rms residual = 1.18 m s of the six ak signal model while the mean measurement uncertainty is 0.674 m s. the true p, m, k, e parameters of the six planetary signals that were employed in the rv 5 simulation. we now turn to consider how successful the ak method has been in the five challenge simulations that were analysed in this way. out of a total of 10 planetary signals with k > 1 m s, the method correctly identified six as class (p), two as (p ?) and claimed another as (p) which turned out to be the first harmonic of a true planet with period longer than the data set. it missed a true planet with p = 596 d and k = 1.91 m s. the ak method did not successfully detect any of the seven planets with k < 1 m s. although the mean measurement error for all five of the data sets was 0.674 m s, the fit residuals ranged from 1.2 to 1.7 m s. on the other hand, the ak method did not lead to any false detections. two signals were initially listed as (p ?) in data set 4 but one was strongly ruled out by the bayes factor. for the other, the differential gls periodogram played an important role in restricting the classification to (p ?). another signal was initially listed as (p ?) in data set 5 but again was strongly ruled out by the bayes factor. for the challenge data sets analysed to date, the standard deviation of the data is clearly dominated by sa. table 13 summarizes the performance of the ak approach regarding its ability to penetrate the fog of sa. the last column gives the ratio of the initial data standard deviation to the standard deviation of the final residuals which has an average value of 5.9 ; however, the residuals are on average a factor of 2.3 the mean measurement uncertainty. the average reduction that is due to the linear regression term alone is a factor of 2.5. as was mentioned in section 3, the ak method was employed to distinguish between sa and planetary candidates. 32 shows the individual k parameter marginal distributions for the eight planets detected plus one test data set planet based on ak model fits plus a log (rhk) regression term. set, the results are based on model fits consisting of m aks plus a log (rhk) regression, where m is the total number of signals fit. 33 shows the individual k parameter marginal distributions for the eight planets detected plus the one test data set planet, based on model fits consisting of k aks plus m k keplerians plus a log (rhk) regression. m is the total number of signals and (m k) is the number classified as a planetary candidate in the analysis. in this case set, the results are based on model fits consisting of k aks plus (m k) keplerians plus a log (rhk) regression, where m is the total number of signals. there is a known bias towards higher eccentricity values for keplerian models of rv data, e.g. shen & turner (2008) and zakamska, pan & ford (2011). is it really true that the ak models are biased towards higher k values, or do they have a bias towards higher e, which would also inflate the k values ? 34 show a comparison of the marginal eccentricity distributions for the three planets detected in the rv 1 data set. the solid curves are the distributions obtained with the ak model and the dashed are for the pure kepler model. if anything, the eccentricity bias of the ak model fits is towards lower values when compared to the pure kepler fits. the lower row of panels show the corresponding comparison for k values for the rv 1 planets. the top row of panels show a comparison of the marginal eccentricity distributions for the three planets detected in the rv 1 data set. the solid curves are the distributions obtained with the ak model and the dashed are for the pure kepler model. figs 35 and 36 show similar plots for the period parameter. in fig. 36, only two of the nine marginals overlap the true period within the 68 per cent credible region. this could be a consequence of the remaining undetected planets with smaller k values and/or inadequate modelling of the sa signals, leading to correlated residuals. set, the results are based on model fits consisting of m aks plus a log (rhk) regression, where m is the total number of signals fit. set, the results are based on model fits consisting of k aks plus (m k) keplerians plus a log (rhk) regression, where m is the total number of signals. the rv challenge winning team of mikko tuomi and anglada escude included a first - order moving average (ma) in their keplerian analysis along with a correlation with all sa observables. it therefore seemed logical to explore whether augmenting our ak models with a ma term would lead to a noticeable improvement in results. to investigate we did several runs on the rv 3 data set that included a ma term (tuomi. our general pth order ma model rv is given by z(ti) as follow : (4)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{eqnarray } z(t_i) & = & y(t_i) + \sum _ { \eta = 1}^p \big [\gamma _ { \eta } \times{\rm exp } \big (-\frac{(t_i - t_{i-\eta }) } { \lambda _ { \eta } } \big) \nonumber \\ & & \times (v(t_{i-\eta }) - y(t_{i-\eta })) \big ], \end{eqnarray}\end{document}where y(ti) is given by equation (1), v(ti) is the measured radial velocity, p is the order of the moving average, and and are the unknown ma parameters for = 1 to p. of the three ma models, the second - order ma was judged to yield the best results. the upper panel of fig. 37 shows the eccentricity versus period parameters for an rv 3 six - signal ak model plus log (rhk) regression which includes a second - order ma term. it exhibits a broad low - eccentricity peak centred on p = 2300 d. recall that the true period is 2315 d. the other periods are similar to our earlier results with no ma term. the lower panel shows the span of the apodization window within the overall data window for each signal (grey trace for map values of and ta, black for a representative set of samples which is partially hidden below the grey). although the apodization window for the p = 2300 d signal spans the data, the coverage for the p = 17 and 48 d is judged to be not as good as that obtained for the no ma case. the middle is a plot of the apodization time constant,, versus apodization window centre time, ta. the upper panel shows the eccentricity versus period parameters for an rv 3 six - signal ak model plus the log (rhk) regression and includes a second - order ma term. the middle panel shows a plot of the apodization time constant,, versus apodization window centre time, ta, where the symbols refer to different signal periods specified in the top panel. the lower panel shows the span of the apodization window within the overall data window for each signal (grey trace for map values of and ta, black for a representative set of samples which is partially hidden below the grey). 38 shows the eccentricity versus period parameters for an rv 3 six - signal model consisting of three ak signals, three keplerian signals plus log (rhk) regression and includes a second - order ma term. the lower panel shows the span of the apodization window within the overall data window for each signal (grey trace for map values of and ta, black for a representative set of samples which is partially hidden below the grey). the middle panel is a plot of the apodization time constant,, versus apodization window centre time, ta. the values of the ma parameters and the extra noise parameter are \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \gamma _ 1 = 0.59 \pm 0.05, \lambda _ 1 = 3.0_{-1.4}^{+0.9}$\end{document } d, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \gamma _ 2 = 0.35 \pm 0.05, \lambda _ 2 = 68_{-63}^{39}$\end{document } d and s = 1.39 0.05 m s. finally, we show a comparison of k and p parameter marginal distributions for the no ma case (black) and the second - order ma case (grey). 39 show k parameter marginal distributions for the 17 (left) and 48 d (right) planets detected in rv 3. set, the results are based on model fits consisting of k aks plus (m k) keplerians plus a log (rhk) regression, where m is the total number of signals and (m k) is the number classified as a planetary candidate. the upper panel shows the eccentricity versus period parameters for an rv 3 six - signal model consisting of three ak signals, three keplerian signals plus the log (rhk) regression and includes a second - order ma term. the middle panel shows a plot of the apodization time constant,, versus apodization window centre time, ta, where the symbols refer to different signal periods specified in the top panel. the lower panel shows the apodization window for each signal (grey trace for map values of and ta, black for a representative set of samples which is partially hidden below the grey). the upper panels show k parameter marginal distributions for the 17 and 48 d planets detected in rv3. the black trace is for the no ma case and the grey corresponds to the second - order ma case. set, the results are based on model fits consisting of k aks plus (m k) keplerians plus a log (rhk) regression, where m is the total number of signals. the second - order ma analysis was repeated using a wider prior search range for extending from 10 d to eight times the data duration. this resulted in a change in period of one of the sa signals from 8.3 to 29 d (with = 10 d) and a change in the parameters of the 17 d signal such that apodization window no longer spanned the data duration. based on this very limited comparison, it is not clear that including a ma term has improved our ability to distinguish sa and planetary signals in this one particularly challenging data set. for the rv 3 data set, the ma analysis suggests that there is a significant correlation in the residuals of the six ak signal fit. the results reported in this paper indicate that an ak model provides a useful way to distinguish planetary signals from sa - induced signals in precision rv data. the general model for m ak signals includes a linear regression term between rv and the sa diagnostic log (rhk), as well as an extra gaussian noise term with unknown standard deviation. in the current implementation, the ak method achieved a reduction in sa noise by a factor of approximately 6. the analysis also employed a differential version of the gls periodogram that uses a control diagnostic to provide an additional means of distinguishing sa signals and to help guide the choice of new periods. the ak model estimates for k were found to have a bias to larger values. for this reason, final parameter estimates for the planetary candidates were derived from fits that include ak signals to model the sa components and simple keplerians to model the planetary candidates. preliminary results are also reported for ak models augmented by a ma component that allows for correlations in the residuals. based on a very limited comparison, it is not clear that including a ma term has improved our ability to distinguish sa and planetary signals. the final residuals are still a factor of 2.3 higher on average than the measurement uncertainties. a simple symmetrical gaussian ak is only expected to provide an approximate model for some of the sa signals. | a new apodized keplerian (ak) model is proposed for the analysis of precision radial velocity (rv) data to model both planetary and stellar activity (sa) induced rv signals. a symmetrical gaussian apodization function with unknown width and centre can distinguish planetary signals from sa signals on the basis of the span of the apodization window. the general model for m ak signals includes a linear regression term between rv and the sa diagnostic log (rhk), as well as an extra gaussian noise term with unknown standard deviation. the model parameters are explored using a bayesian fusion markov chain monte carlo code. a differential version of the generalized lomb scargle periodogram that employs a control diagnostic provides an additional way of distinguishing sa signals and helps guide the choice of new periods. results are reported for a recent international rv blind challenge which included multiple state - of - the - art simulated data sets supported by a variety of sa diagnostics. in the current implementation, the ak method achieved a reduction in sa noise by a factor of approximately 6. final parameter estimates for the planetary candidates are derived from fits that include ak signals to model the sa components and simple keplerians to model the planetary candidates. preliminary results are also reported for ak models augmented by a moving average component that allows for correlations in the residuals. |
clinicians have been asking this question for 15 years now, and the answer is still unclear. richard troughton and mark richards published a seminal paper in the lancet in 2000, in which they launched the hypothesis of guiding heart failure (hf) treatment with objective measurement of natriuretic peptides (nps). this prospective pilot study was conducted in christchurch, new zealand and included 69 patients with a history of decompensated hf and systolic dysfunction. the participants were randomized to management by a standardized clinical algorithm or to clinical management with np - guided drug uptitration (1). the goal in the np - guided arm was to drive plasma concentrations of ntprobnp to 1000 pg / ml, would benefit from prolonged specialized hf clinical assistance (pre - paradigm clinical treatment) compared to referral back to general practitioners. the results demonstrated no differences in the composite score for mortality and hospitalization for cardiac causes, suggesting that baseline np had limited value in the selection of out - of - hospital management strategy in hf patients. the problems with these trials are multiple but in many ways understandable as clinicians struggle to find the right metrics to use to guide therapy. although some trials have had targets for titration of the natriuretic peptides, in many instances, these goals have not been achieved in a majority of the patients. if only 30% of the cohort reaches the goal suggested, one might ask has the hypothesis really been tested ? in addition, should the goals of therapy be a fixed level of natriuretic peptide regardless of the starting point or should it be some percentage change in the baseline value or is there a need for both types of criteria. this is of particular importance because of the marked biological variation of natriuretic peptides (14). in some studies, very large changes are necessary to be sure that the changes observed are due to treatment and not conjoint biological and clinical variability (15). those with heart failure with preserved ejection fractions (hfpef) tend to have different natriuretic peptide levels than those with heart failure with reduced ejection fractions (hfref). those with valvular heart disease may or may not be similar to either of those groups. a third strategy may emerge with availability of lcz696 in the market (post - paradigm clinical treatment). although the mechanisms involved are complex, it appears that bnp levels are increased by lcz696. on the other hand, ntprobnp values are reduced although we do not know if they are reduced commensurate with the levels that would be necessary to make outcomes with agents that do not include neprilysin inhibition. thus, it could be that ntprobnp will become the preferred peptide biomarker for therapy guidance (16). in addition, given its markedly improved efficacy, it may be that natriuretic peptides elevations will help to identify those who may benefit from neprilysin inhibition. an analogy between acute coronary syndrome (acs) and chronic hf relative to the use of biomarkers and their impact on therapy is clear. in acs, the presence of chest pain, st segment ups and downs in the ecg and cardiac troponin rise and fall is indicative of a high - risk patient that requires urgent - preferred catheterization to open the culprit artery in order to relief symptoms and improve prognosis. in chronic hf, the presence of dyspnea, a reduced ejection fraction in the echocardiogram and a very high level of circulating natriuretic peptides may identify a high - risk patient who is a candidate to switch to lcz696 in order to improve symptoms, reduce mortality (both sudden and pump failure death), and reduce hf - hospitalizations (figure 1) this is not strictly np guided therapy, as it was firstly hypothesized by troughton and richards, but rather using nps to prescribe a new treatment option which has shown a dramatic beneficial effect compared with conventional treatment. this new strategy is supported by the data from the paradigm trial, the first trial in incorporating an objective measure of severity using nps into the inclusion criteria (17). to overcome the uncertainty produced by the conflicting results of single studies of the first strategy described above, three meta - analyses investigated the utility of np - guided therapy in patients with chronic hf (18 - 20). these metaanalyses comprised data from six, eight, or 12 randomized clinical trials. in the meta - analysis by felker. (18), only six studies were collected, which reported on 1,627 patients. although a significant benefit for all - cause mortality in patients assigned to np - guided therapy was reported, the analysis was limited by the inclusion of three still unpublished studies, which prevented detailed collection of patient population characteristics. (19) included 1,726 patients in eight studies. in this analysis, the favorable effect on all - cause mortality in patients assigned to np - guided therapy was mostly driven by the time - chf trial (6) in the sensitivity analysis section of the metaanalysis. the statistical significance of the effect was lost when the time - chf trial, but not any other trial included in the meta - analysis, was removed from the analysis. notably, no difference was observed for all - cause or hf - related hospitalization. this meta - analysis for the first time reports a benefit for hf - related hospitalization ; moreover, the mortality benefit observed was more consistent and not influenced in the sensitivity analysis by any single study or by any potential confounders. this meta - analysis was the only one to investigate separately the effects of bnp- and ntprobnp - guided therapy, suggesting that ntprobnp- but not bnp - guided therapy was significantly associated with improved survival as well reduced hospitalization. a word of caution is necessary here, since no single trial has been designed specifically to compare head - to - head bnp- vs. ntprobnp - guided therapy. meta - analysis data did not find a significant benefit for elderly patients when, elderly subgroups from three trials were analyzed : time - chf, battlescarred, and upstep trials (6 - 8). it is conceivable that the more frequent presence of comorbidities may prevent or even promote potentially harmful up titration of hf drugs in elderly patients ; however, this speculation requires further confirmation. the dense and comprehensive guidelines on hf from both the european society of cardiology (esc) (65 pages) (21) and the american college of cardiology / american heart association (acc / aha) (92 pages)(22) devote just a few lines to the issue of np - guided therapy. the esc guidelines for the diagnosis and treatment of hf published in 2012 state that high np concentrations are associated with a poor prognosis, and a fall in peptide levels correlates with a better prognosis. however, several randomized clinical trials that evaluated np - guided treatment (intensifying treatment in order to lower peptide levels) have given conflicting results. it is uncertain whether outcome is better using this approach than by simply optimizing treatment (combinations and doses of drugs, devices) according to guidelines (21). no indications on class of recommendation or level of evidence are provided in the esc guidelines. the 2013 acc / aha guidelines for the management of hf state that np - guided hf therapy can be useful in achieving optimal dosing of guideline - directed medical treatment in select clinically euvolemic patients who are followed in a well - structured hf disease management program with a class of recommendation iia and a level of evidence b (22). this statement is followed by the explanatory text : np levels improve with treatment of chronic hf, with lowering of levels over time in general, correlating with improved clinical outcomes. therapy has been studied against standard care without np measurement to determine whether guided therapy renders superior achievement of guideline - directed medical treatment in patients with hf. however, randomized clinical trials have yielded inconsistent results. the positive and negative np - guided therapy trials differ primarily in their study populations, with successful trials enrolling younger patients and only those with hfref. in addition, a lower np goal and/or a substantial reduction in nps during treatment are consistently present in the positive guided therapy trials. although most trials examining the strategy of biomarker guided hf management were small and underpowered, two comprehensive meta - analyses concluded that np - guided therapy reduces all - cause mortality in patients with chronic hf compared with usual clinical care, especially in patients < 75 years of age. this survival benefit may be attributed to increased achievement of guideline - directed medical treatment. in some cases, if the np value does not fall after aggressive hf care, risk for death or hospitalization for hf is significant (22). in sum, both guidelines solicit additional information. where to next for the biomarker - guided management of hf ? there is no doubt that further trials are required to provide conclusive evidence. such a confirmation study is currently under way : the guide - it (guiding evidence based therapy using biomarker intensified treatment in heart failure) study is designed to definitively assess the effects of an np - guided strategy in high - risk patients with systolic hf on clinically relevant endpoints of mortality, hospitalization, quality of life, and medical resource use. guide - it is a prospective, randomized, controlled, unblinded, multicenter clinical trial designed to randomize approximately 1,100 high - risk subjects with systolic hf (lvef 40%) to either usual care (optimized guideline - recommended therapy) or a strategy of adjusting therapy with the goal of achieving and maintaining a target nt - probnp level of < 1,000 pg / ml (23). the estimated study completion date is december 2017. in addition to revisiting the strategy in the event of new effective drugs, such as the groundbreaking lcz696 (17), which has been approved for use in the united states, further studies should examine the potential utility of other markers, such as st2, either alone or in combination with nps (24). st2 manifests much less variability than do natriuretic peptides which may be ideal for following changes with treatment (25). however, the targets that need to be achieved are still unclear. despite the uncertainties, the consistently strong and independent relationship of nps with prognosis should encourage physicians to measure nps early after diagnosis and periodically thereafter for risk stratification. this will allow appropriate surveillance and fully informed counselling of both patients and their families. in spite of the fact that the trials conducted to date have had different designs and pursued different np targets in varied populations of patients with hf, the use of nps to guide pharmacologic therapy in patients with chronic hf seems to be associated with a reductions in mortality and hf - related hospitalization, especially in younger patients (< 75 years) with reduced lvef. there remains a need for definitive trials with sufficient power to confirm the efficacy of this strategy (e.g., guide - it), yet the existing evidence suggests that serial np measurement as an audit and/or adjunct to decision making for dose titration in hf is rational and likely to improve outcomes. | over the last 15 years, the hypothesis that intensified treatment directed at reducing natriuretic peptide (np) concentrations may improve the outcomes of patients with heart failure (hf) has been scrutinized in several prospective clinical trials, with conflicting results. collectively, however, the data suggest that np concentrations may be useful in guiding hf management and improving hf - related morbidity and mortality. in this review, we summarize the existing data investigating the use of nps as targets for outpatient hf therapy. we focus on the information gathered in randomized clinical trials and comprehensive meta - analyses, and also on the recommendations of international guidelines (primarily guidelines from the european society of cardiology and the american college of cardiology / american heart association). although the results for this approach are promising overall, additional well - designed prospective randomized controlled trials (e.g., the guide - it trial) are necessary to confirm or refute the utility of np - guided outpatient hf management. |
in the recent times, colon - specific technologies have utilized single or combination of the following primary approaches, with varying degrees of success : (1) ph - dependent systems, (2) time - dependent systems, (3) prodrugs, and (4) colonic microflora - activated systems [1, 2 ]. among the different approaches to achieve colon specific drug delivery system, the use of polymers specifically degraded by colonic bacterial enzymes (such as -glucoronidase, -xylosidase, -galactosidase, and azoreductase) holds promise. microbially activated delivery systems for colon targeting are being developed to exploit the potential of the specific nature of diverse and luxuriant microbiota associated with the colon compared to other parts of the gastrointestinal (gi) tract. these colonic microbiotas produce a large number of hydrolytic and reductive enzymes which can potentially be utilized for colonic delivery [1, 2 ]. most of these systems are based on the fact that anaerobic bacteria in the colon are able to recognize the various substrates and degrade them with their enzymes. natural gums are often preferred to synthetic materials due to their low - toxicity, low - cost, and easy availability. a number of colon - targeted delivery systems based both on combination of ph, polysaccharides and biodegradable polymers have been designed and developed by various research groups for successful delivery of drugs to the colonic region [3, 4 ]. it is insoluble in water, hydrates quickly, and swells into a homogenious hydrogel consistency or mass which pose difficulty for its use as polysaccharide coat. but, it seemed to be an interesting polymer for the preparation of hydrophilic matrix tablets [6, 7 ]. however, sterculia gum in the form of hydrophilic matrix can not protect the drug from being released in stomach and small intestine. besides, sterculia gum is expected to retard drug release due to its higher swelling index, and at the same time its degradation by the colonic microflora would make it ideal to deliver drugs in the colon. the property of higher swelling index would provide greater surface area for more bacterial enzymatic attack. this property of the gum could be used to produce hydrostatic pressure in the design of microflora triggered colon targeted drug delivery system (mcdds). in this system, the hydrostatic force is produced by osmotic agents and polymer swelling which concurrently drives the drug out of the system through the pores created by the pore - forming agent in the inner coating after exposure of the system to the colonic fluid [8, 9 ]. in addition, eudragit rlpo polymer has been reported to increase the permeability to colonic fluid due to the presence of higher number of quaternary ammonium groups. hence, the objectives of present investigation was to design mcdds based on swelling property of sterculia gum and to study the influence of different independent variables on dependent variables. the design of mcdds comprises of an osmotic tablet core containing model drug azathioprine (aza), sterculia gum as binder, and other excipients ; an inner semipermeable coating which is over coated with enteric layer to provide acid and intestinal resistance. the study includes the optimization of chitosan / eudragit rlpo mixed film coating for colonic delivery of polysaccharide core and to investigate the effects of the polymer blend ratio, concentration of pore former in the coat and coating thickness on the resulting drug release and to propose the drug release mechanism of the system. the innermost layer of chitosan / eudragit rlpo provides desired intestinal resistance, but controlling drug release in the colon. eudragit l100 was deposited in order to protect the delivery system from the gastric acidic conditions. a multilayered approach was selected, since such a dosage form was less likely to undergo dose dumping, and also, it may facilitate the spreading of the drug over the inflamed regions of the colonic lumen. the feasibility of the novel mcdds was studied using aza as a model anti - inflammatory drug via in vitro evaluation of drug release characteristics and in vivo assessment of pharmacokinetics in rabbits [11, 12 ]. citric acid monohydrate, anhydrous lactose, magnesium stearate, disodium hydrogen phosphate (na2hpo4), and potassium dihydrogen phosphate kh2po4 were purchased from loba chemie, mumbai, india. eudragit rlpo and eudragit l100 were obtained from rhom pharm, darmstadt, germany). peg 400, acetone, isopropyl alcohol and 95% ethanol, triethyl citrate, and talc were purchased from rankem, mumbai. microflora degradation studies of sterculia gum were conducted in phosphate buffer solution (pbs) ph 7.4 containing rat caecal content [13, 14 ]. the caecal contents were dispersed in pbs under anaerobic environment (bubbled with co2 gas), and the concentration of the caecal contents was adjusted to 4.0, 8.0 and 12.0% (w / v) in the pbs. finely grounded sterculia gum powder 100 mg was added into 10 ml of caecal pbs and incubated at 37c under anaerobic condition. the ph of caecal pbs was measured at 2 h interval up to 8 h using a ph meter. the core tablets of aza having an average weight of 240 5 mg were prepared by direct compression using a single stroke tablet punching machine fitted with 8 mm round standard concave punches. sterculia gum was used as binder cum hydrophilic matrix former, anhydrous lactose as diluents, citric acid as ph regulating excipient, and magnesium stearate as lubricant [15, 16 ]. in the initial trial, a coating solution of eudragit rlpo (10% w / v) in propan-2-ol : acetone (60 : 40) containing 15% w / w or 25% w / w concentration of chitosan was used to apply a semipermeable coat on the core tablet. peg 400 (25% of total coating materials) was added to improve the physicomechanical property of eudragit rlpo film. the coating conditions were as follows : stainless steel pan, 200 mm diameter, four baffled, rate of rotation of the coating pan ; 40 rpm, nozzle diameter of spray gun ; 1 mm, spray rate ; 5 ml / min, spray pressure ; 2 bar, drying temperature ; 40c. after coating, the tablets were dried for 8 hours at 3540c in order to remove the residual solvent. a full 3 factorial design was used for optimization of coating solutions [18, 19 ]. the concentration of chitosan was selected by using central composite design (ccd) under design expert software (version 8.0). the studied factors (independent variables) were concentration of pore former, chitosan (x1), and weight gain in coating thickness, eudragit rlpo (x2). the dependent variables selected for the study include lag time for drug release up to 2% in scf (y1) and percent drug release in 12 hours (y2) and 18 hours (y3). the thickness, hardness, drug content uniformity and weight uniformity were determined in a similar manner as stated for conventional oral tablets in the accredited pharmacopoeia. in order to optimize the coating formula containing different concentration of pore former, in vitro dissolution studies of core coated with different proportions of coating materials were carried out in usp dissolution test apparatus, type i (campbell electronics, mumbai, india) in 900 ml of simulated colonic fluid (scf is phosphate buffer medium, ph 7.4 containing rat caecal content 4% and -glucosidase 2% w / v) for 18 hours under anaerobic environment [20, 21 ]. aliquots of dissolution fluid were analyzed at specified time intervals to determine the release of aza by uv - visible spectrophotometer at wavelength of 281 nm. the response values (lag time in hour, % drug release in 12 hour and 18 hour resp.) of coated tablets based on 3 factorial design were subjected to analysis by response surface reduced quadratic model with the help of design expert software (version 8.0). statistical validity of the polynomial was established on the basis of anova provision in the design expert software, and significant terms (p fc4 > fc1), it became more susceptible to bacterial attack creating pores immediately resulting in shorter lag time (0.15 h) for drug release. it was observed that increased in the level of weight gain from 10%, 12%, and 14% in the batches of fc1, fc2, and fc3 and keeping the concentration of chitosan constant at 15% w / w made chitosan particles less susceptible to bacterial attack, resulting in longer lag time and lesser percentage of drug released in 18 h owing to less accessibility of the chitosan particles across the eudragit coat by the colonic bacteria. figure 3 shows that as the coating thickness was increased, drug release was decreased, as evidenced by the difference factor f1 value which was lower than 15. for the calculation of f1 and f2 (similarity factor) values, only one data point at which more than 85% of the drug release had been released was taken into consideration. anova of the dependent variables indicated that the assumed regression models were significant (p < 0.0001) and valid for each considered response (table 3). the response values of the coated tablets based on factorial design generated a mathematical model, which indicated that both the level of pore former and coating thickness had significant influence on percentage of drug release in the simulated colonic fluid at ph 7.4. the equations of the responses were found to be as follows : (1)y1 = 0.300.12 x1 + 0.094 x2 + 0.025 x1 x2 + 0.069 x12 + 0.019 x22y2=47.91482 + 0.93240 x12.5969 the above second - order polynomial equations represent the quantitative effects of independent variables (x1 and x2) upon the responses (y1, y2, and y3). the validity of the above equations was justified by substituting the values of x1 and x2 in (1) to obtain the predicted values of y1, y2, and y3. the observed and predicted values for the y2 response were found to be in good agreement (table 4). the three - dimensional response surfaces plots were drawn to estimate the effects of the independent variables on each considered response (figure 4). the best colonic drug delivery system based on coating with microporous eudragit rlpo containing optimum amount of chitosan would be a system that could protect drug release in the higher parts of the small intestine and deliver the drug only at the colonic region. chitosan particles in the rlpo coat remained undigested in the intestinal fluid due to absence of bacterial enzyme, but degraded in the colonic fluid due to the presence of vast anaerobic bacteria and allowed the drug release to occur. therefore, the concentration of chitosan in the eudragit coat could be the key factor for lag time. the lag time was inversely related to the level of chitosan in the eudragit coat. the lag time in colonic environment (ph 7.4) was considered as response y1 and optimum duration for the response was considered to be 30 minutes. during this lag time, the chitosan in the eudragit coat comes in contact with the colonic bacteria formed in situ delivery pores for release of the drug. thus, the percent of drug release in 12 h and 18 h was considered as response y2 and y3 with a constraint of minimum of 40% and 80% release, respectively. a suitable formulation which could meet these target responses would be able to release the maximum amount of drug in the colon despite its 2 h lag time in simulated gastric fluid (sgf, 0.1 m hcl at ph 1.2 containing 3.2 mg / ml pepsin) and 4 h lag time in simulated intestinal medium (sif, phosphate buffer media at ph 6.8 containing 5 mg / ml pancreatin). the best formulation showing drug release corresponded to 18.96% of chitosan (pore former) and 11.3% of coating thickness of eudragit rlpo film provided the desired release as shown in figure 5. the above quantity (x1 and x2) of formulation was substituted in (1) to obtain the predicted responses. the validity of the optimization procedure was confirmed by preparing a new batch of coating formulation with the concentration provided by the software and the observed response were found to be inside the constraints and close to the predicted responses. results of in vitro dissolution study showed that the over coating with 10% w / w of enteric coating material (eudragit l100, dissolves above ph 6.0) provided the desired acid and intestinal resistance of the optimized chitosan - eudragit rlpo coated tablet. figure 6 shows the in vitro release profile of optimized mcdds in sequential phosphate buffer medium at different ph releasing more than 90% of the drug within 24 h duration. release kinetic data revealed that the optimized mcdds was fitted well into first - order model and apparent lag time was found to be 6 hour, followed by higuchi spherical matrix release. it was evident that r (0.9888) value was higher in first - order kinetic model as compared to the other release models. the reason for first - order kinetic release was due to the presence of enzyme degradable chitosan in the eudragit rlpo film which led to the formation of in situ orifices by bacterial enzyme and leaching out drug into the surrounding medium from the central polysaccharide core tablet containing sterculia gum. when the majority of chitosan particle in the eudragit coat was degraded by colonic bacterial enzymes, it ruptured due to swelling pressure of the gum core and a gradual increase in drug release was observed, as swelling increases greater surface area of sterculia gum available for bacterial action. from the stability study, the developed mcdds was found to bestable, because there was no significant change in the percentage drug content and hardness after six month of stability study stored at 40c 2c/75% 5% rh. a novel simple, precise, selective, specific, reproducible, and low cost routine reverse phase hplc method was developed and validated as per ich guidelines. there were no such interfering peaks observed between the retention time of 6-mp and is. a good resolution was obtained between 6-mp and is with retention time of 7.88 minutes for 6-mp and 4.9 minutes for is. the method was found to be linear (r = 0.999) within the analytical range of 53.32 to 4975.00 ng / ml. maximum recovery of the drug was obtained by using methanol : acetonitrile mixture (1 : 1). the results of the method validation were proved to be accurate and reproducible, and the drug was stable in rabbit plasma up to one month period at room temperature and at three freeze - thaw cycles. mean plasma 6-mp concentration versus time profiles after a single oral dose of mkt, ec, and mcdds are depicted in figure 7. mkt, the peak plasma concentration (cmax) of 6-mp was obtained within 1.5 h of administration, indicating the immediate absorption of aza from the gastrointestinal tract and quick conversion into its active metabolite, 6-mp in blood. the cmax value of 6-mp following oral administration of mkt tablet was found to be 1430.08 ng / ml at the time maximum (tmax) of 1.5 h. the cmax value of 6-mp for ec tablet of aza without containing sterculia gum was found to be 847.5 ng / ml at tmax of 5.0 h. from the results of in vitro release study, it was observed that the drug was released after 2.0 h of dissolution study which was quite desirable, due to the fact that the drug would be released from the tablets after passing the stomach region as the tablets were enteric coated. the results of in vivo studies of ec tablets showed that drug was not released in the stomach up to 2.0 h and therefore it gives tmax of 5.0 h. thus, the in vivo finding has good correlation with the in vitro results. a lag time of 6.0 h was observed from the mcdds which revealed that the tablet had passed through the git and after reaching the colon only the drug was released and appeared in plasma as 6-mp. therefore, the cmax value of 6-mp for the mcdds could found to be 453.56 ng / ml at tmax of 9.0 h after oral administration. the results of anova revealed that there was significant difference of auc0- between the mcdds, ec and mkt formulation (p < 0.05). the results explained that the mkt formulation was more rapidly absorbed from the upper gastrointestinal tract of rabbit. but the ec and mcdds were not absorbed from the upper git due to which they showed greater value of auc0 as shown in the table 5. it is evident that auc for mcdds was higher as compared to the reference formulation ec and mkt formulations (mcdds < ec < mkt). result suggests that the extent of absorption of aza from the developed mcdds was decreased from the large intestine, but increased from the upper part of the git as seen in case of ec and mkt formulation. from the in vivo studies, the cmax of mcdds was found to be almost half of the ec tablet without containing sterculia gum. the longer tmax value (9.0 h) and low cmax value (453.56 ng / ml) of mcdds as compared to the reference formulations had proved that the mcdds released drug only at the colonic region of the rabbit intestine. this reveals localization of the drug in the colonic mucosa from the mcdds and thereby, possibly reducing the risk of systemic toxicity. microflora degradation study revealed that sterculia gum can be used to release drug in the colonic region by utilizing the action of enterobacteria. the developed mcdds exhibit gastric and small intestinal resistance but were susceptible to bacterial enzymatic attack and the potential of the system as a carrier for drug delivery to the colon is confirmed. the swelling property of sterculia gum can be used to produce hydrostatic pressure inside the tablet if it is coated with semipermeable membrane and can be used to target drug to the colon. chitosan - eudragit rlpo mixed film coating provided the favourable characteristics to the sterculia gum core tablets to deliver it directly into the colon. chitosan in the mixed film coat was found to be degraded by enzymatic action of the microflora in the colon. the degradation of chitosan was the rate - limiting factor for drug release in the colon. drug release from the mcdds was directly proportional to the concentration of chitosan, but inversely related to the weight gain in thickness of eudragit rlpo coat. the enteric layer of eudragit l100 could protect eudragit rlpo membrane containing chitosan from formation of pore or rupture before scf dissolution procedure. drug release from optimized mcdds fitted well into first - order kinetic model followed by higuchi spherical matrix release model. the hplc method developed shows good resolution to evaluate the pharmacokinetic parameters of the drug. pharmacokinetic studies revealed that the mrt value (13.81 h) was higher for mcdds as compared to the other two reference formulations, which were 3.60 h for mkt and 6.62 h for ec tablets, respectively. finally, in vivo evaluation of mcdds in rabbit showed delayed tmax, prolonged absorption time, decreased cmax, and decreased absorption rate constant (ka) indicating that drug was slowly absorbed from the colon making the drug available for local action in the colon, thereby, reducing the risk of systemic toxicity of the drug as compared to other dosage forms. | the purpose of this study is to explore the possible applicability of sterculia urens gum as a novel carrier for colonic delivery system of a sparingly soluble drug, azathioprine. the study involves designing a microflora triggered colon - targeted drug delivery system (mcdds) which consists of a central polysaccharide core and is coated to different film thicknesses with blends of chitosan / eudragit rlpo, and is overcoated with eudragit l00 to provide acid and intestinal resistance. the microflora degradation property of gum was investigated in rat caecal medium. drug release study in simulated colonic fluid revealed that swelling force of the gum could concurrently drive the drug out of the polysaccharide core due to the rupture of the chitosan / eudargit coating in microflora - activated environment. chitosan in the mixed film coat was found to be degraded by enzymatic action of the microflora in the colon. release kinetic data revealed that the optimized mcdds was fitted well into first - order model, and apparent lag time was found to be 6 hours, followed by higuchi release kinetics. in vivo study in rabbits shows delayed tmax, prolonged absorption time, decreased cmax, and absorption rate constant (ka), indicating a reduced systemic toxicity of the drug as compared to other dosage forms. |
recent diagnostic imaging tests such as computed tomography (ct) and magnetic resonance imaging (mri) contribute to improving the diagnosis of pancreatobiliary cancers [14 ]. however, from the point of cost benefit, it is not practical to perform these tests for all patients as screening. thus, less - invasive and simple screening tests are still required. as screening tests, ca19 - 9 and cea have been reported as comparatively useful tumor markers for pancreatobiliary cancers [57 ]. on the other hand, various forms of gene mutation are now present in the cancer chemotherapy process in pancreatobiliary cancers. among these genes, mutation of the p53 gene has been reported in various tumors, and even in pancreatobiliary cancers it has been found at the rate of 30~50% [913 ], and in pancreatic cancer at the rate of 60%. infiltrative cancers in particular have been reported to have a high rate of at least 70% of gene mutation. apart from the detection of such gene mutation, a method to detect the igg antibody (serum anti - p53 antibody) induced in serum against the p53 protein accumulating due to p53 gene mutation, as a biomarker, was developed around 1990. reported the usefulness of the measurement of serum anti - p53 antibody in various malignant tumors [1620 ] and suggested that it is clinically useful particularly in cancers that are in the early stage comparatively, where the positive rate is high. as a novel tumor marker for esophageal cancer, colon cancer, and breast cancer, it became eligible for health insurance coverage from 2007 in japan. moreover, it has been shown to be useful even in the prediction of prognosis during the treatment process of cancers and relapse in postsurgery cases. on other hand, it is expected to be useful in the measurement of serum anti - p53 antibody as in gastrointestinal cancer even in malignant pancreatobiliary tumors. in the present study, serum anti - p53 antibody measurement was performed for cases of pancreatobiliary cancer experienced at our institution. in addition, the rate of p53 protein overexpression was examined in those cases that could be examined pathologically. 35 patients with pancreatic cancer, 12 patients with biliary tract cancer (table 1), and a control group consisting of 31 patients with benign pancreatobiliary diseases (13 with common bile duct stones, 6 with chronic pancreatitis, 4 with benign bile duct stricture, 2 with pancreatic pseudocyst, 2 with autoimmune pancreatitis, 2 with adenomyomatosis of the gallbladder, 1 with pancreatobiliary maljunction, and 1 with benign pancreatic duct stricture) (table 2) that had been hospitalized for treatment at this institution between december 2010 and april 2011 were entered into this study. mean age was 69.3 years (range, 5183 years) for pancreatic cancer, 72.3 years (range, 5588 years) for biliary tract cancer, and 65.0 years (range, 3586 years) for benign pancreatobiliary tract disease. the male - to - female ratio was 19 : 16 for pancreatic cancer, 8 : 4 for biliary tract cancer, and 25 : 6 for benign pancreatobiliary tract disease. serum ca19 - 9, cea, and anti - p53 antibody were determined for all patients prior to treatment. the required serum sample of 0.3 ml was used to measure anti - p53 antibody by elisa and the measurement kit was mesacup anti - p53 test (medical biological research institute inc., in addition, immunostaining was performed with p53 protein (d0 - 7, dako, glostrup, denmark) by the sab method on formalin - fixed paraffin - embedded fragments obtained from those patients from whom adequate tissue samples could be obtained by biopsy or surgical resection. cells with nuclei stained brown were judged as positive cells. a comparison was made with he staining (figure 1) and the percentage of cancer cells that were positive was calculated. a comparison was made with the staining results of noncancerous epithelium of the same fragment to determine the diagnostic performance of cancer by p53 protein overexpression. diagnostic accuracy, sensitivity, and specificity of each marker were calculated and compared with the final diagnosis. statistical analyses were performed with statmate iii (atms co. ltd., tokyo, japan). mean cea (standard value : < 5.0 ng / ml) in the pancreatic cancer group was 38.33 ng / ml, the positive rate was 42.8%, mean ca19 - 9 (standard value : < 37 in addition, mean cea in the biliary tract cancer group was 21.42 ng / ml, the positive rate was 41.6%, mean ca19 - 9 was 5859.88 u / l, and the positive rate was 91.6%. in the pancreatobiliary cancer group, mean cea was 34.01 ng / ml, the positive rate was 74.0%, mean ca19 - 9 was 3836.6 u / l, and the positive rate was 87.2% (tables 3, 4, 5, and 6). among all patients in the pancreatic cancer and biliary tract cancer groups, there was no patient with serum anti - p53 antibody positive value that exceeded the standard value. in the pancreatic cancer group, the level in 27 patients was below the measurement sensitivity, and for the patients with a level that was highly sensitive, the mean value was 0.716 u / ml (0.411.23 u / ml). in the biliary tract cancer groups, the level was below the measurement sensitivity in 9 patients, while the mean value for patients with a level that was highly sensitive was 0.716 u / ml (0.411.20 u / ml). in the pancreatobiliary cancer group, the mean value for patients with a level that was highly sensitive was 0.716 u / ml (0.411.23 u / ml) (tables 3, 4, 5, and 6). rate of p53 protein overexpression in the 16 patients (surgical resection specimens from 5 patients and biopsy specimens from 11 patients) of the pancreatic cancer group that could be tested was 43.7% (7 patients) and in the 9 patients (surgical resection specimens from 2 patients and biopsy specimens from 7 patients) of the biliary tract cancer group was 55.5% (5 patients). in the pancreatobiliary cancer group, the rate was 48.0% (tables 7 and 8). among the patients with benign pancreatobiliary diseases (biopsy specimens from 9 patients), the rate of p53 protein overexpression was 0%. the p53 gene encodes a 53-kd dna binding nuclear phosphoprotein with a short half - life that negatively regulates cell growth and proliferation, and its alteration or loss is thought to deprive cells of these inhibitory signals [2224 ]. several investigators have reported that pancreatic ductal cancers frequently show mutations of the p53 gene [2527 ] as in biliary tract cancer [2831 ]. thus, there may be an obvious potential for the measurement of p53 gene products, namely, p53 protein, to diagnose pancreatobiliary malignancy. so far, the main procedures for detecting p53 gene mutation are the analysis of gene sequences from rna eluted from tissues such as resected materials and the detection of the mutant p53 protein by immunostaining. induction of serum anti - p53 antibody against mutant p53 protein in cancer cells has been reported previously [32, 33 ]. development of the elisa kit that detects anti - p53 antibody is expected to be clinically useful as a screening test because it will enable the easy prediction of gene mutation. according to the review by soussi in 2000, there is no report on biliary tract cancer. in terms of pancreatic cancer, previous reports showed various levels of positive rate of serum p53 antibodies, ranging from 4% to 27%. in addition, shimada. investigated 1085 solid tumor patients with a total of 15 types of solid tumors in 2003 and reported a positive rate of 16% for biliary tract cancer and 10% for pancreatic cancer. with regard to the ratio of p53 mutations in pancreatobiliary cancers, several investigators have reported that they emerged in approximately 40% [2531 ]. on the other hand, to date, there are many articles on the usefulness of p53 immunostaining for the diagnosis of pancreatic cancers [3539 ] and biliary tract cancers [3337 ]. the ratio of protein overexpression of pancreatobiliary cancers is approximately 60% though the range is from 40% to 80% [3544 ]. there is discrepancy of positive rate between p53 mutation and protein expression. current commercially available antibodies for p53 stains are both the wild - type and mutant p53 proteins. in fact, two reports have revealed that p53 protein overexpression correlates well with gene mutation in gallbladder cancer and cholangiocarcinoma. in the present study, we strictly defined that more than 70% of positive cells indicates overexpression, suggesting p53 mutation. as a result, the p53 overexpression positive rate was 43.7% in pancreatic cancer and 55.5% in biliary tract cancer. surprisingly, in the present study, no anti - p53 antibody was detected in both pancreatic cancer and biliary tract cancer though the levels of ca19 - 9 or cea were elevated in the same cases. we guessed that the reasons why p53 overexpression could not induce serum antibody were that p53 overexpression does not necessarily induce serum antibody and possibly some immunological malformation might be present in the patients with pancreatobiliary cancers. considering the clinical application of the current serum p53-antibody measurement and p53 immunostaining to diagnose pancreatobiliary malignancy, p53 immunostaining appears to be useful compared to serum anti - p53 antibody because of higher positive rate. in the present study, although p53 immunostaining was also used only for surgically resected specimens, the application of p53 immunostaining using biopsy specimens may be useful to distinguish benign from malignant as we previously described. therefore, we should compare serum anti - p53 antibody with p53 immunostaining using biopsy specimens as a next step in the near future. there are some limitations in this study because of the small sample size, lack of a control group, and no analysis of p53 gene mutation. in conclusion, our study clarified that serum anti - p53 antibody measurement does not contribute to the diagnosis of pancreatobiliary cancers. instead, traditional p53 immunostaining still appears to be valuable in combination with standard procedures. | background. recent diagnostic imaging tests contribute to improving the diagnosis of pancreatobiliary cancers. however, it is not practical to perform these tests for all patients as screening. thus, less - invasive and simple screening tests are still required. a method to detect the igg antibody induced in serum against the p53 protein accumulating due to p53 gene mutation, as a biomarker, was developed around 1990. method. 35 patients with pancreatic cancer, 12 patients with biliary tract cancer, and 31 patients with benign pancreatobiliary diseases were entered into this study. measurement of serum anti - p53 antibody was conducted in all patients. in addition, the rate of p53 protein overexpression was examined in those cases that could be examined pathologically. result. among all patients in the pancreatic cancer and biliary tract cancer groups, there was no patient with serum anti - p53 antibody positive value that exceeded the standard value. the rate of p53 protein overexpression was 48.0% in the patients with pancreatobiliary cancers and 0% in the benign pancreatobiliary diseases group. conclusion. serum anti - p53 antibody measurement does not contribute to the diagnosis of pancreatobiliary cancers. instead, traditional p53 immunostaining still appears to be valuable in combination with standard procedures. |
streptococcus canis (sc) is a zoonotic pathogen that is transferred primarily from companion animals such as dogs and cats to humans through both animal bites and other mechanisms, and usually infects immunocompromised rather than immunocompetent hosts. this species has also been isolated from a variety of other animals, including cows, rats, mink, mice, rabbits, and foxes. sc strains are -hemolytic, and they appear as large white colonies surrounded by zones of complete hemolysis when cultured on sheep blood agar plates. furthermore, lancefield grouping, based on the composition of carbohydrate antigens in the cell wall, was used to classify sc as a group g streptococcus. the filamentous m protein is a major somatic virulence factor in group a streptococci, and the m - like protein produced by sc strains is thought to play a similar role in sc. we present the first reported human case of uncomplicated bacteremia following a dog bite, caused by sc harboring the scm gene, which encodes m - like protein. furthermore, we review published reports of the clinical and microbiological characteristics of sc infection in humans. a 71-year - old man was admitted to our hospital with swelling and redness in his right leg, complicated by fever and rigor. his underlying medical conditions included atrial fibrillation, hypertension, superior mesenteric vein thrombosis, liver cirrhosis (lc) following infection with hepatitis c virus. one year prior to admission, he had received the non - conjugated, pneumococcal polysaccharide vaccine because of the splenectomy. the patient was the owner of a dog that had become sick and had bitten his right leg several days previously. on admission to the emergency room, the patient exhibited a temperature of 40.2 c, blood pressure of 150/110, a respiratory rate of 25 breaths / min, and an oxygen saturation of 94% (equivalent to the ambient concentration), and he was tachycardic with a heart rate of 106 bpm. the clinical examination was unremarkable with the exception of a systolic murmur (levine ii / vi) at the apex and the remarkable swelling and redness of his right leg. the leukocyte cell count and c - reactive protein concentration were 8500/l and 0.30 mg / dl, respectively. transthoracic echocardiography showed no evidence of vegetation that might indicate endocarditis, and a computed tomography scan of the chest, abdomen, and pelvis revealed no evidence of infective foci. cellulitis was diagnosed and the intravenous administration of the antibiotic cefmetazole was initiated (4 g per day, administered as two 2-g doses) ; however, concerns about severe infection were raised, because he had undergone a splenectomy. after admission, duplicate blood cultures revealed the presence of gram - positive cocci, and the cefmetazole treatment was replaced by the combined intravenous administration of ampicillin (12 g per day, administered as six 2-g doses) and clindamycin (1800 mg per day, administered as three 600-mg doses). the patient - origin samples were cultured on a sheep blood agar plate for 24 h at 35 c in 5% co2, resulting in the growth of large, smooth, white, non - mucoid -hemolytic colonies with group g carbohydrate antigens (fig. the infecting species was matched to sc with 99.9% probability, using a rapid i d 32 strep api system (sysmex biomrieux co. ltd., unfortunately, the dog died from the disease and the sc strain could not be isolated from the dog. the isolate from the patient was stored at 80 c for further characterization. in summary, the patient was diagnosed with uncomplicated bacteremia caused by sc, and was treated with a 2-week course of combined ampicillin and clindamycin therapy at set doses. the treatment was successful, and the patient remained well with no recurrence of bacteremia during the 4-month follow - up period. the phenotypic and genotypic characteristics of the isolate were determined, and are summarized in table 1. the identification of the isolated species as sc was confirmed by sequencing the 16s rrna (read length 1426 bp) ; the isolate displayed 99.02% identity to sc strain atcc 43496(t). furthermore, it was possible to amplify the cfg gene, encoding a camp factor co - hemolysin found in sc, from the extracted dna. additionally, it was possible to detect the presence of a scm gene, encoding the major virulence factor m - like protein ; the amplified sequence (read length 912 bp) was closely related to scm from other two sc strains : 321 324a (accession no. 2). multilocus sequence typing (mlst) was performed by cross - referencing the sequences of 7 housekeeping genes (gki, gtr, muri, muts, recp, xpt, and yqiz) from our isolate with those registered into the sc mlst database (http://pubmlst.org/scanis/). the isolate was found to be a sequence type (st) 9 strain, possessing the allelic profiles 3, 5, 3, 3, 1, 2, and 3 for each of the seven genes, respectively. antimicrobial susceptibility assays revealed that the sc isolate was susceptible to penicillin, cephalosporin, tetracyclines (tcs), glycopeptides, lincomycins, sulfamethoxazole / trimetoprim, chloramphenicol, and fluoroquinolones. susceptibility to macrolides was mixed, as the isolate was susceptible to erythromycin but not to azithromycin : its susceptibility was intermediate. it should be noted, however, that the breakpoints of antibiotic concentrations used to determine susceptibility were those for viridans group streptococci, since no breakpoints for sc are described in the clinical and laboratory standards institute guidelines. while this susceptibility testing suggested that the isolate might be resistant to azithromycin, our pcr - based results indicated that this isolate did not possess the macrolide / lincosamide (ml) resistance genes, erm(a), erm(b) or mef(a). to the best of our knowledge, this is the first reported human case of uncomplicated bacteremia caused by an st9 sc harboring the scm gene. the m - like protein expressed by the scm gene is a novel virulence factor with possibility of anti - phagocytic activity. additionally, this protein acts cooperatively with enolase to bind to the c - terminal mini - plasminogen region of plasminogen, recruiting the latter to the bacterial surface and enhancing the transmigration and survival of the bacterium,. however, not all sc strains isolated from animals possess the scm gene ; one study detected the scm gene in only thirteen of nineteen strains examined (68.4%). consistent with this result, a separate study found that 90.0% of canine and 83.3% of feline sc strains harbored the m - like protein. in this study, it was not possible to isolate and identify the sc strain directly from the pet dog of the patient, since the dog died from the illness while the patient was hospitalized, and we need to confirm the presence of the scm gene among sc strains prospectively recovered from companion animals in japan. the mlst method for typing sc strains has been established, and st9 was found to be the most prevalent type among the 85 sc isolates (23/85 ; 27.1%), including among strains originating in humans (n = 5). according to information in the mlst database, st9 strains are isolated from cats, dogs, and cows from germany, portugal, and the us. reported sources of st9 sc isolates were skin and soft tissue exudate, vaginal exudate, ear exudate, urine, and others. several human infections with the st9, the prevalent st, originating from portugal, are registered into the database ; the tissue sources of infection were skin and soft tissue exudate, respiratory tract secretions, and blood specimens. the human cases caused by other sts 2, 3, 4, 12, and 14 also originated in portugal and the us. in this case study, we describe a human infection with a pathogenic st9 sc strain harboring the scm gene, and in future it will be interesting to analyze the relationship between the presence of the scm gene and the st of the sc strains isolated from companion animals and humans in japan. the isolate in this case did not possess the ml - resistance genes, erm(a), erm(b), or mef(a), although azithromycin was not effective against this bacterium. previously, resistance rates of 27% against tc and 10.8% against ml were reported among 37 sc strains isolated from dogs between 2000 and 2005. additionally, the presence of the resistance genes tet(m) or tet(o) alone, or combinations of resistance genes [tet(m)/tet(l), tet(l)/tet(s), and tet(o)/erm(b) ] have been detected in tc - resistant sc isolates (n = 23 ; resistance rate, 27%). therefore, ml- and/or tc - resistance should be considered when antimicrobials are found to be ineffective in veterinary clinical practice. sc infection is rare, but host characteristics linked to susceptibility to infection, including the immunity, have been described previously. in humans, underlying medical conditions, particularly diabetes mellitus, can increase the susceptibility, as can a compromised immune system,. on the other hand, the presence of virulence factors could enhance the potential infectivity with sc ; we have described the presence of the m - like protein virulent factor in this case, but it is possible that other virulent factors might enhance sc pathogenesis in immunocompetent individuals, and their investigation using comprehensive approaches including genome sequencing and proteomics will be important in the future. the entry site of sc into human host should also be considered. most cases of sc infection, except for dog bites, originate in pre - existing wounds and skin ulcers,. notably, however, ohtaki and colleagues recently reported the first documented human case of sepsis caused by sc without a dog bite in japan. while the entry mechanism remains unclear, we speculate that the pathogenic sc, which may be resident at / around the oropharynx, skin, genitourinary tract, and anal tract, seem to invade the host through invisible wounds on human skin,. companion animals kept in households are hugely important to individuals of all ages in japan, so much so that some human hospitals have introduced animal - assisted therapy to improve the mental health of human patients. therefore, when presented with feverish patients who maintain close contact with these animals, clinicians should consider infection with sc as well as with pasteurella sp., prevotella sp. furthermore, since an animal s life is completely controlled by its human owner, the one health concept, which recognizes that human health and animal health are connected, should be employed to study the crosstalk concerning bacteria, including sc, that infect both humans and animals, to maintain their future health. | highlightsthis is the first reported human case of bacteremia caused by streptococcus canis having scm gene encoding m - like protein.the identity was based on similarity of its 16s rrna and detection of the specific cfg gene encoding a co-hemolysin.this isolate was confirmed to be sequence type 9.this strain did nt have the erm(a), erm(b), or mef(a), macrolide resistance genes, but was not susceptible to azithromycin. |
idiopathic osteolysis is a heterogeneous group of rare diseases in which there is a spontaneous, aggressive and extensive bone resorption. idiopathic osteolysis was first described in 1838 and again in 1872 by jackson (1, 2) who reported a case of " boneless arm ". in 1955, gorham and stout (3) defined a specific disease entity and reviewed 24 cases from the literature. the gorham - stout syndrome presents progressive idiopathic osteolysis of one bone or contiguous bones around one focus, without respect for joint boundaries. in 1985, there have been a number of publications and case reports which do not appropriately fit into this classification (8 - 13). we present a case of histologically proven massive osteolysis documented with plain radiography, ct and mri. to our knowledge, this is the first case in which multifocal, non - contiguous, osteolytic skip lesions without associated nephropathy and without a hereditary pattern is described in one extremity. a 38-year - old man is initially presented with pain and decreased strength in the left arm. laboratory results were normal including renal function tests (urea, creatinine), thyroid and parathyroid hormone (pth) tests. the patient was treated with non - steroidal anti - inflammatory drugs but the pain was not relieved, the patient was referred for radiography 2 years later. during this time, radiography demonstrated almost complete non - contiguous osteolysis in the left elbow, proximal and distal radius, ulna, wrist, carpal bones, proximal and distal metacarpals and phalanges (fig. static images from bone scintigraphy with 99 technecium methylene diphosphate (99mtc - mdp) showed increased activities in the osteolysed regions (fig. 1e, f). to define the extent of the osteolysis, ct examination was performed. mri demonstrated that the soft tissue masses and the affected bones were hypointense to isointense with muscle on t1-weighted imaging (tr / te, 732/12) and were of heterogeneous signal intensity on t2-weighted imaging (tr / te, 3986/99) (fig. multi - site fine needle aspiration biopsy and tru - cut biopsy were undertaken ; bone specimens were taken from proximal, distal radius and proximal ulna for pathological examinations. this revealed fibrous tissue containing proliferated vascular structures replaced with bone trabeculae and bone marrow (fig. the pathological specimen obtained at open biopsy of a lesion in the left proximal radius also confirmed such findings. gorham disease must be distinguished from osteolysis secondary to other pathologic processes, including the hereditary, metabolic, neoplastic, infectious and immunologic etiologies. common differential diagnoses included hereditary multicentric osteolysis, essential osteolysis with nephropathy, metastasis, osteomyelitis, and rheumatoid arthritis. the clinical findings are usually helpful when ruling out these diseases (5, 6). idiopathic osteolysis is a heterogeneous group of rare diseases in which there is spontaneous onset of mostly peripheral osteolysis without obvious reasons. (4) described the most commonly accepted classification with five types of idiopathic osteolysis. type i, hereditary multicentric osteolysis with dominant transmission is commonly seen at early childhood with complaints of spontaneous pain and swelling beginning in the hands and feet. type ii, hereditary multicentric osteolysis with recessive transmission is similar to type i except for possible associations with severe generalized osteoporosis. type iii, is a non - hereditary multicentric osteolysis with nephropathy appearing in childhood. type iv, gorham - stout syndrome is a monocentric syndrome which involve any part of the skeleton. rarely, two or more anatomic regions are affected, separated by normal osseous structures. apparently, any bone can be involved, including the small tubular bones of hands and feet, spine, skull and the mandible. the gorham - stout syndrome presents as progressive idiopathic osteolysis of one bone or contiguous bones around one focus without respect for joint boundaries. while contiguous bony involvement is typical, multiple foci with skip lesions have not been reported in the literature (14). type v, winchester syndrome is a rare childhood carpotarsal osteolysis syndrome with autosomal recessive transmission. it is associated with contractures, shortness of stature, skin lesions, corneal clouding and osteoporosis without nephropathy. this patient, without any underlying conditions, was diagnosed as idiopathic osteolysis based on radiologic, morphological and clinical findings. however, our case does not readily fit in to the classification of idiopathic osteolysis according to hardegger. this case fits most closely into the type iv of hardegger classification, however multifocal, non - contiguous osteolysis with skip lesions differ from the usual characteristics of gorham syndrome. there have been increasing numbers of cases which can not accurately be placed within this classification (8 - 13). white (8) reported four patients with multifocal osteolysis in association with severe skin lesions. beals and bird (9) observed one case of carpotarsal osteolysis without associated nephropathy and a hereditary pattern. (10) described a woman with osteolytic lesions of the metacarpal and metatarsal bones and terminal phalanges without a family history or renal involvement ; burkhard. (13) and tauro (11) noted cases of ' multicentric gorham - stout syndrome ' and downing. (12) published one case of multicentric osteolysis in both hands and feet, especially of the phalanges, associated with normal renal functions and with no genetic basis. we report a unique pattern of involvement in the upper left extremity with non - contiguous, multifocal osteolysis. this case is an addition to the enlarging group which can not be readily placed in the proposed classification of idiopathic osteolysis. | a patient with a 2-year history of pain in the left arm, and decreased strengths unrelieved by non - steroidal anti - inflammatory therapy, was being referred for repeating radiography. the radiologic examinations have demonstrated a unique pattern of non - contiguous osteolysis in the left elbow, proximal and distal radius, ulna, wrist, carpal bones, proximal and distal metacarpals and phalanges. multi - site biopsies were being performed and confirmed the diagnosis of massive osteolysis. to our knowledge, this is the first case in which multifocal, non - contiguous osteolysis with skip lesions without associated nephropathy and without a hereditary pattern is being described in one extremity. |
to establish the desirable occlusion and articulation with proper inclination of teeth in deep - bite patients, orthodontic therapy alone is difficult and inefficient. therefore, orthognathic surgical procedures, which reconstruct occlusal plane by aligning teeth or correcting skeletal deformities, are preferred to obtain functional and marked esthetic results. since these procedures support the patient both physically and psychologically, they are constructive for the patient. in fact, these procedures could simplify the prosthodontic phase of treatment without damaging the tooth structure. anterior segmental osteotomy is an important surgical procedure for the correction of maxillary and mandibular protrusion or retrusion to achieve improved occlusion and facial profile. this osteotomy procedure is primarily for correction of bimaxillary dentoalveolar protrusion, anterior open bite, excessive inclination of anterior teeth, excessive vertical, or anteroposterior development of the maxillary dentoalveolar process and severe skeletal problems that can not be corrected with orthodontic treatment. in addition, the decreased vertical dimension of occlusion (vdo) in deep - bite patients can also cause unpleasant esthetic results, reduced masticatory capacity, muscle atrophy and pulpal sensitivity. a progressive approach should be followed to restore vdo. for such situations, occlusal splints, fixed or removable partial dentures the aim of the treatment was to reduce the anterior deep - bite and overjet by intrusion of the maxillary incisors to correct the maxillary protrusion. additionally, the second aim was to create an adequate space for an implant supported fixed prosthesis through multidisciplinary treatment approaches including orthodontic, surgical, and prosthetic procedures. a 45-year - old male patient had been admitted to gazi university, department of oral and maxillofacial surgery, with a chief complaint of difficulty in chewing and an unattractive smile. extraoral examination showed a reduction in the lower facial height, protuberant lips, wrinkles, drooping, overclosed commissures, and excessive gingival display caused by collapsed vdo. furthermore, the pretreatment profile demonstrated a marked protrusion of the maxilla with partial edentulism. besides, no pocket depth of over 2 mm or mobility was observed around any of the remaining teeth. the intraoral and radiographic examination verified that # 12, # 13, # 14, # 24, # 16, # 17, # 23, # 24, # 26, # 27, # 35, # 36, # 37, # 44, and # 46 teeth were lost [figure 1 ]. during the clinical examination of the patient by the orthodontist, convex profile with upper lip protrusion and gummy smile were detected. he also had severe deep - bite and increased overjet with anterior maxillary protrusion [figure 1 ]. since the cephalometric analysis showed that maxillary central incisors were proclined (1-na = 17 mm, 1/na = 44, 1/ans pns = 127), the overjet was not within normal ranges (14 mm) [figures 2 and 3 ]. (c) panoramic radiograph maxillary superposition, t0 : pretreatment, t1 : after surgery, t2 : after prosthetic rehabilitation cephalometric measurements of the patient, t0 : pretreatment, t1 : after surgery, t2 : after prosthetic rehabilitation the treatment plan was formulated in consultation with a prosthodontist, orthodontist, and an oral - maxillofacial surgeon. first, a diagnostic setup was constructed by the prosthodontist. then, an interocclusal record was prepared with a polyvinyl - siloxane occlusal registration material (exabite ii ; gc corp., tokyo, japan) on a semi - adjustable articulator (stratos 200, ivoclar, vivadent, germany) using a face - bow record. following a careful evaluation of the patient, the patient had no maxillary canines or posterior teeth to provide anchorage for retraction or intrusion of maxillary incisors. first, the patient was young and did not want to use a partial prosthesis. he also rejected this option because of the difficulties that might occur during establishing esthetic at anterior region. therefore, to restore the lost vdo with severe deep - bite and stabilize the maxillary anterior segment in its desired position, increase the vdo by provisional removable partial prosthesis following subapical anterior maxillary segmental osteotomy. then, full - mouth rehabilitation with implant - teeth supported metal - ceramic restorations was considered. finally, stabilizing the maxillary anterior segment in the desired position by surgical therapy and the restoration of the edentulous maxillary posterior regions with 6 implants was suggested to the patient. four months after surgery, the fixation system was removed [figure 5a and b ]. after the surgical stage, the maxillary incisors were retruded by 3 mm and impacted for 4 mm according to cephalometric superimpositions [figure 3 ]. (c) provisional removable restoration the occlusal vertical dimension was determined by the niswonger method and verified with the closest speaking space method. the space between lower centric occlusion line and the upper closest speaking line was named as the closest speaking space. the patient 's freeway space was 7 mm (difference between rest vertical dimension and vdo). following the impaction of maxillary incisors for 4 mm, the new occlusal vertical dimension was set by approximately 3 mm increase using the incisal guidance pin of the articulator. at the first stage of the rehabilitation, a provisional removable restoration was fabricated at increased vdo as a guide for the definitive oral rehabilitation [figure 5c ] to be used for 3 months. the proper vdo was determined by using the physiologic rest position of the mandible as a guide and noting the existing interocclusal distance. the patient 's mastication, muscle sensitivity, temporomandibular junction pain, phonation and anterior and posterior speaking space were evaluated in this period. extensive clinical examination, including prosthetic workups, revealed that misaligned maxillary second premolar teeth would not support functional or esthetic prosthetic restoration. six dental implants (4 units 4.1 mm 10 mm and 2 units 4.8 mm 10 mm ; standard plus implants, straumann ag, basel, switzerland) were placed to the maxillary arch (# 14, # 15, # 17, # 23, # 24, and # 26) in accordance with the prosthetic and surgical guidance. additionally, # 11, # 21, and # 22 teeth were prepared and provisional fixed restorations were made at increased vdo [figure 6a ]. six months after the first surgery, second - stage surgery was performed. for soft - tissue healing around implants, (a) following implant placement. (b) after preparation of the teeth in consultation with the patient, full - mouth metal ceramic crowns were considered to be the best therapeutic option. then, teeth were prepared with circumferential shoulder margins of 11.2 mm and an occlusal reduction of 1.52 mm [figure 6b ]. provisional restorations were prepared by the dental technician and cemented temporarily (temp bond netm ; kerr). the protrusive contact, canine guidance, esthetics, and phonetics were assessed, and 1- and 2-monthly regular checkups were performed. definitive impressions of all teeth and abutments were made with a polyether impression material (impregum, 3 m espe, st. the models were mounted using an arbitrary facebow (dentatus aed, dentatus usa ltd., ny, usa) and a centric relation record was obtained using polyether bite registration material (ramitec, 3 m espe) on a semi - adjustable articulator (dentatus arh, dentatus usa ltd.). the patient was checked at 1, 2 weeks, 1, 3, 6, and 12 months and then examined annually by visual and radiographic examinations [figure 7c ]. the patient acknowledged improved function and esthetics, and was pleased with the results [figure 7b ]. the cephalometric analysis of the patient before and after surgery and following prosthetic rehabilitation is given in figure 8. follow - up panoramic radiographs were taken after treatment and annually for up to 5 years. a satisfactory functional and esthetic result was obtained after 5 years of follow - up [figure 9 ]. to restore the dentition and improve the facial appearance in the present case, the vdo had to be increased to approximately 7 mm. however, there was no adequate dentition for orthodontic anchorage. therefore, 4 mm incisor intrusion was achieved by anterior segmental osteotomy. at the end of treatment anterior maxillary osteotomy is the most aggressive but multi - purpose treatment option for patients having bimaxillary protrusion and/or dentoalveolar protrusion with severe extrusion. in the present clinical report, the osteotomy line was kept well above the apices of the laterals and the apices of teeth were protected without any damage. besides, for restoring the vertical height, the teeth (# 11, # 21, and # 22) had root canal treatment, before preparation procedures. the implant placement following virtual planning of implant positions was performed according to the multidisciplinary treatment approach which included a maxillofacial surgeon and prosthodontist. overall, surgery and prosthetic rehabilitation resulted in greater reduction of overjet (12 mm) and greater improvement in skeletal and dental aspects. in the present case, increasing vertical dimension with removable denture following fixed restoration of the remained teeth in upper jaw could be a treatment alternative to surgery, because surgical reconstruction might have disadvantages including the costs, length of recovery, and surgical complications. additionally, full - mouth restoration including implants in the posterior region could be used as prosthetic method for increasing the vdo. a previous study indicated that increasing vdo by restorative procedures should be undertaken cautiously, since this procedure disrupts a patient 's dental physiology and adaptation. in addition, it was reported that the patient can adapt a 5 mm increase in vdo. therefore, correction of dentofacial deformity caused by the lost vdo was treated partially with surgical procedures (4 mm intrusion) and partially by fixed restorations. besides, the increase in vdo should be achieved with fixed restorations rather than a removable denture, since it improves function and esthetics and is therefore more predictable for patient adaptation. previous studies indicated that the testing period of increased vdo with provisional restorations could be 26 months. the use of removable partial dentures was suggested as provisional restorations for the patients with decreased vdo. during a 3-month period, the patient was carefully evaluated to assess the adaptation to the vdo obtained with a removable prosthesis. a mutually protected articulation was used to rehabilitate the present patient with provisional and definitive restorations. furthermore, the patient had increased overbite and marked protrusion at the beginning of the treatment [figure 1 ]. both the facial appearance and the occlusion were significantly improved at the end of the prosthetic rehabilitation [figure 7 ]. the prosthetic restorations performed in the present case report improved the quality of life of the patient. furthermore, dental practitioners should keep in mind that conventional prosthetic treatment might often be all that is needed for patients with skeletal problems. | this case report demonstrates the full - mouth rehabilitation of a 45-year - old male patient with severe deep - bite by increasing vertical dimension. the technique of anterior maxillary osteotomy performed in the present situation has been found to be effective, requiring anterior and inferior repositioning of the anterior maxilla to provide an esthetic and functional implant supported fixed prosthesis. four months after surgery, the fixation system was removed, and 6 dental implants were placed. the anterior and inferior movements of the segment allowed for natural tooth anatomy and size in the definitive implant supported partial fixed prosthesis. a satisfactory functional and esthetic result was obtained after 5 years of follow - up. |
avaliar a contribuio da anlise molecular do gene cystic fibrosis transmembrane conductance regulator (cftr, regulador da condutncia transmembrana na fibrose cstica) na investigao diagnstica da fibrose cstica em pacientes com suspeita de fibrose cstica (fc) leve ou atpica. os voluntrios foram submetidos avaliao clnica, laboratorial e radiolgica ; espirometria, microbiologia do escarro, ecografia heptica, teste do suor e anlise molecular do gene cftr. compararam - se as caractersticas dos pacientes divididos em trs grupos, segundo o nmero de mutaes identificadas (duas ou mais, uma e nenhuma). foram avaliados 37 pacientes com achados fenotpicos de fc, com ou sem confirmao pelo teste do suor. houve predomnio do sexo feminino (75,7%), e a mdia de idade dos participantes foi de 32,5 13,6 anos. a anlise molecular contribuiu para o diagnstico de fc em 3 casos (8,1%), todos esses com pelo menos duas mutaes. houve a identificao de uma e nenhuma mutao, respectivamente, em 7 (18,9%) e 26 pacientes (70,3%). outras mutaes encontradas foram p.a559 t, p.d1152h, p.t1057a, p.i148 t, p.v754 m, p.p1290p, p.r1066h e p.t351s. a anlise molecular da regio codificadora do gene cftr apresentou uma contribuio limitada para a investigao diagnstica desses pacientes com suspeita de fc leve ou atpica. cystic fibrosis (cf) is an autosomal recessive disease caused by mutations in a gene that is located on the long arm of chromosome 7 and that encodes the cystic fibrosis transmembrane conductance regulator (cftr) protein. although cf is usually diagnosed in childhood (in the first year of life in 70% of cases), the number of cases of cf diagnosed in adolescence and adulthood has increased as a result of a higher level of clinical suspicion and the availability of diagnostic techniques. the diagnosis is based on phenotypic findings, family history, newborn screening test results, and quantitative pilocarpine iontophoresis sweat test results. the sweat test is considered the gold standard for the diagnosis of cf, which is confirmed by two or more determinations of sweat chloride concentrations greater than 60 meq / l at different time points. in cases in which sweat chloride concentrations are found to be borderline or normal, additional diagnostic tests are needed, molecular analysis being performed in order to identify mutations in the cftr gene. this is due to the fact that the number of known mutations is quite large (over 1,900), although only a minority is included in commercially available panels. despite its shortcomings, analysis of mutations in the cftr gene has been increasingly used as a diagnostic method for cf. the absence of mutations means that the diagnosis of cf is highly unlikely, and differential diagnoses, such as ciliary dyskinesia and immunodeficiency, should be considered. the objective of the present study was to evaluate the contribution of molecular analysis of the cftr gene coding region to the diagnostic investigation of adolescents and adults suspected of having mild or atypical cf, as well as to compare the characteristics of three groups of patients, divided according to the number of cftr gene mutations identified (none, one, or two or more, the last of the three confirming the diagnosis of cf). we sought to evaluate the contribution of molecular analysis of the cftr gene to the diagnostic investigation of adolescents and adults suspected of having mild cf (diagnosis confirmed by sweat test results and mild lung disease without pancreatic insufficiency) or atypical cf (clinical phenotype consistent with cf without sweat test confirmation). the study protocol was approved by the research ethics committee of the hospital de clnicas de porto alegre (hcpa, porto alegre hospital de clnicas ; protocol no. 08 - 549). although we received donations from private companies (roche and united medical), those sponsors had no role in the study design ; in the collection, analysis, and interpretation of data ; in the writing of the manuscript ; or in the decision to submit the manuscript for publication. the study population consisted of patients selected from among those treated at the hcpa department of pulmonology outpatient clinic for adolescents and adults with cf, located in the city of porto alegre, brazil. we included individuals 14 years of age with phenotypic findings of cf (digital clubbing, bronchiectasis, chronic infection with typical bacteria, and exocrine pancreatic insufficiency), with or without sweat test confirmation. we excluded patients in whom the phenotypic findings were attributable to other diseases, such as ciliary dyskinesia and primary immunodeficiency ; pregnant patients ; and patients who declined to participate in the study or who declined to give written informed consent. volunteers were selected from among patients attending the abovementioned outpatient clinic for routine medical visits between 2009 and 2010. the interviewer used a data collection form in order to gather information on the following variables : age ; gender ; marital status ; race ; family history of cf ; presence of digital clubbing ; and body mass index (bmi), in kg / m. all of the patients underwent 2-h oral glucose tolerance tests, with the exception of those with a previous diagnosis of diabetes mellitus based on fasting blood glucose levels, in accordance with the american diabetes association criteria. the shwachman - kulczycki score was used in order to assess overall disease severity. this clinical scoring system is based on four different aspects (general activity, physical examination, nutrition, and chest x - ray findings). each is scored on a 5 - 25 point scale, a better performance translating to a higher score. we reviewed the bacteriological tests performed on sputum samples collected during routine clinical visits in the last 12 months. identification of mucoid and nonmucoid pseudomonas aeruginosa, methicillin - sensitive and methicillin - resistant staphylococcus aureus, burkholderia cepacia, and haemophilus influenzae was recorded when they were identified at least twice in sputum samples collected during routine clinical visits at intervals longer than 30 days. spirometry was performed in the hcpa department of pulmonology with a masterscreen spirometer and the program v4.31 (jaeger, wrzburg, germany) in accordance with the brazilian thoracic association technical acceptability criteria. three acceptable maneuvers were performed, the values obtained on the best test being recorded. all parameters were expressed as a percentage of the predicted values for age, height, and gender. for the diagnosis of liver disease in cf, we used the ultrasound scoring system developed by williams. the scoring system is based on three ultrasound features : liver parenchyma - normal (1 point), coarse (2 points), or irregular (3 points) ; liver edge - smooth (1 point) or nodular (3 points) ; and periportal fibrosis - absent (1 point), moderate (2 points), or severe (3 points). a final score of 3 is consistent with normal liver, higher scores being suggestive of progressive liver disease. the sonographer at the hcpa interpreted and scored the findings of routine ultrasound examinations. sequencing of the fragments was performed using the big dye(tm) terminator v3.1 ready reaction cycle sequencing (applied biosystems, foster city, ca, usa) and fluorescent dye terminator sequencing on a genetic analyzer (abi prism(tm) 3130xl, applied biosystems). for the statistical analysis, the data were processed and analyzed with the aid of the ibm spss statistics software package, version 18.0 (ibm corporation, armonk, ny, usa). descriptive analysis was performed, quantitative data being presented as mean sd or median (interquartile range). qualitative data were expressed as n (%). in the statistical analysis, the patients were divided into three groups by the number of known cf - causing mutations identified (two or more, one, or none). the three groups were compared by one - way anova for continuous variables with normal distribution ; by the kruskal - wallis test for ordinal variables or for continuous variables without normal distribution ; and by the chi - square test for categorical variables, yates ' correction or fisher 's exact test being used when necessary. the level of significance was set at 5%, and all tests were two - tailed. between may of 2009 and november of 2010, we evaluated 37 patients with phenotypic findings of cf, with or without sweat test confirmation. females predominated in the study sample, which consisted of 28 females (75.7%) and 9 males (24.3%). the mean age was 32.5 13.6 years (range, 14 - 67 years). most of the patients were white (only 1 patient was non - white), and 16 patients (43.2%) reported having relatives (first- and second - degree relatives) with a confirmed diagnosis of cf. the mean bmi was 22.4 3.85 kg / m (range, 15.3 - 30.0 kg / m. only 3 patients (8.1%) met diagnostic criteria for diabetes mellitus, and 13 (35.1%) met diagnostic criteria for chronic sinus disease. regarding sputum microbiology, the most commonly isolated bacterium was p. aeruginosa (43.2%), followed by s. aureus (35.1%). h. influenzae was identified in 7 patients (18.9%), and b. cepacia was isolated in 5.4% of the patients. the mean fev1 was 68.31 25.40% of predicted, the mean fvc was 80.0 19.4% of predicted, and the mean fev1/fvc ratio was 71.68 17.34%. sweat electrolytes were evaluated in two samples, the mean weight of the first sample being 242.00 85.99 mg and the mean weight of the second sample being 228.50 95.00 mg. chloride concentrations in the first and second samples were, respectively, 54 26.14 meq / l and 51.76 23.37 table 1general characteristics of the patients suspected of having mild or atypical cystic fibrosis. variablespatients(n = 37) gender male9 (24.3) female28 (75.7) age, years 32.5 13.6 race white36 (97.3) non - white1 (2.7) bmi, kg / m 22.4 3.85 family history of cf16 (43.2) exocrine pancreatic insufficiency5 (13.5) digital clubbing8 (21.6) diabetes mellitus3 (8.1) chronic sinus disease13 (35.1) sputum bacteriology pseudomonas aeruginosa 16 (43.2) mucoid p. aeruginosa 7 (18.9) nonmucoid p. aeruginosa 10 (27.0) staphylococcus aureus 13 (35.1) methicillin - sensitive s. aureus 12 (32.4) methicillin - resistant s. aureus 2 (5.4) burkholderia cepacia 2 (5.4) haemophilus influenzae 7 (18.9) fev1, l 2.20 0.95 fev1, % of predicted 68.31 25.4 fvc, l 2.99 0.90 fvc, % of predicted 80.0 19.4 fev1/fvc 71.68 17.34 sweat test sample 1 sodium, meq / l57.57 27.34 chloride, meq / l54.00 26.14 sample weight, mg242.34 85.99 sample 2 sodium, meq / l57.19 22.12 chloride, meq / l51.76 23.37 sample weight, mg228.50 95.00cf : cystic fibrosisbmi : body mass indexavalues expressed as n (%), except where otherwise indicated.bvalues expressed as mean sd values expressed as n (%), except where otherwise indicated. values expressed as mean sd table 2 compares the three groups of patients (those in whom two or more mutations were identified, those in whom only one mutation was identified, and those in whom no mutations were identified) in terms of their characteristics. there were no significant differences among the groups regarding gender, age, race, or family history of cf. there were no significant differences among the three groups regarding exocrine pancreatic insufficiency, which was found in 2, zero, and 3 patients, respectively. there were also no significant differences among the groups regarding presence of digital clubbing, bmi, presence of diabetes mellitus, or presence of chronic sinus disease. regarding sputum microbiology, we found no significant differences among the groups in terms of the identification of p. aeruginosa, s. aureus, h. influenzae, and b. cepacia. there were no significant differences among the groups regarding the shwachman - kulczycki score, the williams liver score, or the presence of bronchiectasis. there were also no statistically significant differences among the three groups regarding the mean fvc and fev1, in % of predicted, or the mean fev1/fvc ratio. there were no differences among the groups in terms of sweat sodium and chloride concentrations. there were no differences among the three groups regarding normal, borderline, or abnormal sweat test results. those results were observed, respectively, in 1, 2, and 1 of the patients in whom at least two mutations were identified ; in 1, 3, and 3 of the patients in whom one mutation was identified ; and in 12, 4, and 10 of the patients in whom no mutations were identified. table 2comparison of three groups of patients (those in whom two or more mutations were identified, those in whom one mutation was identified, and those in whom no mutations were identified) in terms of their characteristics. gender0.242 male1 (25.0)0 (0.0)8 (30.8) female3 (75.0)7 (100.0)18 (69.2) age, years 30.80 10.9030.00 9.9533.00 14.430.851 race white4 (100.0)7 (100.0)25 (96.2)0.805 non - white0 (0.0)0 (0.0)1 (3.8) bmi, kg / m 22.9 3.723.3 2.322.2 4.30.801 family history of cf3 (75.0)2 (28.6)11 (42.3)0.322 exocrine pancreatic insufficiency2 (50.0)0 (0.0)3 (11.5)0.570 digital clubbing0 (0.0)0 (0.0)8 (30.8)0.115 ogtt glucose intolerance0 (0.0)2 (28.6)4 (15.4)0.624 diabetes0 (0.0)1 (14.3)2 (7.7) chronic sinus disease2 (50.0)4 (57.1)7 (26.9)0.266 sputum bacteriology pseudomonas aeruginosa 1 (25.0)5 (71.4)10 (38.5)0.218 mucoid p. aeruginosa 1 (25.0)3 (42.9)3 (11.5)0.162 nonmucoid p. aeruginosa 0 (0.0)3 (42.9)7 (26.9)0.306 staphylococcus aureus 3 (75.0)3 (42.9)7 (26.9)0.154 methicillin - sensitive s. aureus 2 (50.0)3 (42.9)7 (26.9)0.530 methicillin - resistant s. aureus 1 (25.0)1 (14.3)0 (0.0)0.062 burkholderia cepacia 0 (0.0)0 (0.0)2 (7.7)0.639 haemophilus influenzae 0 (0.0)1 (14.3)6 (23.1) shwachman - kulczycki score 80 (32.5)75 (20.0)70 (31.3)0.748 liver score 3 (0)3 (0)3 (0)0.399 presence of bronchiectasis2 (50.0)6 (85.7)19 (73.1)0.439 fev1, l 3.01 0.712.44 0.702.20 1.130.317 fev1, % of predicted 89.7 26.072.2 14.768.2 29.00.338 fvc, l 3.7 0.43.2 0.52.9 1.20.359 fvc, % of predicted 95.5 16.181.7 6.278.5 23.20.320 fev1/fvc 80.3 12.574.8 14.173.7 19.00.785 sweat test sample 1 sodium, meq / l56.8 20.359.14 27.356.5 28.00.973 chloride, meq / l53.8 15.761.3 23.1051.34 27.70.674 sample 2 sodium, meq / l53.3 10.356.4 27.858.1 22.20.941 chloride, meq / l49.7 10.5052.2 26.052.2 24.40.985 sweat test result normal1 (25.0)1 (14.3)12 (46.2)0.306 borderline2 (50.0)3 (42.9)4 (15.4) abnormal1 (25.0)3 (42.9)10 (38.5)cf : cystic fibrosisbmi : body mass indexogtt : oral glucose tolerance testavalues expressed as n (%), except where otherwise indicated. bvalues expressed as mean sd.cvalues expressed as median (interquartile range). oneway anova for continuous variables with normal distribution or kruskal - wallis test (ordinal variables or continuous variables without normal distribution) ; chi - square test (categorical variables), yates ' correction or fisher 's exact test being used when necessary : oral glucose tolerance test values expressed as n (%), except where otherwise indicated. oneway anova for continuous variables with normal distribution or kruskal - wallis test (ordinal variables or continuous variables without normal distribution) ; chi - square test (categorical variables), yates ' correction or fisher 's exact test being used when necessary the mutations identified by molecular analysis are presented in table 3., we identified three mutations (p.t351s and p.f508del in the first allele, and p.p1290p in the second allele). other mutations identified were p.a559 t, p.d1152h, p.t1057a, p.i148 t, p.v754 m, p.p1290p, and p.r1066h. table 3mutations in the groups of patients in whom at least one mutation was identified.groupsmutationspatientsallele 1allele 2 2 mutations1p.t351s / p.f508delp.p1290p2p.a559tp.d1152h3p.v232dp.f508del4p.v232dp.f508del1 mutation5p.t1057a6p.i148t7p.v754m8p.p1290p9p.f508del10p.f508del11p.r1066h this was a cross - sectional study evaluating patients who presented with phenotypic findings consistent with cf and who were referred to a referral outpatient clinic for the diagnosis and treatment of cf in adolescents and adults. the molecular analysis of the cftr gene contributed to the definitive diagnosis of cf in 4 (10.8%) of the 37 patients evaluated. in 7 patients (18.9%), only one cf - causing mutation was identified, whereas, in 26 patients (70.3%), no mutations were identified. none of the clinical characteristics evaluated were found to be associated with the genetic diagnosis. the presence of exocrine pancreatic insufficiency tended to be more common in patients with a confirmed genetic diagnosis of cf, although the difference was not statistically significant. of the patients with a genetic diagnosis of cf, only 1 had abnormal sweat test results. however, of the 7 patients in whom one mutation was identified, 3 had abnormal sweat test results, as did 10 of the 26 patients in whom no mutations were identified. clinical characteristics and reasons for referral included the presence of chronic lung disease and chronic sinus disease, bronchopulmonary colonization with germs suggestive of cf, digital clubbing, family history of cf, gastrointestinal abnormalities, and nutritional abnormalities. all of the patients had previously undergone sweat tests at least twice. in the present study, of the 4 patients with a genetic diagnosis of cf, 1 can be characterized as having mild, classic cf because that patient had late manifestations of the disease and abnormal sweat test results, whereas the remaining 3 can be characterized as having atypical cf because they presented with borderline or normal sweat electrolyte values. the development of molecular analysis techniques allowed the identification of more than 1,900 mutations in the cftr gene, as can be seen in the cystic fibrosis mutation database (http://www.genet.sickkids.on.ca/cftr). genetic mutations have been classified as severe (class i - iii mutations) or mild (class iv - vi mutations) on the basis of the molecular defect of the cftr protein. in individuals with class i mutations, the cftr protein is not synthesized ; in those with class ii mutations, the cftr protein is improperly processed in the endoplasmic reticulum ; in those with class iii mutations, the cftr protein is improperly regulated ; in those with class iv mutations, the cftr protein shows defective conductance ; in those with class v mutations, cftr protein production is defective ; and in those with class vi mutations, there is rapid degradation of the cftr protein. nonclassic forms of cf have been associated with mutations that reduce but do not eliminate the function of the cftr protein. in general, individuals who are homozygous for class i - iii mutations present with pancreatic insufficiency, diabetes, high rates of meconium ileus, early mortality, more rapid decline in lung function, more severe malnutrition, and liver disease. patients with class iv and v mutations present with milder disease, pancreatic sufficiency, and better survival. no mutations in the cftr gene are identified in 1.0 - 1.5% of all patients with classic cf. in cases of nonclassic cf, our molecular analysis of the cftr gene included analysis of the coding region and of the flanking regions. however, mutations in these regions are less common and would probably not have explained all of the cases in our sample. the most common mutation is p.f508del (deletion of the amino acid phenylalanine at position 508) ; however, the frequency of this mutation varies across populations, being approximately 47% in brazil. in an analysis of brazilian patients with cf, one group of authors showed that p.f508del and four other mutations (p.g542x, p.n1303k, p.g551d, and p.r553x) accounted for 56% of cf alleles. the spectrum of cf mutations in brazil indicates a strong european influence, being particularly similar to that in the italian population. in a previous study conducted at the hcpa, the p.f508del mutation was found in 48.7% of the alleles. the sensitivity of cf genotyping depends entirely on the number of mutations tested and on the ethnicity of the individuals being tested. the low sensitivity of the method is generally due to the large number of known mutations and to the fact that commercially available panels include only a minority of those mutations. it should be taken into consideration that our study sample consisted of patients selected from among those referred to our facility (a referral center for cf) because of the difficulty in establishing a diagnosis. one group of authors reported 6 cases of cf diagnosed in adulthood, with suppurative lung disease, preserved pancreatic function, and only one mutation identified. the authors concluded that the diagnostic spectrum of patients investigated in adulthood is different from that of those diagnosed in childhood. one study sought to determine whether changes in the function of the cftr protein were responsible for the full spectrum of variant cf phenotypes. of those patients, 29 had two mutations in the cftr gene, 15 had one mutation, and 30 had no mutations. as occurred in our study, there were no differences among patients with two, one, or no mutations in terms of their clinical characteristics and sweat chloride concentrations. the authors concluded that factors other than mutations in the cftr gene can produce phenotypes clinically indistinguishable from nonclassic cf caused by cftr protein dysfunction. in 2004, one group of authors published a study evaluating the clinical characteristics and diagnostic parameters of patients diagnosed with cf in adulthood. of 1,051 individuals with cf, 73 (7%) were diagnosed with the disease in adulthood. of the 46 patients diagnosed with cf after 1990, 30 (65%) were diagnosed by sweat testing, 15 (33%) were diagnosed by mutation analysis, and 31 (67%) were diagnosed by a combination of both methods. nasal potential difference measurements alone confirmed the diagnosis in the remaining 15 patients (33%). the authors concluded that patients with cf presenting in adulthood generally present with pancreatic sufficiency, inconclusive sweat test results, and a high prevalence of mutations that are not seen in childhood. the major limitation of the present study is the small sample size (in particular, the small number of cases with a confirmed diagnosis), which precludes the generalization of the results of the comparison among the three groups in terms of their clinical characteristics and limits the external validity of the study. another limitation is that we did not perform nasal potential difference measurements, because the method was not available for use at our hospital during the study period. the clinical implication of the present study is that it demonstrates the difficulty that specialists face in diagnosing cf in adolescents and adults clinically suspected of having the disease. the sweat test is not specific enough to rule out cf in such patients. in conclusion, in this population of patients who had findings consistent with cf and who were referred to a referral program for adolescents and adults with cf for evaluation, the molecular analysis of the cftr gene coding region contributed to the definitive diagnosis of cf in 3 patients (8.1%) and allowed the identification of mutations in 1 patient with mild cf, previously confirmed by sweat testing. patients with abnormal sweat electrolytes and with no identified mutations probably have alterations that are currently unknown. none of the clinical characteristics evaluated were found to be associated with the genetic diagnosis. | objective : to evaluate the diagnostic contribution of molecular analysis of the cystic fibrosis transmembrane conductance regulator (cftr) gene in patients suspected of having mild or atypical cystic fibrosis (cf). methods : this was a cross - sectional study involving adolescents and adults aged 14 years. volunteers underwent clinical, laboratory, and radiological evaluation, as well as spirometry, sputum microbiology, liver ultrasound, sweat tests, and molecular analysis of the cftr gene. we then divided the patients into three groups by the number of mutations identified (none, one, and two or more) and compared those groups in terms of their characteristics. results : we evaluated 37 patients with phenotypic findings of cf, with or without sweat test confirmation. the mean age of the patients was 32.5 13.6 years, and females predominated (75.7%). the molecular analysis contributed to the definitive diagnosis of cf in 3 patients (8.1%), all of whom had at least two mutations. there were 7 patients (18.9%) with only one mutation and 26 patients (70.3%) with no mutations. none of the clinical characteristics evaluated was found to be associated with the genetic diagnosis. the most common mutation was p.f508del, which was found in 5 patients. the combination of p.v232d and p.f508del was found in 2 patients. other mutations identified were p.a559 t, p.d1152h, p.t1057a, p.i148 t, p.v754 m, p.p1290p, p.r1066h, and p.t351s. conclusions : the molecular analysis of the cftr gene coding region showed a limited contribution to the diagnostic investigation of patients suspected of having mild or atypical cf. in addition, there were no associations between the clinical characteristics and the genetic diagnosis. |
prostate cancer is the most frequent tumor in men, afflicting african american males to a greater degree than caucasians. morbidity and mortality are mainly attributable to metastasis ; yet the mechanisms associated with progression are largely unknown. localized carcinomas are readily removed surgically, but once a tumor has established metastases, current therapies are not curative and prolong survival by only a few years. metastasis occurs through a multistep process, where metastatic cells must intravasate local tissues and enter into and survive in the blood stream. these cells then extravasate into the secondary tissue and initiate and maintain micrometastases at distant sites, with the end result being the development of a metastatic tumor [1, 2 ]. during each step of this process, cancer cells exhibit transdifferentiation properties that allow both the spatial and temporal expression of epithelial and mesenchymal properties in response to microenvironment signals and its own basic survival needs (e.g., motility and invasion versus proliferation). thus, a model of cellular transitions, as opposed to a continual progression to permanent differentiation state, is emerging as a significant mechanism during metastasis. a greater understanding of these mechanisms will result in clinical improvements and a better control of the metastasis process. epithelial - mesenhymal transition (emt) was first described during development [3, 4 ] ; however an emt - like phenotypic change has been observed in a number of solid tumors [57 ]. this transition is typically characterized by a loss in e - cadherin and cytokeratin expression. emt in cancer, as in development, is associated with an increase in cell proliferation [8, 9 ] and the acquisition of a mesenchymal phenotype that includes vimentin, n - cadherin, and osteopontin expression. in both normal development emt and cancer - associated emt, the loss of e - cadherin is critical to the differentiation and maintenance of the epithelial phenotype and provides a structural link between adjacent cellular cytoskeletons, which is important for tissue architecture. cells that have undergone emt (e - cadherin negative mesenchymal cells) subsequently become more migratory and invasive and proceed to traverse underlying basement membranes, with an acquired ability to intravaste the surrounding local tissue and gain access to vascular conduits. as such, the loss of e - cadherin is rate limiting for emt [10, 11 ]. recent reports from this laboratory and others have described a mesenchymal to epithelial reverting transition (mert) to occur, where mesenchymal - like prostate cancer cell lines reexpress e - cadherin to become epithelial - like, and reestablish cellular adhesion during colonization within the liver tumor microenvironment [12, 13 ]. these findings are shared in clinical metastases of various cancer origins including breast, colon, and bladder, where robust membrane expression of e - cadherin was observed, and the paired more differentiated primary tumors were e - cadherin negative [6, 14 ]. thus, a reversion of the mesenchymal phenotype appears to be important in latter stages of metastasis. numerous studies have shown that the underlying influence of these cellular transitions is a consequence of tumor - stromal interactions [15, 16 ]. coculture studies have found that the survival and proliferation of cancer cells are intimately linked to the soluble factors in the microenvironment, such as egf, tgf-, igf - l that contribute to survival and the subsequent formation of macrometastasis [1720 ]. however, these factors are not likely to have a direct effect during initial metastatic colonization, and thus heterotypic and homotypic cellular adhesion has been proposed to provide the necessary survival signals for successful colonization [21, 22 ]. current state - of - the - art technology does not provide the necessary resolution to determine at the single cell level in patients or experimental in vivo systems, individual cells that have successfully colonized the secondary site. however, numerous reports have firmly established that cancer - stromal interactions in vitro or in three - dimensional (3d) assays accurately mimic the drug sensitivity / resistance behavior of those cells found within solid tumors in vivo in a preclinical or clinical setting. thus, we employed a novel coculture assay to determine the cellular plasticity of cancer cells promoted by the bone stroma and the effect of tumor - stromal interactions on irradiation therapy in prostate cancer. the arcap model is the only robust prostate cancer bone metastatic model which demonstrates epithelial to mesenchymal transition(emt). the arcap progression model consists of arcape (epithelial) and arcapm (mesenchymal), where the arcape cells have a bone metastatic potential of 12.5% and the arcapm cells have a bone metastatic potential of 100%. the arcape and arcapm cells express the classical markers of emt [24, 25 ]. herein we present findings that arcapm cells undergo mert when cocultured within the bone microenvironment in 3d and 2d cultures. additionally, arcape cells that retained an epithelial phenotype exhibited a measurable growth advantage and retained ability to form colonies, however only under coculture conditions with bone stroma. furthermore, blocking the ability of arcape or arcapm cells from e - cadherin - mediated cell - cell adhesion or integrin alpha v beta - associated adhesion significantly affected arcap cell survival within bone stroma and sensitized these cells to radiation treatment. the human prostate cancer cell lines, arcape, arcapm, the hs-27a bone stromal cells (atcc, manasss, va) and the pt - n or pt - c human prostate stromal cell. isolation and characterization of the human prostate cancer rfp - arcap cell lines has been reported. red fluorescent protein- (rfp-) transfected cells were maintained in g418 (350 mg / ml) prior to experimentation. all cell lines were grown in a 5% co2 incubator at 37c in media consisting of t - medium (invitrogen, carlsbad, ca) supplemented with 5% (v / v) fetal bovine serum and 1% penicillin - streptomycin. initial cocultures were performed as previously described [12, 13 ] with modifications. cocultures consisted of 50 000 cells / cm of hs-27a bone marrow stromal cells and 2000 cells / cm prostate cancer cells. cocultures were maintained in serum - free t - media and plated on tissue culture dishes. cells were plated at low densities in six - well plates for 24 hours and then were irradiated with the appropriate radiation dose. twenty - four hours later, the media were changed and cells were incubated until they formed colonies having at least 50 or more cells. seventeen days later colonies were rinsed with pbs, stained with methanol / crystal violet dye, and counted. the colony formation ability was calculated as a ratio of the number of colonies formed, divided by the total number of cells plated, times the plating efficiency [(# of colonies formed total # cells plated) plating efficiency ]. for experiments with cocultures, cells were initially incubated on a mat of stromal cells for 24 hours and radiated ; 4 hours later clonogenic assay was performed. for antibody - based experiments using anti - e - cadherin (15 g / ml, decma or shep8 - 7, sigma) and anti - integrin alpha - v (20 g / ml, cnt095) antibody, cancer cells were treated with respective antibodies for 24 hours prior to plating them on a mat of stromal cells. external beam radiation was delivered on a 600 varian linear accelerator (varian medical systems, inc.palo alto, ca) with a 6 mv photon beam. a 40 40 cm field size was utilized and petri dishes were placed on 1.5 cm of superflab bolus. monitor units (mus) were calculated to deliver the dose to a depth of dmax at a dose rate of 600 mu / min. representative findings are shown for all experiments, which were performed in triplicate, repeated a minimum of three times. recently, the arcap model has been described to closely mimic the patho - physiology of advanced clinical human prostate cancer bone metastasis. these cells exhibit a cuboidal - shaped epithelial morphology with high expression of epithelial markers, such as cytokeratin 18 and e - cadherin. the lineage - derived arcapm cells have a spindle - shaped mesenchymal morphology and phenotype. arcapm cells have decreased expression of e - cadherin and cytokeratins 18 and 19 but increased expression of n - cadherin and vimentin. these cells have decreased cell adhesion and increased metastatic propensity to bone and adrenal glands. the morphologic and phenotypic changes observed in the arcapm cells closely resemble those of cells undergoing emt. previously, we have demonstrated a mesenchymal to epithelial reverse transition (mert) of metastatic prostate cancer cell lines within an experimental coculture model and confirmed in patients with liver metastasis [13, 28 ]. our findings have recently been confirmed in prostate cancer bone metastasis where e - cadherin and -catenin were robustly expressed in late stage carcinomas. therefore we sought to identify the significance of the bone microenvironment within the experimental arcap model. to assess cellular plasticity of the arcap emt model, we coultured arcap cells with hs-27a cells in 3d rwv (rotary wall vessel) system for 3 days. arcape cells formed larger prostate organoids than arcapm cells (data not shown). upon immunohistochemical examination of organoids, we observed that both arcape and arcapm express e - cadherin and lack n - cadherin expression (figure 1(a)). to further examine the influence of tumor - stroma interactions over a multiday period we utilized a similar 2d cocultures method. utilizing immunoctyochemical analysis, we observed a lack e - cadherin and robust n - cadherin staining after 1 day in both arcape and arcapm cocultures. however by day 4, both arcape and arcapm cells formed tumor nest that express e - cadherin and lack n - cadherin staining (figure 1(b)). it is worthy to note that arcapm tumor nest appeared to develop at much smaller extent, compared to arcape cocultures. since arcape cells formed larger tumor nest and spheroids when cocultured with hs-27a cells compared to arcapm cells, we sought to further assess if hs-27a cells preferentially stimulated the growth of arcape cells versus arcapm cells. utilizing gfp - transfected hs-27a bone marrow stromal cells and rfp - transfected arcape or arcapm cells (figure 2(a)), we examined the proliferative ability of arcap cells in homotypic and coculture conditions. growth of rfp - transfected arcape and arcapm cells, respectively, was quantified by relative fluorescent units (rfu) of transfected cell lines over a 6-day period in homotypic cultures and coculture conditions (figure 2(a)). as previously reported, homotypic cultured arcapm shows significant growth compared to arcape homotypic cultures ; however cocultures reversed this trend with arcape cells demonstrating the most significant growth (figure 2(b)). although arcapm cells have a higher plating efficiency than arcape cells, arcape cells exhibited an 8-fold increase in their ability to form colonies after coculture compared to 1.35-fold increase of cocultured arcapm cells (figure 2(c)). phase - contrast microscopy of colonies after coculture shows that arcapm colonies appear loosely adherent, while arcape cells are compact and interact physically with few of the bone stromal fibroblast (figure 2(d)). taken together, these results demonstrate that arcapm cells reexpress e - cadherin when grown with bone stromal cells for longer periods. additionally, arcape cells which have high levels of e - cadherin gain enhanced growth and self - renewal ability when cocultured with bone stromal cells. mesenchymal cancer cells have been thought to be more tumorigenic, aggressive, and resistant to treatments when compared to epithelial cancer cells. a similar trend was observed in both arcape and arcapm cells after (4 gy) irradiation treatment. arcapm homotypic cancer cells are more resistant to radiation treatment compared to arcape homotypic cancer cells (figure 3(a)). however, arcapm cocultures did not affect the radiation sensitivity of arcapm cancer cells. the highly sensitive arcape cells exhibit a significant increased resistance to radiation therapy, up to 3-fold, as result of their interaction with bone stromal cells (figure 3(a), p <.01). to further assess the role of the prostate stromal cells on tumor - stromal interactions influencing arcap cellular behavior, we cocultured paired prostate stromal fibroblasts isolated either from normal (pt - n) or from cancer - associated regions (pt - c). again, arcape cells cocultured with (pt - n) or (pt - c) exhibited a 7-fold and 8-fold increase in colony formation, respectively (figure 3(b), p <.01). we also saw a similar trend in a growth analysis assay (data not shown). however when measuring clonogenic ability after radiation treatment, arcape cells cocultured with either pt - n or pt - c had increased radiation resistance, with a 2-fold difference observed between homotypic cultured cells. although a significant increase in clonogenic formation was observed in pt - c versus pt - n cocultures (p <.05), this did not significantly effect the radiation sensitivity of arcapm cells (figure 3(c)). taken together, both bone and prostate stromal cell have a grown inductive effect on arcape cancer cells and mediate radiation resistance (up to 2 - 3 fold) in epithelial cancer phenotype, but not in arcapm mesenchymal cancer cells. the importance of cell adhesion (i.e., cell - cell and cell - ecm adhesion) on the survival of disseminated cancer cells has been well documented as a requirement for colonization and survival within the metastatic microenvironment [3234 ]. therefore we utilized a well - known e - cadherin blocking antibody (shep8 - 7) and a pan - integrin antibody (cnt095) that targets human alpha - v - integrin and also was shown to block prostate tumor growth within bone. since arcape cells express high levels of the epithelial marker e - cadherin, and arcapm cells can be microenvironmentally induced to express e - cadherin, we tested whether either of these blocking antibodies would affect the colony forming ability of either arcape or arcapm bone stroma - cocultured cells. pretreatment with e - cadherin antibody did not affect the colony forming capacity of either arcape or arcapm homotypic cultured cells ; however it significantly reduced the ability of arcapm- (p <.001) and arcape- (p < additionally, e - cadherin blocking antibody pretreatments further increased sensitivity to radiation treatment of arcapm cells in homotypic and cocultured conditions, similarly (p <.01). e - cadherin blocking antibody - pretreated arcape cells showed the most significant increased sensitivity to radiation treatment in homotypic compared cocultured conditions (p <.001), however a significant reduction in colony formation, to a lesser extent, was observed in arcape cocultured cells (figure 4, p <.01). therefore, targeting e - cadherin limited both epithelial and mesenchymal cells ability to form colonies after coculture with bone stromal cells. to determine the influence of intergin alpha v cell adhesion with bone microenvironment, we performed similar clonogenic formation assay. pretreatment with cnt095 antibody significantly decreased the clonogenic ability of both arcapm and arcape cells in homotyic cultures (figure 5, p <.001). additionally, cnt095 significantly decreased bone stroma - induced radiation resistance in cancer cells in both arcapm (p <.001) and arcape (p <.001) cancer cells, with the most significant reduction in cocultured conditions (p <.001) (figure 5). taken together, these results suggest that bone stroma - induced radiation resistance is mediated through both e - cadherin and integrin alpha v beta signaling in epithelial and mesenchymal cells. thus, e - cadherin and integrin alpha v beta appear to present novel targets for metastatic and radiation resistant cells. it is well documented in prostate and others cancers that emt is associated with initial transformation from encapsulated to invasive carcinomas. the mesenchymal phenotype, which is required for dissemination, has been suggested to revert to an epithelial phenotype in distant metastasis [13, 14, 29, 36 ]. this has been evidenced in the primary tumors which lack e - cadherin expression and, showing nuclear -catenin expression, show strong membrane staining for both e - cadherin and -catenin in metastatic liver or bone microenvironment [28, 29 ]. we have previously shown, in commonly utilized prostate cancer cells lines du-145 and pc-3, that reexpression of e - cadherin and reversion of the mesenchymal phenotype is a rate limiting for metastatic seeding of primary rat hepatocytes. since bone metastasis is most prevalent in prostate cancers, we sought to extent these finding utilizing the arcap model, which is the first prostate cancer emt model demonstrating histomorphological features and classical markers in a lineage - derived series of cells, to determine the functional relationship of this cellular transition. whether this is accomplished through exposure to soluble growth factors or the bone microenvironment, the end result decreased differentiation with increased metastatic potential [25, 27, 37 ]. our initial results show that arcapm cells maintained in 3d rotary wall vessel (rwv) or 2d cocultures underwent mert when cocultured with hs-27a bone stromal cells, as shown through expression of e - cadherin and of n - cadherin expression (figures 1(a) and 1(b)). moreover arcape cells show a significant enhancement in colony formation (8) and significant growth pattern comparable to arcapm (1.35) cocultures (figures 2(b) and 2(c)). a recent report has shown through rfp cell tracking that selected arcape clones after in vivo inoculation into the bone microenvironment gives rise to both arcape and arcapm populations. these findings coupled with our observed reversion of arcapm cells to arcape like cells suggest that tumor - stromal - induced cellular plasticity gives rise to distinct populations of cancer cells within bone microenvironment, the mesenchymal phenotype and its kinetic characteristics (motility / invasive), and the epithelial characteristics necessary for secondary tumor development. the fact that the arcapm cells have an increase propensity for metastasis compared to arcape cells suggest that dissemination from the primary tumor mass requires the mesenchymal phenotype. however a mesenchymal to epithelial transition is associated with initial metastatic seeding and subsequent formation of a cohesive tumor mass within the bone microenvironment. this hypothesis is supported in a bladder cancer model, where lineage - derived series of emt - transformed mesenchymal - like cells exhibit increased lung metastasis in vivo ; however secondary tumor formation is predominantly enhanced by the presence of epithelial cells compared to mesenchymal cells. since epithelial reversion enhances the growth of tumor cells in bone microenvironment, and this is observed in multiple experimental models and clinical metastases, there is a question of whether this transition is required for metastatic seeding and therefore an avenue for therapeutic intervention(s). to gain insight into the importance of this reversion, we utilized ionizing radiation on arcape and arcapm homotypic and cocultured cells. our results show that arcape homotypic cultures when compared to arcapm homotypic cultures are more sensitive to radiation treatment (figure 3(a)). however in the presence of bone or prostate stromal cells, arcape cells gained increased radiation resistance, with increased proliferative and colony forming capacity (figures 2(b) and 2(c)). this phenomenon was not observed in the arcapm cocultures. to determine the underlining causes of this observation, we hypothesized that cell - cell interactions through e - cadherin or cell - ecm interactions through integrins may mediate the stromal induced proliferative effect and radiation resistance in arcape cancer cells. using e - cadherin neutralizing antibody (shep8 - 7) and pan - anti - integrin alpha v antibody (cnt095), we were able to significantly block the stromal induced colony forming ability on arcape cancer cells (figures 4 and 5). additionally, both antibodies significantly blocked the radiation resistance of arcape in cocultured conditions (figures 4 and 5). the e - cadherin neutralizing antibody also had an effect on homotypic arcapm - radiated cells and arcapm cells within cocultures (figure 4). thus it appears that blocking bone stroma - induced reexpression of e - cadherin in arcapm in the presence of bone stromal cells reduced the colony forming capacity of these cells (figure 4). the decreased radiation sensitivity of e - cadherin expressing cells compared to cells lacking e - cadherin expression has recently been demonstrated in a cocultured model of mcf-7 (e - cad positive) and mda - mb-231 (e - cad negative) cells with normal and radiation - induced senescent fibroblast, where radiation in mcf-7 cells showed enhanced resistance to radiation treatment compared to mda - mb-231 cells. these findings are consent with our model of a reepithelization requirement within tumor microenvironment. cnt095 antibody was toxic to both arcapm and arcape homotypic and cocultured cells. additionally cnt095 increased radiation sensitivity, even to a greater extent than e - cadherin neutralizing antibody treatment (figure 5). these findings are consistent with our results of ctn095 treatment that causes a significantly reduced number of tumors generated by c4 - 2b cells, along with a concomitant increase of cortical bone in mice (unpublished data). although c4 - 2b cells have not been observed to undergo emt, this would suggest that targeting the cell - ecm in vitro and in vivo could be limiting the cell cohesiveness necessary for metastatic tumor formation. e - cadherin neutralizing antibody (shep8 - 7) has been shown to sensitize multicellular spheroids to microtubule binding therapies in the taxane family in ht29 human colorectal adenocarcinoma cells. a more recent observation is that survival of androgen receptor - expressing differentiated prostate cells is dependent on e - cadherin and pi3k, but not on androgen, ar, or mapk. given the predominate role for pi3k in cell survival and reports that pi3k is rapidly recruited to cell membrane to stabilize e - cadherin junctions and that pi3k activation requires integrin alpha v activity suggests that pi3k is possibly responsible for the increased growth and colony formation gained within the tumor microenvironment. thus in the absence of stimulating growth factors, it is possible that e - cadherin / pi3k or integrin alpha v / pi3k is involved in a signaling cascade that is initiated by the tumor microenvironment, at least during initial metastatic seeding. in conclusion, our data demonstrate that the e - cadherin and integrin alpha nctional adhesive interaction is a possible adjuvant therapy avenue for patients treated with radiation. although an in - depth in vivo exploration of targeting epithelial - like versus mesenchymal - like cells is necessary to translate these findings to the clinical situation, our results indeed raise critical questions as to how we view prostate cancer metastasis and subsequently target metastatic tumor cells for therapy. additionally, we have generated an in vitro model, that closely mimics the clinical situation, to delineate in a stepwise manner the dynamic tumor - host interaction(s) that promote cellular plasticity in the later stages of metastasis. the identification of further key molecules driving mert in this system holds promise for the development of preventative and therapeutic strategies to minimize metastatic disease. | hs-27a human bone stromal cells, in 2d or 3d coultures, induced cellular plasticity in human prostate cancer arcape and arcapm cells in an emt model. cocultured arcape or arcapm cells with hs-27a, developed increased colony forming capacity and growth advantage, with arcape exhibiting the most significant increases in presence of bone or prostate stroma cells. prostate (pt - n or pt - c) or bone (hs-27a) stromal cells induced significant resistance to radiation treatment in arcape cells compared to arcapm cells. however pretreatment with anti - e - cadherin antibody (shep8 - 7) or anti - alpha v integrin blocking antibody (cnt095) significantly decreased stromal cell - induced radiation resistance in both arcape- and arcapm - cocultured cells. taken together the data suggest that mesenchymal - like cancer cells reverting to epithelial - like cells in the bone microenvironment through interaction with bone marrow stromal cells and reexpress e - cadherin. these cell adhesion molecules such as e - cadherin and integrin alpha v in cancer cells induce cell survival signals and mediate resistance to cancer treatments such as radiation. |
in a 2009 report, the american association of medical schools (aamc) and howard hughes medical institute (hhmi) articulate goals for quantitative biology teaching that can serve as a starting point. specifically, biology students should be able to demonstrate quantitative numeracy and facility with the language of mathematics, interpret data sets and communicate those interpretations using visual and other appropriate tools, make statistical inferences from data sets, extract relevant information from large data sets, make inferences about natural phenomena using mathematical models, apply algorithmic approaches and principles of logic (including the distinction between cause / effect and association) to problem - solving, andquantify and interpret changes in dynamical systems (aamc and hhmi, 2009, pp. demonstrate quantitative numeracy and facility with the language of mathematics, interpret data sets and communicate those interpretations using visual and other appropriate tools, make statistical inferences from data sets, extract relevant information from large data sets, make inferences about natural phenomena using mathematical models, apply algorithmic approaches and principles of logic (including the distinction between cause / effect and association) to problem - solving, and quantify and interpret changes in dynamical systems (aamc and hhmi, 2009, pp. although these quantitative skills are critical, we propose that other skills inherent to being a quantitative biologist may be equally important, such as the ability to collaborate across disciplines (e.g., hackett and rhoten, 2009 ; milton., 2010). we also posit that engendering positive student attitudes about quantitative work is important, because students ' interests and values, as well as their emotional responses, such as anxiety or enjoyment, can have significant effects on their willingness to engage in learning activities, persevere when they face difficulties, and persist in certain educational or career paths (steiner and sullivan, 1984 ; glynn., 2007 ; rheinlander and wallace, 2011 ; matthews., 2013 ; poladian, 2013). finally, we anticipate that positive skill and attitudinal outcomes will likely lead to desirable behavioral outcomes, such as enrollment in additional quantitative courses, completion of more quantitative degree programs, and pursuit of further education or careers in quantitative biology. thus, we propose that our goals for students should go beyond development of quantitative skills to include more positive emotional responses to quantitative work, such as greater enjoyment or reduced anxiety;more positive beliefs about the ability to do quantitative work, such as increased confidence and self - efficacy;increased interest in quantitative work;greater sense of the centrality of mathematics, statistics, and computation to the practice of life sciences, including their relevance and importance;improved ability to work in interdisciplinary teams ; andincreased intentions to pursue or actual pursuit of further education and careers in quantitative biology. more positive emotional responses to quantitative work, such as greater enjoyment or reduced anxiety ; more positive beliefs about the ability to do quantitative work, such as increased confidence and self - efficacy ; increased interest in quantitative work ; greater sense of the centrality of mathematics, statistics, and computation to the practice of life sciences, including their relevance and importance ; improved ability to work in interdisciplinary teams ; and increased intentions to pursue or actual pursuit of further education and careers in quantitative biology. just as data are needed to support hypotheses and conclusions in science research, data are needed to support the contention that students are benefiting from instruction. in particular, educational data should be collected to demonstrate whether students are making progress toward achieving the intended goals. what can students to do to convince us that they can use statistical methods to make inferences from data sets ? how can we be sure that students understand the theory behind a mathematical model of a biological phenomenon and can use that model to make predictions ? how will we know that students are less anxious about tackling quantitative problems or that they see math as relevant to their work as biologists ? we must collect assessment data, such as students ' solutions to problems, explanations of results or phenomena, or analyses and models of data. published methods for assessing students ' development of quantitative skills and other important outcomes are fairly limited. a number of assessments of quantitative reasoning or quantitative literacy have been developed, primarily to document quantitative skills of non science majors (e.g., steele and kilic - bahi, 2010 ; sundre and thelk, 2010). similarly, attitudinal assessments have been developed primarily for general audiences rather than biology majors (reviewed in chamberlin, 2010). more tools are needed to document students ' progress toward quantitative biology related outcomes, especially beyond introductory or non majors biology. to this end, we encourage teams of biologists, quantitative scientists, and education specialists to collaborate in developing and testing a broader suite of assessment tools related to quantitative biology. assessments are much more than homework problems or exams they are data - collection tools. it is not necessary, or even desirable, to always use published assessment tools when we teach, since these tools may not align with our teaching goals. just as in science, educators often have to develop tools or techniques to address the task at hand. we can use results gathered from these tools to inform what and how we teach a process called formative assessment. others have offered very useful advice on designing assessments (angelo and cross, 1993 ; sundberg, 2002 ; tanner and allen, 2004). we will highlight just a few ideas here that are easily adapted to teaching in any domain. to identify areas of confusion, we can periodically hand out index cards near the end of class and ask students to write one thing they learned and one thing they are still confused about. we can quickly peruse student responses and address the confusing ideas directly during the next class. we can also give challenging problems for students to work on or data sets to analyze, either as homework or in class, alone or in groups. we need to select these problems carefully to align with learning goals and give students practice solving the kinds of problems they will be expected to solve on exams or other high - stakes assessments. students earn a small amount of credit (e.g., a few points for genuine, on - task effort) for completing the work before we discuss it as a whole class. we can ask students to share how they went about tackling the problem or conducting the analysis, what their results are, and where they ran into difficulties. we can then offer guidance as needed. with goals and assessments in mind, we can choose what and how we will teach. some resources we can adapt or adopt for use with our own students are already available. some educators have developed entire research projects, courses, or course series (e.g., edelstein - keshet, 2005 ; chiel., 2010 ; duffus and olifer, 2010 ; miller and walston, 2010 ; rheinlander and wallace, 2011). for example, the symbiosis curriculum at east tennessee state university is a tightly integrated, three - course sequence that replaces the standard introductory biology, introductory statistics, and calculus i requirements. an initial assessment of the first two cohorts demonstrated student gains in both mathematical and biological knowledge, and further assessment is planned (depelteau., 2010). introductory courses have also been created that focus on learning the process of science, with data analysis as the main quantitative element (e.g., bell, 2011 ; goldey., 2012). at the upper level, math bio courses such as bioinformatics, mathematical biology, and mathematical modeling have been developed with the aim of bringing biologists, computational scientists, and mathematicians together to learn from one another (hydorn., 2005). others have launched collaborations between upper - level math and biology classes for students to learn from one another as they work together on a math bio project or problem (greer and palin, 2012). most of us do n't have the time, resources, or inclination to develop an entire course. instead, we can teach more quantitatively by using single lessons or modules that emphasize quantitative outcomes (e.g., jungck. the american biology teacher contains numerous quantitative biology activities scattered throughout their issues, but lse is especially useful for finding evidence - based instructional strategies and curricula. for example, speth and colleagues (2010) infused data - driven problems and quantitative tasks into their ecology and evolutionary biology course, which led to improvements in students ' abilities to represent data graphically. one of these sites, mathbench, was developed by biologists at the university of maryland and includes 30 + freely available online math bio modules that can be integrated into existing life sciences courses. thompson and colleagues (2010) have shown that students who complete these modules report gains in their quantitative skills and increased comfort with solving quantitative problems. web and journal resources for teaching quantitative biology. challenges of teaching quantitatively include fitting quantitative elements into an already - packed curriculum and convincing colleagues that a new version of an existing course serves students as well as what has been done in the past. concerns about failing to cover content may be assuaged by work from hester and colleagues (2014), who demonstrated that students in a quantitative introductory molecular and cell biology class scored equally well on biology test questions when compared with students who completed a traditional content - driven class. they stress the importance of using a learner - centered approach to achieving such outcomes. indeed, results from numerous meta - analyses (e.g., freeman., 2014) demonstrate that science students perform better when taught using active - learning approaches in place of traditional lectures in other words, when instructors stop talking and engage students in tasks that promote meaningful, intellectual engagement (allen and tanner, 2005). to prepare future generations of life scientists to take full advantage of mathematics and computation to understand the living world, we need to change how we are teaching. start by articulating goals for quantitative biology instruction consider quantitative and other professional skills as well as attitudinal outcomes, as all are important for developing expertise in quantitative biology. then define the evidence needed to show that students have made progress toward achieving the goals and how this evidence will be gathered through assessments. finally, design instruction to align with goals and assessments. some quantitative biology curricula and assessments are already available, but new resources are needed and should be developed through the collective efforts of quantitative biologists and education specialists. | more than a decade has passed since the publication of bio2010, calling for an increased emphasis on quantitative skills in the undergraduate biology curriculum. in that time, relatively few papers have been published that describe educational innovations in quantitative biology or provide evidence of their effects on students. using a backward design framework, we lay out quantitative skill and attitude goals, assessment strategies, and teaching resources to help biologists teach more quantitatively. collaborations between quantitative biologists and education researchers are necessary to develop a broader and more appropriate suite of assessment tools, and to provide much - needed evidence on how particular teaching strategies affect biology students ' quantitative skill development and attitudes toward quantitative work. |
pleomorphic adenoma (pa) is the most common salivary gland tumor classified as benign epithelial tumors 1. various cell types can be seen in the tumor indicating a high occurrence of cell differentiation. the results suggested that wnt is involved in cell differentiation in pa. in the present study, we considered that notch might also be involved in cell proliferation and differentiation in the same manner that okuda., we focused on notch expression in pa since it has been hypothesized to be strongly associated with neoplastic cell differentiation. tissue samples from department of oral pathology, school of dentistry, aichi gakuin university, diagnosed histologically as pa were further re - evaluated for the purpose of this research. a total of 30 cases of pa based on who classification were used in this experiment. the specimens used in this study were the same as those used by okuda. 2, described in table 1. specimens were fixed in neutral buffered formalin solution, subjected into series of alcohol for dehydration and then embedded in paraffin. then after, the specimens were serially sectioned into 4 m stained with hematoxylin and eosin and examined under a light microscope. briefly, deparaffinized sections were pre - treated for antigen retrieval in citrate buffer (mitsubishi chemical medience, tokyo, japan) with a ph of 6.0 and placed in autoclave at 120 c for 15 min. then after, sections were covered with serum - free protein block (dako japan co., ltd., notch1 rabbit polyclonal antibody (anti - notch-1 intracellular domain antibody, ab83232, abcam, cambridge, uk) was used as the primary antibody. immunofluorescent staining was also performed using notch1 rabbit polyclonal antibody, ck7 mouse monoclonal antibody (1:100 ; abcam) and ck13 mouse monoclonal antibody (ae8 ; 1:100 ; abcam). double staining was done by combining notch1 and ck7 as well as notch1 and ck13. after deparaffinization, notch1-ck7 and notch1-ck13 were pre - treated in citric acid buffer (mitsubishi chemical medience, tokyo, japan) with a ph of 6.0 and placed in microwave for 1 min. then after, sections were covered with serum - free protein block (dako), incubated at room temperature for 30 min. the primary antibodies notch1 and ck7 (1:100 ; can get signal, toyobo co.,, osaka, japan) were allowed to react at 4 c for 16 hours. for the secondary antibody, donkey anti - rabbit igg h&l (1:200 ; alexa fluor 594 ; abcam) and donkey anti - mouse igg h&l (1:200 ; alexa fluor 488 ; abcam) were carried out after reaction with can get signal (toyobo) at 1:200 at room temperature for 60 min. the present study was approved by the ethics committee of aichi gakuin university, school of dentistry under the title diagnosis and clinicopathological study on the elucidation of salivary gland tumors ' (no. generally, the tumor consists of various tissue types with small and/or large duct - like / cystic spaces in the tissues. the tumor is round in shape and covered with relatively thin fibrous connective tissue. the substantial portion of the tumor consists of glandular structures of tumor nests surrounded by fibrous tissue. the tumor stroma consists of duct - like structures predominantly ductal and myoepithelial cells forming cystic cavities. the mesenchymal part consists of myoepithelial cells, spindle shaped cells and myxoma - like tissue formed by round or oval cells dissociated from the tumor growth. the myoepithelial cells have sparsely formed cord - like structures and the presence of mucous was confirmed. cartilage - like tissues can be seen in a wide range possibly due to the presence of cartilage - like matrix and cartilage - like cells. neoplastic myoepithelial cells are dissociated from the mucous or cartilage - like substrate by their own secretions. the tumor parenchyma might have been formed by myxomatous cells, which migrated to seep into the structure of mesenchymal and cartilage - like cells. thus, the epithelial component is dissociated and mixed into the mesenchymal - like tissue, giving rise to a ' mixed appearance '. notch1 expression was observed in the cytoplasm of ductal epithelial cells as well as in some of the nuclei. notch expression was also observed in the nucleus of tumor cells surrounding solid tumor nests (fig. notch was expressed in the cytoplasm of plasmacytoid myoepithelial cells but not in the nucleus. in areas undergoing squamous metaplasia, notch was strongly expressed in the cytoplasm and nucleus of basal cells. however, the expression became weak towards the outer squamous cells (fig. the cartilage - like cells representing the characteristic feature of pa showed strong cytoplasmic expression but not nuclear reaction (fig. likewise, the myoepithelial cells in myxomatous area showed faint expression on the cell membrane but no cytoplasmic or nuclear reaction were detected (fig. double immunofluorescent staining revealed that notch and ck7 were co - expressed by tumor cells in ductal structures. notch expression was observed in most of the nucleus of tumor cells in solid nests as well as those in ductal structures (fig. on the other hand, notch was observed in the nucleus from basal cell to squamous cells (fig. double immunofluorescent staining of notch and ck13 revealed that most basal cells expressed notch although expression decreased towards the squamous cells. furthermore, nuclear expression was observed in basal cells and the expression became weak on the prickle cell layer (fig. generally, the tumor consists of various tissue types with small and/or large duct - like / cystic spaces in the tissues. the tumor is round in shape and covered with relatively thin fibrous connective tissue. the substantial portion of the tumor consists of glandular structures of tumor nests surrounded by fibrous tissue. the tumor stroma consists of duct - like structures predominantly ductal and myoepithelial cells forming cystic cavities. the mesenchymal part consists of myoepithelial cells, spindle shaped cells and myxoma - like tissue formed by round or oval cells dissociated from the tumor growth. the myoepithelial cells have sparsely formed cord - like structures and the presence of mucous was confirmed. cartilage - like tissues can be seen in a wide range possibly due to the presence of cartilage - like matrix and cartilage - like cells. neoplastic myoepithelial cells are dissociated from the mucous or cartilage - like substrate by their own secretions. the tumor parenchyma might have been formed by myxomatous cells, which migrated to seep into the structure of mesenchymal and cartilage - like cells. thus, the epithelial component is dissociated and mixed into the mesenchymal - like tissue, giving rise to a ' mixed appearance '. notch1 expression was observed in the cytoplasm of ductal epithelial cells as well as in some of the nuclei. notch expression was also observed in the nucleus of tumor cells surrounding solid tumor nests (fig. notch was expressed in the cytoplasm of plasmacytoid myoepithelial cells but not in the nucleus. in areas undergoing squamous metaplasia, notch was strongly expressed in the cytoplasm and nucleus of basal cells. however, the expression became weak towards the outer squamous cells (fig. the cartilage - like cells representing the characteristic feature of pa showed strong cytoplasmic expression but not nuclear reaction (fig. likewise, the myoepithelial cells in myxomatous area showed faint expression on the cell membrane but no cytoplasmic or nuclear reaction were detected (fig. double immunofluorescent staining revealed that notch and ck7 were co - expressed by tumor cells in ductal structures. notch expression was observed in most of the nucleus of tumor cells in solid nests as well as those in ductal structures (fig., notch was observed in the nucleus from basal cell to squamous cells (fig. double immunofluorescent staining of notch and ck13 revealed that most basal cells expressed notch although expression decreased towards the squamous cells. furthermore, nuclear expression was observed in basal cells and the expression became weak on the prickle cell layer (fig. pa is the most common benign epithelial tumor of salivary glands based on who classification 1. the tumor shows a wide variety of tumor development brought about by cell proliferation and differentiation as mentioned in previous studies 4 - 6. the results showed that tumor cells in ductal structure and in solid tumor nests expressed wnt. it was inferred that -catenin pathway was involved in cell differentiation indicated by wnt expressions in cells undergoing squamous metaplasia 2. for this reason, we believed that notch would have a role in tumor cell differentiation considering its association with other tumors 7, 8. notch appears as a typical signal that controls the growth of tissues responsible for the fate of cells 9. notch is a single - pass transmembrane receptor with a domain outside and inside the cell membrane. notch intracellular domain (nicd) is cleaved and binds to a ligand such as jagged. cleaved nicd is moved from the cell membrane into the cytoplasm, binds with suppressor of hair - less (su(h)) to form a complex and acts on downstream target gene in the nucleus thus activating the expression 10. in addition to the role of transmitting instructions for various morphogenesis and tissue differentiation during development, notch plays an important role in cell - cell signaling and is involved in stem cell maintenance, differentiation and neuronal function in adult. when there is a disturbance in the activity of notch signaling pathway, it becomes oncogenic detected in several cancers such as esophageal cancer, breast cancer and lymphoblastic acute leukemia (t - all) 11, 12. in addition, notch has been the focus of researches on the metastasis of malignant tumors such as adenoid cystic carcinoma and malignant ameloblastoma 13, 14, believed to be a huge factor in the progress of malignant tumors. studies in notch have been done in odontogenic tumors such as ameloblastoma 15 - 17. notch is expressed in solid nests and in squamous metaplasia in ameloblastoma, implicating its contribution in cell differentiation and morphogenesis. moreover, in calcifying cystic odontogenic tumor, calcifying epitheioma (pilomatrixoma), odontoma and craniopharyngioma, notch expression in ghost or shadow cells was observed 18 - 20. this means that notch inhibits the production of a ligand in receiving cell signal between notch ligand and notch receptor to adjacent cells through a negative feedback mechanism. in contrast, during binary cell fate determination, numb acts an inhibitor of notch signaling cycle causing asymmetric distribution of the notch pathway. this led to overexpression suggesting that notch - jagged1 is the primary mechanism in determining the fate of ghost cell 21. squamous metaplasia depicted as having a variety of cell differentiation is commonly observed in odontogenic tumors such as ameloblastoma. muraki suggested a close relationship between notch and ameloblastoma shown by the localization of notch in peripheral tumor nests 15. from this aspect, we suspected that notch might also be involved in cell differentiation in pa. comparing the results of our study with previous reports, from the partial ck7 expression and substantial notch expression in ductal epithelial cells as well as the notch expression in solid tumor nests, it can be inferred that notch is involved in cell differentiation 2, 22. ck13 expression was observed in cells undergoing squamous metaplasia and notch expression was seen in the nucleus of basal and squamous cells 23. the intense notch expression in basal cells and weak expression in squamous cells suggests that notch is involved in the differentiation from basal to squamous cell. moreover, the loss of nuclear expression on the surface layer would signify that differentiation is about to end or has been terminated. notch was expressed in the cytoplasm of cartilage cells and in the cell membrane of mucous cells but not in the nucleus indicating that differentiation has been concluded. notch involvement is suspected in cell differentiation in areas showing ductal structures and squamous metaplasia. in the study by okuda, small cuboidal cells forming ductal structure expressed wnt and the expression was also confirmed in the basal cells surrounding those cells undergoing squamous metaplasia. the results coincided with our present study implicating the function of notch in the same sites causing cell differentiation 2. in summary moreover, notch is expressed by basal cells undergoing squamous metaplasia suggesting the participation of notch in cell differentiation in pa. | the expression of notch in 30 cases of pleomorphic adenoma was examined by immunohistochemistry. comparing the results of our study with previous literatures, from the partial ck7 expression and substantial notch expression in ductal epithelial cells as well as the notch expression in solid tumor nests, it can be inferred that notch is involved in cell differentiation. ck13 expression was observed in cells undergoing squamous metaplasia and notch expression was seen in the nucleus of basal and squamous cells. the intense notch expression in basal cells and weak expression in squamous cells suggests that notch is involved in the differentiation from basal to squamous cell. moreover, the loss of nuclear expression on the inner layer would signify that differentiation is about to end or has been terminated. notch was expressed in the cytoplasm of cartilage cells and in the cell membrane of mucous cells but not in the nucleus indicating that differentiation has been concluded. notch involvement is suspected in cell differentiation in areas showing ductal structures and squamous metaplasia. in summary, notch is involved in cell differentiation of ductal cells in pa. nuclear expression was shown in tumor cells in solid nests and surrounding structures. moreover, notch is expressed by basal cells undergoing squamous metaplasia suggesting the participation of notch in cell differentiation in pa. |
the endothelium - derived relaxing factor, recently identified as nitric oxide (no) or a closely related compound, has potent antiatherosclerotic properties. no released from endothelial cells works in concert with prostacyclin to inhibit platelet aggregation ; it inhibits the attachment of neutrophils to endothelial cells and the expression of adhesion molecules. therefore, under all conditions where an absolute or relative no deficit is encountered, the process of atherosclerosis is being initiated or accelerated. the half - life of no, and therefore its biological activity, is decisively determined by oxygen - derived free radicals such as superoxide (o2). super - oxide reacts rapidly with nitric oxide (no) to form the highly reactive intermediate peroxynitrite (onoo). the rapid bimolecular reaction between no and o2, yielding onoo (rate constant 1.9 10/m / s), is about 5 to 10 times faster than the dismutation of o2 by superoxide dismutase. therefore, onoo formation represents a major potential pathway of no reactivity depending on the rates of tissue o2 production. peroxynitrite is also a highly reactive intermediate that may cause oxidative damage to lipids, proteins, and dna. there is a growing body of evidence that endothelial dysfunction in the setting of hypercholesterolemia, diabetes mellitus, hypertension, or chronic smoking is often a consequence of enhanced no degradation by oxygen - derived free radicals rather than diminished no formation due to decreased activity and/or expression of the nitric oxide synthase. therefore, in many instances the most effective approach to improve no bioavailability in the presence of risk factors is to lower o2 levels, eg by treatment withscavenging agents or by the administration of drugs that specifically inhibit o2 production. the effects of antioxidants such as vitamin c, - and -carotene, or vitamin e on the prognosis in patients with coronary - artery disease are very disappointing. so far, there is just one study showing a reduction in coronary - event rates in patients with angiographically evident coronary - artery disease (the cambridge heart antioxidant study [chaos ] trial) after treatment with vitamin e (400 - 800 iu / day), although the overall prognosis in these patients was not improved. other randomized trials, such as the alpha - tocopherol, beta carotene cancer prevention study, the gruppo italiano per lo studio della sopravvivenza nell'infarto miocardico (gissi - prevenzione trial), and the heart outcomes prevention evaluation (hope) study, failed to demonstrate any improvement of the prognosis in patients with coronary artery disease. how can one explain the lack of benefit from antioxidants despite the known causal role of oxidative stress in the initiation and progression of atherosclerosis ?. however, the rate constant for the reaction of vitamins e and c with o2 is much slower(1000- to 10 000-fold) than the rate constant for the reaction between no and o2. therefore, in order to scavenge o2, antioxidants must be administered in very high con centrations, to reach compartments where o2 is formed (such as endothelial and smooth - muscle cells). when high concentrations of vitamins are used, however, pro - oxidative effects may come into play. for example, low concentrations of vitamin e improved endothelial function in cholesterol - fed animals, while high concentrations of the vitamin had the opposite effects and even worsened endothelial function. one explanation for this is that when vitamin e reacts with a radical, it becomes the vitamin - e radical, ie the tocopheroxyl radical, which itself may participate in pro - oxidative events. these findings may indicate that the optimal dose of antioxidants must be titrated in order to improve rather than worsen vascular function. the phenomenon may at least partly explain the failure of antioxidants to improve prognosis in patients with coronary - artery disease. it is also possible that combinations of antioxidants, such as vitamins c and e, need to be used to prevent accumulation of the vitamin - e radical. the effect of angiotensin - converting - enzyme (ace) inhibitors on the progression of atherosclerosis and endothelial function has been studied in several animal models and in patients with coronary - artery disease. it has been consistently shown that ace inhibition slows the progression of atherosclerosis and improves impaired endothelial dysfunction without altering plasma cholesterol levels. in contrast to the published findings in studies of antioxidants, ace inhibitors seem to have a beneficial influence on the prognosis in patients with coronary - artery disease. how do ace inhibitors beneficially influence vascular function in atherosclerosis ? angiotensin ii, in turn, stimulates the release of endothelin-1 from endothelial cells and induces the expression of the preproendothelin gene in endothelial and smooth - muscle cells. inhibition of kininase ii, which is responsible for the breakdown of bradykinin, leads to high local concentrations of bradykinin. this substance, in turn, is a potent stimulus for the release of endothelium - derived hyperpolarizing factor, no, and prostacyclin. a novel, recently identified, mechanism contributes to the detrimental effects of angiotensin ii on vascular superoxide production. angiotensin ii has been shown to increase vascular superoxide production by activating an nadh - driven oxidase, one of the most significant superoxide - producing enzymes in endothelial and smooth - muscle cells. recent studies with hypercholesterolemic animals and patients with coronary - artery disease indicate that activation of this enzyme contributes considerably to endothelial dysfunction and early plaque formation. the stimulatory effects of angiotensin ii on the activity of the hadh - driven oxidase would suggest that in the presence of an activated renin - angiotensin system (local or circulating), vascular dysfunction due to increased vascular superoxide production is likely. indeed, there is a large body of literature providing evidence that the renin - angiotensin system is causally linked to the development and progression of atherosclerosis. incubation in vitro of cultured smooth - muscle cells with native low - density lipoproteins (ldls) increases the expression of the angiotensin ii receptor subtype at1. similar phenomena have been observed in animals fed cholesterol, in animals that are hyperlipidemic because of an ldl - receptor defect, and in patients with hypercholesterolemia. angiotensin ii facilitates the recruitment of monocytes / macrophages into the vessel wall by stimulating the production of the monocyte chemoattractant protein (mcp-1) and vascular - adhesion molecules. further indirect support for the involvement of the renin - angiotensin system in the development of atherosclerosis was provided by studies testing the antiathero - sclerotic properties of ace inhibitors and of at1-receptor antagonists. these studies have shown that both treatment regimens beneficially influence endothelial function, reduce oxidative stress within vascular tissue by inhibiting the vascular nadh oxidase, and, therefore, retard the formation of atherosclerotic plaques. the recently published results of the hope study seem to strengthen the idea that inhibition of the renin - angiotensin system, rather than treatment with the classical antioxidant -tocopherol, beneficially affects the prognosis in patients with coronary - artery disease. treatment with ramipril significantly lowered the risk of cardiovascular mortality and nonfatal cardiovascular events in high - risk patients who had vascular disease or diabetes plus one known cardiovascular risk factor. thus, it may be concluded that inhibition of the renin - angiotensin system and the subsequent inhibition of superoxide - producing enzymes provide a better antioxidative regimen than the administration of classic antioxidants, which merely scavenge already formed reactive oxygen species. | the results of recent randomized trials to test the influence of antioxidants on coronary - event rates and prognosis in patients with coronary - artery disease were disappointing. in none of these studies did the use of vitamin e improve prognosis. in contrast, treatment of coronary - artery disease with angiotensin - converting - enzyme (ace) inhibitors reduced coronary - event rates and improved prognosis. ace inhibition prevents the formation of angiotensin ii, which has been shown to be a potent stimulus of superoxide - producing enzymes in atherosclerosis. the findings suggest that inhibition of superoxide production at enzymatic levels, rather than symptomatic superoxide scavenging, may be the better choice of treatment. |
a study data set of 817 cases with available oncotype dx test results (cases from 2004 to 2009, from magee - womens hospital of the university of pittsburgh medical center) was used to build the prediction models. all cases included in the study were sent for oncotype dx testing owing to clinical requests received by the department of pathology. tumor grading information (including the nottingham grade, score, and the individual components of grading), tumor size, semiquantitative immunohistochemical results for er, pr, her2, and ki-67 were available from pathology reports. at our institution, er and pr results are reported using a semiquantitative immunohistochemical score (commonly known as h - score '), which details the percentage of positive cells showing none, weak, moderate, or strong staining. the score is given as the sum of the percent staining multiplied by an ordinal value corresponding to the intensity level (0 : none ; 1 + : weak ; 2 : moderate ; 3 + : strong). the resulting score ranges from 0 (no staining in the tumor) to 300 (diffuse intense staining). her2 semiquantitated immunohistochemical results were reported according to the college of american pathologist / american society of clinical oncology (cap / asco) guidelines. immunohistochemical scores of 0 and 1 + were considered a negative result and a score of 3 + was considered a positive result. the final her2 status on her2 2 + immunohistochemical cases was determined based on the fish result and classified as negative (negative for amplification, ie her2:cep17 ratio of 2.2), or equivocal (her2:cep17 ratio of 1.82.2). statistical analyses were performed using sas version 9.2 (sas institute, cary, nc, usa). a significance level was set at 0.05 and all p - values reported were two - sided. multiple linear regression analysis was performed to model the prediction of the oncotype dx recurrence score by nottingham score (range 39), ki-67 labeling index (0100), tumor size (in cm), h - scores (range : 0300) for er and pr, and her2 status (negative, equivocal, or positive). the first regression model included all available parameters (including ki-67 index) for prediction of oncotype dx recurrence score. the third regression model included only semiquantitative immunohistochemical expression level for er, pr, her2, and ki-67. ki-67 was available in less than half of the study data set cases, as it has only been routinely used at our institution since 2007. using the estimated coefficients derived by the three regression models, three equations were created and were labeled as new magee equations. the new magee equations were tested on a validation set of 255 cases (cases from our institution, sent for oncotype dx testing from 2010 until early 2011). in addition, our previously published equation (original magee equation) was also applied to the validation set cases. the original magee equation is represented as follows : recurrence score=13.424 + 5.420(nuclear grade)+5.538(mitotic count)0.045(er h - score)0.030(pr h - score)+9.486(0 for negative / equivocal and 1 for her2 positive). once the recurrence score was estimated using the four equations in microsoft excel worksheets (see supplementary data), the cases were categorized as low risk, intermediate risk, and high risk, using the same cutoffs as the actual recurrence score. concordance statistics were performed to compare the actual oncotype dx recurrence score category to the estimated / predicted recurrence scores category derived from each equation. based on data availability, the linear regression analyses on study cases resulted in three new magee equations and are represented below : new magee equation 1 : recurrence score=15.31385+nottingham score1.4055+erihc(0.01924)+prihc(0.02925)+(0 for her2 negative, new magee equation 2 : recurrence score=18.8042+nottingham score2.34123+erihc(0.03749)+prihc(0.03065)+(0 for her2 negative, 1.82921 for equivocal, 11.51378 for her2 positive)+tumor size0.04267. new magee equation 3 : recurrence score=24.30812+erihc(0.02177)+prihc(0.02884)+(0 for her2 negative, 1.46495 for equivocal, 12.75525 for her2 positive)+ki-67 0.18649. the original and new magee equations were then applied to each of the 255 validation set cases to estimate the recurrence score. using this data set, the mean (median) recurrence score for actual oncotype dx was 20 (19) compared with 17.8 (16.3) for original magee equation, 20 (19.1) for new magee equation 1, 19.9 (19.6) for new magee equation 2, and 19.5 (18.5) for new magee equation 3 (table 1). the concordance between actual oncotype dx recurrence score and the estimated recurrence score calculated from magee equations with respect to categorization ranged from 54.3 to 59.4% (tables 2, 3, 4, 5). the pearson 's correlation coefficient (figure 1) between estimated and actual recurrence score was similar for each of the equations (0.60404, 0.61661, 0.60386, and 0.59407 for original magee equation, new magee equation 1, new magee equation 2, and new magee equation 3, respectively). with the exclusion of the intermediate - risk categories for both the actual recurrence score and estimated recurrence score, the concordance for each equation increased to more than 95%, reflecting the very low two - step discordance (concordance 96.9% (95/98), 100% (76/76), 98.6% (75/76), and 98.7% (79/80) for original magee equation, new magee equation 1, new magee equation 2, and new magee equation 3, respectively). when the estimated recurrence score fell in the intermediate category with any of the equations, the actual recurrence score was either intermediate or low in more than 80% of the cases (tables 2, 3, 4, 5). with original magee equation, 93 cases were estimated to be intermediate recurrence score (table 2). of these, 75 (81%) remained either low or intermediate with actual oncotype dx recurrence score. the remaining 18 cases (19%) that were determined to be high on actual oncotype dx recurrence score had a median score of 36 compared with the estimated median score of 26. with new magee equation 1, 122 cases were estimated to be intermediate recurrence score (table 3). of these, 104 (85%) remained either low or intermediate with actual oncotype dx recurrence score. the remaining 18 cases (15%) that were determined to be high on actual oncotype dx recurrence score had a median score of 33 compared with the estimated median score of 25. with new magee equation 2, of these, 121 (85%) remained either low or intermediate with actual oncotype dx recurrence score. the remaining 21 cases (15%) that were determined to be high on actual oncotype dx recurrence score had a median score of 35 compared with the estimated median score of 26. with new magee equation 3, of these, 101 (85%) remained either low or intermediate with actual oncotype dx recurrence score. the remaining 18 cases (15%) that were determined to be high on actual oncotype dx recurrence score had a median score of 33 compared with the estimated median score of 23. oncotype dx test is currently widely used by clinicians in the united states. despite the known pitfalls of oncotype dx assay in evaluation of single gene status, this is somewhat expected as many of the genes analyzed in the assay have individually been shown to have prognostic and predictive value. although the seminal paper was reported to show benefit of 21 gene / oncotype dx assay over individual standard histopathologic parameters, there are dearth of studies that have compared the combined prognostic / predictive power of standard histology and immunohistochemical markers with oncotype dx assay. recently, the study by cuzick provide evidence that standard clinical and pathologic parameters can be even better than oncotype dx assay for prognostication. this study was undertaken to estimate the oncotype dx recurrence score using standard histologic and immunohistologic findings that are routinely reported. the concordance between the estimated recurrence score category and the oncotype dx recurrence score category ranged from 55 to 60%. the two - step discordance (meaning an estimated recurrence score that is high, when the oncotype dx recurrence score is low, and vice versa) was either not present (for new magee equation 1) or negligible (for the other equations). one can therefore conclude that if the estimated recurrence score is clearly in the high or low categories, it is predictive of the oncotype dx recurrence score category with > 95% certainty. even in cases where the estimated recurrence score category predicted an intermediate category, the results were clinically useful. an estimated recurrence score (using new magee equations) in the intermediate category means that the actual oncotype dx recurrence score category will be either intermediate or low approximately 85% of the time. the remainder 15% cases in the validation set that were determined to be high risk by actual oncotype dx recurrence score had median score close to the 31 point cutoff. these results are important as the national surgical adjuvant breast and bowel project - b20 trial showed that cases with intermediate recurrence score derive minimal or no benefit with adjuvant chemotherapy. therefore, majority of the patients with estimated recurrence score in the intermediate category are unlikely to derive large benefit from chemotherapy. the cases that have estimated recurrence score at the higher end of intermediate category may be considered for chemotherapy based on individual benefit and risk. these equations provide clinically useful information, using data from standard pathologic reporting of breast cancer. of our four equations, new magee equation 2 had the highest concordance for categorization (60%), and includes nottingham score, er h - score, pr h - score, her2 status, and tumor size (and does not include ki-67). this may indicate some confounding results from the equations that use ki-67 (new magee equations 1 and 3). given that all of the equations utilize either the nottingham score or the mitotic count component of the nottingham score, the actual mitotic activity is either similar or better predictor of tumor proliferation than ki-67 immunohistochemistry. the previous studies have shown the importance of ki-67 in determining the oncotype dx recurrence score, but ki-67 alone appears to be inferior to combined histologic and immunophenotypic data. although the overall correlation between estimated and actual recurrence score was good, it was not perfect. first, the estimated recurrence score measures the morphologic and immunophenotypic data and actual recurrence score measures gene expression levels and some variability is expected if two different parameters are measured. secondly, interobserver variability for grading and semiquantifying immunohistochemical results among pathologists can lead to under- or overestimation of recurrence score. last, but not the least, there may be characteristics intrinsic to the oncotype dx assay that can alter the recurrence score. one major issue is the possible effect of various benign breast components on recurrence score. despite gross macrodissection or even microdissection of tumor tissue for polymerase chain reaction analysis, many non - invasive tumor tissue components (such as stromal fibroblasts, adipose tissue, lymphocytes, macrophages, normal ducts and lobules, in situ carcinoma, epithelial proliferation, etc) can be admixed during mrna extraction and may alter the recurrence score by at least a few points. recently, acs demonstrated the impact of mitotically active cellular stroma on oncotype dx recurrence score. their results suggested that increased stromal cellularity and/or associated inflammatory cells in low - grade invasive breast cancer may contribute to apparent increase in recurrence score. apart from tumor macrodissection / microdissection, reproducibility of the assay between the same tumor block and in between different tumor blocks of the same tumor has not been extensively studied. cronin reported the analytical validation of the oncotype dx assay, but did not address the reproducibility of recurrence score on re - extracted mrna from the same block or difference in recurrence score values between different blocks of the same tumor. it is also possible that variation in tissue handling and fixation can alter recurrence score, but there is no published data on this subject. delay to formalin fixation can not only alter immunohistochemical results and mitotic counts by a pathologist but can also alter mrna expression level of many genes. owing to the variability of all of these factors, it is not surprising that there is less than perfect correlation between oncotype dx recurrence score and the magee equations that we have created for estimating recurrence score. decades of prior work has shown the importance of tumor grade, tumor size, lymph node status, hormone receptors and her2 status in determining patient prognosis and prediction of response to hormonal therapy and systemic chemotherapy. our equations use all of these factors and we have demonstrated that they can be useful in estimating the recurrence score. risk prediction models such as the st gallen, adjuvant ! online, and the nottingham prognostic index use some of these factors to predict outcome, and have been used by clinicians to guide therapy. the st gallen system does not include her2 status in prognostication (although accepted her2-positive status to assign trastuzumab in 2007) and owing to overlapping features in some cases, risk categorization could be difficult. online does not include her2 status in the equation and also does not account for tumor hormone receptor content (quantification) for prognostication and prediction of chemotherapy effectiveness. the oncotype dx include expression levels of genes that are critical in determining prognosis and effectiveness of chemotherapy, but this test also has several shortcomings as discussed above. therefore, all of these predictive models and assays should be considered as estimates and clinicians should use all available information rather than result of one assay. our study reinforces the findings in our pilot study, and prior studies that show correlation between standard pathology findings and the oncotype dx recurrence score. in a study of 77 cases, tang and co - workers showed the correlation between aggressive morphologic features and lack of pr expression with high oncotype dx recurrence score. the importance of pr semiquantitative score was also shown by clark, who identified an inverse relationship between pr expression level and oncotype dx recurrence score, which was independent of tumor grade. recently, one large study has shown the prognostic significance of semiquantitative er, pr, her2, and ki-67 immunohistochemical results to be similar to the oncotype dx recurrence score. the study also showed that combining the immunohistochemical results with clinical parameters provided superior prognostic information than oncotype dx alone. in another large recent study, tang integrated the recurrence score with clinical and pathologic factors and reported a better assessment of distant recurrence. the follow - up time for patients in our study (the 255 validation set cases from 2010 to 2011) is short. by following clinical outcomes, we hope to verify the utility of our findings, and reinforce the importance of standard morphoimmunohistologic variables. the equations we have created are user - friendly and available free of any cost to the user. by using the microsoft excel worksheets we have provided (see supplementary data), pathologists and oncologists can easily calculate estimated recurrence score themselves and compare the result to the actual recurrence score. if an estimated recurrence score falls clearly in the high - risk or low - risk category, then oncologists should not expect a dramatically different result from oncotype dx. in these cases, the use of oncotype dx may be avoided. in cases where oncotype dx is performed, a result dramatically different from the estimated recurrence score should be thoroughly investigated by the pathologist in concert with the clinical team, to ensure that the oncotype dx result is accurate in the sense that it is representative of the tumor that is properly microdissected. | oncotype dx is a commercial assay frequently used for making chemotherapy decisions in estrogen receptor (er)-positive breast cancers. the result is reported as a recurrence score ranging from 0 to 100, divided into low - risk (< 18), intermediate - risk (1830), and high - risk (31) categories. our pilot study showed that recurrence score can be predicted by an equation incorporating standard morphoimmunohistologic variables (referred to as original magee equation). using a data set of 817 cases, we formulated three additional equations (referred to as new magee equations 1, 2, and 3) to predict the recurrence score category for an independent set of 255 cases. the concordance between the risk category of oncotype dx and our equations was 54.3%, 55.8%, 59.4%, and 54.4% for original magee equation, new magee equations 1, 2, and 3, respectively. when the intermediate category was eliminated, the concordance increased to 96.9%, 100%, 98.6%, and 98.7% for original magee equation, new magee equations 1, 2, and 3, respectively. even when the estimated recurrence score fell in the intermediate category with any of the equations, the actual recurrence score was either intermediate or low in more than 80% of the cases. any of the four equations can be used to estimate the recurrence score depending on available data. if the estimated recurrence score is clearly high or low, the oncologists should not expect a dramatically different result from oncotype dx, and the oncotype dx test may not be needed. conversely, an oncotype dx result that is dramatically different from what is expected based on standard morphoimmunohistologic variables should be thoroughly investigated. |
in this prospective quasi - randomized, doubleblinded, placebo - controlled study, a total of 146 reproductive women aged between 18 - 35 years old who were referred to outpatient clinics of shahid beheshty and al - zahra hospitals from december 2009 to february 2010 for infertility treatments, having at least two of three rotterdam consensus criteria as oligomenorrhea or amenorrhoeic cycle, hyperandrogen - ism, or 10 or more follicles with size range of 2 - 10 mm on trans vaginal sonography (aloka1000,7.5mh.z probe), were enrolled. women should not have taken any hormonal or medication drugs, effective on metabolic systems for 3 months before starting the study and patients with diseases such as liver diseases, hyper or hypothyroidism, hyperprolactinemia, adrenal hyperplasia, kidney disease, cardiovascular diseases, hormonal sex - secreting neoplasm, diabetes, nervous system disorder and mentally disorders were excluded. after approval of ethical committee of isfahan university of medical sciences with registry number 388547 and support of vice chancellor of research at this university for the funding, all patients gave their written informed consents. before any intervention, on the third day of follicular phase of spontaneous or induced menstrual cycle with medroxy progesterone acetate, blood samples as baseline hormonal assessment of dehydroepiandrostrone sulfate (dheas), follicle stimulating hormone (fsh), luteinizing hormone (lh), triglyceride (tg), total cholesterol, high density lipoprotein cholesterol (hdl), and low density lipoprotein cholesterol (ldl) were collected and recorded (tg, total cholesterol pars azmoon, tehran, iran. the experimental group who received genistein (bergamon, italy) 18 mg twice a day orally and the control group taking similar capsules with cellulose as a placebo for 3 months. patients were followed closely for 3 months and were instructed to attend our outpatient clinics if they had any problems. 4 subjects in the experimental group did not continue the study because of gastrointestinal side effects of genistein, and 5 patients from the placebo group were excluded later because of incomplete data. patients participation diagram after 3 months of supplementation therapy blood was taken from all subjects on the third day of their follicular phase of menstrual cycle for assessment of reproductive hormones and lipid profiles. data analysis was performed using the spss version 15.0 (spss, inc., chicago usa). all data between two groups were compared and analyzed using anova test (z = 1.96, z = 0.84) and p value less than 0.05 was considered statically significant. from 146 patients who enrolled in the study, 4 patients in the experimental group and 5 patients from the placebo group were excluded. so study continued with 69 subjects in the case and 68 in the placebo group (figure 1). no significant difference was seen between two groups regarding age, weight, and bmi. the mean sd age of patients in genistein group was 27.11 5.76 and in the control group was 27.45 5.77 ; the difference was not statistically significant. phytoestrogen supplementation significantly reduced lh (p = 0.000), tg (p = 0.000), ldl (p = 0.000), dheas (p = 0.000) and testosterone (p = 0.000) levels in patients after receiving genistein comparing with before supplementation therapy but in the placebo group they were not different. finally according to our results only ldl cholesterol was lower significantly after using genistein compared with placebo (120.15 10.68 vs. 126.61 14.81 mg / dl respectively, p = 0.04). comparison of clinical characteristic of the study subjects at baseline and after 3 months in genistein and placebo groups in the current study treatment with genistein for 3 months resulted in a significant reduction in ldl cholesterol compared with placebo. metabolic syndrome and hormonal disturbances are prevalent findings among pcos women. metabolic syndrome is a group of conditions including obesity, high blood pressure, blood fat abnormality and borderline high blood sugar and insulin levels, which together increase chances of cardio vascular disease and type 2 diabetes.14 in tehran, iran, it has been estimated that more than 30% of adults might be affected.15 some studies have evaluated the effects of nutrients on glycemic control of type 2 diabetes and metabolic syndrome. their results have shown beneficial effects of soy protein consumption.1617 two meta - analysis concluded that isofla - vones content of soy might be responsible for its lipid lowering effect.1819 but some other studies did not confirm these results.20 therefore, because of these controversies we decided to evaluate the effect of genistein on hormonal and metabolic abnormalities in women with pcos. lissin and cooke suggested that diets containing soy - protein may provide favorable benefits in reducing ldl cholesterol and cardiovascular events.21 azadbakht in a randomized cross over clinical trial which was done on 42 postmenopausal women with metabolic syndrome comparing soy protein with esoy nut and controlled diet, showed that neither soy protein nor soy nut could affect weight and serum leptin levels.22 wiseman in a randomized cross over design compared the effect of a dietary regimen high in isoflavones with a similar product in which all of the soy was removed by alcohol. their results showed that antioxidant effect of soy may protect against the oxidative lipid damage that is the leading cause of cardiovascular diseases and cancers.23 a study azadbakht indicated that soy compounds like isoflavones, fibers, phospholipids, fatty acids and its other components could have beneficial effects on cardio metabolic abnormalities such as hypercholesterolemia and lipid abnormality.24 results of our study revealed that administration of genistein not only reduced ldl cholesterol but also significantly reduced lh, tg, dheas and testosterone parameters after 3 months. ohno also showed that genistein has a significant role on steroidogenesis in the adrenal gland and testis of rat, and decreasing the testosterone level.25 romualdi performed a pilot prospective study on patients with pcos, which revealed that treating patients with phytoestrogens result in improvement of lipid assessment, and they suggested that using phytoestrogens may have a possible advantage in improvement of lipid assessment in women with pcos.26 we also observed the same effect on improvement of lipid assessment. according to the research of kurzer soy consumption appear to have modest hormonal effects on both pre- and postmenopausal women.27 consuming 45 - 200 mg / dl isoflavones in different products like soy milk or soy flour or soy foods would decrease the midcycle fsh and lh. according to our results in genistein group, lh, testosterone, and in conclusion, results of our study suggest that supplementation therapy with genistein that is rich of soy phytoestrogen has possible advantages in patients with pcos and may be chosen as an alternative treatment for these women and may provide favorable advantages in reduction of related complications. we did not analyze mean of different variables between two groups at the baseline. it seems that lh, testosterone, and dheas at the baseline, might have been different between the placebo group and genistein group. however significant differences that were observed between results of before and after treatment in genistein group may overcome this limitation.measuring weight and body mass index in two groups was not designed in our proposal to see their impact on the results. it seems that lh, testosterone, and dheas at the baseline, might have been different between the placebo group and genistein group. however significant differences that were observed between results of before and after treatment in genistein group may overcome this limitation. measuring weight and body mass index in two groups was not designed in our proposal to see their impact on the results. we may also suggest using different doses of genistein on reproductive hormonal and lipid profiles. ekh was responsible for data analysis, data gathering and interpretation of results and performed clinical follow - ups. | background : phytoestrogens are a group of plants derived compounds with weekly estrogen effect that appear to have protective effects on metabolic and hormonal abnormalities of women with polycystic ovary syndrome (pcos). so the aim of this study was to investigate the effect of soy phytoestrogens on reproductive hormones and lipid profiles in pcos women.methods:in this quasi - randomized trial, 146 subjects with pcos were divided into two groups ; the experimental group who received genistein (bergamon, italy) 18 mg twice a day orally and the control group that received similar capsules with cellulose for 3 months. hormonal features and lipid profiles were measured before and after 3 months of supplement therapy.results:after 3 months of supplement therapy there were no statistically significant differences in high density lipoprotein cholesterol (hdl) and follicle stimulating hormone (fsh) serum levels in genistein and placebo group before and after treatment ; however serum levels of luteinizing hormone (lh), triglyceride (tg), low density lipoprotein cholesterol (ldl), dehydroepiandrostrone sulfate (dheas) and testosterone were significantly decreased after 3 months therapy in genistein group.conclusions:genistein consumption may prevent cardiovascular and metabolic disorders in pcos patients by improving their reproductive hormonal and lipid profiles. |
calcium has long been recognized as an essential intracellular messenger involved in many pivotal biochemical pathways. the biochemically relevant information attributed to this ionic species is believed to be encoded in the concentration and spatio - temporal properties of the calcium signal. the relationship that exists between calcium and the regulated response has been attributed to the complexity of the calcium signal triggering the physiological response (knight and baker, 1987). in this paper, we focus on one of the temporal properties of the calcium signal, the rate of calcium delivery. the role of the time dependence of calcium delivery in defining the observed differences in the calcium sensitivity of sea urchin egg secretory vesicles was examined. no evidence was found to support the hypothesis that the calcium sensitivity of individual secretory vesicles is dependent upon the rate of calcium delivery. since a graded response to calcium represents a defining feature of calcium - regulated exocytosis, several classes of limiting mechanisms these include heterogeneity in the calcium sensitivity of individual vesicles, calcium - dependent inactivation, and rate - dependent inactivation through a calcium - dependent intermediate (knight and baker, 1982). recently, adaptation has been proposed as a property of calcium - regulated exocytosis in presynaptic terminals in which the sensitivity of synaptic vesicles to calcium was reported to decrease in response to either multiple exposures or different rates of calcium (hsu., 1996). our result that the calcium sensitivity of secretory vesicles is invariant with the rate of calcium delivery supports the hypothesis that the calcium sensitivity of individual vesicles within a population of exocytotic vesicles is heterogeneous before initiating the fusion process (blank., 1998) and that the magnitude of the calcium stimulus is the single controlling variable that determines which subpopulations of vesicles enter the fusion process. these results are incompatible with several classes of models that have been used to describe calcium - regulated exocytosis. materials and methods related to the use of the two specimens of sea urchins, stronglyocentrotus purpuratus and lytechinus pictus are described in the companion paper (blank., 1998). the rate of calcium delivery was varied using either perfusion or uv photolysis of dm - nitrophen (kaplan and ellis - davies, 1988). the time - dependent increase in calcium at the sample is referred to as a calcium ramp even if the change in calcium activity with time was not linear. since the calcium concentration can never change instantaneously, there will always exist a period of time over which the calcium concentration varies. turbulent exchange of solutions within the flow chamber, described in the companion paper (blank., 1998) and referred to as a calcium step, corresponds to a calcium ramp occurring in 10 mm and was roughly linear in pca as determined by discrete sampling at different time points and subsequent measurement using a calcium electrode as described previously (blank., 1998). if both the initial solution composition and the rate of removal from the gradient mixer are kept constant, then the temporal response of the sample to ramps created using different total volumes can be compared by renormalizing time to the beginning and ending of the ramp. this normalization procedure provides a relationship between the calcium concentration at the sample and the fusion response. fusion change in response to a calcium ramp is designated the dynamic response. ramps are useful for comparing manipulations that are believed to alter the calcium dependence of exocytosis and conditions where the calcium dependence of exocytosis may be different. however, depending upon the rate of delivery, it may be inappropriate to use calcium ramps to determine the steady state calcium dependence of vesicle fusion or the kinetics of fusion. for a given ramp protocol, these differences were due to errors in precisely defining the zero time point, reproducing the exact volume flow rate, and perhaps to variability in the distribution of thresholds between preparations. the ph of samples taken at different time points dropped by a maximum of only 0.15 u for the standard solutions containing 50 mm pipes, and was constant for solutions containing 100 mm pipes. increasing ph buffering capacity did not affect the fusion response to the calcium ramp. since treatment with ph 6.0 solutions (but not ph 6.4) results in vesicles that do not fuse (data not shown), care must be taken to avoid conditions that lead to acidification of the preparation as ph - dependent effects could be mistaken for calcium - dependent effects. calcium ramps generated using photolysis of dm - nitrophen, as described in shafi. (1994), correspond to an 60 m change over 1 s, a rate of delivery intermediate between turbulent exchange and slow perfusion. photolysis of dm - nitrophen was required to evaluate the relationship between changes in calcium concentration and the first fusion event after an initial fusion response, because transient flexing of the chamber during turbulent exchange alters the optical path. the change in optical path during turbulent exchange makes it difficult to evaluate when the first fusion event occurs because the high volume flow (8 ml / s) lasts, typically, for 0.5 s. this limitation does not exist with photolysis. free calcium concentrations are estimated using the fluorescent indicator, rhod-2 (molecular probes, inc., eugene, or) and calibrated as described previously (shafi., 1994). error in the estimation of the free calcium concentration arises primarily from error in kd, contributions from fluorescence beyond the plane of focus, and misregistration between the planes of uv and fluorescence excitation and emission. propagation of the error in kd (4.0 0.8 m ; shafi., 1994) leads to an error of 0.2 pca u. the other two optical properties are expected to bias the determinations towards an underestimation of the calcium concentration. for calcium concentrations in the neighborhood of the midpoint of the calcium activation curve, the uncertainty in kd introduces an uncertainty in the estimation of the free calcium concentration by a factor of 2. in the photolysis double challenge experiments, light scattering and fluorescence were monitored simultaneously during a transient increase in calcium (first challenge) and increases to high concentrations (> 500 m, second challenge). the first detectable fusion event during the second challenge was correlated with the calcium concentration. the criteria for the first detectable fusion event was the first light scattering (% fusion) value outside the envelope defined by 5% fusion. this range in fusion, 5% fusion, corresponded to the steady state peak to peak noise in the light scattering signal. this criteria represents a conservative estimate for detection and places an upper limit on the calcium concentration required for subsequent fusion in the photolysis double - challenge protocol. the results from a total of 30 perfusion ramps and 48 photolysis ramps are reported. the average dynamic response of s. purpuratus and l. pictus to an 11-min ramp in the total calcium is shown in fig. 1 a. the dynamic response of l. pictus, compared with s. purpuratus, is shifted in time, indicating that higher calcium concentrations are required for the same response (fig. the time to 50% response is significantly different between the two species (4.75 0.12 and 5.40 0.19 min for s. purpuratus, n = 6, and l. pictus, n = 2, mean sem or range, respectively). this phenotypic variation with species is consistent with the shift in the calcium activity curves measured using step changes in calcium (blank., 1998). for the same rate of calcium delivery, s. purpuratus is more sensitive to calcium than l. pictus. the dynamic responses observed using these ramps were shifted along the pca axis compared with the stable, submaximal responses obtained with step changes in the calcium concentration (blank., 1998). this shift is expected if overlap between the characteristic times associated with the exocytotic process and the calcium ramp is significant because the dynamic response is strongly influenced by the convolution of the calcium delivery with the underlying fusion kinetics. vesicle fusion, detected at a later time, may have entered the fusion process at an earlier time in response to a lower calcium concentration. whether this shift is secondary to the relationship between calcium and the extent of fusion if the calcium - delivery history has no effect on the steady state extent of fusion, then interrupting the ramp and holding the calcium concentration constant should result in extents of fusion identical to those produced by step changes to the same calcium concentration. the dynamic response to an 11-min ramp with and without interruption is shown in fig. interrupted ramps resulted in 70 9% (mean sem, n = 3) fusion at a calcium concentration of 60 m. interrupting the ramp and maintaining the preparation at this calcium concentration produced submaximal extents of fusion that are indistinguishable from those produced by step changes to the same calcium concentration. this is indicated by the overlap of the interrupted ramp data with the calcium activation curve described by the log - normal cumulative distribution function (this paper, see fig. 8 a, ; blank., 1998, a). for these experiments, the more highly buffered solution (6 mm egta, 6 mm hedta, 3 mm nitrilotriacetic acid) was used. to what extent, if any, is the behavior of the unfused vesicles altered by the kinetics of calcium delivery ? after the establishment of a stable, submaximal extent of fusion, the calcium ramp was continued and the exocytotic response of the remaining vesicles was compared with the response obtained from a continuous ramp. when the time axis is rescaled to the concentration of calcium present at the sample, no systematic shifts in the response are observed for interrupted and continuous ramps. the pca at 85% fusion in the dynamic responses of the interrupted and continuous ramp are identical (pca85% = 3.88 0.05). as a further test, the shape of the dynamic response was compared by rescaling the time axis after continuation of the interrupted calcium ramp. the rescaled plot of the final 30% fusion for interrupted and continuous ramps is shown in fig. 3 a. the slope of the cross - correlation between the fusion response for interrupted and continuous ramps using normalized time as the parametric variable is 1.01 0.00 (fig there are no significant differences between the dynamic response of the remaining unfused vesicles in either a continuous or interrupted calcium ramp. if the cessation of fusion occurs because a specific population of vesicles is removed through fusion, then changing the rate at which a defined concentration of calcium is delivered may alter the fusion kinetics but not the underlying relationship between calcium and the extent of fusion. this hypothesis was tested by altering the buffering properties of the solution, total concentration of calcium in the second chamber of the gradient maker, or increasing the ramp duration from 11 to 34 min. examples of the dynamic response to both 11- and 23-min ramps are shown in fig. 4 a. when the time axis is rescaled to the concentration of calcium present at the sample, no systematic shifts in the response are observed and 100% fusion is always obtained (fig. 4 b). the difference in pca at 50% fusion in the dynamic response to the two ramps is not significant (pca50% = 3.49 0.05 and 3.57 0.05 for 11- and 23-min ramps, respectively, p 60 m (data not shown). (b) the calcium at the onset of fusion after the second challenge is indicated by point 3. the horizontal lines define the peak - to - peak noise envelope and the first detectable fusion event is indicated. point 1 marks the beginning of uv irradiation, point 2 marks the time at which the calcium concentration matches the peak transient (first challenge), and point 3 marks the onset of fusion. the data were collected using a sample time of 0.02 s with an offset of 0.01 s between light scattering and fluorescence data. | differences in the calcium sensitivity of individual secretory vesicles can explain a defining feature of calcium - regulated exocytosis, a graded response to calcium. the role of the time dependence of calcium delivery in defining the observed differences in the calcium sensitivity of sea urchin egg secretory vesicles in vitro was examined. the calcium sensitivity of individual secretory vesicles (i.e., the distribution of calcium thresholds) is invariant over a range of calcium delivery rates from faster than micromolar per millisecond to slower than micromolar per second. any specific calcium concentration above threshold triggers subpopulations of vesicles to fuse, and the size of these subpopulations is independent of the time course required to reach that calcium concentration. all evidence supports the hypothesis that the magnitude of the free calcium is the single controlling variable that determines the fraction of vesicles that fuse, and that this fraction is established before the application of calcium. submaximal responses to calcium can not be attributed to alterations in the calcium sensitivity of individual secretory vesicles arising from the temporal properties of the calcium delivery. models that attempt to explain the cessation of fusion using changes in the distribution of calcium thresholds arising from the rate of calcium delivery and/or adaptation are not applicable to this system, and thus can not be general. |
the prevalence of congenital anomalies of the coronary arteries (caas) is reported to be approximately 0.2 - 1.4% in the general population. of them,. it may be benign appearing as an incidental finding on routine coronary angiogram or sometimes, may be complicated with atherosclerosis and present with spectrum from stable coronary artery disease to acute coronary syndrome with stormy course. a 34-year - old male was admitted to emergency department with retrosternal chest pain at rest of 4 h duration with perspiration and occasional dizziness. electrocardiogram showed st elevation in leads ii, iii, and avf, reciprocal changes in leads i and avl, and complete heart block (fig. 1a). he was preloaded with 325 mg aspirin, 40 mg rosuvastatin and 60 mg prasugrel along with iv fluids and vasopressors. the left coronary arteries were of normal origin and distribution with normal flow in left anterior descending artery (lad) and circumflex artery (lcx). rca was hooked with a 3.5 judkin s right 6 f guiding catheter (medtronic, usa). lesion was crossed with a 0.014 " 140 cm fielder fc wire with help of a finecross microcatheter (asahi, japan) (fig. 3). once parked distally, finecross was advanced and fielder fc was exchanged with a 0.014 " 140 cm bmw wire (abott, usa). distal tip of bmw wire was not in typical distribution of rca but as we encountered, no resistance and movement of distal tip along with the feel was sufficient to say that it was in true lumen (fig. we treated him with upstream tirofiban (10 g / kg/3 min) and dilated with a 2 10 mm minitrak balloon (abott, usa) (fig. contrast injection this time showed one large branch going beyond crux giving posterior descending artery and two parallel large coronary arteries distally. lesion was stented with a 3.5 23 mm xience prime drug - eluting stent (abott, usa) (fig. 4c) and post - dilated by a 3.5 10 minitrak nc balloon (abott, usa) achieving timi iii flow (fig. control coronary angiogram demonstrated atypical double rca as there were two parallel coronary arteries distal to the occlusion (fig. stay, complete heart block reverted to 2:1 atrioventricular block, and then went back to normal sinus rhythm on third day (fig. he was discharged in stable condition with dual antiplatelets, statin, and beta blocker. (a) electrocardiogram showing complete heart block ; (b) 2:1 atrioventricular block ; (c) wenckebach phenomenon ; (d) normal sinus rhythm. (a) bmw guide wire parked distally after exchange with feider wire ; (b) lesion being predilated with 2 10 minitrak balloon ; (c) stent being deployed across the lesion ; (d) stent being post - dilated with non - compliant balloon. double rca is a very rare coronary anomaly, whose true definition and correct diagnosis remain controversial [2, 3 ]. sometimes, it is very difficult to distinguish double rca with single orifice from rca which has a high take - off of a large right ventricular artery. right anterior oblique (rao) view may be helpful in differentiating double rca from a large right ventricular branch as it provides better demonstration of artery courses in such circumstances. sato have proposed that double rcas are defined when they supply the blood to the inferior left myocardium, thus both of the rcas should course downwardly to reach the interventricular sulcus whether or not they cross the crux. the first report about double rca anomaly in the literature was by barthe. after the origin of a conus artery and a ventricular branch, the most anterior rca descended toward the acute margin of the heart and terminated in a small posterior descending artery. the second rca terminated in a small posterior descending and posterolateral branches. in our cases, both rcas were almost identical in size and both gave rise to a pda. by using this reasonable classification, we diagnosed our case as atypical double rca. since the first report, this rare anomaly has been accepted as a benign entity. however, its involvement with atherosclerosis has also been reported, where revascularisation had been performed either by coronary artery by - pass surgery or elective percutaneous coronary intervention (pci) [7, 8 ]. rohit have reported primary pci of double rca presenting with acute inferior wall infarction but there was no rhythm disturbance in their case. to the best of our knowledge and after extensive search in medical literature, we are reporting for the first time, double rca presenting with complete heart block with cardiogenic shock where primary pci was performed. rca maintains a course in the atrioventricular groove and forms the uppermost portion of the posterior descending branch. the length of each of the two posterior descending branches varies from patient to patient : in our patient, both the branches were large ; therefore, their occlusion was responsible for the symptoms. | double right coronary artery (rca) is an extremely rare coronary artery anomaly. we here report an atherosclerotic double rca which appeared after primary percutaneous intervention performed to treat a 34-year - old male presenting with acute inferior myocardial infarction, cardiogenic shock and complete heart block. this is an unusual case as double rca had been hidden by total atherosclerotic occlusion of the proximal part of the rca and complete restoration of patency led complete heart block back to normal sinus rhythm. |
hereditary dystrophies of the retina, such as retinitis pigmentosa (rp), are considerable causes of blindness in humans. research efforts concerning these currently not treatable diseases are focused on the genetic background, the mechanisms of degeneration, and possible treatment strategies. animal models in rodents, for example, the retinal degeneration rd1 and rd10 mice, are well characterized and described [39 ]. in rd1 and rd10 mice, missense point mutations in the gene encoding for the -subunit of rod cgmp phosphodiesterase type 6 (pde) result in the described disease pattern [39 ]. the gene mutation leads to the degeneration of first rods and then consecutively cones with a central to peripheral gradient. the fact that in both animal models firstly rods and secondly cones degenerate, which is comparable to rp [39 ], seems to be caused by missing diffusible factors normally secreted by the rods. this kind of retinal degeneration is concomitant with a pronounced reduction in the thickness of the outer nuclear layer (onl) [39 ]. the retinal development in the rd1 and rd10 mice is comparable to normal mice up to postnatal day 8 (p8). however, while in rd1 mice, the degeneration becomes apparent at p11, in rd10 mice, the degeneration starts at p16 and the peak of photoreceptor degeneration is reached at p25. by p60, no photoreceptors are left. because of the later onset and milder retinal degeneration, rd10 mice seem to be more suitable to study slow disease mechanisms in rp. retinal vessels become sclerotic at 4 weeks of age and the a - wave and b - wave in the electroretinogram are visible with the age of 3 weeks and no longer detectable with the age of 2 months. to characterize retinal degeneration, monitoring the time course of the disease is indispensable. using histology to observe retinal changes requires a large number of animals to examine. therefore, it is of interest, if data from functional examinations and in vivo imaging correlate well with histological data. we examined eyes of wild type and rd10 mice in different age groups to determine retinal function by means of the full - field electroretinogram (erg) as well as retinal thickness by means of spectral domain optical coherence tomography (sd - oct) scanning. the erg examinations were performed under general anesthesia with ketamine and xylazine. this anesthesia was reported to have no influence on the oscillatory potentials and other erg waveforms. all experiments were performed in accordance with the arvo statement for the use of animals in ophthalmic and vision research and in accordance with the german law for the protection of animals and after approval was obtained by the regulatory authorities. all possible steps were taken to avoid animal suffering at each stage of the experiment. adult pigmented wild type mice (c57bl/6j) and rd10 mice were maintained under controlled light conditions (12 : 12 hours of light / dark cycle) with food and water available ad libitum. animals (n = 3 in each group) were examined at the age of 2, 3, 5, 7, 9, 12, 24, and 48 weeks. at the end of the follow - up, animals at the same age were euthanized by isoflurane (forene 100% (v / v), abott gmbh, wiesbaden, germany) overdosing and decapitated for histological examinations. for erg, oct, and fluorescein angiography, animals were anesthetized with an intraperitoneal injection of a mixture of ketamine (70 mg / kg ketamin 10%, ceva, germany) and xylazine (10 mg / kg xylazin 2% bernburg, medistar, ascheberg, germany) in 0.1 ml of saline. electroretinogram recordings (erg) were performed with the reti system designed for rodents (roland consult electrophysiological diagnostic systems, brandenburg, germany). mice were dark adapted for one hour and the pupils were dilated using 2.5% phenylephrine hydrochloride ophthalmic solution (tropicamide 2.5% eye drops, pharmacy of the university hospital aachen, germany). after local anesthesia with proxymetacaine hydrochloride 0.5% eye drops (proparakain - pos, ursapharm, saarbrcken, germany), a custom - made goldring electrode (animal electrode 0.5 mm 3 mm roland consult) was placed on the corneal surface of each eye. methylcellulose (methocel 2%, omni vision, puchheim, germany) served for a good contact and to maintain corneal moisture. the erg was recorded as full - field erg according to the standard protocol of the international society for clinical electrophysiology of vision (iscev). a- and b - wave amplitude and implicit times of rod and cone responses were determined. spectral domain optical coherence tomography (sd - oct) scans were performed using the spectralis oct system (heidelberg engineering, heidelberg, germany). to correct rodent optics, the system was modified according to recommendations of the manufacturer with a + 25 d lens in front of the scanning system. cross - sectional images centered on the optic disk as the main landmark were obtained from the retina. retinal thickness was measured at six positions along the cross sectional image of the retina (maximum distance of 600 m from the optic nerve head) and averaged for each eye (figure 2(b), red arrows). in the vast majority of cases, three positions on each side of the optic nerve head were chosen. however, as preliminary experiments showed, no thickness differences were observed, even if the six positions were taken on one side of the optic disk (figure 2(b)). values represent mean sd. the confocal image (ir reflection image, wavelength 715 nm) of the fundus recorded by the oct system was used for documentation. after dilatation of the pupils by tropicamide 2.5% eye drops (pharmacy of the university hospital aachen, germany), images were taken by a confocal laser scanning microscope (heidelberg retina angiograph-1, heidelberg engineering, germany) in the fluorescein angiography mode. shortly before the measurements, mice were intraperitoneally injected with 1020 l fluorescein (fluorescein alcon 10%, alcon pharma gmbh, freiburg i m breisgau, germany). in brief, eyes were enucleated and opened by an encircling cut at the limbus. the retinae in the eyecup were immersion fixed for 30 minutes in 4% paraformaldehyde (pa) in 0.1 m phosphate buffer (pb) at room temperature and washed in pb several times. tissue was incubated in 10% sucrose in pb for 1 hour, followed by 30% sucrose over night. the retina was flat embedded and frozen in optimal cutting temperature compound (neg-50, richard allen scientific, thermo fisher scientific, germany). vertical sections (i.e., perpendicular to the retinal layers ; thickness of 20 m) were cut on a cryostat (hm 560 cryostar, microm, walldorf, germany) and collected on superfrost plus slides (menzel, braunschweig, germany). sections were pretreated with blocking solution (5% chemiblocker (chemicon, hofheim, germany), 0.5% triton - x100 in pb, and 0.05% nan3) for 1 hour, followed by incubation with primary antibodies over night, diluted in the same solution. sections were washed in pb and incubated with secondary antibodies diluted in 5% chemiblocker, 0.5% triton - x100 in pb for 1 hour, washed in pb and coverslipped with aqua polymount (polysciences, eppelheim, germany). sections were examined with a confocal laser scanning microscope (tcs sp5 ii ; leica microsystems, heidelberg, germany) with 63x/1.4 oil immersion lenses. the following primary antibodies were used : against gfap (anti - glial fibrillary acidic protein, raised in chicken, 1 : 2000 ; novus, germany) ; against cabp (anti - calbindin 28 k, raised in mouse, 1 : 1000 ; sigma, germany) ; against glutamine synthetase (raised in mouse, 1 : 4000 ; bd biosciences, germany) ; against pkc (anti - protein kinase c, raised in rabbit, 1 : 4000 ; santa cruz, usa) ; against calretinin (ab1550, raised in goat, 1 : 3000 ; millipore, germany) ; against hcn1 (rtq-7c3, raised in rat, 1 : 10 ; f. mller, forschungszentrum jlich, germany) ; against rhodopsin (1d4, 1 : 500 ; r. s. molday, univ. of british columbia, canada) ; and against recoverin (ab5585, raised in rabbit, 1 : 2000 ; millipore, germany). secondary antibodies included donkey anti - chicken cy2 (1 : 400 ; dianova, germany), donkey anti - mouse cy3 (1 : 100 ; dianova, germany), donkey anti - rabbit cy2 (1 : 400 ; dianova, germany), donkey anti - rat cy3 (1 : 500 ; dianova, germany), donkey anti - mouse dy649 (1 : 500 ; dianova, germany), and donkey anti - goat alexa647 (1 : 200 ; invitrogen, germany). peanut agglutinin (pna, biotinylated, 1 : 1600 ; sigma aldrich ; germany) was visualized using streptavidin alexa 647 (1 : 100 ; invitrogen, germany). for hematoxylin and eosin (he) staining eyes were dehydrated in a tissue dehydration automat (mtm, slee, mainz, germany), by incubation in a series of increasing ethanol concentrations (2x 70%, 2x 96%, and 3x 100% for 1 hour), followed by xylene (3x 1 hour) and paraffin (4x 1 hour), and embedded in paraffin. sections of 5 m thickness were cut with a microtome (r. jung, heidelberg, germany), collected on slides, deparaffinized, rehydrated, and stained with hematoxylin and eosin. images were performed by a leica dmrx microscope. because of the larger variability observed in retinal thickness measurements in he - staining (probably due to the preparation process), we chose to determine retinal thickness in vertical sections stained for immunohistochemistry at six positions close to the papilla (comparable positions to the cross sectional images of the oct, maximum distance of 600 m from the optic nerve head). erg measurements were performed in wild type versus rd10 mice, anesthetized with ketamine and xylazine using goldring electrodes as active electrodes instead of contact lenses (figure 1(a)), in front of a ganzfeld stimulator following a standardized protocol. the light - induced electrical activity of both eyes was recorded as full - field flash ergs as described in the iscev standard protocol. typically, the erg waveform (figure 1(b)) consists of an early negative wave (a - wave ; primary light response in photoreceptors), followed by large positive deflection (b - wave ; dominated by the activity of on - bipolar cells and mller cells). riding on top of the b - wave are the oscillatory potentials that probably involve inner retinal circuitry. in wild type mice, the amplitude of a- and b - wave increased with light intensity and with age, reaching their maximal levels at the age of 12 weeks (figures 1(b) and 1(c)). in rd10 mice, the waves of the erg were completely abolished (figures 1(b) and 1(c)). retinal thickness was measured and the fundus of the eye was observed in vivo by optical coherence tomography (oct) (figure 2). for each retina, thickness was measured at six locations close to the optic disc (examples marked by red arrows in figure 2(b), column 1). while in wild type mice, a decrease of thickness between the second and third week of age, followed by a relatively constant retinal thickness (figure 2, column 3) was observed, in rd10 mice, a significant loss of retinal thickness was obvious (figure 2, columns 1 and 2). the outer nuclear layer (onl, marked by red bars in figures 2(c) and 2(f), column 1) was visible as a thin line up to 9 weeks. retinal separation was only observed in one 9-week - old mouse locally determined directly above the optic disc and in one 24-week - old mouse near the papilla (figure 2(g), first and second columns). in all of other animals of each age group (n = 3), no separation was found throughout the whole retina. in figure 2(i), the averaged thickness values of the retina of wild type (figure 2(i)1) and rd10 mouse (figure 2(i)2) determined in the oct were plotted against the age in weeks. the loss of thickness in the rd10 mice was mainly due to the thinning of the onl (figure 2(i)3), while the thickness of inner retinal layers stayed nearly constant (figure 2(i)4). up to the age of 9 weeks, the onl thickness was reduced to 10.2% (thickness at 3 weeks : mean of 102.6 m ; thickness at 9 weeks : mean of 10.44 m ; n = 3 for each age group). the retinae of the two strains were also examined using fluorescein angiography (figure 3). results from the above reported non - invasive tests were compared to data obtained with histological techniques. for this evaluation, retinal areas close to the optic disc were chosen, comparable to the regions used for thickness measurements in the oct (figure 2). in contrast to wild type mice, in most of the rd10 mice older than 3 weeks, artificial retinal separation was observed, probably based on the combination of photoreceptor degeneration and the preparation technique (figure 4). in accordance with the results obtained with oct, a decrease with age in the retinal thickness of rd10 mice was observed in histology in he staining (figure 4) as well as in immunohistochemical stainings (figure 5). in 5-, 7-, and 9-week - old rd10 mice, the onl was reduced to one row of photoreceptor somata. in the oct measurements, thickness of wild type retinae (7 weeks) was determined as 203 5.86 m, which agreed well with the thickness of 186.3 11.26 m obtained from immunohistochemically stained sections at corresponding positions (figure 5(d)). the histological work - up of the retinae may account for the observed differences in thickness of approximately 10 to 15% (figure 5(d)). to further investigate degenerative changes in the rd10 mouse retina and to identify cellular changes, immunohistochemical techniques were employed using specific antibodies and confocal laser scanning microscopy (figure 5). in figure 5, different cell populations in the degenerated retina were visualized using three stainings with different combinations of antibodies. the results were consistent with those obtained by other methods : photoreceptor somata and outer segments degenerated (figure 5, staining 1), while inner retinal cells such as bipolar cells, horizontal cells, and amacrine cells survived (figure 5, staining 2). in 7-week - old wild type mice, 10 to 12 layers of somata were visible in the onl (figure 5(a)). in accordance with our findings in the he staining, in rd10 mice, the onl was reduced to one row of somata at 7 weeks (figure 5(b), staining 1, green) and completely vanished at 24 weeks (figure 5(c), staining 1, green), while the thickness of inner retinal layers seemed to be unaffected (figures 5(b) and 5(c)). in wild type retina, second - order neurons that contact rods like rod bipolar cells (figure 5(a), staining 2, green) and horizontal cells (figure 5(a), staining 2, red) display elaborate processes (see insets in figure 5(a), staining 2). in rd10 retinae, such processes are lost (figures 5(b) and 5(c), staining 2). in wild type retina, gfap expression was only found in astrocytes, while mller cells were only positive for glutamine synthetase (figure 5(a), staining 3). in rd10 mice, mller cells were also positive for gfap (note the vertically oriented processes), indicating that they had become reactive during the retinal degeneration process (figures 5(b) and 5(c), staining 3, green). animal models of retinal degenerations and dystrophies, such as the rd10 mouse, are important to study the underlying disease mechanisms and also to establish possible treatment approaches [39 ]. no reduction of welfare of these animals over weeks was observed, although a loss of eyesight developed within the age of three weeks. many studies on retinal degeneration rely on the combination of data obtained from large populations of experimental animals, sacrificed at different stages of the degeneration process. recently, non - invasive tools such as erg, sd - oct, and fluorescein angiography have become promising methods that might allow following retinal degeneration in individual animals. in the present study, we show that the combination of these methods allows to precisely describe the degeneration of the retina in vivo during the course of the degenerative process. the data we present here were obtained by non - invasive methods and are in accordance with findings of other groups [8, 11 ]. the values of a- and b - wave in the erg were comparable to the results of other research groups [8, 9, 11 ]. angiographic findings in the vasculature revealed no significant differences between wild type and rd10 mice. the thickness of the onl or of the entire retina measured in vivo by oct scans was very well comparable to the thickness values obtained from histology. pennesi. found a separation between the outer retina and the pigment epithelium (neurosensory detachment) in the retina of rd10 mice at the age of 64 days. in our series of oct scans, we were not able to confirm this finding. in vivo however, after oct, when the eyes were prepared for histology, separation was commonly observed probably induced during the histological work - up. the difference between our results and those of pennesi. might be explained by differences in the type of oct devices. alternatively, our results may indicate that, although separation is not always manifest in vivo, it can be more easily induced in the rd10 mouse eye than in wild type eyes. the whole eye was sectioned, which enabled us to also evaluate other parts than the neural retina. as a disadvantage, sectioning the entire eye is more prone to artifacts such as retinal separation that we observed especially in older rd10 mice. immunohistochemistry provides the advantage that the major neuronal and glial cell classes of the retina can be visualized in much detail using cell type specific antibodies. our immunohistochemical results confirmed the early degeneration of rod and cone photoreceptors, the reactivity of mller cells, and neuronal remodeling processes in certain types of bipolar and horizontal cells. in summary, our data indicate that noninvasive techniques such as sd - oct scan of the retina in rodents are powerful tools to monitor the course of retinal degeneration with respect to morphometric analyses and at the same time reduce the number of animals sacrificed for histological techniques. quantitative anatomic parameters can be extracted from sd - oct scans and are in good accordance with morphometric data from histological work - up. however, single cells and their involvement in the degenerative mechanisms can only be identified by immunohistochemical techniques optimally combined with confocal fluorescence imaging technology. | background. to evaluate the correlation between erg, oct, and microscopic findings in the rd10 mouse. methods. c57bl/6j wild type mice and rd10 mice were compared at the age of 2, 3, 5, 7, 9, 12, 24, and 48 weeks (each age group n = 3) using full - field electroretinography (erg), spectral domain optical coherence tomography (sd - oct), fluorescein angiography (fa), hematoxylin & eosin histology (he), and immunohistology (ih). results. while in wild type mice, the amplitude of a- and b - wave increased with light intensity and with the age of the animals, the rd10 mice showed extinction of the erg beginning with the age of 5 weeks. in oct recordings, the thickness of the retina decreased up to 9 weeks of age, mainly based on the degradation of the outer nuclear layer (onl). afterwards, the onl was no longer visible in the oct. he staining and immunohistological findings confirmed the in vivo data. conclusion. erg and oct are useful methods to evaluate the retinal function and structure in vivo. the retinal changes seen in the oct closely match those observed in histological staining. |
subjects between the ages of 30 to 49 years who received cataract surgery at st. mary 's hospital from 1995 to 2004 (n = 976) were included in this study. patients with a history of ocular trauma, uveitis, ocular or systemic diseases other than diabetes and hypertension, congenital cataracts, and those who received combined surgeries were excluded. the type of lens opacity, urban / rural region, and preoperative and postoperative visual acuities were analyzed. seoul, the capital of korea, is the largest city in the country and is home to 25% of the entire korean population, was regarded as an urban region. other cities and provinces outside of seoul, korea were considered to be rural regions. using a slit lamp biomicroscope, two ophthalmologists (ksn and skc) of st. mary 's hospital, the catholic university of korea examined the anterior segment of both eyes. the pupils of all other subjects were dilated with topical tropicamide / phenylephrine hydrochloride (mydrin - p ; santen, osaka, japan) eye drops until the pupil diameter was at least 7.0 mm. nuclear opalescence and brunescence were assessed with a narrow slit beam and cortical and posterior subcapsular (psc) opacities were assessed with retroillumination. lens opacity grading was conducted using the internationally recognized objective lens grading system, lens opacity classification system iii (locs iii). the locs iii is a systemic method of grading the severity of lens opacities according to photographic standards using four major characteristics : nuclear opalescence, nuclear color, cortical cataract, and psc cataract. a cataract was defined as a locs iii score of 4 or more for nuclear opalescence or nuclear color, a locs iii score of 2 or more for a cortical cataract, and a locs iii score of 2 or more for a psc cataract. we also analyzed distinct types of cataracts : nuclear only, cortical only, psc only, or mixed. additionally, anterior polar (ap) type subcapsular opacities were evaluated because they are frequently found in this age group. an ap opacity was defined as a subcapsular opacity at the center of the pupil seen in the non - dilated and dilated states. in our study, due to the large percentage of ap and psc opacities a mixed type lens opacity (ap + psc) category was created to compare the percentage of patients with cortical only or nuclear only type opacities. the mixed type opacity was thus defined as a combination of nuclear and cortical opacities without a ap or psc opacity component. operating procedures included either phacoemulsification or extracapsular cataract extraction with intraocular lens implantation under local anesthesia. the cochran - armitage proportion trend test technique was used to identify changes of each parameter with the passage of time. the quoted p - values are 2-sided and were considered to be statistically significant when calculated to be < 0.05. using a slit lamp biomicroscope, two ophthalmologists (ksn and skc) of st. mary 's hospital, the catholic university of korea examined the anterior segment of both eyes. the pupils of all other subjects were dilated with topical tropicamide / phenylephrine hydrochloride (mydrin - p ; santen, osaka, japan) eye drops until the pupil diameter was at least 7.0 mm. nuclear opalescence and brunescence were assessed with a narrow slit beam and cortical and posterior subcapsular (psc) opacities were assessed with retroillumination. lens opacity grading was conducted using the internationally recognized objective lens grading system, lens opacity classification system iii (locs iii). the locs iii is a systemic method of grading the severity of lens opacities according to photographic standards using four major characteristics : nuclear opalescence, nuclear color, cortical cataract, and psc cataract. a cataract was defined as a locs iii score of 4 or more for nuclear opalescence or nuclear color, a locs iii score of 2 or more for a cortical cataract, and a locs iii score of 2 or more for a psc cataract. we also analyzed distinct types of cataracts : nuclear only, cortical only, psc only, or mixed. additionally, anterior polar (ap) type subcapsular opacities were evaluated because they are frequently found in this age group. an ap opacity was defined as a subcapsular opacity at the center of the pupil seen in the non - dilated and dilated states. in our study, due to the large percentage of ap and psc opacities a mixed type lens opacity (ap + psc) category was created to compare the percentage of patients with cortical only or nuclear only type opacities. the mixed type opacity was thus defined as a combination of nuclear and cortical opacities without a ap or psc opacity component. operating procedures included either phacoemulsification or extracapsular cataract extraction with intraocular lens implantation under local anesthesia. the cochran - armitage proportion trend test technique was used to identify changes of each parameter with the passage of time. the quoted p - values are 2-sided and were considered to be statistically significant when calculated to be < 0.05. a total of 11,111 patients underwent cataract surgery in our hospital from 1995 to 2004. of the 11,111 patients, only 976 subjects (8.8%) met the inclusion criteria. male patients accounted for the majority of the patient population, 79.0% (771 / 976), while female patients accounted for 21.0% (205 / 976) of the study population. in terms of home environment, 60.9% (594 / 976) of subjects were from an urban region and 39.1% (382 / 976) were from a rural region. the proportion of adults with cataracts aged 30 to 49 years from 1995 to 2004 was 11.5%, 9.7%, 9.2%, 7.9%, 8.7%, 10.4%, 6.5%, 7.4%, 12.1%, and 5.9%, respectively in each year. the proportion of adults with cataracts displayed a statistically significant decrease with the passage of time (p = 0.0002) (fig. the proportion of male patinets from each year showed statistically significant decrease with the passage of time (p = 0.0002). the proportion of total female patients from each year showed no statistically significant trend with the passage of time (p = 0.0599). the most common lens opacities were ap opacities (35.7%, 348 / 976) and psc opacities (35.1%, 343 / 976). mixed ap and psc opacities (7.0%, 68 / 976), cortical opacities (6.0%, 59 / 976), and nuclear opacities (5.4%, 53 / 976) followed in descending order. of note, the mixed ap and psc opacities were more common than cortical opacities or nuclear opacities alone (fig. mixed nuclear and cortical type lens opacities accounted for 10.8% (105 / 976) of the study population. among the proportions of lens opacity types, the proportion of mixed ap and psc opacities showed a statistically significant decrease with the passage of time (p < 0.0001) while the proportion of cortical opacities displayed a statistically significant increase with the passage of time (p < 0.0001). the cochran - armitage test results of other lens opacities and the previously discussed elements are demonstrated in table 2. the percentage of subjects with a preoperative best - corrected visual acuity (bcva) less than 20 / 40 was 73.2% (714 / 976). after a postoperative period of 2 months, 92.7% (905 / 976) subjects showed a bcva of more than 20 / 40. the shortest follow up period was 2 months and some patients are still being followed presently. a total of 11,111 patients underwent cataract surgery in our hospital from 1995 to 2004. of the 11,111 patients, only 976 subjects (8.8%) met the inclusion criteria. male patients accounted for the majority of the patient population, 79.0% (771 / 976), while female patients accounted for 21.0% (205 / 976) of the study population. in terms of home environment, 60.9% (594 / 976) of subjects were from an urban region and 39.1% (382 / 976) were from a rural region. the proportion of adults with cataracts aged 30 to 49 years from 1995 to 2004 was 11.5%, 9.7%, 9.2%, 7.9%, 8.7%, 10.4%, 6.5%, 7.4%, 12.1%, and 5.9%, respectively in each year. the proportion of adults with cataracts displayed a statistically significant decrease with the passage of time (p = 0.0002) (fig. the proportion of male patinets from each year showed statistically significant decrease with the passage of time (p = 0.0002). the proportion of total female patients from each year showed no statistically significant trend with the passage of time (p = 0.0599). the most common lens opacities were ap opacities (35.7%, 348 / 976) and psc opacities (35.1%, 343 / 976). mixed ap and psc opacities (7.0%, 68 / 976), cortical opacities (6.0%, 59 / 976), and nuclear opacities (5.4%, 53 / 976) followed in descending order. of note, the mixed ap and psc opacities were more common than cortical opacities or nuclear opacities alone (fig. mixed nuclear and cortical type lens opacities accounted for 10.8% (105 / 976) of the study population. among the proportions of lens opacity types, the proportion of mixed ap and psc opacities showed a statistically significant decrease with the passage of time (p < 0.0001) while the proportion of cortical opacities displayed a statistically significant increase with the passage of time (p < 0.0001). the cochran - armitage test results of other lens opacities and the previously discussed elements are demonstrated in table 2. the percentage of subjects with a preoperative best - corrected visual acuity (bcva) less than 20 / 40 was 73.2% (714 / 976). after a postoperative period of 2 months, 92.7% (905 / 976) subjects showed a bcva of more than 20 / 40. the shortest follow up period was 2 months and some patients are still being followed presently. in this study, the percentage of subjects who underwent cataract surgery aged 30 to 49 years was 8.8% (976 / 11,111). this number is much less than previously mentioned in the kim study that reported a prevalence of cataracts in patients older than 20 years old as 13.98% or the prevalence of cataracts in patients over 19 years of age from the korea national health and nutrition examination survey that was found to be 24.1%. although the proportion is different from the prevalence, this result suggests that age is the most important risk factor for the development of cataracts. since there are few reports regarding the epidemiology of cataracts among adults aged 30 to 49 years, it is difficult to compare the prevalence of cataracts in korea with other countries. however, the prevalence of cataracts in patients aged 40 to 49 years old have been reported as 7.0% and 6.5% in two chinese studies. considering the fact that the prevalence of cataracts is lower in younger subjects, the 8.8% of 30 to 49 years old in this study, which did include younger subjects, seems to be higher than other chinese studies. the prevalence of cataracts among patients aged 30 to 49 years was 12.8% in the korea national health and nutrition examination survey, which is greater than the proportion found in our study. a possible explanation for this is that all patients with cataracts may not have undergone surgery. in this study, male subjects made up 79.0% of the patient population and and females accounted for 21.0%, which is a noticeable male predominance of the study population. the most common type of lens opacity was the ap opacity (35.7%), which is a rare condition outside of korea. kim and joo demonstrated that the prevalence of ap opacities in korea was high in comparison with other countries and was significantly higher in males. according to the study of kim., ap opacities were much more common in males (81.4%) and in those younger than 40 years (45.4%) in a korean population. the racial factor of koreans is considered to have affected our results such that the proportion of adults aged 30 to 49 years with cataracts was relatively higher with a predominance of ap opacities and male subjects than other races. the ap opacity is limited to the anterior subcapsular area and the resultant lens opacity occurs in a relatively small area. as shown by our results, ap opacities occurred mainly in males aged 30 to 49 years and caused severe vision impairment in this active population and led to heavy social and economic losses. the ap opacity and psc opacity had greater subjective and objective effects on vision more so than other lens opacity types [25 - 29 ], such that cataract surgical intervention is indicated at earlier stages. this may be another reason why in our study, most subjects (70.8%) between 30 to 49 years of age who received cataract surgeries had either an ap or psc opacity. many studies have investigated the epidemiology of cataracts in different races and at different ages. subjects of these studies were at least 40 years and older in singapore, china, taiwan, and australia. these studies all showed predominance of the nuclear opacity and more females than males, which were different from the results of our study. in older subjects of various races, even in other asian races, the results were also different compared with the present study. however, the prevalence of cataracts increased with age in all of these studies, which is consistent with our study results. thus, it is likely that age affects the development of cataracts in all ages and races. the overall proportion of cataracts among adults aged 30 to 49 years showed statistically significant decreases with the passage of time (cochran - armitage test, p = 0.0002). due to the wide distribution of ophthalmic services and the development of cataract surgery, authors hypothesized that the rate of cataract surgery in this age group would increase with the passage of time. the korean society is getting older and the proportion of young people is getting smaller as time progresses. according to the census taken by the korean statistics department the proportion of the population aged 30 to 49 years decreased to 31.16% in 2005 from 34.51% in 1995. one of the limitations of our study is that the subjects were not representative of the general population, but rather patients who underwent cataract surgeries. therefore, the data may show some differences with the general population and more vision threatening lens opacity types may have been overrepresented, which may have resulted in an underestimate of nuclear or cortical opacities. however, considering the lower prevalence of cataracts in the younger age group and only severe visual disturbances may lead to ophthalmological examination, it seems reasonable to select subjects who have undergone cataract surgery for the purpose of larger data collection. however, nearly 40% of subjects were from a rural area, which is a considerable proportion regarding that the location of the hospital in seoul, korea. since korea is a racially homogeneous nation and data from rural areas was substantially included, the regional differences seem to have little influenced on the study population. in conclusion, our results have revealed long - term characteristics and changes in the prevalence of cataracts among adults aged 30 to 49 years in korea over a 10-year study period. the proportion of patients with cataracts this age group was relatively higher and had a predominance of ap and psc opacities as well as male patients in comparison with studies of senile cataracts in other races. further studies on the assessment of the risk factors and studies based on the general population with larger sample numbers are required to substantiate these results. | purposeto investigate the long - term characteristics of cataracts among adults aged 30 to 49 years in korean over a span of 10 years.methodssubjects between the ages of 30 to 49 years who underwent cataract surgery at st. mary 's hospital from 1995 to 2004 (n = 976) were included. patients with a history of ocular trauma, uveitis, other ocular or systemic diseases, and congenital cataracts were excluded. additional information including type of lens opacity, urban / rural region, and pre- and postoperative visual acuities were analyzed. lens opacity grading was conducted using lens opacity classification system iii. the cochran - armitage proportion trend test was used to analyze vision changes with the passage of time.resultsamong the patients who had undergone cataract surgeries, 8.8% (976 / 11,111) met the inclusion criteria. the mean age was 41.7 5.45 years. gender breakdown of the patient population included 79.0% male and 21.0% female. in terms of home environment, 60.9% were from an urban region and 39.1% from a rural region. opacity type included anterior polar (ap), posterior subcapsular (psc), ap and psc, cortical, and nuclear in 35.7%, 35.1%, 7.0%, 6.0%, and 5.4% of patients, respectively. at a 2-month postoperative follow - up appointment, 92.7% of patients showed a best - corrected visual acuity of more than 20 / 40.conclusionspredominance of ap and psc opacities as well as male patients was observed in this study population. |
the prevalence of obesity has raised dramatically in recent years. increased adiposity, particularly, visceral fat accumulation, is closely associated with premature atherosclerosis and many metabolic alterations including insulin resistance, dyslipidemia and hypertension.. obesity is one of the most common disorders in climacteric women and occurs in approximately 65% of them. recent data suggested that menopause status is associated with differences in adipose tissue metabolism in both, the abdominal and gluteal region. menopause has been shown to contribute to the development of central obesity, insulin resistance and worsening of glucose and lipid metabolism that increase the risk for cardiovascular disease in women. in obese women the primary cause for this situation seems to be a menopausal metabolic syndrome observed in 40% of climacteric women. adipose tissue produces and releases hormones and other biologically active molecules adipokines- that regulate several metabolic activites of the human body. among these adipokines adiponectin has been shown to directly or indirectly affect insulin sensitivity through modulation of insulin signaling and the molecules involved in glucose and lipid metabolism. decrease in the circulating levels of adiponectin by genetic and environmental factors is associated with the development of diabetes and the metabolic syndrome. the use of adiponectin is suggested as a novel therapeutic tool for diabetes and the visceral obesity metabolic syndrome but evaluation of its effectiveness will require further clinical studies. menopause is associated with a raise in follicle - stimulating hormone (fsh) and luteinizing hormone (lh) levels and a fall in estrogens. the average age of menopause is 51 years (45 to 55 yrs). during the transition from the reproductive years through menopause and beyond, women experience many changes, among them changes in adipose tissue metabolism that may contribute to body fat distribution. women have more body fat compared to men, and there is a gender - specific difference in fat distribution. in women, adipose tissue is accumulated especially around the hips, buttocks, and thighs while men have a larger intra - abdominal fat mass. among several hormones, estrogens promote, maintain and control the typical distribution of adipose tissue and its metabolism through still partly unknown mechanisms. lipolysis in humans is controlled through the -adrenergic (lipolytic) and 2-adrenergic (antilipolytic) receptors. in visceral adipocytes adrenaline stimulates lipolysis (high /2 receptor ratio) but in subcutaneous adipocytes it has an adverse effect ((high 2/ receptor ratio). pedersen demonstrated that estradiol, only through the estrogen receptor, inhibits adrenaline - stimulated lipolysis in human subcutaneous fat cells by increasing the amount of 2-adrenergic antilipolytic receptors. this may explain how estradiol is related to typical female subcutaneous adipose tissue distribution because this inhibition is not observed in visceral fat depots. in women, estradiol may shift accumulation of fat from visceral into subcutaneous depots. this difference, abolished after menopause, suggests that female sex steroid hormones, mainly estrogens, influence adipogenesis and adipose tissue metabolism. during postmenopausal the redistribution of body fat, after menopause, may be essential in linking the menopause with metabolic alterations which confer to cardiovascular disease (cvd) risk. changes in the hormone levels at menopause, in particular estrogen deficiency, are associated with an increase in total adiposity, preferentially at visceral region. recent data suggested that in postmenopausal women low estrogen concentrations, compared with relatively elevated levels of circulating androgens, may explain, at least in part, the body fat redistribution, loss of subcutaneous fat and gain of visceral fat. lipoprotein lipase (lpl) from adipose tissue is very important in accumulation and distribution of fat stores. it was suggested that regional differences in subcutaneous adipose tissue metabolism are related to menopause status. lpl in the gluteal and abdominal fat tissue seems to be more active in postmenopausal compared with perimenopausal women that, together with concomitant lower lipolysis, may predispose postmenopausal women to increase body fat after menopause. the more atherogenic lipid profile and increased level of the prothrombotic plasminogen activator inhibitor-1 is observed in women after menopause. additionally, circulating cortisol concentration is increased that is associated with central obesity, elevated blood pressure, insulin resistance and dyslipidemia. it has been reported that increased production of adiponectin, peroxisome proliferator - activated receptor (ppar) and fatty acid transporter in adipose tissue from gluteal region may be a physiological response to preserve systemic insulin sensitivity in estrogen - deficient women at postmenopause. among the different possible mechanisms, adiponectin seems to be the most interesting and promising biologically active molecule released from fat cells since it has profound protective actions in the pathogenesis of diabetes mellitus and cardiovascular disease. adiponectin is secreted from adipose tissue and compared with many hormones, is very abundant in the plasma. human plasma adiponectin concentration is associated with sex and is significantly higher in women than in men. interestingly, sex differences in circulating adiponectin levels in older adults can not be explained by sex hormone regulation. in healthy women, plasma concentration of adiponectin inversely relates to visceral fat mass and visceral fat area, however the correlation is weak in peri- and postmenopausal women comparing to that in younger women. the menopausal transition increases serum adiponectin concentration, however, the data related to its levels and association with body fat and regulatory factors are contradictory. two big studies have shown a significant inverse correlation of adiponectin with estradiol that was observed in healthy postmenopausal women, even after adjustment for age and body mass index (bmi). laughlin assessed the determinants of serum adiponectin in postmenopausal women and men aged 50 - 92 yrs and found positive association of adiponectin with testosterone, and negative with bioavailable estradiol in both sexes. recently, it has been reported that dehydroepiandrosterone sulfate (dhea - s), a precursor of androgens and estrogens, may upregulate adiponectin gene expression in a depot - dependent manner. the effect of dhea - s was observed only in visceral adipocytes from fat depots of morbidly obese humans. on the other hand, increased levels of free testosterone, low sex hormone - binding globulin (shbg) in postmenopausal women were shown to be associated with decreased production of adiponectin. adiponectin is involved in a number of metabolic processes, such as glucose utilization, fatty acid oxidation in muscles, decreased insulin resistance in the liver and the metabolism of adipose tissue, but the physiological role of adiponectin needs further explanation. adiponectin accumulates in injured vascular walls, bound to collagens i, iii and v present in the subendothelial intima, indicating that it may be involved in the repair process of damaged vasculature. recently it was shown that low adiponectin concentration in postmenopausal women was associated with adverse changes in carotid intima - media thickness and stiffness that was not dependent on other cardiovascular risk factors. these include proinflammatory factors such as cytokines (il-6, and tnf-), monocyte chemotactic protein-1 and c - reactive protein (crp). decreased expression and plasma levels of adiponectin may serve as a marker of increased metabolic and inflammatory risk. the association exists between adiponectin gene expression and its plasma levels which results from exclusive secretion of this adipokine by adipocytes. this is not the case for the pro - inflammatory il-6 or tnf- gene expression in fat cells because these molecules are also secreted by a number of other cell types. it was found that plasma adiponectin levels and hs - crp correlate inversely what may suggest that decreased production of adiponectin contributes to the systemic and vascular inflammation commonly found in obesity. the potential role of adiponectin in obesity and related pathologies is directed mainly to protection against atherogenesis and insulin resistance. some studies suggest that adiponectin could be a marker of risk for developing menopausal metabolic syndrome. adiponectin has been shown to exert anti - inflammatory and antiatherogenic properties within the arteries and thus may negatively modulate the process of atherogenesis. adiponectin increases insulin sensitivity in various models of insulin resistance and in vitro increases the ability of sub - physiologic levels of insulin to suppress glucose production in isolated hepatocytes. this protein intensifies peripheral tissues sensitivity to insulin and its deficiency can contribute to the development of insulin resistance in type 2 diabetes and obesity. estrogen deficiency is increasingly being recognized as a cause of metabolic syndrome, characterized by visceral obesity, insulin resistance, impaired lipid metabolism. adiponectin enhances fatty acid oxidation in liver and muscle, thus reducing triglyceride content in these tissues. moreover, it stimulates glucose utilization in muscle and inhibits glucose production by the liver, consequently decreasing blood glucose levels. recent studies have indicated that adiponectin levels are significantly lower in obese than in non - obese women at the same stage of postmenopause and lower in those with metabolic syndrome. lobo. reported that weight gain and obesity lead to the increased prevalence of metabolic syndrome in postmenopausal women and use of transdermal hormonal therapy is beneficial overall for reducing many of the parameters of metabolic syndrome. it was reported that centrally located fat was the main determinant of variability in adiponectin concentration in healthy postmenopausal women. from many studies can be concluded that low plasma adiponectin was associated with all the components of the metabolic syndrome. the association of the adiponectin genetic variation with obesity, metabolic syndrome and diabetes mellitus has been found in a taiwanese elderly population. it seems however, that in humans adiponectin gene does not play a role of the master obesity gene. decreased adiponectin concentration is rather a predictor of the development of type 2 diabetes than obesity. low adiponectin level most likely reflects obesity - dependent adipose tissue - specific insulin resistance and mediates the effect of obesity on insulin resistance in the liver and muscles. most probably, the adipose tissue - specific insulin sensitivity rather than general adiposity itself determines the adiponectin expression in the adipose tissues (figure 2). the influence of menopausal status on the relationship between adiponectin and insulin resistance was studied and it was found that significant inverse association between adiponectin and homeostasis model assessment of insulin resistance (homair) occurred only after menopause. the authors concluded that adiponectin may play a role in the improvement of insulin sensitivity after, rather than before, menopause. several counter - regulatory hormones and inflammatory cytokines, such as tnf-, that mediate insulin resistance, were shown to reduce either adiponectin mrna expression or protein secretion. high levels of tnf- and low estradiol play the most important role in development of insulin resistance. it was suggested that adiponectin decreases the secretion of tnf- and antagonizes tnf- by influencing on the expression of many adhesion molecules and the adhesion of monocytes to endothelial cells. postmenopausal women had higher tnf- than perimenopausal, however postmenopausal non - obese showed slightly lower tnf- levels compared with obese women. the associations between adipocytokines and traditional risk factors for cardiovascular disease were assessed in women at postmenopausal stage. the larger decreases in adiponectin over the menopause transition were associated with greater increase in systolic blood pressure, insulin and insulin resistance and with greater decreases in high density lipoprotein (hdl - cholesterol). review of the data confirmed positive association of adiponectin with hdl - cholesterol and negative relation with low - density lipoprotein (ldl - cholesterol) and triglycerides (tg) but not with high total cholesterol. adiponectin should be regarded as a most important among adipocytokines. decreased adiponectin level, caused by obesity - induced insulin resistance in the adipose tissue, leads to decreased insulin sensitivity in the liver and skeletal muscle and in consequence to insulin resistance - related metabolic phenotypes. understanding the mechanisms by which sex hormones affect total and regional body fat distribution and widening our knowledge about pathophysiology of obesity and insulin resistance will have important therapeutic and preventive implications for women at menopause. | obesity is associated with premature atherosclerosis, as well as with many metabolic alterations including insulin resistance, dyslipidemia and hypertension. visceral fat accumulation, particularly, is closely associated with the development of metabolic syndrome. the menopause transition, as well as the early postmenopausal period, is associated with increase in total and central obesity. among adipocytokines secreted by the adipose tissue adiponectin is the only one that has a protective role in the development of obesity - related disorders, such as type 2 diabetes and cardiovascular disease.this review aims to present a role that adiponectin may play during the progress of menopause in relation to development of menopausal metabolic syndrome. |
zinc oxide (zno) nanoparticles represent an important class of commercially applied materials. they have been widely applied in diagnostics, therapeutics, drug - delivery systems, electronics, cosmetics, personal care products, and food additives, due to their magnetic, catalytic, semiconducting, antimicrobial, ultraviolet - protective, and binding properties.14 however, the increasing use of zno nanoparticles has raised concern about their potential toxicity for humans and the environment. the majority of in vivo toxicity studies on zno nanoparticles have investigated acute toxicity and subacute toxicity after a single or repeated dosing, respectively, via inhalation, ingestion, injection, or dermal penetration.510 however, much work has yet to been done to determine absorption amounts and bioavailability. pharmacokinetic (pk) studies require a systematic and thorough quantitative analysis of absorption, distribution, metabolism, and excretion in whole animals, and provide measures of kinetic profiles in plasma and all tissues until the agent is completely cleared from the body.11,12 thus, pk studies provide basic information about nanoparticle entry into systemic circulation, organs targeted for accumulation, and time required for elimination. kinetic parameters provide information on the half - lives and residence times of nanoparticles, and thus pk studies are needed to understand the biological interactions of nanoparticles with tissues and to determine the effects of long - term exposure. on the other hand, toxicokinetics (tk) applies pk tools to define the relationship between kinetic behaviors of a toxicant and the occurrence of toxic events.13 both pk and tk profiles of nanoparticles are highly dependent on exposure routes and physicochemical properties, such as size, shape, surface charge, surface chemistry, and chemical composition.11,14 unlike other metal oxide nanoparticles, such as titanium dioxide, cerium oxide, and iron oxide, zno nanoparticles are not highly stable and tend to dissolve in aqueous solutions, subsequently releasing zinc ions from the particles.1518 the solubility of zno nanoparticles depends on ph, concentration, particle size, and the presence of organic compounds.15,19,20 thus, their instability and solubility under physiological conditions pose a challenge in distinguishing if the toxicity of zno nanoparticles results from the particulate or zinc toxicity. controversies continue to exist on the toxicity of zno nanoparticles as well as their fates in biological systems.2123 this review summarizes the biokinetic behaviors of zno nanoparticles obtained by different approaches, with discussion of tk, target organs, solubility, biological fates, and toxicity potentials. time - course analysis of plasma concentrations after administering a single dose of zno nanoparticles is an effective method for quantification of absorption and bioavailability, and helps in the estimation of distribution as well as elimination phases.24 most absorption studies on zno nanoparticles evaluate biokinetics after a single- or repeated - dose oral exposure, since oral administration generally decreases bioavailability due to gastrointestinal barriers, the first - pass effect, and incomplete absorption related to liver and gut - wall functions. on the other hand, intravenously injected nanomaterials directly enter the systemic circulation, and thus in principle obtain 100% bioavailability. determining biokinetic properties of zno nanoparticles often relies on the quantitative analytical techniques commonly applied to inorganic materials, ie, quantification of zinc content in biological samples. methods for quantification include inductively coupled plasma - atomic emission spectroscopy, inductively coupled plasma - mass spectroscopy, and atomic absorption spectrophotometry. following a single oral administration, plasma concentration versus when three different doses (50, 300, and 2,000 mg / kg) of two different nanoparticle diameters (20 and 70 nm), dispersed in citrate/4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (hepes), were orally administered to rats, all pk parameters, such as, maximum concentration, time to reach maximum concentration (tmax), area under the plasma concentration time curve (auc ; a measure of the total amount that reaches the systemic circulation), half - life (t), and mean residence time (average time that a molecule remains in the body), increased clearly in a dose - dependent manner.25 in particular, the absorption rate and distribution phase were highly dependent on exposure dose, showing tmax values at 1, 6, and 24 hours after receiving 50, 300, and 2,000 mg / kg, but returned to normal levels within 6, 24, and 96 hours, respectively (figure 1). oral absorption efficiency was determined to be about 13%, 25%, and 31%, respectively. further kinetic behavior studies on surface - charge effects (negative and positive) of zno nanoparticles showed that negatively charged particles (capped with citrate / hepes, zno) were absorbed in larger amounts than positively charged particles (capped with l - serine / hepes, zno), about 11%, 15%, and 16% absorptions for 50, 300, and 2,000 mg / kg doses, respectively.26 therefore, it was concluded that surface charge rather than particle size was the dominating factor affecting absorption efficiency. mechanistic studies are further needed to understand the reason for the high absorption efficiency of negatively charged zno nanoparticles compared to positively charged particles. on the basis of absorption efficiency, zno nanoparticles with negative charge can be more efficient for biological application, whereas positively charged particles may cause less toxicity. table 1 summarizes the particle size, surface charge, and pharmacokinetic behaviors of zno nanoparticles. moreover, kinetic behaviors of zno nanoparticles in all cases differed from those of zinc ions compared to zncl2 administration, showing a rapid absorption rate, high absorption amount, and long t for zinc ions.26 therefore, the particulate form seems to be primarily absorbed into the bloodstream. after repeated - dose administration, the tk of zno nanoparticles is different from that obtained by a single exposure. the absorption of 40 nm zno nanoparticles dispersed in distilled water was investigated following repeated oral administration to rats by measuring blood zinc concentration after 13 weeks of the treatment;27 a clear dose response relationship was demonstrated, showing significantly increased zinc levels in rats administered 536.8 mg / kg but not in rats treated with 134.2 and 268.4 mg / kg. this suggests that the highest dose administered remained in the blood circulation 24 hours after final gavage. the no observed adverse - effect level of zno nanoparticles was 268.4 mg / kg for both male and female rats,27 which seems to be closely correlated to persistence at 536.8 mg / kg in the body. similar observations were found in a repeated dose 90-day oral tk study of 20 nm zno nanoparticles suspended in citrate / hepes in rats;28 a significant increase in plasma zinc levels was detected in rats administered 250 mg / kg at 90 days and 500 mg / kg at 2890 days. furthermore, elevated plasma zinc levels were found in some rats treated with 125 mg / kg. the difference in zinc - level persistence between the former and latter studies may have been due to different particle sizes tested or dispersing conditions. nevertheless, repeated oral exposure of zno nanoparticles could lead to systemic long - term accumulation, which may imply potential toxicity after long - term exposure. worth noting is that the tolerable upper intake level for zinc is 40 mg / day in adults.29 more caution needs to be taken when the human body is repeatedly exposed to nanoparticles. another important factor to be considered for understanding tk of zno nanoparticles is their fates in the bloodstream. the kinetics of neutron - activated zno nanoparticles of two different sizes (10 and 71 nm) was evaluated in mice after intravenous injection, with znno3 as a control;30 the kinetic parameters for the two nanoparticle sizes were similar, but greater plasma auc and t values were found for znno3 than zno nanoparticles. these results are in good agreement with the report by paek, described earlier.26 although part of the zno nanoparticles can dissolve in biological fluids, the kinetic behaviors of zno nanoparticles in terms of absorption are likely different from those of zinc ions. therefore, the nanoparticles are likely to be primarily present in particulate forms in the systemic circulation. the tissue distribution of zno nanoparticles has been evaluated in whole animals, often associated with toxicity evaluation. tissue - distribution study is essential in identifying target organs and target - specific toxicity, and requires quantification of nanoparticle distribution over various organ systems following a single or repeated exposure. tissue - distribution kinetics after a single administration provides residence times of nanoparticles in the body and elimination times. tissue - distribution patterns are highly dependent on exposure route, animals, and the physicochemical properties of nanoparticles. orally administered zno nanoparticles of 20 and 70 nm capped with citrate / hepes or l - serine / hepes were determined to accumulate in kidneys, liver, and lungs in rats after a single - dose administration, regardless of particle size, surface charge, or sex (table 1 and figure 2).25,26 tissue - distribution kinetics demonstrated a similar tendency to that found in plasma concentration time profile (figure 1), showing elevated zinc concentrations at 624 hours and 12 days in kidneys and liver after administration of 300 and 2,000 mg / kg, but returned to normal levels at 2 and 7 days, respectively. high retention of zno nanoparticles in lungs for the first hour can be explained by the fact that particles of 3080 nm tend to be generally sequestered in lung tissue.31 the same target organs for zno nanoparticles were determined by applying optical imaging of cy5.5-conjugation and positron emission tomography imaging of fluorinated particles.32,33 zno nanoparticles of 40 nm distributed to the liver and kidneys following repeated oral administration to rats for 13 weeks ; however, lung distribution was not included in this study.21 on the other hand, elevated zinc levels were detected in the liver, spleen, and kidneys in mice orally administered zno nanoparticles of about 93 nm, and caused acute liver toxicity.34 different tissue - distribution patterns between oral zno nanoparticles and zncl2 were demonstrated, showing higher distribution of zno nanoparticles in lungs, but lower distribution in kidneys and liver than zncl.26 gamma ray - emitting radioactive zno nanoparticles were primarily distributed in lungs and to a lesser extent in the liver, kidneys, and spleen after a single intravenous injection to mice.35 the liver, spleen, kidneys, and lungs were found to be the main target organs for neutron - activated zno nanoparticles of two different sizes (10 and 71 nm) in mice following intravenous injection, showing a size - dependent effect;30 high tissue accumulation was found for 10 nm zno versus 71 nm zno particles. on the other hand, the highest zinc - tissue levels were found in kidneys after injection of znno3, while zno nanoparticles accumulated in larger amounts than znno3 in the liver, spleen, and lungs, demonstrating different tissue distributions between zno particles and znno3.30 intraperitoneally injected zno nanoparticles (93 nm) were more effectively distributed in the liver, spleen, kidneys, lungs, and heart in mice, compared to their distribution in the liver, spleen, and kidneys following oral administration.34 meanwhile, inhalation of 20 nm zno nanoparticles in rats led to elevated zinc content in liver, but severe toxicological effects were observed in both liver and lung tissues.9 the liver and kidneys are likely to be common target organs, regardless of different exposure routes, experimental animal types, and physicochemical properties of zno nanoparticles. therefore, the potential toxicity of zno nanoparticles to these organs has to be considered. furthermore, the tissue distribution of zno nanoparticles differs from that of zinc ions, which leads us to conclude major particulate uptake into organs. the excretion kinetics of nanoparticles is important in the context of understanding the elimination processes of wastes or metabolites. in general, entities of less than 6 nm in hydrodynamic diameter (hd) are capable of glomerular filtration, while those of larger than 8 nm hd are not.36,37 the renal filtration threshold for proteins is typically less than 5 nm in hd.38 indeed, nanoparticles with an hd smaller than 5.5 nm were determined to undergo urinary excretion efficiently.39 therefore, large particles should be decomposed or biodegradable prior to clearance via urine. conversely, fecal excretion involves the elimination of both nonabsorbed entities after oral ingestion and metabolites excreted via bile that are not reabsorbed from the small intestinal gut. the excretion kinetics of zno nanoparticles can be affected by exposure routes or physicochemical properties. however, fecal and biliary excretion routes seem to play major roles in nanoparticle elimination, regardless of exposure routes, particle size, surface charge, sex, or experimental animal type. most orally administered zno nanoparticles (20 or 70 nm, negative or positive charge) were excreted via the fecal route in rats, while a small portion of nanoparticles was cleared via urine.25,26 size - dependent urinary excretion kinetics was also demonstrated ; 20 nm nanoparticles were more rapidly cleared compared to 70 nm nanoparticles, probably associated with easy decomposition or dissolution characteristics of smaller particles. the excretion profile of zno nanoparticles was not dependent on surface charge.26 therefore, particle size rather than surface charge determines the excretion kinetics of nanoparticles. although no significant effect of particle size on absorption has been found, it is probable that larger 70 nm particles exhibit more toxicity than 20 nm ones, because 70 nm is cleared more slowly than 20 nm. highly elevated zinc concentration was detected in feces after 13 weeks of consecutive oral administration to rats,21 which is in good agreement with the results by baek and paek.26 fecal excretion of radioactive zno nanoparticles in mice following intravenous injection was also clearly demonstrated.35 it is worth noting that the principal pathway of zinc excretion is via feces, and absorbed zinc is reexcreted into the small intestine via the biliary route,40 whereas, zinc elimination through the kidney plays a minor role.40 therefore, the excretion process of zno nanoparticles appears to follow the same pathway as zinc ions. time - course analysis of plasma concentrations after administering a single dose of zno nanoparticles is an effective method for quantification of absorption and bioavailability, and helps in the estimation of distribution as well as elimination phases.24 most absorption studies on zno nanoparticles evaluate biokinetics after a single- or repeated - dose oral exposure, since oral administration generally decreases bioavailability due to gastrointestinal barriers, the first - pass effect, and incomplete absorption related to liver and gut - wall functions. on the other hand, intravenously injected nanomaterials directly enter the systemic circulation, and thus in principle obtain 100% bioavailability. determining biokinetic properties of zno nanoparticles often relies on the quantitative analytical techniques commonly applied to inorganic materials, ie, quantification of zinc content in biological samples. methods for quantification include inductively coupled plasma - atomic emission spectroscopy, inductively coupled plasma - mass spectroscopy, and atomic absorption spectrophotometry. following a single oral administration, plasma concentration versus when three different doses (50, 300, and 2,000 mg / kg) of two different nanoparticle diameters (20 and 70 nm), dispersed in citrate/4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (hepes), were orally administered to rats, all pk parameters, such as, maximum concentration, time to reach maximum concentration (tmax), area under the plasma concentration time curve (auc ; a measure of the total amount that reaches the systemic circulation), half - life (t), and mean residence time (average time that a molecule remains in the body), increased clearly in a dose - dependent manner.25 in particular, the absorption rate and distribution phase were highly dependent on exposure dose, showing tmax values at 1, 6, and 24 hours after receiving 50, 300, and 2,000 mg / kg, but returned to normal levels within 6, 24, and 96 hours, respectively (figure 1). oral absorption efficiency was determined to be about 13%, 25%, and 31%, respectively. further kinetic behavior studies on surface - charge effects (negative and positive) of zno nanoparticles showed that negatively charged particles (capped with citrate / hepes, zno) were absorbed in larger amounts than positively charged particles (capped with l - serine / hepes, zno), about 11%, 15%, and 16% absorptions for 50, 300, and 2,000 mg / kg doses, respectively.26 therefore, it was concluded that surface charge rather than particle size was the dominating factor affecting absorption efficiency. mechanistic studies are further needed to understand the reason for the high absorption efficiency of negatively charged zno nanoparticles compared to positively charged particles. on the basis of absorption efficiency, zno nanoparticles with negative charge can be more efficient for biological application, whereas positively charged particles may cause less toxicity. table 1 summarizes the particle size, surface charge, and pharmacokinetic behaviors of zno nanoparticles. moreover, kinetic behaviors of zno nanoparticles in all cases differed from those of zinc ions compared to zncl2 administration, showing a rapid absorption rate, high absorption amount, and long t for zinc ions.26 therefore, the particulate form seems to be primarily absorbed into the bloodstream. after repeated - dose administration, the tk of zno nanoparticles is different from that obtained by a single exposure. the absorption of 40 nm zno nanoparticles dispersed in distilled water was investigated following repeated oral administration to rats by measuring blood zinc concentration after 13 weeks of the treatment;27 a clear dose response relationship was demonstrated, showing significantly increased zinc levels in rats administered 536.8 mg / kg but not in rats treated with 134.2 and 268.4 mg / kg. this suggests that the highest dose administered remained in the blood circulation 24 hours after final gavage. the no observed adverse - effect level of zno nanoparticles was 268.4 mg / kg for both male and female rats,27 which seems to be closely correlated to persistence at 536.8 mg / kg in the body. similar observations were found in a repeated dose 90-day oral tk study of 20 nm zno nanoparticles suspended in citrate / hepes in rats;28 a significant increase in plasma zinc levels was detected in rats administered 250 mg / kg at 90 days and 500 mg / kg at 2890 days. furthermore, elevated plasma zinc levels were found in some rats treated with 125 mg / kg. the difference in zinc - level persistence between the former and latter studies may have been due to different particle sizes tested or dispersing conditions. nevertheless, repeated oral exposure of zno nanoparticles could lead to systemic long - term accumulation, which may imply potential toxicity after long - term exposure. worth noting is that the tolerable upper intake level for zinc is 40 mg / day in adults.29 more caution needs to be taken when the human body is repeatedly exposed to nanoparticles. another important factor to be considered for understanding tk of zno nanoparticles is their fates in the bloodstream. the kinetics of neutron - activated zno nanoparticles of two different sizes (10 and 71 nm) was evaluated in mice after intravenous injection, with znno3 as a control;30 the kinetic parameters for the two nanoparticle sizes were similar, but greater plasma auc and t values were found for znno3 than zno nanoparticles. these results are in good agreement with the report by paek, described earlier.26 although part of the zno nanoparticles can dissolve in biological fluids, the kinetic behaviors of zno nanoparticles in terms of absorption are likely different from those of zinc ions. therefore, the nanoparticles are likely to be primarily present in particulate forms in the systemic circulation. the tissue distribution of zno nanoparticles has been evaluated in whole animals, often associated with toxicity evaluation. tissue - distribution study is essential in identifying target organs and target - specific toxicity, and requires quantification of nanoparticle distribution over various organ systems following a single or repeated exposure. tissue - distribution kinetics after a single administration provides residence times of nanoparticles in the body and elimination times. tissue - distribution patterns are highly dependent on exposure route, animals, and the physicochemical properties of nanoparticles. orally administered zno nanoparticles of 20 and 70 nm capped with citrate / hepes or l - serine / hepes were determined to accumulate in kidneys, liver, and lungs in rats after a single - dose administration, regardless of particle size, surface charge, or sex (table 1 and figure 2).25,26 tissue - distribution kinetics demonstrated a similar tendency to that found in plasma concentration time profile (figure 1), showing elevated zinc concentrations at 624 hours and 12 days in kidneys and liver after administration of 300 and 2,000 mg / kg, but returned to normal levels at 2 and 7 days, respectively. high retention of zno nanoparticles in lungs for the first hour can be explained by the fact that particles of 3080 nm tend to be generally sequestered in lung tissue.31 the same target organs for zno nanoparticles were determined by applying optical imaging of cy5.5-conjugation and positron emission tomography imaging of fluorinated particles.32,33 zno nanoparticles of 40 nm distributed to the liver and kidneys following repeated oral administration to rats for 13 weeks ; however, lung distribution was not included in this study.21 on the other hand, elevated zinc levels were detected in the liver, spleen, and kidneys in mice orally administered zno nanoparticles of about 93 nm, and caused acute liver toxicity.34 different tissue - distribution patterns between oral zno nanoparticles and zncl2 were demonstrated, showing higher distribution of zno nanoparticles in lungs, but lower distribution in kidneys and liver than zncl.26 gamma ray - emitting radioactive zno nanoparticles were primarily distributed in lungs and to a lesser extent in the liver, kidneys, and spleen after a single intravenous injection to mice.35 the liver, spleen, kidneys, and lungs were found to be the main target organs for neutron - activated zno nanoparticles of two different sizes (10 and 71 nm) in mice following intravenous injection, showing a size - dependent effect;30 high tissue accumulation was found for 10 nm zno versus 71 nm zno particles. on the other hand, the highest zinc - tissue levels were found in kidneys after injection of znno3, while zno nanoparticles accumulated in larger amounts than znno3 in the liver, spleen, and lungs, demonstrating different tissue distributions between zno particles and znno3.30 intraperitoneally injected zno nanoparticles (93 nm) were more effectively distributed in the liver, spleen, kidneys, lungs, and heart in mice, compared to their distribution in the liver, spleen, and kidneys following oral administration.34 meanwhile, inhalation of 20 nm zno nanoparticles in rats led to elevated zinc content in liver, but severe toxicological effects were observed in both liver and lung tissues.9 the liver and kidneys are likely to be common target organs, regardless of different exposure routes, experimental animal types, and physicochemical properties of zno nanoparticles. therefore, the potential toxicity of zno nanoparticles to these organs has to be considered. furthermore, the tissue distribution of zno nanoparticles differs from that of zinc ions, which leads us to conclude major particulate uptake into organs. the excretion kinetics of nanoparticles is important in the context of understanding the elimination processes of wastes or metabolites. in general, entities of less than 6 nm in hydrodynamic diameter (hd) are capable of glomerular filtration, while those of larger than 8 nm hd are not.36,37 the renal filtration threshold for proteins is typically less than 5 nm in hd.38 indeed, nanoparticles with an hd smaller than 5.5 nm were determined to undergo urinary excretion efficiently.39 therefore, large particles should be decomposed or biodegradable prior to clearance via urine. conversely, fecal excretion involves the elimination of both nonabsorbed entities after oral ingestion and metabolites excreted via bile that are not reabsorbed from the small intestinal gut. the excretion kinetics of zno nanoparticles can be affected by exposure routes or physicochemical properties. however, fecal and biliary excretion routes seem to play major roles in nanoparticle elimination, regardless of exposure routes, particle size, surface charge, sex, or experimental animal type. most orally administered zno nanoparticles (20 or 70 nm, negative or positive charge) were excreted via the fecal route in rats, while a small portion of nanoparticles was cleared via urine.25,26 size - dependent urinary excretion kinetics was also demonstrated ; 20 nm nanoparticles were more rapidly cleared compared to 70 nm nanoparticles, probably associated with easy decomposition or dissolution characteristics of smaller particles. the excretion profile of zno nanoparticles was not dependent on surface charge.26 therefore, particle size rather than surface charge determines the excretion kinetics of nanoparticles. although no significant effect of particle size on absorption has been found, it is probable that larger 70 nm particles exhibit more toxicity than 20 nm ones, because 70 nm is cleared more slowly than 20 nm. highly elevated zinc concentration was detected in feces after 13 weeks of consecutive oral administration to rats,21 which is in good agreement with the results by baek and paek.26 fecal excretion of radioactive zno nanoparticles in mice following intravenous injection was also clearly demonstrated.35 it is worth noting that the principal pathway of zinc excretion is via feces, and absorbed zinc is reexcreted into the small intestine via the biliary route,40 whereas, zinc elimination through the kidney plays a minor role.40 therefore, the excretion process of zno nanoparticles appears to follow the same pathway as zinc ions. recent studies have focused extensively on the determination of in vivo fates of zno nanoparticles to investigate whether their fates are as intact particulate forms or dissolved ionic forms in cells or tissues. in particular, the solubility of zno nanoparticles must be considered for oral evaluation, because of their high dissolution in acidic fluids versus alkali fluids.15,16,19 the biological fates of nanoparticles are still unclear ; however, many studies suggest that the primary bioavailable form of zno nanoparticles in tissues is ionic zinc rather than the particulate form. cho reported complete 40 nm zno nanoparticle dissolution in simulated gastric fluid compared to almost - intact particles in distilled water.21 the conclusion was drawn that the absorption of zinc ions from zno nanoparticles under acidic gastric conditions contributes to their oral toxicity pancreatitis.27 paek recently demonstrated a contradicting report of partial dissolution (13%14%) of 20 and 70 nm zno nanoparticles capped with citrate / hepes or l - serine / hepes in simulated gastric fluid.26 when absorbed plasma levels and tissue - distribution concentration of zno nanoparticles or zncl2 were calculated based on soluble zinc dose, the difference in kinetics between particles and zncl2 was greater, indicating the effect of particulate forms on biokinetic behaviors.26 the conflicting results regarding the solubility between two studies may be related to the use of capping agents in the paek study. they also determined that the major fate of zno nanoparticles in tissues was as the ionic form, based on the fact that no particulate forms were observed in transmission electron microscopy on the liver and kidneys following both oral and intravenous administration.26 the ionic zinc fate in tissues was also supported by x - ray absorption spectroscopy, showing new zn s bond formation in organs in rats administered zno nanoparticles;25 indeed, zn o and zn zn bonds in the wurtzite structure were found in the reference zno nanoparticles.25 therefore, the nanoparticles enter the blood circulation in both particulate and ionic forms, but mainly as particles, and localize in organs primarily as zinc ions. finally, the zinc appears to be cleared in the same manner as zinc ions. li suggested that both dissolved zinc ions and nanoparticulate forms must be considered for toxicity evaluation of zno nanoparticles.22 hao also identified the toxicity of zno nanoparticles as a function of particle toxicity, and not as a result of only particle dissolution.23 therefore, the question as to whether zno nanoparticles are absorbed into the bloodstream as both particles and zinc ions or only as ionic forms remains to be answered, which may depend on the preparation method or dispersing agent used for nanoparticles. the fates of zno nanoparticles in human bronchial epithelial cells (beas-2b) were determined by scanning transmission x - ray microscopy and x - ray absorption near - edge structure analysis;41 the nanoparticles are taken up by cells in particulate forms, then completely and rapidly dissolve inside cells, generating zn ligated by thiol groups. this is consistent with the in vivo zno nanoparticle fate determined by paek.26 the bioavailability fate of isotope - labeled zno nanoparticles was traced by coherent anti - stokes raman scattering and scanning transmission electron microscopy with energy dispersive x - ray spectroscopy in mud shrimp (corophium volutator);42 ionic zinc from particles in an aqueous environment was determined primarily to contribute to the uptake and bioavailability fate of zno nanoparticles. although the particulate form affects the kinetics and toxicity of zno nanoparticles, it appears that the fate of zno nanoparticles in tissues or cells is primarily as ionic zinc, which should be considered in underlying the mechanisms of their in vitro and in vivo toxicity (table 1 and figure 3). on the other hand, the particle - dissolution properties and ionic fate of zno nanoparticles in tissues are not advantageous for such biological applications as drug - delivery systems, diagnostics, and therapeutics, which could be overcome, for example, by using capping agents or coating materials. it is worth noting that part of zno nanoparticles are dissolved in biological fluids, but the nanoparticles retain their particulate forms in the systemic circulation. therefore, both particulate and zinc ionic fates must be considered to understand the toxicity and tk of zno nanoparticles. protein corona, is important for the interpretation of biokinetic behaviors, bioavailability, and toxicity potential. when an inorganic or organic material comes in contact with biological fluids, such as blood, rapid interactions occur instantly and lead to protein adsorption on the surface of nanoparticles. therefore, the interaction of nanoparticles with proteins is highly dependent on the surface characteristics and particle size of the nanoparticles.43,44 most of the studies on nanoparticle protein interaction have been performed with blood or plasma proteins, such as albumins, immunoglobulins, fibrinogen, lipoproteins, and coagulation factors, to examine binding, adsorption, and changes in protein structure.4547 these types of interactions may cause undesirable toxic effects or facilitate the delivery of nanoparticles to organs, because plasma proteins play a critical role in the disposition, transportation, and deposition of both endogenous and exogenous molecules by noncovalent interaction.48 in particular, nanoparticle protein corona implicates cellular interaction in terms of toxicity, uptake, and immune response. for example, it was reported that albumin - adsorbed single - walled carbon nanotubes contributed to the induction of anti - inflammatory response in mouse leukemic monocyte macrophage cell line.49 similarly, adsorption of the pulmonary surfactant protein a on magnetite nanoparticles was determined to enhance cellular binding and uptake of nanoparticles by alveolar macrophages, while albumin adsorption led to a remarkable decrease.50 on the other hand, albumin - coated polystyrene nanoparticles were internalized into cells via caveolae - mediated endocytosis, because caveolae are capable of the transcytosis of albumin through the cell membrane.51 apolipoproteins are of importance in the context of their ability to bind to diverse types of nanoparticle surfaces.52 in particular, apolipoprotein e was able to transport nanoparticles across the blood brain barrier, although a small amount of protein was bound to the surface.53 in this case, the neurotoxicity of nanoparticles must be also considered, although apolipoprotein e - adsorbed nanoparticles can be used as carriers for delivering drugs at brain target sites. it is clear that biological activity and molecular targeting of nanoparticles could be dependent on protein types adsorbed on nanoparticles. furthermore, information about protein structural or conformational changes as a consequence of protein nanoparticle interaction is crucial, as these may cause a loss of bioactivity and subsequently lead to potential toxicological effects (figure 4). bovine serum albumin (bsa), the most abundant plasma protein in cows, was adsorbed onto colloidal zno nanoparticles (65 nm), and the driving force for this interaction was determined to be electrostatic attraction.54 bhogale reported the spontaneous formation of a bsa zno (7.5 nm) complex by hydrogen and van der waals forces, resulting in slight conformational modifications in bsa structure.46 the binding of zno nanoparticles to albumin as well as other plasma proteins, such as protamine and thrombin, was also demonstrated by gann ;55 when they also incubated the nanoparticles with human cells, the particles induced a rounded up moreover, zno nanoparticles were determined to be more highly agglomerated in biological buffer containing plasma proteins than in water, leading to an increase in protein binding to the nanoparticles.48 when the mechanism of fibrinogen adsorption on zno nanoparticles was investigated, both electrostatic and hydrophobic interactions were responsible for the adsorption, resulting in protein denaturation.56 high fibrinogen adsorption was caused by zno nanoparticles with smaller aggregate size versus larger aggregate size ; this can be explained by an inverse relationship between aggregate size and surface area. cytochrome c, an essential protein component of the electron - transport chain, was also used to evaluate its interaction with 60 nm zno nanoparticles;57 the structure and thermodynamic stability of cytochrome c was not significantly affected by its adsorption on the nanoparticles. zno nanoparticles actively interact with biological matrices ; however, their interaction affecting biokinetics, absorption, distribution, and toxicity in vivo remains to be elucidated. biokinetic studies on zno nanoparticles are necessary to provide basic information about their absorption characteristics, bioavailability, t, residence times, clearance rates, and organs targeted. in particular, such studies are essential in terms of predicting potential toxicological effects and for identifying correlations with acute or subacute toxicity. although kinetic studies are in their infancy compared with the extensive studies conducted on zno nanoparticle toxicities in vitro and in vivo, recent research on their plasma concentration time profiles showed different biokinetic profiles of the particles compared to those of zinc ions. furthermore, their tk persistence at high doses after repeated exposure seems to cause adverse effects. the liver and kidneys were found to be common target organs, regardless of exposure routes, animals tested, and physicochemical properties of nanoparticles. it was also suggested that fecal excretion plays a major role in the clearance of zno nanoparticles. on the other hand, the biological fate of zno nanoparticles is likely to be primarily in the ionic form, not the particulate form, in cells and tissues. however, the question of zno nanoparticle absorption into the circulatory system as particles and/or zinc ions remains to be answered. zno nanoparticles interact with proteins, such as plasma and blood proteins, probably by electrostatic attraction, which leads to protein binding or adsorption. further in vivo research protein interaction on biokinetics, absorption, tissue distribution, bioavailability, and potential toxicity. | biokinetic studies of zinc oxide (zno) nanoparticles involve systematic and quantitative analyses of absorption, distribution, metabolism, and excretion in plasma and tissues of whole animals after exposure. a full understanding of the biokinetics provides basic information about nanoparticle entry into systemic circulation, target organs of accumulation and toxicity, and elimination time, which is important for predicting the long - term toxic potential of nanoparticles. biokinetic behaviors can be dependent on physicochemical properties, dissolution property in biological fluids, and nanoparticle protein interaction. moreover, the determination of biological fates of zno nanoparticles in the systemic circulation and tissues is critical in interpreting biokinetic behaviors and predicting toxicity potential as well as mechanism. this review focuses on physicochemical factors affecting the biokinetics of zno nanoparticles, in concert with understanding bioavailable fates and their interaction with proteins. |
autotransplantation is the surgical transposition of a tooth from its original site to another extraction or surgically formed recipient site in the same individual. autotransplantation is advocated in various conditions such as teeth with extensive caries, advanced periodontal diseases, congenitally missing, impacted, or ectopically erupting teeth, tooth loss due to trauma, teeth with large endodontic lesions and localized severe periodontitis which does not show promising prognosis. autotransplantation is cost - effective and shows a higher success rate with the maintenance of a unique sensory system and promoting proper healing of the periodontal environment to sound tissue. it is preferred in young patients as it allows normal orofacial growth. in autotransplantation, misalignment or supraeruption of more than 2 mm of donor tooth can affect the pulp of an otherwise healthy tooth. in such conditions, pulp therapies that can be performed are pulpotomy (partial or complete) or pulpectomy depending upon vitality or maturity of tooth. pulpotomy is the surgical amputation of coronal portion of the pulp to the level of healthy pulp and is followed by the placement of suitable medicament that will promote healing and preserve the vitality of remaining radicular pulp that is necessary for continuous root development. this case report highlights a 4-year follow - up of a case of immediately performed mineral trioxide aggregate (mta) pulpotomy in autotransplanted mandibular left immature third molar to replace the grossly decayed mandibular left first molar in a 17-year - old female. a 17-year - old healthy asian girl reported to the department with the chief complaint of pain in the lower left posterior region. past dental history revealed that the patient had spontaneous pain, followed by swelling in relation to the same tooth around 8 months ago. clinical and radiographic examinations revealed that the lower left first molar (tooth # 36) was irreparably damaged [figure 1a ]. considering the patient 's age, condition of tooth # 36, availability of ipsilateral third molar with incomplete root formation [figure 1b ], economical status, and the patient 's willingness, autotransplantation with mta pulpotomy was decided as a definitive treatment plan. the patient was explained about the risks, complications, and possible outcomes of autotransplantation and mta pulpotomy. a free and clarified consent form was signed by the patient 's mother, where all the risks and complications of the treatment were explained, authorizing the patient 's preplanned dental intervention. an intraoral preoperative radiograph of recipient (tooth # 36) (a) and donor tooth (tooth # 38) (b). mandibular left third molar (tooth # 38) was extracted carefully (c) and transplanted in the socket of tooth # 36. it was in supraocclusion (around 4 to 5 mm) (d) the standard preoperative procedures were performed : intraoral antisepsis with 0.12% chlorhexidine digluconate for 1 min and perioral antisepsis with povidone. under local anesthetic solution with adrenaline (2% lidocaine with 1 : 100,000 epinephrine, lox 2% neon lab, india), tooth # 36 was extracted. mandibular left third molar (tooth # 38) was extracted using osteotomy, so as to make its extraction easy with minimum trauma to its periodontal tissues [figure 1c ] and was transplanted in the socket of tooth # 36. the extraoral time from extraction of the tooth # 38 to transplantation was 10 min. after tooth transplantation, it was found that the transplanted tooth was in supraocclusion (around 4 - 5 mm) [figure 1d ]. this occlusal adjustment resulted in a mechanical exposure of the pulp and, hence, it was decided to perform an immediate mta pulpotomy. the pulp chamber was enlarged and freshly mixed mta was packed in the pulp chamber space followed by a glass ionomer restoration [figure 2a d ]. nonrigid temporary splinting through malleable orthodontic wire and composite resin from tooth # 34 to # 37 was executed. the patient was instructed to perform daily mouth rinsing with 0.12% chlorhexidine gluconate, twice a day and was prescribed amoxicillin 500 mg and ibuprofen 400 mg orally for 7 days. the patient was recalled after 1 day to check whether any symptoms were present and the tooth was restored permanently using composite restoration. the patient 's mother was instructed regarding the importance of the follow - up appointments and the patient was clinically and radiographically followed up for every 6 months for the next 4 years. radiograph of autotransplanted mandibular left third molar (tooth # 38) in the socket of tooth # 36 (a). under rubber isolation, follow - up radiograph at 2 years (c), and 4 years (d) showed complete healing of extraction socket with the appearance of normal lamina dura autotransplantation is a simple and viable treatment option for missing teeth or for teeth indicated for extraction when a suitable donor tooth is available. various factors influencing the success of autotransplantation are the patient 's age, the stage of root development (open or closed apex), the number of roots present (single or multirooted), oral hygiene, similarity of root morphology of donor tooth with recipient tooth, etc. it is more successful in young patients because teeth with immature roots show higher success rate due to greater chances of revascularization and adjacent alveolar growth. chances of regeneration of pulp in autotransplanted immature tooth is very high (around 96%) compared to teeth with closed apices (around 15%). in the presented case, the presence of immature roots was the main reason for such a long - term clinical and radiographic success rate. autotransplanted tooth should have intimate contact in buccolingual and mesiodistal direction with the recipient site to improve the level of nutrition and the blood supply for its higher success rate. in the absence of adequate buccolingual width, the alveolar ridge may get resorbed due to pressure from autotransplanted tooth. in the present case, the buccolingual dimension of the donor tooth was compatible with the width of the recipient socket, but the mesiodistal size of the donor tooth was considerably larger and, hence, the donor tooth was in a supraocclusal position. autotransplanted tooth # 38 showed good initial stability and gingival tissue on the mesial and distal aspects of the tooth were sutured to optimize postoperative healing. in addition, selective occlusal adjustment in tooth # 38 was carried out to avoid any occlusal discrepancy. various treatment options are available for such a clinical situation ranging from enameloplasty to vital pulp therapy including indirect pulp treatment (ipt), direct pulp treatment (dpt), pulpotomy, and pulpectomy depending upon the degree of severity. mta induces predictable and rapid dentin formation with greater structural integrity and completes dentin bridging. in addition, in response to mta pulpotomy, the pulp shows less inflammation, hyperemia, and necrosis, as well as a thicker dentinal bridge with more frequent odontoblastic layer formation. it can be concluded that autogenous tooth transplantation, when well indicated, planned, and performed, can be a viable alternative mainly in young patients, allowing the reestablishment of the functionality (mastication) and aesthetics as well as to contribute clinically for bone formation stimulus at the transplanted site. proper planning, surgical technique knowledge, the clinician 's ability to perform the procedure, and the patient 's compliance have a fundamental role in the success of autotransplantation. the success of autotransplantation can be further influenced by a number of other factors such as the patient 's age, the developmental stage of the transplanted tooth, the type of tooth transplanted, the surgical technique employed, and the extra - alveolar time span before the tooth is transplanted. | autotransplantation is the surgical transposition of a tooth from its original site to another, replacing a lost or a compromised tooth by another tooth, usually the third molar in the same individual. this technique is considered a viable method due to its high success rate, well - grounded treatment option, provided the case selection and the procedure followed is within the acceptable limits. autotransplantation is considered as an alternative approach of oral rehabilitations in a conservative manner mainly in young patients with compromised financial conditions to perform a high cost treatment. it is a fast way to recover function and aesthetic properties without interfering with the orofacial growth. this report describes a successful 4-year follow - up of a case of immediately performed mineral trioxide aggregate (mta) pulpotomy in autotransplantated mandibular left immature third molar to replace the mandibular left first molar that was extracted due to extensive carious lesion. |
postoperative ileus (poi) is a transient impairment of normal gastrointestinal (gi) motility seen after major abdominal operations and periodically after nonabdominal operations, with characteristics including nausea and vomiting, bloating, abdominal pain and discomfort, absence of passage of flatus or stool, accumulation of gas and fluid in the bowel, and poor tolerance of oral intake.1 surgical manipulation of the intestine during surgery correlates with decreased contraction of intestinal smooth muscle,2 and the use of postoperative opioids for pain control acts on enteric nervous system -receptors, slowing intestinal transit times.3 therefore, after major abdominal surgery, poi is often a foregone conclusion, prolonging hospital stay, increasing medical costs, and delaying advancement of enteral diet. recent data indicate a significant economic burden on the health care system in the care of poi, approaching us$1.5 billion annually.4 with such profound impact on economics and patient comfort, poi remains an important issue for health care, specifically relating to abdominal surgery. to this end, several measures are aimed at reducing the duration and magnitude of poi. these measures each address the various factors that impact on postoperative gut function, and all are variably included in accelerated - care pathways. the major elements of these care pathways include the nonuse of nasogastric tubes in the postoperative period, opioid - sparing analgesia, early mobilization, intravenous fluid restriction, early feeding, and the use of prokinetics and other drugs that have been shown to have a positive impact on postoperative gut function.5 however, sparing opioids after surgery remains a difficult task, as many patients still require opioid pain control following major abdominal surgery. as such, specific treatments to lessen the negative impact of these narcotics on postoperative bowel dysfunction are thought to be valuable. alvimopan is an oral, peripherally acting -opioid receptor antagonist designed to mitigate antimotility effects of opioids on the gi tract without compromising opioid - based analgesia.6 in this review, the role of alvimopan in gi recovery of bowel resection after abdominal operation, and as a corollary, hospital costs, safety, and side effects are considered. in our systematic review of the literature, a us national institutes of health s national library of medicine pubmed online literature search was employed. alvimopan, post - operative ileus, ileus, return of bowel function, and bowel resection. inclusion criteria included published data from randomized controlled trials and meta - analyses specifically studying alvimopan as an experimental variable in poi after open operations, including bowel resection. several controlled trials have examined administration of alvimopan in the postoperative period and its effects on gi recovery after open abdominal surgery. in 2001, the first of these trials was reported in the new england journal of medicine which studied 78 patients, most of whom underwent total abdominal hysterectomy. time to passage of flatus and bowel movement was decreased, along with an associated decrease in the time to readiness for discharge in the alvimopan group.7 this study paved the way for several multicenter randomized double - blind trials showing correlation with alvimopan and gi recovery, as well as time to hospital discharge after abdominal surgery8,9 and decreased requirement of nasogastric tube placement.10 in patients undergoing total abdominal hysterectomy and treated with alvimopan postoperatively for 7 days (in hospital and at home), alvimopan significantly decreased time to first bowel movement and flatus, as well as demonstrating subjectively better bowel movement quality in the alvimopan - treatment arm. adverse events up to 30 days after surgery were also monitored, with the most common of these being nausea, vomiting, constipation, and gas pain, with no statistical significance of adverse events between the placebo and alvimopan groups.11 when administered to patients undergoing open bowel resection, alvimopan significantly accelerated gi recovery and hospital discharge compared to an accelerated postoperative care pathway alone.12 furthermore, in a pooled analysis of four phase iii randomized double - blind controlled trials examining adult patients undergoing laparotomy with partial small or large bowel resections, alvimopan was shown to improve time to tolerance of oral diet and passage of first stool, as well as time to discharge order written. moreover, number - needed - to - treat analysis demonstrated that treating seven patients would decrease length of hospital stay by 1 day.13 since the publication of these randomized controlled trials, several meta - analyses have been performed with the aggregated data. in 2007, tan published a meta - analysis of trials in patients undergoing bowel resection or total abdominal hysterectomy in which gi recovery was measured. the results of this meta - analysis of 2,195 patients showed that alvimopan improved time to tolerance of solid food, passage of flatus and stool (gi-3), and time to tolerance of solid food and passage of stool (gi-2). as with prior studies, no significant difference was noted in treatment - emergent adverse events, including nausea, vomiting, abdominal distention, constipation, and gas pain.14 a second meta - analysis of patients undergoing abdominal surgery who were treated with accelerated - care pathways pooled 1,388 patients, in which half received alvimopan. analysis revealed that treatment with alvimopan in the perioperative period resulted in reduction in time to hospital discharge order, gi-3, and gi-2 recovery. one limitation of this meta - analysis was the absence of data in the use of alvimopan following laparoscopic surgery.15 more recently, a multicenter randomized double - blind placebo - controlled trial of alvimopan in 277 patients following radical cystectomy was published by the european association of urology. all patients undergoing radical cystectomy were eligible if they received postoperative intravenous opioid - based patient - controlled analgesia and removal of nasogastric tube by the morning of postoperative day 1, and a standardized postoperative care pathway was used that included ambulation protocol, diet advancement on postoperative day 3, exclusion of epidural anesthesia / analgesia, and opioid - sparing medication (ketorolac or cox-2 inhibitors) dose restriction. this study showed statistically significant more rapid gi-2 recovery with a shorter mean length of stay and less ileus - related morbidity in the alvimopan arm.16 data gained from randomized trials on poi have shown overall that alvimopan has similar treatment - emergent adverse - event profiles compared to placebo with regard to nausea, vomiting, gas pain, and abdominal distension. in a 2007 analysis of four prospective alvimopan poi trials, poi - related morbidity was examined. in alvimopan - treatment groups, overall postoperative morbidity, nasogastric tube insertion, and overall complications of poi were less than placebo.17 one safety concern with alvimopan relates to adverse cardiac events in patients with opioid - induced bowel dysfunction being treated with low - dose 0.5 mg twice - daily alvimopan over 12 months. a single trial demonstrated a nonsignificant trend toward more cardiac - related adverse events.18 as a result of the poi trials and demonstration of safety, the us food and drug administration (fda), approved alvimopan in 2008 for the treatment of poi, with ongoing evaluation to ensure continued benefit. via the entereg access support and education program, hospital pharmacies must be registered and pharmacists and practitioners trained in the administration of alvimopan. additionally, it was approved for inpatient use only, allowing for 12 mg preoperative dosing plus 12 mg twice - daily administration for 7 days from the operative day, for the indication of poi.19 poi following abdominal surgery increases patient morbidity and length of stay, resulting in health care economic burden. alvimopan is approved for poi, but data on its cost - effectiveness have not been examined in phase iii randomized trials. using data gained from a phase iv trial of alvimopan for poi following radical cystectomy, medication use, procedures, total hospital days, and readmissions related to poi were recorded for the 277 patients in the original study. the authors demonstrated that poi - related health care costs were lower for alvimopan by $ 2,340 per patient, significant compared to placebo, and mean total combined costs were diminished by $ 2,640 per patient.20 in two retrospective matched - cohort studies of patients undergoing bowel resection, outcomes of total hospital costs and cost components and length of stay were compared between the control and study arms. the first of these studies, published in 2011, matched 480 alvimopan patients with two controls each. mean total hospital costs were shown to be statistically significant at $ 1,040 less per patient, and length of stay for the alvimopan patients was significantly different compared to controls. upon subanalysis of laparoscopic versus open procedures, costs did not differ significantly.21 the second of these studies, published in 2014, examined data from the university health system consortium and matched patients undergoing bowel resection receiving alvimopan with appropriate controls. laparoscopic and open cohorts were analyzed, with the laparoscopic alvimopan cohort exhibiting shorter length of stay and intensive care unit (icu)-admission rate, and the open cohort showed shorter length of stay and icu - admission rate as well as lower overall hospital cost when both groups were compared to controls. furthermore, outcomes in the alvimopan cohort, including length of stay, icu - admission rate, and hospital costs, were all significantly lower.22 several controlled trials have examined administration of alvimopan in the postoperative period and its effects on gi recovery after open abdominal surgery. in 2001, the first of these trials was reported in the new england journal of medicine which studied 78 patients, most of whom underwent total abdominal hysterectomy. time to passage of flatus and bowel movement was decreased, along with an associated decrease in the time to readiness for discharge in the alvimopan group.7 this study paved the way for several multicenter randomized double - blind trials showing correlation with alvimopan and gi recovery, as well as time to hospital discharge after abdominal surgery8,9 and decreased requirement of nasogastric tube placement.10 in patients undergoing total abdominal hysterectomy and treated with alvimopan postoperatively for 7 days (in hospital and at home), alvimopan significantly decreased time to first bowel movement and flatus, as well as demonstrating subjectively better bowel movement quality in the alvimopan - treatment arm. adverse events up to 30 days after surgery were also monitored, with the most common of these being nausea, vomiting, constipation, and gas pain, with no statistical significance of adverse events between the placebo and alvimopan groups.11 when administered to patients undergoing open bowel resection, alvimopan significantly accelerated gi recovery and hospital discharge compared to an accelerated postoperative care pathway alone.12 furthermore, in a pooled analysis of four phase iii randomized double - blind controlled trials examining adult patients undergoing laparotomy with partial small or large bowel resections, alvimopan was shown to improve time to tolerance of oral diet and passage of first stool, as well as time to discharge order written. moreover, number - needed - to - treat analysis demonstrated that treating seven patients would decrease length of hospital stay by 1 day.13 since the publication of these randomized controlled trials, several meta - analyses have been performed with the aggregated data. in 2007, tan published a meta - analysis of trials in patients undergoing bowel resection or total abdominal hysterectomy in which gi recovery was measured. the results of this meta - analysis of 2,195 patients showed that alvimopan improved time to tolerance of solid food, passage of flatus and stool (gi-3), and time to tolerance of solid food and passage of stool (gi-2). as with prior studies, no significant difference was noted in treatment - emergent adverse events, including nausea, vomiting, abdominal distention, constipation, and gas pain.14 a second meta - analysis of patients undergoing abdominal surgery who were treated with accelerated - care pathways pooled 1,388 patients, in which half received alvimopan. analysis revealed that treatment with alvimopan in the perioperative period resulted in reduction in time to hospital discharge order, gi-3, and gi-2 recovery. one limitation of this meta - analysis was the absence of data in the use of alvimopan following laparoscopic surgery.15 more recently, a multicenter randomized double - blind placebo - controlled trial of alvimopan in 277 patients following radical cystectomy was published by the european association of urology. all patients undergoing radical cystectomy were eligible if they received postoperative intravenous opioid - based patient - controlled analgesia and removal of nasogastric tube by the morning of postoperative day 1, and a standardized postoperative care pathway was used that included ambulation protocol, diet advancement on postoperative day 3, exclusion of epidural anesthesia / analgesia, and opioid - sparing medication (ketorolac or cox-2 inhibitors) dose restriction. this study showed statistically significant more rapid gi-2 recovery with a shorter mean length of stay and less ileus - related morbidity in the alvimopan arm.16 data gained from randomized trials on poi have shown overall that alvimopan has similar treatment - emergent adverse - event profiles compared to placebo with regard to nausea, vomiting, gas pain, and abdominal distension. in a 2007 analysis of four prospective alvimopan poi trials, poi - related morbidity was examined. in alvimopan - treatment groups, overall postoperative morbidity, nasogastric tube insertion, and overall complications of poi were less than placebo.17 one safety concern with alvimopan relates to adverse cardiac events in patients with opioid - induced bowel dysfunction being treated with low - dose 0.5 mg twice - daily alvimopan over 12 months. a single trial demonstrated a nonsignificant trend toward more cardiac - related adverse events.18 as a result of the poi trials and demonstration of safety, the us food and drug administration (fda), approved alvimopan in 2008 for the treatment of poi, with ongoing evaluation to ensure continued benefit. via the entereg access support and education program, hospital pharmacies must be registered and pharmacists and practitioners trained in the administration of alvimopan. additionally, it was approved for inpatient use only, allowing for 12 mg preoperative dosing plus 12 mg twice - daily administration for 7 days from the operative day, for the indication of poi.19 poi following abdominal surgery increases patient morbidity and length of stay, resulting in health care economic burden. alvimopan is approved for poi, but data on its cost - effectiveness have not been examined in phase iii randomized trials. using data gained from a phase iv trial of alvimopan for poi following radical cystectomy, medication use, procedures, total hospital days, and readmissions related to poi were recorded for the 277 patients in the original study. the authors demonstrated that poi - related health care costs were lower for alvimopan by $ 2,340 per patient, significant compared to placebo, and mean total combined costs were diminished by $ 2,640 per patient.20 in two retrospective matched - cohort studies of patients undergoing bowel resection, outcomes of total hospital costs and cost components and length of stay were compared between the control and study arms. the first of these studies, published in 2011, matched 480 alvimopan patients with two controls each. mean total hospital costs were shown to be statistically significant at $ 1,040 less per patient, and length of stay for the alvimopan patients was significantly different compared to controls. upon subanalysis of laparoscopic versus open procedures, costs did not differ significantly.21 the second of these studies, published in 2014, examined data from the university health system consortium and matched patients undergoing bowel resection receiving alvimopan with appropriate controls. laparoscopic and open cohorts were analyzed, with the laparoscopic alvimopan cohort exhibiting shorter length of stay and intensive care unit (icu)-admission rate, and the open cohort showed shorter length of stay and icu - admission rate as well as lower overall hospital cost when both groups were compared to controls. furthermore, outcomes in the alvimopan cohort, including length of stay, icu - admission rate, and hospital costs, were all significantly lower.22 since alvimopan gained fda approval for inpatient use in 2008, its safety has been adequately demonstrated in clinical trials, with no observable difference in treatment - related adverse - event profiles compared to placebo. it should be noted that safety concerns related to adverse cardiac events were observed in patients being treated for opioid - induced bowel dysfunction, not poi, and they were administered alvimopan in a vastly different dosing strategy than currently recommended. also, the incidence of adverse cardiac events was not significantly different when compared to controls. in the aforementioned cost benefit analyses, alvimopan was shown to reduce postoperative health care costs for patients undergoing radical cystectomy and bowel - resection operations, which if implemented following a wider range of abdominal operations, could greatly reduce total health care dollars spent during the postoperative period. acute - phase reactants in the systemic inflammatory response following abdominal surgery are mitigated with laparoscopic versus open procedures.23 this raises questions regarding the efficacy of poi - reducing drugs like alvimopan in laparoscopy. a paucity of data exists in the use of alvimopan in the setting of laparoscopic surgery ; therefore, the argument for its use in this setting is not as strong. while recent retrospective data show promise for alvimopan following laparoscopic bowel resection for reducing poi, data on length of hospital stay and hospital costs are conflicting.22,24,25 poi remains a major factor in determining length of hospital stay, patient morbidity, and medical costs after abdominal operation. accelerated - care pathways and early advancement of diet offer low - cost options of reducing length of stay and health care dollars spent.26 however, these advancements are still hindered by the widespread and necessary use of opioids for postoperative pain control following abdominal surgery, making ileus - mitigating alvimopan an appropriate option for reducing poi following abdominal surgery. continued data showing improvement in length of hospital stay and reduction of poi with direct correlation with ileus - related costs and overall postoperative costs will have a large impact on the implementation of alvimopan into postoperative accelerated - care pathways for abdominal surgery. the several aforementioned clinical trials, pooled analyses, and meta - analyses provide a strong argument in favor of the use of alvimopan following open gi surgery, radical cystectomy, and total abdominal hysterectomy. the current dosing strategy follows fda recommendations and most study parameters, with one 12 mg preoperative dose given up to 2 hours prior to surgery and twice - daily 12 mg dosing while an inpatient postoperatively. this regimen for the indication of poi has been shown to improve gi-2 recovery and decrease length of hospital stay in the treatment arms of these trials. | postoperative ileus (poi), which occurs after surgical manipulation of the bowel during abdominal operations, is associated with prolonged hospital stay, increasing medical costs, and delayed advancement of enteral diet, which contributes to a significant economic burden on the healthcare system. the use of accelerated care pathways has shown to positively impact gut function, but inevitable postoperative opioid use contributes to poi. alvimopan is a peripherally acting -opioid receptor antagonist designed to mitigate antimotility effects of opioids. in our review, we examined ten trials on alvimopan s use after abdominal operations. several of the earlier studies on patients undergoing bowel resection showed correlations between the study group and gi recovery as defined by passage of flatus, first bowel movement, and time to readiness for discharge. data in patients undergoing total abdominal hysterectomy showed similarly decreased gi recovery time. additionally, data within the past few years shows alvimopan is associated with more rapid gi recovery time in patients undergoing radical cystectomy. based on our review, use of alvimopan remains a safe and potentially cost - effective means of reducing poi in patients following open gi surgery, radical cystectomy, and total abdominal hysterectomy, and should be employed following these abdominal operations. |
within the next 20 years, it is anticipated that copd will rank fifth for overall causes of disability worldwide (murray and lopez 1996). year 2000 statistics rank copd as the fourth most common cause of death in the us (minino and smith 2001). when considering smoking burden in the mortality rankings, copd rises from fourth to third with greater than 25% of all money spent on smoking - related illness consumed as a result (zaher 2004). from a global perspective, copd is first on the list for worldwide deaths related to smoking. the medical community has been aware of the connection between the use of tobacco and the incidence of copd for decades. it is estimated that between 1 in 10 and 1 in 20 long - term smokers will develop clinical disease (strassels 1999). perhaps even more striking than that, however, is the fact that in comparison with non - smokers, those who abuse tobacco exhibit a mortality rate 1213 times higher (american lung association 2005). although copd ranks behind coronary heart disease and stroke when comparing disability - adjusted life years, it has the greatest smoking - related influence since the disease may begin to have an impact on the life and health of a smoker several decades before death. the average smoker loses 8 years of life, and 25% will die before the age of 69 years (secretary of state for health and secretaries of state for scotland, wales, and northern ireland 1998). establishing the cost burden of copd is a daunting task. in order to create the most accurate picture, both direct costs (medications and oxygen, services through health - care providers, inpatient stays, institutional care, diagnostic testing, and visits to the emergency room) and indirect costs (lost wages due to illness that encompass both patients and caregivers, decreased productivity on the job, and travel) possible variations such as inaccuracy of diagnostic coding and methods used to estimate future earnings further cloud the issue. the costs associated with copd are substantial, and data show that overall healthcare expenditures for patients with copd are nearly double that of those without (mapel 2000). in 1993 us dollars, copd was found to cost triple that of asthma on a per capita basis at an average of $ 1522 annually (sullivan 2000). a study examining the amount of money spent for patients under medicare found costs to be nearly 2.5 times higher for beneficiaries with copd than those without ($ 8482 vs $ 3511 per capita respectively) (grasso 1998). a study designed to estimate the annual direct medical costs of the disease from a societal perspective (1996 dollars) found that $ 14.5 billion were expected to be spent on patients with chronic bronchitis or emphysema (wilson 2000). indirect costs were not estimated in this study, making those predictions a significant underestimation of the true cost of the disease. another study that prospectively followed patients at multiple centers for a full year to determine the direct cost of copd was published in 2003 (miravitlles 2003). medications and oxygen, costs of physician visits and visits to the emergency room for exacerbations, hospitalizations, admissions to an intensive care unit, and procedure test costs were included in the data analysis. the mean cost of a single exacerbation was found to be $ 159, and the global direct yearly per - patient cost was $ 1876. these figures are again bound to be underestimations because of the exclusion of indirect cost measurement. optimization of the care of the copd patient typically costs a substantial amount of money, and cost - minimization strategies may be in direct opposition to that goal (sullivan 2000). those individuals charged with deciding policy must take several factors into consideration including the burden of the disease (epidemiology as well as cost), the environment of the setting in question, and the cost - effectiveness of available interventions. though both the young and the old abuse tobacco, the disease burden is substantially higher in patients over the age of 65 years (national heart, lung, and blood institute 2000). copd is relatively rare in persons younger than middle - age (ward 2000). this is an important factor to consider when looking at any intervention that affects the outcomes of patients with copd since preserved years of life and the quality of those years are primary markers of cost - effectiveness. disability - adjusted life years, mortality rates, and rates of hospitalization for copd are greater than are those for coronary heart disease, stroke, and lung cancer (zaher 2004). when examining cost - effectiveness, it is necessary to take all future costs of treatment and disease into account as copd remains a progressive and incurable disease that will be present for the lifetime of the patient (ramsey and sullivan 2003). determining the cost - effectiveness (ce) of an intervention is far from simple. as stated previously, both direct and indirect costs must be included in an analysis in order to consider it complete. however, most ce analyses consider only direct costs. this ratio takes the amount by which the cost of one intervention exceeds another (the incremental cost), and divides that figure by the amount of money that the use of the intervention in question exceeds the outcome expected by the alternative (the incremental effectiveness) (garber 1996). the united states panel on cost - effectiveness in health and medicine, formed by the united states public health service (usphs), recommended that certain standards be met by investigators of ce analyses (ubel 2000). such an analysis estimates the number of quality adjusted life years (qalys) produced when a particular amount of money is used to fund a specific intervention (boyd 1990). qalys take into account the years that are affected by an illness and weights them of lower value than those during which a patient enjoys good health. a value of 0 is designated for years during which the patient s quality of life is no better than death, and a value of 1 implies perfect health and the best possible quality of life (garber 1996). the point at which an intervention stops being cost - effective has been defined in the medical literature as between $ 20 000 and $ 50 000 per qaly (warner 1997 ; tengs and wallace 2000). in the uk, the national institute for clinical excellence has set the benchmark for ce at 20 000 per qaly (godfrey 2005). ce analyses can be performed from multiple perspectives including those of society at large (program cost), an insurer, a patient, or an employer. because the process of ce analysis is neutral politically and economically though the most appropriate perspective is still being deliberated, the usphs stipulates that public utility estimates should be the basis for measurements of the ce of a given intervention (ubel 2000). the argument for this perspective is that ce analysis exists as a tool to determine how scarce resources belonging to a society should be assigned. an individual patient is not shrouded from self - interest, making bias in the assignment of ce a possibility. however, the argument can be made that because society as a whole is blind to the effects of a specific illness, it can not make informed decisions, and a bias against an illness, particularly an illness such as copd that is sometimes designated a disease of self - infliction, may cloud the issue. additionally, society may not look at ce as an issue solely of qalys, but may favor patients who are severely ill, meaning that fewer qalys would be gained through an intervention in comparison with interventions aimed at those with a smaller disease burden. the possibility also exists for the geriatric population to be viewed as less valuable because they are felt to have already consumed their resources (ubel 2000). an employer may see the cost of an intervention as excessive since workers may leave the company, making another employer the beneficiary of a person s improved productivity before the break - even point. additionally, it has been hypothesized that programs requiring no financial investment on the part of the patient may attract those who are in reality not as motivated to quit, and as such, the overall effectiveness of the program may be diminished (curry 1998). simply put, a given amount of money today is worth more than that same amount will be tomorrow. a sensitivity analysis is often applied to data as well. because there are large disparities in economic data, it is sometimes necessary to use a all studies examining the ce of smoking cessation require the investigators to employ some amount of modeling (godfrey 2005). for instance, most studies considered long - term extend for a maximum of 1 year ; however, smokers may still relapse past that point in time. because there are limited data beyond 12 months, long - term rates of abstinence from smoking must be estimated (song 2002). the point at which patients can be labeled lifelong quitters has yet to be determined (ockene 2000). utilization of a sensitivity analysis determines the likelihood that the conclusion of an intervention as cost - effective will be upheld if uncertain values are higher or lower than those used for the original calculations (garber 1996). a comparison of ce analyses examined the utilization of the usphs recommendations (phillips and chen 2002). though discounting was frequently employed, only 22% of studies used the suggested rate of 3%. incremental ratios were used more frequently, but were not a component of 17% of studies. the population studied and the methods used can significantly change outcomes (haxby and baldwin 1996). there are currently no studies examining the ce of smoking cessation as it relates directly to patients with copd. the difficulty with the administration of such a study is that copd does not exist in a vacuum. because patients with copd tend to be older, many of these, such as coronary heart disease, hypertension, and cancer to name but a few, have their own link to smoking. therefore, if qalys are to be used as an outcome measure, it is unlikely that the physiological burden of one disease will be easily separated from that of another. additionally, the ultimate cause of mortality might be identifiable, but the decline in health leading up to that point may not be attributable to a single illness. the number of years of life saved in studies where disease - specific mortality is estimated is typically smaller than when smokers and quitters are compared for overall mortality rates (curry 1998). multiple studies examining the ce of various smoking cessation programs and reporting outcomes in terms of qalys saved, or more frequently total life - years saved (lys), have been published (table 1). six of these studies were completed to examine overall program (societal) costs. of these, two reported both qalys saved and lys (javitz 2004a ; feenstra 2005). the remaining four programs all reported outcome data for lys alone (wasley 1997 ; lennox 2001 ; tomson 2004 ; godfrey 2005). three of the studies were done from the perspective of the payer, one reporting cost per qaly saved (tran 2002), and the other two reporting cost per lys (curry 1998 ; gilbert 2004). the final study evaluated data from the perspective of an employer over the lifetime of its workforce and reported findings as cost per lys (warner 1996). most of them included a sensitivity analysis of the data generated, and the majority took background quit rates and likely relapse percentages into account. despite the inconsistency in study design among the ten, the programs were all deemed cost - effective by the investigators both pre- and post - sensitivity analysis completion. several other studies examining ce have been completed, but did not report data per qaly saved or lys. one such study, an economic model of bupropion and a work - site smoking cessation program, demonstrated the ce of the intervention (halpern 2000). the group studied was a cohort of workers and their adult dependants until all had reached the age of retirement (65 years) and death (assumed to be age 85 years). for every dollar spent on a smoking cessation intervention, it was estimated that between $ 5 and $ 6.50 was saved when considering both direct and indirect costs. considering just the money saved on health care, between $ 4 and $ 4.70 was saved per dollar spent. over 20 years, the estimated savings for a managed care organization under this model was between $ 5.7 and $ 6.4 million. this study did estimate the number of cases of copd that could be prevented assuming 100 000 employees and 60 000 dependants were affected. at the end of 20 years, it was expected that 420670 fewer cases of obstructive lung disease would be seen. two bupropion regimens and 2 behavioral interventions were combined in another study examining the ce from an employer s perspective (javitz 2004b). the authors concluded that after 5 years, the employer would be expected to realize a benefit of $ 3735 per non - smoker at a total per - enrollee cost of $ 119283 depending on the regimen used. the per - enrollee benefit to benefits were expected to be realized from a decrease in medical expenses of 19%, a decrease in the number of days absent from work (4 days for men and 2 days for women prorated by years post - quit), and a productivity gain of > 50%. it should be noted that this study was completed using caucasian middle - class subjects who were aware that bupropion would be given, so these data are likely not applicable across all patient groups. another study examining a program in terms of cost to the employer using a decision tree analysis found that combinations of 5 weeks of nicotine replacement treatment at an average cost of $ 128, along with 5 clinic visits ($ 75) and 5 consultations with a pharmacist ($ 75) were cost - effective when patients were fully reimbursed (mcghan and smith 1995). the net benefit per converted non - smoker was found to be $ 302 for the first year, and $ 1483 for each additional year after cessation. the authors of yet another analysis concluded that an employer could expect a net benefit of up to $ 338 per successful quitter in the first year when bupropion and/or nicotine replacement was provided (neilsen and fiore 2000). the ce of a program administered by family physicians in australia utilizing special training for the physicians involved demonstrated that the program was cost - effective for all parties (buck 2000). physicians were trained to gauge the readiness of a patient to quit using the transtheoretical model. self - reported quit rates at 12 months were verified with carbon monoxide readings of < 14 ppm. ce was defined as the cost per quitter believed to have done so as a direct result of the program. the total program cost to the group of smokers who were prepared to quit was $ 23 429, and $ 25 734 for the entire group of smokers (1995 dollars). the net quit rate was 7.7% with associated costs of $ 421 for the organizers, $ 984 for the physicians, $ 348 for the smokers, and $ 1749 for society. included in the analysis was the cost of the training which makes this study unique, but also makes comparisons with other studies difficult. ce is expected to improve over time as the training is a one time cost and will continue to be spread over a greater number of quitters. a systematic review of the ce of smoking cessation studies was recently published (ronckers 2005). in an attempt to standardize the studies for comparison, fourteen studies and 26 overall comparisons were included, and only studies applicable to the non - community setting were used. it was determined that the data analyzing future costs was lacking as only 3 of the studies reported healthcare savings, and a single study reported costs anticipated to be incurred over an expanded lifetime. relapse rates were not controlled for in many studies (12 for short - term, and 18 for long - term). after standardization was complete, cost per lys ranged from $ 490 to $ 15 280 compared with $ 220 to $ 5050 for the original reported data. the incremental ce of counseling with follow - up compared with counseling alone was $ 5006000. when the included studies were adjusted with a discount rate, costs nearly doubled. despite the disparities between the data pre- and post - standardization dependence on tobacco is a chronic disorder, and relapse is extremely common (percival and milner 2002). it is estimated that there are 45.7 million former smokers in the us (centers for disease control and prevention 1999). the 1994 national health interview supplement provided data demonstrating that 46.4% of smokers had engaged in a serious attempt to quit during the previous year (cinciripini and mcclure 1998). despite that fact, successful quitters have typically engaged in at least 3 attempts prior to achieving abstinence, and many will unfortunately never succeed in achieving continued abstinence (curry and mcbride 1994 ; percival and milner 2002). the majority of patients who relapse will do so within 7 months of their quit date, and a full 70% will begin using tobacco again within the year (ockene 2000 ; brandon 2004). those who have engaged in formal treatment programs are more likely to remain former smokers than self - quitters who have an estimated 1-year relapse rate of 90%. the risk of relapse, though it does decrease over time, remains significant even after a year of abstinence. it has been estimated that over a 7-year period, 50% of successful quitters will begin to smoke again, meaning that these individuals will not experience the long - term benefits of cessation (godfrey 2005). of those patients that relapse, up to 38% will attempt to quit again within the following year (hughes 1992). rates of relapse have the potential to decrease the overall ce of smoking cessation interventions. it has been hypothesized that programs aimed at keeping former smokers from abusing tobacco again may prove more cost - effective than cessation interventions themselves (brandon 2004). follow - up serves to remind quitters why they stopped smoking in the first place, and contributes to continuing abstinence (jackson 2001). a study looking at the effect of a program on maintenance of smoking abstinence was published in 2004 (brandon and demichele 2004). mailings and booklets were mailed out to former smokers in varying combinations and at different frequencies. a 4% discount rate was employed. for the patients receiving the higher levels of contact, relapse rates were decreased (p<0.05). dividing the mean cost of the two most intensive interventions with the difference in abstinence rates at 24 months demonstrated that both were cost effective at $ 186 and $ 360 respectively. it was estimated that a permanent quit added an additional 2.25 qaly to the life of a successful abstainer. limitations of this study include the fact that smokers were only required to have 10 non - smoking weeks behind them when they enrolled, and the fact that the subjects were self - selected, meaning that they were probably motivated to maintain their non - smoking status. the provision of relapse prevention programs is therefore likely to be an extremely cost - effective endeavor since repeated use of cessation programs will in many cases be avoided. it has been demonstrated that the elimination of a co - pay (the amount an insured person is expected to pay out of pocket for medical services) can increase the rate of program utilization 3-fold, and that 1.5 times the number of smokers would quit if full coverage were available (curry and mcbride 1994). both the public health service (phs) and the preventive services task force recommend that benefits for smoking cessation be made available (department of health and human services 2005). it is further recommended that coverage should be available for a minimum of 2 quit attempts annually, and that co - pays should be minimal or eliminated completely. included in the benefits should be a minimum of 4 counseling sessions lasting at least 30 minutes, and prescription and over - the - counter medications (bupropion and nicotine replacement). the coverage for over the - counter products is especially important as some may believe that the availability of these medications to the public somehow relieves the government and insurers from their obligation to help with financial support. cutting out coverage of medications or decreasing the inventory of medications used in the treatment of smoking is sometimes done because smoking may be viewed as a self - inflicted behavioral health problem instead of as a true chronic addictive disorder with a high risk of relapse (jonk 2005). additionally, employers have been reluctant to pay for cessation aids as employee turnover negates the certainty that the employer will reap the benefits of the expenditure directly (warner 1996). despite the additional success associated with full coverage, a survey completed in 2002 found that managed care organizations (mcos) it has been hypothesized that there are several reasons for this lack of consistency in coverage. second, there is a limited vocal demand of such services by either patients or employers. third, similar to the dilemma that employers face with turnover, an mco may not realize the full benefits of an enrollee transitioning to former - smoker status as they may not stay with the same plan (curry 1998). results generated from the use of a computer simulation model to assess the effects of an mco either covering or not covering smoking cessation treatment was recently published (warner 2004). after discounting at the 3% rate, the mco expenditures were found to be $ 20.1 million at a cost per coverage - induced quitter of $ 6791, and a cost per lys of $ 3417. it was estimated that over a 30-year period, 19 881 smokers would successfully quit as a direct result of having coverage through the mco, and that the average gain in life - years would be 7.1. by spending money on cessation, studies have shown that smoking cessation programs are highly cost effective when compared with interventions in other areas. it has been estimated that if the uk s national health service covered the cost of nicotine patches for quitters, the average cost per lys would be 392 for those younger than age 55, and 785 for those older (stapleton 1999). this is less expensive than coverage for hip replacement, or screening programs for hyperlipidemia and breast cancer (the department of health 1990 ; ham 1995). the money spent per benefit user in one study for which patients had full benefit coverage for cessation ($ 328) is also less than that spent on hypertension treatment ($ 592) or heart disease ($ 6941) on an annual basis. this is especially important considering that treatment in these cases extends over the life of the patient (curry 1998). as smoking cessation is more cost - effective than other interventions which are typically covered by insurance, and because smoking contributes to a plethora of negative health - related outcomes that in turn lead to additional health care expenditures by payers, society, and employers alike, it seems particularly non - sensical that coverage for complete cessation programs is not universal. it is a logical conclusion that spending to help many smokers quit, though increasing expenditures in the short term, would result in a overall decrease in spending in multiple areas across the healthcare continuum. coverage for smoking cessation should be universal, and co - pays should be low if not eliminated. smoking cessation is the most preventable cause of copd, and in fact is the most preventable known cause of death (westmaas 2000). when examining studies measuring the ce of interventions, it is difficult to generalize the data. populations differ in terms of economics, education, and motivation, interventions are varied, and the inclusion of indirect and direct costs is inconsistent. outcomes are not expressed in a standardized manner. what has been consistently demonstrated throughout the literature, however, is that even modest rates of abstinence by program users can produce substantial gains in health, and may therefore prevent significant expenditures in healthcare over a lifetime. this is especially true when considering younger smokers who have not yet developed copd since smokers who quit by the age of 35 years have a life - expectancy no different that those who never abused tobacco (doll 1994). healthcare providers are not doing as much as can be done to help smokers quit. every year 50%70% of smokers visit either a dentist or a physician (hayward 1989 ; anonymous 1993). these practitioners consistently report low levels of smoking intervention behaviors (smith 2003). although brief opportunistic interventions have the most effect on smokers who use smaller numbers of cigarettes per day, the interaction is still important as that light smoker may transition to heavy smoking over time (west 2000). one study found that a maximum of 3 minutes of anti - smoking advice could increase quit rates by over 2% (westmaas 2000). smokers have consistently reported that advice from healthcare practitioners does help motivate them to attempt to stop. regardless of the methods employed, smoking cessation remains among the most cost - effective healthcare interventions. few interventions in fact have a lower cost per qaly saved (godfrey and fowler 2002). for this reason, coverage for cessation therapy should be universal, and programs should be in place for relapse prevention. comparing the financial burden that copd places on society to | the cost burden of copd is substantial for patients and families, payers, and society as a whole. smoking has been known for decades to be the leading cause of the disease. numerous studies have been completed to address the cost - effectiveness of programs created to aid smokers in their efforts to quit. because several assumptions must be made in order to conduct such a study, and because differences in study design are numerous, comparison of data is difficult. however, studies have consistently shown that regardless of the perspective from which the study was completed, or the methods used to help smokers abstain, the interventions are cost - effective. although no study has been conducted specifically to assess the cost - effectiveness of smoking cessation interventions as they relate directly to patients with copd, based on current data it can be concluded that smoking cessation programs are cost - effective for this population. |
the accurate duplication of the genome is critical to the survival of any organism. dna damage, such as that caused by uv irradiation, can disrupt the replication machinery and prevent it from completing its task [1, 2 ]. in escherichia coli, a number of the cellular events associated with the recovery of replication forks arrested by uv - induced lesions are known to involve several gene products in the recf pathway [35 ]. following replication arrest, the nascent lagging stand of dna is partially degraded through the coordinated activity of the recj nuclease and recq helicase. the extent of degradation is limited by recf - o - r, which facilitates loading and formation of a reca filament at the stalled fork. both biochemical and cellular studies suggest that recf, -o, and -r, together with reca, facilitate strand exchange or regression at the branch point of the arrested fork [6, 7 ]. cellular studies suggest that this processing restores the lesion - containing region to a double - stranded form, allowing nucleotide excision repair to access and repair the lesion [6, 8 ]. in the absence of either processing or repair, the recovery is delayed and elevated levels of rearrangements, mutagenesis, and lethality are observed [810 ]. a number of other gene products have also been postulated to participate in aspects of the recovery process but have yet to be examined in vivo. uvrd is a dna helicase that participates in both nucleotide excision repair and replication - associated processes. nucleotide excision repair is the process by which bulky adducts and lesions are removed and repaired from dna [11, 12 ]. during nucleotide excision repair (ner), a heterotetramer, uvra2uvrb2, recognizes and binds the damaged region [11, 13, 14 ]. uvrd acts after incision to release the resulting 10 to 12 bp oligonucleotide and uvrb - uvrc complex from the dna [1518 ]. the resultant gap is then filled in by dna polymerase i and sealed by dna ligase. during replication, uvrd function is required to displace the nascent dna strand during methyl - directed mismatch repair, a replication - coupled process that removes mispaired bases [20, 21 ]. it is required for replication of several rolling - circle plasmids and copurifies with dna polymerase iii holoenzyme under some conditions. conjugational and transformational recombination frequencies increase in uvrd mutants [24, 25 ] and decrease in strains overexpressing uvrd. in addition, uvrd mutants are constitutively induced for the sos response and show elevated levels of reca foci [27, 28 ]. the concept that uvrd may process replication forks following arrest comes from a number of genetic observations. uvrd mutants exhibit synthetic lethality with rep [29, 30 ], which encodes another 3-5 helicase that is required for the replication of phage x174 and some plasmids [31, 32 ] and is postulated to remove obstacles on the dna during replication such as bound proteins or transcriptional machinery [33, 34 ]. viability in uvrd rep double mutants can be restored by mutations in recf, reco, and recr, which are required to process and restore replication following arrest by dna damage [5, 6, 35 ]. subsequent studies found that purified uvrd was capable of displacing oligos and reca filaments from synthetic replication fork structures in vitro [36, 37 ]. these observations led some researchers to speculate that, in addition to its other roles, uvrd function may participate in displacement of the lagging strand and reca filament from arrested replication forks [37, 38 ]. however, the molecular function of uvrd at replication forks has not been directly examined in vivo. here we characterize the role of uvrd at the replication fork following arrest by uv - induced damage in vivo. however, the initial degradation, processing and regression of the arrested fork occur normally in the absence of uvrd. similar to other mutants deficient in nucleotide excision repair, the regressed fork structures fail to resolve in uvrd mutants and continue to accumulate and persist. these observations indicate that uvrd is not required to catalyze fork regression in vivo and support the idea that the hypersensitivity and failure to restore replication in the absence of uvrd are likely due to its role in nucleotide excision repair. all bacterial strains used in this study are in an sr108 background, a thya36 deoc2 derivative of w3110. sr108, cl579 (sr108 recf332::tn3), hl952 (sr108 uvra::tn10), hl1054 (hl108 uvrd::tetr), and hl944 (sr108 recq1803::tn3) have been described previously [4, 6, 8, 40 ]. the kanamycin resistance gene was amplified from tn5 using pcr primers 5cccaacctatttttacgcggcggtgccaatggacgtttct- atggacagcaagcgaaccg3 and 5aggccaaataaggtgcgcagcaccgcatc - cggcaacgttatcagaactcgtcaagaag3. the pcr product was then transformed into dy329 to generate cl1272, selecting for kanamycin resistance. the gene replacement was transferred into sr108 using standard p1 transduction to generate cl1302 (sr108 uvrd::kan). fresh overnight cultures were diluted 1 : 100 in dgcthy medium (davis medium supplemented with 0.4% glucose, 0.2% casamino acids, and 10 g / ml thymine) and grown to an od600 of between 0.4 and 0.5 at 37c in a shaking bath. serial dilutions of each culture were plated in triplicate on luria - bertania plates supplemented with 10 g / ml thymine and uv irradiated with the indicated doses. a sylvania 15 watt germicidal lamp (254 nm) delivering an incident dose of 0.9 j / m / s (0.2 j / m / s for doses less than 20 j / m) was used for all irradiations. fresh overnight cultures were diluted 1 : 100 in 50 ml dgcthy medium supplemented with 0.1 ci / ml [c]-thymine and grown to an od600 of 0.3 at 37c in a shaking water bath. half of each culture was mock - irradiated, and the other half was irradiated with an incident dose of 27 j / m. at the indicated times, duplicate 0.5 ml aliquots of each culture were pulse - labeled with 1 ci / ml [h]-thymidine for 2 min at 37c. the cells were then lysed and the dna precipitated using ice - cold 5% trichloroacetic acid (tca). the dna was filtered onto 2.4 cm fisherbrand glass fiber filters, and the amount of c and h was determined using a liquid scintillation counter. fresh overnight cultures were diluted 1 : 100 in 6 ml dgcthy medium supplemented with 0.1 ci / ml [c]-thymine and grown to an od600 of 0.3 in a shaking water bath at 37c. at this point, cultures were pulse - labeled for 5 s with 1 ci / ml [h]-thymidine, filtered onto a 0.45 micron millapore filter, and rinsed twice with 1x net buffer (100 mm nacl, 10 mm edta, ph 8.0, 10 mm tris, ph 8.0). the cells were then resuspended in 10 ml nonradioactive, prewarmed dgcthy media, uv - irradiated at an incident dose of 27 j / m, and incubated in a 37c shaking water bath. triplicate 0.2 ml samples were taken at time zero, followed by duplicate samples every 20 min for the duration of the experiment. these samples were added to 5% tca to lyse the cells and precipitate the dna. the dna was filtered onto 2.4 cm fisherbrand glass fiber filters, and the amount of radioactivity on each filter was measured using a liquid scintillation counter. cultures harboring the pbr322 plasmid were grown overnight in dgcthy medium in the presence of 100 g / ml ampicillin. one milliliter of this culture was pelleted, resuspended at a 1 : 100 ratio in 20 ml of dgcthy medium, and grown without ampicillin to an od600 of 0.5 at 37c in a shaking water bath. the cultures were then uv - irradiated with 50 j / m, and 0.75 ml aliquots were transferred to an equal volume of ice - cold 2x net (200 mm nacl, 20 mm edta ph 8.0, 20 mm tris, ph 8.0) at the times indicated. these samples were then pelleted, resuspended in 0.14 ml of lysis buffer (1.5 mg / ml lysozyme, 0.5 mg / ml rnase a in 10 mm tris, ph 8.0, 1 mm edta, ph 8.0), and incubated at 37c. after 30 min, 10 l of 20% sarkosyl and 10 l of 10 mg / ml proteinase k were added and the incubation was continued for 30 more min. the samples were then extracted twice with 4 volumes of phenol / chloroform / isoamyl alcohol (25 : 24 : 1) and extracted once with 4 volumes of chloroform / isoamyl alcohol (24 : 1). the samples were dialyzed against 200 ml of te buffer (2 mm tris, ph 8.0, 1 mm edta, ph 8.0) for 1 h on floating 37 mm whatman 0.05 m pore discs and digested with pvuii overnight at 37c. the samples were loaded onto 0.4% agarose gel following extraction with 2 volumes of chloroform / isoamyl alcohol (24 : 1) and run at 25 v for 16 hours in 1x tbe buffer (tris - borate - edta, ph 8.0). for the second dimension, the lanes were excised, rotated 90 degrees, recast in a 1% agarose gel in 1x tbe, and the gel was electrophoresed at 200 v for 7 h. the dna from the gels was transferred to a hybondn+ nylon membrane by standard southern blotting, and the plasmid dna was detected with an [-p]dctp (mp biomedicals) labeled pbr322 probe that was prepared using a nick translation protocol (roche). radioactivity was visualized and quantified using a storm 840 phosphoimager and imagequant software (ge lifesciences). we constructed a uvrd deletion, uvrd::kan and compared its uv resistance along with a previously characterized strain, uvrd::tet (parental strain hl 1054), with that of uvra and recf mutants (figure 1). uvra is required for the initial step of nucleotide excision repair and recf is required for processing and maintaining forks arrested by uv - induced damage. both uvrd mutations rendered cells more sensitive to uv irradiation than wild - type cells. consistent with previous studies, uvrd mutants are more sensitive than recf mutants but less sensitive than uvra mutants. the higher resistance of uvrd compared with uvra can be explained by its role in turnover of uvrc. uvrd mutants retain a limited ability to carry out nucleotide excision repair, and remain proficient in repairing 6 - 4 photoproducts, which are removed preferentially before cyclobutane pyrimidine dimers or lesions in transcribed genes. it is also important to note that recf mutants are able to withstand considerably more uv exposure than uvrd mutants. the recf protein is involved in the stabilization of disrupted replication forks, and, consequently, the susceptibility of recf mutants to uv damage is related to the frequency with which the replication machinery encounters a lesion. in the presence of nucleotide excision repair, the frequency of these events is substantially decreased. therefore, that the uvrd mutant is considerably more sensitive than the recf mutant would indicate that the uvrd protein still plays a substantial role in nucleotide excision repair. to determine if uvrd is required to resume dna replication following arrest by uv - induced damage, we monitored dna synthesis over time in uv - irradiated cultures of uvrd mutants. cultures grown in the presence of c - thymine were uv - irradiated or mock - irradiated and allowed to recover over a period of 90 min. the rate of synthesis was monitored by pulse - labeling aliquots of the culture with h - thymidine for two min at various times during the recovery period. in this manner, both the total dna accumulation (c - incorporation) and the rate of synthesis (h - incorporation/2 min) can be followed simultaneously. by this assay in wild - type cells, the rate of synthesis dropped over 90% immediately following uv - irradiation and then began to recover after approximately 20 min and approached preirradiation levels by the end of the 90 min time course. a transient pause in the accumulation of dna in the wild - type culture was also observed consistently at times prior to when replication resumed (figure 2). for the purposes of comparison, we also examined mutants lacking recf and uvra, which have been shown previously to be defective in the resumption of replication following arrest by uv damage. in these mutants, no further dna accumulation was observed following irradiation and the rate of synthesis did not recover (figure 2). when we examined uv - irradiated cultures of uvrd, we observed that the rate of dna synthesis was inhibited to a similar extent as in recf and uvra cultures after irradiation and also failed to recover (figure 2). the results indicate that uvrd is necessary for the resumption of replication following arrest by uv - induced damage. following the arrest of replication by uv - induced damage, the nascent dna at the replication fork is displaced and partially degraded prior to the resumption of replication. recent studies have postulated that uvrd may function in clearing and processing of blocked replication forks, which may account for its failure to restore dna synthesis [38, 44, 45 ]. alternatively, uvrd may function at forks blocked by uv damage specifically in a nucleotide excision repair capacity. to determine which roles of uvrd may be required in replication recovery following uv damage, we examined whether uvrd contributes to the displacement and degradation of the nascent dna at replication forks arrested by uv - induced damage. we reasoned that if the uvrd helicase were required to displace the nascent dna, then the degradation of the nascent dna at the arrested replication fork would be reduced in the protein 's absence. to monitor dna degradation, cultures grown in media containing c - thymine were pulse - labeled for 5 s with h - thymidine, collected on filters, resuspended in nonradioactive media, and immediately uv - irradiated. the amount of radioactivity remaining in the cultures the dual radio - labeling allows us to simultaneously monitor the degradation that occurs in the total genomic dna (c) and the nascent dna synthesized immediately prior to irradiation (h). following irradiation of wild - type cultures, the genomic dna primarily remained intact and little or no degradation was detected (figure 3). however, consistent with earlier studies, some limited degradation of the nascent dna was detected at early times following irradiation [4, 8 ]. the loss of h - labeled dna ceased at a time that correlated with the resumption of dna synthesis and then began to increase (figure 3). in principle, an increase in h should not be possible with this assay design. previous work has shown that this increase is most likely due to remaining intracellular pools of radio - labeled thymidine that could not be washed away. in the absence of recf, which is required to limit the degradation at blocked replication forks, the nascent dna degradation was more extensive and continued over a longer duration until approximately 50% of the nascent dna has been degraded (figure 3). in previous work this may explain why the degradation ceases after half of the nascent dna has been degraded. for the purposes of comparison, we also examined the degradation occurring in recq and uvra mutants. recq is a helicase that has been demonstrated to participate with recj to displace and degrade the nascent dna at replication forks blocked by uv - induced damage. in recq mutants, no degradation of the nascent dna was observed following irradiation and the remaining intracellular pools of h - labelled thymidine were rapidly incorporated (figure 3). uvra is required for the initial recognition step of nucleotide excision repair and is not thought to play any role in processing of the replication fork. following irradiation of uvra mutants, we observed that the nascent dna degradation still occurred, consistent with what has been reported previously (figure 3 and [4, 8 ]). when we examined uv - irradiated cultures of uvrd, we observed that degradation of the nascent dna occurred and was similar in extent to that seen in uvra mutants (figure 3). the data indicate that when replication is arrested by uv - induced damage, uvrd is not required for and does not contribute to the degradation of the nascent dna in vivo. to further differentiate between a potential role for uvrd in nucleotide excision repair and in processing replication forks, we compared the structural intermediates that are formed at replication forks following uv irradiation in uvrd mutants to uvra and recf mutants. previous work has shown that defects in nucleotide excision repair or replication fork regression lead to different structural intermediates following arrest. intermediates were visualized on replicating molecules of the pbr322 plasmid using a two - dimensional (2d) gel electrophoresis technique. replicating cells containing this plasmid were irradiated with 50 j / m, a dose that produces approximately one lesion per plasmid strand. cells were harvested at various times after irradiation, and the dna was purified and digested with pvuii, which linearizes the plasmid proximal to its unidirectional origin of replication. the replication intermediates were then examined using 2d agarose - gel electrophoresis and southern analysis with p - labeled pbr322 as a probe. in the absence of damage, nonreplicating plasmids migrate as a linear 4.5 kb fragment, which forms the prominent large spot on the blot (figure 4(a)). replicating molecules, which form y - shapes, migrate more slowly due to their increased size and nonlinear shape and appear as an arc extending out from the spot of linear plasmid fragments. following irradiation of wild - type cultures, a transient cone region is observed above the arc of replicating y - shaped molecules, consisting of x - shaped and double y - shaped molecules (figure 4). in previous work, we demonstrated that a portion of these molecules represent products that were formed by a recf - catalyzed regression of the replication fork dna [3, 6, 46 ]. these damage - induced intermediates begin to resolve after 30 min, at a time that correlates with the removal of lesions and the recovery of replication. in the absence of recf, the arrested fork dna is not maintained and these intermediate structures are not observed (figure 4). by contrast, in uvra mutants, the fork regression occurs normally but fails to resolve as the obstructing lesion is not removed from the dna. in these mutants, the regressed fork intermediate is seen to persist and accumulate, forming higher - order, illegitimate intermediates by the end of the 90 min time course (figures 4(b) and 4(c)). we reasoned that if uvrd was required to catalyze the regression of the fork dna at uv - induced lesions, then the cone region intermediates would be reduced or absent in these mutants following uv irradiation. however, when we examined uvrd mutants, we observed elevated levels of these intermediates that accumulated throughout the 90 min time course (figure 4). these intermediates went on to form the higher - order intermediates that are a hallmark of nucleotide excision repair - deficient mutants, consistent with the high levels of recombination and strand exchange seen in these mutants [9, 10].the presence of the fork regression products in uvrd mutants indicates that uvrd is not required to catalyze this reaction in vivo. further, the similarity between the intermediates seen in uvra and uvrd mutants would suggest that the failure of uvrd mutants to resume dna synthesis after uv irradiation is most likely due to their inability to carry out nucleotide excision repair. in addition to its role in nucleotide excision repair, uvrd has also been postulated to catalyze fork regression and the displacement of the nascent lagging strand during the recovery of replication after arrest [36, 44, 45 ]. here, we examined the functional roles for uvrd 's contribution to cell survival and the recovery of replication following arrest by uv - induced damage. we observed that both the nascent strand processing and regression of the fork dna occurs normally in the absence of uvrd. rather than diminished levels of regressed fork intermediates forming in uvrd mutants, we observed that elevated levels of these intermediates formed and accumulated, similar to that seen in other nucleotide excision repair mutants. the observations are most consistent with the idea that the failure to restore replication in uvrd mutants is due to its role in nucleotide excision repair. a role of uvrd in nucleotide excision repair, by itself, could sufficiently account for the hypersensitive and replication - defective phenotypes observed in uvrd mutants after uv irradiation. uvrd is required for the turnover of uvrc, which is not upregulated during the sos response. thus, only a limited amount of repair occurs in the absence of uvrd, which is generally restricted to the repair of 6,4-photoproducts. the minimal amount of nucleotide excision repair seen in uvrd mutants is consistent with it being modestly more resistant to uv damage than other repair mutants of this class. otherwise, with respect to the processing of the nascent dna, fork reversal, and impaired recovery of replication, uvrd mutants exhibit phenotypes nearly identical to those of other nucleotide excision repair mutants. the concept that uvrd may function in displacing the nascent dna and promote fork reversal following arrest developed from a number of indirect genetic observations. a series of previous studies observed that in recbc mutants, which are defective in double - strand break repair, elevated levels of chromosome breaks can be detected in thermosensitive replication mutants, dnae and dnan (the catalytic subunit of pol iii and the pol iii clamp, resp. [48, 49 ]) at the restrictive temperature [37, 44, 45 ]. if cells were additionally mutated in uvrd, the level of detectable chromosome breaks was reduced. the authors speculated that these chromosome breaks arose as a result of replication forks collapsing to generate double - strand breaks. however, the assays employed in these studies were unable to address where the breaks form in the chromosome, and other studies have suggested that breaks repaired by recbc do not form directly at the replication forks following arrest in vivo [4, 5, 50 ]. curiously, these studies also noted that a different uvrd mutant lacking both atpase and helicase activity failed to suppress chromosome breaks in these backgrounds. when considering the differences between the results obtained in these studies, it is also important to consider the mechanism by which replication is arrested in each case. whereas we used uv - induced damage to block the replication machinery, studies observing chromosomal breaks have often disrupted the replisome proteins themselves, using thermosensitive mutants. it seems probable that the biological events occurring after the loss of replication proteins would be distinct from those that occur when replication is blocked by impediments such as proteins or lesions, especially if one assumes that the replication proteins are required for the natural recovery process. consistent with this, previous work from our lab has demonstrated a marked difference between the events following replication arrest caused by uv - induced damage and disruption of the dnab helicase. whereas replication forks blocked by uv - induced lesions are protected and maintained by the recfor proteins, disruption or loss of dnab helicase results in the collapse and degradation of the replication fork, a process that is antagonized by recfor function. other genetic studies have inferred a role for uvrd in processing replication forks based on the synthetic lethality between rep and uvrd mutants [29, 35 ]. the rep helicase is suggested to play a role in removing nucleoproteins, dna secondary structures, or transcriptional machinery encountered by the replisome during replication [34, 52 ]. these observations have been interpreted to suggest that uvrd may be partially redundant with rep function in removing nucleoprotein impediments encountered during replication. however, both rep and uvrd are directly associated with replication processes and it is unclear whether the synthetic lethality of rep uvrd double mutants can be attributed to the inability to overcome transcriptional blocks to replication or as a result of other impediments. we have shown that when replication is blocked by uv - induced damage, it does not contribute to the displacement of the lagging strand or replication fork reversal but is required to carry out nucleotide excision repair before replication can resume. we do not rule out the possibility that uvrd contributes to fork processing when replication encounters other impediments, such as dna - bound proteins, rna polymerases, or even other forms of damage. it would be of interest to pursue these investigations in future studies as well as address how uvrd can generate chromosome breaks in the unusual case where replication proteins are targeted for disruption using thermosensitive mutants. | uvrd is a dna helicase that participates in nucleotide excision repair and several replication - associated processes, including methyl - directed mismatch repair and recombination. uvrd is capable of displacing oligonucleotides from synthetic forked dna structures in vitro and is essential for viability in the absence of rep, a helicase associated with processing replication forks. these observations have led others to propose that uvrd may promote fork regression and facilitate resetting of the replication fork following arrest. however, the molecular activity of uvrd at replication forks in vivo has not been directly examined. in this study, we characterized the role uvrd has in processing and restoring replication forks following arrest by uv - induced dna damage. we show that uvrd is required for dna synthesis to recover. however, in the absence of uvrd, the displacement and partial degradation of the nascent dna at the arrested fork occur normally. in addition, damage - induced replication intermediates persist and accumulate in uvrd mutants in a manner that is similar to that observed in other nucleotide excision repair mutants. these data indicate that, following arrest by dna damage, uvrd is not required to catalyze fork regression in vivo and suggest that the failure of uvrd mutants to restore dna synthesis following uv - induced arrest relates to its role in nucleotide excision repair. |
subacute sclerosing panencephalitis (sspe) is a progressive inflammatory and degenerative disease of central nervous system caused by persistent infection of immune - resistant measles virus. the average period between exposure and onset of sspe ranges between 7 and 12 years. the typical clinical course of sspe is characterized with intellectual deterioration, personality and behavioral changes, myoclonic jerks, and sometimes pyramidal and extrapyramidal symptoms. however, in about 10% of patients clinical manifestations of sspe are not typical and that may cause a delay in the diagnosis and treatment of the disease. here, we report a case of sspe presenting with atypical clinical signs as loss of consciousness and gait instability. we report this patient in order to emphasize the importance of serial electroencephalogram (eeg) in sspe diagnosis and to remind sspe with atypical course. a 14-year - old boy was referred to us with loss of consciousness and gait instability. there was fatigue and decreased consciousness for 2 days and loss of consciousness in the last 24 h. there was no fever and vomiting. he was confused and responding to verbal stimulus with nonspecific sounds and withdrawing in response to pain. serologies for epstein - barr virus, cytomegalovirus, herpes simplex virus, and mycoplasma were negative. the eeg showed irregular activity with generalized slow waves and cerebral magnetic resonance imaging (mri) showed asymmetrical nonspecific signals on basal ganglia [figure 1 ]. cerebrospinal fluid (csf) examination showed no cells, and normal protein (35 mg / dl) and glucose (68 mg / dl). axial t2-weighted and flair mri showed asymmetrical nonspecific signals on basal ganglia meningoencephalitis and acute disseminated encephalomyelitis (adem) were suspected with present clinical and laboratory findings and he was treated with intravenous acyclovir initially. also, intravenous immunoglobulin (ivig) 400 mg/ kg / d for 5 days were administered because of the cerebral mri findings which might be compatible with adem. his second eeg revealed periodical generalized high - voltage slow wave complexes discharges that did not disappear with diazepam induction so that sspe was considered. the diagnosis of sspe was suspected and csf total and measles igg index, and csf oligoclonal bands were detected. increased titers of measles antibody in serum (1/256) and csf (1/8) (normal : 1/4 or lower) were found by complement fixation test. these results confirmed the diagnosis of sspe, and treatment with isoprinosine (100 mg/ kg / day) was administered. he is in follow - up for 6 months without any abnormal clinical findings except minimal personality changes. the characteristic initial clinical signs of sspe are personality and behavioral changes and myoclonic jerks. sspe can also present with unusual features like generalized convulsions, loss of consciousness, acute - subacute coma, visual loss, ataxia, and hemiparesis. to date, in the literature many cases of sspe have been reported with atypical features.[35 ] the patient described here manifested atypical clinical findings and initially the diagnosis of sspe was not considered. unlike previously reported cases with fulminant presentation, we could achieve remission in our patient with ivig and isoprinosine. periodical high - amplitude slow wave complexes which can not be suppressed with diazepam is a characteristic eeg sign of sspe. although periodical complexes are usually generalized and may be detected at the onset of the disease, they may rarely be focal and unilateral. reported that a 14-month - old girl was admitted with hemiparesis and focal convulsion, and they confirmed the sspe diagnosis only after a long - term follow- up and periodical high - amplitude slow wave complexes detected on serial eegs. similarly, our patient was admitted with atypical clinical presentation and eeg findings were normal at the onset but there were periodical generalized high - voltage slow wave complexes that can not be suppressed with diazepam on 7 day eeg. so we suspected sspe, and high serum and csf measles antibody titers confirmed the diagnosis. that is why when a patient with a primary measles infection in history admitted with atypical clinical signs did not respond to treatment, and eeg should be evaluated carefully. serial eegs and lumbar puncture for csf measles antibodies should be considered to rule out sspe. mri is the best radiological imaging method for sspe. generally, mri is normal at the onset of the disease. cerebral atrophy and ventricular enlargement may also be seen on mri, but none of these findings are specific for sspe. reported that in some of the patients despite severe clinical course, mri are normal. so that they concluded that there is no correlation between mri and clinical course. the reported patients were managed as adem because of the periventricular white matter involvement in cerebral mri. reported that basal ganglia involvement is not infrequent in sspe. on admission, cerebral mr t2a and flair images of our patient showed nonspecific hyperintense asymmetrical lesions on basal ganglia. ivig, alfa interferon, ribavirin, steroids, and plasmapheresis have also been reported to be effective in sspe treatment. these drugs can not supply cure, they only slow the disease progression or prolong survival. prashanth and gurer reported that temporary remission could be rarely seen with isoprinosine and ivig in patients with sspe. he is in follow - up for 6 months without any abnormal clinical signs and symptoms except minimal personality changes. also, we think that our patient is in temporary remission. as a result, sspe is still an important medical problem in the developing countries. so sspe should be considered when a patient with measles history is admitted because of atypical clinical features like loss of consciousness, acute partial - generalized convulsion, acute - subacute coma, visual loss, ataxia, and hemiparesis. eeg of these patients should be evaluated carefully and serial eegs with diazepam should be performed in sspe - suspected cases. despite these surveys if sspe can not be ruled out, serum and csf measles antibodies should be examined. | we report a 14-year - old boy who presented with loss of consciousness and gait instability. the electroencephalogram (eeg) showed generalized slowing with irregular activity and cerebral magnetic imaging revealed asymmetrical nonspecific signals on basal ganglia. his second electroencephalogram revealed periodical generalized high - voltage slow wave complexes which did not disappear with diazepam induction. subacute sclerosing panencephalitis (sspe) was considered and the diagnosis was confirmed with the identification of measles antibodies in cerebrospinal fluid. our findings show that sspe should be in mind in the differential diagnosis of meningoencephalitis and acute disseminated encephalomyelitis and highlight the significance of eeg in the diagnosis of unidentified cases. |
children s oncology group (cog) member institutions care for the majority of infants, children, and adolescents with acute lymphoblastic leukemia in north america and oceania. work by the legacy children s cancer group (ccg), dating back more than 40 years, serves as the foundation for many current cog trials. studies prior to 1983 built on the pioneering work of donald pinkel and his colleagues at st. jude children s research hospital,(1) and introduced berlin frankfurt mnster (bfm)-based post induction intensification (protocol ib or consolidation and protocol ii or delayed intensification (di),(2) and a widely - used age - based dosing schedule for it (it) therapy.(3) the prognostic significance of early marrow response, assessed by marrow blast percentage 7 and 14 days into induction, was defined. (4) event - free survival (efs) improved with vincristine and prednisone pulses as the sole post - induction intensification and extended maintenance it methotrexate replaced pre - symptomatic whole brain irradiation for lowest risk patients.(5) thirteen trials, conducted from 1983 through 1995 were summarized in the december 2000 issue of leukemia. (6) two 19831988 studies (100 series), namely, ccg-106 (7) and ccg-123, (8) proved the advantage of early bfm - based strategies, prior to the introduction of bfm protocol m or methotrexate 5 g / m, over previous ccg efforts for higher risk (hr) children. a third study, ccg-105, showed that more effective systemic therapy and extended it methotrexate could spare all cns negative standard risk (sr) children from whole brain irradiation and proved the value of post induction intensification.(9, 10) induction anthracycline, higher dose induction prednisone, and intensive consolidation added no further benefit for standard risk patients receiving di and vincristine - prednisone pulses in maintenance. the 19891995 studies (1800 series) further restricted whole brain irradiation (11) and showed the value of longer and stronger post - induction intensification, the so - called augmented bfm regimen for hr patients (12) and dexamethasone for sr patients. (13) patients received monthly vincristine and prednisone or dexamethasone pulses through maintenance in all of these trials, unlike contemporary bfm practice. this report provides further follow - up on past 19831995 studies, and adds 4 additional trials and 3482 additional patients from 19962002 (1900 series). replacement of 6-mercaptopurine (6mp) with 6-thioguanine (6tg) provided an efs advantage but with unacceptable liver toxicity for sr patients on ccg-1952.(14) it triple therapy, i.e., cytarabine, methotrexate, and hydrocortisone, halved cns relapse rates compared to it methotrexate alone but allowed excess marrow and testes relapses on a methotrexate - poor platform, resulting in an inferior survival.(15) ccg-1962 showed that pegylated asparaginase safely and effectively replaced native asparaginase.(16) ccg-1961 explored the components of the augmented bfm regimen for higher risk patients with a rapid day 7 response and showed the advantage for stronger, not longer post induction intensification.(17) this report excludes the final ccg trial, ccg-1991, which completed accrual only in 2005.(18, 19) the clinical trials evaluation panel of the national cancer institute of the united states approved all protocols. details of all studies have been published. between 1983 and 2002, 13,298 infants, children, and adolescents, age 25% marrow blasts on day 7 of induction (slow early responders, ser) were initially treated on a pilot study of longer and stronger post induction intensification, the augmented bfm regimen. after an initial cohort demonstrated the safety of this regimen, ser patients were randomly allocated to our standard ccg - modified bfm regimen or to the augmented bfm regimen.(12) infants 25% on day 14 of induction received the augmented bfm regimen after induction. patients were randomized to receive native (21 doses) or pegylated (3 doses) asparaginase. (16) on ccg-1961, hr rer patients were randomly assigned to receive standard or longer duration and standard or stronger intensity post induction intensification. hr ser patients received the augmented bfm regimen and were randomly assigned to either weekly doxorubicin or sequential idarubicin / cyclophosphamide in each of two di phases. (17) at the start of the study, b - precursor ser patients were randomly assigned to receive or not to receive b43-pap, an anti - cd19 pokeweed antiviral protein immunotoxin. however, the manufacturer withdrew the drug from study. (29) infants, 5% and older children, age 10 years, with presenting wbc 200,000/l were also eligible. (35) on the ccg-1900 series (19962002), patients with t(4;11), t(9;22), hypodiploidy 50 chromosomes) patients went from 35% and 80% to 54% and 83%, respectively, over the same time periods. as the mix of infants and higher and lower risk patients differed over time, figures 13 display efs by study series for sr and hr b - precursor, t - cell, and infants, respectively, in order to facilitate cross series comparisons. the efs and os improved significantly overtime for sr b - precursor patients (p 10) went from 18.9% to 14.3%. (47) following this, all cog all trials now use pegylated rather than native asparaginase, thus sparing children unneeded intramuscular injections. (48) freyer examined survival after relapse for hr patients on ccg-1961 randomized to more or less effective post induction intensification. (49) contrary to intuition but in agreement with other observations excluding intravenous 6mp, post relapse survival was identical for patients relapsing from more and less effective regimens. as relapse rates decrease over time with improved therapy, remission deaths become larger contributors to overall death rates. 34% for hr studies, with adolescent patients being at higher risk. among patients older than 15 years, remission deaths comprise 25% of adverse events.(50) remission deaths after 5 years may be increasing as more patients receive hematopoietic stem cell transplant in first remission. bhatia comment that about 16% of all patients alive and in remission at two years after allogeneic bone marrow will expire in the next 8 years.(51) transplantation accounts for the increased remission death rate among adolescents and young adults treated according to adult versus pediatric protocols.(52) unfortunately, improvements in therapy have been accompanied by increases in toxicity. the most striking has been the increase in avascular necrosis of bone (avn), which was rarely recognized in patients diagnosed before 1986, but became more common, especially in adolescents and young adults, with the ccg 1800 era trials.(53,54) this complication can lead to significant life - long morbidity with many patients requiring joint replacement surgery during adolescence or early adulthood. altered dosing of dexamethasone during di, i.e., days 17 and days 1521, rather than days 121, (55) provide some decrease in the incidence but excessive avn led to a suspension of the randomization to induction dexamethasone for adolescents on aall0232.(56) screening for exceedingly rare anthracycline cardiotoxicity is standard while screening for avn in older populations with a risk that exceeds 10% has not been adapted. while identification of lesions prior to collapse seems desirable (57), the significance of early mri findings remains in doubt.(58) another lesson learned from these twenty years of trials is the need for adequate sample size to answer critical questions. statistical power depends on the magnitude of the impact of an intervention and the number of captured events not patients. as trial planning is based on prior data and outcomes tend to improve over time, baseline event rates are often overestimated. if the trials had been designed to detect a 50% or greater reduction in risk of failure, effective interventions, such as dexamethasone for sr all, or augmented bfm for hr all, may have been missed. marginal sample size limits opportunity for exploration of potential interactions and generation of novel hypotheses that will support future trials. sample size estimates should be based on most recent event rates and moderate treatment impact. with improved outcomes, a geometrically increasing number of patients must be treated to prevent one event (number needed to treat). when efs went from 40% to 60% on ccg-106, (7) a one - third reduction in failures, only five patients had to be exposed to a novel therapy to benefit one patient. for example, increasing efs from 88% to 92%, a one third reduction in failure, requires that 25 patients receive the experimental intervention to benefit one patient. on ccg 1991, (19) increasing efs through better primary treatment can obviate the need for salvage treatment of prevented relapses, usually morbid and too often ineffective, and provide a net decrease in the use of medical services. (59) for the future, better ascertainment of patients at higher and lower risk of relapse is critical, and new therapies must be developed that are targeted at the molecular abnormalities that cause leukemia and/or treatment failure. most cooperative treatment groups have incorporated minimal residual disease (mrd) testing to identify patients at higher or lower risk of relapse. patients with an mrd burden greater than 0.01% at end induction have an increased risk of relapse. however in contemporary cog trials, half of relapses still arise among patients with end - induction mrd < 0.01%. (60) adding a second mrd time point earlier (60) or later (61) in therapy can help to refine mrd - based risk assessment. minimal residual disease is prognostic in t - cell as well as b - precursor leukemia. (62) the newer genomic technologies including gene expression profiles (63) and arrays to detect genomic copy number alterations (64) may lead to better insight into the molecular basis of leukemogenesis (65) and identify new potential therapeutic targets like jak2. (66) the roles of pharmacogenomics (67) and patient / family treatment adherence (68) are under study. in philadelphia chromosome positive chronic myelogenous leukemia(69) and all (70) (70) understanding the mechanism(s) of imatinib resistance has led to novel, effective treatments. (71) one might reasonably hope that understanding of the mechanism(s) of treatment failure in childhood all holds similar promise. over the past 40 years, cure of this once incurable disease has become commonplace. with deeper insight into leukemia biology | the children s cancer group enrolled 13,298 young people age < 21 years on one of 16 protocols between 1983 and 2002. outcomes were examined in three time periods, 19831988, 19891995, 19962002. over the three intervals, 10-year event - free survival (efs) for rome / nci standard risk and higher risk b - precursor patients was 68% and 58%, 77% and 63%, and 78% and 67%, respectively ; while for standard risk and higher risk t - cell patients, efs was 65% and 56%, 78% and 68%, and 70% and 72%, respectively. five - year efs for infants was 36%, 38%, and 43%, respectively. seminal randomized studies led to a number of important findings. stronger post induction intensification improved outcome for both standard and higher risk patients. with improved systemic therapy, additional it methotrexate effectively replaced cranial radiation. for standard risk patients receiving three - drug induction, iso - toxic substitution of dexamethasone for prednisone improved efs. pegylated asparaginase safely and effectively replaced native asparaginase. thus, rational therapy modifications yielded better outcomes for both standard and higher risk patients. these trials provide the platforms for current children s oncology group trials. |
to describe the anatomy and coronal alignment of the leg, a number of descriptive terms are used. the anatomical axis of each bone refers to a line drawn along the centre of the intramedullary canal. the mechanical axis of the femur refers to a line drawn from the centre of the femoral head to the centre of the knee. for the tibia, the mechanical axis refers to a line between the centre of the knee and the centre of the ankle. the anatomical and mechanical axes of the femur form an angle of approximately 6, while the two axes of the tibia are usually equivalent (fig. right leg demonstrates mechanical axis (white line) and anatomical axis (purple line) of the femur. the anatomical and mechanical axes of the tibia are usually the same (red line). on the left leg, maquet s line passes through the medial compartment of the knee, indicating varus alignment. the global mechanical axis, sometimes referred to as maquet s line, describes a line drawn from the centre of the femoral head to the centre of the talus (fig. normally, this line passes through the centre of the knee. the anatomical femorotibial angle (afta) describes the angle between the anatomical axes of the femur and tibia, and is usually about 6 of valgus. the mechanical femorotibial angle (mfta), formed by the mechanical axes of the two bones, is usually 0 or neutral, although variation exists in nature. this is sometimes referred to as the hip - knee - ankle angle (hka). variance in limb rotation and knee flexion may have significant impact on the observed angles. in a valgus knee model with a true afta of 18, swanson measured a change of almost 7 in the apparent afta with 20 of internal and external rotation. in general, the closer an extra - articular deformity to the knee, the greater is its importance. in 1977, lotke and ecker first examined the correlation between implant positioning and functional outcome in 70 tkas. they noted a significant correlation between good clinical results and good alignment. in four of their five failures, denham and bishop, in a 1978 study of biomechanics in relation to knee reconstruction, defined optimal positioning to be 7 4 of anatomical valgus for the femoral component and 90 4 to the anatomical axis for the tibia, to ensure the weight - bearing line passed through the centre of the joint. hvid and nielsen reported an increased incidence of radiolucent lines at two years surrounding tibial components implanted with > 4 tilt in any direction, with the interesting exception of varus angulation in osteoarthritic knees. in an important 1991 study, jeffrey published the results of 115 early denham knee arthroplasties, with a median follow - up of eight years. using long - leg radiographs to assess coronal plane alignment, they found a significant difference in the rate of loosening between those aligned within 3 of the mechanical axis maquet s line (3% loosening), and those outside these limits (27% loosening ; p = 0.001). these studies are summarised in table i. summary of early studies supporting neutral mechanical alignment interestingly, not all studies from this period supported a neutral mechanical axis. bargren reported a failure rate of 2.3% for the freeman swanson (iclh) knee when aligned between 1 to 5 of anatomical valgus (1 to 5 varus mechanical alignment), against an overall failure rate of 27%. in the last few years, several reports have been highlighted challenging the superiority of neutral mechanical alignment. summary of studies challenging the aim of neutral alignment notes : kss, knee society score ; womac, western ontario and mcmaster university osteoarthritis index ; iks, international knee society score ; sf-36, short form-36 ; adl, activities of daily living. regarding survival, in 2007 morgan reviewed the outcomes of 197 kinemax tkas at a mean of nine years post - operatively, and found no difference in revision rate between those in neutral, varus or valgus alignment. in a larger study, parratte published a retrospective review of 398 cemented primary knee arthroplasties performed at the mayo clinic using three modern prostheses. 3. they found no difference in survivorship at 15 years between the well - aligned and outlier groups, and concluded that describing alignment as a dichotomous variable was of little value for predicting durability. in a similar study of 501 tkas using a single prosthesis, bonner and co - workers found a weak trend towards a higher revision rate in those outside the 0 3 range ; however, this fell short of statistical significance (p = 0.47). they concluded that the relationship between mechanical alignment and survival for primary tka is weaker than previously reported. with regards to function, two medium - term studies have suggested that functional outcome is not adversely affected by residual post - operative varus alignment. from a series of 218 primary tkas, matziolis and colleagues compared the results of the 30 knees with the greatest post - operative varus alignment, to neutrally aligned, matched controls. the varus group had a mean post - operative mechanical axis deviation of 6.3 (3.9 to 10.7). there was no difference in functional results using multiple validated measures, and no revisions in either group at a minimum five - year follow - up. magnussen and colleagues, from the centre albert trillat in lyon, examined the results of 553 tkas for varus osteoarthritis, comparing those with neutral post - operative mechanical alignment (0 3) and those with residual varus alignment > they found no difference in knee society score (kss) or revision rate between the two groups, provided the residual varus was femoral in origin. one recent study has found superior functional results for tkas with mild residual varus. in a study of 143 consecutive tkas for varus osteoarthritis, vanlommel observed that the 46 knees with residual varus of 4 to 7 (ftma 174 to 177) demonstrated significantly better kss and western ontario and mcmaster university osteoarthritis index (womac) scores than the neutral and significant varus groups at a mean of 7.2 years. a number of criticisms have been made of early studies showing decreased survivorship with non - alignment of the mechanical axis. most used only short - leg radiographs for assessment and involved early prosthesis designs no longer in use today. polyethylene quality was inferior, and the sterilisation methods employed are now known to cause material property degradation. most data comes from studies into navigation in tka, examining short- to medium - term results. a systematic review in 2012 concluded that there was improved coronal plane alignment but no functional improvement with navigation ; however, a recent meta - analysis did find improved function in the navigation group. recently, bellemans and co - workers have introduced the concept of constitutional varus, suggesting a neutral mechanical axis may be abnormal and even undesirable for many patients. in their study, 32% of men and 17% of women had a natural mechanical alignment 3 of varus. similarly, others have explored the cylindrical axis of the knee and the concept of kinematic alignment. kinematic alignment is based on the finding that the true axis about which knee flexion and extension occur is not perpendicular to the mechanical axis, and places the femoral and tibial components accordingly to recreate this anatomical axis. howell and co - workers reported equivalent or slightly better womac and oxford knee scores (oks) for varus and valgus outlier groups in 198 kinematically - aligned tkas, although this did not reach significance. a more recent study of 219 consecutive, kinematically - aligned tkas from the same author reported a comparable revision rate to registry data for the same prosthesis at six years, regardless of tibial component varus or overall limb alignment. there were three revisions reported, including one for tibial component loosening, with two further revisions pending for patellar component loosening. dossett, in a randomised control trial, evaluated the short - term outcomes of 41 kinematically- and 41 mechanically - aligned tkas. while the overall limb alignment was similar, the kinematic alignment group had 2.3 more tibial component varus and 2.4 more femoral component valgus. kss, womac and oks were superior in the kinematically - aligned group. while there were no catastrophic early failures in these studies, the long - term survival of kinematically - aligned tkas is unknown. ishikawa, in a recent computer simulator and finite element analysis, found near - normal knee kinematics in kinematically - aligned tkas ; however, both patellofemoral and tibiofemoral peak contact stresses were increased by as much as 200% and 270% respectively in the kinematically - aligned model. furthermore, the accuracy of the patient - specific instrumentation systems typically required to achieve kinematic alignment are still being investigated and may be inferior to traditional or navigated systems. contrary to these results, a number of authors have reported inferior results associated with tibial component varus. berend and colleagues, in a study of a cohort of 3152 knees with a mean five - year follow - up, found tibial component varus > 3 to significantly increase the odds of failure (hazard ratio 17.2, p 8 of anatomical valgus, and when one component was implanted to correct for malalignment of the other component, despite resulting in neutral global limb alignment. there was no difference in survivorship between those with neutral tibial component and neutral overall alignment and those with neutral tibial alignment and overall varus limb alignment (< 2.5), suggesting some residual varus global alignment in itself does not compromise results. karachalios found residual deformity to be much more common in valgus knees and associated with significantly inferior clinical results using the bristol knee score. fang reported a revision rate of 1.5% for those with post - operative valgus alignment compared with 0.5% for those in neutral alignment, noting that those with residual valgus tended to fail from ligament instability. koskinen, in a study of 48 valgus knees implanted with cruciate - retaining prostheses, found residual valgus deformity to significantly increase the risk of revision with an odds ratio of 2 (95% confidence interval 1 to 3, p = 0.025). eight of the 14 revisions were for progressive medial collateral ligament (mcl) instability. consistent with these clinical reports, bryant and coworkers, in a recent cadaveric study, found valgus loading of a tka to significantly increase lateral tibio - femoral contact pressures and mcl strain. as noted by tew and waugh in 1985, while coronal alignment is certainly a factor in the outcome of tka, it may not be the most important factor and may serve to compound failure from other causes. other technical factors, such as sagittal and rotational alignment, joint line restoration, and soft - tissue balance all influence the final outcome. recent work on kinematic alignment would suggest that the ideal alignments for patient function and prosthesis longevity may in fact be different. if so, advances in materials technology may allow for implant survival in a more functional but non - optimal mechanical environment. while mild residual global varus deformity may not negatively impact outcomes, survivorship may be negatively affected by varus of the tibial component. this research received no specific grant from any funding agency in the public, commercial, or not - for - profit sectors. | recent studies have challenged the long - held notion that neutral mechanical alignment after total knee arthroplasty leads to optimal function and survivorship.the ideal alignment for function and survivorship may actually be different.kinematic alignment, where components are implanted to re - create the natural flexion / extension axis of the knee, may lead to improved functional results.residual varus alignment may not adversely impact survivorship provided the tibial component is implanted in neutral alignment.cite this article : lording t, lustig s, neyret p. coronal alignment after total knee arthroplasty. efort open rev 2016;1:12 - 17. doi : 10.1302/2058 - 5241.1.000002. |
there are many reasons why researchers choose to publish the results of their research but one of the most important is to contribute to the advancement of medicine and science. when research involves human subjects, sharing results is more than a personal choice, it is an ethical obligation (1). publishing results ensures that patient care is based on good science and that the field of medicine advances according to accurate knowledge. it is also part of the commitment researchers make to research subjects. according to prominent bioethicists, the risks of clinical research are only justified if society gains knowledge, which is only possible when results are shared (2). although these principles are widely accepted, a substantial amount of human research continues to go unreported and unpublished. this article explores researchers ' ethical obligation to report the results of research involving human subjects and discusses current challenges and solutions. an important starting point for this discussion is a brief review of the declaration of helsinki. the declaration of helsinki is a set of international ethical principles regarding the conduct of human research. it was initially published in 1964 and has been amended 7 times, the most recent revision occurring in 2013 (3). it is a cornerstone document in the field of human research ethics and has been referred to as " the most widely accepted guidance worldwide on medical research involving human participants"(4). many medical journals, including the journal of korean medical science, refer to the declaration in their requirements for publication (5, 6). the declaration includes a section on the ethical requirement of registering, publishing and disseminating research results (1). the section addresses two main requirements : 1) that research involving human subjects must be registered in a publicly accessible database and 2) that there is an ethical obligation regarding publication and dissemination of research results. the declaration specifically states that, " researchers, authors, sponsors, editors and publishers all have ethical obligations with regard to the publication and dissemination of the results of research " (1). it goes on to clarify that negative, inconclusive and positive results all must be published or made publicly available (1). although publication of research results is a widely accepted component of ethical research, in actual practice it is often neglected or substantially delayed (7). for example, one study found that only 46% of us nih - funded trials were published in a peer - reviewed, medline - indexed journal within 30 months of completion (8). a similar finding was discovered of vaccine trials conducted in multiple countries. (9) found that " the proportion of trials published 12, 24, 36, and 48 months after completion was 12%, 29%, 53%, and 73%, respectively " (9). similarly, a study at a university in germany found that only half of the studies approved by the ethics committee at the institution resulted in subsequent publication (10). non - publication of results wastes resources and denies the field of medicine the opportunity to learn from the outcomes. multiple studies have found that trials with negative results are published significantly less often and significantly less quickly than trials with positive results (11, 12). an analysis in the field of psychiatry compared published literature against us fda reviews of research involving antidepressant agents. based on the published literature it appeared that 94% of studies were positive but the fda analysis indicated that only 51% were positive (13). this discrepancy was because most of the negative results were not published or were published in a way that conveyed a positive outcome. the authors of the analysis concluded that the actual efficacy of the antidepressant drug class is less than would be expected based on published literature alone (13). for example, one study conducted at a hospital in spain followed the publication outcomes of all drug - evaluating clinical trials approved by the ethics committee of the institution. the study found that trials with positive results were published significantly more often and significantly more quickly than trials with negative results (11). additionally, a study that included manuscripts from multiple countries, including the republic of korea, found that the number of articles reporting positive results increased by over 20% during the years of 1990 through 2007 and that corresponding authors in asian countries reported more positive results than those in the us and europe (14). the higher publication of positive results is a responsibility not only to researchers or authors but also to editors and reviewers. some editors and reviewers devalue negative results or inconclusive findings and automatically reject the manuscript. since human subject studies frequently produce negative or inconclusive results, the negative attitude of some editors and reviewers may be a barrier to publication. the icmje recommends that editors make editorial decisions based on factors such as the manuscript 's overall quality and relevance to the journal, and not on the conclusiveness of the results (15). the international committee of medical journal editors (icmje) reminds editors that negative and inconclusive results can make an important contribution to science and that findings that are not statistically significant may provide important data for a subsequent meta - analysis (15). the declaration of helsinki and the icmje both require registration of clinical trials in a publicly accessible database before patient enrollment (1, 16). this means that all journals that follow icmje guidance, including jkms, only publish manuscripts on trials that were properly registered. clinical trial registration is important because it improves transparency, helps to reduce research duplication, contributes to the scientific evidence base and circumvents the issues of publication bias and selective reporting (17). studies suggest that data in registries may also be more complete than what is published in medical literature. for example, the us registry [clinicaltrials.gov ] requires results reporting and one study found that the results in the registry, especially serious adverse events, were more complete than the results in published articles (18). however, the strength of registries depends on researchers ' submission of timely and accurate data and evidence suggests that concerning gaps still exist (19). although publication of research results is a widely accepted component of ethical research, in actual practice it is often neglected or substantially delayed (7). for example, one study found that only 46% of us nih - funded trials were published in a peer - reviewed, medline - indexed journal within 30 months of completion (8). a similar finding was discovered of vaccine trials conducted in multiple countries. (9) found that " the proportion of trials published 12, 24, 36, and 48 months after completion was 12%, 29%, 53%, and 73%, respectively " (9). similarly, a study at a university in germany found that only half of the studies approved by the ethics committee at the institution resulted in subsequent publication (10). non - publication of results wastes resources and denies the field of medicine the opportunity to learn from the outcomes. multiple studies have found that trials with negative results are published significantly less often and significantly less quickly than trials with positive results (11, 12). an analysis in the field of psychiatry compared published literature against us fda reviews of research involving antidepressant agents. based on the published literature it appeared that 94% of studies were positive but the fda analysis indicated that only 51% were positive (13). this discrepancy was because most of the negative results were not published or were published in a way that conveyed a positive outcome. the authors of the analysis concluded that the actual efficacy of the antidepressant drug class is less than would be expected based on published literature alone (13). for example, one study conducted at a hospital in spain followed the publication outcomes of all drug - evaluating clinical trials approved by the ethics committee of the institution. the study found that trials with positive results were published significantly more often and significantly more quickly than trials with negative results (11). additionally, a study that included manuscripts from multiple countries, including the republic of korea, found that the number of articles reporting positive results increased by over 20% during the years of 1990 through 2007 and that corresponding authors in asian countries reported more positive results than those in the us and europe (14). the higher publication of positive results is a responsibility not only to researchers or authors but also to editors and reviewers. some editors and reviewers devalue negative results or inconclusive findings and automatically reject the manuscript. since human subject studies frequently produce negative or inconclusive results, the negative attitude of some editors and reviewers may be a barrier to publication. the icmje recommends that editors make editorial decisions based on factors such as the manuscript 's overall quality and relevance to the journal, and not on the conclusiveness of the results (15). the international committee of medical journal editors (icmje) reminds editors that negative and inconclusive results can make an important contribution to science and that findings that are not statistically significant may provide important data for a subsequent meta - analysis (15). the declaration of helsinki and the icmje both require registration of clinical trials in a publicly accessible database before patient enrollment (1, 16). this means that all journals that follow icmje guidance, including jkms, only publish manuscripts on trials that were properly registered. clinical trial registration is important because it improves transparency, helps to reduce research duplication, contributes to the scientific evidence base and circumvents the issues of publication bias and selective reporting (17). studies suggest that data in registries may also be more complete than what is published in medical literature. for example, the us registry [clinicaltrials.gov ] requires results reporting and one study found that the results in the registry, especially serious adverse events, were more complete than the results in published articles (18). however, the strength of registries depends on researchers ' submission of timely and accurate data and evidence suggests that concerning gaps still exist (19). researchers in korea should remain committed to publishing the results of all human research they conduct. jkms is an ideal choice for publishing because it is committed to publishing high - quality research regardless if the results are positive, negative, or inconclusive. other journals also provide good publication options for manuscripts that may otherwise be hard to publish. for example, several journals have launched sections focused on publishing negative results and a few journals exclusively publish negative or inconclusive results (20,21,22,23). this is not only a sound decision from an ethical and scientific standpoint, but may also benefit both the author and the publisher. one of the aforementioned studies determined that even though positive results were published more often and more quickly than negative results, the impact factor between the two groups was not significantly different (11). researchers in korea should also abide by all trial registration requirements that govern the research they conduct. the online registration system for clinical trials conducted in the republic of korea is the clinical research information service (cris). cris is a primary register of the who international clinical trials registry platform (ictrp) and was established at the korea centers for disease control and prevention (kcdc) with support from the ministry of health and welfare (mohw) (24). however, the reporting requirements may be updated in the future based on the who 's current evaluation of ictrp 's policy on results reporting (25). all individuals involved in conducting or publishing human research have an ethical obligation to disseminate results regardless of the conclusiveness. to meet this commitment, researchers should register their trials in a publicly accessible database and disseminate their findings through publication or other public mechanisms. editors and reviewers should make editorial decisions based on manuscripts ' overall quality and relevance to the journal and not the conclusiveness of the results. editors should also only publish papers regarding clinical trials that were properly registered. disseminating research results this paper aimed to inform, review current gaps, and discuss solutions regarding this ethical obligation. | researchers have an ethical responsibility to report the results of research involving human subjects. dissemination of results ensures that patient care is based on good science and that the field of medicine advances based on complete and accurate knowledge. however, current evidence suggests that publication is often neglected or substantially delayed, especially in the case of negative and inconclusive results. researchers, editors and reviewers should value all high - quality research regardless of the conclusiveness of the results and ensure that all research involving human subjects is registered in a publicly accessible database. |
idiopathic thrombocytopenic purpura (itp) is an autoimmune disorder with a low platelet count characterized by premature platelet destruction and suppression of platelet production mediated by autoantibodies, which may predispose to bleeding.1) since severe bleeding is uncommon when the platelet count exceeds 30000/ul, treatment is usually indicated when a platelet count is less.2) considering the crucial role of platelets in thrombotic events, the prevalence of coronary artery disease (cad) in patients with itp seems to be uncommon, especially when the platelet count is low. patients with itp have increased risks for thrombosis and atherosclerosis associated with larger and more adhesive platelets, direct endothelial damage,3) and negative effects of therapy with steroids4) or intravenous immunoglobulin (ivig).5) since relatively few case reports have been reported, no recommendations have been issued regarding the management of thrombocytopenic patients with cad. moreover, considering the high bleeding risk, a careful balance must be achieved between the prevention of thrombosis and hemorrhagic risk. we present two patients with itp and cad who were successfully treated using different therapeutic strategies. a 65-year - old man was transferred to our emergency room (er) with epigastric pain. the patient had taken oral steroids for itp (prednisolone 55 mg / day), which had increased the platelet count from 8000 to 73000/ul. at er electrocardiography (ecg) showed st segment elevation in leads v 1 - 3, which was consistent with an anterior wall acute myocardial infarction. cardiac enzyme (troponin i) was elevated (7.61 ng / ml, normal range : 0.0 - 0.1 ng / ml). blood coagulation tests showed a prothrombin time (pt) of 13.4 seconds { international normalized ratio (inr) 1.15 } and an activated partial thromboplastin time (aptt) of 35.1 seconds. primary percutaneous coronary intervention (pci) with loading dose clopidogrel 300 mg and aspirin (asa) 500 mg was performed. coronary angiography (cag) revealed nearly total occlusion with the thrombolysis in myocardial infarction (timi) grade 2 in the proximal left anterior descending coronary artery (lad) (fig. after balloon angioplasty, one drug eluting stent (des, 3.028 mm, coroflex please ; b. braun melsungen ag, germany) was implanted in the proximal lad, and achieved an optimal angiographic result and timi grade 3 flow in the lad (fig. 1b). after removing the sheath introducer, careful manual compression of the femoral puncture site was performed and no bleeding complication occurred. daily treatment with asa 100 mg and clopidogrel 75 mg was continued and no symptoms or bleeding complication were noted after discharge. a 67-year - old man with a 10-year history of treatment resistant itp was admitted with effort - induced chest pain (canadian cardiovascular society class iii). ten years previously, a splenectomy was performed but it was ineffective in increasing platelet count. on admission, blood coagulation tests showed a pt of 11.2 seconds (inr 1.04) and an aptt of 30.2 seconds. concerning about bleeding due to a low platelet count and gastrointestinal disturbance, antiplatelet medication maintained on a single antiplatelet regimen (clopidogrel 75 mg / day). on hospital he was administered two consecutive courses of ivig and subsequent platelet transfusion and intravenous (iv) steroid (methylprednisolone 500 mg). cag revealed 60% stenosis in the left main trunk, total occlusion of the proximal lad (timi grade 0 distal flow) with collateral flow timi grade 2 from the rca to the lad, and 50% luminal stenosis in the middle rca (fig. after careful discussion with the patient, a coronary artery bypass graft (cabg) strategy was chosen. after sheath removal, the perclose proglide 6 f device (abbott vascular, usa) was applied at the femoral puncture site without bleeding complication. while preparing for cabg, the platelet count dropped again to 14000/ul. after 2 days of ivig, iv steroid, and platelet transfusion, the platelet count increased to 189000/ul. cabg was performed using off - pump techniques, and the lima was connected to the lad. to minimize the operation time initial activated clotting time was 136 seconds, iv unfractionated heparin 6000 iu (100 iu / kg) was administered. a 65-year - old man was transferred to our emergency room (er) with epigastric pain. the patient had taken oral steroids for itp (prednisolone 55 mg / day), which had increased the platelet count from 8000 to 73000/ul. at er electrocardiography (ecg) showed st segment elevation in leads v 1 - 3, which was consistent with an anterior wall acute myocardial infarction. cardiac enzyme (troponin i) was elevated (7.61 ng / ml, normal range : 0.0 - 0.1 ng / ml). blood coagulation tests showed a prothrombin time (pt) of 13.4 seconds { international normalized ratio (inr) 1.15 } and an activated partial thromboplastin time (aptt) of 35.1 seconds. primary percutaneous coronary intervention (pci) with loading dose clopidogrel 300 mg and aspirin (asa) 500 mg was performed. coronary angiography (cag) revealed nearly total occlusion with the thrombolysis in myocardial infarction (timi) grade 2 in the proximal left anterior descending coronary artery (lad) (fig. after balloon angioplasty, one drug eluting stent (des, 3.028 mm, coroflex please ; b. braun melsungen ag, germany) was implanted in the proximal lad, and achieved an optimal angiographic result and timi grade 3 flow in the lad (fig. 1b). after removing the sheath introducer, careful manual compression of the femoral puncture site was performed and no bleeding complication occurred. daily treatment with asa 100 mg and clopidogrel 75 mg was continued and no symptoms or bleeding complication were noted after discharge. a 67-year - old man with a 10-year history of treatment resistant itp was admitted with effort - induced chest pain (canadian cardiovascular society class iii). ten years previously, a splenectomy was performed but it was ineffective in increasing platelet count. on admission, blood coagulation tests showed a pt of 11.2 seconds (inr 1.04) and an aptt of 30.2 seconds. concerning about bleeding due to a low platelet count and gastrointestinal disturbance, antiplatelet medication maintained on a single antiplatelet regimen (clopidogrel 75 mg / day). on hospital he was administered two consecutive courses of ivig and subsequent platelet transfusion and intravenous (iv) steroid (methylprednisolone 500 mg). cag revealed 60% stenosis in the left main trunk, total occlusion of the proximal lad (timi grade 0 distal flow) with collateral flow timi grade 2 from the rca to the lad, and 50% luminal stenosis in the middle rca (fig. after careful discussion with the patient, a coronary artery bypass graft (cabg) strategy was chosen. after sheath removal, the perclose proglide 6 f device (abbott vascular, usa) was applied at the femoral puncture site without bleeding complication. while preparing for cabg, the platelet count dropped again to 14000/ul. after 2 days of ivig, iv steroid, and platelet transfusion, the platelet count increased to 189000/ul. cabg was performed using off - pump techniques, and the lima was connected to the lad. to minimize the operation time, a single graft to the lad was made rather than multivessel grafting. initial activated clotting time was 136 seconds, iv unfractionated heparin 6000 iu (100 iu / kg) was administered. although the prevalence of cad in patients with itp seems to be rare, considering the crucial role of platelets, the coexistence of itp and cad is not unusual. if a patient with chronic thrombocytopenia has cad, then the presence of known cardiovascular risk factors, such as a relevant family history, hypertension, diabetes mellitus, dyslipidemia, chronic kidney disease, and cigarette smoking should be considered. bleeding tendency is one of the most important problems of itp and cad, especially in patients with des, because of long - term dual antiplatelet therapy. thus, the appropriate use of periprocedural support treatment to increase platelet numbers probably minimized bleeding. in itp, thrombocytopenia itself does not protect against thrombosis, and cases of acute coronary syndrome have been reported.3) accordingly it appears that some factors other than platelet number are involved. patients with itp may be predisposed to coronary thrombosis because their platelets are larger and more adhesive to vascular surfaces.6) furthermore, an antigenic mimicry between platelets and endothelial cells may also lead to endothelial damage by autoantibodies directed against platelet surface antigens.3) in addition, steroid and ivig treatment may be related to an increased risk of cad and thrombosis in itp.4)5) steroids induce metabolic changes as well as a hypercoagulable state, both of which may promote atherosclerosis.7) infusion of ivig may induce expansion of plasma volume with subsequent hypertensive reactions, increased oxygen demand, and cardiac decompensation,8) and also increase in plasma and blood viscosity.9) in case 1, steroid therapy appeared to play a role as a precipitating agent with another factor, such as hyperglycemia. percutaneous coronary intervention has been successfully performed in itp despite markedly different platelets counts (range from 3000/ul10) to 200000/ul11)) without major bleeding. however, performance of pci in a patient with itp presents a particular problem that requires sufficient inhibition of platelet function to prevent stent thrombosis (st), but not enough to cause bleeding. because des requires long - term maintenance with dual antiplatelet agents to prevent st, bare metal stents (bms) are generally implanted during pci in order to use the dual antiplatelet therapy in as less time as possible. however, like our case 1, des can be safely implanted in a background of itp and cad without any serious bleeding complications.11)12) although neskovic.13) proposed a management algorithm of bms placement followed by lifelong asa and short termed clopidogrel, we believe that des can be applied safely in this subset of patients if platelet number and bleeding tendency are careful monitored. regarding the vascular approach, a radial artery is preferred due to evidence of a lower risk of bleeding, as well as easy hemostatic compression, early ambulation, and patient comfort.10)12)14) however, a vascular approach should be decided on having considered platelet count, degree of emergency, characteristics of coronary lesions, and vascular integrity. as described for our patients, both transfemoral and transradial approaches were successfully used for cag or pci without any bleeding complication.15) in addition, arterial sealing and closing devices have been demonstrated to be effective at achieving immediate hemostasis after sheath removal and to allow early ambulation, reduce local complications, and provide patient comfort.16) such hemostatic devices may be especially helpful in patients with a high risk of bleeding and with performing through transfemoral route. historically, cabg is generally preferred to pci in these itp patients because it produces better results for all types of lesion and facilitates the management of antiplatelet therapy after the procedure.17) despite the low platelet count, cabg was successfully carried out with a moderate increase in bleeding risk compared to cabg in the general population. the risk of significant bleeding was higher in the itp population, 12.5%, compared to 5.4% in the general population.18) perioperative treatments, such as prophylactic splenectomy, steroid treatment, ivig, and platelet transfusion, may reduce complication rates by increasing platelet counts. in particular, some authors have suggested preoperative ivig as a treatment of choice,18) especially when a rapid increase in platelet count is needed (as occurred in case 2). however, as mentioned above, associations have been reported between cad and perioperative management, such as ivig, steroid, and platelet transfusion. case 2 underwent cabg using an off - pump technique and a lima conduit. an off - pump cabg technique may be a safer strategy, because it avoids the use of an extracorporeal circuit and, thus, minimizes platelet dysfunction.19) one of the benefits of using off - pump cabg rather than conventional cabg is the significant reduction in blood loss and the reduced need for transfusion of platelets and other blood products.20) moreover, given the minimal bleeding rate, extending conduit use including internal mammary arteries appears appropriate.18) we present two patients with itp and cad, who were treated differently, using pci and cabg. although the optimal management of thrombocytopenic patients with cad remains uncertain, our experiences of the two described cases suggest that both coronary revascularization techniques can be a useful strategy in these patients, even when thrombocytopenia is severe. we conclude that various revascularization strategies are possible in itp patients with cad and that treatment should be individualized after taking into consideration initial diagnosis and patient variables, such as platelet count and bleeding tendency. | idiopathic thrombocytopenic purpura (itp) is an autoimmune disorder with a low platelet count characterized by premature platelet destruction and suppression of platelet production mediated by autoantibodies, which may predispose to bleeding. although the prevalence of coronary artery disease (cad) in itp seems to be rare, their co - occurrence is not unusual. patients with itp have increased risks for thrombosis and atherosclerosis associated with hemostatic factors, endothelial damage, and the negative effects of steroid and immunoglobulin therapies. thus, the coexistence of itp and cad presents complex problems requiring a balance between hemorrhagic risk and prevention of thrombosis. here, the authors present two patients with itp, who were revascularized in different ways for cad. although the optimal management of thrombocytopenic patients with cad is uncertain, individualized treatment modalities can be useful in patients with itp and cad. |
spirometry after bronchodilation is crucial in assessing the presence of airway obstruction, which is necessary for the diagnosis of chronic obstructive pulmonary disease (copd).1 chronic airway obstruction is mostly assessed using the ratio of forced expiratory volume in 1 second (fev1)/forced vital capacity (fvc) fvc but there were no significant differences compared with the non - copd group. sixty - eight subjects were classified as having goldcopdvc > fvc and in univariate analyses, these subjects with goldcopdvc > fvc had higher weight, higher hemoglobin, lower fev1, more obstruction and higher rv and tlc compared to the non - copd group (table 2). in logistic regression, with goldcopdvc > fvc vs non - copd as the dependent variable, there were significant associations with age (or 1.08, 95% ci 1.011.15), wheeze (or 2.3, 95% ci 1.054.9), decreased fev1 (or 0.82, 95% ci 0.780.86) and increased fvc (or 1.19, 95% ci 1.141.24 and increased rv (or 1.02, 95% ci 1.011.04) (table 6). the most important findings in this general population - based study were that the prevalence of copd, defined as the pres - ence of airflow limitation, was significantly higher when the ratio fev1/vc was calculated using the highest value of svc or fvc compared with using fvc only. this was independent of whether the gold or the lln definition of copd was applied. additional subjects who were identified as having copd when applying the vc approach compared with the fvc approach (goldcopdvc > fvc) were less obstructed than the remaining subjects with copd. still, these additional subjects had decreased fev1 and increased rv, indicating presence of obstruction and air trapping, compared to healthy subjects. these results underscore that the use of only fvc when assessing airflow limitation may result in a considerable underdiagnosis of subjects with mild copd. we observed a significantly higher prevalence of copd, defined as the presence of postbronchodilator airflow limitation, when including the highest value of fvc or svc as the denominator when calculating the fev1/vc ratio. this important aspect has mostly been neglected in previous studies, but there are some exceptions. in a portuguese study of a clinical population, it was observed that the prevalence of airway obstruction (copd) increased from 43.9% when using fvc to 52.2% when using svc as the denominator.21 in a swedish study of sick - listed subjects who were current smokers, the prevalence of copd according to the gold guidelines increased from 14.0% to 16.8% when the best value of fvc or svc was used in the calculation of the fev1/vc ratio compared with only using fvc.8 when applying the lln approach among these smokers, the prevalence of copd increased from 17.6% to 21.7%. in our study, when applying the maximum value of svc or fvc as the denominator in the fev1/vc ratio, the prevalence of copd increased, probably because of a more sensitive definition. sixty - eight subjects who were added (goldcopdvc > fvc) when using the vc approach appeared healthier compared with the goldcopdfvc group but compared to the non - copd group they seemed to be more obstructive and with some degree of air trapping. not infrequently, in subjects with light - to - moderate airflow obstruction and dynamic compression, fvc is lower than vc.22 this is thought to result from closure of small airways at a higher volume during a forced expiration than when performing the svc. our results indicate that a definition of airflow limitation based on vc instead of fvc will identify more subjects with mild obstruction and air trapping as having copd. to the best of our knowledge, therefore, we consider that the importance of using the maximum value of svc or fvc as a measure of vc needs to be examined when estimating the prevalence of copd. in order to enable an appropriate comparison between studies, it needs to be clearly stated whether the fvc approach or the vc approach has been applied. our study does not support the assumption that there is only a negligible difference between svc and fvc in unselected populations.6 rather, our findings indicate that the vc approach will result in a more sensitive definition of copd, and probably an increased tendency to make a false - positive copd diagnosis. an alternative conclusion is that the fvc approach may result in considerable underrecognition of subjects with copd. whether application of the vc concept (based on svc) will result in more valid and reproducible estimates and better prediction of lung function decline needs to be investigated in longitudinal studies. overall, the clinical implications of using fvc or vc as a denominator when assessing airway obstruction need to be further evaluated. this raises the important issue of whether a decreased fev1/vc ratio (regardless of the definition) is just a marker of airflow limitation. for a clinically relevant diagnosis of copd, there is further need for clinical signs or structural abnormalities.23 previous studies have shown that the prevalence of copd differs between populations when different definitions of copd are used.2427 most studies have reported a higher prevalence of copd using the gold definition compared with the lln approach as recommended by the ers / ats. however, this was not the case in our study because we found a similar prevalence of copd, regardless of the definition. this difference between studies is probably due to the comparatively narrow age interval of our study of 5064 years because overestimation of copd owing to the gold criteria increases with advancing age. a swedish study on subjects aged fvc is reported. given that the average response rate in the present study was 50%, another concern in nonresponse bias. it is well known that smokers are overrepresented among nonresponders, males and urban citizens, but this is mainly observed among younger subjects.28 the prevalence of copd in this population - based sample of subjects aged 5064 years was highly dependent on whether vc or fvc was used when calculating the fev1/vc ratio. hence, the use of only fvc when assessing airflow limitation may result in a considerable under diagnosis of subjects with mild copd. copd is a progressive disease, and early detection is very important to allow for immediate interventions, such as smoking cessation. | backgroundspirometric diagnosis of chronic obstructive pulmonary disease (copd) is based on the ratio of forced expiratory volume in 1 second (fev1)/vital capacity (vc), either as a fixed value < 0.7 or below the lower limit of normal (lln). forced vital capacity (fvc) is a proxy for vc. the first aim was to compare the use of fvc and vc, assessed as the highest value of fvc or slow vital capacity (svc), when assessing the fev1/vc ratio in a general population setting. the second aim was to evaluate the characteristics of subjects with copd who obtained a higher svc than fvc.methodssubjects (n=1,050) aged 5064 years were investigated with fev1, fvc, and svc after bronchodilation. global initiative for chronic obstructive lung disease (gold) copdfvc was defined as fev1/fvc < 0.7, goldcopdvc as fev1/vc < 0.7 using the maximum value of fvc or svc, llncopdfvc as fev1/fvc below the lln, and llncopdvc as fev1/vc below the lln using the maximum value of fvc or svc.resultsprevalence of goldcopdfvc was 10.0% (95% confidence interval [ci ] 8.212.0) and the prevalence of llncopdfvc was 9.5% (95% ci 7.811.4). when estimates were based on vc, the prevalence became higher ; 16.4% (95% ci 14.318.9) and 15.6% (95% ci 13.517.9) for goldcopdvc and llncopdvc, respectively. the group of additional subjects classified as having copd based on vc, had lower fev1, more wheeze and higher residual volume compared to subjects without any copd.conclusionthe prevalence of copd was significantly higher when the ratio fev1/vc was calculated using the highest value of svc or fvc compared with using fvc only. subjects classified as having copd when using the vc concept were more obstructive and with indications of air trapping. hence, the use of only fvc when assessing airflow limitation may result in a considerable under diagnosis of subjects with mild copd. |
it is a potent opioid analgesic with ultra - short duration of action, extremely rapid peak effect, and an equally consistent and rapid elimination with complete cessation of effect within a maximum of 10 minutes. in clinical practice an excessive bolus dose however can cause rapid onset of potentially life - threatening side effects, such as bradycardia, hypotension, muscular rigidity, and apnea. we report a case of an inadvertent remifentanil bolus which induced sudden bradycadia, hypotension, and apnea. it was immediately detected and successfully managed in our surgical intensive care unit (sicu). a 36-year - old woman was admitted to sicu after resection of a hepatic mass. she was intubated, ventilated, and sedated with propofol and remifentanil infusion provided analgesia. on the second postoperative day she remained hemodynamically stable, was weaned from the ventilator, and extubated on day 4. propofol and remifentanil infusions were stopped 1 hour and 15 minutes before the extubation, respectively. after tracheal extubation, the patient was fully awake, breathing spontaneously, respiratory rate was 20 - 24 breaths per minute, oxygen saturation was 100%, and she was hemodynamically stable. thirty minutes after extubation, the lumen of the central venous catheter, used for the remifentanil infusion up to 15 minutes prior to extubation, was used to infuse a plasma protein fraction bag at a rate 125 ml / hour. within 2 - 3 minutes, the heart rate of the patient decreased to 48 beats per minute, oxygen saturation dropped to 60%, she stopped breathing, and systolic blood pressure decreased to 86 mm of hg [figure 1 ]. atropine was given, and within 3 minutes her heart rate increased to 60 beats per minute and her blood pressure improved to 108 mm of hg. concurrently, her heart rate and blood pressure improved (72 - 74 beats per minute and 112 - 120 mm of hg, respectively) oxygen saturation reached 100% with a respiratory rate of 22 - 24 breaths per minute (oxygen supplementation 5 liters per minute was given by nasal canula). remifentanil is an ultra - short acting opioid analgesic which acts on mu - receptors ; it has a rapid onset of action (1.3 minutes). this combined with an ultra - short duration of action and rapid elimination (3 minutes) makes remifentanil an analgesic medication of choice in icus. if an excessive remifentanil bolus dose is injected, it leads to potentially life - threatening adverse effects such as bradycardia, hypotension, muscular rigidity, and apnea. the use of remifentanil for patient - controlled analgesia (pca), in which the bolus dose of remifentanil range between 0.25 and 1 g / kg has been described. remifentanil - pca was provided with a bolus facility of 50 pg administered over 5 minutes, followed by a 5-min lockout in combination with a background infusion. bowdle. studied the effects of remifentanil in the immediate postoperative period ; 29% patients developed respiratory adverse events. interestingly, apnea occurred in 8.7% patients and 83% of them received a bolus dose of remifentanil. in this study, depending on the type of tubing used and the site of connection, the dead space of the main intravenous tubing between the port where remifentanil is inserted into the main intravenous infusion line and the patient 's vein can vary from 1 to 5 ml. in these conditions, a change in the flow rate of the intravenous fluid will have a clear impact on the delivery of remifentanil. if the flow in the main intravenous tubing is suddenly increased, the amount of remifentanil contained in the dead space will be flushed abruptly into the patient 's circulation, leading to a bolus effect of remifentanil mainly bradycardia, hypotension, apnea, and rigidity. in our patient, remifentanil was used in a standard solution of 400 g / ml. as the patient was on higher dose (0.4 mcg / kg / minute) of remifentanil 1 - 2 ml may have remained in the tubing and bivalve connection must have been flushed when the same port and connection were used to infuse the plasma protein fraction with higher rate (125 ml / hour). the bolus dose of the remifentanil flushed must have been around 400 - 800 g. this is sufficient to cause the potentially life - threatening adverse effects encountered in this patient. bowdle. have also reported a case of one patient becoming unconscious, cyanosed, and bradycardic after an intravenous line was flushed ; the same line was used for remifentanil infusion. to avoid such serious preventable clinical problems, hug has suggested ventilation with a bag - valve - mask and following recommendations. avoid intravenous bolus and flushing of the line which was used for remifentanil infusion.treat and/or prevent bradycardia and hypotension with anti - cholinergic medications.if apnea and rigidity occur with excessive bolus of remifentanil, it will be difficult to give positive pressure ventilation. in this situation, a short - acting muscle relaxant can be used and the patient ventilated until the effects of the bolus dose wear off. avoid intravenous bolus and flushing of the line which was used for remifentanil infusion. treat and/or prevent bradycardia and hypotension with anti - cholinergic medications. if apnea and rigidity occur with excessive bolus of remifentanil, it will be difficult to give positive pressure ventilation. in this situation, a short - acting muscle relaxant can be used and the patient ventilated until the effects of the bolus dose wear off. to prevent similar incidents in our icu in future, we started to use a more diluted remifentanil infusion, given through a dedicated cannula or connecting remifentanil infusion closer to the patient using a three way, and started to remove the infusion lines used, to place the remifentanil on hold for preparing the patient for extubation. it is essential to be aware of these rapidly occurring, potentially life - threatening effects of excessive bolus doses of remifentanil. acute care physicians, intensivists, anesthesiologists, and critical care nurses must be aware of this to ensure proper management. | remifentanil is an opioid analgesic frequently used in intensive care patients because of its rapid onset of action, potency, and ultra - short duration. if an excessive dose is given, it leads to rapid, short lasting, potentially life - threatening side effects such as apnea, bradycadia, hypotension, and rigidity, following rapid peak serum levels. we report a 36-year - old woman developing apnea with bradycardia and hypotension, following an infusion in the central venous catheter lumen that had been used for remifentanil till tracheal extubation. the patient was immediately ventilated with bag - valve - mask and improved within 8 minutes. she became fully awake, heart rate and blood pressure returned to normal, and oxygen saturation improved to 100%. acute care physicians, intensivists, anesthesiologists, and critical care nurses should be aware of this clinical problem in order prevent it as much as possible and to initiate immediate resuscitative measures. |
current rectal cancer treatment is based on a multidisciplinary approach entailing surgery, chemotherapy, and radiotherapy. the aim of surgery is to remove the rectum and the mesorectum contained within the intact fascia of the rectum. this technique reduces pelvic recurrence, prolongs survival, and preserves postoperative erectile and urinary function by avoiding nerve injury. laparoscopic anterior resection with total mesorectal excision (tme) has been recently introduced as a treatment option for rectal cancer. oncologic outcomes of laparoscopic tme are comparable to those of the open counterpart, and the postoperative course showed improvement in several retrospective and randomized controlled studies. robot - assisted surgery is considered an evolution of traditional laparoscopy, but little data support any real benefits of this technology. robotic attributes improve surgeon dexterity where fine manipulation of tissues in a close, fixed operating field or when hand - sewn sutures and knot tying are required. therefore, we believe that a robotic approach could be relevant for laparoscopic anterior rectal resection. to evaluate the role of robotics in rectal surgery, we compared intra- and postoperative outcomes of anterior resection using a traditional laparoscopic approach (traditional laparoscopic anterior resection ; tlar) and a robot - assisted procedure with the 3-arm da vinci surgical system (intuitive surgical inc., sunny - vale, ca) (robot - assisted laparoscopic anterior resection ; rlar). between march 2004 and october 2008, a minimally invasive approach was proposed to all patients with a histologically proved rectal adenocarcinoma irrespective to the stage of disease. preoperative workup included physical examination, colonoscopy, total - body computed tomography, and blood count. patients preoperatively staged as t3 or t4 without distant metastases were treated by preoperative radiochemotherapy (45 gy for 4 weeks together with systemic 5-fluouracil intravenous infusion) and were reevaluated with a clinical examination and computed tomography 20 days after treatment. resectable synchronous liver metastases were not considered a contraindication for a minimally invasive approach and were treated at the same time of the primary tumor (one - stage resection). liver resections were always carried out with the aid of the robotic system. the day before surgery clinical parameters analyzed included patient characteristics, operative variables, pathologic examination, short - term and medium - term outcomes. perioperative data included operative time, blood loss, conversion rate, perioperative complications, and length of hospital stay. operative time was calculated as the time between pneumoperitoneum induction and port - site closure. pathologic examination included type, stage of disease (tnm), number of lymph nodes harvested, and longitudinal and radial margins of excision. patients underwent a weekly clinical examination during the 30 days after discharge and then were followed up every 6 months with a physical examination, tumor markers, liver ultrasound, computed tomography, chest x - ray, and colonoscopy. sexual function impairment was defined as the impossibility of achieving an erection or ejaculation after surgery. patients with pre - existing poor genital function were excluded from the statistical analysis. during the study period, we performed total mesorectal excision (tme), with transection of the rectum at the level of the pelvic floor and removal of intact mesorectum, for patients with mid and distal rectal cancer. for tumors of the upper rectum or recto - sigmoid junction, transection of the rectum and mesorectum 4 cm below the lower border of the tumor this approach has been demonstrated to be effective as routine tme for all rectal cancers. in cases of very low tumors, an intersphincteric resection with specimen extraction through abdominoperineal resections (apr) were proposed to patients with sphincter - invading lesions or with very low tumors and poor fecal continence. one camera port and 3 working trocars are positioned after co2 pneumoperitoneum at 12 mm hg is induced using a veress needle. the patient is kept in a steep trendelenburg position during the whole procedure to remove the small bowel from the pelvis. the left colon is fully mobilized by using the harmonic scalpel along the posterior plane covered by toldt 's fascia, after which the left ureter and gonadal vessels are identified. dissection then proceeds cranially to the origin of the inferior mesenteric artery (i m a) and inferior mesenteric vein (imv). i m a is divided between clips at its origin and imv at the level of the duodenojejunal flexure. the cleavage plane between the presacral fascia and the visceral layer that underlines the mesorectum is then identified at the level of the sacral promontory. trocar position for robot - assisted anterior rectal resection and traditional laparoscopic anterior rectal resection. c : camera port ; o1 and o2 : operative trocars ; a1 and a2 : accessory trocars. measurement of distance between the tumor and the cutting line is performed by digital exploration or endoscopy. division of the rectum is carried out with a linear endoscopic stapler inserted through the right iliac fossa trocar. proximal section of the vascular arcade and colon is performed laparoscopically, and the specimen is extracted through a left lower quadrant minilaparotomy. the anastomosis is created with a mechanical circular stapler inserted transanally, according to the double - stapled technique. we perform a hybrid technique with laparoscopic mobilization of the colon and robotic - assisted mesorectal excision, as described by pigazzi. the scrub nurse and one on - table assistant dress the robot while pneumoperitoneum is being established. therefore, time for abdominal insufflation with the veress needle and robot docking are superimposed. a 12-mm camera port, two 8-mm robotic working ports, and 2 additional laparoscopic trocars are placed as shown in figure 1. a medial - to - lateral dissection with high ligation of the inferior mesenteric vein and artery near its origin is carried out laparoscopically followed by laparoscopic mobilization of descending and sigmoid colon and of the splenic flexure, if necessary. the 2 working arms usually carry a cadier forceps on the left and a hook cautery on the right. once the tme is completed, the assistant divides the distal rectum by using a 30-mm linear stapler through the 12-mm laparoscopic port. the specimen is extracted through a minilaparotomy on the left lower quadrant, and the anastomosis is created as described above. parametric variables are given as means sd and were analyzed with the student t test. frequencies were analyzed with the test, and the mann - whitney test was used for nonparametric data. survival curve analysis was carried out with the kaplan - meier method, and the evaluation of differences between the groups was performed with the log - rank test. statistical analysis was carried out using prism 4.0.3 data analysis software for windows (graphpad software, san diego, ca, usa). during the study period, we performed total mesorectal excision (tme), with transection of the rectum at the level of the pelvic floor and removal of intact mesorectum, for patients with mid and distal rectal cancer. for tumors of the upper rectum or recto - sigmoid junction, transection of the rectum and mesorectum 4 cm below the lower border of the tumor this approach has been demonstrated to be effective as routine tme for all rectal cancers. in cases of very low tumors, an intersphincteric resection with specimen extraction through abdominoperineal resections (apr) were proposed to patients with sphincter - invading lesions or with very low tumors and poor fecal continence. one camera port and 3 working trocars are positioned after co2 pneumoperitoneum at 12 mm hg is induced using a veress needle. the position of the trocars is shown in figure 1. the patient is kept in a steep trendelenburg position during the whole procedure to remove the small bowel from the pelvis. the left colon is fully mobilized by using the harmonic scalpel along the posterior plane covered by toldt 's fascia, after which the left ureter and gonadal vessels are identified. dissection then proceeds cranially to the origin of the inferior mesenteric artery (i m a) and inferior mesenteric vein (imv). i m a is divided between clips at its origin and imv at the level of the duodenojejunal flexure. the cleavage plane between the presacral fascia and the visceral layer that underlines the mesorectum is then identified at the level of the sacral promontory. trocar position for robot - assisted anterior rectal resection and traditional laparoscopic anterior rectal resection. c : camera port ; o1 and o2 : operative trocars ; a1 and a2 : accessory trocars. measurement of distance between the tumor and the cutting line is performed by digital exploration or endoscopy. division of the rectum is carried out with a linear endoscopic stapler inserted through the right iliac fossa trocar. proximal section of the vascular arcade and colon is performed laparoscopically, and the specimen is extracted through a left lower quadrant minilaparotomy. the anastomosis is created with a mechanical circular stapler inserted transanally, according to the double - stapled technique. we perform a hybrid technique with laparoscopic mobilization of the colon and robotic - assisted mesorectal excision, as described by pigazzi. the scrub nurse and one on - table assistant dress the robot while pneumoperitoneum is being established. therefore, time for abdominal insufflation with the veress needle and robot docking are superimposed. a 12-mm camera port, two 8-mm robotic working ports, and 2 additional laparoscopic trocars are placed as shown in figure 1. a medial - to - lateral dissection with high ligation of the inferior mesenteric vein and artery near its origin is carried out laparoscopically followed by laparoscopic mobilization of descending and sigmoid colon and of the splenic flexure, if necessary. the 2 working arms usually carry a cadier forceps on the left and a hook cautery on the right. the on - table assistant uses 2 ports for suctioning and retraction. once the tme is completed, the assistant divides the distal rectum by using a 30-mm linear stapler through the 12-mm laparoscopic port. the specimen is extracted through a minilaparotomy on the left lower quadrant, and the anastomosis is created as described above. parametric variables are given as means sd and were analyzed with the student t test. frequencies were analyzed with the test, and the mann - whitney test was used for nonparametric data. survival curve analysis was carried out with the kaplan - meier method, and the evaluation of differences between the groups was performed with the log - rank test. statistical analysis was carried out using prism 4.0.3 data analysis software for windows (graphpad software, san diego, ca, usa). seventy - six consecutive patients were treated for rectal cancer between march 2004 and october 2008. a minimally invasive approach was proposed to all patients. in 7 cases, however, conversion to laparotomy was necessary, 3 patients preferred an open approach, so they were all excluded from the study. the 2 groups are matched for age, bmi, asa status, and tnm stage. a greater number of low rectal cancers were deliberately treated by a robotic approach, because after the first cases we felt a subjective improvement in low mesorectal dissection using the da vinci system and randomization abandoned because tlar was considered disadvantageous. moreover, the rlar group differs from the tlar also for the greater number of patients who underwent neoadjuvant chemoradiotherapy and patients with a history of previous abdominal surgery. bmi = body mass index ; tlar = traditional laparoscopic anterior rectal resection ; rlar = robot - assisted anterior rectal resection. as mentioned above, in the rlar group more patients underwent tme than in the tlar group. intraoperative and pathologic data tlar = traditional laparoscopic anterior rectal resection ; rlar = robot - assisted anterior rectal resection ; pme = partial mesorectal excision ; tme = total mesorectal excision ; apr = abdominoperineal resection ; caa = intersphinteric resection with coloanal anastomosis. robot - assisted operations comprising a tme (total proctectomy and abdomino - perineal resection) were significantly faster than the laparoscopic counterparts. on the other hand,, there were not conversions to open surgery, but in 2 patients the planned robotic approach was abandoned in favor of traditional laparoscopy because the rectal cancer was higher than expected at the preoperative workup. a diverting stoma was never performed. in all cases, adequate tumor - free resection and radial margins were obtained, and the number of lymph nodes harvested was comparable between groups (table 2). in both groups, concomitant procedures were carried out but time for their execution and respective blood - loss were not considered for statistical analysis. stage iv patients with resectable liver metastases underwent 1-stage resection of the primary and liver metastasis, a 1.5-cm nodule in segment 8 and a 1.5 nodule in segment 7 in the rlar and tlar groups, respectively. as mentioned above, in the rlar group more patients underwent tme than in the tlar group. intraoperative and pathologic data tlar = traditional laparoscopic anterior rectal resection ; rlar = robot - assisted anterior rectal resection ; pme = partial mesorectal excision ; tme = total mesorectal excision ; apr = abdominoperineal resection ; caa = intersphinteric resection with coloanal anastomosis. robot - assisted operations comprising a tme (total proctectomy and abdomino - perineal resection) were significantly faster than the laparoscopic counterparts. on the other hand, there were not conversions to open surgery, but in 2 patients the planned robotic approach was abandoned in favor of traditional laparoscopy because the rectal cancer was higher than expected at the preoperative workup. a diverting stoma was never performed. in all cases, adequate tumor - free resection and radial margins were obtained, and the number of lymph nodes harvested was comparable between groups (table 2). in both groups, concomitant procedures were carried out but time for their execution and respective blood - loss were not considered for statistical analysis. stage iv patients with resectable liver metastases underwent 1-stage resection of the primary and liver metastasis, a 1.5-cm nodule in segment 8 and a 1.5 nodule in segment 7 in the rlar and tlar groups, respectively. the 30-day mortality was null, and no significant differences occurred in terms of specific complications between the 2 groups of patients (table 3). tlar = traditional laparoscopic anterior rectal resection ; rlar = robot - assisted anterior rectal resection. two patients in the tlar group required postoperative transfusion for trocar and rectal bleeding, respectively. both cases were treated conservatively, but the patient with the rectal hemorrhage developed an anastomotic fistula requiring a diverting loop - ileostomy, prolonged antibiotic therapy, and total parenteral nutrition. patients in both groups scheduled for adjuvant chemoradiation or chemotherapy alone underwent treatment one month after surgery (tlar 7 patients, 3311 days ; rlar 9 patients, 316 days). during the follow - up period, we did not identify differences between groups in the incidence of erectile dysfunction and fecal incontinence. postoperative erectile dysfunction does not seem to be correlated with the extent of mesorectal dissection. in fact, all 5 cases observed were patients with tumors in the higher third of the rectum. however, it is more likely that it is correlated with other factors, such as the learning curve and the complexity of mesorectal excision. erectile dysfunction was reported by the first 2 patients in the rlar group and by a patient with a bulky tumor in the tlar group. concerning oncologic results, we evaluated all the 66 patients with a mean follow - up of 18.7 and 29.2 months in the tlar and rlar groups, respectively. during this period, 2 patients (3% of total patients) died of cancer : 1 in the tlar and 1 in the rlar group. the local recurrence rate was 5.4% and 0% in the tlar and rlar, respectively. a total of 4 patients in the tlar group (6% of the total patients) are alive with metastatic disease and/or local recurrence. one patient at 47 months after surgery was palliated with bowel stenting and radiotherapy for local recurrence and carcinosis. one patient has brain and adrenal metastases, and in the third the ct scan showed local recurrence and multiple liver and lung metastases in rapid progression under chemotherapy. the fourth patient underwent robot - assisted tme for local recurrence 8 months after a traditional laparoscopic pme. no differences were observed in overall and disease - free survival, but we found a trend towards a better disease - free survival in the rlar group (figure 2). application of robotics to the treatment of rectal cancer has been demonstrated to be feasible in recent studies highlighting technical advantages brought about by the da vinci system in tme. the general advantages of this robotic system are a 3-dimensional view, hand - tremor filtering, fine dexterity, and motion scaling, providing an absolute benefit when the operative field is narrow and fixed and sharp dissection is necessary. despite the subjective experience of the surgeon at the console being impressive, to date there are no comparative studies demonstrating a real impact of this technology on patient outcome. to the best of our knowledge, after a few cases, we preferred to treat all patients with low rectal cancer with a robotic approach mismatching the 2 groups, the mean follow - up time is not appropriate to give definitive results on oncologic outcome, and the series is small for a powerful statistical analysis. nevertheless, because the short - term results were surprising with respect to operative time and conversion rate, it was decided that publication of these results would be of interest. on the other hand, what from a statistical point of view is a bias can be considered a point of strength of the study. in fact, outcome results have to be weighted on the major complexity of the procedures performed in a robot - assisted approach. the majority of patients in the rlar group had previous abdominal surgery and low rectal cancer requiring a tme. in addition, in the rlar group, more patients underwent neo - adjuvant chemoradiation in respect to the tlar and oar groups. our study indicates for the first time that robot - assisted tme can be performed in a significantly shorter operative time compared with tlar and with a lower conversion rate. distal and radial margins were tumor - free in all cases as obtained in the tlar group. these data demonstrate that rlar respects oncological criteria for mesorectal excision and improve surgical maneuvers, reducing operating times. on the contrary, no advantages in terms of subjective and objective results were obtained in pme. in cases of high rectal tumors, rlar results in longer operating times. these data rely on the easy execution of pme during laparoscopic left colon mobilization by simply prolonging the plane of dissection above the inferior mesenteric artery over the sacral promontory. this maneuver is greatly facilitated in laparoscopy by pneumodissection, and we do not believe that robotics could further improve it. perhaps, studies comparing a totally robot - assisted and totally laparoscopic pme are needed to validate this impression. regarding complications and postoperative outcome, both minimally invasive approaches resulted in a comparable early postoperative course. no differences were reported between groups in the incidence of sexual dysfunction, even if its expected frequency in the rlar group is higher than that observed due to the larger amount of low rectal tumors. survival curve analysis revealed no differences between the 2 groups, but a trend towards a better disease - free survival was highlighted in the rlar group. notably, in the rlar group, there are not local recurrences during the follow - up period. this result can be explained by a different tumor response to adjuvant chemotherapy or to an increasing number of neoadjuvant therapies in the rlar group, but possible improvement in local disease control by robotic dissection is also a reasonable possibility. image magnification and 3-dimensional vision could be responsible for this result as a consequence of the fine dissection and the easier identification of the cleavage planes also in a narrow pelvis. this observation, if confirmed in randomized controlled trials, could dramatically change the standard approach to rectal cancer. coupled with better local control, a minimally invasive procedure could accelerate the beginning of adjuvant treatments by reducing complications and patient discomfort. as a matter of fact, laparoscopic colorectal resection is associated with a better early outcome than that of traditional open surgery. it is convincing that a better postoperative course could itself be a factor in improving survival of patients with advanced disease requiring early postoperative chemotherapy. in our series, therefore, robot - assisted tme could allow an increasing number of patients with low rectal cancer to benefit from the intrinsic advantages of minimally invasive surgery. unfortunately, in our study the length of stay can not be used as a discriminating factor of a better early outcome. indeed, in italy the healthcare delivery system does not give patients any financial incentives to be discharged early. the general attitude is to discharge patients in relation to the absence of complications, tolerance of a normal diet, and patient preference. despite the fact that the limitations of the study do not permit definitive results, robotics is likely to improve laparoscopic tme but not pme. future prospective controlled studies should be aimed at verifying whether robotic tme might increase local control of rectal cancer, disease - free patient survival, and postoperative sexual function in male patients. if confirmed, our data suggest the possibility for a tailored approach to rectal cancer with a predominant role for robotics for lower cancer treatment and a restricted use of traditional laparoscopy to cancers requiring pme. | background : traditional laparoscopic anterior rectal resection (tlar) has recently been used for rectal cancer, offering good functional results compared with open anterior resection and resulting in a better postoperative early outcome. however, laparoscopic rectal resection can be technically demanding, especially when a total mesorectal excision is required. the aim of this study was to verify whether robot - assisted anterior rectal resection (rlar) could overcome limitations of the laparoscopic approach.methods:sixty-six patients with rectal cancer were enrolled in the study. twenty - nine patients underwent rlar and 37 tlar. groups were matched for age, bmi, sex ratio, asa status, and tnm stage, and were followed up for a mean time of 12 months.results:robot-assisted laparoscopic rectal resection results in shorter operative time when a total mesorectal excision is performed (165.910 vs 21037 minutes ; p<0.05). the conversion rate is significantly lower for rlar (p<0.05). postoperative morbidity was comparable between groups. overall survival and disease - free survival were comparable between groups, even though a trend towards better disease - free survival in the rlar group was observed.conclusion:rlar is a safe and feasible procedure that facilitates laparoscopic total mesorectal excision. randomized clinical trials and longer follow - ups are needed to evaluate a possible influence of rlar on patient survival. |
patients with t2 dm and pll were identified by one of the authors (w.t.g.) in clinics sponsored by divisions of endocrinology or nutrition sciences at academic institutions during a 25-year period. ten of these patients (half of the total) agreed to participate in metabolic studies on a research ward and constitute the current study population. all patients with pll in the study were females of various ethnic and racial identities. there are no reasons to suspect men can not also be affected by t2 dm and pll, even though men may be more difficult to identify than women because of differences in subcutaneous fat. in fact, we encountered one such hispanic man with symmetrical lipoatrophy of the forearms who did not agree to participate in this study. nine of the patients with pll in the study had overt t2 dm, whereas one met the criteria for prediabetes. five of the nine pll patients with t2 dm were treated with insulin plus metformin or a sulfonylurea and the remainder with oral hypoglycemic drugs. a single laboratory conducted the metabolic studies, assuring continuity of methods and comparability of data during this interval. characteristics of patients with t2 dm with pll compared with patients with common t2 dm from a larger database of t2 dm patients metabolically studied in the same laboratory, the patients with pll were matched by age, bmi, fasting glucose, ethnicity, and diabetes status to 10 patients with commonly occurring t2 dm who did not have clinically evident lipodystrophy. comparative data in the study groups with and without pll are also delineated in table 1. all patients were withdrawn from any medicines used to treat diabetes or dyslipidemia for 1 to 3 weeks so that they could be studied in the untreated state. all patients denied positivity for hiv and explicitly denied that any other family members had the appearance or diagnosis of lipodystrophy to their knowledge. none of the patients engaged in heavy alcohol use (more than 2 drinks / day or 10 drinks / week), and orthostatic hypotension was excluded by sitting and standing blood pressure checks. this study was approved by the institutional review boards of the institutions, and written informed consent was obtained in all patients. patients were equilibrated on a metabolic ward on a diet consisting of 20% protein, 30% fat, and 50% carbohydrate for 3 days. standard 75-g oral glucose tolerance tests were performed after an overnight fast. to assess glucose disposal rates (gdrs), hyperinsulinemic - euglycemic clamps were performed at a maximally effective insulin concentration, as previously described (19). a catheter was inserted into the brachial vein, and a calibrated syringe pump was used to administer regular insulin in a square wave at a rate of 200 mu / m / min. this infusion provided steady - state serum insulin levels that were maximally effective for promoting glucose uptake in skeletal muscle in patients with t2 dm and fully suppressing hepatic glucose production (19). to prevent hypokalemia, a variable - rate infusion of a 20% dextrose solution was used to maintain the plasma glucose level at 90 mg / dl for at least 3 h, with plasma glucose levels assessed every 5 min throughout the clamp. during the final three 20-min intervals, the mean glucose infusion rate was used to calculate maximal glucose uptake for each individual. whole - body glucose uptake was calculated based on the glucose infusion rate corrected for changes in the glucose pool size, assuming a distribution volume of 19% body weight and a pool fraction of 0.65. under these conditions, the glucose infusion rate in milligrams per minute is equal to the gdr, and the data were normalized to total body weight (kg) or body surface area (m). if normally distributed, the data were expressed as mean se, and the student t test was used to analyze whether differences between the patients with t2 dm with and without pll were statistically significant. if data were not normally distributed, values were presented as median (first third quartile), and statistical significance was determined using the nonparametric wilcoxon rank test. statistical analysis was performed using sas 9.2 software (sas institute, cary, nc) and microsoft excel. serum alanine aminotransaminase (alt), aspartate aminotransaminase (ast), and alkaline phosphatase (alp) values were expressed as a percentage of the clinical laboratory s established upper limit of the normal reference range. patients with t2 dm and pll were identified by one of the authors (w.t.g.) in clinics sponsored by divisions of endocrinology or nutrition sciences at academic institutions during a 25-year period. ten of these patients (half of the total) agreed to participate in metabolic studies on a research ward and constitute the current study population. all patients with pll in the study were females of various ethnic and racial identities. there are no reasons to suspect men can not also be affected by t2 dm and pll, even though men may be more difficult to identify than women because of differences in subcutaneous fat. in fact, we encountered one such hispanic man with symmetrical lipoatrophy of the forearms who did not agree to participate in this study. nine of the patients with pll in the study had overt t2 dm, whereas one met the criteria for prediabetes. five of the nine pll patients with t2 dm were treated with insulin plus metformin or a sulfonylurea and the remainder with oral hypoglycemic drugs. a single laboratory conducted the metabolic studies, assuring continuity of methods and comparability of data during this interval. characteristics of patients with t2 dm with pll compared with patients with common t2 dm from a larger database of t2 dm patients metabolically studied in the same laboratory, the patients with pll were matched by age, bmi, fasting glucose, ethnicity, and diabetes status to 10 patients with commonly occurring t2 dm who did not have clinically evident lipodystrophy. comparative data in the study groups with and without pll are also delineated in table 1. all patients were withdrawn from any medicines used to treat diabetes or dyslipidemia for 1 to 3 weeks so that they could be studied in the untreated state. all patients denied positivity for hiv and explicitly denied that any other family members had the appearance or diagnosis of lipodystrophy to their knowledge. none of the patients engaged in heavy alcohol use (more than 2 drinks / day or 10 drinks / week), and orthostatic hypotension was excluded by sitting and standing blood pressure checks. this study was approved by the institutional review boards of the institutions, and written informed consent was obtained in all patients. patients were equilibrated on a metabolic ward on a diet consisting of 20% protein, 30% fat, and 50% carbohydrate for 3 days. standard 75-g oral glucose tolerance tests were performed after an overnight fast. to assess glucose disposal rates (gdrs), hyperinsulinemic - euglycemic clamps were performed at a maximally effective insulin concentration, as previously described (19). a catheter was inserted into the brachial vein, and a calibrated syringe pump was used to administer regular insulin in a square wave at a rate of 200 mu / m / min. this infusion provided steady - state serum insulin levels that were maximally effective for promoting glucose uptake in skeletal muscle in patients with t2 dm and fully suppressing hepatic glucose production (19). to prevent hypokalemia, a variable - rate infusion of a 20% dextrose solution was used to maintain the plasma glucose level at 90 mg / dl for at least 3 h, with plasma glucose levels assessed every 5 min throughout the clamp. during the final three 20-min intervals, the mean glucose infusion rate was used to calculate maximal glucose uptake for each individual. whole - body glucose uptake was calculated based on the glucose infusion rate corrected for changes in the glucose pool size, assuming a distribution volume of 19% body weight and a pool fraction of 0.65. under these conditions, the glucose infusion rate in milligrams per minute is equal to the gdr, and the data were normalized to total body weight (kg) or body surface area (m). if normally distributed, the data were expressed as mean se, and the student t test was used to analyze whether differences between the patients with t2 dm with and without pll were statistically significant. if data were not normally distributed, values were presented as median (first third quartile), and statistical significance was determined using the nonparametric wilcoxon rank test. statistical analysis was performed using sas 9.2 software (sas institute, cary, nc) and microsoft excel. serum alanine aminotransaminase (alt), aspartate aminotransaminase (ast), and alkaline phosphatase (alp) values were expressed as a percentage of the clinical laboratory s established upper limit of the normal reference range. all patients were females, and the race / ethnicity distribution was four european americans, four african americans, one asian american, and one hispanic american. nine patients had t2 dm with variable severity of hyperglycemia, and one patient had prediabetes with impaired glucose tolerance (igt). as assessed by bmi (kg / m), patients ranged from lean (30). loss of subcutaneous fat in the forearms only (4 patients) and forearms and calves (3 patients) were the most common presentations, with lipodystrophy involving forearms, calves, and thighs in one patient (fig. 1.) and forearms, calves, thighs, and arms in two patients, with interscapular region involvement in one of these latter patients. with the loss of subcutaneous fat in the forearms and calves, we can not rule out the possibility that there was a gain in fat above the level of lipoatrophy, for example, in the arms and thighs (i.e., when the arms and thighs were not affected by lipoatrophy). patient 1 is shown with arrows indicating lipodystrophy of the forearms, thighs, and legs. the patients with pll were matched with 10 patients without pll based on t2 dm status, race, age, and bmi. accordingly, as reported in table 1, subgroups with and without pll both consisted of nine t2 dm patients and one igt patient, and there were no statistically significant differences in mean bmi (p = 0.94), age (p = 0.78), and fasting glucose levels (p = 0.19). in addition, the mean waist - to - hip ratio was equally elevated in both subgroups at 0.9, and mean blood pressures were comparable (data not shown ; p = ns). however, the mean hba1c was somewhat higher in the pll patients (10.6 0.6%) than in the control t2 dm subgroup (8.0 1.0% ; p 150 mg / dl) in 9 of the 10 patients with pll, with values ranging from 106 to 2,050 mg / dl. as shown in fig. 2c, the median triglyceride level was markedly elevated by more than threefold in the pll patients compared with patients without pll, with values of 400 (232491) vs. 129 (95156) mg / dl, respectively (p 30). loss of subcutaneous fat in the forearms only (4 patients) and forearms and calves (3 patients) were the most common presentations, with lipodystrophy involving forearms, calves, and thighs in one patient (fig. 1.) and forearms, calves, thighs, and arms in two patients, with interscapular region involvement in one of these latter patients. with the loss of subcutaneous fat in the forearms and calves, we can not rule out the possibility that there was a gain in fat above the level of lipoatrophy, for example, in the arms and thighs (i.e., when the arms and thighs were not affected by lipoatrophy). patient 1 is shown with arrows indicating lipodystrophy of the forearms, thighs, and legs. the patients with pll were matched with 10 patients without pll based on t2 dm status, race, age, and bmi. accordingly, as reported in table 1, subgroups with and without pll both consisted of nine t2 dm patients and one igt patient, and there were no statistically significant differences in mean bmi (p = 0.94), age (p = 0.78), and fasting glucose levels (p = 0.19). in addition, the mean waist - to - hip ratio was equally elevated in both subgroups at 0.9, and mean blood pressures were comparable (data not shown ; p = ns). however, the mean hba1c was somewhat higher in the pll patients (10.6 0.6%) than in the control t2 dm subgroup (8.0 1.0% ; p 150 mg / dl) in 9 of the 10 patients with pll, with values ranging from 106 to 2,050 mg / dl. 2c, the median triglyceride level was markedly elevated by more than threefold in the pll patients compared with patients without pll, with values of 400 (232491) vs. 129 (95156) mg / dl, respectively (p 400-fold from their baseline assessment (24). both of these studies suggest strongly that there is an underestimation of prevalence and variability in clinical presentation for the partial lipodystrophies. from another perspective, t2 dm and pll represent a new phenotype that further exemplifies the heterogeneous nature of t2 dm. it is tempting to hypothesize that fat loss in t2 dm and pll is an extreme manifestation of adipose tissue dysfunction generally observed in patients with metabolic syndrome and t2 dm, which features macrophage infiltration, fibrosis, inflammation, and dysregulated secretion of adipocytokines (eg, leptin, adiponectin, and resistin). in t2 dm with and without pll, adipose tissue defects lead to ectopic lipid accumulation in other tissues such as liver (25). these considerations suggest that patients with insulin resistance and t2 dm may exist along a continuum, with some patients having more subtle or subclinical diminution of subcutaneous fat in the distal extremities. given the history in several patients that the lipodystrophy preceded the diagnosis of diabetes and that one patient had prediabetes, any normoglycemic patient presenting with pll should be monitored closely for the eventual development of diabetes. in any event, more detailed studies of patients with t2 dm and pll compared with patients without pll are needed to elucidate pathophysiology, and additional reports are needed to more precisely define t2 dm with pll as a clinical entity. the profound degree of insulin resistance and lack of insulin - mediated glucose uptake should be considered in the choices and doses of antidiabetic medications, and careful evaluation and aggressive therapy for marked hypertriglyceridemia and steatohepatitis should be undertaken. along these same lines, promising results have been observed with leptin replacement therapy in patients with several types of lipodystrophy (2628). for example, a reduction in serum triglycerides and intrahepatic lipid content was demonstrated in patients with fpl after 6 months of metreleptin treatment (28). it remains to be seen whether pharmacological administration of leptin can ameliorate glycemic control, insulin resistance, hypertriglyceridemia, and hepatic steatosis in t2 dm with pll. even so, partial pll and the accompanying severity of metabolic abnormalities may not be rare. for the most part, patients in this study presented with t2 dm and were initially suspected to have pll by instinctively inspecting the forearms of each new patient during the introductory shaking of hands. certainly, all t2 dm patients with overt hypertriglyceridemia and hepatic transaminase elevations or with high insulin requirements should be examined closely for pll. thus, t2 dm with pll represents a previously unrecognized phenotype of lipodystrophy and of diabetes. these patients exhibit symmetrical lipodystrophy of the distal limbs, acanthosis nigricans, earlier onset t2 dm, and marked insulin resistance with little insulin - mediated glucose uptake, as well as hypertriglyceridemia and hepatic transaminase elevations that are greater in severity than observed in patients with commonly occurring t2 dm. | objectivelipodystrophies are categorized by the extent of fat loss (generalized vs. partial) and by inheritance (congenital vs. acquired). we examined whether a group of patients with partial lipodystrophy of the limbs (pll), type 2 diabetes mellitus (t2 dm), and an absence of a family history of lipodystrophy constitute a new clinical subtype.research design and methodsten women with t2 dm and pll were identified in academic diabetes clinics and were matched by age, sex, bmi, ethnicity, and diabetes status with 10 women with control t2 dm without lipodystrophy. all patients were characterized by clinical evaluation and hyperinsulinemic clamp.resultspatients with t2 dm and pll exhibited symmetrical loss of subcutaneous fat in forearms, or forearms plus calves, and acanthosis nigricans. maximally stimulated glucose disposal rates were markedly reduced by 56% in the t2 dm with pll group compared with the control t2 dm patients, whether normalized by body weight or surface area. most pll patients exhibited little or no insulin - mediated glucose uptake after subtraction of non - insulin mediated glucose uptake. the t2 dm with pll group also had greater elevations in hepatic transaminases and triglycerides and earlier onset of diabetes compared with control t2dm.conclusionst2dm with pll represents a previously unrecognized phenotype of lipodystrophy and of t2 dm. these t2 dm patients exhibit symmetrical lipodystrophy of the distal limbs, acanthosis nigricans, marked insulin resistance with little insulin - mediated glucose uptake, hypertriglyceridemia, and hepatic transaminase elevations, which are greater in severity than observed in patients with common t2 dm. |
leptospirosis is a zoonotic infection in humans and animals caused by leptospira species of the spirochete family (1). the first phase occurs during the active leptospira infection named as bacteriemic or septicemic phase. in this phase, flu - like symptoms (including fever, severe headache, myalgia, chills, nausea and vomiting, conjunctival suffusion, abdominal pain, anorexia, coughing and sore throat) occur for more than 5 - 7 days. the second phase, immunologic, occurs immediately after the bacteriemic phase or 1 - 3 days after asymptomatic period. ten percent of patients with leptospirosis are affected by a severe form of disease or weil 's syndrome (with a mortality rate of 5 - 40%) (2). common symptoms of this syndrome are due to liver, kidney and blood vessels involvement. symptoms of this severe disease occur after 3 to 7 days and include persistent jaundice, decreased urine output, anemia, rash, hypotension, shock, changes in consciousness, skin and mucosal hemorrhagic lesions and pulmonary hemorrhage (1 - 6). on entering the body, there is widespread hematogenous dissemination and penetration of tissue barriers, including invasion to the central nervous system and aqueous humor of the eye. transendothelial migration of spirochetes is facilitated by a systemic vasculitis, accounting for a broad spectrum of clinical illness (2, 7). severe vascular injury can be developed, leading to pulmonary hemorrhage, ischemia of the renal cortex and tubular - epithelial cell necrosis, and destruction of the hepatic architecture, resulting in jaundice and liver cell injury, with or without necrosis (2, 8 - 11). immune - mediated mechanisms have been postulated to affect the severity of symptoms and immune mechanisms, including circulating immune complexes, anticardiolipin antibodies, and antiplatelet antibodies, but their significance has not been proven yet (2). old age, pneumonia, renal failure, and thrombocytopenia are associated with a bad prognosis (1). thrombocytopenia occurs in the absence of disseminated intravascular coagulation and may accompany progressive renal dysfunction (2). in this study, we investigated the role of corticosteroids to improve thrombocytopenia due to leptospirosis. this study was approved by the ethics committee of mazandaran university of medical sciences (code no : 9186, date : december 19, 2012). the sample size in each group was calculated based on previous studies including that performed by villanueva. the sample size was calculated as 22 based on the following formula, but we enrolled 56 patients. n = (2 (z1-/2 + z1-))/(1 - 2) = 22 1 = 8.3, 2 = 7.6, = 0.05, = 0.2, = 0.0625. totally, 187 patients were admitted as leptospirosis based on clinical and epidemiologic criteria in razi hospital of ghaemshahr, north of iran from august 2011 to september 2013 (two years) (serology tests had not positive results in all cases, those patients diagnosed clinically with false negative serology results were excluded). thrombocytopenia was classified to mild (plt < 150000), moderate (plt < 100000) and severe (plt platelet count had normal findings in 17 patients and 98 cases had mild thrombocytopenia and thus excluded. the treatment group received corticosteroid (prednisolone 1 mg / kg / day) in addition to antibiotic therapy (ceftriaxone 1 g / iv / daily) until improvement of thrombocytopenia or for a maximum one - week and the control group received the same dosage of antibiotics, but received placebo instead of corticosteroid during this period. exclusion criteria were patients with negative mat or those with any health - threatening complications caused by corticosteroid or patients who had previous intake of steroids or other antibiotics two weeks or less prior to the diagnosis of disease and patients whom their clinician did not administered steroids due to some compelling factors like hypersensitivity to steroids, and finally those who were not willing to participate. sixteen patients due to absence of serologic evidence (mat had negative results) were excluded and the final analysis was performed on 56 patients in two divided groups. statistical analysis was performed by independent t - test, chi - square, kaplan - meier, log rank and breslau using spss software (version 13). to confirm the diagnosis of leptospirosis by mat, serum was separated immediately and poured into a sterile polypropylene tube and sent to the reference laboratory of hisarak while maintaining the cold chain. patients age in the two groups (cases and controls) was compared using independent t - test, which had no significant difference (p = 0.254). the average age in case group was 49.75 8.45 and 46.68 11.26 years in the control group. gender was assessed using chi - square test, which revealed no statistical difference between the two groups (p = 0.789). treatment group included 14 females and 14 males and control group 13 females and 15 males. time needed for the improvement of thrombocytopenia was evaluated in the two groups using kaplan - meier and log rank test. the treatment group required a mean duration of 4.41 0.197 days and the control group 5.72 0.318 days. the treatment group had a median of 4 0.215 days and the control group 5 0.255 days (log rank was 8.625), which was statistically significant (p = 0.003) (degree of freedom (df) = 1) (figure 1 and table 3). duration of hospitalization in the two groups was compared using kaplan - meier, log rank and breslau test. the treatment group had a mean of 5.24 0.244 days and the control group 6.23 0.329 days. the treatment group had a median of 5 0.221 days and the control group 6 0.297 days (log rank was 4.825) ; therefore, there was a significant difference between them (p = 0.028), df = 1 and breslau = 4.916 with df = 1 and p = 0.027 (figure 2 and table 3). there was no significant difference between the two groups regarding mortality rate, intubation, platelet count, duration of icu admission, and pulmonary, renal or hepatic involvement. in our study, five patients expired including two patients in the case group (one in moderate thrombocytopenia subgroup and the other in the severe thrombocytopenia subgroup) and three in the control group (all in the severe thrombocytopenia subgroup). the two groups were divided into two subgroups according to the severity of thrombocytopenia (table 2) as moderate (50000 < plt < 100000) and severe (plt < 50000). the two subgroups of moderate and severe thrombocytopenia were compared regarding required time for thrombocytopenia improvement ; p - values in moderate and severe subgroup were 0.016 and 0.001, respectively, which was statistically significant. besides, duration of hospital stay was compared between moderate and severe subgroups using brislow test ; p - values were 0.06 and 0.006, respectively, there was no significant differences in moderate group, but the group there were severe a statistical difference was significant (table 3). there was no significant difference between the two subgroups (moderate and severe thrombocytopenia) between the case and control groups regarding mortality, intubation, length of stay in icu, pulmonary, renal or hepatic involvement and platelets count. abbreviations : icu, intensive care unit ; cxr, chest x - ray ; n / v, nausea and vomiting ; loc, decreased level of consciousness ; lap, lymphadenopathy ; esr, erythrocyte sedimentation rate ; crp, c - reactive protein ; inr, international normalized ratio ; bill - t, bilirubin - total ; bill - d, bilirubin - direct ; ast, aspartate aminotransferase ; alt, alanine aminotransferase ; alk.p, alkaline phosphatase. duration = duration in days required for the improvement of thrombocytopenia. hospitalization = length of hospital stay (in days). there was no significant difference between the two groups regarding renal, pulmonary or hepatic involvement, intubation, mortality rate and hospitalization duration in icu. the above situations were not improved with treatment of glucocorticoid. despite the fact, required duration for the improvement of thrombocytopenia and duration of hospitalization in two groups were different significantly. on the other hand, treatment with corticosteroids have an essential role in the treatment of many immune - associated diseases, such as sle, rheumatoid arthritis (ra) and itp. prednisolone (1 mg / kg / day) is used for the treatment of mild itp (immune or idiopathic thrombocytopenic purpura) ; while, high - dose corticosteroid (steroid pulse therapy) is used for the severe forms (1, 13). russell villanueva. in the philippines, performed an investigation on 36 patients with leptospirosis and found no significant reduction in mortality, duration of hospitalization and dialysis rates between the control and steroids groups (12). furthermore, a study by trivedi. in india performed on 602 patients showed that renal and liver involvements had no effect on mortality (14). similarly, in this study, statistical analysis showed that renal, lung or liver involvements and the severity of thrombocytopenia had no effect on mortality. contrary to our results, a clinical trial on 30 patients by vv shenoy. in india showed that corticosteroid therapy within 12 hours of pulmonary involvement due to leptospirosis decreased the mortality rate (15). our study showed that corticosteroid therapy decreased hospital stay only in severe subgroup thrombocytopenia (not in the moderate subgroup). to optimally determine whether adjunctive steroid use in leptospirosis is beneficial, an adequately powered randomized control trial with a larger sample size is recommended. | background : thrombocytopenia is associated with a bad prognosis in leptospirosis.objectives:we investigated the effect of corticosteroids to improve thrombocytopenia due to leptospirosis.patients and methods : in a clinical trial, all patients admitted with leptospirosis in razi hospital of ghaemshahr, north of iran were enrolled in a 2-year study. totally, 56 patients with moderate to severe thrombocytopenia were randomized to control and treatment groups. the treatment group received corticosteroid (prednisolone 1 mg / kg / day for maximum one week) in addition to the standard antibiotic therapy.results:there was no significant difference regarding age and gender between the two groups (p = 0.254, p = 0.789, respectively). the mean duration to improve thrombocytopenia was 4.41 0.197 days in the treatment group and 5.72 0.318 days in the control group, which was significantly different (p = 0.003). duration of hospitalization in the treatment group was 5.24 0.244 days and 6.23 0.329 days in the control group, which was significantly different (p = 0.028). the two groups had no significant difference regarding mortality, intubation, level of platelet, duration of icu admission and pulmonary, renal or hepatic involvement.conclusions:corticosteroid therapy decreased the length of hospitalization only in severe subgroup thrombocytopenia, but not in the moderate subgroup. |
coupling of metal on conventional polyethylene have been traditionally used as bearing surface of total hip arthroplasty (tha). however, this coupling could make debris of polyethylene resulting in an aseptic loosening over time is well known1). previous other studies reported young age and increased activity levels as independent risk factors for an aseptic loosening23). for this reason, an alternate bearing surfaces such as ceramic on ceramic (coc), metal on highly cross - linked polyethylene (hxlpe) have been used in young patients45). since 2004, our adult artificial joint reconstruction institute started to use a 36 mm metal head coupling with hxlpe for primary tha, if possible. to gain better artificial hip joint stability, 36 mm metal head have been used popularly6). also, to reduce wear problem of polyethylene, the use of hxlpe have increased7). so, our institute has used 36 mm metal head coupling with hxlpe as articulation surface regardless of patient age. currently, many papers are focusing on coc bearing surface of tha for younger cohort8910). on the other hand, few reports were for results of 36 mm metal head coupling with hxlpe as younger cohort 's bearing surface. the purpose of this paper is to evaluate the results of primary tha using 1st generation hxlpe in patients aged 50 years and less with minimum five year follow - up. a retrospective review of 52 consecutive primary thas performed by one senior author was conducted. among 52 cases, so, we evaluated 41 hips (31 patients ; 14 males and 17 females). all patients underwent tha with a 36 mm metal head on hxlpe between 2004 and 2010. osteoarthritis included 13 cases of 2nd osteoarthritis (dysplastic hip sequela 9 cases, post - traumatic sequela 4 cases, slipped capital femoral epiphysis sequela 1 case). another 9 cases were ankylosing spondylitis and 7 cases underwent primary tha due to osteonecrosis of femoral head (table 1). mean patient 's age was 41 years (range, 22 - 50 years), and mean follow - up duration was 83 months (62 - 139 months). a cementless acetabular cup with a porous coating (trilogy ; zimmer inc., warsaw, in, usa) and a hxlpe with an inner diameter of 36 mm (longevity ; zimmer inc.) were placed in all patients. acetabular components had an average outer diameter of 54 mm (range, 50 - 60 mm). 1050 polyethylene, which had been pre - heated and cross - linked with a 9.5 mrad electron - beam. the preforms were then melted to eliminate the remaining free radicals and sterilized using a gas plasma. components were used in 32 cases underwent cementless femoral fixation (fig. 1) and versys (zimmer inc.) components in 9 cases underwent cemented femoral fixation. all surgical procedures was modified hardinge 's approach with the patient in the lateral position. all acetabular components were inserted using a press fit technique with under reaming of the acetabulum by 1 to 2 mm. to secure initial mechanical stability of the acetabular component, we used adjunctive acetabular screw when needed. if cementless femoral stem had a rotational instability when subject to rotational stress test after femoral trial stem insertion, we used cemented femoral fixation regardless of patient 's age. all cementless stems were inserted using standard press fit techniques to insure longitudinal and rotational stability, and all cemented femoral stems were inserted using meticulous third generation cementing techniques. prophylactic antibiotics were administrated to all 41 cases, and the same postoperative protocol was used in all. patients were allowed to sit on the first postoperative day and stand with supports, according to ability, after blood drainage removal. no range of motion limitation was present immediately after surgery, and no abduction pillow was used in any patient. patients were followed at 6 weeks, and at 3, 6, and 12 months postoperatively. in addition, modified harris hip scores (hhs) and merle d'aubigne and postel score were determined. modified hhs were classified as excellent (91 - 100), good (81 - 90), fair (71 - 80), or poor (61 - 70), and the merle d'aubigne and postel scores were used to categorize patients to six grades according to level of pain (1 - 6), mobility (1 - 6), and the ability to walk (1 - 6). in cases that underwent uncemented fixation, the status of fixation of femoral component was assessed using the method of engh.11), and in cases that underwent cemented fixation, femoral components were assessed the amount of cement filling using the method of barrack.12), using immediate postoperative radiographs. all radiographic examinations included an anteroposterior (ap) view of the pelvis centered over the pubis, and axial view by a shoot through lateral of the hip. acetabular cup abduction angles were measured using the methods of engh.13) and kennedy). the evidence of linear radiolucencies, bony ingrowth, fracture, and osteolysis were determined using sequential radiographic views, which also allowed comparative assessments of component position versus immediate postoperative views to determine the presence of component migration and/or loosening. penetrations of femoral head into polyethylene liners were calculated as two - dimensional linear penetrations on ap radiographs of the pelvis using polyware pro three - dimensional distal version 5.10 software (draftware inc., vevay, in, usa) by well - trained one chief resident. 2). in this program, wear rate is calculated through the 3-point marked on edges of the femoral head and acetabular cup using serial plain radiograph. this program allowed us to know volumetric wear size using pelvis ap and axial view. so, we decided to check linear wear rate using serial pelvis ap view only. we checked bedding in state wear using postoperative and post one year operative pelvis ap view16). to check steady state wear rate, this program divided the result with the number of year and let us know annual wear rate automatically. average modified hhs at final follow - up was 875 (range, 81 - 98), and it was better than ' good ' in all cases, and merle d'aubigne and postel scores were more than 15 (range, 15 - 18) in all cases. radiographic final follow - up exams showed stable fixation in all patients with uncemented femoral components, and barrack type a or b in all patients with cemented femoral components. mean acetabular cup inclination and anteversion were 45.81(range, 36.33-54.91) and 13.26(range, 6.72-27.71), respectively. there was no radiographic evidence of osteolysis in the pelvis or proximal femur, and no acetabular cup or femoral stem failing due to aseptic loosening. in all patients, average femoral head penetration during the first postoperative year (predominantly representing polyethylene creep) was 0.0640.002 mm / year, and the average steady - state wear rate determined using radiographs taken at oneyear postoperatively and at latest follow - up was 0.0420.001 mm / year. first is high activity of young cohort, second is patient 's remained long life span. this condition will result in more wear rates of articulation surfaces compared with old. improvement in prosthetic design and bearing surfaces has eliminated in concerns of wear problem in younger patients. however, concerns of coc bearing surface 's negative property remained 1819). besides problems of squeaking and fracture of ceramic head, some paper reported possibility of increasing stress on trunnion compared with metallic head when using big size of femoral head20). our institute has used 36 mm metal head coupling with hxlpe as an articulation surface regardless of patient 's age. it has been shown that hxlpe wear rates decreased by 58% to 74% over the ultra - high molecular weight polyethylene in vitro study21). during midterm follow - up for this cohort, steady - state wear rate was 0.0420.001 mm / year. this result is less than 0.1 mm / year regarded as osteolysis threshold wear rate established by dumbleton). but, there are also some trade - offs in using 36 mm metal head coupled with hxlpe. unfortunately, the increase in gamma radiation dose is associated with the degradations of other mechanical properties including a decrease in tensile yield strength and fatigue strength and resultant liner breakage23). previously, our institute reported a liner rim area breakage case in tha after using 1st generation hxlpe mated against 36 mm metal head21). majority of these reports pointed out high body mass index (bmi), improper acetabular cup position, thin liner thickness and impingement between femoral stem and liner, etc. this patient belonged to normal bmi and proper acetabular cup position so called ' safe zone ' on radiographs. so, we conducted revision with larger acetabular cup than index operation to apply thicker liner. the average liner thickness of this 41 cohorts was 7.46 mm (range, 6.8 - 9.9 mm). in this cohort, there was no liner breakage during follow - up periods. during follow - ups, she sustained car accident and had injury of femoral head posterior dislocation with acetabular fracture. anteversion of the index cup was 8. the patient underwent isolated acetabular revision just after second dislocation, and has done routine indoor activity well since then. there were some reports 36 mm metal head could result in high volumetric wear compared with 28 mm metal head25). polyware software could measure volumetric wear size using pelvis ap and axial view. however, hip axial we conducted during follow - up periods showed irregularity could result in some errors of measuring wear rate. so, we decided to check linear wear rate using serial pelvis ap view only. it is well known inflammatory disease cohort show a lower activity compared with other disease cohort26). third, our study has some limitations on measuring wear rate. as to method of wear measurement, radiostereometric analysis (rsa) however, many radiographic in vivo studies of polyethylene wear in tha are restricted to measurements on plain radiographs because the rsa set - up is expensive and not widely available. polyware software does not supply the accuracy required, and for such situations we recommend rsa. for assessment of medium - term or long - term wear measurements in larger groups of patients, it is known as the polyware method is optimal, simple, and in relatively close agreement with the gold standard of rsa. based on this finding, we think 36 mm metal head coupling with hxlpe as the good alternate articulation surface when planning tha for patients aged 50 years and less. | purposewe evaluated the clinical and radiographic midterm results of primary total hip arthroplasty (tha) using a 36 mm diameter femoral head on 1st generation highly cross - linked polyethylene (hxlpe) in patients 50 years and less with minimum five year follow-up.materials and methodswe retrospectively reviewed 31 patients (41 hips) aged 50 years and less underwent primary tha with a 36 mm diameter femoral head on hxlpe between 2004 and 2010. clinical follow - ups included specific measurements like modified harris hip scores (hhs) and merle d'aubigne and postel score. for radiologic evaluations, together with position of acetabular cup at six weeks later of postoperation, we separately calculated the penentrations of femoral head into polyethylene liners during postoperation and one year later check - ups, and during one year later check - ups and final check-ups.resultsthere were no major complications except for one case of dislocation. average modified hhs at final follow - up was 88 (81 - 98), and merle d'aubigne and postel scores were more than 15. mean acetabular cup inclination and anteversion were 45.81(36.33-54.91) and 13.26(6.72-27.71), respectively. average femoral head penetration of steady - state wear rate determined using radiographs taken at one - year postoperatively and at latest follow - up was 0.0420.001 mm / year.conclusionbased on minimum 5 years clinical results, we think 36 mm metal head coupling with hxlpe as the good alternate articulation surface when planning tha for patients aged 50 years and less. |
we describe three cases of submacular hemorrhage (smh) that occurred two to four days after anti - vascular endothelial growth factor (anti - vegf) intravitreal injection for occult choroidal neovascularisation (cnv) in age related macular degeneration1 (amd) and their management. almost 2500 anti - vegf intravitreal injections for neovascular amd were performed in our department between january 2007 and december 2009. three patients developed an acute smh after the injection involving most of the macular region. fundus fluorescein angiography (ffa), indocyanine green angiography (icga) and optical coherence tomography (oct) were carried out. an injection of 0.2 ml of subretinal recombinant tissue plasminogen activator (rtpa) (125 g / ml) through a 41-gauge flexible translocation microcannula (dorc - dual bore bss injection needle 0.1 mm tip) followed.2 the rtpa was injected inferiorly to the smh in order to create a bullous retinal detachment encompassing the entire blood clot. finally a fluid - air exchange was performed and patients maintained a supine position for 45 minutes followed by a postoperative prone position. in january 2008, a 67-year old woman with 20/20 visual acuity and metamorphopsia in her right eye (re) had been treated for seven months with an injection of ranibizumab each month for an occult cnv. the ffa performed at that time demonstrated, in the re, a paramacular pigment epithelial detachment of 8.07 mm and a serous neuroepithelial detachment involving the fovea (figure 1). four days after the 8th intravitreal anti - vegf injection a srh developed and the visual acuity dropped to light perception. the patient had four further intravitreal injections of bevacizumab between may 2008 and august 2008. an 84-year old woman, affected by cardiac arrhythmia treated with amiodarone, presented in january 2008 complaining of metamorphopsia in her re. an occult cnv due to amd was identified and she underwent three intravitreal bevacizumab injections in the re. in april 2008 her visual acuity was 20/125 in the re and 20/63 in the left eye (le), and the ffa and icga demonstrated an occult choroidal neovascularisation of 18.55 mm in the le. two days after the first intravitreal injection of bevacizumab, she developed a thick smh and her visual acuity decreased to hand motion. in june 2007 a 72-year old woman, who had already undergone in her re four ranibizumab injections for a wet amd, started complaining of metamorphopsia in her le with a visual acuity of 20/20. a ranibizumab intravitreal injection was carried out in her le and two days after a smh occurred (figure 2). one year after surgery (figure 3) her visual acuity was unmodified and no other treatment was performed. submacular hemorrhage is not a rare complication during the natural history of occult neovascularisation in amd. it has been reported that it occurs in 17.0% of amd cases with the presence of retinal pigment epithelial detachment (ped).3 this complication has been also described after photodynamic therapy especially in cases of amd with ped.49 in our cases only in one of the three patients was a ped present before the treatment (case 1). in that case recently a few studies have described the occurrence of large submacular hemorrhages after the intravitreal injection both of bevacizumab and ranibizumab. karagiannis has hypothesized that this event might also be due to changing from bevacizumab to ranibizumab.10 in the cases that we report, only one kind of anti - vegf was injected in each patient before the occurrence of the hemorrhage. the mechanism of submacular hemorrhage in these cases remains unknown, but it has been hypothesized that the contraction of the neovascular membrane could lead to new vessels rupturing, especially in large lesions.11,12 in addition, a reduction of tight junctions in retinal pigment epithelial and endothelial cells related to the decrease in vegf availability could promote the vessel rupture,13 even though recently peng have demonstrated that permeability and selectivity of the junctions are not affected by vegf, bevacizumab or ranibizumab.14 vascular endothelial growth factor regulates crucial processes, such as embryo- and organogenesis as well as immune system, endocrinology, hematopoiesis, (lymphoid) vessel architecture and reparative processes in adults.15,16 it might be therefore expected that its inhibition could cause multiple adverse effects. although the intravitreal administration of smaller doses can drastically reduce systemic exposure, and current and past clinical trials do not provide sufficient statistical power when evaluating whether systemic events significantly differ between the treatment and control groups,1721 possible local side effects on retinal perfusion and survival of neuronal tissue must be taken into consideration.22 goverdhan and lochhead1 has described four cases of submacular hemorrhage after intravitreal bevacizumab all occurring in large neovascular lesions and the same finding was described by baeteman reporting six cases of submacular hemorrhage after ranibizumab injection.23 in these series the hemorrhages developed at a median of 14 to 25 days after the anti - vegf injection, while in our cases the median was 2.6 days. moreover it is interesting to note that the patient described in our third case developed a large subretinal hemorrhage after the injection but the initial lesion was relatively small and no ped was noticed. the occurrence of submacular hemorrhage has been also related to anticoagulant therapy and to increased blood pressure.2426 in our series no patients had history of systemic hypertension or anticoagulant treatment. the toxicity of subretinal blood to the neurosensory retina has been demonstrated in clinical studies27 and in animal models.28 possible mechanisms of blood - induced retinotoxicity include mechanical effects such as fibrotic shearing of photoreceptors, hypoxia, and metabolic disruption imposed by the clot as a diffusion barrier. direct neurotoxicity seems to be induced by the migration of blood components, such as iron, to the photoreceptor layer.29 the management of submacular hemorrhage has evolved greatly during the past 15 years. a variety of therapeutic approaches have been developed, all with the common goal of clearing the submacular blood to minimize permanent damage to the photoreceptors and retinal pigment epithelium. many options have been proposed including intravitreal gas injection;30,31 pars plana vitrectomy and submacular surgery, both with and without the assistance of rtpa;3238 intravitreal injection of gas and pneumatic displacement of the submacular hemorrhage with associated intravitreal injection of rtpa;3941 pars plana vitrectomy ; subretinal injection of r - tpa and fluid gas exchange;42 pars plana vitrectomy and subretinal rtpa injection, followed by evacuation of the liquefied blood through a 500 m retinotomy with the aid of perfluorocarbon compression of the overlying retina;43 intravitreal anti - vegf;44 combined rtpa, expansile gas and bevacizumab;45 and co - application of rtpa and bevacizumab.46 many procedures include the use of rtpa. subretinal rtpa has recently been demonstrated to achieve best anatomical results than intravitreal rtpa.47 patients with subretinal hemorrhages secondary to amd are psychologically distressed as a result of acute loss of vision.48 in our series subretinal r - tpa injection followed by gas tamponade allowed the displacement of the hemorrhage in all the three cases enabling the follow - up and the further treatment of the amd. large subretinal hemorrhage is a possible complication of intravitreal anti - vegf treatment in amd and it may occur days or weeks after the injection. further studies are required for the complete comprehension of the mechanism of the pathogenesis. the surgical approach with vitrectomy, | we describe three cases of submacular hemorrhage that occurred two to four days after anti - vegf intravitreal injection for occult choroidal neovascularisation in age - related macular degeneration and their management with 25 gauge pars plana vitrectomy with injection of subretinal recombinant tissue plasminogen activator (rtpa) followed by fluid - air exchange and postoperative prone position. vitrectomy, subretinal rtpa injection and fluid - gas exchange apply as a safe and effective treatment in these cases. functional results seem to be positive especially if surgical treatment is promptly performed. |
teeth being the central component of the masticatory apparatus of the skull are good sources of material for civil and medicolegal identification. teeth provide resistance to damage in terms of bacterial decomposition and fire when rest of body is damaged beyond recognition which makes them valuable tool in forensic investigation. sexual dimorphism refers to the systemic difference in the form (either in shape or size) between individuals of different sexes in the same species. sex determination using dental features is primarily based upon the comparison of tooth dimensions in males and females, or upon the comparison of frequencies of nonmetric dental traits, like carabelli 's trait of upper molars. mesiodistal and buccolingual diameters of the permanent tooth crown are the two most commonly used and researched features used in determining sex on the basis of dental measurements. yuen. conducted a study on mesiodistal dimension of deciduous and permanent teeth of the southern chinese population and found that none of the primary teeth nor three of the permanent teeth were found to have significant sex differences in size. percentage sexual dimorphism ranged from 0.06% to 1.97% for the primary teeth and from 0.36% to 5.27% for the permanent teeth. the aim of the present study was firstly to investigate whether there is any sexual dimorphism observed between mesiodistal (m - d) dimension of permanent maxillary incisors, canines, and secondly, the accuracy with which these could be employed for the determination of sex in population. the study sample consisted of 100 dental students (50 males and 50 females) selected from d.j. college of dental sciences and research, modinagar belonging to north india, who were selected based on the following criteria : age-20 - 30 years.complete set of fully erupted teeth.peridontally healthy teeth.noncarious teeth.nonattrited and intact teeth.satisfactorily aligned maxillary teeth, no spacing or diastema, and no crowding.no history or clinical evidence of crown restoration, orthodontic treatment, trauma. complete set of fully erupted teeth. no history or clinical evidence of crown restoration, orthodontic treatment, trauma. after obtaining informed consent, the maximum mesiodistal dimension of each tooth was measured between the anatomic contact points directly on the subject, with the help of a digital vernier caliper accurate to 0.01 mm (mitutoyo digital caliper, japan) held parallel to the occlusal plane. if it was difficult to place the vernier caliper, manual divider was used with very fine tips to measure the dimension ; later we measured the divider distance with the same digital vernier caliper [figure 1 ]. measuring the mesiodistal dimension of the maxillary right central incisor clinically on the patient with an electronic vernier caliper all the measurements were done by a single examiner to eliminate interobserver error. each reading was taken three times and the average of three values was obtained to minimize the intraobserver error. the mean, range, and standard deviation were calculated for the size of the teeth. a two - sample t - test was used to test for statistical difference between means. table 1 shows detailed description of each tooth selected for study such as a mean value and standard deviation and p value both for males and females separately. statistical analysis of permanent maxillary incisors and canines showed that the mesiodistal dimensions of only right and left maxillary canines were significantly different in males compared to those in females. raw coefficients are the discriminant function coefficients used to calculate the discriminant score. to assess the sex, tooth dimensions are multiplied with the respective raw or unstandardized coefficients and added to the constant. if the values thus obtained were greater than the sectioning point the individual was considered a male and if less than the sectioning point the individual was considered female. i.e., y = a + b (p1) + b(m2) where a = constant of function between right and left maxillary canines, b = unstandardized coefficient of that particular tooth [table 2 ]. canonical discriminant function coefficient tables 3a c shows the level of determining sex accurately in males and females when right and left maxillary canines are considered separately and in combination respectively. accuracy of determination of sex using teeth 13 accuracy of determination of sex using teeth 23 accuracy of determination of sex using teeth 13 and teeth 23 when the level of accuracy for sex determination was measured using right maxillary canine separately, it was found that 44% females and 54% males were classified correctly whereas when the level of accuracy for sex determination was measured using left maxillary canine separately, 60% females and 60% males were classified correctly. when the level of accuracy for sex determination was measured using right and left maxillary canines together, it was found that 64% females and 58% males were classified correctly. table 4 shows the range of the measured mesiodistal dimension of right and left maxillary canines (which shows sexual dimorphism) for both males and females. percent of dimorphism the percentage of dimorphism is defined as the percentage by which the tooth size of males exceeds that of females. the percentage of dimorphism for each tooth was calculated using the following formula : percentage of dimorphism = { (xm / xf)1 } 100 where xm = mean male tooth dimension ; xf = mean female tooth dimension. the percentage of dimorphism is defined as the percentage by which the tooth size of males exceeds that of females. the percentage of dimorphism for each tooth was calculated using the following formula : percentage of dimorphism = { (xm / xf)1 } 100 where xm = mean male tooth dimension ; xf = mean female tooth dimension. table 4 shows percent of dimorphism as observed for right and left maxillary canines. gender determination in damaged and mutilated dead bodies or from skeletal remains constitutes the foremost step for identification in medico - legal examination and bioarcheology. whenever it is possible to predict the sex, identification is simplified because then missing persons of only that sex need to be considered. although the dna profile gives accurate results yet measurement of linear dimensions such as arthopometric or odontometric parameters can be used for determination of sex in a large population because they are simple, reliable, inexpensive, and easy to measure. considering the fact that there are differences in odontometric features in specific populations, even within the same population in the historical and evolutional context, it is necessary to determine specific population values in order to make identification possible on the basis of dental measurements. thus the study evaluated mesiodistal dimension of permanent maxillary incisors and canines specific for males and females of the north indian population. doris. have indicated that the early permanent dentitions provide the best sample for tooth size measurements because early adulthood dentition has less mutilation and less attrition in most individuals. consequently, the effect of these factors on the actual mesiodistal tooth width would be minimum. thus only subjects in the 20 - 30 years age group were included in the study sample. various odontometric dimensions have been used for the purpose of sex estimation such as mandibular canine index, buccolingual dimension of teeth, and height of tooth. in this study, all the required dental measurements were taken directly on the subjects. as it was difficult to accurately measure the buccolingual width, of maxillary incisors, and canines, under indirect vision, only the mesio - distal width of these teeth was evaluated for sexual dimorphism. univariate analysis of the study showed that m - d dimensions of male dentition are greater than those of females which is in accordance with previous studies. richardson. found that teeth of males tend to be larger than those of females for each type of tooth in both the arches. howe. in their study found combined mesiodistal width for males to be more compared to females. in this study, statistically significant dimorphism was exhibited by only two permanent maxillary anterior teeth, i.e., right and left maxillary canines. the hashim and murshid study in 1993 also showed that the canines were the only teeth to exhibit sexual dimorphism., studied the magnitude of sexual dimorphism by measuring the mesiodistal width of the canine teeth and showed that however, minzuno reported that maxillary canine showed a higher degree of sexual dimorphism compared to the mandibular canine in a japanese population. also exhibited a sexual dimorphism which is in accordance with the studies conducted on turks by iscan. a study conducted by otuyemi and noar shows dimorphism in maxillary canines bilaterally and another by lund and monstad shows dimorphism of maxillary canine. the multivariant analysis of the data showed that when combination of values for right and left maxillary canines was taken 64% females were classified correctly and 58% males were classified correctly. however the study conducted by al - rifaiy showed that an average of 65.5% individuals could be classified correctly. according to moss, it is because of the greater thickness of enamel in males due to the long period of amelogenesis compared to females.because of y chromosomes producing slower male maturation. according to moss, it is because of the greater thickness of enamel in males due to the long period of amelogenesis compared to females. because of y chromosomes producing slower male maturation. some authors have explained that such variation could be due to environmental influences on tooth size. variation in food resources exploited by different populations has been explained as one such environmental cause. there can be a complex interaction between a variety of genetic and environmental factors that are responsible for the variation in the magnitude of dimorphism. according to garn., teeth have behaved in many ways through the course of evolution, ranging from reduction of the entire dentition to reduction of one group of teeth in relation to another. the study evaluated the use of a linear dimension (mesiodistal) of permanent maxillary incisors and canines because of simplicity and reliability. the study showed that right and left maxillary canines can be used for sex determination with 64% of accuracy in the case of females and 58% accuracy in the case of males. thus this study indicates that maxillary canines show significant sexual dimorphism and can be used as an adjunct along with other accepted procedures for sex determination when fragmentary remains are encountered in mass disasters. | background : sexual dimorphism refers to the differences in size, shape, etc., between males and females. the dentition 's use in sex assessment has been explored and advocated owing to its strength and resistance to peri- and post - mortem insults.objectives:the study evaluated permanent maxillary incisors and canines for sexual dimorphism and estimated the level of accuracy with which they could be used for sex determination.materials and methods : the study was conducted on 100 subjects (50 males, 50 females). the mesiodistal dimension of permanent maxillary incisors and canines was measured and the data were subjected to statistical analysis.result:univariate analysis revealed that all permanent maxillary incisors and canines exhibited larger mean values of mesiodistal dimension in males compared to females but only canines were found to be statistically significant for sexual dimorphism.conclusion:the study showed maxillary canines exhibiting significant sexual dimorphism and can be used for sex determination along with other procedures. |
retrotransposons are mobile genetic elements, closely related to retroviruses, which use their own proteins in conjunction with cellular machinery to replicate independently of the genome. the yeast retrotransposon ty3, and retroviruses such as human immunodeficiency virus type-1 (hiv-1), encode reverse transcriptase (rt), a dna polymerase that converts the single - stranded rna (ssrna) genome of positive polarity into double - stranded dna (dsdna). during this reverse transcription process, two obligatory dna strand transfers occur to generate the long terminal repeats (ltr) that control genomic dna integration and its expression (1). in the early stages of replication, a trna primer anneals to the primer binding site (pbs) close to the 5-end of the ssrna, where rt synthesizes the complementary dna (cdna) strand, referred to as minus strand strong stop dna (-sssdna). while rt synthesizes -ssdna, its rnaseh domain degrades the 5-end of the rna template. further dna polymerization requires -sssdna transfer, where the newly synthesized single - stranded cdna anneals to the 3-untranslated terminal region (utr) of the rna template (13). however, thermodynamically stable structures within the cdna and the 3-utr rna make duplex formation improbable. the nucleocapsid (nc) protein acts as a nucleic acid chaperone that destabilizes these secondary structures and facilitates dna rna hybrid formation (48). nc also participates in the second dna strand transfer, where the plus dna strand anneals to the structured pbs region of the minus dna strand (912). these transfer events are required for rt to transcribe the remaining genomic rna into dsdna flanked by the ltr, which the homologous enzyme integrase inserts into the cellular genome. replication of retroelements requires the nucleic acid chaperone activity of nc proteins, which tend to be small cationic proteins with minimal structure other than one or two cchc - motif zinc fingers (13,1317). hiv-1 nc is 55 amino acids in length, with two zinc fingers and a basic n - terminal tail (13). it directs annealing of the trnai primer to the pbs of the genomic rna (5,18,19). the viral rna has 5 and 3 repeat regions that include stable trans - activation response element (tar) hairpins, and hiv-1 nc facilitates rearrangement of these nucleic acids during the minus strand transfer step of reverse transcription (1012). nc is also an essential nucleic acid chaperone involved in genomic rna dimerization and virus assembly (2024). the chaperone activity of hiv-1 nc involves nucleic acid aggregation, duplex destabilization and rapid binding kinetics (2530). nucleic acid aggregation, an effect due to protein - induced interactions that make the dna molecule attracted to itself, is associated with the cationic domain of hiv-1 nc. duplex destabilization involves aromatic residues in the zinc fingers, which stack with ssdna bases (31,32). thus optimal chaperone activity of hiv-1 nc is highly sensitive to the zinc - finger architecture, and relies on a delicate balance between destabilizing secondary structures and promoting complementary strand annealing. a recent study examining the nucleic acid chaperone activity of nc proteins from several retroviruses established that the nucleic acid interaction characteristics that are important for nucleic acid chaperone activity varied significantly for different viruses (33,34). from these studies, it is clear that hiv-1 nc has optimal chaperone activity compared to other nc proteins. although nucleic acid chaperones from hiv-1 and other retroviruses have been extensively studied, less is known about chaperone activity in ltr retrotransposons (4,35,36). since ty3 nc is a likely ancestor of hiv-1 nc, here we examine its nucleic acid chaperone properties and compare them to those of hiv-1 nc. in addition to allowing comparison of ty3 nc to the paradigm of nucleic acid chaperone proteins, understanding these differences may also be useful for the development of drugs that target the nc protein from the rapidly evolving hiv-1 retrovirus (3739). ty3 nc is a 57-residue protein with one zinc finger and a basic n - terminal tail (40). ty3 nc is monomeric in solution, and it is required for efficient annealing of the trnai primer on the bipartite ty3 pbs and rna dimerization (41). the utr regions of the ty3 genome also form secondary structures, and minus strand transfer requires ty3 nc to overcome the energetic barrier in forming the dna there are distinct structural differences between ty3 nc, which has only one zinc finger with two aromatic residues, and hiv-1 nc, which has two zinc fingers with one aromatic residue each. the cationic tail of ty3 nc, which has minimal structure, also contains an aromatic residue (tyrosine). ty3 nc, with 20 basic residues (pi 11.5), has a slightly higher overall charge than hiv-1 nc (pi 10), with 15 basic residues. although minimal information is available about the 3d structure of ty3 nc, it is extremely likely to have high charge density, consistent with retroviral nc proteins of known structure such as hiv-1 nc and moloney murine leukemia virus (mulv) nc (42). furthermore, the length and structural complexity of the utr regions seem to be related to the chaperone activity of a number of retroviral nc proteins, and the secondary structures in the ty3 utr regions are not as thermodynamically stable as the hiv-1 tar hairpins (25). dna stretching and other biophysical methods have been used to show that the properties of hiv-1 nc are specifically tuned to optimize its interactions with both dsdna and ssdna. specifically, both zinc fingers are required to maintain their native order and structure, and seemingly minor mutations result in loss of rapid kinetics of the dna protein interaction (26). other retroviral nc proteins exhibited less rapid kinetics in dna stretching experiments, particularly mulv and human t - cell lymphotropic virus type 1 (htlv-1) nc (33,34). notably, mulv nc is the only nc protein studied that contained a single zinc finger, and it exhibited relatively slow kinetics. thus, previous results suggest that two zinc fingers are generally required to optimize the kinetics of nc dna interactions (26,27,33,34). to determine the capability of a single zinc finger to facilitate nc dna interactions and to understand the connection between ty3 nc 's structure and function as a nucleic acid chaperone, we probed the thermodynamics and kinetics of wild type and mutant nc dna interactions with single dna molecules. we found that, despite the presence of only a single zinc finger, wild - type ty3 nc aggregates nucleic acids, promotes complementary strand annealing, and exhibits rapid kinetics resembling that of hiv-1 nc. four mutants of ty3 nc demonstrate that these chaperone properties require the zinc finger as well as the presence of its cationic n - terminal tail. thus, ty3 nc 's single zinc finger is necessary and sufficient to facilitate rapid dna protein interactions, but a second zinc finger may be required for more effective nucleic acid destabilization by nc proteins, such as that observed for hiv-1 nc and tar hairpins. dual beam optical tweezers were used to capture biotin - labeled bacteriophage dna between two streptavidin - coated polystyrene beads (bangs labs). surrounding dna molecules were rinsed out of solution with buffer (50 mm na, 10 mm hepes, ph 7.5), and the captured dna molecule was then stretched and released at a pulling rate of 100 nm / s to obtain dna - only force - extension curves (figure 1a, black), which are typically characterized by models of polymer elasticity. the worm - like chain (wlc) model describes dsdna in terms of length bds at a given force f : (1) where pds is the persistence length, bds is the contour length and sds is the stretch modulus. the freely jointed chain (fjc) model describes ssdna in terms of length bss at a given force f : (2) figure 1.(a) typical force - extension (solid) and release (dashed) curves of -dna (black) obtained with optical tweezers. the wlc model (blue line) describes dsdna. near the dsdna contour length, minimal hysteresis is evident in these solution conditions (50 mm na, 10 mm hepes, ph 7.5). (b) quantification of the hysteresis area ratio for a typical dna extension and release curve extension (solid) and release (dashed) curve of dna in the presence of ty3 nc 2-ncp9 dd are shown in green. a linear combination of these two models is shown in black, indicating the fraction of ssdna exposed to solution upon dna extension. relative hysteresis is the ratio of a1, the area between the stretch (solid green) and release (dashed green) curves, and a2, the area between the stretch (solid green) and melted dna fraction (black) curves. (c) equilibrium dissociation constant kd determined from change in average melting force fm as a function of protein concentration c fit to a simple dna binding isotherm [equations (3) and (5) ]. data points for mutant 2-ncp9 dd are shown with standard error bars, with a fit (blue line) that yields kd = 20 (1) nm and saturated melting force fm= 16 (0.5) pn. kd was estimated for mutants 1-ncp9 and ncp9 dd with this method, but could not be obtained for mutant 2-ncp9, which did not affect dna melting force. (a) typical force - extension (solid) and release (dashed) curves of -dna (black) obtained with optical tweezers. the wlc model (blue line) describes dsdna. near the dsdna contour length, minimal hysteresis is evident in these solution conditions (50 mm na, 10 mm hepes, ph 7.5). (b) quantification of the hysteresis area ratio for a typical dna extension and release curve extension (solid) and release (dashed) curve of dna in the presence of ty3 nc 2-ncp9 dd are shown in green. the wlc and fjc models are shown in blue and red, respectively. a linear combination of these two models is shown in black, indicating the fraction of ssdna exposed to solution upon dna extension. relative hysteresis is the ratio of a1, the area between the stretch (solid green) and release (dashed green) curves, and a2, the area between the stretch (solid green) and melted dna fraction (black) curves. (c) equilibrium dissociation constant kd determined from change in average melting force fm as a function of protein concentration c fit to a simple dna binding isotherm [equations (3) and (5) ]. data points for mutant 2-ncp9 dd are shown with standard error bars, with a fit (blue line) that yields kd = 20 (1) nm and saturated melting force fm= 16 (0.5) pn. kd was estimated for mutants 1-ncp9 and ncp9 dd with this method, but could not be obtained for mutant 2-ncp9, which did not affect dna melting force. figure 1a shows the wlc (blue) and fjc (red) polymer models with typical parameter values [bds = 0.34 nm / bp, pds = 48 nm and sds = 1200 pn in equation (1), bss = 0.55 nm / bp, pss = 0.75 nm and sss = 720 pn in equation (2) ]. after obtaining force - extension curves of a single dna molecule ty3 nc and its mutants were introduced into solution with the dna held under slight tension in an effort to reduce formation of extremely stable protein the first force - extension curve after protein exchange was therefore stretched from zero extension to the original starting extension after dna release (example in figure 1b, solid green curve, starting force of 10 pn). at least three stretch release cycles were performed for each measurement, and subsequent force - extension curves were the same within error in the case of wild type ty3 nc. the 50 mm na concentration was used for comparison with earlier studies of other nc proteins. both the salt and protein concentration in vivo are higher than those used here, but the increased binding in low salt tends to compensate for the lower protein concentration. melting forces were determined by averaging along the length of the force - induced melting plateau in the presence of each protein. hysteresis was quantified by calculating a1, the area between the force - extension (figure 1b, solid green) and release (figure 1b, dashed green) curves of dna in the presence of wild - type ty3 nc and its mutants. a linear combination of the wlc and fjc models (figure 1b, blue and red, respectively) indicates the fraction of ssdna generated upon dna extension (figure 1b, black), as described in (44). the total amount of hysteresis possible is a2, the area between the extension curve (figure 1b, solid green) and this linear combination (figure 1b, black). relative hysteresis is the ratio of a1 and a2, ranging from 0.1 (0.03) in the absence of protein, to a theoretical maximum of 1, which would indicate that all the ssdna generated is bound by protein upon dna release and does not dissociate on the time scale of the release (1 min). averages and uncertainties (standard error) for all values reported were calculated using at least three measurements. to quantify the effect of wild - type ty3 nc on the shape of the force - induced melting plateau, transition width f was determined from the slope at the midpoint of melting transition, as described in (27,45). change in transition width as a function of protein concentration c may be described by a simple dna binding isotherm (46) : (3) where kd is the equilibrium dissociation constant and the fractional dna binding is given by the change in transition width : (4) with fsat defined as the transition width at saturated protein concentration. standard error for measured data points was calculated from at least three measurements, and fits to equations (3) and (4) were performed using analysis. ty3 nc mutants have negligible effect on the transition width, so kd was obtained from their effect on the average melting force fm, as reviewed in (43). change in melting force is fm = fm fm, where fm= 61.0 (0.5) pn, the melting force in the absence of protein. fm as a function of protein concentration c may be described by equation (3), where the fractional binding is given by the change in melting force : (5) with fm defined as the average melting force at saturated protein concentration. data points with standard error were fit with equations (3) and (5) to quantify kd for mutant 2-ncp9 dd (figure 1c). this method was used to estimate kd for mutants 1-ncp9 and ncp9 dd, but mutant 2-ncp9 did not affect melting force over two orders of magnitude change in protein concentration. ty3 nc protein of 57 amino acids and its mutants were synthesized on the solid phase using fmoc (9-fluorenylmethoxycarbonyl)- and opfp (pentafluorophenyl ester)-protected amino acids and purified to homogeneity by hplc (47). optical tweezers were used to stretch and release a single molecule of bacteriophage dna in the absence of protein and in the presence of a nearly saturated concentration of wild type ty3 nc (figure 2a). while bacteriophage dna is not the sequence acted on by ty3 nc, it represents a random sequence, allowing us to measure the ability of the protein to remodel general nucleic acid structures. in the absence of protein, as the molecule approaches its contour length of 0.34 nm / bp, the elasticity of the backbone causes a sharp increase in force. at 60 pn, the dna molecule lengthens more than 1.5 times with minimal increase in force as it undergoes a cooperative force - induced melting transition from dsdna to ssdna (4850). the force increases rapidly again at the end of this cooperative phase transition, at 0.6 nm / bp. as the dna is released back to low extensions, the force - extension curve is almost completely reversible, exhibiting only minor hysteresis, which is the difference between the extension and release curves. figure 2.(a and b) typical force - extension (solid) and release (dashed) curves of -dna in the presence of wild type ty3 nc. (a) dna only (black) and 5 nm wild type ty3 nc (green). (b) 5 nm (green) and 25 nm (blue) wild type ty3 nc. (c) change in the transition width f of dna force - induced melting as a function of wild type ty3 nc concentration. f0, where f is the melting transition width in the presence of protein and f0 = 3.6 (0.3) pn, the melting transition width of dna only. standard error determined from at least three measurements was used to compute error bars for f. a fit (blue line) to a simple dna binding isotherm [equations (3) and (4) ] yields kd = 3.5 (0.5) nm and fsat = 6.2 (0.4) pn. protein concentrations significantly above saturation (80150 nm) were also included in the fit (data not shown). (a and b) typical force - extension (solid) and release (dashed) curves of -dna in the presence of wild type ty3 nc. (a) dna only (black) and 5 nm wild type ty3 nc (green). (b) 5 nm (green) and 25 nm (blue) wild type ty3 nc. (c) change in the transition width f of dna force - induced melting as a function of wild type ty3 nc concentration. f0, where f is the melting transition width in the presence of protein and f0 = 3.6 (0.3) pn, the melting transition width of dna only. standard error determined from at least three measurements was used to compute error bars for f. a fit (blue line) to a simple dna binding isotherm [equations (3) and (4) ] yields kd = 3.5 (0.5) nm and fsat = 6.2 (0.4) pn. protein concentrations significantly above saturation (80150 nm) were also included in the fit (data not shown). in the presence of 5 nm wild type ty3 nc, the force increases at low extensions, below the dna contour length (figure 2a). the transition at the end of the melting plateau also shifts to lower extensions, decreasing by 0.025 nm / bp. these effects are due to nucleic acid aggregation, in which protein - induced interactions make the dna molecule attracted to itself. a 5-fold increase in protein concentration leads to small increases in these two effects, reflecting additional nucleic acid aggregation (figure 2b). the force - induced melting plateau is slightly sloped in the presence of wild type ty3 nc this increase in transition width reflects a loss of dna melting cooperativity, which indicates that the dna molecule is more likely to undergo conformational rearrangements, an effect which has been observed for multiple nucleic acid chaperone proteins (27,34,45,46). a simple dna binding isotherm [equations (3) and (4) ] fit to the change in transition width f as a function of protein concentration c yields an equilibrium dissociation constant kd = 3.5 (0.5) nm and saturated change in transition width fsat = 6.2 (0.4) pn (figure 2c, blue line). the lack of hysteresis indicates that ty3 nc exhibits rapid kinetics, allowing it to dissociate quickly from ssdna. rapid kinetics, which is characteristic of nucleic acid chaperones, is correlated with a protein 's ability to facilitate re - annealing. in contrast, proteins that preferentially bind ssdna, such as t4 gp32, induce significant hysteresis, and proteins that preferentially bind dsdna, such as hmg, stabilize the duplex and increase the melting force (43). the melting force in the presence of wild type ty3 nc is slightly higher than that of dna only (table 1), which indicates net stabilization of the dna duplex. in order to elucidate how a protein that stabilizes duplex dna can act as a nucleic acid chaperone, four mutants of ty3 nc were used to further investigate the dna binding role of the zinc finger and n - terminal tail (figure 3). the n - terminal tail was deleted to varying degrees in mutants 1-ncp9 and 2-ncp9, leaving the zinc finger intact. mutant ncp9 dd has a largely intact n - terminal tail, but no zinc finger. figure 3.structure of (a) wild - type ty3 nc, (b) 1-ncp9, (c) 2-ncp9, (d) ncp9 dd and (e) 2-ncp9 dd. basic residues shown in blue and zinc coordinating residues shown in green. table 1.melting force and hysteresis area in the presence of wild type ty3 nc and its mutants, measured at protein concentrations c (force - extension curves shown in figures 2, 47), near or above kd. equilibrium dissociation constants kd reported for 50 nm naty3 nc proteinc (nm)fm (pn)hysteresis (ratio)kd (nm)wild type568.0 (1.0)0.26 (0.03)3.5 (0.5)1-ncp92059.4 (0.7)0.68 (0.1)12 (3)2-ncp95060.6 (0.1)0.49 (0.1)ncp9 dd371.5 (0.4)0.55 (0.1)3 (2)2-ncp9 dd1367.1 (0.5)0.67 (0.1)20 (1)all values were calculated with at least three measurements, reflecting the uncertainty reported (standard error).the melting force is an average along the length of the force - induced melting plateau in the presence of each protein. the melting force of dna only in 50 mm na is 61.0 (0.5) pn.hysteresis is an area ratio that reflects amount of protein still bound upon dna release (figure 1b). the ratio increases with the amount of ssdna observed upon dna release, up to a maximum value of 1. the minimal hysteresis in the absence of protein yields an area ratio of 0.1 (0.03).kd was quantified from the change in transition width in the case of wild - type ty3 nc (figure 2c). change in melting force was used to determine kd for ty3 nc mutants (figure 1c), with the exception of 2-ncp9, which did not affect melting force upon dna binding.ty3 nc mutant 2-ncp9 did not appreciably bind dna on the first stretch release cycle (figure 5a) over two orders of magnitude in protein concentration (1100 nm). at protein concentrations 50 nm and above, release cycle (figure 2b and c) and this effect did not change significantly at higher concentrations. therefore data from the third force - extension curve is included in table 1 to provide a comparison of melting force and hysteresis ratio for this mutant. structure of (a) wild - type ty3 nc, (b) 1-ncp9, (c) 2-ncp9, (d) ncp9 dd and (e) 2-ncp9 dd. basic residues shown in blue and zinc coordinating residues shown in green. melting force and hysteresis area in the presence of wild type ty3 nc and its mutants, measured at protein concentrations c (force - extension curves shown in figures 2, 47), near or above kd. equilibrium dissociation constants kd reported for 50 nm na all values were calculated with at least three measurements, reflecting the uncertainty reported (standard error). the melting force is an average along the length of the force - induced melting plateau in the presence of each protein. the melting force of dna only in 50 mm na is 61.0 (0.5) pn. hysteresis is an area ratio that reflects amount of protein still bound upon dna release (figure 1b). the ratio increases with the amount of ssdna observed upon dna release, up to a maximum value of 1. the minimal hysteresis in the absence of protein yields an area ratio of 0.1 (0.03). kd was quantified from the change in transition width in the case of wild - type ty3 nc (figure 2c). change in melting force was used to determine kd for ty3 nc mutants (figure 1c), with the exception of 2-ncp9, which did not affect melting force upon dna binding. ty3 nc mutant 2-ncp9 did not appreciably bind dna on the first stretch release cycle (figure 5a) over two orders of magnitude in protein concentration (1100 nm). at protein concentrations 50 nm and above, binding that altered hysteresis was achieved only upon the third stretch release cycle (figure 2b and c) and this effect did not change significantly at higher concentrations. therefore data from the third force - extension curve is included in table 1 to provide a comparison of melting force and hysteresis ratio for this mutant. the n - terminal tail of mutant 1-ncp9 is missing the first 16 residues, compromising the protein 's dna binding affinity by 5-fold (table 1). kd was estimated as 12 (3) nm using a simple dna binding isotherm to approximate the decrease in melting force as a function of protein concentration [equations (3) and (5) ]. in striking contrast to wild type ty3 nc, force - extension curves in the presence of 20 nm 1-ncp9 exhibit significant hysteresis (figure 4a). the hysteresis ratio for 1-ncp9 is 0.68 (0.1), relative to 0.26 (0.03) for wild type (table 1). this indicates that the mutant does not dissociate from ssdna on the timescale of the experiment, leading to the loss of rapid kinetics. 1-ncp9 induces less aggregation than wild type ty3 nc, and its effect on the force - induced melting transition width is nominal. furthermore, the melting force is 59.4 (0.7) pn in the presence of the mutant, which is significantly lower than the 68.0 (1.0) pn melting force in the presence of wild type ty3 nc (table 1). figure 4.typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 20 nm ty3 nc mutant 1-ncp9. first stretch release curve shown in green (a and b), and second stretch release curve shown in blue (b). typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 20 nm ty3 nc mutant 1-ncp9. first stretch release curve shown in green (a and b), and second stretch release curve shown in blue (b). to identify the dna binding activity of the zinc finger deletion of the n - terminal tail leaves a mutant that primarily consists of the zinc finger, and has dna binding affinity more than an order of magnitude smaller than that of wild type. although 2-ncp9 does not affect dna melting force or transition width to allow for an estimate of kd, protein concentrations smaller than 50 nm reflected no dna binding. in the presence of 50 nm protein, the first force - extension curve lies almost exactly on top of the dna only curve, showing a negligible effect (figure 5a). release cycle exhibits some hysteresis, indicating slow kinetics (figure 5b), which increases further in the third force - extension curve (figure 5c). the 2-ncp9 mutant is the only ty3 nc protein for which successive stretch - release cycles show additional protein binding. the third stretch - release cycle is required to observe an effect comparable to the other proteins presented in table 1 because 2-ncp9 binds dna with significantly lower affinity than wild type or the other mutants. furthermore, these effects remain the same within error, even up to 100 nm protein concentration. therefore the hysteresis ratio of 0.49 (0.1) is reported in table 1 for comparison. there is less hysteresis than that for 1-ncp9 (table 1), which is consistent with the likelihood that 2-ncp9 has higher charge density. figure 5.typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a c) 50 nm ty3 nc mutant 2-ncp9. first stretch release curve shown in green (a and b), second stretch release curve shown in blue (b and c), and third stretch - release curve shown in red (c). typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a c) 50 nm ty3 nc mutant 2-ncp9. first stretch release curve shown in green (a and b), second stretch release curve shown in blue (b and c), and third stretch - release curve shown in red (c). dna stretching curves in the presence of mutants dominated by the zinc finger imply that the zinc finger of ty3 nc contributes to nucleic acid aggregation and duplex destabilization. both mutants with a compromised n - terminal tail also lack the rapid kinetics of wild type ty3 nc, demonstrating that the cationic tail is required to promote nucleic acid annealing. to identify the dna binding properties of the n - terminal tail, we examined two mutants that lack the zinc finger entirely, ncp9 dd and 2-ncp9 dd. the zinc - finger deletion in mutant ncp9 dd leaves the cationic tail nearly intact, resulting in dna binding affinity most similar to that of wild - type ty3 nc, with kd estimated as 3 (2) nm (table 1). the initial force - extension curve in the presence of 3 nm ncp9 dd exhibits a significantly higher melting force of 71.5 (0.4) pn, which reflects strong dsdna stabilization (figure 6a, table 1). the second stretch exactly follows the previous release curve, indicating that the mutant binds ssdna irreversibly on the timescale of the experiment (figure 6b). ncp9 dd also induces strong dna aggregation, indicated by an increase in the dna stretching force to 1020 pn below the dna contour length, an effect that dominates subsequent stretches. figure 6.typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 3 nm ty3 nc mutant ncp9 dd. first stretch release curve shown in green (a and b), and second stretch typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 3 nm ty3 nc mutant ncp9 dd. first stretch release curve shown in green (a and b), and second stretch release curve shown in blue (b). deletion of both the n - terminal tail and the zinc finger results in a small protein likely to have a high charge density, with dna binding affinity an order of magnitude smaller than that of wild type ty3 nc. a simple dna binding isotherm [equations (3) and (5) ] fit to change in melting force fm as a function of protein concentration c yields kd = 20 (1) nm with saturated change in melting force fm= 16 (0.5) pn. the force - extension curve in the presence of 13 nm 2-ncp9 dd exhibits duplex stabilization, dna aggregation (10 pn force is required to stretch dna below the dsdna contour length), and large hysteresis (figure 7a). in contrast with 2-ncp9 (figure 6b), subsequent stretch release cycles reflect incomplete protein dissociation (figure 7b). dna force - extension curves in the presence of mutants without the zinc finger indicate that the cationic tail of ty3 nc contributes strongly to nucleic acid aggregation, and is largely responsible for dsdna stabilization. both mutants also induce strong hysteresis, and this inhibition of dna annealing abolishes rapid kinetics, which requires both the zinc finger and the n - terminal tail of ty3 nc. figure 7.typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 13 nm ty3 nc mutant 2-ncp9 dd. first stretch release curve shown in green (a and b), and second stretch typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 13 nm ty3 nc mutant 2-ncp9 dd. first stretch release curve shown in green (a and b), and second stretch optical tweezers were used to stretch and release a single molecule of bacteriophage dna in the absence of protein and in the presence of a nearly saturated concentration of wild type ty3 nc (figure 2a). while bacteriophage dna is not the sequence acted on by ty3 nc, it represents a random sequence, allowing us to measure the ability of the protein to remodel general nucleic acid structures. in the absence of protein, as the molecule approaches its contour length of 0.34 nm / bp, the elasticity of the backbone causes a sharp increase in force. at 60 pn, the dna molecule lengthens more than 1.5 times with minimal increase in force as it undergoes a cooperative force - induced melting transition from dsdna to ssdna (4850). the force increases rapidly again at the end of this cooperative phase transition, at 0.6 nm / bp. as the dna is released back to low extensions, the force - extension curve is almost completely reversible, exhibiting only minor hysteresis, which is the difference between the extension and release curves. figure 2.(a and b) typical force - extension (solid) and release (dashed) curves of -dna in the presence of wild type ty3 nc. (a) dna only (black) and 5 nm wild type ty3 nc (green). (b) 5 nm (green) and 25 nm (blue) wild type ty3 nc. (c) change in the transition width f of dna force - induced melting as a function of wild type ty3 nc concentration. f0, where f is the melting transition width in the presence of protein and f0 = 3.6 (0.3) pn, the melting transition width of dna only. standard error determined from at least three measurements was used to compute error bars for f. a fit (blue line) to a simple dna binding isotherm [equations (3) and (4) ] yields kd = 3.5 (0.5) nm and fsat = 6.2 (0.4) pn. protein concentrations significantly above saturation (80150 nm) were also included in the fit (data not shown). (a and b) typical force - extension (solid) and release (dashed) curves of -dna in the presence of wild type ty3 nc. (a) dna only (black) and 5 nm wild type ty3 nc (green). (b) 5 nm (green) and 25 nm (blue) wild type ty3 nc. (c) change in the transition width f of dna force - induced melting as a function of wild type ty3 nc concentration. f0, where f is the melting transition width in the presence of protein and f0 = 3.6 (0.3) pn, the melting transition width of dna only. standard error determined from at least three measurements was used to compute error bars for f. a fit (blue line) to a simple dna binding isotherm [equations (3) and (4) ] yields kd = 3.5 (0.5) nm and fsat = 6.2 (0.4) pn. protein concentrations significantly above saturation (80150 nm) were also included in the fit (data not shown). in the presence of 5 nm wild type ty3 nc, the force increases at low extensions, below the dna contour length (figure 2a). the transition at the end of the melting plateau also shifts to lower extensions, decreasing by 0.025 nm / bp. these effects are due to nucleic acid aggregation, in which protein - induced interactions make the dna molecule attracted to itself. a 5-fold increase in protein concentration leads to small increases in these two effects, reflecting additional nucleic acid aggregation (figure 2b). the force - induced melting plateau is slightly sloped in the presence of wild type ty3 nc this increase in transition width reflects a loss of dna melting cooperativity, which indicates that the dna molecule is more likely to undergo conformational rearrangements, an effect which has been observed for multiple nucleic acid chaperone proteins (27,34,45,46). a simple dna binding isotherm [equations (3) and (4) ] fit to the change in transition width f as a function of protein concentration c yields an equilibrium dissociation constant kd = 3.5 (0.5) nm and saturated change in transition width fsat = 6.2 (0.4) pn (figure 2c, blue line). the lack of hysteresis indicates that ty3 nc exhibits rapid kinetics, allowing it to dissociate quickly from ssdna. rapid kinetics, which is characteristic of nucleic acid chaperones, is correlated with a protein 's ability to facilitate re - annealing. in contrast, proteins that preferentially bind ssdna, such as t4 gp32, induce significant hysteresis, and proteins that preferentially bind dsdna, such as hmg, stabilize the duplex and increase the melting force (43). the melting force in the presence of wild type ty3 nc is slightly higher than that of dna only (table 1), which indicates net stabilization of the dna duplex. in order to elucidate how a protein that stabilizes duplex dna can act as a nucleic acid chaperone, four mutants of ty3 nc were used to further investigate the dna binding role of the zinc finger and n - terminal tail (figure 3). the n - terminal tail was deleted to varying degrees in mutants 1-ncp9 and 2-ncp9, leaving the zinc finger intact. mutant ncp9 dd has a largely intact n - terminal tail, but no zinc finger. figure 3.structure of (a) wild - type ty3 nc, (b) 1-ncp9, (c) 2-ncp9, (d) ncp9 dd and (e) 2-ncp9 dd. basic residues shown in blue and zinc coordinating residues shown in green. table 1.melting force and hysteresis area in the presence of wild type ty3 nc and its mutants, measured at protein concentrations c (force - extension curves shown in figures 2, 47), near or above kd. equilibrium dissociation constants kd reported for 50 nm naty3 nc proteinc (nm)fm (pn)hysteresis (ratio)kd (nm)wild type568.0 (1.0)0.26 (0.03)3.5 (0.5)1-ncp92059.4 (0.7)0.68 (0.1)12 (3)2-ncp95060.6 (0.1)0.49 (0.1)ncp9 dd371.5 (0.4)0.55 (0.1)3 (2)2-ncp9 dd1367.1 (0.5)0.67 (0.1)20 (1)all values were calculated with at least three measurements, reflecting the uncertainty reported (standard error).the melting force is an average along the length of the force - induced melting plateau in the presence of each protein. the melting force of dna only in 50 mm na is 61.0 (0.5) pn.hysteresis is an area ratio that reflects amount of protein still bound upon dna release (figure 1b). the ratio increases with the amount of ssdna observed upon dna release, up to a maximum value of 1. the minimal hysteresis in the absence of protein yields an area ratio of 0.1 (0.03).kd was quantified from the change in transition width in the case of wild - type ty3 nc (figure 2c). change in melting force was used to determine kd for ty3 nc mutants (figure 1c), with the exception of 2-ncp9, which did not affect melting force upon dna binding.ty3 nc mutant 2-ncp9 did not appreciably bind dna on the first stretch release cycle (figure 5a) over two orders of magnitude in protein concentration (1100 nm). at protein concentrations 50 nm and above, release cycle (figure 2b and c) and this effect did not change significantly at higher concentrations. therefore data from the third force - extension curve is included in table 1 to provide a comparison of melting force and hysteresis ratio for this mutant. structure of (a) wild - type ty3 nc, (b) 1-ncp9, (c) 2-ncp9, (d) ncp9 dd and (e) 2-ncp9 dd. basic residues shown in blue and zinc coordinating residues shown in green. melting force and hysteresis area in the presence of wild type ty3 nc and its mutants, measured at protein concentrations c (force - extension curves shown in figures 2, 47), near or above kd. equilibrium dissociation constants kd reported for 50 nm na all values were calculated with at least three measurements, reflecting the uncertainty reported (standard error). the melting force is an average along the length of the force - induced melting plateau in the presence of each protein. the melting force of dna only in 50 mm na is 61.0 (0.5) pn. hysteresis is an area ratio that reflects amount of protein still bound upon dna release (figure 1b). the ratio increases with the amount of ssdna observed upon dna release, up to a maximum value of 1. the minimal hysteresis in the absence of protein yields an area ratio of 0.1 (0.03). kd was quantified from the change in transition width in the case of wild - type ty3 nc (figure 2c). change in melting force was used to determine kd for ty3 nc mutants (figure 1c), with the exception of 2-ncp9, which did not affect melting force upon dna binding. ty3 nc mutant 2-ncp9 did not appreciably bind dna on the first stretch release cycle (figure 5a) over two orders of magnitude in protein concentration (1100 nm). at protein concentrations 50 nm and above, binding that altered hysteresis was achieved only upon the third stretch release cycle (figure 2b and c) and this effect did not change significantly at higher concentrations. therefore data from the third force - extension curve is included in table 1 to provide a comparison of melting force and hysteresis ratio for this mutant. the n - terminal tail of mutant 1-ncp9 is missing the first 16 residues, compromising the protein 's dna binding affinity by 5-fold (table 1). kd was estimated as 12 (3) nm using a simple dna binding isotherm to approximate the decrease in melting force as a function of protein concentration [equations (3) and (5) ]. in striking contrast to wild type ty3 nc, force - extension curves in the presence of 20 nm 1-ncp9 exhibit significant hysteresis (figure 4a). the hysteresis ratio for 1-ncp9 is 0.68 (0.1), relative to 0.26 (0.03) for wild type (table 1). this indicates that the mutant does not dissociate from ssdna on the timescale of the experiment, leading to the loss of rapid kinetics. 1-ncp9 induces less aggregation than wild type ty3 nc, and its effect on the force - induced melting transition width is nominal. furthermore, the melting force is 59.4 (0.7) pn in the presence of the mutant, which is significantly lower than the 68.0 (1.0) pn melting force in the presence of wild type ty3 nc (table 1).. figure 4.typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 20 nm ty3 nc mutant 1-ncp9. first stretch release curve shown in green (a and b), and second stretch typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 20 nm ty3 nc mutant 1-ncp9. first stretch release curve shown in green (a and b), and second stretch release curve shown in blue (b). to identify the dna binding activity of the zinc finger, we examined the 2-ncp9 mutant. deletion of the n - terminal tail leaves a mutant that primarily consists of the zinc finger, and has dna binding affinity more than an order of magnitude smaller than that of wild type. although 2-ncp9 does not affect dna melting force or transition width to allow for an estimate of kd, protein concentrations smaller than 50 nm reflected no dna binding. in the presence of 50 nm protein, the first force - extension curve lies almost exactly on top of the dna only curve, showing a negligible effect (figure 5a). release cycle exhibits some hysteresis, indicating slow kinetics (figure 5b), which increases further in the third force - extension curve (figure 5c). the 2-ncp9 mutant is the only ty3 nc protein for which successive stretch - release cycles show additional protein binding. the third stretch - release cycle is required to observe an effect comparable to the other proteins presented in table 1 because 2-ncp9 binds dna with significantly lower affinity than wild type or the other mutants. furthermore, these effects remain the same within error, even up to 100 nm protein concentration. therefore the hysteresis ratio of 0.49 (0.1) is reported in table 1 for comparison. there is less hysteresis than that for 1-ncp9 (table 1), which is consistent with the likelihood that 2-ncp9 has higher charge density. figure 5.typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a c) 50 nm ty3 nc mutant 2-ncp9. first stretch release curve shown in green (a and b), second stretch release curve shown in blue (b and c), and third stretch - release curve shown in red (c). typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a c) 50 nm ty3 nc mutant 2-ncp9. first stretch release curve shown in green (a and b), second stretch release curve shown in blue (b and c), and third stretch - release curve shown in red (c). dna stretching curves in the presence of mutants dominated by the zinc finger imply that the zinc finger of ty3 nc contributes to nucleic acid aggregation and duplex destabilization. both mutants with a compromised n - terminal tail also lack the rapid kinetics of wild type ty3 nc, demonstrating that the cationic tail is required to promote nucleic acid annealing. to identify the dna binding properties of the n - terminal tail, we examined two mutants that lack the zinc finger entirely, ncp9 dd and 2-ncp9 dd. the zinc - finger deletion in mutant ncp9 dd leaves the cationic tail nearly intact, resulting in dna binding affinity most similar to that of wild - type ty3 nc, with kd estimated as 3 (2) nm (table 1). the initial force - extension curve in the presence of 3 nm ncp9 dd exhibits a significantly higher melting force of 71.5 (0.4) pn, which reflects strong dsdna stabilization (figure 6a, table 1). the second stretch exactly follows the previous release curve, indicating that the mutant binds ssdna irreversibly on the timescale of the experiment (figure 6b). ncp9 dd also induces strong dna aggregation, indicated by an increase in the dna stretching force to 1020 pn below the dna contour length, an effect that dominates subsequent stretches. figure 6.typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 3 nm ty3 nc mutant ncp9 dd. first stretch release curve shown in green (a and b), and second stretch typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 3 nm ty3 nc mutant ncp9 dd. first stretch release curve shown in green (a and b), and second stretch deletion of both the n - terminal tail and the zinc finger results in a small protein likely to have a high charge density, with dna binding affinity an order of magnitude smaller than that of wild type ty3 nc. a simple dna binding isotherm [equations (3) and (5) ] fit to change in melting force fm as a function of protein concentration c yields kd = 20 (1) nm with saturated change in melting force fm= 16 (0.5) pn. the force - extension curve in the presence of 13 nm 2-ncp9 dd exhibits duplex stabilization, dna aggregation (10 pn force is required to stretch dna below the dsdna contour length), and large hysteresis (figure 7a). in contrast with 2-ncp9 (figure 6b), subsequent stretch release cycles reflect incomplete protein dissociation (figure 7b). dna force - extension curves in the presence of mutants without the zinc finger indicate that the cationic tail of ty3 nc contributes strongly to nucleic acid aggregation, and is largely responsible for dsdna stabilization. both mutants also induce strong hysteresis, and this inhibition of dna annealing abolishes rapid kinetics, which requires both the zinc finger and the n - terminal tail of ty3 nc. figure 7.typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 13 nm ty3 nc mutant 2-ncp9 dd. first stretch release curve shown in green (a and b), and second stretch typical force - extension (solid) and release (dashed) curves of (a) dna only (black) and in the presence of (a and b) 13 nm ty3 nc mutant 2-ncp9 dd. first stretch release curve shown in green (a and b), and second stretch recent studies of nucleic acid chaperone proteins from retroviruses and retrotransposons have shown that aggregation, duplex destabilization and rapid kinetics are often characteristic of their chaperone activity. single - molecule stretching experiments have also shown that an increase in the slope of the dna melting plateau is positively correlated with nucleic acid chaperone activity (34,45,46). force - extension curves in the presence of wild type ty3 nc exhibit this increase in transition width, and demonstrate that aggregation of both single- and double - stranded nucleic acids is a key component of its chaperone activity. the increase in the force at extensions below the dna contour length has also been observed with retroviral ncs such as hiv-1 nc and rsv nc (34). in addition, the decrease in ssdna contour length has been reported for orf1p, the nucleic acid chaperone from the line-1 retrotransposon (45,46). dna stretching curves in the presence of ty3 nc also exhibit very little hysteresis, indicating that the protein dissociates quickly from ssdna, allowing the strands to anneal, and rapid kinetics is a key component of its nucleic acid chaperone activity. these results contrast significantly with those obtained in the presence of mulv nc, the only other single zinc finger nc protein studied by dna stretching (34). dna stretching curves in the presence of mulv nc exhibit significant hysteresis and much less aggregation. although the previous results suggested that two zinc fingers may be required for rapid dna interaction kinetics, this study shows that rapid kinetics can be observed even with a single zinc finger nc protein. we examined several mutants to investigate the relationship between the structure of ty3 nc and its nucleic acid chaperone function. stretching curves in the presence of 1-ncp9, which has a partially deleted n - terminal tail, indicate that the zinc finger contributes to weak duplex destabilization, an effect that balances the strong duplex stabilization of the cationic tail. although the distribution of charge depends upon the structure of ty3 nc mutants bound to nucleic acids, which is unavailable, both mutants without the zinc finger must have high charge density. both of these mutants, ncp9 dd and 2-ncp9 dd, significantly increase the melting force, to 71.5 (0.4) pn and 67.1 (0.5) pn, respectively (table 1). the n - terminal tail mutants demonstrate that the cationic residues on the n - terminus stabilize dsdna, while the zinc finger destabilizes dsdna. when the cationic region is deleted, dna destabilization by the zinc finger, which contains two aromatic residues that could potentially stack with ssdna, dominates the overall thermodynamics of the dna - protein interaction. when the zinc finger is deleted, the protein strongly stabilizes dsdna. while duplex stabilization such as that observed for wild type ty3 nc is likely to be somewhat detrimental to nucleic acid chaperone function, this property is a consequence of the high charge density of the protein. a high charge density is required for efficient nucleic acid aggregation, which is a primary requirement for nucleic acid chaperone activity. thus, wild type ty3 nc balances aggregation by its cationic residues and duplex destabilization by its zinc finger, resulting in overall mild duplex stabilization in conjunction with strong aggregation. although all four mutants aggregated both dsdna and ssdna, the effect was strongest with zinc finger deletion. mutant 2-ncp9, which is primarily the zinc finger, showed the least dna aggregation as well as the weakest dna binding. even at 100 nm protein concentration, nearly 4-fold higher than saturated binding of wild type ty3 nc, multiple stretch in contrast, the zinc - finger deletion of ncp9 dd is likely to result in higher charge density, preserving dna binding affinity. these properties are consistent with the ability of ncp9 dd to facilitate trna primer annealing, promote genomic rna dimerization, and initiate cdna synthesis in vitro because these processes do not require significant duplex destabilization to proceed (47). the rapid kinetics of wild type ty3 nc is highly sensitive to protein charge and structure, and deletion of either the zinc finger or the cationic tail forms mutants that induce hysteresis, which demonstrates that rapid kinetics requires both the zinc finger and the n - terminal tail. in fact, only wild type ty3 nc has rapid kinetics, quickly switching between binding single- and double - stranded nucleic acids. the weak duplex destabilization effect of the zinc finger and the strong duplex stabilization effect of the cationic tail work in concert to transiently destabilize secondary structures in the 5- and 3-utr and facilitate annealing of the dna : rna duplex during reverse transcription (2,51). thus, a single zinc finger is sufficient for a highly charged nc protein to exhibit rapid dna protein interaction kinetics. although the high charge density of the protein strongly stabilizes dsdna, the single zinc finger also destabilizes dna, and the resulting balance of these two effects makes ty3 nc a very strong nucleic acid aggregation protein with only weak duplex stabilization. if ty3 required significant duplex destabilization to facilitate minus strand transfer, as is the case for hiv-1, a second zinc finger would likely be needed. in fact, hiv-1 nc probably evolved a second zinc finger for this purpose, in conjunction with the requirements of other critical hiv-1 replication processes, due to the high thermodynamic stability of its tar hairpins. this suggests that nucleic acid chaperone activity of nc proteins is specifically tuned to secondary structures in the utr regions of their genomic rna. the nucleic acid chaperone properties are then optimized to maximize dna aggregation while facilitating only the necessary secondary structure rearrangements required for reverse transcriptase to synthesize a complete functional viral dna. national institutes of health (r01gm72462) ; national science foundation (mcb-0744456) ; institut national de la sant et de la recherche mdicale ; agence nationale de recherches sur le sida et les hpatitis virales ; national science foundation integrative graduate education and research traineeship program (dge-0504331 to k.c.). funding for open access charge : national institutes of health. | reverse transcription in retroviruses and retrotransposons requires nucleic acid chaperones, which drive the rearrangement of nucleic acid conformation. the nucleic acid chaperone properties of the human immunodeficiency virus type-1 (hiv-1) nucleocapsid (nc) protein have been extensively studied, and nucleic acid aggregation, duplex destabilization and rapid binding kinetics have been identified as major components of its activity. however, the properties of other nucleic acid chaperone proteins, such as retrotransposon ty3 nc, a likely ancestor of hiv-1 nc, are not well understood. in addition, it is unclear whether a single zinc finger is sufficient to optimize the properties characteristic of hiv-1 nc. we used single - molecule dna stretching as a method for detailed characterization of ty3 nc chaperone activity. we found that wild type ty3 nc aggregates single- and double - stranded dna, weakly stabilizes dsdna, and exhibits rapid binding kinetics. single - molecule studies in the presence of ty3 nc mutants show that the n - terminal basic residues and the unique zinc finger at the c - terminus are required for optimum chaperone activity in this system. while the single zinc finger is capable of optimizing ty3 nc 's dna interaction kinetics, two zinc fingers may be necessary in order to facilitate the dna destabilization exhibited by hiv-1 nc. |
asthma is a complex and common disorder that is characterized by chronic inammation of the respiratory system, airow obstruction, and airway hyper - reactivity induced by certain stimulants, such as exercise, infection, allergens, and occupational exposures. as one of the most prevalent chronic diseases, asthma affects more than 30 million people globally, especially children and young adults. in the united state alone, asthma affects more than 23 million adults, and women are more likely to be diagnosed with asthma that imposes greater morbidity than in men. symptoms of asthma are multifaceted and include wheezing, coughing, hyperpnea, and feeling of suppression in the chest. previously published evidence suggested that both environmental components and genetic variations may contribute to asthma susceptibility. recently, the associations between asthma and gene polymorphisms have become an intensive area of research that has generated important insights into the pathogenesis of asthma. interleukin-17 (il-17) is a novel pro - inflammatory cytokine family containing 6 distinct isoforms (il-17a, il-17b, il-17c, il-17d, il-17e, and il-17f) and 5 receptors (l-17ra, il-17rb, il-17rc, il-17rd, and il-17rsef). produced by the t helper 17 (th17) subsets of cd4 + t cells, il-17 plays an important role in the development and progression of inflammatory and autoimmune diseases. il-17 can induce the production of pro - inflammatory cytokines and recruit neutrophils and monocytes, together resulting in an immune - mediated inflammatory reaction through the expression of il-17 receptors. from a genetic perspective the polymorphisms of il-17 are shown to be associated with various autoimmune diseases, including asthma, rheumatoid arthritis and inflammatory bowel disease. an increasing number of studies have demonstrated a close relationship between il-17 and neutrophilic inflammation, implicating il-17 as a potential candidate gene in predicting asthma susceptibility. interestingly, an analysis using the tagger software implemented in the haploview software according to the han - chinese beijing data set revealed that rs763780 (7488a / g), rs2275913 (197g / a) and rs8193036 (737c / t) were found to be commonly associated with asthma [15, 16 ]. however, conflicting evidence has also been uncovered indicating that not all 3 snps were associated with asthma susceptibility. therefore, we carried out the current case - control study supplemented with a meta - analysis to definitively evaluate the impact of rs763780, rs2275913, and rs8193036 of il-17 gene on clinical outcomes in asthma patients. the study design was reviewed and approved by the ethics committee of huaihe hospital of henan university. written informed consents were obtained from all subjects prior to the study. all procedures in this study were in compliance with the declaration of helsinki. 2014, 125 asthma patients, comprising 64 males and 61 females in huaihe hospital of henan university, were enrolled as the case group. the mean age for the case group was 39.498.61 years (ranging from 25 to 55 years). all asthma patients met the standards of asthma diagnosis as established by the chinese thoracic society, which include : (1) daytime paroxysmal cough or chronic persistent cough ; (2) postnasal drip syndrome or pharyngeal mucus ; (3) any history of rhinitis, sinusitis, nasal polyps, or chronic laryngopharyngitis ; (4) examinations revealed pharyngeal mucus in the posterior pharyngeal wall with formed cobble stone ; and (5) the cough was relieved after specific treatments. the inclusion criteria were : (1) age : 24~55 years old ; (2) ethnicity : han ; (3) pulmonary function test : positive in bronchial dilation test ; and (4) no wheezing, dyspnea, chest distress, or cough symptoms caused by other diseases. the exclusion criteria were : (1) patients with severe complications ; (2) patients with heart diseases or complications with liver disease and nephropathy ; (3) patients with diseases of the hematopoietic system complicated with tumor diseases ; and (4) pregnant or lactating women. in addition, 132 healthy controls (67 males and 65 females) who underwent physical examinations in our hospital were randomly selected as the control group. the age of the control group ranged from 24 to 52 years with a mean age of 38.238.45 years. ten ml of venous blood were extracted from all subjects after fasting for more than 12 h. the blood samples (4 ml) were anticoagulated with ethylenediaminetetraacetic acid (edta) and stored at 70c. then the samples were incubated in an upright position for 1 h, followed by centrifuging at 3000 rpm for 10 min at room temperature to isolate the peripheral blood mononuclear cells. afterwards, the genomic dna was isolated using a dna extraction kit (cat no. : dp318 - 03, tiangen biotech beijing co. ltd., the remaining 6 ml blood samples were incubated in an upright position for 1 h and were centrifuged at 3000 rpm for 10 min at room temperature. three snp sites, il-17 rs763780, rs2275913, and rs8193036, were selected to conduct the current research. restriction fragment length polymorphism polymerase chain reaction (pcr - rflp) was used to analyze the genotype and allele frequency in 3 sites between the case and control groups. the pcr primers were designed using primer premier 5.0 software and synthesized by shanghai chemical company (china). the amplification sites, primer sequences, fragment length, annealing temperature, and cycle number for the pcr - rflp are presented in table 1. the total volume of pcr reaction included 20 l : 2 l of 10pcr reaction buffer, 2 l of deoxy - ribonucleoside triphosphate (dntp) (2.5 mmol / l for each), 0.5 l of each forward and reverse primer (10 pmol/l), 2.5 u of platinum taq dna polymerase (invitrogen, shanghai, china), and 50 ng of genomic dna. dna was amplified during 30 cycles with 5 min predegeneration at 95c, 30 s denaturation at 95c, 30 s annealing at 58c, and 40 s extension at 72c. then the dna was further extended for 5 min at 72c and stored at 4c. a total of 20 l pcr production was extracted to construct the enzyme reaction system. then the pcr products were digested with restricted enzyme rsai and xmni (new england biolabs ltd., after incubation at 21c overnight, the pcr products were placed in a water bath at 4c for 15 min to terminate the reaction. then the enzyme - digested products were electrophoresis - separated by 2% agarose gel (containing ethidium bromide). the gel imaging system (bio - rad, usa) was used for genotyping interpretation. the electropherograms of enzyme digestion for il-17 rs763780, rs2275913, and rs8193036 snps are presented in figure 1. statistical analysis was conducted using spss 18.0 software (ibm corporation, somers, ny, usa). continuous data are expressed as standard deviation (sd), using t test or variance analysis for comparisons. categorical data was presented with percentages and chi - square test was applied for comparisons between groups. chi - square test was also used to verify whether the genotype distribution of the 3 snps met hardy - weinberg (hw) equilibrium. the genotype frequency and allele frequency between the case and control were calculated by or (odds ratio) with the association between il-17 snps and asthma was assessed using or with 95%ci under a fixed - effects model or a random - effects model. the study design was reviewed and approved by the ethics committee of huaihe hospital of henan university. written informed consents were obtained from all subjects prior to the study. all procedures in this study were in compliance with the declaration of helsinki. 2014, 125 asthma patients, comprising 64 males and 61 females in huaihe hospital of henan university, were enrolled as the case group. the mean age for the case group was 39.498.61 years (ranging from 25 to 55 years). all asthma patients met the standards of asthma diagnosis as established by the chinese thoracic society, which include : (1) daytime paroxysmal cough or chronic persistent cough ; (2) postnasal drip syndrome or pharyngeal mucus ; (3) any history of rhinitis, sinusitis, nasal polyps, or chronic laryngopharyngitis ; (4) examinations revealed pharyngeal mucus in the posterior pharyngeal wall with formed cobble stone ; and (5) the cough was relieved after specific treatments. the inclusion criteria were : (1) age : 24~55 years old ; (2) ethnicity : han ; (3) pulmonary function test : positive in bronchial dilation test ; and (4) no wheezing, dyspnea, chest distress, or cough symptoms caused by other diseases. the exclusion criteria were : (1) patients with severe complications ; (2) patients with heart diseases or complications with liver disease and nephropathy ; (3) patients with diseases of the hematopoietic system complicated with tumor diseases ; and (4) pregnant or lactating women. in addition, 132 healthy controls (67 males and 65 females) who underwent physical examinations in our hospital were randomly selected as the control group. the age of the control group ranged from 24 to 52 years with a mean age of 38.238.45 years. ten ml of venous blood were extracted from all subjects after fasting for more than 12 h. the blood samples (4 ml) were anticoagulated with ethylenediaminetetraacetic acid (edta) and stored at 70c. then the samples were incubated in an upright position for 1 h, followed by centrifuging at 3000 rpm for 10 min at room temperature to isolate the peripheral blood mononuclear cells. afterwards, the genomic dna was isolated using a dna extraction kit (cat no. : dp318 - 03, tiangen biotech beijing co. ltd., beijing, china) according to the manufacturer s instructions. the remaining 6 ml blood samples were incubated in an upright position for 1 h and were centrifuged at 3000 rpm for 10 min at room temperature. three snp sites, il-17 rs763780, rs2275913, and rs8193036, were selected to conduct the current research. restriction fragment length polymorphism polymerase chain reaction (pcr - rflp) was used to analyze the genotype and allele frequency in 3 sites between the case and control groups. the pcr primers were designed using primer premier 5.0 software and synthesized by shanghai chemical company (china). the amplification sites, primer sequences, fragment length, annealing temperature, and cycle number for the pcr - rflp are presented in table 1. the total volume of pcr reaction included 20 l : 2 l of 10pcr reaction buffer, 2 l of deoxy - ribonucleoside triphosphate (dntp) (2.5 mmol / l for each), 0.5 l of each forward and reverse primer (10 pmol/l), 2.5 u of platinum taq dna polymerase (invitrogen, shanghai, china), and 50 ng of genomic dna. dna was amplified during 30 cycles with 5 min predegeneration at 95c, 30 s denaturation at 95c, 30 s annealing at 58c, and 40 s extension at 72c. then the dna was further extended for 5 min at 72c and stored at 4c. a total of 20 l pcr production was extracted to construct the enzyme reaction system. then the pcr products were digested with restricted enzyme rsai and xmni (new england biolabs ltd., after incubation at 21c overnight, the pcr products were placed in a water bath at 4c for 15 min to terminate the reaction. then the enzyme - digested products were electrophoresis - separated by 2% agarose gel (containing ethidium bromide). the gel imaging system (bio - rad, usa) was used for genotyping interpretation. the electropherograms of enzyme digestion for il-17 rs763780, rs2275913, and rs8193036 snps are presented in figure 1. statistical analysis was conducted using spss 18.0 software (ibm corporation, somers, ny, usa). continuous data are expressed as standard deviation (sd), using t test or variance analysis for comparisons. categorical data was presented with percentages and chi - square test was applied for comparisons between groups. chi - square test was also used to verify whether the genotype distribution of the 3 snps met hardy - weinberg (hw) equilibrium. the genotype frequency and allele frequency between the case and control were calculated by or (odds ratio) with 95%ci (confidence interval). the association between il-17 snps and asthma was assessed using or with 95%ci under a fixed - effects model or a random - effects model. no significant difference was found between the asthma patients and healthy controls in terms of age and sex (both p>0.05). the case group had elevated percentages of patients with a smoking history, a family history of cancers, and a history of alcohol consumption compared with the control group, although no statistical significance was achieved (all p>0.05). however, the fev1 was significantly lower in the case group than the control group (p0.05). the comparisons of the rs2275913 and rs8193036 frequencies between the asthma patients and healthy controls were statistically significant in both allele and additive models (all p0.05). the present meta - analysis enrolled 12 eligible case and control studies [13,14,17,2028 ], including 3575 asthma patients and 3671 healthy controls. a total of 6 studies investigated the association between the il-17 7488a / g (rs763780) snp and asthma, which demonstrated that il-17 7488a / g (rs763780) snp may increase asthma risk in allele models (or=0.667, 95%ci=0.4890.908, p=0.010), but not additive models (or=0.693, 95%ci=0.4531.060, p=0.091) (figure 2). the association between il-17197g / a(rs2275913) snp and asthma was investigated in 4 studies, which revealed that the il-17197g / a (rs2275913) polymorphism may elevate the risk of asthma in both allele and additive models (allele model : or=0.764, 95%ci=0.6070.961, p=0.021 ; additive model : or=0.639, 95%ci=0.4360.937, p=0.022) (figure 3). a total of 4 studies explored the association between il-17737c / t (rs8193036) snp and asthma susceptibility. the results in allele and additive model suggested that il-17737c / t (rs8193036) snp may enhance the risk of asthma (allele model : or=0.807, 95%ci=0.7220.903, p0.05). the case group had elevated percentages of patients with a smoking history, a family history of cancers, and a history of alcohol consumption compared with the control group, although no statistical significance was achieved (all p>0.05). however, the fev1 was significantly lower in the case group than the control group (p0.05). the comparisons of the rs2275913 and rs8193036 frequencies between the asthma patients and healthy controls were statistically significant in both allele and additive models (all p0.05). the present meta - analysis enrolled 12 eligible case and control studies [13,14,17,2028 ], including 3575 asthma patients and 3671 healthy controls. a total of 6 studies investigated the association between the il-17 7488a / g (rs763780) snp and asthma, which demonstrated that il-17 7488a / g (rs763780) snp may increase asthma risk in allele models (or=0.667, 95%ci=0.4890.908, p=0.010), but not additive models (or=0.693, 95%ci=0.4531.060, p=0.091) (figure 2). the association between il-17197g / a(rs2275913) snp and asthma was investigated in 4 studies, which revealed that the il-17197g / a (rs2275913) polymorphism may elevate the risk of asthma in both allele and additive models (allele model : or=0.764, 95%ci=0.6070.961, p=0.021 ; additive model : or=0.639, 95%ci=0.4360.937, p=0.022) (figure 3). a total of 4 studies explored the association between il-17737c / t (rs8193036) snp and asthma susceptibility. the results in allele and additive model suggested that il-17737c / t (rs8193036) snp may enhance the risk of asthma (allele model : or=0.807, 95%ci=0.7220.903, p<0.001 ; additive model : or=0.751, 95%ci=0.6480.870, p<0.001) (figure 4). our study interrogated the associations between rs763780, rs2275913 and rs8193036 snps in il-17 gene and asthma susceptibility in an asian population. asthma is an inflammatory and immune disease mediated by aberrant th2 immune responses induced by excessive stimulation of exogenous factors, which engages the ige receptor to elicit the secretion of pro - inflammatory cytokines, including il-17, tnf-, il-1, and il-6. emerging evidence supports that il-17 is closely involved in the pathologies of the airway asthmatics. indeed, functional analysis demonstrated that overexpression of il-17f in a mouse model with increased numbers of neutrophils in the airways resulted in antigen - induced allergic inflammatory responses, whereas il-17f - deficient mice had defective airway neutrophilia responding to allergen challenge. the ability of il-17a and il-17f to induce neutrophils migration suggests that they are involved in severe asthma, in which accumulation of neutrophils in the airways is a major defining hallmark. this is consistent with the role of il-17 in enhancing the activation of bronchial fibroblasts, epithelial cells, and smooth muscle cells and in inducing the secretion of cytokines and chemokines, which in concert leads to the accumulation of neutrophils with proteolytic enzymes that may burden the airway. the most important finding in our study was that rs763780, rs2275913 and rs8193036 snps were closely associated with asthma susceptibility. conducted a genetic analysis investigating the association between asthma and common variants il-17 and il-13, indicating that il-17 may play a role in the etiology of asthma because the il-17a rs8193036 sequence variations significantly influence the risk of asthma. a close association between rs8193036 in the il17a promoter region and pediatric bronchial asthma was also reported in a taiwanese population. the snp rs2275913, located at position 152 bp upstream of the starting site of il-17 mrna, has been reported to influence the susceptibility and pathophysiological features of ulcerative colitis. in addition, chen. demonstrated that il-17 snp rs2275913 was implicated in several asthma - related traits that confer genetic susceptibility to childhood asthma. our study also found that the frequencies of il-17 rs763780 in the asthma patients and healthy controls were statistically different in allele models. intriguingly, a study conducted in saudi arabia suggested no significant association between il17f snps and asthma risk, except for the ag heterozygotes of rs17880588 in il17a. however, qian f. indicated that the c allele of rs763780 in il17 was associated with an increased risk of asthma. our study provides compelling evidence that il-17 snps (rs763780, rs2275913, and rs8193036) may be associated with asthma susceptibility. our study combined a carefully designed case - control study with a large sample size and carried out a meta - analysis using data from previously published studies. however, our results must be interpreted with caution because more prospective studies with larger sample size and diverse populations are needed to validate the association between il-17 snps and the development of asthma. | backgroundthe aim of this study was to examine the associations between the single - nucleotide polymorphisms (snps) of interleukin-17 (il-17), including rs763780 (7488a / g), rs2275913 (197g / a), and rs8193036 (737c / t), and asthma susceptibility in an asian population.material/methodsfrom oct 2013 to dec 2014, 125 asthma patients enrolled in our hospital were selected as the case group. another 132 healthy controls undergoing physical examinations in our hospital were enrolled as the control group. the genotype frequencies of il-17 rs763780, rs2275913 and rs8193036 snps were detected using polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp). comprehensive meta - analysis 2.0 (cma 2.0) software was applied for meta-analysis.resultsour results demonstrated that asthma patients presented with higher frequencies of ga genotype in rs2275913 and tt genotype in rs8193036 of il-17 than healthy controls (both p0.05). the comparisons on the rs2275913 and rs8193036 frequencies between the asthma patients and healthy controls were statistically significant in both allele and addictive models (all p0.05). the overall results of our case - control study were further confirmed by meta-analysis.conclusionsour results revealed that, in an asian population, il-17 rs763780, rs2275913, and rs8193036 snps may be associated with asthma susceptibility, and ga genotype in rs2275913 and tt genotype in rs8193036 of il-17 may contribute to increased risk of asthma in asians. |
in the previous issue of critical care, rumpf and colleagues evaluated the potential contribution of measuring end - tidal carbon dioxide (co2) for suspected pulmonary embolism (pe) in the prehospital setting. capnography has been studied for decades as a potential diagnostic tool for patients with suspected pe. indeed, pe is expected to create areas of reduced arterial flow with normal or increased alveolar ventilation, resulting in increased alveolar dead space volume and reduced global expired co2. this should create a difference between arterial and end - tidal co2 values, as first demonstrated by robin and colleagues in 1959. however, during the two following decades, several authors pointed out the numerous pitfalls and sources of errors in assessing the arterial to end - tidal co2 difference in the clinical suspicion of pe, and this test was finally abandoned until the nineties [3 - 5 ]. three elements explain the current resurgence of expired co2 measurement in the suspicion of pe. first, technical improvements now allow measuring co2 not only for monitoring purposes in intubated patients in operating rooms but also as a diagnostic tool in spontaneously breathing patients in the emergency department or even in the field. second, volumetric capnography, which displays expired co2 as a function of the expired volume of the patient, did much to renew interest in capnography because of its potential for better performance in diagnosing pe than the arterial to endtidal co2 difference, even though that expectation could not be confirmed by recent results. finally, in the era of non - invasive strategies for pe combining several tests of various types, such as clinical evaluation, biological tests, and imaging, the evaluation of a potential role for co2 measurement in combination with those other instruments made sense. numerous studies are available, and although none to date has been able to prove the safety of such a non - invasive strategy incorporating capnography with a high enough level of evidence to allow its recommendation in daily clinical practice, the venue remains interesting [7 - 11 ]. where then can we place the endeavor of rumpf and colleagues ? they included 131 consecutive patients suspected of pe who had an abnormal rapid point - of - care d - dimer result in a prehospital setting and evaluated them with a combination of clinical probability of pe (two - level wells score) and measurement of the end - tidal partial pressure of co2 (pco2). pe was diagnosed in the emergency department by a positive spiral computed tomography, a high - probability v / q scan, or a positive pulmonary angiogram. the combination of a normal end - tidal co2 value (defined as higher than 28 mm hg based on a receiver operating characteristic analysis) and an unlikely probability of pe had a 100% sensitivity and 100% negative predictive value (95% confidence interval [ci ] 90% to 100%) for ruling out pe. in contrast, the association of a low end - tidal co2 value (less than 28 mm hg) and a high clinical probability had only an 86% positive predictive value for pe, and further tests would certainly be required in such patients. clearly, those results are preliminary. this is a small series and it was designed to set the cutoff value for this particular capnography technique and assess its feasibility in the field. moreover, as acknowledged by the authors themselves, the clinicians who established the diagnosis were not blinded to either clinical assessment or capnography results. finally, the prevalence of pe is unusually high, although this would tend to bias the results toward lower, not higher, sensitivity. but the sheer simplicity of the technique used by rumpf and colleagues is appealing and certainly deserves validation in a large - scale prospective study. indeed, it emphasizes the use of expired co2 alone without associated arterial pco2, and this is a pragmatic issue in modern emergency medicine. also, the use of capnography in the prehospital setting is interesting : there might be situations in which a rapid and rough evaluation of the patient 's expired co2 status would help emergency physicians in making vital decisions, such as starting thrombolysis for a suspected fulminant pe, as well as in monitoring the hemodynamic effect of thrombolysis in such patients. finally, the merit of the article by rumpf and colleagues is to remind us that clinical applications of capnography are still growing, especially amongst spontaneously breathing patients. physicians dealing with acute medicine should make every effort to become familiar with expired co2 measurement. inconclusive capnographic results related to tachypneic or apprehensive patients do not overcome the potential for expired co2 to be placed inside the diagnostic algorithm of a challenging disease like pe. co2 : carbon dioxide ; pco2 : partial pressure of carbon dioxide ; pe : pulmonary embolism. | capnography has been studied for decades as a potential diagnostic tool for suspected pulmonary embolism. despite technological refinements and its combination with other non - invasive instruments, no evidence to date allows recommending the use of expired carbon dioxide measurement as a rule - out test for pulmonary embolism without additional radiological testing. further investigations are, however, still warranted. |
a 20-year - old virgin patient with an episode of massive menorrhagia at menarche was admitted to the emergency room (er) of the department of obstetrics and gynecology. her medical history revealed that 15 days prior to the presentation at the emergency department, she had been prescribed a ten - day course of progestogen therapy on request to delay her menstrual cycle. her periods lasting for 6 to 7 days were normal and regular occurring at 25-day intervals. on examination, she was afebrile with blood pressure of 70/40 mm hg and pulse rate of 130 beats per minute. transabdominal ultrasound depicted a distended uterus 90 mm in diameter (figure 1a) which communicated with a markedly distended vagina (figure 1b). she had been bleeding heavily for 5 days causing a drop in hemoglobin level down to 5.1 gr / dl, while other laboratory test results were unremarkable. she was initially treated with blood transfusion (eight units of packed red blood cells and four units of packed fresh - frozen plasma were transfused) and hemostasis was achieved rapidly using high doses of combined oral contaceptive (ethinyl estradiol 0.02 mg, and gestodene 0.075 mg) twelve times a day, tranexamic acid 1000 mg q.i.d., and naproxen sodium 550 mg b.i.d. after one day, a chocolate - like fluid started to spill out from the vagina. heterogeneous structures the largest being 90 mm in diameter were seen in the uterine cavity. (b) transabdominal sonographic view showing the markedly distended vagina measuring 88.9 mm x 39.2 mm (hematocolpos). heterogeneous structures the largest being 90 mm in diameter were seen in the vaginal cavity. congenital abnormalities resulting in hematometrocolpos include imperforate hymen, a complete transverse vaginal septum, vaginal and, rarely, cervical atresia [7, 8, 9 ]. these acquired problems are caused by iatrogenic interventional traumas to the uterine cervix such as cone biopsies, loop electrosurgical procedures, dilation and curettage, obstetric lacerations, cervical or endometrial carcinoma, and radiation therapy [9, 10, 11, 12, 13, 14 ]. firstly, pregnancy and pregnancy - related complications need to be excluded from the patient s medical history. about one fifth of females presenting with heavy menstrual periods may have an underlying blood dyscrasia [2, 15, 16, 17 ]. hmb may be associated with a variety of endocrine disorders such as thyroid disease, adrenal problems and other medical problems such as hepatitis, chronic renal disease or diabetes mellitus. in addition, hmb episodes may occur because of disruptions or abnormalities of the coagulation cascade. in the present case, sonographic findings demonstrated acquired obstruction of the lower female genital tract, specifically hematometra and hematocolpos. the intracavitary findings included different degrees of resolving hemorrhage, but a malignancy, although less likely, could not be ruled out. however, presenting symptoms of hematometra and hematocolpos without any evidence of primary and secondary amenorrhea were considered to be related to massive uterine bleeding following the use of progestin fifteen days previously. in the present case, it was thought that massive uterine bleeding could have caused an obstruction secondary to the clot formation. narrow diameter of the hymenal opening may have facilitated this process. with medical therapy, the patient s clinical symptoms improved, uterine and vaginal bleeding stopped and coagulated blood in the vagina dissolved and drained from the vagina. as in the present case, abnormal uterine bleeding associated with the use of exogenous steroids, systemic or local agents is classified as planning is very important in the treatment of both acute bleed and its maintenance therapy. it is generally recommended that adolescents with active hmb and hemoglobin of less than 8 mg / dl should be admitted into er during an acute bleed [5, 19 ]. intravenous crystalloid infusion for the replacement of the blood volume may be given to a patient with an acute hmb episode which is causing anemia. a randomized controlled trial reported that in 72% of the patients given intravenous [4, 17 ] estrogen, bleeding was stopped after two doses (over 12 h) compared with 38% of controls given a placebo. for adolescents already using combined oral contraceptives (cocs) and admitted with hmb despite treatment, transition to i.v. there is not enough data as yet to recommend one specific type of coc over any other. antifibrinolytics have the effect of halting the lysis of clots occurring at the end of the clotting cascade thus improving the clotting process. antifibrinolytics have been reported to decrease bleeding in about half of the women with hmb and can be administered in combination with contraceptive methods. current studies have also shown that nsaids decrease menorrhagia in adolescents compared to placebo (600 - 1200 mg daily). surgical management of adolescents with hmb is seldom necessary as more than 90% of them will respond to medical management. the underlying etiology of the acquired obstructed cervix in the patient presented here is not as yet fully understood. potential etiologies include progestin use, decreased uterine contractility triggered by high progestin levels, which might have prevented the effective removal of menstrual debris, and lastly, a possible partial obstruction causing massive uterine bleeding and drainage of bleeding around a solid obstruction. decreased drainage of accumulated debris rather than acute hemorrhage may have caused hematometrocolpos. thus, the underlying etiology of the obstruction in this patient was uncertain, and this case denotes an unusual cause of acquired spontaneous hematometra and hematocolpos developed following progestin use. adolescents often present at gynaecologists with hmb, although hmb following the usage of contraceptive pills which may cause hematometrocolpos is rare. the diagnosis and treatment of this situation includes a careful physical, and ultrasonographic examinations, and laboratory tests to exclude other diagnoses such as bleeding disorders, anatomic and endocrine causes. treatment methods include hormonal therapies, antifibrinolytics and nonsteroidal anti - inflammatory drugs, which are effective, well - tolerated and safe. this case shows that a careful history and examination is very important in the recognition of a rarely seen life - threatening menorrhagic episodes arising from usage of progestin with the intention to delay the menstrual cycle. adolescents often present at gynaecologists with hmb, although hmb following the usage of contraceptive pills which may cause hematometrocolpos is rare. the diagnosis and treatment of this situation includes a careful physical, and ultrasonographic examinations, and laboratory tests to exclude other diagnoses such as bleeding disorders, anatomic and endocrine causes. treatment methods include hormonal therapies, antifibrinolytics and nonsteroidal anti - inflammatory drugs, which are effective, well - tolerated and safe. this case shows that a careful history and examination is very important in the recognition of a rarely seen life - threatening menorrhagic episodes arising from usage of progestin with the intention to delay the menstrual cycle. | hematometrocolpos is accumulation of blood in the vagina and uterine cavity due to intra - uterine hemorrhage. a 20-year - old female presented to our clinic with massive menorrhagia at menarche after progestin usage. hematometrocolpos was detected by transabdominal ultrasonography. she was pale because of heavy bleeding for 5 days and hemoglobin level was measured as 5.1 g / dl. initial treatment was blood transfusion and medical drug therapy. after resolution of the hematometrocolpos was shown by transabdominal ultrasound 2 days later, the patient, who was stable, was discharged without complication. obstruction of the female genital outflow tract is rarely seen. hematocolpos has been reported in elderly women following vaginal occlusion due to radiotherapy, vaginal fibroma and labial synechiae causing infection or inflammatory conditions. the case is presented here because of the successful management of hematometrocolpos due to massive dysfunctional uterine bleeding in a young virgin patient. |
coronal plane alignment of the lower limb is an important factor that affects implant stability and clinical outcomes after total knee arthroplasty (tka)1 - 3). varus osteoarthritis of the knee is the most common indication for tka, which is accompanied with contracture of the medial collateral ligament and other medial soft tissue structures4 - 6). thus, correction of a varus deformity using adequate soft tissue release methods is essential to knee stability and clinical improvement1 - 3). soft tissue release techniques have been addressed in a variety of studies, and sequential releases have been mostly recommended3,7 - 10). in particular, some authors suggested that the distal portion of the superficial medial collateral ligament (smcl) should be released first11), whereas others recommended deep mcl and posterior oblique ligament (pol) should precede other procedures6 - 8). the purpose of our study is to test the hypothesis that pol release following deep mcl release would be more beneficial than superficial mcl release following deep mcl release for achieving adequate soft tissue balance using sequential release techniques in minimally invasive surgery (mis)-tka. of the 700 patients who underwent unilateral mis - tka between january 2011 and december 2011 at our institution, 186 patients were enrolled in this retrospective study. the patients were randomly assigned to smcl release group (n=103) and pol release group (n=83) within an interval of one month. exclusion criteria were additional soft tissue releases involving the pes anserinus and semimembranosus tendons other than the deep mcl and concurrent releases of the smcl and pol. patients who underwent revision tka or had an infection, a fracture, a history of knee surgery, or a 10 flexion contracture were also excluded. the mean age of the patients was 67 years (range, 58 to 83 years) in smcl release group and 66 years (range, 52 to 81 years) in pol release group, showing no significant difference. no statistically significant intergroup difference was noted in gender, body mass index, preoperative range of motion (rom), and severity of the preoperative varus deformity (table 1). all the operations were performed by a single surgeon using the same posterior cruciate ligament substituting type (ps type) of prosthesis (scorpio nrg, stryker, allendale, nj, usa). the anterior and posterior cruciate ligaments were sacrificed and a 9 mm distal femoral resection was performed. the proximal tibia was resected to create a 19 mm flexion - extension gap using the linker so that a 10 mm polyethylene insert (pe) could be placed. whether the actual thickness of the inserted pe was close to 10 mm or 10 mm was assessed to investigate if the smcl release or pol release resulted in an increased flexion - extension gap requiring a thicker pe than we had intended to use. the surgery was performed via a less than 2 cm quadriceps tendon incision using the limited anteromedial arthrotomy approach. using extramedullary alignment guides, femoral and tibial bone cuts were made with reference to the mechanical axis of the lower limb. for soft tissue balancing, deep mcl release was followed by pol release or smcl release. if necessary, semimembranosus tendon and/or pes anserinus tendon were additionally released. pol release was defined as the release of the pol located in the posteromedial one third of the knee, one of the five branches of the semimembranosus tendon, and the complex formed by the oblique popliteal ligament from the medial side of the knee to immediately below the semimembranosus tendon. smcl was released 1 - 2 cm distal to the joint line using a periosteal elevator. deep mcl release was performed in all patients and smcl release was carried out in 103 patients and pol release in 83 patients (fig. 1). in patients with 2 mm difference in the flexion - extension gap, additional soft tissue release procedures were performed. thereafter, active and passive joint exercises were allowed within a comfortable range of motion. the difference in the thickness of pe was compared between pol release group and smcl release group. as multiple measurements were obtained from each patient, repeated measure analysis of variance (anova) fisher 's exact test using a permutation method for multiple comparisons was carried out to verify the results. of the 700 patients who underwent unilateral mis - tka between january 2011 and december 2011 at our institution, 186 patients were enrolled in this retrospective study. the patients were randomly assigned to smcl release group (n=103) and pol release group (n=83) within an interval of one month. exclusion criteria were additional soft tissue releases involving the pes anserinus and semimembranosus tendons other than the deep mcl and concurrent releases of the smcl and pol. patients who underwent revision tka or had an infection, a fracture, a history of knee surgery, or a 10 flexion contracture were also excluded. the mean age of the patients was 67 years (range, 58 to 83 years) in smcl release group and 66 years (range, 52 to 81 years) in pol release group, showing no significant difference. no statistically significant intergroup difference was noted in gender, body mass index, preoperative range of motion (rom), and severity of the preoperative varus deformity (table 1). all the operations were performed by a single surgeon using the same posterior cruciate ligament substituting type (ps type) of prosthesis (scorpio nrg, stryker, allendale, nj, usa). the anterior and posterior cruciate ligaments were sacrificed and a 9 mm distal femoral resection was performed. the proximal tibia was resected to create a 19 mm flexion - extension gap using the linker so that a 10 mm polyethylene insert (pe) could be placed. whether the actual thickness of the inserted pe was close to 10 mm or 10 mm was assessed to investigate if the smcl release or pol release resulted in an increased flexion - extension gap requiring a thicker pe than we had intended to use. the surgery was performed via a less than 2 cm quadriceps tendon incision using the limited anteromedial arthrotomy approach. using extramedullary alignment guides, femoral and tibial bone cuts were made with reference to the mechanical axis of the lower limb. for soft tissue balancing, deep mcl release was followed by pol release or smcl release. if necessary, semimembranosus tendon and/or pes anserinus tendon were additionally released. pol release was defined as the release of the pol located in the posteromedial one third of the knee, one of the five branches of the semimembranosus tendon, and the complex formed by the oblique popliteal ligament from the medial side of the knee to immediately below the semimembranosus tendon. smcl was released 1 - 2 cm distal to the joint line using a periosteal elevator. deep mcl release was performed in all patients and smcl release was carried out in 103 patients and pol release in 83 patients (fig. 1). in patients with 2 mm difference in the flexion - extension gap, additional soft tissue release procedures were performed. patients who underwent other medial structure releases were excluded from the study. the patella was resurfaced and the implant was cement fixated in all patients. thereafter, active and passive joint exercises were allowed within a comfortable range of motion. the difference in the thickness of pe was compared between pol release group and smcl release group. as multiple measurements were obtained from each patient, repeated measure analysis of variance (anova) fisher 's exact test using a permutation method for multiple comparisons was carried out to verify the results. the mean pe thickness was 10.61.3 mm (range, 8 to 15 mm) in pol release group and 11.91.8 mm (range, 10 to 18 mm) in smcl release group, showing no significant difference between the groups (p=0.001). specifically, the thickness of the pe that was used in pol release group was 10 mm in 62 patients (72%), 8 mm in three patients (3.4%), 10 mm in 59 patients (68.6%), 12 mm in 21 patients (13.9%), and 15 mm in three patient (3.4%). in smcl release group, the thickness was 10 mm in 33 patients (32%), 12 mm in 54 patients (52.4%), 15 mm in 16 patients (15.5%), and 18 mm in two patients (1.9%) (fig. fisher exact test results showed that the pes were close to 10 mm in thickness in pol group, whereas thicker than 10 mm, such as 12 mm or 15 mm, in many patients in smcl group, which showed statistically significant intergroup difference (p=0.001). in both groups, the mean postoperative rom was 125 in both groups, showing no significant intergroup difference (p=0.643). no notable difference was found between the groups in the postoperative femoro - tibial angle after varus deformity correction (p=0.092), skin incision length (p=0.683), and amount of blood loss (p=0.283). the mean intraoperative tourniquet time was 54.210.4 minutes in pol release group and 51.710.3 minutes in smcl release group. the 3 minutes of difference between the groups was statistically significant (p=0.001), but was not clinically meaningful (table 2). the knee society score (kss) knee score, kss functional score, and western ontario and mcmaster universities (womac) score were improved postoperatively in both groups, but there was no significant difference between the groups (table 3). varus deformity in knee osteoarthritis should be corrected and is often associated with contracture of medial soft tissue structures6,10,12 - 15), such as the deep mcl, smcl, pol, attachment site of the semimembranosus tendon to the posterior capsule, and pes anserinus tendon. release methods of these soft tissue structures have been addressed in various studies, most of which recommend sequential releases6 - 10). deep mcl release is often the first step in sequential releases, which can be followed by a release of the pes anerinus or semimembranous tendon in severely deformed knees. on the other hand, the order of the smcl release and pol release has been dependent on the surgical techniques applied6,13,16,17). theoretically, release of the anterior portion of the smcl is performed to increase the flexion gap, whereas release of the pol, a posteromedial structure that affects the extension gap, is recommended to enlarge the extension gap relative to the flexion gap2,5,6,10). practically, however, the surgeon 's preference often dictates the sequence of soft tissue releases for correction of mild - to - moderate varus deformity. the deep mcl and distal portion of the smcl were released first in some studies11,18), whereas pol release was the first in the sequence in other studies6 - 8). soft tissue release and bone resection in tka are performed taking care to balance the flexion - extension gap as much as possible. bone resection can precede sequential soft tissue releases or can be performed during the release procedures. in this study, we investigated which of the two soft tissue releases (smcl release and pol release) after deep mcl release and bone resection promotes more appropriate soft tissue balance. smcl release resulted in a relatively greater flexion - extension gap, which facilitated mis - tka but required insertion of a relatively thick pe. pol release enabled flexion - extension gap balancing without extra operation time and skin incision compared to smcl release and allowed for insertion of a properly sized pe. in particular, deep mcl and pol were released first considering that pcl resection in tka using a ps type prosthesis tends to increase the flexion - extension gap. insufficient soft tissue release results in unsatisfactory deformity correction, whereas excessive release relatively increases the flexion - extension gap on the medial side, which can eventually lead to instability of the knee20,21). accordingly, in the latter case, lateral soft tissue release is required for gap balancing and a thick pe often needs to be inserted, which can result in restricted rom due to higher joint line, patellofemoral maltracking, and extension restriction22 - 24). in our patients, an 8 mm pe was used in knees with a balanced flexion - extension gap without additional bone resection or soft tissue release, whereas 15 mm pe was inserted in knees with increased lateral ligament laxity and a tight extension gap. the limitations of this study lie in the retrospective nature : 1) only 186 of the 700 tka patients could meet the inclusion criteria and 2) the possibility of selection bias was not eliminated because randomization between groups was not achieved. however, when the two groups where additional soft tissue release was not required were compared, the distribution of the 10 mm pe showed differences. we believe that deep mcl release and pol release in tka is useful for the employment of an mis technique, correction of a mild - to - moderate varus deformity, and insertion of a pe with a proper thickness. we believe that pol and deep mcl releases in mis - tka would be beneficial for varus deformity correction in the osteoarthritic knee. | purposeto assess proper soft tissue balancing of the varus arthritic knee between posterior oblique ligament (pol) release group and superficial medial collateral ligament (smcl) release group.materials and methodsthis retrospective study was performed on 186 patients who underwent minimally invasive surgery (mis) total knee arthroplasty (tka) from january 2011 to december 2011. eighty - three patients were in the group of smcl release and 103 patients were in the pol release group. we intended to use a 10 mm polyethylene insert (pe) during tka, and retrospectively compared the actual thickness of pe between pol release group and smcl release group.resultsthe mean pe thickness was 10.591.3 mm (range, 8 to 15 mm) in pol group and 11.881.8 mm (range, 10 to 18 mm) in smcl group (p=0.001). we found a significant difference in the mean pe thickness between pol release group and smcl release group.conclusionspol and deep mcl releases in mis - tka would be beneficial for varus deformity correction in the osteoarthritic knee. |
despite well over 150 years of clinical use, a detailed molecular mechanism of anesthesia remains unresolved. the once prevailing hypothesis suggested that anesthetics worked through a nonspecific, membrane disruption mechanism, known as the meyer recent studies have shown that most, if not all, anesthetics affect a family of ion channels in the nervous system known as the cys - loop family of pentameric ligand - gated ion channels (plgic). while other potential targets of anesthetics have been also found, e.g., the hcn family of channels, the two - pore k leak channels, and voltage - gated cation channels, cys - loop receptors remain the best characterized and most studied of membrane channels in the context of anesthetic action. these receptors act in response to the release of neurotransmitters from the presynaptic terminal and are targets for multiple pharmacological agents, including alcohol, barbiturates, and benzodiazepines, in addition to anesthetics. the structural changes associated with channel modulation, however, are still poorly understood because of the challenge of resolving high - resolution structures of these receptors. recently, crystal structures of glic (g. violaceus ligand - gated ion channel) and elic (e. chrysanthemi ligand - gated ion channel), which are bacterial homologues of nervous system plgics, have been solved in both the presence and absence of anesthetics and provide a tremendous opportunity to resolve the molecular mechanism behind plgic function and modulation. several hurdles remain to understanding anesthetic action, however, including determining the energetics and kinetics of anesthetic binding to plgics, elucidating how anesthetic binding disturbs the normal dynamics of these channels, and uncovering the anesthetic binding site (or sites) in ligand - gated ion channels. multiple methods have been used to try to elucidate the latter, including crystallography, mutagenesis, photolabeling, and molecular dynamics (md) ; however, multiple binding sites have been reported and there is no consensus as to which site modulates ion channel function. while static structures provide insight into possible binding sites of anesthetics, the modulation of channel function is an inherently dynamic process that requires a dynamic description of the anesthetic / plgic complex. md simulation is a technique that can probe the effects of bound anesthetics on ion channel dynamics with a high degree of spatial and temporal resolutions. moreover, the solution of atomic - resolution (2.93.1) glic structures with bound anesthetics positions md simulations to be an integral tool in understanding how these molecules affect ion channel dynamics in atomic detail. modern anesthetics comprise two main classes based on their delivery method : inhaled (volatile) anesthetics and intravenous anesthetics. most inhaled anesthetics are heavily halogenated (e.g., halothane and desflurane) and can be difficult to model because of the unique chemical properties of large halogens. compared to volatile anesthetics, intravenous anesthetics are generally larger (e.g., propofol and lidocaine) and can comprise complex multi - ring structures (e.g., ketamine and etomidate) that require extensive computational resources to model accurately, making parametrization difficult and time - consuming. because of the availability of parameters for myriad chemical groups in standard force fields, one common solution is to transfer parameters from similar molecules in order to create an amalgamated parameter set for each individual molecule. while this is generally acceptable for bonds and angles, atomic charges and torsions are more complex and not as portable ; moreover, standardized parameters for halogenated ethers are nonexistent and therefore not amenable to this technique. models of halothane have been published previously but were not designed for compatibility with biomolecular force fields, such as charmm. additionally, other models of modern anesthetics have been published. however, with the exception of the isoflurane model developed by hnin., for which adequate comparison to experimental data has been performed, the other models lack extensive and rigorous testing against experimentally determined physicochemical properties. in order to study the effect of anesthetics on ion channels, a set of standardized parameters compatible with biomolecular force fields that are validated against experimentally verifiable physicochemical properties is necessary. in this study, we present a novel set of parameters for the ubiquitous modern anesthetics desflurane, isoflurane, sevoflurane, and propofol (figure 1), which is compatible with the widely used charmm force field for biomolecules. these four species were chosen because they represent four of the most commonly used clinical general anesthetics that these bacterial channels are also sensitive to. the parameters generated for each anesthetic were compared against five different experimentally measured properties, namely, dipole moment, density, heat of vaporization, free energy of solvation in water, and free energy of solvation in oil, to assess the accuracy of the parameter set developed. in all four cases, the atomic models reproduce experimental physicochemical properties, signifying the robustness of the model and reflecting their ability to reproduce the molecular behavior of anesthetics in multiple environments. moreover, we calculated the free energy of partitioning of each anesthetic into a 1-palmitoyl-2-oleyl - sn - glycero-3-phosphatidylcholine (popc) bilayer to investigate how these molecules interact with the membrane. in all cases, the anesthetics preferred the glycerol backbone region of the membrane over either the membrane core or aqueous solution by 45 kcal / mol. we measured how the partitioned anesthetics affected membrane structure by computing the atomic density profiles, area per lipid, deuterium order parameters, dipole potential, and lateral stress profile. no difference was observed in these measurements between a popc - only membrane and a popc membrane with partitioned anesthetics. the results from the physicochemical studies presented suggest that, in physiological context, anesthetics partition to the membrane, without disturbing the structure of the membrane itself, prior to interacting with plgics. the recent development of the force field toolkit (fftk) by our group enables rapid and robust parametrization of small molecules for application to biomolecular simulations employing charmm - compatible force fields. in addition to parameter optimization, fftk provides several tools for assessing parameter quality throughout the course of parameter development. these tools, as well as simulation - based calculations, were utilized extensively to develop optimal parameters for a set of anesthetics as assessed by comparison to experimental data. for a more detailed description of the parametrization process, two levels of theory were used to properly model the different characteristics of the heavily halogenated inhaled anesthetics and the large intravenous anesthetics. ab initio calculations on desflurane, isoflurane, and sevoflurane (inhaled anesthetics) utilized the hybrid b3lyp density - functional theory with the 6 - 311+g(2d, p) basis set for geometry optimization and to calculate bonded, electrostatic, and torsional interactions. b3lyp is known to calculate accurate geometries and hydrogen - bonded complexes for small molecules containing first row elements and has been used to parametrize halogenated molecules previously. for propofol, second - order mller plesset theory (mp2) and the 6 - 31g(d) basis set were used for geometry optimization and to calculate bonded, electrostatic, and torsional terms. parametrization of the anesthetics follows the fftk workflow, which is based on charmm general force field parametrization principles, so as to be consistent with the charmm force field. fftk does not currently support the optimization of lennard - jones (lj) parameters de novo. therefore, all lj parameters for the models presented were adopted from chemically similar atoms in the charmm force field. with the exception of isoflurane, in which the well potential term () was modified, once the geometry was optimized, partial charge assignments were made based on minimum interaction energies and distances between water and all accessible atoms (e.g, an sp carbon would not be accessible to water) derived from quantum mechanical (qm) calculations. the qm dipole moment vector was used as an additional constraint in optimizing charge distribution, with equal weighting applied to the qm dipole and qm water interaction distance terms. in order to reproduce condensed phase properties, parameters for md simulations should overestimate the gas - phase dipole moment of the molecule by as much as 20% and an overestimation of the qm dipole by 1020% if the dipole moment was outside of this range, another iteration of charge optimization was performed followed by another dipole moment measurement. the dipole moment was calculated according to1where the bars denote the vector length, n denotes the number of atoms in the molecule, qi denotes the charge of the ith atom, and ri denotes the position vector of the ith atom. scans of each torsion were made at 3 steps, and the dihedral parameters were fit to the resulting potential energy surface (pes). in order to validate the quality of the parameters generated using this scheme, md simulations were performed to calculate bulk thermodynamic properties of each anesthetic, which were subsequently compared to experimental data (described in further detail below). following the optimization of bond, angle, and dihedral terms against the qm data, the bulk properties of density and enthalpy of vaporization were calculated for each anesthetic and compared against the corresponding experimentally determined values as an initial assessment of the accuracy of the model. a temperature of 298 k was utilized throughout the simulations because the anesthetics are liquid at this temperature, and the experimental data were measured at this temperature. each simulated system comprised 216 copies of the anesthetic positioned on a 6 6 6 cubic grid each with a random initial orientation about its center of mass. the system was first minimized for 10 000 steps, then equilibrated for 100 ps, and finally simulated in an npt ensemble for 2.5 ns. the enthalpy of vaporization (hvap) was measured according to the following equation:2where uliq is the potential energy of the system in the liquid state, p is the pressure of the system, vliq is the volume of the liquid system, nmol is the number of molecules in the system, and ugas is the potential energy of the gaseous system. the brackets... denote a time average over the length of the production simulation. as indicated in eq 2, the pvliq term is negligible and is ignored in this calculation. assuming the intramolecular energy is the same in gas and condensed phases (i.e., ugasintra = uliqintra), the intermolecular interactions energies (i.e., electrostatic and van der waals interactions) can be computed from a single bulk phase simulation. this is done according to3where uliqinter is the average intermolecular energy of the liquid, uliqsys is the average potential energy for the entire system (including inter- and intramolecular interactions), and uliqintrai is the average intramolecular energy of the ith molecule. the brackets... denote a time average over the length of the production simulation. for the sake of completeness, we also calculated the heat of vaporization as detailed in the charmm general force field, using one 100 ns gas phase calculation to calculate the intramolecular energy of the molecule. that the parameter set was not able to reproduce experimental values for density and hvap within the determined error ranges (for example, in the case of isoflurane), then the process of optimization was restarted beginning with charge distribution optimization. only when the parameter set was able to reproduce experimental bulk properties was the parameter set tested against the more computationally intensive and rigorous free energies of solvation. as discussed, the calculated dipole is expected to be 1020% higher than experimental gas phase dipole moment to replicate condensed phase properties. because dipole is calculated using only the equilibrium geometry, calculated values are presented as the mean standard deviation, where standard deviation was calculated across five replicates. values in parentheses are the heat of vaporization calculated utilizing the method employed in the charmm general force field, in which a single but long gas phase trajectory for a copy of the molecular species is presented for comparison. because of the high boiling point of propofol (529 k), the hvap varies widely ; however, the calculated value is well within the experimental range. taking advantage of readily available experimental data on the free energy of solvation in both water (gsolvh2o) and olive oil (gsolvoil) for the anesthetics studied, we computed these values for each of the anesthetics as the final criterion for determining the quality of the parameters. as olive oil is difficult to model because of its unknown and variable composition, dodecane has been used as a substitute in these types of calculations. in each calculation, the anesthetic was placed at the origin of a pre - equilibrated solvent box measuring 30 on each side containing either water or dodecane. alchemical free energy perturbation (fep) (successfully implemented for anesthetics previously) was used to calculate both gsolvh2o and gsolvoil for each anesthetic by incrementally decoupling the molecule from the surrounding solvent environment followed by incrementally recoupling to the surrounding solvent environment. each transformation proceeded over 25 windows run both forward (solvation) and backward (desolvation), a total of 50 windows, to minimize the hysteresis. each alchemical window was equilibrated for 1 ps and simulated for 0.5 ns of data collection, requiring a total of 25 ns for each decouple / recouple cycle. to avoid the end - point catastrophe, the zacharias soft - core potential was used in addition to shifting the lennard - jones potentials by 5.5 and slowly decoupling the electrostatics and van der waals interactions of the anesthetic from solution. the transformation was repeated 10 times for each molecule and the free energy change calculated using the bennett acceptance ratio (bar). thus, the free energy calculations required a total of 250 ns of fep simulation per anesthetic in each environment (a total of 2 s of simulation for all fep transformations). umbrella sampling (us) was used to calculate the free energy profiles for partitioning of anesthetics into a lipid bilayer based on similar protocols used for small molecules. a total of 38 umbrellas with a 1 distance between biasing potentials were defined along the membrane normal ranging from z = 0 (center of membrane) to z = 38 (bulk aqueous solution). the center of mass of each anesthetic was restrained to the center of each umbrella by a harmonic potential using a force constant of 7.17 kcal mol. each umbrella was minimized for 5000 steps and simulated for 10 ns, recording the position of the molecule every 0.2 ps. the free energy profile was reconstructed with wham, utilizing the last 9.5 ns of the trajectory for the analysis. therefore, calculation of the profile for inserting a single anesthetic into the membrane required a total of 380 ns of simulation (totaling 1.52 s for all four anesthetics). in order to increase computational efficiency and gain better statistics for each anesthetic, the simulation system contained two copies of each anesthetic offset in the z - direction by 38 to prevent unwanted interactions between the two molecules. once the pmf was calculated, the profile was used to calculate the popc / water partition coefficient using the following equation:4where w0 is the width of the membrane taken to be the point along the membrane normal (z - axis) where the choline density decays to zero (z = 25). in order to better understand how anesthetics affect membranes and membrane structure, we simulated the interaction of a high concentration of anesthetic with a biological membrane. the popc membrane, measuring 96 96 in the xy - plane and constructed using the membrane builder plug - in of vmd, was solvated and ionized to 150 mm nacl using the solvate and autoionize plug - ins of vmd, respectively. this gave the system initial dimensions of 96 96 120 with 216 lipids (108 lipids per leaflet). the resulting system was minimized for 5000 steps and equilibrated for 3 ns in an npt ensemble (p = 1.0 atm, t = 298 k), giving final dimensions of 95 86 95, and was used as the starting point for the membrane - only (i.e., anesthetic and no protein) simulations. by use of the equilibrated system, anesthetic molecules, including desflurane, isoflurane, sevoflurane, and propofol, were placed randomly in the aqueous phase at an anesthetic / lipid ratio of 1:5 and each of the resulting systems was simulated for an additional 100 ns. all simulations were performed using namd2 together with the set of force fields parameters developed herein for each anesthetic (supporting information) and the charmm36 parameters for the tip3p water model and popc. topology and parameters for dodecane were generated by analogy from hexane in the charmm36 parameter set. the target pressure was set to 1.0 atm and the temperature of the system was set to 298 k (25 c) in order to compare directly to experimental physicochemical properties. hoover langevin piston method, and constant temperature was maintained using a langevin damping coefficient () of 1 ps. nonbonded interactions were cut off after 12 with a smoothing function applied after 10. long - range electrostatic interactions were treated using the particle mesh ewald (pme) method with a grid density greater than 1. a time step of 2 fs was used with bonded and nonbonded forces calculated at every time step, while pme calculations were performed at every other time step. the recent availability of multiple atomic - resolution structures of glic, elic, and glucl (a eukaryotic cys - loop receptor from c. elegans) has enabled the detailed, atomic - level study of anesthetic - induced changes in plgics by md simulations. a set of widely available parameters exhaustively tested against experimental physicochemical properties is lacking, however, for most modern anesthetics. therefore, we have rigorously developed a set of parameters that are compatible with the widely used charmm force field for four ubiquitous anesthetics : desflurane, isoflurane, sevoflurane, and propofol. these four anesthetic species were chosen because they are known to inhibit the bacterial channel glic and, therefore, can be widely utilized in studying anesthetic action in addition to the fact that these four molecules represent the most widely used general anesthetics. while desflurane and sevoflurane have not previously been parametrized for the charmm force field, models for isoflurane and propofol have recently been published, along with a desflurane model for gromos. a summary of recent md simulations employing anesthestics together with the force fields utilized is compiled in table s1 of supporting information. all four anesthetics were parametrized de novo in this study (see supporting information for charmm format parameter and topology files for all four anesthetics). the lennard - jones (lj) terms for all atoms were taken by analogy from the charmm force field and, in all cases except isoflurane, were left unchanged in the models presented here. the equilibrium geometry was first calculated for each anesthetic using ab initio calculations (b3lyp/6 - 311+g(2d, p) for halogenated ethers and mp2/6 - 31g(d) for propofol). once the optimized geometry was established, the minimum energy distance between a water molecule and every nonequivalent, accessible atom in the molecule, was calculated and used to assign a partial charge to each atom in the molecule (see methods for a description of accessible atoms). in order to assess the reliability of the current models, we have calculated several physicochemical properties (dipole moment, density, hvap, gsolvh2o, and gsolvoil) for each anesthetic model and have compared them to experimentally determined values (tables 1and 2). in all cases, the parametrized model reproduced experimentally measured properties within acceptable ranges as described in detail below. standard error in free energies calculated using bar. standard error in log k values calculated using monte carlo bootstrap error analysis. although no data for free energy of solvation in an aqueous solution exist for propofol, by use of the aqueous solubility of 160 mg / l and a vapor pressure of 0.01 mmhg, the free energy of solvation could be predicted. in order to judge whether the equilibrium geometry and charge distribution reflected a chemically relevant state, the magnitude of the dipole moment the experimental dipole moment is generally determined in the gas phase ; therefore, to reproduce the properties of the anesthetics in the condensed phase (i.e., the relevant phase in biological simulations), the models should overestimate the experimental dipole moment by up to 20%. the results in table 1 show that the dipole moments of all anesthetics overestimate the experimental gas phase dipole by 1520%, with propofol being overestimated the most (20.0%) and sevoflurane overestimating the experimental dipole moment the least (16.7%). once the charge distribution and equilibrium geometry were validated against the experimental dipole moment, the parameters for bonds and angles were assigned based on a transformation of the ab initio hessian matrix. following assignment of bond and angle terms, torsion scans were conducted for each molecule with a step size of 3 radiating 180 in each direction from the equilibrium geometry. these scans generated a potential energy surface for the molecule which was fit by the dihedral parameters. with a full set of parameters, we then calculated the density and hvap (eq 2) for each anesthetic from bulk phase md simulations and compared them to experimental values (table 1). the parameters were deemed of sufficient accuracy to calculate gsolvoil if the density was within 5% error of the experimental value and heat of vaporization was within a kt (0.59 kcal / mol at simulation temperature of 298 k) of the experimental value, standards set forth in parametrizing the charmm general force field. the density, in most cases, was consistently below 5% error. the density is exquisitely sensitive to lj terms, and the accuracy of the density for these molecules justifies our transfer of these parameters from the charmm general force field. desflurane and isoflurane had the least accurate hvap ; however, the values were only off by 0.42 kcal / mol, less than a kt different from the experimental value. in the case of propofol, the density was 7.9% lower than experimentally determined, but the hvap was well within the range of experimental values, so the parameters were deemed acceptable. comparison to a previous propofol model, which included cmap terms to adjust the torsional term between the phenol hydroxyl and isopropyl groups, shows that the parameters developed here perform slightly better in terms of dipole moment, density, and heat of vaporization (table s2). it is unclear, however, how these two models will perform with respect to calculating protein all anesthetics, except isoflurane, were able to be parametrized in one iteration. however, the first set of parameters for isoflurane produced a density of 1.522 g / ml (1.7% error) and the hvap was 8.79 kcal / mol, which differs from the experimental value by 1.18 kcal / mol. because larger halogens such as the chlorine atoms in isoflurane are quite polarizable, and they are more strongly affected by the molecular contexts, one expects a higher degree of variability in their interaction with the environment. this in turn results in reduced transferability for parameters for large halogens between different compounds. a parameter set developed for the electronic distribution of these atoms is more sensitive to the chemical environment, and the parameters for these atoms are therefore even less transferable than c, n, and o. the heat of vaporization was too large in the first iteration of isoflurane parametrization, but the dipole moment was accurate, suggesting that electrostatic interactions are reasonable. accordingly, and in order to achieve a better heat of vaporization, we opted to modify the lj potential well term () for the chlorine atom (= 0.343 0.225). by use of the modified lj terms, a complete second round of parametrization was performed (including geometry optimization, charge distribution, and assignment of bonded terms), yielding an isoflurane model that reproduced both density and hvap measures to within the acceptance criteria discussed above (i.e., within 5% error for density and a kt for hvap) (table 1). while being able to reproduce bulk properties is essential to an accurate parameter set, the bulk phase is not necessarily representative of the biological environment and further quantification of parameter assessment is needed. in biological environments, anesthetics are likely to be found in aqueous solution, partitioning into membranes or interacting with protein lumen. therefore, to assess how well each anesthetic behaves in these different environments, the solvation free energies of each model in both aqueous and nonpolar environments were calculated and compared to experimental measurements (figure 2). computed free energy change as a function of the coupling parameter,, in both water (blue) and dodecane (orange). the latter mimics an olive oil environment for desflurane (top left), isoflurane (top right), sevoflurane (bottom left), and propofol (bottom right). the curve shown for each represents the average of 10 decouple / recouple cycles, with the average and error calculated using the bennett acceptance ratio. the free energy of solvation of each molecule was calculated for water (gsolvh2o) and dodecane, the latter of which acts as a mimic for oily environments (gsolvoil). this was done using alchemical free energy perturbation (fep), an expedient, albeit nonphysical, method to calculate the free energy between two chemically distinct states. in this method, the molecule is initially placed in either a box of water or dodecane and the anesthetic is decoupled from its environment by slowly and incrementally scaling the electrostatic and van der waals interactions between the molecule and the environment to zero. with each increment, the free energy cost to transform between these intermediate, nonphysical states can be accurately estimated. because of the immense computational cost of calculating free energies (a total of 2 s was needed for fep data presented here), validation of the parameter set against experimentally measured gsolvh2o and gsolvoil was the last step in determining if the parameters assigned to the model were accurate. the parameters were accepted if the absolute difference in free energy was less than 1.5 kcal / mol and the sign of the calculated free energy and the experimental free energy were the same. table 2 shows the change in free energy associated with the solvation of each anesthetic in water or dodecane. in each case, the model parameters that were judged acceptable using bulk properties produced accurate solvation free energies, some even within a kt of experimental values. the inhaled anesthetics (desflurane, isoflurane, sevoflurane) are completely hydrophobic, having gsolvh2o > 0 while gsolvoil < 0. in contrast, our data suggest that solvation of propofol is favored in both environments but that propofol is more soluble in an oily environment compared to an aqueous environment. in the case of propofol, solvation free energy data for water and oil are not currently available for comparison. however, the free energy of solvation in water can be predicted from aqueous solubility and vapor pressure. by utilizing an aqueous solubility of 160 mg / l and a vapor pressure of 0.01 mmhg, the predicted gsolvh2o is 4.39 kcal / mol, which is extremely close to the value of 3.93 0.30 kcal / mol computed for our model. reproduction of gsolv values in both water and dodecane demonstrates that the parameter set is quite robust and of such quality to be used in a variety of simulation protocols (e.g., protein anesthetic interaction, free energy calculations, binding constant determination, flooding although there is now a general consensus that anesthetics exert their effects on plgics, there is currently a debate as to where the anesthetics bind and how they exert their effects. overton hypothesis suggests that the membrane has some role in the binding and/or action of anesthetics. in order to better understand how anesthetics interact with biological membranes, we simulated the partitioning of anesthetics into a popc membrane and measured the effect on membrane structure. while the partitioning of anesthetics between phases has been studied computationally for various simplified systems, such as water / hexane and water / vacuum interfaces, their behavior in physiologically relevant systems, such as that presented here, has not been previously explored to the best of our knowledge. using umbrella sampling, we first calculated the free energy of partitioning of each anesthetic into a popc membrane. our calculations demonstrate that there is a significant energetic minimum of approximately 45 kcal / mol relative to the bulk aqueous solution (figure 3) where the fatty acyl tails meet the glycerol backbone. at this depth in the membrane, the hydrocarbons composing the fatty acyl tails provide a hydrophobic environment, while the ester moieties and phosphate groups provide some polar nature that can interact with either the ether on the halogenated ether species or the hydroxyl group of propofol. this energetic well suggests that anesthetics preferentially partition into the membrane prior to binding plgics. while the anesthetics show a distinct preference for interfacial regions, there seems to be almost no preference for the membrane core over bulk aqueous solution or vice versa, with the largest difference in free energy being a 1 kcal / mol stabilization of sevoflurane in the membrane core compared to aqueous solution. because detailed free energy profiles are not measurable experimentally, the free energy profiles were transformed (figure 3) to popc / water partition coefficients, in the form of log k, and compared with experimentally measured octanol / water partition coefficients. as can be seen in table 2, we are able to capture the partitioning of these molecules into a nonpolar phase very well. some discrepancies arise, including the relative trend of the magnitude of the partition coefficient among the four anesthetics, and are potentially due to the comparison of octanol / water partition coefficients (experimental) to popc / water coefficients (calculated) and the differing properties of octanol and popc. the color of the atom groups in this image corresponds to the color of the curves in the density profiles. (b) density profile of the simulated systems used to demarcate the regions of the membrane for analysis of anesthetic, total popc density is shown as the black dashed line and water density is shown as the light blue line. popc density was further subdivided into tail (gray), glycerol (red), phosphate (gold), and choline (blue) density. the colors of the curves correspond to the color of the atoms shown in (a). (c) pmf for inserting desflurane (blue), isoflurane (green), sevoflurane (orange), and propofol (red) into the membrane. all anesthetics show a distinct energy minimum at the interfacial region, while there is negligible energy difference between the bulk aqueous environment and midpoint of the lipid bilayer. (d) representative snapshot of (starting on left and moving right) desflurane, isoflurane, sevoflurane, and propofol in the umbrella sampling simulations showing the low energy conformation at the amphipathic boundary of the membrane. while it is known that general anesthetics affect the conduction of plgics, it is still unclear if anesthetics have drastic effects on membrane structure and whether these effects might indirectly lead to ion channel modulation. to better understand how anesthetics interact with the membrane, we simulated a high concentration (initial aqueous concentration of 100 mm or anesthetic / lipid ratio of 1:5) of each anesthetic for 100 ns in a popc membrane system. as the anesthetics partition into the membrane rather rapidly, with 6090% of anesthetics partitioned within 50 ns (figure s1), the length of the simulations was sufficient to observe partitioning of a majority of anesthetic and to explore the effect of these drugs on a popc membrane. to measure the effect of such a high concentration of the anesthetic on membrane structure, we measured several physical properties of the popc membrane (atomic density profiles, area per lipid, order parameters, dipole potential, and lateral stress profiles) after the anesthetics had partitioned into the membrane. as can be seen from figure 4, the anesthetic has no measurable effect on distribution of atomic groups in the membrane, as all atomic groups have no shift in peak density or any difference in distribution width upon partitioning of anesthetics. moreover, the high concentration of anesthetic does not seem to affect the local structure of the headgroups or the palmitoyl / oleyl tails, with no changes in the order parameters detected for any anesthetic simulated (figure 4b, c). the area per lipid (al) was measured for the membrane in both the absence and presence of anesthetics. there was no detectable change, as the al for the pure popc membrane was 65.05 3.15 versus an average of 65.27 0.42 across all four anesthetic simulations (desflurane, 65.47 3.19 ; isoflurane, 65.30 3.18 ; sevoflurane, 64.67 3.13 ; propofol, 65.62 3.19). (a) atomic density profiles for membrane components in the (starting left and moving right) popc, desflurane, isoflurane, sevoflurane, and propofol systems. the atomic densities of the tails (black trace), glycerol (red trace), phosphate (gold trace), and choline (blue trace) moieties are shown as an average over the last 50 ns of the trajectory (accounting for insertion of 6090% of anesthetics). the atomic density of water is also shown (cyan trace) and measures 1.0 g / ml, which is the experimentally determined density of water at 298 k. order parameters for both the headgroup (b) and lipid tails (c) are shown for popc (black), desflurane (blue), isoflurane (green), sevoflurane (orange), and propofol (red). additionally, the order parameters for palmitoyl (dashed line) and oleyl (solid line) tails are shown separately. with those three measures of membrane structure showing no change, we made two additional measurements to see if the effect of anesthetics on the membrane is more subtle. because anesthetics partition to the membrane water interface (figure 5a d)), it is possible that anesthetics might perturb the organization of water molecules at this layer, thereby disturbing membrane electrostatics and structure. therefore, to account for this, we measured the dipole potential of the popc membrane, a net positive potential at the center of the membrane due to the ordering of water molecules at the membrane interface, across all five simulations (figure 5). these plots show that, to within error, there is no significant change in the dipole potential of the membrane, suggesting that there is no gross disturbance of water structure at the membrane surface. it is important to note that dipole calculations from md simulations are known to overestimate the dipole potential, due to the lack of polarizability in classical force fields. comparison between the profiles calculated, however, remains valid, as each simulation suffers from this deficiency. moreover, since these small molecules are partitioning into the membrane, it is conceivable that partitioned anesthetics affect the interlipid dynamics in the membrane, the effects of which can be measured in lateral stress profiles. as can be seen in figure 5, there is no statistically significant difference in the lateral stress profile between popc only and popc / anesthetic membranes for all cases. while these measures do not constitute an exhaustive study of membrane behavior, they do provide significant evidence that anesthetics do not perturb membrane structure, agreeing with previous experiments that have shown no effect of anesthetics on membrane structure at clinically relevant concentrations. noble gas molecules, such as xenon which has been used as an anesthetic, have been shown to disturb membrane structure in previous simulations. these species, however, are vastly different from the general anesthetics studied here in that xenon is a hydrophobic atom, and much smaller in size compared to the anesthetic molecules studied here, that readily partitions to the membrane center, not the amphipathic membrane interface. therefore, it should be noted that the anesthetics studied here did not show any disturbance of membrane structure, but anesthetics with completely distinct chemical structures might have an effect on gross membrane structure. atomic density profiles for desflurane (a), isoflurane (b), sevoflurane (c), and propofol (d). the density of each anesthetic is further subdivided into its constituents to show detail on the distribution of these molecules in the membrane. plot of the dipole potential (e) and the lateral stress profile (f) of the popc membrane in the popc only (black), desflurane (blue), isoflurane (green), sevoflurane (orange), and propofol (red). the dipole potential and lateral stress profiles are symmetric about the center of the membrane. the error bars denote the standard deviation from averaging the profiles across the two halves. md simulations offer an unprecedented opportunity to probe the dynamics of the effect of anesthetics on ion channels with high spatiotemporal resolution, but a lack of tested parameters has significantly hindered progress in this arena. here, we have presented atomic - detailed models for use in md simulations of four ubiquitous modern general anesthetics : desflurane, isoflurane, sevoflurane, and propofol. the models have been shown to reproduce multiple experimentally determined physicochemical properties that demonstrate the robustness of these models and their ability to accurately describe the behavior of the anesthetics in different environments, including aqueous and membranous environments. thus, these parameters are suitable for use in multiple simulation protocols such as probing protein anesthetic interaction, free energy and binding constant calculations, and identification of drug binding sites, among others. using the parameters generated these studies show that there is a significant energy minimum (45 kcal / mol) at the interface between the tail region of the lipids and their glycerol moiety, supporting previous studies that showed the same phenomenon in hexane / water and vacuum / water systems. in contrast to the meyer overton hypothesis, however, there is negligible difference in energy between the membrane core and aqueous solution (less than 1 kcal / mol). it is interesting to note that the glic anesthetic binding site lies at this interfacial level and these data suggest an entrance mechanism whereby the anesthetic penetrates the membrane prior to binding the protein. additionally, flooding the membrane with anesthetics does not perturb any of the membrane structural measurements, including atomic density, order parameters, area per lipid, dipole potential, and lateral stress profile of the popc membrane. while this suggests that anesthetics do not affect membrane structure, more careful studies of membrane physical properties in the presence of anesthetics need to be conducted. this study provides parameters for a set of anesthetics that have been cocrystallized with plgics, allowing for rapid and expanded study of anesthetic modulation of pentameric ligand - gated ion channels. | while small molecules have been used to induce anesthesia in a clinical setting for well over a century, a detailed understanding of the molecular mechanism remains elusive. in this study, we utilize ab initio calculations to develop a novel set of charmm - compatible parameters for the ubiquitous modern anesthetics desflurane, isoflurane, sevoflurane, and propofol for use in molecular dynamics (md) simulations. the parameters generated were rigorously tested against known experimental physicochemical properties including dipole moment, density, enthalpy of vaporization, and free energy of solvation. in all cases, the anesthetic parameters were able to reproduce experimental measurements, signifying the robustness and accuracy of the atomistic models developed. the models were then used to study the interaction of anesthetics with the membrane. calculation of the potential of mean force for inserting the molecules into a popc bilayer revealed a distinct energetic minimum of 45 kcal / mol relative to aqueous solution at the level of the glycerol backbone in the membrane. the location of this minimum within the membrane suggests that anesthetics partition to the membrane prior to binding their ion channel targets, giving context to the meyer overton correlation. moreover, md simulations of these drugs in the membrane give rise to computed membrane structural parameters, including atomic distribution, deuterium order parameters, dipole potential, and lateral stress profile, that indicate partitioning of anesthetics into the membrane at the concentration range studied here, which does not appear to perturb the structural integrity of the lipid bilayer. these results signify that an indirect, membrane - mediated mechanism of channel modulation is unlikely. |
contrast - induced nephropathy (cin) was a common cause of acute kidney injury (aki). the prevalence ranged from 2% to 30% because of different studied cohorts (underwent diagnostic or therapeutic procedures) and cin definitions. patients who developed aki after contrast medium exposure had markedly increased morbidity and mortality even after 1-year follow - up. with the increasing utilization of contrast medium in the intervention procedures and imaging modalities, cin had become an important issue, particularly in chronic kidney disease (ckd) patients, who were more susceptible to cin. taiwan had the highest prevalence of end - stage renal disease (esrd) worldwide for > 10 years before 2009 and remains high currently. a large taiwanese cohort study showed that the prevalence of ckd was 11.9% in adults and was as high as 37.2% in the elderly. with the gradual increase in taiwan 's elderly population furthermore, these ckd patients were prone to contrast medium exposure as they were more often required to undergo evaluation by computed tomography (ct). cin was generally thought to be a reversible form of aki that happened soon after the administration of contrast medium. however, it was increasingly being recognized that the impaired renal function might persist even following the return of serum creatinine to the baseline level. this effect was particularly important in patients with ckd, among whom an occurrence of aki might increase the risk of ckd progression, including to esrd. the long - term impact of contrast medium exposure for ct in ckd patients remains unknown. this study aimed to investigate the association between contrast medium exposure for ct in nonadvanced ckd patients and the development of esrd using retrospective data of taiwan 's national health insurance research database (nhird). because patients with advanced ckd were prone to developing esrd even after a minor disease event, this study focused on patients with nonadvanced ckd. taiwan 's national health insurance program was promulgated on march 1, 1995, by the national health insurance administration (nhia) and covers > 23.03 million residents in taiwan (99.2% of the population). the nhia releases deidentified data to the national health research institute (nhri), which maintains the nhird. the longitudinal health insurance database 2000 (lhid2000) used in this study contains medical information of 1 million national health insurance beneficiaries randomly sampled from the registry of all beneficiaries for the year 2000. claims data in the lhid2000 were retrospectively collected for the period of january 1, 1996, to december 31, 2011. the distributions of sex and age in the original claims data and the sampled data did not differ significantly. the diagnosis codes of the international classification of diseases, ninth revision, clinical modification (icd-9-cm) are used in the nhird. the nhri scrambles patient identification data and replaces them with surrogate numbers to ensure privacy. the data were also collected in accordance with the data regulations of the nhia and the nhri in order to maintain strict confidentiality. because the nhird contains deidentified secondary data for research, the present study was waived from inform consent. this study was approved by the institutional review board of china medical university (cmuh104-rec2 - 115). the patients were defined as having ckd if they had at least 3 outpatient service claims with a diagnosis of ckd or if they had a single hospitalization in which ckd was found in 1 of the 5 spaces used to report their diagnosis when hospitalized using the icd-9-cm (581584, 586588, 403, 404, 285.21). the national health insurance (nhi) reimbursement regulations in taiwan allowed patients with a serum creatinine level of > 6 mg / dl (approximately equivalent to egfr 90% of the contrast medium was ionic contrast medium which was paid by the national health insurance program. statistical analyses were performed using sas 9.4 statistical package (sas institute inc., cary, nc), and the significance level was set at 0.05. differences in demographic characteristics and comorbidities between the study and comparison cohorts were examined using chi - square and 2-sample t - tests. hazard ratio (hr) with 95% confidence interval (95% ci) was calculated for each variable by cox proportional hazards regression. the difference in the development of esrd between the 2 cohorts was estimated using the kaplan meier method and the log - rank test. adjusted hrs for esrd were obtained by cox proportional hazards regression after adjustment for possible confounders, including age, sex, and underlying comorbidities. the adjusted underlying comorbidities were hypertension (htn) (icd-9-cm 401405), diabetes mellitus (dm) (icd-9-cm 250, 357.2, 362.01, 362.02, 366.41), ischemic heart disease (ihd) (icd-9-cm 411414), peripheral arterial occlusive disease (paod) (icd-9-cm 440444), congestive heart failure (chf) (icd-9-cm 428), and anemia (icd-9-cm 280285). diagnoses given ahead of or in concurrence with the diagnosis of ckd were considered to be underlying comorbidities. taiwan 's national health insurance program was promulgated on march 1, 1995, by the national health insurance administration (nhia) and covers > 23.03 million residents in taiwan (99.2% of the population). the nhia releases deidentified data to the national health research institute (nhri), which maintains the nhird. the longitudinal health insurance database 2000 (lhid2000) used in this study contains medical information of 1 million national health insurance beneficiaries randomly sampled from the registry of all beneficiaries for the year 2000. claims data in the lhid2000 were retrospectively collected for the period of january 1, 1996, to december 31, 2011. the distributions of sex and age in the original claims data and the sampled data did not differ significantly. the diagnosis codes of the international classification of diseases, ninth revision, clinical modification (icd-9-cm) are used in the nhird. the nhri scrambles patient identification data and replaces them with surrogate numbers to ensure privacy. the data were also collected in accordance with the data regulations of the nhia and the nhri in order to maintain strict confidentiality. because the nhird contains deidentified secondary data for research, the present study was waived from inform consent. this study was approved by the institutional review board of china medical university (cmuh104-rec2 - 115). the patients were defined as having ckd if they had at least 3 outpatient service claims with a diagnosis of ckd or if they had a single hospitalization in which ckd was found in 1 of the 5 spaces used to report their diagnosis when hospitalized using the icd-9-cm (581584, 586588, 403, 404, 285.21). the national health insurance (nhi) reimbursement regulations in taiwan allowed patients with a serum creatinine level of > 6 mg / dl (approximately equivalent to egfr 90% of the contrast medium was ionic contrast medium which was paid by the national health insurance program. statistical analyses were performed using sas 9.4 statistical package (sas institute inc., cary, nc), and the significance level was set at 0.05. differences in demographic characteristics and comorbidities between the study and comparison cohorts were examined using chi - square and 2-sample t - tests. hazard ratio (hr) with 95% confidence interval (95% ci) was calculated for each variable by cox proportional hazards regression. the difference in the development of esrd between the 2 cohorts was estimated using the kaplan meier method and the log - rank test. adjusted hrs for esrd were obtained by cox proportional hazards regression after adjustment for possible confounders, including age, sex, and underlying comorbidities. the adjusted underlying comorbidities were hypertension (htn) (icd-9-cm 401405), diabetes mellitus (dm) (icd-9-cm 250, 357.2, 362.01, 362.02, 366.41), ischemic heart disease (ihd) (icd-9-cm 411414), peripheral arterial occlusive disease (paod) (icd-9-cm 440444), congestive heart failure (chf) (icd-9-cm 428), and anemia (icd-9-cm 280285). diagnoses given ahead of or in concurrence with the diagnosis of ckd were considered to be underlying comorbidities. a total of 7100 nonadvanced ckd patients and an equal number of matched patients were included in the study (underwent contrast medium - enhanced ct) and comparison cohort (underwent noncontrast medium - enhanced ct), respectively. the mean ages of the contrast medium exposure and noncontrast medium exposure cohorts were 65.31 15.45 and 65.99 15.80 years, respectively. the male to female ratio in the contrast medium exposure and noncontrast medium exposure cohorts were 1.34 and 1.36, respectively. demographic characteristics and comorbidities of nonadvanced ckd patients who underwent contrast medium - enhanced or nonenhanced cts the mean follow - up duration of patients in the contrast medium exposure cohort was 4.53 (4.12) years and was 4.46 (3.99) years for patients in the noncontrast medium exposure cohort. the mean duration between the first diagnosis of ckd and esrd for patients in the contrast medium exposure cohort was 1.57 (0.34) years and was 1.64 (0.78) years for patients in the noncontrast medium exposure cohort. during the follow - up period, the incidence rates (irs) of esrd in the contrast medium exposure and noncontrast medium exposure cohorts were 3.77 and 3.67 per 1000 person - years, respectively. did not show an increased ir of esrd development in the study cohort compared with the comparison cohort (figure 2). (x - axis : follow - up time in years ; y - axis : cumulative incidence per 1000 person - years). esrd = end - stage renal disease. in the univariate analysis, htn, dm, ihd, and chf increased the hr of esrd development in nonadvanced ckd patients. in further multivariate analysis, dm and chf significantly increased the adjusted hr of esrd development (adjusted hr = 3.6 ; 95% ci, 2.515.17 and adjusted hr = 2.25 ; 95% ci, 1.483.40, respectively). however, the contrast medium exposure for ct did not show a significant correlation with esrd development (adjusted hr = 0.91 ; 95% ci, 0.661.26 ; p = 0.580) (table 2). in the subgroup analysis, stratified by sex and age (aged 2039, 4059, 60), we did not observe any correlation between contrast medium exposure and esrd development in all subgroups (table 3). hr of esrd associated with contrast medium exposure in nonadvanced ckd patients subgroup analysis of ir and hr of esrd after contrast medium exposure because of varied follow - up time, the patients in the study cohort (underwent contrast medium - enhanced ct) were further divided into 3 groups : (1) underwent contrast medium - enhanced ct 1 time per year on average, (2) > 1 and 1 and 1 and 1 and 1 contrast medium exposure per year on average), there was an increased risk of esrd development in nonadvanced ckd patients compared with those underwent noncontrast medium - enhanced ct. in the present study, the follow - up time was prolonged for > 1 year to determine the effect of contrast medium exposure on the risk of esrd development in nonadvanced ckd patients. in previous studies, however, the analyses were primarily limited to intra - hospital or 1-year morbidity and mortality. cin is defined as the impairment of renal function after contrast medium exposure with either a 25% increase in the serum creatinine level from baseline or a 0.5 mg / dl (44 mol / l) increase in absolute value within 48 to 72 hours of intravenous contrast medium administration. in a typical course, the serum creatinine level begins to increase at 48 to 72 hours postcontrast medium exposure, peaks at 3 to 5 days, and returns to baseline within 3 to 5 days thereafter. compared with patients with normal kidney function who are generally thought to be not at risk for cin, patients with pre - existing ckd are much likely to develop this complication other risk factors include dm, chf, anemia, administration of high - dose contrast medium, use of first - generation hyperosmolality contrast medium, and application of percutaneous coronary intervention., a growing number of studies have indicated that cin could be a harbinger of esrd development. in a study by maioli, it was shown that persistent kidney damage could occur after cin which highlights the potential of cin to accelerate ckd. in the present study, we observed that a greater frequency of intensive contrast medium exposure (> 1 exposure per year on average) could be an important risk factor for esrd development in nonadvanced ckd patients compared with noncontrast medium exposure. in animal models, it is well accepted that cin might be caused by acute tubular necrosis (atn) ; however, the mechanism of atn remains incompletely understood. two major theories have been proposed to explain the cause of atn : (1) renal vasoconstriction mediated by nitric oxide, endothelin, and adenosine ; and (2) the direct cytotoxic effect of contrast medium. a variety of preventive measures have been suggested to reduce the risk of cin according to its possible pathogenesis, including intravenous volume administration with isotonic saline, isotonic sodium bicarbonate, acetylcysteine administration, use of iodixanol or nonionic low - osmolal agents, such as iopamidol or ioversol, and reduced dose of contrast medium. other preventive measures include avoiding volume depletion, stopping nonsteroid anti - inflammatory drugs use, and withdrawal of angiotensin - converting enzyme inhibitors or angiotensin receptor blockers before contrast medium administration. however, the best preventive measure is to avoid the use of contrast medium. in our study, although we could not examine the effects of preventive measures, we set esrd as the primary endpoint of most concern to ckd patients and observed that if contrast medium was not administered in an intensive frequency, there was no increased risk of esrd development. according to previous studies, in the majority of cin cases, aki was transient, and a complete or near - complete recovery to baseline creatinine occurred within 3 months. in a study by james, it was found that patients who developed aki following contrast medium exposure had an increased risk of progressive long - term kidney function loss. a number of mechanisms have been proposed as possible explanations of the association between cin and progressive kidney function loss. the most widely accepted mechanism involves the impact of underlying comorbidities, such as htn, dm, chf, and pre - existing ckd. patients who developed aki following contrast medium exposure usually had multiple risk factors and these underlying comorbidities may predispose them to progression of ckd. in the present study, we used the propensity scores matching accompanied with the matching of ct frequencies to make the patients in the study and comparison cohorts comparable by standing on the same baseline of underlying conditions and they had equal opportunities to be affected by accidental disease events except the difference of contrast medium exposure or not. we observed a greater progression of ckd to esrd after intensive contrast medium exposures for cts. we inferred that the single random contrast medium exposure and underlying comorbidities may be not critically important risk factors for esrd development in ckd patients. mcdonald proposed that contrast medium exposure for ct did not actually increase the risk of aki in both groups of patients with normal and impaired renal function after single contrast medium exposure. we found a similar result to that reported by mcdonald that a single random exposure to contrast medium for ct may not increase the risk of ckd progression to esrd. however, there was an increased risk of ckd progression if the ckd patients were intensively exposed to contrast medium. it is reasonable to postulate that the patients who had intensive contrast medium exposure might have had multiple acute or severe disease events that required the use of contrast - enhanced imaging studies. however, in contrast to previous studies, in the present study, the selection bias was particularly eliminated by using the propensity score matching between the study and comparison cohorts in order to minimize the impact of potential confounders from underlying comorbidities and accidental disease events, and thereby obtained a clearer understanding of the effects from contrast medium exposure for ct. we also excluded the patients with advanced ckd who were much more susceptible to developing esrd, even after a minor disease event, compared with the general ckd patients. our findings demonstrated that intensive contrast medium exposure may be associated with an increased risk of ckd progression to esrd rather than single random exposure or nonexposure and should therefore be avoided. the major strength of this study was the use of a large sample size from a nationwide database with a prolonged follow - up duration of > 1 year. the most challenging aspect of this study was the elimination of selection bias for contrast medium use for ct in patients with different clinical conditions and severity of impaired kidney function. to overcome this selection bias, also, the matched patients in the study and comparison cohorts had undergone equal times of cts during the study period with the only difference of contrast medium use or not. third, we excluded patients who underwent coronary angiography, which would have resulted in a greater risk of cin compared with ct. fourth, we excluded patients with advanced ckd as such patients are prone to developing esrd and need dialysis even after a minor disease event. first, the major limitation of our used database, nhird, was the lacking of clinical laboratory data, that is, the creatinine level of each patient, pre- and postcontrast medium exposure for ct. also, some detailed information, such as the volume of used contrast medium, was not available. although short - time kidney function change could not be evaluated, our study still provided a valuable long - term observation result. nearly all the published articles focused on short - term kidney function change, that is, cin, and long - term observation study was extremely rare because of complexity. second, the enrolled patients in the study and comparison cohorts might have been in different stages of ckd. however, because of the large enrollee population, the patients with different levels of ckd severity would likely have been distributed equally. third, preventive procedures before contrast medium exposure could not be evaluated in the present study. contrast medium exposure for ct was not associated with an increased risk of esrd development in nonadvanced ckd patients. but when intensive contrast medium exposure for ct was mandatory, alternative imaging modality without contrast medium use should be considered. | abstractthe aim of the study was to investigate the long - term association between contrast medium exposure during computed tomography (ct) and the subsequent development of end - stage renal disease (esrd) in patients with chronic kidney disease (ckd).we conducted a population - based cohort study using taiwan 's national health insurance research database. a total of 7100 patients with nonadvanced ckd who underwent contrast medium - enhanced ct were identified and served as the study cohort. to avoid selection bias, we used the propensity score to match 7100 nonadvanced ckd patients, who underwent noncontrast medium - enhanced ct to serve as the comparison cohort. the age, sex, index year, and frequency of undergoing cts were also matched between the study and comparison cohorts. participants were followed until a new diagnosis of esrd or december 31, 2011. hazard ratios (hrs) with 95% confidence interval (95% ci) were calculated using the cox proportional hazards regression.contrast medium exposure was not identified as a risk factor for developing esrd in nonadvanced ckd patients after confounders adjustment (adjusted hr = 0.91 ; 95% ci, 0.661.26 ; p = 0.580). we further divided the patients who underwent cts with contrast medium use into 1 exposure per year on average, > 1 and 1 and < 2 exposure per year on average and 2 exposure per year on average (adjusted hr = 8.13 ; 95% ci, 5.5711.87 and adjusted hr = 12.08 ; 95% ci, 7.3919.75, respectively) compared with the patients who underwent cts without contrast medium use.this long - term follow - up study demonstrated that contrast medium exposure was not associated with an increased risk of esrd development in nonadvanced ckd patients. |
bariatric surgery (bibp and agb) is routinely performed at the obesity centers of the institutions participating in this study. patients are eligible for bariatric surgery if they meet the following criteria : 1865 years of age and a bmi > 40.0 kg / m alone or a bmi > 35.0 kg / m in the presence of comorbidities, plus a history of at least two previous dietary attempts followed by a relapse. the clinical protocol includes a medical history, physical and biochemical evaluation, and a psychological and psychiatric evaluation performed to verify indications, contraindications, and safety of surgical procedures (3,8). for all subjects undergoing bibp or agb, after surgery the suggested diet is 970 and 1,090 kcal per day in women and men, respectively ; iron is supplemented on the basis of blood examinations performed during the 2nd month. the diet includes 48% carbohydrates (starch or bread), 33% proteins (fat - free parts of different animals and fishes), and 19% lipids (olive oil) ; sweets, cakes, sweetened drinks, alcohol, and animal lipids are forbidden. all foods have to be cooked without oil, butter, or other lipids ; in addition, bibp patients receive vitamin d3 at discharge (two administrations per month), vitamin b12 (5,000 units once per month), and oral antidiarrheal drugs (diphenoxylate or loperamide) when there are > 10 bowel movements per day (3,8). this was a nonrandomized, self - selected, unblinded, active - comparator, bicenter, 6-month study. the subjects, all caucasian, were informed about the nature and aims of the cholesterol metabolism evaluation protocol, and they signed a written informed consent. the choice of surgical procedure was made by the patient together with the surgeon, after a full explanation of the risks and possible benefits of each procedure. in total, 10 subjects underwent bibp and 10 underwent agb. after all interventions, subjects were re - evaluated by a dietitian and physician at 2-week intervals for 2 months and then monthly for up to 6 months, as previously described (3,8). at baseline and 6 months after surgical procedures, the subjects were studied in the early morning in a recumbent position and after an overnight fast. height and weight were measured to the nearest 0.5 cm and 0.1 kg, respectively. a venous line was used for blood sampling, and another venous line on the opposite arm was used for infusions. both venous lines were kept patent by a slow 0.9% nacl saline drip. after a blood drawing for metabolites, sequential infusions of deuterated oxysterols were performed between 9:00 a.m. and 2:00 p.m., according to a previously published protocol (9). serum samples were obtained from blood collected during the sequential infusions of the two hydroxysterols at 0, 60, 80, 100, and 120 min. plant sterols (campesterol and sitosterol) were measured as biomarkers of cholesterol absorption, and lathosterol as a marker of cholesterol synthesis (10). 7--oh - cholesterol and 27-oh - cholesterol are markers of bile acid metabolism, the former of direct intrahepatic metabolism and the latter of mainly extrahepatic catabolism (9) ; bile acid synthesis accounts for > 95% of cholesterol catabolism per day (9). plasma glucose was measured by the glucose oxidation method (ysi, inc., yellow springs, oh). serum insulin was assayed by microparticle enzyme immunoassay (abbott laboratories, pasadena, ca) (8). total cholesterol, hdl cholesterol, and triglyceride levels were assayed by automated enzymatic methods (roche, basel, switzerland). non - hdl cholesterol was calculated as total cholesterol hdl cholesterol (12). the homeostasis model assessment of insulin resistance [homa - ir ] index was calculated as blood glucose (mmol / l) insulin (u / ml) 22.5 (13). quantitative evaluation of lathosterol, campesterol, and -sitosterol in serum was performed by a gas - liquid chromatography / mass spectrometry (gc / ms)based technique as previously described (14). for determination of hydroxysterol serum concentrations, after the addition of 250 ng 19-oh - cholesterol as internal standard to 0.2 ml serum, samples were hydrolyzed and extracted (15). the organic phase was evaporated to dryness under a stream of nitrogen and purified by solid - phase extraction. the fraction containing the hydroxysterols was dried and treated with trimethylsilylimidazole : piperidine (1:1) before analysis by gc / ms. deuterated (d6) 7--oh - cholesterol was obtained by chemical synthesis from deuterated (d6) cholesterol, according to previously described methods (15), and deuterated 27-oh - cholesterol was prepared by synthesis from kryptogenin, using the clemmensen reduction method, as previously described (16). homogeneous suspensions of the sterols in 5% human albumin were prepared on the same day of the infusion experiment (final concentration of 3 and 6 mg / ml of deuterated 7-- and 27-oh - cholesterol, respectively) and filtered through a 0.22-m millipore membrane immediately before infusion, under a laminar flow hood (14). serum samples, obtained from blood collected during the sequential infusions of the two hydroxysterols (see above), were analyzed for deuterium enrichment of 7-- and 27-oh - cholesterol using gc / ms on extracted oxysterols as previously reported (14). the in vivo rate of appearance of the two hydroxysterols was calculated as milligrams per hour from the deuterated / natural sterol ion ratio and infusion rate using the equation described for the steady state by duane and javitt (17). intergroup comparisons and within - group differences were performed by student t test for unpaired and paired data, respectively ; changes before and after 6 months between the two surgical procedures were also compared by student t test for unpaired data. p 95% of cholesterol catabolism per day (9). plasma glucose was measured by the glucose oxidation method (ysi, inc., yellow springs, oh). serum insulin was assayed by microparticle enzyme immunoassay (abbott laboratories, pasadena, ca) (8). total cholesterol, hdl cholesterol, and triglyceride levels were assayed by automated enzymatic methods (roche, basel, switzerland). non - hdl cholesterol was calculated as total cholesterol hdl cholesterol (12). the homeostasis model assessment of insulin resistance [homa - ir ] index was calculated as blood glucose (mmol / l) insulin (u / ml) 22.5 (13). quantitative evaluation of lathosterol, campesterol, and -sitosterol in serum was performed by a gas - liquid chromatography / mass spectrometry (gc / ms)based technique as previously described (14). for determination of hydroxysterol serum concentrations, after the addition of 250 ng 19-oh - cholesterol as internal standard to 0.2 ml serum, samples were hydrolyzed and extracted (15). the organic phase was evaporated to dryness under a stream of nitrogen and purified by solid - phase extraction. the fraction containing the hydroxysterols was dried and treated with trimethylsilylimidazole : piperidine (1:1) before analysis by gc / ms. deuterated (d6) 7--oh - cholesterol was obtained by chemical synthesis from deuterated (d6) cholesterol, according to previously described methods (15), and deuterated 27-oh - cholesterol was prepared by synthesis from kryptogenin, using the clemmensen reduction method, as previously described (16). homogeneous suspensions of the sterols in 5% human albumin were prepared on the same day of the infusion experiment (final concentration of 3 and 6 mg / ml of deuterated 7-- and 27-oh - cholesterol, respectively) and filtered through a 0.22-m millipore membrane immediately before infusion, under a laminar flow hood (14). serum samples, obtained from blood collected during the sequential infusions of the two hydroxysterols (see above), were analyzed for deuterium enrichment of 7-- and 27-oh - cholesterol using gc / ms on extracted oxysterols as previously reported (14). the in vivo rate of appearance of the two hydroxysterols was calculated as milligrams per hour from the deuterated / natural sterol ion ratio and infusion rate using the equation described for the steady state by duane and javitt (17). intergroup comparisons and within - group differences were performed by student t test for unpaired and paired data, respectively ; changes before and after 6 months between the two surgical procedures were also compared by student t test for unpaired data. the sample size allowed for the detection of a 50% difference or more between subjects undergoing restrictive or malabsorptive procedures in total cholesterol decrease, with a type 1 error of 0.05 and a power of 0.8. assuming a difference in cholesterol decrease of 50 mg / dl with an sd of 10 mg / dl (2,57), and a rate of 1:1 between the two groups of subjects, 16 subjects were required. assuming 15% would be noncompleters, table 1 shows the clinical and metabolic data of obese subjects entering the study ; all variables were similar in the two groups, with no significant difference. clinical and metabolic details of obese subjects in the study, divided by surgical technique figure 1 shows that the decrease of bmi, homa - ir, and triglycerides was similar in the two groups ; a small but significant decrease was observed in hdl cholesterol levels in subjects undergoing bibp, but with no significant difference from subjects undergoing agb. also, blood glucose and insulin levels decreased in a significant manner, with no difference between bibp and agb (not shown). in contrast, total cholesterol and ldl cholesterol levels were affected in a different way by bibp and agb, with a clear intergroup difference. p values between columns (two - sided arrows) indicate significance of intergroup differences. figure 2 shows that non - hdl cholesterol, sitosterol, and campesterol levels decreased with bibp, but not with agb. serum lathosterol increased with bibp, but not with agb, with a significant difference between bibp and agb. changes of non - hdl cholesterol and of biomarkers of intestinal absorption of cholesterol (sitosterol and campesterol) and of cholesterol synthesis (lathosterol) induced by bibp and agb. baseline (black columns) and postsurgery (white columns) values are indicated. p values between columns (two - sided arrows) indicate significance of intergroup differences. figure 3 shows that the rate of appearance and serum levels of 7--oh - cholesterol increased with bibp, but not with agb, with a significant difference between bibp and agb. the rate of appearance of 27-oh - cholesterol did not vary with either bibp or agb, but the trend was significantly different ; the serum levels of 27-oh - cholesterol decreased in a similar way with bibp and agb. rate of appearance (mg / h) and serum levels (g / dl) of markers of bile acid metabolism before and after bibp and agb. p values between columns (two - sided arrows) indicate significance of intergroup differences. the aim of this study was to assess intestinal cholesterol absorption, cholesterol synthesis, and cholesterol catabolism in obese subjects undergoing two different surgical techniques, one based on pure malabsorption (bibp) and the other on restriction of the stomach (agb). the studies were performed under basal conditions and 6 months later, when the decrease of bmi was expected to be similar. although the decrease of blood glucose, insulin, homa - ir index, and triglycerides was similar between the two groups, significant differences between pre- and postsurgery cholesterol metabolism appeared in subjects undergoing bibp, but not in subjects undergoing agb. in particular, total cholesterol, ldl cholesterol, non - hdl cholesterol, campesterol, and sitosterol decreased, and lathosterol increased, together with the hepatic cholesterol catabolism pathway (7--oh - cholesterol). this leads us to speculate that with malabsorptive surgery, cholesterol absorption decreases, which is associated with a clear decrease of ldl cholesterol (and of non - hdl cholesterol). as a compensation, cholesterol synthesis increases, and the increase in lathosterol, a marker of cholesterol synthesis, would also point to enhanced ldl receptor activity in the liver, which would lead to reduced circulating ldl levels. in contrast, cholesterol absorption is unchanged in restrictive surgery, and ldl cholesterol shows a small but significant increase, if any. the only effect of purely restrictive surgery is a decrease in extrahepatic cholesterol catabolism, parallel with an increase in ldl cholesterol, a finding that at present is unexplained. these data, obtained at 6 months, can not be assumed as representative of the full picture of cholesterol metabolism afterward ; in any case, these data indicate that different technical surgical techniques have a different effect on cholesterol levels, independent of weight loss. diet after surgery does not seem to be of importance, as differences between bibp and agb were negligible for the fat / cholesterol content ; in addition, fat and cholesterol do not affect intestinal absorption of cholesterol as measured through plant sterols (10). however, it is noticeable that the different effects of bibp and agb persist for up to 3 or 6 years (2,57,18). the cholesterol reduction that we and others have reported after bibp, bpd, or rygb is quite a dramatic phenomenon and is likely due to the major reduction in cholesterol and bile acid reabsorption in the intestine, and possibly due to altered regulation of the feedback mechanisms controlled by nuclear proteins such as lxr, fxr, and peroxisome proliferator activated receptor ; these transcriptional factors are involved in bile acid and cholesterol metabolism in patients undergoing bibp, bpd, or rygb (which cause malabsorption and also reduce bile reabsorption) but not agb (a purely restrictive bariatric procedure) (19). it is also possible that reduced gastric volume and reduced production of gastric lipase, as well as reduced secretion of cholecystokinin (which physiologically stimulates digestive enzyme secretion such as lipases and proteases), might result in a marked decrease in the hydrolysis of triacylglycerols, with a reduction of the absorption of free fatty acids (20). bpd and rygb include partial gastric resection, or functional gastric disconnection ; therefore, gastric bypass and bpd can not be regarded as purely restrictive or purely malabsorptive surgical techniques. blood glucose and serum insulin levels decreased to a similar extent with the two techniques, as was the case for the homa - ir index. these data indicate that changes of cholesterol absorption, synthesis, and catabolism were independent of glycemic control, insulin, and insulin resistance. in conclusion, compared with agb, bibp provides greater cholesterol lowering. | objectivemalabsorptive bariatric surgery (biliopancreatic diversion and biliointestinal bypass [bibp ]) reduces serum cholesterol levels more than restrictive surgery (adjustable gastric banding [agb ]), and this is thought to be due to greater weight loss. our aim was to evaluate the changes of cholesterol metabolism induced by malabsorptive and restrictive surgery independent of weight loss.research design and methodsin a nonrandomized, self - selected, unblinded, active - comparator, bicenter, 6-month study, glucose metabolism (blood glucose and serum insulin levels and homeostasis model assessment of insulin resistance [homa - ir ] index) and cholesterol metabolism (absorption : serum campesterol and sitosterol levels ; synthesis : serum lathosterol levels ; catabolism : rate of appearance and serum concentrations of serum 7-- and serum 27-oh - cholesterol after infusions of deuterated 7-- and 27-oh - cholesterol in sequence) were assessed in grade 3 obesity subjects undergoing bibp (n = 10) and agb (n = 10). evaluations were performed before and 6 months after surgery.resultssubjects had similar values at baseline. weight loss was similar in the two groups of subjects, and blood glucose, insulin levels, homa - ir, and triglycerides decreased in a similar way. in contrast, serum cholesterol, ldl cholesterol, non - hdl cholesterol, serum sitosterol, and campesterol levels decreased and lathosterol levels increased only in bibp subjects, not in agb subjects. a significant increase in 7--oh - cholesterol occurred only with bibp ; serum 27-oh - cholesterol decreased in both groups.conclusionsmalabsorptive surgery specifically affects cholesterol levels, independent of weight loss and independent of glucose metabolism and insulin resistance. decreased sterol absorption leads to decreased cholesterol and ldl cholesterol levels, accompanied by enhanced cholesterol synthesis and enhanced cholesterol catabolism. compared with agb, bibp provides greater cholesterol lowering. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.