article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
a 72-year old woman presented with a two hour history of chest pain and mild respiratory distress. she reported a dull ache across the anterior chest unrelated to exertion, with some radiation to the left shoulder. she had no significant past medical history and no prior history of similar chest pain. physical examination revealed a heart rate of 76, blood pressure 130/65 mmhg, and a respiratory rate of 20/minute. cardiovascular examination revealed normal jugular venous pressure, soft heart sounds, no gallop rhythm, and no murmur. the 12-lead electrocardiogram showed minor st - segment elevation and inverted t - waves in leads v3-v6. serum creatinine phosphokinase was elevated at 330 u / l (normal range : 45 - 130 u / l) and serum troponin i at 3.6 (normal < 0.01). chest - x - ray was unremarkable. coronary angiogram on admission showed no significant coronary artery disease. left ventriculogram revealed apical dyskinesis and basal hyperkinesis, a picture consistent with ttc (figure 1). she was discharged on metoprolol 25 mg twice a day, ramipril 5 mg daily, and warfarin. a repeated cardiac catheterization three months later revealed normal left ventricle function with complete resolution of apical dyskinesis (figure 2). (b) left ventriculogram in systole showing apical dyskinesis (ballooning) and basal hyperkinesis. (b) left ventriculogram in systole showing normal systolic function and complete resolution of apical dyskinesis (ballooning). tako - tsubo cardiomyopathy is a potentially lifethreatening cardiac syndrome characterized bytransient left ventricular dysfunction, without angiographically significant coronary artery stenosis. the disease takes its name from the typical left apical ballooning observed on end systolic left ventriculogram, which has the appearance of a tako - tsubo, a term for an ancient device used in japan to trap octopuses in the sea. other names, stress cardiomyopathy, tako - tsubo cardiomyopathy, left ventricular apical ballooning syndrome, and broken heart syndrome are used interchangeably. it is estimated that about 2% of patients presenting with suspected acute coronary syndromes may actually have ttc. although initially reported only in japan, it has been reported in patients with diverse ethnic background from all over the world [26 ]. the most frequent presentation is chest pain (66%), followed by dyspnea (16%). these include an acute and excessive rise of catecholamine levels, calcium overload with direct myocyte damage, estrogen depletion, multiple vessel epicardial coronary spasm or diffuse microvascular spasm [810 ]. increased sympathetic tone with elevated levels of plasma catecholamines and stress neuropeptides may play an important role in the pathogenesis of myocardial stunning following emotional and physical stress. electrocardiography (ecg) can be normal, or can have nonspecific st- and t - wave abnormalities. the most common ecg abnormality (in 70% of cases) is st - segment elevation in the anterior precordial leads [4, 11 ]. there is less inferior reciprocal st - depression than is typically seen with an anterior st - segment elevation myocardial infarction. ten percent of patients develop q - waves (most frequently in leads v2-v4). within 24 to 48 hours of the acute presentation, the ecg frequently shows deeply inverted t - waves and a markedly prolonged qtinterval in both precordial and limb leads. the qtinterval prolongation often normalizes within two days, but the t - wave abnormalities can take weeks or even months to normalize [6, 11 ]. most patients with ttc have mildly elevated cardiac enzymes (including creatine phosphokinase, troponin i, and t levels) at the time of presentation. these enzyme elevations, however, are much lower than those typically observed with acute myocardial infarction [4, 6 ]. perhaps the most specific diagnostic feature of this syndrome is the unusual left ventricular contractile pattern in the absence of significant coronary artery disease. the left ventriculogram frequently shows akinesis or dyskinesis of the apical and midventricular segments with hyperkinesis of the basal segments (figure 1). the standard supportive care for congestive heart failure with diuretics and vasodilators remains largely empirical. for hemodynamically stable patients, diuretics are used to treat pulmonary congestion, and angiotensin - converting enzyme (ace) inhibitors and beta - blockers are frequently used during the period of lv recovery. there is no consensus on how long to continue these medications ; it is probably safe to stop them once lv function has completely recovered. unless there is a contraindication, systemic anticoagulation hemodynamically unstable patients, the treatment includes inotropic therapy, vasopressor support, and intra - aortic balloon counterpulsation. recent data implicate massive catecholamine release as the pathogenesis of stress - induced myocardial stunning. therefore, it has been recommended to avoid the administration of exogenous catecholamines and beta - agonists whenever possible and to rely on mechanical circulatory support, e.g., intra - aortic balloon counterpulsation. whichever form of hemodynamic support is chosen, most patients only require it for a short time and typically demonstrate rapid clinical recovery. in most patients, the left ventricular function returns to normal within two weeks. the ecg abnormalities usually disappear completely within six months. complications like shock, followed by heart failure, lv thrombus formation, dynamic lv outflow tract obstruction, acute mitral valve regurgitation, and ventricular arrhythmias are seen in 18% of cases (13, 14). interestingly, physical stress has higher mortality rates when compared to patients presenting with emotional stress. its clinical presentation mimics the presentation of acute stelevation myocardial infarction without concomitant epicardial coronary artery disease. despite the initial dramatic presentation of this disease | tako - tsubo cardiomyopathy (transient left ventricular apical ballooning) is a reversible form of cardiomyopathy of unknown etiology. tako - tsubo cardiomyopathy (ttc) is typically precipitated by sudden emotional or physical stress, and is associated with excessive sympathetic stimulation and catecholamine release. its clinical presentation is similar to that of acute coronary syndrome. the diagnosis of ttc must be considered in all patients who develop a transient left ventricular apical (or mid ventricular) ballooning in the absence of obstructive coronary artery disease. although the prevalence of ttc remains unknown, approximately 2% of all patients presenting with a presumed diagnosis of acute myocardial infarction have been found to have this syndrome. an illustrative case report and literature review is provided. |
severe acute pancreatitis (sap) is an inflammatory disorder characterized by an intricate cascade of events originating from digestive enzyme activation in pancreas acinar cells [13 ]. pancreas, a gland which has both exocrine and endocrine functions with a plenty of secretory cells, depends on high endoplasmic reticulum (er) volume and functionality owing to massive protein synthesis and processing. pancreatic islets scatter among the acinar cells and consist mainly of beta cells which secrete insulin, the unique hormone lowering blood glucose level. er stress is provoked by the accumulation of partially folded or misfolded proteins in the er lumen and activates unfolded protein response (upr). increasing evidence has demonstrated that er stress and upr are relevant in numerous pathophysiological disorders including sepsis, ulcerative colitis, rheumatoid arthritis, systemic lupus erythematosus, neurodegenerative diseases, diabetes mellitus, and viral infection. in addition, er stress may play a role in acute pancreatitis and associated beta - cell injury [14, 15 ]. the er chaperone heavy chain binding protein (bip), also known as glucose regulated protein 78 (grp78), is anchored to er transmembrane proteins. when er homeostasis is disrupted, bip binds to unfolded or misfolded proteins to assist folding and is transcriptionally upregulated through the upr to alleviate homeostasis. the 150 kda oxygen regulated protein (orp150) belongs to the heat - shock family 70 and is upregulated by er stress as a chaperone protein. the ccaat / enhancer - binding protein homologous protein (chop) is a specific marker of er stress and upr activation as a proapoptotic transcription factor. when the injury is excessive and invincible, chop is overexpressed to trigger cell death. and 4-phenylbutyric acid (4-pba) is a short - chain fatty acid with three main pharmacological effects as an ammonia scavenger, a weak histone deacetylase inhibitor (hdaci), and an er stress inhibitor. 4-pba has been approved for clinical use in patients suffering urea cycle enzyme deficiencies and hyperammonemia, where it acts as an ammonia scavenger [19, 22, 23 ]. nonetheless, it has been widely studied as a small chemical chaperone to modulate restoration of er homeostasis and multiple concerning pathological conditions [12, 24, 25 ]. however, whether 4-pba is effective in ameliorating pancreatic islet beta - cell damage in sap in vivo has not yet been elucidated. the aim of the present study was to evaluate the effect of 4-pba on beta - cell injury following sap as well as the underlying mechanisms. adult male spf sprague - dawley rats, with weight from 200 g to 250 g, were provided by hunan sja laboratory animal co. (changsha, hunan, china). all animals were housed under standardized environment with free access to standard laboratory rodent chow and sterile water. the study was approved by the committee on ethics of animal experiments of wuhan university and performed in compliance with the guide for the care and use of laboratory animals from the national institutes of health. 4-pba and sodium taurocholate (stc) were obtained from sigma - aldrich co. (st. louis, mo, usa). elivision super / horseradish peroxidase (hrp) kits were purchased from maixin biotech co. (fuzhou, china). rat tumor necrosis factor- (tnf-) and interleukin-1 (il-1) enzyme - linked immunosorbent assay (elisa) kits were purchased from ebioscience inc. (vienna, austria). rat insulin elisa kit was from elabscience biotechnology co. (wuhan, china). bip, orp150, chop, and caspase-3 antibodies were purchased from abcam (cambridge, united kingdom) ; insulin antibody was from cell signaling technology inc. rats were deprived of food for 12 h prior to the experiment but given water ad libitum. after the body weight of all animals was measured, anesthesia to all rats was induced with 4% isoflurane in 2 l / min oxygen in a sealed container and was maintained with 2% isoflurane in 2 l / min oxygen during surgery. the sap rat model was induced by a standardized retrograde infusion of 5% sodium taurocholate (stc) saline solution at a dose of 1 ml / kg body weight into the biliopancreatic duct at a velocity of 0.1 ml / min after laparotomy. the abdominal incision was closed and 20 ml / kg of saline was injected into the back subcutaneously to compensate for the fluid loss. (1) 4-pba treatment group (4-pba group, n = 8) : 4-pba solution was prepared as described earlier and minor steps were revised as follows : equimolar amounts of 4-pba and sodium hydroxide were titrated to ph 7.4 and dissolved in physiological saline. 4-pba was administered via intraperitoneal injection at a dose of 50 mg / kg per day for 3 days from 10:00 a.m. to 1:00 p.m. after last injection sap was induced. (2) severe acute pancreatitis model group (sap group, n = 8) : rats received a volume - matched physiological saline substituted for 4-pba before sap. (3) sham - operation group (so group, n = 8) : in this group, rats received a sham surgery where the pancreas and duodenum were flipped a number of times instead of stc infusion. blood samples were collected by inferior vena cava puncture and centrifuged at 4,000 g for 10 min, and the serum was stored at 20c in individual aliquots. following sacrifice, the head of the pancreas tissue was immediately excised and fixed in 4% phosphate - buffered formaldehyde for hematoxylin - eosin (h&e) staining and immunohistochemical detection. for histopathological analysis, paraffin - embedded pancreatic tissues were sequentially sliced at 4 m thick and treated with h&e staining. the morphologic evaluation of the pancreatic tissues was performed under optical microscope (olympus optical ltd., tokyo, japan) by two experienced pathologists who were blinded to the experimental groups. pancreatic histological assessment was scored for the severity of pancreatitis based on edema, inflammation and hemorrhage, and acinar necrosis according to the standard scale described by schmidt.. serum amylase (amy), lipase (lipa), and glucose levels were measured using standard techniques with a fully automatic chemistry analyzer (advia 2400 clinical chemistry system ; siemens healthcare diagnostics inc. serum insulin, tnf-, and il-1 levels were measured by the use of commercially available elisa kits according to the manufacturer 's instructions. the absorbance was determined by an automated microplate elisa reader (perkinelmer ltd., waltham, mass, usa) and concentrations were computed by the standard curve run on each assay plate. immunohistochemical analyses of bip, orp150, chop, caspase-3, and insulin in paraffin - embedded pancreas sections (4 m) were performed using a standard streptavidin - peroxidase (sp) method and were modified as follows. following xylene deparaffinisation and hydration using a graded series of ethanol solutions : the slides were boiled for 4 min at 121c in a pressure cooker containing 10 mm citrate buffer (ph 6.0) for the epitope retrieval. subsequently the slides were cooled to room temperature and rinsed in phosphate - buffered saline (pbs). endogenous peroxidase activity was blocked by 3% hydrogen peroxide for 15 min. incubating the section in 5% normal goat serum in pbs for minimizing nonspecific staining : the primary antibody was a rabbit polyclonal antibody to bip (1 : 300) and caspase-3 (1 : 50) and monoclonal antibody to orp 150 (1 : 150), chop (1 : 100), and insulin (1 : 200). sections were incubated with the primary antibody overnight at 4c in a humidity box and then incubated with a second antibody. then the slides were counterstained with hematoxylin, dehydrated through an ethanol series, and mounted with coverslips. the negative control experiments were performed in which pbs was substituted for the primary antibody. all sections were examined and photographed using light microscope (400) under blind conditions. immunohistochemical staining was analyzed by image pro - plus 6.0 system (media cybernetics, inc. the measurement parameters were the area sum and integrated optical density (iod) of the aoi. the mean optical density (mod) of bip, orp150, chop, and caspase-3 and insulin expression in islets of different groups were analyzed and compared. a small portion (about 1 mm) of fresh tissue was excised from the pancreas tail and fixed in 2.5% glutaraldehyde (0.1 mol / l phosphate buffer, ph 7.4) over night at 4c, followed by postfixation with 1% osmium tetroxide in the same buffer for 1 h at 4c. ultrathin sections were cut on leica emuc7 ultramicrotome, stained with lead citrate and uranyl acetate, and changes of the beta cells were examined by a ht7700 transmission electron microscope (hitachi, japan). the data were analyzed with spss 20.0 statistical software for windows (spss inc., differences between groups were compared by one - way analysis of variance (anova). the correlations of insulin with tnf-, il-1, and glucose were analyzed using spearman correlation test. as shown in figure 1, compared with so group, serum amy and lipa levels were significantly increased at 12 h in sap group (p 0.05). little morphological evidence of pancreatic injury except mild interstitial edema was observed in so group. in sap group, massive areas of acinar necrosis, inflammatory cell infiltration, and hemorrhage were observed. compared with sap group, the pancreatic histopathological score significantly decreased in the 4-pba group (p < 0.05). many pancreatic islet cells clustered to mass with well - defined boundary from the exocrine pancreas in so group. these cells were equally distributed, plump rounded, with clear margins and oval nuclei placed in the middle. in sap group, islet had an irregular - shaped appearance, with some vacuolization and a significant reduction in number and size of islet cells. an unclear boundary between islet and the exocrine pancreas was observed in 4-pba group ; however, when pretreated with 4-pba, the vacuolar degeneration, karyopyknosis, and number of islet cells were improved as compared to sap group. as illustrated in figure 4, in sap group, serum concentrations of insulin, tnf-, and il-1 were markedly increased compared with those in so group (p < 0.05). by contrast, serum insulin, tnf-, and il-1 levels were significantly reduced by the administration of 4-pba compared with sap group (p < 0.05). compared with so group, serum level of glucose was decreased significantly in sap group (p < 0.05). pretreatment with 4-pba elevated blood glucose level compared with sap group (p < 0.05). all data of serum insulin, tnf-, il-1, and glucose levels were used to calculate correlation coefficient. spearman correlation analysis revealed that serum levels of insulin were positively correlated with tnf- (r = 0.8052, p < 0.05) and il-1 (r = 0.7661, p < 0.05) and showed significantly negative correlation between serum insulin levels and serum glucose levels (r = 0.7600, p < 0.05) (figure 5). immunohistochemical assay was conducted to evaluate the expressions of bip, orp150, chop, caspase-3, and insulin in pancreatic islets. in so group, the weak expressions of bip in pancreatic islets were observed ; in contrast, bip was overexpressed in the islets in sap group ; positive immunostaining for bip was significantly reduced in rats pretreated with 4-pba (p < 0.05 ; figure 6). the expressions of orp150 were weak in the islets of sham - operation rats, and there was intense immunoreactivity in the islets in sap group. in 4-pba group, however, a marked reduction in orp150 staining in the islets was observed (p < 0.05 ; figure 7). in sap group, there was a significant rise in the positive staining for chop in the islets compared with so group, while a markedly weaker immunoreactivity of chop was detected in 4-pba group (p < 0.05 ; figure 8). caspase-3 was expressed weakly in the islets in so group and overexpressed in sap group ; however, significantly lower expressions of caspase-3 were observed in 4-pba group compared with sap group (p < 0.05 ; figure 9). an abundance of insulin granules was well distributed in the middle of islets in so group. after injection of stc, insulin expressions in islets at 12 h were weaker than so group, and pretreatment of 4-pba increased the expressions of insulin in islets compared with those in sap group (p < 0.05 ; figure 10). pancreatic beta cells in so rats showed normal morphology of nuclei, endoplasmic reticulum, and mitochondria. the cells contained abundant secretory granules, which were composed of an electron dense core, an external membrane, and a space between them (figure 11(a)). in sap rats, condensation and margination of nuclear chromatin the number of secretory granules was significantly decreased compared to so group (figure 11(b)). in 4-pba treated rats, tem examination has revealed that beta cells had euchromatic nuclei, slightly dilated cisternae of er, increased mitochondrial matrix density, and secretory granules (figure 11(c)). these suggested that ultrastructural damage of pancreatic islet beta cells was ameliorated by 4-pba pretreatment. the development of sap is a complex process that initiates in the pancreatic acinar cells and is characterized by inflammation response and cell death, usually accompanying disorder of endocrine function as a result of pancreatic islet injury [29, 30 ]. er stress and its responses participate in the development of acute pancreatitis. under the circumstance of unresolved and severe er stress, persistent activation of the upr may destroy the pancreatic acinar cell and beta - cell homeostasis that constantly end in cell death owing to accumulation of misfolded or unfolded proteins and subsequently result in release of digestive enzymes and inflammatory cytokines, as well as insulin [32, 33 ]. 4-pba, a food and drug administration - approved drug, because of its chemical chaperone property by improving er stress, has been used as a therapeutic agent of diabetes associated beta - cell failure [21, 34 ] and some inflammatory diseases [35, 36 ] on cellular as well as organismal level. in addition, this is the first in vivo study, to our knowledge, detailing an islet especially beta cells protective effect of 4-pba in sap. in the present study, the increasing levels of serum amy, lipa, tnf-, il-1, and insulin and decreasing levels of serum glucose after sap were observed. these findings were consistent with our previous research, which demonstrated that a plenty of insulin was released from pancreatic beta cells into the blood as the body was under stress reaction during sap. the prophylactic administration of 4-pba reduced the serum levels of proinflammatory mediators and insulin and increased the serum levels of glucose following sap. this is also supported by the decreased injury of pancreatic acini and islets in light microscopy. otherwise, a negative correlation between serum insulin levels and serum glucose levels was detected, and serum levels of insulin were positively correlated with tnf- and il-1. the results suggested that pancreatic endocrine disorder was associated with the development of sap. on the other hand, beta cells with sparse and light insulin staining were shown in sap rats, while 4-pba added the insulin staining significantly in the survival islets. at the same time, decreased number of secretory granules in beta cells by tem examination and increased insulin levels in serum following sap were detected, while 4-pba raised the number of secretory granules in beta cells and reduced insulin levels in serum. these findings indicated that 4-pba could mitigate the severity of sap, and moreover 4-pba reduced destruction of islets caused by sap and preserved residual pancreatic islet beta - cell function by constraining excessive release of stored insulin and consequently relieved the sap - related pancreatic endocrine disorder. as cellular homeostasis is destroyed, a series of signals were immediately activated to cope with stress by promoting the synthesis of chaperone proteins. previous study has demonstrated that activation of bip improved the capacity of protein folding and processing during er stress. moreover, orp150 has been reported as an er - resident molecular chaperone which facilitated insulin release. excessive er stress leads to overexpression of chop that is hardly expressed under physiological conditions. an obvious increase in the expressions of bip, orp150, chop, and caspase-3 in islets was observed following sap at 12 h, indicating the development of er stress. furthermore, condensed chromatin concomitant with markedly dilated er cisternae and increase of mitochondria damage in pancreatic beta cells were observed using tem in sap rats, and 4-pba eased the ultrastructural injury induced by sap. these results suggested that er stress responses, indicated by grp78 and chop expression, in the pancreatic beta cells were greatly increased after sap was induced. 4-pba could inhibit er stress by suppressing expression of not only bip, orp150, and chop, but also caspase-3, which is a key enzyme in the apoptosis process. further, 4-pba might protect against sap - related pancreatic endocrine disorder by stabilizing the cellular homeostasis and preventing islet apoptotic cell death by means of modulating er stress. the present study demonstrates that er stress is involved in pancreatic beta - cell injury and pancreatic endocrine dysfunction after attack of severe acute pancreatitis. a chemical chaperone, 4-pba, ameliorates the beta - cell injury and dysfunction by protecting the islet structure, controlling synthesized insulin, and inhibiting beta - cell apoptosis and necrosis mediated by er stress. the results obtained from this study suggest that the er stress response can act as a mediator for pancreatic endocrine disorder observed in sap patients. although this work found that 4-pba can exert beneficial effects for sap in rats by its cytoprotective properties to restrain er stress - related inflammation and cell death after sap, the accurate molecular mechanism of 4-pba modulated er stress is recommended to investigate in further research. as 4-pba has been in clinical use, this study provides a theoretical basis that 4-pba can be a new therapeutic strategy restoring pancreatic endocrine function in connection with severe acute pancreatitis. | endoplasmic reticulum (er) stress is a particular process with an imbalance of homeostasis, which plays an important role in pancreatitis, but little is known about how er stress is implicated in severe acute pancreatitis (sap) induced pancreatic beta - cell injury. to investigate the effect of 4-phenylbutyric acid (4-pba) on the beta - cell injury following sap and the underlying mechanism, twenty - four sprague - dawley rats were randomly divided into sham - operation (so) group, sap model group, and 4-pba treatment group. sap model was induced by infusion of 5% sodium taurocholate into the biliopancreatic duct. 4-pba or normal saline was injected intraperitoneally for 3 days in respective group before successful modeling. results showed that 4-pba attenuated the following : (1) pancreas and islet pathological injuries, (2) serum tnf- and il-1, (3) serum insulin and glucose, (4) beta - cell ultrastructural changes, (5) er stress markers (bip, orp150, and chop), caspase-3, and insulin expression in islet. these results suggested that 4-pba mitigates pancreatic beta - cell injury and endocrine disorder in sap, presumably because of its role in inhibiting excessive endoplasmic reticulum stress. this may serve as a new therapeutic target for reducing pancreatic beta - cell injury and endocrine disorder in sap upon 4-pba treatment. |
a 19-year - old, gravida 1, para 0 woman at 39 weeks gestation with a past medical history notable for mild mental retardation, bipolar disorder and hypothyroidism presented to an outside hospital with bloody emesis and tinnitus after a self - reported ingestion of 100 tablets (32.5 g) of aspirin several hours prior. upon initial presentation, she was agitated and tachypneic, with a respiratory rate of 40 breaths / minute and tachycardic, with a heart rate of 120130 beats / minute, but otherwise hemodynamically stable. her laboratory data were notable for a salicylate level of 57.5 mg / dl, bicarbonate of 16 mmol / l and an anion gap of 14. the patient was given bicarbonate and glucose and transferred to the medical intensive care unit, where she was continued on a bicarbonate drip for urine alkalinization. a repeat salicylate level was 41.69 mg / dl with an arterial ph of 7.60. coagulation studies, including prothrombin time (pt), activated partial thromboplastin time (ptt) and international normalized ratio (inr), were all within normal limits. maternal and neonatal acetylsalicylic acid levels over time as the threshold for hemodialysis for aspirin overdose at our institution is a serum salicylate level of 100 mg / dl, the patient was determined not to be a candidate for hemodialysis. a fetal ultrasound indicated a gestational age of 3738 weeks (by fetal biparietal diameter and femur length). the fetal heart tracing showed a baseline fetal heart rate of 160170 beats / minute with minimal variability and multiple spontaneous decelerations. she also began to contract regularly, with cervical change to 3 cm dilation, consistent with early labor. given the non - reassuring fetal heart tracing and the signs that the patient was entering early labor, she was extensively counseled as to the risks and benefits of a cesarean delivery for both herself and the fetus and she consented to the procedure. to minimize risk of maternal hemorrhage, she was given a platelet transfusion prior to transfer to the operating room. a second unit of platelets was also started as the patient was taken to the operating room for an emergent cesarean section under general anesthesia. a vertical skin incision, rather than a pfannenstiel incision, thick meconium was noted at the time of delivery, but the procedure was otherwise uncomplicated. the female neonate weighed 3100 g at delivery and was initially limp and apneic with thick meconium - stained fluid. the initial heart rate was < 60 beats / minute and chest compressions were not performed ; the neonate was subsequently intubated. arterial and venous cord gases drawn immediately after delivery were ph 7.32, co2 43.6 mmhg, base excess 4 and ph 7.36, co2 36.6 mmhg, and base excess 4.3, respectively. a salicylate level also drawn at this time was 33.5 mg / dl, while a level drawn simultaneously from the mother was 27.06 mg / dl. initial complete blood count and coagulation studies at 1 h of life revealed a white blood cell count of 23 900 cells / mm, hemoglobin 13.6 mmol / l, hematocrit 40.3%, platelets 285 000/mm, pt 26.5, ptt 41.6, inr 2.4 and fibrinogen 169. electrolytes drawn at 6 h of life were as follows : sodium 137 meq / l, potassium 2.8 meq / l, chloride 101 mmol / l, bicarbonate 17 mmol / l and calcium 7.1 meq / l. a urine toxicology screen was negative for amphetamines, barbituates, benzodiazepines, cannabinoids, cocaine, methadone, opiates and oxycodone. a head ultrasound was performed and showed no intracranial hemorrhage and no anomalies or malformations. a chest x - ray the neonate received surfactant via endotracheal tube and was started on intravenous fluids with supplemental bicarbonate. she also received one transfusion of fresh frozen plasma (10 cc / kg) and platelets (10 cc / kg) due to the increased inr and mild oozing noted with placement of the umbilical artery and venous catheters. ampicillin and gentamicin were started empirically for a 48-h course ; blood cultures drawn prior to antibiotic therapy showed no growth after 48 h. she was extubated 17 h after delivery and remained stable. the post - natal course was remarkable for respiratory alkalosis, initial hypokalemia and hypocalcemia that resolved following repletion and normoglycemia. the neonate did not pass a hearing test performed on day of life two ; the results of further testing are unknown. there have been several prior reports of in utero salicylate toxicity, with three involving acute ingestion [13 ], two of which resulted in intrauterine fetal demise [2, 3 ]. the remaining cases involve chronic daily usage in the last trimester of pregnancy, and in two of such cases [4, 5 ], fetal or neonatal death was the result, one in utero and one at day of life nine. in several cases, the diagnosis of in utero salicylate exposure was made retrospectively and post - partum [1, 58 ]. in those cases in which salicylate exposure was known in the antepartum setting, the outcome was either intrauterine fetal demise [24 ] or cesarean section due to fetal distress [9, 10 ], although the latter two cases involved chronic salicylate exposure during pregnancy rather than acute intoxication. the treatment in these cases of known in utero salicylate toxicity has largely been expectant management, with outcomes ranging from fetal demise in utero in the cases of large - volume ingestion [24 ] to delivery without sequelae, primarily in the cases of chronic ingestion [6, 7, 10, 11 ] although not exclusively. therefore, in acute maternal toxic salicylate ingestion, appropriate treatment is unclear, particularly whether or not dialysis or prompt delivery would be beneficial in preventing fetal demise in utero. in adult patients, the threshold for hemodialysis to further counteract the effects of salicylates has been suggested at 7080 and 100 mg / dl at our institution. however, it has been noted that the severity of the intoxication does not always correlate with serum salicylate levels. while neither our case nor prior cases have met these criteria, the three cases involving fetal demise in utero involved maternal salicylate levels in the 5060 mg / dl range [3, 4 ], and it has been shown that fetal blood levels are 1.5 times maternal levels [9, 11 ]. furthermore, the neonate eliminates salicylate more slowly due to immature glucuronidation and renal excretory pathways [9, 11 ], and salicylate tends to concentrate in the fetal brain due to a smaller intravascular / intracellular ph gradient in the fetus. this raises the question of whether dialysis should be initiated at lower levels in cases of salicylate toxicity in pregnancy, and if this might be beneficial for the fetus. in only one prior report was hemodialysis utilized, and this was initiated in a patient who presented after in utero fetal demise had already occurred. to our knowledge, there have been no reports of the use of dialysis for toxic overdose of any drug in pregnant patients. there has been a study of acute kidney injury during pregnancy requiring dialysis, but fetal outcomes were not followed. in our case, a gravid patient presented with initial salicylate levels below those in prior case reports where significant morbidity or mortality was the outcome. although the fetus showed signs of distress upon presentation, the decision was made to delay delivery until maternal status had been optimized. it was unclear whether the benefits of maternal hemodialysis would be conferred upon the fetus, as hemodialysis would have little effect on the salicylate that had already entered fetal circulation. in addition, fetal distress in this situation could be attributed to derangements in fetal acid base status, as mentioned in previous case reports, with fetal acidosis persisting despite our patient s alkalosis due to intravenous bicarbonate therapy. indeed, it has been hypothesized that maternal hemodialysis does not benefit the fetus in the case of acute salicylate overdose and that emergent delivery is the most beneficial for the fetus at risk for in utero salicylate toxicity at or near term. maternal hemodialysis was not initiated in our case, with no adverse effect on fetal outcome. as shown in figure 1, neonatal salicylate levels, as the patient s condition stabilized without hemodialysis, she spontaneously began to labor and mode of delivery became a concern. the fetal heart tracing continued to show signs of fetal distress, and despite progressive cervical change, it was thought that the fetus would not tolerate a vaginal delivery. as salicylate metabolites accumulate in the fetal brain, potentially fatal intracerebral hemorrhage could result, as has been reported in other cases [2, 8 ]. given these concerns for fetal well - being, a cesarean section was determined to be the optimal mode of delivery. our experience with this case and further research on similar situations illustrates that maternal hemodialysis is of little benefit to the fetus in cases of salicylate ingestion and that expectant management is reasonable until maternal condition stabilizes, at which time, the patient should be counseled for a cesarean section to avoid fatal fetal intracerebral hemorrhage. | acute salicylate overdose in pregnancy is potentially fatal for both the mother and fetus and presents a unique challenge in intensive care management. while suggested thresholds exist for hemodialysis in adults with toxic salicylate ingestion, it is unclear if these thresholds remain appropriate for the gravid patient, particularly given that medications such as acetylsalicylic acid may cross the placental barrier and accumulate in the fetal bloodstream. we describe a case of a gravid patient at 37 weeks gestational age with a self - reported acetylsalicylic acid ingestion of 32.5 g and review prior cases of both acute and chronic salicylate ingestion in pregnancy in order to determine the clinical precedent for hemodialysis in this situation. |
obstructive sleep apnea (osa), characterized by repeated obstructions of upper airway with intermittent hypoxic exposure, is associated with multiple detrimental physiological and psychological consequences, in addition to being associated with cardiorespiratory diseases, including pulmonary hypertension,1 systemic hypertension,2 cardiac arrhythmias,3 cardiac ischemia4 and cerebral ischemia.5 osa may also cause daytime sleepiness,6 increase the risk of a traffic accident,7 and diminish both quality of life8 and work performance,9 as well as being accompanied by impairment in several cognitive domains, including attention and vigilance decrements, memory gaps, psychomotor dysfunction, and abnormalities in executive functions.1012 on the basis of available population - based studies, osa affects 3%7% of adult men, 2%5% of adult women,1315 and up to 4% of children.16,17 the main pathophysiologic mechanism of cognitive deficits from osa, including intermittent hypoxia, intermittent hypercapnia, and sleep fragmentation,18 are still unclear. previous neuroimaging studies have investigated 1) diminutions in gray matter concentration in the left hippocampus, left rectus gyrus, bilateral superior frontal gyrus, left precentral gyrus, bilateral frontomarginal gyrus, bilateral anterior cingulate gyrus, right insular gyrus, bilateral caudate nucleus, bilateral thalamus, bilateral amygdalo - hippocampus, bilateral inferior temporal gyrus, and cerebellum, and 2) gray matter volume deficits in bilateral hippocampus, bilateral lateral temporal areas, right cuneus, right middle temporal gyrus, left dorsolateral prefrontal cortex, right middle temporal gyrus, and left cerebellum using voxel - based morphometry techniques in osa patients (osas).1923 moreover, diffusion tensor imaging studies showed a wide range of changes in white matter integrity within the corpus callosum, frontal cortex, temporal cortex, parietal cortexes, cingulate bundle, and cerebellum.2426 a single - photon emission computed tomography study found that severe osas showed reduced cerebral blood flow in bilateral parahippocampal gyrus, right lingual gyrus, pericentral gyrus, and cuneus.27 decreased neural activations associated with cognitive impairment have been found in multiple brain regions, including the cingulate gyrus, dorsolateral prefrontal gyrus, inferior frontal gyrus, left postcentral gyrus, inferior and posterior parietal lobes, insula, and right putamen using task - state functional magnetic resonance imaging (fmri) in osas.2830 recently, use of resting - state fmri (rs - fmri) has been increasing to investigate the ongoing neuronal processes in osa. although the majority of previous neuroimaging studies have focused on the brain structural and task - state functional changes of osas, few studies have evaluated the changes in blood oxygen - level - dependent (bold) signals of regional spontaneous activity of osas during resting state and their relationships with behavioral performances. amplitude of low - frequency fluctuation (alff), a newly developed rs - fmri approach, calculates the square root of the power spectrum in a low - frequency range (0.010.08 hz), for detecting the regional intensity of spontaneous fluctuations in bold signals.3133 furthermore, the alff has been proven to have test retest reliability34 and has already been applied to patient studies investigating attention deficit hyperactivity disorder,31 sleep deprivation,35 schizophrenia,36 and early alzheimer s disease.37 however, it has not yet been used to explore the pathophysiological changes in osas. this study is the first to utilize alff as an index to investigate the intrinsic brain activity traits of osas and its potential mechanisms. twenty - five untreated male severe osas and 25 age - matched and years - of - education - matched male good sleepers (gss) were included in this study from the sleep monitoring room of the respiratory department of the first affiliated hospital of nanchang university. each subject was assessed by a detailed clinical interview and physical examination ; in addition, the subjects completed a sleep questionnaire and underwent overnight polysomnography. the inclusion and exclusion criteria for the osas and gss were as the same as in our previous study.38,39 the inclusion criteria for the osas were as follows : male sex ; age > 22 years but 30 events per hour. the exclusion criteria for both osas and gss were as follows : 1) other sleep disorders, such as insomnia and sleep - related eating disorders ; 2) history of cardiovascular disease, hypertension, or diabetes mellitus ; 3) central nervous system disorders (neurodegenerative diseases, epilepsy, head injury, psychosis, hypothyroidism, or current depression) ; 4) left - handedness ; 5) alcohol or illicit drug abuse ; 6) current intake of psychoactive medications ; and 7) contraindications to mri, such as claustrophobia, metallic implants, or devices in the body. this study was approved by the human research ethics committee at the first affiliated hospital of nanchang university, and all participants provided written informed consent forms. the day before the sleep studies, all osas and gss were asked to refrain from drinking alcohol or caffeinated beverages. full nocturnal polysomnography monitoring was performed on osas and gss using the respironics le - series physiological monitoring system (alice 5 le ; respironics, orlando, fl, usa) in the sleep center of our hospital. standard electroencephalogram, electrooculogram, chin electromyogram, electrocardiogram, thoracic and abdominal movements, and snoring were recorded. arterial oxygen saturation (sao2) was measured transcutaneously by fingertip pulse oximetry. in accordance with the american academy of sleep medicine guidelines, apnea was defined as the continuous cessation of airflow for more than 10 seconds and hypopnea was defined as a decrease in airflow by > 30% with arousal or oxygen desaturation > 4%.40,41 the ahi was calculated as the average of the total number of apnea and hypopnea events experienced per hour of sleep. all subjects filled in a sleep questionnaire to assess their daytime sleepiness by the epworth sleepiness scale (ess), with scores between 0 and 24.42 a score higher than 6 was considered somnolence. all subjects underwent a cognitive assessment using the montreal cognitive assessment (moca)43 tool, administered by two independent neuropsychologists, to evaluate their executive function, naming, attention, calculation, language, abstraction, memory, and orientation. a total moca score 1.5 mm maximum displacement in x, y, or z planes and 1.5 of angular motion during the whole fmri scans were rejected. the friston six head motion parameters were used to regress out head motion effects based on recent work showing that higher - order models were more effective in removing head motion effects.45,46 linear regression was also applied to remove other sources of spurious covariates along with their temporal derivatives, including the signal from a ventricular region of interest (roi) and the signal from a region centered in the white matter.47 of note, the global signal was not regressed out in the present data, as in the study by guo for the reason that there is still a controversy around the removal of the global signal in the preprocessing step of resting - state data.47,49 after head - motion correction, the fmri images were spatially normalized to the montreal neurological institute (mni) space using the standard epi template and resampling the images at a resolution of 333 mm. after preprocessing, the time series for each voxel were linearly detrended to reduce low - frequency drift, physiological high - frequency respiratory and cardiac noise, and time series linear detrending. the time series for each voxel were transformed to the frequency domain, and the power spectrum was then obtained. because the power of a given frequency is proportional to the square of the amplitude of this frequency component, the square root was calculated at each frequency of the power spectrum, and the averaged square root was obtained across 0.010.08 hz at each voxel. the details of alff calculation are as described in a previous study.31 to reduce the global effects of variability across the participants, the alff of each voxel was divided by the global mean alff value for each participant. subject characteristics, including age, body mass index (bmi), education, ess score, moca score, and sleep - disordered breathing parameters, were tested using independent sample t - tests to compare osas with gss using ibm statistical package for the social sciences version 19.0 (spss 19.0), and a p - value 22 years but 30 events per hour. the exclusion criteria for both osas and gss were as follows : 1) other sleep disorders, such as insomnia and sleep - related eating disorders ; 2) history of cardiovascular disease, hypertension, or diabetes mellitus ; 3) central nervous system disorders (neurodegenerative diseases, epilepsy, head injury, psychosis, hypothyroidism, or current depression) ; 4) left - handedness ; 5) alcohol or illicit drug abuse ; 6) current intake of psychoactive medications ; and 7) contraindications to mri, such as claustrophobia, metallic implants, or devices in the body. this study was approved by the human research ethics committee at the first affiliated hospital of nanchang university, and all participants provided written informed consent forms. the day before the sleep studies, all osas and gss were asked to refrain from drinking alcohol or caffeinated beverages. full nocturnal polysomnography monitoring was performed on osas and gss using the respironics le - series physiological monitoring system (alice 5 le ; respironics, orlando, fl, usa) in the sleep center of our hospital. standard electroencephalogram, electrooculogram, chin electromyogram, electrocardiogram, thoracic and abdominal movements, and snoring were recorded. arterial oxygen saturation (sao2) was measured transcutaneously by fingertip pulse oximetry. in accordance with the american academy of sleep medicine guidelines, apnea was defined as the continuous cessation of airflow for more than 10 seconds and hypopnea was defined as a decrease in airflow by > 30% with arousal or oxygen desaturation > 4%.40,41 the ahi was calculated as the average of the total number of apnea and hypopnea events experienced per hour of sleep. all subjects filled in a sleep questionnaire to assess their daytime sleepiness by the epworth sleepiness scale (ess), with scores between 0 and 24.42 a score higher than 6 was considered somnolence. all subjects underwent a cognitive assessment using the montreal cognitive assessment (moca)43 tool, administered by two independent neuropsychologists, to evaluate their executive function, naming, attention, calculation, language, abstraction, memory, and orientation. a total moca score 1.5 mm maximum displacement in x, y, or z planes and 1.5 of angular motion during the whole fmri scans were rejected. the friston six head motion parameters were used to regress out head motion effects based on recent work showing that higher - order models were more effective in removing head motion effects.45,46 linear regression was also applied to remove other sources of spurious covariates along with their temporal derivatives, including the signal from a ventricular region of interest (roi) and the signal from a region centered in the white matter.47 of note, the global signal was not regressed out in the present data, as in the study by guo for the reason that there is still a controversy around the removal of the global signal in the preprocessing step of resting - state data.47,49 after head - motion correction, the fmri images were spatially normalized to the montreal neurological institute (mni) space using the standard epi template and resampling the images at a resolution of 333 mm. after preprocessing, the time series for each voxel were linearly detrended to reduce low - frequency drift, physiological high - frequency respiratory and cardiac noise, and time series linear detrending. the time series for each voxel were transformed to the frequency domain, and the power spectrum was then obtained. because the power of a given frequency is proportional to the square of the amplitude of this frequency component, the square root was calculated at each frequency of the power spectrum, and the averaged square root was obtained across 0.010.08 hz at each voxel. the details of alff calculation are as described in a previous study.31 to reduce the global effects of variability across the participants, the alff of each voxel was divided by the global mean alff value for each participant. subject characteristics, including age, body mass index (bmi), education, ess score, moca score, and sleep - disordered breathing parameters, were tested using independent sample t - tests to compare osas with gss using ibm statistical package for the social sciences version 19.0 (spss 19.0), and a p - value < 0.05 was deemed significant. for functional data, two - sample student s t - test was used to analyze the difference between the two groups, with age and years of education as nuisance covariates of no interest. a corrected significance level of individual voxel p<0.001 and a cluster volume (v) 270 mm (a minimum continuous v of 270 mm), using a false discovery rate (fdr)-corrected cluster threshold of p<0.05, was used to determine statistical significance. on the basis of the alff findings, the brain regions that demonstrated significant level of difference between groups were indentified. these regions were classified as rois and saved as masks using the rest version1.8 software (http://www.resting-fmri.sourceforge.net). for each roi, the mean alff value was extracted by averaging the alff values over all voxels for each osa. finally, the mean alff values were entered into ibm spss 19.0 to calculate their correlations with the behavioral performances. the osas had significantly higher scores for bmi (t = 6.25, p<0.001), ahi (t = 15.51, p<0.001), sao2 < 90% (t = 6.66, p<0.001), arousal index (t = 6.85, p<0.001), and ess score (t = 7.64, p<0.001) and had significantly lower scores for rapid eye movement (rem) sleep (t = -5.4, p<0.001) and moca (t = -2.16, p=0.036) than the gss. compared with gss, osas showed significant lower - alff areas in the cluster of right precuneus and bilateral posterior cingulate gyrus and a higher - alff area in the left inferior frontal gyrus. the mean alff values of these altered areas were extracted (figure 2). in the osas, the ahi score displayed a significant positive correlation with the arousal index (r=0.642, p=0.001) and negative correlations with rem% (r=0.429, p=0.032) and moca score (r=0.405, p=0.045). n2% (percentage of total sleep time at diagnostic polysomnography spent in the relevant stage) displayed negative correlations with rem% (r=0.584, p=0.002) and ess score (r=0.531, p=0.006). bmi displayed significant positive correlation with arousal index (r=0.582, p=0.002) and negative correlation with the lowest oxygen saturation (r=0.647, p<0.001). the mean signal value of the observed lower - alff area displayed significant positive correlations with the lowest oxygen saturation (r=0.447, p=0.025) and moca score (r=0.405, p=0.045). because different alff areas were found between osas and gss, they might be utilized as markers to separate the osas from the gss. to test this possibility, the mean alff values of the different brain regions were extracted and used for analysis of the receiver operating characteristic curves. in the present study, the values for the areas under the curves of the left inferior frontal gyrus and the cluster of right precuneus and bilateral posterior cingulate gyrus were 0.93 and 0.90, respectively. further diagnostic analysis showed that the sensibility and specificity of the two clusters were 92% and 80%, respectively. the osas had significantly higher scores for bmi (t = 6.25, p<0.001), ahi (t = 15.51, p<0.001), sao2 < 90% (t = 6.66, p<0.001), arousal index (t = 6.85, p<0.001), and ess score (t = 7.64, p<0.001) and had significantly lower scores for rapid eye movement (rem) sleep (t = -5.4, p<0.001) and moca (t = -2.16, p=0.036) than the gss. compared with gss, osas showed significant lower - alff areas in the cluster of right precuneus and bilateral posterior cingulate gyrus and a higher - alff area in the left inferior frontal gyrus. in the osas, the ahi score displayed a significant positive correlation with the arousal index (r=0.642, p=0.001) and negative correlations with rem% (r=0.429, p=0.032) and moca score (r=0.405, p=0.045). n2% (percentage of total sleep time at diagnostic polysomnography spent in the relevant stage) displayed negative correlations with rem% (r=0.584, p=0.002) and ess score (r=0.531, p=0.006). bmi displayed significant positive correlation with arousal index (r=0.582, p=0.002) and negative correlation with the lowest oxygen saturation (r=0.647, p<0.001). the mean signal value of the observed lower - alff area displayed significant positive correlations with the lowest oxygen saturation (r=0.447, p=0.025) and moca score (r=0.405, p=0.045). because different alff areas were found between osas and gss, they might be utilized as markers to separate the osas from the gss. to test this possibility, the mean alff values of the different brain regions were extracted and used for analysis of the receiver operating characteristic curves. in the present study, the values for the areas under the curves of the left inferior frontal gyrus and the cluster of right precuneus and bilateral posterior cingulate gyrus were 0.93 and 0.90, respectively. further diagnostic analysis showed that the sensibility and specificity of the two clusters were 92% and 80%, respectively. our previous study50 had demonstrated that many brain areas have obvious sex differences after normal sleep status and during sleep loss status. in this study, so as to avoid the influence of the sex differences or a lopsided sex ratio, only male osas were recruited. our study is the first to investigate the effect of osa on resting - state brain activity using the alff method. in our current study, we found that osas showed higher alff in the left inferior frontal lobe and lower alff in the cluster of right precuneus and bilateral posterior cingulate gyrus, compared with gss, and showed lower moca score than gss. moreover, the observed lower - alff area displayed significant positive correlations with the lowest oxygen saturation and moca score. as known, the lower - alff area in the cluster of right precuneus and bilateral posterior cingulate gyrus is largely included in the default mode networks (dmns).51 similarly, prilipko found that osas showed abnormal deactivation in the dmn during working - memory tasks and a significantly positive correlation between the deactivation of dmn regions and behavioral performance,52 suggesting that suppression of activity in the dmn plays a role in cognitive impairment. beebe also found, using sophisticated meta - analytic models, that osa had a substantial impact on vigilance and executive functions but a negligible impact on intellectual and verbal function. yaouhi found that the glucose metabolic activity of precuneus and cingulate gyrus, which were not atrophic, was reduced in osas, compared with that in gss, using a f - fluoro-2-deoxy - d - glucose positron emission tomography method,54 and that this functional impairment may have been caused partly by remote effects originating from morphologically impaired areas with decreased connectivity.55 furthermore, our study found a positive correlation between cerebral deactivation in parts of regions of the dmn and the lowest oxygen saturation, suggesting that intermittent hypoxia may be an important factor for the dmn dysfunction in osas. the cingulate area is activated by dyspnea,56 breathlessness,57 and emotion related to the need for air58 and is involved in autonomic functions, including maintenance of blood pressure and salivary secretion, which suggests that the cingulate cortex has a complex and indirect relationship with the central networks that control respiration.59,60 previous structural neuroimaging studies have found gray matter loss and white matter integrity reduction in the cingulate in osas.25,26 joo also found that osas had decreased gray matter concentrations in the cingulate cortex, which may explain the clinical manifestations such as respiratory, affective, and cardiovascular disturbances. ayalon found that osas showed decreased brain activation in left precentral gyrus, left anterior, and posterior cingulate, compared with control subjects, during an attention task. similar results have been reported during valsalva maneuvers.62 these studies suggest that the cingulate gyrus may be particularly vulnerable to osa - related impairment, independent of the specific cognitive challenge measured. in support of these functional and structural findings, our study found lower - alff areas in the posterior cingulate in osas compared with gss. moreover, a significant positive correlation between the lower - alff area and the moca score was observed in the osas. behavior relationship demonstrated that the abnormal properties of the posterior cingulate were associated with impaired cognitive function in osas. the precuneus plays an important role in fundamental cognitive functioning, including episodic memory retrieval, visual spatial imagery, self - processing, and consciousness.63 our previous study38 found lower regional homogeneity area in the precuneus, which showed a significant negative correlation with sleep time, suggesting that decreased sleep time may be an important factor for dysfunction in the precuneus. in the current study, the lower - alff area in the right precuneus displayed significant positive correlation with moca score, suggesting that the abnormalities of the precuneus may be associated with a cognitive dysfunction. ayalon found that compared with gss, osas showed increased activity in the bilateral inferior frontal gyrus, and a significant relationship between increased activation in the left inferior frontal gyrus and better immediate recall during a verbal learning task was found, suggesting an adaptive compensatory response. in support of this finding, in our study, osas showed higher alff in the left inferior frontal lobe, compared with gss, which was consistent with previous studies on sleep deprivation65 and healthy aging.66 in conclusion, our findings suggest that the alff method may be a useful noninvasive imaging tool and a symbolic early biomarker for the detection of cerebral changes and for indexing of the changes of cognitive function, which may be helpful in the development of imaging biomarkers for the detection of cerebral changes. furthermore, the abnormal spontaneous activity of the dmn region and the frontal lobe may be involved in the underlying pathophysiology of osas. first, a larger sample size, as well as female and children populations, should be studied. second, another group comparison, both before and after the treatment, will yield significant insight. | backgroundthe majority of previous neuroimaging studies have demonstrated both structural and functional abnormalities in obstructive sleep apnea (osa). however, few studies have focused on the regional intensity of spontaneous fluctuations during the resting state and the relationship between the abnormal properties and the behavioral performances. in the present study, we employed the amplitude of low - frequency fluctuation (alff) method to explore the local features of spontaneous brain activity in osa patients (osas).methodstwenty - five untreated male severe osas and 25 age - matched and years - of - education - matched male good sleepers (gss) were included in this study. the alff method was used to assess the local features of spontaneous brain activity. the mean signal values of the altered alff areas were analyzed with receiver operating characteristic curve. partial correlation analysis was used to explore the relationship between the observed mean alff values of the different areas and the behavioral performances.resultscompared with gss, osas had significantly higher scores for body mass index, apnea hypopnea index, arterial oxygen saturation < 90%, arousal index, and epworth sleepiness scale (ess) score ; furthermore, osas had significantly lower scores for rapid eye movement sleep and in the montreal cognitive assessment (moca). compared with gss, osas showed significant lower - alff areas in the cluster of the right precuneus and bilateral posterior cingulate gyrus, as well as a higher - alff area in the left inferior frontal gyrus. the area under the curve values of the lower- and higher - alff areas were 0.90 and 0.93, respectively. further diagnostic analysis exhibited that the sensibility and specificity of the two clusters were 80% and 92%, respectively. the mean signal value of the lower - alff cluster displayed significant positive correlations with lowest oxygen saturation (r=0.447, p=0.025) and moca score (r = 0.405, p=0.045).conclusionosas may involve in a dysfunction in the default mode network and an adaptive compensatory response in the frontal lobe, which reflect the underlying pathophysiology of cognitive impairment. |
approximately 5,100 isolates of m. tuberculosis complex, predominately from patients in tb control programs in the northeast united states, are part of the wadsworth center spoligotype database. most of these strains have been collected through ongoing sentinel surveillance projects in massachusetts and new york city from 1996 to the present. in our strain collection, pcr amplifications were performed on extracted dna or cell suspensions, which were heat - killed at 80c for 1 hr in an oven. spoligotype patterns were analyzed with bioimage whole band analysis v3.4 software (genomic solutions, ann arbor, mi) on a sun ultra10 workstation (sun microsystems inc., spoligotype patterns were given descriptive nomenclature according to the standard method (16), along with a unique arbitrary numeric designation by the centers for disease control and prevention (cdc). is6110-based restriction fragment length polymorphism (rflp) analysis was performed, according to standard protocol (17), at the wadsworth center (albany, ny) and the public health research institute (new york city, ny), on approximately 3,700 of these isolates. rflp patterns were analyzed with bioimage whole band analysis v3.4 software (genomic solutions). rflp pattern designations for sentinel surveillance isolates were assigned a unique arbitrary numerical designation by cdc. sequence logo analysis was originally devised as a method to find blocks of related amino acids between protein sequences and display the information in an intuitive visual description that illustrates both the residue and the degree of conservation at each position (18). logo analysis has been used to look for functional and evolutionary relationships among groups of proteins and nucleic acids (19). spoligologo analysis (15) was accomplished by using weblogo software from the school of the biological sciences at the university of cambridge (available from : url : http://www.bio.cam.ac.uk/seqlogo/). to be compatible with weblogo, letter designations (x = hybridization, o = no hybridization signal) were used to denote the pattern of hybridization observed for each spoligotype pattern. spoligotype patterns to be compared were entered directly into weblogo and a postscript file of the results was generated. thus, we compared hybridization to spacer 1 in the group of selected spoligotypes, followed by analysis of spacer 2, and so on for all 43 spacers. for convenience of illustration, two groups of isolates were chosen for spoligologo analysis. the first set consisted of 43 strains of m. bovis (13) in our collection. the second set was 12 low - band (exhibiting fewer than six copies of is6110 by rflp analysis) m. tuberculosis isolates from vietnam - born, massachusetts sentinel surveillance case - patients. vietnamese patients are the largest foreign - born group represented in the low - band data from massachusetts. approximately 5,100 isolates of m. tuberculosis complex, predominately from patients in tb control programs in the northeast united states, are part of the wadsworth center spoligotype database. most of these strains have been collected through ongoing sentinel surveillance projects in massachusetts and new york city from 1996 to the present. in our strain collection, pcr amplifications were performed on extracted dna or cell suspensions, which were heat - killed at 80c for 1 hr in an oven. spoligotype patterns were analyzed with bioimage whole band analysis v3.4 software (genomic solutions, ann arbor, mi) on a sun ultra10 workstation (sun microsystems inc., santa clara, ca). spoligotype patterns were given descriptive nomenclature according to the standard method (16), along with a unique arbitrary numeric designation by the centers for disease control and prevention (cdc). is6110-based restriction fragment length polymorphism (rflp) analysis was performed, according to standard protocol (17), at the wadsworth center (albany, ny) and the public health research institute (new york city, ny), on approximately 3,700 of these isolates. rflp patterns were analyzed with bioimage whole band analysis v3.4 software (genomic solutions). rflp pattern designations for sentinel surveillance isolates were assigned a unique arbitrary numerical designation by cdc. sequence logo analysis was originally devised as a method to find blocks of related amino acids between protein sequences and display the information in an intuitive visual description that illustrates both the residue and the degree of conservation at each position (18). logo analysis has been used to look for functional and evolutionary relationships among groups of proteins and nucleic acids (19). spoligologo analysis (15) was accomplished by using weblogo software from the school of the biological sciences at the university of cambridge (available from : url : http://www.bio.cam.ac.uk/seqlogo/). to be compatible with weblogo, letter designations (x = hybridization, o = no hybridization signal) were used to denote the pattern of hybridization observed for each spoligotype pattern. spoligotype patterns to be compared were entered directly into weblogo and a postscript file of the results was generated. thus, we compared hybridization to spacer 1 in the group of selected spoligotypes, followed by analysis of spacer 2, and so on for all 43 spacers. for convenience of illustration, two groups of isolates were chosen for spoligologo analysis. the first set consisted of 43 strains of m. bovis (13) in our collection. the second set was 12 low - band (exhibiting fewer than six copies of is6110 by rflp analysis) m. tuberculosis isolates from vietnam - born, massachusetts sentinel surveillance case - patients. vietnamese patients are the largest foreign - born group represented in the low - band data from massachusetts. figure 1 illustrates logo analysis with spoligotyping data. spoligotyping identified 28 different spoligotypes associated with m. bovis from 43 isolates in our collection. letter designations were chosen for compatibility with the weblogo program as described in methods. the tallest x and o characters represent areas of absolute concordance between the patterns chosen for analysis. where differences occur, the ratio of those spoligotypes showing hybridization to those that do not is represented by relative height differences of the characters in that column. the resulting spoligologo (figure 1b) shows that spacers 20, 25, 26, and 38 are present in all 28 spoligotype patterns. the absence of spacers 3943 in these spoligotype patterns is consistent with an identification of m. bovis (13). the greatest polymorphism between the patterns appears in spacers 3 through 16 (figure 1b). spoligotype patterns probably evolve through the loss of spacer sequences through a variety of mechanisms (7,20). we try to extrapolate back to the hypothetical founder of these m. bovis isolates, which we believe had spacers 138 and not 3943. no isolate with this probable m. bovis founder spoligotype has yet been observed in the wadsworth center spoligotype database. panel a illustrates the raw hybridization data followed by the same patterns coded for logo analysis. to be compatible with weblogo analysis, patterns were converted to a 43-character long string consisting of the letters x and o. the letter x represents a positive hybridization, and o represents no hybridization detected for each of the 43 spacer sequences. panel c shows the summary graphic of the spoligotypes by collapsing the data into a single row. legend : x = hybridization observed to spacer, o= no hybridization observed to spacer, = positive hybridization in every spoligotype pattern for that individual spacer sequence, = no hybridization, =positive hybridization in > 50% of the patterns, = no hybridization in > 50% of the patterns. foreign - born persons, especially those from regions with high tb case rates, are of concern for tb transmission in the united states (21,22). the low - band m. tuberculosis strains from vietnam - born patients, which we selected, produced another spoligologo pattern (figure 2). the ability of spoligologo analysis to collapse even a small selection of spoligotype patterns from a select group of strains (figure 2a) into the possible founder spoligotype can be observed in the summary (figure 2c). however, additional typing methods would be required to verify that the strains are related, rather than exhibiting convergent evolution of their respective spoligotypes. logo analysis on nine different spoligotypes observed for mycobacterium tuberculosis isolates from vietnam - born patients in massachusetts demonstrating fewer than six copies of is6110 by rflp analysis. legend : x= hybridization observed to spacer, o= no hybridization observed to spacer, = positive hybridization in every spoligotype pattern for that individual spacer sequence, = no hybridization, =positive hybridization in > 50% of the patterns, = no hybridization in > 50% of the patterns. as previously suggested (5,7,23), m. tuberculosis strains that generally contain spacers 3343 may form a family that is an intermediate lineage between the beijing (11,12) and non - beijing m. tuberculosis strain families, such as haarlem (2). spoligotyping, microarrays, and dna - chips are all examples of reverse - hybridization array - based assays. although microarrays and dna - chips can contain thousands of bits of data, the principle behind them is similar to that of the spoligotype assay, which uses a simple 1 x 43 array. array - based assays use reverse hybridization in which a labeled sample is probed against a series of proteins or nucleic acids that are bound to a solid support, such as a nylon membrane or silica. the result for each potential binding event the binary nature of array - based assays allows the data to be analyzed usefully with algorithms associated with motif recognition, such as sequence logo analysis. the relative low cost and simplicity of the spoligotype assay means it can be performed by many laboratories and the digital nature of the data facilitates the exchange of information among researchers. the growth in the availability of array - based assays has outpaced the ability of conventional software analysis packages to provide every possible method of analysis. customized versions of software are extremely expensive, and researchers, who want to implement these protocols without specialized software, lack methods of collating the large amounts of data. problems arise when attempts are made to judge the significance of similar but nonidentical array data. identifying possible families in these array patterns may be important in understanding the evolution and spread of pathogens such as m. tuberculosis. our method for collapsing array - based data can be used to find and present patterns or signature motifs in these types of data. as previously noted (1), cluster analysis of large rflp databases is difficult for a combination of reasons, including software failure and intralaboratory variations. digital data, such as spoligotyping, mycobacterial interspersed repetitive unit (24), and variable number tandem repeat analyses (25), will probably form the basis for any large dna fingerprinting projects in the future (26). strains that cluster by one typing method must be analyzed by other methods to ensure that the groupings represent clusters of true relatedness and not cases of convergent evolution. bioinformatic analyses, like logo analysis, may prove useful in obtaining further data from the large m. tuberculosis complex dna typing databases already in existence. spoligologo analysis is a graphic method of presenting similar spoligotypes that may elicit useful insights into the geographic spread of tuberculosis. potential families of tb strains could be identified on the basis of their logo ; these strains could then be analyzed by additional dna - typing methods to confirm the relationship, followed examining relevant patient data (e.g., country of birth). a similar analysis was performed for the m. tuberculosis w - beijing family (11) that helped elucidate the evolution of a multidrug resistant strain in new york city. spoligologo analysis could help identify more of these families, determine their global origin, and evaluate their spread. determining the sources and spread of tuberculosis is an important tool in preventing further infections. understanding the geographic origin of an m. tuberculosis dna fingerprint could be useful, especially in understanding the sources and spread of strains in the u.s. foreign - born population, among whom differentiating recently transmitted disease from reactivation of a past exposure can be difficult. | spacer oligonucleotide (spoligotyping) analysis is a rapid polymerase chain reaction based method of dna fingerprinting the mycobacterium tuberculosis complex. we examined spoligotype data using a bioinformatic tool (sequence logo analysis) to elucidate undisclosed phylogenetic relationships and gain insights into the global dissemination of strains of tuberculosis. logo analysis of spoligotyping data provides a simple way to describe a fingerprint signature and may be useful in categorizing unique spoligotypes patterns as they are discovered. large databases of dna fingerprint information, such as those from the u.s. national tuberculosis genotyping and surveillance network and the european concerted action on tuberculosis, contain information on thousands of strains from diverse regions. the description of related spoligotypes has depended on exhaustive listings of the individual spoligotyping patterns. logo analysis may become another useful graphic method of visualizing and presenting spoligotyping clusters from these databases. |
atherosclerotic heart disease and chronic heart failure remain a major worldwide health problem. according to the american heart association statistics, over one in three american adults have one or more types of cardiovascular disease resulting in an average of 1 death every 39 seconds. in addition, millions of people are now living with the results of palliated congenital heart disease such as artificial valves and conduits and declining ventricular function. significant advances in medical care ; pharmacologic therapy, interventional catheterization, and surgical procedures ; coronary artery bypass grafting and hybrid techniques, ventricular restoration, ventricular assist devices, and organ transplantation have improved the lives of many. yet these therapies are expensive, yield variable results and are not available or applicable to all clinical states. finally, many of these modalities do not get to the heart of the matter : a reduction in the effective contractile architecture or the need for true autologous cardiac structures. undifferentiated cells capable of self - renewal and developing into various tissues and organs are referred to as stem cells (sc). multiple sources of human stem cells, embryonic and nonembryonic (bone marrow, adipose tissue and umbilical cord blood), have been characterized and studied in preclinical scenarios. embryonic stem cells, for example, have great potential for regeneration given their high content of pluripotent cells. currently mired in political and ethical debate, their use is further complicated by the risk of teratoma formation. stem cells from adult sources (bone and adipose tissue) can provide an alternative but may carry a higher risk of somatic mutations [5, 6 ]. umbilical cord blood contains various populations of stem cells and progenitors including hematopoietic stem cells (hscs), mesenchymal stem cells (mscs), endothelial colony forming cells (ecfcs) and more primitive unrestricted somatic stem cells (usccs) [7, 8 ]. given its more nave state and younger environmental exposure ucb retains great pluripotentiality, less immunogenicity, and fewer mutations. conversely, it may be more difficult to harvest under sterile conditions and in sufficient volume. finally, although ucb is a rich source of many populations of primitive stem cells, the yield of each cell line from any given sample may vary considerably. despite the increasing attempts to limit the use of exogenous blood and its components, allogeneic transfusion remains a necessity in a significant percentage of hospitalized patients. this is particularly true when caring for patients at the extremes of ages with cardiovascular disease. umbilical cord blood (ucb) is rich in adult and fetal hemoglobin cells as well as platelets and other cellular constituents and offers minimal immunologic reaction. given fetal hemoglobin 's enhanced oxygen affinity ucb offers an ideal blood substitute and has been used to treat adults suffering from anemia associated with diabetes mellitus, rheumatoid arthritis, and infectious diseases such as malaria, leprosy, tuberculosis and hiv. thalassemia and sickle cell patients have also benefited from the stem cells derived from ucb. major limitations to its widespread use include, the relatively small volume of blood obtained (approximately 150 cc 's) from one placenta, shelf life (approximately 30 days), consent for and administration of serologic tests from the pregnant woman prior to delivery, issues of sterility (vaginal delivery > caesarian section), and increased cost (6x 's the expense of voluntarily donated allogeneic rbc) during collection and cultural and superstitious barriers [11, 12 ]. premature infants are often born with multiple major medical problems including cardiopulmonary disease requiring long - term hospitalization, interventional procedures, and blood transfusion. in the past, although the collection and preparation of placental and umbilical cord blood was technically possible, a number of questions were raised regarding its safety and utility (given the variable rates of eventual transfusions). the probability of needing and benefiting from ucb transfusion may now be possible to estimate from parameters such as gestational age, birth weight, and apgar scores. a recent study investigating the use of ucb in neonates undergoing general surgical procedures found this technique useful and noted that 64% of patients avoided allotransfusion. in addition, reports are now appearing of neonates undergoing the repair of complicated congenital cardiac defects using aucb to prime the extracorporeal circuit. myocardial damage produces a loss of myocytes and can result in progressive chamber thinning and dilation. medical and surgical therapies attempt to reperfuse potentially viable myocardium, pharmacologically or mechanically augment cardiac output or replace the heart. none of these treatments are aimed at regenerating the myocyte and other structural cardiac components. on the heels of major successes in allogeneic stem cell transplantation (alsct) and more recently related and unrelated umbilical cord blood transplantation (ucbt) for numerous malignant and nonmalignant diseases, many researchers and clinicians see great hope for application in regenerative therapy. an animal model provided the initial evidence that cardiac structure and contractility could be improved with cell transplantation. fetal cardiomyocytes transplanted into rat hearts following cryoinjury improved systolic function and limited scar progression. follow - up studies reported similar results in animal models after transplantation of cardiomyocytes, skeletal myoblasts, smooth muscle cells, and c - kit - positive bone marrow stem cells [19, 20 ]. it appeared that replacement of the functional myocyte unit in injured myocardium would become a clinical reality. early human studies demonstrated the feasibility of cell transplantation (skeletal myoblasts) into patients with ischemic heart failure. outcomes in these small studies were variable, and risks seemed to be centered around and increased incidence of postoperative arrhythmias. the multicenter magic (myoblast autologous grafting in ischemic cardiomyopathy) trial was then undertaken in europe. inclusion criteria were severe left ventricular dysfunction, postinfarction scar, and concomitant coronary artery bypass grafting (cabg). thigh myoblasts were injected into and on the borders of the scar following bypass grafting. there was no improvement, at the 6-month study point, in left ventricular (lv) function ; however, a significant decrease in lv end - diastolic and systolic volumes were observed. highly variable results were also obtained when investigators utilized bone marrow - derived cells during cabg [24, 25 ]. a reexamination of the animal and human data showed that only a small percentage (1%) of transplanted cells remain engrafted at the original site a few weeks following administration. cell loses occur due to wash out during application and death of cells initially residing in this ischemic environment. thus, the original hope of repopulating injured areas of myocardium with myocytes recreating functional contractile units has yet to be realized. despite this disappointment currently, studies are underway to define possible paracrine effects (inducing angiogenesis, restoring and stabilizing the extracellular matrix, and limiting apoptosis) caused by the small mass of surviving cells that may limit maladaptive cardiac remodeling [2729 ]. heart defects are the most common congenital affliction and occur in approximately 14 out of 1000 live births [1, 30 ]. the various structural lesions can result in profound physiologic perturbations as a result of pulmonary over circulation, cyanosis, and pressure or volume overload of the cardiac chambers. as a consequence, congenital heart disease remains the number one cause of death in the first year of life. approximately 25,000 surgical procedures are performed each year in an attempt to correct or palliate these conditions. children with congenital heart defects often require a series of operations in the first few years of life. chronic pressure or volume overload lesions of either the right or left side of the heart ; aortic and pulmonary valve disease, coarctation of the aorta, single ventricle lesions may produce significant myocardial dysfunction resulting in chronic congestive failure. often requiring multiple interventions, they are candidates for cell and tissue therapy to help restore contractile function. multiple conditions may be associated with underdevelopment or absence of the semilunar valves. currently, valve repair is attempted but often culminates in replacement of the aortic or pulmonary valves with bioprosthetic or mechanical prostheses (valves and or valved conduits). although hemodynamically adequate, these valves often fail by calcification and or tissue ingrowth relatively rapidly and have no capacity for growth thus necessitating multiple reoperations, and many require systemic anticoagulation with its attendant risks. a great deal of research is now underway to develop tissue - engineered valves seeded with a patient 's own cells with the potential for growth and lack of immunogenicity. combining the techniques of cell harvesting, cell augmentation, and tissue - engineering the hope is to bank suitable stem cells and grow them into useable valve substitutes. scaffolds made of decellularized xenografts or tissue engineered biodegradable matrices have been designed to replace traditional valve supports. autologous or donated umbilical cord blood could serve as an ideal source of donor cells. patients born with univentricular hearts (tricuspid and or pulmonary atresia as well as hypoplastic left heart syndrome) require multiple operative procedures utilizing prosthetic shunts culminating in a fontan procedure. often a circumferential prosthetic tube is placed to channel the deoxygenated blood from the abdomen and lower extremities directly into the lungs, thereby bypassing the missing pulmonary ventricle. similarly, patches or baffles of artificial material (dacron, ptfe) are used on a daily basis in pediatric cardiac surgery to connect or reroute blood flow within the heart. these conduits and patches have no growth potential, carry a risk of thrombosis as well as infection, and may require systemic anticoagulation. tissue - engineered vascular grafts, seeded with autologous endothelial stem cells, could produce the optimal vascular graft with the ability to keep pace with somatic growth, eliminate the need for reoperation, and greatly reduce the risk of postoperative thrombosis and infection. following successful animal studies, tissue - engineered vascular grafts (tevgs) were implanted in humans undergoing total cavopulmonary connections demonstrating the feasibility of this technique. the number of adults living with congenital heart disease now outnumbers children afflicted with these conditions. many of these patients were operated upon in an earlier era when medical and surgical techniques were not as well refined. for example, repairs of tetralogy of fallot were routinely performed at an older age through large right ventricular incisions and employing long transannular patches with long cardiopulmonary bypass times and suboptimal myocardial protection. as a result, they often exhibit severe right ventricular dilation and fibrosis. in addition as this patient population ages and their comorbidities increase (obesity, diabetes mellitus, etc.) they may develop left ventricular dysfunction as well as a consequence of epicardial coronary artery disease. given the existing shortage of hearts for cardiac replacement and the uncertainties of ventricular device support in this population, restoration of their ventricular function with cell - based therapies could have significant impact on the lives of many. umbilical cord blood is a relatively easily obtainable source of multiple populations of pluripotent cells seemingly less hampered by mutations and immunogenicity. when harvested it provides a readily available, lifelong source of cells for therapy. it is rapidly becoming the standard of care for use in hematologic and oncologic disorders. although the volume and numbers of particular cells may be limited in any one sample, transplantation of multiple units from different donors may be required and has been accomplished with good results [3739 ], and recent strides in stem cell expansion and transduction should augment supplies. the fields of cell transplantation, tissue engineering, and regenerative medicine are poised to impact heart disease in a similar way to that seen in oncohematologic disorders and inborn errors of metabolism. despite the genetic, biological, and engineering complexities involved, restoration of ventricular function and the development of living and growing vascular grafts and valves is becoming a reality. umbilical cord blood will certainly play a central role in seeding these accomplishments. | despite advances in the fields of prevention, medical intervention and surgical therapy, cardiovascular disease remains a major public healthcare issue. a promising area of research is the potential application of regenerative therapies with pluripotential stem cells to reduce the burden of heart disease and its sequelae. umbilical cord blood, a rich source of multiple populations of nonembryonic stem cells, will be a valuable resource and has the potential to advance therapeutic options for patients with acquired and congenital heart disease. |
narcotics have been used since long as a component of balanced anaesthesia, thus minimizing the anaesthetic requirement both during induction and maintenance as well as attenuating the pressor response during laryngoscopy and intubation. equally significant is their role in provision of smoother recovery period by minimizing postoperative pain. other than pain, the factors like postoperative nausea and vomiting (ponv), shivering, sedation and respiratory depression are equally important in recovery from the effects of anaesthetic drugs. the present study aimed at comparing the postoperative recovery characterstics of fentanyl and butorphanol in patients undergoing open cholecystectomy under general anaesthesia. the present study configured one hundred adults patients of american society of anaesthesiologists (asa) grade 1 or 2 of either sex scheduled to undergo elective open cholecystectomy and were randomly assigned to receive fentanyl (group f ; n = 50) or butorphanol (group b ; n = 50). both group were premedicated with midazolam 0.04 mg / kg intravenously followed by injection fentanyl 2 mcg / kg or butorphanol 40 mcg / kg. standard induction was done with propofol 2 mg / kg and vecuronium 0.1 mg / kg was used for intubation. postoperatively analgesia, sedation, ponv, shivering, respiratory depression and recovery score were observed. the recovery time was less in group f (p > 0.05) while post operative analgesia (p 0.05) was more in group b. the incidence of respiratory depression was more in group b (p > 0.05). it is concluded that besides easy availability and lower cost, butorphanol decreased propofol consumption intraoperatively and provided better analgesia and prophylaxis against shivering in postoperative period. the introduction of thiopental sodium into clinical practice by waters and lundy in 1934 marked the advent of modern intravenous anaesthesia. the ideal intravenous anaesthetic drug would provide hypnosis, amnesia and analgesia. because no single drug is ideal, it is a common practice among anaesthesiologists to include a small dose of narcotic analgesic as part of anaesthetic technique. these narcotic agents in addition to providing analgesia also minimizes the requirement for potent anaesthetic agent during induction and maintenance of anaesthesia. narcotics have also been used for attenuation of pressor response during laryngoscopy and intubation and are believed to provide a comfortable recovery from anaesthesia. ideally the recovery should be smooth and gradual and free from pain, postoperative nausea and vomiting (ponv), shivering, deep sedation or respiratory depression and should enable a shorter stay in recovery room. in addition, there should not be any major complications related to airway or cardiovascular system during recovery. delayed recovery not only leads to increased morbidity but also is a potential financial burden both on the hospital as well as the patient. each drug has got its own advantages and disadvantages depending on its pharmacokinetics and pharmacodynamic properties. though there are numerous studies which have compared different opioids, only a few studies have been carried out to compare the recovery characterstics of fentanyl and butorphanol. in the present study, we have compared the recovery characterstics of above mentioned drugs when used in combination with propofol. after the approval of hospital 's ethical committee and written informed consent from the patients, a prospective, randomized, double blind study was carried out among hundred american society of anaesthesiologists (asa) grade 1 and 2 adult patients undergoing elective cholecystectomy. patients with history of hypertension, coronary artery disease, hepatic, renal and endocrine disorders and patients on psychoactive drugs or with history of narcotic abuse and allergy to the trial drug or its constituents were excluded from the study. in the operation theatre standard monitors including electrocardiogram (ecg), non - invasive blood pressure (nibp) and pulse oximetry were applied and baseline parameters recorded. after securing intravenous access patients were preloaded with 15 ml / kg of normal saline. the study drugs were prepared by an anaesthesia - technician either as 25 mcg / ml of fentanyl or 500 mcg / ml of butorphanol. injection midazolam 0.04 mg / kg (maximum dose of 3 mg) was given as iv premedication followed by the study drug i.e., either 2 mcg / kg of fentanyl or 40 mcg / kg of butorphanol. induction of anaesthesia was achieved with propofol 2 mg / kg and vecuronium 0.1 mg / kg was used to facilitate tracheal intubation. subsequently, anesthesia was maintained with propofol infusion of 100 mcg / kg / min, and 67% nitrous oxide in oxygen and supplementary doses of vecuronium. additional boluses of propofol 20 - 30 mg were given as and when required judged by light anaesthesia plane, notably a 25% increase in mean arterial pressure or heart rate above base line values, any muscle movement, sweating or lacrimation. intraoperatively, any untoward incident requiring emergency intervention was recorded and treated symptomatically. at the end of operation, neuromuscular blockade was reversed using neostigmine 0.05 mg / kg and glycopyrrolate 0.01 mg / kg and extubation was done when the patients got fully awake. postoperatively, pulse rate and blood pressure was measured every 15 min for first hour and then half hourly for next three hours. patients were also observed every 15 min for respiratory depression (respiratory rate 0.05).,) which was measured from the time nitrous - oxide was stopped, was less in group f. mean recovery time was lower (11 3 min) in group f as compared to group b (12.5 3 min). in post anaesthesia care unit (pacu) we assessed recovery by using steward scoring system. patients attained maximum steward score of six earlier in group f as compared to group b but the difference was not statistically significant (p > 0.05). three patients in the group b and one patient in group f showed delayed recovery [table 3 ]. number of patients showing maximum steward score of 6/6 at various time intervals significant pain was experienced by 56% of patients in group f while only 14% patients in group b required rescue analgesic on shifting to recovery room. all patients in group f required rescue analgesic within 30 minutes of shifting to recovery room while in group b 54% patients were pain free after 30 minutes of stay in recovery room. the mean respiratory rate was lower in group b as compared to the fentanyl group upto 3 hours postoperatively. however, there was no incidence of respiratory depression in any patient from either group (respiratory rate < 8 breaths / minute). postoperatively, hypoxemia (spo2 < 92% on room air) occurred in 6% patients while no such episode occurred in fentanyl group. incidence of nausea and vomiting was also comparable in both the groups with slightly lower incidence in patients who were administered butorphanol. of the 18% patients in group f while 12% patients in group b had ponv. postoperative sedation as assessed by ramsay sedation score was higher in group b. two patients had ramsay grade edation and 1 patient had grade 5 sedation, 1 patient in group f had grade 4 sedation 30 minutes after shifting to recovery room. incidence of postoperative shivering requiring treatment with injection pethidine was higher in group f (18%) as compared to group b (4%) which was significant on statistical comparison (p < 0.05) [table 4 ]. a smooth recovery in the postoperative period is the most desired thing by any anaesthesiologist. however it can become very unpleasant in the presence of postoperative pain, nausea and vomiting, shivering, excessive sedation and respiratory depression. these side effects not only cause delay in recovery with prolonged pacu stay but can also be a potential psychological and emotional setback to the patients and the relatives. based on the background of these facts, the present study was carried out with an emphasis on comparing the recovery characterstics of fentanyl and butorphanol. the pharmacodynamic properties of a particular opioid depends on the type of receptor to which it is bound, its binding affinity and whether the receptor is activated. it is a kappa receptor agonist as well as mu receptor antagonist, while fentanyl is primarily a mu receptor agonist. equipotent doses of butorphanol, morphine, pethidine and pentazocine produces same duration of analgesia. fentanyl a pure agonist can be given through intramuscular, intravenous, transdermal or buccal route. fentanyl in different doses can be used to provide analgesia, as component of balanced anaesthesia or surgical anaesthesia in very high doses. patients in group f had shorter recovery time as compared to group b but this difference was not statistically significant. all patients in both the groups attained steward score of 6 after sixty minutes of shifting to recovery room. six percent patients in group b and 2% patients in group f showed delayed recovery. similar findings had been reported earlier in which no difference in recovery is seen with either butorphanol or fentanyl. all these patients in group b were elderly females and prolongation of drug effect could be both due to phamacodynamics as well as pharmacokinetic mechanism, while delayed recovery with fentanyl can be explained only by increased individual sensitivity to the opioids. in the present study complaint of pain was significantly less in group b as compared to group f. it has been demonstrated earlier that administering a small dose of fentanyl (100 mcg) at the time of induction failed to provide effective postoperative analgesia in patients undergoing ambulatory gynaecologic laparoscopy. similar observations were made in another study in which author noted significant postoperative pain in 40% patients receiving fentanyl and in only 17% patients in the butorphanol group (p < 0.05). in addition to relatively uncommon postoperative respiratory complication of airway obstruction and aspiration, hypoxemia can occur in postoperative period. in this study 3 cases of post operative hypoxemia were seen in group b. in the earlier studies no episode of hypoxemia or respiratory depression was seen in any of the patients in two groups. butorphanol clearance is decreased in geriatric patients resulting in prolonged elimination - half life and this could be the reason for postoperative hypoxemia. ponv not only lead to patient discomfort but rarely can cause pulmonary aspiration when patients are recovering from the effects of anaesthetic drugs. the incidence of nausea and vomting in our study is much less copared to earlier studies which reported an incidence up to 61% with fentanyl in outpatient laproscopic procedures. the lower incidence of ponv in our study could be attributed to antiemetic effect of propofol which we have used both for induction as well as maintenance of anaesthesia. propofol was used in the present study both for induction and maintenance as compared to thiopentone and isoflurane used by the authors in previous study. post anaesthesia shivering is another complication which can occur in 5 - 65% of patients in recovery period depending on age, sex, anaesthetic agent used for induction and maintenance of anaesthesia and duration of surgery. shivering not only causes physical discomfort but also causes precipitous rise in oxygen consumption which may be poorly tolerated by a patient with diminished cardiorespiratory reserve. in the present study incidence of shivering was significantly less in group b. in fact butorphanol has been used previously for its antishivering properties as an alternative to pethidine. based on observations made in the present study it can be concluded that use of butorphanol is associated with less anaesthetic (propofol) consumption, better post operative analgesia with a better protection against post operative shivering. the only major drawback with butorphanol was postoperative hypoxemia and sedation in geriatric patients. | background and aim : narcotics have been used since long as a component of balanced anaesthesia, thus minimizing the anaesthetic requirement both during induction and maintenance as well as attenuating the pressor response during laryngoscopy and intubation. equally significant is their role in provision of smoother recovery period by minimizing postoperative pain. other than pain, the factors like postoperative nausea and vomiting (ponv), shivering, sedation and respiratory depression are equally important in recovery from the effects of anaesthetic drugs. the present study aimed at comparing the postoperative recovery characterstics of fentanyl and butorphanol in patients undergoing open cholecystectomy under general anaesthesia.materials and methods : the present study configured one hundred adults patients of american society of anaesthesiologists (asa) grade 1 or 2 of either sex scheduled to undergo elective open cholecystectomy and were randomly assigned to receive fentanyl (group f ; n = 50) or butorphanol (group b ; n = 50). both group were premedicated with midazolam 0.04 mg / kg intravenously followed by injection fentanyl 2 mcg / kg or butorphanol 40 mcg / kg. standard induction was done with propofol 2 mg / kg and vecuronium 0.1 mg / kg was used for intubation. anaesthesia was maintained with propofol infusion and 67% nitrous oxide in oxygen. intraoperative hemodynamic parameters were observed and recorded. postoperatively analgesia, sedation, ponv, shivering, respiratory depression and recovery score were observed.results:the recovery time was less in group f (p > 0.05) while post operative analgesia (p 0.05) was more in group b. the incidence of respiratory depression was more in group b (p > 0.05). ponv was comparable in both the groups. postoperative shivering was significantly low in group b (p < 0.05).conclusion : it is concluded that besides easy availability and lower cost, butorphanol decreased propofol consumption intraoperatively and provided better analgesia and prophylaxis against shivering in postoperative period. |
pain is a highly complex, dynamic, subjective experience that is useful in growing children, serving to warn them of danger and limiting exposure to additional injury. however, untreated, acute, or recurrent or chronic pain may have significant and lifelong consequences (both physiologically and psychologically). since pain is an inherently subjective phenomenon, it is often said that the gold standard for pain assessment in both children and adults is verbal reporting [13 ]. it is the only way to determine the intensity and quality of the pain present. however, reliable description in children especially in intellectually disabled (i d) children is very difficult. children with intellectual disability have an added challenge of not being able to express the pain or verbalize it. hence, to gather pain relevant information, caregivers were interviewed regarding their children for expression of pain, experience, treatment, and coping behavior. research shows that children with developmental disabilities generally experience more pain than the normal children due to chronic systemic conditions associated with their disability [46 ]. many children have idiosyncratic behaviors such as moaning / grunting which may lead to over / underestimation of pain. the aim of the study was to evaluate the dental pain in children with intellectual disabilities from a caregiver 's perspective. the study was initiated after obtaining clearance from the institutional ethics committee, chettinad health city. they were residing at vasantham institution for intellectually disabled children, mogappair, chennai, tamil nadu, india. all the children in the control group were of normal intellectual growth as determined by their academic evaluations. age group ranged from 5 to 18 years.the study group has a history of intellectual disability as verified by the child 's medical file or caregivers reporting.caregivers were able to understand spoken english / tamil.the control group included children who had normal intellectual development. the study group has a history of intellectual disability as verified by the child 's medical file or caregivers reporting. the nature of the study was explained and the investigators assisted them in filling the questionnaire. to assess the change in behavior in intellectually disabled children during tooth ache, a dental discomfort questionnaire (ddq+) was developed. the questionnaire was drafted after extensive interviews with parents or caregivers of children with pain by versloot. a lot of questions relating to the behavior of intellectually disabled children were added to the ddq+. the questionnaire was filled during the interviews by the caregivers with the help of the investigators. the questions were tabulated and the caregivers had to select the most appropriate option that explained the occurrence of pain / discomfort in children. (scored as one), and always (scored as two). a total numeric mean for each child and a mean of the ddq+ for the group caregivers and investigators were also asked to rate the child 's dental pain on a ten point scale where zero represented the absence of pain and ten the maximum pain imaginable. the scale was converted to an ordinal scale with never, mild, moderate, and severe categories. mild pain was when the rating was between 1 and 3, moderate was between 4 and 7, and severe pain was between 8 and 10. the caries examination was based on the who criteria according to which the dmft / dft (decayed, missing, and filled teeth) indices were scored. a frank cavitation which is a break of 0.5 mm or more into enamel any teeth filled with any restoration except sealants were considered as filled teeth. student 's t - test, degree of freedom, mean and standard deviation, and chi - square test were analyzed. the sample investigated in this study was a total of 236 children, out of which 111 were intellectually disabled children and 125 were healthy children. the dmft and dft scores of the sample investigated were tabulated (table 1). the difference in the number of filled teeth between the study and control group was negligible. the investigators put forward questions describing the specific behavioral pattern of the children experiencing dental pain. these questions were presented to the caregivers in order to find out the perception of dental pain between the control and study group and whether it was comparable. the behavioral pattern which was specifically exhibited by the children during dental pain was documented as per the caregiver 's perception. outcome of the tabulation in this study showed that i d children had problems in brushing teeth especially the upper teeth and it was statistically significant (p = 0.00). the other significant change during pain included biting with the molar instead of the other teeth (p = 0.001). most of the i d children reached for the cheek region while eating, a behavioral change depicting vague dental pain which they were unable to express otherwise. typically developing children reported ear pain at night (p = 0.014), during daytime (p = 0.02), and a few while eating (p = 0.01). in the entire study, excessive salivation in i d children during dental pain (p = 0.00) was one of the most important behavioral changes observed by the caregivers. adding to this, the other significant behavioral change was the habit of placing their hand or objects inside the mouth (p = 0.00) (table 2). according to the international association for study of pain (iasp), pain is defined as an unpleasant sensory and emotional experience associated with actual or partial tissue damage. a reliable description of such pain is generally difficult in children and even more challenging in i d children. intellectual disability is defined as mental retardation or impairment in the areas of development or cognitive activities. intellectual disability is a disability characterized by significant limitations both in intellectual functioning and in adaptive behavior, which covers many everyday social and practical skills. dental problems are more common in people with special needs, sometimes not only because of the disability itself but also because of inadequate oral health care. these special children required special health care approaches as they had very poor oral hygiene. according to research and the literature, these children had physical, mental, sensory, behavioral, cognitive, emotional, and chronic medical conditions which required health care beyond the usual measures and which involved specialized knowledge, increased awareness, attention, and accommodation. information about pain in children with cognitive impairment was always insufficient and less reliable for a dentist [1113 ]. to gather any data related to pain the investigators or health care provider had to rely on the caregiver 's perception depending on the level of cognitive impairment, and pain coping and expression varied in these special children. the identification and interpretation of dental pain in severe cognitive communication and motor impairments were challenging. we concluded that there is a high incidence of dental pain and treatment needs that are not catered to. in spite of parents and caregiver 's educational qualifications, dental pain is rarely understood and treated ; this was due to the other major chronic systemic illnesses the children undergo. hence, dental pain in children goes unnoticed often and they are not brought to the dentist for routine checkup. mostly caregivers identify dental pain based on the i d children change in behavior and bring it to the notice of the healthcare provider. hence, mostly i d children reach the dentist in an acute state of pain leaving very few options to save the teeth. the data outcome of this study indicates that i d children have problem in brushing upper and lower teeth. this was because of fear and anxiety amongst intellectually disabled children in placing a foreign object into their mouth. children should be trained patiently to overcome these problems which require a dentist 's and a caregiver 's cooperation. reaching for cheek while eating and earache at night or during meals were also common behavioral changes during dental pain. the caregivers should understand these signs and bring the children to the dentist immediately because the pain expressed in such manner is mostly of acute nature. most of the i d children had excessive salivation and the habit of placing their hand or objects inside the mouth during dental pain. according to researches, an increase in dental caries causes more dental pain which leads to these pain related behavior. so caregivers and dentists have to work mutually to recognize specific changes in behavioral pattern. though this study was done based on research articles specializing on pediatric dentistry and cognitive impairment in children, it still had a number of limitations which include lack of professional assessment of i d children. future studies including the comparison between different degrees of intellectual disability could further provide more specific conclusions. intellectually disabled children had more problems in brushing upper teeth and exhibited the habit of reaching for the cheek while eating. the prevalence of reporting dental pain was more in typically developing children than in intellectually disabled children. | aim. children with developmental disabilities generally experience more pain than the normal children. description of pain is generally difficult in children and more so in children with intellectual disabilities. the study aimed at evaluating dental pain in children with intellectual disabilities. methods. the survey was carried out in an institution caring for intellectually disabled children to determine the oral health status and the treatment needs of the special kids. 236 children were surveyed out of which the test group is comprised of 111 intellectually disabled children and the control group had 125 normal children with age ranging between five to eighteen years. a questionnaire was presented to the caregivers to elaborate about dental pain in their wards using the dental discomfort questionnaire (ddq+). the children were examined for dental caries and periodontal status based on the who indices for oral hygiene status. result. results revealed a statistically significant difference between intellectual disability and brushing, chewing, and earache. the frequency of reporting dental pain was lesser in the intellectually disabled group. conclusion. children with intellectual disability tended to report dental pain of any nature with lesser frequency than typically developing peers. they also faced greater difficulty in brushing and chewing. |
microbes are the biggest reservoir of biodiversity in natural forests and are involved in nutrient transformations thereby maintaining the forest ecosystem. there are many natural forest types present in the north eastern region of india and many are still far from human understanding and any kind of anthropogenic interference. murlen national park is an undisturbed natural forest falling within the indo - burman biodiversity hotspot zone. this region contains diverse ecological niches with leading hotspots in terms of endemics and provides unique niches for the evolution of novel microorganisms although this ecologically important region has been poorly explored in terms of soil microflora. the ecology and functional role of most of the microbes are unknown due to their cultural constrains. a recent advance in molecular microbial ecology has provided means to identify microbial life in many ecosystems without the need to culture the microorganisms through a metagenomic approach,. next - generation sequencing technology has been successfully applied to study bacterial diversity in different environments such as bat guano, hot spring, lake, cave sediments, etc. n, 88 36 44.860 e) in a sealed sterile container and the metagenomic dna was extracted separately using mp - biomedical soil kit and finally mixed to prepare a composite sample. v4 region of bacterial 16s rrna gene was amplified by pcr according to de mandal.. sequencing was performed on illumina miseq platform and the analysis was carried out by qiime data analysis package,. metagenome consisted of 151.81 mb data consisting of 302,416 reads with a g + c content of 56.48%. more than 85% of the sequence had a phred score > = q30 and individual sequence length was 251 bp (supplementary table 1). a total of 29 phyla were detected in our analysis and the dominant phyla were acidobacteria (39.45%) followed by proteobacteria (26.95%), planctomycetes (7.81%), actinobacteria (7.18%), bacteroidetes (6.65%), chloroflexi (4.11%) and nitrospirae (3.33%). however the analysis identified 100 bacterial orders dominated by iii115 (23.94%), rhizobiales (13.97%), actinomycetales (5.83%), solibacterales (5.06%), burkholderiales (4.83%), saprospirales (4.61%), nitrospirales (3.33%), gemmatales (3.40%), ellin6513 (2.94%), thermogemmatisporales (2.74%) and acidobacteriales (2.55%). a total of 138 genus were detected and the most dominating among them were da101 (7.02%), followed by gemmata (1.03%), candidatus xiphinematobacter (1.02%), and rhodoplanes (0.92%). however, 84.44% reads were not identified at the genus level which suggested that the uniqueness and unidentified bacterial community structure might lead to reveal novel bacterial populations with some unique properties (supplementary fig. our study, which is the first to study bacterial communities using high - throughput methods in murlen national forest soil, a pristine reserve forest, revealed the presence of diverse bacterial population. this will be helpful in cataloging and describing the bacteria diversity of the forests of mizoram that needs to be conserved and simultaneously could be the habitat for large number of economically important microbes. 1.bacterial community structure from phylum to species level of murlen national park metagenome can be visualized in this file using krona visualization tool.supplementary table 1..bacterial community structure from phylum to species level of murlen national park metagenome can be visualized in this file using krona visualization tool.. | paired end illumina mi - seq sequencing of 16s rrna gene amplicon was carried out to study the bacterial community in the soil of murlen national park located in indo - burman biodiversity hotspot region. metagenome consisted of 302,416 reads with 151.81 mb data and g + c content of 56.48%. more than 85% sequence was having a phred score > = q30 and individual sequence length was 251 bp. metagenome sequence data are available at ncbi under the bioproject database with accession no. srp057136. community metagenomics revealed a total of 1802 species belonging to 29 different phyla dominated by acidobacteria (39.45%), proteobacteria (26.95%) and planctomycetes (7.81%). our data detected a wide group of bacterial community which will be useful in further isolating and characterizing the economic importance of bacteria from this region. |
giant serpentine aneurysm was described in 1977 by segel and mclaurin14) as a subcategory of giant aneurysms, distinct from the saccular variety. patients with a large or giant aneurysm of the internal carotid artery (ica) located in the paraclinoid area often present with cranial nerve symptoms. cavernous ica aneurysms can have a mass effect on the oculomotor, trochlear, or abducens nerve, resulting in internal or external ophthalmoplegia. it is most likely associated with carotid ophthalmic or hypophyseal aneurysms, but rarely occurs with a cavernous ica aneurysm. we report a patient with a serpentine cavernous ica aneurysm who presented with visual symptoms that progressively improved after endovascular coil trapping. a 44-year - old woman presented with decreased right visual acuity of 1-month duration. two weeks previously, she had complained of dry eye and was diagnosed with optic neuritis at a private clinic. the examination showed a decrease in her right visual acuity to 0.04 compared to 1.0 on the left side. the right visual field showed a 3/4 defect involving all but the right lateral upper quadrant. on magnetic resonance imaging (mri) of the brain, a large aneurysm, 19 12 mm in size, well marginated, and oval - shaped, with a heterogeneous signal void was seen in the right parasellar region, probably in the cavernous sinus (fig. computed tomography angiography (cta) showed fusiform dilatation of the right cavernous ica, suggestive of a fusiform aneurysm with an approximate size of 30 20 mm (fig. fundus photography showed right optic nerve atrophy with a pale neural rim on the right optic disc (fig. the findings on transfemoral catheter angiography (tfca) were similar to those obtained with mri and cta. 4a), followed by observation of the collateral flow during temporary occlusion of the parent artery. after 20 min, the collateral flow was deemed tolerable. the patient was then evaluated by single - photon emission computed tomography (spect). because the results showed well - maintained vascular reserve (fig. 4b), we chose to perform coil embolization of the large serpentine aneurysm with occlusion of the parent artery (fig. postoperatively, the patient had no obvious neurological deficits. a second round of mri and spect 24 h after the embolization showed no abnormalities. nine months after coil embolization, the patient 's visual field and visual acuity had improved considerably (table 1, fig. radiologically these aneurysms may be serpentine, whereas macroscopically they may be referred to as large fusiform aneurysms, and pathologically as dissecting, atherosclerotic, or dysplastic. this confusion about the exact nature of the aneurysm can be resolved by considering the natural history, clinical presentation, and treatment rationale. patients with dissecting intracranial aneurysms typically present with subarachnoid hemorrhage and have a high incidence of early rebleeding.12) however, patients with large fusiform lesions present with a progressive mass effect and are at less risk of suffering hemorrhage.1)16) the imaging features of large serpentine aneurysms are also characteristic.1)11) computed tomography shows an extra - axial mass originating from the artery with intramural thrombosis. magnetic resonance imaging shows a heterogeneous oval mass, indicative of thrombi of different ages, and a " flow - void " lesion with an enhanced rim. there are several reports of surgical (hunterian) ligation, trapping, resection, and thrombectomy with and without vascular bypass.2)4)8)14)16) surgical removal alone is a direct, attractive treatment. several therapeutic options have been reported.1)3)9)13)14) however, the perioperative morbidity and mortality are 30 - 35%. one reason is the difficulty preserving the surrounding vessels during surgical dissection and excluding the aneurysm from the normal cerebral vasculature. in addition, the functionally distal areas of the brain are supplied by the channel within the serpentine aneurysm. therefore, the goal of surgical treatment is the elimination of the blood flow to the aneurysm and maintenance of the blood flow to the distal cerebral territory. first, the surgical dissection to expose the aneurysm may require aggressive retraction, resulting in brain injury. second, adjacent important neurovascular structures can be compressed by the aneurysm and may adhere tightly to its surface. third, the neck of a serpentine aneurysm can be difficult to identify in the surgical field. some large serpentine aneurysms have been managed successfully using endovascular procedures intended to induce thrombosis and shrinkage of the mass.1) this is an indirect treatment strategy compared with surgical removal, but it has several advantages. an endovascular treatment does not require extensive retraction that can cause injury of the normal cerebral tissue due to microsurgical dissection. furthermore, an endovascular treatment can be used to obtain clear angiographic images to visualize the serpentine vascular channels on the aneurysm surface. clinical improvement following endovascular occlusion of an aneurysm causing a mass effect has been reported in > 75% of cases.5)6)7)10)11) a dramatic decrease in aneurysm size is a common finding on mri after successful endovascular occlusion.15)17) one report suggested that occlusion of the parent artery is more effective at decreasing the volume and relieving the mass effect than is endosaccular occlusion,17) which may result in the accumulation of embolic material in the aneurysm, thereby limiting shrinkage of the aneurysm. nevertheless, endosaccular obliteration has been effective in reducing the mass effect.10) it has the advantage of preserving the normal brain and vascular structures., we did not clearly differentiate whether the pathogenesis of the visual disturbance involved embolism from the aneurysm itself or pulsatile compression by the aneurysm sac. however, our patient with a serpentine aneurysm presenting as a visual disturbance was treated by endovascular trapping. this was a better therapeutic choice than proximal occlusion because trapping can block both anterograde and retrograde flow, potentially reducing intra - aneurysmal pressure and promoting thrombogenesis. careful studies were performed before trapping, using cross - compression and balloon occlusion to evaluate the cerebral hemodynamics. however, in patients with poor collateral flow, extracranial - intracranial bypass surgery should be considered. nonetheless, even in those cases, endovascular trapping is a useful option, particularly when performed in combination with bypass surgery. we described the case of a patient with a large serpentine aneurysm who presented with visual disturbances. this patient was treated successfully with coil embolization after careful studies of the intracranial hemodynamics. | this report describes a case of a serpentine fusiform aneurysm of the internal carotid artery in a patient who presented with visual disturbances. the serpentine aneurysm was treated successfully by coil trapping and occlusion of the parent artery, accompanied by balloon dilation. nine months post - operatively, the patient 's visual acuity had improved considerably. |
there are many advantages of using a gene - based approach to track cellular and molecular activity with a noninvasive imaging platform like magnetic resonance imaging (mri). gene - based contrast provides longevity of the signal throughout the cell s life cycle. this approach also enables tracking of inherent biological activity and detection of the onset of cellular changes using reporter gene expression. with such a tool, the activity of choice can be monitored by programing the magnetic resonance (mr) contrast signal using genetic engineering. nevertheless, as with most emerging molecular imaging technologies, there are also a number of challenges to overcome. despite the superb anatomical resolution of mri, this dilution factor is compounded by the magnitude of the molecular signal from gene - based iron labeling, which is much lower than traditional exogenous contrast agents like dextran - coated superparamagnetic iron oxide (spio) nanoparticles. there remains a need for development of more sensitive and/or signal - specific mr detection methods, software, and hardware. as molecular mri pushes forward, we anticipate improvements on all levels and particularly with respect to the incorporation of magnetosome genes to optimize formation of an mr detectable iron biomineral in mammalian cells.14 in addition, we expect the conversation will shift to include recognition of the interplay between cellular iron homeostasis and the addition of genetically engineered iron contrast. by permitting the cell to generate its own iron nanoparticles, we are also allowing the cell to dispose this iron in a biologically compatible manner and we are asking the animal subject to handle the iron load in a physiologically acceptable manner. we therefore hypothesize (a) that molecular imaging using gene - based iron contrast will be influenced by intrinsic iron regulatory mechanisms and (b) that these iron - handling processes may be used to modulate and interpret mr images. herein, we examine general features of mammalian iron regulation and the components of transverse relaxation that respond to cellular iron, with particular reference to the potential of magnetotactic bacterial gene expression as an mr contrast agent. studies using maga as a prototype for magneto - some - like particle formation in mammalian cells indicate that expression of select iron - handling protein from magnetotactic bacteria imparts magnetic properties compatible with, but not subject to, iron homeostasis in the host cell.5,6 by considering the interplay between dynamic iron regulation and gene - based image contrast, we highlight features of iron metabolism that may impinge on the mr signal and be used to understand and manipulate gene - based mri contrast. the expression of maga, a magnetotactic bacterial protein and putative iron transporter,7 has been assessed in several mammalian cell types and consistently provides an increase in total cellular iron in response to an extracellular iron supplement.5,6,811 while there are differences in iron handling among the parental cell types,5,10 maga - derived mr contrast is nevertheless detectable and quantifiable, as measured by the transverse relaxation rates. thus, maga serves as a prototype for the expression of magnetotactic bacterial genes in mammalian cells, including magnetosome genes, to impart magnetic characteristics by increasing cellular iron content without causing cytotoxicity.8,9,11 the presence of iron particles within tissue creates strong local magnetic fields, which are nonuniform over small distance scales (~ few m). the wide distribution of local magnetic field strengths experienced by water protons results in signal decay through magnetization dephasing over this distance scale. this dephasing can potentially lead to signal loss on both gradient echo and spin echo images. signal decay as a function of echo time on gradient echo sequences represents the total transverse relaxation rate (r2), whereas the corresponding rate for spin echo sequences (r2) is known as the irreversible part of r2, ie, the part of r2 that is not reversed by a refocusing pulse. these decay rates typically increase with the strength of the main static magnetic field12,13 because of increased polarization of the iron particles at high fields. a third rate, known as r2, defined as r2 = r2 r2, is also influenced by iron and is thought to be a more specific indicator of microscopic magnetic field inhomogeneities12 compared to r2. figure 1 shows a plot of both r2 and r2 versus total cellular iron content, in the context of gene - based iron labeling using maga expression.14 these measurements were performed at 3 t using methods described in detail elsewhere.6,14 briefly, r2 was measured from a set of single spin echo images (nine te values from 13 to 300 ms) and r2 with a multigradient echo sequence (12 te values from 5 to 80 ms). subtraction of r2 from r2 provided r2. as shown in figure 1, the relative changes in r2 are larger than those in r2. in addition, the lower y - intercept in the plot of r2 compared to that of r2 demonstrates the smaller contribution from noniron sources (eg, the interaction of protons in water with protons in macromolecules). although r2 has the potential to provide more iron - related specificity than r2, accurate measurement of r2 requires that magnetic field variations over macroscopic distance scales are minimal or that image processing methods15 to correct for this variation are applied. the degree of signal reversibility (influence of iron on r2 versus r2) depends, in part, on the distance scale of spatial variation of the local magnetic fields relative to the typical (diffusion - related) displacement of water molecules during the lifetime of the mr signal. typically, larger distance scales correspond to greater reversibility because diffusing water protons experience smaller changes in the microscopic magnetic field, and the limit of very large distance scales corresponds to the so - called static dephasing regime.16 a further interesting feature of iron - containing tissues or cell systems is that the value of r2, measured with multiple spin echo sequences like the carr meiboom gill, increases with increasing interecho time.13,1720 that is, the decay becomes more irreversible as the refocusing pulses are moved further apart, providing more time during each refocusing interval for changes in the local magnetic field experienced by diffusing water protons. recently, this behavior was observed in the context of gene - based iron - labeled expression systems, using the magnetotactic bacterial maga expression system in human mda - mb-435 melanoma cells.21,22 thus far, we have discussed methods of quantifying mri signal changes associated with iron - labeled cells based on the decay rate of the magnitude of the mri signal (ie, relaxometry). a different approach involves assessing the influence of iron on the phase of gradient echo signals. spatial variations in magnetic susceptibility (eg, due to iron or myelin)23 lead to spatial variations in gradient echo signal phase ; hence, this phase distribution depends not only on the magnitude of magnetic susceptibility variations but also on the geometry.24 susceptibility - weighted imaging allows for detection of sources of magnetic susceptibility variation but does not account for the geometry of the distribution.24 quantitative susceptibility mapping25 utilizes somewhat sophisticated postprocessing26 to quantify these phase - related signal changes and to account for the complete spatial distribution of the magnetic susceptibility (ie, geometry). these, and perhaps other, biophysical considerations of the cellular iron contrast signal will ultimately impinge on the accurate in vivo measurement of mri reporter gene expression. since fluctuations in gene expression reflect changes in transcriptional activation, the ideal detection method for mri reporter gene expression should respond to this modulation in a quantitative manner.10 a fuller appreciation of how to manipulate the components of the mr signal to best reflect changes in mri reporter gene expression may include exploitation of the interplay between the irreversible and reversible transverse relaxation rates. with few exceptions, cellular iron regulation has not been critically discussed in the context of iron labeling for mri contrast. however, there are a number of features of mammalian iron homeostasis that should be considered in order to fully appreciate the influence of iron labeling on a given cell type. cell tracking strategies for mri that use either spio (exogenous) or gene - based (endogenous) iron contrast are superimposed on the cell s intrinsic iron - handling properties. at the minimum, there are two levels of iron regulation currently recognized.27 at a systemic level, the hepcidin ferroportin axis regulates iron export and therefore iron recycling (fig. 2). hepcidin is a peptide hormone predominantly synthesized in the liver and secreted in response to increases in circulating iron. hepcidin is the ligand for ferroportin, a transmembrane protein mainly found in the plasma membrane of hepatocytes, enterocytes, and macrophages., hepcidin regulates systemic iron via posttranslational modulation of iron export from cells positioned to regulate the body s iron levels in the blood and gastrointestinal system. at a cellular level, the transferrin this is a widespread form of regulation and serves to meet the cell s large mitochondrial demand for iron cofactor in addition to other cellular reactions.28 this axis is mainly regulated posttranscriptionally by the interaction of iron response proteins (irp ; in the cytoplasm) with iron response elements (ire, hairpin structures found on the 3 or 5 end of mrna encoding select proteins). this protein rna interaction (table 1) either stabilizes the transcript (at the 3 end) to promote translation or sterically impedes the process (at the 5 end). when cellular ferritin stores are low, transferrin receptor (tfrc) expression is upregulated ; conversely, when cellular iron is high (plenty of ferritin), tfrc expression is downregulated. ferroportin transcripts contain ire at the 5 end similar to the ferritin subunits;27 hence, the regulation of systemic and cellular iron homeostasis is linked. restricted expression of ferroportin coupled with its response to extracellular signaling from hepcidin add additional complexity to the regulation of cellular iron. transferrin binds iron and delivers it to the tfrc for internalization and distribution of iron within the cell as required.29 virtually all cells express tfrc at some level. in addition, in vivo mouse models indicate that iron export from cells to blood depends completely on ferroportin.30 thus, the endocrine regulation of ferroportin by hepcidin is central to iron physiology and many disease states. metabolically active cells have a greater requirement for iron cofactor and will typically express higher levels of tfrc to accommodate this need (table 1). ferritin production, on the other hand, will decrease to lower iron storage and facilitate iron availability. in cells over - expressing a modified form of ferritin, in which neither of the two ferritin protein subunits are regulated by irp, both heavy and light subunits lack the ire needed for the normal response to cellular iron homeostasis.31 as a result, the engineered cells can store extra iron, presumably in the form of ferritin. since this mri signal was comparable to the magnetosome - like particles detected using maga expression, our study suggests that iron contrast from magnetotactic bacterial gene expression arises through a mechanism that is distinct from mammalian iron homeostasis.6 moreover, western blot analysis of tfrc levels in each expression system showed appropriate downregulation in response to extracellular iron supplementation, confirming that irp are functional in these genetically modified cells. macrophage are a ferroportin - expressing cell type with the ability to control iron import and export, and thus iron recycling. in the alternatively activated m2 state, macrophages display high tfrc (iron import) and high ferroportin (iron export) activity, and therefore provide effective iron recycling.32,33 however, in response to pro - inflammatory stimuli, which trigger hepcidin expression, macrophages convert to an m1 phenotype represented by low tfrc and low ferroportin expression. under these conditions, iron recycling is limited and cellular ferritin expression is high, contributing to an iron storage phenotype. using this cell line, corna showed that m1 macrophages only import iron when its extracellular concentration is high, while m2 macrophages can import iron even when its extracellular concentration is low, congruent with an increase in tfrc expression. understanding the iron biochemistry of m1 and m2 macrophages takes on clinical importance when the hemorrhage that follows myocardial infarction is considered. there is evidence that failure to clear iron leads to dysregulation of the inflammatory response and increased incidence of heart failure.34,35 in the context of gene - based iron labeling for mri, the literature9,11,31 suggests that most of these engineered cell types will respond to ~200 m iron supplementation in culture to achieve maximal iron loading and mr detection ; however, very few reports have thoroughly examined the intrinsic iron transport characteristics of any given cell type. in human mda - mb-435 melanoma cells, long - term iron - supplemented culture (containing 250 m ferric nitrate) has no appreciable effect on transverse relaxation rates in the absence of maga or modified ferritin overexpression.6 however in p19 cells, a mouse teratocarcinoma, the untransfected parental cell line displays a pronounced, although transient, increase in transverse relaxation rates and cellular iron content in response to iron supplementation.5 further analysis shows that ferroportin expression in p19 is unexpectedly high. the immunoblot in figure 3 was prepared from total cellular protein from p19 and mda - mb-435 samples, wherein lysed cells were solubilized and their protein quantified and electrophoretically separated following published procedures.6,36,37 a ferroportin antibody reveals the bands comprising the full - length iron export protein (fig. 3a, arrow at ~60 k) and its lower molecular weight (mw) degradation products. 3b, band at ~35 k), densitometry indicates that there is ~two to four times more ferroportin (60 k species) in p19 than in mda - mb-435 (genetools, version 3.06.04 ; syngene). the p19 iron recycling phenotype is similar to alternatively activated m2 macrophages, characterized by high levels of both tfrc and ferroportin activity.5,38 moreover, despite the active export of iron, maga - expressing p19 cells display a persistent increase in transverse relaxation rates unlike the transient uptake of iron in the parental line.5 this result suggests that iron handling and/or compartmentalization secondary to magnetotactic bacterial gene expression is distinct from mammalian iron regulatory mechanisms (manuscript in preparation). we also expect that p19 cells might respond to much lower concentrations of iron supplement and note that cho used 25 m ferric citrate for effective iron supplementation of maga - expressing mouse embryonic stem cells.8 given the multipotent properties of p19, we speculate that cells with stem - like features may display effective iron recycling. in conjunction with in vivo repetitive imaging, a dietary iron supplement has been used to optimize the detection of xenografts overexpressing iron - handling proteins like maga and the modified ferritin subunits.39 an iron - rich diet should be expected to increase hepcidin secretion, and thus decrease ferroportin expression. this would lower iron export from targeted cells, favoring iron retention and cellular contrast. however, this could be a problem for the specificity of imaging if cells that naturally handle iron, such as macrophages, infiltrate the tumor xenograft as part of the immune response to foreign cell invasion. the m1 macrophage phenotype may increase tumor contrast and report inflammatory rather than tumor cell activity. this may explain the steady increase in parental tumor contrast observed in subcutaneous melanoma cell xenografts over five weeks of repetitive mri.39 iron deficiency has the reverse effect, decreasing systemic hepcidin secretion to permit a rise in ferroportin activity. iron deficiency or anemia can be induced in several ways, including blood loss, iron chelation, and chronic inflammation. the link between anemia and inflammation involves hepcidin expression, which is transcriptionally regulated by the inflammatory cytokine interleukin 6.40 thus, the chronic inflammation of disease may be important to consider when tracking cells or therapies by mri in preclinical models.41,42 there are further implications for the removal of unwanted iron from cells using inducible ferroportin expression vectors and hepcidin regulation as tools to manipulate the process. in this way, therapeutic cells may be subjected to iron labeling for in vivo tracking with an option to attenuate or reverse the process when it is no longer needed. appreciating that different cell types can have different iron - handling capabilities should add both insight and versatility to gene - based iron labeling. this understanding should also extend to spio labeled cells, in which the mr contrast signal dissipates over time as the cells divide, degrade the spio and dispose of the iron mineral. there are a number of pre / clinical settings where the results and theory presented here can be further investigated. for example, in the case of a heart attack, tissue injury prompts an inflammatory response upon which macrophages act to prevent infection at the site of the wound, remove dead cells, and promote scar tissue formation.43 resident macrophages are likely to be the first responders.44 resting monocytes, from spleen and bone marrow precursors, may also be recruited to the wound. in the acute phase, pro - inflammatory signaling will induce an m1 macrophage phenotype characterized by low tfrc, high ferritin, and low ferroportin. this iron storage phenotype mimics the iron overload disease state and is associated with high hepcidin levels. transition to an anti - inflammatory phase is accompanied by a return to an iron recycling phenotype with high tfrc, low ferritin, and high ferroportin. these m2 macrophages are comparable to an iron deficiency disease state, which is associated with low hepcidin levels. there are many questions that surround the inflammatory response in heart disease and many other illnesses with an inflammatory component. could hepcidin levels be used to monitor the pro - inflammatory response ? to what extent does autocrine regulation of iron metabolism influence the local tissue environment ? could gene - based mri contrast be used to monitor therapy or inflammation - dependent changes in cellular iron using reporter gene expression ? there are multiple opportunities for molecular imaging approaches to exploit gene - based iron labeling in the context of systemic and cellular iron biochemistry. at the minimum, there are two levels of iron regulation currently recognized.27 at a systemic level, the hepcidin ferroportin axis regulates iron export and therefore iron recycling (fig. 2). hepcidin is a peptide hormone predominantly synthesized in the liver and secreted in response to increases in circulating iron. hepcidin is the ligand for ferroportin, a transmembrane protein mainly found in the plasma membrane of hepatocytes, enterocytes, and macrophages., hepcidin regulates systemic iron via posttranslational modulation of iron export from cells positioned to regulate the body s iron levels in the blood and gastrointestinal system. this is a widespread form of regulation and serves to meet the cell s large mitochondrial demand for iron cofactor in addition to other cellular reactions.28 this axis is mainly regulated posttranscriptionally by the interaction of iron response proteins (irp ; in the cytoplasm) with iron response elements (ire, hairpin structures found on the 3 or 5 end of mrna encoding select proteins). this protein rna interaction (table 1) either stabilizes the transcript (at the 3 end) to promote translation or sterically impedes the process (at the 5 end). when cellular ferritin stores are low, transferrin receptor (tfrc) expression is upregulated ; conversely, when cellular iron is high (plenty of ferritin), tfrc expression is downregulated. ferroportin transcripts contain ire at the 5 end similar to the ferritin subunits;27 hence, the regulation of systemic and cellular iron homeostasis is linked. restricted expression of ferroportin coupled with its response to extracellular signaling from hepcidin transferrin binds iron and delivers it to the tfrc for internalization and distribution of iron within the cell as required.29 virtually all cells express tfrc at some level. in contrast, most cells do not export iron and contain very little ferroportin. in addition, in vivo mouse models indicate that iron export from cells to blood depends completely on ferroportin.30 thus, the endocrine regulation of ferroportin by hepcidin is central to iron physiology and many disease states. metabolically active cells have a greater requirement for iron cofactor and will typically express higher levels of tfrc to accommodate this need (table 1). ferritin production, on the other hand, will decrease to lower iron storage and facilitate iron availability. in cells over - expressing a modified form of ferritin, in which neither of the two ferritin protein subunits are regulated by irp, both heavy and light subunits lack the ire needed for the normal response to cellular iron homeostasis.31 as a result, the engineered cells can store extra iron, presumably in the form of ferritin. since this mri signal was comparable to the magnetosome - like particles detected using maga expression, our study suggests that iron contrast from magnetotactic bacterial gene expression arises through a mechanism that is distinct from mammalian iron homeostasis.6 moreover, western blot analysis of tfrc levels in each expression system showed appropriate downregulation in response to extracellular iron supplementation, confirming that irp are functional in these genetically modified cells. macrophage are a ferroportin - expressing cell type with the ability to control iron import and export, and thus iron recycling. in the alternatively activated m2 state, macrophages display high tfrc (iron import) and high ferroportin (iron export) activity, and therefore provide effective iron recycling.32,33 however, in response to pro - inflammatory stimuli, which trigger hepcidin expression, macrophages convert to an m1 phenotype represented by low tfrc and low ferroportin expression. under these conditions, iron recycling is limited and cellular ferritin expression is high, contributing to an iron storage phenotype. using this cell line, corna showed that m1 macrophages only import iron when its extracellular concentration is high, while m2 macrophages can import iron even when its extracellular concentration is low, congruent with an increase in tfrc expression. understanding the iron biochemistry of m1 and m2 macrophages takes on clinical importance when the hemorrhage that follows myocardial infarction is considered. there is evidence that failure to clear iron leads to dysregulation of the inflammatory response and increased incidence of heart failure.34,35 in the context of gene - based iron labeling for mri, the literature9,11,31 suggests that most of these engineered cell types will respond to ~200 m iron supplementation in culture to achieve maximal iron loading and mr detection ; however, very few reports have thoroughly examined the intrinsic iron transport characteristics of any given cell type. in human mda - mb-435 melanoma cells, long - term iron - supplemented culture (containing 250 m ferric nitrate) has no appreciable effect on transverse relaxation rates in the absence of maga or modified ferritin overexpression.6 however in p19 cells, a mouse teratocarcinoma, the untransfected parental cell line displays a pronounced, although transient, increase in transverse relaxation rates and cellular iron content in response to iron supplementation.5 further analysis shows that ferroportin expression in p19 is unexpectedly high. the immunoblot in figure 3 was prepared from total cellular protein from p19 and mda - mb-435 samples, wherein lysed cells were solubilized and their protein quantified and electrophoretically separated following published procedures.6,36,37 a ferroportin antibody reveals the bands comprising the full - length iron export protein (fig. 3a, arrow at ~60 k) and its lower molecular weight (mw) degradation products. 3b, band at ~35 k), densitometry indicates that there is ~two to four times more ferroportin (60 k species) in p19 than in mda - mb-435 (genetools, version 3.06.04 ; syngene). the p19 iron recycling phenotype is similar to alternatively activated m2 macrophages, characterized by high levels of both tfrc and ferroportin activity.5,38 moreover, despite the active export of iron, maga - expressing p19 cells display a persistent increase in transverse relaxation rates unlike the transient uptake of iron in the parental line.5 this result suggests that iron handling and/or compartmentalization secondary to magnetotactic bacterial gene expression is distinct from mammalian iron regulatory mechanisms (manuscript in preparation). we also expect that p19 cells might respond to much lower concentrations of iron supplement and note that cho used 25 m ferric citrate for effective iron supplementation of maga - expressing mouse embryonic stem cells.8 given the multipotent properties of p19, we speculate that cells with stem - like features may display effective iron recycling. in conjunction with in vivo repetitive imaging, a dietary iron supplement has been used to optimize the detection of xenografts overexpressing iron - handling proteins like maga and the modified ferritin subunits.39 an iron - rich diet should be expected to increase hepcidin secretion, and thus decrease ferroportin expression. this would lower iron export from targeted cells, favoring iron retention and cellular contrast. however, this could be a problem for the specificity of imaging if cells that naturally handle iron, such as macrophages, infiltrate the tumor xenograft as part of the immune response to foreign cell invasion. the m1 macrophage phenotype may increase tumor contrast and report inflammatory rather than tumor cell activity. this may explain the steady increase in parental tumor contrast observed in subcutaneous melanoma cell xenografts over five weeks of repetitive mri.39 iron deficiency has the reverse effect, decreasing systemic hepcidin secretion to permit a rise in ferroportin activity. iron deficiency or anemia can be induced in several ways, including blood loss, iron chelation, and chronic inflammation. the link between anemia and inflammation involves hepcidin expression, which is transcriptionally regulated by the inflammatory cytokine interleukin 6.40 thus, the chronic inflammation of disease may be important to consider when tracking cells or therapies by mri in preclinical models.41,42 there are further implications for the removal of unwanted iron from cells using inducible ferroportin expression vectors and hepcidin regulation as tools to manipulate the process. in this way, therapeutic cells may be subjected to iron labeling for in vivo tracking with an option to attenuate or reverse the process when it is no longer needed. appreciating that different cell types can have different iron - handling capabilities should add both insight and versatility to gene - based iron labeling. this understanding should also extend to spio labeled cells, in which the mr contrast signal dissipates over time as the cells divide, degrade the spio and dispose of the iron mineral. there are a number of pre / clinical settings where the results and theory presented here can be further investigated. for example, in the case of a heart attack, tissue injury prompts an inflammatory response upon which macrophages act to prevent infection at the site of the wound, remove dead cells, and promote scar tissue formation.43 resident macrophages are likely to be the first responders.44 resting monocytes, from spleen and bone marrow precursors, may also be recruited to the wound. in the acute phase, pro - inflammatory signaling will induce an m1 macrophage phenotype characterized by low tfrc, high ferritin, and low ferroportin. this iron storage phenotype mimics the iron overload disease state and is associated with high hepcidin levels. transition to an anti - inflammatory phase is accompanied by a return to an iron recycling phenotype with high tfrc, low ferritin, and high ferroportin. these m2 macrophages are comparable to an iron deficiency disease state, which is associated with low hepcidin levels. there are many questions that surround the inflammatory response in heart disease and many other illnesses with an inflammatory component. could hepcidin levels be used to monitor the pro - inflammatory response ? to what extent does autocrine regulation of iron metabolism influence the local tissue environment ? could gene - based mri contrast be used to monitor therapy or inflammation - dependent changes in cellular iron using reporter gene expression ? there are multiple opportunities for molecular imaging approaches to exploit gene - based iron labeling in the context of systemic and cellular iron biochemistry. among the advantages of mri is the excellent soft tissue contrast and sensitivity of the signal to ferromagnetic particles. by introducing spio nanoparticles into cells, more recent application of gene - based iron labeling to cell tracking strategies has further broadened the possibilities for addressing molecular and cellular function using mri reporter gene expression. effective use of this tool will entail development of both mr methods and gene - based iron labeling. in conjunction with expression systems designed to sequester iron biominerals for mri and circumvent mammalian iron regulation, the influence of iron - handling pathways may nevertheless be important for image interpretation. choice of cell, capacity for iron uptake and retention, manipulation of plasma iron concentration, and perhaps choice of expression system are likely to factor into the mr detection and analysis. | using a gene - based approach to track cellular and molecular activity with magnetic resonance imaging (mri) has many advantages. the strong correlation between transverse relaxation rates and total cellular iron content provides a basis for developing sensitive and quantitative detection of mri reporter gene expression. in addition to biophysical concepts, general features of mammalian iron regulation add valuable context for interpreting molecular mri predicated on gene - based iron labeling. with particular reference to the potential of magnetotactic bacterial gene expression as a magnetic resonance (mr) contrast agent for mammalian cell tracking, studies in different cell culture models highlight the influence of intrinsic iron regulation on the mri signal. the interplay between dynamic regulation of mammalian iron metabolism and expression systems designed to sequester iron biominerals for mri is presented from the perspective of their potential influence on mr image interpretation. |
gastrointestinal (gi) tract is the most frequently involved extranodal site in non - hodgkin 's lymphoma (nhl). individuals with defects in cellular immunity are prone to develop various types of opportunistic infections. strongyloides stercoralis is found mainly in tropical and subtropical areas, and has been reported to infect 100 million people worldwide. the diagnosis of parasites often requires a high index of suspicion and the use of specialized techniques. a 49-year - old man, with no significant co morbidities and no history of smoking or alcohol use, presented with upper abdominal pain and flatulence since 3 months. thus, the patient was diagnosed with diffuse large b cell nhl (nhl dlbcl) of the stomach stage i - ea. he received three cycles of cyclophosphamide, vincristine, epirubicin, and prednisolone (ceop) chemotherapy. following three cycles, upper gi endoscopy revealed an ulcerative lesion involving incisura and distal part of lesser curvature and part of antrum, indicative of progressive disease. he then received four cycles of salvage mine (mitoxantrone, ifosfamide, and etoposide) following which he achieved complete remission. patient declined further chemotherapy ; therefore, he received consolidation radiation therapy with 45 gy/25 # over 5 weeks to stomach and perigastric nodes. bone marrow aspiration and biopsy was normal. as there was no concrete evidence of recurrent disease, patient again presented 3 months later with 15-day history of persistent dull aching epigastric pain. abdominopelvic computed tomography (ct) scan showed pyloric wall thickness of 1.1 cm, wall thickening around lesser curvature up to 6 mm, tiny sized perigastric nodes, and enlarged left para - aortic nodes in retroperitoneum as well as mesentery. upper gi scopy showed mucosal thickening in the distal body and antrum of stomach, extending till pyloric rim, with the differential diagnoses being post - treatment changes or residual disease [figure 1 ]. stomach biopsy showed gastric mucosa with acute and chronic inflammation accompanying s. stercoralis larvae [figure 2 ]. mucosal thickening in distal body and antrum of stomach, extending till pyloric rim strongyloides stercoralis larvae in the foveolar epithelium and lamina propria of gastric mucosa the patient was treated with ivermectin 10 mg (200 g / kg) daily on two consecutive days. follow - up upper gi scopy showed erosions in the distal body and antrum of stomach. biopsy showed no organisms, parasites, or helicobacter pylori, with no evidence of lymphoma. our patient presented about 3 months after completing therapy, with recurrent episodes of epigastric pain, gi bleeding. ct scan, positron emission tomography (pet) scan, and upper gi endoscopy revealed gastric wall thickening and lymphadenopathy. although it would be tempting to treat this constellation of symptoms and signs as recurrent disease, it would have been inappropriate in our patient. s. stercoralis is an intestinal roundworm that infects humans transcutaneously. after entering the bloodstream through the skin, the filariform larvae migrate to the lungs, ascend up the tracheobronchial tree (pulmonary migration), and descend down the gi tract to reach the small bowel. most cases of chronic s. stercoralis infection are asymptomatic. if present, the symptoms include gi symptoms like midepigastric pain, vomiting, either constipation or diarrhea, borborygmus, and perianal itching. some people develop marked symptoms of increased larval migration, especially gi and respiratory symptoms, with a large number of parasitic larvae detectable in sputum and stool. this is called hyperinfection and is usually noted in persons with a defect in cell - mediated immunity. patients who have coexisting lymphoma and strongyloides infection often have a fulminant course. in a review by genta. of 17 patients with disseminated strongyloides and underlying lymphoma, the authors suggested that this parasite should be aggressively sought out and treated prior to initiating immunosuppressive therapy. hyperinfection of s. stercoralis has occurred in patients on doses as low as 1 mg of dexamethasone daily for 8 weeks. in our patient, the diagnosis of strongyloides infection was delayed for an approximate period of 5 months after the onset of symptoms because of low index of suspicion. fortunately, immunosuppressive chemotherapy and corticosteroid therapy were not administered during this period, which is probably why our patient did not develop hyperinfection syndrome, and the parasite was easily eradicated, once diagnosed. the diagnosis of strongyloidiasis in humans is usually based on finding rhabditoid larvae in fecal material. the histologic diagnosis of strongyloidiasis from biopsies and surgical specimens is usually made incidentally in patients undergoing endoscopy for gi disease. opportunistic parasitic infections represent one of the major challenges in the management of cancer patients. viral and bacterial infections are readily diagnosed by well - established serologic and microbiologic methods. in contrast, the diagnosis of parasites requires a high index of suspicion and the use of specialized techniques. | we report the case of a 49-year - old man with a diagnosis of gastric diffuse large b cell non - hodgkin 's lymphoma, treated with two lines of chemotherapy followed by radiotherapy, and presented about 3 months after completing therapy with recurrent episodes of epigastric pain, gastrointestinal (gi) bleeding. computed tomography scan, positron emission tomography scan, and upper gi endoscopy revealed gastric wall thickening and lymphadenopathy. biopsy and histopathology ultimately revealed strongyloides stercoralis infection that was mimicking disease recurrence. opportunistic parasitic infections represent one of the major challenges in the management of cancer patients. |
vitamin e (tocopherol) and vitamin c (ascorbic acid) are well - known lipophilic and hydrophilic chain - breaking antioxidants, respectively. because antioxidant activity in homogeneous solutions may not be the same as that in heterogeneous solutions, the antioxidant properties of heterogeneous solutions including aggregated systems (micelles, liposomes, and microemulsions) have been investigated. variation of biomembrane microenvironments may turn vitamin e into a pro - oxidant agent. ascorbic acid contains hydroxyl groups in positions 2 (pka : 11.6), 3 (pka : 4.2), 5 (secondary alcoholic residue), and 6 (primary alcoholic residue) (figure 1). ascorbic acid is an ineffective antioxidant for lipid peroxidation in hydrophobic phases, but it works very efficiently in aqueous media. structural modification of position 2, 3, 5, or 6 of the ascorbic acid ring contributes not only to its stabilization as an antioxidant but also to the formulation of a variety of pharmaceutical and cosmetic products with antioxidant activity. for example, the antioxidant activity of o - substituted ascorbic acid derivatives at the c-2 position ascorbic acid 2-glucoside, ascorbic acid 2-phosphate, and ascorbic acid 2-sulfate was investigated by takebayashi.. the radical - scavenging profiles of ascorbic acid derivatives were closer to those of uric acid and glutathione than to that of ascorbic acid. hydrophobic ascorbic acid derivatives, in which one or more hydrocarbon chains are attached to the ascorbic acid ring, retain the activity displayed by ascorbic acid. the antioxidant activity of various 6-o - alkanoyl - ascorbic acids is much better than that of ascorbic acid and tocopherols both in vivo and in vitro. the role of longer alkyl chains in facilitating the insertion of ascorbic acid derivatives into the cellular bilayer broadens its use to nonaqueous media. the addition of hydrocarbon chains (e.g., ethers and esters at positions 2, 3, 5, or 6 of the ascorbic acid ring) results in the formation of amphiphilic structures in which ascorbic acid can produce self - assembled supramolecular aggregates such as micelles and vesicles. in this paper, hydrophilic ascorbic acid derivatives have been used not only as antioxidants but also as food or pharmaceutical excipients [4, 5 ]. they are usually loaded into a nanoparticle formulation to prevent oxidation of the drugs and the components [4, 6 ]. ascorbyl n - alkyl fatty acid derivatives have been well investigated as antioxidants for nanoparticle formulations, such as micelles, microemulsions, and liposomes. physicochemical properties of ascorbic acid derivatives described in the paper and their applications are summarized in tables 1 and 2, respectively. physicochemical property, especially, solubility of ascorbyl acid derivatives was apparently changed not only by the substitution of alkyl chains but also by the chain length. several papers have described ascorbic acid derivatives including the current methods of synthesis, so we hereby focused on the nanoparticle formulations themselves. as a 2-o - substituted ascorbic acid, asc - g was used as not only a solubilizer but also as an additive for nanoparticle formation. asc - g has 2 beneficial properties : high stability against thermal and oxidative degradation and rapid conversion to ascorbic acid by -glucosidase in blood and liver cells [8, 9 ]. moreover, it is expected to be used in the development of lipid - soluble vitamins and as the principal component in cosmetic ingredients. inoue. reported solubilization and nanoparticle formation of clarithromycin (cam) using asc - g. we used ascorbic acid as a solubilizing agent because it can solubilize cam ; however, photodecomposition of ascorbic acid was observed in aqueous media. to avoid photodecomposition, asc - g was used instead of ascorbic acid to improve the dissolution characteristics of cam (figure 2). cogrinding of cam with asc - g at a molar ratio of 1 : 1 or less was an effective way to improve cam solubility in aqueous solution. molecular interaction between the n, n - dimethyl group of cam and the hydroxyl group of asc - g in aqueous solution was observed by h and c nuclear magnetic resonance (nmr). in addition to solubilization, cam nanoparticle formation was observed when a 2 : 1 ground mixture of cam and asc - g was dispersed into an aqueous media. this molar ratio - specific nanoparticle formation might be attributable to a grinding - induced interaction in the solid state via the ketone group in the lactone ring of cam. it is concluded that cogrinding with asc - g is a promising method for modifying the dissolution properties of cam. further study focusing on the application of asc - g in other poorly water - soluble drugs is required. the self - assembly properties depend on the length of the n - alkyl fatty chain. ascorbyl monoalkylate starts to aggregate at the krafft point, at which the solubility reaches the critical micellar concentration (cmc). above this temperature, ascorbyl monoalkylate can aggregate in micelles or the gel phase, depending on the alkyl side chain. upon cooling, liquid - crystal structures (coagels) are obtained for less soluble derivatives (ascorbyl laurate, ascorbyl myristate, and ascorbyl palmitate). these structures can solubilize drugs, improve their stability, and promote their permeation through the skin. activity (ra) measurement of some antioxidant chemicals indicated that hydrophobic vitamin c derivatives (from ascorbyl octanoate to ascorbyl stearate) keep the same antioxidant activity of vitamin c but have the advantage of being soluble in both aqueous and hydrophobic media. these derivatives possess the same ra of several natural products ; therefore, they can be used as radical scavengers in the protection of such natural compounds. the enediol functionality of ascorbyl palmitate is prone to oxidation in the presence of oxygen, a process that usually leads to formation of dehydroascorbyl palmitate (figure 3) in which the oh functionality is oxidized into keto moiety [1315 ]. the self - assembling and antioxidant activities of asc-8 were reported by lonostro.. asc-8 formed homogeneous micelles in ph 2 aqueous solution at 25c (nonionic form), exhibiting nearly spherical aggregates as revealed by viscosity, dynamic light scattering (dls), and small - angle neutron scattering (sans) experiments. the critical micelle concentration was 6 mm (surface tension), with a hydrodynamic radius of 30 (light scattering) and 25.4 (sans), area per molecule of about 57.6, and aggregation number of 84. solubilization of drugs was performed above the cmc and krafft temperature determined by surface tension and conductivity measurements. the solubility of hydrophobic drugs, such as phenacetin, danthron, anthralin, and retinoic acid, was greatly enhanced by the solubilization. furthermore, the antioxidant activity exhibited by the ascorbate rings that form the hydrophilic external shells in asc-8 micellar dispersions can protect degradable materials that have been solubilized in the internal hydrophobic micellar core from radical - initiated oxidation. asc - p has been used as a model drug for nanosized lipid carriers. as an antioxidant, asc - p has been also used in the cosmetics, food, and pharmaceutical industries. reported the physicochemical characterization and in vitro release studies of asc - p - loaded nanostructured lipid carriers (nlc gels) [17, 18 ]. nlc gels were prepared by a high - pressure homogenization technique using oil labrafil m1944 and solid lipids such as cetyl alcohol (ca), imwitor 900 (gms), and nonionic hydrophilic white beeswax (bw). nanosized particles asc - p - loaded gms > asc - p - loaded ca. in viscoelastic analysis, all formulations showed that the storage modulus (g) was higher than the loss modulus (g) and that the phase angle was 90% after 3-month storage at 4c, 25c, and 40c. the mean size of the asc - p nanosuspensions prepared by redispersion of the lyophilized product was significantly higher compared with the system using 210% trehalose as a cryoprotectant. dissocubes technology appeared to be effective in preparation of asc - p nanoparticles using the optimum formulation. representative applications of asc - p for therapeutic uses include the skin permeation enhancer and synergistic cytotoxic action. skin permeation enhancement of asc - p by liposomal hydrogel (lipogel) formulation was reported by lee.. the asc - p - incorporated liposome was formulated as lipogel by dispersion of the liposome into a poloxamer hydrogel matrix. the permeated amounts of asc - p from the lipogels were higher than that of the control hydrogel containing transcutol to solubilize asc - p. skin permeation of asc - p improved when an electric current system that mimics an electric skin massager was used. in the cathodal delivery condition, the skin permeation characteristics of the negative lipogels were superior to those obtained with the neutral lipogels. reported anticancer toxicity of asc - p - incorporated liposomes and micelles in numerous cancer cell lines. asc - p - incorporated liposomes preferentially associated with various cancer cells compared to noncancer cells. in addition, asc - p enhanced the cytotoxic action of paclitaxel when simultaneously incorporated into liposomes. the tumor - cell association and killing and the cytotoxic action of encapsulated paclitaxel in liposomes can potentiate the effect of asc - p and paclitaxel. cancer cell cytotoxicity and targeting was also observed both in vitro and in vivo using polyethylene glycol phosphatidylethanolamine micelles. the mechanism of cell death was reported to be due to generation of reactive oxygen species. similar cytotoxic activity against tumor cells was reported using polymeric nanoparticles containing the antitumor compound transdehydrocrotonin (dhc) and l - ascorbic acid 6-stearate (asc - s), which was taken up more easily by tumor cells than by normal ones. asc - s - dhc nanoparticles were prepared by the nanoprecipitation method, in which plga, dhc, and asc - s dissolved in acetone were added to an aqueous solution containing pluronic f68 and polyvinyl alcohol (pva). asc - s - dhc nanoparticles showed high drug loading efficiency (8188%) and negative zeta potential (29 to 32 mv) due to asc - s. asc - s - dhc nanoparticle suspension was a more effective antitumor agent than free dhc or dhc nanoparticles. apoptosis induction of an asc - s - dhc nanoparticle suspension was increased by the receptor - mediated pathway. reported on the formation, characterization, and applications of asc - p vesicles (aspasomes). submicron - sized aspasomes were prepared using a film hydration method. a lipid film composed of various molar ratios of ascorbyl palmitate and cholesterol (27/63 to 72/18) and dicetyl phosphate at 10 mol% of total lipid was hydrated with phosphate buffered saline (pbs, ph 7.4). aspasomes could encapsulate the hydrophilic drug zidovudine (azt) when the film was hydrated with azt - containing pbs. the suspension was then sonicated with an ultrasonicator for preparation of azt - encapsulated aspasomes. the cholesterol content of the aspasomes was not related with vesicle size, zeta potential, or percent of azt entrapment. the release rate of azt was changed by variation of the proportion of cholesterol, although there was no relation between release rate and cholesterol content. the antioxidant potency of ascorbyl moiety was retained even after the conversion of ascorbyl palmitate into an aspasome, and it rendered much higher antioxidant activity than ascorbic acid. the aspasome also showed enhanced skin permeation and retention properties of azt, likely due to a role of asc - p as a permeation enhancer. asc - dp has been used in the field of cosmetics [29, 30 ] and shows extremely low water solubility. in contrast with asc - p, asc - dp can not form micelles or liposomal structures on its own ; however, the asc - dp - distearoylphosphatidylethanolamine - polyethylene glycol 2000 (dspe - peg) complex forms stable nanoparticles (figure 4). prepared drug - containing asc - dp / dspe - peg nanoparticles and investigated their physical stability. amphotericin b (amb), a polyene macrolide antibiotic drug used to treat systemic invasive fungal infection, was selected as the model drug because it specifically interacts with dspe - peg. this intermolecular interaction is believed to contribute to the effectiveness of amb incorporation into the asc - dp / dspe - peg nanoparticles. the stability, toxicity, and blood residence of the amb / asc - dp / dspe - peg nanoparticles was also investigated. the minimum lethal dose of fungizone, a formulation of amb solubilized with sodium deoxycholate, was 3.0 mg / kg, while that of amb / asc - dp / dspe - peg nanoparticles was 10.0 mg / kg in a formulation that was intravenously administered to mice. intravenously administered amb / ascdp / dspe - peg nanoparticles were detected at higher concentrations than fungizone in plasma. thus, the asc - dp / dspe - peg nanoparticle system appears to be a promising delivery system for hydrophobic drugs. formulation of hydrophilic and hydrophobic drugs using a nanosized carrier system is a promising way to achieve the desired therapeutic effect. nanoparticle formation of ascorbic acid derivatives with or without drugs is practically applicable as transdermal and injectable formulations. the ascorbic acid derivatives shown in this paper can possibly be used as a model drug, a component of the carrier, or both. ascorbic acid derivatives have been widely used as antioxidative drugs, the activities of which are similar to that of ascorbic acid. when combined with other excipients, such as oil with lipids and chitosan derivatives, ascorbic acid and its derivatives are also used as cytotoxic drugs against cancer cell lines. ascorbic acid derivatives with an alkyl chain are preferred because of the interaction with and insertion into the hydrophobic part of the membrane. this combined use with anticancer drugs incorporated in the carrier system apparently increased the efficacy. a formulation design based on the chemical structure of the components is required not only to prepare stable drug nanoparticles but also to the broader application of ascorbic acid derivatives in therapeutic uses. the intermolecular interaction between each component and ascorbic acid derivatives contributes to effective drug solubilization and stabilization to enable nanoparticle formulation. for example, aspasomes were formulated as vesicles composed of various components that interacted with each other. furthermore, the complex formation between the hydrophobic drug n-4472 and ascorbic acid and the subsequent self - association contributed to form the colloidal particles in aqueous solution (figure 5). a novel drug delivery carrier system using ascorbic acid derivatives is going to be developed using this chemical structure - based design. physicochemical characterization of the colloidal particles is important for understanding the drug absorption mechanism and therapeutic efficacy, although it is not easy. the molecular mobility measurement of a drug in aqueous media using nmr is useful to evaluate the molecular states of the drug in the formulation as well as in the dispersing media. this mechanistic study revealed the role of ascorbic acid derivatives in vitro and in vivo. | drug nanoparticle formulation using ascorbic acid derivatives and its therapeutic uses have recently been introduced. hydrophilic ascorbic acid derivatives such as ascorbyl glycoside have been used not only as antioxidants but also as food and pharmaceutical excipients. in addition to drug solubilization, drug nanoparticle formation was observed using ascorbyl glycoside. hydrophobic ascorbic acid derivatives such as ascorbyl mono- and di - n - alkyl fatty acid derivatives are used either as drugs or carrier components. ascorbyl n - alkyl fatty acid derivatives have been formulated as antioxidants or anticancer drugs for nanoparticle formulations such as micelles, microemulsions, and liposomes. asc - p vesicles called aspasomes are submicron - sized particles that can encapsulate hydrophilic drugs. several transdermal and injectable formulations of ascorbyl n - alkyl fatty acid derivatives were used, including ascorbyl palmitate. |
multiple sclerosis (ms), as the most common inflammatory demyelinating disease of the central nervous system (cns) and also the most common cause of neurological disability at young age, is an inflammatory demyelinating disease characterized by lymphocyte infiltration and inflammation of the cns white matter. such demyelinating process typically shows 4 clinical courses including : relapsing remitting (rrms) which is the most common type (80%), characterized by unpredictable relapses followed by periods of months and years of relative quiet with no sings, and usually beginning with a clinical isolated syndrome (cis) not fulfilling the criteria of ms ; secondary progressive (spms) occurring in around 65% of those with initial rrms, who eventually have progressive neurologic decline between acute attacks ; primary progressive (ppms) occurring in 10 - 20% of all, with no remission after the initial symptoms ; and progressive relapsing (prms) describing a steady neurologic decline with superimposed attacks (1). the most widely used scale evaluating the severity of ms is the edss (expanded disability status scale) defined by a set of rules (2) and providing a numerical quantification of the neurological examination. the etiology of ms is unclear ; however, it is thought that both genetic and environmental factors play a role in its pathogenesis (3). ms may result from the failure of tolerance mechanisms including cd4+cd25+ t regulatory cells (treg) (4), which prevent expansion of pathogenic t cells directed against myelin determinants, or other self - tissue antigens. a lot of studies have reported numeric or functional deficiencies of tregs in various human autoimmune diseases including inflammatory demyelinating disorders of the cns (5). although there is not yet a specific surface marker for treg subsets, naturally occurring cd4+cd25+treg (ntreg) cells can be characterized on the basis of their high expression of cd25 (in contrast to the intermediate expression in recently activated t cells) and the intracellular expression of the fork head transcription factor 3 (foxp3) (6). another treg population, cd8+cd28- treg (7) which lacks co - stimulatory molecule of cd28, is associated with some suppressor abilities and its failure has been recognized in numerous animal (810) as well as human autoimmunities (1112). the role of cd4+cd25+foxp3 + and cd8+cd28- treg cells (7, 13, 14) has been studied in ms. the present study has evaluated both of these treg populations in all types of ms and has compared the results with healthy controls. peripheral blood samples were obtained from a total of 84 ms patients in remission phase, who were diagnosed according to clinical examination and mri, and 75 sex and age - matched healthy controls. the edss (expanded disability status scale) (15), the type of ms (cis, rrms, ppms, spms, prms), duration as well as treatment of the illness, and the number of recurrences were determined for each patient before sampling. blood samples of all subjects were taken after signing the informed consent form approved by the local ethical committee. at least one million fresh peripheral blood mononuclear cells (pbmcs) were separated from 2 ml of anticoagulated blood by ficoll - hypaque (lymphodex, inno - train, germany) density gradient centrifugation. cd4+cd25+foxp3 + tregs were detected in one tube by staining with a cocktail of anti - human surface cd4-fitc / cd25-pe, and intracellular foxp3-pe - cy5 according to the manufacturer s instructions (ebioscience, usa). in this procedure, cd4 + -fitc / cd25 then the cells were stained by 10 l anti - human foxp3 antibody and were incubated at 4c for 30 min. inducible cd8+cd28- tregs were detected in another tube by staining with anti - human cd3-pe, cd8a - pe - cy5, and cd28-fitc. all lymphocytes in each sample were gated on the basis of light scattering properties and then at least 20,000 events were obtained to count each subtype of tregs. having gated cd4+cd25+cells, we counted cd4+cd25+foxp3+cells on the basis of simultaneous expression of cd25 and foxp3. to count cd8+cd28- tregs, gated cd3-expressing lymphocytes were counted on the basis of expression of cd8 and no expression of cd28 (figure 1). all antibodies and their isotype - matched controls were purchased from ebioscience, usa. the percentages of cd4+cd25+foxp3 + and cd8+cd28- cells were analyzed by a 3-color flow cytometry using bd facscalibur flow cytometer and cellquest software version 3 (bd, usa). a) having gated on cd4 + cells, we counted cd4+cd25+foxp3 + cells b) having gated on cd3 + cells, we counted cd8+cd28- cells numbers of cd4+cd25+foxp3 + cells and cd8+cd28-cells in peripheral blood samples of 84 ms patients and 75 healthy controls data was expressed as meansd. the statistical indices of tregs were analyzed using independent t and chi - square tests. correlations between variables were calculated by pearson s correlation coefficient, and simultaneous effects of various factors on tregs were analyzed by multiple linear regressions with backward method. adjusted r squared was determined as a criterion of goodness - of - fit test, and p<0.2 was considered for exclusion from the model. peripheral blood samples were obtained from a total of 84 ms patients in remission phase, who were diagnosed according to clinical examination and mri, and 75 sex and age - matched healthy controls. the edss (expanded disability status scale) (15), the type of ms (cis, rrms, ppms, spms, prms), duration as well as treatment of the illness, and the number of recurrences were determined for each patient before sampling. blood samples of all subjects were taken after signing the informed consent form approved by the local ethical committee. at least one million fresh peripheral blood mononuclear cells (pbmcs) were separated from 2 ml of anticoagulated blood by ficoll - hypaque (lymphodex, inno - train, germany) density gradient centrifugation. cd4+cd25+foxp3 + tregs were detected in one tube by staining with a cocktail of anti - human surface cd4-fitc / cd25-pe, and intracellular foxp3-pe - cy5 according to the manufacturer s instructions (ebioscience, usa). in this procedure, cd4 + -fitc / cd25 then the cells were stained by 10 l anti - human foxp3 antibody and were incubated at 4c for 30 min. inducible cd8+cd28- tregs were detected in another tube by staining with anti - human cd3-pe, cd8a - pe - cy5, and cd28-fitc. all lymphocytes in each sample were gated on the basis of light scattering properties and then at least 20,000 events were obtained to count each subtype of tregs. having gated cd4+cd25+cells, we counted cd4+cd25+foxp3+cells on the basis of simultaneous expression of cd25 and foxp3. to count cd8+cd28- tregs, gated cd3-expressing lymphocytes were counted on the basis of expression of cd8 and no expression of cd28 (figure 1). all antibodies and their isotype - matched controls were purchased from ebioscience, usa. the percentages of cd4+cd25+foxp3 + and cd8+cd28- cells were analyzed by a 3-color flow cytometry using bd facscalibur flow cytometer and cellquest software version 3 (bd, usa). a) having gated on cd4 + cells, we counted cd4+cd25+foxp3 + cells b) having gated on cd3 + cells, we counted cd8+cd28- cells numbers of cd4+cd25+foxp3 + cells and cd8+cd28-cells in peripheral blood samples of 84 ms patients and 75 healthy controls the statistical indices of tregs were analyzed using independent t and chi - square tests. correlations between variables were calculated by pearson s correlation coefficient, and simultaneous effects of various factors on tregs were analyzed by multiple linear regressions with backward method. adjusted r squared was determined as a criterion of goodness - of - fit test, and p<0.2 was considered for exclusion from the model. basic and clinical characteristics of ms patients and controls enrolled in our study are shown in table 1. the least edss score was related to the most benign type of ms named cis and then it raised in more sever types of ms. there were not any significant differences in the frequency of tregs in terms of age and gender (table 1). the frequency of cd4+cd25+foxp3+tregs in ms patients was significantly lower than that in healthy controls (p=0.006) (table 1). the frequency of cd4+cd25+foxp3 + tregs was different in ms patients according to type of ms in such a way that the frequency of cd4+cd25+foxp3 + tregs in severe forms of ms (ppms, spms, prms) was significantly higher than that in the mild forms (cis, rrms) (p=0.03) (table 2). basic and clinical characteristic of ms patients and controls cis : clinical isolated syndrome, rrms : relapsing remitting multiple sclerosis, ppms : primary progressive multiple sclerosis, spms : secondary progressive multiple sclerosis, prms : progressive relapsing multiple sclerosis, edss : expanded disability status scale, tregs : regulatory t cells values of tregs according to different variates in ms patients cis : clinical isolated syndrome, rrms : relapsing remitting multiple sclerosis, ppms : primary progressive multiple sclerosis, spms : secondary progressive multiple sclerosis, prms : progressive relapsing multiple sclerosis, edss : expanded disability status scale there was not any significant correlation between the frequency of tregs with age and various clinical variables including edss scores, number of recurrences, duration of the disease, and duration of the treatment (table 3). also, no correlation was found between the frequencies of tregs with age in healthy group (data not shown). using linear multiple regression analysis, we found a significant goodness - of - fit for both subsets of treg frequencies (cd4+cd25+foxp3+treg : adjusted r=0.845, p<0.001 ; cd8+cd28-treg : adjusted r=0.759, p<0.001). cd4+cd25+foxp3 + treg frequencies remained not significant in the presence of factors of positive family history (p=0.519), number of recurrences (p=0.656), and edss score (p=0.939). although the factors of age, sex, disease duration, and treatment duration stayed in the model, the frequency of such cells turned significant in the presence of age (p<0.001) and treatment duration (p=0.016). the model also revealed that cd8+cd28-treg frequencies remain insignificant in the presence of factors of positive family history (0.315), edss score (0.908), disease duration (0.466), and treatment duration (0.409). although the factors of age, sex, and number of recurrences stayed in the model, the frequency of such cells turned significant only in the presence of age (p<0.001) (table 4). correlation between the number of treg subtypes with age and different clinical variates in ms patients linear multiple regression analysis evaluating the effect of different factors on the frequency of tregs in ms patients basic and clinical characteristics of ms patients and controls enrolled in our study are shown in table 1. the least edss score was related to the most benign type of ms named cis and then it raised in more sever types of ms. there were not any significant differences in the frequency of tregs in terms of age and gender (table 1). the frequency of cd4+cd25+foxp3+tregs in ms patients was significantly lower than that in healthy controls (p=0.006) (table 1). the frequency of cd4+cd25+foxp3 + tregs was different in ms patients according to type of ms in such a way that the frequency of cd4+cd25+foxp3 + tregs in severe forms of ms (ppms, spms, prms) was significantly higher than that in the mild forms (cis, rrms) (p=0.03) (table 2). basic and clinical characteristic of ms patients and controls cis : clinical isolated syndrome, rrms : relapsing remitting multiple sclerosis, ppms : primary progressive multiple sclerosis, spms : secondary progressive multiple sclerosis, prms : progressive relapsing multiple sclerosis, edss : expanded disability status scale, tregs : regulatory t cells values of tregs according to different variates in ms patients cis : clinical isolated syndrome, rrms : relapsing remitting multiple sclerosis, ppms : primary progressive multiple sclerosis, spms : secondary progressive multiple sclerosis, prms : progressive relapsing multiple sclerosis, edss : expanded disability status scale there was not any significant correlation between the frequency of tregs with age and various clinical variables including edss scores, number of recurrences, duration of the disease, and duration of the treatment (table 3). also, no correlation was found between the frequencies of tregs with age in healthy group (data not shown). using linear multiple regression analysis, we found a significant goodness - of - fit for both subsets of treg frequencies (cd4+cd25+foxp3+treg : adjusted r=0.845, p<0.001 ; cd8+cd28-treg : adjusted r=0.759, p<0.001). cd4+cd25+foxp3 + treg frequencies remained not significant in the presence of factors of positive family history (p=0.519), number of recurrences (p=0.656), and edss score (p=0.939). although the factors of age, sex, disease duration, and treatment duration stayed in the model, the frequency of such cells turned significant in the presence of age (p<0.001) and treatment duration (p=0.016). the model also revealed that cd8+cd28-treg frequencies remain insignificant in the presence of factors of positive family history (0.315), edss score (0.908), disease duration (0.466), and treatment duration (0.409). although the factors of age, sex, and number of recurrences stayed in the model, the frequency of such cells turned significant only in the presence of age (p<0.001) (table 4). correlation between the number of treg subtypes with age and different clinical variates in ms patients linear multiple regression analysis evaluating the effect of different factors on the frequency of tregs in ms patients we evaluated the frequency of two subtypes of tregs and showed that the frequency of cd4+cd25+foxp3 + cells is significantly lower in ms patients than in healthy controls ; it is also significantly lower in mild forms of ms than in sever forms. although inconsistent with some other studies (1619) that showed no significant differences in the circulatory number of cd4+cd25 + cells in patients with ms compared to that in healthy controls, our study showed lower circulatory number of cd4+cd25+foxp3 + cells in ms patients, which may be due to their disturbed thymic development (20) and/or their recruitment into the inflamed organ i.e. cns. it may be considered that the reduction in the percentage of cd4+cd25+foxp3 + cells could be one probable reason (or at least a predisposing factor) of ms. restoring the frequency as well as function of regulatory cells in ms patients after taking inf-, strengthens the likelihood of this idea (21). evaluating the percentage of tregs in different types of ms, we found that the number of cd4+cd25+foxp3 + cells in mild forms of ms (cis and rrms) was significantly lower than in severe forms (spms, ppms, and prms), yet we found a study inconsistent with ours (16). it is likely that in more sever types of ms, more de novo or induced production of cd4+cd25+foxp3+tregs, as a manifestation of their immunomodulatory function, constitutes a circulatory reservoir that replaces the cns - redistributed ones. such observation has also been made in rejection episodes of organ transplantation, in which more circulatory number of tregs, as a demonstration of their generation, tries to compensate both the residing ones in lymphoid tissues (to block initiation of aggressive immune responses) and migrating ones to graft sites (to inhibit the aggressive cells that have escaped from the regulation) (22). however, despite several studies which have demonstrated that rather functional defects of tregs are present in ms patients (7, 1619, 23), we showed that numbers of such cells may also be important in determining the severity of the disease. in other words, according to their immunomodulatory roles, naturally increasing numbers of tregs in sever forms, in line with therapeutic procedures which increase the number of tregs such as inf- (21) and inhibitors of histone deacetylase (22), may delay the progression of the process to more severe types. although not statistically significant, the circulatory frequency of cd8+cd28-tregs was lower in our ms patients than in healthy controls. however, some other studies found a significant decrease (7, 2426). according to our knowledge, the exact pathophysiologic basis of such reduction is not clear, but it may simply be a demonstration of tolerance failure in ms patients. however, adjusting the effects of different factors, we showed that age affects the frequency of both subsets of tregs and treatment duration affects the frequency of cd4+cd25+foxp3+tregs. the effect of age also has been shown in other studies (17, 20). the limitation of our study was that we did not monitor the changes of tregs longitudinally. this limitation allowed just a cross - sectional analysis of treg profiles of only limited robustness. secondly, functional assays which provide further information on the immunoregulatory status of the patients were not performed. it should also be mentioned that we studied a greater number of ms patients in comparison with others working on numerical status of tregs in ms patients. our study shows that although the number of cd4+cd25+foxp3 + cells is reduced in ms patients, there is no statistical correlation between the number of such cells and the type / severity of ms according to edss scale. according to our results it seems that treg cells may play an important role in the pathogenesis of ms. | objective(s):regulatory t cells, including cd4+cd25+fox3 + and cd8+cd28- cells play an important role in regulating the balance between immunity and tolerance. since multiple sclerosis is an inflammatory autoimmune disease, regulatory t cells are considered to be involved in its pathogenesis. in this study, we investigated the circulatory numbers of the two mentioned types of regulatory t cells and also their association with different clinical characteristics in 84 multiple sclerosis patients.materials and methods:84 patients with multiple sclerosis and 75 normal individuals were studied. demographic and clinical information of all participants were collected via questionnaire and clinical examination as well as mri. the peripheral blood frequency of two different subgroups of regulatory t cells (cd4 + cd25+foxp3 + and cd8+cd28- cells) were analyzed by flow cytometry using anti - human antibodies conjugated with cd4-fitc / cd25-pe / foxp3-pe - cy5, cd3-pe / cd8a - pe - cy5/cd28-fitc.results : the frequency of cd4+cd25+foxp3 + cells in multiple sclerosis patients was significantly less than that in healthy controls (p=0.006) and in mild forms less than that in sever forms (p=0.003). there was not any correlation between the frequency of regulatory t cells and different clinical variables.conclusion:our results showed that the number of cd4+cd25+foxp3 + cells decreases significantly in multiple sclerosis patients, which probably shows the regulatory role of these cells in multiple sclerosis. |
in ireland community mental health care consultations are provided by both primary care and specialised public mental health services. however, unlike the specialised public mental health service consultations, primary care service consultations are not currently free for the majority of irish residents. patients on the lowest end of the socioeconomic ladder qualify for state medical or gp visit cards which are a form of state health insurance that entitles the holder to receive free primary care consultations in addition to the universally free public specialist mental health consultations. all other patients including those with private health insurance pay for all primary care consultations which average around 60 dollars per consultation. a detailed description of the structure of both primary care and community mental health service provision in ireland, as well as the proportions of patients with medical / gp visit cards and private health insurance and the packages received by these patients have been given in two related publications [1, 2 ]. the irish department of health statement of strategy 20082010 emphasizes that the proportion of care needs met in community should be maximized with a shift from hospital system to primary care setting. this is consistent with international studies which have reported that patients with mental health difficulties reported no deterioration in their clinical condition while under the care of general practitioners (gps). it is also consistent with reports that formal liaison between gps and specialist services improves functional outcomes in chronically mentally ill patients [5, 6 ]. in line with these observations, one study reported that patients with mild to moderate depression and anxiety found it more acceptable to receive psychiatric care from primary than from specialized psychiatric services. in 2003, the government of ireland commissioned an expert group to review ireland 's mental health policy. the policy document produced by this expert group in 2006, entitled : a vision for change, recommends that links between specialist mental health services, primary care services, and voluntary groups that are supportive of mental health should be enhanced and formalised. however, some studies have identified challenges including patients ' lack of confidence in gp care, gps not being adequately trained to provide mental health care, and primary care not being adequately resourced with a multidisciplinary team to facilitate the care of patients with mental health difficulties, which cause some service users deemed to have relatively low clinical needs to remain within the specialist psychiatric service [1, 2, 9, 10 ]. a survey of a section of gps working in ireland in 2003 indicated that despite the fact that 35% of general practice attendees have mental health problems, and that over 95% of these problems are dealt with in primary care, only 32% of gps had received postgraduate training in psychological therapies. there is also evidence that suggests that gps are willing to take responsibility for physical health care [10, 12 ] but do not perceive themselves as involved in the mental health or overall care of people with enduring mental illness [10, 13 ]. this study explores the preferences and views of patients attending a local community mental health clinic regarding their continuing care with primary care or specialist mental health services once they have been stabilised on their treatment. as no prior questionnaire existed, a self - administered questionnaire of 20 items based on literature review and reflecting the objectives of our study was designed by the researcher. the questionnaire included questions on patients demographic and clinical characteristics such as age, sex, marital and employment status, possession of state or private medical insurance, frequency of attendance of psychiatric clinic, presence of medical comorbidity, registration with and frequency of attendance of general practice surgery, preference for receiving continuing care from primary care or specialised psychiatric services when mentally stable on treatment, and reasons for the choice. it was reviewed by a multidisciplinary group of six experts (two researcher and four psychiatrists) and pretested with five patients who were not included in the study sample. it took approximately 10 minutes to complete, and no financial incentive was offered to respondents. 150 consecutive psychiatric patients attending for outpatient review in a community mental health centre in dublin were approached and asked to complete the questionnaire. the study received approval from the research and ethics committee of the college of psychiatry of ireland. after complete description of the study to the participants, written informed consent was obtained before they completed the survey forms. this cross - sectional survey was conducted between april and june 2009 and data were analysed using descriptive statistics and chi - square test with spss version 17. the mean age for all respondents was 45.48 year (sd = 13.01 years) and the mean years for which patients had been attending the local specialised psychiatric service was 8.6 years (sd = 8.1 years). overall, 42 (29%) patients reported that they had been stable on their medication for more than one year while 13 (9%) patients reported that they had been stable on their medication for between 6 months and one year. again, 39 (27%) patients had had no changes made to their psychiatric medicines in over one year, 16 (11%) patients were on a depot injection, and 36 (25%) patients had a community psychiatric nurse assigned to them for follow - up visits. 45 (31%) patients reported that on the average, they attend the psychiatric clinic for review once every month, 48 (33%) said they attend about once every six weeks, 34 (23%) reported that they attend once every two months, and the rest said they attend once every 3 or more months. within the previous three months, 71 (49%) patients reported that they have visited their gp between one and three times and 19 (13%) reported they had visited their gp more than three times for a medical review. overall, 32 (22%) patients reported that they attended their gp regularly for review and prescriptions for chronic medical conditions. of the 83 patients who have had previous inpatient psychiatric treatment, 57 (69%) reported that their inpatient treatment had been more than a year previously and the remainder had been within the last one year. overall, 29 (20%) patients indicated that they would prefer to attend their gp for their psychiatric care once they have been stabilised on their medication from specialised psychiatric services. 98 (68%) patients expressed a preference to continue attending specialised psychiatric services even if they are stable on their treatment and the remaining 18 (12%) patients expressed no preference for either primary care or specialised psychiatric services. i performed a chi - square test to examine the association between the demographic and clinical variables (including gender, age group, relationship and employment status, possession of a medical card or private health insurance, and the presence of a medical comorbidity) and the expression of a preference to receive continuing care from primary care. i found no significant association between any of these demographic and clinical variables and the expression of a willingness to receive continuing psychiatric care from primary care (p > 0.05 for all comparisons). the reasons given by patients who stated a preference for and against attending their gp for their psychiatric needs once they are stable on medication are as outlined in tables 2 and 3, respectively. this study has established that the majority of irish patients (98, 68%) would prefer to continue receiving mental health care from specialised psychiatric services rather than receive such care from primary care even if they become stable on their treatment. the majority of these patients (67, 68%) reported that they would be worried about the quality of the psychiatric care they would receive from their gp even if they are stable on their treatment. many of these patients (40, 41%) also expressed that they did not have a medical or gp visit card and can not afford to pay for gp consultations. in one multidisciplinary team 's retrospective review of the clinical notes of all patients attending a psychiatric outpatient clinic to determine the appropriateness of continuing to provide psychiatric services in a specialised mental health clinic rather than in a primary care setting, it was recommended that 35.2% of all the patients could be discharged back into primary care for continuing management. community mental health services usually come under financial pressure and there are significant constraints hampering the effective management of the volume of consumers under their care, leading usually to long waiting times for access to psychiatric services. these tend to cause concerns among gps and the community generally, including confusion and bewilderment in gps when faced with difficult mental health problems for which they could not easily access support from specialist care [3, 15 ]. findings from my study indicate that the two main challenges hampering the transfer of care of stable mental health patients into primary care are the lack of confidence in gp care and the cost of gp consultations relative to the relatively free consultations from specialised psychiatric services. without addressing these two challenges, specialised psychiatric services would have to cope with caring for relatively stable patients which tend to diminish their capacity to take on new referrals from primary care. of the 29 (20%) patients who reported that they would prefer to attend primary care for their continuing mental health care once they are stable on their treatment, 18 (62%) stated that they had confidence in the care they would receive from their gp whilst 13 (45%) said it would be handy for them to attend their gp for both their physical and mental health needs. again, 9 (31%) of these patients said that receiving continuing mental health care from primary care would take away the stigma often attached to attending psychiatric services. providing good generalist care which addresses both mental and physical health needs is recognised internationally as one of the benefits of primary care service involvement in the care of patients with mental health difficulties. this study suggests that if a similar set of conditions exist in terms of the cost of consultations between primary care and specialised psychiatric services, and if gps were adequately trained to provide continuing care for patients with enduring mental health difficulties, then the capacity of specialized psychiatric services to take on new referrals as well as care for acutely unwell patients would be greatly enhanced. two previous surveys of gps working in ireland indicate that those gps who undertook a psychiatric rotation as part of their gp training expressed significantly more confidence in their ability to recognise and manage psychiatric presentations in primary care compared with gps who did not undertake such training [2, 11 ]. to achieve optimal outcomes for people with common mental disorders discharged back into primary care, it is essential that primary care teams have training in good practice guidelines on assessment, diagnosis, management, criteria for referral, and methods of shared care if necessary. addressing deficits in the knowledge and skills base of gps in the management of mental health conditions should be coupled with changes in the policy that makes it financially burdensome for patients to receive mental health care from gps when the same services are provided free of charge in public mental health clinics. the results of the study should be considered within the context of a number of limitations. firstly, this study does not take into account the views of psychiatrists and gp 's which are described elsewhere [1, 2 ]. secondly, it does not take into account the views of mental health patients who are cared for solely in primary care, thus creating a source of bias for our results. thirdly, although the questionnaire used was reviewed by a multidisciplinary team, it was nonetheless not standardised and so, the results may not be generalisable to other jurisdictions. furthermore, the multidisciplinary team that reviewed the questionnaire used in the study did not include a gp which is an important drawback. again, the patients sampled were selected from only one community psychiatric catchment area in dublin and so, the responses may not be nationally representative. notwithstanding these limitations, the results of this study are hugely important as they underscore the need to promote collaborative strategies and policies in mental health care. collaboration between gps and community mental health teams can improve and expand access to care for people with mental illnesses. most patients who attend specialised psychiatric services in ireland prefer to continue attending specialized psychiatric services even when they are mentally stable on their treatment as opposed to attending primary care. the most reasons for this revolve around fears of inadequate psychiatric care from gps and the cost of gp consultations relative to the free consultations they get from specialised psychiatric services. this can significantly restrict the capacity of specialised community mental health teams to take on new referrals from primary care. the irish government, the college of general practitioners, and the college of psychiatry of ireland need to work collaboratively to remove the bottlenecks which hinder the active involvement of primary care in the management of patients with enduring mental health difficulties. | objective. to investigate the preferences of psychiatric patients regarding attendance for their continuing mental health care once stable from a primary care setting as opposed to a specialized psychiatric service setting. methods. 150 consecutive psychiatric patients attending outpatient review in a community mental health centre in dublin were approached and asked to complete a semistructured questionnaire designed to assess the objectives of the study. results. 145 patients completed the questionnaire giving a response rate of 97%. ninety - eight patients (68%) preferred attending a specialized psychiatry service even when stabilised on their treatment. the common reason given by patients in this category was fear of substandard quality of psychiatric care from their general practitioners (gps) (67 patients, 68.4%). twenty - nine patients (20%) preferred to attend their gp for continuing mental health care. the reasons given by these patients included confidence in gps, providing same level of care as psychiatrist for mental illness (18 patients or 62%), and the advantage of managing both mental and physical health by gps (13 patients, 45%). conclusion. most patients who attend specialised psychiatric services preferred to continue attending specialized psychiatric services even if they become mentally stable than primary care, with most reasons revolving around fears of inadequate psychiatric care from gps. |
gastric cancer is one of the most common cancers in korea, and the fourth most common cancer worldwide. although the proportion of early gastric cancer has increased as a result of routine screening in korea and japan, gastric cancer is often diagnosed in the advanced stage. however, even after curative surgery, locoregional recurrence and distant metastasis are significant problems, and the survival outcome is usually unsatisfactory. the intergroup 0116 (int 0116) study demonstrated a major survival advantage by the use of adjuvant chemoradiotherapy (crt) following curative surgery. the results of this study have changed the standard of care favoring the use of both chemotherapy and radiation therapy (rt) in the postoperative setting. treatment planning guidelines recommended by the int 0116 study suggested that parallel opposed anteroposterior - posteroanterior (ap - pa) fields represent a practical arrangement for the majority of patients. with the wide availability of computerized treatment planning systems, the 3-dimensional (3d) plan has enabled more accurate delineation of high - risk target volumes, and usage of unconventional field arrangements for better dose distribution. however, computed tomography (ct)based simulation was not mandatory in the past, and the majority of patients were treated based on the initial preoperative ct information, which did not reflect postoperative geometric changes in the internal organs. the actual location of the kidneys after surgery was shifted upwards, and a considerable portion of the left kidney could have been exposed to radiation if the treatment plan had been made based on the preoperative ct alone. therefore, we hypothesize that use of the ct - based (3d) rt plan, via improved and optimized radiation dose delivery and normal tissue sparing, would lead to decreased treatment - related toxicity and improved survival outcomes. the 2-dimensional (2d) plan based on the preoperative ct was used until july 2007, and the 3d simulation was adopted thereafter at samsung medical center. first, we compared the dosimetric parameters of ap - pa beam arrangement between 3d simulation and the conventional fluoroscopic 2d - based simulation plan. a few clinical studies have reported on differences in the dosimetric parameters of 3d ap - pa versus 2d ap - pa plans. second, we evaluated the clinical impact of 3d versus 2d simulation in terms of acute toxicity, recurrence, and survival, by performing a matched cohort study. retrospective analyses were performed in 321 patients treated with adjuvant crt following curative surgery and d2 dissection from 2006 to 2008 at samsung medical center. basic eligibility criteria for postoperative adjuvant treatment were similar to those used in the int 0116 trial except for the inclusion of patients with positive resection margins after surgery. rt with 2d plan, which was in concordance with the int 0116 protocol, was applied in 121 patients from january 2006 to may 2007 (2d group). rt with a ct - based treatment plan was applied in 200 patients from june 2007 to september 2008 (3d group) : ap - pa beams were used in 98 patients ; and 3-beam arrangements were used in 102 patients. after exclusion of 102 patients treated with the ct - based 3-beam plan, 98 patients treated with the ct - based ap - pa plan were compared with their 2d counterparts. for the purpose of objective comparability, stages were matched, and 158 patients were eligible for the analysis : 98 patients in the 3d group ; and 60 patients in the 2d group. a list of the patients demographic, treatment - related, and pathologic results is shown in table 1. the median follow - up period was 24 months (range, 5 to 29 months) in the 3d group and 36 months (range, 5 to 51 months) in the 2d group. the median age was 53 years (range, 24 to 75 years), and male predominance was observed in both groups. the proportion of younger patients (50 years) was greater in the 3d group (36.7%) than in the 2d group (21.7% ; p=0.041). no differences in the overall american joint committee on cancer (ajcc) stage, t stage, and n stage were observed between the two groups. the 3d group included two patients with positive resection margins. a larger number of patients with close resection margins (less than 3 cm) was included in the 3d group than in the 2d group (47 and 23, respectively ; p=0.024). two chemotherapy regimens were used during the current study period. the first regimen (iv fluorouracil and leucovorin [fl ] regimen) consisted of intravenous fluorouracil (400 mg / m / day) and intravenous leucovorin (20 mg / m / day) for five consecutive days, starting at 3 - 7 weeks following surgery, followed by crt beginning at four weeks after initiation of the first fl chemotherapy cycle. crt consisted of a total radiation dose of 45 gy over 5 weeks, with administration of intravenous fluorouracil (400 mg / m / day) and leucovorin (20 mg / m / day) on the first four and the last three days of rt. at 4 weeks following completion of crt, two additional cycles of 5-day fl chemotherapy were administered at 4-week intervals. the second chemotherapy regimen (oral capecitabine and cisplatin [cp ] regimen) consisted of oral capecitabine (1,000 mg / m, 2 times / day) for 14 consecutive days together with intravenous cisplatin (60 mg / m / day) on the first day of each chemotherapy cycle spaced three weeks apart. after two cycles of cp chemotherapy, crt, with the same rt dose schedule as in the fl regimen, was administered concurrently with oral capecitabine (825 mg / m, 2 times / day) without intravenous cisplatin. at 3 weeks following completion of crt, two additional cycles of cp chemotherapy preoperative ct information was used as a reference for the location of the normal organs before july 2007. rt simulation was performed in the supine position with the arms down. for identification of the anastomotic site and the duodenal stump, the superior margin of the field was set at the upper border of t11 vertebral body or the anastomotic site with at least a 2-cm margin. the inferior border was located at the junction of l2 and l3 vertebral bodies including the head of the pancreas. the right lateral margin was placed at the most lateral portion of the porta hepatis before the bifurcation of the right portal vein or at the duodenal stump or the head of the pancreas with a 1-cm margin. the left lateral border was placed at one vertebral body width from the left lateral border of the vertebrae (fig. a total dose of 45 gy over 5 weeks in daily fractions of 1.8 gy was prescribed at the mid - depth at the isocenter by manual calculation without tissue heterogeneity correction. ct simulation was performed in the supine position with the arms down using iv contrast media. radiation was targeted to the anastomotic site, duodenal stump, and regional lymph nodes. the tumor bed was included in the radiation target volume only in the case of t4 lesion. the anastomotic site, duodenal stump, major vessels (celiac trunk, splenic vessels, superior mesenteric vessels), regional lymphatics around the major vessels, and normal parenchymal organs (liver, kidneys) were contoured on each ct slice for delineation of the clinical target volume (ctv) and the organs at risk (oar). the remnant stomach was not included in the target volume, according to previous studies by lim. and nam. the anastomotic site was excluded from the radiation field if the gross resection margin was 5 cm or greater. if the resection margin was less than 3 cm, the anastomotic site was included in the radiation field. if the resection margin was between 3 cm and 5 cm, inclusion of the anastomotic site was individualized considering the possible radiation toxicity to the adjacent normal structures. the upper, lower, and lateral margins were similar to those of the previous 2d plan, but individually modified based on the internal anatomic relationships. the irradiated nodal regions were individually modified based on the primary tumor location and the surgical findings. the definition of the japanese gastric cancer association was used to delineate the regional lymph node areas. number 7, 8, 9, 11, 12, 13, 14, and 16 lymph nodes were usually included. the parallel opposing oblique beam arrangements usually within 15 degree range were also used to reduce the radiation dose to the kidneys. a total dose of 45 gy over 5 weeks in daily fractions of 1.8 gy was prescribed usually at the isocenter or mid - point of the ctv (fig. the planning ct scans for each patient in the 3d group were retrieved for evaluation. for comparison of the dosimetric parameters between the 3d and 2d plans, second sets of radiation treatment plans were generated according to the same method used in the 2d group for each patient in the 3d group (virtual 2d plan of 3d group, v2d). the corresponding dose - volume histograms (dvhs) of v2d plans were recorded for the kidneys, liver, spinal cord, duodenum, pancreas, and bowel. the spinal cord, duodenum, and bowel are the typical serial organs, and the mean dose and the maximal point doses were recorded for comparison. the percentage of the kidney volume receiving more than 15 gy (v15) and 20 gy (v20), and the percentage of the liver volume receiving more than 30 gy (v30) are widely used in the literature for evaluation of renal and hepatic toxicities and were used for the current comparison. after completion of the planned adjuvant treatment course, regular follow - up was performed, including a physical examination, complete blood cell count (cbc), liver function test, chest x - ray, abdomino - pelvic ct, and gastrofiberscopy. follow - up intervals were 3 months for the first year, 6 months for the next 2 years and yearly thereafter. local recurrence was defined as recurrence at any of the anastomotic sites, duodenal stump, remnant stomach, and tumor bed. regional recurrence was defined as recurrence in the regional lymph nodes within the radiation field. distant metastasis was defined as recurrence outside the radiation field, including remote lymph node, peritoneal seeding, and other solid organ metastasis. if two or more failure sites developed at the same time, they were counted separately. overall survival (os) and disease - free survival (dfs) were estimated using the kaplan - meier method. the survival duration was defined as the time from surgery to the events or the last follow - up without events. chi - square test, cochran mantel - haenszel test, and wilcoxon rank - sum test were used for comparison of differences in the prognostic factors, patterns of recurrence, and complication between the groups. retrospective analyses were performed in 321 patients treated with adjuvant crt following curative surgery and d2 dissection from 2006 to 2008 at samsung medical center. basic eligibility criteria for postoperative adjuvant treatment were similar to those used in the int 0116 trial except for the inclusion of patients with positive resection margins after surgery. rt with 2d plan, which was in concordance with the int 0116 protocol, was applied in 121 patients from january 2006 to may 2007 (2d group). rt with a ct - based treatment plan was applied in 200 patients from june 2007 to september 2008 (3d group) : ap - pa beams were used in 98 patients ; and 3-beam arrangements were used in 102 patients. after exclusion of 102 patients treated with the ct - based 3-beam plan, 98 patients treated with the ct - based ap - pa plan were compared with their 2d counterparts. for the purpose of objective comparability, stages were matched, and 158 patients were eligible for the analysis : 98 patients in the 3d group ; and 60 patients in the 2d group. a list of the patients demographic, treatment - related, and pathologic results is shown in table 1. the median follow - up period was 24 months (range, 5 to 29 months) in the 3d group and 36 months (range, 5 to 51 months) in the 2d group. the median age was 53 years (range, 24 to 75 years), and male predominance was observed in both groups. the proportion of younger patients (50 years) was greater in the 3d group (36.7%) than in the 2d group (21.7% ; p=0.041). no differences in the overall american joint committee on cancer (ajcc) stage, t stage, and n stage were observed between the two groups. the 3d group included two patients with positive resection margins. a larger number of patients with close resection margins (less than 3 cm) was included in the 3d group than in the 2d group (47 and 23, respectively ; p=0.024). two chemotherapy regimens were used during the current study period. the first regimen (iv fluorouracil and leucovorin [fl ] regimen) consisted of intravenous fluorouracil (400 mg / m / day) and intravenous leucovorin (20 mg / m / day) for five consecutive days, starting at 3 - 7 weeks following surgery, followed by crt beginning at four weeks after initiation of the first fl chemotherapy cycle. crt consisted of a total radiation dose of 45 gy over 5 weeks, with administration of intravenous fluorouracil (400 mg / m / day) and leucovorin (20 mg / m / day) on the first four and the last three days of rt. at 4 weeks following completion of crt, two additional cycles of 5-day fl chemotherapy were administered at 4-week intervals. the second chemotherapy regimen (oral capecitabine and cisplatin [cp ] regimen) consisted of oral capecitabine (1,000 mg / m, 2 times / day) for 14 consecutive days together with intravenous cisplatin (60 mg / m / day) on the first day of each chemotherapy cycle spaced three weeks apart. after two cycles of cp chemotherapy, crt, with the same rt dose schedule as in the fl regimen, was administered concurrently with oral capecitabine (825 mg / m, 2 times / day) without intravenous cisplatin. at 3 weeks following completion of crt, two additional cycles of cp chemotherapy were administered at 3-week intervals. preoperative ct information was used as a reference for the location of the normal organs before july 2007. rt simulation was performed in the supine position with the arms down. for identification of the anastomotic site and the duodenal stump, the superior margin of the field was set at the upper border of t11 vertebral body or the anastomotic site with at least a 2-cm margin. the inferior border was located at the junction of l2 and l3 vertebral bodies including the head of the pancreas. the right lateral margin was placed at the most lateral portion of the porta hepatis before the bifurcation of the right portal vein or at the duodenal stump or the head of the pancreas with a 1-cm margin. the left lateral border was placed at one vertebral body width from the left lateral border of the vertebrae (fig. a total dose of 45 gy over 5 weeks in daily fractions of 1.8 gy was prescribed at the mid - depth at the isocenter by manual calculation without tissue heterogeneity correction. ct simulation was performed in the supine position with the arms down using iv contrast media. radiation was targeted to the anastomotic site, duodenal stump, and regional lymph nodes. the tumor bed was included in the radiation target volume only in the case of t4 lesion. the anastomotic site, duodenal stump, major vessels (celiac trunk, splenic vessels, superior mesenteric vessels), regional lymphatics around the major vessels, and normal parenchymal organs (liver, kidneys) were contoured on each ct slice for delineation of the clinical target volume (ctv) and the organs at risk (oar). the remnant stomach was not included in the target volume, according to previous studies by lim. and nam. the anastomotic site was excluded from the radiation field if the gross resection margin was 5 cm or greater. if the resection margin was less than 3 cm, the anastomotic site was included in the radiation field. if the resection margin was between 3 cm and 5 cm, inclusion of the anastomotic site was individualized considering the possible radiation toxicity to the adjacent normal structures. the upper, lower, and lateral margins were similar to those of the previous 2d plan, but individually modified based on the internal anatomic relationships. the irradiated nodal regions were individually modified based on the primary tumor location and the surgical findings. the definition of the japanese gastric cancer association was used to delineate the regional lymph node areas. number 7, 8, 9, 11, 12, 13, 14, and 16 lymph nodes were usually included. the parallel opposing oblique beam arrangements usually within 15 degree range were also used to reduce the radiation dose to the kidneys. a total dose of 45 gy over 5 weeks in daily fractions of 1.8 gy was prescribed usually at the isocenter or mid - point of the ctv (fig. the planning ct scans for each patient in the 3d group were retrieved for evaluation. for comparison of the dosimetric parameters between the 3d and 2d plans, second sets of radiation treatment plans were generated according to the same method used in the 2d group for each patient in the 3d group (virtual 2d plan of 3d group, v2d). the corresponding dose - volume histograms (dvhs) of v2d plans were recorded for the kidneys, liver, spinal cord, duodenum, pancreas, and bowel. the spinal cord, duodenum, and bowel are the typical serial organs, and the mean dose and the maximal point doses were recorded for comparison. the percentage of the kidney volume receiving more than 15 gy (v15) and 20 gy (v20), and the percentage of the liver volume receiving more than 30 gy (v30) are widely used in the literature for evaluation of renal and hepatic toxicities and were used for the current comparison. preoperative ct information was used as a reference for the location of the normal organs before july 2007. rt simulation was performed in the supine position with the arms down. for identification of the anastomotic site and the duodenal stump, the superior margin of the field was set at the upper border of t11 vertebral body or the anastomotic site with at least a 2-cm margin. the inferior border was located at the junction of l2 and l3 vertebral bodies including the head of the pancreas. the right lateral margin was placed at the most lateral portion of the porta hepatis before the bifurcation of the right portal vein or at the duodenal stump or the head of the pancreas with a 1-cm margin. the left lateral border was placed at one vertebral body width from the left lateral border of the vertebrae (fig. a total dose of 45 gy over 5 weeks in daily fractions of 1.8 gy was prescribed at the mid - depth at the isocenter by manual calculation without tissue heterogeneity correction. ct simulation was performed in the supine position with the arms down using iv contrast media. radiation was targeted to the anastomotic site, duodenal stump, and regional lymph nodes. the tumor bed was included in the radiation target volume only in the case of t4 lesion. the anastomotic site, duodenal stump, major vessels (celiac trunk, splenic vessels, superior mesenteric vessels), regional lymphatics around the major vessels, and normal parenchymal organs (liver, kidneys) were contoured on each ct slice for delineation of the clinical target volume (ctv) and the organs at risk (oar). the remnant stomach was not included in the target volume, the anastomotic site was excluded from the radiation field if the gross resection margin was 5 cm or greater. if the resection margin was less than 3 cm, the anastomotic site was included in the radiation field. if the resection margin was between 3 cm and 5 cm, inclusion of the anastomotic site was individualized considering the possible radiation toxicity to the adjacent normal structures. the upper, lower, and lateral margins were similar to those of the previous 2d plan, but individually modified based on the internal anatomic relationships. the irradiated nodal regions were individually modified based on the primary tumor location and the surgical findings. the definition of the japanese gastric cancer association was used to delineate the regional lymph node areas. number 7, 8, 9, 11, 12, 13, 14, and 16 lymph nodes were usually included. the parallel opposing oblique beam arrangements usually within 15 degree range were also used to reduce the radiation dose to the kidneys. a total dose of 45 gy over 5 weeks in daily fractions of 1.8 gy was prescribed usually at the isocenter or mid - point of the ctv (fig. the planning ct scans for each patient in the 3d group were retrieved for evaluation. for comparison of the dosimetric parameters between the 3d and 2d plans, second sets of radiation treatment plans were generated according to the same method used in the 2d group for each patient in the 3d group (virtual 2d plan of 3d group, v2d). the corresponding dose - volume histograms (dvhs) of v2d plans were recorded for the kidneys, liver, spinal cord, duodenum, pancreas, and bowel. the spinal cord, duodenum, and bowel are the typical serial organs, and the mean dose and the maximal point doses were recorded for comparison. the percentage of the kidney volume receiving more than 15 gy (v15) and 20 gy (v20), and the percentage of the liver volume receiving more than 30 gy (v30) are widely used in the literature for evaluation of renal and hepatic toxicities and were used for the current comparison. after completion of the planned adjuvant treatment course, regular follow - up was performed, including a physical examination, complete blood cell count (cbc), liver function test, chest x - ray, abdomino - pelvic ct, and gastrofiberscopy. follow - up intervals were 3 months for the first year, 6 months for the next 2 years and yearly thereafter. local recurrence was defined as recurrence at any of the anastomotic sites, duodenal stump, remnant stomach, and tumor bed. regional recurrence was defined as recurrence in the regional lymph nodes within the radiation field. distant metastasis was defined as recurrence outside the radiation field, including remote lymph node, peritoneal seeding, and other solid organ metastasis. if two or more failure sites developed at the same time, they were counted separately. the mean values of 3d and v2d were assessed using the paired t test. overall survival (os) and disease - free survival (dfs) the survival duration was defined as the time from surgery to the events or the last follow - up without events. chi - square test, cochran mantel - haenszel test, and wilcoxon rank - sum test were used for comparison of differences in the prognostic factors, patterns of recurrence, and complication between the groups. two different rt plans derived from the same patient in the 3d group (3d vs. v2d) were compared. the median field width and length in the 3d group and v2d group was 10.0 cm (range, 8.0 to 15.0 cm) and 12.5 cm (range, 9.0 to 17.0 cm), and 13.0 cm (range, 11.0 to 15.0 cm) and 14.8 cm (range, 12.0 to 17.0 cm), respectively (p 50 years), sex, eastern cooperative oncology group (ecog), t, n, stage, pathology, tumor grade, status of the resection margin, type of surgery, chemotherapy, and rt plan. in univariate analysis, ecog 1 and 2 were poor prognostic factors compared to ecog 0, advanced t, n and ajcc stage, positive or close resection margin, and type of surgery (subtotal gastrectomy with billroth ii reconstruction and total gastrectomy was worse than subtotal gastrectomy with billroth i reconstruction) for dfs, distant recurrence - free survival, and os, and close resection margin for regional recurrence - free survival. in multivariate analysis, ecog, advanced t and n, and status of the resection margin were meaningful for os. the acute toxicity profiles of patients treated with fl regimen and those treated with cp regimen were analyzed separately. no difference was observed in both groups during and one month post - rt regardless of the chemotherapy regimen used, as shown in table 5, whereas the between - group difference in the incidence of acute toxicity during rt with fl regimen was marginal (p=0.054). major complications, including grade 4 bowel toxicity were observed in two patients of the 2d group. small bowel resection and anastomosis was performed in one patient with bowel perforation at six months post - adjuvant crt and in the other patient with adhesive bowel obstruction at 14 months post - treatment. serial changes in cbc and blood chemistry of all patients were assessed at five time points before, during, and after rt : preoperative (baseline) ; postoperative (before the first chemotherapy) ; pre - rt ; during rt ; and after rt (at 3 - 4 weeks after completion of rt, just before initiation of the next chemotherapy cycle). no statistically significant differences in cbc and blood chemistry tests were observed between the two groups, as shown in fig. two different rt plans derived from the same patient in the 3d group (3d vs. v2d) were compared. the median field width and length in the 3d group and v2d group was 10.0 cm (range, 8.0 to 15.0 cm) and 12.5 cm (range, 9.0 to 17.0 cm), and 13.0 cm (range, 11.0 to 15.0 cm) and 14.8 cm (range, 12.0 to 17.0 cm), respectively (p 50 years), sex, eastern cooperative oncology group (ecog), t, n, stage, pathology, tumor grade, status of the resection margin, type of surgery, chemotherapy, and rt plan. in univariate analysis, ecog 1 and 2 were poor prognostic factors compared to ecog 0, advanced t, n and ajcc stage, positive or close resection margin, and type of surgery (subtotal gastrectomy with billroth ii reconstruction and total gastrectomy was worse than subtotal gastrectomy with billroth i reconstruction) for dfs, distant recurrence - free survival, and os, and close resection margin for regional recurrence - free survival. in multivariate analysis, ecog, advanced t and n, and status of the resection margin were meaningful for os. the acute toxicity profiles of patients treated with fl regimen and those treated with cp regimen were analyzed separately. no difference was observed in both groups during and one month post - rt regardless of the chemotherapy regimen used, as shown in table 5, whereas the between - group difference in the incidence of acute toxicity during rt with fl regimen was marginal (p=0.054). major complications, including grade 4 bowel toxicity were observed in two patients of the 2d group. small bowel resection and anastomosis was performed in one patient with bowel perforation at six months post - adjuvant crt and in the other patient with adhesive bowel obstruction at 14 months post - treatment. serial changes in cbc and blood chemistry of all patients were assessed at five time points before, during, and after rt : preoperative (baseline) ; postoperative (before the first chemotherapy) ; pre - rt ; during rt ; and after rt (at 3 - 4 weeks after completion of rt, just before initiation of the next chemotherapy cycle). no statistically significant differences in cbc and blood chemistry tests were observed between the two groups, as shown in fig. this is the first study to quantify the dosimetric and clinical influences of the 3d plan with ct - based simulation in postoperative crt for gastric cancer in terms of ap - pa field arrangement. the term first was used after conducting electronic searches on pubmed using the following keywords : stomach cancer, postoperative radiation therapy, ct simulation, ap - pa, and clinical outcomes. theoretically, 3d - crt enables more conformal dose delivery and normal tissue sparing than classic 2d rt. several studies concerning radiation field arrangements in postoperative crt for gastric cancer from the dosimetric aspects have been reported. for example, an australian group suggested the split - field technique, instead of the ap - pa plan, by dividing the planning target volume into two abutting sections, with each section treated using a separate, optimized field arrangement. they reported lower mean doses to the right kidney (18 gy vs. 35 gy in 1/3 kidney, 6 gy vs. 4 gy in 2/3 kidney), the left kidney (18 gy vs. 40 gy in 1/3 kidney, 5 gy vs. 5 gy in 2/3 kidney), and the spinal cord (17 gy vs. 45 gy), and a higher dose to the liver (mean, 31 gy vs. 10 gy in 1/3 liver) in 15 studied patients. however, the problems of match - line, such as generation of cold or hot area, were unavoidable despite using a single isocenter technique. another report by a group in israel compared a non - coplanar four - field arrangement with the ap - pa plan and the four - field box technique in 19 patients. according to the results, the doses to the spinal cord and both kidneys intensity - modulated rt (by either step - and - shoot or tomotherapy) is another treatment option under investigation, with more sparing of dose to the kidney and cord. however, it appears to offer only limited advantages when compared with sophisticated 3d conformal rt planning. all of these studies were plan comparison studies using multiple beam arrangements with ap - pa plans without clinical results, which are different from the current study comparing ap - pa 2-beam arrangements contingent upon ct simulation and analyzing relevant clinical results in a larger number of patients. parallel opposed ap - pa fields are considered the most practical arrangement for the overwhelming majority of postoperative adjuvant radiotherapy cases. in addition, the current national comprehensive cancer network (nccn) guidelines strongly recommend the use of ct simulation and 3d treatment plan. however, the ct - based simulation was not mandatory in the past and the majority of patients were treated based on the initial preoperative ct information, which did not reflect the postoperative anatomic changes. the gastric surgical adjuvant rt consensus report recommended obtainment of three sets of simulation films for the traditional 2d treatment plan : the first set for identification of surgical clips and staple lines ; the second set following administration of intravenous contrast for identification of the location of the kidneys ; and the final set following barium swallow for identification of the anastomotic site, as well as the gastric stump. before the ct era, the second set was not routinely obtained in practice following administration of intravenous contrast, and the first and third sets were usually used for the 2d simulation. the primary sites of the tumor, the major vasculature including the celiac axis, superior and inferior mesenteric arteries, porta hepatis, splenic artery, and both kidneys were identified based on preoperative ct images, without considering the probable postoperative position shifts. only on rare occasions, when ct scan was performed postoperatively because of surgical problems, such as abdominal pain with fever, sustained ileus, suspicious abscess formation, etc., the postoperative ct scan could be used as the reference for the target delineation. it is usually recommended that the doses to the surrounding organs should be kept as low as possible in order to reduce treatment - related side effects. in this study, for the purpose of comparing the dosimetric parameters between plans with or without ct - based simulation, second alternative rt plans, which followed the conventional 2d plan method with anatomic reference using the preoperative ct, were generated in the same patients. as expected, all dosimetric parameters of the normal tissues were lower in patients of the 3d group, without exception. emami. reported that the tolerance doses associated with a 5% risk of renal dysfunction at five years were 23 gy after single, whole kidney irradiation and 20 gy if both kidneys were irradiated. in addition, it is known that development of radiation - induced nephropathy could occur even at doses lower than the tolerance limit. although there are reports of development of impaired renal function in children at 12 to 14 gy, the threshold dose for renal damage in adults with normal baseline renal function is approximately 15 gy with conventional fractionation. renal damage may not manifest for years following rt, therefore, long - term follow - up is important. in one long - term study, therefore, the renal dose should be kept as low as possible through careful treatment planning, and ct simulation appears mandatory to achievement of this goal. in the current study, the mean dose to the left kidney was 767.4 cgy versus 1,734.2 cgy and that of the right kidney was 656.0 cgy versus 965.0 cgy for the 3d and v2d group favoring ct simulation, respectively (p 0.05), whereas the difference in the incidence of acute toxicity during rt with fl regimen was marginal with a p - value of 0.054. the plan comparison was performed between the 3d group and the v2d group, a virtual 2d plan of the 3d group, not between the 3d group and the 2d group. in this respect, it should be considered that the dosimetric results of the v2d group may not reflect the actual clinical features of the 2d group as in the 3d group. in summary, the 3d plan enabled precise delineation of the target volume and oar by visualization of geometric changes in the internal organs after surgery. the dvh of normal tissues in the 3d plan was superior to that of the v2d plan ; however, similar clinical features were observed between the 3d group and the 2d group. the dosimetric parameters of normal tissues in the 3d ap - pa plan were lower than those of the v2d ap - pa plan, without exception, however, the clinical features, including acute toxicity, recurrence, and survival were similar between the 3d group and the 2d group. our findings could facilitate understanding of the merits and demerits of ct - based ap - pa planning over 2d planning in postoperative treatment of patients with advanced gastric cancer. | purposethe purpose of this study is to investigate the dosimetric and clinical influence of computed tomography based (3-dimensional [3d ]) simulation versus conventional 2-dimensional (2d)based simulation in postoperative chemoradiotherapy (crt) for patients with advanced gastric cancer in terms of parallel opposed anteroposterior - posteroanterior field arrangement.materials and methodsa retrospective stage - matched cohort study was conducted in 158 patients treated with adjuvant crt following curative surgery and d2 dissection from 2006 to 2008 at samsung medical center : 98 patients in the 3d group ; and 60 patients in the 2d group. for comparison of the dosimetric parameters between 3d plan and 2d plan, second sets of radiation treatment plans were generated according to the same target delineation method used in the 2d group for each patient in the 3d group (v2d). acute toxicity, recurrence, and survival were analyzed. the median follow - up period was 28 months (range, 5 to 51 months).resultsthe 3d group showed better dose - volume histogram (dvh) profiles than the v2d group for all dosimetric parameters, including the kidneys, liver, spinal cord, duodenum, pancreas, and bowel. however, no difference in acute gastrointestinal toxicity and survival outcomes was observed between the 3d group and the 2d group.conclusionthe 3d plan enabled precise delineation of the target volume and organs at risk by visualization of geometric changes in the internal organs after surgery. the dvh of normal tissues in the 3d plan was superior to that of the v2d plan, but similar clinical features were observed between the 3d group and the 2d group. |
the exponential growth in numbers of older adults is unprecedented in the history of the united states. longer life spans and aging baby boomers will double the population of americans aged 65 years or older during the next couple of decades to about 72 million. thus, it is expected that, by 2030, older adults will account for nearly 20% of the united states population. currently, there are approximately 40 million persons aged 65 years and over in the united states. this represents 13% of the united states population, meaning that 1 in every 8 americans is in this age group. along with the general aging trends for america 's population, a significant increase in racial and ethnic diversity will be also observed. although young individuals in the united states current reflect diversity more strikingly than their older counterparts, the racial and ethnic makeup of older adults is also changing. the african american older population was about 3.3 million in 2010 and is projected to grow over 9.9 million by 2050. currently, african americans aged 65 years and over account for approximately 8% of the older population ; however, this number is expected to increase to 11% by the year of 2050 [2, 3 ]. population aging comes with wide - ranging challenges, not only for the individual, but also for society, especially for the health sector. expenditures for health care are expected to increase at considerable levels as chronic diseases increasingly affect the growing numbers of older adults in most developed countries [1, 4 ]. high rates of chronic diseases and disabilities are observed in the older population as recently demonstrated by a centers for disease control and prevention report. african americans bear a disproportionate burden of disease morbidity, disabilities, and injuries compared to other racial groups. for instance, information shows that in the united states nearly 30% of the population aged 65 years and over has diabetes. among them, african americans (18.7%) present the highest prevalence compared to whites (10.2%). in addition, other health issues also appear to be disproportionately prevalent in the african american population. for example, african americans exhibit higher level of disabilities compared to whites [7, 8 ]. different factors, including physical inactivity, have been suggested to explain health disparities, such as higher rates of diseases in african americans [912 ]. african american women are a particular vulnerable group to unhealthy lifestyles, such as physical inactivity, and the resultant chronic diseases and conditions. physical activity has the potential to promote health and well - being, delay the onset of chronic diseases and disabilities, and reduce the risk of premature death [13, 14 ]. however, for health benefits, it is recommended that adults accumulate at least 150 minutes per week of moderate to vigorous intensity physical activity. evidence - based interventions focused on lifestyle behavior changing, such as physical activity promotion, have been recommended to enhance health in different age groups including the older adult population. despite solid evidence of the benefits of physical activity, participation rates are low worldwide with the older population reporting higher levels of inactivity compared to young age groups. however, data from the behavioral risk factor surveillance system shows that in the united states african american present with very low rates of physical activity participation at recommended levels. additionally, older african american women appear to be a vulnerable group to physical inactivity. factors such as health issues, family demands, lack of money, reduced public resources available, and neighborhood safety have been suggested as factors preventing individuals from engaging in physical activity among african americans and other at risk population groups [20, 21 ]. however, it is also possible that the lack of physical activity among older african americans could be related to public health messages. public health messages used to educate the general public towards physical activity may not be clearly interpreted by, or are not adequately reaching this population. as interventions should be culturally tailored, so should the messages used to promote positive behaviors such as physical activity. thus, it is essential to first understand how a certain group of interest views a given topic. in this sense, a study aiming to explore how older african american women conceptualize physical activity is of great importance and is a step towards the development of culturally sensitive messages that may have a better impact on this population. furthermore, cultural values and the legacy of racism, segregation, and discrimination carried by this population may shape their views of opportunities for and barriers to physical activity. by employing objective assessment of physical activity in conjunction with a participatory research approach, moreover, facilitators of and barriers to being physically active in their local environment were also examined. physical activity is a complex and dynamic behavior that clearly depends on multiple factors as previously mentioned. in this sense, ecological models are adequate and effective for better understanding of complex health behaviors that are involved in daily living, such as physical activity. this study was driven by the social ecological model of health behavior which suggests that individual behavior does not occur in isolation but emerges from a complex multi - level interaction between the individual, the environment, and the social cultural context where they live. this model provides a useful and important framework for understanding the numerous factors enabling or detracting from participation in this complex and dynamic behavior. a cross - sectional mixed - methods research design approach employing a participatory research technique was adopted. the institutional review board of the university of illinois approved the research protocol and signed inform consent was obtained from participants before data collection. a total of 7 older african american women aged 65 to 75 years living in urbana - champaign, il, were interviewed. the recruitment process involved flyers posted in health centers, senior centers, and local food stores. participants had to be able to walk independently and to be able to answer questions coherently by themselves. this study did not include older adults living in institutionalized settings (i.e., nursing homes, etc.), as well as individuals with significant cognitive and physical functioning decline. participants selected to take part in this study were cash compensated throughout each step of the study. participants in this study followed three different steps during the data collection process that occurred during october and november of 2013. participants completed a questionnaire to collect information on age, height, weight, years of education, income level, marital status, self - reported health, number of diagnosed diseases, medications taken, and health insurance coverage. at this phase, participants could select whether to meet at the investigators laboratory / office or at their own home. participants wore an accelerometer at the hip (actigraph gt3x plus) for 7 consecutive days for physical activity assessment. along with the week wearing the accelerometer, participants were given a disposable camera to take pictures of meaningful places (indoor and outdoor) that they go and things they do in their daily lives, as well as people they interact with, which for them were related of being active or physical activity. photo elicitation is a participatory research technique that invites participants to take photographs of salient features in their lives that are personally meaningful and possess significant explanatory power. after completion, accelerometers and cameras were retrieved for physical activity data analysis and photo development. after photo development, participants were invited to take part in the individual interview, which was conducted in a quiet room (investigator 's office). among approximately 25 photos, four meaningful photos were selected by the participants and 2 additional ones were selected by the investigator. the 2 photos selected by the investigator were selected with the goals of providing different insights from the ones selected by the participant, thereby assisting with the physical activity discussion. interviews were conducted in english and lasted about 60 minutes. during the interview, participants were asked questions about the photos and their representation. additionally, follow - up questions were used to discuss physical activity (interview guide available upon request with the investigator). at the end of each interview the entire set of photos provided by the participant were displayed in the table. follow, participants were asked to take one more look on the entire set of photos to talk about anything that was not previously covered in the interview, if any. the interviews were recorded using a digital recorder and transcribed to a word document by native english speakers. the 150 minutes per week of moderate to vigorous physical activity intensity was adopted as the cut point to classify the participants as active or inactive for health benefits. thematic analysis consists of the identification of themes that naturally emerge from the data as being important to the description of the phenomenon. therefore, after transcription, the interviews were coded and analyzed for common themes and key patterns that emerged from the conversations. credibility and reliability of the data were examined employing investigators ' triangulation with 2 other researcher colleagues. seven older african american women took part in this study (68.43 3.20). all participants were classified as inactive for health benefits according to the criteria adopted above (figure 1). table 1 displays, in detail, the sociodemographic and health information of the participants. regarding habitual physical activity, accelerometer data showed that none of the 7 participants achieved the recommended level of physical activity for health benefits. figure 1 displays the current recommendations for physical activity to achieve health benefits, the mean level of physical activity observed in the participants of this study, and the findings observed by troiano and colleagues study conducted in a national sample in the united states. the women in this study viewed physical activity as a broad concept, which extends beyond traditional exercise routines. although they did not provide a clear definition of what physical activity is, some of the participants were able to suggest examples of what physical activity means to them. the way the older inactive african american women conceptualized physical activity was generally consistent with a public health definition of physical activity, that is, covering a variety of lifestyle - related activities. the following is an example: it is like getting out there and mowing the grass ; getting out there and cleaning the gutters, painting like i paint. and that is what i think, and apart from that is exercising too. (female 71) it is like getting out there and mowing the grass ; getting out there and cleaning the gutters, painting like i paint. and that is what i think, and apart from that is exercising too. (female 71) when asked about how much physical activity women in their age should do, and if they ever heard about any government recommendation regarding physical activity, the answers were diverse. the united states guidelines recommend that every adult should accumulate at least 150 minutes per week of moderate to vigorous physical activity for health benefits. however, none of the interviewed women appeared to be aware of the current recommendations. although they all agreed that being physically active was important, there was a misconception regarding the amount needed. in addition, none of the women talked about intensity, which is an important element within the recommendation along with frequency and duration to achieve health benefits. the following is an example: as much as they can you do what you can ! but be consistent you know ? even if you have a walker, you do that. (the same woman said) twenty, ten minutes every morning of physical exercise and that is all the government requires. but that is like selling a product or something so i do not know the validity of those type [sic ] of things. (female 71) as much as they can you do what you can ! but be consistent you know ? this is just my opinion. (the same woman said) twenty, ten minutes every morning of physical exercise and that is all the government requires. but that is like selling a product or something so i do not know the validity of those type [sic ] of things. (female 71) the interviews revealed that despite agreeing that some physical activity is better than nothing, women in this study understood little about the specific details of physical activity recommendations in terms of frequency, duration, and intensity. the older african american women described different factors related to social support, that is, friends ; senior centers and churches as facilitators for physical activity. women talked how having a companion for physical activity could be an encouragement to be active. it takes a different type of courage and strength for people to go and do something (female 65). most of the time i try to go down to douglas center at least for 45 minutes a day maybe not often [sic ] fridays but most of the time for about 45 minutes the senior building (douglas center annex) in the mornings i would walk over there for, [sic ] maybe a half - hour to 45 minutes. moreover, the interviews revealed that church initiatives towards physical activity may be a promising way to promote physical activity among african american women. the following is an example : from time to time, we have people. we have students that come through we have people who come through and we try to do some programming one young man that comes through and he was teaching us tai chi. participants recognized the importance of green areas and parks nearby as facilitators for physical activity. the following is an example : and this is like in the back of my house you know there is a big field and there is like a walkway through the park district i just like the nature, it just lifts you up, it is just beauty. it is a beauty of nature and it makes you eyes get in tune with nature. i love to hear the birds, i love to hear the crickets, i love all of that ; the creatures that are on the earth, now does that make sense ? (female 67). african american women participating in this study talked about how health problems related to having a chronic physical condition prevent them from being more active. i need a new knee replacement (female talking about reason on [sic ] why older african americans are not so active). i am trying to get my friends to walk more, like i tell my friend [she ] now she had a knee replacement and she will say (you know i can not walk) (female 66). environmental barriers emerged in terms of bad weather and lack of safety in the environment, that is, cracked sidewalks, and neighborhood in the context of fear of crime. the following is an example : so it is a lot of walking area ; and then sometime i come back down kirby. so i just like i said i like walking ; but i do not like walking in the cold (female 66). in addition, problems in the neighborhood related to lack of infrastructure such as poor sidewalks and fear - related violence were expressed as factors detracting participants from being more active. the following is an example : you see this here (talking about a cracked sidewalk). my friend actually did that and she had to go to the doctor and they had to do a mri. that is like about 2 inches up and if you are walking and you are not looking, anybody not even an old person but even a child could fall and hurt themselves (female 67) ; and when it was nice weather, they have their hoods on their heads. so i got that feeling that something was not quite right if you cover it up, you know.. table 2 summarizes the facilitators and barriers influencing physical activity that emerged from participants ' photos and interviews. factors influencing physical activity in different age groups have received increased attention due to concerns regarding physical inactivity and its negative impact on individual health and cost to the society. this study adopted a mixed - methods approach employing a participatory research technique to explore perceptions of and factors influencing physical activity among older african american women. it was observed that, on average, women participating in this study perform nearly 61 minutes per week of moderate to vigorous physical activity. this value is less than half of the current recommended level of physical activity to achieve health benefits. these authors observed in a national sample of older adults in the united states that african americans / blacks aged 60 years and over perform on average nearly 41 minutes per week of the recommended level of physical activity. however, the values observed for the women in this study are similar to the values observed by troiano and colleagues when examining physical activity in older white and mexican american women of similar age. the averages observed were, respectively, 61.6 and 58.1 minutes per week. taken together, these findings suggest that physical inactivity continues to be a concern in the older adult population in the united states. in this sense, urged public health actions are needed to mitigate such problem. furthermore, it was observed that many participants lack basic knowledge regarding recommended levels of physical activity, especially in terms of frequency, duration, and intensity. moreover, it was observed that women in this study believe that the amount of physical activity needed for people in their age should be determined by the individual. these findings are similar to those observed by wilcox. in a study of underactive rural women living in south carolina. similar to our findings, the authors also observed that their participants held the opinion that frequency, duration, and intensity should be determined by the individual. taken together, these findings suggest that the promotion of the physical activity guidelines for americans should be stressed in order to make individuals more aware of the scientific evidence regarding the quantity and intensity of physical activity needed to achieve health benefits. even though attempts to disseminate information about the physical activity guidelines for americans exist (e.g., websites), none of the participants in this study heard about any government recommendations for physical activity. although all women in this study agreed that some physical activity is better than none, the findings suggest that none of them appear to be fully aware of some of the basic recommendations for physical activity to achieve health benefits. our in - depth interviews suggest that social and environmental factors often serve as facilitators of physical activity in this population. regarding barriers, a number of personal and environmental factors were found to be barriers to physical activity. these findings are similar to those observed by mathews. in a multicultural study conducted among older adults as well as several other studies in the literature [20, 2831 ]. for instance, mathews and colleagues examined physical activity enablers and barriers in a sample of older americans composed of 6 racial / ethnic groups (i.e., african americans, american indians, latinos, chinese, vietnamese, and whites). the authors observed that no barriers to physical activity were mentioned in common across all groups ; however, barriers discussed frequently by at least 3 racial / ethnic groups included physical health problems, built environment / community design, financial costs, weather, and lack of time. common facilitators across 5 or more groups were observed by the authors who found that social support, conducive built environment, health benefits, and physical activity programs were reported as physical activity enablers by the participants. belza and colleagues also found similar findings for both enablers of and barriers to physical activity studying the most prevalent racial / ethnic groups of older adults living in united states. taken together, the findings from these studies allied to the findings of the present study suggest that most of the barriers and facilitators for physical activity are not exclusive for african americans. similar factors positively and negatively affecting physical activity participation have been reported by other racial groups. these findings reinforce current knowledge of factors associated with physical inactivity in older african americans and older adults in general and constitute important implications for public health initiatives and community - based interventions aiming to promote active living among african americans. both facilitators and barriers related to physical activity expressed by the women participating in this study are in line with proximal and distal factors influencing physical activity proposed by the social ecological model of health behavior. based on the information gathered from the participants, it is noteworthy to highlight the role of the organizational level in both promoting and preventing physical activity. it reinforces the necessity of developing community - based interventions to physical activity to target specific groups. the present study employed a participatory approach known as photo elicitation along with an objective assessment of physical activity to enhance our knowledge of how physical activity is understood among older inactive african american women. the combination of objective (accelerometry) and subjective (photo elicitation) approaches provides an opportunity to add to the extant literature. previous studies addressing similar purposes as the present study adopted only focus group or individual interviews along with self - reported or subjective assessments of participant physical activity levels. since individuals often overestimate their physical activity levels when assessed by self - report methods, it is difficult to be confident about their actual activity status. the combination of both qualitative and quantitative approaches has the potential to generate more meaningful and useful information. it is important to highlight that photo elicitation is not a substitute for other methods such as individual interviews or focus group. instead, the technique serves as a useful supplement to these approaches that have the potential to enhance the quality of the findings. as stated by hagedorn, the images captured in photography invite people to take the lead in inquiry, facilitating their discussion of an experience. photographic interviews elicit a unique return of insights that might otherwise be impossible to obtain with other techniques. photographs sharpen memory and give the interview an immediate character of realistic construction and function. moreover, investigators state that the act of sharing and talking about pictures evokes the power of visual images to communicate not only life experience but individuals ' expertise and knowledge. thus, although photo elicitation has the purpose of having people recording and reflecting positive and negative things in their community, it also promotes a critical dialogue about important community issues by the lens of large and small group discussion of photographs ; and also can be used as a tool to reach policymakers [34, 35 ]. our study was based on participatory - approach along with in - depth interview of a nonrandomized sample of 7 inactive older african american women. we do not know if the patterns that emerged would have differed if a different cohort of african american women had been selected. caution is warranted when generalizing the outcomes to the broader population of older african american women and african americans in general. however, despite the small sample size, it is important to highlight that qualitative studies drastically differ from quantitative studies regarding ideal sample size. moreover, studies adopting partial or full qualitative designs are less concerned with the generalizability of the findings. instead, the goal is to better understand how particular groups view / perceive a particular phenomenon and extract rich data that can be add to the literature. although no amount of physical activity can stop the aging process, there is now compelling evidence that a moderate amount of regular physical activity can minimize the physiological effects of aging and increase active life expectancy by limiting the development and progression of chronic disease and disabling conditions. culturally, sensitive approaches to physical activity promotion are essential to help reduce heath disparity among older adults.. suggest that it is important to match the cultural characteristics of minority populations with public health interventions to enhance receptivity to, acceptance of, and salience of health information and programs. the authors recognize the importance of factors like belief systems, religious and cultural values, life experiences, and group identity as powerful filters through which information is received. therefore, such factors should be considered in the development of both interventions aiming to improve chronic diseases through physical activity as well as health communication campaigns. in fact, health communication is believed to be an important aspect for educating and promoting positive behaviors such as physical activity at the population level. as noted by balbale. tailoring and improving the message design for underserved groups is essential if we are to mitigate or eliminate the burden of health disparities. | introduction. older african american women are particularly vulnerable to unhealthy lifestyle behaviors such as physical inactivity and the resultant chronic diseases and conditions. this study explored older african american women 's perception of physical activity as well as facilitators of and barriers to being physically active in their local environment. methods. using a participatory research approach, a total of 7 women aged 65 years and over had their pa level assessed objectively through accelerometry. in addition, physical activity was discussed through the photo - elicitation procedure, which was supplemented by semistructured interviews. qualitative thematic analysis was used to identify patterns and themes emerging from participants ' interview. results. participants exhibited low levels of physical activity and viewed physical activity to be a broadly defined, nonspecific construct. interviews revealed that many participants lack important knowledge about physical activity. a variety of personal, social, and environmental facilitators and barriers were reported by the participants. conclusion. efforts should be made towards clarifying information on physical activity in this population in order to help them incorporate physical activity into their routines, overcome barriers, and make use of opportunities to be active. |
osseointegration is the most important factor in successful implant treatment. in the early stage, machined surface implants using pure titanium were reported to have achieved successful osseointegration, but there were limitations in case of low volume and quality of bony tissue1. in addressing these issues, various surface - treated implants were developed and sold to facilitate osseointegration and promote initial healing. among them, hydroxyapatite (ha)-coated implants made by applying ha on the surface using plasma spray to generate depression, undercut, and porosity were introduced in the mid-1980s to increase osteogenesis and facilitate osseointegration2 ; they were actively used in the 1990s. note, however, that most products were terminated because many researchers reported high failure rates. some researchers claimed that, from the long - term perspective, ha - coated implants can lose osseointegration because, if the coated surface is detached from the fixture or resorbed, the implant and bone are separated ; thus becoming dynamically unstable. even with satisfactory early osseointegration, the ha - coating is easily contaminated, and this results in its resorption and subsequent failure of the implant3. nonetheless, some researchers report that advancements in ha - coating technology have resolved these problems and produced long - term stable clinical results. insufficient stability resulting from ha - coating desquamation and irregular coating thickness has been addressed with technological advancements such as ion plating4 and ion sputtering5, thermal decomposition method6, and biomimetic process. another viable option is the more recently developed thermally induced liquid - phase deposition method 7. currently, it is regarded as principle wherein a certain healing period is assigned without loading. according to brnemark.8, premature loading after implant placement can generate fibrous tissue on the bone - implant interface rather than bone deposition ; thus, insufficient healing period increases the possibility of early or delayed mobility of the implant. the minimum healing period suggested by brnemark in 1977, based on 10 years ' clinical experience, was 3 months for the mandibular implant and 5 - 6 months for the maxillary one8. excessive loading during this period can damage the balance between bone generation and bone resorption and result in fibrous connective tissue that interferes with osseointegration. note, however, that the traditional healing period suggested by brnemark may not be suitable today because the brnemark research was based only on machined surface implant ; it did not consider the implant design, surface treatment, surgical method, and biomechanical prosthesis10. recent research on the stability of immediate and early loading reported success rates of 88 - 10%, suggesting that the healing period after treatment will continue to decrease1,11,12. marginal bone height is an important factor in the implant 's functional and aesthetic success, and maintaining the proper height of marginal bone is a precondition for the implant 's long - term, satisfactory use. marginal bone resorption in the bone - implant interface interferes with the stability of surrounding tissues and causes periimplantitis or mobility of the implant. vercruyssen and quirynen13 reported that, in their long - term research, smoking, guided bone regeneration, dehiscence defect, and bony tissue are closely related to the height of marginal bone around the implant. based on the researchers ' reports, i.e., failure of a loading implant most frequently occurs within one year of functioning14, this study measured the amount of resorption after one year of loading. to compare the stability of ha - coated implants with different loading initiation times, two different implants that secured thinner and more even thickness of ha coating and increased crystallization rate were placed on patients : osstem ts iii ha (osstem implant co., busan, korea) and zimmer tsv - ha (zimmer dental, carlsbad, ca, usa). after applying immediate and delayed loading based on the definition of cochran.15, implant survival rate was measured according to criteria established by buser.16 and cochran.17 after one year of loading, the resorption amount of crestal bone was evaluated retrospectively. this study was conducted by the section of dentistry at seoul national university bundang hospital, following approval by the institutional review board (approval no. the 1-year retrospective study involved a total of 41 patients (74 implants, 22 males and 19 females with mean age of 53.110.70) who had 1 or 2 implants placed consecutively in their posterior maxilla or mandible and immediate or delayed loading between september 2010 and april 2011. osstem ts iii ha was implanted in 17 patients (33 implants), and zimmer tsv - ha (41 implants), in 24 patients.(table 1) patient selection criteria for implant placement were as follows : 1) patients older than 18 years whose jaw growth was finished ; 2) patients with posterior teeth loss and available alveolar bone height of more than 6 mm ; 3) patients with adequate mesio - distal and horizontal available bones ; and 4) patients with antagonistic tooth of placed implant. the following were the criteria for exclusion : 1) pregnant women ; 2) patients who had a heart attack only recently ; 3) patients with uncontrollable systemic disease ; 4) patients with hemorrhagic disease or disease requiring the administration of anticoagulant ; 5) patients with, or suspected of having, a psychological disease ; 6) patients who were scheduled to undergo tooth extraction within 2 months in the placement area and patients with severe periodontal disease in the surrounding teeth ; 7) patients with grade d4 bony tissue ; 8) patients who need extensive bone graft ; and 9) patients for which placing an implant is difficult (patients with severe oral habit such as bruxism). in this study, all surgeries and prosthesis treatments were performed by 1 surgeon and 1 prosthodontist. implants were placed according to each manufacturer 's guidelines, and bone graft was performed when a small defect around the implant was noted. if the residual bone in the maxillary posterior teeth was 6 - 10 mm, sinus membrane elevation and bone graft were performed using a crestal approach, and implantation was done at the same time. based on the period from implant placement to loading by prosthesis, 42 implants were categorized as immediate loading (il) group, and 32 implants, as delayed loading (dl) group. the il group was then subdivided into 18 osstem ts iii ha implants and 24 zimmer tsv - ha implants based on the implant system. the dl group was also subdivided into 15 osstem ts iii ha implants and 17 zimmer tsv - ha implants.(table 2) based on the definition of ioannidou and doufexi12, the il group had a temporary crown restored within 48 hours as well as occlusion with the opposite tooth (after 1.810.40 days on the average) ; final restoration was done 3 - 6 months after placement (6 months for the maxilla and 3 months for the mandible) after confirming osseointegration. the dl group had healing period of 2.8 - 7.9 months (5.5 months for the maxilla and 3.0 months for the mandible on the average) after placement, with final restoration and occlusion with the opposite tooth. for the temporary crown restoration of the il group, occlusion space as wide as 1 accufilm (parkell, farmingdale, ny, usa) was applied when biting slightly ; occlusal contact was unavailable for lateral movement. in the final restoration of the successful il group and dl group, occlusion space as wide as 1 shimstock (kocodental, bucheon, korea) was created when biting slightly. both the il group and dl group visited our hospital on the initial day of loading and 1 year later for periapical radiography and to evaluate the clinical symptoms, mobility of implant, radiolucency around the implant, and status of soft tissue to determine the implants ' survival rate. using the criteria suggested by buser.16 and cochran.17, the implant survival rate was evaluated : a. no clinical implant mobility ; b. no pain or neural problem ; c. either infection around the implant is not consistent, or it has not recurred ; d. neither radiolucency around the implant nor rapid bone loss. to measure and compare marginal bone resorption around the implant, digital periapical radiography was taken vertically from the longitudinal axis using the parallel cone technique. marginal bone level was measured on the mesial and distal sides of the implant, with the mean of two values regarded as representative value. considering the fact that the distance between the threads of fixture (thread pitch) was 0.8 mm (4.5 mm in diameter) or 0.9 mm (5 mm in diameter) for ts iii ha and 0.6 mm for tsv, the distance from the implant platform to the first bone - implant contact (bic) in radiographs was measured and calculated by enlargement ratio. marginal bone loss was calculated as the difference between the values taken on the initial day of loading and values taken at 1-year prosthetic loading. because of the submerged machined collar (1 mm band) of tsv, the placement depth of machined - to - resorbable blast media junction during surgery had to be compensated when bone loss was measured at 1-year follow - up. this depth was subtracted from the measurement to adjust the actual bone loss of the textured surface. the difference was measured by setting 2 dots on the radiograph using impax (agfa corp. measurement was conducted by one dentist who did not participate in the implant treatment. after placing the ha - coated implants, data was examined to determine whether there is significant relationship between initial loading time, initial loading time by implant system, initial loading time by maxilla and mandible, and change of crestal bone 's height after 1 year of loading using mann - whitney (=0.05) of ibm spss statistics ver. this study was conducted by the section of dentistry at seoul national university bundang hospital, following approval by the institutional review board (approval no. the 1-year retrospective study involved a total of 41 patients (74 implants, 22 males and 19 females with mean age of 53.110.70) who had 1 or 2 implants placed consecutively in their posterior maxilla or mandible and immediate or delayed loading between september 2010 and april 2011. osstem ts iii ha was implanted in 17 patients (33 implants), and zimmer tsv - ha (41 implants), in 24 patients.(table 1) patient selection criteria for implant placement were as follows : 1) patients older than 18 years whose jaw growth was finished ; 2) patients with posterior teeth loss and available alveolar bone height of more than 6 mm ; 3) patients with adequate mesio - distal and horizontal available bones ; and 4) patients with antagonistic tooth of placed implant. the following were the criteria for exclusion : 1) pregnant women ; 2) patients who had a heart attack only recently ; 3) patients with uncontrollable systemic disease ; 4) patients with hemorrhagic disease or disease requiring the administration of anticoagulant ; 5) patients with, or suspected of having, a psychological disease ; 6) patients who were scheduled to undergo tooth extraction within 2 months in the placement area and patients with severe periodontal disease in the surrounding teeth ; 7) patients with grade d4 bony tissue ; 8) patients who need extensive bone graft ; and 9) patients for which placing an implant is difficult (patients with severe oral habit such as bruxism). in this study, all surgeries and prosthesis treatments were performed by 1 surgeon and 1 prosthodontist. implants were placed according to each manufacturer 's guidelines, and bone graft was performed when a small defect around the implant was noted. if the residual bone in the maxillary posterior teeth was 6 - 10 mm, sinus membrane elevation and bone graft were performed using a crestal approach, and implantation was done at the same time. based on the period from implant placement to loading by prosthesis, 42 implants were categorized as immediate loading (il) group, and 32 implants, as delayed loading (dl) group. the il group was then subdivided into 18 osstem ts iii ha implants and 24 zimmer tsv - ha implants based on the implant system. the dl group was also subdivided into 15 osstem ts iii ha implants and 17 zimmer tsv - ha implants.(table 2) based on the definition of ioannidou and doufexi12, the il group had a temporary crown restored within 48 hours as well as occlusion with the opposite tooth (after 1.810.40 days on the average) ; final restoration was done 3 - 6 months after placement (6 months for the maxilla and 3 months for the mandible) after confirming osseointegration. the dl group had healing period of 2.8 - 7.9 months (5.5 months for the maxilla and 3.0 months for the mandible on the average) after placement, with final restoration and occlusion with the opposite tooth. for the temporary crown restoration of the il group, occlusion space as wide as 1 accufilm (parkell, farmingdale, ny, usa) was applied when biting slightly ; occlusal contact was unavailable for lateral movement. in the final restoration of the successful il group and dl group, occlusion space as wide as 1 shimstock (kocodental, bucheon, korea) was created when biting slightly. both the il group and dl group visited our hospital on the initial day of loading and 1 year later for periapical radiography and to evaluate the clinical symptoms, mobility of implant, radiolucency around the implant, and status of soft tissue to determine the implants ' survival rate. using the criteria suggested by buser.16 and cochran.17, the implant survival rate was evaluated : a. no clinical implant mobility ; b. no pain or neural problem ; c. either infection around the implant is not consistent, or it has not recurred ; d. neither radiolucency around the implant nor rapid bone loss. to measure and compare marginal bone resorption around the implant, digital periapical radiography was taken vertically from the longitudinal axis using the parallel cone technique. marginal bone level was measured on the mesial and distal sides of the implant, with the mean of two values regarded as representative value. considering the fact that the distance between the threads of fixture (thread pitch) was 0.8 mm (4.5 mm in diameter) or 0.9 mm (5 mm in diameter) for ts iii ha and 0.6 mm for tsv, the distance from the implant platform to the first bone - implant contact (bic) in radiographs was measured and calculated by enlargement ratio. marginal bone loss was calculated as the difference between the values taken on the initial day of loading and values taken at 1-year prosthetic loading. because of the submerged machined collar (1 mm band) of tsv, the placement depth of machined - to - resorbable blast media junction during surgery had to be compensated when bone loss was measured at 1-year follow - up. this depth was subtracted from the measurement to adjust the actual bone loss of the textured surface. the difference was measured by setting 2 dots on the radiograph using impax (agfa corp., after placing the ha - coated implants, data was examined to determine whether there is significant relationship between initial loading time, initial loading time by implant system, initial loading time by maxilla and mandible, and change of crestal bone 's height after 1 year of loading using mann - whitney (=0.05) of ibm spss statistics ver. implant survival rate after 1 year of loading was 100%, and mean bone loss of all test groups was 0.260.59 mm. for the comparison based on loading time, mean bone loss of the il group was 0.320.69 mm, and that of the dl group was 0.160.42 mm, but the difference was not statistically significant (p=0.260).(table 3) regarding bone loss of the il group and delayed group receiving the osstem ts iii ha, bone loss was 0.521.00 mm and 0.110.20 mm, respectively, but the difference was not statistically significant (p=0.556).(table 4) for patients receiving the zimmer tsv - ha, bone loss of the il group and dl group was 0.170.21 mm and 0.170.21 mm, respectively, but the difference was not statistically significant (p=0.338).(table 5) in comparing the bone loss of il group and dl group in the maxilla and the mandible, bone loss in the maxilla was 0.410.82 mm and 0.100.16 mm in the il group and dl group, respectively, but the difference was not statistically significant (p=0.526).(table 6) likewise, in the mandible, bone loss of the il group was 0.270.61 mm, and that of the dl group was 0.390.84 mm ; the difference was not statistically significant (p=0.620).(table 7) ha - coated implants were introduced in the 1990s and were found to facilitate the adhesion and proliferation of osteoblasts with good coherence of serum protein and growth factors, perform well on poor - quality bony tissue by significantly increasing osseointegration between implant and bony tissue, and allow performing early loading by shortening the osseointegration period18 - 20. note, however, that the coating quality and thickness varied by manufacturer, and the coating was occasionally removed during implantation. thus, a divided ha was found to have risk of impairing osseointegration and initiating an inflammatory response3,21. after the introduction of ion plating and ion sputtering, these problems were resolved, and the success rate has steadily increased along with advancements in ha - coated technology7. in 2005, trisi.18 collected samples from the clinical specimen of 10-year - old ha - coated implants and, after histological analysis, reported loss of less than 25% for the ha - coating surface and bic rate of 78.48%. in other words, for patients receiving proper prosthetic treatment and adequate maintenance, persistent ha coating and long - term survival were possible. many other studies also noted progress in ha - coated implants and good clinical results18 - 20. haptite (dentis co., ltd., daegu, korea) claimed to have resolved uneven coating and desquamation problems by reducing coating thickness to 2 m using an ultra - thin coating technique applied in vacuum at room temperature22. the zimmer tsv - ha used in this study recorded a 97% success rate because it increased the ha crystallization rate to 97% with the application of plasma coating over ha and special mp-1 process using compressed hydration heat treatment23. crystallization rate is an important factor in ha - coated implants because a non - crystallized ha - coated surface may melt, break, or disintegrate and cause the implant to fail. in this study, the coating thickness of osstem ts iii ha was 20 - 70 m, and that of zimmer tsv - ha was 20 - 150 m. in both products, (xrd) and energy dispersive spectrometer (eds) analysis, the ca / p ratio of osstem ts iii ha was 1.69, and that of zimmer tsv - ha was 1.65. the crystallization level of osstem ts iii ha was 98%, and that of zimmer tsv - ha was 96.30.6. in iso / tc106, ha implants must have crystallization rate of more than 62%. considering the fact that the crystallization rate of the steri - oss implant (nobel biocare ab, gteborg, sweden) is 73.3%, both products used in this study have high crystallization rates. for successful osseointegration under immediate loading following implantation, various tests and research have been conducted, and their results have been reported. in an animal test that compared a function group and a non - function group by applying a crown immediately after implantation, the microscopic examination revealed a higher rate of osseointegration in the function group. in addition, some studies found that successful osseointegration relies on loading, dental hygiene, condition of bony tissue, surgical technique, and prosthesis ; thus, if the bony tissue at the implant site is healthy, tissues are subjected to minimal damage during the surgical process, and prosthesis restoration is performed carefully, osseointegration within 2 weeks is possible with early functional loading24. according to some studies, the success rate and survival rate under protocols calling for early loading and delayed loading following normal healing period do not differ greatly, but implant failure is greatly affected by the patient 's overall physical condition, local factors such as poor oral hygiene, and unsuitable bony tissue at the implantation site25,26. based on this study 's results, even when applying immediate loading to ha - coated implants, the survival and bone resorption rates are not significantly different when applying delayed loading after a normal healing period. loading was reported not to cause independently the generation of fibrous tissue membrane, but the amount of micromotion at the bone - implant interface was more relevant. calandriello and tomatis27 reported that micromotion of more than 100 m retards healing at the bone - implant surface, whereas szmukler - moncler.10 claimed that micromotion of more than 150 m causes the generation of fibrous tissue membrane rather than bone deposition. therefore, reducing micromotion and increasing the success rate with immediate loading require using an implant that has been designed for easy placement and less mobility to secure primary stability10,27. in both groups, average alveolar bone resorption rates under different loading times were within 0.240.59 mm ; this was lower than the results of previously published research. according to schincaglia.28, the average bone resorption rate after 1 year of loading in mandibular single implant restoration was 1.200.55 mm in the il group and 0.770.38 mm in the dl group. recently, elsyad.29 reported a rate of 0.910.63 mm in the il group and 0.510.39 in the dl group. for a two - piece implant, bone resorption rate of 1.5 - 2.0 mm from the 2nd surgery to 1 year of loading is regarded as normal30,31. in 1994, albrektsson and colleagues32,33 stressed that a successful implant should have less than 1.5 mm bone resorption during the first year of prosthetic treatment and subsequent annual bone resorption rate of less than 0.2 mm. therefore, the bone resorption rate of both groups in this study is believed to be low due to the successful early stability of the ha - coated implant, skilled surgical technique, and highly motivated patients. this research is limited because it is neither a retrospective study nor based on a selected test group and a control group. initial stability following implantation was not measured in all cases using ostell mentor (integration diagnostics ab, gteborg, sweden) or others ; neither were bone resorption rates by type of prosthesis compared because we reviewed medical records and radiographs of patients who had previously received implant treatment. another limitation of this study was its insufficient control of statistical data because each patient received a different number of implants ; the location of implant placement and its length and diameter also differed. the results of this study demonstrated no significant difference, but this may be due to a number of factors in this study design. for one, the use of two different implant brands increases the difficulties in interpreting the results properly. the different implants not only had different coating properties but also different thread design and different diameters, which may influence implant stability during the healing period. long - term follow up after 1 year of observation is necessary, and future research with prospective study should be undertaken with only 1 implant system by strictly controlling patient age, location and number of implant placements, initial stability of implant, and follow - up surgical treatment. in this retrospective research, ha - coated implant placed in the maxillary and mandibular posterior areas recorded short - term clinical success regardless of the loading time ; the amount of marginal bone resorption also met the criteria for successful implantation. mean bone loss after 1 year of loading was not significantly different between the il group and the dl group ; neither was the difference in bone resorption rates statistically significant between the two groups by type of implant system and by dental location. the limitations of this study include not only the study period but also other variables such as surgeon 's bias, different brands of implant, etc. even with the limited study period of one year, however, this study suggests that ha - coated implants can secure a high success rate under immediate loading. | objectivesthe objective of this study is compare the rate of marginal bone resorption around hydroxyapatite - coated implants given different loading times in order to evaluate their stability.materials and methodsthe study was conducted retrospectively for one year, targeting 41 patients whose treatment areas were the posterior maxilla and the mandible. osstem ts iii ha (osstem implant co., busan, korea) and zimmer tsv - ha (zimmer dental, carlsbad, ca, usa), which employ the new hydroxyapatite coating technique, were used. the patients were divided into two groups - immediate and delayed loading - and the bone level at the time of loading commencement and after one year of loading was measured using periapical radiography. differences between the groups were evaluated using mann - whitney (=0.05).resultsfor all patients as a single group, the survival rate of the implants was 100%, and the mean marginal bone loss was 0.260.59 mm. in comparison of the differences by loading, mean marginal bone loss of 0.320.69 mm was recorded for the immediate loading group whereas the delayed loading group had mean marginal bone loss of 0.160.42 mm. however, the difference was not significant (p>0.05).conclusionwithin the limited observation period of one year, predictable survival rates can be expected when using immediately loaded hydroxyapatite - coated implants. |
the recent us study 2008 alzheimer s disease facts and figures from the authors of the framingham heart study reveals that alzheimer s disease (ad) and dementia have outstripped cancer and stroke as a more common cause of death. we are concerned that this change not only represents a shift in assessment and treatment of cancer and stroke, but displays the importance of identifying risk factors for ad and dementia. the united states alzheimer s disease study showed that the baby boom generation, which is defined as residents born between the years of 1946 to 1965, seem to be at particular risk of developing ad or dementia. of the 78 million baby boomers in america, at least 10 million are expected to get dementia in their remaining lifetime. based on the percentage of baby boomers in western australia, south australia and queensland, we estimate the percentage of baby boomers at an australian national level to be 29% of a total population of approximately 21.5 million. therefore, of the estimated 6,235,000 baby boomers in australia, at least 798,000 are expected to develop dementia in their lifetime, if australia follows the united states trend, posing enormous economic costs and challenges to the health care system. the us trend towards increased risk of developing dementia is likely to be similar for australia s baby boomers on account of epidemiological trends reported by the australian bureau of statistics (abs) for western australian, south australia and queensland. there are no data available on the most populated states of victoria and new south wales. the epidemiological trends include risk factors such as smoking, obesity and sedentary life style. this paper further defines the risk factors for dementia and ad and how they might be correctable in the future. the aim is to provide evidence - based guidelines for dementia prevention in the 21st century as relevant to the australian population. the pubmed database was interrogated from 19942010 using key words of dementia, alzheimer s disease, baby boomers and evidence - based guidelines. the australian bureau of statistics (abs) makes information publicly available on their website and information was identified for western australia, south australia and queensland. the abs did not possess information at the time of the study for the other states or for the nation as a whole. the recent 2008 alzheimer s disease usa study states the problem in the united states where it is estimated that 10 million (1 in 8) american baby boomers will develop ad. currently in 2008 an estimated 5.2 million americans of all ages have ad, with about one in 8 people older than 65 (approximately 13%) having the disease. women are more likely to develop ad than men, probably because they live longer. therefore, the female gender itself is not a risk factor once age is considered. the lifetime risk for ad can not be predicted from birth ; however, the lifetime risk of developing ad is one in 6 for women and in 10 for men who live to be at least 55 (figure 1a). the remaining lifetime risk of any dementia, including ad for women and men is higher than that of ad alone (figure 1b). this lifetime risk of dementia and ad will substantially increase in the future unless there are new preventative treatments. this study raises implications for the 78 million baby boomers in america, of which it is estimated that 10 million can expect to develop ad in their remaining lifetime. the authors note that these are conservative estimates due to the nature of data and that the true lifetime risk to baby boomers would actually be greater. as many as half a million new cases will develop every year by 2010. by 2050 that number the years 2000 to 2005 have seen the decline in death rates of heart disease, breast cancer, prostate cancer and stroke ; however, the rates of ad have increased by almost 45% (figure 1c). this decline in death rates from other causes of death currently ad is among the top 10 leading causes of death for people of all ages, and number 5 for those 65 years and older. however, it is important to note that ad and dementias co - exist with other medical conditions, including hypertension, coronary artery disease, cognitive heart failure and others. the ad usa study also shows that people with fewer years of education are more likely to develop ad and dementia, a finding supported by other studies. importantly, the implications of ad on health care, long - term care and end - of - life care services are of great concern. most individuals develop ad and other dementias as a co - morbidity with one or more other serious medical conditions. financial and emotional costs of this disease, with particular attention to carers, must also be emphasized. figure 1(a) percentage of women and men who will develop alzheimer s disease in their remaining lifetime if they live to be at least age 55, framingham heart study. (b) percentage of women and men who will develop dementia in their remaining lifetime if they live to be at least age 55, framingham heart study. (c) percentage change in leading causes of death from 2000 to 2005. (a) percentage of women and men who will develop alzheimer s disease in their remaining lifetime if they live to be at least age 55, framingham heart study. (b) percentage of women and men who will develop dementia in their remaining lifetime if they live to be at least age 55, framingham heart study. an overview of the epidemiology of australia s baby boomers based on the australian bureau of statistics (abs) data raises concern over their risk of developing ad and dementia. according to the abs, the baby boom generation refers to all australian residents born in the years 1946 to 1965, including those who migrated to australia from countries which did not experience the baby boom. figure 2 shows the population pyramid of australia in 2003 and the ages of the baby boomers. three separate abs studies specific to baby boomers in western australia, south australia and queensland have been identified from which we have made assumptions pertaining to the whole of australia. for the purposes of this paper the most important results of these studies were those of self - assessed health status, smoking status, alcohol consumption and exercise patterns, as they are potential risk factors for ad and correctable in the future (table 1). in 2001, western australia s 557,000 baby boomers were aged 36 to 55 years and made up 29% of the population. in south australia 29% of the population nearly one in three queenslanders (29%) are baby boomers (1,039,000) and this percentage is set to grow dramatically over the coming years. of all the baby boomers in 2001, 25%, 26% and 28% from western australia, south australia and queensland, respectively, were smokers. in western australia, two - thirds of baby boomers were inactive or undertaking low levels of exercise. in queensland and south australia, 71% and 73%, respectively, were sedentary or undertaking low levels of exercise. in western australia, queensland and south australia, more than 50% were overweight or obese. the percentage of baby boomers exhibiting risky or high - risk levels of alcohol consumption in western australia, queensland and south australia were 14%, 13.1%, and 11.5%, respectively. while in western australia (83%), queensland (82%) and south australia (79%) a high percentage of baby boomers reported a self - assessed health status of good, very good or excellent, there were higher proportions reporting long - term health conditions. in both queensland and western australia, high cholesterol and hypertensive disease in queensland and western australia, high cholesterol in older baby boomers was 11% and 13.6%, respectively. in younger baby boomers it was 4% and 5.6%, respectively. in queensland and western australia hypertensive disease was 15% and 13.9% in that order for older baby boomers ; in younger baby boomers it was 4.2% and 4.6%, respectively. using a non - parametric analysis of variance there were no significant differences between the three states and health risk factors as listed in table 1 [kruskal - wallis statistic = 3.611, corrected for ties and approximated using, p=0.1644 ]. the prevalence and incidence data for queensland, south australia and western australia are shoen in tables 2 and 3, respectively. using a non - parametric analysis of variance there are no statistically significant differences between these states of australia and the prevalence and incidence of dementia [prevalence : kruskal - wallis = 3.567, p=0.1964 ; incidence kruskal - wallis = 5.333, p=0.0714 ]. table 1health risk factors of baby boomers : western australia, south australia and queensland.western australiasouth australiaqueensland(2001)(2001)(2001)number of baby boomers557,700441,0001,039,000younger (born 195665)297,300231,000549,300older (born 194655)260,400210,000489,500self assessed health status- excellent / very good281,900221,300534,000younger (born 195665)160,200119,700291,600self assessed health status- good178,000122,200322,100younger (born 195665)96,60074,90096,000older (born 194655)81,40047,300104,700self assessed health status- fair / poor81,10091,400182,900younger (born 195665)29,10031,20028,500older (born 194655)52,00060,10036,400current smoker134,400115,000290,900younger (born 195665)82,50067,90093,100older (born 194655)51,90047,10066,900risky / high risk alcohol consumption74,70051,300136,100younger (born 195665)37,20021,300n / aolder (born 194655)37,50030,000n / asedentary / low exercise358,600323,200322,100 (sedentary)younger (born 195665)183,100172,400n / aolder (born 194655)175,500150,800n / aoverweight / obese276,700221,800561,100younger (born 195665)142,000109,900279,400older (born 194655)134,600111,900328,800high cholesterolyounger (born 195665)16,600n / a22,000older (born 194655)35,400n / a53,800hypertensive diseaseyounger (born 195665)12,500n / a25,300older (born 194655)36,200n / a73,400non - parametric anova = 3.611 ; p=0.1644. non - parametric anova = 3.611 ; p=0.1644. table 2prevalence of dementia in individuals aged under 65 (10).genderqueenslandsouth australiawestern australiamale1.250.490.62female0.710.290.34total1.960.780.96non - parametric anova = 3.467, p=0.1964. table 3incidence of dementia in individuals aged under 65 (10).genderqueenslandsouth australiawestern australiamale0.100.040.05female0.100.040.05total0.200.080.10non - parametric anova = 5.333, p=0.0714. the recent 2008 alzheimer s disease usa study states the problem in the united states where it is estimated that 10 million (1 in 8) american baby boomers will develop ad. currently in 2008 an estimated 5.2 million americans of all ages have ad, with about one in 8 people older than 65 (approximately 13%) having the disease. women are more likely to develop ad than men, probably because they live longer. therefore, the female gender itself is not a risk factor once age is considered. the lifetime risk for ad can not be predicted from birth ; however, the lifetime risk of developing ad is one in 6 for women and in 10 for men who live to be at least 55 (figure 1a). the remaining lifetime risk of any dementia, including ad for women and men is higher than that of ad alone (figure 1b). this lifetime risk of dementia and ad will substantially increase in the future unless there are new preventative treatments. this study raises implications for the 78 million baby boomers in america, of which it is estimated that 10 million can expect to develop ad in their remaining lifetime. the authors note that these are conservative estimates due to the nature of data and that the true lifetime risk to baby boomers would actually be greater. as many as half a million new cases will develop every year by 2010. by 2050 that number the years 2000 to 2005 have seen the decline in death rates of heart disease, breast cancer, prostate cancer and stroke ; however, the rates of ad have increased by almost 45% (figure 1c). this decline in death rates from other causes of death currently ad is among the top 10 leading causes of death for people of all ages, and number 5 for those 65 years and older. however, it is important to note that ad and dementias co - exist with other medical conditions, including hypertension, coronary artery disease, cognitive heart failure and others. the ad usa study also shows that people with fewer years of education are more likely to develop ad and dementia, a finding supported by other studies. importantly, the implications of ad on health care, long - term care and end - of - life care services are of great concern. most individuals develop ad and other dementias as a co - morbidity with one or more other serious medical conditions. financial and emotional costs of this disease, with particular attention to carers, must also be emphasized. figure 1(a) percentage of women and men who will develop alzheimer s disease in their remaining lifetime if they live to be at least age 55, framingham heart study. (b) percentage of women and men who will develop dementia in their remaining lifetime if they live to be at least age 55, framingham heart study. (c) percentage change in leading causes of death from 2000 to 2005. (a) percentage of women and men who will develop alzheimer s disease in their remaining lifetime if they live to be at least age 55, framingham heart study. (b) percentage of women and men who will develop dementia in their remaining lifetime if they live to be at least age 55, framingham heart study. an overview of the epidemiology of australia s baby boomers based on the australian bureau of statistics (abs) data raises concern over their risk of developing ad and dementia. according to the abs, the baby boom generation refers to all australian residents born in the years 1946 to 1965, including those who migrated to australia from countries which did not experience the baby boom. figure 2 shows the population pyramid of australia in 2003 and the ages of the baby boomers. three separate abs studies specific to baby boomers in western australia, south australia and queensland have been identified from which we have made assumptions pertaining to the whole of australia. for the purposes of this paper the most important results of these studies were those of self - assessed health status, smoking status, alcohol consumption and exercise patterns, as they are potential risk factors for ad and correctable in the future (table 1). in 2001, western australia s 557,000 baby boomers were aged 36 to 55 years and made up 29% of the population. in south australia 29% of the population nearly one in three queenslanders (29%) are baby boomers (1,039,000) and this percentage is set to grow dramatically over the coming years. of all the baby boomers in 2001, 25%, 26% and 28% from western australia, south australia and queensland, respectively, were smokers. in western australia, two - thirds of baby boomers were inactive or undertaking low levels of exercise. in queensland and south australia, 71% and 73%, respectively, were sedentary or undertaking low levels of exercise. in western australia, queensland and south australia, the percentage of baby boomers exhibiting risky or high - risk levels of alcohol consumption in western australia, queensland and south australia were 14%, 13.1%, and 11.5%, respectively. while in western australia (83%), queensland (82%) and south australia (79%) a high percentage of baby boomers reported a self - assessed health status of good, very good or excellent, there were higher proportions reporting long - term health conditions. in both queensland and western australia, high cholesterol and hypertensive disease were more frequently reported by older baby boomers than by younger baby boomers. in queensland and western australia, high cholesterol in older baby boomers was 11% and 13.6%, respectively. in younger baby boomers it was 4% and 5.6%, respectively. in queensland and western australia hypertensive disease was 15% and 13.9% in that order for older baby boomers ; in younger baby boomers it was 4.2% and 4.6%, respectively. using a non - parametric analysis of variance there were no significant differences between the three states and health risk factors as listed in table 1 [kruskal - wallis statistic = 3.611, corrected for ties and approximated using, p=0.1644 ]. the prevalence and incidence data for queensland, south australia and western australia are shoen in tables 2 and 3, respectively. using a non - parametric analysis of variance there are no statistically significant differences between these states of australia and the prevalence and incidence of dementia [prevalence : kruskal - wallis = 3.567, p=0.1964 ; incidence kruskal - wallis = 5.333, p=0.0714 ]. table 1health risk factors of baby boomers : western australia, south australia and queensland.western australiasouth australiaqueensland(2001)(2001)(2001)number of baby boomers557,700441,0001,039,000younger (born 195665)297,300231,000549,300older (born 194655)260,400210,000489,500self assessed health status- excellent / very good281,900221,300534,000younger (born 195665)160,200119,700291,600self assessed health status- good178,000122,200322,100younger (born 195665)96,60074,90096,000older (born 194655)81,40047,300104,700self assessed health status- fair / poor81,10091,400182,900younger (born 195665)29,10031,20028,500older (born 194655)52,00060,10036,400current smoker134,400115,000290,900younger (born 195665)82,50067,90093,100older (born 194655)51,90047,10066,900risky / high risk alcohol consumption74,70051,300136,100younger (born 195665)37,20021,300n / aolder (born 194655)37,50030,000n / asedentary / low exercise358,600323,200322,100 (sedentary)younger (born 195665)183,100172,400n / aolder (born 194655)175,500150,800n / aoverweight / obese276,700221,800561,100younger (born 195665)142,000109,900279,400older (born 194655)134,600111,900328,800high cholesterolyounger (born 195665)16,600n / a22,000older (born 194655)35,400n / a53,800hypertensive diseaseyounger (born 195665)12,500n / a25,300older (born 194655)36,200n / a73,400non - parametric anova = 3.611 ; p=0.1644. non - parametric anova = 3.611 ; p=0.1644. table 2prevalence of dementia in individuals aged under 65 (10).genderqueenslandsouth australiawestern australiamale1.250.490.62female0.710.290.34total1.960.780.96non - parametric anova = 3.467, p=0.1964. table 3incidence of dementia in individuals aged under 65 (10).genderqueenslandsouth australiawestern australiamale0.100.040.05female0.100.040.05total0.200.080.10non - parametric anova = 5.333, p=0.0714. the kungsholmen project found that patients with high blood pressure greater than 180 mmhg had a 50% increase of developing ad and dementia (table 4). a risk score for the prediction of dementia based on risk factors at mid - life found high systolic blood pressure to significantly predict dementia. low diastolic pressure less than 65 mmhg led to a 40% increased risk of developing ad or dementia. the kungsholmen project found that heart failure was associated with an over 80% increased risk of dementia and ad. men with unrecognized myocardial infarction are at increased risk of dementia and cerebral small vessel disease. results of the whitehall ii study suggest an association between coronary heart disease and cognitive performance in middle - aged adults. as indicated in the kungsholmen project, use of antihypertensive drugs may decrease risk of dementia and ad, as they may counteract the combined effect on dementia due to the genetic risk factors apoe4 and high systolic blood pressure. a study using the hypertension in the very elderly trial cognitive function assessment (hyvet - cog) found that antihypertensive treatment in elderly patients does not statistically reduce the incidence of dementia ; however, this may be due to early follow up. the authors indicate that the hyvet findings, when included in a meta - analysis, might support antihypertensive treatment to reduce incident dementia. some studies indicate that treatment of dementia might slow cognitive decline and prevent ad. a study by xu. found that diabetes mellitus increases the risk of dementia in very old people even after adjusting for other confounders. there seems to be an association between type 2 diabetes and apoe4 allele, and increased risk of developing ad. high body mass index was found to be a significant predictor of dementia indicated by the risk score as per kivipelto. found that central obesity in mid - life increases risk of dementia independent of diabetes and cardiovascular co - morbidities. high cholesterol was found to be a significant predictor of dementia indicated by the risk score as per kivipelto. heavy drinking and smoking were associated with reduced age of onset of late s disease (load), with data suggesting that the elimination of smoking and heavy drinking could substantially reduce the age - specific prevalence of load. life habits such as smoking and alcohol were also found to be associated with an increased risk of dementia and ad in the kungsholmen project. current smoking was found to increase the risk of dementia which was more pronounced in persons without the apoe4 allele than apoe4 carriers. a cognitively inactive person was 2.6 times more likely to develop ad than a cognitively active person. a number of other studies have also shown that greater cognitive activity is associated with reduced cognitive decline in mild cognitive impairment, dementia or ad. according to andel., it was found that exercise at mid - life may reduce odds of dementia in older adulthood, suggesting that exercise interventions should be explored as a potential strategy for delaying disease onset. highlighted new evidence on the controversial topic of whether non - steroidal anti - inflammatory drugs may protect against ad. it was found that there was a dose - response effect with the long - term use of non - steroidal anti - inflammatory drugs, specifically ibuprofen, for lowering the risk for ad. according to the study by kivipelto., the apoe4 allele was an independent risk factor for dementia / ad even after adjustments for socio - demographic, lifestyle and vascular factors. among the apoe4 carriers, physical activity, alcohol drinking and smoking increased the risk of dementia / ad. in apoe4 carriers this increased risk of dementia was associated with low - moderate intake of polyunsaturated and moderate - high intake of saturated fats. concluded that apoe4 carriers may be more vulnerable to environmental factors and thus lifestyle interventions might modify dementia risk, particularly among genetically susceptible individuals. this has been supported by studies which show that other genetic risk factors influence the vulnerability of the central nervous system to the development of ad and includes genes involved with cholesterol and amyloid metabolism, microtubular associated protein tau, inflammatory factors and others. these risk factors for ad and dementia are of particular importance for baby boomers in australia. in western australia, 25% of baby boomers are currently smoking, 14% are consuming risky or high levels of alcohol, 67% are inactive or undertaking low levels of exercise, and 51% are overweight or obese, with a similar pattern in queensland and south australia. our emphasis of the importance of lifestyle risk factors on the development of ad in younger adults is supported by other investigators. table 4dementia risk factors : evidence-base.high blood pressure obesity / high bmi smoking alcohol head injury low cognitive activity low physical activity non - steroidal anti - inflammatory drugs history of coronary heart disease antihypertensive drugs diabetes mellitus cholesterol genetic : apoe4 the kungsholmen project found that patients with high blood pressure greater than 180 mmhg had a 50% increase of developing ad and dementia (table 4). a risk score for the prediction of dementia based on risk factors at mid - life found high systolic blood pressure to significantly predict dementia. low diastolic pressure less than 65 mmhg led to a 40% increased risk of developing ad or dementia. the kungsholmen project found that heart failure was associated with an over 80% increased risk of dementia and ad. men with unrecognized myocardial infarction are at increased risk of dementia and cerebral small vessel disease. results of the whitehall ii study suggest an association between coronary heart disease and cognitive performance in middle - aged adults. as indicated in the kungsholmen project, use of antihypertensive drugs may decrease risk of dementia and ad, as they may counteract the combined effect on dementia due to the genetic risk factors apoe4 and high systolic blood pressure. a study using the hypertension in the very elderly trial cognitive function assessment (hyvet - cog) found that antihypertensive treatment in elderly patients does not statistically reduce the incidence of dementia ; however, this may be due to early follow up. the authors indicate that the hyvet findings, when included in a meta - analysis, might support antihypertensive treatment to reduce incident dementia. some studies indicate that treatment of dementia might slow cognitive decline and prevent ad. a study by xu. found that diabetes mellitus increases the risk of dementia in very old people even after adjusting for other confounders. there seems to be an association between type 2 diabetes and apoe4 allele, and increased risk of developing ad. high body mass index was found to be a significant predictor of dementia indicated by the risk score as per kivipelto. found that central obesity in mid - life increases risk of dementia independent of diabetes and cardiovascular co - morbidities. high cholesterol was found to be a significant predictor of dementia indicated by the risk score as per kivipelto. heavy drinking and smoking were associated with reduced age of onset of late s disease (load), with data suggesting that the elimination of smoking and heavy drinking could substantially reduce the age - specific prevalence of load. life habits such as smoking and alcohol were also found to be associated with an increased risk of dementia and ad in the kungsholmen project. current smoking was found to increase the risk of dementia which was more pronounced in persons without the apoe4 allele than apoe4 carriers. a cognitively inactive person was 2.6 times more likely to develop ad than a cognitively active person. a number of other studies have also shown that greater cognitive activity is associated with reduced cognitive decline in mild cognitive impairment, dementia or ad. according to andel., it was found that exercise at mid - life may reduce odds of dementia in older adulthood, suggesting that exercise interventions should be explored as a potential strategy for delaying disease onset. highlighted new evidence on the controversial topic of whether non - steroidal anti - inflammatory drugs may protect against ad. it was found that there was a dose - response effect with the long - term use of non - steroidal anti - inflammatory drugs, specifically ibuprofen, for lowering the risk for ad. according to the study by kivipelto., the apoe4 allele was an independent risk factor for dementia / ad even after adjustments for socio - demographic, lifestyle and vascular factors. among the apoe4 carriers, physical activity, alcohol drinking and smoking increased the risk of dementia / ad. in apoe4 carriers this increased risk of dementia was associated with low - moderate intake of polyunsaturated and moderate - high intake of saturated fats. concluded that apoe4 carriers may be more vulnerable to environmental factors and thus lifestyle interventions might modify dementia risk, particularly among genetically susceptible individuals. this has been supported by studies which show that other genetic risk factors influence the vulnerability of the central nervous system to the development of ad and includes genes involved with cholesterol and amyloid metabolism, microtubular associated protein tau, inflammatory factors and others. these risk factors for ad and dementia are of particular importance for baby boomers in australia. in western australia, 25% of baby boomers are currently smoking, 14% are consuming risky or high levels of alcohol, 67% are inactive or undertaking low levels of exercise, and 51% are overweight or obese, with a similar pattern in queensland and south australia. our emphasis of the importance of lifestyle risk factors on the development of ad in younger adults is supported by other investigators. table 4dementia risk factors : evidence-base.high blood pressure obesity / high bmi smoking alcohol head injury low cognitive activity low physical activity non - steroidal anti - inflammatory drugs history of coronary heart disease antihypertensive drugs diabetes mellitus cholesterol genetic : apoe4 there is limited data on the health of baby boomers at a national level in australia. important abs data has been gathered in western australia, queensland and south australia ; however, data for the most populated areas of australia (new south wales and victoria, where the risk of dementia development is of greatest potential economic impact) are not available. we recommend that data be collected at a national level in order to better determine the level of risk of dementia of our baby boomers and to provide a foundation for prevention. we have not demonstrated statistically significant differences in risk factors or dementia prevalence and incidence for western australia, south australia and queensland. further studies might help to address the role of genetic and lifestyle risk factors in those under 65 years in comparison with those over 65 years in the australian states. this paper has shown that there are a myriad of factors which may impact on the risk of dementia, including genetic and non - genetic. whilst associations with dementia have not been proven, we recommend that those variables which promote a healthy lifestyle should be adopted. target populations include those baby boomers with mild cognitive impairment where stringent application of risk factor modification might prevent transformation to dementia. however, in our experience mild cognitive impairment is found in only 4.9% of younger adults with the suspicion of dementia. we propose that activities promoting a healthy heart will lead to a healthy brain. these might help to prevent dementia and are probably best incorporated into health promotion, prevention and early intervention programs in primary practice. | baby boomers are individuals born in the years 1946 to 1965. the objective of this paper was to define the risk factors for dementia and alzheimer s disease (ad) and their relevance to australian baby boomers, with the aim of providing evidence - based guidelines for dementia prevention. a series of pubmed searches (19942010) were conducted with relevant key words. data was included from the australian bureau of statistics (abs) in relation to baby boomers in australia. article titles and abstracts were assessed by two reviewers for inclusion. searches through abs revealed no specific study on baby boomers at a national level ; information was only available for western australia, south australia and queensland. a number of genetic and non - genetic risk factors for dementia were identified most of which remain controversial and require further study. we did not identify significant differences in the prevalence and incidence of dementia in those under 65 years in queensland, south australia and western australia. there were no correlations of risk factors and dementia between the australian states. modification of risk factors has not been proven to reduce the incidence and prevalence of dementia and ad in baby boomers. nevertheless, on available evidence, we recommend : i) active management of cardiovascular risk factors such as hypertension ; ii) the encouragement of a healthy lifestyle (eg, weight reduction, exercise) as offering the best pathways to reduce the emerging dementia risk for baby boomers. the implications are that activities promoting a healthy heart might lead to a healthy brain and help to prevent dementia. |
out of the 98% average radiation dose received by humans from natural sources, approximately 52% occurs due to inhalation of radon, thoron and their progeny in the dwellings (1). radon (222rn), which is considered a noble gas, is colorless, odorless, tasteless and naturally radioactive (2). when inhaled, a fraction of radon and its progeny are transported to the lungs (3) and produce severe biological damage, which could eventually lead to lung cancer (4 - 6) ; alpha decay of radon and its progeny causes this radiation damage. even though soil is the main source of indoor radon (7), studies have shown a positive correlation between the radon exhalation rate and its concentration in building materials (8). review of studies on the construction materials in iran (9) indicated a high content of uranium and radium in the granite which was used for many years in construction and decoration, especially on the interior surfaces of buildings. the only other radon isotope that can be generated indoors in significant amounts is thoron (220rn). because of its short half - life (55.6 seconds), thoron in soil gas underneath a building, in most cases can not survive long enough to enter the building and contribute to the indoor thoron level therefore, indoor thoron is typically due to the exhalation from thorium, which may be present in materials used on the interior surfaces of the building (10). given that distinct coating materials affect radiation emissions from radon, thoron, and their progeny (11, 12), it is expected that these concentrations will vary in places with different wall and floor covering materials. high concentrations of radon and thoron in indoor air, and poor ventilation along with prolonged exposure due to residency in the building, turn indoor radon and thoron into a potential hazard. as a result, the increase of indoor radon and thoron in iran due to changes in construction styles and building materials is of concern in recent years. in addition, modern buildings are known for enhancing airtight construction and decreasing natural ventilation. this risk is of especially high priority in public buildings such as hospitals, due to the large populations in these places (13). this study was intended to discover the relationship between indoor radon and thoron concentrations and the construction materials used on the interior surfaces of buildings, as well as the correlation between these concentrations and the type of ventilation system (natural or artificial). in addition, the goal was to identify those factors that primarily affect indoor radon and thoron concentrations and to develop a model for describing their behavior depending on the related parameters. accordingly, how building material and ventilation type influence indoor radon and thoron concentrations was assessed using multiple linear regression techniques. in this study, which was performed as an analytical descriptive study, measurement of radon and thoron was conducted from october to december 2012 in three hospital buildings (imam khomeini (ra), taleghani, and imam reza (as)) in kermanshah, a city in the west of iran, using the rtm-1688 - 2 radon meter made by sarad, germany. the places of that measurements were taken were determined based on the material used and the ventilation system ; measurements were made in different parts of the buildings with various interior coverings and different ventilation systems for comparison purposes. measurements in 34 locations, selected from different parts of three studied hospitals, were carried out three times (once per month). the device was placed at a height of 0.8 m to 2 m (3 to 6.5 feet) from the floor in the typical breathing zone, at least 50 cm (20 inches) from the ceiling and 20 cm (8 inches) from other objects so as to allow normal airflow around the detector, and approximately 40 cm (16 inches) from an interior wall or approximately 50 cm (20 inches) from an exterior wall. additionally, the device placement was intended to avoid air currents caused by heating, ventilating and air conditioning vents, doors, fans and windows (14). in each measurement, after 150 minutes of continuous suction of the air, radon and thoron concentrations simultaneously were reported with a 95% confidence interval by the device. information was also collected on the type of the building material and ventilation system for each measurement location. data obtained was analyzed using stata 8 statistical software. to compare the average data, one - way anova and, the multivariate linear regression model was used to determine the effects of building material and ventilation type on indoor radon and thoron concentrations. in this regression analysis, p based on the results, the average concentrations of indoor radon and thoron in the studied hospitals were 11.44 4.9 bq / m and 4 3.9 bq / m, respectively. the highest concentrations of radon and thoron were observed in the imam reza (as) hospital (table 1). figure 1 presents radon and thoron concentrations in rooms with different wall coverings. as can be seen from the the the radon level in rooms with the wall coverings granite and plaster and then plaster and pvc wall covering was the highest, it was the lowest in those with travertine and plaster wall covering, and it was significantly different in the rooms (p = 0.024). thoron concentration in rooms with walls covered with granite and travertine was the highest and it was the lowest in rooms with wall coverings plaster covered by oil paint and travertine and plaster, with significant differences (p = 0.022). in terms of floor covering, the maximum and minimum radon concentrations were observed in granite and plastic (vinyl) floor covering, respectively (figure 2) with a significant difference (p = 0.002). thoron concentration in rooms with various floor coverings was significantly different (p = 0.01). half of the wall surface was covered by a structure and the other half by another structure. radon concentration in rooms ventilated by central air conditioning system and then in those with no ventilation was the highest, while it was the lowest in those ventilated by a window (natural ventilation) (figure 3), although the difference was not statistically significant (p = 0.16). despite the fact that thoron concentration as influenced by ventilation type did not show a significant difference (p = 0.36), it was the highest in rooms ventilated by central air conditioning system along with double - glazed windows and the lowest in rooms with no ventilation. the multivariate linear regression model based on the effect of different wall coverings on the radon concentration (table 2) showed that if the structure travertine and plaster is the basis for comparison, rooms with wall coverings pvc and then " plaster " had the highest concentrations and rooms with walls covered with granite and travertine had the lowest. in the case of thoron, rooms with walls covered with granite and plaster and ceramic had the highest concentrations and rooms with wall coverings travertine had the lowest. the results of the multivariate linear regression model also revealed that rooms with a granite floor covering contained the highest concentration and rooms with plastic (vinyl) floor covering contained the lowest. rooms with floor covered with travertine and those with plastic floor covering contained the highest and lowest thoron concentrations, respectively. in addition, the model showed that rooms with no ventilation and those ventilated by central air conditioning system had the maximum radon concentration and rooms ventilated by windows had the minimum. based on the model, rooms with no ventilation and those ventilated by windows (natural ventilation) had the highest concentration of thoron and those with central air conditioning system had the lowest. statistically significant based on the results, indoor radon concentration in the hospitals studied was much less than the maximum of 100 bq / m that is recommended by world health organization (10). given that wall and floor covering materials, in contrast to ventilation type, made significant differences in the concentrations of indoor radon and thoron, it can be deduced that building material influenced the concentration of these gases more than the type of ventilation system. results obtained from measurements of radon and thoron in rooms with different wall and floor coverings, as well as different types of ventilation, differed from what was achieved based on the multivariate linear regression model. this is due to the fact that the effect of various factors on radon and thoron overlap ; that is, the floor and wall coverings combine to affect radon and thoron levels in a room. whereas in the multivariate linear regression model, the effect of different variables on the concentrations are considered together, in which case the net effect of each variable is more clearly revealed. according to the results of the multivariate linear regression model, pvc and plaster and the maximum concentration of thoron escaped from walls covered with granite and plaster and ceramic. the lowest radon concentration was emitted in rooms with walls covered with granite and travertine and the lowest thoron level was exhaled in rooms with walls covered with travertine. it would seem that in terms of radon and thoron emissions, plaster is the most inappropriate and travertine is the most appropriate covering for walls. although there no radium (the source of radon) in pvc wall covering, the highest radon level was observed in rooms with pvc wall coverings. this may be explained by the fact that pvc covering has a smooth surface and therefore particles remain suspended in the air, while these particles are partly adsorbed by other coverings. on the other hand, pvc wall covering increases the airtightness of the room, which prevents radon that originates in the soil from escaping. both of these theories should be investigated. based on the results of the multivariate linear regression model, the highest concentrations of radon and thoron were measured in rooms with the floor covered with granite and travertine, respectively, while the lowest radon and thoron concentrations were emitted in plastic (vinyl) floor covering rooms. therefore it can be concluded that both granite and travertine are inappropriate materials for flooring in terms of radon and thoron emissions, and plastic (vinyl) floor covering is the best. high emissions of radon and thoron from building materials such as granite and plaster can be attributed to the high radium and thorium content of the materials. studies on radon activity in building materials in iran do not recommend the use of granite and local stone from high background radiation areas (hbras) ; based on these results, the uranium and radium content in granite is high and can significantly increase radon levels in indoor areas where it is used. the use of these stones indoors is a health risk for residents and should be remedied (15 - 17). evaluation of radon concentration in dwellings of the city of mysore in india also indicated higher radon concentration in those buildings with granite floorings versus other building materials. in addition, houses with mosaic flooring showed a slightly lower radon exhalation rate than cement flooring houses (18). similarly, results obtained from this study in mysore showed that, in terms of radon and thoron exhalation, mosaic is suitable for floor covering. introduced plastic as the most effective material inhibiting radon exhalation from the floor (12). based on the multivariate linear regression model, natural ventilation for radon and central air conditioning system for thoron had better performance. similarly, moura. showed a significant effect of natural ventilation on indoor radon concentration (19). experimental studies in sweden (20) and the uk (21) showed that increased natural ventilation on average can reduce indoor radon concentration by a factor of two. in another study it was shown that mechanical ventilation can be a greater risk factor for indoor radon than a balanced ventilation system. the researchers of this study have explained this result by postulating an increase in radon suction from the soil beneath due to the indoor air pressure gradient created by the mechanical ventilation system (22). perhaps the higher efficiency of natural ventilation versus central air conditioning system in regards to indoor radon can be attributed to the increase of radon suction from the building ground. however, it should be noted that all measurements in this study were done by one device, and the duration of each measurement was long, so it was not possible to measure radon simultaneously or at the same time of the day in different parts of the hospitals. therefore, the use of proper materials and adequate ventilation can reduce the potential exposure to radon and thoron indoors, which is of utmost importance particularly in buildings with a high density of residents, including hospitals. | backgroundbuilding materials and the ventilation rate of a building are two main factors influencing indoor radon and thoron levels (two radioactive gases which have the most important role in human natural radiation exposure within dwellings).objectivesthis analytical descriptive study was intended to determine the relationship between indoor radon and thoron concentrations and the building materials used in interior surfaces, as well as between those concentrations and the type of ventilation system (natural or artificial).materials and methods102 measurements of radon and thoron levels were taken from different parts of three hospital buildings in the city of kermanshah in the west of iran, using an rtm-1688 - 2 radon meter. information on the type of building material and ventilation system in the measurement location was collected and then analyzed using stata 8 software and multivariate linear regression.resultsin terms of radon and thoron emissions, travertine and plaster were found to be the most appropriate and inappropriate covering for walls, respectively. furthermore, granite and travertine were discovered to be inappropriate materials for flooring, while plastic floor covering was found suitable. natural ventilation performed better for radon, while artificial ventilation worked better for thoron.conclusionsinternal building materials and ventilation type affect indoor radon and thoron concentrations. therefore, the use of proper materials and adequate ventilation can reduce the potential human exposure to radon and thoron. this is of utmost importance, particularly in buildings with a high density of residents, including hospitals. |
ultrasonography showed an irregularly shaped hypoechoic mass in the cranial pole of the right kidney. cytology revealed moderate cellularity smears composed of epithelial cell clusters, which consisted of an exclusive population of oncocytic cells seen in sheets and papillary clusters along with abundant single cells. a moderate - to - abundant amount of densely stained granular cytoplasm with round nuclei and indistinct nucleoli was seen. a final diagnosis of renal oncocytoma was made on the basis of histology, immunohistochemical staining profile (positive for cytokeratin, and negative for chromogranin a, neuron - specific enolase and vimentin) of neoplastic cells, together with the electronic microscopy results. we believe that this is the first report of the cytological features of feline renal oncocytoma. primary renal tumours are uncommon and make up about 1.52.5% of all feline neoplasms. in 1999, henry reported 19 primary feline renal tumours that consisted of tubulopapillary or tubular carcinoma (n = 13), transitional cell carcinoma (n = 3), adenoma (n = 1), haemangiosarcoma (n = 1) and nephroblastoma (n = 1). feline renal leiomyosarcoma, squamous cell carcinoma and sarcomatoid renal cell carcinoma have also been sporadically reported. oncocytes are large cylindrical or polyhedral cells characterised by abundant eosinophilic, granular cytoplasm, which is caused by the presence of large numbers of mitochondria. so far, feline oncocytomas have only been reported in the nasal cavity, salivary gland and nasopharyngeal lesion. however, renal oncocytomas were first reported in humans in 1942 and in dogs in 2000. human renal oncocytomas are relatively common : 37% of all renal tumours vs two cases of canine renal oncocytomas. a 9-year - old male neutered domestic shorthair cat was brought to the irion animal hospital in korea appearing anorexic. the cat was formerly diagnosed with chronic renal failure (iris stage 3) and had been treated with isotonic polyionic replacement fluid for several years. biochemical analysis of the blood with vettest8008 (idexx laboratories) revealed highly elevated concentrations of blood urea nitrogen (> 130 mg / dl ; reference interval [ri ] 1636 mg / dl), creatinine (7.5 mg / dl ; ri 0.82.4 mg / dl) and phosphate (8.8 mg / dl ; ri 3.17.5 mg / dl). urine specific gravity was 1.010 and urine protein creatinine ratio (urc) was 0.1 (vettest8008 ; idexx laboratories). ultrasonography revealed an irregularly shaped mass that was hypoechoic to renal cortex and medulla at the cranial pole of the right kidney and a minimally hyperplastic lymph node in the cranial abdomen region. ultrasound - guided fine - needle aspiration (fna) of the renal mass was performed using a 23 g needle attached to a 10 ml syringe. blood mixed particulate material was obtained and air dried, and 95% ethanol - fixed smears were then made and stained with diff - quik. the cranial abdominal lymph node was insufficiently large and surrounded with vasculatures for the performance of fna. cytological examination revealed moderate cellularity smears composed of epithelial cell clusters consisting of an exclusive population of oncocytic cells seen in sheets and papillary clusters, along with abundant single cells. a moderate - to - abundant amount of densely stained granular cytoplasm with round nuclei and indistinct nucleoli was seen. the differential diagnoses were oncocytoma, chromophobe carcinoma, clear cell renal cell carcinoma and neuroblastoma - associated renal cell carcinoma. under general anaesthesia, (a) cytological examination revealed moderate cellularity smears composed of epithelial cell clusters consisting of an exclusive population of oncocytic cells seen in sheets and papillary clusters, along with abundant single cells (magnification 40). (b) moderate - to - abundant densely stained granular cytoplasm with round nuclei and indistinct nucleoli (magnification 100) in gross appearance, the tumours were mahogany or dark reddish brown, well circumscribed and contained a central scar (approximate size 2.83 cm 2.2 cm 3.5 cm) (figure 2). the tumours were mahogany / dark reddish brown, well circumscribed and contained a central scar (approximate size 2.83 cm 2.2 cm 3.5 cm). a rim of compressed normal renal parenchyma was found the mass was sent to the comparative pathology department of asan medical center (korea) for histopathological examination. the tissues were fixed with 10% buffered formalin and embedded in paraffin ; 5 m sections were stained with haematoxylin and eosin. histologically, the tissue was composed of solid nests, anastomosing cords and closely packed glands separated by a delicate fibrovascular stroma. individual neoplastic cells were cylindrical to polyhedral in shape, had distinct cell borders and contained moderate amounts of finely granular eosinophilic cytoplasm and round - to - oval nuclei (figure 3) commercially available antibodies against chromogranin (clone dak - a3, 1:1600 ; dako), cytokeratin (clone ae1/ae3, 1:400 ; novo), neuron - specific enolase (clone bbs / nc / vi - h14, 1:400 ; dako) and vimentin (clone v9, 1:500 ; zymed) were used, with various secondary polyclonal antibodies. immunohistochemical staining was performed using a benchmark xt autoimmunostainer with optiview dab detection kit (ventana medical systems) according to the manufacturer s instructions and using the reagent supplied with the kit. the neoplastic cells were negative for chromogranin a, neuron - specific enolase and vimentin, indicating that the origin was not mesenchymal or neuronal / neuroendocrine (figure 3b). (a) the tissue was composed of solid nests, anastomosing cords and closely packed glands separated by a delicate fibrovascular stroma (haematoxylin and eosin, 10). (b) individual neoplastic cells were cylindrical to polyhedral in shape, had distinct cell borders and contained moderate amounts of finely granular eosinophilic cytoplasm and round - to - oval nuclei (haematoxylin and eosin, 40). (f) vimentin negative (magnification 40) ancillary testing using an electron microscope (jem-1400 ; jeol) was performed on slices prepared from fixed formalin mass. ultrastructurally, neoplastic cells were interconnected via junctional complexes and contained numerous round - to - oval, electron - dense mitochondria (figure 4). on the basis of the immunohistochemical staining profile of the neoplastic cells, together with electron microscopy results, a diagnosis of renal oncocytoma was made. the neoplastic cells were interconnected via junctional complexes and contained numerous round - to - oval, electron dense mitochondria (2500 electron microscope) cytologically, smears from well - sampled human renal oncocytoma reveal numerous isolated cells or loose clusters with abundant, eosinophilic, granular cytoplasm, well - demarcated cell borders, and round nuclei with small or medium nucleoli. in the current case, the smear consisted of dyshesive cells and eosinophilic - to - basophilic granular cytoplasm, and most features were equivalent to human renal oncocytoma. however, some cells were also aggregated in tubular or papillary forms along with eosinophilic intracellular materials. benign renal neoplasms according to the 2004 world health organization classification of renal tumours in human medicine, mai recently reported two cases of human oncocytic renal cell carcinoma. those tumours not only revealed cytological atypia and lymph node metastasis, but also showed similar immunological features to renal oncocytoma. buergelt and adjiri - awere reported a canine bilateral renal oncocytoma that invaded the lumbar muscle. with this in mind, renal oncocytomas should be considered as having very low rather than no malignant potential, although the typical classification is benign. in the present case a slightly enlarged lymph node in the cranial abdomen could not be evaluated by ct scan, but the cranial abdominal lymph node is being evaluated ultrasonographically every 12 months. to date, the cat only manifests clincal signs associated with chronic renal failure. although oncocytoma has characteristic features and fna is helpful for preoperative diagnosis, jing and christina reported a great degree of overlap in the cytological spectrum between renal oncocytoma and renal cell carcinomas with eosinophilic granular cytoplasm. this may impede accurate diagnosis in routine examination of fna specimens, even although each tumour has classic cytological features. in human medicine, clinical diagnostic dilemmas and the difficulty of cytological or histopathological differentiation of renal oncocytoma from chromophobe renal cell carcinoma still persist. in feline medicine, as renal cell carcinoma with eosinophilic granular cytoplasm has not been reported, a comparison was not possible. however, helpful information will be provided by ancillary immunohistochemical staining with electron microscopy examination in difficult cases, as in human medicine. cytological features of feline renal oncocytoma were oncocytic cells in sheets or clusters with abundant single cells. however, some cells were also aggregated in tubular or papillary forms along with eosinophilic intracellular materials. a moderate to abundant amount of densely stained granular cytoplasm with round nuclei and indistinct nucleoli was also noted. most cytological features of feline renal neoplasia are equivalent to human renal oncocytoma. to the best of our knowledge, further analyses of feline renal oncocytoma and feline renal cell carcinoma with eosinophilic granular cytoplasm are needed. | case summarya 9-year - old male neutered domestic shorthair cat presented with anorexia. ultrasonography showed an irregularly shaped hypoechoic mass in the cranial pole of the right kidney. ultrasound - guided fine - needle aspiration of the renal mass was performed. cytology revealed moderate cellularity smears composed of epithelial cell clusters, which consisted of an exclusive population of oncocytic cells seen in sheets and papillary clusters along with abundant single cells. a moderate - to - abundant amount of densely stained granular cytoplasm with round nuclei and indistinct nucleoli was seen. the cytological diagnosis was renal oncocytic neoplasm. ct and surgical resection revealed a firm tan mass in the right kidney. a final diagnosis of renal oncocytoma was made on the basis of histology, immunohistochemical staining profile (positive for cytokeratin, and negative for chromogranin a, neuron - specific enolase and vimentin) of neoplastic cells, together with the electronic microscopy results.relevance and novel informationwe believe that this is the first report of the cytological features of feline renal oncocytoma. |
epidemiological data indicate that adverse life events during the first few years of life can increase the risk for psychopathology, including drug addiction [1, 2 ]. in fact, early life stress has been proposed to predict alcohol drinking in adolescence and alcohol abuse and dependence at adulthood (see for review). alcohol dependence affects millions of people worldwide, and alcohol consumption at adolescence has reached alarming rates. in rodents, the effects of early life stress can be studied in a controlled manner by removal of the dam during the first 2 weeks of life (for a review on the animals models of dam - litter interaction disruption, please consult [57 ]). the effects of early life stress on alcohol consumption currently available are inconsistent and highly dependent on environmental factors such as the species and strains used and the protocol used for the maternal separation protocol (see as an example). in rats, repeated maternal separation during early postnatal life (180360 min. a day during the first three weeks of life) has been reported to induce an increase in alcohol intake [912 ], although no changes in alcohol consumption have also been reported [1315 ]. it is worth mentioning that the investigation of possible sex differences in this regard has been neglected. in the last years, we have focused on the investigation of the early maternal deprivation (md) animal model, that is, 24 h of dam - litter separation on postnatal day (pnd) 9. adolescent animals exposed to md have been reported to exhibit a trend to increased impulsivity, depressive - like responses, and impairments in cognitive function [1618 ]. at adolescence, an increase in striatal dopamine levels has also been reported as a consequence of md, possibly reflecting an altered brain reward system. actually, md seems to modify the response of animals to diverse drugs of abuse, including cannabinoids [7, 18, 20 ], 3,4-methylenedioxymetamphetamine (mdma), and cocaine. there is evidence about a relationship between stress and alcohol consumption (see [23, 24 ] for review) although the nature of this relationship is far from being understood. at this point, it is worth mentioning that, in a previous study, alcohol consumption during adolescence rendered animals more susceptible to acute stressor - specific effects in terms of alcohol consumption. therefore, in the present study alcohol deprivation was employed as a potential stressful stimulus that may influence motivation to drink [26, 27 ], and alcohol deprivation was also combined with restraint stress since exposure to restraint stress has been reported to increase alcohol consumption in rats. in the present study we aimed to analyze the effects of md on adolescent alcohol consumption, as well as addressing to which extent a previous history of early life stress (md) could modulate the consequences of subsequent stressful life events (alcohol deprivation and alcohol deprivation combined with the concomitant exposure to restraint stress) on voluntary alcohol intake. given the amount of evidence supporting sex differences in the consequences of md, both male and female animals were employed in the present study. experiments were performed in agreement with the european directive 2010/63/eu on the protection of animals used for scientific purposes and in compliance with the spanish royal decree 1201/2005, october 21, 2005 (boe n 252), about protection of experimental animals. experiments were carried out on the offspring of rats purchased from harlan laboratories (rossdorf, germany), which were mated (one male two females for ten consecutive days) in our animal facilities approximately 2 weeks after their arrival. after mating, female rats were housed individually in standard plexiglas cages (50 25 17.5 cm.) and the animals were monitored daily for parturition. on the day of birth, postnatal day (pnd) 0, the litters were culled and sex balanced to 8 pups per dam (4 males and 4 females). no cross - fostering was allowed. litters were randomly assigned to each experimental group : control (co) and maternal deprivation (md). all pups were weaned at pnd 22 and housed in pairs of sibling rats separated by sex. all animals were maintained in our animal facilities at the faculty of biological sciences in the complutense university of madrid (ex08-ucs) at a constant temperature (21 1c) and humidity (60 10%) in a reverse 12-hour dark - light cycle (lights on at 20.00 h), with free access to food (commercial diet for rodents a04/a03 ; safe, augy, france) and water. early md was performed as previously described. in brief, on pnd 9, litters were submitted to 24 hours of maternal deprivation ; that is, dams were removed from their home cages at 09.00 h, pups were weighted and remained undisturbed in the same room until the next day (pnd 10, 09.00 h) when pups were weighted again, and dams were placed back in their corresponding home cages. pups from the control group (co) were not manipulated but for body weight control on pnd 9 and pnd 10. body weight was registered every six days until weaning (on pnd 16 and pnd 22). a total of 10 litters were used in the present experiment (5 co litters and 5 md litters) ; however, due to a technical mistake, 2 cages from the md group had to be excluded from the study, and thus the total number of animals used was 76 (20 co males and 20 co females and 18 md males and 18 md females). once the rats became adolescents (pnd 28), rats were given free access to a bottle containing an ethanol solution (20% v / v) in addition to the water bottle. the ethanol solution (v / v) measurements of alcohol and water intake were made daily during the recording periods, as well as body weight. voluntary alcohol intake was recorded (1) during adolescence, from pnd 28 to pnd 50 ; (2) during a four - day period after one week of alcohol cessation, from pnd 57 to pnd 60 ; and (3) during a four - day period after a second period of alcohol cessation combined with exposure to restraint immobilization stress (30 min. per day under white light conditions) on the last three days of alcohol cessation, from pnd 67 to pnd 70. the amount of alcohol intake was expressed as grams (g.) and alcohol intake per body weight (kg.). daily voluntary alcohol consumption was calculated during the three recording periods, and alcohol intake during the first 2 h. of alcohol exposure was also evaluated for the two last periods following exposure to additional stress (see experimental schedule for details, figure 1). body weight and food intake were controlled throughout the experimental period. during the evaluation of alcohol consumption animals remained paired housed to avoid possible interferences with the md protocol due to isolation [28, 29 ]. food intake was evaluated by placing a known amount of food in each cage and measuring the remaining amount after 24 hours. this procedure was performed during the adolescent period (voluntary alcohol consumption) and after the first and second alcohol cessation periods. body weight was registered at pnd 9, pnd 16, and pnd 22 (before weaning) and daily thereafter during the periods of voluntary alcohol consumption, that is, adolescence, and following alcohol cessation. body weight (bw) gain (in grams) was analyzed and calculated as the difference in bw referenced to pnd 9 during the preweaning period, pnd 28 during adolescence, and pnd 50 during the two periods of alcohol cessation. additionally, growth rate (gr) was calculated as the percentage of bw gain divided by the reference bw employed during each period : gr (%) = (bw gain / bwref.) data were analyzed using a two - way analysis of variance (anova), considering sex (male or female) and neonatal condition (co or md) as independent factors. shapiro - wilk and levene tests were used to confirm normality and homoscedasticity of the data. repeated measures anova was employed when appropriate, that is, bw gain and growth rate. tukey post hoc comparisons were performed only for significant interactions, as well as additional one - way anovas. statistical analyses were performed by the spss 19.0 software package (spss inc., chicago, il, usa). no significant differences in alcohol intake were found during voluntary alcohol consumption at adolescence (control males : 16.6 1.9 g / kg / day ; control females : 17.2 1.9 neither the repeated measures anova nor the anova analysis of the averaged alcohol intake during adolescence revealed any significant difference (see figure 2). however, it is worth mentioning that md females showed a trend for increased levels of alcohol intake during the first days of alcohol exposure. following one - week cessation, no significant differences were found on daily voluntary alcohol consumption (data not shown). however, a significant effect of the neonatal condition was found during the first 2 h of alcohol exposure (f(1,34) = 4.48 ; p < 0.05). both male and female animals consumed more alcohol than their corresponding co animals during the first 2 h of alcohol exposure (figure 3(a)). although not significant, a trend for higher levels of alcohol consumption was found for female animals when compared to males during these first 2 h of alcohol exposure (f(1,34) = 3.79 ; p = 0.06). no significant interaction between sex and neonatal condition was found. following a second period of alcohol cessation combined with restraint stress during the last three days, no significant differences were found on daily voluntary alcohol consumption (data not shown). however, a significant effect of the neonatal condition was found during the first 2 h of alcohol exposure (f(1,34) = 5.47 ; p < 0.05). md animals exhibited a higher alcohol intake than co animals during the period of alcohol exposure (figure 3(b)). during this time period, a significant effect of sex appeared (f(1,34) = 5.30 ; p < 0.05). as for the previous time period, females showed higher levels of alcohol consumption compared to males during the first 2 h of alcohol exposure. no significant interaction between sex and neonatal condition was found. during the preweaning period, a significant effect of the neonatal condition was found when analyzing bw gain (f(1,16) = 89.88 ; p < 0.001) and growth rate (f(1,16) = 20.58 ; p < 0.001). neither a significant effect of the sex condition nor a significant interaction between factors was found. the md episode induced a significant reduction in bw gain and growth rate during the preweaning period (table 1). during adolescence, when animals had free access to alcohol, bw gain (figure 4(a)) and growth rate (figure 4(b)) were significantly affected by sex (f(1,72) = 281.62 ; p < 0.001 ; f(1,72) = 97.26 ; p < 0.001, resp.) and neonatal condition (f(1,72) = 6.47 ; p < 0.05 ; f(1,72) = 28.88 ; p < 0.001, resp.). no significant interaction between sex and neonatal condition was found. as expected, female animals showed lower bw gain and growth rate than male animals, while md animals showed a lower bw gain but a higher growth rate than control animals. the analysis of accumulated food intake rendered a significant effect of sex (f(1,34) = 104.78 ; p < 0.001) with females eating less than males and a significant effect of the neonatal condition (f(1,34) = 11.57 ; p < 0.005) with md animals consuming less food than their corresponding controls (figure 4(c)). a significant effect of sex on bw gain was found after the first (f(1,72) = 501.87, p < 0.001) and second (f(1,72) = 683.69 ; p < 0.001) periods of alcohol cessation, with females showing a lower bw gain than males across periods (data not shown). similarly, the analysis of growth rate (figures 5(a) and 5(c)) revealed a significant effect of sex after the first (f(1,72) = 242.03, p < 0.001) and second (f(1,72) = 341.55 ; p < 0.001) periods of alcohol cessation. moreover, the analysis of growth rate also revealed a significant effect of the neonatal condition after the two alcohol cessation periods (first period : f(1,72) = 7.30 ; p < 0.01 and second period : f(1,72) = 14.65 ; p < 0.001). for the growth rate analyses, a significant interaction between sex and neonatal condition was also found (first period : f(1,72) = 8.14 ; p < 0.01 and second period : f(1,72) = 8.62 ; p < 0.005). during the two periods of alcohol exposure, female animals showed a lower growth rate than male animals, but md only increased growth rate among male animals (no differences were observed among females). regarding the analysis of the accumulated food intake (figures 5(b) and 5(d)), a significant effect of sex was revealed (first period : f(1,34) = 210.18 ; p < 0.001 and second period : f(1,34) = 162.40 ; p < 0.001) ; males consumed more food than females during these two time periods. a significant effect of the neonatal condition was also found after the second period of alcohol cessation (f(1,34) = 6.29 ; p < 0.05) ; during this period md animals consumed less food than control animals. no significant interaction between sex and neonatal condition was found for any of the time periods analyzed. early life stress, in the form of a single 24-hour episode of md at pnd 9, did not affect baseline voluntary alcohol intake during adolescence in rats of both sexes. however, md seemed to exacerbate the effects of subsequent stress exposure on alcohol intake. animals exposed to neonatal md, compared to control non - md animals, showed higher levels of alcohol intake following a short period of alcohol cessation as well as after the combination of an additional period of alcohol cessation concomitant to restraint stress exposure. under the present experimental conditions, md, per se, did not appear to predict prospective alcohol intake during adolescence in either sex. previous studies have investigated the impact of early life stress on voluntary alcohol intake, but different protocols of maternal separation were employed, that is, repeated and shorter episodes of maternal separation, and it is well known that different experimental procedures of this model of early life stress render different results. moreover, most of the previous studies have investigated the effects of early life stress on adult animals, leaving adolescents out of the focus. following repeated brief episodes of neonatal maternal separation, some studies reported an increase in alcohol intake [912 ], although other studies found no changes in alcohol consumption [1315 ]. discrepancies with previous reports may result from the timeframe selected for alcohol exposure, that is, adolescence ; the protocol of early life stress employed, that is, md ; and differences in the protocol of alcohol exposure, that is, previous alcohol habituation, alcohol concentration, and/or choice between two or more bottles. however, present findings suggest md animals to be more vulnerable to the acute effects of stress in terms of later alcohol consumption. in fact, md animals showed higher levels of alcohol intake than control animals following a short period of alcohol cessation, and an additional short period of alcohol cessation combined with restraint stress. a previous study reported an increase in voluntary alcohol intake in adolescent animals exposed to a protocol of repeated maternal separation by using a paradigm of intermittent free access to alcohol. since the paradigm of alcohol exposure employed in that study included brief periods of alcohol withdrawal, also considered as stressful stimuli (see below), those results could be considered similar to our present findings. alcohol withdrawal has been considered as a potent stressor capable of disrupting several stress circuitries including the hpa axis and has been proposed as a suitable model to study the impact of alcohol reexposure on relapse. moreover, a previous study that investigated the vulnerability of animals to the consequences of stress on alcohol intake revealed that alcohol deprivations in combination with more severe stress protocols, that is, electric foot shock, were able to increase alcohol consumption if animals had initiated alcohol intake during adolescence. similarly, roman. reported an increase in alcohol intake during the exposure in adult life to a restraint protocol and throughout the postrestraint period in male and female animals exposed to repeated periods of brief maternal separation. the relationship between stress and alcohol consumption is complex and poorly understood (see [23, 24 ] for review) ; however, present data suggest that early life stress and in particular md may render animals more vulnerable to the consequences of future stressful situations regarding alcohol intake. early life stress has been associated with alterations in the development and establishment of several neurotransmitter circuitries involved in the stress response. as an example, md has been reported to alter the development of the dopaminergic, serotonergic, and glutamatergic systems, known to be involved in alcohol effects and vulnerability [19, 32, 33 ]. a disruption of the endogenous cannabinoid system has also been reported as a consequence of md [17, 3438 ]. the endocannabinoid (ecb) system appears to be of special interest in the context of the present study since it has been proposed as one of the underlying mechanisms of alcohol use and abuse and, more recently, as a putative candidate for the proclivity to alcohol intake observed in animals submitted to certain protocols of maternal separation. therefore, the changes induced by the md episode on the ecb system may possibly underlie the increased alcohol intake reported after the exposure to stressful challenges later in life. in humans, epidemiological studies indicate higher rates of alcohol abuse and dependence in men compared to woman. however, data from animal models show the opposite ; female animals seem more prone to consume alcohol than males [42, 43 ]. discrepancies between human and animal studies may result from sociocultural factors, but the investigation of the underlying neurobiological substrates may help us to better understand these sex differences. in the present study, female animals consumed more alcohol than males in a two - bottle choice paradigm following an episode of alcohol cessation combined with restraint stress. since sex differences in the response to stressors have been extensively described [44, 45 ], a differential response to stress in male and female animals might underlie, at least in part, the greater influence of stress on alcohol intake in females. as in previous studies from our group, md animals showed a significantly diminished bw gain until weaning when compared to co animals [36, 46, 47 ], as well as a significantly decreased growth rate. however, these growing profiles changed after weaning. during adolescence, when animals had free access to alcohol, md animals still showed lower bw gain than control animals, but they also showed a higher growth rate than controls. these results suggest that md animals gain less body weight but they did it faster than control animals. the higher growth rate was accompanied by a decrease in food intake, suggesting an altered body weight regulation in md animals that is evidenced in adolescence, coincident with alcohol exposure. it is worth mentioning that later in life, as evaluated following the exposure to stressful events, that is, alcohol cessation and alcohol cessation combined with restraint stress, only among male animals did the effects of md on growth rate persist. though a specific effect of weaning on the different growth rate of control and md animals can not be ruled out, it is important to point out that md modifies the metabolic response to a metabolic challenge such as a high fat diet. from this point of view, the present data may indicate that md alters the metabolic response to alcohol, apparently in a sex dependent manner, though a direct confirmation of this hypothesis would require further experiments. we have previously reported that md rats show a long lasting leptin deficiency (observed in neonates and adult rats) as well as an altered hypothalamic development [47, 49, 50 ]. recently, de timary. have proposed a model for disruption of energy balance in alcohol dependent subjects in which altered leptin levels play a central role. the interactions between metabolic alterations induced by early life stress and those induced by alcohol abuse deserve further investigation, since adaptations of energy balance may contribute (aside from the effects of alcohol on the brain reward system) to the modulatory effects of md on stress - induced alcohol intake. early maternal deprivation did not affect baseline voluntary alcohol consumption during adolescence but enhanced the levels of voluntary alcohol intake following exposure to stressful events later in life. moreover, this episode of early life stress seemed to alter energy balance and metabolism since somatic growth and food intake were persistently modified in these animals. future research is needed in order to clarify the impact of metabolic changes, such as altered leptin levels, on the susceptibility to increase alcohol intake in response to stress. | in the present study, we aimed to assess the impact of early life stress, in the form of early maternal deprivation (md, 24 h on postnatal day, pnd, 9), on voluntary alcohol intake in adolescent male and female wistar rats. during adolescence, from pnd 28 to pnd 50, voluntary ethanol intake (20%, v / v) was investigated using the two - bottle free choice paradigm. to better understand the relationship between stress and alcohol consumption, voluntary alcohol intake was also evaluated following additional stressful events later in life, that is, a week of alcohol cessation and a week of alcohol cessation combined with exposure to restraint stress. female animals consumed more alcohol than males only after a second episode of alcohol cessation combined with restraint stress. md did not affect baseline voluntary alcohol intake but increased voluntary alcohol intake after stress exposure, indicating that md may render animals more vulnerable to the effects of stress on alcohol intake. during adolescence, when animals had free access to alcohol, md animals showed lower body weight gain but a higher growth rate than control animals. moreover, the higher growth rate was accompanied by a decrease in food intake, suggesting an altered metabolic regulation in md animals that may interact with alcohol intake. |
pasteurella multocida (p. multocida) is the etiologic agent of bovine pneumonia and hemorrhagic septicemia in cattle which has been estimated to cause huge economic losses. five capsule types are routinely identified in p. multocida (a, b, d, e, and f) and each is generally associated with, but not completely restricted to, a specific host. p. multocida has the typical characteristics of an opportunistic pathogen that is affected by various host and pathogen specific determinants and can survive in the oral cavity and upper respiratory tract of wild and domestic animals. in both, animals and humans, p. multocida is often associated with chronic as well as acute infections that can lead to significant morbidity (manifested as pasteurellosis, pneumonia, atrophic rhinitis, hemorrhagic septicemia and/or cellulitis, abscesses, and meningitis) and mortality, particularly in animals [2, 3 ]. nevertheless, pasteurellosis is still a relatively uncommon cause of mortality in human, even though deaths due to pasteurellosis have increased in recent years in the united states [4, 5 ], and pasteurellosis in human is often due to bites or scratches by cats or dogs [6, 7 ]. the first complete genome sequence of p. multocida was pm70, isolated from avian species in 2001. since then, the complete or incomplete genomes of 57 p. multocida isolates have been sequenced, including at least ten complete genomes from the species in the ncbi database. all of the currently available p. multocida genomes are between 1.43 mbp and 2.44 mbp in length and comprise a single circular genome with a g+c content between 36.9% and 41%. the available data were used to identify a number of important similarities and differences between these strains and determine their virulence. several species - specific putative virulence factors, including the capsular and virulence - associated genes, have been proposed to play a key role in the interactions with the host [10, 11 ]. p. multocida possesses a number of virulence factors which include polysaccharide capsule, endotoxins or lipopolysaccharide (lps), outer membrane proteins (omps), fimbriae, exotoxins, multocidins or siderophores, extracellular enzymes, plasmids, and the virulence - associated genes (tbpa, pfha, toxa, hgbb, hgba, fur, tonb, exbb, hgbb, nanh, nanb, soda, sodc, ompa, omph, oma87, plpb, fima, hsf-1, hsf-2, tadd, and ptfa) [1, 12, 13 ]. it is speculated that the virulence factors expressed by p. multocida are likely to play key roles in pathogenesis. comparative genomics provides an effective source for better understanding the virulence of different isolated strains. in this study, genome sequencing and comparative genomics analysis were carried out to investigate the underlying virulence factors of the high virulent and low virulent bovine p. multocida capsular type a strains, pmcq2 and pmcq6, respectively. two p. multocida isolates (pmcq2 and pmcq6) have been previously isolated from the fatal pneumonia lungs of feedlot calves at gaojiazhen farms in fengdu (chongqing, china, longitude / latitude 107.70/29.89) from 2011 to 2012. based on morphological characteristics, biochemical properties, and 16srrna gene sequence analysis, the bacteria were identified as p. multocida. further analysis with pcr amplification of p. multocida species - specific gene kmt-1 and serotype - specific genes hyad - hyac, bcbd, dcbf, ecbj, and fcbd indicated that the isolates were p. multocida capsular type a, named as pmcq2 and pmcq6, and the virulence of the two strains determined by ld50 in kunming mice showed that pmcq2 is a high virulent strain and pmcq6 is a low virulent strain with 2.2 10 cfu and 1.14 10 cfu, respectively. isolated strains were maintained at 80c in martin broth (mb) plus 10% glycerol. pmcq2 and pmcq6 were inoculated in 5 ml mb at 37c overnight with shaking. the concentration was determined by viable cell counting on martin agar plates at 37c for 24 h. genomic dnas of the two strains were isolated using the qiagen dna extraction kits. bp reads of each genome were assembled into 7 and 32 contigs for strains pmcq2 and pmcq6, respectively. open reading frames (orfs) were annotated by searching against the nr, swiss - prot, and cog databases with manually curation using blastp (e - value < 1e 5) (table s1 in supplementary material available online at http://dx.doi.org/10.1155/2016/4512493). the rrna and trna genes were identified using rnammer and trnascan, respectively. a comprehensive genome map containing coding and noncoding genes, cog annotations, and overall g+c content was plotted using perl - svg. mummer is ideally suited for aligning genomes when the genome sequences are very similar and provides genome - wide sequence comparisons to determine the maximum unique matches between two sequences. here, mummer and blastn (e - value of 1e 10) were applied for a detailed collinearity analysis of the three bovine pm genomes, pmcq2, pmcq6, and pm36950 at nucleotide sequence levels. pm36950 is also bovine p. multocida capsular type a strain and was obtained from the ncbi genebank and was used as the reference genome sequence. the blast score ratio (bsr) method was used to compare peptide identities within three genomes (pmcq2, pmcq6, and pm36950) using a measure of similarity based on the ratio of blast scores. the output of the bsr analysis enables global visualization of the degree of proteome similarity among genomes and enables the genomic synteny (conserved gene order) between each genome pair to be assessed. the bsr was calculated by dividing the query score by the reference score for each reference peptide. following calculation of the bsrs, the four quadrants were derived from a bsr threshold value of 0.4, which was empirically determined to represent approximately 30% amino acid identity over approximately 30% of the peptide length and is a commonly used threshold for peptide similarity. the four quadrants were determined for each of the query genomes and colored accordingly : yellow, unique to the reference, pmcq2 < 0.4, and pmcq6 < 0.4 ; red, common to all three, pmcq2 0.4, and pmcq6 0.4 ; green, common between pmcq2 and pm36950, but absent in pmcq6, pmcq2 < 0.4, and pmcq6 0.4 ; blue, common between pmcq6 and pm36950, but absent in pmcq2, pmcq2 0.4, and pmcq6 < 0.4. genomic islands (gis) are clusters of genes in prokaryotic genomes of probable horizontal origin. insertion sequences (iss) of p. multocida were identified by searching sequences against the is database (table s1) that collects all iss of bacteria and archaea. isfinder was implemented to launch blast with the e - value 1e 10 to search the database. signal peptide, transmembrane domain, gpi - anchor, and general subcellular localization were predicted with signalp v3.0, tmhmm server 2.0, gpi - som, and psortb to screen potential secretory proteins that contain signal peptide and no membrane localization signals. the virulence factor database (vfdb) is an integrated and comprehensive online resource for curating information about virulence factors of bacterial pathogens (table s1). based on homologous analysis, some virulent factors (iss, gis, vf, secretory proteins, and membrane proteins) were obtained in the sequenced strains. in combination with the potential virulent genes of p. multocida and gene annotation information, the genome sequences of bothpmcq2 and pmcq6 strains were successively sequenced by illumina miseq platform. using pm36950 as a reference strain, pmcq2 genome is 2.32 mbp in size with 39.12% g+c content, containing 2,000 predicted coding regions, 4 rrnas operons, and 49 trnas. pmcq6 genome is 2.29 mbp in size with 40.09% g+c content, containing 1,969 predicted coding regions, 1 rrna operon, and 43 trnas. the single circular genome maps of the two p. multocida genomes were shown in figure 1. there are no obvious species - specific features of the coding density, and the g+c content is highly conserved. compared with some other p. multocida strains carrying multiple plasmids that may either be cryptic or carry antibiotic resistance genes, both pmcq2 and pmcq6 genomes do not contain any plasmids. taken together, there are only slightly differences in genome sizes, predicted gene numbers, and g+c contents between pmcq2 and pmcq6. some differences in protein numbers among cog categories of pmcq2 and pmcq6 were identified (including those listed as protein numbers for pmcq2 and pmcq6, resp.) : energy production and conversion (109 and 111), amino acid transport and metabolism (158 and 156), nucleotide transport and metabolism (60 and 57), carbohydrate transport and metabolism (165 and 166), coenzyme transport and metabolism (89 and 86), translation, ribosomal structure, and biogenesis (132 and 129), transcription (81 and 79), replication, recombination, and repair (111 and 100), cell wall / membrane / envelope biogenesis (145 and 158), inorganic ion transport and metabolism (121 and 120), general function prediction only (183 and 181), function unknown (158 and 157), signal transduction mechanisms (42 and 44), and intracellular trafficking, secretion, and vesicular transport (38 and 40) (figure 2). the colinearity analysis at the nucleotide level provides information on sequence insertion or deletion. by aligning the genome at the nucleotide level, there was no significant differences among the large segments between high virulent pmcq2 and low virulent pmcq6, and the two strains revealed high colinearity with pm36950 (figures 3(a)3(c)). direct comparison of the complete nucleotide sequences using blast revealed the similarity between pmcq2 and pm36950, pmcq6 and pm36950, and pmcq2 and pmcq6 is 90%, 90%, and 99%, respectively. pmcq2 and pmcq6 showed higher homology as indicated by matched cds (figure 3(d)). by bsr analysis, the protein sequences shared a high degree of synteny among pmcq2, pmcq6, and pm36950, using pm36950 as a reference strain (figure 4). however, some unique proteins were identified, pmcq2 and pmcq6 (blast score ratio is less than 0.4). there are 32 unique proteins in pmcq2 genome (including transposase is200, elongation factor tu - a-1/2, srfc, lsrr, tola, and peptidase b) and only two unique proteins found in pmcq6 genome (pasteurella filamentous hemagglutinin protein and mercuric transport protein mert). the relative chromosomal locations of the unique proteins (red thick marks) of pmcq2 and pmcq6 were shown in figure 5. using a venn diagram of three bovine p. multocida strains, the unique gene groups were significantly different among three strains, containing 37, 29, and 245 gene groups in pmcq2, pmcq6, and pm36950, respectively (figure 5). the major virulence factors identified in p. multocida are capsule proteins, lipopolysaccharides, membrane proteins, and secreted proteins. here, together with genome sequences of pmcq2 and pmcq6, published genome sequences of high virulent strains (pm36950 and pmhn06) and avirulent strains (pm3480 and pm70) from ncbi were selected for comparative genomics analysis (table 1). comparing the pmcq2 and pmcq6 genomes with the complete genome sequences of pm36950 (g+ca_000234745.1), pmhn06 (g+ca_000255915.1), pm3480 (g+ca_000259545), and pm70 (g+ca_000006825.1) using blast, a number of virulence - associated genes were identified that were absent or present in all of the comparison strains (table 2). a number of genes or gene clusters have been implicated as important for virulence of p. multocida. some of these genes encoding putative virulence factors are universally present in all six p. multocida genomes, including genes encoding prophage, genomic islands, insertion sequences, virulence factor, secretory proteins, and outer membrane proteins. by comparing the high virulent strains (pmcq2, pm36950, and pmhn06) with low virulent strain (pmcq6) and avirulent strains (pm3480 and pm70), unique genes which were correlated with virulence and only presented in high virulent strains were identified. for instance, insertion sequence (transposase is200) only existed in three high virulent strains, suggesting that is200 elements are not conserved sequences and do not spread among all p. multocida strains. is605 and secreted protein pmcq2_2g0088 (modb) and nonspecific tight adherence protein d pmcq2_3g0367 were presented only in pmcq2 genome (table 2). in addition, genomic islands (gis) are clusters of genes in prokaryotic genomes and are probable horizontal origin. homology analysis of these gis with the draft genomes of pmcq2 and pmcq6 was carried out using orthomcl1.4 (blast p value 1e 5, percent identity cutoff 60%, and percent match cutoff 60%). the result showed that transcriptional regulator pmcq2_7g0006 and hypothetical proteins pmcq2_5g0013 and pmcq2_5g0025 are present in high virulent strains (pmcq2 and pmhn06) but absent in low virulent strain pmcq6 and the avirulent strains (pm70 and pm3480). taken together, comparative genomics analysis supplies essential information for understanding the virulence of different capsular type (a, d, and f) and different host origin (bovine, avian, and swine) strains. five unique genes and two insertion sequences were identified only in high virulent strains, providing candidate virulence factors for further studies on the pathogenesis of different p. multocida strains (table 3). moreover, comparative genomic analysis allows the identification of core genes and/or disease - specific factors. the first complete p. multocida genome was sequenced from strain pm70 in 2001, from which 104 putative virulence - associated genes were identified ; this facilitated new approaches for studying the pathogenesis of p. multocida. until now, the complete and incomplete genomes of 57 p. multocida have been sequenced in ncbi database. in this study, two bovine p. multocida capsular type a genomes (high virulent pmcq2 and low virulent pmcq6) were sequenced. comparative genomics analysis was performed among pmcq2, pmcq6, and four other p. multocida genomes (pm36950, pmhn06, pm3480, and pm70) from ncbi. some virulence genes were identified among different virulent strains ; five genes and two insertion sequences were only identified in high virulent strains, which might be responsible for the virulence differences among high virulent, low virulent, and avirulent strains. the genome sequences of high virulent pmcq2 and the low virulent pmcq6 have high similarity, but the virulence of two strains is significantly different. it could be speculated that the unique genes may play a key role in virulence. compared with pmcq6, the five genes and two insertion sequences are predicted virulence - associated genes in pmcq2 and other high virulent strains. further studies to construct mutant strains targeting these genes would be of great importance to prove their contributions to virulence. besides, pmcq2 has more than 30 other unique genes that might also orchestrate the virulence differences of pmcq2 and pmcq6. these genes include recombinase, phage - related genes, phage n-6-adenine - methyltransferase, phage terminase, and prophage integrase. based on homology analysis, prophage - associated genes, gis, iss, secretory proteins, and membrane proteins were screened for different virulence - associated genes among different virulent strains. insertion sequences usually only carry genes of transposon sequences for the transposition in bacteria and can also induce a variety of genomic rearrangements ; they also play an important role in bacterial host specificity and virulence [33, 34 ]. transposase is200 was found in three high virulent isolated strains encoding the 7 genes (pmcq2_1g0197, pmcq2_1g0267, pmcq2_1g0316, pmcq2_1g0378, pmcq2_2g0113, pmcq2_4g0323, and pmcq2_4g0359), but is200 was not present in the low virulent strains (pmcq6, pm70) or the avirulent strain (pm3480). the is200 elements may adapt to different hosts in closely related genera but stochastic loss can appear in some low virulent or avirulent strains. according to previous reports, is200-related transposons may have already existed in remote stages of bacterial evolution, such as salmonellae, and is200-based methods have been described for the identification of certain salmonella serovars. the function and host range of transposase is200 in p. multocida still need to be further studied. pmcq2_2g0088 has been suggested to encode a subfamily of atp - binding cassette (abc) transporters that have a possible role in remodeling the cell envelope and entry of the pathogen into nonphagocytic cells. bacterial abc transporters are essential for the uptake of nutrients, including rare elements such as molybdenum. abc transporters are integral membrane proteins that actively transport molecules across cell membranes, and these three proteins are coded by moda, modb, and modc genes, respectively. the moda, modb, and modc proteins are very similar in various organisms (escherichia coli, haemophilus influenzae, azotobacter vinelandii, and rhodobacter capsulatus). in this study, the sbp - box gene family is specific to plants and encodes a class of zinc finger - containing transcription factors with a broad range of functions. however, the function of the modb protein family has not been clearly established ; pmcq2_2g0088 might affect the virulence of strain and needs to be further studied as a candidate virulence factor. the present study revealed that p. multocida strains carry different virulence genes which may indicate variation in the pathogenicity. it could be speculated that the specific genes of different strains play the most important role for the difference of pathogenicity. by extensive genomics and proteomics analysis, the intensive study on virulence genes provides deeper understanding of host specificity and pathogenesis and also provides insights into the host - microbe interactions and the immunologic mechanism, contributing to the development of novel vaccines. | the pasteurella multocida capsular type a isolates can cause pneumonia and bovine respiratory disease (brd). in this study, comparative genomics analysis was carried out to identify the virulence genes in two different virulent p. multocida capsular type a isolates (high virulent pmcq2 and low virulent pmcq6). the draft genome sequence of pmcq2 is 2.32 mbp and contains 2,002 protein - coding genes, 9 insertion sequence (is) elements, and 1 prophage region. the draft genome sequence of pmcq6 is 2.29 mbp and contains 1,970 protein - coding genes, 2 is elements, and 3 prophage regions. the genome alignment analysis revealed that the genome similarity between pmcq2 and pmcq6 is 99% with high colinearity. to identify the candidate genes responsible for virulence, the pmcq2 and pmcq6 were compared together with that of the published genomes of high virulent pm36950 and pmhn06 and avirulent pm3480 and pm70 (capsular type f). five genes and two insertion sequences are identified in high virulent strains but not in low virulent or avirulent strains. these results indicated that these genes or insertion sequences might be responsible for the virulence of p. multocida, providing prospective candidates for further studies on the pathogenesis and the host - pathogen interactions of p. multocida. |
the aim of this study was to provide research and collaboration overview of iranian research efforts in the field of traditional medicine during 2010 - 2014. this is a bibliometric study using the scopus database as data source, using search affiliation address relevant to traditional medicine and iran as the search strategy. subject and geographical overlay maps were also applied to visualize the network activities of the iranian authors. highly cited articles (citations > 10) were further explored to highlight the impact of research domains more specifically. about 3,683 articles were published by iranian authors in scopus database. the compound annual growth rate of iranian publications was 0.14% during 2010 - 2014. tehran university of medical sciences (932 articles), shiraz university of medical sciences (404 articles) and tabriz islamic medical university (391 articles), were the leading institutions in the field of traditional medicine. medicinal plants (72%), digestive system s disease (21%), basics of traditional medicine (13%), mental disorders (8%) were the major research topics. united states (7%), netherlands (3%), and canada (2.6%) were the most important collaborators of iranian authors. iranian research efforts in the field of traditional medicine have been increased slightly over the last years. yet, joint multi - disciplinary collaborations are needed to cover inadequately described areas of traditional medicine in the country. | background : the aim of this study was to provide research and collaboration overview of iranian research efforts in the field of traditional medicine during 2010-2014.methods:this is a bibliometric study using the scopus database as data source, using search affiliation address relevant to traditional medicine and iran as the search strategy. subject and geographical overlay maps were also applied to visualize the network activities of the iranian authors. highly cited articles (citations > 10) were further explored to highlight the impact of research domains more specifically.results:about 3,683 articles were published by iranian authors in scopus database. the compound annual growth rate of iranian publications was 0.14% during 2010 - 2014. tehran university of medical sciences (932 articles), shiraz university of medical sciences (404 articles) and tabriz islamic medical university (391 articles), were the leading institutions in the field of traditional medicine. medicinal plants (72%), digestive system s disease (21%), basics of traditional medicine (13%), mental disorders (8%) were the major research topics. united states (7%), netherlands (3%), and canada (2.6%) were the most important collaborators of iranian authors.conclusion:iranian research efforts in the field of traditional medicine have been increased slightly over the last years. yet, joint multi - disciplinary collaborations are needed to cover inadequately described areas of traditional medicine in the country. |
claudin-1 is a member the claudin family of proteins, which are important in tight junction formation 1. they play roles in major cellular functions such as growth and adhesion and are responsible for regulating the paracellular transport of molecules 2. claudins were first shown to be abnormally expressed in breast and ovarian cancer 3, and have since been found to play roles in other cancers such as melanoma 4, renal and squamous cell carcinomas 2, to name just a few. however, these proteins, and other tight junction proteins such as zona occludens-1 (zo-1) have been shown to alter their subcellular localization during malignant progression 5. in melanocytic lesions, we have shown that claudin-1 expression is not only increased, but that its subcellular localization becomes dysregulated, moving away from its typical location at the cell membrane 4. benign lesions and less aggressive melanomas express claudin-1 in the nucleus, whereas aggressive melanomas have an abundance of claudin-1 in the cytoplasm. we have shown that increasing claudin-1 expression in less metastatic melanoma cells caused an increase in melanoma cell motility, as well as in levels of mmp-2 activation and secretion. increased claudin-1 expression did not correlate to increases in tight junction function, presumably due to the fact that it was expressed in the cytoplasm, rather than solely at the cell membrane 4. other studies have shown that protein kinase activity is important for the regulation and localization of claudin expression. it has been shown that protein kinases such as protein kinase a (pka) and protein kinase c (pkc) can phosphorylate claudins 6,7. phorbol ester treatment, which activates conventional pkc isoforoms, increased the expression 8 and cytoplasmic distribution of claudin-1, and simultaneously reduced tight junction barrier integrity 7. conversely, activation of atypical pkc isoforms using bryostatin instead increased the expression of claudin-1 in the tight junction complex, and increased tight junction barrier integrity 9. in melanoma, we have shown that claudin-1 expression levels are increased upon phorbol ester treatment, and decreased by inhibitors of conventional pkc isoforms, implying that, in melanoma, claudin-1 expression is dependent upon pkc isoforoms such as, and 4. in this study, we also examine the effects of pka on claudin-1 expression and localization, and how the localization of claudin-1 can affect melanoma cell motility. tight junction proteins have long been thought to be solely responsible for the transport of paracellular molecules. recent data from cancer studies indicate that these proteins also play important roles in signal transduction. in part, this is facilitated by the translocation of claudins to subcellular locations other than their normal location at the cell membrane. we show here that phosphorylation modifications of the tight junction protein claudin-1 cause its translocation to the cytoplasm and nucleus and that the subcellular localization of claudin-1 may dictate the metastatic capacity of melanoma cells. our findings suggest that nuclear versus cytoplasmic expression of claudin-1 may become a valuable marker for diagnosis of malignant melanoma. nuclear localization of claudin-1 is evident in nevi, and less metastatic melanoma cells 4. to determine if the nuclear localization of claudin-1 was related to the increased invasive capacity of melanoma cells, we created a claudin-1 expression vector expressing claudin-1 containing a nuclear localization signal (pdsredcldn1-nls) however, transfection of this vector into g361 melanoma cells (which have low levels of claudin-1) resulted in both nuclear and cytoplasmic expression of claudin-1 (figure 1 a) despite the fact that claudin-1 was attached to a nls. this led us to ask whether a post - translational modification such as phosphorylation might be resulting in the transport of claudin-1 out of the nucleus. since we have previously implicated pkc in melanoma progression, and claudin-1 expression, we transfected pdsredcldn1-nls into g361 cells, and then treated the transfected cells with phorbol ester (pma). treatment of cells with 200 nm pma resulted in an almost complete exclusion of claudin-1 from the nucleus (figure 1b). this implies that active pkc may exist in the nucleus of melanoma cells, and the presence of active pkc isoforms in the nuclei of many cell types has been confirmed 10 - 12. staining of the g361 cells with antibodies to phosphorylated pkc (,,) demonstrates that there is active pkc in melanoma cell nuclei as well (figure 1c). further, we performed immunoprecipitation studies using an antibody that binds to any protein that is a potential pkc substrate, followed by western analysis for claudin-1. in uacc647 melanoma cells which are highly metastatic and have high levels of claudin-1 4, claudin-1 co - immunoprecipitates with the pkc substrate antibody (figure 1d). in the presence of pkc inhibitors, which we have previously demonstrated to decrease claudin-1 expression 4, there is a decrease in the levels of claudin-1 precipitated by the pkc substrate antibody. g361 cells, which have very little endogenous claudin-1, and low levels of pkc, show no immunoprecipitation of claudin-1 with the pkc substrate antibody (figure 1d). to better characterize the phosphorylation of claudin-1 by pkc, we performed an in silico analysis of the putative pkc phosphorylation sites for claudin-1. we found that there are five putative pkc phosphorylation sites on the claudin-1 protein (212 amino acids long), but all of these are also sites of pka phosphorylation (table 1). there are however, three unique sites of pka phosphorylation, at amino acid residues 65 - 69, and 189 - 192 and 201 - 205. it should be noted that the aa189 - 192 site overlaps with a pkc / pka phosphorylation site (aa188 - 191). to assess whether pkc or pka was responsible for the phosphorylation and nuclear exclusion of claudin-1, we used site - directed mutagenesis of our pcdna3.1-cldn1 vector to make mutants that either mimicked a constitutively phosphorylated state (conversion of the phosphorylation site to an aspartic acid residue, referred to as d mutants) or mutants that are non - phosphorylable (conversion of the phosphorylation site to an alanine residue, referred to as a mutants). this vector, when transfected into melanoma cells shows both cytoplasmic and nuclear expression of claudin-1, as compared to empty vector controls (figure 2a). the sites of phosphorylation close to the end of the protein sequence (aa200 - 212) did not provide us with successful mutants. mutations to alanine in pkc / pka sites did not affect the subcellular localization of claudin-1, but alanine mutations of the two unique pka sites caused nuclear localization of claudin-1 (figure 2b). mutations to aspartic acid in both pka only as well as pkc / pka sites caused cytoplasmic redistribution of claudin-1 with complete exclusion from the nucleus (figure 2c). nuclear localization of claudin-1 upon mutation of the pka sites could be mimicked using pka inhibitors. untreated m93 - 047 cells have high levels of claudin-1 and exhibit a diffuse, largely cytoplasmic pattern of claudin-1 (figure 3a). upon treatment with pka inhibitors for 15 minutes, claudin-1 shuttles into the nucleus (figure 3b). after 1 hour of treatment with pka inhibitor, claudin-1 is still highly nuclear, although some claudin-1 has started to shuttle out of the nucleus (figure 3c). this is unlike the situation with pkc inhibitors, which cause a general downregulation of claudin-1 expression 4. furthermore, it is interesting to note that all of the cell lines have similar levels of phospho - pka (figure 3d) which explains why the transfected claudin-1 is shuttled out of the nucleus even when transfected into less metastatic g361 cells, which have low amounts of phospho - pkc 4,13. taken together these data indicate that pka is likely contributing to the subcellular localization of claudin-1. we have previously shown that increasing the levels of cldn-1 increases the invasion of melanoma cells 4. to determine if the increase in claudin-1 needs to be cytoplasmic and not nuclear to affect the ability of melanoma cells to invade, we first performed a stable transfection of our g361 cells with the s69a (pka, non - phosphorylatable) claudin-1 mutants. as can be seen the pcdna3.1-cldn1 transfected cells have plenty of cytoplasmic claudin as compared to the stable empty vector clones (figure 4a, b) whereas the s69a mutants have largely nuclear expression of claudin-1 (figure 4c). to test their invasive capacity, as compared to empty vector controls, cells transfected with the pka deactivating s69a mutation did not show any increase in invasion. however, g361 cells transfected with the claudin-1 overexpressing vector showed a nearly 2-fold increase in invasion as compared to the empty vector control (figure 4d). these data appear to support the hypothesis that nuclear overexpression of claudin-1 does not increase the invasive capacity of melanoma cells, where cytoplasmic expression of claudin-1 does. nuclear localization of claudin-1 is evident in nevi, and less metastatic melanoma cells 4. to determine if the nuclear localization of claudin-1 was related to the increased invasive capacity of melanoma cells, we created a claudin-1 expression vector expressing claudin-1 containing a nuclear localization signal (pdsredcldn1-nls) however, transfection of this vector into g361 melanoma cells (which have low levels of claudin-1) resulted in both nuclear and cytoplasmic expression of claudin-1 (figure 1 a) despite the fact that claudin-1 was attached to a nls. this led us to ask whether a post - translational modification such as phosphorylation might be resulting in the transport of claudin-1 out of the nucleus. since we have previously implicated pkc in melanoma progression, and claudin-1 expression, we transfected pdsredcldn1-nls into g361 cells, and then treated the transfected cells with phorbol ester (pma). treatment of cells with 200 nm pma resulted in an almost complete exclusion of claudin-1 from the nucleus (figure 1b). this implies that active pkc may exist in the nucleus of melanoma cells, and the presence of active pkc isoforms in the nuclei of many cell types has been confirmed 10 - 12. staining of the g361 cells with antibodies to phosphorylated pkc (,,) demonstrates that there is active pkc in melanoma cell nuclei as well (figure 1c). further, we performed immunoprecipitation studies using an antibody that binds to any protein that is a potential pkc substrate, followed by western analysis for claudin-1. in uacc647 melanoma cells which are highly metastatic and have high levels of claudin-1 4, claudin-1 co - immunoprecipitates with the pkc substrate antibody (figure 1d). in the presence of pkc inhibitors, which we have previously demonstrated to decrease claudin-1 expression 4, there is a decrease in the levels of claudin-1 precipitated by the pkc substrate antibody. g361 cells, which have very little endogenous claudin-1, and low levels of pkc, show no immunoprecipitation of claudin-1 with the pkc substrate antibody (figure 1d). to better characterize the phosphorylation of claudin-1 by pkc, we performed an in silico analysis of the putative pkc phosphorylation sites for claudin-1. we found that there are five putative pkc phosphorylation sites on the claudin-1 protein (212 amino acids long), but all of these are also sites of pka phosphorylation (table 1). there are however, three unique sites of pka phosphorylation, at amino acid residues 65 - 69, and 189 - 192 and 201 - 205. it should be noted that the aa189 - 192 site overlaps with a pkc / pka phosphorylation site (aa188 - 191). to assess whether pkc or pka was responsible for the phosphorylation and nuclear exclusion of claudin-1, we used site - directed mutagenesis of our pcdna3.1-cldn1 vector to make mutants that either mimicked a constitutively phosphorylated state (conversion of the phosphorylation site to an aspartic acid residue, referred to as d mutants) or mutants that are non - phosphorylable (conversion of the phosphorylation site to an alanine residue, referred to as a mutants). this vector, when transfected into melanoma cells shows both cytoplasmic and nuclear expression of claudin-1, as compared to empty vector controls (figure 2a). the sites of phosphorylation close to the end of the protein sequence (aa200 - 212) did not provide us with successful mutants. mutations to alanine in pkc / pka sites did not affect the subcellular localization of claudin-1, but alanine mutations of the two unique pka sites caused nuclear localization of claudin-1 (figure 2b). mutations to aspartic acid in both pka only as well as pkc / pka sites caused cytoplasmic redistribution of claudin-1 with complete exclusion from the nucleus (figure 2c). nuclear localization of claudin-1 upon mutation of the pka sites could be mimicked using pka inhibitors. untreated m93 - 047 cells have high levels of claudin-1 and exhibit a diffuse, largely cytoplasmic pattern of claudin-1 (figure 3a). upon treatment with pka inhibitors for 15 minutes, claudin-1 shuttles into the nucleus (figure 3b). after 1 hour of treatment with pka inhibitor, claudin-1 is still highly nuclear, although some claudin-1 has started to shuttle out of the nucleus (figure 3c). this is unlike the situation with pkc inhibitors, which cause a general downregulation of claudin-1 expression 4. furthermore, it is interesting to note that all of the cell lines have similar levels of phospho - pka (figure 3d) which explains why the transfected claudin-1 is shuttled out of the nucleus even when transfected into less metastatic g361 cells, which have low amounts of phospho - pkc 4,13. taken together these data indicate that pka is likely contributing to the subcellular localization of claudin-1. we have previously shown that increasing the levels of cldn-1 increases the invasion of melanoma cells 4. to determine if the increase in claudin-1 needs to be cytoplasmic and not nuclear to affect the ability of melanoma cells to invade, we first performed a stable transfection of our g361 cells with the s69a (pka, non - phosphorylatable) claudin-1 mutants. pooled stable clones were analyzed for the expression of claudin-1 and its subcellular localization. as can be seen the pcdna3.1-cldn1 transfected cells have plenty of cytoplasmic claudin as compared to the stable empty vector clones (figure 4a, b) whereas the s69a mutants have largely nuclear expression of claudin-1 (figure 4c). to test their invasive capacity, stable clones were allowed to invade through a matrigel - coated invasion chamber. as compared to empty vector controls, cells transfected with the pka deactivating s69a mutation did not show any increase in invasion. however, g361 cells transfected with the claudin-1 overexpressing vector showed a nearly 2-fold increase in invasion as compared to the empty vector control (figure 4d). these data appear to support the hypothesis that nuclear overexpression of claudin-1 does not increase the invasive capacity of melanoma cells, where cytoplasmic expression of claudin-1 does. claudin-1 has been shown to play an important role in skin development and tumorigenesis. claudin-1 null mice die from dehydration within a few hours of birth due to the breakdown of barrier integrity in the epidermis 14. in humans, patients with the pathological condition known as aec (ankyloblepharon - ectodermal dysplasia - clefting) also have compromised skin integrity, and this has been shown to correlate to the lack of claudin-1 and also to the loss of p63 15. further, we have previously shown that increasing claudin-1 expression increases melanoma metastasis 4. in this study we demonstrate that the nuclear localization of claudin-1 can not contribute to the migratory capacity of melanoma cells. these data confirm our previous observations that nuclear claudin-1 is expressed largely in benign nevi, and early stage melanoma, but that highly metastatic melanoma cells tend to have increased claudin-1 in the cytoplasm and at the membrane, but very little nuclear staining 4. further, we demonstrate that claudin-1 subcellular localization is affected by pka, although constitutively activating both pka and pkc sites results in the cytoplasmic distribution of claudin-1. however, the deactivation of pkc sites does not cause nuclear localization of claudin-1. unlike pkc, which we have previously shown to decrease the levels of claudin-1 expression, pka inhibition does not appear to affect claudin-1 levels, but does cause nuclear sequestration of claudin-1, implying that pka is required for claudin-1 exclusion from the nucleus. it is curious that in cases where claudin-1 is low, it is predominantly nuclear, despite abundant active pka. this observation implies that the levels of claudin-1 may need to reach a certain threshold prior to being shuttled out of the nucleus. hence, in metastatic melanoma cells that have high levels of pkc, there is increased claudin-1 expression, and when enough is expressed in the nucleus, pka causes its translocation to the cytoplasm. it is known that the nuclear expression of other tight junction proteins such as zo-1 can inhibit proliferation 16, but in our stable s69a transfectants, we see no difference in the rate of proliferation between the transfectants with nuclear claudin-1 and the empty vector controls (data not shown). it has been suggested that the translocation of claudin-1 into the nucleus of cells, despite the absence of a nuclear localization signal may require apc, zo-1 or zo-2, possibly as shuttles for claudin-1 17. this opens up the possibility that wnt signaling is involved in claudin-1 expression and localization. indeed, a study shows that increasing -catenin increases the expression of claudin-1 in colorectal cancer cells, and that claudin-1 expression is increased in more aggressive cancers 18. we have previously demonstrated the importance of the non - canonical wnt signaling pathway in melanoma 13,19,20, and have shown that wnt5a increases the epithelial to mesenchymal transition (emt) in melanoma cells, leading to increased invasion 13. these effects all require pkc, and since we have shown that, in melanoma, claudin-1 expression is dependent upon pkc, it is likely that wnt5a may also increase claudin-1 expression further, claudin-1 is important in mediating an emt in colon cancer cells 17, similar to that seen with wnt5a. all of these data taken together imply that claudin-1 is an important marker of melanoma progression, especially when its subcellular localization is considered, as we have shown that its cytoplasmic expression is critical for increased malignancy. how it interacts with other molecules involved in melanoma malignancy, such as members of the wnt pathway, remains to be determined. cell lines. as previously described 4, the human melanoma cell lines uacc647 and m93 - 047 were cultured in rpmi-1640 media (gibco - brl, bethesda, md) supplemented with 10% fetal bovine serum (fbs) (hyclone, logan, ut), 100 units / ml penicillin g and 100 units streptomycin (gibco - brl). g361 cells were maintained in mccoy 's 5a medium (gibco - brl) with 10% fbs. site - directed mutagenesis was performed on the claudin-1 sequence in the pcdna3.1/v5-his vector using the quikchange ii site - directed mutagenesis kit (stratagene, la jolla, ca) to mutate the sites indicated in table 1. for initial experiments attempting to attach cldn1 to a nuclear localization signal, cldn1 was then subcloned into the pdsred2-nuc vector (clontech, mountainview, ca). the cells were transfected with claudin-1 expression vectors or empty vector controls, using lipofectamine plus (gibco - brl). after six hours of transfection, cells were treated with 500g / ml g418, clones were selected and analyzed for cldn1 expression by confocal microscopy using a zeiss meta 510 confocal microscope (zeiss, thornwood, ny). treatments. for pkc inhibition studies g 6983 (sigma, st. louis, mo) was used at a concentration of 1um, and pma (cell signaling, beverly, ma) was used at a concentration of 200 nm as previously described 4. for vehicle controls, pka inhibitor (cell permeable, myristoylated protein kinase a inhibitor amide 14 - 22, calbiochem, san diego, ca), was used at a concentration of 10m for the indicated times. the pka activator, forskolin (sigma) was used at a concentration of 5 m for the indicated times. as previously described 4, for claudin-1 staining, cells were grown on glass slides, and allowed to reach 80% confluency. cells were fixed using 95% methanol, washed and blocked with a fluorescent blocking buffer (0.2% triton - x100, 0.2% bsa, 0.2%, casein, 5% normal goat serum, 0.2% gelatin, 0.02% sodium azide) for 1 hour at room temperature. incubation in claudin-1 primary antibody at 0.25g / ml (zymed laboratories, san francisco, ca) was performed overnight at 4c. the cells were washed again with pbs for 30 minutes, probed with secondary antibody (conjugated with alexa fluor-488, invitrogen, carlsbad, ca), then washed again with pbs, mounted in pro - long gold (invitrogen, carlsbad, ca) with dapi and then examined using confocal microscopy. -tubulin (1:1000), lamin - a (1:1000), phospho- pka (1:1000) and pkc substrate (1:200) antibodies were obtained from cell signaling (beverly, ma). claudin-1 antibody (1:1000) was obtained from zymed laboratories (san francisco, ca). cells were grown to 80% confluency and then harvested on ice as previously described 4. nuclear and cytoplasmic extracts were obtained according to manufacturer 's instructions using the ne - per extraction kit (pierce, rockford, il). 50g of each lysate was run out on sds - page 10% tris - glycine nu - page gels (invitrogen) and transferred onto 0.2 micron pvdf. the membranes were probed with antibodies and then visualized using the ecl system (amersham biosceinces, piscataway, nj). for immunoprecipitation, 250g of lysate was incubated with protein a / g agarose (sigma) for 4 hours to clear the lysate. the mixture was centrifuged gently, and the lysate was removed from the beads and placed into a new, siliconized microfuge tube. pkc substrate antibody was added at a ratio of 1:200, and the lysate and antibody were incubated with gentle rocking overnight at 4c. protein a / g agarose was then added for 6h, after which time the lysate was removed, and the agarose washed in ripa three times. sds - based sample buffer was used to remove the bound proteins from the agarose, and the entire mixture was subjected to western analysis for claudin-1 as described above. matrigel invasion assays were performed using transwell migration chambers (corning life sciences, lowell, ma) as previously described 21. briefly, 8m filters were coated with 150l of 80g / ml reconstituted basement membrane (matrigel, becton dickinson, franklin lakes, nj). wild type or mutant claudin-1 expressing clones were serum starved for 16h, and 2 x 10 cells were seeded onto the filters. the total volume on the top of the filter was adjusted to 800l of serum free medium and 800l of medium containing 20% fetal calf serum was placed in the lower well to act as a chemoattractant. cells were allowed to invade and adhere to the lower chamber, after which they were stained using crystal violet, and counted. a student 's t - test was performed when required in at least 3 independent experiments. | cytoplasmic expression of claudin-1 in metastatic melanoma cells correlates to increased migration, and increased secretion of mmp-2 in a pkc dependent manner, whereas claudin-1 nuclear expression is found in benign nevi. melanoma cells were transfected with a vector expressing cldn-1 fused to a nuclear localization signal (nls). despite significant nuclear localization of claudin-1, there was still transport of claudin-1 to the cytoplasm. phorbol ester treatment of cells transfected with nls - claudin-1 resulted in an exclusion of claudin-1 from the nucleus, despite the nls. to ascertain whether pkc or pka were involved in this translocation, we mutated the putative phosphorylation sites within the protein. we found that mutating the pkc phosphorylation sites to mimic a non - phosphorylated state did not cause a shift of claudin-1 to the nucleus of the cells, but mutating the pka sites did. mutations of either site to mimic constitutive phosphorylation resulted in cytoplasmic claudin-1 expression. stable claudin-1 transfectants containing non - phosphorylatable pka sites exhibited decreased motility. these data imply that subcellular localization of claudin-1 can be controlled by phosphorylation, dicating effects on metastatic capacity. |
eukaryotic cellular identity, growth, and homeostasis, extending to the level of organs, systems, and whole organisms depends in part on refined and adaptive regulatory control of gene expression. nongenetic determinants of gene expression variability has highlighted the role of chromatin modifying enzymes in integrating environmental cues into biological effects via changes in transcriptional activity. to date, much attention in this regard has been paid to the histone deacetylase (hdac) family of enzymes. hdac enzymes are divided into four different classes based on sequence homology, cellular localization, and phylogenic relationships to yeast homologues : class i (hdacs 1, 2, 3, and 8), class iia (hdacs 4, 5, 7, and 9), class iib (hdacs 6, 10), class iii (sirtuins 17), and class iv (hdac 11). abnormal expression levels (both increased and decreased expression) of hdac 1, 2, 3, and 6 that have been correlated with many diseases, including several forms of cancer, heart failure, inflammatory diseases, and cognitive and psychiatric disorders (table 1). however, our knowledge of normal hdac density and alterations in hdacs with human disease remains extremely limited and invasive methodologies used so far to investigate hdac distribution are not compatible with translational medicine. therefore, our goal was to develop a positron emission tomography (pet) imaging probe, which can quantify the density of hdac 1, 2, 3, and 6 in vivo. evaluating the expression and distribution of epigenetic machinery in vivo will improve our understanding of their relationship with disease and would provide an opportunity to intervene with treatment. the challenge for hdac research is developing a technique for quantifying the hdac density that can be used in living subjects. the non - invasive imaging technique, pet, is an excellent tool to visualize chromatin - modifying enzymes in animals and human. pet can provide molecular level insight into protein density and interaction with drugs by quantifying the distribution of a radiotracer with extraordinarily high sensitivity. to date there are no validated tools for assessing the densities of hdac enzymes in human despite the importance of these enzymes and their remarkably high expression. efforts by others have resolved non - invasive probes for imaging hdac enzyme density in vivo, however these tools have rapid binding kinetics and poor brain penetrating ability or bind to a different subset of hdacs than the isoforms that have been extensively implicated in diseases via study of patients and preclinical animal models. herein, we report the development of [c](e)-3-(4-((((3r,5r,7r)-adamantan-1-ylmethyl)(methyl)amino)methyl)phenyl)-n - hydroxyacrylamide ([c]martinostat, [c]6) (figure 1) as a molecule ready for translation to human pet imaging (hdac 1, 2, 3, and 6). compound 6 is an adamantane - based hydroxamic acid with selective binding to hdac 1, 2, 3, and 6 with subnanomolar potency and fast binding kinetics. using rodent and nonhuman primate pet imaging, we demonstrate robust uptake and high specific binding in brain, heart, spleen, kidney, and pancreas. using this tool, measurement of hdac density of target isoforms 1, 2, 3, and 6 is possible in peripheral organs and brain for the first time. measuring hdac target density / occupancy with the aformentioned non - invasive tool promises a major advance to understand epigenetic mechanism in normal body tissues and diseases. self - blocking experiments have demonstrated the sensitivity of [c]6 to resolve differences in hdac expression in peripheral organs and brain. further, blocking experiments with the clinical approved hdac inhibitor, saha, underscore the utility of this tool to evaluate hdac density and target engagement with different therapeutics. taken together, our findings highlight the immediate utility of [c]6 as a preclinical pet tool to investigate hdac expression in animal models. furthermore, we outline and discuss the optimal properties of [c]6 as an hdac radiotracer that strongly support its development as a clinical research tool. we have developed a potent hdac imaging agent, termed [c]6, incorporating three key structural features to create a versatile and translational probe for visualizing hdac expression in vivo. intravenous injection of trace amounts of [c]6 (nanogram scale) in baboon and imaging by pet - mr demonstrates quantifiable uptake in the brain and in diverse peripheral organs. this illustrates the potential for [c]6 as a broadly applicable tool in evaluating hdac density in humans. hdac inhibitors comprise diverse structural classes including hydroxamic acids, natural cyclic peptides, and short - chain fatty acids as well as aminoanilines and ketones. most classes of hdac inhibitors contain three main structural elements to their pharmacophore : (i) a capping group, (ii) a linker domain, and (iii) a zinc - binding group, critical for enzyme action. modification of these structural elements has so far revealed that the brain uptake of most hdac inhibitors is limited. to develop an hdac pet probe with broad disease applicability, we wanted to integrate a chemical structure that would exhibit robust exposure to both peripheral organs and the brain. in medicinal chemistry efforts by others, the adamantyl group has been identified as a structural subunit that confers cns distribution in several drugs classes including antiviral drugs, cannabinoid receptor modulators. further, adamantane - based hydroxamic acids were recently reported and showed strong evidence of hdac inhibition. using these previous studies to guide our synthesis efforts, we designed compound 6, a cinnamic acid - based hdac inhibitor containing an adamantyl group as a blood brain barrier (bbb) carrier (figure 1). compound 6 was synthesized through reductive amination, followed by conversion into a hydroxamic acid in the presence of hydroxylamine and sodium hydroxide. the radiosynthesis of [c]6 was accomplished using its desmethyl precursor in dmso with [c]methyl iodide ([c]ch3i) as outlined in scheme 1. reagents and conditions : (a) nabh4, meoh, overnight, rt, 75% ; (b) formaldehyde, acoh, nabh4, meoh, rt, overnight, 55%. (c) nh2oh (aq), 1 m naoh, meoh / thf, 0 c to rt, 4 h, 42% for 6, 40% for 5 ; rcy of [c]6, 35% (non - decay corrected to trapped [c]ch3i). the in vitro inhibitory activities of 6 were measured for each hdac isoform hdac1 through hdac9 (table 2) using recombinant human enzymes, with ic50 values for the fda approved hdac inhibitor drug, suberoylanilide hydroxamic acid, vorinostat (saha), measured in parallel as a reference (to assess the variability among different assays). compound 6 showed nanomolar ic50 values for class - i hdac isoforms (hdac 13, 0.3, 2.0, and 0.6 nm, respectively), and the class - iib hdac 6 (4.1 nm), with > 100-fold selectivity over each of the other hdac isoforms assayed. using [c]6 in vitro, we measured the partition coefficient (log d) at 2.03 and calculated tpsa of 52.5, which are in the preferred range for brain penetration, and further detected plasma protein binding (ppb), as measured in blood from baboon (1.4% unbound) and human (5.5% unbound), at levels consistent with those for the clinical dopamine d2 receptor radiotracer, [c]raclopride (figure s1). in vitro ic50 (nm) values using recombinant human enzymes for hdac subtypes 19 and specific substrates demonstrate that 6 is a selective inhibitor of hdac 13 (0.32.0 nm) with decreased potency to inhibit hdac 6 (4.1 nm) or other subtypes (> 352 nm). comparatively, the hydroxamate hdac inhibitor saha exhibited lower affinity for hdac targets 13 (3.011 nm). response plots in cultured primary mouse neuronal cells measuring relative h3k9ac and h4k12ac levels revealed potent induction of histone acetylation (ec50) by 6 (100 nm) compared to saha (19003400 nm). to test the selective binding of 6 over other potential protein targets, we screened the percentage inhibition of 6 (50 nm) using radioligand displacement assay against 4 zinc - dependent enzymes including matrix metalloproteinases and 80 additional non - hdac or zn - dependent central nervous system (cns) targets. we determined minimal if any off - target binding, indicating high selectivity of 6 to the hdac family (table s1). the only potential off - target binding was the dopamine transporter (dat) as implicated by the in vitro test. 6 (50 nm) resulted in a 24% inhibition of dat (where 50% inhibition is the minimum threshold to identify a potential binding event). therefore, to exclude a putative binding interaction of 6 to dat (given that it is a relatively high dentistry brain protein), we used the established radiotracer [c]-cft to evaluate dat density / occupancy in rats and observed no impact of 6 treatment (1 mg / kg, ip, 90 min prior) (figure s2). to further establish that [c]6 binding was specific for hdac targets we observed that specific binding of [c]6 was reduced by preincubation of sagittal rat brain sections with either of the unlabeled hdac inhibitors : saha, a hydroxamic acid - based hdac inhibitor (selective for class i and iib hdac isoforms), or ci-994, a benzamide - based hdac inhibitor (selective for hdac 1, 2, and 3 isoforms) (figure s1c, d). to first test [c]6 as a radiotracer in vivo, we conducted pet imaging focused on rat brain. using pet - ct, we determined that [c]6 exhibited high bbb penetration and sustained binding over the scanning time (60 min) when administered by intravenous bolus injection (0.91.1 mci per animal), as shown in figure s3a. to confirm that [c]6 was not effluxed from the brain by the xenobiotic pump, p - glycoprotein (p - gp), we measured radioligand uptake in brain after treatment with the p - gp inhibitor, cyclosporin a (csa), and found no difference compared to control treatment (figure s4a). additionally, [c]6 binding in the rat brain was disrupted by an iv challenge with unlabeled 6 20 min after tracer administration as evidenced by a rapid decrease in the time this rapid loss of radioactivity from brain regions provided confirmation of the reversibility of [c]6 binding to cns targets (figure s4b). to determine the stability of [c]6 in brain, we measured the presence of radiolabeled parent compound and polar metabolites in homogenized rat brain tissue 30 min post - in vivo injection of [c]6. by eluting extracted and homogenized rat brain with solvents containing fractional increases of acetonitrile in water, we resolved a pattern of radioactivity indicating intact parent compound in the brain with limited degradation over the duration of a typical 3090 min pet scan (figure s5a). a similar pattern indicating unmetabolized [c]6 was observed in baboon plasma, 5 min post - injection of the tracer (figure s5b). to investigate the specificity of [c]6, we performed pet imaging studies in rats with a 5 min pretreatment of unlabeled 6 at different doses (0.001, 0.1, 0.5, and 2.0 mg / kg). we found that [c]6 binding in brain was blocked in a dose - dependent manner with a stepwise reduction in the percent tracer uptake after administration of unlabeled 6 (figure s3b). to test the sensitivity of [c]6 against other hdac inhibitors, we pretreated a rat with cn54, a highly brain penetrant hydroxamic acid hdac inhibitor as determined by lc - ms - ms (brain / plasma = 4.5 after 20 min administration of cn54 at 10 g / kg via iv), and saha, a hydroxamic acid hdac inhibitor with limited brain penetrating ability. as expected, there was robust in vivo blockade of radioactivity in brain with the treatment of cn54, but not saha (figure s3c). next, we chose to utilize nonhuman primates to evaluate the distribution and specificity of [c]6. in baboons, we found that high brain uptake (5060 in vt, total volume of distribution) of [c]6 based on pet - mr focused on the head. similar to the blocking results we obtained in rats, injection of unlabeled 6 (0.5 and 1.0 mg / kg, iv) dose - dependently reduced the radioactivity uptake (measured as vt) in specific brain regions including cerebellum, cortex, putamen, and caudate (figure 2). the averaged bmax of whole brain, 19.6 2.9 m of protein, was calculated from the pet image on the basis of the established relationship between total binding and dissociation rate and was consistent with ex vivo protein quantification in rodents by two methods. physiological effects (i.e., respiration rate, blood pressure, heart rate, and end - tidal co2) were unchanged at any administered dose of 6 or [c]6. (a) the total volume of distribution (vt) images from one representative animal show robust differences in radiotracer uptake at baseline and after blocking (0.5 mg / kg iv, 10 min pretreatment) ; (b) two independent baseline - blocking studies were used to resolve quantitative vt data which show that pretreatment with unlabeled 6 (0.5 or 1.0 mg / kg) dose - dependently blocks tracer uptake in different baboon brain regions. wb : whole brain ; cb : cerebellum ; m1 : primary motor cortex ; pu : putamen ; th : thalamus ; v1 : primary visual cortex ; ca : caudate ; wm : white matter. after [c]6 intravenous bolus injection, radioactivity in arterial plasma clears rapidly as expected and as depicted in figure s5c. polar metabolites were observed in the plasma (50% of the plasma radioactivity after 10 min) ; however, radioactivity in brain tissue of rodents at late time points (30 min post administration) was associated almost exclusively with the parent molecule. these data support that the pet images for the brain tissue largely represent [c]6 and not radiolabeled metabolites. for quantitative analysis of the nhp pet imaging data, two - tissue compartmental modeling was applied to analyze dynamic [c]6 pet data, corrected for arterial input function and parent compound metabolism to interpret results from intact and perfused radiotracer. based on the modeling results (figure 2), blocking with 0.5 and 1.0 mg / kg, vt decreased in all brain regions. based on our rodent experiments and dose - equilibration for body mass, we assumed that a 1.0 mg / kg dose would provide full saturation of hdac binding. therefore, 5080% of the signal represented specific binding in the selected brain regions suggesting that [c]6 has sufficient sensitivity to assess a wide range of cns diseases in which hdac may be altered, such as alzheimer s disease and in mood disorders, and for evaluation of drug - hdac engagement. we further evaluated the tracer uptake and blockade in peripheral organs in baboons. [c]6 showed high uptake in major organs including heart, kidney, pancreas, and spleen (figure 3). the uptake in these organs was markedly decreased by pretreatment with unlabeled 6, indicating that the [c]6 signal also represents hdac expression in peripheral organs. to further confirm the sensitivity of [c]6 to detect changes in hdac occupancy, we measured radiotracer uptake in the baboon both before and after 75 min infusion of saha (5 mg / kg, iv). we found that radiotracer uptake in peripheral tissue was robustly blocked by saha infusion, consistent with efficient distribution of this hdac inhibitor blocking agent in nonbrain organs (figure s6). axial views of summed pet images (4080 min) superimposed with mr images from the same baboon following injection of radiotracer (4 mci / baboon). images illustrate tracer uptake in organs of interest at baseline and after pretreatment with unlabeled 6 (0.5 mg / kg). robust blocking was observed in organs of interest including : a, heart ; b, spleen ; c, kidneys ; and d, pancreas. activity curves (baseline, blue ; blocking, red) demonstrate a high specific binding of [c]6 in these peripheral organs as the percent injected tracer dose per cm tissue is markedly reduced by blocking. epigenetic therapies that target regulatory mechanisms of the human genome represent an emerging class of novel therapeutic agents. the importance of understanding aberrant enzyme expression of chromatin modifying enzymes including hdacs is highlighted by the discovery that protein coding mutations may play a role in human disease pathologies linked to cancer in major organs, cardiac dysfunction, and cns disorders. the impact of these enzyme density changes is further implicated in disease as recent large - scale genome - wide association studies (gwas) have shown that gene regulatory regions key in many common human diseases harbor an enrichment of single nucleotide polymorphisms (snps). this evidence of deregulated gene expression mechanism points to a more general need to target epigenetic machinery that may be causally involved in disease pathogenesis. therefore, developing therapeutics for many human diseases can be best accomplished by first understanding the density and distribution of epigenetic machinery including hdac enzymes in vivo. development of specific pet radiotracers to measure hdac density or any other epigenetic component, with high uptake and major organs, is challenging. there are a number of major factors (summarized here a through d) that determine the success of a radiotracer candidate. some factors can be predicted from in vitro assays (e.g., binding affinity and selectivity), and those which are more empirically determined (e.g., specific to nonspecific binding ratio). (a) the binding affinity and selectivity of a radiotracer for its target must be high enough to produce sufficient signal to background for detection and selective for the target so that images represent the biological target. (b) additionally, radiotracers must exhibit specific binding, which is challenging to predict but can be easily measured by presaturating the target with an unlabeled (nonradioactive) form of the radiotracer thus resulting in decreased binding of radiotracer to its target. unlabeled compound binding is also expected to alter the distribution and pharmacokinetics of the radioligand. in general, small molecular weight (98% purity, as determined by a high - pressure liquid chromatography (hplc) system (ymc triart c-18 (150 mm 4.6 mm 3 u) mobile phase : a : 0.05% tfa in water / b : 0.05% tfa in acetonitrile. gradient : 15% b to 95% b in 8.0 min, hold until 9.5 min, 15% b in 13.0 min hold until 15.0 min. the quantitative nmr test were conducted by sai life sciences ltd., and 1,4-dimethoxybenzene was used as the reference. [c]co2 (1.2 ci) was obtained via the n (p,)c reaction on nitrogen with 2.5% oxygen, with 11 mev protons (siemens eclipse cyclotron), and trapped on molecular sieves in a tracerlab fx - mei synthesizer (general electric). [c]ch4 was obtained by the reduction of [c]co2 in the presence of ni / hydrogen at 350 c and recirculated through an oven containing i2 to produce ch3i via a radical reaction. all animal studies were carried out at massachusetts general hospital (phs assurance of compliance no. the subcommittee on research animal care (srac) serves as the institutional animal care and use committee (iacuc) for the massachusetts general hospital (mgh). pet - mr imaging was performed in anesthetized (ketamine, isoflurane) baboon (papio anubis) to minimize discomfort. highly trained animal technicians monitored animal safety throughout all procedures, and veterinary staff were responsible for daily care. all animals were socially housed in cages appropriate for the physical and behavioral health of the individual animal. animals were fed thrice per diem, with additional nutritional supplements provided as prescribed by the attending veterinarian. audio, video, and tactile enrichment was provided on a daily basis to promote psychological well - being. pet - ct imaging was performed in anesthetized (isoflurane) rats (sprague dawley) to minimize discomfort. highly trained animal technicians monitored animal safety throughout all procedures, and veterinary staff were responsible for daily care. all animals were socially housed in cages appropriate for the physical and behavioral health of the individual animal. animals were given unlimited access to food and water, with additional nutritional supplements provided as prescribed by the attending veterinary staff. animals were euthanized at the end of the study using sodium pentobarbital (200 mg / kg, ip). adamantan-1-ylmethanamine (1) (1 g, 6.0 mmol) and (e)-methyl 3-(4-formylphenyl)acrylate (2) (1 g, 5.3 mmol) was dissolved in meoh (30 ml), and the mixture was stirred at room temperature for 2 h. sodium borohydride (0.61 g, 16 mmol) was then added, and the suspension was stirred overnight at room temperature. the white precipitate was filtered and dried to obtain the product 3 (1.35 g, yield : 75%).h nmr (500 mhz, cdcl3) : 7.69 (d, j = 16 hz, 1h), 7.48 (d, j = 7 hz, 2h), 7.35 (d, j = 7 hz, 2h), 6.43 (d, j = 16 hz, 1h), 3.81 (s, 2h), 3.80 (s, 3h), 2.23 (s, 3h), 1.96 (s, 3h), 1.631.73 (m, 6h), 1.53 (s, 6h) ; c nmr (125 mhz, cdcl3) : 167.55, 144.78, 143.81, 132.87, 128.35 (2c), 128.08 (2c), 117.10, 62.15, 54.28, 51.65, 40.85 (3c), 37.24 (3c), 33.49, 28.48 (3c). lc - ms calculated for c22h29no2 expected [m ] : 339.2 ; found [m + h ] : 340.3. to a solution of 3 (0.5 g, 1.5 mmol) in meoh / thf (5 ml/5 ml) at 0 c was added nh2oh (50% aq solution, 3 ml) followed by 1 m naoh (2 ml). the mixture was stirred at 0 c for 2 h, warmed to room temperature, and stirred for 2 h. acidification with 1 m hcl to ph 78 (ph paper) resulted in product precipitation. the precipitate was filtered and dried to obtain 4 (0.2 g, 40%) as white solid. h nmr (500 mhz, cdcl3) : 7.69 (d, j = 16 hz, 1h), 7.47 (d, j = 7.5 hz, 2h), 7.39 (d, j = 7.5 hz, 2h), 6.42 (d, j = 16 hz, 1h), 3.80 (s, 3h), 3.54 (s, 2h), 2.19 (s, 3h), 2.10 (s, 2h), 1.95 (s, 3h), 1.621.723 (m, 6h), 1.53 (s, 6h) ; c nmr (125 mhz, cdcl3) : 164.92, 141.31, 139.69, 133.75, 128.61 (2c), 127.42 (2c), 116.88, 71.09, 61.08, 53.31, 40.41 (3c), 36.77 (3c), 32.84, 28.48 (3c). lc - ms calculated for c21h28n2o2 expected [m ] : 340.5 ; found [m + h ] : 341.3. quantitative nmr purity : 95.10%. to a solution of 3 (0.5 g, 1.5 mmol) in meoh (30 ml) was added formaldehyde (33% aq solution, 2 ml) followed by acetic acid (0.1 ml). the mixture was stirred at room temperature for 2 h. sodium borohydride (0.61 g, 16 mmol) was then added, and the suspension was stirred overnight at room temperature. the white precipitate was filtered and purified by flash chromatography in hexanes : ethyl acetate (4:1) to obtain the product 3 (0.29 g, yield : 55%) as white solid. h nmr (500 mhz, meoh - d4) : 7.55 (d, j = 16 hz, 1h), 7.52 (d, j = 7.5 hz, 2h), 7.37 (d, j = 7.5 hz, 2h), 6.47 (d, j = 16 hz, 1h), 3.77 (s, 2h), 2.21 (s, 2h), 1.94 (s, 3h), 1.661.76 (m, 6h), 1.541.55 (m, 6h) ; c nmr (125 mhz, meoh - d4) : 164.93, 141.32, 139.71, 133.76, 128.62 (2c), 127.43 (2c), 116.8901, 61.08, 53.32, 40.42 (3c), 36.78 (3c), 32.84, 28.48 (3c). lc - ms calculated for c21h28n2o2 expected [m ] : 353.2 ; found [m + h ] : 354.1. to a solution of 5 (0.5 g, 1.4 mmol) in meoh / thf (3 ml/3 ml) at 0 c was added nh2oh (50% aq solution, 3 ml) followed by 1 m naoh (2 ml). the mixture was stirred at 0 c for 2 h, warmed to room temperature, and stirred for 2 h. acidification with 1 m hcl to ph 78 (ph paper) resulted in product precipitation. the precipitate was filtered and dried to obtain 6 (0.21 g, 42%) as white solid. h nmr (500 mhz, dmso - d6) : 7.49 (d, j = 7.5 hz, 2h), 7.42 (d, j = 16 hz, 1h), 7.33 (d, j = 7.5 hz, 2h), 6.45 (d, j = 16 hz, 1h), 3.48 (s, 2h), 2.11 (s, 3h), 2.06 (s, 2h), 1.89 (s, 3h), 1.551.65 (m, 6h), 1.46 (s, 6h) ; c nmr (125 mhz, dmso - d6) : 163.15, 142.00, 138.43, 139.91, 129.36 (2c), 127.77 (2c), 119.06, 70.12, 64.57, 45.71, 41.01 (3c), 37.21 (3c), 35.27, 28.33 (3c). lc - ms calculated for c22h30n2o2 expected [m ] : 354.2 ; found [m + h ] : 355.3. hdac inhibition assays : compounds were tested in a 12-point dose curve with 3-fold serial dilution starting from 33.33 m. purified hdacs were incubated with 2 m (the concentration is kept the same for all the hdacs, below km of substrate) carboxyfluorescein (fam)-labeled acetylated or trifluoroacetylated peptide substrate (broad substrates a and b, respectively) and test compound for 60 min at room temperature, in hdac assay buffer that contained 50 mm hepes (ph 7.4), 100 mm kcl, 0.01% bsa, and 0.001% tween-20. reactions were terminated by the addition of the known pan hdac inhibitor lbh -589 (panobinostat) with a final concentration of 1.5 m. substrate and product were separated electrophoretically, and fluorescence intensity in the substrate and product peaks were determined and analyzed by labchip ez reader. the percent inhibition was plotted against the compound concentration, and the ic50 value was determined from the logistic dose mouse primary neuronal cultures were generated in factory precoated poly - d - lysine 96-well plates (bd biosciences no. bd356692) treated overnight with 75 l / well of laminin [0.05 mg / ml ] (sigma no. e15 embryonic mouse forebrain was dissociated into a single cell suspension by gentle trituration following trypsin / dnase digestion (trypsin : cellgro no. 12,500 cells per well were plated in 100 l neurobasal medium (gibco no. 21103 - 049) containing 2% b27 (gibco no. after 13 days, cultures were treated with hdac inhibitors by pin transfer of compound (185 nl per well) using a cybi - well vario pinning robot (cybio corp., germany) and subsequently incubated for 24 h at 37 c with 5% co2 and then fixed in 4% formaldehyde for 10 min. following two washes with phosphate - buffered saline, cells were permeabilized and blocked with 0.1% triton x-100 and 2% bsa in pbs. cells were stained with an anti - ac - h4k12 antibody (millipore, catalog no. 04119) and alexa488-conjugated secondary antibody (molecular probes). cell nuclei were identified by staining with hoechst 33342 (invitrogen, h3570). cell nuclei and histone acetylation signal intensity were detected and measured using a laser - scanning microcytometer (acumen ex3, ttp laptech). acumen explorer software was used to identify a threshold of histone acetylation signal intensity such that, without hdac inhibitor, > 99.5% of cells had intensity levels below the threshold. in the presence of hdac inhibitors, cells signal intensities above the threshold were scored as bright green cells and expressed as a percentage normalized to dmso controls. ec50 values were determined from curve fitting using graphpad prism v5 software (graphpad software, inc. 6 was submitted to a panel of 80 binding assays for common transmembrane and soluble receptors, ion channels, and monoamine transporters in the cns (high - throughput profile p-3, cerep, france). this concentration was > 10 the ic50 values determined for hdac targets (0.34.1 nm, see table 2, main text) and in vast excess of the amount of 6 administered in pet imaging experiments. for example, injected dose = 1 mci / rat ; specific activity (see figure s2) = 1 mci/1 nmole ; therefore, calculated dose = 1 nmole 6/ rat. inhibition of control binding did not exceed 45% for any target assayed, supporting that 6 predominantly binds hdac targets. [c]ch3i was trapped in a tracerlab fx - m synthesizer reactor (general electric) preloaded with a solution of precursor (4) (1.0 mg) in dry dmso (300 l). the solution was stirred at 100 c for 4 min, and water (1.2 ml) was added. the reaction mixture was purified by reverse phase semipreparative hplc (phenomenex luna 5u c8(2), 250 10 mm, 5 m, 5.0 ml / min, 40% h2o + ammonium acetate (0.1 m)/ 60% ch3cn), and the desired fraction was collected. the final product was reformulated by loading onto a solid - phase exchange (spe) c-18 cartridge, rinsing with 1 m naoh aq (5 ml), eluting with etoh (1 ml), and diluting with 50 l acetic acid in saline (0.9%, 9 ml). the chemical and radiochemical purity of the final product was tested by analytical hplc (agilent eclipse xdb - c18, 150 4.6 mm). the identity of the product was confirmed by analytical hplc with additional co - injection of reference standard. the average time required for the synthesis from end of cyclotron bombardment to end of synthesis was 35 min. the average radiochemical yield was 35% (nondecay corrected to trapped [c]ch3i). chemical and radiochemical purities were 95% with a specific activity 1.0 0.2 ci/mol (eob). specific radioactivity (sa) of [c]6 was calculated from an analytical hplc sample of 100 l. a calibration curve of known mass quantity versus hplc peak area (254 nm) was used to calculate the mass concentration of the 100 l. sa was determined using the mass concentration value determined for the formulated [c]6 solution, volume, and measured radioactivity. the identity of the mass peak assigned to [c]6 was supported by a second hplc injection, where [c]6 was mixed with nonradioactive compound 6 and yielded a single peak. an aliquot (50 l) of the formulated radiotracer was added to a test tube containing 2.5 ml of octanol and 2.5 ml of phosphate buffer solution (ph 7.4).the test tube was mixed by vortex for 2 min and then centrifuged for 2 min to fully separate the aqueous and organic phase. a sample taken from the octanol layer (0.1 ml) and an additional aliquot of the octanol layer (2.0 ml) was carefully transferred to a new test tube containing 0.5 ml of octanol and 2.5 ml of phosphate buffer solution (ph 7.4). the previous procedure (vortex mixing, centrifugation, sampling, and transfer to the next test tube) was repeated until six sets of aliquot samples had been prepared. the radioactivity of each sample was measured in a well counter (perkinelmer, waltham, ma).the log d of each set of samples was derived by the following equation : log d = log (decay - corrected radioactivity in octanol sample 10/decay - corrected radioactivity in phosphate buffer sample). an aliquot of radiotracer in saline (10 l) was added to a sample of baboon or human plasma (0.8 ml). the mixture was gently mixed by repeated inversion and incubated for 10 min at room temperature. following incubation a small sample (20 l) was removed to determine the total radioactivity in the plasma sample (at ; at = abound + aunbound). an additional 0.2 ml of the plasma sample was placed in the upper compartment of a centrifree tube (amicon, inc. the upper part of the centrifree tube was discarded, and an aliquot (20 l) from the bottom part of the tube was removed to determine the amount of radioactivity that passed through the membrane (aunbound). plasma protein binding was derived by the following equation : % unbound = aunbound 100/at. twenty m thick sagittal rat brain sections were cut using a 20 c cryostat, thaw - mounted onto gelatin - coated slides, fixed in 4% paraformaldehyde containing 2% ethanol for 60 min at 4 c, and washed 10 min in ice - cold 10 mm tris - hcl, ph 7.4. sections were then incubated at room temperature in a 50 ml bath containing either (i) 5% dmso as control ; (ii) unlabeled 6 (100 m) or (iii) saha (100 m) for 10 min ; or (iv) ci-994 (100 m) for 2 h to allow for slow hdac binding kinetics known for benzamide compounds including ci-994. all incubation baths contained 10 mm tris - hcl + 5% dmso, ph 7.4. [c]6 was prepared as described, and 100 ci was added to each bath. following 10 min incubation at room temperature, sections were washed 2 1 min in 10 mm tris - hcl (ph 7.4) and carefully wiped dry on absorbent towels. sections were exposed for 1 h to a multisensitive phosphorscreen and developed using a cyclone plus phosphorimager (both from perkinelmer). resulting parent image was evaluated using imagej software (nih) with jet color lookup table (lut) with whole - image intensity adjusted to enrich red color in control sections. individual images of sections were cropped using imagej with no additional adjustment to color levels / thresholds. male sprague dawley rats were utilized in pairs, anesthetized with inhalational isoflurane (forane) at 3% in a carrier of 1.52 l / min medical oxygen, and maintained at 2% isoflurane for the duration of the scan. the rats were arranged head - to - head in a triumph trimodality pet / ct / spect scanner (gamma medica, northridge, ca). rats were injected standard references or vehicle via a lateral tail vein catheterization at the start of pet acquisition. dynamic pet acquisition lasted for 60 min and was followed by computed tomography (ct) for anatomic coregistration. pet data were reconstructed using a 3d - mlem method resulting in a full width at half - maximum (fwhm) resolution of 1 mm. reconstructed images were exported from the scanner in dicom format along with an anatomic ct for rodent studies. these files were imported to pmod (pmod technologies, ltd.) and manually co - registered using six degrees of freedom. volumes of interest (vois) were drawn manually as spheres in brain regions guided by high - resolution ct structural images and summed pet data, with a radius no 99.5% of cells had intensity levels below the threshold. in the presence of hdac inhibitors, cells signal intensities above the threshold were scored as bright green cells and expressed as a percentage normalized to dmso controls. ec50 values were determined from curve fitting using graphpad prism v5 software (graphpad software, inc. 6 was submitted to a panel of 80 binding assays for common transmembrane and soluble receptors, ion channels, and monoamine transporters in the cns (high - throughput profile p-3, cerep, france). this concentration was > 10 the ic50 values determined for hdac targets (0.34.1 nm, see table 2, main text) and in vast excess of the amount of 6 administered in pet imaging experiments. for example, injected dose = 1 mci / rat ; specific activity (see figure s2) = 1 mci/1 nmole ; therefore, calculated dose = 1 nmole 6/ rat. inhibition of control binding did not exceed 45% for any target assayed, supporting that 6 predominantly binds hdac targets. [c]ch3i was trapped in a tracerlab fx - m synthesizer reactor (general electric) preloaded with a solution of precursor (4) (1.0 mg) in dry dmso (300 l). the solution was stirred at 100 c for 4 min, and water (1.2 ml) was added. the reaction mixture was purified by reverse phase semipreparative hplc (phenomenex luna 5u c8(2), 250 10 mm, 5 m, 5.0 ml / min, 40% h2o + ammonium acetate (0.1 m)/ 60% ch3cn), and the desired fraction was collected. the final product was reformulated by loading onto a solid - phase exchange (spe) c-18 cartridge, rinsing with 1 m naoh aq (5 ml), eluting with etoh (1 ml), and diluting with 50 l acetic acid in saline (0.9%, 9 ml). the chemical and radiochemical purity of the final product was tested by analytical hplc (agilent eclipse xdb - c18, 150 4.6 mm). the identity of the product was confirmed by analytical hplc with additional co - injection of reference standard. the average time required for the synthesis from end of cyclotron bombardment to end of synthesis was 35 min. the average radiochemical yield was 35% (nondecay corrected to trapped [c]ch3i). chemical and radiochemical purities were 95% with a specific activity 1.0 0.2 ci/mol (eob). specific radioactivity (sa) of [c]6 was calculated from an analytical hplc sample of 100 l. a calibration curve of known mass quantity versus hplc peak area (254 nm) was used to calculate the mass concentration of the 100 l. sa was determined using the mass concentration value determined for the formulated [c]6 solution, volume, and measured radioactivity. the identity of the mass peak assigned to [c]6 was supported by a second hplc injection, where [c]6 was mixed with nonradioactive compound 6 and yielded a single peak. an aliquot (50 l) of the formulated radiotracer was added to a test tube containing 2.5 ml of octanol and 2.5 ml of phosphate buffer solution (ph 7.4).the test tube was mixed by vortex for 2 min and then centrifuged for 2 min to fully separate the aqueous and organic phase. a sample taken from the octanol layer (0.1 ml) and an additional aliquot of the octanol layer (2.0 ml) was carefully transferred to a new test tube containing 0.5 ml of octanol and 2.5 ml of phosphate buffer solution (ph 7.4). the previous procedure (vortex mixing, centrifugation, sampling, and transfer to the next test tube) was repeated until six sets of aliquot samples had been prepared. the radioactivity of each sample was measured in a well counter (perkinelmer, waltham, ma).the log d of each set of samples was derived by the following equation : log d = log (decay - corrected radioactivity in octanol sample 10/decay - corrected radioactivity in phosphate buffer sample). an aliquot of radiotracer in saline (10 l) was added to a sample of baboon or human plasma (0.8 ml). the mixture was gently mixed by repeated inversion and incubated for 10 min at room temperature. following incubation a small sample (20 l) was removed to determine the total radioactivity in the plasma sample (at ; at = abound + aunbound). an additional 0.2 ml of the plasma sample was placed in the upper compartment of a centrifree tube (amicon, inc. the upper part of the centrifree tube was discarded, and an aliquot (20 l) from the bottom part of the tube was removed to determine the amount of radioactivity that passed through the membrane (aunbound). plasma protein binding was derived by the following equation : % unbound = aunbound 100/at. twenty m thick sagittal rat brain sections were cut using a 20 c cryostat, thaw - mounted onto gelatin - coated slides, fixed in 4% paraformaldehyde containing 2% ethanol for 60 min at 4 c, and washed 10 min in ice - cold 10 mm tris - hcl, ph 7.4. sections were then incubated at room temperature in a 50 ml bath containing either (i) 5% dmso as control ; (ii) unlabeled 6 (100 m) or (iii) saha (100 m) for 10 min ; or (iv) ci-994 (100 m) for 2 h to allow for slow hdac binding kinetics known for benzamide compounds including ci-994. all incubation baths contained 10 mm tris - hcl + 5% dmso, ph 7.4. [c]6 was prepared as described, and 100 ci was added to each bath. following 10 min incubation at room temperature, sections were washed 2 1 min in 10 mm tris - hcl (ph 7.4) and carefully wiped dry on absorbent towels. sections were exposed for 1 h to a multisensitive phosphorscreen and developed using a cyclone plus phosphorimager (both from perkinelmer). resulting parent image was evaluated using imagej software (nih) with jet color lookup table (lut) with whole - image intensity adjusted to enrich red color in control sections. individual images of sections were cropped using imagej with no additional adjustment to color levels / thresholds. male sprague dawley rats were utilized in pairs, anesthetized with inhalational isoflurane (forane) at 3% in a carrier of 1.52 l / min medical oxygen, and maintained at 2% isoflurane for the duration of the scan. the rats were arranged head - to - head in a triumph trimodality pet / ct / spect scanner (gamma medica, northridge, ca). rats were injected standard references or vehicle via a lateral tail vein catheterization at the start of pet acquisition. dynamic pet acquisition lasted for 60 min and was followed by computed tomography (ct) for anatomic coregistration. pet data were reconstructed using a 3d - mlem method resulting in a full width at half - maximum (fwhm) resolution of 1 mm. reconstructed images were exported from the scanner in dicom format along with an anatomic ct for rodent studies. these files were imported to pmod (pmod technologies, ltd.) and manually co - registered using six degrees of freedom. volumes of interest (vois) were drawn manually as spheres in brain regions guided by high - resolution ct structural images and summed pet data, with a radius no < 1 mm to minimize partial volume effects. tacs were exported in terms of decay corrected activity per unit volume at specified time points with gradually increasing intervals. papio anubis baboons, deprived of food for 12 h prior to the study, were included in the pet - mr scans. atropine 0.05 mg / kg was used intramuscularly to prevent excessive secretion (15 or 30 min of ketamine and xylazine). anesthesia was induced with intramuscular xylazine (0.52.0 mg / kg) and ketamine (10 mg / kg). after endotracheal intubation, v- and a - lines were inserted, and anesthesia was maintained using isoflurane (11.5%, 100% o2 or 50/50 o2/n2o, l l / min). during anesthesia, heart rate, respiration rate, blood pressure, o2 saturation, and end tidal co2 were monitored. the baboon was catheterized antecubitally for radiotracer injection, and a radial arterial line was placed for metabolite analysis. pet - mr images were acquired in a biograph mmr scanner (siemens, munich, germany) and pet compatible 8-channel coil arrays for nonhuman primate brain imaging with a pet resolution of 5 mm and field of view of 59.4 and 25.8 cm (transaxial and axial, respectively). dynamic pet image acquisition was initiated followed by administration of the radiotracer in a homogeneous solution of 10% ethanol and 90% isotonic saline. an memprage sequence began after 30 min of the baseline scan for anatomic co - registration. to characterize the specific binding of [c]6, a second imaging experiment was carried out in which unlabeled 6 was co - administered intravenously at the start of acquisition. both scans were carried out in the same animal on the same day, separated by 2.5 h. in both scans, 45 mci of [c]6 was administered to the baboon. dynamic data from the pet scans were recorded in list mode and corrected for attenuation. baboon data were reconstructed using a 3d - osem method resulting in a fwhm resolution of 4 mm. simultaneous pet - mr data were acquired using a siemens biograph mmr system (siemens medical solutions u.s.a., inc., malvern, pa). mr body imaging was performed with real - time respiratory bellows - gating and using the body matrix coil and the built - in spine coil as the receiving coil elements. high - resolution anatomical t1w axial, coronal, and sagittal dual - echo scan with the following parameters : tr 115 ms, te1 1.23 ms, te2 2.46 ms, matrix size 256 168, fov 35 cm, phase fov 65.6%) and 4 mm slice thickness were obtained. additionally, in particular for the purpose of optimal visualization of the pancreas, high - resolution fat - suppressed axial t2w turbo spin echo (tse) data were obtained with the following parameters : tr 5264 ms, te 98 ms, matrix size 488 235, fov 18.0 cm, phase fov 75%, fa 150, and 3 mm slice thickness. for the purpose of mr - based attenuation correction (mrac) of the pet data, default t1-weighted (t1w) 2-point dixon 3d volumetric interpolated breath - hold examination (vibe) scans were obtained. pet data were obtained using a single - bed acquisition with an axial field of view of 25.8 cm, transaxial field of view of 59.4 cm, and axial and transaxial resolution of 4.8 and 4.7 mm, respectively. pet data were acquired dynamically for 80 min after administration of the radiotracer in a homogeneous solution of 10% ethanol and 90% isotonic saline. to characterize the specific binding of [c]6, a second imaging experiment was carried out in which unlabeled 6 was co - administered intravenously at the start of acquisition. both scans were carried out in the same animal on the same day, separated by 2.5 h. in both scans, 45 mci of [c]6 was administered to the baboon. in order to evaluate the blocking of [c]6 by saha, an separate dual - injection study of [c]6 was performed. in that experiment continuous saha infusion (2 mg / ml at 0.16 ml / min) was started after 45 min of baseline scan with [c]6, and the infusion was continued during the 80 min pet scan after a second injection of [c]6. in all cases pet data were recorded in list mode, and reconstruction was performed using a 3d - osem method resulting in a fwhm resolution of 4 mm. attenuation correction was performed using the aforementioned 2-point dixon 3d vibe mr - derived attenuation maps. data of each 80 min scan were reconstructed for tac analysis using the following framing : 12 10, 3 20, 4 30, and 15 300 s. for the dedicated self - blocking and saha blocking experiments, additional static pet data were reconstructed using data obtained between 40 and 80 min and 2045 min, respectively, in order to visually display the effects of blocking in multiple organs. pet data were motion - corrected, spatially smoothed with a 2.5 mm fwhm gaussian filter, and registered to the black baboon brain atlas using jip tools optimized for nonhuman primate data processing (www.nitrc.org/projects/jip). image registration was carried out on high - resolution mprage mri image using a 12 degree of freedom linear algorithm and a nonlinear algorithm to the atlas brain. kinetic modeling was carried out in pmod (pmod3.3, pmod technologies ltd., tacs were exported from the whole brain, cerebellum, primary motor cortex, putamen, thalamus, primary visual cortex, caudate, and white matter vois for analysis. a two - tissue compartmental model was used to estimate regional volume of distribution (vt) with a metabolite - corrected plasma tac. voxel - wise vt maps were calculated using a logan plot from the dynamic pet data. the time until linearity of the plot was achieved and determined for each scan. in addition, regional k1/k2 and k3/k4 values were also obtained from the baseline scans using a two - tissue compartmental model. it is known thatwith the assumption that kd = 0.4 m (assumed from ex vivo hdac - complex kd measure for saha, which exhibits a similar ic50 in in vitro activity - based assays we determined). averaged bmax from the selected vois was estimated to be 19.6 2.9 m (mean sd). arterial samples collected during imaging from the baboon were centrifuged to obtain plasma, which was then removed and placed in an automated gamma counter that was calibrated to the pet scanner. metabolite analysis was conducted on a custom automated robot fitted with phenomenex spe strata - x 500 mg solid phase extraction cartridges that were primed with ethanol (2 ml) and deionized water (20 ml). protein precipitation was achieved by addition of plasma (300 l) to acetonitrile (300 l), which was centrifuged for 1 min to obtain protein - free plasma (pfp). 300 l of pfp / acetonitrile solution was diluted into deionized water (3 ml), loaded onto the c18 cartridge, and removed of polar metabolites with 100% water. next, a series of extractions were performed using water and acetonitrile in quantities : 95:5, 90:10, 85:15, 80:20, 70:30, 60:40, 30:70, and 100% acetonitrile at a volume of 4 ml. a control experiment was performed before metabolite analysis to determine the retention of the parent compound by injection of a small amount of [c]6 onto a test series of extraction cartridges. each sample was counted in a wizard2 automatic gamma counter to determine the presence of radiolabeled metabolites. one rat under pentobarbital anesthesia (50 mg / kg, ip) was administered 0.538 mci of [c]6 by tail vein injection in 0.7 ml and after 30 min, sacrificed by pentobarbital overdose (additional 150 mg / kg, ip), and followed by rapid decapitation. the brain was removed, sagitally hemisected, and homogenized in 2 ml acetonitrile. the resulting suspension was centrifuged at 1500 rpm for 5 min, and 0.6 ml of clear supernatant was vortexed with 3 ml water and applied to phenomenex spe strata - x 500 mg solid phase extraction cartridges, washed, and fractionally eluted with water containing increasing proportions of acetonitrile (100:0, 95:5, 90:10, 85:15, 80:20, 70:30, 60:40, 30:70, 0:100). each sample was counted in a wizard2 automatic gamma counter to determine the presence of radiolabeled metabolites. | epigenetic enzymes are now targeted to treat the underlying gene expression dysregulation that contribute to disease pathogenesis. histone deacetylases (hdacs) have shown broad potential in treatments against cancer and emerging data supports their targeting in the context of cardiovascular disease and central nervous system dysfunction. development of a molecular agent for non - invasive imaging to elucidate the distribution and functional roles of hdacs in humans will accelerate medical research and drug discovery in this domain. herein, we describe the synthesis and validation of an hdac imaging agent, [11c]6. our imaging results demonstrate that this probe has high specificity, good selectivity, and appropriate kinetics and distribution for imaging hdacs in the brain, heart, kidney, pancreas, and spleen. our findings support the translational potential for [11c]6 for human epigenetic imaging. |
central retinal artery occlusion (crao) causes painless and sudden visual loss in the affected eye resulting in infarction of the retina with subsequent necrosis. it accounts for about 1/10,000 visits to ophthalmologists each year (1, 2). a meaningful recovery of visual acuity occurred in only < 10% of patient (3, 4). since von graefe first described the crao in 1859, various treatments have been advocated but there is none that has proven effective. crao occurs by occlusion of the central retinal artery with small emboli from atherosclerotic plaque of internal carotid artery. based on this principle, thrombolysis was suggested for restoring retinal blood flow in crao through dissolving the thromboemboli (5 - 10). we report our crao cases that were treated with intra - arterial thrombolysus (iat). to our knowledge, this is the first case report in korea. a 69-yr - old man with a history of hypertension and diabetes mellitus was transferred to our hospital for sudden visual loss in his left eye which had occurred 9 hr ago. in medical history, he had no ophthalmic problem and had maintained good visual acuity. on examination, vision was light - perception in left and 20/20 in right eye. fundus examination revealed white edematous retina and typical " cherry - red spot " as well as vessel fragmentations suggesting crao (fig. perfusion of retina was markedly diminished with arteriovenous (av) transit time of 5 min while choroidal perfusion was normal on fundus fluorescein angiography of left eye (fig. intraocular pressure was 9 mmhg and slit lamp examination of anterior segment, lid, and orbit showed normal findings. because the neurological examination showed no abnormality and he had not recently experienced any neurological symptoms, we skipped the brain imaging studies which were usually performed in the stroke patients. ten hours after symptom onset, we performed cerebral angiography with biplane angiographic unit (integris allura ; philips medical systems, eindhoven, netherlands). there was no atherosclerotic lesion in distal carotid and proximal cervical internal carotid artery on left carotid angiogram. internal carotid angiogram showed no occlusion of left ophthalmic artery up to distal segment and normal choroidal blush (fig. we changed diagnostic catheter for 6f guiding catheter (envoy ; cordis, warren, new jersey). on selective angiogram at ophthalmic artery using a microcatheter (excelsior sl-10 ; boston scientifics, natick, massachusetts), there was no definite occlusion in branches including ciliary arteries and muscular branches from ophthalmic artery (fig. after the microcatheter was placed in proximal segment of the ophthalmic artery, urokinase (green cross pharmacy, yongin, korea) and abxicimab (reopro ; lilly, indianapolis, indiana) which are usually used for iat in intracerebral artery occlusion were hand - injected slowly up to 400,000 units and 4 mg, respectively. urokinase was administrated firstly for finbrinolysis and abxicimab was added for preventing from further platelet aggregation. their doses were reduced due to small size and territory of central retinal artery and for safety. compared with before preoperative angiograms there was no procedure - related complication or event. during the procedure, we could not find any improvement of retinal perfusion on fundus examination and the patient had no subjective improvement of vision. one hour after thrombolysis, the patient experienced marked restoration of vision and visual field. at one day after thrombolysis, his visual acuity was hand motion while he could see 20/100 using his temporal visual field. the fundus fluorescein angiography showed normalized retinal arterial filling with av transit time of 18 sec (fig. the b wave amplitude of maximal combined response of electroretinogram was 331.7 uv in his right eye and 250.2 uv in his left eye. however, he had severe macular edema on optical coherence tomography and showed no further improvement of vision thereafter. because there was no newly developed neurologic sign implying brain lesions, the brain imaging study was not performed, additionally. a 47-yr - old man presented with sudden decrease of visual acuity in left eye for 10 hr. on ophthalmic examination 1 month ago, he could have seen 20/20 with his left eye. eight years ago, he had also experienced sudden visual loss in his right eye for crao. at that time, because he had visited at hospital 2 days after onset, he had not treated for visual loss and visual acuity was no light perception. 4a). on fundus fluorescein angiography, there was a delay in arterial filling and av transit time was 70 sec (fig. the selective angiogram of ophthalmic artery showed a choroidal blush and no occlusion in its branches. a microcatheter was placed at the origin of ophthalmic artery and urokinase was hand - injected. during the injection, his visual acuity improved and retinal perfusion increased on fundus examination, so we stopped the iat after the injection of 300,000 units of urokinase (fig. one day after iat, his vision improved to 20/40 and fundus fluorescein angiography showed normal retinal perfusion with av transit time of 12 seconds (fig. two weeks after iat, his visual acuity improved to 20/25 and there was no more retinal edema (fig. a 69-yr - old man with a history of hypertension and diabetes mellitus was transferred to our hospital for sudden visual loss in his left eye which had occurred 9 hr ago. in medical history, he had no ophthalmic problem and had maintained good visual acuity. on examination, vision was light - perception in left and 20/20 in right eye. fundus examination revealed white edematous retina and typical " cherry - red spot " as well as vessel fragmentations suggesting crao (fig. perfusion of retina was markedly diminished with arteriovenous (av) transit time of 5 min while choroidal perfusion was normal on fundus fluorescein angiography of left eye (fig. intraocular pressure was 9 mmhg and slit lamp examination of anterior segment, lid, and orbit showed normal findings. because the neurological examination showed no abnormality and he had not recently experienced any neurological symptoms, we skipped the brain imaging studies which were usually performed in the stroke patients. ten hours after symptom onset, we performed cerebral angiography with biplane angiographic unit (integris allura ; philips medical systems, eindhoven, netherlands). there was no atherosclerotic lesion in distal carotid and proximal cervical internal carotid artery on left carotid angiogram. internal carotid angiogram showed no occlusion of left ophthalmic artery up to distal segment and normal choroidal blush (fig. we changed diagnostic catheter for 6f guiding catheter (envoy ; cordis, warren, new jersey). on selective angiogram at ophthalmic artery using a microcatheter (excelsior sl-10 ; boston scientifics, natick, massachusetts), there was no definite occlusion in branches including ciliary arteries and muscular branches from ophthalmic artery (fig. after the microcatheter was placed in proximal segment of the ophthalmic artery, urokinase (green cross pharmacy, yongin, korea) and abxicimab (reopro ; lilly, indianapolis, indiana) which are usually used for iat in intracerebral artery occlusion were hand - injected slowly up to 400,000 units and 4 mg, respectively. urokinase was administrated firstly for finbrinolysis and abxicimab was added for preventing from further platelet aggregation. their doses were reduced due to small size and territory of central retinal artery and for safety. compared with before preoperative angiograms there was no procedure - related complication or event. during the procedure, we could not find any improvement of retinal perfusion on fundus examination and the patient had no subjective improvement of vision. one hour after thrombolysis, the patient experienced marked restoration of vision and visual field. at one day after thrombolysis, his visual acuity was hand motion while he could see 20/100 using his temporal visual field. the fundus fluorescein angiography showed normalized retinal arterial filling with av transit time of 18 sec (fig. the b wave amplitude of maximal combined response of electroretinogram was 331.7 uv in his right eye and 250.2 uv in his left eye. however, he had severe macular edema on optical coherence tomography and showed no further improvement of vision thereafter. because there was no newly developed neurologic sign implying brain lesions, the brain imaging study was not performed, additionally. a 47-yr - old man presented with sudden decrease of visual acuity in left eye for 10 hr. the best corrected visual acuity of his left eye was 20/70. on ophthalmic examination 1 month ago, he could have seen 20/20 with his left eye. eight years ago, he had also experienced sudden visual loss in his right eye for crao. at that time, because he had visited at hospital 2 days after onset, he had not treated for visual loss and visual acuity was no light perception. fluorescein angiography, there was a delay in arterial filling and av transit time was 70 sec (fig. the selective angiogram of ophthalmic artery showed a choroidal blush and no occlusion in its branches. a microcatheter was placed at the origin of ophthalmic artery and urokinase was hand - injected. during the injection, his visual acuity improved and retinal perfusion increased on fundus examination, so we stopped the iat after the injection of 300,000 units of urokinase (fig. one day after iat, his vision improved to 20/40 and fundus fluorescein angiography showed normal retinal perfusion with av transit time of 12 seconds (fig. two weeks after iat, his visual acuity improved to 20/25 and there was no more retinal edema (fig. in results of meta - analysis of 158 iat patients for crao (11), visual improvement occurred on average in 147 patients (93%), with 13% achieving 20/20 or better, 25% achieving 20/40 or better, and 41% achieving 20/200 or better. the overall complication rate was 4.5% (10/220), including 1 local hemorrhage, 5 transient ischemic attacks, 1 hypertensive crises, 1 intracerebral hemorrhage, and 2 strokes. this result suggested the benefit of iat compared with natural history and conservative treatment of crao. although some author suggested that there was no correlation between outcome and time to treatment (6), 6 - 12 hr of time window is generally accepted (12 - 14). visual prognosis is often poor when thrombolysis is administered more than 20 hr after crao (12 - 16). in case 1, although we recanalized the central retinal artery within 12 hr after symptom onset, the improvement of functional visual outcome was limited. to our thought, the delay from symptom onset to procedure was too long to make significant functional improvement. in addition, the patient in case 1 could see better immediately after thrombolysis and his vision deteriorated after one night, which suggests that reperfusion injury on retinal neurons could be another cause of limited restoration. interestingly, case 2 showed better visual outcome than 1, although the time to treatment was similar. the severity of retinal ischemia determined by pre - treatment visual acuity and degree of arterial occlusion by fundus angiography could be the major reason for better visual outcome in case 2. therefore, we suggest that the better visual outcome might be achieved in cases with the shorter time window and with milder arterial obstruction and good pre - iat visual acuity. even though we have experienced small number of cases of crao treated with iat, the team approach appears to be critical in terms of managing crao patients. ophthalmologists can confirm crao with fundus examination and fluorescein angiography and rule out other diseases which can make the sudden monocular blindness. in addition, visual outcome should be evaluated frequently by ophthalmologists before, during, and after iat. the north american symptomatic carotid endarterectomy trial has shown the risk of transient monocular visual loss to be about 10% after 3 yr for patients with ipsilateral carotid artery stenosis (17, 18). therefore, the patients with crao are likely to have the risk of future cerebral stroke. although the risk of cerebral infarction is lower after retinal transient ischemic attack (tia) than that after hemispheric tia in this study (17), neurologists should plan the prevention strategies including control and treatment of stroke risk factors (19). the microcatheter with s - shaped distal tip is adequate for ophthalmic artery selection and maintenance of stability during procedures. the microwires used for routine intracerebral procedures which have 0.014 " in diameter can be introduced into the main trunk of ophthalmic artery. fibrinolytic and antiplatelet agents can be also chosen like as iat for acute stroke. according to reports, the doses of urokinase and tpa were 100,000 - 1,200,000 units and 10 - 40 mg, respectively (11, 16). it should be usually adjusted on the basis of revascularization of the retinal arteries evaluated on ophthalmoscopic examination during procedures, but it is advisable that the maximum dose is reduced for safety compared with intracerebral stroke although the recanalization may be not confirmed during iat. mechanical thrombolysis using microwire with soft tip can be done in case of occlusion in main trunk of ophthalmic artery. other author suggested that thrombolytics had to be administrated in a branch of external carotid artery in case of ipsilateral internal carotid artery occlusion or severe stenosis (16), but its efficiency remained unknown. the recanalization of central retinal artery is not often visualized due to small size on angiogram. improvement of retinal perfusion even without recanalization of this artery can be achieved by making crao into branch retinal artery occlusion and augmentation of the flow to retina via anastomosis if it may recanalize other branches. the detailed technical aspects, indications, and clinical efficacy of iat for crao is still not fully elucidated. the eagle (european assessment group for lysis in the eye) (20), the first prospective randomized clinical trial evaluating the effect of ia tpa, is ongoing. therefore, endovascular surgeons should have an interest in this disabling disease and participate in treatment. technically, iat for crao is more feasible than intracerebral artery occlusion but clinical significance is much different, so that it should be performed within appropriate range of safety. | central retinal artery occlusion (crao) causes severe visual loss in affected eye and vision does not recover in more than 90% of the patients. it is believed that it occurs by occlusion of the central retinal artery with small emboli from atherosclerotic plaque of internal cerebral artery. retina is a part of the brain, thus basically crao is corresponding to acute occlusion of intracerebral artery and retinal ischemia is to cerebral stroke. therefore, intra - arterial thrombolysis (iat) has been considered as a treatment method in crao. recently, we treated 2 patients diagnosed as crao and could achieve complete recanalization on fundus fluorescein angiogram with iat. of them, one recovered visual acuity to 20/25. we report our 2 crao cases treated with iat and discuss technical aspects for iat and management of patient. to the best of our knowledge, this is the first korean report of iat for crao. |
cancer is a major public health problem that can torment everyone in all parts of the world (1). testicular cancer develops in the testis, a part of the male reproductive tract which produces sperm, other male reproductive cells such as sertoli and leydig cells and androgens (2).testicular cancer may be due to irregularities of germ cell development during embryogenesis (3). imperfections during male germ cell development can lead to the formation of testicular germ cell tumors (tgcts), which are classified as teratomas, nonseminomas and seminomas (4). on the other hand, the molecular basis of most cancers remains unclear (5). with this possibility that cancers can be eliminated by specific immune responses, it can be suggested that most of cancers may be the result of an incomplete immune response in clearing abnormal cells (6). the innate immunity, as the first line of host defense, can recognize specific molecular patterns of microbial components via a limited number of receptors called pattern recognition receptors (prrs) (7). these receptors can recognize pathogen - associated molecular patterns (pamps) and activate signal - transduction pathways that induce the expression of a variety of immune - response genes. the recently identified receptors of the toll family appear to have a major role in the induction of inflammatory responses (8). the genes that are expressed in response to tlr signaling encode proteins which are important in several innate immune responses (6). up to now, ten tlr members with different roles have been identified in human (9). according to their localization, tlrs are divided into two main subgroups : cell surface and cytosolic groups (10). on the other hand, there are some evidences that specific chronic inflammatory diseases involving tlrs signaling can lead to cancer development (11, 12). also, high expression of some tlrs has been reported in many tumor cells, or tumor cell lines (13). in addition, numerous recent studies indicated that nuclear factor -kappa b (nf - kb) is found in a number of human malignancies (14, 15). nf - kb is one of principal transcription factors activated by tlrs signaling pathways (6). so it seems that nf - kb signaling pathway may be a link between tlrs, chronic inflammation and tumor development (16). to date, the alteration in tlrs gene expression was not studied in human testicular cancers so we decided to study and compare gene expression of some tlrs in the normal and testicular cancer tissues. four members of the tlrs family were selected based on their function, ligands and their location in cell (tlr2, 3, 4 and 9). tlr2 and 4 are members of cell surface group.tlr2 and its associated receptors (tlr1 and tlr6), are mainly involved in the detection of molecules derived from gram - positive bacteria, fungi (zymosan) and synthetic lipoproteins (17 - 19). tlr3 recognizes rna from double - stranded viruses, while tlr9 recognize sun methylated cpg dna found richly in prokaryotic genomes and dna viruses (21, 22). actually, one of the most important aspects of our selection was diversity in ligand recognition (gram negative and positive bacteria and viruses) and cell localization (cell surface and cytosolic) of these tlrs. therefore, expression of tlrs 2, 3, 4 and 9 as main components of innate immunity has been investigated in this study. in this case control study, the normal testis samples (control group) were obtained from ten men who underwent testis surgery for benign reasons such as testicular sperm extraction (tese). cancer samples were obtained from ten men who underwent orchiectomy because of seminoma (case group). the samples were collected at royan institute, laleh hospital and shariati hospital of tehran, iran. all procedures were approved by the royan ethics committee. written informed consent was obtained from all participants prior to the collection of tissue samples. all samples were immediately coated by rnalater (ambion, huntington, uk) and then transported to the laboratory. samples after cutting at 5 mm were transferred to 2ml cryovial tubes (greiner bio - one, frickenhausen, germany) and then immersed in liquid nitrogen containers for 30 seconds. rna isolation, cdna synthesis and reverse transcription pcr (rt - pcr) after thawing the frozen samples, tissues were removed from rnalater and then total rna was extracted using tri - reagent (sigma, pool, uk) according to the manufacturer 's instructions that we used in our pervious study (23). total rna was treated with dnase i (fermentas, sanktleon - rot, germany) to remove genomic dna contamination from samples. first - strand cdna synthesis was performed using oligodt primers and the superscript ii reverse transcriptase system (fermentas, germany). negative rt controls were prepared without inclusion of the enzyme (non - reverse transcriptase controls, rt controls). the rt - pcr was performed by combining cdna, platinum blue pcr super mix (invitrogen, paisley, uk) and the forward and reverse primers for tlr2, 3, 4 and 9 (metabion, martinsried, germany). the forward and reverse primer sequences used are depicted in table i. the amplication was continued for 40 cycles under the following conditions : 5 minutes at 95c for initial denaturation, followed by 39 cycles of 45 seconds at 95c, 45 seconds at 58 - 60c (different temperature for different tlrs, table i) and 45 seconds at 72c. non - template water controls were also included to ensure lack of reagent dna contamination (negative control). rt - pcr was performed to detect gene expression of tlr2, 3, 4 and 9 in normal and cancer testis samples. after pcr, all samples were transferred on 1.7% agarose gel (sigma, uk) then electrophoresis was performed with 1x tae buffer (invitrogen, uk) at 95 v for 40 - 50 min. results were illustrated by using an ultraviolet trans illumination and digital images were captured by gel documentary machine (carestream, berlin, germany). quantitative real time pcr (qpcr) quantitative real - time pcr (q - pcr) was performed in triplicates with the constructed cdnas and the same primers that were used in pcr reactions (table i). sybr green jump start taq ready mix (sigma) master mix [containing 10 l sybr green, 7 l of water, 1 l of each primers (20 pmol/l) and 1 l of cdna ] was added to each well of pcr plate and amplication was performed under the following conditions : 50 cycles of 95c for 30s, 58 - 60c for 30s and 72c for 30s (24). results were analyzed using applied biosystems sds 7000 (applied biosystem, foster, usa). briefly, the difference in cycle times, ct was determined as the difference between the tested gene and the reference housekeeping gene, human - actin. the fold change was calculated as all experiments included negative controls (no cdna). tlr2, 3, 4 and 9 expressions in the normal and cancer testis samples our findings indicate that tlr2,3,4 and 9 genes are expressed in all normal and testicular cancer specimens. all amplified products were of the predicted size and control experiments with non - reverse transcriptase rna of each sample confirmed that there was no contamination of genomic dna in the samples. compare to housekeeping gene expression, it seems that the tlrs gene expression was more in cancer samples than normal tissues especially for tlr2 and 4 (figure 1). quantitative expression of tlr2, 3, 4 and 9 between normal and cancer testis samples q - pcr analysis was used to investigate the relative expression of these tlr genes to compare between normal and cancer testis tissues. although cancer samples showed significantly stronger expression of all examined tlrs compared to normal ones, this difference was more significant for tlr2 and 4 (figure 2). sequence of tlrs primers used in the current investigation. data obtained from other reports are referenced results of rt - pcr for tlrs 2, 3, 4 and 9 mrna expression in human normal and cancerous testis tissues. also, endometrial samples and non - template water were used as positive and negative controls mean sem of normalized expression values for tlr 2, 3, 4 and 9 genes in human normal and cancerous testis tissues. the level of statistical significance was set at p<0.05 and data was analyzed using student s group t - test (n=10). the present study revealed that the genes of tlrs 2, 3, 4 and 9 were expressed in normal and cancerous testis tissues. as testis is an organ that produces sperm, it is very important to protect spermatozoa from microbes during its formation, maturation, transit and storage (26). our finding due to the expression of some tlrs in normal testis tissue may provide supporting evidence that tlrs as members of innate immunity play important role in the testis protection against microbial pathogens (27). in addition, higher expression of tlr2, 3, 4 and 9 in seminoma in comparison to normal testis tissues in present study is in consistence with other studies which revealed elevated expression of some tlrs in other malignancies such as ; colon cancer, breast cancer, gastric cancer, ovarian cancer and prostate cancer (28 - 32). there is one potential explanation for higher expression of these tlrs in cancerous testis tissues. since tlrs signaling pathways lead to the activation of nf - kb and some other studies have directly demonstrated that nf - kb is often found in a number of human malignancies, it can be suggested that nf - kb may play an essential role in tlrs - induced tumorigenesis when tlrs are increased (14, 33). although this study revealed significant changes in some tlrs expression between normal and cancerous testis tissues, we could not draw any definite conclusion because of small sample size. one potential explanation was suggested for the alteration in tlrs gene expression in testicular cancer : this increase may be one of causative factors in tumorogenesis because tlrs activate nf - kb. further studies are recommended to evaluate the difference in protein expression level, to confirm this suggestion by evaluating the expression of nf - kb, and also to investigate other tlrs gene expression in cancerous testis tissue. | background : it has been suggested that malfunction of immune system may causes testicular cancer. recently, our understanding of innate immune system has been expanded, by discovery of toll - like receptors (tlrs). some studies have shown that polymorphisms of tlr2 and 4 may affect on the risk of cancer. also, the role of tlrs 3 and 9 have been shown in apoptosis and metastasis of cancer cells in animal models. objective : little information is available about the influence of innate immunity on testicular malignancy. therefore, expression of tlrs 2, 3, 4 and 9 as main components of innate immunity has been investigated in this study. materials and methods : in this case control study, tlrs gene expression was examined by rt - pcr in normal testis and testicular cancer tissues. real time quantitative pcr (q - pcr) analysis was used to compare the relative expression of tlrs between the samples. results : mrnas of tlr 2, 3, 4 and 9 were expressed in all normal and cancer samples. q - pcr reveals that cancer samples had stronger expression of these genes compared with normal ones. conclusion : it seems that the different tlrs expression in testicular cancer cells may contribute to extensive signaling pathways involved in carcinogenesis. |
it was 1991less than ten years after the cause of aids had been identified and researchers already thought they might have a successful vaccine. evidence from several laboratories suggested that it was possible to develop a vaccine against hiv by inoculating individuals with a crippled version of the virus that could not replicate, a strategy similar to that used to produce measles, mumps, and polio vaccines. in their tests, researchers used a virus similar to hiv, called simian immunodeficiency virus (siv), which infects rhesus macaque monkeys. over time researchers inactivated siv, injected it into the monkeys as a vaccine, and tested whether the animals were protected against live siv infection. indeed, several monkeys were protected, and aids researchers were encouraged that an effective human aids vaccine would soon follow. however, in october 1991, a brief article was published that sent aids vaccine research into a tailspin. like others, e. james stott 's laboratory had immunized macaques with inactivated siv, which protected them against subsequent infection with live virus. in contrast to earlier reports, the stott laboratory included a negative control that was missing from the earlier studies. thus, a second group of monkeys was immunized with the human host cells that had been used to grow the inactivated siv, but which had not been infected with siv and, therefore, contained no trace of the virus. the purpose of this negative control was to ensure that the immune reaction, which had successfully protected the monkeys, was specific for siv antigens, and was not induced by something other than siv. equally surprising was the fact that protection in the vaccine group was not associated with antibodies that recognized siv antigens. first, hla class i and ii molecules were shown to be expressed on the surface of hiv and siv enveloped viruses such as hiv and siv are coated with a lipid membrane that is stolen from the host cell as the virus exits, and this coat includes host membrane proteins including hla. interestingly, the amounts of hla on the viruses ' envelope exceeded those of the main viral antigen gp120. second, immunization of macaques with purified hla class ii protected the animals from infection with siv that bore the same hla but not against siv grown in cells that expressed different hla. although some inactivated virus vaccine studies also reported siv - specific antibody responses, the protection achieved in these studies was not due to a classic vaccine effect, intended to generate immunologic memory against specific viral antigens. rather, a non - siv - specific experimental artifact, namely the immune reaction against xenogeneic hla, was shown to be the cause of the protection. despite the fact that more than 200 macaques in several independent studies were protected from infection, presumably by anti - hla antibodies, the whole inactivated virus aids vaccine approach was largely discarded in favor of pursuing vaccines that would generate hiv / siv - specific adaptive humoral and cellular immunity. this was a sensible and rational decision at the time, taken by following the rigorous scientific process of rejecting the initial hypothesis based on the experimental results and controls. if now, almost 30 years after hiv was isolated, an effective virus - specific vaccine against hiv were available, there would be no reason to look back at those experiments and revisit their outcome. however, the limited success of some promising - looking hiv vaccine trials in recent years prompted us to reflect and reconsider retrospectively some of the earlier studies on hiv / siv vaccines. can we learn anything from the failed negative control of the stott laboratory 's experiment ? would we still consider the outcome of that study to be an artifact, if instead of searching for anti - siv responses, we could reformulate the hypothesis and postulate that anti - hla reactions can protect against siv / hiv infections ? as early on as 1993, a letter in science suggested that the protection induced by foreign hla activation should be pursued as a possible aids vaccine strategy. might immunologic factors other than anti - hla antibodies have been activated by foreign hla recognition ? such mechanisms may have been overlooked or not detected in the earlier siv / macaque studies, but could have contributed to the observed protection against infection. more recent independent studies discovered multiple protective roles for xenoantigen- and alloantigen - activated immunity. these components included anti - ccr5 (c - c chemokine receptor type 5) antibodies, and several innate antiviral factors in both the siv / macaque and hiv / human experiments. these factors include the cd8 t cell - derived anti - hiv factor (cd8-sf) and the -chemokines rantes (regulated upon activation, normal t - cell expressed, and secreted), mip-1 (macrophage inflammatory protein-1), and mip-1, which block the ccr5 coreceptor, essential for virus entry into target leukocytes. these results raise the possibility that anti - siv factors and anti - ccr5 antibodies also contributed to protection against infection in the early vaccine studies. intentional in vivo alloimmunization of recurrent spontaneously - aborting women against their partners ' peripheral blood leukocytes induced : (a) increased levels of rantes, mip-1, mip-1, and cd8-sf ; (b) decreased ccr5 and cxcr4 (c - x - c chemokine receptor type 4) coreceptor expression ; and (c) increased resistance to in vitro hiv infection, a picture that resembled the results obtained by xenogeneic immunization in the siv / macaque model. hla alloantigen stimulation of human peripheral blood leukocytes also induced the soluble factor edn (eosinophil - derived neurotoxin) in monocytes and the cytodine deaminase apobec3 g (a3 g) in cd4 t cells. both edn and a3 g interfere with hiv replication in the crucial window of opportunity after virus entry and before reverse transcription. this effect can also been seen in vivo, in alloimmunization of recurrent spontaneously - aborting women, for example, which resulted in increased a3 g that was associated with reduced cd4 t - cell susceptibility to hiv infection in vitro. a study of vertical perinatal (i.e., from mother to baby during delivery) transmission of hiv in kenya indicated that babies with hla class i similar to that of their mother were more likely to contract hiv. several cohorts of individuals have been identified that are repeatedly exposed to hiv, but appear not to have become infected. one cohort of hiv - exposed seronegative patients was identified in couples in which only one partner is hiv - infected, and who do not use safe sexual practices. these hiv - exposed seronegative individuals produced anti - ccr5 serum antibodies, and their peripheral blood leukocytes exhibited elevated levels of a3 g. thus, hla alloantigen recognition might contribute to protecting against both vertical and horizontal hiv transmission. none of these antiviral mechanisms may be, on its own, sufficient to provide effective protection from siv / hiv infection. for example, immunization of macaques against ccr5 provided partial protection from siv challenge, but did not achieve the same levels of protection that had been observed in studies using inactivated siv vaccine. however, when several mechanisms such as the ones described above are activated simultaneously, they may synergize in conferring a protective effect. should a vaccine strategy that generates the above arsenal of multiple innate and antibody - mediated protective mechanisms against siv / hiv be seriously considered as an aids vaccine ? this question can be now raised retrospectively, since the induction of the anti - hiv / siv factors by xenoantigen or alloantigen recognition was reported only after the inactivated virus vaccine strategy had been dropped. in march 2008, the division of aids (daids), national institute of allergy and infectious diseases (niaid) held a summit meeting in bethesda, maryland, to discuss the repeated failures that spanned a 20-year period of attempts to develop an effective hiv antigen - specific prophylactic aids vaccine, and to consider plans for the future. our subsequent commentary on the summit suggested that innovative nontraditional approaches not bound to the paradigm of prime - boost stimulation of adaptive immunity should be considered in order to overcome some of the characteristic features that allow hiv to escape immune control. among the problems that undermine the effectiveness of virus - specific aids vaccines is the fact that hiv bypasses virus - specific immunity by mutating away from the immunogenic viral epitopes for which a vaccine was designed. another important hurdle for adaptive immunity is the rapid rate at which hiv and siv infect mucosal sites. thus, by infecting macaques intravaginally with siv, ashley haase 's laboratory estimated that endocervical infection occurs within a few hours of viral challenge, resulting in rapid migration of infection - susceptible cd4 t cells to the site of viral exposure. these findings suggest that adaptive immune responses induced by aids vaccines may be too late, too little. therefore, upon exposure to infectious hiv / siv, protective mechanisms should already be active at the site of viral challenge during this brief window of opportunity. the potential protective effect of an alloantigen - based aids vaccine must be considered alongside the disadvantages that this approach may have. predicted advantages and disadvantages of alloantigen - based aids vaccines (inactivated allogeneic hiv and/or uninfected allogeneic leukocytes) are listed in table 1, and are summarized in the text below. ccr5, c - c chemokine receptor type 5 ; cd8-sf, cluster of differentiation 8-supressor factor ; edn, eosinophil - derived neurotoxin ; hla, human leukocyte antigen ; mip-1, macrophage inflammatory protein-1 ; rantes, regulated upon activation, normal t - cell expressed, and secreted ; siv, simian immunodeficiency virus. recognition of allogeneic leukocytes uniquely leads to rapid primary hla - specific responses, and immunization with either allogeneic leukocytes or inactivated siv induces potent anti - hla antibody responses. thus, based on the high density and immunogenic potential of hla on the hiv envelope, anti - hla antibodies are likely to react against hiv more efficiently than antibodies against viral envelope antigens. notably, immunization with purified hla was sufficient to achieve protection from infection, demonstrating the potency of anti - hla antibodies in neutralizing siv. however, when inactivated hla - bearing siv was used as a vaccine by stott and others, they observed not only anti - hla protective antibodies, but also anti - siv antibodies that were induced by siv antigens expressed by the immunizing hiv particles. therefore, the inactivated hiv / siv approach may meet the requirement for both antiviral and anti - hla immunity. noteworthy here is the fact that those experiments of hla - associated immunity protected macaques from intravenous infection with high doses of virus. whether anti - hla, anti - ccr5, and other innate antiviral factors may be present at mucosal level in amounts sufficient to protect from infection via sexual exposure is still unknown. it is possible that the efficacy of hla immunization might even be higher against natural exposure to moderate (or suboptimal) doses of virus. an attractive feature of alloantigen - based aids vaccines is that, because it would not rely on hiv epitopes, alloimmunization would be indifferent to viral mutation. furthermore, the innate antiviral factors and anti - ccr5 antibodies induced by immunization with allogeneic leukocytes inhibit siv and hiv replication at different points in the viral cycle. this may increase the pressure on hiv, which is less likely to develop mutations that would escape the multiple inhibitory mechanisms activated by alloantigen immunization [6 - 10 ]. most importantly, if anti - hla and anti - ccr5 antibodies generated by alloantigen - based aids vaccines can be induced at mucosal sites at the time of infectious challenge, they may exert protective activity during this narrow window of opportunity, bypassing the too late or too little problem. among the arguments against using alloantigen - based aids vaccines are the facts that allogeneic immunization might induce autoimmune or other detrimental immunologic conditions and exclude vaccine recipients from future allogeneic tissue transplantation. however, the probability that vaccine recipients would receive allografts in the future would be low in many hiv endemic regions of the world, and antirejection drugs could be used to prevent allograft rejection. furthermore, allogeneic leukocytes are often transferred during blood transfusions, and more than 2,500 recurrent spontaneously - aborting women have received multiple immunizations (some more than 25 years ago) from their husbands without detected detrimental effects. one counterargument to this observation is that recurrent spontaneously - aborting women were immunized only against their partners ' hla, whereas immunization against multiple hla would be needed to induce protection from hiv infection. nevertheless, detrimental effects associated with exposure to different hla types are not commonly observed in individuals who have received multiple transfusions. the fact that the hla types on the surface of hiv with which an individual will make contact would be those of the infecting host, and therefore can not be predicted, presents a problem for alloantigen - based aids vaccines. one possible solution would be to engineer a group of maximally - discordant hla haplotypes into a selected target leukocyte cell line. this cell line could then be used as the vaccine itself, or as the source of hiv / siv particles to be utilized as the vaccine. ideally, such vaccines could generate anti - hla antibodies to protect against hiv / siv expressing several different hla. another pitfall of the alloantigen - based aids vaccine approach may be that the efficacy of protection could correlate inversely with the level of hla matching between the vaccinated individual and the infecting virus. thus, one would expect that, if the vaccinated individual and infecting hiv were perfectly hla matched, there would be no protective effect provided by anti - hla antibodies. in this rare situation, anti - hiv activity might be limited to the effect of alloantigen - based aids vaccine - induced anti - ccr5 coreceptor antibodies. thus, the lack of hla alloantigen recognition would not activate antiviral factors, and vaccine - induced anti - hla antibodies would not recognize the matched hla on the infecting virus as allogeneic. on the contrary, anti - hla antibody - mediated protection and innate antiviral factors would be highest with maximal hla discordance between the vaccinated individual and the infecting virus. different degrees of protection might be observed between these two extremes, depending on the level of hla matching. another potential problem with alloantigen - based aids vaccines is the relatively high frequency of hla - specific cd4 t cells, which could be activated by immunization against hla alloantigens and may result in an increased number of potential targets for hiv infection. the problem of increased cd4 t cell targets for infection, however, would also be shared by other vaccine strategies, including vector - based hiv - specific vaccines. whether an increase in the number of targets for infection could be counteracted by the multiple protective mechanisms that an alloantigen - based aids vaccine would induce is unknown. the only clue comes from early macaque studies involving xenoimmunization showing that anti - hla antibody [1 - 3 ], and probably innate antiviral factors and anti - ccr5 antibodies, appeared to overcome any increase in hla - specific cd4 t - cell targets, ultimately protecting the host from infection. one major concern for the immune responses induced by alloantigen - based aids vaccines is whether they would induce long - lasting protection and immunologic memory. hla alloimmunization of recurrent spontaneously - aborting women indicated that reduced ccr5 coreceptor expression was maintained for at least 12 months, the period of follow - up after alloimmuniztion. however, innate responses may be different, because the same study indicated that the -chemokines were detected for only 6 months after alloimmunization. thus, the innate mechanisms that participate in the protective response may be more short - lived than adaptive immune responses. this could be advantageous because long - term innate responses, if achieved, might be detrimental to the host. a3 g was reported in memory t cells, suggesting that this antiretroviral factor might not be so time - critical. although these innate factors might not be sufficient by themselves to protect against infection, they could contribute to protection against mucosal infection if activated in the presence of vaccine - induced pre - existing anti - hla and anti - ccr5 antibodies. furthermore, it is possible that once immunized against allogeneic hla, subsequent natural exposures to hiv bearing allogeneic hla molecules would repeatedly boost anti - hla and anti - ccr5 antibody responses, as well as rapidly reactivate the transient antiviral factors. another problem to be overcome is that the hla carried by the viral envelope would remain allogeneic only as long as infection did not occur (figure 1). if the arsenal of antiviral mechanisms induced by hla recognition failed to prevent infection of the host target cells, newly produced hiv particles would carry the hla of the host, which would not be recognized as foreign. thus, the window of opportunity for an alloantigen - based aids vaccine to be protective would be strictly time - limited, and vaccine - induced antibodies and innate antiviral factors (the second line of defense) would optimally need to prevent infection, since they may not efficiently suppress viral replication once hiv has acquired self hla from the host (figure 1b). therefore, by definition, an effective alloantigen - based aids vaccine would have to be sterilizing and could not permit infection to be established (figure 1a). again, the only clue we have as to whether this would work is the fact that more than 200 xenoantigen - immunized macaques were protected against siv infection. (a) upon exposure to hiv particles carrying allogeneic human leukocyte antigen (hla), preformed anti - hla antibodies in the immunized host will opsonize and block challenging hiv. anti - ccr5 (c - c chemokine receptor type 5) antibodies and -chemokines will inhibit hiv interaction with its coreceptor and, in case hiv successfully enters target cells, intracellular restriction factors such as eosinophil - derived neurotoxin (edn) and apobec3 g will prevent productive infection. this allogeneic hla - induced arsenal of antibodies and antiviral factors may efficiently prevent infection (sterilizing immunity) and result in full protection. (b) if alloantigen - based aids vaccine - induced antiviral mechanisms fail to prevent productive infection, newly produced hiv particles budding from the host 's cells will carry self hla and will not be recognized as allogeneic anymore. anti - hla antibodies will not react with self hla - carrying hiv, antiviral factors would not be produced to counteract the spread of the infection, and anti - ccr5 antibody induced by alloantigen - based aids vaccines might not offer sufficient protection. we have summarized the mechanisms by which hla recognition may result in protection from hiv / siv. however, it should be noted that not all of these potentially protective mechanisms were : (a) tested using both inactivated hiv / siv and allogeneic or xenogeneic uninfected cells ; (b) studied in both the siv / macaque (xenogeneic) and hiv / human (allogeneic) models ; and (c) analyzed using both in vitro and in vivo systems. these issues should be carefully investigated in comprehensive and purpose - designed in vitro and in vivo studies to properly appreciate the potential for an alloantigen - based aids vaccine approach. for example, it is not known whether inactivated virus would induce anti - ccr5 antibody and/or activate some or all of the innate antiviral factors induced by alloimmunization of humans in vivo firstly, xenogeneic leukocyte immunization of macaques was reported to induce anti - hla antibodies [1 - 3 ] and mucosal immunization of macaques with macaque allogeneic peripheral blood leukocytes (instead of xenogeneic human cell lines) activated siv - inhibiting chemokines, increased anti - ccr5 antibody levels and was associated with decreased in vitro siv infectivity. secondly, some of these features were seen in recurrent spontaneously - aborting women who produced elevated levels of -chemokines and a3 g upon alloimmunization, and their cd4 t cells were protected against in vitro infection by hiv. would immunization using inactivated virus or purified hla be more effective ? to complete a meaningful comparative analysis of these two alloantigen - based aids vaccine strategies, additional in vivo macaque immunization and live mucosal siv challenge studies may need to be performed. these studies should compare animals immunized with inactivated virus, animals immunized with purified hla, and negative control animals for antibodies against hla and ccr5, and for innate antiviral factors. the kinetics with which these factors are re - activated in the first hours after siv challenge at both the mucosal and systemic levels should be monitored because of the too late, too little issue. the argument can be made that xenoantigen - expressing cells may be more potent immunogens than alloantigen - expressing cells, which could have provided the protection observed in the stott 's experiment. however, macaques immunized with allogeneic peripheral blood leukocytes were protected against infection by siv grown in simian cells. additionally, a subsequent study indicated that mucosal immunization with allogeneic peripheral blood leukocytes resulted in induction of cd8-sf, mip-1, mip-1 and anti - ccr5 antibody, and increased resistance to siv infection. in humans, administration of inactivated hiv-1 (remune) as an immunotherapeutic vaccine resulted in the induction of antibody responses against hla class i and ii present in the human cell line used for virus production. these findings indicate that immunization with allogeneic cells may induce protective effects similar to those obtained using xenogeneic cell lines. although alloimmunization might induce some anti - hiv antibodies, due to the partial three - dimensional homology between hla and hiv gp120, the use of allogeneic cells instead of inactivated virus has the disadvantage of not including the generation of hiv - specific adaptive t cell immunity. thus, an inactivated hiv vaccine strategy that also incorporates alloimmunization may combine the above described benefits of an alloantigen - based aids vaccine with the potential for generating memory hiv - specific responses. an argument could be made that the use of allogeneic cells would avoid the risk of exposing vaccinees to incompletely inactivated hiv. we are aware of only one international workshop on alloimmunization as an alternative aids vaccine strategy. that workshop was held in 1999, before anticoreceptor antibodies and most of the above - noted innate anti - siv / hiv factors were reported to result from hla alloimmunization. the more recent and increasing body of evidence showing different alloinduced mechanisms of interference with hiv replication and infection suggest that it may be time to reassess this alternative vaccine strategy. this report reconsiders an aids vaccine approach that was discarded 20 years ago because it was not virus - specific. the unorthodox and seemingly counter - scientific approach, conceptually based on a failed negative control, takes advantage of the facts that : (a) immunologically - potent hla acquired from infected cells are carried on the hiv envelope ; and (b) these transplantation antigens are allogeneic to the susceptible host at the time of exposure to infectious hiv. we view expression of foreign hla as a transient achilles heel for hiv, which creates a brief window of opportunity in which preformed, on - site anti - hla and anti - ccr5 antibodies could initially block or limit virus entry. the additional alloantigen - based aids vaccine - induced arsenal of antiviral factors could provide a one - two punch to prevent productive infection. | this report revisits the accidental discovery that protection against simian immunodeficiency virus (siv) infection in the early successful experimental aids vaccine studies in rhesus macaques was due to antibodies directed against human leukocyte antigens (hlas). the inactivated virus vaccine approach was discarded because protection was due to the host 's immune reaction against the hla acquired by siv from the human cell lines in which it was grown, rather than against antigenic determinants of siv itself. subsequent studies have revealed that immune recognition of hla on uninfected leukocytes also induces other factors that inhibit infection by both siv and the human immunodeficiency virus. pro and con aspects of immunization against hla as a potential aids vaccine strategy are discussed. |
acute ischemic stroke (ais) in children is a rare event with an incidence of 1 to 8 per 100 000 children per year. seizures occur in the first hours in up to 50%. besides vasculopathy, thrombophilia or cardiac disorders, cancer, and chemotherapy are known predisposing factors for ais. while solid tumors primarily are associated with venous thromboembolism, malignant hematologic disorders like acute leukemia cause hemorrhagic and thrombotic complications in both venous and arterial vessels. in childhood, we report the case of a 2-year - old boy who presented to our emergency department after a generalized tonic - clonic afebrile seizure with postictal impaired consciousness and right sided hemiparesis. since 3 days he suffered from recurrent vomiting, diarrhea, and weakness. immediate cranial computed tomography (ct) scan and ct angiography revealed a large left - sided ischemic infarction with edema and midline shift due to thrombotic occlusion of the carotid artery, the middle cerebral artery (mca), and the anterior cerebral artery (aca). laboratory workup showed 196 g / l leukocytes with 72% blast cells, 6.3 g / dl hemoglobin, 84 g / l platelets, and a lactate dehydrogenase of 3599 u / l. coagulation testing showed a beginning disseminated intravasal coagulopathy (dic) with low thromboplastin time (40% ; normal value = 70% to 120%), normal activated prothrombin time (32 seconds ; normal value = 25 - 42 seconds), low fibrinogen levels (124 mg / dl ; normal value = 160 - 400 mg / dl), and high d - dimers (63.6 g / ml ; normal value = < 0.6 g / ml). due to high leukocyte count, immediate hydration with 3 thrombolysis, interventional thrombectomy, and anticoagulation were discussed within our interdisciplinary pediatric stroke team but dismissed based on the high bleeding risk and probable low efficiency in leucocyte thrombi. after 8 hours of leukapheresis and hydration, the leucocyte count decreased to 60 g / l, and chemotherapy with low - dose cytarabine was started. neuromonitoring was performed including intracranial pressure measurement. despite swelling of the left hemisphere, maximum intracranial pressure in the first 2 days standard care with 30 head of bed elevation, normotonia, normoglycemia, normothermia, normonatremia, sedation, and muscle relaxation was performed. twenty - four hours later leukocytes rose again and the patient now showed a dilated left pupil unreactive to light. repeat cranial ct scan revealed a second ais on the right side but no new vessel occlusion (see figures 1 and 2). on day 3 both pupils were dilated and unresponsive to light due to brain stem herniation, intracranial pressure increased to maximum 59 mm hg. decompressive craniectomy had been discussed and dismissed in our pediatric stroke team as the long - term prognosis of a large bi - hemispheric infarction in a patient with malignant disease was regarded as dismal. due to poor prognosis no further therapy was initiated and the patient died a few hours later. cranial ct scan with (a) and without contrast (b) at admission to hospital shows a large left - sided infarction and midline shift due to complete occlusion of the left carotid artery, aca, and mca. nonenhanced cranial ct scan 24 hours after admission shows a new large right - sided infarction. over the next several days further coagulation test results were received and showed a low protein c (26% ; normal value = 70% to 140%) and s (45% ; normal value = 70% to 140%) activity, factor viii levels were high (172% ; normal value = 50% to 150%), and genetic testing revealed a heterozygous mthfr polymorphism (c677 t). leukemic blasts expressed cd33, cd15, hladr, cd56, cd36, cd4, moab7.1, cd38, cd99, and cll1 and a mutation in the ftl3 gene in codon 835 was found. epileptic seizures are rarely a primary symptom but occur in contrast to adult stroke in nearly 50% of patients during the acute phase. in our patient a prolonged epileptic seizure with postictal right - sided weakness and hemiparesis were the first symptoms. due to these symptoms an immediate cranial ct scan was performed and showed a large left - sided infarction with complete obstruction of the internal carotid artery, the mca, and the aca. due to leukocytosis and low hemoglobin levels and platelet count, several cases of acute arterial thrombosis as first manifestation of cancer, mainly leukemia, in adults and only few reports in children have been published. to our knowledge, this is the first case of stroke in a pediatric patient with an underlying aml fab m5. coagulopathy can occur in all aml patients but is mainly associated with aml fab m3 (acute promyelocytic leukemia) and can be either associated with bleeding symptoms or thrombosis. hypercoagulability is associated with a high leukocyte count (white thrombus), higher expression of tissue factor, and cancer procoagulant on the blast cells leading to activation of coagulation cascade and thrombosis. overall, thrombosis remains a rare event (12% in adults, 1.1% in children) while hemorrhage due to fibrinogenolysis, dic caused by high annexin ii levels, higher proteolysis, and cytokine release (il-1, tnf-) occurs more often. breccia could demonstrate that thrombotic events are more likely associated with specific immunologic and molecular parameters (cd2, cd15 expression, flt3-itd mutation). in our patient, an flt3-itd mutation that is presumed to be an additional risk factor for the development of ischemic stroke and a heterozygous mthfr polymorphism (c677 t) was found. the low protein c and s levels and high factor viii levels are signs of activation and consumption in the coagulation cascade. use of recombinant tissue plasminogen activator (rtpa) is often limited by time delay, low platelet count, and underlying bleeding risk in aml. due to low plasminogen levels in aml, therapeutic effects of thrombolysis could be impaired and higher doses as usual probably are needed, associated with increased bleeding risk. with underlying leukocytosis, thrombus material may largely be composed of leukocytes (white thrombus) instead of fibrin and platelets that may further limit rtpa effectiveness. the use of a stent retriever seems to be a feasible method for therapy of ais in childhood. mechanical thrombectomy could be postulated as a method to reopen vessels occluded by leukocyte thrombi but up to now no data exist for its use and outcome. up to now interventional thrombectomy is only used in addition to rtpa with the same bleeding risk as with rtpa alone. in our patient, rtpa was no option due to the time delay with already demarcation of the infarction area and unacceptable bleeding risk that also limited the use of low - molecular - weight heparin or unfractioned heparin. furthermore, we supposed that anticoagulation would not prevent further thrombus formation due to leukostasis. g / l until chemotherapy with cytarabine according to the current bfm (berlin - frankfurt - mnster) protocol was started. despite immediate leucoreductive therapy the recurrent stroke most probably was caused by leukostatic or embolic occlusion of the right - sided aca und mca with once again increasing leukocyte count, although the ct angiography did not reveal occluded vessels on this side. beside leukostasis the cell death of leukocytes induced by hydration and chemotherapy may have resulted in an additional release of procoagulative substances and further activation of the coagulation cascade. it remains to be discussed if low - dose anticoagulation would have reduced the risk of secondary thrombosis. we believe that the patient s bleeding risk would have been unacceptably high under this treatment due to the aml associated high bleeding risk and developing dic. craniotomy as therapy for refractory increased intracranial pressure might be a possible therapeutic option considering the high plasticity and good rehabilitation capacity of young brains. however, there was the decision not to perform craniotomy due to the mentioned high bleeding risk associated with the underlying aml and the dismal prognosis with large size of the infarcted area in both hemispheres. epileptic seizures are an unusual presenting symptom of pediatric arterial ischemic stroke. the differential diagnosis should include aml with hyperleukocytosis. standard treatments of ischemic stroke may not be effective due to the leucocyte - rich nature of thrombi in this disease. time delay to diagnosis and treatment seems to be of utmost importance as leukoreductive treatment may not be sufficiently successful when started with delay. mo : contributed to conception and design ; contributed to acquisition ; drafted manuscript ; critically revised manuscript ; gave final approval ; agrees to be accountable for all aspects of work ensuring integrity and accuracy. kk : contributed to conception and design ; contributed to acquisition ; critically revised manuscript ; gave final approval ; agrees to be accountable for all aspects of work ensuring integrity and accuracy. f heinen : contributed to conception and design ; contributed to acquisition ; critically revised manuscript ; gave final approval ; agrees to be accountable for all aspects of work ensuring integrity and accuracy. is : contributed to conception and design ; contributed to acquisition ; critically revised manuscript ; gave final approval ; agrees to be accountable for all aspects of work ensuring integrity and accuracy. f hoffmann : contributed to conception and design ; contributed to acquisition ; critically revised manuscript ; gave final approval ; agrees to be accountable for all aspects of work ensuring integrity and accuracy. kr : contributed to conception and design ; contributed to acquisition ; critically revised manuscript ; gave final approval ; agrees to be accountable for all aspects of work ensuring integrity and accuracy. lg : contributed to conception and design ; contributed to acquisition ; critically revised manuscript ; gave final approval ; agrees to be accountable for all aspects of work ensuring integrity and accuracy. | introduction : acute ischemic stroke (ais) is a rare event in infancy. besides vasculopathy, thrombophilia, or cardiac disorders, cancer and chemotherapy are known predisposing factors for ais. leukemia can be associated with different abnormal coagulation parameters, but severe bleeding or thrombosis occurs rarely. clinical course : we report the case of a 2-year - old boy who was presented to our emergency ward after a prolonged seizure with right sided postictal hemiparesis. cranial computed tomography scan revealed a large infarction and edema due to thrombosis of the left carotid artery, the middle cerebral artery, and the anterior cerebral artery. laboratory workup showed 196 g / l leukocytes with 75% myeloid blast cells. immediate exchange transfusion, hydration, and chemotherapy with cytarabine were started. during the hospital course intracranial pressure increased and the patient developed a unilateral dilated pupil unresponsive to light. cranial computed tomography scan revealed a new infarction in the right middle cerebral artery territory. refractory increased intracranial pressure and brain stem herniation developed, and the child died 3 days after admission to hospital. conclusion : seizures with postictal hemiparesis due to cerebral infarction can be a rare manifestation of acute myeloid leukemia. leukocytosis and cancer - induced coagulopathy are main reasons for thrombosis and/or hemorrhage. high leukocyte counts need immediate interventions with hydration, careful chemotherapy, and perhaps exchange transfusion or leukapharesis. in the presence of thrombosis, anticoagulation must be discussed despite the risk of bleeding due to hyperfibrinolysis and low platelet counts. mortality may be reduced by awareness of this rare presentation of leukemia and prompt institution of leucoreductive treatment. |
in 1994, the global project on anti - tuberculosis drug resistance surveillance was initiated by the who and the international union against tuberculosis and lung diseases, aiming to measure the magnitude of drug - resistant tuberculosis and to monitor trends. at this time, a first set of guidelines was developed to assist national tuberculosis control programs in conducting anti - tuberculosis drug resistance surveys. the guidelines were based on 3 main principles that are still essential in today 's drug resistance surveillance and are described in detail elsewhere : (1) data should be representative of the patients with tuberculosis in the country / geographical setting under study ; (2) patients ' treatment histories should be carefully obtained and available medical records reviewed, to clearly determine whether patients have or have not previously received antituberculosis drugs ; and (3) laboratory methods for antituberculosis drug susceptibility testing should be selected from among those recommended by who, and all laboratory processes should be quality - assured in cooperation with a partner supranational reference laboratory [8, 1113 ]. since 1994, five global reports on anti - tuberculosis drug resistance surveillance have been published [5, 1417 ]. drug resistance data have been systematically collected and analyzed from 114 countries worldwide (59% of all countries of the world). of these countries, only 42 can rely on continuous surveillance systems based on routine diagnostic drug susceptibility testing of all patients. the remaining 72 countries have relied on special surveys of representative samples of patients (figure 1). trends in drug resistance are available for only 59 countries or subnational settings in which > 1 drug - resistance survey or surveillance procedure was conducted during 19942009. given the limited availability of susceptibility testing to second - line antituberculosis drugs worldwide, a large number of resource - limited countries do not have yet the laboratory capacity to diagnose xdr - tb, which has been identified in 68 countries thus far (figure 2). characteristics of available first - line antituberculosis drug resistance data, 19942010. countries that reported at least one case of since the beginning of the global project on anti - tuberculosis drug resistance surveillance, 2 main mechanisms to measure drug resistance have been used : the organization of special surveys (surveys are defined as discrete studies measuring drug resistance among a specially - designed sample of tuberculosis cases representative of an entire population of tb cases) on selected samples of patients, and the establishment of a surveillance system based on routine drug susceptibility testing of all patients. over the past 15 years although surveys face several limitations as described below, in the absence of a feasible alternative that could provide an equivalent amount of information, they are still used in resource - constrained settings with limited laboratory capacity to routinely monitor drug resistance. first, they may be limited in their representativeness and may possibly underestimate the true magnitude of primary and acquired resistance, particularly in settings where concurrent tuberculosis and human immunodeficiency virus (hiv) infection is frequent or where patients with tuberculosis are commonly treated by private health providers. second, surveys are logistically complex and demanding, taking considerable amounts of human and financial resources of the national tuberculosis control program and reference laboratory during the planning, implementation, and analysis phases of a study. third, surveys often are not able to monitor epidemiological trends, because frequencies of drug resistance among patient populations usually do not change rapidly, and only small differences would be expected between surveys conducted a few years apart. the smaller the difference in frequencies, the larger the sample size would be needed to detect a statistically significant difference ; in most circumstances, this means that excessively large sample sizes would be needed. fourth, surveys are not designed to detect localized outbreaks, which could go completely unrecognized even during the course of a study if the outbreak site was not among those selected for patient enrollment. a different surveillance approach is needed to capture the heterogeneity of drug resistance at the local level and avoid over- or underestimating the magnitude of drug resistance by random inclusion or exclusion of outbreaks. finally, the precision of survey results is usually suboptimal in countries with relatively low frequencies of mdr - tb. sample sizes for surveys are calculated to achieve a targeted precision for a predefined estimated proportion of mdr - tb ; the value of such a precision is generally recommended to be no more than 20% of the estimated proportion. in settings with low frequencies of mdr - tb, a high precision can not be reached without capturing a sample that would be so large as to make the survey unfeasible. sentinel surveillance systems represent a useful interim approach for countries that intend to establish countrywide routine drug susceptibility testing but that lack necessary health care resources. under sentinel surveillance, specific laboratory or hospital sites ideally, sites are selected that provide geographical variability and minimize bias. as laboratory capacity is enhanced, more diagnostic sites can progressively join the sentinel system until routine surveillance in all sites is achieved countrywide. the only option to reduce bias and to accurately measure the magnitude of drug resistance and monitor its trends is through the establishment of routine surveillance, which implies systematic ongoing collection, collation, and analysis of data for public health purposes, as reiterated by the world health assembly [20, 21 ]. in 1994, the global project on anti - tuberculosis drug resistance surveillance was initiated by the who and the international union against tuberculosis and lung diseases, aiming to measure the magnitude of drug - resistant tuberculosis and to monitor trends. at this time, a first set of guidelines was developed to assist national tuberculosis control programs in conducting anti - tuberculosis drug resistance surveys. the guidelines were based on 3 main principles that are still essential in today 's drug resistance surveillance and are described in detail elsewhere : (1) data should be representative of the patients with tuberculosis in the country / geographical setting under study ; (2) patients ' treatment histories should be carefully obtained and available medical records reviewed, to clearly determine whether patients have or have not previously received antituberculosis drugs ; and (3) laboratory methods for antituberculosis drug susceptibility testing should be selected from among those recommended by who, and all laboratory processes should be quality - assured in cooperation with a partner supranational reference laboratory [8, 1113 ]. since 1994, five global reports on anti - tuberculosis drug resistance surveillance have been published [5, 1417 ]. drug resistance data have been systematically collected and analyzed from 114 countries worldwide (59% of all countries of the world). of these countries, only 42 can rely on continuous surveillance systems based on routine diagnostic drug susceptibility testing of all patients. the remaining 72 countries have relied on special surveys of representative samples of patients (figure 1). trends in drug resistance are available for only 59 countries or subnational settings in which > 1 drug - resistance survey or surveillance procedure was conducted during 19942009. given the limited availability of susceptibility testing to second - line antituberculosis drugs worldwide, a large number of resource - limited countries do not have yet the laboratory capacity to diagnose xdr - tb, which has been identified in 68 countries thus far (figure 2). characteristics of available first - line antituberculosis drug resistance data, 19942010. countries that reported at least one case of since the beginning of the global project on anti - tuberculosis drug resistance surveillance, 2 main mechanisms to measure drug resistance have been used : the organization of special surveys (surveys are defined as discrete studies measuring drug resistance among a specially - designed sample of tuberculosis cases representative of an entire population of tb cases) on selected samples of patients, and the establishment of a surveillance system based on routine drug susceptibility testing of all patients. over the past 15 years although surveys face several limitations as described below, in the absence of a feasible alternative that could provide an equivalent amount of information, they are still used in resource - constrained settings with limited laboratory capacity to routinely monitor drug resistance. first, they may be limited in their representativeness and may possibly underestimate the true magnitude of primary and acquired resistance, particularly in settings where concurrent tuberculosis and human immunodeficiency virus (hiv) infection is frequent or where patients with tuberculosis are commonly treated by private health providers. second, surveys are logistically complex and demanding, taking considerable amounts of human and financial resources of the national tuberculosis control program and reference laboratory during the planning, implementation, and analysis phases of a study. third, surveys often are not able to monitor epidemiological trends, because frequencies of drug resistance among patient populations usually do not change rapidly, and only small differences would be expected between surveys conducted a few years apart. the smaller the difference in frequencies, the larger the sample size would be needed to detect a statistically significant difference ; in most circumstances, this means that excessively large sample sizes would be needed. fourth, surveys are not designed to detect localized outbreaks, which could go completely unrecognized even during the course of a study if the outbreak site was not among those selected for patient enrollment. a different surveillance approach is needed to capture the heterogeneity of drug resistance at the local level and avoid over- or underestimating the magnitude of drug resistance by random inclusion or exclusion of outbreaks. finally, the precision of survey results is usually suboptimal in countries with relatively low frequencies of mdr - tb. sample sizes for surveys are calculated to achieve a targeted precision for a predefined estimated proportion of mdr - tb ; the value of such a precision is generally recommended to be no more than 20% of the estimated proportion. in settings with low frequencies of mdr - tb, a high precision can not be reached without capturing a sample that would be so large as to make the survey unfeasible. sentinel surveillance systems represent a useful interim approach for countries that intend to establish countrywide routine drug susceptibility testing but that lack necessary health care resources. under sentinel surveillance, specific laboratory or hospital sites ideally, sites are selected that provide geographical variability and minimize bias. as laboratory capacity is enhanced, more diagnostic sites can progressively join the sentinel system until routine surveillance in all sites is achieved countrywide. the only option to reduce bias and to accurately measure the magnitude of drug resistance and monitor its trends is through the establishment of routine surveillance, which implies systematic ongoing collection, collation, and analysis of data for public health purposes, as reiterated by the world health assembly [20, 21 ]. first, they may be limited in their representativeness and may possibly underestimate the true magnitude of primary and acquired resistance, particularly in settings where concurrent tuberculosis and human immunodeficiency virus (hiv) infection is frequent or where patients with tuberculosis are commonly treated by private health providers. second, surveys are logistically complex and demanding, taking considerable amounts of human and financial resources of the national tuberculosis control program and reference laboratory during the planning, implementation, and analysis phases of a study. third, surveys often are not able to monitor epidemiological trends, because frequencies of drug resistance among patient populations usually do not change rapidly, and only small differences would be expected between surveys conducted a few years apart. the smaller the difference in frequencies, the larger the sample size would be needed to detect a statistically significant difference ; in most circumstances, this means that excessively large sample sizes would be needed. fourth, surveys are not designed to detect localized outbreaks, which could go completely unrecognized even during the course of a study if the outbreak site was not among those selected for patient enrollment. a different surveillance approach is needed to capture the heterogeneity of drug resistance at the local level and avoid over- or underestimating the magnitude of drug resistance by random inclusion or exclusion of outbreaks. finally, the precision of survey results is usually suboptimal in countries with relatively low frequencies of mdr - tb. sample sizes for surveys are calculated to achieve a targeted precision for a predefined estimated proportion of mdr - tb ; the value of such a precision is generally recommended to be no more than 20% of the estimated proportion. in settings with low frequencies of mdr - tb, a high precision can not be reached without capturing a sample that would be so large as to make the survey unfeasible. sentinel surveillance systems represent a useful interim approach for countries that intend to establish countrywide routine drug susceptibility testing but that lack necessary health care resources. under sentinel surveillance, specific laboratory or hospital sites ideally, sites are selected that provide geographical variability and minimize bias. as laboratory capacity is enhanced, more diagnostic sites can progressively join the sentinel system until routine surveillance in all sites is achieved countrywide. the only option to reduce bias and to accurately measure the magnitude of drug resistance and monitor its trends is through the establishment of routine surveillance, which implies systematic ongoing collection, collation, and analysis of data for public health purposes, as reiterated by the world health assembly [20, 21 ]. in the past 15 years, surveys and surveillance have been largely relying on culture and drug susceptibility testing methods based on solid media, which are associated with a very long turn - around times for results (at least 34 months) and enormous workload for laboratory personnel. we are now in a new era for tuberculosis and mdr - tb diagnosis resulting from the advent of technological advances that make it possible to detect tuberculosis and rifampicin resistance much more rapidly. for example, line probe assays cut down the time of diagnosis of rifampicin resistance, which acts as a proxy for mdr - tb in most settings, to 2 days. this technology can be directly applied on smear - positive sputum samples stored in ethanol, for which it performs similarly to phenotypic drug susceptibility testing to correctly identify resistance to rifampicin. it requires less laboratory infrastructure and workload and allows for safer transportation of specimens and simplified survey logistics [23, 24 ]. the time needed for diagnosis of tuberculosis and rifampicin resistance has been cut down even further to 2 h by a more recent diagnostic tool, xpert mtb / rif. this technology is almost completely automated and very simple to use, and it requires little training and minimal biosafety measures. it has not yet been tested on specimens preserved in alcohol, which would further simplify specimens ' transportation and logistics, but very importantly this technique has high sensitivity with smear - negative specimens. with this tool, it will be feasible to study frequencies of drug resistance in patients with smear - negative specimens, such as children, hiv - positive patients, and others with paucibacillary forms of tuberculosis. in the past 15 years, patients with smear - negative specimens have been excluded from surveys to avoid excessive workload in the laboratories and complex logistics, given that the culture yield in this group is relatively low, compared with that for smear - positive cases. more experience should be gained to determine the best role of this new technology in the diagnostic algorithm for tuberculosis and mdr - tb as well as in surveillance activities. the who and the global laboratory initiative are committed to support the expansion of new and rapid tuberculosis diagnostic technologies in 27 countries over the next 5 years through expand - tb, an extensive laboratory capacity building initiative. this initiative will greatly enhance the possibility for countries to diagnose mdr - tb and xdr - tb using the most up - to - date technologies. although the aim is to improve diagnosis and clinical care by expanding access to drug susceptibility testing, a large amount of population - level drug resistance data will also be generated that, if properly collected and analyzed, could be used by national tb control programs for surveillance purposes. access to routine molecular drug susceptibility tests will be initially prioritized among patients at higher risk of carrying drug - resistant strains, such as persons with history of tuberculosis treatment. for this reason, special surveys or sentinel surveillance will still have a role for several years to measure the magnitude of drug resistance in patients not at high risk of drug resistance, including those who have never previously been treated for tuberculosis. the use of different surveillance approaches, such as lot quality assurance sampling techniques that are already used to investigate drug resistance in hiv, or the development of high - throughput single nnucleotide ppolymorphism based surveillance technologies could represent alternatives to special surveys or sentinel surveillance to improve our understanding of drug resistance, particularly for persons who have never previously been treated for tuberculosis, until routine surveillance becomes available everywhere. in addition to greater availability of diagnostic tests, we are in an era of enhanced commitment toward universal access to treatment for all patients with tuberculosis, including those who have been previously treated. these patients historically have received less attention by country programs and the international community, given that they usually have more serious forms of disease that often are more difficult and expensive to diagnose and cure. previously treated patients constitute a very heterogeneous group composed of patients who experience relapse after receiving successful treatment, those who return after default, and those who start receiving a re - treatment regimen after having experienced previous treatment failure, as well as other patients (ie, those who do not fit into one of the aforementioned categories), such as those who received unknown or nonstandardized treatment regimens. frequencies of mdr - tb vary substantially between the different categories of previously treated persons ; overall, the frequency is > 60% in some former soviet union settings. it is evident that no single standardized re - treatment regimen would be effective for all previously treated persons with tuberculosis, and understanding the magnitude and patterns of resistance in each of the categories mentioned above is crucial to guide the choice of treatment [28, 31 ]. routine surveillance of drug resistance allows for proper treatment of all patients with tuberculosis and is critical for accurate planning, budgeting, and monitoring of tuberculosis and mdr - tb control activities. this is relevant for all countries, including those with particularly limited resources and where the management of mdr - tb has to compete with other pressing health needs in a context of increasing financial constraints. even if the majority of patients with tuberculosis globally do not have drug - resistant infection, the epidemiological situation may change dramatically in a few years time if drug - resistant cases are not adequately managed. the prospects of a successful outcome of treatment for patients with mdr - tb are much lower than for those with drug - susceptible disease, with only 60% of treatment success reached globally, compared with 86% in the group of new smear - positive patients [5, 33 ]. these facts make the surveillance of drug resistance today and in the coming years even more pertinent than it was when the global project on anti - tuberculosis drug resistance surveillance was launched. whether performing routine surveillance, sentinel surveillance, or special surveys to monitor antituberculosis drug resistance, 3 major challenges are encountered : the need to incorporate hiv testing, the need to expand surveillance efforts to all health care providers, and the need to assure appropriate care to all those found with drug - resistant disease. outbreaks of drug - resistant tuberculosis among people living with hiv infection have been widely documented in nosocomial and other congregate settings. if not rapidly diagnosed and treated, mdr - tb and xdr - tb can indeed lead to very high case - fatality rates among persons with concurrent hiv infection. unfortunately little information is available on the association of hiv infection and drug - resistant tuberculosis at the population level [35, 36 ]. in recent years, national tuberculosis control programs have experienced great difficulties in incorporating hiv testing in drug - resistant tuberculosis surveillance activities, because this requires strong collaboration and coordination between tuberculosis and hiv control programs. knowing the relationship between hiv and mdr - tb epidemics at population level can help in the identification of high - risk groups and in the planning of effective public health control measures. inclusion of hiv testing should therefore be encouraged during antituberculosis drug resistance surveillance activities. in many regions of the world, patients with tuberculosis symptoms seek care from private health care providers before approaching the services of the national tuberculosis control program. in these areas, private providers are often perceived to deliver better services and treatment options. in reality, this may not be the case, because it is known that the majority of patients seeking re - treatment in the public sector had been unsuccessfully treated in the first instance by private providers. drug - resistance surveys are usually conducted only in the public sector for logistic and organizational reasons. therefore, in countries with a large private health care sector, these studies may not be able to accurately capture the real magnitude of the problem. in such settings, it has been suggested that drug - resistance surveys in the public sector should be complemented by small surveys in the private sector to determine the existence and direction of any bias introduced by excluding private providers from surveys. additionally, public - private mix initiatives can serve as platforms to gradually involve private laboratories and practitioners in surveillance activities. in the early years of drug - resistance surveillance, second - line drugs for the treatment of mdr - tb surveys were conducted to estimate the magnitude of the problem and helped to advocate for more resources to diagnose and treat patients with drug - resistant tuberculosis. the disparity between the number of patients with mdr - tb receiving second - line treatment and those awaiting diagnosis and/or treatment is still enormous, with only 12% of those in need estimated to have received treatment in 2009. globally the number of centers capable of providing care to patients with mdr - tb according to international standards has increased, and presently, most countries have at least 1 referral center for treatment with second - line drugs. in this changing environment, implementation of surveys and the scale - up of surveillance systems for drug resistance should proceed in parallel with the scale - up of mdr - tb treatment services. this will ensure appropriate treatment with second - line antituberculosis drugs for all persons in whom drug - resistance tuberculosis is detected [6, 40 ]. surveillance efforts have been monitoring national and regional trends in drug - resistant tuberculosis since the mid-1990s. as a result of the recent commitment towards provision of universal access to care and the availability of new diagnostic tools, we are now in a new era for anti - tuberculosis drug resistance surveillance. for the first time in the history of tuberculosis control, technologies to rapidly detect tuberculosis and rifampicin resistance have become a reality, allowing for surveillance activities with less demanding laboratory infrastructure and capacity. although neither rapid diagnosis nor treatment for mdr - tb is currently widely available, there is an unprecedented level of political commitment and resource mobilization to accelerate access in the coming few years, changing the way in which drug resistance is monitored. routine surveillance linked to patient care will gradually replace special surveys that, until now, have been the main approach to monitor drug resistance in resource - limited countries. because resource - limited programs are making efforts to establish routine drug susceptibility testing of all patients with histories of previous treatment, a new opportunity has been made available to obtain surveillance data for use in strengthening tb control program planning and performance. | availability of new diagnostic tools and global commitment towards universal access to tuberculosis care will accelerate capacity of resource - limited countries to monitor anti - tuberculosis drug resistance. special surveys will be replaced by routine surveillance of drug resistance linked to patient care. |
a retrospective review of the medical records and radiographic imaging was performed. permission to review and present this information in 2004, a 65-year - old man sustained a fall from standing height in which he suffered a t10 compression fracture with significant local kyphosis (figs. 1 and 2). computed tomography (ct) the patient underwent a partial posterolateral vertebral column resection and t911 laminectomy with instrumented fusion from t6 to l3 (fig. the patient did well postoperatively and was followed as an outpatient until a solid arthrodesis was obtained. sagittal reformat of a computed tomography myelogram showing t10 fracture with spinal canal stenosis. five years after this surgery, the patient presented to the emergency department complaining of severe back pain following another fall. 4). despite the presence of a fracture in the middle of the prior t6l3 construct close examination of the ct scan showed no lucencies around the pedicle screws suggesting loosening of the screws, nor was there any evidence of screw breakage. the overall kyphosis from t6l3 was found to be 68 degrees on postoperative imaging from his index procedure in 2004 (fig. this change in local kyphosis was interpreted that the mode of failure was a three - column bony injury with bending of the rods themselves or loosening of hardware not appreciated on imaging. a decrease in overall kyphosis can occur with bending of the rods resulting in extension of the entire spinal segment. in this sense, the pedicle screw instrumentation remained intact and solidly in place, but bending of the rods allowed for enough motion through the fusion mass and construct that a refracture of t10 occurred. sagittal reformat of computed tomography scan in 2009 after fall resulted in refracture through fusion mass and extension - bending of the rods. sagittal plane bending of the rods in an extension direction will result in a decrease in overall kyphosis angle. postoperative lateral plain film from index surgery prior to reinjury showing overall kyphosis of 68 degrees. this interpretation of the preoperative imaging studies was confirmed intraoperatively. after exposing and removing the rods and cross - connectors, this posterior instrumentation was replaced with larger screws and a quarter - inch rod. a postoperative ct scan after this posterior revision surgery showed a persistent distraction of the anterior and middle columns. due to concerns for compromised axial load - bearing ability and subsequent possible further instability, this patient underwent an anterior partial corpectomy of t8 and t9 with placement of an iliac crest allograft (fig. postoperative computed tomography scan after revision posterior fusion and anterior corpectomy with placement of iliac crest allograft. all incisions are healed, the instrumentation is intact, and the patient has gone on to develop a solid arthrodesis. he is clinically doing well and was allowed to return to work and activity as tolerated. ankylosing spondylitis is a seronegative inflammatory disease that affects the axial skeleton.1 it can lead to fusion of the facet joints, as well as the intervertebral disc, into a fixed, hyperkyphotic posture. in addition to this sagittal plane imbalance, patients with ankylosing spondylitis often have generalized osteopenia, making them prone to spinal fractures after even minor trauma.2 these spinal fractures are often missed on plain radiographs due to distortion of normal anatomy and occasional difficulty with patient positioning. for this reason, ct scans are often recommended to exclude a fracture in any patient with ankylosing spondylitis.3 spinal fracture in ankylosing spondylitis usually occur at the cervicothoracic junction,4 but can also affect the thoracic and lumbar spine.5 these fractures have a higher risk of neurological compromise due to the higher incidence of epidural hematoma as well as the possibility of translation at the newly mobile fracture site.1 6 operative fixation of spinal fracture in the ankylosing spondylitis patient often involves multiple points of fixation, usually at least three levels above and below the fracture site. the rate of pseudarthrosis is low as these patients have a predilection to spinal arthrodesis. fractures through a fusion mass have been reported in noninstrumented and instrumented fusions for idiopathic scoliosis.7 8 fractures of bones with prior instrumentation are most likely due to a nonunion of a fracture or pseudarthrosis of the attempted fusion. however, our patient represents a different mode of failure. our patient did not develop a pseudarthrosis that led to hardware failure and failure of the entire surgical construct. he did not develop a nonunion of his thoracic fracture that led to hardware failure. on all preoperative imaging studies, the hardware appeared to be intact, unbroken, and solidly seated in bone. intraoperatively, all pedicle screws were solidly seated into bone, and the fusion mass appeared to be intact. on further review of the ct scans from this recent injury as well as the imaging from after his prior surgery, we noted that there was a difference in overall kyphosis. with all the pedicle screw instrumentation solidly in place, the most likely explanation for the mode of failure is that this patient sustained an extension - distraction injury in the middle of his prior construct that resulted in a three - column bony injury with bending of the rods. revision surgery involved replacement of pedicle screws and use of a quarter - inch rod for increased stiffness of the construct.9 although fractures caudal to an arthrodesis in an ankylosing spondylitis patient have been described,1012 fractures within an instrumented arthrodesis have not. patients with ankylosing spondylitis develop generalized osteopenia and a fixed sagittal plane imbalance that predisposes them to spinal fractures. operative fixation should involve treating the spine like a long bone in which multiple points of fixation are obtained. despite a solid arthrodesis and well - placed instrumentation, patients with ankylosing spondylitis can still sustain a spinal fracture after minor trauma. in this case report, we present a patient who sustained an extension - distraction fracture in the middle of a solid instrumented arthrodesis. careful vigilance must be maintained in ruling out spinal fractures in all patients with ankylosing spondylitis, even those with a preexisting instrumented fusion. | the objective of this article is to report a case of a patient with ankylosing spondylitis who sustained a fracture through a prior solid arthrodesis without loosening or changing posterior instrumentation. there have been few cases reported of a patient with ankylosing spondylitis suffering a fracture through a prior instrumented arthrodesis. none have noted the instrumentation remaining intact with the fracture through the middle of the construct. the surgeon must be aware of this possibility to avoid spinal instability that may lead to a neurological deficit. we retrospectively reviewed the case. a review of the literature was performed through a pubmed search. a patient was found to have a fracture within a prior construct despite the presence of a posterior instrumentation. the mechanism of failure was a three - column spine fracture with bending of the rods. this patient was treated with a revision posterior / anterior instrumentation and fusion with placement of larger - diameter rods for added stiffness. fractures through a prior instrumented arthrodesis are rare but still can occur in the ankylosing spondylitis patient. given the higher risk of epidural hematoma and neurological compromise in this patient population, the surgeon must keep this on the differential diagnosis when treating patients with a prior instrumented arthrodesis. |
iodine deficiency (i d) is the principal factor responsible for abnormal physical and mental development among children. all age groups are affected by i d, but growing children and pregnant mothers (pms) are the most vulnerable as they are sensitive to even marginal i d. during pregnancy, the requirement of iodine increases to 250 g / day when compared to normal adult (150 g / day) to meet the higher metabolic demands of thyroxin (t4) production, transfer iodine to fetus and increased renal iodine clearance by the mother. inadequate consumption of iodine by the pm, leads to insufficient production of thyroxin by the fetus resulting in retarded fetal growth. i d increases the risk of still birth, abortions, increased perinatal deaths, infant mortality, and congenital anomalies. children born to iodine deficient pms often results in stunted growth, cretinism and have lower intelligent quotient scores. world - wide, iodine deficiency disorders (idd) is public health problem that needs utmost attention. a recent study conducted in united kingdom revealed that 67% of the pms had low iodine intake. it is estimated that in india, more than 200 million people are at the risk of i d, while 71 million suffer from goiter and other idd. the irrigated plains and the hilly regions of the sub - himalayas is a known idd endemic belt. an earlier study conducted among adolescent pms in uttaranchal (2003) reported total goiter rate (tgr) of 15% and median urinary iodine concentration (uic) level of 95 various studies conducted among pms from different regions of india reported the prevalence of idd as 22.9% (delhi), and 9.5% (himachal pradesh), respectively. there are studies available on status of i d amongst school age children ; however there is a lack of data on the prevalence of i d among pms in uttarakhand state. thus, the present study was conducted to assess the iodine nutrition status among pms in three districts (pauri [p ], nainital [n ], and udham singh nagar [usn ]) of uttarakhand. the study was conducted in the year 2012 in state of uttarakhand, which has 13 districts distributed in three geographical regions namely : garhwal, kumaon, and tarai (plain), one district was selected randomly from each region, i.e., p, n and usn, respectively. in each district, 30 clusters were identified by utilizing population proportionate to size sampling methodology recommended by who / unicef / iccidd. the antenatal clinics organized in 30 clusters were identified. in the identified antenatal clinics, the pms consuming drugs, which could influence their thyroid status, were excluded from the study. the clinical examination of thyroid of each pm was conducted by two trained field investigators. the grading of goiter was done according to the criteria recommended jointly by who / unicef / iccidd (i) grade 0 - not palpable and not visible (ii) grade i - palpable but not visible (iii) grade ii - palpable and visible. the intra and inter observer variation was controlled by repeated training and random examination of goiter grades by first author. the intra and inter observer variation was minimized by repeated training of two field investigators and by random examinations of goiter grades by first author. the intra observer variation was 10% and inter observer variation was 30% at the beginning of study. this was minimized to less than 5% by repeated training before the data collection was started. in each cluster, 13 casual urine samples were collected from the list of pms enrolled for clinical thyroid examination. the iqc sample was analyzed 30 times and mean and standard deviation (sd) of this pooled was calculated. the iqc samples of known concentration of iodine content were run with every batch of study urine samples. if the results of the iqc samples were within the range (i.e., mean 2 sd) then the urine sample results of study subjects was deemed valid. however, if the results were outside the range of iqc sample, then the whole batch of the study subjects was repeated. similarly, a minimum of 11 pms were selected from each cluster and were provided with an auto seal polythene pouches with an identification slip. they were requested to bring four teaspoons of salt (about 20 g) from their family kitchen and the iodine content of the salt samples was analyzed by standard iodometric titration method. since iodine crystals are smaller than salt crystals and hence they get settled at the bottom of the pack. the project was approved by ethical committee of all india institute of medical sciences, new delhi. keeping in view the anticipated prevalence of 5%, a confidence level of 95%, absolute precision of 3% and a design effect of 2, a sample size of 450 was calculated. however, we included 481 (p), 614 (n) and 632 (usn) pms from each district. keeping in view the anticipated prevalence of 5%, a confidence level of 95%, absolute precision of 3% and a design effect of 2, a sample size of 450 was calculated. however, we included 481 (p), 614 (n) and 632 (usn) pms from each district. a total of 1727 pms were selected from p (481), n (614) and usn (632). the prevalence of goiter grade i was found to be 24.5% (p), the prevalence of goiter grade ii was found to be 0.4% (p), 0.5% (n) and 0.9% (usn). the tgr was found to be 24.9 (p), 20.0 (n) and 16.1 (usn)% [table 1 ]. distribution of pregnant mother in three districts (pauri, nainital, udham singh nagar) of uttarakhand a total of 1404 urine samples were collected from p (404), n (468) and usn (532). the median uic levels were found to be 110 g / l (p), 117.5 g / l (n) and 124 g / l (usn), respectively. the percentage of pms having uic level of < 50 g / l were 24.0 (p), 0.9 (n) and 11.7 (usn) [table 1 ]. a total of 1494 salt samples were collected from district pauri (349), n (548) and usn (597). it was found that 57.9 (p), 67.0 (n) and 50.3 (usn)% of salt samples had iodine content of 15 ppm and more which is a stipulated level of iodine by government of india [table 1 ]. a total of 1727 pms were selected from p (481), n (614) and usn (632). the prevalence of goiter grade i was found to be 24.5% (p), the prevalence of goiter grade ii was found to be 0.4% (p), 0.5% (n) and 0.9% (usn). the tgr was found to be 24.9 (p), 20.0 (n) and 16.1 (usn)% [table 1 ]. distribution of pregnant mother in three districts (pauri, nainital, udham singh nagar) of uttarakhand a total of 1404 urine samples were collected from p (404), n (468) and usn (532). the median uic levels were found to be 110 g / l (p), 117.5 g / l (n) and 124 g / l (usn), respectively. the percentage of pms having uic level of < 50 g / l were 24.0 (p), 0.9 (n) and 11.7 (usn) [table 1 ]. a total of 1494 salt samples were collected from district pauri (349), n (548) and usn (597). it was found that 57.9 (p), 67.0 (n) and 50.3 (usn)% of salt samples had iodine content of 15 ppm and more which is a stipulated level of iodine by government of india [table 1 ]. pregnant women are a prime target group for idd control activities because they are especially sensitive to marginal i d. the thyroid hormones are crucial for brain and neurological development. the severe form of i d leads to cretinism and mental retardation. a recent study among pms in united kingdom has documented that child of iodine deficient pms are more likely to have low verbal intelligent quotient, poor reading accuracy, and comprehension. in the present study, the prevalence of goiter was found to be 24.9% (p), 20.0% (n) and 16.1% (usn) indicating i d as a moderate public health problem among pm in uttarakhand. earlier studies conducted amongst pms in uttaranchal (2003) and rajasthan (2008) revealed a goiter prevalence of 15.0% and 3.1%, respectively. uic is currently the most practical biochemical marker for iodine nutrition when carried out with appropriate technology and sampling. assessing urinary iodine in pms provides an opportunity to establish the iodine status of a group that is crucial because of the susceptibility of the developing fetus to i d. during pregnancy, median uics of between 150 g / l and 250 g / l define a population, which has no i d. in the present study, the uic levels of less than 150 g / l were observed in all the three districts. the median uic levels among pms were found to be 110 g / l (p), 117.5 g / l (n) and 124 g / l (usn), respectively indicating the presence of insufficient iodine intake by the pms in all the three districts. an earlier study conducted among pms in district usn reported the median uic level of 95.0 the findings of the present study were substantiated by low percentage of consumption of salt with adequate iodine content. 50.3% (usn) of families were consuming salt with iodine content of more than 15 ppm. an earlier study conducted in rajasthan (2008) revealed that only 22.7% of pms consumed salt with iodine content of 15 ppm and more. we are unable to compare findings of our study on iodine status amongst pms with other similar studies due to lack of published data. findings of our study indicates that the pms in all the three districts of uttarakhand are iodine deficient as indicated by low median uic levels and lower consumption of adequately iodized salt. thus, there is a need for revitalizing the national idd control program to ensure supply of salt with adequate iodine content of 15 ppm and more to achieve elimination of idd in uttarakhand state. since, most vulnerable group for i d for health consequences is the fetus and hence the assessment of i d status of the pms should be included in the monitoring of idd control program. the intra and inter observer variation in goiter examination was controlled by repeated training and random examination of goiter grade by expert. however in spite of all the precautions for the quality control, a possibility existed for misclassification of normal thyroid gland to goiter grade i. the intra and inter observer variation in goiter examination was controlled by repeated training and random examination of goiter grade by expert. however in spite of all the precautions for the quality control, a possibility existed for misclassification of normal thyroid gland to goiter grade i. | background : uttarakhand state is a known endemic area for iodine deficiency.objective:the present study was conducted with an objective to assess the iodine nutritional status amongst pregnant mothers (pms) in districts : pauri (p), nainital (n) and udham singh nagar (usn) of uttarakhand state.materials and methods : thirty clusters from each district were selected by utilizing the population proportionate to size cluster sampling methodology. a total of 1727 pms from p (481), n (614) and usn (632) were included. the clinical examination of the thyroid of each pm was conducted. urine and salt samples were collected from a sub samples of pms enlisted for thyroid clinical examination.results:the total goiter rate was found to be 24.9 (p), 20.2 (n) and 16.1 (usn)%. the median urinary iodine concentration (uic) levels were found to be 110 g / l (p), 117.5 g / l (n) and 124 g / l (usn). the percentage of pms consuming salt with iodine content of 15 ppm and more was found to be 57.9 (p), 67.0 (n) and 50.3 (usn).conclusion : the findings of the present study revealed that the pms in all three districts had low iodine nutritional status as revealed by uic levels of less than 150 g / l. |
vitamin k epoxide reductase (vkor) enzyme converts vitamin k (vk) 2, 3-epoxide to vk hydroquinone, a required cofactor for the post - translational gamma - carboxylation of several blood coagulation factors (factors ii, vii, ix, x, protein c and s) and other vk - dependent proteins, such as osteocalcin bone gla protein and matrix gla protein. the gamma- glutamyl carboxylase enzyme requires reduced vk as a cofactor in the clotting pathway. oral anticoagulants (oas) (warfarin, acenocoumarol and phenprocoumon) inhibit the regeneration of reduced vk by targeting the enzyme vkor and there by blocks the clotting mechanism. the inter - individual variability in oa dose is influenced by the genes of two enzymes, cytochrome p450 (cyp) 2c9, the enzyme that metabolizes the oas and vitamin k epoxide reductase complex (vkorc1), the pharmacological target enzyme of those drugs. the genetic variation in the cyp2c9 gene (in particular, the common cyp2c9 2 and cyp2c9 3 alleles) was a result in decreased enzyme activity and affects the pharmacokinetics of oa and its dose requirement. polymorphisms in the vkorc1 gene encoding the vkor enzyme leads to inter individual variability in susceptibility to develop bleeding and other adverse reactions to oral anti - coagulants. the impact of vkorc1 genetic variation on warfarin dose requirement confirmed that the genetic polymorphisms of vkorc1 are significant determinants of inter- individual dose requirement. it has been found that genetic variations in the cyp2c9 and vkorc1 genes together account for 35 - 50% variability in the dose requirement for initiation and maintenance of oas. there is an evidence that specific haplotypes can help to determine the dose of oas. single nucleotide polymorphisms (snps) found in haplotype a (3730 g > a, 2255c > t, 1542 g > c, 1173 c > t and 1639 g > a) versus wild type alleles in haplotype b can be used to determine whether the person require low, intermediate or high dose of oas. cyp4f2 genetic polymorphism (rs2108622) was found to be associated with reduced hepatic cyp4f2 enzyme activity and higher levels of vk. cyp4f2 functions as a vk mono - oxidase, probably generating the -hydroxy derivative of the substrate. carriers of the cyp4f2 433 m allele have a reduced capacity to metabolize vk, secondary to a cyp4f2 dependent decrease in the steady state hepatic concentrations of the enzyme. therefore, patients with the cyp4f2 3 polymorphism are likely to have an elevated hepatic level of vk and thus are likely to require a higher warfarin dose to prompt the expected anticoagulant response. south indians constitute about 21.7% of the total population of india and residing at four states (tamil nadu, andhra pradesh, kerala and karnataka) (http://www.census india.govt.in/2011census, accessed on august, 2011). this population shares a common ancestry (dravidians), but the present day population distinguishes themselves from one another in terms of language, culture and dietary habits with limited admixture. found that the ancestral south indians were distinct from the ancestral north indians and east indians. in our previous studies, we have found that the polymorphic profile of the genes encoding some of the phase i and phase ii drug metabolizing enzymes (cyp2e1, cyp2a6, cyp3a5, cyp2c9, cyp2c19, cyp2d6, thiopurine methyl transferase and uridine diphosphate - glucoronyl transferases) as well as drug transporters (multidrug resistance 1 and organic cation transporters 1) were significantly different between south indians and other population groups. these findings raise the possibility that the frequency of variants of other genes including the oa dose determining vkorc1 and cyp4f2 genes may be different in our population. this is the first study to establish the haplotype structure of the vkorc1 and genotype / allele frequencies of the cyp4f2 in india, in particular for south indians. in this study, we have also compared our data with those of other population groups included in the hapmap project (http://hapmap.ncbi.nlm.nih.gov/). the present study included 470 unrelated healthy volunteers from south indian states (tamil nadu, andhra pradesh, kerala and karnataka) of both genders, aged between 18 and 60 years with a family history of three generations in south india and speaking any one of the south indian languages. blood samples were collected from tamilians (n = 110), andhrites (n = 120), kannadigas (n = 120) and keralites (n = 120). the institute ethics committee approved the study and was conducted according to declaration of helsinki. written informed consent a volume of 5 ml of venous blood was collected using sodium ethylene diamine tetra acetic acid as anticoagulant. deoxyribonucleic acid (dna) was extracted by using a standard phenol : chloroform protocol. genotyping of vkorc1 and cyp4f2 was carried out by real - time thermo cycler (7300 applied biosystems ; life technologies corporation, carlsbad, ca, usa) using taqman snp genotyping assays (assay i d for vkorc1 c__7473918_10, rs7294, c__26291751_10, rs2359612, c__2847860_10, rs8050894, c__30204875_10, rs9934438, c__30996661_30, rs9923231 and assay i d for cyp4f2 c_16179493_40, rs2108622). the polymerase chain reaction (pcr) was carried out in duplicate in a 20-l final volume that contained 10 l of taqman universal pcr master mix (2x), 0.5 l of 20x working stock of snp genotyping assay and 4.5 l of genomic dna diluted in dnaase free water and 5 l of milli - q water (millipore corporate headquarters, billerica, ma, usa). the thermocycler conditions included one cycle at 50c for 2 min ; one cycle at 95c for 10 min to activate the amplitaq gold polymerase followed by 40 cycles of denaturation at 92c for 15 s and annealing / extension at 60c for 1 min. the allelic discrimination was performed using 7300 sds software version 1.4 (applied biosystems ; life technologies corporation, carlsbad, ca, usa). statistical analysis was performed using the graphpad instat 3 software (graphpad software inc., san diego, ca, usa). weinberg equilibrium was tested by chi - square test to compare the observed genotype frequencies of south indian population with the expected genotype frequencies calculated from the observed allele frequencies. pairwise linkage disequilibrium (ld) pattern and haplotype frequencies were estimated using haploview 4.1 (daly lab, broad institute, cambridge, ma02141, usa). all snps with minor allele frequencies of 0.01% were excluded and minimum haplotype frequency was set as 1%. haplotype blocks were defined by using four gametes rule incorporated by analysis in haploview software. whereas, d value 0.8) and white color represents moderate to low ld (d 0.5). the blue color in indian (gih) indicates missing genotype data) in south indian population, a strong ld pattern (d > 0.8) was observed between all the snps except the ld pattern between rs8050894 and rs9934438 only moderate ld (yri), a very strong ld pattern (d = 1) was observed between rs7294 and rs2359612, rs2359612 and rs9934438, rs2359612 and rs9923231, rs7294 and rs9923231 rs9934438 and rs9923231, rs7294 and rs9934438. only low ld (d 0.8) was observed between other snps. in the four south indian populations, the ld pattern was observed. in tamilians only moderate ld pattern (d 0.5) was observed between rs7294 and rs9934438, rs8050894 and rs9934438, rs9934438 and rs9923231. in andhrites, a moderate ld pattern (d a (rs7294), located in the 3 untranslated region of the gene, is associated with increased warfarin dose requirements (warfarin resistance). in our study conducted the haplotype analysis and established a significant contribution of vkorc1 to inter individual variability in warfarin dose. the ten most common snps (at positions 381, 861, 2653, 3673, 5808, 6009, 6484, 6853, 7566 and 9041 of the vkorc1 reference sequence [genbank accession number ay587020 ]) were used to construct the five major haplotypes and the association of these haplotypes were observed in caucasian patients. a low dose haplotype group haplotype a is more frequent in asians (89%) ; whereas in caucasians, haplotype b is more frequent (58%). the previous pharmacogenetics studies have provided the indications that the south indian population may have distinct polymorphic distribution features regarding the vkorc1 locus. in our study, we did not observe a significant difference in the genotyping frequencies of tamilians, kannadigas, andhrites and keralites. only the genotype frequencies of rs7294 and rs2359612 in kannadigas were significantly different from the tamilians population. the pooled results of south indians genotypes were compared with that of the hapmap population. we have observed a highly significant difference between the different ethnic population groups and south indians. only the japanese population did not significantly differ for the snps rs7294, rs2359612 and rs9934438. the haplotype frequencies of the vkorc1 locus in south indians were compared with those of the hapmap population (http://hapmap.ncbi.nlm.nih.gov/) by establishing the haplotype structure for africans, caucasians, han chinese, japanese and indian groups. the haplotype frequencies in south indians were significantly different from africans, han chineses and japaneses, but not from the gih. the major haplotype observed in our population is acgcg (75.6%), but this haplotype was observed at different levels in africans (43.7%), caucasians (38.3%), han chineses (11.5%) and japaneses (8.7%), but close to that of gih (80.9%). thus, the present study reveals that the south indians are anticipated to fall under the high dose requirement groups for the oas. a previous study has established the haplotype frequency (rs7196161, rs17880887, rs9923231, rs2884737, rs9934438 and rs17880624) in the malaysian indians and found that the tcgtca (h7) is more frequent in indians as compared with chinese and malays. in addition to the cyp2c9 and vkorc1 polymorphisms, a snp in the cyp4f2 gene has been shown to contribute to warfarin dose requirement, albeit to a lesser extent, through genome wide association studies. another study has shown that patients with a variant allele namely cyp4f2 3, require higher maintenance warfarin dose as compared with those with wild type allele in han chinese patients. in this study, we have established the frequency of cyp4f2 3 allele and compared it with that of the hapmap populations. both the allele and genotype frequencies significantly differed across these population groups with the exception of gujarati indians from houston. the united states food and drug administration updated the label of warfarin twice : in 2007 advising physicians to consider the use of genetic tests to improve their initial estimate of the initial dosage, then in 2010 adding a new table with the range of expected therapeutic warfarin doses based on cyp2c9 and vkorc1 genotypes. based on the evidences many studies have proposed the algorithms for calculating the maintenance dose and initial dose of oas using the multivariate statistical techniques. however, the proposed algorithms appear to be specific for each population group very likely due to differences in distribution of polymorphisms. thus, it is useful to establish the polymorphic profile of the study population / cohort before conducting pharmacogenetic studies on oas. at this end, we have established the genotype, allele and haplotype frequencies of vkorc1 and cyp4f2 genotype and allele frequencies for the south indian population. the frequencies of the vkorc1 and cyp4f2 allele / genotype in the south indian population were distinct from other world population groups. these results will not only contribute to the better understanding of the genetic basis of ethnic variation in oa dose requirement response, but also establishes the frame work for future algorithm based dose determination of oas in indians. | background : genetic variation in the vitamin k epoxide reductase complex (vkorc1) and cytochrome p450 4f2 (cyp4f2) genes were found to be strongly associated with the oral anticoagulant (oa) dose requirement. the distribution of genetic variation in these two genes was found to show large inter- and intra - ethnic difference.materials and methods : a total of 470 unrelated, healthy volunteers of south indians of either sex (age : 18 - 60 years) were enrolled for the study. a 5 ml of venous blood was collected and the genomic deoxyribonucleic acid (dna) was extracted by using phenol - chloroform extraction method. real - time quantitative polymerase chain reaction (rt - pcr) method was used for genotyping.results:the variant allele frequencies of vkorc1 rs2359612 (t), rs8050894 (c), rs9934438 (t) and rs9923231 (a) were found to be 11.0%, 11.8%, 11.7% and 12.0%, respectively. the variant allele vkorc1 rs7294 was (80.1%) more frequent and the variant allele cyp4f2 3 was found to be 41.8% in south indians. the allele, genotype and haplotype frequencies of vkorc1 and cyp4f2 gene were distinct from other compared hapmap populations (p < 0.0001).conclusion : the findings of our study provide the basic genetic information for further pharmacogenetic based investigation of oa therapy in the population. |
motor and cognitive impairments in stroke patients dramatically reduce their independence in activities of daily living (adl). in particular, the physical symptoms of stroke have a greater effect on the patients independence than the cognitive component1. therefore, understanding the relationship between motor function and adl is important to design efficient rehabilitation programs aimed at improving adl performance. this ability to perform adl is influenced by motor functions of the upper and lower limbs2, 3 and the trunk4,5,6. likhi.7 reported that adl performance in stroke patients correlated more closely with the impairment level of the trunk than that of the upper limb, whereas lower limb impairment showed no correlation with adl. however, fong.8 reported that lower limb impairment correlated more closely with adl than upper limb impairment. in contrast, ezure.9 reported that the upper limb, lower limb, and trunk functions were significantly correlated with adl. multiple linear regression analysis revealed that trunk function exhibited a stronger relationship with adl than the affected side function. therefore, the impact of limb and trunk function impairment on adl in stroke patients remains highly controversial. this is consistent with the well - known strong association between motor functions of the affected upper and lower limbs. for instance, a correlation analysis between the affected upper limb function and adl must be conducted in the absence of the effect of the affected lower limb function on adl. to the best of our knowledge, no study has conducted partial correlation analyses between limb or trunk function impairment and adl in stroke patients. therefore, the present study aimed to investigate the independent influence of the affected upper and lower limb, trunk, and unaffected side function on adl using partial correlation analysis. the study cohort included 77 stroke patients (53 males and 24 females) who were admitted to the northern fukushima medical center between october 2010 and november 2013. they fulfilled the following inclusion criteria : first stroke ; unilateral supratentorial hemispheric lesion ; absence of marked cognitive deterioration [5 cognitive items of the functional independence measure (fim)11, described below ] ; and unilateral spatial neglect based on the stroke impairment assessment set12 (sias ; described below). the mean patient age was 68.5 years, and the mean time from stroke onset was 84.8 days. subject characteristics are listed in table 1table 1.stroke-related characteristics of study subjectsmeansdrangeage, years68.512.73693time post - stroke, days84.837.437236males, % 69.2right - sided hemiparesis, % 48.8affected upper limb function (010)6.43.0010affected lower limb function (015)11.73.8115trunk function (06)5.31.006unaffected side function (06)5.30.926barthel index (0100)86.817.75100motor item of fim (1391)73.316.02291fim : functional independence measure. the study protocol was approved by the institutional ethics review board of northern fukushima medical center (fukushima, japan). fim : functional independence measure we compiled data on motor function, trunk function, and unaffected side function from the sias, barthel index (bi)13, and fim evaluations. the sias test (05) items evaluate motor function of the affected limb (knee - mouth, finger function, hip flexion, knee extension, and foot - pat tests), the trunk (abdominal muscle strength and verticality), and the unaffected side (strength of knee extension and grip strength). details on the method, reliability, and validity of sias have been reported elsewhere12, 14,15,16. in addition, the independence index of adl was determined using the bi and motor items of the fim scoring system. in the present study, the affected upper limb function was calculated from the total score of the knee - mouth and finger function tests. lower limb function was calculated from the total score of the hip flexion, knee extension, and foot - pat tests. furthermore, trunk function was calculated from the total score of the abdominal muscle strength and verticality tests, and the unaffected side function was calculated from the total score of grip strength and knee extension strength tests. we used simple correlation and partial correlation analyses to remove the effect of age and other motor function parameters (affected upper limb, lower limb, trunk, and unaffected side function), and estimated the independent effect of the affected upper limb, lower limb, trunk, and unaffected side functions on bi or fim. all correlations were investigated using spearman s rank correlation analysis with spss version 22.0 for windows ; p values < 0.05 were considered statistically significant. it was observed that half of the patients (48.8%) had right - sided hemiparesis, with mild to moderate impairment of the upper and lower limbs. simple and partial correlation analyses were conducted between the parameters of motor function (affected upper limb, lower limb, trunk, and unaffected side function) and adl (bi or fim scores) (table 2table 2.simple and partial correlation analyses between motor functions and indexes of activities of daily living (fim and bi) in stroke patientssimple correlation (n=77)partial correlation (n=77)fimbifimbiaffected upper limb function0.310.340.020.07affected lower limb function0.510.510.480.42trunk function0.370.330.150.13unaffected side function0.380.340.320.27values are spearman s rank coefficients ; p0.01. fim : functional independence measure ; bi : barthel index). moreover, simple correlation analyses revealed significant positive correlations for all comparisons. partial correlation analyses generated remarkably different data when the effect of age and other body part functions on adl were excluded. significant positive correlations were found between the affected lower limb or unaffected side function and bi or fim. in contrast, there was no significant correlation between the affected upper limb or trunk function and bi or fim. this discrepancy is explained by the strong functional interactions between the affected upper limb and lower limb functions and between the trunk and unaffected side functions (table 3table 3.simple correlation analyses between motor functions in stroke patientsaffected u / l functionaffected l / l functiontrunk functionunaffected side functionaffected u / l function0.680.010.08affected l / l function0.680.140.03trunk function0.010.140.39unaffected side function0.080.030.39values are spearman s rank coefficients ; p0.01. fim : functional independence measure ; bi : barthel index ; u / l : upper limb ; l / l : lower limb). fim : functional independence measure ; bi : barthel index values are spearman s rank coefficients ; p0.01. fim : functional independence measure ; bi : barthel index ; u / l : upper limb ; l / the present study provides insightful information on the relationship between motor function and adl in stroke patients. the ongoing debate on motor functions affecting adl was resolved by designing partial correlation analysis protocols considering the possible interactions between body parts. simple correlation analysis suggested that the affected upper limb, lower limb, unaffected limbs, and trunk influence adl performance. in contrast, partial correlation analysis, excluding age and the influence of other body parts, revealed the absence of correlation between the affected upper limb or trunk function and adl in stroke patients. this discrepancy was explained by the strong interactions between the affected upper and lower limb functions and between trunk and unaffected side functions. this new information on motion dynamics in stroke patients should lead to the development of more efficient rehabilitation programs. this study demonstrates that adl performance in stroke subjects is hindered more by the affected lower limb than by the unaffected side. previous studies reported that balance2, gait17, 18, and stair19 performance are affected by lower limb function. thrane.20 reported that the affected lower limb function is associated with self - care dependency. further, the present study also indicates that the affected lower limb function plays an important role in adl. we established a considerable relationship between the unaffected side function and adl, based on the strength of the quadriceps muscle of the lower limb and the grip strength. it has been reported that the strength of quadriceps muscle influences sit - to - stand21 and transfer22 activities in stroke subjects. colebatch.24 indicated that the strength of muscles ipsilateral to the lesion was reduced in hemiplegic patients compared with healthy subjects. therefore, rehabilitation programs aiming to improve adl should target the muscle strength on the unaffected side. the lack of correlation between the affected upper limb function and adl may be explained by the fact that most activities can be performed with the unaffected upper limb. further, previous studies mentioned that the upper limb function is required to reach a certain threshold before performance actually starts to increase25, and improvement in the functional limitations of the upper limb does not necessarily lead to a full recovery of adl function26. therefore, there may be a non - linear relationship between the affected upper limb function and adl. thrane.20 reported no significant relationship between the affected upper limb impairments and adl using lower limb function as covariate, as in our study. thus, the impact of upper limb function impairments on everyday activities may be lower than expected27. the close relationship between trunk function and adl has been reported by previous studies4,5,6,7, 9. however, to the best of our knowledge, this is the first study to identify the independent effect of trunk function on adl using partial correlation analysis. in addition, our results suggest that the impact of trunk function on adl is lower than expected. however, the average score of trunk function in our patients was very high, suggesting that a relationship between trunk function and adl could have been missed due to the ceiling effect. therefore, this result should be carefully interpreted. first, simple and partial correlation analyses can only detect linear relationships between two variables.. the correlations between each motor function and adl may differ depending on the adl independence level. | [purpose ] this study aimed to clarify the independent impact of the affected upper and lower limb, trunk, and unaffected side motor functions on activities of daily living in stroke patients using partial correlation analysis. [subjects and methods ] this retrospective study included 77 stroke patients. motor functions were assessed using the stroke impairment assessment set, and the activities of daily living performance was assessed using the barthel index or functional independence measure. further, simple and partial correlation analyses were conducted between each motor function and activities of daily living parameter. [results ] simple correlation analysis identified significant positive correlations for each pair. in contrast, partial correlation analysis only identified significant positive correlations between the affected lower limb or unaffected side functions and the barthel index or functional independence measure. this discrepancy between the two tests was explained by the significant interaction between the affected upper and lower limb functions and between the trunk and unaffected side functions. [conclusion ] the present study identified the affected lower limb and unaffected side motor functions as the major determinants of activities of daily living performance in stroke patients. these findings suggest that rehabilitation programs can be improved by targeting these areas. |
we report on a 28-year - old woman, who presented two months postpartum after delivering twins with complaints of transient ischemic attack (tia), dyspnea and chest pain. physical examination demonstrated jugular venous distention (jvd) and s3 gallop on cardiac auscultation along with minimal rales and pedal edema. her electrocardiogram (ecg) showed sinus tachycardia with lateral t wave inversion (fig. laboratory work up revealed an elevation in her cardiac biomarkers with a peak troponin - i level of 10.2 ng / ml. the echocardiogram showed moderate left ventricular (lv) dilatation with severely reduced lv systolic function and left ventricular ejection fraction (lvef) < 15% associated with a 2.1 cm apical thrombus (fig. 2). given the chest pain, elevated cardiac biomarkers and ecg changes suggestive of ischemia, a coronary angiography was performed which revealed two filling defects in the distal segment of the second obtuse marginal artery with a hazy appearance consistent with thrombi (fig. aspiration thrombectomy was performed with multiple passes at the site of thrombi and fresh clot was retrieved (fig. post - procedure, the patient did well ; her troponin - i levels down - trended and her symptoms improved. she was started on oral anticoagulation for treatment for left ventricular apical thrombus and she was strongly counseled on avoidance of future pregnancies and tubal ligation. she was discharged on oral anticoagulation, and guideline directed heart failure medical therapy. two sequential thrombi in the distal segment of the obtuse marginal 2 (om2). repeat images demonstrating resolution of the stenosis in the obtuse marginal 2 (om2). peripartum cardiomyopathy (ppcm) is characterized by the development of heart failure during the last month of pregnancy or during the first five months of the post - partum period in the absence of any other identifiable causes of heart failure (1, 2). several risk factors have been identified with ppcm including ethnicity, age, pregnancy - induced hypertension or pre - eclampsia, multiparity, multiple gestations, obesity and chronic use of tocolytics (2). in the case described, multiple gestations, pregnancy with twins, and african descent were identified as significant clinical risk factors. ppcm is known to increase the risk of thrombus formation and arterial emboli (3, 4). the risk of acute myocardial infarction is approximately three times higher in pregnant women compared to non - pregnant women of the same age (5 - 6 - 7 - 8). in our case, the inherent hypercoaguable state that exists in pregnancy along with poor lv systolic function and resulting stasis of blood flow in dilated heart, likely provided an environment for the development of an intraventricular thrombus (3, 4). the findings of two intracoronary thrombi in the setting of otherwise normal coronary arteries, which were free of atherosclerotic disease, suggests embolism from lv mural thrombus as the primary mechanism of her coronary thrombi and myocardial infarction. upon review of available literature there are only two reported cases of embolic myocardial infarction in the setting of ppcm and an associated lv thrombus (9, 10). our case is unique in the aspect that catheter - based aspiration thrombectomy was performed safely for reperfusion therapy and was successful with the resolution of thrombus as documented angiographically (fig., we propose that it be considered as a treatment modality in future similar cases in the absence of contraindications. | acute coronary syndrome (acs) due to embolic phenomenon in the setting of peripartum cardiomyopathy (ppcm) and left ventricular mural thrombus is a rare occurrence. there have been two known cases described in medical literature. we present a unique case in which catheter - based aspiration thrombectomy was used to successfully treat a patient with acs due to coronary emboli in the setting of ppcmand left ventricular mural thrombus. we believe this to be the first report of the use of aspiration thrombectomy in such a clinical case. |
in early march 2003, a 26-year - old man was admitted to a general medical ward of the prince of wales hospital ; he had been ill for 1 week with fever, chills, and rigor. his previous health had been good, and he had no history of recent travel. physical examination showed a temperature of 40.2c and bronchial breath sounds at the right upper zone lung field. chest x - ray confirmed right upper lobe consolidation (figure, part a). chest radiographs performed a, at admission, b, on day 4, and c, on day 16 of hospitalization for index sars case - patient, prince of wales hospital. a complete blood profile on admission showed a leukocyte count 3.1 x 10/l, absolute neutrophil count 2.0 x 10/l, lymphocyte count 0.7 x 10/l, platelet count 112 x 10/l, and hemoglobin 14.7 g / dl. the patient had mild renal impairment, with a creatinine of 119 mol / l, urea and electrolytes within normal limits, and alanine transaminase mildly elevated at 90 iu / l (normal < 58 a diagnosis of atypical or viral pneumonia was suspected because of the low leukocyte count and normal c - reactive protein. other laboratory tests were performed, including blood, sputum, and urine cultures, nasopharyngeal aspirate for influenza and parainfluenza, indirect immunofluorescence for respiratory syncytial viral antigen detection, and atypical pneumonia titer (for adenovirus, psittacosis, q fever, influenza a and b, and mycoplasma). the patient was housed in a general medical ward with no specific isolation facility. after admission his high fever and productive cough, now with thick, yellowish sputum, persisted. he also complained of progressive dyspnea, headache, dizziness, generalized malaise, and myalgia. his pulse and blood pressure were normal, and his oxygen saturation was approximately 98% on room air. a sputum culture yielded normal oral flora, and sputum smears were negative for acid - fast bacilli. nasopharyngeal aspiration was negative for influenza viruses a and b, respiratory syncytial virus, adenovirus, and parainfluenzavirus types 1, 2, and 3, with the use of commercial immunofluorescence assay. a chest radiograph on day 4 showed progression of pneumonia, with consolidation changes over the right upper and lower lobes (figure, part b). a repeat complete blood profile showed a leukocyte count of 5.4 x 10/l with persistent lymphopenia and a platelet count of 98 x 10/l. amoxicillin - clavulanate was therefore changed to intravenous cefotaxime, 1 g every 8 h ; clarithromycin (500 mg twice a day) was continued. as the patient s condition deteriorated progressively and he had difficulty in expectorating sputum, salbutamol, 0.5 g four times a day, driven by a jet nebulizer at 6 l of oxygen per min, was given to assist mucociliary clearance. starting from day 6, the patient s fever and chest condition gradually improved. however, over the next 2 weeks, 138 persons (mostly healthcare workers) who had been in contact with him had onset of a similar illness with high fever and pneumonia. the patient was subsequently confirmed to be the index case - patient in this hospital outbreak of sars (1). further history showed that he had visited a hotel in kowloon, hong kong, where a 64-year - old physician from southern china had stayed for 2 days ; this physician later died of severe atypical pneumonia 10 days after admission to a regional hospital in kowloon (2). the cause of the illness was not known at the time of the physician s death. our patient was identified as the index case - patient 5 days after the onset of this large outbreak at the prince of wales hospital, as he was the first patient who had the characteristic clinical, radiologic, and laboratory features of sars and had epidemiologic links with other infected persons. after 8 days, use of the nebulized bronchodilator was stopped because of the possibility of enhancing sars transmission, and the patient was isolated in a private room with negative - pressure ventilation. after the patient completed a 7-day course of cefotaxime and a 10-day course of clarithromycin, his pneumonia recovered gradually, and serial chest radiographs confirmed resolution of his consolidation (figure, part c). an immunofluorescence test for antibody against sars - cov subsequently confirmed an elevated titer of 1:5,120 in convalescent - phase serum collected on day 21 of illness. convalescent - phase serum was negative for other atypical pneumonia organisms, including adenovirus, psittacosis, q fever, influenza a and b, and mycoplasma. repeat complete blood count showed that lymphocytes and thrombocytes had returned to normal, along with serum creatinine and alanine transaminase levels. the patient was isolated in a private room until day 27 of his hospital stay, when his nasopharyngeal aspirate and urine samples were confirmed to be negative for sars - cov. repeat chest radiograph at follow - up 2 weeks later showed no residual parenchymal opacity, and the patient remained asymptomatic. this report describes the index patient responsible for the hospital outbreak in the prince of wales hospital (2). he was linked to spread of the virus to more than 100 persons (1). this outbreak, together with similar events in canada (3), singapore (4) and other cities where the source of infection was also related to the chinese physician (5), led to increased awareness of this emerging global infection caused by a novel coronavirus (6). the super - spread event in prince of wales hospital caused by this patient was related to failure to apply isolation precautions, as the disease had not been recognized during the early part of his admission. the use of a nebulized bronchodilator may also have enhanced the spread of the virus in the ward, and this practice was stopped for patients with suspected sars after this incident (7). this case report illustrates the natural history of sars in a young, previously healthy patient who received no specific therapy. his clinical features and laboratory parameters were similar to those of other patients with sars (25). his clinical course followed a typical pattern with progression of pneumonia during the 2nd week of his illness (8). he was treated presumptively for bacterial community - acquired pneumonia with conventional antimicrobials (9), without antiviral agents or corticosteroids. he started to improve by the 3rd week and subsequently recovered uneventfully. during the global outbreak in 2003, treatment of sars was empiric. several groups have reported the use of ribavirin (25,7,8) and corticosteroids (2,3,7,8,10,11) with generally favorable outcomes. ribavirin has been associated with substantial adverse reactions, including hemolytic anemia, elevated transaminases, and bradycardia (4), and has demonstrated no in vitro activity against sars - cov (12). further studies, preferably with a randomized, placebo - control design, are needed to address treatment of this disease, which has high attack rates and is frequently fatal. | during the global outbreak of severe acute respiratory syndrome (sars) in 2003, treatment was empiric. we report the case history of the index patient in a hospital outbreak of sars in hong kong. the patient recovered after conventional antimicrobial therapy. further studies are needed to address treatment of sars, which has high attack and death rates. |
mononeuropathy multiplex is a rare complication during the course of chronic hepatitis b, despite various neuropathies following acute hepatitis b having been reported previously. the serological tests for hepatitis were consistent with chronic active hepatitis b. after treatment with oral prednisone combined with an antiviral agent, the sensory and motor symptoms improved and hepatitis b virus replication was reduced. we suggest that chronic immune - mediated neuropathy associated with hepatitis b virus infection should be considered in the differential diagnosis of patients with hepatitis b. among the several types of hepatitis, chronic active hepatitis b can cause peripheral neuropathies by vascular- or immune - mediated pathology.1,2 previously reported neuropathies in patients with hepatitis b virus (hbv) infection include vascular neuropathies such as polyarteritis nodosa (pan) and demyelinating neuropathies such as chronic inflammatory demyelinating polyneuropathy and guillain - barr syndrome.3 however, chronic immune - mediated, nonvasculitic mononeuropathy multiplex (mm) in association with chronic hepatitis b has been reported only rarely. we report a case of hbv - related multiple axonal neuropathy that mimicked vasculitic mm, and was complicated by chronic active hepatitis b. a 30-year - old, male hbv carrier complained of pricking and burning discomfort in the distal potions of the first to third fingers of the left hand, and dysesthesia of the left foot of 2 months duration. despite treatment with medication for the pain at another hospital, the sensory symptoms progressed. by 5 weeks after the onset of the initial symptoms the patient had new complaints of difficulty with extension of the left ankle joint and flexion of all of the fingers on the left hand except for the fifth finger. just prior to admission to the hospital, paresthesia of the right hand and foot developed. on admission to the hospital, the initial nerve conduction study (ncs) findings suggested a multifocal sensorimotor mononeuropathy of the axonal type (table 1 and 2). an extensive workup for the etiology of mm including fasting blood sugar, cerebrospinal fluid examination, and tests for cryoglobulin and immunoglobulins (igm, igg, iga, and ige) with serum protein electrophoresis, antinuclear, antineutrophil cytoplasmic, anti - ss - a / b, anti - centromere, anti - scl70, anti - dsdna, anti - sm, anti - cardiolipin antibodies, rheumatoid factor, proteins c and s, ch50/c3/c4 complement, lupus - anticoagulant, and thyroid function were negative. however, chronic active hepatitis b was diagnosed by hepatitis serology testing as follows : 1) positive hbsag, hbeag, hbv pcr, and anti - hbc, 2) markedly increased titers of hbv dna (124 ng / ml), and 3) negative anti - hbs and anti - hbe. aspartate aminotransferase and alanine aminotransferase levels were elevated (47 and 85 u / ml, respectively), but the erythrocyte sedimentation rate, and blood urea nitrogen, and serum creatinine levels were all within normal limits. we initially thought that our patient had hepatitis - b - related pan because he had three of the associated features (i.e., mm, chronic hbv infection, and myalgia), as per the american college of rheumatology 1990 criteria for the diagnosis of pan.4 treatment with methylprednisolone pulse therapy (1 g intravenously for three consecutive days) followed by oral prednisone (1 mg / kg / day) was started together with an antiviral agent (100 mg lamivudine). a left sural nerve biopsy revealed no evidence of inflammatory cell infiltration or necrotic changes in the vessels walls. we performed abdominal visceral angiography on the hepatic, renal, and superior mesenteric arteries to rule out systemic vasculitis. the results of the angiography were within normal limits and did not reveal multiple small aneurysms or arterial constrictions. the sensory and motor symptoms had improved 2 months later, and the hbv replication was reduced (follow - up hbv dna : 2,230 pg / ml). the follow - up ncs showed improvement in the compound motor action potential and sensory nerve action potential (snap) amplitudes compared to the previous ncs findings, except for an absent snap over the finger - to - wrist segments of the left median nerve (table 1 and 2). mm is a painful asymmetric sensory and motor peripheral neuropathy involving isolated damage to at least two separate nerve areas. it is a syndrome of diverse causes including diabetes mellitus, demyelinating, infectious, or neoplastic etiology. in association with chronic active hepatitis b, mm associated with pan is relatively common. our case manifested with multifocal sensorimotor mononeuropathy accompanied by chronic active hepatitis b, pan is a necrotizing vasculitis of medium - sized arteries ; its most prominent clinical manifestations include variable signs such as mm, weight loss, livedo reticularis, hypertension, abnormal renal blood tests, myalgia and arthritis, testicular pain, hbv infection, evidence of vasculitis on abdominal angiography, and abnormal nerve biopsy. the presence of three or more of these ten factors is associated with pan with a sensitivity of 82.2% and a specificity of 86.6%.4 furthermore, hbv infection has been reported in around 30% of patients with pan, although pan is a rare complication of hepatitis b.1,5 in our patient, a sural nerve biopsy did not disclose evidence of vasculitis, despite marked loss of myelinated fibers. however, the absence of vasculitis in the biopsy specimens dose not exclude vasculitis for several reasons : 1) multifocal vasculitis may occur in a more proximal part of the nerve (sampling bias), 2) the confirmative rate of specific vasculitis by biopsy is low,6 and 3) sural nerve biopsy results may only provide information about the small arteries, thereby missing the vasculitis of medium - sized arteries (as in pan). we therefore performed abdominal visceral angiography to seek evidence of vasculitis in the medium - sized to small arteries ; the sensitivity and specificity of abdominal angiography in pan are reported to be 89% and 90%, respectively. according to hekali, 2- to 5-mm - sized and multiple (10) aneurysms on abdominal angiography are strongly supportive of a diagnosis of pan.7 furthermore, the evidence of vasculitis in 80% of all patients with pan may be established angiographically, although the clinical significance of angiography for investigation in suspected pan might be controversial.8 in our case, we thought that the diagnosis could be nonsystemic small - vessel vasculitic neuropathy associated with hbv infection, although negative hisotopathologic and angiographic results do not completely exclude the presence of localized pan. in general, an immune - mediated neuropathy should be considered if other causes of multifocal neuropathies, including diabetes mellitus and vasculitic neuropathies, have been excluded.9 the beneficial response to steroid treatment also raised the possibility of a chronic immune - mediated neuropathy. the chronic immune - mediated neuropathies are a diverse group of disorders that result from immune - mediated damage to the peripheral nerves. chronic hepatitis b is not only a recognized risk factor for the development of an immune - mediated neuropathy, but also a common infection, with it being estimated that there are more than 300 million sufferers worldwide.10 the underlying pathology and mechanisms of the peripheral neuropathy following hbv infection have not been elucidated. however, immune - mediated neuronal damage secondary to the direct action of the virus itself on the nerve fibers, or deposition of immune complexes of hbsag and hbeag on the vasa nervorum can lead to peripheral neuropathies. in addition, viral replication might be an important factor in the disease activity or pathogenesis, as suggested by the high titers of hbv dna and the improvement in clinical symptoms after the administration of antiviral agents.11 our patient improved clinically with the gradual attenuation of hbv replication after treatment with lamivudine. in summary, we have presented an interesting case with steroid - responsive sensorimotor mm associated with chronic active hepatitis b that was not accompanied by any evidence of vasculitis. early diagnosis and treatment in an immune - mediated neuropathy are very important for the control of disease activity and progression. if peripheral sensory or motor symptoms develop in patients with hepatitis b, chronic immune - mediated neuropathy associated with hbv infection should be considered in the differential diagnosis. | backgroundmononeuropathy multiplex is a rare complication during the course of chronic hepatitis b, despite various neuropathies following acute hepatitis b having been reported previously.case reporta 30-year - old man presented with sensorimotor symptoms in multiple peripheral nerves. the serological tests for hepatitis were consistent with chronic active hepatitis b. after treatment with oral prednisone combined with an antiviral agent, the sensory and motor symptoms improved and hepatitis b virus replication was reduced.conclusionswe suggest that chronic immune - mediated neuropathy associated with hepatitis b virus infection should be considered in the differential diagnosis of patients with hepatitis b. |
thyroid hormone is a fundamental regulator of biological processes, including cell proliferation, differentiation, and metabolic balance. thyroid hormone plays a crucial role in brain development, which is illustrated by the dramatic neurologic impairment observed in untreated neonatal hypothyroidism, a condition leading to cretinism [24 ]. the adult brain is also sensitive to thyroid hormone in view of mood disorders, depression, memory, cognitive and motoric impairments frequently observed in hypothyroid patients. the major secretory product of the human thyroid gland is thyroxine (t4), a prohormone that does not efficiently bind thyroid hormone receptor (tr). t4 has to be converted to 3,5,3-triiodothyronine (t3) in order to bind to tr and initiate thyroid hormone - mediated changes in gene expression profiles. notably, a significant amount of brain t3 is derived from the local activation of prohormone t4 to t3 (80% in the cortex), suggesting that most t3 acting in the brain is generated in situ from t4 deiodination. plasma t3 was also shown to enter the brain, and studies on the monocarboxylate transporter 8 (mct8) knock - out mice indicate that mct8 plays an important role in this process, but other transporters might also be involved [8, 9 ]. however, only supraphysiological doses of t3 were sufficient to suppress pro - trh mrna in the hypothalamic paraventricular nucleus of hypothyroid rats indicating that t4 uptake into the brain is important for normal function of t3-mediated processes in this tissue. further studies are required to better understand the transport of different thyroid hormone derivatives across the blood - brain and csf - brain barrier, the consequences of this mechanism, and the factors affecting this process (see also section 3.3). local t3 generation in the brain is catalyzed by the type 2 deiodinase (d2), a tightly controlled selenoenzyme [1114 ]. d2 is the only known protein capable of producing t3 in the human brain. beyond d2-mediated t3 generation, type 3 deiodinase (d3) is also similarly important for thyroid hormone economy in the brain [16, 17 ]. d3 inactivates t3 and converts t4 to reverse - t3 that can not bind to tr. thus, in contrast to d2, d3 catalyzes the inactivation pathway of thyroid hormone metabolism. d2 is expressed in glial cells, including astrocytes in different brain regions and tanycytes, the specialized glial cells in the walls and floor of the third ventricle of the mediobasal hypothalamus [1820 ]. in contrast to the glial d2, d3 expression in the brain is restricted to neurons. while historically glial elements of the brain were viewed as a type of connective tissue of the cns without any real function, this view was overturned by the abundant data on the complex role of glial cells in brain metabolism. according to this more recent hypothesis, glial d2 provides t3 for neighboring neurons that express tr but lack t3 generating capacity [4, 19, 20, 2325 ]. thyroid hormone exerts its biological effects predominantly via binding to its nuclear tr, but specific nongenomic effects have also been suggested [2629 ]. two tr isoforms, and, act as ligand - regulated transcription factor and have a central role in transducing the hormonal signal into a cellular response in the brain (reviewed in [30, 31 ]). despite accumulating evidence demonstrating that thyroid hormone alters astrocytes function (see section 2) the presence of tr in astrocytes has been suggested by in vitro studies [3234 ], but lower receptor concentrations have been detected compared to oligodendrocytes or neurons. the presence of tr could also be detected in purified glial nuclei from postnatal rat brain. in contrast, in vivo data suggested that thyroid hormone would mediate astrocyte function indirectly, based on the lack of immunofluorescence staining of tr receptor isoforms 1, 1, and 2 in gfap positive astrocytes of the adult rat brain. interestingly the same group used immunofluorescent to locate tr in cultured astrocytes, in line with other in vitro data. astrocytes from distinct developing brain regions are differently responsive to thyroid hormone, with the highest sensitivity in the hemispheres. thyroid hormone has been shown to be essential for maturation of rat cerebellar astrocytes, and tr1 knock - out mice display astrocyte maturation defects suggesting the role of this tr isoform to mediate a direct effect of thyroid hormone action in astrocytes. presently, most studies agree with the presence of tr1 isoform in astrocytes ; discrepancies remain in the case of tr receptor subtypes. thyroid hormone action occurs within limited time windows, a spatially and timely controlled phenomenon. cultured cells and most astrocytomas are devoid of the same control conditions, which normally act on cells in the brain, and this could be a background of the different experimental results obtained between in vitro and in vivo data. in addition, cultured astrocytes are most likely reactive astrocytes, and the heterogeneity of the in vitro experimental results regarding tr expression in these cells may reflect the different experimental conditions, such as the brain region and the age of the animals used for cultivation or the different culture conditions. active transport of thyroid hormone into brain cells adds to the complexity of thyroid hormone economy in the central nervous system [42, 43 ]. the mct8 (slc16a2) and organic anion transporter 1c1 (oatp1c1) are the best studied thyroid hormone transporters [44, 45 ]. mct8 seems to be the predominant neuronal t3 transporter, and its mutations are associated with the allan - herndon - dudley syndrome characterized by congenital hypotonia that progresses to spasticity with severe psychomotor delays [44, 46, 47 ]. oatp1c1 has high affinity to t4 and is expressed in brain endothelial cells and also in vascular end - feet of astrocytes. other thyroid hormone transporters have also been identified including mct10, which seems to transport t3 more effectively than mct8 and the l - type amino acid transporters (lats). mct10 expression was demonstrated in microglia while lat1 and lat2 expression was found both in astrocytes and neurons ; lat2 was also present in microglia. studies on the mct8 deficient mouse revealed that in the absence of functional mct8, alternative thyroid hormone transporters play an important complementary role in neuronal t3 transport. in contrast, the lack of alternative pathways, for example, lat2 in developing human neurons, might be involved in the devastating neurodevelopmental phenotype seen in mct8-deficient patients with allan - herndon - dudley syndrome [8, 52 ]. studies on transgenic mice with targeted inactivation of different members of the deiodinase enzyme family, mct8, or their combined deletion provided important information on the complex nature of functional interactions between factors regulating thyroid hormone metabolism and transport in the brain and other tissues [8, 9, 5358 ]. despite the relatively mild brain phenotype of d2ko or mct8ko mice, their combined inactivation led to aggravated manifestation of thyroid hormone deprivation and resulted in similar effects as observed in hypothyroidism [9, 59].these data confirmed the crucial role of d2 in local t3 generation in the brain and suggested that changes in d2 expression could compensate for defects in mct8 function in the rodent brain. numerous aspects of deiodinase - mediated changes of thyroid hormone metabolism have been carefully reviewed and provide a comprehensive view on the molecular and biochemical properties, structure, regulation, and biological functions of these enzymes in the brain and different tissues [24, 6069 ]. in the present paper we will focus on the role and regulation of thyroid hormone in neuroglia, representing an exciting aspect of emerging significance for thyroid hormone economy. we provide a concise overview on the most important effects of thyroid hormone on glial cells, followed by the discussion of novel data on d2-mediated glial t3 generation and its role under specific physiological and pathophysiological conditions. it has been known for decades that hypothyroidism can result in numerous brain defects, including decreased dendritic arborization of purkinje cells, diminished axonal outgrow and myelinization, and insufficient cortical layer organization. although thyroid hormone also impacts the adult brain, the underlying cellular and molecular events are less understood [71, 72 ]. various aspects of thyroid hormone - mediated brain function were extensively reviewed (see section 1). available data on thyroid - hormone - regulated gene networks are yet limited, but accumulating evidence indicates that various sets of genes are regulated along this pathway. in a recent study, thyroid hormone action on adult rat striatum was monitored using gene expression profiling. the numerous up or down regulated sets of genes involved various pathways affecting for example, circadian regulation, oxidative stress response, phenylethylamine degradation, mapk pathway, phosphate metabolism, signal transduction, and cell structure. these findings revealed novel aspects of brain related thyroid hormone action that need to be studied in details. numerous examples of thyroid hormone - dependent gene expression in the brain are related to neurons, which could be a result of direct neuronal effect or an indirect glia - mediated signal. neuroglial cells are heavily involved in the regulation of neuronal metabolism and activity, glucose supply, cerebral blood flow, and neurotransmitter levels in mature brain. the detailed description of mechanisms how glial cells are involved in this process is an ongoing effort and requires further studies. we will briefly summarize below how thyroid hormone targets glial cells and mediates their function that has also consequence on glia - mediated neuronal activities. thyroid hormone affects the differentiation and maturation of different glial subtypes including astrocytes, oligodendrocytes, and microglia [7577 ]. although many aspects of glial linages are yet controversial, evidence has been obtained in vitro that oligodendrocytes and astrocytes are derived from a common precursor, the glial restricted precursor cells (grp). grps are tripotential cells, owning the ability to divide into myelin producing oligodendrocyte or two types of astrocytes, depending on the factors contained in growth medium. in vitro studies demonstrated that mature oligodendrocytes were developed from precursor cells in the presence of thyroid hormone and platelet - derived growth factor (pdgf). the concept that these two glial cell types originate from a common lineage was also supported by findings that show reciprocal changes in oligodendrocyte / astrocyte cell density in the rat white matter upon changes in serum t4 level. furthermore, the number of matured oligodendrocytes and astrocytes was reduced in the brain of hypothyroid animals within white matter tracts [81, 82 ]. morphological differentiation of astrocytes from progenitors to mature cells has been explained by thyroid hormone - mediated actions affecting cytoskeletal proteins (f - actin, gfap) [40, 83 ]. in hypothyroid neonatal rats, t3 upregulates gfap production and reorganizes gfap filaments and transforms the flat polygonal astrocytes into process - bearing cells [85, 86 ]. not only t3, but t3-mediated growth factor secretion can enhance gfap expression, thanks to several growth factor binding domains in its promoter region [87, 88 ]. microglial cell development is also affected by thyroid hormone. in the cortical forebrain of hypothyroid neonatal rat t3 favored survival of microglias in vitro and have triggered their process extension [77, 89 ]. the mechanisms by which thyroid hormone promotes differentiation were not yet fully revealed, but there are several candidates for this process, for example, cell - cycle modulators like e2f-1, cyclin d1, and p27. e2f1 is a key transcription factor, that controls g1 to s phase transition and has an impact on cyclin d1. e2f-1 and cyclin d1 expression is down regulated via tr - mediated transcriptional repression [92, 93 ]. another candidate of this pathway, p27 cyclin - dependent kinase inhibitor was upregulated in response to t3 [94, 95 ]. decreased amount of e2f-1 and cyclin d1 protein and increased levels of the p27 cell - cycle inhibitor may shift cell fate towards differentiation. myelination represents the best characterized t3-dependent glial action in the brain [9698 ]. thyroid hormone regulates oligodendrocyte differentiation and myelin production via tr - mediated transcriptional effects [34, 99 ]. thyroid hormone depletion resulted in delayed expression of oligodendrocyte - specific markers and decreased the number of oligodendrocyte cell bodies in the main white matter tracts. hypothyroidism delayed the expression of genes encoding structural proteins of myelin, for example, myelin basic protein (mbp), proteolipid protein (plp), and myelin - associated glycoprotein (mag) and resulted in reduced numbers of myelinated axons and lower myelin content. sensitivity period of these genes for thyroid hormone extends from the end of the first postnatal week up to the end of the first month in rat [76, 103 ]. thyroid hormone action on astrocytes during brain development is illustrated by enhanced secretion of extracellular matrix proteins and growth factors. astrocytes were previously shown to produce laminin and fibronectin [104, 105 ]. subsequent studies demonstrated t3-induced expression of laminin and fibronectin in cultured cerebellar astrocytes and revealed that both laminin and fibronectin were organized in fibrillar pattern on the cell surface, while hypothyroid conditions changed this distribution for a disorganized extracellular matrix of punctuate pattern. as an underlying mechanism it was suggested that astrocytes modulate extracellular matrix composition via t3-mediated growth factor secretion [104, 107 ]. basic fibroblast growth factor (bfgf) and epidermal growth factor (egf) are secreted by cerebellar astrocytes in response to t3 and seem to promote extracellular matrix protein secretion and organization in an autocrine manner. egf was suggested to exert its effect on extracellular matrix protein secretion through mapk / phosphatidylinositol 3-kinase pathway. astrocytes also secrete nerve growth factor (ngf) in a t3-dependent manner, which allows potent control of neurite growth and survival [109111 ]. beyond t3, the effect of t4 on astrocytes was also demonstrated suggesting that thyroid hormone could also impact astrocytes via a nongenomic pathway. t4 exerts its effect on the microfilament network of astrocytes by dynamically organizing f - actin filaments, facilitating integrin clustering, and focal contact formation [112, 113 ]. polymerized actin filament network was observed in cultured astrocytes after treatment with t4 and reverse t3 while t3 did not affect the polimerization rate [114, 115 ]. adhesive interactions among the extracellular matrix protein laminin, integrins, and the microfilament network play a fundamental role in the regulation of neural cell migration during brain development. in vitro studies on neurite development demonstrated that neurons, cocultured with astrocytes under thyroid hormone - depleted conditions, showed reduced total neurite length and decreased neurite numbers. as a consequence, these data suggest that thyroid hormone - mediated actions on astrocytes are important events in neuron migration and axon formation. while thyroid hormone impacts glial function in various manner (see above), neuroglia is not only target but also the predominant source of t3 in the brain. as mentioned above, astrocytes and tanycytes below, we will discuss factors and conditions affecting d2 regulation in glial cells, since they can contribute to the better understanding of thyroid hormone signaling in the brain. d2 is negatively regulated by thyroid hormone, through a mechanism that involves product (t3-) mediated transcriptional downregulation of the dio2 gene and substrate (t4-) induced posttranslational decrease of d2 protein levels (reviewed in, see section 3.2). the negative regulation of d2 activity suggests a homeostatic regulation of t3 generation [116118 ]. however, region - specific differences within the brain regarding the response to hyper- or hypothyroidism are reflected by changes in d2 regulation. d2 is reciprocally regulated by thyroid hormone in various brain regions but shows only modest response in the hypothalamus [19, 119121 ]. the fact that d2 activity in the hypothalamus is concentrated in tanycytes suggests marked differences between astrocytes and tanycytes regarding thyroid hormone response and balance. while in astrocytes t3 production seems to serve homeostatic purposes, the relative insensitivity of d2 to t3 in tanycytes would indicate that other signals act more importantly on d2 expression, thus controlling local t3 production. however, a link has been suggested between the developmental state of astrocytes and their responsiveness to thyroid hormone. although tanycytes are still considered as terminally differentiated cells, data have been accumulating that at least a subpopulation of this inhomogeneous cell layer might behave as progenitor cells. this is supported by observations that the tanycyte layer in the wall of the third ventricle regenerates in two weeks following alloxan - induced destruction, and tanycytes could be considered a neurogenic niche in response to igf - i. this is presently unclear whether differences in differentiation stages or a more specific factor is responsible for the different responsiveness to thyroid hormone of the two cell types. it has been suggested that d2-generated t3 in tanycytes of the mediobasal hypothalamus could play a role in the pathogenesis of nonthyroidal illness during infection [63, 66, 67, 124 ]. nonthyroidal illness syndrome (euthyroid sick syndrome or low t3 syndrome) is accompanied by low t3 and sometimes low t4 serum levels and associated with nonelevated or inappropriately elevated tsh levels during infection, sepsis, starvation, malignancy, life - threatening trauma, and other critical illness [125128 ]. although the syndrome has been known for decades, it is still a matter of debate whether the changes of thyroid hormone profile provide physiologic compensation for illness or it represents pathological conditions [129131 ]. systemic administration of bacterial lipopolysaccharide (lps) increased d2 mrna expression in tanycytes and d2 activity in the rat mediobasal hypothalamus (figure 1) accompanied by falling serum thyroid hormone and tsh levels. this phenomenon was also observed in mice, immediately followed by decreased expression of thyroid receptor 2, tsh in the pituitary and decreased type 1 deiodinase mrna in the pituitary and liver. lps induced suppression of trh expression in the hypothalamic paraventricular nucleus of wild type but the effect was abolished in the d2 knock - out mice (figure 2) (see section 3.3). although this model is not suitable to dissect the role of specific glial subtypes in this mechanism, it clearly demonstrated the fundamental role of d2 activity in trh suppression during infection and supported the hypothesis of a close interaction between neurons and glial cells and their role in regulating brain functions via t3 availability. importantly, while the continuous increase in d2 activity of cortical astrocytes seemed to be the consequence of falling t4 levels, d2 activation in tanycytes followed kinetics that was independent of thyroid hormone levels [132, 134 ]. it was also demonstrated that lps - induced d2 expression on the mediobasal hypothalamus was not dependent on circulating corticosterone, either. unexpectedly, cultured astrocytes of the rat cerebral hemispheres increased their d2 activity in response to lps, and glucocorticoids enhanced this effect. it is presently not clear why this effect is not reflected in vivo by the kinetics of cortical d2 induction. importantly nf-b, a potent effector of lps - induced signaling, transcriptionally activated the d2 encoding dio2 gene, and a functional nf-b binding site was identified and characterized in the human dio2 5 flanking region [132, 137 ]. nf-b was also involved in the lps - induced increase in d2 activity in cultured astrocytes. further studies on the kinetics of lps - induced activation of the nf-b pathway in the rat mediobasal hypothalamus indicated that nf-b activation contributes to sustaining the lps - induced d2 response in a subset of tanycytes. however, this is not the initiating mechanism of lps - induced d2 response in tanycytes. the same study suggested that tsh of the part tuberalis could also play a role in this process. the factor(s) that initiate tanycytal d2 induction in the starting phase of lps - evoked infection are presently not known. however, taking into account the highly active nature of d2-catalyzed t3 generation even a subpopulation of tanycytes could provide a significant amount of t3 for the modulation of trh expression. to asses this appropriately, it would be important to understand in details the pathways that allow tanycyte - generated t3 to reach hypophysiotropic trh neurons in the paraventricular nucleus. iodine availability is critically important to maintain proper thyroid hormone levels. during moderate iodine deficiency most thyroid hormone target tissues are only mildly affected, due to rapid physiological adaptations of the hypothalamo - hypophyseal - thyroid axis, which maintains plasma t3 at the normal range [139, 140 ]. via glial d2 and neuronal d3, a moderately severe iodine deficiency resulted in increased d2 mrna and activity in different brain regions. d2 sensitivity to iodine deficiency was region specific, the hippocampus and cerebral cortex represented the most responsive regions. d2 induction in this regions indicated that astrocytes increase their t3-generating activity under iodine deficiency. tanycytes of the mediobasal hypothalamus also increased their d2 expression and activity although their response was lower compared to astrocytes in the cortex and hippocampus. since increase of d2 activity was higher than that of mrna expression, it could be speculated that not only pretranslational events are involved here in d2 regulation but also prolonged d2 half - life due to decreased d2 ubiquitination (see section 3.2) could contribute to this effect. increased glial d2 in iodine deficiency was paralleled with reduced neuronal d3. thus mitigating the effects of iodine deficiency by both increased t3 generation and reduced t3 degradation reflected the particular importance of adaptation of the brain to iodine deficiency. various aspects of iodine deficiency modulated alterations of thyroid hormone deiodination were extensively reviewed elsewhere. fasting resulted in twofold increase in d2 mrna expression and activity in rat mediobasal hypothalamus, and it was straightforward to suggest that this could suppress trh expression in the hypothalamic paraventricular nucleus and downregulate this way the hypothalamo - hypophyseal - thyroid axis. however, fasting - mediated decrease of trh expression in the paraventricular nucleus of the tr2-null transgenic mice remained unaffected although tr2 represents the key tr isoform involved in t3-mediated negative regulation of trh expression in transgenic mice. this finding demonstrated that tanycyte - generated t3 during fasting should not have major direct effects on trh expression in the paraventricular nucleus. as an alternative pathway, the hypothalamic ventromedial nucleus was also suggested as a target translating changing hypothalamic t3 levels into the modulation of food intake. the role of glial d2-mediated hypothalamic t3 in fasting is not yet resolved, and related data are reviewed elsewhere [25, 61, 63, 66 ]. d2 expression in the mediobasal hypothalamus is controlled by light, and this has consequences on reproductive function. light exposure - induced d2 expression in the mediobasal hypothalamus of the japanese quail (coturnix japonica) represents a crucial event in the signal transduction pathway ensuring photoperiodic response of gonads. intracerebroventricular administration of t3 mimicked the photoperiodic response, whereas the d2 inhibitor iopanoic acid prevented gonadal growth. interestingly, beyond median eminence and infundibular nucleus d2 induction was also observed in the dorsal and lateral hypothalamus. based on this finding it can not be excluded that not only tanycytes but other cell types, for example, hypothalamic astrocytes could be also involved in this mechanism, but this aspect was not studied in details. a mechanism for light - induced d2 expression in the mediobasal hypothalamus was also revealed in quail showing a preceding peak of tsh-subunit expression in the pars tuberalis via a camp - dependent mechanism. it was demonstrated that intracerebroventricular administration of tsh to short - day quail stimulated gonadal growth and d2 expression and proved that tsh in the pars tuberalis therefore seems to trigger long - day photoinduced seasonal breeding. a homology between avian and mammalian photoperiodic regulation of reproduction has been observed since d2 expression was also increased in djungarian (siberian) hamsters (phodopus sungorus) under long days ; the signal was weaker under short days while melatonin injection decreased d2 expression under long days. these results indicate that d2 expression in tanycytes may be involved in the regulation of seasonal reproduction both in mammals and birds. regulation of seasonal reproduction by photoperiodic regulation of hypothalamic thyroid hormone levels also involves reciprocal changes of d2 and d3 expression that is reviewed elsewhere along with data on other models of seasonal reproduction [66, 147, 148 ]. after traumatic brain injury d2 mrna was upregulated in reactive astrocytes in rat. in the cerebral cortex near the contusion d2 mrna was upregulated on the first day after injury ; in the following days the signal was shown to have expanded to the hippocampus, where the astrocytic localization of upregulated d2 mrna was obvious and bordered the neuronal granule cell layer. furthermore, different stressors including relatively mild ones (e.g., handling) increased d2 activity in a stressor- and brain - region dependent manner. the frontal cortex showed the highest d2 response, and motor stress was the most dominant stressor in this region while no effect was seen in the cerebellum. a stressor - dependent decrease of t4 tissue concentration was also observed but stressor - dependent deviations were also found since, for example, gently handling resulted in elevated t4 in the frontal cortex. a strict correlation between d2 activity and tissue t4 levels could not be found suggesting the role of specific factors and not simply the falling t4 level in stress - related d2 increase. deiodinases are tightly regulated during various developmental processes (reviewed in [4, 151 ]). it was shown that the human fetal brain is already sensitive to thyroid hormones before the onset of the fetal thyroid [152, 153 ]. the presence of high - affinity t3 binding sites with a specificity that resembles that of the nuclear t3 receptors was also demonstrated in the human fetal brain and its concentration increased by tenfold from ten to sixteen weeks. d2 expression and activity was detected in the human fetal cortex already from seven to eight weeks of gestation. it has been also demonstrated that during the second trimester t3 increases in the cortex due to d2 activity, while it remains very low in cerebellum because of d3-mediated thyroid hormone inactivation. although deiodinase activities were also studied in the developing rat brain,, data are limited on ontogenic aspects of d2 expression in different glial subtypes. increasing d2 expression was detected in the developing chicken brain in perivascular localizations probably localized to glial cells. it was also demonstrated that d2 was expressed in chicken tanycytes before the onset of thyroid hormone - dependent negative feedback. furthermore, d2 and nkx2.1 were coexpressed at e13 and p2 in tanycytes but not in the perivascular glia indicating a glial - subtype - specific regulation of d2 expression. it has been demonstrated that d2 expression in glial cells is under the control of multiple factors. these include the increase of d2 activity upon camp induction [160, 161 ] that is in line with the finding of an evolutionary conserved cre site in the dio2 promoter [61, 162164 ]. selenium dependence, phorbol esters and glucocorticoids, acidic fibroblast growth factor also impact d2 activity. it has been demonstrated that d2 activity in the brain undergoes rapid and substrate - induce changes [116, 117 ]. the underlying mechanism was later identified demonstrating that d2 undergoes substrate - induced ubiquitination followed by its degradation in the proteasome [168170 ]. this was a unique example of substrate - induced selective proteolysis that involves ubiquitination of an endoplasmic reticulum resident enzyme and represented the first demonstration that such a regulatory pathway controls activation of a hormone. the pathway works also in primary cultures of astrocytes, since mg132 a proteasome uptake inhibitor could block substrate - induced d2 inactivation. it has been revealed that d2 forms homodimers that undergo ubiquitination - mediated transient and reversible conformation changes. since dimerization of d2 monomers is crucial to maintain the proper conformation of the active center of the enzyme, ubiquitination - mediated changes result in the rapid loss of d2 activity. since d2 ubiquitination represents a rapid way for the regulation of t3 generation its mechanism was studied in detail in the past several years. ubc6 and 7 were identified as the ubiquitin conjugases (e2) involved in the ubiquitination of d2 [173, 174 ], while usp-33 and usp-20 (vdu1 and 2) deubiquitinate d2 and prolong its half - life. a novel type of ubiquitination motif containing a 18-aa - loop structure of the d2 protein was identified and characterized [176, 177 ]. wsb1 (swip1) was recognized as a sonic hedgehog - induced socs - box containing protein of unknown function [178, 179 ]. importantly, it could be shown that wsb1 serves as the ubiquitin ligase (e3) that links d2 to the elongin bc - cul5-rbx1 ubiquitinating catalytic core complex. data are accumulating on how crucial elements of the d2 ubiquitination machinery are expressed in d2-expressing glial subtypes. the available data revealed cell - type - specific differences in the expression of crucial elements of the d2 ubiquitinating / deubiquitinating machinery in the rodent brain. wsb1, the d2 e3 ligase, is expressed both in gfap - expressing astrocytes in different brain regions and in tanycytes in the mediobasal hypothalamus (figure 3). this suggested that the wsb1-d2 interaction, a process required for d2 ubiquitination, could be functional in these cells. in contrast to wsb1, the teb4 e3 ligase could not be detected in gfap - expressing astrocytes, only in the cerebellum, but it was expressed in tanycytes. furthermore, the usp33 (vdui) d2 deubiquitinase is co - expressed with d2 only in tanycytes but not in astrocytes (figure 3). wsb1 and usp33 expression in the brain was not affected by thyroid hormone status indicating that these genes are not involved in the homeostatic response to hypo- or hyperthyroidism. the available data suggested that kinetics of d2 ubiquitination and consequent selective proteolysis in the proteasome could be different among different subtypes of glial cells. among d2-expressing cell types of the brain, tanycytes express the most comprehensive set of genes involved in ubiquitination - mediated d2 regulation, that ensures both wsb1- and teb4-mediated ubiquitination ligation to d2- and also usp33 deubiquitinase - mediated d2 reactivation. in astrocytes d2 deubiquitinaton is either not possible, or it works via usp20 or other unidentified d2 deubiquitinases. astrocytes and tanycytes of the neuroglial compartment are the predominant source of t3 present in the brain while tr in neurons represents a major target of thyroid hormone. as discussed above, neurons can not generate t3 but express type 3 deiodinase (d3), the t3 degrading enzyme. while numerous observations suggested that glial thyroid hormone metabolism could affect neuronal function (see section 3.1), until recently no direct evidence could be obtained to prove the existence of deiodinase - mediated transcriptional t3 footprints in neurons. recently a two - dimensional coculture was used based on the d2-expressing h4 glioma cells and the d3-expressing sk - n - as neuronal cell line. it has been shown that t4 could activate the endogenously expressed t3-sensitive enpp2 gene of the neuronal compartment only if the glial compartment was present. this model led to the demonstration that d2-mediated glial t3 generation from physiological amount of t4 can directly affect thyroid hormone - dependent gene expression in a paracrine fashion. a different approach using expression profiling - based assessment of thyroid - hormone - regulated gene expression in the cerebral cortex of the mct8, d2, and mct8/d2 knock - out mice suggested that negative regulation required d2-generated t3, while peripheral t3 entering the brain should be sufficient to maintain normal expression of positively regulated genes. specific signals as hedgehog proteins [176, 182 ], bacterial lipopolysaccharide (lps) [132, 133, 137, 183 ], and hypoxia have been established as regulators of deiodinase activities. it was also studied how these specific signals impact neuroglial thyroid hormone metabolism in the coculture system. the sonic hedgehog morphogene decreases glial thyroid hormone activation via wsb1-mediated posttranslational downregulation of d2 (see section 3.2) and increases neuronal d3 expression. this demonstrates the existence of a mechanism ensuring a fine - tuned balance between sonic hedgehog - mediated proliferation and t3-evoked differentiation. it has been also demonstrated that in the brain t3 upregulates crucial elements of the sonic hedgehog signaling pathway that could represent a compensatory feedback loop for sonic hedgehog - mediated t3 regulation. the effect of lps on d2 expression and its relation to nonthyroidal illness were discussed in section 3.1. in contrast to sonic hedgehog, lps - induced glial d2 activity and decreased neuronal d3 in the h4-sk - n - as system and as a consequence resulted in a decreased t3-mediated gene expression in the neuronal compartment. these data were complemented with in vivo observation on the lps evoked model of nonthyroidal illness. lps could not induce trh suppression on the paraventricular nucleus of the d2 knock - out mice only in wild types (figure 2) (see also section 3.1). this indicated that glial (highly probably tanycytal) d2-generated t3 in the hypothalamus could play an important role in t3-mediated suppression of the hypophysiotropic trh neurons and consequently in the decreased activity of the hypothalamo - hypophyseal - thyroid axis during the infection - evoked subtype of nonthyroidal illness. in contrast, hypoxia affected predominantly neuronal d3 activity in the h4- sk - n - as system. this effect could be also demonstrated in a rat in vivo hypoxia / ischemia model showing d3 induction in cortical neurons and in the hippocampal pyramidal and granular cell layers. the glial aspect of this phenomenon requires further studies since an independent study on primary cultures of astrocytes demonstrated hypoxia - induced increase of d2 activity. these data established deiodinase enzymes as glial and neuronal control points for the regulation of thyroid hormone action in the brain during health and disease (figure 4) | thyroid hormone plays a crucial role in the development and function of the nervous system. in order to bind to its nuclear receptor and regulate gene transcription thyroxine needs to be activated in the brain. this activation occurs via conversion of thyroxine to t3, which is catalyzed by the type 2 iodothyronine deiodinase (d2) in glial cells, in astrocytes, and tanycytes in the mediobasal hypothalamus. we discuss how thyroid hormone affects glial cell function followed by an overview on the fine - tuned regulation of t3 generation by d2 in different glial subtypes. recent evidence on the direct paracrine impact of glial d2 on neuronal gene expression underlines the importance of glial - neuronal interaction in thyroid hormone regulation as a major regulatory pathway in the brain in health and disease. |
exposure to air polluted with particles less than 2.5 micron in size is associated epidemiologically with adverse cardiopulmonary health consequences in humans. the goal of this study was to characterize human pulmonary responses to controlled experimental high - dose exposure to fine and ultrafine magnesium oxide particles. we quantified bronchoalveolar lavage (bal) cell and cytokine concentrations, pulmonary function, and peripheral blood neutrophil concentrations in six healthy volunteers 18 to 20 hr after inhalation of fine and ultrafine magnesium oxide particles produced from a furnace system model. we compared postexposure studies with control studies from the same six subjects. mean + /- standard deviation (sd) cumulative magnesium dose was 4,138 + /- 2,163 min x mg / m3. by weight, 28% of fume particles were ultrafine (< 0.1 micron in diameter) and over 98% of fume particles were fine (< 2.5 micron in diameter). there were no significant differences in bal inflammatory cell concentrations, bal interleukin (il)-1, il-6, il-8, tumor necrosis factor, pulmonary function, or peripheral blood neutrophil concentrations postexposure compared with control. our findings suggest that high - dose fine and ultrafine magnesium oxide particle exposure does not produce a measurable pulmonary inflammatory response. these findings are in marked contrast with the well - described pulmonary inflammatory response following zinc oxide particle inhalation. we conclude that fine and ultrafine particle inhalation does not result in toxicity in a generic manner independent of particle composition. our findings support the concept that particle chemical composition, in addition to particle size, is an important determinant of respiratory effects.imagesfigure 1.figure 2. afigure 2. b |
|
the study was funded by the american diabetes association and approved by the university of minnesota institutional review board. we recruited participants between january 2007 and march 2009 from clinics and communities in the twin cities metro area of minnesota. patients were either referred to the study by their physicians or self - referred from flyers distributed at health fairs, community centers, and churches ; media advertisements ; word of mouth ; or postcards. the study included men and women aged 40 years and older with a diagnosis of pad (resting or postexercise ankle - brachial index [abi ] of 1.3, indicating arterial calcification, we obtained toe - brachial indexes (9). great toe pressures were obtained with a toe cuff and photoplethysmography (summit doppler vista avs 2007) to detect the systolic pressure at which blood flow returned. eligible individuals were randomized to intervention or control using permuted blocks with randomized block sizes 2, 4, 6, or 8 to ensure equal numbers in both groups. outcomes were analyzed according to the randomized allocation (intention - to - treat). all participants viewed a 7-min educational video about pad and its clinical leg symptoms, life - threatening consequences of pad (heart attack and stroke), other adverse outcomes (walking disability), and strategies for disease and risk factor management (smoking cessation, weight control, aerobic activity). after the video, each participant met face - to - face with the research coordinator. the coordinator queried participants regarding self - management behaviors (i.e., glucose monitoring, blood pressure monitoring) and gave them a calendar in which to document their daily glucose results, weekly blood pressures, and any routine lipid results provided by their primary care physician. participants received parking vouchers for each visit and $ 30 for each of the 3- and 6-month assessment visits. intervention group subjects participated in a home - based walking program with three components : 1) a one - on - one interaction with the research coordinator at baseline ; 2) walking training and weekly group walking classes with an instructor ; and 3) biweekly telephone calls for 6 months. for the baseline interaction, discussion focused on the participant s current stage of change (12), as determined from his or her responses to part 1 of the patient - centered assessment and counseling for exercise (pace) protocol (e.g., i ve been doing vigorous exercise 3 or more days per week for the last 6 months or more for this study, we modified the original pace assessment and counseling treatment manual (13) to address the specific walking recommendations for patients with pad, rather than any form of exercise. the participant then completed part 2 of the pace protocol (one of three possible instruments depending on the score in part 1) to better define specific factors that facilitate adherence to routine exercise (walking). for example, individuals with a pace score of 24 were asked to write down the two main benefits they hoped to gain from being active and were asked to make a physical activity plan and check off roadblocks to routine exercise via walking (e.g., the coordinator reviewed each participant s plans for walking routinely and discussed how to overcome roadblocks. after the baseline visit, participants were scheduled to complete two 1-h walking training sessions, led by an experienced exercise instructor. sessions were held at the university of minnesota or another location suitable for walking (e.g., a park). the exercise instructor asked participants to describe what they hoped to gain from walking for exercise. session two was a practice walking session with the exercise instructor and one or more participants. for this session, participants listened to an audiotaped instructional aid developed by the american heart association. participants were then encouraged to walk 1 day per week with the study exercise instructor and other participants, as available, and to continue walking on their own at least 3 days per week for a minimum of 4 days of walking each week ; participants were advised to walk 50 min total for each session and, using their pedometers, to increase the number of steps by 50 each session., intervention participants completed the pace assessment and the exercise behaviors questionnaire (described below) (15) and discussed their strategies for atherosclerotic risk factor control and adherence to walking during the past 2 weeks. individuals randomized to the attention control group participated in twice - monthly phone calls with the research coordinator. during these 10- to 15-min calls, control group participants shared and discussed the information documented in their calendars on blood glucose, blood pressure, and cholesterol levels (if available) and their smoking habits, if applicable. it has a summary -statistic for reliability of 0.81 (95% confidence interval [ci ] 0.78, 0.84) and a summary -statistic for validity of 0.58 (95% ci 0.52, 0.64) (16). the primary outcome was change from baseline to 6 months in mean maximal treadmill walking distance, determined from using the gardner - skinner graded exercise treadmill test with electrocardiographic monitoring (17). secondary outcomes were change from baseline to 3 months in mean maximal treadmill walking distance and changes from baseline to 3 and 6 months in the measures listed below. we captured the participant s ability to walk in the community (i.e., lower limb function) using the validated interviewer - administered walking impairment questionnaire (18). this survey captures three domains : walking distance, walking speed, and stair - climbing capacity. the domains are scored on 0 to 100 scales, 0 representing complete inability to perform the task and 100 representing no limitations in walking short and long distances, walking at a fast pace, and climbing three flights of stairs. health - related quality of life was measured using the medical outcomes study (mos) short form survey (sf-36) (19). each subscale is scored from 0 to 100 ; higher scores indicate more positive quality of life. depressive symptoms, which are associated with walking impairment in patients with pad (20), were measured using the geriatric depression score, a 15-item screening instrument. we measured self - efficacy self - confidence to perform certain activities to manage their disease using the six - item self - efficacy for managing chronic disease scale (21). the association of self - efficacy with walking ability, measured in these patients at baseline, is reported elsewhere (22). we administered the stanford patient education research center exercise behavior survey during each follow - up phone call. the exercise behaviors survey is a six - item instrument with questions regarding the type of activity and the length of time during which the patient engaged in that activity during the past week (23). during each biweekly phone call, study staff asked whether the patient had developed chest pain, shortness of breath, or any symptoms requiring hospitalization in the past 2 weeks. if the participant responded yes, he / she was asked about diagnostic testing, final diagnosis, and whether the hospital physician stated the participant could continue in the study. the study staff also ascertained leg symptoms, testing for pad (e.g., angiography), or invasive therapy for pad. intervention and control groups were compared according to baseline characteristics using fisher s exact tests for categorical variables and t tests (two - sided) for continuous variables. analyses were done using sas (v. 9.1.3 ; sas institute, cary, nc). the treatment groups were compared according to change from baseline to 6- and 3-month follow - up using the same tests. as a check for selection bias from dropouts, we performed longitudinal analyses of four outcomes, the primary outcome and three secondary outcomes of particular interest : treadmill walking distance, walking speed from the walking impairment questionnaire, and the physical and mental health aggregates of sf-36. the analysis used a mixed linear model, including up to 3 cases per participant (baseline, 3 months, 6 months), using all available data. treatment groups were compared according to change from baseline to the average of the 3- and 6-month visits, an average treatment effect over the two follow - ups. the longitudinal results were very similar to the simpler comparisons of changes by the 3- and 6-month visits and are reported briefly. a priori, 64 patients per arm gave 80% power to detect a moderate standardized effect size of 0.50 (a difference between groups of 0.06 miles in average change in treadmill walking distance). we recruited participants between january 2007 and march 2009 from clinics and communities in the twin cities metro area of minnesota. patients were either referred to the study by their physicians or self - referred from flyers distributed at health fairs, community centers, and churches ; media advertisements ; word of mouth ; or postcards. the study included men and women aged 40 years and older with a diagnosis of pad (resting or postexercise ankle - brachial index [abi ] of 1.3, indicating arterial calcification, we obtained toe - brachial indexes (9). great toe pressures were obtained with a toe cuff and photoplethysmography (summit doppler vista avs 2007) to detect the systolic pressure at which blood flow returned. eligible individuals were randomized to intervention or control using permuted blocks with randomized block sizes 2, 4, 6, or 8 to ensure equal numbers in both groups. outcomes were analyzed according to the randomized allocation (intention - to - treat). all participants viewed a 7-min educational video about pad and its clinical leg symptoms, life - threatening consequences of pad (heart attack and stroke), other adverse outcomes (walking disability), and strategies for disease and risk factor management (smoking cessation, weight control, aerobic activity). after the video, each participant met face - to - face with the research coordinator. the coordinator queried participants regarding self - management behaviors (i.e., glucose monitoring, blood pressure monitoring) and gave them a calendar in which to document their daily glucose results, weekly blood pressures, and any routine lipid results provided by their primary care physician. participants received parking vouchers for each visit and $ 30 for each of the 3- and 6-month assessment visits. intervention group subjects participated in a home - based walking program with three components : 1) a one - on - one interaction with the research coordinator at baseline ; 2) walking training and weekly group walking classes with an instructor ; and 3) biweekly telephone calls for 6 months. for the baseline interaction, discussion focused on the participant s current stage of change (12), as determined from his or her responses to part 1 of the patient - centered assessment and counseling for exercise (pace) protocol (e.g., i have been thinking of starting to exercise in the next 6 months = 2 ; i ve been doing vigorous exercise 3 or more days per week for the last 6 months or more for this study, we modified the original pace assessment and counseling treatment manual (13) to address the specific walking recommendations for patients with pad, rather than any form of exercise. the participant then completed part 2 of the pace protocol (one of three possible instruments depending on the score in part 1) to better define specific factors that facilitate adherence to routine exercise (walking). for example, individuals with a pace score of 24 were asked to write down the two main benefits they hoped to gain from being active and were asked to make a physical activity plan and check off roadblocks to routine exercise via walking (e.g., the coordinator reviewed each participant s plans for walking routinely and discussed how to overcome roadblocks. after the baseline visit, participants were scheduled to complete two 1-h walking training sessions, led by an experienced exercise instructor. sessions were held at the university of minnesota or another location suitable for walking (e.g., a park). the exercise instructor asked participants to describe what they hoped to gain from walking for exercise. session two was a practice walking session with the exercise instructor and one or more participants. for this session, participants listened to an audiotaped instructional aid developed by the american heart association. participants were then encouraged to walk 1 day per week with the study exercise instructor and other participants, as available, and to continue walking on their own at least 3 days per week for a minimum of 4 days of walking each week ; participants were advised to walk 50 min total for each session and, using their pedometers, to increase the number of steps by 50 each session., intervention participants completed the pace assessment and the exercise behaviors questionnaire (described below) (15) and discussed their strategies for atherosclerotic risk factor control and adherence to walking during the past 2 weeks. individuals randomized to the attention control group participated in twice - monthly phone calls with the research coordinator. during these 10- to 15-min calls, control group participants shared and discussed the information documented in their calendars on blood glucose, blood pressure, and cholesterol levels (if available) and their smoking habits, if applicable. at baseline only, the lifestyle and clinical survey was administered to ascertain sociodemographics and comorbidities. it has a summary -statistic for reliability of 0.81 (95% confidence interval [ci ] 0.78, 0.84) and a summary -statistic for validity of 0.58 (95% ci 0.52, 0.64) (16). the primary outcome was change from baseline to 6 months in mean maximal treadmill walking distance, determined from using the gardner - skinner graded exercise treadmill test with electrocardiographic monitoring (17). secondary outcomes were change from baseline to 3 months in mean maximal treadmill walking distance and changes from baseline to 3 and 6 months in the measures listed below. we captured the participant s ability to walk in the community (i.e., lower limb function) using the validated interviewer - administered walking impairment questionnaire (18). this survey captures three domains : walking distance, walking speed, and stair - climbing capacity. the domains are scored on 0 to 100 scales, 0 representing complete inability to perform the task and 100 representing no limitations in walking short and long distances, walking at a fast pace, and climbing three flights of stairs. health - related quality of life was measured using the medical outcomes study (mos) short form survey (sf-36) (19). each subscale is scored from 0 to 100 ; higher scores indicate more positive quality of life. depressive symptoms, which are associated with walking impairment in patients with pad (20), were measured using the geriatric depression score, a 15-item screening instrument. we measured self - efficacy self - confidence to perform certain activities to manage their disease using the six - item self - efficacy for managing chronic disease scale (21). the association of self - efficacy with walking ability, measured in these patients at baseline, is reported elsewhere (22). we administered the stanford patient education research center exercise behavior survey during each follow - up phone call. the exercise behaviors survey is a six - item instrument with questions regarding the type of activity and the length of time during which the patient engaged in that activity during the past week (23). we captured the participant s ability to walk in the community (i.e., lower limb function) using the validated interviewer - administered walking impairment questionnaire (18). this survey captures three domains : walking distance, walking speed, and stair - climbing capacity. the domains are scored on 0 to 100 scales, 0 representing complete inability to perform the task and 100 representing no limitations in walking short and long distances, walking at a fast pace, and climbing three flights of stairs. health - related quality of life was measured using the medical outcomes study (mos) short form survey (sf-36) (19). each subscale is scored from 0 to 100 ; higher scores indicate more positive quality of life. depressive symptoms, which are associated with walking impairment in patients with pad (20), were measured using the geriatric depression score, a 15-item screening instrument. we measured self - efficacy self - confidence to perform certain activities to manage their disease using the six - item self - efficacy for managing chronic disease scale (21). the association of self - efficacy with walking ability, measured in these patients at baseline, is reported elsewhere (22). we administered the stanford patient education research center exercise behavior survey during each follow - up phone call. the exercise behaviors survey is a six - item instrument with questions regarding the type of activity and the length of time during which the patient engaged in that activity during the past week (23). during each biweekly phone call, study staff asked whether the patient had developed chest pain, shortness of breath, or any symptoms requiring hospitalization in the past 2 weeks. if the participant responded yes, he / she was asked about diagnostic testing, final diagnosis, and whether the hospital physician stated the participant could continue in the study. the study staff also ascertained leg symptoms, testing for pad (e.g., angiography), or invasive therapy for pad. intervention and control groups were compared according to baseline characteristics using fisher s exact tests for categorical variables and t tests (two - sided) for continuous variables. analyses were done using sas (v. 9.1.3 ; sas institute, cary, nc). the treatment groups were compared according to change from baseline to 6- and 3-month follow - up using the same tests. as a check for selection bias from dropouts, we performed longitudinal analyses of four outcomes, the primary outcome and three secondary outcomes of particular interest : treadmill walking distance, walking speed from the walking impairment questionnaire, and the physical and mental health aggregates of sf-36. the analysis used a mixed linear model, including up to 3 cases per participant (baseline, 3 months, 6 months), using all available data. treatment groups were compared according to change from baseline to the average of the 3- and 6-month visits, an average treatment effect over the two follow - ups. the longitudinal results were very similar to the simpler comparisons of changes by the 3- and 6-month visits and are reported briefly. a priori, 64 patients per arm gave 80% power to detect a moderate standardized effect size of 0.50 (a difference between groups of 0.06 miles in average change in treadmill walking distance). 1). of the 462 eligible for an in - person visit, we excluded 371 for lack of objective evidence of pad or inability to complete treadmill testing. we enrolled 145 participants ; 19 (13.1%) provided no treadmill outcome measures at the 6-month follow - up visit. atherosclerotic risk factors were common : 106 (73%) participants were former or current smokers and 119 (82%) had hypertension. at baseline, 19 (26%) baseline characteristics by randomized group for the baseline outcome measures, data are mean (sd). fisher s exact test for categorical variables and t tests for continuous variables ; two answered more than one category ; t tests comparing means of the two randomized groups ; physical functioning, role - physical, bodily pain, general health, vitality, social functioning, role - emotional, and mental health are captured by the mos sf-36. overall, subjects walked a mean distance of 448 m (sd 237.1) on the treadmill at baseline. considering changes from baseline to 6 months (table 2), intervention and control groups did not differ significantly in the primary outcome, change in maximal treadmill walking distance (average [se ] change : control 39.2 [19.6 ] meters, intervention 24.5 [19.6 ] ; p = 0.60), or change in treadmill walking distance until onset of pain (average [se ] change : control 52.3 [23.6 ] meters, intervention 66.7 [21.0 ] ; p = 0.65). the intervention group had greater improvement than control subjects in two secondary outcomes, walking speed and mental health. the intervention group 's average walking speed improved by 5.7 (2.2) percentage points, whereas the control group 's average score decreased by 1.9 (2.8) percentage points (p = 0.034) ; and the intervention group 's mental - health average score improved by 3.2 (1.5) units, compared with a decrease of 2.4 (1.5) units for the control group (p = 0.01). there was a nonsignificant trend toward greater improvement in quality of life (i.e., physical functioning and role - emotional) for the intervention group compared with the control group. comparison of intervention and control groups and change from baseline to 6 months p value from a t test ; physical functioning, role - physical, bodily pain, general health, vitality, social functioning, role - emotional, and mental health are captured by the mos sf-36. results from the longitudinal analyses differed little from those in the simple analyses of change to 6- and 3-month follow - up. for example, in the longitudinal analysis of walking speed, the intervention group improved by 7.6 units more than the control group (se 3.0, p = 0.013 ; compare with table 2). for our primary outcome, the effect of study treatment differed depending on whether the subjects were taking claudication medication at baseline (p = 0.0025 in a test of the interaction) ; overall, the study groups did not differ significantly in the primary outcome of maximal treadmill walking distance after adjusting for baseline use of claudication medication (p = 0.074). additionally, there were no significant differences between study groups in 3 or 6-month changes in walking speed, physical functioning, mental health, physical component summary score, or mental component summary score after adjusting for baseline use of claudication medication. we have presented results from the first large - scale trial of a home - based walking intervention for people with dm and pad. a 6-month home - based walking program did not improve the primary outcome of 6-month change in maximal treadmill walking distance compared with control. however, the 6-month home - based walking program did improve some secondary outcomes, specifically walking speed and 6-month physical functioning and mental health (i.e., role - emotional). these results suggest that home - based walking holds promise for improving walking speed and quality of life in people with dm and pad. earlier studies of walking interventions in pad demonstrated improvement in walking speed, but they were based on supervised treadmill walking interventions (24,25). our intervention was home - based, with one weekly group walking class, and can be easily implemented in clinical practice. an additional benefit of our intervention was improvement in mental health per the sf-36 quality of life measure. prior trials (24,25) showed improved quality of life for people with pad who completed a supervised treadmill walking program. we add to these prior studies by showing improved quality of life for people with pad randomized to a 6-month home - based walking intervention. both physical and role - emotional functioning were improved for people randomized to the intervention. although these improvements were not statistically significant, the changes highlight the need for development of more robust home - based walking interventions in future trials targeting people with pad. when comparing intervention to control, there were trends toward benefit for several outcome measures including time to onset of pain, walking impairment parameters (i.e., distance, stair climbing), all quality of life subscale scores, and exercise behaviors. we found no differences between the intervention and control groups on changes from baseline to 6 months in the outcomes of self - efficacy or depressive symptoms. we did find an association of self - efficacy with walking ability at baseline (22), but the final results from the trial suggest that our intervention did not affect self - efficacy. strengths of this study include a 6-month intervention focused on home - based walking and patients with diabetes with pad and either intermittent claudication or atypical leg symptoms. this latter group, people with dm and pad with atypical leg symptoms, is often underrepresented in exercise trials for pad. an additional strength of this study was the translation of an intervention initially developed for a primary - care clinical setting (i.e., pace) into a community - based intervention to promote home - based walking in a high - risk population. limitations of the study include possible contamination of the attention control group, since the counselors were the same for both groups. additionally, over 90% of participants enrolled in the study because they hoped to increase their walking. this was discovered in a close - out survey in which participants were asked about their perceptions of the study and whether enrolling in the study motivated them to walk. this finding highlights the need to carefully develop recruitment materials so the focus of intervention is not so apparent as to lead to participation bias. we used various methods to increase minority participation (e.g., announcements on radio stations in which listening audiences were largely minorities, attendance at churches in which members were minorities) but, given that most study assessments required visiting the university and people in the community were not as willing to do that, less than 10% of our participants were ethnic minorities. finally, at baseline, control participants were more likely to use claudication medication than intervention participants. this could have influenced the trend toward a greater change in the primary outcome for control as compared with intervention participants. our study is the first large - scale walking intervention trial in pad to use home - based walking versus an attention control. we demonstrated that a home - based walking program can be used in patients with dm and pad. such a program may improve walking speed and quality of life in this high - risk population. | objectivedetermine the efficacy of a home - based walking intervention to improve walking ability and quality of life in people with diabetes and peripheral arterial disease (pad).research design and methodswe conducted a randomized, controlled, single - blind trial within university - affiliated clinics in our local community. we randomized 145 participants (45 women) with diabetes and pad to our intervention a 6-month behavioral intervention targeting levels of readiness to engage in routine walking for exercise versus attention control. our primary outcome was 6-month change in maximal treadmill walking distance. secondary outcomes included 3-month change in maximal walking distance, lower limb function (i.e., walking impairment scores), quality of life (medical outcomes short form survey), exercise behaviors, depressive symptoms, and self - efficacy at 3 and 6 months.resultsthe mean age of participants was 66.5 (sd 10.1) years. intervention and control groups did not differ significantly in 6-month change in maximal treadmill walking distance (average [se ] 24.5 [19.6 ] meters vs. 39.2 [19.6 ] meters ; p = 0.60). among secondary outcomes, for the intervention and control groups, respectively, average walking speed scores increased by 5.7 [2.2 ] units and decreased by 1.9 [2.8 ] units (p = 0.03) ; the mental health quality of life subscale score increased by 3.2 [1.5 ] and decreased by 2.4 [1.5 ] units (p = 0.01).conclusionsa home - based walking intervention did not improve walking distance but did improve walking speed and quality of life in people with diabetes and pad. clinicians should consider recommending home - based walking therapy for such patients. |
dry eye disease is one of the most common public health problems in the field of ophthalmology that causes decreased physical, psychological, social and occupational functioning, and interferes with daily activities like reading, driving, computer work and watching tv. the effect of this disease on quality of life is similar to severe migraine and angina. outbreaks are increasing with the use of contact lenses and refractive surgery such as lasik. the purpose of this paper is to assess the causes of dry eye and its prevention by the principles of hygiene. in this review study, traditional medicine resources like al canon fil tibb, sharh - al - al asbab and exir - e - azam have been studied with engine motors such as google scholar and pubmed. from the perspective of iranian traditional medicine, the principles of maintaining health include air, food and drink, exercise and rest, sleep and wakefulness, mental state, retention of essential materials and depletion of wastes from the body. proper performance of each principle is useful for the prevention of disease in different organs, including the eyes. recommendations for the prevention or treatment of dry eye disease include the prevention of dryness in the eye or the entire body. accordingly, one of the most effective managements of dry eye disease is avoiding foods that affect the eye in this way ; for example garlic and onion. maintaining eye health is related to aspects of physical and mental health of the whole body. therefore, codification of an integrated plan that contains eating and sleeping patterns, exercise, general clearing, eye clearing, and mental health is essential for treating dry eye disease. | background : dry eye disease is one of the most common public health problems in the field of ophthalmology that causes decreased physical, psychological, social and occupational functioning, and interferes with daily activities like reading, driving, computer work and watching tv. the effect of this disease on quality of life is similar to severe migraine and angina. in addition, the severity of the disease is closely related to depression. outbreaks are increasing with the use of contact lenses and refractive surgery such as lasik. the purpose of this paper is to assess the causes of dry eye and its prevention by the principles of hygiene.methods:in this review study, traditional medicine resources like al canon fil tibb, sharh - al - al asbab and exir - e - azam have been studied with engine motors such as google scholar and pubmed.results:from the perspective of iranian traditional medicine, the principles of maintaining health include air, food and drink, exercise and rest, sleep and wakefulness, mental state, retention of essential materials and depletion of wastes from the body. proper performance of each principle is useful for the prevention of disease in different organs, including the eyes. recommendations for the prevention or treatment of dry eye disease include the prevention of dryness in the eye or the entire body. in addition, the stomach and brain are important to eye health. accordingly, one of the most effective managements of dry eye disease is avoiding foods that affect the eye in this way ; for example garlic and onion.conclusion:maintaining eye health is related to aspects of physical and mental health of the whole body. therefore, codification of an integrated plan that contains eating and sleeping patterns, exercise, general clearing, eye clearing, and mental health is essential for treating dry eye disease. |
our study sample comprised all patients newly diagnosed with type 1 diabetes consecutively admitted to the steno diabetes center between 1 september 1979 and 31 august 1984. nine patients were excluded ; seven because of serious mental illness and two because of microalbuminuria at the onset of diabetes. plasma 25(oh)d3 was analyzed in samples from approximately 3 years after diagnosis or the subsequently closest available sample (median [range ] years after diagnose = 3.0 [2.39.1 ]) and before any of the patients developed microalbuminuria. the patients attended the outpatient clinic every 3 or 4 months as part of routine follow - up. they were treated by diabetologists and nurses according to previously described guidelines (12). twenty - four hour urinary albumin excretion rate (uaer) was measured in each patient at least once a year (12). development of persistent microalbuminuria and persistent macroalbuminuria were defined as uaer between 30 and 300 mg/24 h and > 300 mg/24 h, respectively, in at least two of three consecutive samples, with an increase of at least 30% above the baseline level (13,14). plasma 25(oh)d3 is found to be stable when tested after more than 10 years of storage (15), making long - term epidemiologic studies of circulating plasma 25(oh)d3 possible. before initiation of the current study, we tested the stability of plasma 25(oh)d3 in samples taken from this exact cohort. we analyzed plasma 25(oh)d3 in samples taken from the same subjects at the same time of year and stored for 5, 10, 15, 20, and 25 years. no statistical significant difference between mean levels of plasma 25(oh)d3 was shown (data not shown). plasma levels of 25(oh)d3 were determined by high performance liquid chromatography / tandem mass spectrometry (department of clinical biochemistry, lilleblt hospital, vejle, denmark). a plasma 25(oh)d3 value equal to or below the 10% percentile (15.5 nmol / l) was considered severe vitamin d deficiency in accordance with our previous study on vitamin d and mortality in type 2 diabetes (3). patients were classified as smokers if they smoked more than one cigarette a day ; smoking history was elicited by questionnaire. retinopathy was assessed through dilated pupils and graded as absent, background, or proliferative (12). baseline data are from first assessment 6 months after the onset of type 1 diabetes, after initial glycemic stabilization. variables with skewed distribution are expressed as medians (interquartile range) ; values for all other variables are means (sd). for nonnormally distributed variables, comparisons between groups were performed using the mann - whitney u test, and unpaired student t tests were used for normally distributed variables. whether low vitamin d levels predicted all - cause mortality in an explanatory model, a cox proportional hazards regression analysis was performed. initially, a univariate analysis was performed using baseline variables (sex, age, plasma total cholesterol, systolic blood pressure, uaer, smoking), all which have previously been shown to be associated with increased all - cause mortality. all time - to - event variables were analyzed with a log - rank test and displayed as kaplan - meier plots according to levels of vitamin d either above or below the lower 10% percentile. all statistical calculations were performed using spss for windows, version 14.0 (spss, chicago, il) baseline data are from first assessment 6 months after the onset of type 1 diabetes, after initial glycemic stabilization. variables with skewed distribution are expressed as medians (interquartile range) ; values for all other variables are means (sd). for nonnormally distributed variables, comparisons between groups were performed using the mann - whitney u test, and unpaired student t tests were used for normally distributed variables. whether low vitamin d levels predicted all - cause mortality in an explanatory model, a cox proportional hazards regression analysis was performed. initially, a univariate analysis was performed using baseline variables (sex, age, plasma total cholesterol, systolic blood pressure, uaer, smoking), all which have previously been shown to be associated with increased all - cause mortality. all time - to - event variables were analyzed with a log - rank test and displayed as kaplan - meier plots according to levels of vitamin d either above or below the lower 10% percentile. all statistical calculations were performed using spss for windows, version 14.0 (spss, chicago, il) we followed 220 patients newly diagnosed with type 1 diabetes for a median (range) of 26.0 (1.029.0) years. the median (range) vitamin d concentration was 44.6 (1.7161.7) nmol / l. baseline clinical and laboratory characteristics of 220 type 1 diabetic patients in accordance with levels of 25(oh)d3 data are n, means (sd), or medians (interquartile range). the patients were divided into two subgroups based on their vitamin d level being either equal to and below or above the value of the lower 10% percentile. nmol / l in both men and women, and 22 (10%) of the 220 included patients with a vitamin d value below this level. vitamin d level was not associated with age, sex, uaer, and blood pressure, but a weak negative association was found with hba1c. (r = 0.14, p = 0.04). during follow - up, 44 (20%) of seven of the 22 (32%) patients with vitamin d levels 15.5 nmol / l died compared with 37 (19%) of the patients with vitamin d levels > 15.5 nmol / l (p = 0.06). figure 1 shows a kaplan - meier curve for mortality according to a vitamin d level equal to and below or above the lower 10% percentile. in a cox proportional hazards model, the unadjusted hr (95% ci) for mortality in subjects with vitamin d levels equal to or below the lower 10% percentile was 2.0 (0.94.4), p = 0.1. the association persisted and became statistically significant after adjustment for uaer, hba1c, and conventional cardiovascular risk factors (age, sex, blood pressure, cholesterol, smoking) (covariate adjusted hr 2.7 [1.16.7 ], p = 0.03). an analysis of vitamin d as a continuous variable in the cox model could not demonstrate a significant relation to all - cause mortality, suggesting the relationship is not linear over the range of vitamin d values. kaplan - meier curves of all - cause mortality in 220 type 1 diabetic patients in accordance with a vitamin d level equal to and below or above the lower 10% percentile, 25(oh)d3 = 15.5 nmol / l ; dashed black line, 25(oh)d3 15.5 nmol / l. during follow - up, 81 (34%) of these patients, 6 (27%) had a vitamin d level equal to or below the lower 10% percentile. of the 81 patients who developed microalbuminuria, 27 (12%) progressed to persistent macroalbuminuria, but only 2 of the patients with vitamin d levels equal to or below the lower 10% percentile progressed, corresponding to 9%. a cox proportional hazards model showed that low vitamin d levels at baseline did not predict the development of micro- or macroalbuminuria (unadjusted hr 1.1 [0.52.4 ], p = 0.8 and hr 1.3 [0.35.4 ], p = 0.7, respectively). a total of 192 (80%) patients developed background retinopathy, and 18 (82%) of the patients had vitamin d levels equal to or below the lower 10% percentile. of the 192 patients, 34 (15%) patients progressed to proliferative retinopathy, and one of these patients had low vitamin d level at baseline, corresponding to 5%. vitamin d levels equal to or below the lower 10% percentile at baseline did not predict development of background retinopathy or proliferative retinopathy (hr 1.1 [0.71.7 ], p = 0.8 and hr 3.1 [0.422.9 ], p = 0.3, respectively). after adjusting for progression promoters, the associations between severe vitamin d deficiency at baseline and development or progression of microvascular complications weakened further. of these patients, 6 (27%) had a vitamin d level equal to or below the lower 10% percentile. of the 81 patients who developed microalbuminuria, 27 (12%) progressed to persistent macroalbuminuria, but only 2 of the patients with vitamin d levels equal to or below the lower 10% percentile progressed, corresponding to 9%. a cox proportional hazards model showed that low vitamin d levels at baseline did not predict the development of micro- or macroalbuminuria (unadjusted hr 1.1 [0.52.4 ], p = 0.8 and hr 1.3 [0.35.4 ], p = 0.7, respectively). a total of 192 (80%) patients developed background retinopathy, and 18 (82%) of the patients had vitamin d levels equal to or below the lower 10% percentile. of the 192 patients, 34 (15%) patients progressed to proliferative retinopathy, and one of these patients had low vitamin d level at baseline, corresponding to 5%. vitamin d levels equal to or below the lower 10% percentile at baseline did not predict development of background retinopathy or proliferative retinopathy (hr 1.1 [0.71.7 ], p = 0.8 and hr 3.1 [0.422.9 ], p = 0.3, respectively). after adjusting for progression promoters, the associations between severe vitamin d deficiency at baseline and development or progression of microvascular complications weakened further. in this 26-year prospective observational follow - up study, we found very low levels of plasma 25(oh)d3 (equal to or below the 10% percentile) after onset of diabetes to be a strong and independent predictor of all - cause mortality in type 1 diabetic patients. this association was not only independent of glycemic control and conventional cardiovascular risk factors, but also independent of uaer. severe vitamin d deficiency at baseline did not predict development or progression of microvascular complications in the eye and kidney. our finding of an association between severe vitamin d deficiency and increased risk of mortality complement recent data from epidemiological studies suggesting similar associations in other populations. for the general population, a cross - sectional study of 13,331 participants from the national health and nutrition examination survey (nhanes) iii (2) showed low vitamin d levels to be associated with all - cause mortality. a study of mainly nondiabetic ckd patients (16) found vitamin d to independently predict all - cause mortality and increased risk of progression to dialysis. also among patients with nondiabetic end - stage renal disease, low levels of vitamin d have been associated with all - cause mortality (17). in healthy subjects, vitamin d deficiency mainly results from inadequate sunlight exposure, skin color, and inadequate nutritional supply of vitamin d containing foods. seasonal variations in vitamin d levels occur depending on geographic latitude and sun exposure in particularly. a study (18) done in the general population in a northern european country showed a seasonal variation of vitamin d insufficiency of 73% and 29% for winter and summer, respectively. furthermore, several conditions such as obesity and absorption, liver, or kidney disorders pose an increased risk of developing vitamin d deficiency. the mechanisms of action behind the increased mortality risk seen among patients with the lower levels of vitamin d at baseline are unclear. a growing amount of evidence indicates that vitamin d, through activation of the vitamin d receptor, has clinically important noncalcemic pleiotropic effects. activation of the vitamin d receptor is associated with suppression of the raas (19), cardiac myocyte hypertrophy (20), vascular calcification, and atherosclerosis lowering, anti - inflammatory (21), and immunomodulatory actions. also, an inverse relationship is found between vitamin d and increased incident risk of certain cancers as well as a higher mortality from these cancers (1). diabetic patients have a higher rate of cardiovascular morbidity and mortality compared with the general population. in a 10 year follow - up study of a cohort of 593 normoalbuminuric patients with type 1 diabetes, we have previously shown that more than one - third died of known cardiovascular causes and 25% died of unknown, potentially cardiovascular causes (4), hence a large number of the observed deaths in the cohort of the current study are likely to be from cardiovascular causes. in a cross - sectional study of type 2 diabetic patients with mild kidney impairment, vitamin d deficiency was shown to be strongly associated with a higher prevalence of manifest cardiovascular disease when compared with normal vitamin d status (22). in a recent study of type 2 diabetic patients (23), which investigated the mechanism by which vitamin d deficiency mediates increased risk of cardiovascular disease, investigators found a reduced vitamin d receptor signaling to be a potential mechanism underlying increased foam cell (macrophages that ingested oxidized ldl) formation and accelerated cardiovascular disease in diabetic compared with nondiabetic patients. given the observational design, the current study does not elaborate further on underlying mechanisms but indirectly adds to the increasing amount of data suggesting that vitamin d substitution might be a potential therapeutic target to prevent vascular disease progression. however, it is not possible to rule out that low levels of vitamin d may result from a single yet unidentified factor that is at the same time responsible for the increased risk seen in this study. the pathogenesis behind microvascular complications in diabetes is complex and thought to involve multiple pathways. development of microalbuminuria in diabetic patients is closely associated with an increased risk of both renal and cardiovascular disease. it has been suggested that microalbuminuria often regresses to normoalbuminuria, but in this cohort, spontaneous and permanent regression to normoalbuminuria occurred in only 16% of the patients progressing to microalbuminuria, whereas 34% progressed to persistent macroalbuminuria during follow - up (24). of particular importance to diabetic nephropathy is an activation of the intrarenal raas and the proinflammatory nuclear factor-b pathway, both promoting progressive renal damage. in a post (10) found that administration of a vdra compared with placebo caused reduction in albuminuria in nondiabetic ckd as measured by a dipstick method (p = 0.004). importantly, the effects appeared to be independent of concomitant therapies to inhibit the raas. recently the vital study, a randomized controlled clinical trial with 281 type 2 diabetic patients with diabetic nephropathy, has shown that administration of a vdra (paricalcitol) in addition to blockade of the raas causes sustained reduction in albuminuria and thereby potentially has clinically relevant renoprotective effects in patients with diabetic nephropathy (11). a cross - sectional study of 581 type 2 diabetic patients shows significant association between the existence of proliferative retinopathy and a decrease in 25(oh)d3. also, investigators found a decrease in 25(oh)d3 according to the number of microvascular complications present (25). a cross - sectional design does not contribute to clarification on causality and effect, but fuels speculation that low levels of vitamin d might be a risk marker of development or progression of both diabetic nephropathy and/or retinopathy. in this study, however, we did not find low 25(oh)d3 levels to significantly predict development or progression of microvascular complications. this could be because of the lack of power based on a low number of events as the hr for both retinopathy and albuminuria was above 1 in patients with severe vitamin d deficiency. it is also possible that a potentially damaging effect of low vitamin d is offset by optimized patient treatment aiming at improving blood glucose and lowering blood pressure inclusive of raas blockade. in our study, international consensus is lacking in regard to definitions of what vitamin d levels are to be regarded as normal, insufficiency, and deficiency. the limits for a physiological optimal vitamin d level are still a matter of debate in the literature. although 25(oh)d3 is shown to be stable in stored samples (15), storing could affect absolute concentrations because of evaporation, thus we arbitrarily chose the lower 10% percentile rather than an absolute value. we have previously used the same method to define the cutoff in a follow - up study in type 2 diabetic patients (3). furthermore, we have recently analyzed plasma 25(oh)d3 in fresh samples from 200 type 2 diabetic patients and we found the lower 10% percentile in these patients to deviate only 0.1 nmol / l from the danish national definition of severe vitamin d deficiency existing at the time. the stability of plasma 25(oh)d3 levels in our samples was tested before analysis as previously described. no statistically significant difference in levels was found when compared according to years of storage. one element of methodological strength is the prospective design and long follow - up period as well as completeness of follow - up. given the observational design, it is not possible to infer causality from the associations described. further limitations of our study are related to possible changes in the level of vitamin d throughout the year. we did not adjust for seasonal change. nor did we have baseline data on physical activity, which could be related to outdoor activity, sun exposure and thereby levels of vitamin d. vitamin d levels are also influenced by nutritional status. unfortunately no nutritional parameters were available except bmi, which was not related to vitamin d levels (data not shown). we were therefore not able to adjust for any of these possible cofounders, but in general, the patients were young and healthy apart from newly diagnosed type 1 diabetes. more observational studies are needed to confirm this finding, but as mentioned, we have performed the same analysis in a cohort consisting of type 2 diabetic patients and found similar results in regards to all - cause mortality and development / progression of diabetic nephropathy. furthermore, in the study comprising type 2 diabetic patients, very low levels of 25(oh)d3 were also able to predict an increased risk of cardiovascular disease. another limitation to the current study is that we do not have access to data on the cause of death. in conclusion, with the present prospective follow - up study we are now able to show that baseline levels of 25(oh)d3 equal to or below the 10% percentile predict increased risk of all - cause mortality in type 1 diabetic patients, as already shown for the general population, in patients with nondiabetic ckd and for patients with type 2 diabetes (3). we were not able to demonstrate an association between baseline levels of 25(oh)d3 equal to or below the 10% percentile and development of microvascular complications in type 1 diabetic patients. randomized controlled clinical trials administrating vdra are necessary in order to prove causality between vitamin d status and survival prognosis in diabetic patients. | objectiveto evaluate vitamin d as a predictor of all - cause mortality, progression from normoalbuminuria to micro- or macroalbuminuria, and the development of background or proliferative retinopathy in patients with type 1 diabetes.research design and methodsa prospective observational follow - up study in which an inception cohort of type 1 diabetic patients was followed from onset of diabetes diagnosed between 1979 and 1984. plasma vitamin d [25(oh)d3 ] levels were determined by high performance liquid chromatography / tandem mass spectrometry in 227 patients before the patients developed microalbuminuria. values equal to or below the 10% percentile (15.5 nmol / l) were considered severe vitamin d deficiency.resultsmedian (range) vitamin d was 44.6 (1.7161.7) nmol / l. vitamin d level was not associated with age, sex, urinary albumin excretion rate (uaer), or blood pressure. during follow - up, 44 (18%) patients died. in a cox proportional hazards model, the hazard ratio for mortality in subjects with severe vitamin d deficiency was 2.7 (1.16.7), p = 0.03, after adjustment for uaer, hba1c, and conventional cardiovascular risk factors (age, sex, blood pressure, cholesterol, smoking). of the 220 patients, 81 (37%) developed microalbuminuria and 27 (12%) of these progressed to macroalbuminuria. furthermore, 192 (87%) patients developed background retinopathy, whereas 34 (15%) progressed to proliferative retinopathy. severe vitamin d deficiency at baseline did not predict the development of these microvascular complications.conclusionsin patients with type 1 diabetes, severe vitamin d deficiency independently predicts all - cause mortality but not development of microvascular complications in the eye and kidney. whether vitamin d substitution in type 1 diabetic patients can improve the prognosis remains to be investigated. |
the optimal timing for treatment in dentofacial orthopedics is linked intimately to the identification of periods of accelerated or intense growth that contribute significantly to the correction of skeletal imbalances in an individual patient. precise evaluation of the developmental stage forms an integral part of both diagnosis and treatment plan for pediatric patients. different authors have advocated various methods of determining skeletal maturity based on radiographs of specific structures, such as epiphysis - diaphysis fusion of long bones, medial extremity of the clavicle, epiphyseal head of the first rib, epiphyseal union of the anterior iliac crest, and fusion of the sphenoid bone with the basilar part of the occipital bone. however, these skeletal methods not only present some inconveniences in view of the variability of bone maturation, as influenced by environmental factors, but necessitate additional radiographs as well. the hand - wrist radiograph has been one of the most commonly used methods for skeletal developmental assessment. panoramic and lateral cephalometric radiographs form a part of essential diagnostic examination for the comprehensive diagnosis and treatment planning of an orthodontic patient. apart from its use in studying skeletal, dental, and soft - tissue structures, the usefulness of lateral cephalometric radiographs for assessing maturation has also been studied. a distinct advantage of cervical maturity evaluation is that it does not entail extra radiation exposure for the orthodontic patient. hand - wrist and cervical maturation methods are highly correlated, therefore it does not justify to take an extra hand wrist radiograph for skeletal maturation determination. hassel and farman suggested six stages of classification of the cervical vertebrae based on the shape of the second to the fourth vertebrae on lateral cephalogram. apart from viewing maxillomandibular structures, an orthopantomogram can also be used to assess the dental maturity of the patient. dental development can be assessed from either the phase of tooth eruption or the stage of tooth calcification, with the latter being more reliable. proposed a method for estimation of the subject 's dental maturity based on eight calcification stages, which span from the first sign of tooth calcification to apex closure for the seven left permanent mandibular teeth. however, short time intervals between different developmental stages may adversely affect the possibility of identifying the relationship between tooth development and maturation. the third molar offers a unique advantage over other teeth because its development tends to continue for a longer period and until a later age (8 - 18 years). the continuation of third molar development during adolescence provides a different point of reference from the other teeth. if a positive correlation between third molar development and general growth can be evaluated, it would be possible to use the third molar as a growth indicator in pubertal patients. this study has been conducted to estimate dental maturity using the demirjian index (di) for the mandibular third molar, to investigate the relationships between dental maturity and cervical vertebral skeletal maturity among growing patients, and to evaluate the clinical value of the third molar as a growth evaluation index. the aims and objectives of this study were : to estimate dental maturity using the di for the mandibular third molarto investigate the relationship between dental maturity and skeletal maturity among growing patientsto evaluate the use of the mandibular third molar as an adjunctive tool for assessment of adolescent growth in combination with cervical vertebraeto evaluate the clinical value of the third molar as a growth evaluation index. to estimate dental maturity using the di for the mandibular third molar to investigate the relationship between dental maturity and skeletal maturity among growing patients to evaluate the use of the mandibular third molar as an adjunctive tool for assessment of adolescent growth in combination with cervical vertebrae to evaluate the clinical value of the third molar as a growth evaluation index. the samples were derived from panoramic, lateral cephalometric radiographs of 300 male and 315 female subjects registered as patients at the department of orthodontics at government dental college and hospital, ahmedabad, gujarat, india. the age range of the sample in females was 9 - 18 years with the mean age of 14 years, and in males was 10 - 18 years with the mean age of 13.4 years. the following criteria in individuals were used for the selection of subjects : well - nourished and free of any known serious diseasenormal growth and dental development ; no missing teeth or supernumerary teethno congenital oral or maxillofacial anomalies such as cleft lip and palate. well - nourished and free of any known serious disease normal growth and dental development ; no missing teeth or supernumerary teeth no congenital oral or maxillofacial anomalies such as cleft lip and palate. in this study, the lower left third molar has been used as a sample because of higher estimation errors in calculating the maturation of the upper molar than the lower molar. the root of the upper third molar may overlap with anatomic structures such as the palate, the inferior border of the zygomatic arch, or the maxillary sinus septum. cases in which the development of the left and right third molars differed remarkably or in which developmental anomalies were observed were excluded. in which one of eight stages of calcification (a to h) was assigned to the third molar tooth [table 1 and figure 1 ]. dental calcification stages using di dental calcification stages using the di the cervical vertebrae maturation indicators (cvmi) were evaluated by dividing the second, third, and fourth vertebrae into six groups depending on their maturation patterns on lateral cephalogram using the classification of hassel and farman [table 2 and figure 2 ]. each sample is assigned di (a to h) based on the mandibular third molar development and cervical maturation stage based on skeletal maturation. all the data thus compiled from the lateral cephalogram and panoramic radiographs of the samples were subjected to appropriate statistical analysis. we performed statistical analysis using microsoft office excel 2007 (microsoft) and ibm - spss version 22 software (ibm inc.). the mean values of chronologic age in males and females were calculated at each stage of the di. the median values of cvmi stages were calculated at each stage of the di in males and females. to study the relationship between di and the cvmi, the frequency and the percentage distribution of the stages of calcification were recorded for each tooth, and the pearson chi - square test (x) value and correlation coefficient (r) were estimated to determine the relationships between di and cvmi. independent sample t - tests were performed for comparison of mean age at different stages of di between males and females. the following criteria in individuals were used for the selection of subjects : well - nourished and free of any known serious diseasenormal growth and dental development ; no missing teeth or supernumerary teethno congenital oral or maxillofacial anomalies such as cleft lip and palate. well - nourished and free of any known serious disease normal growth and dental development ; no missing teeth or supernumerary teeth no congenital oral or maxillofacial anomalies such as cleft lip and palate. in this study, the lower left third molar has been used as a sample because of higher estimation errors in calculating the maturation of the upper molar than the lower molar. the root of the upper third molar may overlap with anatomic structures such as the palate, the inferior border of the zygomatic arch, or the maxillary sinus septum. cases in which the development of the left and right third molars differed remarkably or in which developmental anomalies were observed were excluded. in which one of eight stages of calcification (a to h) was assigned to the third molar tooth [table 1 and figure 1 ]. dental calcification stages using di dental calcification stages using the di the cervical vertebrae maturation indicators (cvmi) were evaluated by dividing the second, third, and fourth vertebrae into six groups depending on their maturation patterns on lateral cephalogram using the classification of hassel and farman [table 2 and figure 2 ]. each sample is assigned di (a to h) based on the mandibular third molar development and cervical maturation stage based on skeletal maturation. all the data thus compiled from the lateral cephalogram and panoramic radiographs of the samples were subjected to appropriate statistical analysis. in this study, the lower left third molar has been used as a sample because of higher estimation errors in calculating the maturation of the upper molar than the lower molar. the root of the upper third molar may overlap with anatomic structures such as the palate, the inferior border of the zygomatic arch, or the maxillary sinus septum. cases in which the development of the left and right third molars differed remarkably or in which developmental anomalies were observed were excluded. in which one of eight stages of calcification (a to h) was assigned to the third molar tooth [table 1 and figure 1 ]. the cervical vertebrae maturation indicators (cvmi) were evaluated by dividing the second, third, and fourth vertebrae into six groups depending on their maturation patterns on lateral cephalogram using the classification of hassel and farman [table 2 and figure 2 ]. each sample is assigned di (a to h) based on the mandibular third molar development and cervical maturation stage based on skeletal maturation. all the data thus compiled from the lateral cephalogram and panoramic radiographs of the samples were subjected to appropriate statistical analysis. we performed statistical analysis using microsoft office excel 2007 (microsoft) and ibm - spss version 22 software (ibm inc.). the mean values of chronologic age in males and females were calculated at each stage of the di. the median values of cvmi stages were calculated at each stage of the di in males and females. to study the relationship between di and the cvmi, the frequency and the percentage distribution of the stages of calcification were recorded for each tooth, and cross - tabular statistics were performed. the pearson chi - square test (x) value and correlation coefficient (r) were estimated to determine the relationships between di and cvmi. independent sample t - tests were performed for comparison of mean age at different stages of di between males and females. tables 3 and 4 show the mean age for each stage of di in males and females, respectively. although the mean ages at different stages of di individually indicate that lower third molar development is completed earlier in males than in females, it was statistically insignificant except in stage d [table 5 ]. mean chronological age along with the development of the third molar (di) (male) mean chronological age along with the development of the third molar (di) (female) comparison of the mean age between males and females at different stages of di in this study, the results of the chi - square test show the statistically significant interdependence of di and cvmi in males (p < 0.0001) [degree of freedom (df) = 35 ] [table 6 ] as well as in females (p < 0.0001) (df = 28) [table 7 ]. interdependence between di and cvmi (male), chi - square test interdependence between di and cvmi (female), chi - square test there was found a statistically significant positive correlation between the development of the third molar (di) and cvmi in both males (r = 0.81) (p < 0.0001) and females (r = 0.72) (p < 0.0001). di and mean age also have a high positive correlation in both males (r = 0.79) (p < 0.0001) and females (r = 0.80) (p < 0.0001). in addition, cvmi and mean age have a high positive correlation in both males (r = 0.84) (p < 0.0001) and females (r = 0.84) (p correlation between di, cvmi, and chronological age (male), pearson correlation statistical test correlation between di, cvmi, and chronological age (female) in males, distribution of cvmi to di [table 10 ] shows that di stage b is characterized by their concentration of cvmi stage 2 (66.7%), di stage c is characterized by their concentration of cvmi stage 3 (60.0%), and di stage d is characterized by their concentration of cvmi stage 3 (40.9%) and stage 4 (50%). in females, distribution of cvmi stage to di [table 11 ] shows that di stage b is characterized by their concentration of cvmi stage 2 (42.9%) and stage 3 (42.9%), di stage c is characterized by their concentration of cvmi stage 3 (53.3%) and stage 4 (33.3%), di stage d is characterized by their concentration of cvmi stage 4 (31.8%) and stage 5 (43.2%), and di stage e is characterized by their concentration of cvmi stage 5 (42.9%) and stage 6 (42.9%). frequency distribution of cvmi by di (male) frequency distribution of cvmi by di (female) maturational indices have been proposed to evaluate skeletal maturity in the growing patient when planning orthodontic / orthopedic treatment or for clinical and research purposes. the ease of recognizing the stages of dental development and the availability of panoramic radiography are practical reasons for attempting to assess physiologic maturity without resorting to hand - wrist radiograph. (alara) principle is especially important for children and young adults, and thus high - radiation methods should not be used frequently to assess growth. dental maturity, in particular, has an advantage of being easily evaluable during regular dental treatment. dental maturity is determined by the stage of tooth eruption or the stage of tooth formation. chertkow indicated that the completion of root formation in the mandibular canines prior to apical closure may be used clinically as a maturity indicator for pubertal growth spurts with the same degree of confidence as the indicators described for hand - wrist radiographs among white children. however, root formation and apex closure of mandibular canines are completed by the age of 13 years, and most children exhibit active growth up to the age of 16 - 17 years. a study by bolanos. showed that the root formation of the third molar is complete at an average of 18.5 years. the third molar has a unique feature compared to other teeth in that its development tends to continue over a long period and until a later age. the continuation of third molar development during adolescence provides a different point of reference from the other teeth. recent studies have verified that demirjian 's classification system shows the least intraexaminer and interexaminer errors and a high correlation with biological age. therefore, dental maturity in this study was determined by evaluating the stages of tooth formation of the third molar by demirjian 's method. the results also show a statistically significant positive correlation between dental maturity (di) and skeletal maturity (cvmi) consistent with the findings of engstrom., krailassiri., uysal., and kalinowska., who also have suggested a strong relationship between dental maturity and skeletal maturity. for both sexes, di stage b showed the highest percentage distribution at stage 2 of cvmi [tables 10 and 11 ]. the relationship between skeletal maturity and peak height velocity (phv) is well established. fishman and hagg and taranger found that the appearance of the adductor sesamoid of the thumb indicates the beginning of the pubertal growth spurt (onset of phv), which corresponds to stage 2 of cvmi. in the present study, hence, di stage b signifies the prepeak of the pubertal growth spurt or onset of phv in both the sexes. in the present study, for male subjects, stages c and d corresponded to cvmi stage 3 [table 10 ], while for female subjects, stages b and c corresponded to cvmi stage 3 [table 11 ]. bjork and helm found that the mp3cap stage heralds the peak of the pubertal growth spurt, which corresponds to fishman 's skeletal maturity indicator 6 (stage 3 of the cvmi). it can be inferred that di stages c and d in males represent the peak of the pubertal growth spurt, while di stages b and c in females show that the peak of the pubertal growth spurt has not been passed. in this study in males, the samples in demirjian stages e or above are predicted to occur at the stages higher than cvmi stage 3, and the samples in demirjian stages f are predicted to occur at the stages higher than cvmi stage 4 [table 10 ]. in females, the samples in demirjian stages e or above are predicted to occur at stages higher than cvmi stage 4 [table 11 ]. in contrast to the study by sun - mi cho. where it was shown that in females, the samples in demirjian stages e or above are predicted to occur at the higher stages of cvmi stage 5. thus it can be concluded that in females di stage e and in males di stage f correlate that the peak of the pubertal growth spurt has been passed. the mean ages at different stages of di individually indicate that lower third molar development is complete earlier in males than in females, but it is statistically insignificant except for stage d, which signifies the peak of the pubertal growth spurt in males. this finding is consistent with the results of bolanos., which showed for males and females similar age distribution, mean age, and developmental stages, with negligible differences in the mean degree of formation of the four molars. however, findings by mincer., solari., sisman., and golovcencu. showed that lower third molar development is complete earlier in males than in females. the revealed correlation between lower third molar development and skeletal maturity in this study will allow clinicians to use the mandibular third molar as an adjunctive tool to assess adolescent growth, in combination with cervical vertebrae evaluations. individual variations should be taken into consideration when using the developmental stage of the third molar in growth evaluations, as third molars are known for their many variations, based on previous studies. this cross - sectional study has limitations in terms of the evaluation of results because the subjects in this study were in the pubertal growth period and mainly concentrated in di stages c, d, and e. increasing the number of subjects in each stage would further increase the accuracy of results obtained. further longitudinal study with a larger sample size is recommended for establishing specific guidelines to use the di of the mandibular third molar for growth assessment. both males and females show statistically significant positive correlation between the development of the third molar (di) and cvmidi stage b signifies the prepeak of pubertal growth spurt in both males and femalesin males, di stages c and d represent the peak of the pubertal growth spurtin females, stages b and c correlate that the peak of the pubertal growth spurt has not been passeddi stage e in females and di stage f in males correlate that the peak of the pubertal growth spurt has been passedboth sexes present similar developmental pace of the third molar, except for di stage d in males that signifies the peak of puberty. both males and females show statistically significant positive correlation between the development of the third molar (di) and cvmi di stage b signifies the prepeak of pubertal growth spurt in both males and females in males, di stages c and d represent the peak of the pubertal growth spurt in females, stages b and c correlate that the peak of the pubertal growth spurt has not been passed di stage e in females and di stage f in males correlate that the peak of the pubertal growth spurt has been passed both sexes present similar developmental pace of the third molar, except for di stage d in males that signifies the peak of puberty. dental maturity evaluation using the mandibular third molar can be used as an adjunctive tool for adolescent growth assessment in clinical orthodontics. | objective : this study was done with the following objectives : to estimate dental maturity using the demirjian index (di) for the mandibular third molar ; to investigate the relationship between dental maturity and skeletal maturity among growing patients ; to evaluate the use of the mandibular third molar as an adjunctive tool for adolescent growth assessment in combination with the cervical vertebrae ; to evaluate the clinical value of the third molar as a growth evaluation index.materials and methods : samples were derived from panoramic radiographs and lateral cephalograms of 615 subjects (300 males and 315 females) of ages ranging 9 - 18 years, and estimates of dental maturity (di) and skeletal maturity [cervical vertebrae maturation indicators (cvmi) ] were made.results:a highly significant association (r = 0.81 for males and r = 0.72 for females) was found between di and cvmi. di stage b corresponded to stage 2 of cvmi (prepeak of pubertal growth spurt) in both sexes. in males, di stages c and d represent the peak of the pubertal growth spurt. in females, stages b and c show that the peak of the pubertal growth spurt has not been passed. di stage e in females and di stage f in males correlate that the peak of the pubertal growth spurt has been passed.conclusion:a highly significant association exists between di and cvmi. mandibular third molar di stages are reliable adjunctive indicators of skeletal maturity. |
lipomas are benign, encapsulated tumours of mesenchymal origin, arising from the adipose tissue. superficial, simple lipomas can grow for many years without causing any functional problems, and they rarely reach very large dimensions. the surgical excision of giant occipitocervical lipomas is necessary for aesthetic concerns, pain and limitation of neck motion, especially in the recumbent position. a 52-year - old male patient was admitted to our clinic due to swelling at the back of his head. the history revealed that the swelling had been present for 10 years ; it had grown gradually from the size of a small hazelnut. during the patient 's general physical examination, a large, mobile mass of 10 10 cm was found, localized in the left occipitocervical region. the patient magnetic resonance imaging (mri) revealed a mass of 10 10 cm in the left occipitocervical region that had adhered to the adjacent bone structure, causing a thickening of the scalp ; however, there was no bone defect or destruction. the patient was operated on, and the subcutaneous mass was totally excised [figure 1 ]. during the pathological examination the excised soft tissue mass was classified as a lipoma. (a) axial and (b) sagittal t2-weighted mr imaging shows the large lipoma ; (c) the lipoma in the occipitocervical region ; (d) the resected lipoma ; (e) picture of the completely resected lipoma a 56-year - old male patient was admitted to our clinic due to a swelling at the back of the head. the physical examination revealed a giant, painful mass covering the entire left occipital region. an mri showed a 11 10 cm mass, with a smooth, lobulated contour, and subcutaneous localization in the occipital region extending halfway down the neck, hyperintense on the t1-t2-weighted sequences with a thin septal contrast enhancement after contrast administration, which was adherent to the surrounding muscle tissue and bone. the pathological examination of the mass revealed a tumour covered with a thin, fibrous, connective tissue capsule that consisted of thin vascular structures formed by mature adipocytes of large vacuolated cytoplasm. (a) axial and (b) sagittal t2-weighted mr imaging shows the giant lipoma ; (c) the lipoma in the occipital region ; (d) the capsule of the lipoma after skin incision ; (e) the resected lipoma peeled off from the surrounding tissue and removed together with the capsule ; (f) picture of the completely resected lipoma after anaesthesia and intubation, the patient was placed in a prone position. following this, the capsule of the mass was reached via an elliptical skin incision about half the size of the mass. with careful dissection of the subcutaneous tissues surrounding the capsule, the skin was primarily closed. to prevent the accumulation of blood in the potential space and enhance early adhesion, a 52-year - old male patient was admitted to our clinic due to swelling at the back of his head. the history revealed that the swelling had been present for 10 years ; it had grown gradually from the size of a small hazelnut. during the patient 's general physical examination, a large, mobile mass of 10 10 cm was found, localized in the left occipitocervical region. the patient magnetic resonance imaging (mri) revealed a mass of 10 10 cm in the left occipitocervical region that had adhered to the adjacent bone structure, causing a thickening of the scalp ; however, there was no bone defect or destruction. the patient was operated on, and the subcutaneous mass was totally excised [figure 1 ]. during the pathological examination the excised soft tissue mass was classified as a lipoma. (a) axial and (b) sagittal t2-weighted mr imaging shows the large lipoma ; (c) the lipoma in the occipitocervical region ; (d) the resected lipoma ; (e) picture of the completely resected lipoma a 56-year - old male patient was admitted to our clinic due to a swelling at the back of the head. the physical examination revealed a giant, painful mass covering the entire left occipital region. an mri showed a 11 10 cm mass, with a smooth, lobulated contour, and subcutaneous localization in the occipital region extending halfway down the neck, hyperintense on the t1-t2-weighted sequences with a thin septal contrast enhancement after contrast administration, which was adherent to the surrounding muscle tissue and bone. the pathological examination of the mass revealed a tumour covered with a thin, fibrous, connective tissue capsule that consisted of thin vascular structures formed by mature adipocytes of large vacuolated cytoplasm. (a) axial and (b) sagittal t2-weighted mr imaging shows the giant lipoma ; (c) the lipoma in the occipital region ; (d) the capsule of the lipoma after skin incision ; (e) the resected lipoma peeled off from the surrounding tissue and removed together with the capsule ; (f) picture of the completely resected lipoma after anaesthesia and intubation, the patient was placed in a prone position. following this, the capsule of the mass was reached via an elliptical skin incision about half the size of the mass. with careful dissection of the subcutaneous tissues surrounding the capsule, the skin was primarily closed. to prevent the accumulation of blood in the potential space and enhance early adhesion, lipoma is a benign tumour of mesenchymal origin that is rarely seen in the head and neck region. although the recurrence rate is not high, resection may be difficult due to the large size and adherence to the surrounding tissues. especially in our second case, resection was difficult due to the hard capsule, which was adherent to the occipital bone. lipomas are usually asymptomatic, but they can cause pain when they are large and press on the nerves. the two patients in our study were admitted to the hospital due to pain and cosmetic concerns. lipomas tend to locate in the trunk, shoulders, posterior neck, and axilla. approximately 80% are in the form of a single lesion, and they are generally seen in women. on the other hand, in addition to a physical examination, radiological assessment is necessary for the evaluation of the nature of the lipoma and surgical planning. connection with the surrounding tissues and bone can be evaluated by computed tomography (ct) and magnetic resonance imaging (mri). in the case of suspicious certain positions of the body and/or some daily physical activities may be restricted due to the size of the tumour. lipomas that are large, painful, and cause cosmetic problems should be operated on following good preoperative planning. | lipomas are capsulated benign tumours that are commonly found in all body parts. a lipoma is a well - defined mesenchymal tumour that arises from the adipose tissue. although giant lipomas are rare in the head and neck regions, when they are located here, they are most commonly found in the subcutaneous posterior neck area. recurrence as well as invasion is very rare after total surgical excision. in this article, we present two rare cases of giant lipomas in the posterior occipitocervical region, which is an exceptional location. |
a groundbreaking paradigm shift, the discovery of noncoding rnas (ncrnas), established the conventional one gene, one protein model to be an oversimplified view of gene regulation. numerous ncrna classes are now implicated in central nervous system (cns) functions ; micrornas (mirnas), natural antisense transcripts (nats) and long intergenic rnas (lincrnas) all have reported regulatory activities in the brain. while pleiotropic ncrnas, including mirnas, can target large numbers of genes and signaling pathways simultaneously, there are also ncrnas, such as nats, which hybridize to a limited and precise subset of candidates. growing evidence indicates that distinct neuronal ncrna mechanisms, particularly mirnas, likely influence the development of psychiatric disease. here we review the role of mirnas in the neurobehavioral deficits of cns disorders and also discuss the reported contributions of other ncrna classes. mirnas have recently emerged as a global regulator of gene expression and, ultimately, effector of synaptic physiology. these mirnas function by several mechanisms, including ribosomal rna modifications, repression of mrna expression by rna interference, alternative splicing, and regulatory mechanisms mediated by rna - rna interactions. the processing from a primary (pri) transcript to precursor (pre) and mature mirna in the brain requires the standard mirna biogenesis machinery, including drosha, dicer, dgcr8, and argonaute (ago) proteins. functional knockdown of dicer, which processes the pre - mirna to its mature transcript, leads to reduced neuronal size and branching as well as aberrant axonal pathfinding. correspondingly, mice with genetic knockout of the pri - mirna processing protein dgcr8 display a loss of synaptic connectivity and reduced number and size of dendritic spines. at the behavioral level, these mice display impaired spatial working memory - dependent tasks. interestingly, it has been shown that mirnas are formed in part by processing of pre - mirnas locally within dendritic spines. furthermore, synaptic stimulation leads to local processing of pre - mirnas in proximity to the synapse ; a cohort of mirnas are localized within the synapse, including mir-219 - 5p, mir-124, mir-134, mir-138, and mir-125b. these mirnas directly impact learning and memory behaviors, neurotransmission, neurogenesis among other functions and their disruption contribute to psychiatric impairments. the transition from neural stem cells (nscs) to neural progenitors and ultimately to fully differentiated neurons is highly regulated by a complex interaction of mirnas and other factors. in general, let-7, mir-124 and mir-9 it is typically held that mir-134 and mir-25 induce the proliferation and/or inhibit the differentiation of nscs and neural progenitors. in parallel, mir-137 both decreases and increases nsc proliferation, either enhancing or opposing neuronal maturation. there is an intricate overlap and feedback occurring between these key mirnas, mediated in part by their target genes. adult neurogenesis is reportedly decreased in neurodegenerative disease and depression, and is modulated by antidepressant therapeutics. thus, the following discussions regarding mirna pathways in psychiatric disorders (outlined in table 1) may involve neurons derived at all stages of brain maturity. the copy number variant (cnv) at 22q11.2, resulting in digeorge syndrome, is the most common rare variant identified in schizophrenia, occurring in approximately one percent of patients. many children with 22q11.2 deletion syndrome have developmental delays and learning disabilities, with a substantially elevated risk of developing schizophrenia (30%). though the 22q11.2 region contains 30 to 40 genes, many have not been well characterized ; one notable gene is digeorge syndrome critical region gene 8 (dgcr8), an essential contributor to microrna biogenesis. microdeletion of 22q11.2 in mice results in the downregulation of a cluster of mirnas with corresponding changes in cognitive and behavioral functions. of the common genetic variants enriched in patients with schizophrenia, there is a well - established signal at mir-137 and several of its target genes. schizophrenia patients with a mir-137 risk allele exhibit greater symptom severity, significantly altered functional connectivity, reduced white matter integrity, smaller hippocampi and larger lateral ventricles. functionally validated targets of mir-137 include such schizophrenia risk genes as cacna1c, tcf4 and znf804a, while additional putative targets include erbb4, gabra1, grin2a, grm5, gsk3b, nrg2, and htr2c. overexpression of mir-137 in a human nsc line identified direct and indirect mir-137 targets in neural cells. while direct mir-137 targets were enriched for transcription factors and cell cycle genes, indirect targets included pathways enriched in schizophrenia genome wide association studies, particularly major histocompatibility complex, synapses, fmrp interacting rnas and calcium channels. more recently, the largest study of common variance identified 108 regions significantly associated with schizophrenia, including significant hits at mir-137 and mir-548. post - mortem profiling of mirna expression in the prefrontal cortex of schizophrenia patients identified a global increase in mirna expression compared to control populations. more specifically, although the mature and pre - mirna species were increased (particularly of mir-181b and mir-26b), there was no significant difference in transcription of the source pri - mirna. these results suggest that the changes were due to increased mirna biogenesis rather than altered mirna transcription. the authors further observed upregulated expression of drosha and dgcr8, both of which are involved in pri - mirna processing, and speculate this is the ultimate cause of aberrant mirna levels. additionally, human analyses have started to reveal a profile signature of mirna dysregulation in peripheral tissues such as plasma and serum of schizophrenia patients. intriguingly, plasma levels of mir-181b (discussed above) were found to predict response to antipsychotic treatment ; correspondingly, mir-30e has also been postulated as a plasma biomarker of schizophrenia. nmda - r signaling, one of the most consistently implicated pathways in schizophrenia, is strongly controlled by mir-219. notably, mir-219 is the most enriched mirna in the human synapse, the most downregulated in cortical synaptosomes of schizophrenia patients, and was dysregulated in cortical tissue from two patient cohorts. moreover, neuronal inhibition of mir-219 - 5p in mice significantly altered the precipitation of schizophrenia behavior by nmda - r antagonists. taken together, mir-219 - 5p actively mediates synaptic functions and the development of psychiatric phenotypes. nmda - r also regulates mir-132, which is implicated in learning and memory functions, long - term potentiation and neurotransmission. mir-132 expression is repressed in mice with genetic disruption of the enzyme which produces the nmda - r co - agonist d - serine, and these d - serine deficient mice recapitulate some of the neurobehavioral and cognitive impairments presented in patients with schizophrenia. expression of mir-132 was dysregulated in human cortical tissue from two schizophrenia datasets but those expression changes were in opposite directions ; it remains possible that mir-132 is disrupted in specific neuronal cell types or distinct subcellular regions of neurons in schizophrenia. interestingly, the nmda - r regulated transcripts mir-132 and mir-219 - 5p (discussed above) regulate circadian rhythm, which is frequently disrupted in schizophrenia and other psychiatric disorders. in addition, a subset of other mirnas also reportedly regulate circadian functions, including mirs 279, 142 - 3p, 185, 138, let-7b, 125a, 206 and 182. indeed, mirna regulators of nmda - r signaling and circadian rhythm could yield new therapeutic targets for treatment of neurobehavioral deficits. mirna expression is responsive to current therapeutics administered for bipolar disorder, which is known to share overlapping genetic links with schizophrenia. in rats treated with either lithium or valproate, there are a cohort of mirnas altered in the hippocampus, including let-7b, let-7c, mir-128a, mir-24a, mir-30c, mir-34a, mir-221 and mir-144. valproate and lithium significantly modulate brain - derived neurotrophic factor (bdnf) levels, a critical regulator of neuronal homeostasis, which is itself regulated by both short and long ncrnas, such as mir-124a. notably, mir-124a is linked to depression - related behaviors, as discussed in the section below. as more post - mortem datasets become publicly available, we believe that groups of consistently altered transcripts in schizophrenia and bipolar disorder will emerge and potentially converge. combining multimodal snp and exome sequencing genotype information with rna and mirna expression datasets will facilitate mirna - mrna correlations. arguably, some of the more persistent mirna associations in schizophrenia to date implicate mir-137, mir-181b, and mir-219 - 5p (table 1). there is accumulating evidence for significant contribution of mirna mechanisms in mood disorders such as depression. in the prefrontal cortex of depressed subjects who had died by suicide, 21 mirnas were significantly down - regulated in the major depressive disorder (mdd) group. more mirnas were down - regulated than upregulated, implying a global down - regulation of mirna levels in mdd. furthermore, almost half of the down - regulated mirnas were transcribed by the same pri - mirna gene transcripts (mir-142 - 5p and 142 - 3p ; mir-494, 376a, 496, and 369 - 3p ; mir-23b, 27b and 24 - 1 ; mir-34b and 34c ; mir-17 and 20a) or found within the same chromosomal region (mir-424 and 20b at xq26.2 - 3, 377 kb apart ; mir-142 and 301a at 17q22, 820 kb apart ; mir-324 - 5p and 497 at 17p13.1, 205 kb apart), suggesting that the down - regulated mirna expression may be due to decreased transcription. in addition, a set of 29 mirnas formed an inter - connected network in the mdd group : let-7b, mir-132, 181b, 338 - 3p, 486 - 5p, and 650 were hubs. a recent study of genotyping polymorphisms from three mirna processing genes (dgcr8, ago1, and gemin4) found that dgcr8 rs3757 was associated with increased risk of suicidal tendency and improvement response to antidepressant treatment, whereas ago1 rs636832 showed decreased risk of suicidal tendency, suicidal behavior, and recurrence. thus, polymorphisms in mirna processing genes may influence depression risk and treatment. molecular targets of anti - depressants frequently engage the transporters of serotonin, a monoamine neurotransmitter. mirnas regulate the serotonin transporter (sert) and its response to serotonin reuptake inhibitor (ssri) therapeutics. specifically, ssri antidepressant fluoxetine (prozac) treatment in mice induces expression of mir-16 while repressing the mir-16 target sert. another sert associated mirna, mir-135, was found to control the onset of co - existing depression and anxiety symptoms in mice as well as the response to anti - depressant treatment. because of limited studies in depressed patients, it is difficult to pinpoint specific mirnas consistently implicated in the pathogenesis of depression ; nevertheless, mirnas that influence bdnf, including mir-132 and mir-34, and neuroinflammation, such as the let-7 family, may be highly relevant (table 1). intriguingly, mir-124a repression of bdnf provokes depression - related behaviors and significantly mediates neurogenesis. future studies could investigate if current anti - depressant therapeutics signal through mir-124a or other disease - associated mirnas to enhance adult hippocampal neurogenesis. the link between ncrnas and stress, anxiety, or fear related responses opens new avenues for therapeutic intervention. while a range of genetic associations have been loosely implicated in post - traumatic stress disorder (ptsd), epigenetic factors likely play a defining role in disease progression. a panel of disrupted mirnas in the blood of military veterans with active ptsd symptoms have been identified ; these ptsd - associated mirnas were significantly associated with immunological pathways, suggestive of their pathogenic mechanisms in the disorder. indeed, abnormal systemic immune responses are routinely reported in stress - related conditions, consistent with its regulation by the ptsd - linked mirnas. intriguingly, a few of the mirna transcripts altered in the veterans suffering from ptsd, including mir-19b and mir-223, were also perturbed in the serum and amygdala of a ptsd animal model. stress and anxiety, however, are not unique behaviors to ptsd and are provoked through many distinct triggers. overexpression of mir-34c in the central amygdala elicited an anxiolytic - like effect in mice stressed through acute restraint ; furthermore, mir-34c directly targets a key mediator of stress responses, the corticotropin releasing factor receptor type 1 (crfr1) gene. notably, mir-34a was recently reported to regulate fear related responses through notch signaling in mice. although mir-34a did nt alter anxiety - related parameters in the same manner as mir-34c, it is possible that the mir-34 family is central in behavioral manifestations. in addition to the above mentioned mirnas, mirs - 608, 124a, 132, 330 - 3p, and 16 are also implicated in anxiety phenotypes through genetic associations or in vivo analyses. specifically, mir-124 is linked to both anxiety and stress related behaviors through glucocorticoid and corticosteroid signaling, respectively. moreover, ablation of the mirna biogenesis enzyme dicer in the central amygdala of mice provoked the onset of anxiety - like symptoms. mice with dicer knockout specifically in dopaminoceptive neurons also exhibit behavioral changes, including ataxia as well as front and hind limb clasping. human genetic linkage studies and animal models also revealed mirna pathways in panic or fear responses. at least four mirnas have single- nucleotide polymorphisms (snps) in mirna sequences located within panic disorder associated genes, including mir-22, mir-138 - 2, mir-148a, and mir-488. furthermore, mir-128 expression is increased with the formation of fear - extinction memory in mice, which is the re - conditioning of the memory to overcome established fear behaviors. an individual s ability to cope with there is contrasting mirna expression between rats who developed learned helpless (lh), a behavior that resembles stress - induced depression, compared to rats who did not develop depression (non - learned helpless [nlh ]) in spite of receiving similar inescapable shocks. one set of mirnas showed large, significant, and consistent down - regulation in the frontal cortex of nlh rats compared to a blunted response in lh rats (mir-96, mir-141, mir-182, mir-183, mir-183, mir-198, mir-200a, mir-200a, mir-200b, mir-200b, mir-200c, and mir-429). these synaptically enriched mirnas are encoded at a few shared polycistronic loci, suggesting coordinated control of their transcription, and they share 5-seed motifs which indicate similar or overlapping sets of target mrnas. interestingly, half of this set are predicted to hit creb1 as a target, and binding sites for creb lie upstream of mir-96, mir-182, mir-183, mir-200a, mir-200b, mir-200c, mir-220a, and mir-200b. this suggests that a feedback loop arrangement may also exist between creb and creb - stimulated mirnas and target genes. because these mirnas are down regulated in nlh rats, but not lh rats, this can be interpreted as a homeostatic response intended to minimize repressive effects on creb1. although more studies are needed to identify a list of mirnas associated with stress, anxiety and fear, some putative candidates are emerging (table 1). as discussed previously, mir19b and mir-223 were dysregulated in human and animal models of ptsd and should be evaluated further for therapeutic targeting in trauma - induced stress. notably, these two transcripts share over 80 bioinformatic mrna targets through targetscan prediction. additionally, the mir-34 family may exhibit an overlapping role in anxiety and fear responses. overall, replication studies in human and animals will further define persistent mirna mechanisms in these neurobehavioral deficits. the copy number variant (cnv) at 22q11.2, resulting in digeorge syndrome, is the most common rare variant identified in schizophrenia, occurring in approximately one percent of patients. many children with 22q11.2 deletion syndrome have developmental delays and learning disabilities, with a substantially elevated risk of developing schizophrenia (30%). though the 22q11.2 region contains 30 to 40 genes, many have not been well characterized ; one notable gene is digeorge syndrome critical region gene 8 (dgcr8), an essential contributor to microrna biogenesis. microdeletion of 22q11.2 in mice results in the downregulation of a cluster of mirnas with corresponding changes in cognitive and behavioral functions. of the common genetic variants enriched in patients with schizophrenia, there is a well - established signal at mir-137 and several of its target genes. schizophrenia patients with a mir-137 risk allele exhibit greater symptom severity, significantly altered functional connectivity, reduced white matter integrity, smaller hippocampi and larger lateral ventricles. functionally validated targets of mir-137 include such schizophrenia risk genes as cacna1c, tcf4 and znf804a, while additional putative targets include erbb4, gabra1, grin2a, grm5, gsk3b, nrg2, and htr2c. overexpression of mir-137 in a human nsc line identified direct and indirect mir-137 targets in neural cells. while direct mir-137 targets were enriched for transcription factors and cell cycle genes, indirect targets included pathways enriched in schizophrenia genome wide association studies, particularly major histocompatibility complex, synapses, fmrp interacting rnas and calcium channels. more recently, the largest study of common variance identified 108 regions significantly associated with schizophrenia, including significant hits at mir-137 and mir-548. post - mortem profiling of mirna expression in the prefrontal cortex of schizophrenia patients identified a global increase in mirna expression compared to control populations. more specifically, although the mature and pre - mirna species were increased (particularly of mir-181b and mir-26b), there was no significant difference in transcription of the source pri - mirna. these results suggest that the changes were due to increased mirna biogenesis rather than altered mirna transcription. the authors further observed upregulated expression of drosha and dgcr8, both of which are involved in pri - mirna processing, and speculate this is the ultimate cause of aberrant mirna levels. additionally, human analyses have started to reveal a profile signature of mirna dysregulation in peripheral tissues such as plasma and serum of schizophrenia patients. intriguingly, plasma levels of mir-181b (discussed above) were found to predict response to antipsychotic treatment ; correspondingly, mir-30e has also been postulated as a plasma biomarker of schizophrenia. nmda - r signaling, one of the most consistently implicated pathways in schizophrenia, is strongly controlled by mir-219. notably, mir-219 is the most enriched mirna in the human synapse, the most downregulated in cortical synaptosomes of schizophrenia patients, and was dysregulated in cortical tissue from two patient cohorts. moreover, neuronal inhibition of mir-219 - 5p in mice significantly altered the precipitation of schizophrenia behavior by nmda - r antagonists. taken together, mir-219 - 5p actively mediates synaptic functions and the development of psychiatric phenotypes. nmda - r also regulates mir-132, which is implicated in learning and memory functions, long - term potentiation and neurotransmission. mir-132 expression is repressed in mice with genetic disruption of the enzyme which produces the nmda - r co - agonist d - serine, and these d - serine deficient mice recapitulate some of the neurobehavioral and cognitive impairments presented in patients with schizophrenia. expression of mir-132 was dysregulated in human cortical tissue from two schizophrenia datasets but those expression changes were in opposite directions ; it remains possible that mir-132 is disrupted in specific neuronal cell types or distinct subcellular regions of neurons in schizophrenia. interestingly, the nmda - r regulated transcripts mir-132 and mir-219 - 5p (discussed above) regulate circadian rhythm, which is frequently disrupted in schizophrenia and other psychiatric disorders. in addition, a subset of other mirnas also reportedly regulate circadian functions, including mirs 279, 142 - 3p, 185, 138, let-7b, 125a, 206 and 182. indeed, mirna regulators of nmda - r signaling and circadian rhythm could yield new therapeutic targets for treatment of neurobehavioral deficits. mirna expression is responsive to current therapeutics administered for bipolar disorder, which is known to share overlapping genetic links with schizophrenia. in rats treated with either lithium or valproate, there are a cohort of mirnas altered in the hippocampus, including let-7b, let-7c, mir-128a, mir-24a, mir-30c, mir-34a, mir-221 and mir-144. valproate and lithium significantly modulate brain - derived neurotrophic factor (bdnf) levels, a critical regulator of neuronal homeostasis, which is itself regulated by both short and long ncrnas, such as mir-124a. notably, mir-124a is linked to depression - related behaviors, as discussed in the section below. as more post - mortem datasets become publicly available, we believe that groups of consistently altered transcripts in schizophrenia and bipolar disorder will emerge and potentially converge. combining multimodal snp and exome sequencing genotype information with rna and mirna expression datasets will facilitate mirna - mrna correlations. arguably, some of the more persistent mirna associations in schizophrenia to date implicate mir-137, mir-181b, and mir-219 - 5p (table 1). there is accumulating evidence for significant contribution of mirna mechanisms in mood disorders such as depression. in the prefrontal cortex of depressed subjects who had died by suicide, 21 mirnas were significantly down - regulated in the major depressive disorder (mdd) group. more mirnas were down - regulated than upregulated, implying a global down - regulation of mirna levels in mdd. furthermore, almost half of the down - regulated mirnas were transcribed by the same pri - mirna gene transcripts (mir-142 - 5p and 142 - 3p ; mir-494, 376a, 496, and 369 - 3p ; mir-23b, 27b and 24 - 1 ; mir-34b and 34c ; mir-17 and 20a) or found within the same chromosomal region (mir-424 and 20b at xq26.2 - 3, 377 kb apart ; mir-142 and 301a at 17q22, 820 kb apart ; mir-324 - 5p and 497 at 17p13.1, 205 kb apart), suggesting that the down - regulated mirna expression may be due to decreased transcription. in addition, a set of 29 mirnas formed an inter - connected network in the mdd group : let-7b, mir-132, 181b, 338 - 3p, 486 - 5p, and 650 were hubs. a recent study of genotyping polymorphisms from three mirna processing genes (dgcr8, ago1, and gemin4) found that dgcr8 rs3757 was associated with increased risk of suicidal tendency and improvement response to antidepressant treatment, whereas ago1 rs636832 showed decreased risk of suicidal tendency, suicidal behavior, and recurrence. thus, polymorphisms in mirna processing genes may influence depression risk and treatment. molecular targets of anti - depressants frequently engage the transporters of serotonin, a monoamine neurotransmitter. mirnas regulate the serotonin transporter (sert) and its response to serotonin reuptake inhibitor (ssri) therapeutics. specifically, ssri antidepressant fluoxetine (prozac) treatment in mice induces expression of mir-16 while repressing the mir-16 target sert. another sert associated mirna, mir-135, was found to control the onset of co - existing depression and anxiety symptoms in mice as well as the response to anti - depressant treatment. because of limited studies in depressed patients, it is difficult to pinpoint specific mirnas consistently implicated in the pathogenesis of depression ; nevertheless, mirnas that influence bdnf, including mir-132 and mir-34, and neuroinflammation, such as the let-7 family, may be highly relevant (table 1). intriguingly, future studies could investigate if current anti - depressant therapeutics signal through mir-124a or other disease - associated mirnas to enhance adult hippocampal neurogenesis. the link between ncrnas and stress, anxiety, or fear related responses opens new avenues for therapeutic intervention. while a range of genetic associations have been loosely implicated in post - traumatic stress disorder (ptsd), epigenetic factors likely play a defining role in disease progression. a panel of disrupted mirnas in the blood of military veterans with active ptsd symptoms have been identified ; these ptsd - associated mirnas were significantly associated with immunological pathways, suggestive of their pathogenic mechanisms in the disorder. indeed, abnormal systemic immune responses are routinely reported in stress - related conditions, consistent with its regulation by the ptsd - linked mirnas. intriguingly, a few of the mirna transcripts altered in the veterans suffering from ptsd, including mir-19b and mir-223, were also perturbed in the serum and amygdala of a ptsd animal model. stress and anxiety, however, are not unique behaviors to ptsd and are provoked through many distinct triggers. overexpression of mir-34c in the central amygdala elicited an anxiolytic - like effect in mice stressed through acute restraint ; furthermore, mir-34c directly targets a key mediator of stress responses, the corticotropin releasing factor receptor type 1 (crfr1) gene. notably, mir-34a was recently reported to regulate fear related responses through notch signaling in mice. although mir-34a did nt alter anxiety - related parameters in the same manner as mir-34c, it is possible that the mir-34 family is central in behavioral manifestations. in addition to the above mentioned mirnas, mirs - 608, 124a, 132, 330 - 3p, and 16 are also implicated in anxiety phenotypes through genetic associations or in vivo analyses. specifically, mir-124 is linked to both anxiety and stress related behaviors through glucocorticoid and corticosteroid signaling, respectively. moreover, ablation of the mirna biogenesis enzyme dicer in the central amygdala of mice provoked the onset of anxiety - like symptoms. mice with dicer knockout specifically in dopaminoceptive neurons also exhibit behavioral changes, including ataxia as well as front and hind limb clasping. human genetic linkage studies and animal models also revealed mirna pathways in panic or fear responses. at least four mirnas have single- nucleotide polymorphisms (snps) in mirna sequences located within panic disorder associated genes, including mir-22, mir-138 - 2, mir-148a, and mir-488. furthermore, mir-128 expression is increased with the formation of fear - extinction memory in mice, which is the re - conditioning of the memory to overcome established fear behaviors. an individual s ability to cope with there is contrasting mirna expression between rats who developed learned helpless (lh), a behavior that resembles stress - induced depression, compared to rats who did not develop depression (non - learned helpless [nlh ]) in spite of receiving similar inescapable shocks. one set of mirnas showed large, significant, and consistent down - regulation in the frontal cortex of nlh rats compared to a blunted response in lh rats (mir-96, mir-141, mir-182, mir-183, mir-183, mir-198, mir-200a, mir-200a, mir-200b, mir-200b, mir-200c, and mir-429). these synaptically enriched mirnas are encoded at a few shared polycistronic loci, suggesting coordinated control of their transcription, and they share 5-seed motifs which indicate similar or overlapping sets of target mrnas. interestingly, half of this set are predicted to hit creb1 as a target, and binding sites for creb lie upstream of mir-96, mir-182, mir-183, mir-200a, mir-200b, mir-200c, mir-220a, and mir-200b. this suggests that a feedback loop arrangement may also exist between creb and creb - stimulated mirnas and target genes. because these mirnas are down regulated in nlh rats, but not lh rats, this can be interpreted as a homeostatic response intended to minimize repressive effects on creb1. although more studies are needed to identify a list of mirnas associated with stress, anxiety and fear, some putative candidates are emerging (table 1). as discussed previously, mir19b and mir-223 were dysregulated in human and animal models of ptsd and should be evaluated further for therapeutic targeting in trauma - induced stress. notably, these two transcripts share over 80 bioinformatic mrna targets through targetscan prediction. additionally, the mir-34 family may exhibit an overlapping role in anxiety and fear responses. overall, replication studies in human and animals will further define persistent mirna mechanisms in these neurobehavioral deficits. although mirnas are arguably the most extensively characterized class of ncrna in neurons, long ncrnas (lncrna) are increasingly implicated in cns functions. long ncrnas acts as mirna sponges and can bind proteins and rnas that regulate transcriptional changes and epigenetic modifications of chromatin. indeed, these transcripts regulate basic neuronal biology as well as genes with strong disease - association. bc1, one of the first lncrna transcripts characterized in the brain, is now known to modulate metabotropic receptor signaling. select members of the nat class of ncrnas in the brain are functional and modulate expression of their sense partner ; nats are endogenously transcribed and exhibit at least partial sequence complimentarity to protein - coding genes, ranging from short to long in nucleotide length. an emerging area of investigation indicates that long and short neuronal ncrnas are co - regulatory, which is discussed more throughout the following sections. for example, the bace1 gene linked to psychiatric and cognitive deficits in alzheimer s disease (ad) ] is reportedly modulated by a network of competitive ncrna interactions. more specifically, it was shown that mir-485 - 5p binding sites in bace1 are masked through a long antisense transcript, bace1-as. evidence demonstrates that lncrnas participate in neural plasticity, supported by the expression of a large number of these transcripts in dendrites. in addition, a genome - wide analysis show that lncrnas are modulated by neuronal activity in human brain. reports suggest that fine - tuned regulatory control of the embryonic brain by these transcripts is required for development of mature cns functions. mouse knockout studies involving long - intergenic ncrnas (lincrnas) found that loss of function for linc brn1b results in a reduction of cerebral cortex progenitor cells and abnormal cortical lamination amongst other pathologies. furthermore, a subset of lincrnas bind mirnas and inhibit their functions (i.e. mirna sponge), which can reportedly disrupt brain development. circular ncrnas (circrna) were also recently reported to function as mirna sponges in neurons. for example, a circrna was found to have multiple mirna binding sites, including for mir-7, and both were co - expressed in neocortical and hippocampal neurons. these studies further indicate the importance of interactions between ncrnas in the brain and the need to uncover their epigenetic networks. neurotrophins, which play a key role in maintaining homeostatic activity in the cns, reportedly respond to lncrna signaling. for example, the neurotrophin bdnf has sequence complementarity with a conserved nat, termed bdnf - as. functionally, bdnf - as was reported to modulate neuronal growth in vitro and in vivo. the sequence complementarity of this noncoding transcript appears to extend into the 3 untranslated region (3utr) of bdnf, which contains regulatory mirna binding sites such as mir-124a. mir-124, as discussed in previous sections, modulates depression and related neurobehavioral deficits ; it is possible that the bdnf - as partly functions by preventing mir-124 from binding to bdnf. for example, an endogenous noncoding antisense transcript to the htt gene (httas) functionally regulates htt expression, which is the primary genetic aberration in hd and associated cognitive and neurobehavioral pathology. genetic variations in the disrupted in schizophrenia 1 (disc1) gene are consistently linked with schizophrenia - associated behaviors. a recent report suggests the lncrna gomafu mediates disc1 splicing events, resulting in splice variants linked to schizophrenia. gomafu, is implicated in neural development and is downregulated in cortical tissue of schizophrenia patients and in activated human neuronal cells. several groups have reported genetic association of disc2 with schizophrenia as well as other psychiatric disorders ; however, disc2 is not conserved among species, hampering investigation of its regulatory mechanisms. one intriguing possibility is the existence of regulatory loop between disc1 and the two ncrna transcripts disc2 and gomafu. recent peripheral blood profiling studies also identified significant disruption of lncrnas in depression, specifically patients with mdd, 17 of which were documented as depression - related gene in previous studies. in parallel, this study uncovered potential mirna - mrna networks that are consistent with genes previously associated with depression. future studies could investigate co - regulatory mechanisms between the dysregulated mirnas and lncrnas in the disease. additionally, the lncrna antisense transcript coded by loc285758 has been implicated in violent suicide completers, likely triggered through depression or other psychiatric disorders. similar to mirnas, it is possible some of the lncrnas listed above may mediate the development of the distinct psychiatric symptoms through control of circadian genes. global transcriptome profiling studies indicate that lncrnas, including nats, epigenetically regulate circadian biology. indeed, an antisense rna to a circadian gene in neurospora, termed qrf, is regulated by light and represses the expression of its sense partner frq, through chromatin modifications. regulating neural plasticity, neurogenesis, and numerous behavioral phenotypes, it is clear that ncrnas contribute to the pathogenesis of many psychiatric disorders. moreover, direct evidence comes from human postmortem brain and animal studies indicating perturbed ncrna levels in disparate disease such as huntington s, schizophrenia, depression, ptsd among others. despite these findings, one needs to find an integrated view of these ncrna network(s). it is known that differential co - expression of distinct mirna groups can directly mediate human disease pathogenesis as well as serve as a biomarker profile for disease diagnosis. the disrupted mirnas, and their corresponding mrna target genes in each psychiatric disease, are likely to interact with and regulate each other, both directly as targets and indirectly as part of larger regulatory networks. furthermore, correlated mirnas and mrnas may be coordinately regulated by a (possibly overlapping) set of transcription factors or other epigenetic influences. it remains to be determined whether the changes in the mirna / mrna network are i) similar or different across distinct brain regions ii) cell type - specific and iii) reversible mechanisms. the underlying reasons for altered ncrna expression remain unresolved and could result from a number of factors, including genetic changes in the promoter region or other locations within the gene. additionally, defects in rna editing or epigenetic suppression of the chromosomal region encoding the ncrnas can also occur. finally, mirnas, lncrnas, and their processing genes are susceptible to regulation by well - established signaling modulators such as bdnf, creb, calcium, or calcium responsive neurotransmitters. for example, recently it was reported that dicer is activated by proteolytic cleavage under conditions of elevated calcium levels. the networking of mirnas and other ncrnas into critical pathways such as neurotransmission, neurogenesis, and neurodevelopment may open up an entirely new understanding of psychiatric disease. ultimately, we expect that for many of the complex psychiatric disorders we have considered, novel links between ncrna mechanisms and the disease pathology will continue to emerge. | the human genome project has revolutionized our understanding of the underlying mechanisms in psychiatric disease. it is now abundantly clear that neurobehavioral phenotypes are epigenetically controlled by noncoding rnas (ncrnas). the microrna (mirna) class of ncrnas are ubiquitously expressed throughout the brain and govern all major neuronal pathways. the attractive therapeutic potential of mirnas is underscored by their pleiotropic capacities, putatively targeting multiple pathways within a single neuron. many psychiatric diseases stem from a multi - factorial origin, thus conventional drug targeting of single proteins may not prove most effective. in this exciting post - genome sequencing era, many new epigenetic targets are emerging for therapeutic investigation. here we review the reported roles of mirnas, as well as other ncrna classes, in the pathology of psychiatric disorders ; there are both common and unique ncrna mechanisms that influence the various diagnoses. collectively, these potent epigenetic regulators may clarify the disrupted signaling networks in psychiatric phenotypes. |
since 2000, over 35,000 new cases of tuberculosis (tb) have been recorded annually in korea, raising concerns about an increasing incidence of multidrug - resistant tb (mdr - tb) (1). globally, the epidemiological synergy between hiv and tb co - infection and the deadly synergy between hiv and mdr - tb are major public health threats (2). the prevalence of human immunodeficiency virus (hiv) infection in korea is very low (less than 0.1%), but hiv / tb co - infection is gradually increasing (3, 4). although the relationship between hiv infection and tb is well understood, the association between hiv and mdr - tb is not clear (5). the aim of this study was to evaluate the prevalence of and risk factors for mdr - tb infection in hiv / tb co - infected patients. this was a retrospective cohort study at the national medical center of korea, which has 540 beds, is managed under governmental supervision, and has one of the largest hiv care centers in korea. eight hundred and fourteen hiv patients were registered from january 2005 to may 2011. of these, 55 clinically diagnosed tb patients with records of drug - susceptibility tests (dsts) were enrolled and analyzed. patients whose drug - susceptibility profiles were unavailable and those transferred from other institutions without previous laboratory records were excluded. acid - fast bacilli (afb) identification was carried out using bacteriological, molecular (accupower mtb real - time pcr kit ; bioneer co., daejeon, korea), and histopathological methods. the dsts were performed using absolute concentration methods and/or the genotype mtbdr plus assay (hain lifescience, nehren, germany). mdr - tb was defined as in vitro resistance to at least isoniazid (inh) and rifampin (rif). extensively drug - resistant tuberculosis (xdr - tb) was defined as mdr - tb with additional resistance to any fluoroquinolone and any of the second - line anti - tb injectable drugs (6). traditional absolute concentration test data were used when the results of the 2 dst tests were not consistent. clinical data including cd4 cell count and viral load were collected within 4 weeks of tb diagnosis. acquired immune deficiency syndrome (aids) - defining clinical illnesses were determined using the us centers for disease control and prevention criteria (7). to explore associated risk factors for mdr - tb in hiv / tb co - infected patients, demographic characteristics, clinical parameters and clinical outcomes were compared between the mdr - tb group and the non - mdr - tb group. univariate analysis was performed to assess the association between predictor variables and drug - susceptibility patterns of mycobacterium tuberculosis among hiv / tb co - infected cases. p values were determined using the independent t - test or the mann - whitney u - test in the case of quantitative variables. fisher 's exact test was performed to analyze the association between categorical variables and drug - susceptibility patterns of m. tuberculosis. this study was approved by the institutional review board of the national medical center (protocol no ; h-1105/011 - 004). this was a retrospective cohort study at the national medical center of korea, which has 540 beds, is managed under governmental supervision, and has one of the largest hiv care centers in korea. eight hundred and fourteen hiv patients were registered from january 2005 to may 2011. of these, 55 clinically diagnosed tb patients with records of drug - susceptibility tests (dsts) were enrolled and analyzed. patients whose drug - susceptibility profiles were unavailable and those transferred from other institutions without previous laboratory records were excluded. acid - fast bacilli (afb) identification was carried out using bacteriological, molecular (accupower mtb real - time pcr kit ; bioneer co., daejeon, korea), and histopathological methods. the dsts were performed using absolute concentration methods and/or the genotype mtbdr plus assay (hain lifescience, nehren, germany). mdr - tb was defined as in vitro resistance to at least isoniazid (inh) and rifampin (rif). extensively drug - resistant tuberculosis (xdr - tb) was defined as mdr - tb with additional resistance to any fluoroquinolone and any of the second - line anti - tb injectable drugs (6). traditional absolute concentration test data were used when the results of the 2 dst tests were not consistent. clinical data including cd4 cell count and viral load were collected within 4 weeks of tb diagnosis. acquired immune deficiency syndrome (aids) - defining clinical illnesses were determined using the us centers for disease control and prevention criteria (7). to explore associated risk factors for mdr - tb in hiv / tb co - infected patients, demographic characteristics, clinical parameters and clinical outcomes were compared between the mdr - tb group and the non - mdr - tb group. univariate analysis was performed to assess the association between predictor variables and drug - susceptibility patterns of mycobacterium tuberculosis among hiv / tb co - infected cases. p values were determined using the independent t - test or the mann - whitney u - test in the case of quantitative variables. fisher 's exact test was performed to analyze the association between categorical variables and drug - susceptibility patterns of m. tuberculosis. this study was approved by the institutional review board of the national medical center (protocol no ; h-1105/011 - 004). among the 814 hiv patients registered, 119 patients received anti - tb treatment. among these 119, 55 patients had records of the dst results. in 55 subjects with available the dst results, eight had past medical history of anti - tb treatment and 47 were primary tb cases. including 6 xdr - tb patients, 32.7% (18 of 55) were identified with mdr - tb. in 47 primary tb cases, 29.7% (14 of 47) were mdr - tb (i.e., primary or transmitted mdr - tb). in 37 patients with non - mdr - tb, 34 had there was no difference in demographic factors including age, gender, and body mass index (bmi) between the 2 groups (table 1). no difference was found regarding the medical history (including previous tb history, treatment adequacy, and use of highly active antiretroviral therapy [haart ]) prior to tb diagnosis. however, patients ' immune status differed between the 2 groups : the median cd4 count was lower in the mdr - tb group than in the non - mdr - tb group (57 vs 121 cells/l), but this result was not statistically significant (p = 0.251). notably, the frequency of additional aids - defining clinical illnesses other than tuberculosis before or at the time of tb diagnosis was significantly higher in the mdr - tb group (27.8%, 5 of 8) than in the non - mdr - tb group (5.4%, 2 of 37) (p = 0.032). there were no significant differences between the two groups with regard to the well - reported risk factors for both mdr - tb and hiv, including smoking, drinking, and socioeconomic status as classified by the status of health insurance. excluding 1 xdr - tb patient who died of head trauma, in - hospital mortality was significantly higher in the mdr - tb group (38.9%, 7 of 18) than in the non - mdr - tb group (13.5%, 5 of 37) (p = 0.043). in xdr - tb cases, this is the first study in korea to address the issue of mdr - tb among hiv / tb co - infected patients in a low hiv - prevalence and intermediate tb - burden setting. the prevalence of mdr - tb among hiv / tb co - infected patients was 32.7% (18 of 55) in our center, which is significantly higher than that among the general population (9% in 2008). in addition, the rate of primary mdr - tb is 29.7% (14 of 47), which is approximately 13 times higher than that in the general population (2.3%, 2003 - 2008) (8). a wide range of mdr - tb prevalence has been observed in different countries, which implies that there are many local confounders and common factors between mdr - tb and hiv (5). on an individual level, it has been suggested that immunosuppression is a mechanism that may allow hiv infection to contribute to the development of mdr - tb. molecular studies have suggested that mdr - tb strains are related to loss of fitness and have a tendency to spread in immunocompromised hosts (9, 10). in this regard, cd4 cell count and aids - defining illness are well - established markers of immunosupression, and our results support the suggestion that immunosuppression is associated with mdr - tb infection. the cd4 t - cell counts in the mdr - tb group were lower than those in the non - mdr - tb group, although this result was not statistically significant. furthermore, aids - defining illnesses other than tb were observed more frequently in the mdr - tb group than in the non - mdr - tb group (p = 0.032), suggesting that immunosuppression by hiv infection may be associated with mdr - tb infection. in korea, hiv patients tend to be stigmatized and isolated from society. as a result, they tend to be of low socioeconomic status, consume excessive alcohol, and smoke, all of which increase the risk of mdr - tb infection (5, 11). however, our results show no significant difference in these factors between the 2 groups. the higher in - hospital mortality rate among hiv / mdr - tb - infected patients in our results is consistent with previous findings (12, 13). in this context, the early diagnosis and rapid recognition of dr - tb in hiv patients are necessary to improve prognoses. while dst using conventional methods has a long turnaround time, a new molecular test is fast and sensitive (14, 15). thus, we propose that this new test should always be performed in hiv patients who are suspected of having tb. as a retrospective single center study, more than half (64 of 119) of the hiv / tb co - infected patients were excluded because their dst data was not available. and the lack of information such as tb exposure history or use of second - line tb drugs may make it hard to analyze risk factors. given that the prevalence of hiv / tb co - infection is very low, and it is relatively troublesome to confirm the drug susceptibility of m. tuberculosis in hiv / tb co - infected patients, however, our results could play a crucial role in understanding of hiv / tb co - epidemic in korea. in conclusion, the prevalence of mdr - tb among hiv / tb co - infected patients is significantly higher than that in the general population. surveillance of drug - resistant tb among hiv infected patients is essential to reduce mortality and prevent the ongoing spread of drug resistance and should be conducted urgently. in addition, hiv - related immunosuppression may be associated with mdr - tb infection. | much controversy surrounds the issue of whether hiv infection is a risk factor for developing multidrug - resistant tuberculosis (mdr - tb). in this study, we evaluated the prevalence of and risk factors for mdr - tb in hiv - infected patients at the national medical center of korea. we reviewed the medical records of hiv / tb co - infected patients from january 2005 to may 2011 ; the drug susceptibility profiles were available for 55 patients. of these, 32.7% had mdr - tb, which was approximately 3.6 times higher than the prevalence among the general population. additionally, there were more additional aids - defining clinical illnesses in the mdr - tb group than in the non - mdr - tb group (27.8% vs 5.4%, p = 0.032). these results suggest that hiv infection and hiv - related immunosuppresion may contribute to the development of mdr - tb. |
generic mortality scoring systems for children admitted to intensive care units (icus) have been developed for use at specific time points in the icu stay. two systems have been validated in paediatric icus (picus) : the paediatric risk of mortality (prism) and the paediatric index of mortality (pim). the prism, which is used in picus worldwide, requires an observation period of 24 hours, and the updated prism iii score measures severity at two time points (12 and 24 hours) during the picu stay. the pim and the recently updated pim2 scores are calculated 1 hour after admission. the 1224 hour period of observation has been a criticism levelled at the prism scoring system, and it has been speculated that it may diagnose rather than predict death. with the pim and pim2 scores, the single measurement of values shortly after admission is susceptible to random variation or may reflect a transient state resulting from interventions during transport. severity models have been used for time periods different from those for which the scores were developed. in children with meningococcal septic shock, castellanos - ortega and coworkers recorded the worst values for each variable included in the glasgow meningococcal septicaemia prognostic score, the malley score, and the pim score over the first 2 hours in the picu. indeed, early identification of patients who could benefit from therapeutic interventions may be useful. we hypothesized that an intermediate observation period (we arbitrarily chose a time point of 4 hours after picu admission) would be a good compromise between two objectives to take into account a short period of stabilization after a patient 's admission to the picu and to obtain an accurate measure of illness severity in the picu. to our knowledge, no study has ever evaluated the accuracy of generic paediatric scoring systems in predicting death for the whole picu population, and for time periods different from those for which the scores were developed. the aim of the present study was to externally validate the prism, prism iii and pim scores at their intended time points, and to compare their accuracy in predicting mortality at those times with their accuracy at a different time period, namely 4 hours after admission. all consecutive patients admitted to our university hospital picu from june 1998 through to may 2000 were included unless they met the following exclusion criteria : admission in a state requiring cardiopulmonary resuscitation without achieving stable vital signs for at least 2 hours ; admission for scheduled procedures normally done in other hospital wards ; prematurity ; and age more than 18 years. data were prospectively collected to generate scores and predictions for the time periods for which the scores were developed (i.e. pim at 1 hour, prism at 24 hours, prism iii at 12 hours, and prism iii at 24 hours) and to generate scores and predictions for a different time point (i.e. 4 hours after admission). the pim2 score was not evaluated because it had not yet been reported when we began the study. the probabilities of death were calculated at different time points (table 1). to generate a prediction for the prism iii 4-hour score, we used the prism iii 12-hour equation (1996 version). in order to compare observed with expected mortality and to estimate the calibration of the scores, a hosmer lemeshow goodness - of - fit test with five degrees of freedom (df ; we considered five classes of mortality probability : 0% to 30%). such discrepancies have been reported with both paediatric and adult generic scoring systems. the length of stay was studied by bertolini and coworkers because the prism score could not correctly predict outcome. those authors found a good calibration for patients with a length of stay of 4 days or less and a poor calibration in those patients who stayed for longer than 4 days. the present study showed that, for the time periods for which the scores were developed, the pim score provided the earliest (from day 3) and longest (to day 28) calibration. for a different time point (i.e. 4 hours), the three scores were calibrated after a few days : day 2 for the prism 4-hour assessment, day 3 for the prism iii 4-hour assessment, and day 4 for pim 4-hour assessment ; only the pim 4-hour assessment was calibrated until discharge. moreover, patient mortality is affected by demographical, physiological and diagnostic data, but it also depends on many other factors such as comorbidities, which did not appear to be accounted for sufficiently in our population. in the recently reported pim2, the numbers of diagnostic criteria (high risk and low risk diagnosis) and comorbidities have been increased. in fact, prism score, acute physiology and chronic health evaluation (apache) score, mortality probability model (mpm) score and simplified acute physiology score (saps) were reported in several studies to exhibit good discrimination but poor calibration [23,25 - 29 ]. unsatisfactory calibration of scores can be attributed to various factors, including poor performance of the medical system (if observed mortality is greater than predicted mortality), differences in case mix and mortality rate, as well as failure of the score equation to model the actual situation accurately. the above mentioned paediatric studies did not give any information on the childrens ' characteristics (case mix), which potentially could explain discrepancies between discrimination and calibration. indeed, the two studies using the additional variables of the prism iii score did not provide a clear description of their population. important differences in case mix data are represented by mortality rates, which were different between picus (e.g. 4.8% for pollack and coworkers, 6.6% for gemke and van vught and 10.0% in the present study). the further the hospital mortality rate diverged from the original rate, the worse the performance of the model. goodness - of - fit tests are more sensitive than aucs, and it has been suggested that, in the presence of good discrimination, bad calibration due to the source is correctable by using customization. however, diamond demonstrated that perfect calibration and perfect discrimination can not coexist ; a perfectly calibrated model is not perfectly discriminatory because it has an auc of only 0.83 rather than 1. customization of a score is justified when the database on which it was developed is old and when the score is used in a specific population. however, customization by a unit could lead to inability to evaluate (or compare) performance between units. is a score with poor calibration useful ? if scores are used to assess quality of care, as estimated by smr, then calibration, rather than discrimination, is the best measure of performance. it is also recognized that there are no formal means of directly comparing the values derived from the goodness - of - fit test. our data and those reported by livingston and coworkers showed large differences in goodness - of - fit test values between several scores. thus, one can consider that a way to describe calibration of a score is to detail the goodness - of - fit test values for different classes of mortality probability, which reflects exact prediction across the full range of severity (tables 3 and 5). scoring systems are used to compare or control for severity of illness in clinical trials and have been integrated into guidelines. the question is, what kind of scoring system do we need if we are to include children in clinical trials ? we probably need a score that represents well the patient 's condition early after admission to the picu. with this aim in mind pim score takes into account the condition of the patient directly on arrival in the picu (i.e. when the patient 's condition is least affected by therapeutic intervention). prism score require an observation period of 24 hours, which represents a limitation of its use as an inclusion criterion in clinical trials. to date, no consensus has been reached as to which approach represents the ' gold standard '. in order to minimize inclusion delay, pollack and coworkers proposed estimation of the probability of death using the prism iii calculated 12 hours after admission. however, this delay is too long for serious diseases (e.g. meningococcal septic shock). in the present thus, a 4-hour observation period seems to be a good compromise, allowing evaluation of the patient 's clinical condition and permitting stabilization, without delaying inclusion in a therapeutic trial. calculation of the scores at 3 or 5 hours would probably have yielded similar results. to our knowledge, no study has compared the performance of generic paediatric mortality scores calculated within a few hours of admission to the picu. castellanos - ortega and coworkers used a similar approach in a specific population of children with meningococcal septic shock by calculating one generic (pim) and two specific scores 2 hours after picu admission ; the pim 2-hour score was as discriminant (auc 0.82) as their new score (auc 0.92 ; p = 0.10) but exhibited poor calibration. the present study indicates that, among generic scores calculated at 4 hours after admission and with good discriminatory capacity (i.e. auc > 0.80), only the pim 4-hour score was well calibrated. the updated pim2, which takes into account new primary reasons for icu admission and comorbidities, must be validated for the time point for which it was developed and at a different time point. further studies are required before the pim (or pim2) 4-hour score can be used as an inclusion criterion for clinical trials. among generic paediatric mortality scores calculated at 4 hours after admission in 802 consecutive children, only the pim score was both discriminant and calibrated auc = area under the receiver operating characteristic curve ; df = degrees of freedom ; icu = intensive care unit ; picu = paediatric intensive care unit ; pim = paediatric index of mortality ; prism = paediatric risk of mortality ; smr = standardized mortality ratio. the authors ' contributions were as follows : study conception and design : francis leclerc and stphane leteurtre ; acquisition of data : stphane leteurtre, jessica wirth, odile noizet, eric magnenant, ahmed sadik, catherine fourier and robin cremer ; analysis and interpretation of data : stphane leteurtre, francis leclerc and jessica wirth ; draft of the article : stphane leteurtre, francis leclerc and eric magnenant ; critical revision of the manuscript for important intellectual content : all investigators read and commented regarding important intellectual content ; statistical expertise : stphane leteurtre and jessica wirth ; admistrative, technical, or materiel support : stphane leteurtre, ahmed sadik, odile noizet, catherine fourier and robin cremer ; supervision : francis leclerc. effect of the length of stay on calibration of the paediatric index of mortality (pim), paediatric risk of mortality (prism) and prism iii scores for (a) the time points for which the scores were developed (1 hour [h1 ] for pim, 24 hours [h24 ] for prism, and 12 hours [h12 ] and h24 for prism iii) and (b) a different time period, namely 4 hours (h4). effect of the length of stay on discrimination of the paediatric index of mortality (pim), paediatric risk of mortality (prism) and prism iii scores for (a) the time points for which the scores were developed (1 hour [h1 ] for pim, 24 hours [h24 ] for prism, and 12 hours [h12 ] and h24 for prism iii) and (b) a different time period, namely 4 hours (h4). lemeshow goodness - of - fit test values and aucs : time point for which the scores were developed auc, area under the receiver operating characteristic curve ; df, degrees of freedom ; pim, paediatric index of mortality ; prism, paediatric risk of mortality. hosmer lemeshow goodness - of - fit test values : time point for which the scores were developed significantly greater than 1 (p = 0.002). ci, confidence interval ; pim, paediatric index of mortality ; prism, paediatric risk of mortality ; smr, standardized mortality ratio. lemeshow goodness - of - fit test values and aucs : 4 hours auc, area under the receiver operating characteristic curve ; df, degrees of freedom ; pim, paediatric index of mortality ; prism, paediatric risk of mortality. hosmer - lemeshow goodness of fit test values : 4 hours significantly greater than 1 (p < 0.0001 for prism at 4 hours and p = 0.0025 for prism iii at 4 hours). ci, confidence interval ; pim, paediatric index of mortality ; prism, paediatric risk of mortality ; smr, standardized mortality ratio. | introductiontwo generic paediatric mortality scoring systems have been validated in the paediatric intensive care unit (picu). paediatric risk of mortality (prism) requires an observation period of 24 hours, and prism iii measures severity at two time points (at 12 hours and 24 hours) after admission, which represents a limitation for clinical trials that require earlier inclusion. the paediatric index of mortality (pim) is calculated 1 hour after admission but does not take into account the stabilization period following admission. to avoid these limitations, we chose to conduct assessments 4 hours after picu admission. the aim of the present study was to validate prism, prism iii and pim at the time points for which they were developed, and to compare their accuracy in predicting mortality at those times with their accuracy at 4 hours.methodsall children admitted from june 1998 to may 2000 in one tertiary picu were prospectively included. data were collected to generate scores and predictions using prism, prism iii and pim.resultsthere were 802 consecutive admissions with 80 deaths. for the time points for which the scores were developed, observed and predicted mortality rates were significantly different for the three scores (p < 0.01) whereas all exhibited good discrimination (area under the receiver operating characteristic curve 0.83). at 4 hours after admission only the pim had good calibration (p = 0.44), but all three scores exhibited good discrimination (area under the receiver operating characteristic curve 0.82).conclusionsamong the three scores calculated at 4 hours after admission, all had good discriminatory capacity but only the pim score was well calibrated. further studies are required before the pim score at 4 hours can be used as an inclusion criterion in clinical trials. |
key clinical messageprimary aldosteronism (pa) in pregnancy is rare. due to pharmacological limitations and risks associated with surgical intervention during pregnancy, clinical decision making in this area is difficult. we report the shortterm use of eplerenone in the management of hypertension and hypokalemia due to pa in pregnancy. |
|
our synthetic strategy (figure 2), inspired by stork s elegant synthesis of reserpine, targets a variety of yohimbinoid alkaloid natural products from the elaboration of pentacycles related to 15, which vary only in the indole moiety. pentacycle 15 could in turn arise from aminonitrile 16, where careful tuning of the reaction conditions would enable cyclization to either series of c(3) epimeric natural products. the aminonitriles related to 16 would arise from a condensation / strecker sequence with a common intermediate aldehyde (17) and the requisite amine derivative. aldehyde 17 was expected to arise from oxidative cleavage of hydrindanone 18, which could be constructed from a diels - alder reaction between diene 19 and enone ester 20. this cycloaddition would set four contiguous stereocenters, leaving only the c(3) stereocenter to be set at a later stage. our synthetic studies commenced with readily available diene 19 (figure 2) and enone ester 20. heating the mixture of these two compounds in toluene at 100 c afforded hydrindanone 18 in 89% yield as a > 10:1 ratio of the endo : exo diastereomers (endo assignment is in reference to the more electron withdrawing ketone moiety), which were readily separated by column chromatography. of note, the enantiomers of the endo adducts can be readily separated on a preparatory scale using supercritical fluid chromatography and a chiral odh column (for further details, see the supporting information). while access to 18 sets the stage for preparing the natural products in enantioenriched form, the syntheses reported herein were carried out in racemic form. hydrogenation of 18, silyl ether cleavage and sulfonation of the resulting primary alcohol group yielded benzenesulfonate 21 in 82% yield over three steps. at this juncture, treatment of aldehyde 17 with potassium cyanide in the presence of various tryptamine derivatives then furnished the desired aminonitriles (16a - c) as single diastereomers and in excellent overall yields. the relative stereochemistry of the 4-ome tryptamine aminonitrile was unambiguously established by x - ray crystallographic analysis (see ortep 16b, figure 2 ; some hydrogen atoms removed for clarity). substrates 16a - c were subjected to pictet - spengler cyclization conditions (table 1), with special attention paid to the role arene nucleophilicity plays in both the rate and stereoselectivity of the pentacycle formation. consistent with the elegant studies of the stork group, treatment of aminonitriles 16a - c with hydrochloric acid (0.1 m in thf) at 23 c resulted in exclusive formation of the -diastereomer (i.e., 23a - c ; see entries 1 - 3) for all substrates. the relative stereochemistry was unambiguously assigned for substrate 23b by x - ray crystallographic analysis (see ortep, table 1 ; some hydrogen atoms removed for clarity). more surprising, however, was that the inherent diastereoselectivity of the thermal pictet - spengler cyclization (heating to 160 c in acetonitrile ; method b in table 1) of the substrates was greatly influenced by the nature of the indole fragment (see entries 4 - 6). tryptamine - derived aminonitrile 16a cyclized upon heating in acetonitrile to afford a 1:3 (:) mixture of diastereomers, whereas 4-methoxytryptamine substrate 16b and 6-methoxytryptamine substrate 16c cyclized to give a 1:1.8 (:) and 1:8 (:) mixture of diastereomers, respectively. of note, the latter observation is in line with the observed diastereoselectivity for the thermal cyclization of aminonitrile 3 in refluxing acetonitrile reported by stork. because several yohimbinoid natural products possess the indole substitution pattern present in 16a and 16b, the stereoselectivities for these cyclizations needed to be improved if a versatile approach to the yohimbinoid natural products was to be realized. as such, we embarked upon a campaign to optimize the diastereoselectivity of the pictet - spengler cyclization under thermal conditions (i.e., method b) and chose to focus on substrate 16b as it represented the most challenging selectivity scenario. stork has previously proposed the formation of a tight ion pair between the departing cyanide and forming iminium ion under thermal pictet - spengler conditions for aminonitriles, which leads to attack of the arene nucleophile from the -face (see 2624b, figure 3). on the basis of this analysis, we reasoned that a solvent with a lower static permittivity (dielectric constant) would lead to tighter ion pairing and further enhance the diastereoselectivity of the cyclization. in an initial investigation of solvent effects (entries 3 - 7, table 2), only acetonitrile and isopropanol, among solvents of similar polarity, provided the desired diastereomer (24b) as the major product, suggesting a more participatory role of the solvent. several mechanistic possibilities that may exist are shown in figure 3. in one scenario, an acetonitrile solvent molecule could engage iminium ion 26 to form a different electrophilic species (see 27 or 28, figure 3) that could then be displaced by the indole moiety in a direct intramolecular sn2-like process. as a probe for this mechanistic possibility, nucleophilic additives such as dmap and imidazole were investigated. gratifyingly, heating aminonitrile 16b to 160 c in the presence of dmap in toluene led to reversal of the stereoselectivity (from a 1.8:1.0 d.r. (:) for the thermal cyclization without additives in toluene ; entry 7, table 2) to favor the diastereomer (1:2 d.r. (:) ; entry 10, table 2) relative to cyclization in the absence of additives (1:1.8 d.r. upon addition of a stronger nucleophile (in the form of nai ; entry 11, table 2), a greater than 1:10 d.r. although the mechanism of the thermal pictet - spengler cyclization and the role of the iodide additive is still unclear, it may be that rapid exchange of the cyanide for the iodide occurs to produce a reactive iodo species (analogous to 16b, figure 3). at this juncture, iminium ion 27 could begin to form with the much larger iodide serving as an intimate counteranion and effectively blocking the -face and leading, overwhelmingly, to the -diastereomer (24b) as the major product. computational studies are currently underway to provide insight on the observed diastereoselectivities of the pictet - spengler reaction as well as the role of additives such as nai. with optimized cyclization conditions leading to either c(3) epimer in hand, all that remained to complete the synthesis of venenatine (9) and alstovenine (12) was removal of the allyl ester by deallylation / decarboxylation and cleavage of the benzyl ether in 23b and 24b (figure 4). toward this end, we have found that treatment of ester 23b with a pd(ii) precatalyst under neutral conditions and elevated temperature facilitates conversion to the desired monoester (29) along with some elimination of the benzyloxy group to give an enoate (30). hydrogenolysis of the benzyl ether in 29 to give venenatine (9) was fraught with its own challenges. neither increasing the h2 pressure (up to 200 psi) nor using acid additives resulted in the desired benzyl ether cleavage. however, treatment of 29 with bbr3 at low temperature selectively cleaved the benzyl ether, leaving both the methyl ester and methyl ether intact, to afford venenatine (9) in 60% yield. the stereochemical assignment of the methyl ester group was determined by noesy studies (for further details, see supporting information). interestingly, in the case of alstovenine the use of the deallylation / decarboxylation conditions employed for venenatine pentacycle 23b led only to recovered starting material and the product of -hydroxy elimination. this undesirable outcome could be circumvented through the use of a more homogenous catalyst system (pd2dba3, pyrrolidine) to afford 31. lastly, bbr3 promoted cleavage of the benzyl ether yielded alstovenine (12). while the spectroscopic data for synthetic and natural alstovenine were in reasonable agreement, we were surprised to observe some large inconsistencies (> 4.8 ppm) when the c data for synthetic venenatine was compared with that reported for the isolated natural product, especially given the support for our assignment by x - ray and noesy analysis of key intermediates. in an effort to identify the origin of these discrepancies, computational predictions for the c nmr chemical shifts of 9 were undertaken since all attempts to obtain an authentic sample for comparison failed. in general, the computed predictions for the c nmr chemical shifts (calculated at the smd(chloroform)-mpw1pw91/6 - 311+g(2d, p)//b3lyp/6 - 31+g(d, p) level with linear scaling ; for complete computational details see the supporting information) were found to be in better agreement with our synthetic data (mean absolute deviation (mad) of 1.37 ppm) than with the isolation data (mad of 1.85 ppm). furthermore, the computational predictions identified two c resonances (at 104.3 ppm and 31.0 ppm) from the isolation data as outliers ; both deviating by 5.0 ppm or more from the computational data (a complete line listing comparison can be found in the supporting information). importantly, the outlier at 104.3 ppm reported in the c data for isolated venenatine, which was one of the resonances that differed markedly from our synthetic c data, also varies significantly from the corresponding c resonances reported for closely related congeners including alstovenine, 16-epi - alstovenine, 16-epi - venenatine, and 9-methoxy-3-epi--yohimbine, which are all in line with our synthetic data. while no conclusive statement can be made regarding the origin of this discrepancy, it is possible that the reported data for isolated venenatine may have been mistabulated. in summary, we have identified, an effective, general path to the syntheses of a subset of yohimbinoid alkaloids that are epimeric at c(3). this work, which has resulted in the first total syntheses of the alkaloids venenatine and alstovenine in racemic form, builds on important observations by stork pertaining to aminonitrile pictet - spengler cyclizations. key to the success of our synthetic studies was the identification of conditions to effectively control the diastereoselectivity of a late - stage pictet - spengler cyclization employing a variety of indole nucleophiles. highlights from this study include : 1) the use of a hydrindanone intermediate 18, which allows rapid, stereoselective synthesis of the yohimbinoid skeleton, 2) the discovery that nucleophilicity of the indole moiety plays a significant role in the inherent diastereoselectivity of the pictet - spengler cyclization, and 3) the addition of an exogenous nucleophile (nai) that leads to the complete reversal of the diastereoselectivity in the installation of the c(3) center. | the yohimbinoid alkaloids have received considerable attention from the synthetic community due to their interesting chemical structures and varied biological activity. although there have been several elegant syntheses of certain members of this group of alkaloids, a truly unified approach has yet to be developed. in short, general approaches to this compound class have been hampered by a lack of complete control in setting the c(3) stereocenter at a late stage. herein, we report that a functionalized hydrindanone enables a divergent strategy that builds on precedent from stork, which addresses this long standing challenge. utilizing an aminonitrile intermediate, the stereochemistry at c(3) of the yohimbinoid skeleton can be effectively controlled in a pictet - spengler reaction. this approach has been applied to the first total syntheses of the c(3) epimeric natural products venenatine and alstovenine. |
hip fracture occurs primarily in the elderly, and is one of the most important causes of disability and death in this age group (1). the number and mean age of the elderly continues to increase, and thus fracture incidence is likely to follow (2 - 5). hip fracture is becoming a major health burden worldwide. rowe. (6) at our institute, reported the first epidemiological study on hip fracture in korea and provided much information. however, since the previous study conducted in 1991 (reported in 1993) the socio - economic environment has changed and the number of elderly koreans has increased. the purpose of this study was to determine the incidence of hip fracture in 2001, to compare this with that of 1991. patients aged 50 yr or more, living in gwangju city and chonnam province, korea, and who sustained a fracture of the hip during the year 2001 were investigated. primary patient information was obtained from the health insurance review agency (hira). as a crosscheck, all hospitals to which patients suspected of hip fracture might have been referred were visited. a total of 125 hospitals was visited, and medical records and radiographs were reviewed. all registered patients with a diagnosis of hip fracture or with a suspected diagnosis of hip fracture were reviewed. in this study, only patients who were admitted to hospitals for primary treatment of a first hip fracture were selected. we also interviewed patients or relatives by telephone to confirm post - fracture course or survival. the time from injury to interview ranged from 15 to 25 months with a mean of 18 months. only fractures of the femoral neck and intertrochanteric fractures were included, subtrochanteric fractures were excluded, since they usually caused by high energy trauma. information collected from the hospital records included age, sex, the nature of injury, the day of injury, location, the period from injury to hospital presentation, the method of treatment, the degree of osteoporosis, and the presence of concomitant medical conditions. location and type of fracture were determined from radiographs. the level of daily activity was graded into 4 groups according to a modification of halpin and nelson classification (8). the semiactive group in his classification was subdivided into those with " moderate activity " and those with " limited activity ". in the present study, we described patients with full and moderate activity as having " good activity ", and those with limited activity or who were bedridden as having " poor activity ". age and sex specific annual incidences were calculated using the population of the gwangju city and chonnam province area as of 1 july 2001. data were analyzed using the spss for windows v11.0 (spss, chicago, il, u.s.a.). for all analyses, a p - value of < 0.05 was considered statistically significant. data were analyzed using the spss for windows v11.0 (spss, chicago, il, u.s.a.). for all analyses, a p - value of < 0.05 was considered statistically significant. the population of the gwangju city and chonnam province, aged 50 yr or more in 2001, was 864,966, of whom 491,673 were female and 373,293 were male, giving a sex ratio of 1.3:1. these individuals accounted for 25% of the total population (3,483,073) of this area. hip fractures occurred in 1,152 patients, an incidence of 0.133% (13.3/10,000 per year) in this age group ; 15.0/10,000 in gwangju and 12.6/10,000 in chonnam. incidences were 3.1/10,000 in the age group 50 - 59 yr, 9.3 between 60 - 69 yr, 26.6 between 70 - 79 yr, and 62.8 in patients aged 80 yr or more. age specific incidence rates showed a gradual increase (p<0.001) (table 1). no significant differences were found between the incidences in urban and rural areas. in the urban area (gwangju, mokpo, yeosu, and suncheon cities), this was 14.2/10,000 and in the rural area 12.5/10,000 (p=0.239). the mean age of patients who sustained a fracture was 74.1 yr (range 50 to 100 yr), and was 70.6 yr in men and 76.2 yr in women. the mean age for a fracture of the femoral neck was 74.1 yr and for an intertrochanteric fracture 74.2 yr. the mean age of patients from urban areas was 73.9 yr and from rural areas 74.4 yr. there was a 5.6-yr difference between the mean age of men and women (p<0.001), but no statistical difference was found between the two fracture types or between their incidences in urban and rural areas. in terms of sex distribution among those that experienced a fracture, 730 were females and 422 males, a ratio of 1.7:1 (p<0.001). the frequency of hip fractures among men was 11.3 per 10,000 per year (422/373,293), and among women was 14.8 per 10,000 (730/491,673), thus female patients predominated (p<0.001). fractures occurred in spring in 301 patients, summer in 276, fall in 292, and winter in 283, which was not significantly different (p=0.746). 907 patients (78%) were injured by slipping at ground level, 101 by falls from more than one meter, 79 in road traffic accidents, and 65 from other causes. the average period elapsed between injury and presentation at hospital was 2.7 days, ranging from the day of injury to 180 days after injury. the subtypes were subcapital in 278 (50%), transcervical in 160 (29%) and basicervical in 119 (21%). and there were 595 intertrochanteric fractures ; type i of the tronzo classification (9) was found in 43 (7%), type ii in 153 (26%), type iii in 269 (45%), type iv in 116 (19%), and type v in 14 (2%). radiographic examinations showed definite osteoporosis (singh grade i - iii) in 70%, borderline osteoporosis (grade iv or v) in 29%, and 1% were normal (grade vi). definite osteoporosis was seen in 48% of patients aged 50 - 59 yr, in 65% of those aged 60 - 69 yr, in 70% of those between 70 - 79 yr and in 81% in those aged 80 yr or more (table 2). definite osteoporosis was identified in 63% of males and in 73% of females (p=0.000). osteoporosis was observed in 73% of fractures of the femoral neck and in 67% of intertrochanteric fractures (p<0.012). operations included replacement arthroplasty of the femoral head in 434, total hip replacement in 39, and osteosynthesis in 537. the types of fixation used in osteosynthesis were a compression hip screw in 341, multiple pins in 83, an ender intramedullary nail in 5, a rowe plate in 2, a gamma nail in 101, and an angled blade plate in 5. arthroplasty was performed in 393 of 490 operations for a fracture of the femoral neck, and in 80 of 520 procedures for intertrochanteric fracture (table 3). of 1,010 patients (88% of all patients) who received an operation, 374 (37%) achieved full activity postoperatively, 245 (24%) moderate activity, 180 (18%) limited activity, and 211 (21%) were bedridden. in 142 patients that received non - operative management 33 (23%) showed full activity, 9 (6%) moderate activity, 17 (12%) limited activity, and 83 (59%) were bedridden. postinjury activity was good in 61% of the operated group and in only 30% of the non - operated group (p<0.001). of the 1,152 patients, 172 died within 12 months of injury, a mortality rate of 14.9%. the age and sex adjusted mortality rate in the general population was 5.8% in this age group. in detail, the mortality rate in the operated group was 5.5% within 3 months of injury, 7.7% within 6, 10.5% within 9, and 12.3% within 12. the mortality rate in the non - operated group was 16.2% within 3 months of injury, 23.2% within 6, 32.4% within 9, and 33.8% within 12 (p<0.001). thus the annual mortality rate of patients that experienced fracture (14.9%) was 2.6 times higher than in the general population (5.8%). to determine significant changes during the 10-yr period from the year of 1991, when the first korean epidemiological study of hip fracture was conducted by our institution in the same area (6), the year 2001 and 1991 results were compared. the total annual number of hip fractures rose considerably during the 10-yr period from 247 in the year 1991 to 1,152 in 2001, an average increase of 36.6% per year. the fracture incidence also increased remarkably from 3.3 per 10,000 in 1991 to 13.3 in 2001, representing a 4-fold increase over 10 yr (p<0.001). in 1991, the total population of gwangju city and chonnam province area was 3,685,283 and the population aged 50 yr or more was 757,417, accounting for 20.6% of the total population. in the year 2001, there was a 5.5% decrease in the total population versus 1991, but the population aged 50 yr or more increased by 14.2% (p<0.001). the mean age of the elderly that experienced a hip fracture also rose during this 10-yr period from 70 yr in 1991 to 74 yr in 2001. in women this increase was from 73 yr to 76 yr, and in men from 67 yr to 71 yr. although seasonal incidences were not significantly different, there was a difference between the observed seasonal increases. increases in incidence of fractures were higher in winter (4.7-fold increase) and spring (4.4-fold increase) than in fall (3.8-fold) and summer (3.6-fold), suggesting that the elderly people are becoming at higher risk of falling in the cooler seasons. regarding fracture pattern, a definite increase was observed in unstable intertrochanteric fracture (tronzo type iii, iv, v), which is usually caused by a severe fall. in 1991, the proportion of unstable intertrochanteric fractures was 54%, which increased to 66% in 2001 (p=0.006). a significant increase in definite osteoporosis was noted, from 50% in the year 1991 to 70% in the year 2001 (p<0.001). a remarkable increase was observed in two age groups : 27% in the year 1991 to 48% in the year 2001 in those aged 50 - 59 yr (p=0.012) and 37% in the year 1991 to 65% in the year 2001 in those aged group of 60 - 69 yr (p<0.001) (table 2). to determine significant changes during the 10-yr period from the year of 1991, when the first korean epidemiological study of hip fracture was conducted by our institution in the same area (6), the year 2001 and 1991 results were compared. the total annual number of hip fractures rose considerably during the 10-yr period from 247 in the year 1991 to 1,152 in 2001, an average increase of 36.6% per year. the fracture incidence also increased remarkably from 3.3 per 10,000 in 1991 to 13.3 in 2001, representing a 4-fold increase over 10 yr (p<0.001). in 1991, the total population of gwangju city and chonnam province area was 3,685,283 and the population aged 50 yr or more was 757,417, accounting for 20.6% of the total population. in the year 2001, there was a 5.5% decrease in the total population versus 1991, but the population aged 50 yr or more increased by 14.2% (p<0.001). the mean age of the elderly that experienced a hip fracture also rose during this 10-yr period from 70 yr in 1991 to 74 yr in 2001. in women this increase was from 73 yr to 76 yr, and in men from 67 yr to 71 yr. although seasonal incidences were not significantly different, there was a difference between the observed seasonal increases. increases in incidence of fractures were higher in winter (4.7-fold increase) and spring (4.4-fold increase) than in fall (3.8-fold) and summer (3.6-fold), suggesting that the elderly people are becoming at higher risk of falling in the cooler seasons. regarding fracture pattern, a definite increase was observed in unstable intertrochanteric fracture (tronzo type iii, iv, v), which is usually caused by a severe fall. in 1991, the proportion of unstable intertrochanteric fractures was 54%, which increased to 66% in 2001 (p=0.006). a significant increase in definite osteoporosis was noted, from 50% in the year 1991 to 70% in the year 2001 (p<0.001). a remarkable increase was observed in two age groups : 27% in the year 1991 to 48% in the year 2001 in those aged 50 - 59 yr (p=0.012) and 37% in the year 1991 to 65% in the year 2001 in those aged group of 60 - 69 yr (p<0.001) (table 2). our results confirm a rising trend in the absolute number of hip fractures from 247 in 1991 to 1,152 in 2001, which is equivalent to a fracture incidence from 3.3 persons per 10,000 population in the year 1991 to 13.3 in 2001, and an age - adjusted incidence from 3.74 persons per 10,000 population in the year 1991 to 13.3 in the year 2001. this study also confirms rising trends in age - specific incidences of women and men, as illustrated in table 1. an increase of 4.8-fold was observed in women and 3.1-fold increase in men in terms of fracture incidence during the 10-yr period from the year 1991 to 2001. in the first limitation, there were patients who were not treated in the hospitals after hip fractures. as their number is very small compared with the number of hospital admission in the present medical system, the resulting underestimation of the incidence of these fractures is negligible. in the second limitation, patients developed the hip fracture in our study area were transferred to the other region in any cause. informations obtained from the hira were included all the patients who had hip fractures in our country. because we selected all the patients registered in the gwangju city and chonnam province among the above mentioned patients, the loss of patients who were transferred to outside the gwangju city and chonnam province could be prevented. in most industrialized countries (1) reported a 2.7-fold increase in fracture incidence over 27 yr in finland. (10) reported an increase of 59.7% in women and 42.2% in men in annual hip fracture numbers during the period 1972 - 1984. in singapore, fracture incidences in 1957 - 1963, were 106/10,000 in women and 148/10,000 in men for ethnic chinese and 44 in women and 52 in men for ethnic malays (11). according to studies made in 1991 - 1998 (12), these incidences increased to 410 in women and 168 in men for chinese and 264 in women and 71 in men for malay. these data mean that the increase in fracture incidence was from 3.7- to 6.0-fold in women and from 1.1- to 1.4-fold in men. in the present study, an increase in fracture incidence of 4.8-fold was observed in women and 3.1-fold in men during the 10-yr period from the year 1991 to 2001. thus, our study demonstrates that the number of hip fractures in gwangju city and chonnam province, korea has increased at a rate that can not be explained by demographic changes alone. the precise reason for this are not known, but increases of osteoporosis and injurious falls of the elderly could partly account for the difference. the incidence of osteoporosis and an increased propensity for injurious falls have been proposed as factors frequently in the literature (1, 13 - 16). these factors include increased body height, greater occurrence of associated systemic diseases, poorer nutrition including calcium and vitamin d, more frequent use of drugs (particularly psychotropic drugs), greater consumption of tobacco and alcohol, a less active life style, poorer general mobility including an impaired gait, balance, proprioception, reaction times, and muscle strength (1, 13, 15, 17). as a possible explanation for the rising incidence observed in the present study, three factors are suggested by our results. firstly, there was an increase in the elderly population from 20.6% of the total population in the year 1991 to 24.8% in the year 2001. secondly, bone weakness increased due to osteoporosis. patients with definite osteoporosis increased substantially from 50% in the year 1991 to 70% in the year 2001. a remarkable increase was observed in two age groups, i.e., 27% in the year 1991 to 48% in the year 2001 for those aged 50 - 59 yr, and 37% in the year 1991 to 65% in the year 2001 for those aged 60 - 69 yr. as compared with the year 1991 figures in the year 2001 fractures increased more so in winter (5.5-fold) and in spring (5.3-fold) than in the summer (4.0-fold) and fall (4.2-fold), suggesting that the elderly people are becoming at higher risk of falling in the cooler seasons. in addition, the proportion of unstable intertrochanteric fracture increased from 54% in 1991 to 66% in the year 2001. in conclusion, the reasons for this rising trend of hip fracture in gwangju city and chonnam province, korea, were not fully explained. however, an increase in the elderly population, an increase in osteoporosis, and an increase in injurious falls could partly account for the observed increase. | the purpose of study was to determine the incidence of hip fracture in 2001, to compare this with that of 1991, and to identify possible causes of change. patients aged 50 yr or more living in gwangju city and chonnam province, korea, and who sustained a fracture of the hip during 2001 were investigated. only patients who were admitted to hospitals for primary treatment of the first hip fracture were selected. there were 1,152 patients. a comparison of fracture incidences for 1991 and 2001 showed considerable increase during the 10-yr period. the total annual number of hip fractures rose from 247 in 1991 to 1,152 in 2001 and the fracture incidence also increased remarkably from 3.3 persons per 10,000 population in 1991 to 13.3 in 2001, representing a 4-fold increase over 10-yr. the reasons for this rising trend of hip fracture were not fully explained. however, an increase in the elderly population, an increase in osteoporosis, and an increase in injurious falls could partly account for the observed increase. |
hepatocellular carcinoma (hcc) is a rare tumour in young adults. in older patients, common predisposing conditions include cirrhosis in general, and in particular chronic liver disease associated with persistent hepatitis b and c infection. however, young patients who develop hcc are less likely to have associated chronic liver disease (33%) compared to adults (7090%). in children, inborn errors of metabolism, such as alpha-1-antitrypsin deficiency, hereditary tyrosinaemia, gaucher 's disease, congenital biliary atresia, urea cycle defects, and familial cholestatic syndrome caused by a bile salt export pump deficiency, may be the underlying cause. prognosis in the presence of metastatic disease is poor, although it may be somewhat better in children and younger adults compared to older adults, with long - term survival of 1020% compared to less than 5%, respectively. we describe a case of advanced hcc in a young patient arising in a non - cirrhotic liver, which was thought to be causally associated with a congenital cholestasis syndrome. the patient was first admitted to the hospital as an infant when he was 2 weeks old. the reason was weakness and jaundice. bilirubin was elevated to 500 mol / l, of which only one third was conjugated. a diagnosis of abo haemolytic disease of the newborn was suspected, but intensive phototherapy and exchange transfusion had only limited effect. a liver biopsy performed at the age of 2 months showed severe pan- and multiacinar canalicular cholestasis with numerous bile thrombi and cholestatic rosettes. liver cells were swollen with marked feathery degeneration and there was widespread giant cell transformation. there were scattered apoptotic hepatocytes but only minimal accompanying inflammation. in addition, there was focal extramedullary haematopoiesis. portal bile ducts were present in normal numbers, and there was no morphological evidence of extrahepatic large duct obstruction. a biliary scintigraphy confirmed cholestasis, showing no drainage of bile into the central hepatic bile ducts or the duodenum, and the extrahepatic bile ducts were normal at endoscopy. bilirubin slowly normalised during the following year, while alkaline phosphatases stayed elevated at 1,0001,500 u / l for several years, indicating a mild, long - term cholestasis (fig. the patient developed recurrent, intermittent swollen legs and periorbital oedema, and had episodes of stomach pain and fatigue. repeated liver biopsies at the age of 3 and 6 years showed only minimal, non - specific portal inflammation without evidence of cholestasis or fibrosis. a diagnosis of aagenaes syndrome was suspected ; however, no typical genetic alterations were found, and the patients condition improved spontaneously and alkaline phosphatases normalised as he reached adolescence. at the age of 17 years a ct scan demonstrated a 150 100 mm necrotic tumour in the right liver lobe with multiple hepatic satellite nodules, multiple metastases to the lungs, a tumour embolus in the right atrium and extensive thromboses involving the inferior vena cava, hepatic vein and portal vein. serum -foetoprotein (fp) was markedly raised at 296,000 u / ml (normal < 14 u / ml), while hcg was normal. no clinical or biochemical evidence of cirrhosis was found and hepatitis virus titres were negative. a biopsy from the large liver mass showed a malignant tumour composed of hepatocyte - like cells, organised in a trabecular pattern. immunohistochemical staining revealed a typical phenotype, including tumour cell positivity for hep - par1, glypican-3 and fp. taken at the same time from a lung metastasis revealed infiltrating hcc, subsequently confirmed by immunohistochemistry. a biopsy from the non - tumorous liver showed reactive tissue without evidence of cirrhosis. the patient 's oncological treatment is summarised in figure 2 together with fp values and the results of tumour evaluation by ct - scans. at the time of first treatment his poor condition (who performance status (ps) 3) precluded combination chemotherapy and single - drug cisplatin was therefore offered. prior to the second treatment cycle, his condition had improved (ps 2), allowing the administration of five series of combination chemotherapy, which contained gemcitabine, docetaxel and cisplatin. toxicity included diarrhoea and neutropenia ctc grade i, together with vomiting, anorexia, anaemia and alopecia (grade ii). a further improvement in the patient 's clinical condition was observed during this treatment, and its effect was confirmed by a major, partial response on the corresponding ct scans (fig. the response defined by ct was preceded by a rapidly dropping fp. after a pause in chemotherapy, ct scans showed progression, accompanied by a continuous rise in fp. at the first progression, sorafenib at standard dose was offered. toxicity was dose limiting and consisted of neutropenia grade ii, diarrhoea, vomiting, rash and pruritus grade iii, requiring a 4-week treatment break. sorafenib was then administered at a reduced dose for 2 weeks and later escalated with acceptable toxicity. at the 2nd objective progression the patient was offered chemotherapy with gemcitabine and oxaliplatin, but no apparent effect was observed., the patient had remained in excellent general condition (ps 01). at the 3rd progression, experimental treatment with erlotinib plus bevacizumab however, bevacizumab was never administered because of deterioration in the patient 's general condition. he continued on best supportive care and lived for a further 3 months, totalling 13 months of survival after initiation of chemotherapy. in this rare case, the development of hcc was associated with a history of neonatal and childhood cholestasis with elevated bilirubin and alcalic phosphatases, and intermittent episodes of periorbital oedema and oedema in the legs, stomach pain and fatigue. these symptoms resemble those of the rare aagenaes syndrome, also called lymphoedema cholestasis syndrome. the heritance of this disorder is mainly autosomal recessive ; however, dominant inheritance has also been proposed. a key symptom is transient jaundice with increased conjugated bilirubin that becomes evident soon after birth with recurrent episodes throughout life. oedema in the legs due to hypoplasia of the lymphatic vessels begins around school age and may progress. globally, more than 80 cases have been described. there has been only one previous case diagnosed in denmark, apart from the current case, in which the diagnosis was strongly suspected. patients with aagenaes syndrome have an approximately 25% risk of developing liver cirrhosis, mainly in early childhood. one previous patient who had frequent episodes of cholestasis died at the age of 50 years with cirrhosis and hcc (professor aagens, personal communication 2012). in the current case, the diagnosis of aagenaes syndrome could not be clearly established, in part because of the lack of permanent signs of lymphoedema and absence of typical genetic alterations. although not specific, the histological picture was consistent with various forms of congenital neonatal cholestasis syndrome, including aagenaes syndrome. the choice of systemic treatment in juvenile hcc is difficult, since no phase iii studies of adolescent patients with advanced hcc have been performed. an aggressive approach, including liver tumour resection or liver transplantation and metastasectomy when feasible, is often advocated. in contrast to adult patients with hcc, in whom the tyrosine - kinase inhibitor sorafenib is the only approved drug today, pediatric and juvenile patients are often treated with chemotherapy with much higher response rates. for example, cisplatin and doxorubicin or cisplatin/5-fluorouracil / vincristine produced responses in approximately 50% of treated patients. molecular differences in tumorigenesis and in the underlying liver diseases may account for this difference in effect, comparing children and adults. interpretation of treatment reports is, however, hampered since children with hepatoblastoma, a tumour type which is more chemosensitive than hcc, were included. early studies, e.g. with doxorubicin, showed only modest response rates with significant toxicity, without any clear survival benefits. more recently, phase ii - studies of newer drugs showed response rates around 20% with acceptable toxicity, for example when using gemcitabine / oxaliplatin, in one study combined with the anti - angiogenetic antibody bevacizumab. an asian study of 371 patients randomised to either oxaliplatin + 5-fluorouracil / leucovorin or doxorubicin was insignificant at the preplanned final survival analysis (p = 0.0695), but significant at a follow - up analysis (p = 0.0425). a randomised phase ii study of 96 patients treated by either sorafenib / doxorubicin or doxorubicin showed a clear advantage for the two - drug combination (median time to progression 6.4 vs. 2.8 months, p = 0.02) and also the median overall survival was significantly improved (13.7 vs. 6.5 months, p = 0.006). results of a phase iii - study of this combination are pending. response to chemotherapy is apparently more frequently seen in patients with hcc in nonalcoholic cirrhosis, in the absence of cirrhosis, or in patients with rare variants of hcc, and complete responders have even been reported in patients with metastatic disease. the effect of sorafenib has only been studied in adult patients, most of whom had hcc associated with cirrhosis, or with hepatitis b or c virus infection. sorafenib is a per oral tyrosine kinase inhibitor with activity against multiple growth factors, especially angiogenic growth factors. two randomised phase iii - studies showed modest median survival benefits of 2.8 and 2.3 months, respectively, the hazard ratio of sorafenib versus placebo being approximately 0.69 [12, 13 ]. objective response rates reported were less than 5%, but rare major responders have been documented even in the setting of metastatic hcc. the effect of sorafenib in children and young patients is unknown, although a recent phase i study showed that the treatment is feasible. the current case illustrates that early development of hcc may be associated with congenital cholestasis, even in the absence of cirrhosis. it confirms that chemotherapy, although experimental, is feasible and tolerable in juvenile advanced hcc arising in a non - cirrhotic liver and can provide a major objective response and a meaningful palliation for individual patients. | this case describes the clinical course and treatment of a 17-year - old male patient with advanced hepatocellular carcinoma (hcc) arising in a non - cirrhotic liver. the disease was thought to be caused by a congenital cholestatic syndrome associated with intermittent oedema in childhood, resembling the rare aagenaes syndrome. treatment choices in advanced hcc arising in adolescence are discussed. |
on recognizing the importance of medical laboratory technology and its impact on the health services of saudi arabia, king faisal university (kfu) developed a medical laboratory technology program allied to the college of medicine and medical sciences in 1989. although the profession of medical laboratory technology is a young one, it has acquired a unique body of knowledge and practice. students intending to pursue a career in medical laboratory technology need to understand their critical role in the health care team. graduates of this program at kfu receive a bachelor 's degree (b.sc.) in medical laboratory technology at the end of their course and are eligibile to work as medical laboratory technologists in the clinical laboratories of the various hospitals and health centers in the kingdom. the health goal of the kingdom is to provide effective and comprehensive health care for all its citizens. the kingdom has gone to great lengths to establish hospitals and clinics and to train physicians. the optimal use of these facilities depends on the availability of a variety of allied health professionals to provide essential health care services. in the kingdom, the work of the medical laboratory technologists is done almost exclusively by expatriate staff. in keeping with the kingdom 's policy of introducing saudi nationals into the health services, the training of medical technologists had to start early for the graduates to enter the service as soon as feasible. the colleges of medicine in the kingdom are in the best position to initiate programs in medical laboratory technology, since many of the resources needed for these programs are already available there. the main objectives of the mlt program are : (1) to train competent clinical laboratory personnel to meet present and future needs in primary, secondary, and tertiary health care and research centers in the kingdom. (2) to collaborate with the ministry of health, other institutions and colleges in the kingdom engaged in medical laboratory education for the purpose of improving the quality of training provided in the kingdom to the highest possible standards. (3) to implement effective programs of continuing education for medical laboratory technologists. (4) to encourage and prepare medical laboratory technology graduates for the external certifying examinations and postgraduate programs to improve their standard and expand their horizon. students applying to the program must be high school graduates. to be accepted they must have had a high school certificate examination score of eighty five percent (85%) and above, and must have passed a written admission test and a personal interview. since its inception, a total of 270 students have been enrolled and one hundred and thirty eight (138) students have successfully graduated from the program (figures 1 and 2). as can be seen in figure 2, the number of graduates in 1994, almost twice that of the preceding and succeeding years, is accounted for by the fact that because of the semester system, two batches had graduated within the year. the percentage of student attrition mostly for family reasons, (eg, marriage and/or transfer to other areas of the kingdom) has been low. faculty involved in the training mlt students include mlt staff and faculty members, including demonstrators, lecturers, assistant professors, associate professors and professors of other departments like pathology, biochemistry, microbiology etc. other personnel involved in training these students include laboratory consultants, laboratory supervisors and medical technologists in the various laboratories of different teaching hospitals. mlt students admission / year mlt graduates : 1992 - 2000 (1412 - 1421) some of the problems encountered in the evaluation of the programme have been the negative attitude, misunderstanding and misconception of students families of the meaning and nature of work of the medical laboratory technologist. this problem was however, overcome when the importance of medical technology and its impact on health services was explained. the limited number of places for training in hospital laboratories has restricted the student intake. moreover, besides interfering with the clinical laboratory services for patients, the quality of training would be affected by the presence of large number of students in the laboratories. until september 2001, the program was exclusively for females. the mlt program is a 4 + 1 year (2 + 1 curriculum of study), resembling the 2 + 2 curriculum adopted by a number of schools. the first two and a half years, preprofessional years in the mlt program include courses stated in table 1. subjects taught during first year, second year and first semester of third year during the four years of college, the students take islamic culture courses. as the language of instruction is english, mlt students also take courses in both general and scientific english, needed for the improvement of their language and the understanding of the new terminology. these courses are conducted at the college of medicine with an average of 1 - 3 lectures a week for each course, one to two laboratory practical sessions a week for the courses with a practical component, and also an average of one tutorial per week. the professional phase of this program begins in the second semester of third year through the fourth year. the courses and training in this phase provide students with theoretical background and relevant laboratory skills, with an emphasis on the practical training aspects of medical laboratory technology. the didactic lecture component describes the basic theoretical knowledge of the subject, while the laboratory component emphasizes the techniques used. during the first semester in year three, students work on simulated patients specimens. they are expected to grasp the principles, procedures, methodology and interpretation of all practical tests. the training during the final three semesters consists of structured rotations through the laboratories of king fahd hospital of the university and affiliated clinical laboratories of other teaching hospitals in the eastern province. the first block comprises three long rotations of 10 weeks each, and three short ones of eight weeks each in the second block (table 2). second semester of third year and fourth year courses (56 weeks) during this phase, students work full time in the different hospital laboratories and rotate through all the disciplines of the clinical laboratory. the proposed curriculum is designed to train a generalist who is capable of dealing with all aspects of laboratory practice rather than a specialist whose expertise is predominantly in one area. the adaptability of the generalist to work in multiple areas will ensure that there is always someone to do the work. this is the preferred training by many technologists.1 course grades are determined on the basis of a written examination, a comprehensive practical examination and in most of the courses particularly those of the professional phase, an oral examination. the oral examinations are usually conducted in the presence of external examiners from other universities or health institutions in the kingdom. besides the comprehensive final examinations at the end of the courses, there is continuous assessment of the students during each course. in addition to the practical examinations at the end of each course, students must pass a two - part final certifying examination at the end of the four years, one after the long rotations, and another after the short rotations. a revised curriculum recently submitted for approval, with a change in the number of credit hours for some courses, includes new courses such as medical genetics and laboratory management (table 3). at kfu, students must go through an additional year as laboratory interns before they are eligible to work as qualified medical laboratory technologists. the main objective of this training period is to consolidate the theoretical and practical knowledge of the graduates and refine the skills gained previously. it also provides an opportunity to explore their areas of interest and career choices as well as an on the job training. the graduates rotate through the laboratories of the various hospitals of the eastern province subject to availability of space. the rotations were previously for four months each according to the following options : hematology and blood banking or microbiology and serology with either clinical chemistry or histotechnology. special evaluation forms that assess the essential attributes of a medical laboratory technologist are used to monitor and evaluate the interns throughout the period. the criteria used for assessment include technical skills, judgement, reliability, responsibility, safety, knowledge, punctuality, and professional attitude. the department of mlt, college of applied medical sciences implemented a modified internship training (as from year 2000) to include all laboratory disciplines instead of the three structured rotations mentioned above. the new training will include the six major laboratory sections : clinical chemistry, microbiology, blood banking, hematology, serology/ immun - ology, and histopathology/ cytology. this system was adopted to overcome the problem of laboratory space, cope with the increasing number of students and graduates, and expand the training options for interns. during the past ten years, we have witnessed the evolution and progress of the mlt program at king faisal university. the mlt program at kfu in contrast to other medical technology programs in the kingdom and abroad has some unique features. at kfu, students enter the mlt program after high school and spend four years in an inclusive curriculum to obtain a bachelor 's degree in medical laboratory technology. they also work an additional year as laboratory interns before being eligible to work as qualified laboratory technologists. the graduates with this structured curriculum and internship training are competent in all areas of laboratory practice, because the program is based on a comprehensive approach. though there are different educational programs and formats of curricula for medical laboratory technology they all have the common requirements for a baccalaureate degree, and supervised practical training.23 for comparison they are briefly : (1) 2 + 2 program (similar to kfus program), where the students take the required science prerequisites and are given general education during the first two years (preprofessional courses), then complete the last two years with lectures, and practical training and laboratory experience in a clinical setting (professional years). (2) 3 + 1 program which is college - based, offers the basic science and general education. in this structure, students take these courses during the first 3 years, and spend the last year in an affiliated hospital to acquire practical laboratory experience. (3) in the 4 + 1 program, the student must already have a baccalaureate degree in a discipline such as biology. she / he is given and additional year of training in lectures and practical experience. (4) the integrated program is similar to the 2 + 2 program. in this, students take clinical laboratory science courses throughout the first three years along with other basic science and general education courses. during their senior year the other type of program is the clinical laboratory technician / medical laboratory technician program, mostly based in a community college or junior college. the first year of study is spent in science and general education courses and the second, in clinical practicums. this is somewhat similar to the diploma programs in the health colleges or health institutes in the kingdom, which are of 2 - 3 years duration. the curriculum is constantly being evaluated and revised, for it is the concern of all educators to assess future needs, so that new areas of technology are incorporated in a timely and appropriate manner to prepare students and graduates to meet the challenges and demands of the 21st century. it is the mlt department 's view that an intern trained in this manner is better equipped to meet the kingdoms present and future expectation of the laboratory personnel, which is the ability to work in any laboratory. many employers prefer that students have an internship training before employment and are pleased with many aspects of this approach.4 developers and educaters of mlt programs recognize the importance of a hands - on experience in preparing graduates to be productive effective workers upon completion of their studies. another positive feature of offering internships is the opportunity to preview a potential employee for the laboratory.4 medical laboratory technology was introd - uced as a department within the context of the college of medicine and medical sciences. this discipline has grown from six students at its inception to the 138 successfully graduated within a decade of its existence. the mlt department is now part of the established applied medical sciences college which includes respiratory therapy and physiotherapy, a new department soon to open. the success of the mlt program is partly due to the collaboration with the ministry of health and the armed forces medical services. the training of the students in hospital laboratories belonging to these institutions has provided them with the experience of the differing work environment, and also helped them to gain confidence. the laboratories of the future years will pose great challenges as technology takes enormous strides forward at great speed, and the demand for competent technologists in the kingdom increases. to meet these demands, the mlt training in the kingdom will have to rise to the occasion and become more challenging. recommendations have to made for good coordination and communication among the various programs.56 there might be a need for the formation of a national society or a board for clinical laboratory science to ensure the same standards of education and training throughout the kingdom, and that effective methods are formulated to monitor the performance and maintain high standards of work among laboratory professionals.56 it is also very important to encourage mlt graduates to acquire certification (licensing).78 one example of these certification examinations is the national certification examination for laboratory personnel (ncalp). this laboratory personnel licensure is mandatory for laboratory professionals in many parts of the united states.8 licensure adds stature to the profession. many of the kfu, mlt graduates have been keen to acquire certification and many have been successful. many of our graduates have succeeded in passing the american national certification agency (nca) examination for medical laboratory personnel at the first attempt. the certification process is designed to provide and measure a standard of knowledge desirable for medical laboratory personnel. the percentage pass rate was 83.3%, which exceeds the percentage reported for united states institutions. future plans also include : the implementation of a career development policy for these graduates once they are employed. this policy being considered by king fahd hospital of the university will assign well - defined job descriptions for the different strata of laboratory technologists and serve as a structure for promotion. postgraduate training is very essential for these graduates to upgrade their knowledge, experience and career. the suggested program will include research, classroom instruction and laboratory service. after a lenghty debate many of the graduated technologists are employed at different health sectors in senior positions as laboratory technologists and supervisors. medical laboratory technology covers a broad area of knowledge and provides many opportunities for advancement. it is also a flexible profession, which allows one not only to progress in laboratory work, but also to branch off into other disciplines if desired e.g. medicine.910 it is a multidisciplinary field that provides students with laboratory skills as well as a foundation in science. it is also known as a career with a moderate to high job satisfaction rate.911 further national research is necessary to identify the status of mlt programs in the kingdom and the innovative methods that would enhance the stability and advancement of clinical laboratory science education. | this paper documents the evolution of the medical laboratory technology (mlt) program established in 1989 (1408/1409 h) at the college of medicine and medical sciences, king faisal university. the rationale, objectives, the general outline of the program as well as methods of instruction and evaluation are discussed. the internship period and future plans are also addressed. two hundred and seventy (270) students had been enrolled in the program since its inception until september 2000. ten batches (138 graduates) have already successfully graduated. one hundred and fifteen (83.3%) graduated technologists are employed in the different health sectors and educational institutions in the kingdom. |
cervical cancer is the third most common cancer in women, and the seventh of overall cancers worldwide, with an estimated 529,000 new cases in the year 2008.1 it has been estimated that more than 87% of the global burden occurs in developing countries, where it accounts for 13% of all female cancers. high - risk regions include the eastern and western africa regions.1 in sudan cervical cancer ranks as the second most common cancer among women with age - standardized incidence of 15 per 100,000 and age - standardized mortality of 25 per 100,000.2 substantial reduction in cervical cancer will only be realized if sustainable cervical cancer screening programs are implemented on a global scale to assure early detection and treatment of precancerous lesions. effective programs must meet three targets : at least 70% of the targeted population should be screened at least once in a lifetime ; screening assays and diagnostic tests must be reproducible and sufficiently sensitive ; and specificity for the detection of high - grade precursor lesions and effective treatment must be provided.3 screening with use of pap smear and liquid - based cytology has contributed significantly to the reduction of cervical cancer in developed countries.4 in addition, screening for human papillomavirus with use of dna testing has proven useful in early detection of the disease.5 nevertheless, these methods of screening are very difficult to implement in low - resource countries due to the lack of laboratory infrastructure and trained professionals. therefore there is a vital need for alternative preventive methods for cervical cancer in developing countries.6 recently, interest in visual inspection with acetic acid (via) has increased. numerous studies have been conducted on its accuracy and its ability to detect cervical lesions when compared with other techniques, both conventional and non - conventional. this test is easy, cost - effective, and fits well to low resource countries.8 via is based on the premise that the majority of preinvasive and invasive cervical lesions are visible on examination by the naked - eye after application of acetic acid. it involves insertion of a vaginal speculum and application of 3%5% acetic acid solution using a cotton swab. if there is an acetowhitening area present, the result of the test is positive. the normal squamous epithelium tissue of the cervix is pink. on application of acetic acid, cervical intraepithelial neoplasia (cin) lesion takes on a white color due to the increased precipitation of nuclear proteins and cytokeratins in the cervical epithelium.9 this study aimed to determine feasibility of the via screening method for cervical cancer as an alternative to a pap smear in the primary health care setting in sudan, and to compare performance of via and pap smear. a cross - sectional study of 1250 asymptomatic women living in khartoum, sudan, was conducted in primary health care centers in khartoum state, sudan, during the period of december 2009 to april 2010. healthy married women aged 2550 years, living in khartoum state and who were willing to participate in screening, were included in the study. pregnant women, women with absent menstrual periods, and women with a previous history of cervical cancer, abnormal cytology, or hysterectomy, were excluded from the study. eligible women were included in the study after they were given information about the study s objectives, screening test procedures, and the benefits to be gained from screening. the women who agreed to participate in the study provided written consent. a questionnaire focusing on sociodemographic, obstetrics and gynecological variables, and other risk factors was filled in by each participant with the assistance of registered nurses. the women then underwent a complete physical and gynecological examination, and pelvic assessment performed by a physician trained in early detection of cancer. the pap smear sampling and via testing were performed by the same physician. the via test was performed by application of 3%5% acetic acid into the cervix uteri by using sterile forceps and a small piece of cotton. after 5 minutes a naked - eye assessment was performed under direct illumination of a 100-watt halogen lamp. a positive via test was defined as well - marginated, raised, opaque, acetowhite lesion(s) observed on the cervix uteri within the squamo - columnar junction zone (the region in the uterine cervix in which the squamous lining of the vagina is replaced by the columnar epithelium typical of the body of the uterus and which is a common site of neoplastic change).10 the pap smear sample was obtained by using a spatula. the pap smear was fixed with ethanol for 30 minutes and sent to a cytologist for investigation. the cytological results of the pap smear were reported according to the bethesda system.10 positive cytology diagnosis was considered when any of these pathological changes were detected : a typical squamous cell of undetermined significance, cin, or invasive cancer. the total number of women who were invited to participate in the study was 1250. of them, 985 women agreed to participate, giving a response rate of 79%. of the total number of responding women, 51 (5.2%) were excluded due to varying reasons : 25 had an absence of menstrual periods, 16 were not sure about their last menstrual period, three had a previous history of cervical cancer treatment, and 6 were under fertility treatment. women with positive via or positive pap smears were referred to a gynecological oncologist at a specialized oncology center for colposcopy and biopsy. the obtained biopsies were examined by a histopathologist for confirmation of the results of both screening tests. the time interval between the screening test and colposcopy was 212 days for women with positive via and 721 days for women with a positive pap smear ; the delay of pap smear results was due to the laboratory process, which took a longer time to investigate the smear specimens. data were entered into stata (v9.2 ; stata corp, college station, tx). descriptive statistics were used to analyze the demographic data and to compare the results of both screening tests. t - tests were used to detect any significant difference between continuous variables (age, age of becoming sexually active, and number of deliveries). the chi squared test was used to detect any significant difference between categorical variables and positive results of via and pap smear tests in the screened women in each group. sensitivity, specificity, positive and negative predictive values were compared for both screening tests. the number of women who fulfilled the eligibility criteria, offered informed consent, and agreed to participate in the study, was 934 (95% of total number of the respondents). the mean age of the eligible 934 participants was 34.8 years for those that screened negative and 32.8 years for those that screened positive (table 1). the number of deliveries ranged from one to seven live births, with a mean of two births for the study sample ; 35.2% were nulliparous. the main education level was primary school, and the majority of participating women were principally unpaid domestic workers. the place of residence was urban for 62.1%, and rural for 37.9% of the women. the majority of women (76%) in the study sample used an oral contraceptive pill, and 76% of women had an episiotomy during vaginal delivery (table 1). all women had undergone counseling and clinical assessment before screening ; 86 (9.2%) of them had signs of cervical infection such as chlamydia, bacterial, and candida albican infections. the results of all screened women revealed that 71 (7.6%) women were positive when via tested, and according to the later pap smear results 48 (5.1%) were positive (table 2). there was an overlap between via and pap smear in positive results of 24 samples. comparisons between the study sample characteristics, via test positive results, and pap smear positive results revealed that there was a significant difference in the age of women who tested positive by via and pap smear (mean age 32.3 years versus 38.3 years, respectively). there was a significant difference between positive results of via and pap smear in relation to women who had gone through female genital mutilation (93.0% versus 79.2% ; p = 0.05). there was also a significant difference between women who had cervical infection and positive results of via versus pap smear (33.9% versus 54.2% ; p = 0.04 ; table 2). the results of histopathology revealed that 88 of 119 (73.9%) confirmed positive, of which 53 of 71 (74.6%) had a positive via and 35 (72.9%) had a positive pap smear. moreover, classification of the positive specimens showed that (75%) of cases were cin and (25%) were in stage 1. the categories of histopathological findings differed based on the screening test, via significantly detected more cases in stage 1 than pap smears (19 versus 3 ; p = 0.001 ; table 3). there were 24 overlapping positive cases of via and pap smear, of which 52.6%, 31.6%, 10.5%, and 5.3% were cin1, cin2, cin3, and stage 1, respectively. comparison of the performance of two via and pap smears in terms of sensitivity and specificity, and in positive and negative predictive values brought varied results (table 4). via had higher sensitivity than pap smear but lower specificity. via / pap combined had higher sensitivity and specificity than via and pap smear alone. african countries rank second highest for morbidity and mortality of cervical cancer after asia.1 sudan occupies the top level of cervical cancer morbidity and mortality in northern african countries.2 in these countries there are no screening programs, or the programs are ineffectively developed and poorly organized. the majority of the screening programs are using the pap smear method and attempt to imitate the excellent outcome achieved in developed countries (finland is the best worldwide example for decrease in cervical cancer incidence as a result of a well - organized screening program).27 nevertheless, the results of these programs have been very poor due to lack of infrastructure, inadequate training for medical staff, poor organization, lower coverage of women at risk, no standardized quality control systems, and a lack of follow - up and treatment of positive cases.12 therefore, in recent years, screening using a new method has emerged as an alternative to the conventional pap smear, which involves visual inspection with use of acetic acid.7 via has become a promising alternative for developing countries because it is inexpensive, rapid, requires brief training, and does not require laboratory equipment. a number of earlier studies have reported that via has a comparable or superior result to pap smears in the detection of cervical cancer.8 this is the first study carried out to determine the feasibility of via as a screening method for cervical cancer in the primary health care setting in sudan. the study was preceded by a pilot study which showed that 16% of screened women were positive when screened by via.13 the result of the final study is lower (7.6%). the findings of this study revealed that via detected significantly more positive women than pap smears (7.6% versus 5.1% ; p = 0.004) with an overlap between the two screening tests in 19% of positive results. via had higher sensitivity and positive predictive values than pap smears but lower specificity and negative predictive values, respectively. via detected more confirmed diagnosed cases of intraepithelial cervical intraepithelial neoplasia than pap smears ; however, the difference was not statistically significant and in the confirmed diagnosed cases of invasive cervical cancer in stage 1, via detected significantly more cases than pap smears (35.8% versus 8.6% ; p = 0.001). the result of screened - positive women by via in this study (7.6%) was higher than that found in bangladesh (4.8%)14 and in angola (6.6%),15 but lower than in kenya (13.9%)16 or in honduras (14%),17 and it was much lower than found in el salvador (26.5%),18 or in thailand (38.1%).19 in our study the sensitivity of via was 60.2%. this finding is similar to that reported in tanzania (60.6%),20 higher than in colombia (53.6%),21 but lower than in india (80.0%),22 in angola (70.7%),15 and, again, in india (98%).23 sensitivity and specificity of the via test in this study was consistent with pooled via sensitivity that was described by an international agency on research for cancer multicenter study in india and africa.24 the specificity of the via test in our study was 42% ; it was lower compared to pap smears (65%), and lower than found for via in kenya (75%)25 and in angola (94.5%).15 there was only a small (although marginally significant, p = 0.05) difference in the total proportion of confirmed cases by colposcopy (74.6% versus 72.9%) for via and pap respectively. there was no significant difference in confirmed cases of cin1, cin2, and cin3 among the via positive tests than among the pap positive tests. in turn, via detected significantly more (p < 0.001) cases of cervical cancer in stage 1 (35.8%) than pap smears (8.6%). the sensitivity value for via in our study is higher than that found by basu in calcutta, india ; 74.6% and 55.7% respectively. 26 in our study via detected more cases of cin than pap smear (36 versus 32). nevertheless, the results of this study delineate the potential benefits of using via within the primary health care setting in low resource countries. via increases detection of premalignant lesions of the cervix and diminishes the probability of women defaulting before they are appropriately followed - up and treated. we believe that via can be used as a screening tool in low resource countries, not only in the primary health care setting but also in general hospitals. the results of this study showed that via has higher sensitivity, but lower specificity, compared to pap smears. a combination of via / pap increased sensitivity and specificity of detection of cervical cancer. the findings of the study indicate that via is useful for the screening of cervical cancer in the primary health care setting in khartoum state, sudan. | objectiveto determine the feasibility of visual inspection with the use of acetic acid (via) as a screening method for cervical cancer, an alternative to the pap smear used in primary health care setting in sudan, and to compare sensitivity, specificity, positive and negative predictive values, and histological diagnosis of positive cases of both tests.methodsa cross - sectional study of 934 asymptomatic women living in khartoum, sudan, was conducted during 20092010. a semi - structured questionnaire containing socio - economic and reproductive variables was used to collect data from each participant. methods of screening used were via and conventional pap smear, followed by colposcopy and biopsy for confirmation of the positive results of both screening tests.resultsthe tests identified altogether 119 (12.7%) positive women. via detected significantly more positive women than pap smear (7.6% versus 5.1% ; p = 0.004), with an overlap between the two screening tests in 19% of positive results. there was no significant difference between via and pap smear findings and sociodemographic and reproductive factors among screened women. use of colposcopy and biopsy for positive women confirmed that 88/119 (73.9%) were positive for cervical intraepithelial neoplasia. via had higher sensitivity than pap smear (74.2% versus 72.9% ; p = 0.05) respectively. out of 88 confirmed positive cases, 22 (25.0%) cases were invasive cervical cancer in stage 1, of which 19 versus three were detected by via and pap smear respectively (p = 0.001). via had higher sensitivity and lower specificity than pap smear (60.2% versus 47.7%) and (41.9% versus 83.8%) respectively. the combination of via / pap has better sensitivity and specificity than each independent test (82.6% and 92.2%).conclusionthe findings of this study showed that via has higher sensitivity and lower specificity compared to pap smear, but a combination of both tests has greater sensitivity and specificity than each test independently. it indicates that via is useful for screening of cervical cancer in the primary health care setting in sudan, but positive results need to be confirmed by colposcopy and biopsy. |
periodontal disease (pd) is part of the global burden of disease (gbd). pd is possibly associated with 200 systemic diseases. published systematic reviews and meta - analyses indicate that pd is linked to many systemic diseases, such as pulmonary disease, cardiovascular disease, head and neck cancer, survival of dental implants, and diabetes. hence, seeking the risk factors for preventing pd is an important task. besides the genetic factors [812 ] sex, cigarette smoking, alcohol, diabetes, obesity, metabolic syndrome, osteoporosis, dietary calcium, vitamin d, and stress are well accepted risk factors for pd. helicobacter pylori (hp) is cultured from gastric biopsy specimens of gastric inflammation and peptic ulcer patients and is considered to be responsible for these diseases, especially for gastric cancer worldwide. besides gastric diseases, published systematic reviews and meta - analyses demonstrated that hp is also associated with diabetes, chronic tonsillitis, atopic diseases, pancreatic cancer, recurrent aphthous stomatitis, myocardial infarction, and esophageal cancer. obviously, pd and hp are both associated with some diseases. hp is largely transmitted through oral - oral or fecal - oral routes and the oral cavity is a reservoir of pathogens, including hp ; hp is widely detected in the oral pathology. the first relevant study was performed by asikainen. in 1994 and revealed a negative association ; however, subsequent studies showed inconsistent results and there is little data from chinese populations. therefore, this study was designed to investigate the association between hp and pd in han chinese. we conducted a case - control study according to the strengthening the reporting of observational studies in epidemiology (strobe) statement. the patients were from the department of stomatology, taihe hospital, hubei university of medicine. all participants were enrolled between september 3, 2012 and september 2, 2014 and provided signed informed consent. we excluded those who used prophylactic antibiotics or anti - inflammatory drugs, had a history of pd treatment, were receiving ongoing orthodontic therapy, had fewer than 6 teeth present, or had current pregnancy. this study was reviewed and approved by the committee for ethical affairs of the taihe hospital, hubei university of medicine at shiyan city, hubei province. all potential eligible subjects were selected from han chinese population with similar age, sex, level of education, body mass index (bmi), physical exercise, history of alcohol use and diabetes mellitus, and other demographic characteristics. two investigators were trained before the study and used standardized procedures to increase consistency. as controls we included all subjects with newly - diagnosed pd during the study period who met the same inclusion criteria as cases but the diagnostic criteria was : pd was defined as presence of more than 4 teeth with 1 site or more having a probing pocket depth (ppd) 4 mm and clinical attachment level (cal) 3 mm (24). these ppd and cal were evaluated at 4 sites on each tooth (mesial, distal, buccal, and lingual). cal was measured as the distance from the cemento - enamel junction (cej) to the base of the pocket. subgingival dental plaques were collected from each case and control using a sterile universal curette. the dental plaques were broken and cultivated on columbia agar plates (oxoid of thermo fisher scientific inc., the rapid urease test (rut), a commercially available rapid gastric urease test kit, was used to for detecting hp, and the detailed methods of culture and polymerase chain reaction (pcr) are described elsewhere. the sample was identified as positive hp if the test gel color changed from yellow to red within 20 min, up to a maximum of 60 min. we used means with standard deviation (sd) or percentage to summarize the frequency distributions of age, sex, level of education, other demographic characteristics, and clinical characteristics of the study population. to investigate the association between hp and pd, the chi - square test or fisher z test was used to analyze the association, and the unadjusted odds ratios (ors) with corresponding 95% confidence intervals (cis) were calculated. considering the confounding risk factors of pd, we then performed a multiple logistic regression analysis to obtain adjusted ors and their 95%cis. we conducted a case - control study according to the strengthening the reporting of observational studies in epidemiology (strobe) statement. the patients were from the department of stomatology, taihe hospital, hubei university of medicine. all participants were enrolled between september 3, 2012 and september 2, 2014 and provided signed informed consent. we excluded those who used prophylactic antibiotics or anti - inflammatory drugs, had a history of pd treatment, were receiving ongoing orthodontic therapy, had fewer than 6 teeth present, or had current pregnancy. this study was reviewed and approved by the committee for ethical affairs of the taihe hospital, hubei university of medicine at shiyan city, hubei province. all potential eligible subjects were selected from han chinese population with similar age, sex, level of education, body mass index (bmi), physical exercise, history of alcohol use and diabetes mellitus, and other demographic characteristics. two investigators were trained before the study and used standardized procedures to increase consistency. as controls we included all subjects with newly - diagnosed pd during the study period who met the same inclusion criteria as cases but the diagnostic criteria was : pd was defined as presence of more than 4 teeth with 1 site or more having a probing pocket depth (ppd) 4 mm and clinical attachment level (cal) 3 mm (24). these ppd and cal were evaluated at 4 sites on each tooth (mesial, distal, buccal, and lingual). cal was measured as the distance from the cemento - enamel junction (cej) to the base of the pocket. subgingival dental plaques were collected from each case and control using a sterile universal curette. the dental plaques were broken and cultivated on columbia agar plates (oxoid of thermo fisher scientific inc., waltham, ma, united states). the rapid urease test (rut), a commercially available rapid gastric urease test kit, was used to for detecting hp, and the detailed methods of culture and polymerase chain reaction (pcr) are described elsewhere. the sample was identified as positive hp if the test gel color changed from yellow to red within 20 min, up to a maximum of 60 min. we used means with standard deviation (sd) or percentage to summarize the frequency distributions of age, sex, level of education, other demographic characteristics, and clinical characteristics of the study population. to investigate the association between hp and pd, the chi - square test or fisher z test was used to analyze the association, and the unadjusted odds ratios (ors) with corresponding 95% confidence intervals (cis) were calculated. considering the confounding risk factors of pd, we then performed a multiple logistic regression analysis to obtain adjusted ors and their 95%cis. a total of 212 participants with 103 cases and 109 controls were finally included (age range, 25 to 95 years). tables 1 and 2 tables 1 and 2 shows that the basic characteristics of cases and controls were similar ; however, the ppd, cal, and number of hp - positive individuals were significantly different between cases and controls. in the unadjusted analysis, hp - positive subjects had significantly increased risk of pd (2.63 times higher) (95%ci=1.484.67) than hp - negative subjects. the estimates remained unaltered after adjustment for age, sex, level of education, physical exercise, body mass index, and history of alcohol and diabetes mellitus, and this association remained significant (or=2.82, 95% ci=1.555.13) (table 3). stratified analysis by sex, bmi categories, alcohol use history, physical exercise, level of education, and history diabetes mellitus indicated there were no significant interactions between pd and any of these exposure variables (table 3). hp is a gram - negative, urease - producing bacterium that colonizes gastrointestinal mucosa and is considered as a risk factor for many oral diseases. in this case - control study, we found that hp significantly increased risk of pd (2.82 times higher) after adjusting for age, sex, level of education, physical exercise, bmi, and history of alcohol use and diabetes mellitus., published in 1994 and revealing a negative association ; however, our results are similar to those of dye. of course, there are many relevant published studies with inconsistent results and we suggest a meta - analysis on this topic, also for detecting the consistency of association. the association between hp and risk of pd can be explained based on several mechanisms. in 2012. carried out a systematic review and meta - analysis of randomized controlled trials, indicating that adjunction of periodontal treatment to eradication therapy appears to reduce gastric hp recurrence. first, there is experimental evidence that hp probably exists in the gingiva and plays a role in the development of pd. second, this study included all non - smokers and the well - known risk factors of pd, such as alcohol use, diabetes, bmi, and physical exercise, were adjusted. after adjusting, the association remained significant and the risk was increased from 2.63 times to 2.82 times. for strength of association, the unadjusted or is 2.63 and the adjusted or is 2.82, which is a mild - to - moderate association. third, gastrointestinal mucosa is the well - accepted place of hp colonization, and the oral mucosa is also a place for bacterial colonization, especially the gingival sulcus. hence, we can conclude that the oral cavity is also a reservoir of hp. based on hill s criteria, there are some limitations that should be addressed for further investigating the association besides the above items. first, our study is a case - control study and therefore it can not reveal the temporal sequence of hp and pd. whether pd exists first and then creates an environment for hp or whether hp plays a role in the onset and development of pd remains unknown. to address this question, we suggest a cohort study, especially a prospective cohort design. second, the present study did not explore whether the severity of pd increases when the counts of hp are higher. hence, relevant animal studies need to be carried out to determine if there is a dose - response relationship between hp and pd. third, due to lacking the tissue of cases and controls, we could not to explore whether there is a genetic background. there are many increased risk polymorphisms of pd, such as interleukin-4 gene 590 c / t polymorphism, cyclooxygenase-21195g / a polymorphism, and interleukin-1 899 (+ 4845) c / t polymorphism. hence, in further research, we suggest the investigators consider including the risk polymorphism in their study. this is the first case - control study in a han chinese population who live in an upland city. periodontists should ask patients about history of gastritis, gastric ulcer, and duodenal ulcer, especially for gastro - esophageal reflux disease (gerd) patients. if the patient has symptoms of these gastric diseases, the periodontist should suggest the relevant treatment in order to maintain the effect of periodontal therapy. hence, they should advise their patients to check and treat pd status during and after treatment for gastric disorders ; this strategy might decrease the risk of gastric hp recurrence. hp - positive patients had significantly increased risk of having pd compared with hp - negative subjects. hence, for better understanding the relationship between these 2 diseases, future cohort, especially prospective cohort studies, on immuno - inflammatory, usual risk factors, and genetic polymorphisms between the hp and pd are necessary. periodontists and gastroenterologists should know about the potential association between hp and pd, and educate pd patients on the risk and the importance of their gastric disorders during dental visits and supragingival scaling. | backgroundthis study was performed to test the association between helicobacter pylori (hp) and periodontal disease (pd).material / methodsthis was a case - control study in a comprehensive hospital, including all patients with newly diagnosed pd between 2012 and 2014 as cases and all patients without pd as controls, thorough periodontal examinations. those who tested positive for hp were examined by means of polymerase chain reaction. single and multivariate logistic regression was used to analyze the data using spss 19.0 software.resultsthis case - control study included 212 han chinese non - smoking adults. the results indicated that hp - positive status significantly increased the risk of pd (2.63 times higher (odds ratio [or]=2.63 ; 95% confidence interval [ci]=1.484.67). after adjustment for age, sex, level of education, physical exercise, body mass index, and history of alcohol and diabetes mellitus, this association remained significantly (or=2.82, 95% ci=1.555.13).conclusionspd might be associated with hp infection in adults and hp infection may be a significant and independent risk factor for pd. |
hela cells were cultured in dmem (media tech) with 10% fetal bovine serum (hyclone) and 1% penicillin streptomycin (invitrogen). hela cells stably expressing m4-blast constructs were established by lentivirus infection followed by selection with 4 g / ml blasticidin (invitrogen). rin1 wild type, rin1 were made in in pm4-blast vector. in rin1, tyrosines 36, 121, 148, and 295 were mutated to phenyalanine. the rab5-gtp pulldown construct was created using the zn finger domain of rabenosyn (zfyve20), a rab5 binding domain. the sequence encoding amino acids 140 of human zfyve20 was amplified using forward primer 5-atgcgctagcagatctactagtatggcttctctggacgaccc and reverse primer 5-atgcggatccttatctagattcccctgagtgttcttcct. ligation compatible restriction sites in each primer (xbai / spei and bamhi / bglii) were used for stepwise head - to - tail additions in pks bluescript. the 4x concatemer was then inserted into the bamhi - ecori sites of pgex-2 t to create pgex-4xzfyve (r5bd - gst). active rab5 from cells were pulled down using the construct : pgex-4xzfyve - gst, purified on glutathione beads as previously described. briefly cells were serum starved for about 18 h. stimulation was performed with control medium or 100 ng / ml egf medium. cells were lysed after the respective times with np-40 lysis buffer (150 mm tris ph 8.0, 50 mm nacl, 1% np-40) containing 1 mm pmsf, 10 ug / ml leupeptin, 1 um pepstatin and 1 mm sodium orthovanadate (sigma aldrich) in the presence of 10 mm mgcl2. lysates were subject to pull - down at 4 c with 4x - zfyve - gst on glutathione beads in order to enrich for activated rab5. beads were then washed with the lysis buffer, boiled in laemmli loading buffer, followed by gel electrophoresis and analysis of rab5 by immunoblotting. for immunoblotting, the membranes were blocked with 5% milk in tbst (0.1% tween-20) followed by incubation with primary and secondary antibodies at room temperature. the membranes were washed with tbst between the incubations and developed using the ecl plus western blotting reagent (vwr) or scanned using a li - cor odyssey scanner. quantification of immunoblots was performed using the li - cor odyssey software or imagej (nih). antibodies used for immunoblotting and their sources were pan - rab5 1:1000 (abcam, # ab18211), tubulin 1:5000 (sigma aldrich, # t6074 - 200 ul), rin1 1:1000 (mouse mab, clone # c9e11, colicelli lab, abpro), sheep - anti - mouse - hrp 1:3000 (amersham biosciences, # na931), goat - anti - rabbit - hrp 1:3000 (kirkegaard and perry, # 4741506), goat - anti - rabbit - irdye 800 1:5000 (li - cor biosciences, # 926 - 32211) and goat - anti - mouse - irdye 680 1:5000 (li - cor biosciences, # 926 - 32220). cells were serum starved for about 12 h. boyden chambers (cell culture inserts, 8 m, bd falcon) were coated with 10 ug / ml fibronectin overnight at 4 c. the cell culture inserts were rinsed once in pbs and placed on 24-well plates, containing either control medium or 100 ng / ml egf medium. cells were allowed to migrate across the transwell at 37 c for 24 h. the chambers were then rinsed in pbs and fixed with 4% pfa. cells that had migrated were stained with crystal violet and counted under the microscope using a hemocytometer. hela cells were cultured in dmem (media tech) with 10% fetal bovine serum (hyclone) and 1% penicillin streptomycin (invitrogen). hela cells stably expressing m4-blast constructs were established by lentivirus infection followed by selection with 4 g / ml blasticidin (invitrogen). all rin1 expression constructs were made in lentivirus vectors. rin1 wild type, rin1 were made in in pm4-blast vector. in rin1, tyrosines 36, 121, 148, and 295 were mutated to phenyalanine. the rab5-gtp pulldown construct was created using the zn finger domain of rabenosyn (zfyve20), a rab5 binding domain. the sequence encoding amino acids 140 of human zfyve20 was amplified using forward primer 5-atgcgctagcagatctactagtatggcttctctggacgaccc and reverse primer 5-atgcggatccttatctagattcccctgagtgttcttcct. ligation compatible restriction sites in each primer (xbai / spei and bamhi / bglii) were used for stepwise head - to - tail additions in pks bluescript. the 4x concatemer was then inserted into the bamhi - ecori sites of pgex-2 t to create pgex-4xzfyve (r5bd - gst). active rab5 from cells were pulled down using the construct : pgex-4xzfyve - gst, purified on glutathione beads as previously described. briefly cells were serum starved for about 18 h. stimulation was performed with control medium or 100 ng / ml egf medium. cells were lysed after the respective times with np-40 lysis buffer (150 mm tris ph 8.0, 50 mm nacl, 1% np-40) containing 1 mm pmsf, 10 ug / ml leupeptin, 1 um pepstatin and 1 mm sodium orthovanadate (sigma aldrich) in the presence of 10 mm mgcl2. lysates were subject to pull - down at 4 c with 4x - zfyve - gst on glutathione beads in order to enrich for activated rab5. beads were then washed with the lysis buffer, boiled in laemmli loading buffer, followed by gel electrophoresis and analysis of rab5 by immunoblotting. for immunoblotting, the membranes were blocked with 5% milk in tbst (0.1% tween-20) followed by incubation with primary and secondary antibodies at room temperature. the membranes were washed with tbst between the incubations and developed using the ecl plus western blotting reagent (vwr) or scanned using a li - cor odyssey scanner. quantification of immunoblots was performed using the li - cor odyssey software or imagej (nih). antibodies used for immunoblotting and their sources were pan - rab5 1:1000 (abcam, # ab18211), tubulin 1:5000 (sigma aldrich, # t6074 - 200 ul), rin1 1:1000 (mouse mab, clone # c9e11, colicelli lab, abpro), sheep - anti - mouse - hrp 1:3000 (amersham biosciences, # na931), goat - anti - rabbit - hrp 1:3000 (kirkegaard and perry, # 4741506), goat - anti - rabbit - irdye 800 1:5000 (li - cor biosciences, # 926 - 32211) and goat - anti - mouse - irdye 680 1:5000 (li - cor biosciences, # 926 - 32220). cells were serum starved for about 12 h. boyden chambers (cell culture inserts, 8 m, bd falcon) were coated with 10 ug / ml fibronectin overnight at 4 c. the cell culture inserts were rinsed once in pbs and placed on 24-well plates, containing either control medium or 100 ng / ml egf medium. cells were allowed to migrate across the transwell at 37 c for 24 h. the chambers were then rinsed in pbs and fixed with 4% pfa. cells that had migrated were stained with crystal violet and counted under the microscope using a hemocytometer. | stimulation of a receptor tyrosine kinase (rtk), such as egfr, leads to ras activation followed by rin1 activation. rin1, in turn, activates rab5 family gtpases, as well as abl tyrosine kinases. as expected, rin1 expression directly correlates with rab5-mediated egfr endocytosis. we previously showed that normal receptor endocytosis and internalized egfr fate also depend on the ability of rin1 to concomitantly activate abl tyrosine kinases, consistent with the established role of abl kinases in cytoskeleton remodeling and the growing evidence that such remodeling plays a role in endocytic processes. here we report that growth factor - directed cell migration, a physiological process that involves receptor endocytosis and actin remodeling, also requires the ability of rin1 to coordinate rab5 gtpase and abl tyrosine kinase pathways. |
bisphosphonate - related osteonecrosis of the jaws (bronj) is an avascular osteonecrosis of the jaws, associated mainly with intravenous administrated bisphosphonates but also with oral bisphosphonates. intravenous bisphosphonates are used for the management of bone disease and bone metastases, caused by multiple myeloma and other solid tumors, for example, breast cancer, prostate cancer, and lung cancer [1, 2 ]. bps main action is to inhibit osteoclast function and subsequent bone resorption, resulting in the prevention of loss of bone mass and skeletal related events, such as pathologic fractures and pain, caused by the underlying disease [3, 4 ]. a great number of patients with cancer benefit from the therapeutic results of bps. nevertheless bisphosphonate - related osteonecrosis of the jaw (bronj) has been described as an adverse effect of these drugs in various malignancies [58 ], with negative effect on the quality of life of the patients. the diagnosis of osteonecrosis is clinical and according to suggested criteria requires the presence of exposed bone in the jaw area for more than eight weeks, in a patient under current or previous treatment with a bisphosphonate, with no history of radiation therapy to the head and/or neck area. the incidence of bronj ranges considerably due to various factors, such as type of bisphosphonate, type of cancer, way of administration, time of exposure, and number of infusions [1114 ]. the risk of developing bronj in multiple myeloma patients receiving intravenous zoledronic acid or pamidronate is relatively high. previous studies from our team as well as from other groups have identified tooth extraction or chronic trauma of the oral mucosa caused by poorly fitting dentures, poor oral hygiene, and number and duration of zoledronic acid administration as the main triggering factors for the development of onj [12, 1518 ]. however, spontaneous development of bronj is also possible and has been reported [12, 17 ]. several approaches have been evaluated for the treatment of patients who developed bronj and many management strategies have been proposed. nevertheless, it seems that taking preventative measures is the most effective way to face bronj. in our current study we report on the outcome of our series of mm patients who developed onj and discuss management issues. a retrospective review of multiple myeloma patients who were diagnosed with bronj from july 2003 until september 2013 and were treated in the department of clinical therapeutics (athens, greece) was conducted. all the patients reporting symptoms and/or signs compatible with the probability of development of osteonecrosis were prospectively evaluated. bronj was diagnosed by a specialized maxillofacial surgeon (i m) according to the following criteria : patients, with no history of head and/or neck radiotherapy, currently or previously treated with bisphosphonates and presence of exposed bone in the maxilla and/or the mandible for more than eight weeks. all cases with denosumab associated necrosis were excluded, as well as cases in which the whole treatment was not performed by the same group, to avoid data that was not confirmed. from 105 patients with osteonecrosis of the jaws under treatment with antiresorptive agents for any reason (solid tumor metastasis, multiple myeloma, etc.), thirty eight patients were selected according to the aforementioned criteria, that is, multiple myeloma patients with osteonecrosis of the jaw, caused by iv bisphosphonate therapy, who were treated in our clinic from the time of diagnosis of their disease. the determination of the stage of osteonecrosis was made according to the definition and staging system published by the american association of oral and maxillofacial surgeons (aaoms) updated position paper as follows : stage 0, no clinical evidence of necrotic bone, but nonspecific clinical findings and symptoms ; stage 1, exposed and necrotic bone in patients who are asymptomatic and have no evidence of infection ; stage 2, exposed and necrotic bone associated with infection as evidenced by pain and erythema in the region of the exposed bone with or without purulent drainage ; and stage 3, exposed and necrotic bone in patients with pain, infection, and one or more of the following : exposed and necrotic bone extending beyond the region of alveolar bone (i.e., inferior border and ramus in the mandible, maxillary sinus, and zygoma in the maxilla) resulting in pathologic fracture, extra - oral fistula, oral - antral / oral - nasal communication, or osteolysis extending to the inferior border of the mandible or sinus floor. data was abstracted, using a standardized template that collected patient information, medical history, and dental history, including recent dental extractions. information concerning myeloma treatment, for example, number of infusions, duration of bp exposure, time for healing, and time of death, was also evaluated. all patients underwent comprehensive clinical evaluation and panoramic and/or intraoral periapical radiographs, when a com beam ct scan was performed in some cases. management was provided according to general guidelines designed to minimize symptoms and/or achieve resolution of lesions. the protocol we have followed since 2003 for all patients diagnosed with bronj was established based on the data of bibliography and the observation and personal experience of the attendant maxillofacial surgeon (i m). according to our protocol bisphosphonate therapy was interrupted in patients who developed bronj at the time of diagnosis according to guidelines. regardless of stage, chlorhexidine rinses were prescribed for the majority of patients and mobile fragments of bone were managed with non - surgical sequestrectomy (simple removal of mobile bone fragments), typically without the need for local anesthesia. in patients with bronj and no signs of inflammation, avoidance of surgical dental treatment (extractions, implant therapy, and oral surgery procedures), amelioration of oral hygiene, and use of oral antiseptic mouth rinses (chlorhexidine 0.12% for 3 weeks per month, other antiseptic for 1 week per month) were recommended. patients with artificial dentures were advised to remove them, in order to reduce the contact of the denture with the exposed bone and avoid further trauma of the mucosa. when inflammation was present, antimicrobial chemotherapy was given, usually metronidazole 500 mg twice a day for 2 weeks or aminopenicillins in combination with metronidazole for 15 days in more severe cases. alternative choice for patients allergic to aminopenicillin was moxifloxacin for 10 days, as post antibiotic effect makes this treatment equal to a 15-day therapy. according to literature, when bone spindles were present, only minor debridement procedures were attempted, in order to reduce trauma of the adjacent soft tissues. observation and/or minor debridement procedures when radiographic appearance of a sequestrum was observed, minor surgical sequestrectomy under local anesthesia and antibiotic treatment was attempted. patients at stage 3 or patients who showed recurrence were treated with major surgical intervention, that is, peripheral ostectomy under general anaesthesia and antibiotic therapy. absence of exposed necrotic bone, absence of any signs of inflammation of the soft tissues, complete healing of the mucosa, and absence of subjective complains about pain and/or numbness for more than 3 months were considered as complete healing criteria. a total of thirty eight multiple myeloma patients were diagnosed with bronj, 25 males (66%) and 13 females (34%). the patients ' age at time of bronj diagnosis ranged from 29 to 83 years, with mean age of 66 years. twenty - six patients developed bronj in the mandible, 11 in the maxilla, and one patient in both mandible and maxilla. thirty - three patients (87%) were treated with zoledronic acid (zometa ; novartis pharmaceuticals corporation, east hanover, nj, usa) of 4 mg infused over 15 minutes every 4 weeks, 1 patient with pamidronate (aredia ; novartis pharmaceuticals corporation, east hanover, nj, usa), of 90 mg infused every 4 weeks, and 4 patients (11%) were treated with both zoledronic acid and pamidronate. the triggering factor of bronj development was oral surgery, such as tooth extraction in 22 cases, chronic mucosa trauma from artificial dentures in 5 cases, periodontal and/or periapical inflammation in 4 cases. seven cases developed spontaneously, six of them at the mylohyoid ridge (table 1). biopsy and histological assessment of the sequestra were performed in 29 cases, which confirmed the complication. three patients (8%) were diagnosed with stage 0, eight patients (21%) with stage 1, seventeen cases (45%) with stage 2, and ten (26%) with stage 3 onj (table 2). three patients were treated only with observation, mouth rinses with chlorhexidine 0.12% for 3 weeks per month, other antiseptic for 1 week per month, in order to avoid disturbance of the oral flora, and removal of the bony edges of the lesion. one showed complete healing, one remained stable, without any signs of inflammation or pain until death, and one patient developed higher stage of onj (stage 2) and was treated with antibiotics. ten patients were treated with chlorhexidine 0.12% for 3 weeks per month, other antiseptic for 1 week per month, and antibiotics, whenever inflammation appeared. eight of these patients remained stable for a mean follow - up of 24 months (348), one was completely healed after 8 months, with a 5 months follow - up after healing and one patient developed a higher stage of onj and is scheduled for surgery, whenever his health status permits. mean follow - up was 27 months (840) after the confirmation of healing. no recurrence was observed in any of these patients, until the last - follow up or until death. conservative sequestrectomy was attempted after a meantime of 12 months under antibiotic therapy in 16 cases. eleven of these cases showed complete healing ; one case was not yet completely healed at the time of the last follow - up, one patient died during the follow - up after healing period, and three cases underwent a second minor surgery before achieving complete healing. complete healing was observed in both cases, although one patient underwent a second surgery after a period of 5 months, in order to reverse the failure of the first surgery. the other patient underwent two surgeries in different locations each time one in the maxilla and one in the mandible, since he had developed onj bilateral in the maxilla and the mandible. mean follow - up after healing in both cases was more than 6 months (table 3). in patients where healing was stated (n = 24, 63%), by removal of bony edges, spontaneous apoptosis of the sequestra, or sequestrectomy, the median time to healing was 12 months (95% ci 421). a statistically significant difference (p = 0.017) was found between groups with more and less than 16 infusions of bisphosphonates, when median time to healing for those with 16 infusions was 14 months (p = 0.017 ; figure 1). the incidence of bronj is yet undetermined. according to many studies of patients with multiple myeloma, breast, or prostate cancer, who received intravenous amino - bp therapy, the occurrence of osteonecrosis is estimated to be approximately 411% [7, 13, 18 ]. in our study which included only multiple myeloma patients, the probability of developing bronj ranges due to various risk factors. the number and frequency of infusions, but mainly the cumulative dose of bp, are strongly associated with the risk of bronj [12, 19 ]. invasive dental procedures, that is, tooth extractions, implant therapy, oral surgery, as well as mucosa trauma by poor fitting dentures have been reported as the most important triggering factors of developing this complication. however, spontaneous development of bronj occurs in approximately 20% of the patients who develop bronj [20, 21 ]. indeed, in our study 57.9% of the patients who developed osteonecrosis underwent dental extraction, 13.2% had chronic mucosa trauma by artificial dentures, 10.5% of onj patients developed onj due to periodontal and/or periapical inflammation, and in 18,4% patients it occurred spontaneously, which comes in agreement with the latest reviews. the mean number of infusions was 25.5 and the mean time of bp exposure was 36.5 months. in the present study, lesions occurred more frequently in the mandible than in the maxilla (67% versus 33%). the management of bronj is a difficult goal to achieve and still remains controversial, since consensus standard protocol has not yet been established. according to the guidelines of the aaoms, treatment strategies of bronj emphasize mainly the elimination of pain and inflammation and the reduction of the exposure of the necrotic bone and secondarily they emphasize the complete healing of the lesion. several methods have been proposed, which can be categorized as nonsurgical or conservative [2527 ] and surgical approaches [28, 29 ]. nonsurgical treatment includes a combination of antiseptic mouth rinses, antimicrobial chemotherapy, when inflammation occurs, and nonsurgical sequestrectomy and/or debridement. the outcomes of most studies [2427 ] seem to be satisfactory. according to one of the largest in terms of patients, 7180% of the cases, treated conservatively improved or remained asymptomatic and stable. in our study 63% of the patients who were treated with conservative measures (removal of bony edges, spontaneous apoptosis of sequestra, or minor surgical intervention) achieved complete healing and another 23.7% remained asymptomatic and stable, while in 5.2% of the patients major surgical interpretation was performed, because of failure of the conservative treatment. van den wyngaert. suggest that there are several factors, such as stage of onj, patient 's health condition, time of exposure to bp, type of bp therapy, use of chemotherapy before onj, which should be considered in order to proceed to a specific treatment of onj, although it seems that strictly conservative treatment at low stages of the complication can lead to healing in about half of the cases. in agreement with the above confirms management of pain with minimally invasive treatment in more than 60% of the cases, while all of the patients who underwent sequestrectomy spontaneously or gently induced by the surgeon patients, 59% of stage 2, and 50% of stage 3 patients were healed. on the other hand, radical surgical treatment of onj, including extensive sequestrectomy and limited or extensive bone resection, has showed healing of bronj in several studies [2933 ]. the results of the study by wilde. showed that 88% of the patients, treated surgically, achieved complete healing of onj. nevertheless, a statistically high failure rate in stage 3 onj, approximately 36%, may initiate doubts about the efficiency of the surgery, while adequate surgical planning and high degree of experience on the determination of the resection margins are clearly pointed out by the author. stockmann., at a study with 80 patients, report a success rate of about 89%, which declined to 84% within 14 months postoperatively. the outcomes of a review by khl. showed that, when comparing the results of conservative and surgical treatment of bronj, it seems that there is no difference regarding the success of treatment (e.g., 60.5% versus 60.4%), although it appeared that complete healing of bronj after conservative treatment is only successful in low stages of the complication. we also conclude (p = 0.017) that the number of bp infusions is associated with the median time to healing. patients who received less than 16 infusions achieved healing in the half time, compared with patients who received more than 16 infusions (7 versus 14 months). other therapeutic approaches, such as medical ozone and nd : yag laser stimulation [35, 36 ] have given encouraging results in the management of patients with onj but the experience with these methods is limited. in the present study, major surgical intervention was decided only at high levels of onj or in case of failure of conservative measures. both patients who underwent major surgery achieved complete healing. due to bisphosphonates discontinuation, many cases (7) of spontaneous apoptosis of the sequestra have been observed. the mean time of sequestra formation was 10.2 months where the mean time for minor surgery intervention (15 patients) was 15.6 months. it could be a reasonable thought that in that period of time the bone turnover in the necrotic area starts to work. when treatment with iv bisphosphonates could be stopped, it is reasonable to treat patients conservatively until the time where sequestra formation seems to start. therefore, in agreement with the aaoms guidelines, we believe that the cost - benefit for patients who are already debilitated by their malignancy leans to more conservative treatment strategies of onj with satisfactory results and surgical intervention should be performed only in cases of failure of the above strategies. | the use of intravenous bisphosphonates (pamidronate or zoledronic acid) is the cornerstone for the management of multiple myeloma-(mm-) related bone disease. however, osteonecrosis of the jaw (onj) is a rare, but sometimes difficult to manage, adverse effect of bisphosphonates therapy. a retrospective review of all mm patients who were treated with bisphosphonates in our department, from 2003 to 2013, and developed onj was performed. according to inclusion criteria, 38 patients were studied. all these patients were treated as conservatively as possible according to the american association of oral and maxillofacial surgeons criteria. patients were managed with observation, oral antibacterial mouth rinse with chlorhexidine, oral antibiotics, pain control with analgesics, nonsurgical sequestrectomy with or without simultaneous administration of antibiotics, or major surgery with or without antibiotics. healing of the lesions was achieved in 23 (60%) patients who were treated with conservative measures ; the median time to healing was 12 months (95% ci : 421). the number of bisphosphonates infusions influenced the time to healing : the median time to healing for patients who received 16 infusions was it 14 months (p = 0.017). we conclude that a primarily nonsurgical approach appears to be a successful management strategy for bisphosphonate - related onj. |
a 13-year - old premenarchal girl presented with a 2 days history of gradually worsening right iliac fossa (rif) pain and vomiting. she had a background of gastroschisis which was corrected at birth with no further complications. on examination her abdomen was soft with localized tenderness and voluntary guarding of the rif. ultrasound scan of the abdomen revealed an enlarged and echogenic mass in the pelvis which was difficult to characterize sonographically (fig.1). the right ovary was necrotic and enlarged measuring 70 30 30 mm in size (figs.2 and 3). histopathology revealed no underlying ovarian lesion ; the ovary was engorged with massive edema and hemorrhage. findings at exploratory laparoscopy (a) right adnexal torsion (arrow) with moderate amounts of bloody fluid in the pelvis and (b) enlarged right ovary and distal fallopian tube pediatric ovarian torsion is an infrequent diagnosis and it often mimics acute appendicitis 1. in children, it is most common around menarche 2. if left untreated, ovarian torsion may result in tissue necrosis, loss of ovarian function, and may eventually cause infection and peritonitis 1,3. the true incidence of pediatric ovarian torsion is unknown and most cases are due to underlying ovarian pathology 2. emergency surgical exploration to salvage gynecological function is crucial in suspected ovarian torsion, however, children usually present too late after the onset of symptoms 3. | key clinical messagepediatric ovarian torsion is an infrequent diagnosis and it often mimics acute appendicitis. most cases are due to underlying ovarian pathology and if left untreated, ovarian torsion may eventually cause peritonitis. emergency exploratory laparoscopy represents a valuable diagnostic and therapeutic tool in suspected ovarian torsion. |
on september 6, 2008, the article of the title we fought cancer and cancer won was in the newsweek. the subtitle was that it is time to rethink the war on cancer, after billions spent on research and decades of hit or miss treatments. the improved understanding of molecular biology in cancer research has led to a number of new, effective treatments for cancer. however, the age - standardized death rate from all types of cancers combined first increased from 1970 to 1990 and then decreased through 2002, yielding a net decline of 2.7%. therefore, it is necessary to understand the cancer from a different point of view, which has been helped by the oriental medicine. in view of the oriental medicine, mass or nodule is resulted from qi and blood stagnation. the development of a tumor could be interpreted as qi stagnation induced by stress, emotional disturbances, or external factors which could progress into blood stagnation or stasis. traditionally rhus verniciflua stoke (rvs) was considered to have the function of breaking up blood stasis and purging hardness. rvs of the anacardiaceae family, commonly known as the lacquer tree, was documented to be used for treating various stomach diseases, including tumor in east asia including korea at the 15th century [4, 5 ]. recently several experimental studies showed that flavonoids from rvs have effective anti - proliferative and apoptotic activities on various tumor cell lines including human lymphoma, breast cancer, osteosarcoma, and transformed hepatoma cells [47 ]. however, the clinical application of rvs has been limited because an allergenic component, urushiol, causes severe contact dermatitis in sensitive individuals [8, 9 ]. therefore urushiol, a mixture of several derivatives of catechol, should be removed from rvs for pharmaceutical use. our integrative cancer center composed of oncologists and oriental medicine doctors was founded in june, 2006, and the standardized rvs extract was prescribed for the purpose of prolonging survival and improving the quality of life in patients with only palliative therapy available. here, we review on the action mechanism and best outcomes of the standardized rvs extract with or without conventional treatment in patients with advanced or metastatic cancer. rvs stalk, which was 10 years old and grown in wonju, republic of korea, was dried without exposure to direct sunlight and chopped up. the pieces were roasted in an iron pot at 240c for 50 minutes to remove allergens and extracted two times with a 10-fold volume of water at 90c to 95c for 6 hours (korean patent no. the extract was filtered with whatman gf / b filter paper and concentrated under vacuum to remove water. the extraction yield from 100 g of chopped material was 3.3 g. a component analysis method using high - performance liquid chromatography showed that the rvs extract contained fustin, fisetin, sulfuretin, and butein, among others. the quality of the rvs extract was tested and controlled according to the quality standards of the korea food & drug administration and our hospital 's standards (fustin > 13.0%, fisetin > 2.0%, urushiol not detected). daily oral administration is 1350 mg (1 capsule containing 450 mg three times a day) of rvs extract. the rvs was experimentally shown to have antitumor properties in carcinoma of breast and uterine cervix in vitro and suppress tumor volume in a xenograft mouse model system using a549 nonsmall cell lung cancer and lewis lung cancer cells in vivo through inhibiting the proliferation and migratory activity of vascular endothelial growth factor [10, 11 ]. it also significantly inhibited proliferation of human umbilical vein endothelial cells (huvecs) induced by vascular epithelial growth factor (vegf), despite its weak cytotoxicity against huvecs. when vegf alone was present, the wound after scratching the cell monolayer was closed by cell migration. however, the addition of rvs significantly inhibited vegf - induced migration of huvecs similar to control cells (figure 1). maturation of migrated endothelial cells into a tube - like structure is a critical step for formation of functional vessels. huvecs were seeded onto matrigel and stimulated to form capillary networks with vegf. as shown in figure 2(b), robust and complete tube network formation was observed in vegf - stimulated huvecs. however, this effect of vegf was significantly inhibited by rvs showing incomplete sprouting or branching or broken network between tubes of huvecs (figure 2). these results indicate that rvs blocks migration and maturation of endothelial cells induced by vegf. matrix metalloproteinases (mmps) are a family of zinc - dependent endopeptidases that remodel and degrade the extracellular matrix (ecm). cancer cell migration and invasion of surrounding tissues are mediated in part by mmps, especially mmp-2 and mmp-9. the effect of rvs on the invasiveness of human fibrosarcoma ht1080 cells was investigated by boyden chamber assay. the invasiveness of ht1080 cells was reduced in a dose - dependent manner following 24-hour treatment of up to rvs 200 g / ml (figure 3). the ability of rvs extract to inhibit the secretion of mmp-2 and mmp-9 from ht1080 cells was studied. the levels of mmp-2 and mmp-9 were reduced by rvs, suggesting that the decrease in ht1080 cell invasion is a consequence, at least in part, of reduced activities of both mmp-2 and mmp-9. rvs inhibited mmp-2 and mmp-9 activities with ic50 value of 1.01 0.07 g / ml and 1.94 0.11 g / ml, respectively, by spectrofluorometric method which is very low concentration compared to other various herbs (figure 4). the rvs was investigated to prolong survival in nsclc after the failure of first - line or second - line chemotherapy. forty patients treated with rvs for previously treated, advanced nsclc between june 2006 and june 2009 were eligible for the final analysis. the median survival time was 8.4 months with a 1-year survival of 40%, and the disease control rate was 63.6%, which is compatible with external controls in second - line chemotherapy. rvs showed more favorable outcomes in patients with better performance status or adenocarcinoma in terms of overall survival. the common rvs - related adverse events were mild epigastric pain and pruritis. from july 2006 to november 2007, patients with conventional chemotherapy refractory metastatic crc were checked. after fulfilling inclusion / exclusion criteria, overall survival and adverse events of patients treated with rvs in the aftercare period were determined. the median overall survival for the entire population was 10.9 months (95% confidence interval, 5.616.1) and 1-year survival rate was 44.4%, which is compatible with external controls. by survival analysis using cox proportional hazards model, the performance status and the prior chemotherapy regimen number significantly affected overall survival. palliative chemotherapy - nave patients with advanced or metastatic pancreatic adenocarcinoma were checked from july 2006 to june 2010. after applying inclusion / exclusion criteria, 42 patients were eligible for the final analysis. overall survival, clinical benefit, and adverse events of these patients treated with rvs in the aftercare period were determined. the mean rvs administration period was 3.86 months (95% confidence interval : 2.525.20). the median overall survival for the entire population was 7.87 months, and 1-year survival rate was 26.2%, which is compatible with external controls. by using univariate and multivariate analyses, rvs treatment including the performance status and prognostic index significantly affected overall survival. a clinical benefit response was also shown by rvs treatment which was not dependent on concurrent chemotherapy (data not published). a 62-year - old man underwent living donor liver transplantation for both hepatocellular carcinoma and end stage liver disease in march 2005. unfortunately, the hcc recurred with multiple metastases in both lungs in september 2005, 6 months after liver transplantation. after systemic doxorubicin chemotherapy showed progression of lung metastases, he began receiving only rvs treatment in june 2006. four months later, metastatic mass in the right lower lobe of lung had increased in april 2007. after finishing radiation therapy, he developed new liver metastases and died of progressive disease in november 2007. an 82-year - old female was diagnosed with gastric cancer with a polypoid gastric mass approximately 25 mm in diameter at the middle body portion of the lesser curvature, a flat elevated lesion 50 mm in diameter at the prepyloric antrum, and the small gastrohepatic lymph nodes in october 2006. the endoscopic biopsy confirmed well - differentiated adenocarcinoma with a mutation in p53 that showed high nuclear activity of more than 80%. gastrectomy was not done because of old age and the concerns about the quality of life after surgery. five months later, the polypoid mass had markedly decreased and the flat elevated lesion had shrunk slightly, although the gastrohepatic lymph nodes were not changed. the biochemical parameters associated with liver and renal function were within the normal range, and no significant adverse effects from her rvs treatment have been observed. a 47-year - old man presented a 12 cm right renal mass and received a right radical nephrectomy which was pathologically the clear cell type of rcc in july 2006. four months later, follow - up ct and pet scans revealed metastatic multiple pulmonary nodules. after 4 months, ct scans showed a complete response in all pulmonary metastases including resolution of right pulmonary artery thrombosis. a 47-year - old man was diagnosed with the clear cell type of rcc accompanying multiple pulmonary nodules and underwent a radical nephrectomy for a 6.3 cm mass in september 2006. after cytoreductive surgery, the metastases in both lungs aggravated and a right adrenal mass was newly developed. after palliative sunitinib 2 cycles showed progression of lung metastases and both adrenal masses, he began receiving only rvs treatment in july 2007. after 9 months of rvs administration, chest ct scans showed the resolution of the masses, noted previously in the left upper lung. after 13 months of rvs therapy, ct scans showed significant reduction in the size of the metastatic masses in both adrenal glands. no evidence of disease continues in ct scans obtained up to now (july 2011). a 52-year - old female was diagnosed with pulmonary adenocarcinoma accompanying malignant pleural effusion confirmed by histologic examination in august 2006. immunochemical staining pattern was a cytokeratin 7 (strong positive), cytokeratin 20 (negative), and thyroid transcription factor-1 (positive). after 1-month rvs treatment, ct scans showed marked decrease in pleural effusion and no interval change in mass. there was no significant change in tumor and pleural nodularity in a chest ct scans until january 2009. after progression of her disease, she was enrolled in a clinical trial (erlotinib) at other hospital in july 2009 and was lost to follow - up. as several plants were used for cancer in traditional practice, rigorous in vitro and in vivo studies are essential and necessary to evaluate these extract 's efficacy and safety before clinical trials, where the efficacy is dependent on the cancer - cell toxicity. throughout this drug screening model such as the us national cancer institute (nci) 60 human tumor cell line anti - cancer drug screen (nci60) based on cytotoxicity, many drug developments could be possible from natural products. in fact, half of all anti - cancer drugs approved internationally were either natural products or their derivatives and were developed on the basis of knowledge gained from small molecules or macromolecules that exist in nature. however, it is questionable that the cell death is a critical end point for anti - cancer treatments. these days, the advances in the knowledge of cancer biology have developed some molecular - targeted agents for cancer treatment. multiple tyrosine kinase inhibitors targeted on angiogenesis clinically prolong overall survival through cytostatic rather than cytotoxic effect to the cancer cells. korean health care system is different from other countries where two separate medical systems, western medicine and traditional korean medicine, exist. therefore, it is possible for cancer patients to receive medication which might not be approved on conventional drug screen model because of low cytotoxicity. in fact, the rvs extract gave poor outcomes in nci60 cell lines (data not shown). however, some cancer patients in our center survived advanced cancer and are practically proven as responder to rvs extract. except all previously described patients to be published, there are many responders in various cancer cell types including pancreatic cancer, cholangiocarcinoma, and sarcoma refractory to conventional chemotherapy. we suggest that standardized rvs extract could be a natural anticancer candidate from our experiences. single active constituents such as sulfuretin or butein have been characterized from rvs extract, following the conventional pharmaceutical paradigm of drug discovery [25, 26 ]. nevertheless, it is hypothesized that the active compound isolated from plants may rarely have high activity against cancer as the extract at comparable concentration without synergistic interaction or multifactorial effects between compounds present in herbal extracts. cancer is also complex disease having various biological capabilities such as sustaining proliferative signaling, evading growth suppressors, resisting cell death, enabling replicative immortality, inducing angiogenesis, activating invasion and metastasis, genome instability, tumor - promoting inflammation, deregulating energy metabolism, and evading immune destruction. in response to targeted therapy, cancer cells for example, even if potent angiogenesis inhibitors succeed in suppressing specific molecular targets, tumors adapt and shift from a dependence upon continuing angiogenesis to invasiveness and metastasis instead [28, 29 ]. therefore, multiple targeted agents with synergistic interaction are necessary to inhibit the cancer cell progression. the whole extract containing many constituents from natural products might make it possible to be more effective and less toxic in clinic than single potent compound. based on clinical outcomes of rvs, it could be postulated to have various therapeutic targeting on cancer cell except the previously mentioned mechanism of action focused on angiogenesis. in the era of targeted therapy, the predictive biomarkers have been identified to select patients more likely to benefit from it, which indeed makes cancer treatment personalized. in recent development of new drug, well - validated biomarker becomes more and more important from the excellent example of crizotinib targeting alk mutation. unfortunately, there are no known clinically relevant biomarkers which could identify responders to the drugs targeted on angiogenesis. therefore, more research is needed for the predictive factors in order to find rvs extract - responders using molecular biology and traditional korean medicine 's diagnostic methodology. from our clinical results, effective outcome from rvs extract is not dependent on not only the cancer type but also the patient. natural products are also known to affect immune function which could be monitored by immunomodulating cytokines such as ifn-, il-2, and il-10. actually, there are reports on anti - inflammatory function of rvs or rvs flavonoids. butein from rvs inhibits cytokine - induced nitric oxide production by suppression of inflammatory signaling in nf-b pathways. rvs hexane fraction and its major component, fisetin, significantly inhibit inflammatory cytokine production such as tnf-, il-6, il-8, and monocyte chemoattractant protein-1. rvs glycoprotein (36 kda) also has an inhibitory activity of t - helper type 2 (th2) cytokines such as il-4 and il-10, which means to help immune dysfunction. in aggressive pancreatic cancer, a cross talk between tumor cells and cancer - associated fibroblasts was reported to result in the induction of th2-type inflammation which was well correlated with poor survival of patients. therefore, we try to focus cytokines - related immune system and find common genotype or phenotype backgrounds concerning drug metabolism in rvs extract - responders. in conclusion, drug developments from natural products should be differently approached from the conventional pharmaceutical paradigm, and we hope that these preliminary results would stimulate further investigation into the effectiveness and tolerability of other natural products for the treatment of advanced cancers in clinical practice. | active anticancer molecules have been searched from natural products ; many drugs were developed from either natural products or their derivatives following the conventional pharmaceutical paradigm of drug discovery. however, the advances in the knowledge of cancer biology have led to personalized medicine using molecular - targeted agents which create new paradigm. clinical benefit is dependent on individual biomarker and overall survival is prolonged through cytostatic rather than cytotoxic effects to cancer cell. therefore, a different approach is needed from the single lead compound screening model based on cytotoxicity. in our experience, the rhus verniciflua stoke (rvs) extract traditionally used for cancer treatment is beneficial to some advanced cancer patients though it is herbal extract not single compound, and low cytotoxic in vitro. the standardized rvs extract 's action mechanisms as well as clinical outcomes are reviewed here. we hope that these preliminary results would stimulate different investigation in natural products from conventional chemicals. |
obsessive - compulsive disorder (ocd) is a disabling and distressing disorder, beginning in late second decade or early third decade of life. however, symptoms can appear in first decade sometimes as early as 2 years. estimated prevalence of ocd in very young children (5 - 7 years of age) is 0.01% which is much lower than in general pediatric patients (0.5 - 4.0%). pre - pubertal onset is more common in boys than girls, in the ratio of 2 - 3:1. a case of ocd in a 4-year - old child is reported here and related diagnostic and therapeutic dilemmas are discussed. the present case report is about a 4-year - old female child with normal physical and psychological development until date and no family history of significant physical or psychiatric illness was brought for psychiatric consultation, for excessive anger in the child when her mother did not comply with her wishes of performing or not performing certain acts, since last 2 months. child insisted on being bathed by mother repeatedly, up to 5 - 6 times successively. she insisted on dressing herself and denied any assistance / advises in dressing up (even though she had not yet learnt to dress herself properly). she insisted on climbing or walking in a particular way ; climbing each step with one foot not missing any step. she refused to be helped to climb taller steps or to cross hurdles while walking. while returning from school she had to enter the house first, followed by mother. child restrained all family members, from speaking to her unless she speaks to them. she restrained mother from speaking to anyone else apart from her, not even over telephone. child did not wish her behavior to be reported to others and sought repeated reassurance from mother about it. mother had to describe the child 's behavior to the doctor secretly to avoid child 's anger. any noncompliance would result in instantaneous anger which was acted upon by crying, yelling, beating - up mother, scratching mother or herself, pulling her hair and throwing things accessible at the moment like cell - phone, remote - control of television. nail - biting was also observed during such situations, which she did not have earlier. mother had no option than following the child 's wishes, to escape from her anger. mother was unable to adhere to all the child 's orders and felt very sad and frustrated. there was no history of fever prior to onset of symptoms or repeated involuntary movements of face / vocal utterances. it took three - four visits to out - patient department to establish rapport with the child. during the interview, child expressed that her mother makes mistakes in bathing her / dressing her and hence it should be redone correctly. her book should not be touched as some papers may fall - off from the book. she should climb steps or walk in a particular manner in order to avoid slipping into the dirt or else she has to clean herself. morbid - preoccupation with contamination (bathing), symmetry (dressing) and pathological - doubt (reassurance - seeking) were predominant in her behavior. aslo titer was 5.93 iu / ml (normal levels up to 100 iu / ml). as child was unable to answer the questionnaires, mother was administered parent - versions of children yale - brown obsessive - compulsive scale (cybocs), child oc - impact scale - revised parent - version (cois - rp) and problem - behavior checklist (pbcl). on most of the items rating was severe to extreme. on cois - rp score was 55 and on pbcl was107, which was in moderate problem - behavior range. diagnosis of ocd was made using diagnostic and statistical manual of mental disorders, 4 edition criteria. child was started on tablet escitalopram 1.25 mg / day and dose was escalated to 2.5 mg over a period of 2 weeks. on cois - rp score was 10 and on pbcl child scored 90 which is in low problem - behavior. repetitive behaviors and magical thinking which can be part of normal child development occur between age 3 and 6 years. they are self - limiting and rarely time - consuming or distressing. in this child the behaviors were time - consuming, interfered with her daily activities and caused distress to child and mother. distress in ocd could be due to characteristics of the symptom such as irrationality, content, ego - alieness, social acceptability, efforts to resist and associated disability or secondary to being prevented from carrying out compulsive acts. a child 's appreciation of these features is inadequate, they may not evoke the same degree of distress as in adults. even if appreciated, their objective elicitation is difficult. this raises the question, whether it is tenable to diagnose ocd in the absence of above features. but diagnosis of ocd can be reliably made from the age of 4 - 5 years. this child repeatedly asked the mother my acts are not wrong, is it ? child also repeatedly sought reassurance about non - divulgence of her behavior and got angry whenever it was discussed with others. extensive literature review did not yield any reports of ocd in very young children, though children as young as four can develop full - blown ocd. children having ocd rely on their caregivers for symptom execution as they are dependent on them for physical and emotional needs. coercive / disruptive behaviors refer to imposing rules and prohibitions on family members by the patient, due to the disorder. coercion includes forced participation in compulsive rituals, demands to perform actions instead of the child or to refrain from certain behaviors, to avoid distress to the child and compulsive behaviors on the part of the child that negatively impact on others. accommodation refers to family members actions to facilitate rituals, acquiesce to the child 's demands, provide reassurance, decrease child 's responsibility, assist with or complete tasks for the child. parents are willing to sacrifice in order to avoid children 's anger, distress or to restore the peace to the home. distress is correlated with the degree to which family members are involved in the patient 's symptoms. mother of this child was forcibly and extensively involved in doing the compulsive activities for the child. any noncompliance by mother was met with verbal and physical abuse, who felt depressed. father of this child was not targeted as he stayed away most of the time. cognitive - behavior therapy (cbt) is the first - line treatment for ocd in children. normal children aged 5 - 11 year can engage in tasks required for cognitive therapy. the abstract concepts of cbt are difficult to communicate to a child, but children with early - onset ocd having good insight benefit from cbt. any effort to discuss psychopathology was met with resistance in the form of deviating from the topic of discussion. though selective serotonin reuptake inhibitors such as fluvoxamine, sertraline and fluoxetine have been successfully used in childhood - onset ocd, this child was started on tablet escitalopram in very low dose which was titrated gradually. choice of drug was based on the author 's experience with the drug as antidepressant. it is intended to follow - up this child to observe the long - term course and outcome. ocd in very young children though rare and fraught with diagnostic and therapeutic dilemmas, can be reliably diagnosed. though cbt is proposed as the first - line treatment, there are practical difficulties in administering it. pharmacotherapy in very young children is beset with lack of literature regarding type and dose of medication. caregivers of childhood - ocd undergo significant psychological distress due to coercion by the child and the need to accommodate for the child 's obsessive - compulsive behavior. though this child remitted well in short - term, only continued follow - up will reveal long - term course and outcome of her illness. | obsessive - compulsive disorder (ocd) is a very distressing disorder for both patient and caregiver. usual onset of the disorder is in late second or early third decade of life. it is diagnosed in children but rarely before 5 years. a case of ocd in a 4-year - old girl is reported here. diagnostic and therapeutic dilemmas in such a situation are discussed. |
patients with a diagnosis of rrms who had been prescribed bg-12 were enrolled in this prospective cohort study. informed consent was obtained from all patients and controls prior to participation in the protocol, which was approved by the university of michigan institutional review board. patients were between 18 and 65 years of age, had not received another nonsteroidal disease - modifying therapy within the last 30 days, and had not had iv immunoglobulin therapy or plasmapheresis in the last 6 months. four of 5 patients who had received oral or injected steroid treatments discontinued use more than 1 month before taking bg-12, and the other patient began a 6-week taper at the time of starting bg-12. table 1 lists previous nonsteroidal medications taken by each patient and the time of discontinuation. patients were put on a dose escalation schedule and all reached 240 mg bg-12 twice daily within 15 weeks of treatment initiation. a total of 13 patients with rrms were followed longitudinally from pretreatment to 46 months of treatment with bg-12. a baseline peripheral blood sample was drawn within 2 months prior to initiation of bg-12, and after 46 months (20.5 3.8 weeks) of reaching the standard dose of bg-12. sex and age of the patients was 8/13 (61.5%) female, average age 46.0 8.7 years (median 46.5 ; range 3158). the 5 men were 40.4 9.8 years old (median 35 ; range 3357). eight of these patients had a follow - up sample taken after 12 months of treatment (see table 1). peripheral blood mononuclear cells (pbmc) were also obtained from 6 healthy controls : 4/6 (66.7%) female, average age 48.0 9.1 years (median 47.0 ; range 3860), and 2 men aged 31 and 49 years. blood samples (2025 ml) from all participants were collected in sodium citrate cell preparation tubes and processed immediately. total b - cell numbers were calculated by multiplying percentages from flow cytometry and cbc lymphocyte counts. patient demographics and clinical information isolated pbmc from patients and controls were stained with monoclonal antibodies reactive against the cell surface markers cd19, cd27, and cd43 purchased from bd biosciences (east rutherford, nj) and cd24 and cd38 from biolegend (san diego, ca). multicolor flow cytometry was performed for all samples on a beckman coulter (sharon hill, pa) lsr flow cytometer using standardized voltage and compensation settings. data analysis was performed using tree star (ashland, or) flowjo version x.0.6 software. purified b cells were isolated from pbmc by magnetic bead separation using anti - human cd19 magnetic - activated cell sorting beads and the protocol provided by miltenyi biotec (bergisch gladbach, germany). labeled cells were positively selected over ls columns (miltenyi biotec) and were routinely > 98% pure. b cells were cultured in high glucose dulbecco modified eagle medium supplemented with 10% heat - inactivated fetal calf serum, penicillin, streptomycin, insulin (5 g / ml), and transferrin (50 g / ml) with irradiated human cd40 ligand - transduced fibroblasts for 6 days. cell - free supernatants were removed and analyzed for the presence of human il-10 using opteia kit (bd biosciences) following the manufacturer 's protocol. exact p values were calculated using the appropriate statistical tests for each dataset as indicated in the figure legends. two - way analysis of variance with dunn multiple comparison tests were used to establish statistical significance for datasets containing 3 or more groups. comparisons of control and patient samples were performed using mann - whitney tests. paired comparisons of time point data for individual patients patients with a diagnosis of rrms who had been prescribed bg-12 were enrolled in this prospective cohort study. informed consent was obtained from all patients and controls prior to participation in the protocol, which was approved by the university of michigan institutional review board. patients were between 18 and 65 years of age, had not received another nonsteroidal disease - modifying therapy within the last 30 days, and had not had iv immunoglobulin therapy or plasmapheresis in the last 6 months. four of 5 patients who had received oral or injected steroid treatments discontinued use more than 1 month before taking bg-12, and the other patient began a 6-week taper at the time of starting bg-12. table 1 lists previous nonsteroidal medications taken by each patient and the time of discontinuation. patients were put on a dose escalation schedule and all reached 240 mg bg-12 twice daily within 15 weeks of treatment initiation. a total of 13 patients with rrms were followed longitudinally from pretreatment to 46 months of treatment with bg-12. a baseline peripheral blood sample was drawn within 2 months prior to initiation of bg-12, and after 46 months (20.5 3.8 weeks) of reaching the standard dose of bg-12. sex and age of the patients was 8/13 (61.5%) female, average age 46.0 8.7 years (median 46.5 ; range 3158). the 5 men were 40.4 9.8 years old (median 35 ; range 3357). eight of these patients had a follow - up sample taken after 12 months of treatment (see table 1). peripheral blood mononuclear cells (pbmc) were also obtained from 6 healthy controls : 4/6 (66.7%) female, average age 48.0 9.1 years (median 47.0 ; range 3860), and 2 men aged 31 and 49 years. blood samples (2025 ml) from all participants were collected in sodium citrate cell preparation tubes and processed immediately. total b - cell numbers were calculated by multiplying percentages from flow cytometry and cbc lymphocyte counts. isolated pbmc from patients and controls were stained with monoclonal antibodies reactive against the cell surface markers cd19, cd27, and cd43 purchased from bd biosciences (east rutherford, nj) and cd24 and cd38 from biolegend (san diego, ca). multicolor flow cytometry was performed for all samples on a beckman coulter (sharon hill, pa) lsr flow cytometer using standardized voltage and compensation settings. data analysis was performed using tree star (ashland, or) flowjo version x.0.6 software. purified b cells were isolated from pbmc by magnetic bead separation using anti - human cd19 magnetic - activated cell sorting beads and the protocol provided by miltenyi biotec (bergisch gladbach, germany). labeled cells were positively selected over ls columns (miltenyi biotec) and were routinely > 98% pure. b cells were cultured in high glucose dulbecco modified eagle medium supplemented with 10% heat - inactivated fetal calf serum, penicillin, streptomycin, insulin (5 g / ml), and transferrin (50 g / ml) with irradiated human cd40 ligand - transduced fibroblasts for 6 days. cell - free supernatants were removed and analyzed for the presence of human il-10 using opteia kit (bd biosciences) following the manufacturer 's protocol. exact p values were calculated using the appropriate statistical tests for each dataset as indicated in the figure legends. two - way analysis of variance with dunn multiple comparison tests were used to establish statistical significance for datasets containing 3 or more groups. comparisons of control and patient samples were performed using mann - whitney tests. paired comparisons of time point data for individual patients treatment of rrms with the food and drug administration approved oral drug, bg-12 (tecfidera), is known to reduce total pbmc counts compared to pretreatment levels. decreases involve both the t- and the b - lymphocyte populations, yet detailed analysis within these major lymphocyte lineages has not been reported. b cells can be subdivided into groups with distinct functions and states of activation that are distinguishable based on surface marker expression patterns. in this prospective cohort study, b - cell subsets were analyzed from 13 patients with rrms (table 1) before and after 46 months of treatment with 240 mg twice daily oral bg-12. table 1 outlines the demographics and other clinical data for each patient including previous treatments and cbc lymphocyte counts. patients 3, 4, 10, and 11 had taken oral or injected corticosteroids that were discontinued prior to starting bg-12 therapy. patient 1 had a flare that was treated with oral corticosteroids just prior to entering the study, and was tapered off of steroids immediately after bg-12 treatment was initiated. most (11 of 12) of the patients had a marked reduction in peripheral blood lymphocytes (pbl) after 46 months treatment with bg-12 compared to pretreatment levels (table 1). levels of pbl did not decrease between the 4 and 6 months and > 1 year time points for most patients. to determine the effects of bg-12 on b cells, six healthy individuals who had similar demographics for age, sex, and ethnicity were used as controls. figure 1a shows the gating used select cd19 + b cells from a representative patient (rrms 8) at baseline and 4 months after starting bg-12. the majority of these patients with rrms had an elevated percentage of cd19 + b cells prior to bg-12 treatment compared to controls (figure 1b). a significant decrease in the total number of b cells was observed at 46 months of treatment compared to pretreatment levels (figure 1c and table 2). the total number of circulating cd19 + b cells in the patients with rrms did not significantly decrease between 4 and 6 months of treatment and more than 1 year of treatment (table 2). peripheral blood mononuclear cells (pbmc) isolated from patients with relapsing - remitting multiple sclerosis (rrms) before and after bg-12 treatment and healthy controls were stained for b - cell markers. (a) representative forward scatter, side scatter, and anti - cd19 staining from a single patient (rrms-8) shows standardized gating for lymphocytes, single cells, and total cd19 + b cells that was used for all of the samples. (b) comparison of % cd19 + b cells for healthy controls and patients with rrms before treatment. each dot represents an individual sample and lines are the median interquartile range for each group. the exact p value shown below the title was calculated using mann - whitney test. (c) total b - cell numbers / ml of blood for the patients with rrms were calculated before and after 46 months of treatment by multiplying the % cd19 + cells by the lymphocyte counts reported by the clinical pathology laboratory (table 1). exact p value for paired patient data was determined using wilcoxon matched - pairs signed - rank test. (d) representative histograms from patient rrms-8 show gating used to define cd27 + memory b cells. (e) percentages of cd27 + memory b cells in patients with rrms before treatment compared with controls. each dot represents data from one individual and lines are the median and interquartile range for each group. (f) longitudinal % cd27 + memory b - cell data for individual patients with rrms (n = 8) before, after 46 months, and after more than 1 year of treatment with bg-12. total cell numbers of peripheral blood b - cell subsets cd27 has been commonly used to distinguish activated / memory b cells from other b - cell subsets or activation states. cd19+cd27 + cells were analyzed before and after treatment with bg-12 (figure 1, d patients with rrms in this study had lower percentages of circulating cd27 + memory b cells prior to bg-12 treatment than the controls (figure 1e), suggesting that the cd27 b cells, which include a mixture of immature, transitional, and naive b - cell subsets, were overrepresented in the patients with rrms before treatment. as shown in figure 1f, there was some variability in the relative levels of memory vs naive b cells in the patients with rrms before treatment, and bg-12 had differential effects on the ratios. treatment for 46 months led to decreases in the absolute number of circulating cd27 + b cells in all but one patient. the exception was patient rrms-10, who went on to have fewer memory b cells after 1 year of treatment than at baseline (data not shown). long - term treatment with bg-12 did not lead to further significant reductions in the total number of cd27 + b cells in most patients (table 2) or a consistent change in the ratio of cd27 + to cd27 b cells (figure 2c). taken together, these results suggest that bg-12 treatment did not have a selective effect on either the cd27 + memory b cells or the cd27 immature, transitional, or naive b cells, but that there was a generalized decrease of both b - lymphocyte populations in patients with rrms. peripheral blood mononuclear cells (pbmc) isolated from healthy controls and patients with relapsing - remitting multiple sclerosis (rrms) before and after bg-12 treatment were stained and gated for cd19 + b cells as shown in figure 1 and then analyzed for coexpression of cd24 and cd38 or cd27 and cd43. (a) representative staining from patient rrms-8 shows the gating used to select the cd24cd38 (t2-mzp) b - cell subset. (b) representative staining from patient rrms-8 shows gating used to analyze cd43 + cd27 + b-1 b cells before and after 4 months of bg-12 treatment. (c) comparison of t2-mzp b cells in controls and patients with rrms before treatment. each dot represents an individual sample and lines are the median and interquartile range for each group. (d) percentages of b-1 b cells in controls and patients with rrms before treatment. each dot represents an individual and lines are the median and interquartile range for each group. (e) percentages of t2-mzp b cells in individual patients with rrms before bg-12 therapy and after 46 months and > 12 months of treatment. (f) longitudinal changes in percentage of b-1 b cells for individual patients with rrms at baseline, 46 months, and > 12 months bg-12 treatment. the cd27 and cd27 + b - cell populations can be further subdivided into functionally distinct subsets. notably, a subset of regulatory b cells that produce il-10 has been found within the cd27 and cd27 + b - cell subsets. cd27 b cells that are cd24cd38 (figure 2a) have been previously classified as transitional 2 marginal zone precursor (t2-mzp) b cells that produce il-10. circulating t2-mzp b cells were reduced in percentage in these patients with rrms prior to treatment in comparison to controls (figure 2b). unlike the total cd27 b - cell subset, increases in t2-mzp b cells were detected in 10 of 13 patients at 46 months treatment, and were higher than baseline in all 8 patients who were followed for more than 1 year (figure 2c). despite reductions in total b cells, the number of circulating t2-mzp b cells tended to be higher after 46 months of bg-12 treatment and continued to increase over the longer term, resulting in significantly higher total t2-mzp b - cell numbers in the circulation of patients with rrms after 1 year of bg-12 treatment (table 2). the cd27+cd43 + b - cell subset (figure 2d) has been identified as an innate - like b-1 b - cell subtype that, similar to its counterpart in mice, has the capacity to produce il-10 and to regulate immune responses. prior to treatment, b-1 b cells were found in the circulation at very low levels in all but one of the 13 patients with rrms in our study in comparison to healthy controls (figure 2e). despite the inclusion of patient rrms-3, whose b-1 cells were within the normal range, the patients averaged a more than fourfold lower percentage of b-1 b cells than controls. the b-1 b cells responded somewhat differently to bg-12 treatment compared to t2-mzp b cells (figure 2f). after 46 months of treatment with bg-12, the percentage of circulating b-1 b cells was not significantly changed (figure 2f), and there was variability in the response from patient to patient. however, after 1 year of treatment, 6 of 8 patients with rrms had a substantially higher percentage of b-1 b cells than what was present prior to bg-12 treatment. with the exception of patient rrms-3, who had 48,800 b-1 b cells / ml of blood at baseline compared to the 4,200 3,700 b-1 b cells / ml average for the other 7 patients, there was a significant increase in the total number of circulating b-1 b cells after long - term treatment with bg-12 (table 2). not all t2-mzp or b-1 b cells produce il-10 after stimulation, and patients with systemic lupus erythematosus had t2-mzp b cells that were defective in il-10 production. to determine whether b cells from the patients with rrms were functional, cd19 + b cells were purified using magnetic bead positive selection, and then cultured with a cd40 ligand - transduced cell line. this assay was dependent on having enough purified b cells, which was not achieved for all patients and time points. figure 3a shows il-10 data for the 3 patients with rrms in this study who were analyzed at both the pretreatment and 46 months of bg-12 treatment time points. the percentages of t2-mzp and b-1 b cells in the sample prior to culture are shown in figure 3b. the results indicated that levels of il-10 produced by these 3 patients were comparable to the combined levels of t2-mzp and b-1 b cells before or after treatment, but not well - correlated with the individual subsets. a total of 9 patients with rrms were analyzed for cd40 ligand - induced il-10 production at the 46 months treatment time point (figure 3c). while 7 of the 9 patients with rrms released levels of il-10 that correlated strongly with the percentage of t2-mzp plus b-1 b cells found in their blood, 2 patients with rrms appeared to have a reduction in the expected levels of b - cell il-10 production in this assay. cd19 + b cells were positively selected by magnetic bead separation before and after 46 months of bg-12 treatment. purified b cells were stimulated with irradiated hcd40l - fb for 6 days prior to measurement of il-10 in culture supernatants. cultures containing hcd40l - fb alone or b cells with cd40l fibroblasts did not produce il-10 (data not shown). student t test calculated p values for the data before and after treatment were p = 0.0018, p 1 year time points for most patients. to determine the effects of bg-12 on b cells, six healthy individuals who had similar demographics for age, sex, and ethnicity were used as controls. figure 1a shows the gating used select cd19 + b cells from a representative patient (rrms 8) at baseline and 4 months after starting bg-12. the majority of these patients with rrms had an elevated percentage of cd19 + b cells prior to bg-12 treatment compared to controls (figure 1b). a significant decrease in the total number of b cells was observed at 46 months of treatment compared to pretreatment levels (figure 1c and table 2). the total number of circulating cd19 + b cells in the patients with rrms did not significantly decrease between 4 and 6 months of treatment and more than 1 year of treatment (table 2). peripheral blood mononuclear cells (pbmc) isolated from patients with relapsing - remitting multiple sclerosis (rrms) before and after bg-12 treatment and healthy controls were stained for b - cell markers. (a) representative forward scatter, side scatter, and anti - cd19 staining from a single patient (rrms-8) shows standardized gating for lymphocytes, single cells, and total cd19 + b cells that was used for all of the samples. (b) comparison of % cd19 + b cells for healthy controls and patients with rrms before treatment. each dot represents an individual sample and lines are the median interquartile range for each group. the exact p value shown below the title was calculated using mann - whitney test. (c) total b - cell numbers / ml of blood for the patients with rrms were calculated before and after 46 months of treatment by multiplying the % cd19 + cells by the lymphocyte counts reported by the clinical pathology laboratory (table 1). exact p value for paired patient data was determined using wilcoxon matched - pairs signed - rank test. (d) representative histograms from patient rrms-8 show gating used to define cd27 + memory b cells. (e) percentages of cd27 + memory b cells in patients with rrms before treatment compared with controls. each dot represents data from one individual and lines are the median and interquartile range for each group. (f) longitudinal % cd27 + memory b - cell data for individual patients with rrms (n = 8) before, after 46 months, and after more than 1 year of treatment with bg-12. cd27 has been commonly used to distinguish activated / memory b cells from other b - cell subsets or activation states. cd19+cd27 + cells were analyzed before and after treatment with bg-12 (figure 1, d patients with rrms in this study had lower percentages of circulating cd27 + memory b cells prior to bg-12 treatment than the controls (figure 1e), suggesting that the cd27 b cells, which include a mixture of immature, transitional, and naive b - cell subsets, were overrepresented in the patients with rrms before treatment. as shown in figure 1f, there was some variability in the relative levels of memory vs naive b cells in the patients with rrms before treatment, and bg-12 had differential effects on the ratios. treatment for 46 months led to decreases in the absolute number of circulating cd27 + b cells in all but one patient. the exception was patient rrms-10, who went on to have fewer memory b cells after 1 year of treatment than at baseline (data not shown). long - term treatment with bg-12 did not lead to further significant reductions in the total number of cd27 + b cells in most patients (table 2) or a consistent change in the ratio of cd27 + to cd27 b cells (figure 2c). taken together, these results suggest that bg-12 treatment did not have a selective effect on either the cd27 + memory b cells or the cd27 immature, transitional, or naive b cells, but that there was a generalized decrease of both b - lymphocyte populations in patients with rrms. peripheral blood mononuclear cells (pbmc) isolated from healthy controls and patients with relapsing - remitting multiple sclerosis (rrms) before and after bg-12 treatment were stained and gated for cd19 + b cells as shown in figure 1 and then analyzed for coexpression of cd24 and cd38 or cd27 and cd43. (a) representative staining from patient rrms-8 shows the gating used to select the cd24cd38 (t2-mzp) (b) representative staining from patient rrms-8 shows gating used to analyze cd43 + cd27 + b-1 b cells before and after 4 months of bg-12 treatment. (c) comparison of t2-mzp b cells in controls and patients with rrms before treatment. each dot represents an individual sample and lines are the median and interquartile range for each group. (d) percentages of b-1 b cells in controls and patients with rrms before treatment. each dot represents an individual and lines are the median and interquartile range for each group. (e) percentages of t2-mzp b cells in individual patients with rrms before bg-12 therapy and after 46 months and > 12 months of treatment. (f) longitudinal changes in percentage of b-1 b cells for individual patients with rrms at baseline, 46 months, and > 12 months bg-12 treatment. the cd27 and cd27 + b - cell populations can be further subdivided into functionally distinct subsets. notably, a subset of regulatory b cells that produce il-10 has been found within the cd27 and cd27 + b - cell subsets. cd27 b cells that are cd24cd38 (figure 2a) have been previously classified as transitional 2 marginal zone precursor (t2-mzp) b cells that produce il-10. circulating t2-mzp b cells were reduced in percentage in these patients with rrms prior to treatment in comparison to controls (figure 2b). unlike the total cd27 b - cell subset, increases in t2-mzp b cells were detected in 10 of 13 patients at 46 months treatment, and were higher than baseline in all 8 patients who were followed for more than 1 year (figure 2c). despite reductions in total b cells, the number of circulating t2-mzp b cells tended to be higher after 46 months of bg-12 treatment and continued to increase over the longer term, resulting in significantly higher total t2-mzp b - cell numbers in the circulation of patients with rrms after 1 year of bg-12 treatment (table 2). the cd27+cd43 + b - cell subset (figure 2d) has been identified as an innate - like b-1 b - cell subtype that, similar to its counterpart in mice, has the capacity to produce il-10 and to regulate immune responses. prior to treatment, b-1 b cells were found in the circulation at very low levels in all but one of the 13 patients with rrms in our study in comparison to healthy controls (figure 2e). despite the inclusion of patient rrms-3, whose b-1 cells were within the normal range, the patients averaged a more than fourfold lower percentage of b-1 b cells than controls. the b-1 b cells responded somewhat differently to bg-12 treatment compared to t2-mzp b cells (figure 2f). after 46 months of treatment with bg-12, the percentage of circulating b-1 b cells was not significantly changed (figure 2f), and there was variability in the response from patient to patient. however, after 1 year of treatment, 6 of 8 patients with rrms had a substantially higher percentage of b-1 b cells than what was present prior to bg-12 treatment. with the exception of patient rrms-3, who had 48,800 b-1 b cells / ml of blood at baseline compared to the 4,200 3,700 b-1 b cells / ml average for the other 7 patients, there was a significant increase in the total number of circulating b-1 b cells after long - term treatment with bg-12 (table 2). not all t2-mzp or b-1 b cells produce il-10 after stimulation, and patients with systemic lupus erythematosus had t2-mzp b cells that were defective in il-10 production. to determine whether b cells from the patients with rrms were functional, cd19 + b cells were purified using magnetic bead positive selection, and then cultured with a cd40 ligand - transduced cell line. this assay was dependent on having enough purified b cells, which was not achieved for all patients and time points. figure 3a shows il-10 data for the 3 patients with rrms in this study who were analyzed at both the pretreatment and 46 months of bg-12 treatment time points. the percentages of t2-mzp and b-1 b cells in the sample prior to culture are shown in figure 3b. the results indicated that levels of il-10 produced by these 3 patients were comparable to the combined levels of t2-mzp and b-1 b cells before or after treatment, but not well - correlated with the individual subsets. a total of 9 patients with rrms were analyzed for cd40 ligand - induced il-10 production at the 46 months treatment time point (figure 3c). while 7 of the 9 patients with rrms released levels of il-10 that correlated strongly with the percentage of t2-mzp plus b-1 b cells found in their blood, 2 patients with rrms appeared to have a reduction in the expected levels of b - cell il-10 production in this assay. cd19 + b cells were positively selected by magnetic bead separation before and after 46 months of bg-12 treatment. purified b cells were stimulated with irradiated hcd40l - fb for 6 days prior to measurement of il-10 in culture supernatants. cultures containing hcd40l - fb alone or b cells with cd40l fibroblasts did not produce il-10 (data not shown). student t test calculated p values for the data before and after treatment were p = 0.0018, p < 0.0001, and p = 0.2084 for patients (b) stacked bar graph of percentage of circulating t2-mzp b cells (open bars) and b-1 b cells (hashed bars) within the total cd19 + b - cell population before culture. (c) comparison of b - cell il-10 production vs combined levels of t2-mzp and b-1 b cells after 46 months treatment for 9 patients. two patients did not produce il-10 despite high levels of regulatory b cells (marked with x). linear regression for the other 7 patients (diamonds) showed a high degree of correlation : y = 50.3x + 181, r = 0.79, f = 18.7, p = 0.0075. data point at 11.6% t2-mzp + b-1 b cells represents 2 patients, rrms-1 and rrms-2, who produced il-10 = 1,010 45 and 1,008 99 pg / million cells, respectively. our data confirm that treatment of patients with rrms with bg-12 leads to reductions in circulating lymphocytes, including b cells, as previously reported. treatment with bg-12 was found to variably lower the total number of cd27 + memory b cells, as well as the cd27 immature, transitional, and naive b - cell subsets. in contrast, cd24cd38 t2-mzp b cells increased in percentage after 46 months of treatment and remained higher in number than baseline in 8/8 (100%) patients after 1 year of treatment. long - term treatment also led to increased numbers of circulating cd43+cd27 + b-1 cells. both t2-mzp and b-1 b cells have been independently shown to produce the immune regulatory cytokine, il-10, and the production of il-10 by b cells in this study correlated with the combined presence of both of these cell subsets in 7/9 (78%) patients, while 2 patients failed to produce il-10 despite relatively high levels of t2-mzp and b-1 cells. thus, bg-12 treatment of patients with rrms appeared to favor b cells that had immune regulatory potential. the mechanisms underlying these differential effects of bg-12 on circulating b - lymphocyte subsets have not yet been determined. some possibilities for the reductions in the majority of b cells include direct induction of apoptosis or indirect killing of b cells by other cells. another possibility is that bg-12 may have initially affected th cell viability or activation resulting in losses or changes to t - cell help that altered b - cell viability. shifts in cytokine production from th1 toward th2 patterns have been noted in human t cells from patients treated with dmf. these changes in t - cell cytokine output may have contributed to the increase in regulatory b - cell subsets, since the th2 cytokine il-5 has been shown to preferentially stimulate growth of immune regulatory mouse b-1 b cells that expressed fas ligand and il-10. further work is necessary to understand the cells and processes involved and their relative importance to the therapeutic effects of bg-12. direct effects of bg-12 or dmf on signal transduction in human b cells have not been previously reported. bg-12 is known to activate the nuclear factor (erythroid - derived 2)like 2 (nrf2) pathway in neuronal cells. unlike the proapoptotic effects of dmf on t cells, our group recently demonstrated that activation of the nrf2 pathway by dmf can inhibit neuronal cell apoptosis as a possible mechanism of neuroprotection. it will be of interest to determine whether bg-12 activates different signaling pathways and has a pro vs antiapoptotic effect on different subsets of human b cells. one product of nrf2 activation that may play a direct role in the immune response is heme oxygenase1 (ho-1), which is known to stimulate the functions of treg cells. in contrast, very little is known about the role of nrf2 and ho-1 in regulatory b - cell activation and function. it remains to be determined whether bg-12 has direct effects on proliferation or protection from apoptosis of t2-mzp or b-1 b cells. other possibilities for the observed increases in these cell populations include indirect effects through activation of other cell populations or homeostatic proliferation response resulting from the loss of other lymphocytes. in humans, cd24cd38 t2-mzp and cd27+cd43 + b-1 b cells have been designated as regulatory b - cell subsets based on their ability to produce il-10. it should be noted that within these populations, il-10 production only occurs in a fraction of the total subset and is dependent on the method of stimulation. both the t2-mzp and b-1 b - cell subsets were increased in total cell number and percentage following long - term treatment in the majority of the patients we studied. the t2-mzp b cells responded earlier and more consistently than the b-1 b cells, suggesting that different mechanisms were involved in their proliferation. increases in t2-mzp b cells have been noted following treatment of patients with rrms with other medications, suggesting that these cells may be highly important in the regulation of multiple sclerosis (ms) pathogenesis. the response among b-1 b cells in bg-12-treated patients with rrms was more complicated and individualized, with the increase in b-1 b cells only detected after 1 year of treatment, and only in 6 of the 8 patients analyzed. this may have been due in part to the fact that the majority of these innate b cells are resident in the lining of the gut and lungs, and the delayed increase in their numbers in the blood may reflect earlier activation or proliferation in the mucosa. most of the patients had significantly lower levels of b-1 b cells prior to treatment, in agreement with findings of other investigators. however, the previous authors concluded that treatment of patients with rrms with glatiramer acetate, interferon-, or natalizumab had no effect on cd43+cd27 + b-1 b cells. this was in sharp contrast to the effects of glatiramer acetate treatment in mouse eae, which resulted in expansion and increased regulatory function of cd5 + b-1a cells. it should be noted that cd5 is not a specific marker for b-1 cells in humans, complicating the interpretation of previous reports linking human cd5 + b cells to ms pathogenesis. we did not assess il-10 production by intracellular staining, and therefore, were not able to determine whether the freshly isolated b cells were expressing il-10 in vivo. the levels of il-10 produced by 7 out of 9 of the patients with rrms correlated with the combined percentages of t2-mzp and b-1 b cells in the sample, but not with either of the subsets independently. the data for these 7 patients contrasted with previous reports associating autoimmunity with poorly functioning regulatory b cells, and suggest that b cells in these patients with rrms would be capable of contributing to immune regulation. notably, b cells from 2 of the patients with rrms in our study did not produce significant amounts of il-10 despite having relatively high levels of t2-mzp and b-1 b cells. it will be interesting to track clinical responses in these patients long term, and to perform similar analyses on a larger population to determine whether the beneficial effects of bg-12 correlate with the activation and competence of regulatory b cells. it should be noted that this study was done with a limited number of patients, and that continued work should be done with larger groups and longer follow - up to confirm these findings. study of more complex variables, such as the effects of prior treatments as well as duration and severity of disease at treatment initiation, will require much larger groups and may be important in determining which patients are most likely to benefit from bg-12 therapy. an important aspect of our study is the variability of the responses of b cells to bg-12 treatment and how this may relate to clinical responses. none of these 13 patients has relapsed and there have been no new mri lesions during this study (data not shown). the patients have tolerated bg-12 treatment well with only a few reports of minor side effects that have subsided over time. with several cases of pml having been reported, there is understandable concern about long - term effects of bg-12 and a need to screen for jc virus. these issues highlight the need for more long - term studies with large cohorts of patients, which may lead to a better understanding of variables that relate not only to favorable outcomes, but also to severe negative side effects such as pml. it will be interesting to determine whether the short - term effects of bg-12 on t2-mzp or b-1 b cells will predict the long - term clinical efficacy of bg-12 treatment. lundy received nonprofit honorarium from university of connecticut, is on the editorial board for the open rheumatology journal, and received research support from merck, chugai, nih, university of michigan medical school, and edward t. and ellen k. dryer foundation. y. mao - draayer served on the scientific advisory board for, received travel funding, and/or speaker honoraria from, and consulted for acorda, bayer, biogen idec, emd serono, genzyme, novartis, questor, chugai, and teva, and received research support from nih niaid and ninds. | objective : to test the hypothesis that dimethyl fumarate (tecfidera, bg-12) affects b - cell subsets in patients with relapsing - remitting multiple sclerosis (rrms).methods : peripheral blood b cells were compared for surface marker expression in patients with rrms prior to initiation of treatment, after 46 months, and at more than 1 year of treatment with bg-12. production of interleukin (il)10 by rrms patient b cells was also analyzed.results:total numbers of peripheral blood b lymphocytes declined after 46 months of bg-12 treatment, due to losses in both the cd27 + memory b cells and cd27neg b - cell subsets. some interpatient variability was observed. in contrast, circulating cd24highcd38high (t2-mzp) b cells increased in percentage in the majority of patients with rrms after 46 months and were present in higher numbers in all of the patients after 12 months of treatment. the cd43+cd27 + b-1 b cells also increased at the later time point in most patients but were unchanged at 46 months compared to pretreatment levels. purified b cells from 7 of the 9 patients with rrms tested after 46 months of treatment were able to produce il-10 following cd40 ligand stimulation, and the amount corresponded with the combined levels of t2-mzp and b-1 b cells in the sample. none of the patients with rrms in this study have had a relapse while taking bg-12.conclusions:these data suggest that bg-12 differentially affects b - cell subsets in patients with rrms, resulting in increased numbers of circulating b lymphocytes with regulatory capacity. |
lynch syndrome (ls), also known as hereditary non - polyposis colorectal cancer (hnpcc), is an uncommon, but not rare, autosomal dominant familial cancer syndrome (barrow., 2013). this condition predisposes individuals to colorectal carcinoma (crc) as well as various extra - colonic tumours including cancer of the endometrium, ovaries, small bowel, stomach and urothelium (barrow., 2013). tumours arise as a result of inactivating mutations in genes encoding essential proteins in the dna mismatch repair (mmr) pathway (barrow., 2013, this pathway is principally involved in the repair of replication errors, such as base mismatches and small insertions or deletions, in highly repetitive base sequences known as microsatellites (masuda., accumulation of these mutations, in genes involved in carcinogenesis, predisposes cellular malignant transformation ; hence individuals with ls have an increased incidence of specific tumours (barrow., 2013, masuda., 2011). four human mmr genes have been implicated in this condition ; mlh1, msh2, msh6 and psm2 (masuda., mutations icbun mlh1 and msh2 account for approximately 90% of all ls cases (barrow., 2013). in women with ls there is an increased risk of developing both endometrial carcinoma and ovarian carcinoma ; indeed, endometrial carcinoma is seen as commonly as crc in these individuals and is often the sentinel malignancy. in contrast, predisposition to cervical cancer is not a feature of ls (barrow., 2013). there have been only occasional cases of cervical cancer reported in the literature in patients with ls ; one patient with a germline - mutation in msh2, in which the tumour was immunohistochemically deficient for msh2 and msh6 with high levels of msi (mongiat - artus., 2006) and the other with the muir torre variant of ls, where individuals have defects in either msh2 or mlh1 (mongiat - artus., there was no mention of the tumour morphology (mongiat - artus., 2006) while in the second the neoplasm was described as an adenocarcinoma with focal serous papillary features (nair., 2012). in the second case, there was no mention of testing the tumour for msi or undertaking immunohistochemistry for mismatch repair proteins. in this case report, we describe a case of gastric - type cervical adenocarcinoma in a patient with ls secondary to an msh6 mutation. we discuss the possibility that ls may be associated with rare non - hpv related cervical adenocarcinomas. a 50 year - old female underwent a supracervical abdominal hysterectomy and bilateral salpingo - oophorectomy as a prophylactic procedure for previously diagnosed ls. eight years previously, a family history of early onset colonic cancer led to genetic testing, which subsequently revealed a germline mutation in the msh6 gene on chromosome 2, consistent with the diagnosis of ls. the patient had no history of malignancy, with the last colonoscopy for colonic cancer surveillance undertaken 2 years ago and reported as normal. cervical smears were up - to - date and normal with no evidence of a squamous or glandular abnormality. gross pathological examination revealed no abnormality in the uterus, cervix, ovaries or fallopian tubes. the cervix was incompletely excised without representation of the ectocervix or the transformation zone. within the endocervix, these measured 8 mm and 3 mm in their maximum horizontal dimension and both had a depth of invasion of 1.5 mm. both areas comprised moderately differentiated adenocarcinomas composed of tumour cells with atypical nuclei, clear cytoplasm and prominent cell membranes. there was an associated brisk inflammatory infiltrate, mainly consisting of lymphocytes (fig. 1). immunohistochemically, both foci were largely negative for p16 and were negative for oestrogen receptor (er), progesterone receptor (pr) and carcinoembryonic antigen (cea). linear array hpv genotyping (roche molecular diagnostics, pleasanton, california, usa) was performed on paraffin blocks of the areas containing the abnormal cervical glandular proliferation. linear array hpv genotyping involves pcr amplification of target dna followed by hybridization for the detection of 37 hpv types ; 18 high risk types (16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 73, 82) and 19 low risk types (6, 11, 40, 42, 54,55, 61, 62, 64, 67, 69, 70, 71, 72, 81, 83, 84, is39, cp108). hpv testing was negative. given the morphology, immunohistochemistry and the absence of hpv, a diagnosis of primary cervical gastric - type adenocarcinoma was made. immunohistochemistry for mismatch repair proteins was performed and this demonstrated normal nuclear staining with mlh1, pms2 and msh2. msh6 was difficult to interpret due to cytoplasmic immunoreactivity but there was loss of nuclear staining with a positive internal control in the form of nuclear staining of some lymphoid and stromal cells. the ovaries and fallopian tubes showed no histological abnormality. following the histological results, the residual cervix was assessed by examination under anaesthesia (eua), cystoscopy and pelvic mri scan. no cervical abnormality was detected on mri and the 3 cm cervical stump was mobile on eua, with no evidence of parametrial, bladder or rectal involvement. the tumour was provisionally staged as figo 1b1 (based on the histological measurements). both surgery, in the form of a radical hysterectomy with lymphadenectomy, and chemoradiation were considered as equally effective treatment options (landoni., 1997). after discussion with the patient, laparotomy with excision of the cervical stump and vaginal cuff with bilateral pelvic node dissection was undertaken along with omentectomy, given the high rate of intraabdominal dissemination described with cervical gastric - type adenocarcinoma (to be discussed later) (kojima., 2007). there was no evidence of macroscopic disease at laparotomy and histological assessment of all resected specimens, including the cervical stump, parametria, vaginal cuff, omentum, infundibular pelvic ligaments, pelvic nodes and common iliac nodes, was unremarkable with no evidence of residual or metastatic adenocarcinoma. no adjuvant therapy was recommended and routine follow was arranged with the surgical gynaecological team. she has now been in follow up for 18 months with no evidence of disease. a 50 year - old female underwent a supracervical abdominal hysterectomy and bilateral salpingo - oophorectomy as a prophylactic procedure for previously diagnosed ls. eight years previously, a family history of early onset colonic cancer led to genetic testing, which subsequently revealed a germline mutation in the msh6 gene on chromosome 2, consistent with the diagnosis of ls. the patient had no history of malignancy, with the last colonoscopy for colonic cancer surveillance undertaken 2 years ago and reported as normal. cervical smears were up - to - date and normal with no evidence of a squamous or glandular abnormality. gross pathological examination revealed no abnormality in the uterus, cervix, ovaries or fallopian tubes. the cervix was incompletely excised without representation of the ectocervix or the transformation zone. within the endocervix, these measured 8 mm and 3 mm in their maximum horizontal dimension and both had a depth of invasion of 1.5 mm. both areas comprised moderately differentiated adenocarcinomas composed of tumour cells with atypical nuclei, clear cytoplasm and prominent cell membranes. there was an associated brisk inflammatory infiltrate, mainly consisting of lymphocytes (fig. 1). immunohistochemically, both foci were largely negative for p16 and were negative for oestrogen receptor (er), progesterone receptor (pr) and carcinoembryonic antigen (cea). linear array hpv genotyping (roche molecular diagnostics, pleasanton, california, usa) was performed on paraffin blocks of the areas containing the abnormal cervical glandular proliferation. linear array hpv genotyping involves pcr amplification of target dna followed by hybridization for the detection of 37 hpv types ; 18 high risk types (16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 73, 82) and 19 low risk types (6, 11, 40, 42, 54,55, 61, 62, 64, 67, 69, 70, 71, 72, 81, 83, 84, is39, cp108). hpv testing was negative. given the morphology, immunohistochemistry and the absence of hpv, a diagnosis of primary cervical gastric - type adenocarcinoma was made. immunohistochemistry for mismatch repair proteins was performed and this demonstrated normal nuclear staining with mlh1, pms2 and msh2. msh6 was difficult to interpret due to cytoplasmic immunoreactivity but there was loss of nuclear staining with a positive internal control in the form of nuclear staining of some lymphoid and stromal cells. following the histological results, the residual cervix was assessed by examination under anaesthesia (eua), cystoscopy and pelvic mri scan. no cervical abnormality was detected on mri and the 3 cm cervical stump was mobile on eua, with no evidence of parametrial, bladder or rectal involvement. the tumour was provisionally staged as figo 1b1 (based on the histological measurements). both surgery, in the form of a radical hysterectomy with lymphadenectomy, and chemoradiation were considered as equally effective treatment options (landoni., 1997). after discussion with the patient, laparotomy with excision of the cervical stump and vaginal cuff with bilateral pelvic node dissection was undertaken along with omentectomy, given the high rate of intraabdominal dissemination described with cervical gastric - type adenocarcinoma (to be discussed later) (kojima., 2007). there was no evidence of macroscopic disease at laparotomy and histological assessment of all resected specimens, including the cervical stump, parametria, vaginal cuff, omentum, infundibular pelvic ligaments, pelvic nodes and common iliac nodes, was unremarkable with no evidence of residual or metastatic adenocarcinoma. no adjuvant therapy was recommended and routine follow was arranged with the surgical gynaecological team. she has now been in follow up for 18 months with no evidence of disease. we report a rare case of gastric - type adenocarcinoma of the cervix in a patient with ls secondary to a germline mutation in the msh6 mmr gene. as this patient had coexisting endometrial atypical hyperplasia, initially it was considered whether the cervical glandular proliferation could have represented spread from the endometrium. however, a thorough histological examination of the entire endometrium was performed and no evidence of invasive endometrial carcinoma was identified. moreover, the morphology and immunophenotype (hormone receptor negative) were not that of an endometrioid adenocarcinoma of the endometrium. this subtype is an uncommon variant of primary cervical adenocarcinoma which exhibits gastric differentiation (on the basis of mucin histochemistry and immunohistochemistry) and, in contrast to the majority of cervical cancers, is not associated with hpv infection. histologically, gastric type adenocarcinoma is characterised by tumour cells with atypical nuclei and abundant clear or eosinophilic cytoplasm, typically with distinct cell borders. there is sometimes a marked associated inflammatory infiltrate, including lymphocytes, neutrophils and eosinophils. p16 is usually negative or only focally positive, in contrast to hpv associated adenocarcinomas where diffuse positive staining is seen. although the clinical features have not been extensively studied, it is thought that cervical gastric type adenocarcinoma is associated with aggressive behaviour and a poor prognosis, including a possible propensity for peritoneal, omental and adnexal dissemination (kojima., 2007). kojima. found that gastric type adenocarcinomas had a 5 year disease free survival of 30% compared to 74% for usual endocervical - type adenocarcinomas (kojima., 2007). in this case, the tumour exhibited loss of nuclear expression of msh6 thus supporting the association of this adenocarcinoma to the patient 's known msh6 germline mutation, rather than representing a sporadic tumour. this is somewhat unusual as cervical adenocarcinoma is not one of the tumours typically considered to be associated with ls. indeed, a recent study undertaken by mills. demonstrated intact mmr protein in 60 cervical adenocarcinomas (mills., 2012). the mutations in the mmr genes vary between ls patients and are often family - specific. it is plausible that certain mutations confer a susceptibility to the development of unusual tumours. indeed, this theory has been suggested in a separate case report describing an unusual spectrum of tumours in a family of patients with ls (yu., 2009). another recent study described the occurrence of four unusual tumours in patients with ls, suggesting that the spectrum of tumours associated with this syndrome may be wider than is currently appreciated (karamurzin., 2012). germane to the current case, it is interesting that ls associated endometrial carcinomas have been reported to more frequently having a lower uterine segment (lus) location (westin, 2008). given that non - hpv related cervical adenocarcinomas, including gastric - type, may arise proximal to the transformation zone and extend to involve the lus, it is possible that some of the lus carcinomas reported in patients with ls represent non - hpv related cervical adenocarcinomas. our usual practice would be to always carry out a total hysterectomy for patients with ls but this patient was initially treated at a referring hospital by a non gynaecological oncology surgeon and thus underwent a supracervical hysterectomy. this case highlights the fact that unusual tumour types may occur in patients with ls. mmr immunohistochemistry is a useful screening tool in unusual tumours when ls is suspected and loss of immunoreactivity with 1 or more of the mmr proteins may direct further investigations to confirm or exclude ls. mmr immunohistochemistry also has the advantage of suggesting which mmr gene is likely to be mutated and thus focusing further molecular tests.. further study of unusual non - hpv related variants of cervical adenocarcinoma are warranted to ascertain if there is an association with ls. | highlightslynch syndrome (ls) is an uncommon, genetic disorder which predisposes affected individuals to colorectal, endometrial and ovarian malignancies.we report a case of cervical gastric - type adenocarcinoma in a patient with ls.immunohistochemistry for mismatch repair proteins is a useful screening tool in tumours suspected to be associated with ls. |
staphylococcus aureus strain sa957 was obtained from chang gung children s hospital in taiwan. for genome sequencing, a mono - clone of sa957 was picked from lb agar and grown in liquid lb broth at 37 c overnight. the overnight culture was diluted 40-fold with fresh lb broth and incubated at 37 c to reach log phase. the genomic dna was then extracted by qiaamp dna mini kit (qiagen, valencia, ca, usa) and subjected to solid mate - pair library construction. the library was introduced to a solid 3 plus sequencer for 2 50 bp sequencing. cp003603.1) was used as the reference genome and the socs package (ondov. 2008) was used to map the solid reads and to detect single - base substitutions. in detail, the solid reads were firstly filtered by the script filterreads.pl (within socs package) with the quality threshold set as q15. according to the average error rate obtained from a pilot mapping, we decided to keep the first 42 bp of each read and ran the mapping again. the variant mode short variants was set for detecting valid sequence - space mismatches indicated by color - space mismatches. the results were then outputted as the coverage at each position and the valid sequence - space mismatches detected from each strand of the chromosome. only reads with unique hits against the genome were included in the downstream analysis so that spurious alignments were avoided. in addition, the positions with coverage smaller than 500 or larger than 15,000 were discarded because with such low or high coverage there was a higher likelihood of misalignment. if a given position had more than one type of substitution meeting the above criteria, only the major substitution was counted. to differentiate mutations from the sequencing errors, we defined firstly that a mutant allele must have at least five supporting reads on both the forward and reverse strands with the aim of reducing the likelihood that a mutant allele came exclusively from duplicate molecules amplified during library construction. then, the bernoulli test was performed for each variant site. in detail, the function binomdist in microsoft excel was used, where the number_trail was the total coverage of the site, the number_success was the number of reads supporting the mutant allele, and the prob_success was the presumed error rate. the chromosome of sa957 was 2,789,538 bp long. according to the cumulative gc skew and at skew, which were calculated using genskewapp.jar (downloaded from http://genskew.csb.univie.ac.at, last accessed march 13, 2013), the oric and ter site were presumed to be at 0 and 1,414 kb, respectively. the substitutions in the second half of the chromosome were converted into their reverse complement so that the substitution pattern could be entirely described for the leading strand. the frequency of a certain substitution was defined to be the number of this type of substitutions divided by the total number substitutions. for example, f(c a) = number(c a)/number(all). the trend for how each base changed as a percentage during short- and long - term evolution were then predicted based on the frequency of the 12 possible substitution types. in detail, net frequency (a) = f(c a) + f(g a) + f(t a) f(a c) f(a t) f(a g)net frequency (t) = f(a t) + f(c t) + f(g t) f(t a) f(t c) f(t g)net frequency (c) = f(a c) + f(t c) + f(g c) f(c a) f(c t) f(c g)net frequency (g) = f(a g) + f(t g) + f(c g) f(g c) net frequency (a) = f(c a) + f(g a) + f(t a) f(a c) f(a t) g) net frequency (t) = f(a t) + f(c t) + f(g t) f(t a) f(t c) f(t g) net frequency (c) = f(a c) + f(t c) + f(g c) f(c f(c g) net frequency (g) = f(a g) + f(t g) + f(c g) f(g c) the socs package does not support gapped alignment and therefore we used shrimp2 (david. 2011) to create a gapped alignment that would allow the detection of short indel events. strata was adopted to make sure that only the highest scoring mapping for a given read was outputted. the score to extend a gap along the genome sequence was set at 2 and the score to extend a gap along the read sequence was set at 1. indels that were located in the first / last 5 bp of the read were not considered to be valid ones and such hits were discarded from the alignment file using a home - made perl script. 2010) was used to left - align indels so that the same indel would not be represented as a different variant. the bambino program (edmonson. 2011) was used to process the realigned file and detect the indels within it. the following options were set : the minimum number of reads passing all quality filters required at a variant site was set at two ; the required minimum number of unique read names supporting the mutant allele was set at two ; and other options were set at default. only indels that were supported by reads in both the forward and reverse direction were counted. then bernoulli test was performed on each indel site (p < 0.001). only the sites with significantly more reads supporting the indel mutant proceeded to the subsequent analysis. cp003603.1, multi - locus - sequence - type st59) together with s. aureus strains fpr3757 (nc_007793.1, st8), jkd6159 (nc_017338.1, st93), lga251 (nc_017349.1, st425), mrsa252 (nc_002952.2, st36), mw2 (nc_003923.1, st1), n315 (nc_002745.2, st5), and rf122 (nc_007622.1, st151) were used to infer the genomic sequence of an ancestral s. aureus. the derived backbone regions, namely regions that are conserved in all these strains, were extracted from the output backbone file and were further aligned by mafft program (katoh. the length of the concatenated conserved regions totaled 2,393 kb, which is approximately 85% of the whole genome of each strain. the concatenated alignment of the conserved regions was inputted into the baseml program from the paml package (yang 2007) and the marginal reconstruction algorithm was used to infer the genome sequences of the ancestral s. aureus. a neighbor - joining tree was produced by mega5 (tamura. 2011) to provide baseml with a tree structure file. the run mode was set at 0, and the gtr nucleotide substitution model was adopted. clock was set to be 0, indicating no clock and the rates were thus entirely free to vary from branch to branch. four categories for the discrete - gamma model were specified (ncatg = 4). the rateancestor was set to be 1 to force the program to infer the ancestral sequence. single - base substitutions were identified by comparing the ancestral sequences with that of sa957 using the mummer package (kurtz. 2004). in detail, the nucmer program of the package was used to generate a chromosomal alignment ; then the delta - filter program was used to filter the redundant alignment and the show - snps program was finally used to report the substitutions. a home - made perl script was written to make sure that only substitutions that were 5 bp apart were considered to be valid single - base substitutions. home - made perl scripts were written to extract the short indels from the alignments of the conserved regions. to determine the direction of the indel, namely whether it is an insertion or deletion, we firstly need to know the ancestral state of the indel. to do this, we defined that if a certain state was the same in more than five out of the eight clonal complexes, then that state was deemed the ancestral state. staphylococcus aureus strain sa957 was obtained from chang gung children s hospital in taiwan. for genome sequencing, a mono - clone of sa957 was picked from lb agar and grown in liquid lb broth at 37 c overnight. the overnight culture was diluted 40-fold with fresh lb broth and incubated at 37 c to reach log phase. the genomic dna was then extracted by qiaamp dna mini kit (qiagen, valencia, ca, usa) and subjected to solid mate - pair library construction. the library was introduced to a solid 3 plus sequencer for 2 50 bp sequencing. cp003603.1) was used as the reference genome and the socs package (ondov. 2008) was used to map the solid reads and to detect single - base substitutions. in detail, the solid reads were firstly filtered by the script filterreads.pl (within socs package) with the quality threshold set as q15. according to the average error rate obtained from a pilot mapping, we decided to keep the first 42 bp of each read and ran the mapping again. the variant mode short variants was set for detecting valid sequence - space mismatches indicated by color - space mismatches. the results were then outputted as the coverage at each position and the valid sequence - space mismatches detected from each strand of the chromosome. only reads with unique hits against the genome were included in the downstream analysis so that spurious alignments were avoided. in addition, the positions with coverage smaller than 500 or larger than 15,000 were discarded because with such low or high coverage there was a higher likelihood of misalignment. if a given position had more than one type of substitution meeting the above criteria, only the major substitution was counted. to differentiate mutations from the sequencing errors, we defined firstly that a mutant allele must have at least five supporting reads on both the forward and reverse strands with the aim of reducing the likelihood that a mutant allele came exclusively from duplicate molecules amplified during library construction. then, the bernoulli test was performed for each variant site. in detail, the function binomdist in microsoft excel was used, where the number_trail was the total coverage of the site, the number_success was the number of reads supporting the mutant allele, and the prob_success was the presumed error rate. the chromosome of sa957 was 2,789,538 bp long. according to the cumulative gc skew and at skew, which were calculated using genskewapp.jar (downloaded from http://genskew.csb.univie.ac.at, last accessed march 13, 2013), the oric and ter site were presumed to be at 0 and 1,414 kb, respectively. the substitutions in the second half of the chromosome were converted into their reverse complement so that the substitution pattern could be entirely described for the leading strand. the frequency of a certain substitution was defined to be the number of this type of substitutions divided by the total number substitutions. for example, f(c a) = number(c a)/number(all). the trend for how each base changed as a percentage during short- and long - term evolution were then predicted based on the frequency of the 12 possible substitution types. in detail, net frequency (a) = f(c a) + f(g a) + f(t a) f(a c) f(a t) f(a g)net frequency (t) = f(a t) + f(c t) + f(g t) f(t a) f(t c) f(t g)net frequency (c) = f(a c) + f(t c) + f(g c) f(c a) f(c t) f(c g)net frequency (g) = f(a g) + f(t g) + f(c g) f(g c) net frequency (a) = f(c a) + f(g a) + f(t a) f(a c) f(a t) f(a g) net frequency (t) = f(a t) + f(c t) + f(g t) f(t a) f(t c) f(t g) net frequency (c) = f(a c) + f(t c) + f(g c) f(c a) f(c t) f(c g) net frequency (g) = f(a g) + f(t g) + f(c g) the socs package does not support gapped alignment and therefore we used shrimp2 (david. 2011) to create a gapped alignment that would allow the detection of short indel events. was adopted to make sure that only the highest scoring mapping for a given read was outputted. the score to extend a gap along the genome sequence was set at 2 and the score to extend a gap along the read sequence was set at 1. indels that were located in the first / last 5 bp of the read were not considered to be valid ones and such hits were discarded from the alignment file using a home - made perl script. 2010) was used to left - align indels so that the same indel would not be represented as a different variant. the bambino program (edmonson. 2011) was used to process the realigned file and detect the indels within it. the following options were set : the minimum number of reads passing all quality filters required at a variant site was set at two ; the required minimum number of unique read names supporting the mutant allele was set at two ; and other options were set at default. only indels that were supported by reads in both the forward and reverse direction were counted. then bernoulli test was performed on each indel site (p < 0.001). only the sites with cp003603.1, multi - locus - sequence - type st59) together with s. aureus strains fpr3757 (nc_007793.1, st8), jkd6159 (nc_017338.1, st93), lga251 (nc_017349.1, st425), mrsa252 (nc_002952.2, st36), mw2 (nc_003923.1, st1), n315 (nc_002745.2, st5), and rf122 (nc_007622.1, st151) were used to infer the genomic sequence of an ancestral s. aureus. the derived backbone regions, namely regions that are conserved in all these strains, were extracted from the output backbone file and were further aligned by mafft program (katoh. the length of the concatenated conserved regions totaled 2,393 kb, which is approximately 85% of the whole genome of each strain. the concatenated alignment of the conserved regions was inputted into the baseml program from the paml package (yang 2007) and the marginal reconstruction algorithm was used to infer the genome sequences of the ancestral s. aureus. a neighbor - joining tree was produced by mega5 (tamura. 2011) to provide baseml with a tree structure file. the run mode was set at 0, and the gtr nucleotide substitution model was adopted. clock was set to be 0, indicating no clock and the rates were thus entirely free to vary from branch to branch. four categories for the discrete - gamma model were specified (ncatg = 4). the rateancestor was set to be 1 to force the program to infer the ancestral sequence. single - base substitutions were identified by comparing the ancestral sequences with that of sa957 using the mummer package (kurtz. in detail, the nucmer program of the package was used to generate a chromosomal alignment ; then the delta - filter program was used to filter the redundant alignment and the show - snps program was finally used to report the substitutions. a home - made perl script was written to make sure that only substitutions that were 5 bp apart were considered to be valid single - base substitutions. home - made perl scripts were written to extract the short indels from the alignments of the conserved regions. to determine the direction of the indel, namely whether it is an insertion or deletion, we firstly need to know the ancestral state of the indel. to do this, we defined that if a certain state was the same in more than five out of the eight clonal complexes, then that state was deemed the ancestral state. | mutation and selection are both thought to impact significantly the nucleotide composition of bacterial genomes. earlier studies have compared closely related strains to obtain mutation patterns based on the hypothesis that these bacterial strains had diverged so recently that selection will not have had enough time to play its role. in this study, we used a solid autosequencer that was based on a dual - base encoding scheme to sequence the genome of staphylococcus aureus with a mapping coverage of over 5,000. by directly counting the variation obtained from these ultradeep sequencing reads, we found that a g was the predominant single - base substitution and 1 bp deletions were the major small indel. these patterns are completely different from those obtained by comparison of closely related s. aureus strains, where c t accounted for a larger proportion of mutations and deletions were shown to occur at an almost equal frequency to insertion. these findings suggest that the genomic differences between closely related bacterial strains have already undergone selection and are therefore not representative of spontaneous mutation. |
late adolescents phase is the most active periods of life because of double demand of activity and growth, as a result nutritional needs are extremely important at this phase of time. although snacking is a well - established eating pattern among adolescents and can be a source of needed nutrients and calories, it is important that they dont become a substitute for regular meal as it may further lead to cause the development of serious syndrome. night eating syndrome (nes) is one such very specific disorder where the affected individuals wake up several times during the night and is unable to fall back asleep unless they eat something. individuals with the disorder consume one third or more of their daily calories after their evening meal, sometimes rising from their beds once or twice a night to snack. when sleeping and eating behaviors are simultaneously affected, often there is spectrum of disease states that may result and often lead to nes. these unhealthy eating behaviors, faulty food habits such as omitting main meal, and frequent snacking prevalent among adolescents, are also the cause of faulty food habits causing nes. keeping the above in mind, the present study was undertaken to analyze the pattern of nes among the late adolescents. a sample of 380 adolescents (188 male and 192 female) with in the age range of 18 - 22 years were randomly selected from the local five co - educational colleges of chandigarh and hostlers of the same college were also included in the study. questions regarding the respondents sleeping habit, reasons and duration of night snacking were asked from the studied respondents. mean, frequency, percentage and chi square test was used further for analysis of the data. looking at the nes perspective of the studied respondents, results indicated that out of total 380 adolescents, inadequate sleep was seen among more than half of the adolescents i.e. 55.8%, complaining with few brief awakenings at night. highly significant results were seen when chi square value was applied between hostlers and day scholars (=79.14 and p value < 0.001). these specific respondents also complained of nigh snacking and almost 52.3% respondents snacked at night, out of which the percentage of hostlers were (76.3%) more than day scholars. further it was also found that 30.7% respondents snacked almost up to 50% their total calories after evening meal while 1% of studied respondents snacked up to 75% of total calories after dinner meeting up the criteria of nes. the results thus depicted that hostlers were highly involved in eating snacks after dinner than day scholars due to the reason that, hostlers have more fluctuating eating pattern as there is no one to take care of them, moreover late night sleeping and getting up late is also the reason behind late night snacking among adolescents. as seen in the present study, hostlers group were more seen to have night eating behaviors. as, the present study reveals, night snacking syndrome are associated with a number of harmful behaviors, physical and psychological consequences, including poor dietary quality and also skipping main meal and nibbling at night have led to significant changes seen in the eating pattern and life style of late adolescents, further under going night time snacking. as shown in the present study, these fluctuating and changed patterns together could force the youngsters at risk of various chronic illnesses further disrupting their health status and eating attitude, causing clinical eating disorders. so awareness regarding healthy eating is what needed to secure the health of youth and further improving the future generation of the country. moreover, snacks and fast food items should be used as food items of leisure and should not take over as items of regular meals. thus by educating youth we can build up strong nation, as youth are the strong foundation of the country and so it is important to identify strategies for the prevention of nes. | with the increase in the trend of social networking, celebrations, over a couple of decades weather in the hostel or at home. snacking has become an important aspect of activity. today teen prefer snacks more than a proper meal. skipping of meal and nibbling in between meal is a common practice. the main meals (breakfast, lunch and dinner) are missed and total proportions of calories are consumed from the snacks eaten. hence, this disordered eating behavior when continued may further lead to development of serious syndrome i.e., night eating syndrome. a purposive random sample comprising 188 males and 192 females (n=380), adolescents (18 - 22 years) were selected including hostlers and day scholars. the subjects were administered with self - organized questionnaire so to analyze the pattern of nes among them. out of total 380 respondents, the numbers of hostlers were 211 and day scholars 169, while boys were 188 and girls were 192 in number. results indicated that nearly half the percentage of adolescents snacked at night, out of which very few respondents met the criteria of nes, in which the number of hostlers were quite more than the day scholars, i.e.,76.3%. |
we report a case of acute adrenal insufficiency (aai) in a patient with antiphospholipid syndrome (aps). a 44-year - old female patient presented to us with acute abdominal pain associated with recurrent vomiting and giddiness. on examination, her blood pressure was 80/50 mm hg. etiological work - up revealed prolonged activated thromboplastin time, which did nt correct with normal plasma, her anti - cardiolipin antibody and lupus anticoagulant were also positive. she was diagnosed to have aps with adrenal insufficiency and she was started on intravenous steroids and heparin infusion. aai due to the aps can present with acute abdominal pain followed by hypotension. a high index of suspicion is needed to make the correct diagnosis and to initiate appropriate treatment. the more common clinical features of aps include recurrent pregnancy loss and unexplained vascular thrombosis. to fulfill the diagnosis of aps, patients must have at least one clinical event (vascular thrombosis / pregnancy complication) and one laboratory criterion (anti - cardiolipin immunoglobulin g (igg) or immunoglobulin m (igm) antibodies / lupus anticoagulant of the igg or igm class detected on two or more occasions). lupus anticoagulant antibodies are more specific and the anti - cardiolipin antibodies are more sensitive for diagnosis of aps. a 44-year - old female patient presented to us with acute abdominal pain associated with giddiness and vomiting. her initial serum cortisol was 20 g / dl (normal 5 - 25 g / dl) [table 1 ]. repeat serum cortisol done 24 h later was 1.3 g / dl and concurrent plasma adrenocorticotropin hormone was 698 pg / ml (normal 45 pg / ml). these feature confirmed the diagnosis of evolving acute adrenal insufficiency (aai). computed tomography (ct) scan of the abdomen revealed, bilateral enlarged adrenal glands, the right adrenal showed good enhancement with contrast, whereas the left adrenal showed no contrast enhancement suggesting acute ischemia [figure 1 ]. ct angiography repeated at 48 h showed that the previously enhancing right adrenal also failed to enhance with intravenous (iv) contrast. contrast computed tomography scan showed enlarged hypodense left adrenal gland with normally enhancing right adrenal gland computed tomography angiogram of the abdomen with contrast showed bilateral hypodense adrenal enlargement suggestive of adrenal infarct in view of the acute onset of adrenal insufficiency in an otherwise healthy female we initially considered the possibility of underlying vasculitis. thrombotic work - up revealed prolonged activated thromboplastin time, which did nt correct with the addition of normal plasma, indicating the presence of a circulating anticoagulant. her prothrombin time was normal, lupus anticoagulant was positive and anti - cardiolipin antibody level was mildly elevated, 30 gpl units (normal < 25 gpl units). based on the above clinical and laboratory findings, this patient was diagnosed to have aps with bilateral infarction of the adrenal glands leading to aai. she was subsequently started on the oral warfarin and the dose was titrated to maintain the international normalized ratio between 2.5 and 3.0. at discharge, the adrenal gland has multiple arterial supplies, but drains through a single vein making it susceptible for venous infarction. primary aps presenting as aai is indeed very rare and one needs to be alert to this possibility in a young lady presenting with abdominal pain and hemodynamic instability. our patient 's ct scan showed evolving venous infarction initially involving the left and later also involving the right adrenal gland. previously, published literature reveal reports of primary aps causing adrenal insufficiency at different stages of the disease. adrenal failure can be life - threatening in about 10 - 26% of these patients and can be the first presentation of underlying aps. the exact pathophysiological mechanism is not completely understood, but the hypercoagulable state in such patients may lead to venous infarction and destruction of the adrenals leading on to addison 's disease. it can be the first presentation of aps or it can happen later in a previously diagnosed case of aps. in all cases, a high index of suspicion is needed to make the correct diagnosis and to initiate appropriate treatment. | introduction : we report a case of acute adrenal insufficiency (aai) in a patient with antiphospholipid syndrome (aps).case report : a 44-year - old female patient presented to us with acute abdominal pain associated with recurrent vomiting and giddiness. on examination, her blood pressure was 80/50 mm hg. systemic examination was normal. further evaluation revealed hypocortisolemia with elevated plasma adrenocorticotropin hormone indicative of primary adrenal insufficiency. her abdominal computed tomography scan showed features of evolving bilateral adrenal infarction. etiological work - up revealed prolonged activated thromboplastin time, which did nt correct with normal plasma, her anti - cardiolipin antibody and lupus anticoagulant were also positive. she was diagnosed to have aps with adrenal insufficiency and she was started on intravenous steroids and heparin infusion.conclusion:aai due to the aps can present with acute abdominal pain followed by hypotension. a high index of suspicion is needed to make the correct diagnosis and to initiate appropriate treatment. |
transporters belonging to the neurotransmitter : sodium symporter (nss) family are expressed in both eukaryotic and prokaryotic organisms. by facilitating the translocation of a wide range of substrates across cellular membranes, the transporters play important roles in physiological processes such as maintenance of cellular osmotic pressure and neurotransmission. the eukaryotic serotonin (5-hydroxytryptamine, 5-ht) transporter (sert), together with its close relatives the noradrenaline and dopamine transporters (net and dat, respectively), is one of the most widely studied nss transporters. in the central nervous system (cns), sert plays a pivotal role in the termination of serotonergic neurotransmission by reducing the amount of the neurotransmitter available for activation of post - synaptic 5-ht receptors. multiple therapeutic (e.g., antidepressants) and illicit (e.g., cocaine) drugs inhibit this reuptake, hence enhancing the serotonergic neurotransmission. the nss transporters are secondary transporters that use pre - existing ion gradients as an energy source for the translocation of their substrates. in the presence of sodium, the substrate binding site (termed the s1 site), located approximately midway through the membrane, is accessible from the extracellular environment but not from the cytoplasm. upon substrate binding, large conformational changes occur, leading to closure of the extracellular regions and opening of the cytoplasmic parts of the transporters, resulting in the release of substrate and sodium to the cell. however, the fine details of this alternate - access transport mechanism are not fully known. in fact, studies have suggested both 1:1 and 2:1 substrate : transporter stoichiometry. in the latter scenario, it has been suggested that substrate binding to an additional site (termed s2) located in the extracellular vestibule is a prerequisite for initiation of substrate translocation from the centrally located s1 site. homology modeling is an important technique in the study of nss transporters, because, until 2013, only one member of this large family has been solved by x - ray crystallography, namely, the prokaryotic aquifex aeolicus leucine transporter (leut). in accordance with the alternate - access transport mechanism, leut has been crystallized in three major conformations, namely, in the outward - open (s1 site accessible from the extracellular region), outward - occluded (s1 site inaccessible from either side of the membrane), and inward - open (s1 site accessible from the cytoplasm) conformations. co - crystallization with substrates and noncompetitive inhibitors (inhibitors occupying the s2 site) stabilizes the transporter in the outward - occluded conformation. in contrast, leut adopts an outward - open conformation when co - crystallized with the competitive inhibitor trp. a major breakthrough in the field of nss transporters occurred in 2013, when a report on the first eukaryotic nss transporter, the drosophila melanogaster dat in complex with the antidepressant nortriptyline, was published. in addition, 12 crystal structures of leut with key binding pocket residues mutated to hsert (named leutbat) and co - crystallized with four classes of antidepressants were also released. similar to leut co - crystallized with trp, the crystal structures of dat and leutbat show that the antidepressants are competitive inhibitors and stabilize the transporters in an outward - open conformation. new sert compounds may increase our knowledge of both transport and inhibition mechanisms and could potentially lead to the development of new therapeutic drugs. one approach for identification of novel compounds is virtual screening (vs), i.e., the rapid, in silico assessment of large compound libraries, which may be performed using ligand- and/or structure - based approaches. ligand - based vs can be employed using two - dimensional (2d) methods such as fingerprint similarity searching algorithms and three - dimensional (3d) pharmacophore models. ligand - based 3d pharmacophore models are generated by superimposing a set of active molecules (termed reference ligands), determining ligand conformations that can be overlaid in such a way that a maximum number of important chemical features geometrically overlap. in comparison with ligand - based vs, which does not rely on protein 3d information, structure - based vs is performed by compound docking into either x - ray structures or homology models or by using implicit methods such as structure- or structure - docking - based pharmacophore models. only a limited number of sert, net, and dat vs studies have been published. in the majority of studies, ligand - based approaches have been used, although five structure - based vs studies were recently published. in these studies, docking into the central s1 site, the s2 site, or a putative allosteric site outside the proposed substrate translocation pathway in outward - occluded homology models was performed. in the present study, a protocol combining ligand- and structure - based vs approaches has been used to screen five commercial databases containing 3.24 million druglike compounds. the vs protocol comprised 2d and 3d ligand - based screening of the databases and docking of compounds into multiple conformations of the ligand binding pocket detected in an outward - open sert homology model. following vs, compounds were evaluated using in vitro screening and full binding assays and the structures of active compounds were used as queries in a subsequent hit - to - lead (h2l) screening of the databases. in total, 97 compounds belonging to 22 structural classes (chemotypes) were evaluated using in vitro full binding assays. more than three of four compounds tested (74 of 97) were found to be active (ki 5000 nm). the screening and building block collections of five commercial databases were screened : asinex, chembridge, chemdiv, enamine, and life chemicals. prior to screening, the databases were filtered using the lipinski s rule of 5 and veber filters to obtain druglike compounds. the following compounds, belonging to five classes of sert inhibitors, were used as reference ligands during the 2d and 3d ligand - based steps of the vs protocol : (s)-citalopram, desmethyl-(s)-citalopram, didesmethyl-(s)-citalopram, (s)-lu-08 - 052-o, (s)-lu-33 - 086-o, (rs)-fluoxetine, desmethyl-(rs)-fluoxetine, fluvoxamine, sertraline, desmethyl - sertraline, (rs)-venlafaxine, and o - desmethyl-(rs)-venlafaxine [ssri / snri (5-ht - ne reuptake inhibitor) class ], amitriptyline, clomipramine, desipramine, imipramine, protriptyline and (rs)-trimipramine [tca class ], cocaine, ab-248, ab-338, -cft, cpt - d - tartrate, rti-31, rti-32, rti-55 (-cit), rti-83, rti-112, rti-121, rti-142, rti-311 and sn-1 [3-phenyltropane class ], (rs)-mazindol, (rs)-mazindane, (rs)-maz-10, (rs)-maz-85, and (rs)-maz-89 [mazindol class ], and adam, 4fadam, afm, dapa, dasb, idam, madam, odam, and 403u76 [radioligand class ]. the structures and affinities of the reference ligands are shown in the table s1 in the supporting information. individual queries were constructed for the reference ligand classes ; however, because of the structural heterogeneity of the compounds in the ssri / snri group, additional (s)-citalopram, sertraline, fluvoxamine, and fluoxetine / venlafaxine queries were also built. finally, a general query was prepared from the structures of all 56 reference ligands. hence, in the 2d and 3d steps of the vs protocol, 10 reference ligand queries were used for screening. to maximize the screening performance and to obtain structurally diverse compounds, 2d pharmacophore - based fingerprints and structural (hashed chemical) fingerprints were generated based on the 56 reference ligands in the 10 queries. two - dimensional (2d) pharmacophore - based and structural (hashed chemical) fingerprints were generated using the generatemd command line tool of jchem, using default settings. the pharmacophore - based fingerprints were constructed from the 2d molecular structures of the reference ligands by defining the collection of all - atom pharmacophore feature pairs along with their topological distances. the chemical fingerprints encoded the topological structure of the ligands into bit strings using atom type and bond type information (linear and cyclic patterns were detected). the metrics - threshold pair was determined by three optimization iterations for each query which were performed using test sets containing compounds from a given group and randomly selected assumed inactive compounds from the zinc database. the optimized metrics and threshold values used during the screening can be found in table s2 in the supporting information. the optimization of parametrized tanimoto or euclidean metrics and subsequent 2d fingerprint - based screening were performed using the screen command line tool of jchem. first, for all 56 reference ligands, the strongest basic pka descriptor was calculated using the instant jchem calculator plugin. next, the obtained range of this parameter (pka = 311.5) was used in the filtering of compounds that passed the 2d fingerprint - based screening step. compounds with unfavorable admet profiles were then removed from the dataset using the schrdinger software module qikprop. the following admet descriptor values were accepted : number of functional groups (rtvfg = 02), predicted aqueous solubility (qplogs = 6.5 to 0.5), model for gut - blood barrier (qppcaco > 500), and predicted blood - brain coefficient (qplogbb = 3.0 to 1.2). ten ligand - based pharmacophore models were obtained using the catalyst module of discovery studio (accelrys), employing the fast algorithm for generation of ligand stereoisomers and conformational sampling. the hiphop algorithm implemented in catalyst was used for pharmacophore mapping of the compounds that passed the filtering steps of the vs protocol (see above). the compounds were allowed to deviate from the pharmacophore models with maximum one feature except the positively ionizable (pi) group. following the 3d pharmacophore - based screening, overlap analysis was performed using the instant jchem tool from chemaxon in order to remove repeated structures. the construction of the homology model and the 47 binding pocket conformations has been described in detail elsewhere. the model was constructed based on the leut crystal structure co - crystallized with the competitive inhibitor l - tryptophan (pdb i d 3f3a) and a comprehensive alignment of nss transporters, using internal coordinate mechanics (icm) software. the compounds were docked using a flexible docking protocol that previously has been used for reference ligands. the protocol consisted of (1) detection of the ligand binding pocket using the icm pocketfinder, (2) biased - probability monte carlo (bpmc) sampling and minimization of the pocket side chains in the presence of a repulsive density representing a generic ligand to prevent collapse of the binding pocket, and (3) four - dimensional (4d) docking of fully flexible ligands into multiple pocket conformations generated during step (2). in the present study, the compounds were docked into 47 low - energy conformations of the ligand binding pocket. the protein ligand complexes were scored using the virtual ligand screening (vls) scoring function of icm. compounds passed the structure - based screening step when their scores were less than 10 and their protonated amine moieties were located in the vicinity of d98 (tm1). the selected compounds were clustered using molprint2d fingerprints and tanimoto metrics using the schrdinger software module canvas. in addition to the flexible docking results and the clustering of the compounds, the final selection of compounds for in vitro evaluation was based on financial and laboratory limitations and stock availability. rat neocortical tissue was homogenized in 20 volumes of ice - cold 50 mm tris - hcl buffer, ph 7.7 containing 150 mm nacl and 5 mm kcl using an ultra turrax t25b (ika labortechnik, usa) homogenizer (3 pulses, each of 10 s, 19 000 rpm). the resulting supernatant was decanted and pellet was resuspended in the same buffer and centrifuged two more times in the same conditions. two hundred forty microliters (240 l) of the tissue suspension (5 mg / ml), 30 l of 1 nm [h]-citalopram, and 30 l of the analyzed compound or 1 m imipramine (displacer) were incubated at 24 c for 1 h. during the screening experiments the compounds were analyzed at a single concentration of 1.66 10 m. for compounds that exhibited at least 30% [h]-citalopram binding full competition experiments were performed in concentration range from 10 to 10 m. after incubation, the reaction mix was filtered immediately onto a gf / b glass fiber filter, using a 96-well filtermate harvester system (perkinelmer, usa). the filter mate was dried in a microwave oven for 10 min at a power setting of 40% (700 w total power), and then it was placed in a sample bag and 10 ml of liquid scintillation cocktail was melted onto the filter. the radioactivity on the filter was measured using a microbeta trilux 1450 scintillation counter (perkinelmer, usa). the radioligand binding data were analyzed using iterative curve fitting routines graphpad prism 3.0 (graphpad software), which used the built - in three parameter logistic model to describe the ligand competition binding to radioligand - labeled sites. the log ic50 value was estimated from the data used to obtain the ki by applying the cheng prusoff approximation. results are expressed as the means of at least two separate experiments. a second in silico screening of the druglike subset of the five databases was performed using core structures of the compounds in chemotypes c01c13 (see table 1) as queries. the instant jchem substructure searching algorithm and the symbolic query definition language module were employed. following the substructure screening step, the obtained compounds were screened using the basic property and admet filters, 3d pharmacophore models, and flexible docking procedure, as described above. to determine the novelty of the identified compounds, the similarity between the compounds with ki 5000 nm and known sert compounds found in the mdl drug data report (mddr, version 2011) and chembl_13 databases was assessed using chemical hashed fingerprint and tanimoto metric > 0.7 (instant jchem). in the first step of the vs protocol, screening of the druglike subsets of the asinex, chembridge, chemdiv, enamine, and life chemicals databases using 2d pharmacophore - based fingerprints and structural (hashed chemical) fingerprints and 56 reference ligands resulted in a great decrease in the number of compounds : nearly 98.5% of the druglike compounds did not pass this screening step (see table 2). experimental studies have suggested that d98 in transmembrane helix 1 (tm1) may anchor substrates as well as inhibitors in sert. a filter was thus employed to select compounds with basic pka values between 3 and 11.5, i.e., compounds containing at least one protonable nitrogen moiety. an admet filter was also used to remove compounds that had an unfavorable number of functional groups, and/or unfavorable aqueous solubility, blood - brain barrier, and/or gut - blood barrier coefficients. approximately 13 500 compounds passed the filtering steps (see table 2). the compounds were then screened using ten 3d pharmacophore models constructed based on the reference ligands. all 3d pharmacophore models contained one positively ionizable (pi) feature, one hydrophobic (hyd) feature, and one or two aromatic (ar) features (figure 1, figure s1 in the supporting information). the simplest pharmacophore models were the general hypothesis, ssri and tca models, all of which contained one pi, hyd, and ar feature, and the sertraline and mazindol models, which contained one additional ar group (see figure 1, as well as figure s1 in the supporting information). the remaining pharmacophore models were more complex : the 3-phenyltropane, (s)-citalopram, fluoxetine / venlafaxine and fluvoxamine models possessed an additional h - bond acceptor (hba) feature, whereas the radioligand and fluvoxamine models included an additional h - bond donor (hbd) feature and hyd region, respectively (figure s1 in the supporting information). during mapping to the pharmacophore models, the compounds were allowed to deviate from the pharmacophore models with maximum one feature (except the pi feature) in order to be selected. approximately 2300 unique compounds passed the 3d pharmacophore - based screening step of the vs protocol (see table 2). schematic of the 3d general hypothesis pharmacophore model with desmethyl-(r)-fluoxetine mapped (pi, positive ionizable feature ; ar, aromatic feature ; hyd, hydrophobic feature). in the structure - based step of the vs protocol, a homology model generated based on an outward - open leut x - ray structure was used for docking of the compounds that passed the 3d pharmacophore - based screening. in the outward - open conformation, the central s1 site of sert was accessible from the extracellular environment and the putative inhibitor binding region constituted both the central substrate binding site (including d98 (tm1)) and extracellular vestibular regions (including the s2 site) of the transporter (figure 2). protein flexibility was included by docking the compounds into 47 low - energy conformations of the ligand binding pocket, using the 4d docking approach. a total of 564 unique compounds had scores of less than 10 and a protonable nitrogen moiety in the vicinity of that of d98 (tm1) and, hence, passed the structure - based step (table 2). docking results : (a) outward - open sert homology model (gray and red ribbon representation) with ligand binding region detected by icm pocketfinder (gray wire mesh) and (b) docking orientation of c466 - 0145 (chemotype c09). selected amino acid side chains are shown (xstick representation). the localization of the s1 and s2 binding sites are also indicated in the figure. a total of 202 compounds from 37 chemotypes were purchased and screened in vitro using a [h]-citalopram competition binding assay (see table s3 in the supporting information). twenty - three (23) of the compounds that exhibited at least 30% inhibition of [h]-citalopram binding at a concentration of 1.66 10 m were further evaluated in full binding assays (see table s4 in the supporting information). in addition, less - potent compounds were also selected to obtain structure activity relationship (sar) data and to increase the structural diversity of the evaluated compounds (table s4 in the supporting information). in total, 46 compounds from 22 chemotypes were evaluated using [h]-citalopram competition full binding assays (see table 2). the results of the full binding assays revealed that 24 of the 46 compounds had ki 1000 nm (see table s4 in the supporting information). the affinities of 13 compounds ranged between 1000 nm and 3100 nm, whereas the remaining 9 compounds may be regarded as nonbinders (ki > 10 000 nm) (table s4 in the supporting information). thirteen (13) chemotypes (c01c13) contained compounds with ki 1000 nm, 3 (c14c16) had compounds with ki between 2300 and 2700 nm, while 5 (c17c22) only contained compounds regarded as nonbinders (ki > 20 000 nm) (table s4 in the supporting information). to detect analogues of the compounds identified using the vs protocol, an in silico h2l screening of the druglike subsets of the five databases was performed (recall table 2). the substructure search, using the core structures of the compounds in chemotypes c01c13 (table 1) as queries, resulted in the detection of 8700 analogues (see table 2). application of the basic property and admet filters reduced the number of compounds to 5000, while 3855 unique compounds were selected during the 3d pharmacophore - based screening step and 504 unique compounds passed the flexible docking step (table 2). in total, 198 compounds were selected for in vitro [h]-citalopram screening during h2l (table 2). based on the results of the in vitro screening, 33 compounds that exhibited 30% inhibition of [h]-citalopram binding at a concentration of 1.66 10 m and 18 less - potent analogues were selected for evaluation in full binding studies (see table s4 in the supporting information). using the h2l approach, active analogues were identified in 11 of the 13 chemotypes (see table s4 in the supporting information). in total, 22 of the h2l compounds had ki values 1000 nm and compounds with higher affinity than their compounds were identified in five chemotypes (chemotypes c01, c03, c04, c08 and c10 ; see table s4 in the supporting information). the structures of the highest - affinity binder from each chemotype identified using the vs and h2l approaches are shown in figure 3. structures of selected reference ligands and highest affinity ligand in chemotypes c01c16, identified using the vs / h2l protocol. in addition to the number and affinity of compounds identified using vs, the compound novelty is an important vs performance indicator. the structural similarity between the compounds identified in the present study and known sert binders found in the chembl and mddr databases was hence determined. the results of the analysis indicated that compounds in 9 of the 16 chemotypes were structurally nonrelated to known sert ligands while the compounds in the remaining seven chemotypes showed varying degrees of similarities (tanimoto coefficients values ranging from tc = 0.50 to tc = 0.96 ; see table 1). in the present study, a multistep vs protocol (see table 2) has been used to screen for novel, structurally diverse sert compounds in commercially available databases. to accomplish this objective, (i) five databases containing 3.24 million druglike compounds were screened, (ii) multiple compounds from several structural classes of sert inhibitors were used as reference compounds in the ligand - based steps, (iii) docking into 47 low - energy conformations of the binding pocket detected in the outward - open sert homology model was performed in the structure - based step, and (iv) a h2l screening of the databases using the structures of the compounds identified using vs as queries was performed. in vitro evaluation of the compounds was followed by novelty analysis of the identified hits. a combination of ligand- and structure - based vs approaches was used to screen five commercial databases, which were chosen for screening because they contain numerous, as well as a high percentage of, exclusive compounds. the ligand - based approaches have the advantages of not heavily relying on macromolecular target information. in ligand - based vs, 3d pharmacophore models are commonly used ; however, screening of large compound databases using pharmacophore models can be time - consuming. by reducing the number of compounds in the databases prior to pharmacophore - based screening by applying a series of filters, as in the present study another challenge in using ligand - based pharmacophore models is that these implicit models normally only cover a limited chemical space. in the present study, this shortcoming was addressed by constructing ten pharmacophore models based on structurally diverse groups of reference ligands and allowing partial mapping of compounds to the pharmacophore models. by docking compounds into their 3d protein targets, steric and distance - sensitive interactions between the compounds and the protein that are not so easily explained using pharmacophore models, because of the lack of a sert x - ray structure, a homology model constructed using the prokaryotic leut as a template was used for docking in the present study. despite the low overall sequence identity between leut and the eukaryotic nss transporters, leut is considered to be a good homology modeling template. an important consideration during homology modeling of nss transporters, however, is which leut conformation to use as template, i.e., whether to use an outward - open, outward - occluded, or inward - open conformation. because studies have indicated that most sert ligands stabilize outward - facing conformations of the transporter, the two former conformations may be good choices of templates for models used for docking. leut has been co - crystallized in the outward - occluded conformation with tca and ssri antidepressants, which, in leut, are noncompetitive low - affinity inhibitors. in the present study, however, leut co - crystallized with the competitive inhibitor l - tryptophan (trp), which stabilizes leut in an outward - open conformation, was used as a template. our previous results from docking of the reference ligands into outward - open and outward - occluded sert models suggested that the former conformation best accommodated these compounds. in the outward - open conformation, the central substrate binding site of sert, containing d98 (tm1), which was indicated to be important for the binding of 5-ht and inhibitors in sert, was accessible from the extracellular environment and, hence, the putative inhibitor binding region constituted both the central substrate binding site and extracellular vestibular regions of the transporter (figure 2). furthermore, during preparation of the current manuscript, crystal structures of d. melanogaster dat and leutbat were published. in support of our findings, these crystal structures show that the antidepressants indeed are competitive inhibitors of the human transporters and stabilize the transporters in outward - open conformation. in addition to the lack of protein x - ray structures, other limitations of structure - based vs may be a lack of the inclusion of protein flexibility during docking and the difficulties in scoring the protein the degrees of freedom needed to keep proteins fully flexible during docking makes such simulations computationally unfeasible and most standard docking programs use a semiflexible approach, keeping the ligands fully flexible but the proteins rigid. one method to include a degree of protein flexibility is docking into multiple receptor conformations, which is known to improve the results of vs. in the present study, the compounds were docked into 47 low - energy conformations of the ligand binding pocket that had been generated prior to docking by bpmc side - chain sampling. docking into multiple conformations of the binding pocket was also a way of obtaining structurally diverse compounds, since studies have indicated that sert binders most likely stabilize different outward - facing transporter conformations. furthermore, the bpmc side - chain sampling resulted in an increased distance between the aromatic amino acids of the extracellular gate (y176 (tm3) and f335 (tm6)), hence resulting in a widening of the ligand binding pocket. this was important for the binding of the sert binders which are larger in size than the co - crystallized leut inhibitor trp. in structure - based vs, scoring is used to separate potential binders from nonbinders. empirical scoring functions such as the icm vls function consist of weighted energy terms that describe known ligand binding properties (e.g., hydrogen bonding, ionic, lipophilic and aromatic interactions and the conformational entropy loss of the ligand). the limitations of the current scoring functions may, to some degree, be addressed by evaluating the docking results using additional parameters. in the present study, the ability of the highly scored compounds to form an ionic interaction with d98 (tm1) was used to evaluate the top - scored ligands. analysis of the docking orientations of the compounds identified as sert binders showed that they, when interacting with d98 (tm1), occupied the central substrate binding and lower vestibular regions (figure 2). halogenated moieties of the compounds were furthermore often located in the vestibular region. namely, l99 (tm1), g100 (tm1), w103 (tm1), r104 (tm1), y176 and i179 (tm3), and f335 (tm6)have been suggested to form a halogen binding pocket (hbp) in sert. the results of the in vitro full binding assays showed that more than 80% of the compounds evaluated were active (c01c16 ; ki 5000 nm) (see table s4 in the supporting information). in order to find analogues of the highest - affinity binders, a h2l screening of the five databases was undertaken using the core structures of chemotypes c01c13 as queries (recall table 1). the h2l screening resulted in the identification of compounds that would not have been detected using the vs approach alone : comparison of the unique compounds that passed the structure - based steps of the vs and h2l protocols revealed that only 134 compounds had been selected in both approaches (results not shown). the results of the in vitro full binding evaluation showed that 46 of the 97 compounds selected using the vs and h2l approaches had ki values of 1000 nm (see table s4 in the supporting information). the highest affinity obtained was 1.5 nm (t6125232, chemotype c04) (see table s4 in the supporting information, as well as figure 3), which is in the range of the affinities of marketed antidepressants. the clustering of the identified binders furthermore showed that they were structurally diverse, belonging to 16 different structural classes (figure 3), and the theoretical novelty analysis suggested that compounds in multiple of the chemotypes were structurally unrelated to known sert binders in the mddr and chembl databases. these databases, which contain information on compounds derived primarily from the patent and primary scientific literature, respectively, are, however, not fully comprehensive. the novelty analysis did not reveal that t6275452 in chemotype c04 is a known sert binder, showing that the compound is not annotated as such in the databases. hence, although the results indicate that multiple compounds are novel sert binders, the results of the novelty analysis must be more rigorously evaluated. in the present study, virtual screening (vs) of 3.24 million druglike compounds has resulted in the identification of 74 active sert binders belonging to 16 structural classes, of which 46 compounds in 13 chemotypes had ki values of 1000 nm. by combining vs and hit - to - lead (h2l) approaches and selecting compounds that show varying degrees of [h]-citalopram inhibition in the in vitro screening assays sar data may be useful for elucidating the inhibition mechanism of sert and may also be used for the development of compounds as antidepressants. | the serotonin (5-hydroxytryptamine, 5-ht) transporter (sert) plays an essential role in the termination of serotonergic neurotransmission by removing 5-ht from the synaptic cleft into the presynaptic neuron. it is also of pharmacological importance being targeted by antidepressants and psychostimulant drugs. here, five commercial databases containing approximately 3.24 million drug - like compounds have been screened using a combination of two - dimensional (2d) fingerprint - based and three - dimensional (3d) pharmacophore - based screening and flexible docking into multiple conformations of the binding pocket detected in an outward - open sert homology model. following virtual screening (vs), selected compounds were evaluated using in vitro screening and full binding assays and an in silico hit - to - lead (h2l) screening was performed to obtain analogues of the identified compounds. using this multistep vs / h2l approach, 74 active compounds, 46 of which had ki values of 1000 nm, belonging to 16 structural classes, have been identified, and multiple compounds share no structural resemblance with known sert binders. |
ruptured hepatocellular carcinoma (hcc) requires immediate diagnosis and treatment due to its high mortality. the diagnosis is comparatively easy when made based on clinical course, symptoms, and demonstration of hemorrhagic ascites by abdominal paracentesis, but identification of sites of bleeding is important for immediate treatment. contrast - enhanced computed tomography (cect) is performed for identification of these sites in many cases because a wide area can be observed. however, cect is invasive because of iodine allergy, exposure to radiation, and decreased renal function by administration of the contrast agent. contrast - enhanced ultrasonography (ceus) is a non - invasive alternative approach that may be useful for identification of bleeding sites [2, 3 ]. we experienced a case of ruptured hcc that developed as a complication of alcohol - related cirrhosis. the patient had multiple hccs, but the culprit artery was readily treated with transarterial embolization (tae) after identification of the bleeding site using ceus with sonazoid (daiichi sankyo pharmaceutical, tokyo, japan). here he had no relevant medical or family history, but he was a heavy drinker who consumed > 2 l of beer every day. he visited a nearby hospital for a chief complaint of general malaise and was diagnosed with multiple hccs caused by alcohol - related cirrhosis. approximately 1 month after the first visit, he was admitted to our hospital for rapid development of abdominal fullness. physical findings at admission showed blood pressure 148/98 mmhg, pulse rate 64 bpm, ascites retention, and a palpable fist - sized tumor in the epigastric region. blood tests upon admission showed hb 10.4 g / dl (normal 14.017.0 g / dl), ast 55 u / l (normal 1235 u / l), alt 35 u / l (normal 631 u / l),-gtp 283 u / l (normal 958 u / l), t - bil 4.9 mg / dl (normal 0.11.0 mg / dl) and pt % 68 % (normal 70 %), suggesting mild anemia and increased hepatobiliary enzymes. tumor markers were high, as shown by the levels of afp and pivka ii of 27.4 ng / ml (normal 0.015.0 ng / ml) and 567 mau / ml (normal < 40 mau / ml), respectively. hemorrhagic ascites was found in abdominal paracentesis and the case was diagnosed as ruptured hcc. abdominal cect showed a large hcc with a maximum diameter of 15 cm in s7/8 of the liver and multiple hccs in both lobes (fig. 1). the attenuation value of the ascites was as high as 30 hounsfield units, but no clear extravasation was found in the arterial and equilibrium phase, and thus the bleeding site could not be identified. abdominal ultrasonography also showed multiple tumors in both lobes and ascites with high echo density (fig. however, even with these data the bleeding site was unclear, and ceus was performed for the large hcc in s7/8 as the region of interest. the ultrasound equipment used in this examination was ssa-790a (toshiba medical systems, tokyo, japan) with a convex probe (pvt-375bt, 3.75-mhz center frequency). the imaging mode used was wideband harmonic imaging (pulse subtraction) with transmission / reception frequencies of 1.8 and 3.5 mhz, respectively. the mechanical index for acoustic output was set to 0.2 ; the dynamic range was set to 6065 db. a intravenous bolus injection of sonazoid (0.5 ml) was administered via a left cubital venous line followed by 10 ml normal saline flush. observation in the arterial phase showed no clear leakage of contrast agent from this tumor, but punctate high - intensity echoes of sonazoid microbubbles were observed in ascites. in particular, extremely high - intensity echoes of sonazoid microbubbles were present in ascites surrounding the tumor, close to the s5 gallbladder bed. the tumor was imaged again using the re - injection method with sonazoid in the post - vascular phase and leakage of the contrast agent from the tumor into the abdominal cavity was observed, indicating that this was the site of bleeding (fig.. 1dynamic computed tomography scan in the arterial phase showed multiple hypervascular lesions in both hepatic lobes with highly attenuated peritoneal fluidfig. 2 a gray - scale ultrasonography demonstrated a lesion closed to the s5 gallbladder bed (arrow heads) with fluid. b contrast - enhanced ultrasonography (ceus) using the re - injection method with sonazoid in the post - vascular phase showed pulsating active bleeding as extravasation of microbubbles (arrow) from this lesion (arrow heads) into the abdominal cavity dynamic computed tomography scan in the arterial phase showed multiple hypervascular lesions in both hepatic lobes with highly attenuated peritoneal fluid a gray - scale ultrasonography demonstrated a lesion closed to the s5 gallbladder bed (arrow heads) with fluid. b contrast - enhanced ultrasonography (ceus) using the re - injection method with sonazoid in the post - vascular phase showed pulsating active bleeding as extravasation of microbubbles (arrow) from this lesion (arrow heads) into the abdominal cavity abdominal angiography was urgently performed. however, since the tumor on the gallbladder bed was suspected as the bleeding site based on ceus, selective cannulation of the cystic artery was performed (fig. the artery was imaged using carbon dioxide (co2), which is a highly sensitive method for evaluation of blood flow. leakage of co2 out of the vessel was apparent, confirming that the bleeding site was the tumor in s5, which was fed by the cystic artery (fig. tae was conducted using a gelatin sponge (gelpart ; astellas pharma, tokyo, japan) with a particle size of 1 mm, and the clinical course after tae was favorable with arrest of bleeding.fig. 3 a cystic angiography findings showed multiple tumor stains without extravasation of contrast agent. b cystic angiography findings with carbon dioxide showed extravasation (arrow). these findings agreed with the ceus findings a cystic angiography findings showed multiple tumor stains without extravasation of contrast agent. b cystic angiography findings with carbon dioxide showed extravasation (arrow). these findings agreed with the ceus findings ruptured hcc is a common cause of acute non - traumatic intra - abdominal hemorrhage and has an incidence of about 10 % in patients with terminal hcc. ruptured hcc causes severe intraperitoneal bleeding and acute hepatic failure with a poor prognosis, and therefore immediate diagnosis and treatment are required. symptoms include sudden epigastric pain or right hypochondrial pain caused by rapid expansion of glisson s capsule. hemorrhagic shock is observed in 5990 % of patients with ruptured hcc, peritoneal irritation and abdominal prominence occur in 60100 %, and hemorrhagic ascites is present in almost all patients [7, 8 ]. ruptured hcc should be the first suspected condition when such symptoms occur in patients with cirrhosis or hcc. ruptured hcc may be a rupture of a parasitic artery or vein, such as the inferior phrenic vessel, feeding or draining the tumor, with accompanying hemorrhage. this rupture may be caused by secondary trauma to a tumor on the surface of the liver or increased pressure within a tumor due to rapid tumor growth causing invasion and obstruction of a hepatic vein. the risk of rupture is particularly high in patients with large hcc on the hepatic surface, and the clinical course of such cases should be observed carefully, taking this risk into account. in our case with multiple hccs, ruptured hcc was suspected and abdominal paracentesis was performed because of rapid onset of abdominal fullness, which suggested hemorrhagic ascites, despite no abdominal pain or decreased blood pressure. identification of the bleeding site is important to facilitate immediate treatment in a case of suspected ruptured hcc. this is commonly achieved with cect, but there is a possibility that a bleeding site may not be apparent in an image due to the imaging timing, even if active hemorrhage is present. this is because cect has superior spatial resolution, but requires a certain period of time for imaging. several recent reports have suggested that ceus with levovist (schering, berlin, germany) or sonazoid may also be useful for this purpose [2, 3 ]. in 10 patients with ruptured hcc who underwent ceus with levovist and abdominal angiography, matsumoto. found that ceus could be used to differentiate active hemorrhage from inactive hemorrhage by examining the contrast agent in ascites.. found that ceus with sonazoid was effective for identification of the bleeding site in a hepatic surface after radiofrequency ablation (rfa) based on a jet - like high - intensity echo in pleural effusion, although the findings could not be confirmed with color doppler imaging. other reports have suggested the usefulness of ceus with levovist for large ruptured hcc in cases of single tumors, large tumors, or tumors in which bleeding sites were identified for bleeding caused by rfa. the high temporal resolution of ceus is useful for evaluation of hemodynamics, but identification of bleeding sites is difficult in patients with multiple hccs because ceus evaluates only a single cross - sectional image. however, the bleeding site in our case could not be identified with cect because of the presence of multiple hccs, in contrast to previous cases, whereas ceus enabled identification of the bleeding site. in our case, active hemorrhage was suspected because of leakage of sonazoid bubbles in ascites observed in the arterial phase. this led to a detailed examination of potential hcc under the hepatic surface, which has a risk of rupture in a case with multiple hccs. many sonazoid bubbles were found in ascites around hcc on the s5 gallbladder bed, and thus bleeding from this site was suspected. sonazoid was again intravenously injected using the re - injection method with this site as an area of interest and leakage of contrast agent from the tumor surface was confirmed. in subsequent abdominal angiography, selective cannulation was performed for the cystic artery based on ceus findings and imaging with co2 showed extravasation from the hcc. extravasation may not be observed on cect in patients with multiple hccs, as seen in our case, but bleeding sites may be indicated by sonazoid microbubbles in the ascites. the re - injection method with sonazoid to examine the potential bleeding site in the post - vascular phase in ceus permits the site to be identified rapidly, even in patients with multiple hccs. in conclusion, we experienced a case of ruptured hcc. the patient had multiple hccs, but the culprit artery was readily treated with tae after identification of the bleeding site using ceus with sonazoid. | the identification of bleeding sites of ruptured hepatocellular carcinoma (hcc) is important for immediate treatment. we experienced a case of ruptured hcc readily treated with transarterial embolization (tae) after identification of the bleeding site using contrast - enhanced ultrasonography (ceus) with sonazoid. we report the case of a 61-year - old male with multiple hccs caused by alcohol - related cirrhosis, who was admitted for rapid development of abdominal fullness. the diagnosis was established by hemorrhagic ascites by abdominal paracentesis. no clear extravasation was found on contrast - enhanced computed tomography. ceus using the re - injection method in the post - vascular phase showed active bleeding from a lesion close to the s5 gallbladder bed. abdominal angiography was urgently performed. based on ceus findings, selective cannulation of the cystic artery was performed. cystic angiography findings with carbon dioxide showed extravasation. he was treated by tae. our case had multiple hccs, but ceus was useful for the identification of bleeding sites. |
aflatoxins (afs) are carcinogenic, mutagenic, and teratogenic metabolites mainly produced by aspergillus flavus and the very closely related species a. parasiticus (1). these mycotoxins can grow on a wide range of food commodities, including cereals, peanuts, and crops in the eld, but also during postharvest operations and storage (2). the group of afs includes b1, b2, g1, and g2, while afbs include afb1 and afb2, and afgs include afg1 and afg2 (3). afs are potent hepatotoxic, teratogenic, and mutagenic metabolites that are now well - recognized as a public health hazard (1, 4). although some synthetic fungicides have been improved to protect crops against af production, there are some proven indications that these are themselves hazardous to human health (5). therefore, using natural sources is an affirmative approach to protecting from fungal infections in agriculture (6). a medicinal herb, pistacia atlantica subsp. kurdica, has been traditionally used as a therapeutic agent for infections (7 - 9). the genus pistacia belongs to the family anacardiaceae, and among 15 known species of pistachios, only three grow in iran : p. vera, p. khinjuk, and p. atlantica (10, 11). p. atlantica has three sub - species : mutica, kurdica, and cabulica (11). this plant is an evergreen bush that grows native in some southern and central american and eastern mediterranean countries (10). kurdica is obtained as an exudate after crushing the trunk and branches, and has numerous qualities. the gum of this plant is used in medicine, with many researchers reporting that it possesses considerable antimicrobial activity (12, 13). kurdica, as a natural compound, with regard to antifungal activity and inhibition of af production in a. parasiticus infections. kurdica was obtained from saghez sazi (van) (kurdistan, iran) in the summer of 2014. the gum was obtained as an exudate of the trunk and branches. the a. parasiticus strain (american type culture collection 15517) was incubated at 28c for 72 hours on sabouraud dextrose agar (germany, merck). in vitro antifungal susceptibility testing for the determination of minimum inhibitory concentration (mic) was performed according to recommendations provided in the clinical and laboratory standards institute (clsi) m38-a2 document, with some modification in gum concentration (14). rpmi 1640 medium (sigma chemical co.) was buffered to ph 7.0 with mops (sigma), with l - glutamine and without bicarbonate. kurdica was dissolved in water to reach a concentration of 500 mg / ml. it was then diluted to achieve concentrations of 500 to 15.6 mg / ml (500, 250, 125, 62.5, 31.2, and 15.6 mg / ml). the concentration of fungal spores was calculated using the hemacytometry method, and finally adjusted to 2x concentrated suspensions in such a way that each test well contained 5 10 colony - forming units (cfus)/ml. negative (only rpmi 1640 medium) and positive controls were also run alongside each experiment. the mic endpoints were determined as the lowest concentrations that prevented any recognizable growth, mostly based on the antifungal capacity of the gum (100% inhibition). the amount of afs produced by a. parasiticus alone and in combination with different gum concentrations (62.5 mg / ml and 125 mg / ml) was determined using the high - performance liquid chromatography (hplc) technique (waters 474 scanning fluorescence detector) (6). pdb plates containing 62.5 mg / ml or 125 mg / ml of gum were inoculated with 5 10 fungal spores. then, 25 g of each fungal biomass with 2.5 g of sodium chloride was added into 100 ml of hplc - grade methanol and blended for 3 minutes at 18,000 rpm. cell - free filtrates were obtained using whatman filter paper no.4 and subjected to analysis by hplc. quantitative changes in expression of the aflr gene were analyzed by use of a quantitative real - time pcr assay. a. parasiticus was cultured in the presence of 62.5 mg / ml or 125 mg / ml of gum of p. atlantica var. equal amounts of rna (1 g in 20 l) were subjected to cdna synthesis by using random hexamer primers, according to the manual protocol (fermentase). the primers fafl (5'-cggaacagggacttccggcg-3 ') and rafl (5'-gggtggcgggggactctgat-3 ') were designed on the basis of the published sequence of the aflr gene of a. parasiticus (ncbi, accession no : af441438). the b - actin gene (act1) with fact (5'-acggtattgtttccaactgggacg-3 ') and ract (5'- tggagcttcggtcaacaaaactgg-3 ') primers was used as an endogenous reference gene. quantitative real - time pcr was carried out using the sybr green master mix (applied biosystems, foster city, ca, usa) performed with a step one plus real - time pcr system (applied biosystems, foster city, ca, usa). the aflr gene expression was analyzed with rest software (2008 v2.0.7, corbett research, sydney, australia). kurdica was obtained from saghez sazi (van) (kurdistan, iran) in the summer of 2014. the a. parasiticus strain (american type culture collection 15517) was incubated at 28c for 72 hours on sabouraud dextrose agar (germany, merck). in vitro antifungal susceptibility testing for the determination of minimum inhibitory concentration (mic) was performed according to recommendations provided in the clinical and laboratory standards institute (clsi) m38-a2 document, with some modification in gum concentration (14). rpmi 1640 medium (sigma chemical co.) was buffered to ph 7.0 with mops (sigma), with l - glutamine and without bicarbonate. kurdica was dissolved in water to reach a concentration of 500 mg / ml. it was then diluted to achieve concentrations of 500 to 15.6 mg / ml (500, 250, 125, 62.5, 31.2, and 15.6 mg / ml). the concentration of fungal spores was calculated using the hemacytometry method, and finally adjusted to 2x concentrated suspensions in such a way that each test well contained 5 10 colony - forming units (cfus)/ml. negative (only rpmi 1640 medium) and positive controls were also run alongside each experiment. the mic endpoints were determined as the lowest concentrations that prevented any recognizable growth, mostly based on the antifungal capacity of the gum (100% inhibition). the amount of afs produced by a. parasiticus alone and in combination with different gum concentrations (62.5 mg / ml and 125 mg / ml) was determined using the high - performance liquid chromatography (hplc) technique (waters 474 scanning fluorescence detector) (6). pdb plates containing 62.5 mg / ml or 125 mg / ml of gum were inoculated with 5 10 fungal spores. then, 25 g of each fungal biomass with 2.5 g of sodium chloride was added into 100 ml of hplc - grade methanol and blended for 3 minutes at 18,000 rpm. cell - free filtrates were obtained using whatman filter paper no.4 and subjected to analysis by hplc. quantitative changes in expression of the aflr gene were analyzed by use of a quantitative real - time pcr assay. a. parasiticus was cultured in the presence of 62.5 mg / ml or 125 mg / ml of gum of p. atlantica var. equal amounts of rna (1 g in 20 l) were subjected to cdna synthesis by using random hexamer primers, according to the manual protocol (fermentase). the primers fafl (5'-cggaacagggacttccggcg-3 ') and rafl (5'-gggtggcgggggactctgat-3 ') were designed on the basis of the published sequence of the aflr gene of a. parasiticus (ncbi, accession no : af441438). the b - actin gene (act1) with fact (5'-acggtattgtttccaactgggacg-3 ') and ract (5'- tggagcttcggtcaacaaaactgg-3 ') primers was used as an endogenous reference gene. quantitative real - time pcr was carried out using the sybr green master mix (applied biosystems, foster city, ca, usa) performed with a step one plus real - time pcr system (applied biosystems, foster city, ca, usa). the aflr gene expression was analyzed with rest software (2008 v2.0.7, corbett research, sydney, australia). kurdica inhibited a. parasiticus growth at mic values of 125 mg / ml. according to hplc analysis results, afl - b2 and afl - g2 production was significantly decreased and even entirely inhibited in 125 mg / ml of gum (p < 0.01). however, the production of afl - b1 was not fully inhibited at this concentration. based on quantitative real - time pcr results, the rate of aflr gene expression was significantly decreased after treating the a. parasiticus with 125 mg / ml of p. atlantica subsp. the results of an analysis of the relative quantification of the aflr gene after treatment with the gum of p. atlantica subsp. aflatoxins are extremely toxic and carcinogenic metabolites that widely contaminate agricultural commodities and animal feed (15). in recent years, research has been ongoing into the development of new anti - fungal agents or through the search for natural sources to control growth and toxin production of aspergillus species (8, 9, 16). in several studies, ghalem. reported that the gum of p. atlantica has antimicrobial activity against gram - positive and -negative bacteria that are resistant to commonly used antimicrobial agents, and this was considerably dependent on concentration (17). hesami. suggested the potential substitution of antifungal chemicals by p. atlantica subsp. kurdica as a natural inhibitor to control the growth of botrytis cinereain (19). aflatoxin inhibition mainly occurs during the primary stages of cell growth, when the genes involved in aflatoxin biosynthesis are at maximum activity within the fungal cells (7). our study revealed that the rate of aflr gene expression was significantly decreased after treating the fungus with 125 mg / ml of p. atlantica subsp. showed that licorice extract could efficiently inhibit aflr gene expression, and consequently, af production, in a. parasiticus (6). in another study,. showed potent inhibition of a. parasiticus growth and af production with 1 mg / ml of ephedra major (20). kurdica could efficiently inhibit aflr gene expression and the consequent af production in a. parasiticus. this gum may therefore be considered a potential anti - mycotoxic agent in medicine or industrial agriculture. further studies are recommended to determine the effective components of the gum of p. atlantica subsp. kurdica and to consider it as a potential candidate for controlling af contamination of crops in the field. | backgroundaflatoxins are highly toxic secondary metabolites mainly produced by aspergillus parasiticus. this species can contaminate a wide range of agricultural commodities, including cereals, peanuts, and crops in the field. in recent years, research on medicinal herbs, such as pistacia atlantica subsp. kurdica, have led to reduced microbial growth, and these herbs also have a particular effect on the production of aflatoxins as carcinogenic compounds.objectivesin this study, we to examine p. atlantica subsp. kurdica as a natural compound used to inhibit the growth of a. parasiticus and to act as an anti-mycotoxin.materials and methodsin vitro antifungal susceptibility testing of p. atlantica subsp. kurdica for a. parasiticus was performed according to clsi document m38-a2. the rate of aflatoxin production was determined using the hplc technique after exposure to different concentrations (62.5 - 125 mg / ml) of the gum. the changes in expression levels of the aflr gene were analyzed with a quantitative real - time pcr assay.resultsthe results showed that p. atlantica subsp. kurdica can inhibit a. parasiticus growth at a concentration of 125 mg / ml. hplc results revealed a significant decrease in aflatoxin production with 125 mg / ml of p. atlantica subsp. kurdica, and afl - b1 production was entirely inhibited. based on quantitative real - time pcr results, the rate of aflr gene expression was significantly decreased after treatment with p. atlantica subsp. kurdica.conclusionspistacia atlantica subsp. kurdica has anti - toxic properties in addition to an inhibitory effect on a. parasiticus growth, and is able to decrease aflatoxin production effectively in a dose - dependent manner. therefore, this herbal extract maybe considered a potential anti - mycotoxin agent in medicine or industrial agriculture. |
benzo[a]pyrene (bap), an extensively researched carcinogen and mutagen, belongs to the high - molecular - weight polycyclic aromatic hydrocarbon (pah) group of chemicals. bap and other pahs are derived as a result of incomplete combustion and are released into the environment by both natural and anthropogenic activities. some of the proven emission routes are domestic emission and wastes, automobile exhaust, industrial emission, agricultural activities, and also some natural sources. metabolism of bap activates several mixed - function enzymes in the cell and results in the progression of different types of cancer in human and animals. being hydrophobic, bap has been found to accumulate in several organisms, including microalgae, mussels, and mice. microalgae are the primary producers in the food chain and can grow in three diverse ecosystems : fresh water, marine environments, and soil. they support many different life forms that are exclusively dependent on them for food and play a vital role in the environment. microalgae growing in these environments are exposed to different pollutants, which may have natural or anthropogenic sources. accumulation of pollutants by microalgae has an immediate effect on the higher organisms in the food chain that feed on them. the use of microalgae for the removal of different organic pollutants is also gaining importance, apart from their use as pollution indicators. studies related to the catabolic ability of microalgae to remove bap were started recently. it has been shown that the green alga metabolizes bap primarily to cis - dihydrodiols by a dioxygenase enzyme system similar to that in bacteria and also forms bap sulfate ester and glucose conjugates. most mammals and terrestrial plants follow the monooxygenase enzymatic pathway to metabolize bap. most of the biological effects exerted by bap are mediated through aryl hydrocarbon receptors on the cell membrane. in mammalian cells, bap is enzymatically converted into bap - diol epoxide, which can complex with nucleotides to form nucleotide when these adducts are incorporated into dna during dna synthesis, the dna polymerase is prevented from moving further as a result of interference by the adduct, which results in immature termination of dna synthesis. thus, defective metabolism or defective regulation of cellular metabolism occurs, which leads to apoptosis or proliferation of cells. localization of bap in murine macrophages and human fibroblasts has been demonstrated using fluorescence microscopy. fluorescence imaging of the bap distribution in embryonic and larval medaka tissues has also been shown. it is essential to study the uptake and accumulation mechanisms of bap in microalgae, as they are one of the primary producers in the food chain. even though there have been previous reports showing accumulation of bap in this system, intracellular localization and aggregation have not yet been studied using the most recent fluorescence microscopy tools. determination of the bioaccumulation of organic compounds using standard analytical techniques such as gc and hplc is invasive, as it requires killing of the organisms used for the study and the use of solvents to extract the organics. fluorescence microscopy is a noninvasive technique that does not require harmful solvents for the extraction of organics. it also provides information about the accumulation pattern of hydrophobic pollutants inside single cells. indeed, further studies are needed to develop quantitative microscopy tools to quantify the uptake of bap and other fluorescent pollutants by microalgal cells. a microalgal cell contains a wide spectrum of autofluorecent molecules, and thus, it is difficult to distinguish fluorescence from additional molecules such as bap accumulating in the cell unless a specific fluorescence signal that can be unequivocally attributed to bap can be found. in an endeavor to study the accumulation of bap and to visualize the intracellular localization, we used fluorescence lifetime imaging microscopy (flim) with the phasor approach and confocal microscopy with number and brightness (n&b) analysis. the use of fluorescence microscopy and flim in algal studies was started recently, and these techniques have also been used extensively to study biological structures such as photosynthetic structures of plants. one advantage of flim is that the lifetime information can be represented as a phasor plot, thereby allowing better separation of fluorescent components and the identification of a specific lifetime signal from bap. as the background fluorescence of plant cells has a very short lifetime, any fluorescent molecule that is different from the background can be well - separated in the phasor plot. the difference used could be either wavelength, which can be separated by filters, or lifetime, which can be resolved by a phasor plot. hence, we used flim as the technique to detect and image the interaction of the fluorescent pollutant bap with the microalga, chlorella sp. we show that flim can be used to follow the accumulation of bap in chlorella cells. our results suggest that bap accumulates in lipid bodies and/or vacuoles of chlorella for a long time (imaged up to 3 weeks) and that there is frster resonance energy transfer (fret) between bap and photosystems of the cells. the localization of bap in chlorella cells could be visualized while avoiding the background fluorescence due to fluorescing molecules in the algal photosystems and the quenching of bap fluorescence due to fret. our n&b analysis suggests that bap predominantly exists as monomers rather than as aggregates inside the chlorella cells., originally isolated from a soil sample and maintained in the phycology laboratory at the centre for environmental risk assessment and remediation of the environment (cerar), university of south australia, was used in this study. the culture was maintained in bold s basal medium (bbm) as described earlier. the culture was grown in 100 ml erlenmeyer flasks containing 25 ml of bbm in an orbital shaker set at 150 rpm under 3 36 w cool white fluorescent light (100 mol of photosynthetic photon flux density) at 24 2 c. (3 10 cells ml) in 25 ml of bbm placed in 100 ml sterile erlenmeyer flasks. the cultures were examined in an olympus bx41 epifluorescence microscope for the presence of any contaminating fluorescent materials or debris in the medium other than the autofluorescent microalgal cells. the culture was exposed to 100 m bap in culture medium added from a concentrated stock solution prepared in n, n - dimethylformamide (dmf) and incubated in an orbital shaker under constant illumination at 24 2 c as described above. the samples were drawn for confocal microscopy analysis after 1, 5, 12, and 24 h of incubation with bap. bap and nile red images were obtained with a leica sp5 inverted microscope using a 63, 1.2 na water immersion objective. bap was prepared in dmf, resuspended in bbm, incubated with chlorella cells, and used for imaging. bap was excited with a 405 nm laser, and emission was set at 450550 and 600750 nm simultaneously in two channels. for nile red staining, nile red was prepared in dmf (10 mm) and diluted into bbm to a final concentration of 100 m. nile red (100 m) was incubated with chlorella cells in 100 ml of bbm for 1 or 2 h and imaged in the confocal microscope. the fluorophore was excited using a 488 nm laser, and the emission window was set to 500550 nm. flim was carried out using a leica sp5 microscope with a 405 nm pulsed laser at a frequency of 40 mhz. the emission window was set at 450550 nm to collect the emission from bap and 600750 nm to collect the autofluorescence (predominantly photosystems i and ii) of algal cells. the image sizes were set at 256 256 pixels, and the signals were collected for 120 s. the flim data were analyzed using simfcs software. leica sp5 time - correlated single - photon counting (tcspc) lifetime image files (.sdt) were opened in the simfcs flim analysis module, and the phasor plot was generated using the phasor explorer page of simfcs. the sample files were opened, and the different phasor plots for each file were generated and analyzed either to obtain lifetimes or to see quenching processes indicative of fret. the histogram of the time delays at each pixel is transformed into a phasor plot, which is like a vector. the phasor plot is a two - dimensional histogram where the values of the sine cosine transforms are represented in a polar plot. each pixel of the image has a point in the phasor plot. in a reciprocal manner, each point of the phasor plot can be mapped to a pixel of the image. hence, each molecular species has a specific phasor ; molecules can be identified by their position in the phasor plot. n&b analysis was done according to the procedure of dalal. and digman. a time series of 100 frames with a resolution of 256 256 pixels, a pixel size of 49.7 nm, and a pixel dwell time of 8, 12, or 20 s was collected using a nikon c1-z confocal imaging system (nikon eclipse te2000-e with a 63, 1.2 na water immersion objective, hanson institute, adelaide). background counts were collected with the laser off and the detectors on using the same gain and offset settings as used for collecting the time series. the.ids files of the nikon confocal microscope were converted to.bin files and imported into simfcs, and n&b analysis was performed. from the background files, the s factor and factor were estimated and used to analyze the data. total organic carbon and inorganic carbon were measured using a total organic carbon analyzer (1010 toc analyzer, oi analytical, college station, tx, usa). phosphorus and potassium were measured from the aqua regia extract of sediments using inductively coupled plasma mass spectrometry (icp - ms) (agilent 7500 series, agilent technologies, tokyo, japan). both ph and electrical conductivity were measured using the smart chem - lab laboratory analyzer (tps pty ltd., brisbane, australia) and are reported in table s2 in the supporting information. sediments were spiked with bap at two different concentrations (5 and 20 mg l), and 20 g samples of spiked and unspiked sediments were weighed into sterile petri dishes. then the chlorella cells were added to the sediments at a concentration of 5 10 cells (g of sediment) and incubated under continuous 3 36 w cool white fluorescent light at 24 2 c. samples were taken for fluorescence microscopy analysis after 1, 5, 12, and 24 h of incubation. cells that had bap (blue fluorescence) and cells without bap (red fluorescence) were counted separately. the effects of incubation time, bap concentration, and sediment type and their interaction on the bap uptake by chlorella sp. were analyzed by three - way anova using minitab 16 statistical software. bap dissolves in organic solvents because of its hydrophobic nature, and molecules are monodispersed in these solvents. however, to understand the uptake, accumulation, and degradation using biological systems, bap must be suspended in an aqueous medium. bap was dissolved in dmf and subsequently resuspended in bbm to the required concentration and used in this study. hence, it is appropriate to image bap in dmf and an aqueous medium and measure the lifetimes in these media. the image of bap fluorescence in dmf is very uniform (figure 1a) because the molecules are dissolved. however, at the resolution of our microscope it is not possible to see smaller molecular aggregates. the image of bap in the aqueous medium shows aggregates of large size (figure 1b). comparing these two images and taking into account the hydrophobic nature of bap, we concluded that bap forms aggregates in bbm but is monodispersed in dmf. these observations were confirmed later, as discussed in number and brightness analysis below. (a, b) laser confocal microscopy images of bap in (a) dmf and (b) bbm. (c, d) phasor plots of lifetime images of bap in (c) dmf and (d) bbm. fluorescein was used as a lifetime standard (4.1 ns) to reference the phasor plot (the phasor plot with the fluorescein lifetime is not shown). the bap in dmf lifetime image was imported into simfcs and plotted in the phasor plot (figure 1c). the lifetime was found to be a relatively single exponential at 14 ns, as shown by the phasor cluster located very close to the universal circle (where all of the single - exponential decays are found). for all of the solution and suspension samples, the fluorescence decay data were extracted from the images and analyzed using globals for spectroscopy software. the fluorescein data were fit to a single component at 4.1 ns (figure s1a in the supporting information) ; the deviations were very small. similarly, bap in dmf was analyzed by the same algorithm (figure s1b). there was a misfit of unknown origin at the very beginning of the data. however, the fit was much better when performed avoiding first part of the curve (figure s1c). the recovered value of the lifetime using the least - squares analysis algorithm in globals for spectroscopy was 14.5 ns. one potential issue is that the intensity for this sample was very weak and there was a very large background. also, the range that can be used for the b&h card was small, and there were artifacts at the beginning and the end of the time trace. the flim data of bap in bbm in the phasor plot are scattered compared with those for bap in dmf (figure 1d), probably because the sample had very weak fluorescence and was aggregated. the average lifetime lies inside the semicircle with a broader distribution compared with that for bap in dmf. this is expected because of the nature of bap in the aqueous medium, which forms aggregates that are affected by self - quenching. hence, the lifetime is shortened, shifting the phasor cluster toward smaller phase angles. the average lifetime for this sample was 7 ns, and the lifetimes were distributed between 12 and 4 ns. the lifetime of bap in dmf was measured earlier by iwata and co - workers using the pulsed excitation method and further verified by them using the frequency domain method, and the lifetime was found to be 14.7 ns. this value is close to the lifetime that we obtained using lifetime imaging (14 ns). furthermore, we obtained the lifetime of bap in an aqueous medium (bbm). used a tcspc instrument to measure the lifetime of bap in methanol and found the lifetime to be 45 ns, which confirms an earlier report by imasaka. these measurements were carried out in cuvettes, and the data were fitted to obtain the lifetimes. the advantage with the phasor plot is that no fitting of the data is required. furthermore, the lifetime distribution in an image can be better visualized using the phasor plot. the broader lifetime distribution of bap in bbm (figure 1d) compared with bap in dmf (figure 1c) and the chlorella sp. background lifetime (figure 2d, e) are examples where the phasor plot gives a better understanding of the data, as there are no calculations or nonlinear fitting involved. however, when the data do not show a distribution, as in the case of bap in dmf, fitting routines could be used as well. (a c) lifetime images of a chlorella cell : (a) intensity image ; (b) reciprocal plot selected by the cursor in the phasor plot in (d) ; (c) reciprocal plot selected by the cursor in the phasor plot in (e). (d, e) phasor plots of fluorescence lifetimes of a chlorella cell. has several fluorescent molecules, among which chlorophyll a and b are the major ones. flim of chlorella sp. was done as a control to understand the lifetime present in the background. as a result of energy transfer from photosystem ii to i and further down in the electron transport system, the lifetime measured from the phasor plot (figure 2d, e) varied between 1.5 and 0.2 ns. the photosystems could not be distinguished, as the photosystem signals were collected in one channel. however, it is possible to separate regions of the cell with different lifetimes using the phasor plot. the majority of the pixels lifetimes were very short, around 200 ps in regions that can be associated with membranes, confirming that the background lifetime could arise from photosystems. the lifetime image of a chlorella cell is shown in figure 2a. from this image, the phasor plot was generated (figure 2d, e). in a reciprocal selection (from figure 2d), a large cluster of phasor values was selected by the red cursor (red circle), and the pixels corresponding to that cluster are represented in red in figure 2b. similarly, another cluster was selected in figure 2e by the green cursor (green circle), and the corresponding pixels are painted in green in figure 2c. however, it is difficult to interpret these results unequivocally as arising from a specific photosystem. additional information could be obtained, for example, by using different quenchers to find out the distribution of certain fluorescent molecules in the photosystems. the phasor plot representation of the background lifetime of chlorella cells, which is due to photosystems i and ii, is shown in figure 2d, e. similarly, the bap lifetimes in dmf and bbm are plotted in phasor form in figure 1c, d. when we combine these two components (bap and background), the lifetime of bap is reduced from 14 ns to about 8 ns (figure 3a). we considered two possibilities : (1) that the reduction in the lifetime is due to the linear combination of the background lifetime and the bap lifetime in the same pixel, and (2) that there could be quenching of the bap fluorescence, making the bap lifetime become shorter. it is a property of the phasor plot that the linear combination of lifetimes would fall somewhere on line b drawn in figure 3a, depending on the contributions from the two components (f1 and f2). as the phasor plot shows, no phasor points are seen on that line. hence, the bap lifetime could be quenched by either photosystem i or ii, or both. if quenching of the donor bap is due to fret in which the photosystem acts as an acceptor, the phasor would fall anywhere in the quenching trajectory marked a in figure 3a. the red cursor in the phasor plot in figure 3a selects the major phasor cluster, which has been reciprocally shown in red in figure 3b. (a) phasor plot showing the bap lifetime distribution in chlorella sp. the green line labeled as b represents linear combinations of the lifetimes of bap and chlorella background fluorescence, and the green curved trajectory labeled as a represents fret between bap and the photosystems. (b) reciprocal selection from the phasor plot by the red cursor c in (a), showing the bap fluorescence lifetime distribution in chlorella sp. however, the overall trend was that bap was being quenched by the photosystems of chlorella cells. the streaking curved nature of the phasor plot (figure 3a) suggests varying quenching efficiencies of bap fluorescence. finally, another possibility is that bap lifetime is shortened as a result of self - quenching. the flim data suggest that there could be self - quenching of the bap fluorescence and/or energy transfer from bap to the photosystems. n&b analysis is an appropriate method to see whether there are aggregates of bap in chlorella cells. time series (100 frames each) of bap in dmf, bap in bbm, and bap in chlorella cells were taken and analyzed., molecules have an average brightness (bav) of about 6.937, which after calibration corresponds to about 142 000 counts molecule s. the brightness distribution is relatively narrow (figure 4i). there is no evidence of dimers, which would have b = 13, or of larger aggregates. (a d) maps of brightness vs fluorescence intensity for bap in (a) dmf, (b) bbm, and (c, d) chlorella sp. cells. (e) image of bap in dmf showing corresponding pixels selected by the cursor (red circle) in (a). (f) image of bap in bbm showing corresponding pixels selected by the cursor in (b), corresponding to high - brightness aggregates. (cells showing corresponding pixels selected by the cursor in (c), corresponding to average - brightness particles. cells showing corresponding pixels selected by the cursor in (d), corresponding to high - brightness aggregates above average. (i k) histograms showing brightness distributions of bap in (i) dmf, (j) bbm, and (k) chlorella sp. cells. in bbm, bap forms aggregates. figure 4b shows the distribution of intensity and brightness of the aggregates. a wide range of distribution of particles with varying brightness is shown in figure 4j. in figure 4b, the cursor (red circle) selects high - brightness pixels, and the corresponding bigger aggregates are highlighted in the image shown in figure 4f. if we compare bap in dmf and bap in bbm, bap exists as monodispersed molecules in dmf whereas it clearly aggregates in bbm. in chlorella cells, apart from background, there are varying intensity distributions (figure 4c, d). a majority of pixels corresponding to the bap fluorescence are selected by the red circle in figure 4c and are mapped in red in figure 4 g. the average brightness is bav = 5.33 (figure 4k), which is slightly less than that for bap in dmf (figure 4i), indicating low aggregation and some quenching. (b > 6), which are selected by the red circle in figure 4d and painted in red in figure 4h. figure 4 g shows the reciprocal selection of pixels selected by the cursor (red circle) in figure 4c, and similarly, figure 4h shows the reciprocal selection by the cursor in figure 4d. spectroscopic studies of bap monomer, dimer, and trimer had been done by fioressi. bap forms aggregates in aqueous media and is monodispersed in organic solvents. in a cell, as bap prefers to partition into lipid droplets and the membrane portion, it is in a monomeric form. when bap is taken up by a cell, it has to pass through the lipid bilayer, where it attaches as aggregates to the surface and then might dissociate it is a general hypothesis that organic compounds pass passively through plant and animal cells. however, experimental studies of individual organic pollutants and their interactions with different organisms are decisive if there is to be a clear depiction about the interaction properties of the pollutant with diverse organisms and cell types. chlorella cells were incubated with bap at a final concentration of 1, 40, or 100 m prepared in bbm and imaged. there was no detectable difference in the accumulation patterns seen for the different incubation regimes of 5 min and 48 h using confocal microscopy. the cells showed accumulation of bap in specific pockets (figure 5b e). these pockets could be lipid bodies and/or vacuoles considering the localization pattern of bap. (a) confocal microscopy image of chlorella cells showing background photosystem fluorescence. (b) confocal microscopy image showing bap fluorescence in chlorella cells. (c) overlap of chlorella sp. background fluorescence and bap fluorescence (scale bar = 20 m). (d) higher - magnification image showing fluorescence of bap inside chlorella sp. cells (scale bar = 5 m). (e) confocal microscopy image of a chlorella cell showing pictate staining of bap fluorescence. (f) confocal microscopy image of a chlorella cell showing the lipid - specific fluorescent stain nile red. nile red, a lipid - specific dye, was used to determine whether bap accumulation occurs in lipid bodies of chlorella cells. nile red is excited at 488 nm and its emission maximum is at 525 nm, whereas bap is excited at 405 nm and its emission is collected between 450 and 550 nm. as the emissions of these two dyes partially overlap, it is difficult to do simultaneous imaging and show colocalization. hence, bap and nile red images were measured separately using different chlorella cells, and the patterns are shown in figure 5e, f, respectively. compared to nile red staining, bap staining is more punctuated. in order to determine the bap uptake assay by microalgae, fluorescence microscopy analysis was carried out on chlorella cells to detect the bap uptake from sediments. between the two sediments (denoted as s1 and s2), even though their nutrient contents differ greatly (table s2 in the supporting information). bap uptake could not be detected in the algae during the first and fifth hours of incubation, and all of the cells showed only background fluorescence. however, the number of cells with bap fluorescence started to increase after 12 h of incubation (figure 6). during the first few hours of incubation, the quantity of bap taken up by microalgae may not be sufficient to detect using fluorescence microscopy. moreover, no clear morphological differences between the chlorella cells exposed to the bap - spiked sediments and unspiked sediments were observed. earlier, wu. observed morphological changes in aspergillus fungus using fluorescence microscopy. this shows the differential response between microalgae and fungi to bap at the microscopic level. fluorescence microscopy analysis of bap uptake by chlorella sp. in two different sediments (5 and 20 are bap concentrations ; s1 and s2 are sediment types ; and 1, 5, 12, and 24 are incubation periods). analysis by three - way anova indicates that bap concentration, incubation time, and sediment type all have significant effects (p > 0.01) on the bap uptake by chlorella sp. a significant influence of bap concentration and incubation time was seen. a significant influence of incubation time and sediment type (p > 0.01) on bap uptake was also observed. however, there was no significant interaction between bap concentration and sediment type on the bap uptake by chlorella (p > 0.01). flim, confocal microscopy, and n&b techniques can be used to study the uptake, accumulation, and aggregation of bap in living cells. the limitations of imaging of bap localization in chlorella cells is that there is background fluorescence from photosystems and other molecules and there is fret between bap and other molecules in the cell. however, flim can be used to distinguish the background fluorescence from bap fluorescence. the advantages of using the flim phasor and n&b analyses are that bap fluorescence can be distinguished from the background fluorescence and aggregation of bap molecules can be visualized inside the cells. in the case of chlorella sp., bap accumulates at high concentrations inside the cells, preferentially in lipid bodies. bap forms aggregates of various sizes in an aqueous medium (bbm), whereas it exists as monomers or small aggregates inside the cell. this study lays the foundation for studying the interaction of microalgae and fluorescent xenobiotics such as bap using confocal microscopy. indeed, there is more potential for utilizing and refining this technique to study the interaction of fluorescent pollutants in other diverse microorganisms. | benzo[a]pyrene (bap), a polycyclic aromatic hydrocarbon (pah), is one of the major environmental pollutants that causes mutagenesis and cancer. bap has been shown to accumulate in phytoplankton and zooplankton. we have studied the localization and aggregation of bap in chlorella sp., a microalga that is one of the primary producers in the food chain, using fluorescence confocal microscopy and fluorescence lifetime imaging microscopy with the phasor approach to characterize the location and the aggregation of bap in the cell. our results show that bap accumulates in the lipid bodies of chlorella sp. and that there is frster resonance energy transfer between bap and photosystems of chlorella sp., indicating the close proximity of the two molecular systems. the lifetime of bap fluorescence was measured to be 14 ns in n, n - dimethylformamide, an average of 7 ns in bold s basal medium, and 8 ns in chlorella cells. number and brightness analysis suggests that bap does not aggregate inside chlorella sp. (average brightness = 5.330), while it aggregates in the supernatant. in chlorella grown in sediments spiked with bap, in 12 h the bap uptake could be visualized using fluorescence microscopy. |
a sox10-cre bacterial artificial chromosome (bac) construct was generated from the regulatory elements of sox10 within a well - characterized sox10 bac to obtain high levels of cre in nc derivatives. the construct includes a nuclear localized cre sequence connected to a human growth hormone mrna stabilization sequence.14, 15 loxp sites in the bac flanking arms were removed as described by boyle (2008) prior to microinjection of the bac into fertilized mouse eggs by standard procedures. the resulting tg line, hereafter sox10-cre, was made congenic on the c3heb / fej background. transgene - driven reporter expression mirrors known sox10 expression in nc - derived lineages (rosebrock j, buehler dp, dekeyser jl,. experimental animals for nc - derived lineage quantification were from crosses between sox10 ; sox10-cre or sox10 ; sox10-cre / cre mice to r26r mice. sox10 mice were identified by the presence of white feet and belly spotting as well as discernible hypoganglionosis and/or aganglionosis revealed by the absence of tdtomato fluorescent ganglia in the distal intestine. the sox10 recapitulates hscr in humans with animals exhibiting varying lengths of aganglionosis within the bowel despite harboring the same hscr - causing mutation. the presence of the sox10-cre transgene was verified by polymerase chain reaction (pcr) genotyping with primers specific for fragment amplification of the sp6 arm (forward : reverse : ggcactttcatgttatctgagg), t7 arm (forward : aagagcaagccttggaactg ; reverse : tcgagcttgacattgtaggac), and cre - recombinase (forward : gcggcatggtgcaagttgaat ; reverse : cgttcaccggcatcaacgttt). thermocycler conditions for all primers sets listed were as follows : 94c for 5 minutes [0.5-second ramp up to 94c) 35 times ], 72c for 10 minutes, 4c indefinitely. regions of the duodenum, ileum, and midcolon were collected from postnatal (p) 1519 day sox10 and sox10 littermates. laminar muscle preparations containing myenteric plexus were isolated and subjected to immunohistochemical (ihc) analysis using the reagents described in table 1, table 2. after incubation in primary antibodies, all tissues were rinsed in 1x phosphate - buffered saline (pbs)/0.1%triton x-100 solution followed by incubation in secondary antibody dilution in block for 1 to 1.5 hours at room temperature. rinses and incubation in a second secondary antibody dilution was repeated as previously described for double labeling. after secondary antibody incubation, tissues were rinsed in 1x pbs/0.1%triton x-100 followed by rinses in 1x pbs. tissue samples were stored in the dark in 1x pbs at 4c before being mounted onto slides with aqua - poly / mount mounting medium (polysciences, warrington, pa). z - stack images of samples were captured on a zeiss lsm 510 confocal microscope (20 objective magnification with 1.5 software zoom ; carl zeiss, thornwood, ny) to quantify nc derivatives within the ganglia and primary connectives of the myenteric plexus. image brightness and contrast were adjusted in adobe photoshop (adobe systems, san jose, ca) to aid in cell quantification. we quantified n = 56 samples per genotype for all duodenum and ileum nc lineage analyses and n = 56 sox10 and n = 1011 for sox10 samples for colon nc lineage analyses. to determine gastric emptying and small intestine transit rates, 4-week - old (2730 days) or 6-week - old (4248 days) mice fifteen minutes after gavage, the stomach and 10 equal segments of small intestine were collected and homogenized separately. the fluorescence signal from the stomach and each intestinal segment was read on a molecular devices / ljl analyst ht (molecular devices, union city, ca). gastric emptying percent was determined by calculating the proportion of fluorescence that had left the stomach to total recovered fluorescence. a small intestine transit score was assigned by determining the geometric mean of fluorescence within the 10 equal small intestine segments. miller originally described and validated this method in rats, and recent studies have used these assays in mice.19, 20, 21 to depict small intestine transit rates, the average percentage contribution of each individual intestine segment to the motility score was calculated. a heat map was generated using matlab (mathworks, natick, ma), where the intestine segment numbers contributing the most to the small intestine transit score (higher fluorescent intensity) are shown in darker red and those contributing little or none to the score (lower fluorescent intensity) in lighter red. color intensity in between segment number hashes was interpolated to create each heat map (n = 68 mice per genotype, sex, and age). transverse sections (5 m) of entire colon from 6 week or older sox10 and sox10 littermates were stained with h&e. an expert pathologist blinded to genotype scored the sample inflammation based on a previously developed scoring system using hirschsprung mouse models. specifically, a final score of 07 was assigned by assessing the severity of inflammation (03, with 0 = no inflammation or rare neutrophils ; 1 = mild inflammatory infiltrates with no necrosis, 2 = moderate to marked inflammatory infiltrates and mucosal necrosis, and 3 = transmural necrosis) and depth of inflammation (04, with 0 = none, 1 = mucosa, 2 = submucosa, 3 = muscularis propia ; 4 = subserosa / serosa). in this analysis, n = 69 mice per genotype and per sex. for nc lineage quantification, five duodenal, three ileal, and two colonic images were manually counted for each animal. for sox10 mice with hypoganglionosis in the midcolon, additional images were quantified so that a comparable number of neurons were counted between sox10 and sox10 mice. we tested for differences in cell type proportions, gastric emptying rates, small intestine transit rates, and inflammation scores using a student t test assuming unequal variance (welch t test). analysis of variance (f test) was used to test for statistical significance of slope and to determine the coefficients of determination (r). statistical analysis was performed using jmp software (version 10 ; sas institute, cary, nc). all study authors had access to study data, and all authors reviewed and approved the manuscript. a sox10-cre bacterial artificial chromosome (bac) construct was generated from the regulatory elements of sox10 within a well - characterized sox10 bac to obtain high levels of cre in nc derivatives. the construct includes a nuclear localized cre sequence connected to a human growth hormone mrna stabilization sequence.14, 15 loxp sites in the bac flanking arms were removed as described by boyle (2008) prior to microinjection of the bac into fertilized mouse eggs by standard procedures. the resulting tg line, hereafter sox10-cre, was made congenic on the c3heb / fej background. transgene - driven reporter expression mirrors known sox10 expression in nc - derived lineages (rosebrock j, buehler dp, dekeyser jl,. experimental animals for nc - derived lineage quantification were from crosses between sox10 ; sox10-cre or sox10 ; sox10-cre / cre mice to r26r mice. sox10 mice were identified by the presence of white feet and belly spotting as well as discernible hypoganglionosis and/or aganglionosis revealed by the absence of tdtomato fluorescent ganglia in the distal intestine. the sox10 recapitulates hscr in humans with animals exhibiting varying lengths of aganglionosis within the bowel despite harboring the same hscr - causing mutation. the presence of the sox10-cre transgene was verified by polymerase chain reaction (pcr) genotyping with primers specific for fragment amplification of the sp6 arm (forward : reverse : ggcactttcatgttatctgagg), t7 arm (forward : aagagcaagccttggaactg ; reverse : tcgagcttgacattgtaggac), and cre - recombinase (forward : gcggcatggtgcaagttgaat ; reverse : cgttcaccggcatcaacgttt). thermocycler conditions for all primers sets listed were as follows : 94c for 5 minutes [0.5-second ramp up to 94c) 35 times ], 72c for 10 minutes, 4c indefinitely. regions of the duodenum, ileum, and midcolon were collected from postnatal (p) 1519 day sox10 and sox10 littermates. laminar muscle preparations containing myenteric plexus were isolated and subjected to immunohistochemical (ihc) analysis using the reagents described in table 1, table 2. after incubation in primary antibodies, all tissues were rinsed in 1x phosphate - buffered saline (pbs)/0.1%triton x-100 solution followed by incubation in secondary antibody dilution in block for 1 to 1.5 hours at room temperature. rinses and incubation in a second secondary antibody dilution was repeated as previously described for double labeling. after secondary antibody incubation tissue samples were stored in the dark in 1x pbs at 4c before being mounted onto slides with aqua - poly / mount mounting medium (polysciences, warrington, pa). z - stack images of samples were captured on a zeiss lsm 510 confocal microscope (20 objective magnification with 1.5 software zoom ; carl zeiss, thornwood, ny) to quantify nc derivatives within the ganglia and primary connectives of the myenteric plexus. image brightness and contrast were adjusted in adobe photoshop (adobe systems, san jose, ca) to aid in cell quantification. we quantified n = 56 samples per genotype for all duodenum and ileum nc lineage analyses and n = 56 sox10 and n = 1011 for sox10 samples for colon nc lineage analyses. to determine gastric emptying and small intestine transit rates, 4-week - old (2730 days) or 6-week - old (4248 days) mice were gavaged with a rhodamine dextran fluorescence containing meal. fifteen minutes after gavage, the stomach and 10 equal segments of small intestine were collected and homogenized separately. the fluorescence signal from the stomach and each intestinal segment was read on a molecular devices / ljl analyst ht (molecular devices, union city, ca). gastric emptying percent was determined by calculating the proportion of fluorescence that had left the stomach to total recovered fluorescence. a small intestine transit score was assigned by determining the geometric mean of fluorescence within the 10 equal small intestine segments. miller originally described and validated this method in rats, and recent studies have used these assays in mice.19, 20, 21 to depict small intestine transit rates, the average percentage contribution of each individual intestine segment to the motility score was calculated. a heat map was generated using matlab (mathworks, natick, ma), where the intestine segment numbers contributing the most to the small intestine transit score (higher fluorescent intensity) are shown in darker red and those contributing little or none to the score (lower fluorescent intensity) in lighter red. color intensity in between segment number hashes was interpolated to create each heat map (n = 68 mice per genotype, sex, and age). transverse sections (5 m) of entire colon from 6 week or older sox10 and sox10 littermates were stained with h&e. an expert pathologist blinded to genotype scored the sample inflammation based on a previously developed scoring system using hirschsprung mouse models. specifically, a final score of 07 was assigned by assessing the severity of inflammation (03, with 0 = no inflammation or rare neutrophils ; 1 = mild inflammatory infiltrates with no necrosis, 2 = moderate to marked inflammatory infiltrates and mucosal necrosis, and 3 = transmural necrosis) and depth of inflammation (04, with 0 = none, 1 = mucosa, 2 = submucosa, 3 = muscularis propia ; 4 = subserosa / serosa). in this analysis, for nc lineage quantification, five duodenal, three ileal, and two colonic images were manually counted for each animal. for sox10 mice with hypoganglionosis in the midcolon, additional images were quantified so that a comparable number of neurons were counted between sox10 and sox10 mice. we tested for differences in cell type proportions, gastric emptying rates, small intestine transit rates, and inflammation scores using a student t test assuming unequal variance (welch t test). analysis of variance (f test) was used to test for statistical significance of slope and to determine the coefficients of determination (r). statistical analysis was performed using jmp software (version 10 ; sas institute, cary, nc). all study authors had access to study data, and all authors reviewed and approved the manuscript. studies to assess alterations in enteric cell types in vivo have largely focused on comparing total numbers of neurons and glia, although a few studies have assessed neuronal subtypes.20, 23 while informative, ihc analysis alone may not comprehensively identify all nc derivatives in the ens and may miss alterations in patterning and distribution of enteric ganglia depending on the marker used. because sox10 is ubiquitously expressed in nc cells emerging from the neural tube, the use of sox10 regulatory regions linked to a cre driver enables extensive labeling of nc derivatives (rosebrock j, buehler dp, dekeyser jl,., in preparation).24, 25 to visualize nc derivatives within enteric ganglia, we combined a sox10-cre bac transgene with a cre - dependent r26r reporter in crosses with sox10 mice. analysis of sox10 mutants on a mixed background in these crosses is advantageous because this model recapitulates the variable penetrance and severity of aganglionosis seen in human hscr patients.4, 26 in the resulting progeny, the cytoplasmic reporter tdtomato, which is concentrated in the cell soma and labels cellular processes, reveals ganglia structure, density, and connectives of cells in which cre is expressed. we collected laminar gut muscle preparations in pups between postnatal (p) days 15 and 19, before the majority of these animals succumb to megacolon at weaning. we observed similar myenteric ganglia density, spacing between ganglia, and overall architecture of ganglia in the duodenum, ileum, and ganglionated regions of the colon in both sox10 and sox10 pups (figure 1). although comparable ganglia patterning and density were seen, the possibility remained that total numbers of myenteric ncps might differ between sox10 and sox10 animals and could lead to altered gi function. we compared the total numbers of enteric nc - derived cells between sox10 and sox10 pups. this analysis revealed similar total numbers of nc - derived cells between sox10 and sox10 mice in both duodenum (p =.86) and ileum (p =.55) (n = 5 per genotype) (table 3). we did not compare the total number of nc - derived cells in the midcolon as many of the sox10 are clearly hypoganglionic in this region. in both in vitro and in peripheral nervous structures outside the ens, timing and levels of sox10 expression affect neuronal and glial fate acquisition from nc progenitors.10, 11, 12, 27, 28 however, the role of sox10 in neuronal and glial fate acquisition in the ens in vivo has not been determined. feasibly, disruption of sox10 could alter the ratio of these cell types and contribute to gi dysfunction by impacting motility or by contributing to inflammation secondary to perturbing enteric glia. to examine the possibility that ratios of enteric neurons and glia are abnormal in sox10 pups, we quantified the proportions of neurons and glia out of total nc derivatives within the myenteric plexus at p1517. because different regions of the bowel have distinct functions and it is unknown how proximal to regions of aganglionosis aberrancies in lineage segregation might occur, we assessed neuron and glia proportions in the duodenum, ileum, and midcolon. enteric neurons (hu+) and glia (foxd3 +) (figure 2) were ihc labeled, counted, and their proportions out of the total nc derivatives calculated (figure 3a). proportions of neurons and glia were found to be comparable within the duodenum (neurons p =.28 ; glia p =.36) and the ileum (neuron p =.78 ; glia p =.50) between sox10 and sox10 animals (figure 3b and c). although neuronal and glial proportions in the midcolon revealed no statistically significant difference between sox10 and sox10 animals (neurons p =.06 ; glia p =.37), we noted an overall decrease in neuron proportions and an overall increase in glia proportions in sox10 mice (figure 3b and c). given the variable length of aganglionosis present in hscr sox10 mice, which models that seen in hscr patients,4, 26 we compared colonic neuronal and glial proportions against the length of colonic aganglionosis for each sox10 mouse. this analysis detected a strong inverse correlation between neuron proportions and length of colonic aganglionosis (p <.003 ; r = 0.70) (figure 3d). conversely, a strong direct relationship is present between glia proportions and extent of colonic aganglionosis (p <.005 ; r = 0.66) (figure 3d). thus, although neuron and glia proportions in the sox10 small intestine are not altered and do not correlate with aganglionosis ; in the colon, neuronal numbers decrease in concert with an increase in glial numbers as the area of the bowel affected by aganglionosis increases. correlation scores for cell type proportions and extent of aganglionosis for each region of the bowel examined are summarized in table 4. given the presence of multiple lineages, including myofibroblasts, in colonies grown from cultured enteric ncps in vitro,11, 12, 30, 31 we anticipated the possibility of identifying cells within the ens that express neither neuronal nor glial markers. use of the sox10-cre transgene system revealed enteric nc derivatives that were not labeled by neuronal (hu+) or glial (foxd3 +) immunoreagents. however, these cells were extremely rare within myenteric ganglia and primary connectives with an average incidence of 1.5 cells in 1000 nc derivatives in the duodenum, 0.6 cells in 1000 in the ileum, and 6 cells in 1000 in the colon. the presence of this cell type did not statistically significantly differ between sox10 and sox10 in any region of the intestine tested (duodenum p =.41 ; ileum p =.90 ; colon p =.23) (figure 4a). furthermore, the proportions of this cell type did not correlate with the length of aganglionosis (table 4). concurrently, while evaluating neuron and glia proportions, we documented a relatively infrequent population of enteric nc - derived cells that expressed both neuronal (hu+) and glial (foxd3 +) markers. these cells were typically found in small clusters mainly as couplets, triplets, or quadruplets but occasionally found singularly (figure 4b). this cell type was very rare in both sox10 and sox10 mice, and its rate of appearance did not differ between sox10 and sox10 mice in the duodenum (p =.71) or ileum (p =.12). although they were still rare, sox10 mice had more of these double - positive cells within the colon (p <.005). on average, sox10 colon samples contained 40 hu+foxd3 + cells per 1000 nc derivatives whereas sox10 colons only contained 25 hu+foxd3 + cells per 1000 nc derivatives. unlike neurons and glia, the proportion of this cell type did not correlate with disease severity in the colon of sox10 mice (p =.80 ; r = 0.01). additionally, no correlations were identified for this cell type in regions of the small intestine (table 4). because clinicians have identified chronic constipation and incontinence as problematic long - term outcomes in hirschsprung patients, we examined the relative proportions of two resident neuronal subtypes in sox10 mutants with well - known roles in gi motility. calretinin is expressed in cholinergic neurons, and its presence identifies excitatory muscle motor neurons within the myenteric plexus as well as some interneurons and intrinsic primary afferent neurons.1, 32 therefore, alterations in calretinin - expressing (calretinin+) neuron numbers could affect intestinal contraction dynamics and overall motility. the proportion of calretinin+ neurons out of total neurons (hu+) in the myenteric plexus was quantified through ihc analysis (figure 5a). the proportion of calretinin+ neurons in sox10 mice duodenum was statistically significantly greater compared with sox10 littermates (p <.05) (figure 5b). calretinin+ neurons were also present in higher proportions in the ileum of sox10 mice (p <.03) (figure 5c). in sharp contrast to the findings in the small intestine, an overall decrease in the proportion of calretinin+ neurons was evident in the colon. greater variance in colonic calretinin+ neuronal subtype proportions was present in sox10 mutants compared with sox10 samples, similar to the effect seen for colonic neuronal and glial proportions. this analysis revealed that calretinin+ neuron proportions decrease dramatically as the length of aganglionosis increases (p <.0001, r = 0.84) (figure 5e). this effect was limited to the colon as calretinin+ neuron proportions did not correlate with length of aganglionosis in the duodenum nor ileum (table 4). to further define alterations in other motor neuron types, we evaluated neuronal nitric oxide synthase (nnos)-expressing neurons in sox10 mutants (figure 6a). nitrergic (nnos+) neurons in the myenteric plexus are primarily inhibitory motor neurons responsible for the relaxation of intestinal smooth muscle and also include some interneurons. interestingly, although calretinin+ neuron proportions were altered in the duodenum in sox10 mice, nnos+ neuron proportions were comparable between sox10 and sox10 animals (p =.68) (figure 6b). similarly, nnos+ proportions were nearly identical in the ileum between the two genotypes (p =.51) (figure 6c). however, there was a trending increase in nnos+ neuron proportions in the colon of sox10 mice compared with sox10 controls (p =.099) (figure 6d). while calretinin+ neuron proportions in the colon decreased as length of aganglionosis increased, the opposite was true for nnos+ neurons. animals with a greater extent of aganglionosis also exhibited a greater proportion of colonic nnos+ neurons (p =.0014, r = 0.74) (figure 6e). like the majority of cell types we evaluated, correlations for nnos+ neurons were only detected in the colon and not the duodenum and ileum (table 4). substantial numbers of hscr patients suffer gi dysfunction even after surgical resection of aganglionic regions. given the skewing of neuron proportions observed in sox10 animals resulting from increased calretinin+ neurons in the duodenum and ileum, we examined gi motility dynamics proximal to the colon in sox10 mice. to evaluate gastric emptying and small intestine transit rates, we gavaged fasted mice with a nonabsorbable fluorescent meal. gastric emptying was determined by calculating the proportion of fluorescent signal that had left the stomach to the total recovered fluorescence, and small intestine transit rates were determined by calculating the geometric mean of fluorescence within the small intestine.18, 19, 20 because distal intestinal obstruction and colonic distension can affect gi transit more proximally and pups with severe aganglionosis often succumb to megacolon around weaning, we chose to limit our analysis to more mature sox10 mice that survived past weaning to 4 weeks or 6 weeks of age. the sox10 animals that survive to adulthood typically have a short length of aganglionosis, reach their full adult size, and feed and breed normally. initially, gastric emptying and small intestine transit rates were compared in 4-week - old sox10 and sox10 animals. because hscr shows a sex bias in humans, with three in four hscr patients being male, we evaluated gi motility in both sox10 male and female mice. in 4-week - old animals, sox10 males had a statistically significantly slower small intestinal transit rate compared with sox10 males (p <.04) (figure 7a). nearly identical results were obtained for females, with 4-week - old sox10 females also showing statistically significantly reduced small intestinal transit rates (p <.006) (figure 7b). the gastric emptying rates were comparable between sox10 and sox10 mice for both sexes at this age (males : p =.96 ; females : p =.68) (figure 7a and b). these findings are not surprising given the skew of neuronal subtypes we observed in the small intestine of sox10 and the known outcomes among hscr patients. however, because neurally mediated traits are susceptible to change upon increased exposure to sex hormones,33, 34 gastric emptying and small intestine transit rates were also evaluated in older, sexually mature (6-week+) animals. for older male mice, we observed statistically comparable small intestine transit rates between sox10 males and their wild - type sox10 counterparts (p =.57). but, in contrast to the phenotype of 4-week - old males, we observed a marked increase in gastric emptying rates of 6-week - old sox10 males that was not observed in 6-week - old normal sox10 littermates (p <.005) (figure 7c). small intestine transit rates were comparable between 6-week - old sox10 and sox10 females (p =.31) (figure 7d). and, unlike the 6-week - old males, female 6-week - old sox10 and sox10 mice had comparable gastric emptying rates (p =.58) (figure 7d). to summarize, at an early age, both female and male sox10 mice have significant small intestine transit deficits ; however, in older sox10 animals, only males exhibit any type of motility defect. many hirschsprung patients suffer from severe bouts of enterocolitis, and previous studies reported that some animals with an ednrb hscr mutation suffer from enterocolitis that can ultimately lead to bowel perforation, sepsis, and death.22, 35 additionally, inflammatory processes within the bowel could potentially affect gi motility, making it difficult to determine whether gi motility deficits in sox10 mice result from changes in electrical properties due to ens deficits and/or influences of inflammatory processes on the bowel. to determine whether enterocolitis could be affecting gi motility in adult sox10 mice, we harvested entire colons from sox10 and sox10 6-week+ littermates. colons were stained with h&e and scored for inflammation by a pathologist blinded to genotype. we adopted a grading rubric for inflammation based on previous studies in hscr mouse mutants. briefly, each mouse was assigned an inflammation score (07) based on the severity (03) and depth (04) of inflammation. interestingly, sox10 mice had no or very little inflammation, comparable to their wild - type littermates (p =.99) (figure 8a and b). because males and females may differ in the levels of inflammation, we also compared inflammation scores by sex. even when separated by sex, we observed similar levels of inflammation in sox10 and sox10 mice (figure 8c and d). other hallmark features of hirschsprung disease as reported in hscr patients, such as regions of hypoganglionosis proximal to aganglionosis and thickened muscularis propria, were evident (figure 8a). given the intestinal transit alterations in sox10 and the lack of inflammation in this hscr model, our results suggest the motility deficits in this hscr model are neurally mediated. studies to assess alterations in enteric cell types in vivo have largely focused on comparing total numbers of neurons and glia, although a few studies have assessed neuronal subtypes.20, 23 while informative, ihc analysis alone may not comprehensively identify all nc derivatives in the ens and may miss alterations in patterning and distribution of enteric ganglia depending on the marker used. because sox10 is ubiquitously expressed in nc cells emerging from the neural tube, the use of sox10 regulatory regions linked to a cre driver enables extensive labeling of nc derivatives (rosebrock j, buehler dp, dekeyser jl,., in preparation).24, 25 to visualize nc derivatives within enteric ganglia, we combined a sox10-cre bac transgene with a cre - dependent r26r reporter in crosses with sox10 mice. analysis of sox10 mutants on a mixed background in these crosses is advantageous because this model recapitulates the variable penetrance and severity of aganglionosis seen in human hscr patients.4, 26 in the resulting progeny, the cytoplasmic reporter tdtomato, which is concentrated in the cell soma and labels cellular processes, reveals ganglia structure, density, and connectives of cells in which cre is expressed. we collected laminar gut muscle preparations in pups between postnatal (p) days 15 and 19, before the majority of these animals succumb to megacolon at weaning. we observed similar myenteric ganglia density, spacing between ganglia, and overall architecture of ganglia in the duodenum, ileum, and ganglionated regions of the colon in both sox10 and sox10 pups (figure 1). although comparable ganglia patterning and density were seen, the possibility remained that total numbers of myenteric ncps might differ between sox10 and sox10 animals and could lead to altered gi function. we compared the total numbers of enteric nc - derived cells between sox10 and sox10 pups. this analysis revealed similar total numbers of nc - derived cells between sox10 and sox10 mice in both duodenum (p =.86) and ileum (p =.55) (n = 5 per genotype) (table 3). we did not compare the total number of nc - derived cells in the midcolon as many of the sox10 are clearly hypoganglionic in this region. in both in vitro and in peripheral nervous structures outside the ens, timing and levels of sox10 expression affect neuronal and glial fate acquisition from nc progenitors.10, 11, 12, 27, 28 however, the role of sox10 in neuronal and glial fate acquisition in the ens in vivo has not been determined. feasibly, disruption of sox10 could alter the ratio of these cell types and contribute to gi dysfunction by impacting motility or by contributing to inflammation secondary to perturbing enteric glia. to examine the possibility that ratios of enteric neurons and glia are abnormal in sox10 pups, we quantified the proportions of neurons and glia out of total nc derivatives within the myenteric plexus at p1517. because different regions of the bowel have distinct functions and it is unknown how proximal to regions of aganglionosis aberrancies in lineage segregation might occur, we assessed neuron and glia proportions in the duodenum, ileum, and midcolon. enteric neurons (hu+) and glia (foxd3 +) (figure 2) were ihc labeled, counted, and their proportions out of the total nc derivatives calculated (figure 3a). proportions of neurons and glia were found to be comparable within the duodenum (neurons p =.28 ; glia p =.36) and the ileum (neuron p =.78 ; glia p =.50) between sox10 and sox10 animals (figure 3b and c). although neuronal and glial proportions in the midcolon revealed no statistically significant difference between sox10 and sox10 animals (neurons p =.06 ; glia p =.37), we noted an overall decrease in neuron proportions and an overall increase in glia proportions in sox10 mice (figure 3b and c). given the variable length of aganglionosis present in hscr sox10 mice, which models that seen in hscr patients,4, 26 we compared colonic neuronal and glial proportions against the length of colonic aganglionosis for each sox10 mouse. this analysis detected a strong inverse correlation between neuron proportions and length of colonic aganglionosis (p <.003 ; r = 0.70) (figure 3d). conversely, a strong direct relationship is present between glia proportions and extent of colonic aganglionosis (p <.005 ; r = 0.66) (figure 3d). thus, although neuron and glia proportions in the sox10 small intestine are not altered and do not correlate with aganglionosis ; in the colon, neuronal numbers decrease in concert with an increase in glial numbers as the area of the bowel affected by aganglionosis increases. correlation scores for cell type proportions and extent of aganglionosis for each region of the bowel examined are summarized in table 4. given the presence of multiple lineages, including myofibroblasts, in colonies grown from cultured enteric ncps in vitro,11, 12, 30, 31 we anticipated the possibility of identifying cells within the ens that express neither neuronal nor glial markers. use of the sox10-cre transgene system revealed enteric nc derivatives that were not labeled by neuronal (hu+) or glial (foxd3 +) immunoreagents. however, these cells were extremely rare within myenteric ganglia and primary connectives with an average incidence of 1.5 cells in 1000 nc derivatives in the duodenum, 0.6 cells in 1000 in the ileum, and 6 cells in 1000 in the colon. the presence of this cell type did not statistically significantly differ between sox10 and sox10 in any region of the intestine tested (duodenum p =.41 ; ileum p =.90 ; colon p =.23) (figure 4a). furthermore, the proportions of this cell type did not correlate with the length of aganglionosis (table 4). concurrently, while evaluating neuron and glia proportions, we documented a relatively infrequent population of enteric nc - derived cells that expressed both neuronal (hu+) and glial (foxd3 +) markers. these cells were typically found in small clusters mainly as couplets, triplets, or quadruplets but occasionally found singularly (figure 4b). this cell type was very rare in both sox10 and sox10 mice, and its rate of appearance did not differ between sox10 and sox10 mice in the duodenum (p =.71) or ileum (p =.12). although they were still rare, sox10 mice had more of these double - positive cells within the colon (p <.005). on average, sox10 colon samples contained 40 hu+foxd3 + cells per 1000 nc derivatives whereas sox10 colons only contained 25 hu+foxd3 + cells per 1000 nc derivatives. unlike neurons and glia, the proportion of this cell type did not correlate with disease severity in the colon of sox10 mice (p =.80 ; r = 0.01). additionally, no correlations were identified for this cell type in regions of the small intestine (table 4). because clinicians have identified chronic constipation and incontinence as problematic long - term outcomes in hirschsprung patients, we examined the relative proportions of two resident neuronal subtypes in sox10 mutants with well - known roles in gi motility. calretinin is expressed in cholinergic neurons, and its presence identifies excitatory muscle motor neurons within the myenteric plexus as well as some interneurons and intrinsic primary afferent neurons.1, 32 therefore, alterations in calretinin - expressing (calretinin+) neuron numbers could affect intestinal contraction dynamics and overall motility. the proportion of calretinin+ neurons out of total neurons (hu+) in the myenteric plexus was quantified through ihc analysis (figure 5a). the proportion of calretinin+ neurons in sox10 mice duodenum was statistically significantly greater compared with sox10 littermates (p <.05) (figure 5b). calretinin+ neurons were also present in higher proportions in the ileum of sox10 mice (p <.03) (figure 5c). in sharp contrast to the findings in the small intestine, an overall decrease in the proportion of calretinin+ neurons was evident in the colon. greater variance in colonic calretinin+ neuronal subtype proportions was present in sox10 mutants compared with sox10 samples, similar to the effect seen for colonic neuronal and glial proportions. this analysis revealed that calretinin+ neuron proportions decrease dramatically as the length of aganglionosis increases (p <.0001, r = 0.84) (figure 5e). this effect was limited to the colon as calretinin+ neuron proportions did not correlate with length of aganglionosis in the duodenum nor ileum (table 4). to further define alterations in other motor neuron types, we evaluated neuronal nitric oxide synthase (nnos)-expressing neurons in sox10 mutants (figure 6a). nitrergic (nnos+) neurons in the myenteric plexus are primarily inhibitory motor neurons responsible for the relaxation of intestinal smooth muscle and also include some interneurons. interestingly, although calretinin+ neuron proportions were altered in the duodenum in sox10 mice, nnos+ neuron proportions were comparable between sox10 and sox10 animals (p =.68) (figure 6b). similarly, nnos+ proportions were nearly identical in the ileum between the two genotypes (p =.51) (figure 6c). however, there was a trending increase in nnos+ neuron proportions in the colon of sox10 mice compared with sox10 controls (p =.099) (figure 6d). while calretinin+ neuron proportions in the colon decreased as length of aganglionosis increased, the opposite was true for nnos+ neurons. animals with a greater extent of aganglionosis also exhibited a greater proportion of colonic nnos+ neurons (p =.0014, r = 0.74) (figure 6e). like the majority of cell types we evaluated, correlations for nnos+ neurons were only detected in the colon and not the duodenum and ileum (table 4). substantial numbers of hscr patients suffer gi dysfunction even after surgical resection of aganglionic regions. given the skewing of neuron proportions observed in sox10 animals resulting from increased calretinin+ neurons in the duodenum and ileum, we examined gi motility dynamics proximal to the colon in sox10 mice. to evaluate gastric emptying and small intestine transit rates, we gavaged fasted mice with a nonabsorbable fluorescent meal. gastric emptying was determined by calculating the proportion of fluorescent signal that had left the stomach to the total recovered fluorescence, and small intestine transit rates were determined by calculating the geometric mean of fluorescence within the small intestine.18, 19, 20 because distal intestinal obstruction and colonic distension can affect gi transit more proximally and pups with severe aganglionosis often succumb to megacolon around weaning, we chose to limit our analysis to more mature sox10 mice that survived past weaning to 4 weeks or 6 weeks of age. the sox10 animals that survive to adulthood typically have a short length of aganglionosis, reach their full adult size, and feed and breed normally. initially, gastric emptying and small intestine transit rates were compared in 4-week - old sox10 and sox10 animals. because hscr shows a sex bias in humans, with three in four hscr patients being male, we evaluated gi motility in both sox10 male and female mice. in 4-week - old animals, sox10 males had a statistically significantly slower small intestinal transit rate compared with sox10 males (p <.04) (figure 7a). nearly identical results were obtained for females, with 4-week - old sox10 females also showing statistically significantly reduced small intestinal transit rates (p <.006) (figure 7b). the gastric emptying rates were comparable between sox10 and sox10 mice for both sexes at this age (males : p =.96 ; females : p =.68) (figure 7a and b). these findings are not surprising given the skew of neuronal subtypes we observed in the small intestine of sox10 and the known outcomes among hscr patients. however, because neurally mediated traits are susceptible to change upon increased exposure to sex hormones,33, 34 gastric emptying and small intestine transit rates were also evaluated in older, sexually mature (6-week+) animals. for older male mice, we observed statistically comparable small intestine transit rates between sox10 males and their wild - type sox10 counterparts (p =.57). but, in contrast to the phenotype of 4-week - old males, we observed a marked increase in gastric emptying rates of 6-week - old sox10 males that was not observed in 6-week - old normal sox10 littermates (p <.005) (figure 7c). small intestine transit rates were comparable between 6-week - old sox10 and sox10 females (p =.31) (figure 7d). and, unlike the 6-week - old males, female 6-week - old sox10 and sox10 mice had comparable gastric emptying rates (p =.58) (figure 7d). to summarize, at an early age, both female and male sox10 mice have significant small intestine transit deficits ; however, in older sox10 animals, only males exhibit any type of motility defect. many hirschsprung patients suffer from severe bouts of enterocolitis, and previous studies reported that some animals with an ednrb hscr mutation suffer from enterocolitis that can ultimately lead to bowel perforation, sepsis, and death.22, 35 additionally, inflammatory processes within the bowel could potentially affect gi motility, making it difficult to determine whether gi motility deficits in sox10 mice result from changes in electrical properties due to ens deficits and/or influences of inflammatory processes on the bowel. to determine whether enterocolitis could be affecting gi motility in adult sox10 mice, we harvested entire colons from sox10 and sox10 6-week+ littermates. colons were stained with h&e and scored for inflammation by a pathologist blinded to genotype. we adopted a grading rubric for inflammation based on previous studies in hscr mouse mutants. briefly, each mouse was assigned an inflammation score (07) based on the severity (03) and depth (04) of inflammation. interestingly, sox10 mice had no or very little inflammation, comparable to their wild - type littermates (p =.99) (figure 8a and b). because males and females may differ in the levels of inflammation, we also compared inflammation scores by sex. even when separated by sex, we observed similar levels of inflammation in sox10 and sox10 mice (figure 8c and d). other hallmark features of hirschsprung disease as reported in hscr patients, such as regions of hypoganglionosis proximal to aganglionosis and thickened muscularis propria, were evident (figure 8a). given the intestinal transit alterations in sox10 and the lack of inflammation in this hscr model, our results suggest the motility deficits in this hscr model are neurally mediated. the sox10 hscr mutant is one of several hscr models frequently studied to better understand the nc deficits that give rise to aganglionosis.2, 9, 28, 36 the sox10 allele disrupts migration of enteric ncps and contributes to extensive colonic aganglionosis.37, 38 additionally, isolated sox10 enteric npcs do not produce a normal profile of cell lineages when cultured in vitro. despite the insights gained from studying the fetal effects of sox10 mutations on ncp migration and consequent aganglionosis, no prior efforts have investigated postnatal consequences of sox10 mutations on ganglionated regions. in this study, we undertook a comprehensive assessment of nc derivatives in the proximal, ganglionated intestine of sox10 mice to test the hypothesis that the sox10 mutation leads to imbalances in enteric nc - derived lineages and deficits in bowel function. our analysis revealed effects of the sox10 mutation on neuronal - glial lineage segregation in the colon but not the small intestine. interestingly, this study identified significant imbalances in proportions of excitatory and inhibitory enteric neurons accompanied by deficits in intestinal transit and gastric emptying. calretinin+ neurons with roles in muscle contraction were significantly increased in the duodenum and ileum while nnos+ neurons with roles in muscle relaxation were unchanged in these regions. sox10 effects on glial cell specification and ncp multipotency are well established in other aspects of the peripheral nervous system such as the dorsal root ganglion.10, 27, 28, 39 surprisingly, our analysis indicated no effect of the sox10 mutation on neuronal - glial balance in the duodenum and ileum although there was a statistically significant correlation between the proportion of neurons and glia in the sox10 colon and the overall extent of aganglionosis. it is possible that sox10 neurons and glia are born in equal proportions in the colon, with more neurons subsequently succumbing to apoptosis while glia persist. however, increased apoptosis has not been observed in several ens mutants to date.12, 40, 41 moreover, cell death can not adequately account for the observed increases in colonic nnos+ neuron proportions to levels well above the wild - type average in sox10 mice with severe aganglionosis. our study suggests that the timing of ncp lineage choice is likely a key factor in determining not only the length of aganglionosis but ultimately the proportions of enteric glia, neurons, and neuronal subtypes. it has been postulated that premature neuronal differentiation contributes to hscr disease by depleting the enteric ncp pool. premature ncp differentiation would not only exhaust the ncp pool, but may cause certain cell types to be born more or less often based on when (temporally) and where (local environment) lineage choice occurs. this phenomenon could account for the region - specific imbalance of different nc - derived cell types we observed in sox10 mice. such a possibility is corroborated by recent findings in the developing telencephalon, where oscillating or sustained expression of specific transcription factors controls whether neural progenitor cells go on to differentiate into specific cell types or continue to proliferate and give rise to daughter neural progenitor cells. given the diversity of cell types that can arise from cultured nc progenitors in vitro, we were not surprised to identify nc - derived cells in the intestine that did not label with neuronal or glial immunoreagents. these cells are infrequent and might represent a novel cell type or possibly cell turnover within ganglia. because proportions of these nc - derived cells were equivalent between p1519 sox10 and sox10 animals and because they were so rare, we did not attempt to characterize this lineage further. interestingly, in both sox10 and sox10 mice, we observed cells that double - labeled with neuronal (hu+) and glial (foxd3 +) markers. this cell type may represent either a novel lineage or a progenitor(s) undergoing differentiation. given their morphology and tendency to be found in clusters, these cells could also represent neural progenitors with adjacent daughter progenitors or daughter cells not fully committed to a specific cell type. the latter is certainly feasible given that foxd3 is expressed in enteric ncps as well as enteric glia.29, 44 enteric neural progenitors certainly exist in the adult intestine, and their exact location and nature are being actively investigated.21, 24, 31 however, no markers have been found that exclusively label neural stem cells in the intestine, convoluting efforts to characterize this cell type. if truly an enteric neural stem cell, the increase in this cell type in the sox10 colon might represent a futile attempt by the remaining neural stem cells to populate the hypoganglionic or aganglionic areas of the distal intestine. because hscr is a multigenic disorder, whereby an independent variant in any one of several genes can produce aganglionosis, our findings are potentially of broad relevance to other hscr models. hscr mouse models with deficiency of edn3 or ednrb were also found by sandgren (2002) and zaitoun (2013), respectively, to exhibit increases in nnos+ expressing neurons in the colons of these models.23, 45 however, nc - derived cell type proportions and their correlations with length of aganglionosis were not reported. our analysis benefited from the varying levels of aganglionosis present with the sox10 mutation on a mixed background, and this type of analysis may not have been possible in other hscr mouse models where extent of aganglionosis is confined to a small region of distal colon. this type of analysis is important, as similar perturbations of nc fate choice may be occurring in hscr patients and thus the length of aganglionosis could inform patient outcomes and care in the future. furthermore, these other studies did not evaluate any regions of the intestine proximal to the ileum. for the first time, we report alterations in nc - derived proportions (calretinin+ neurons specifically) within the proximal small intestine (duodenum) of a hscr mouse model. the mechanisms driving the altered proportions of nc derivates within hscr mutants are unclear at this time. prenatal obstruction (atresia) has been shown to affect nc derivatives in rats, and the extent of aganglionosis in the sox10 hscr model may effectively be producing a varying length of obstruction. we realize obstruction can not be excluded as a factor that impacts nc derivative choice ; however, sox10 mice are born in mendelian ratios relative to their wild - type littermates, and the majority survive to weaning, which suggests that obstruction does not play a large role prenatally. we specifically elected to examine p1519 pups for nc - derived lineages to ensure that the ens was fully developed and at the same time to try to avoid influences of obstruction on the ens. (the majority of sox10 mice that suffer from obstruction succumb to megacolon near or at weaning when they transition to solid food.) mice with deficits in ens patterning or ncp lineage segregation can exhibit altered gi motility even when no aganglionosis is present.9, 20 however, hscr models have not previously been evaluated for motility deficits within ganglionated regions of the small intestine. many studies limit their analysis to male mice, but we chose to examine both males and females given the difference in incidence of hscr and other neurodevelopmental disorders between males and females. in the sox10 model, we documented slower small intestine transit rates in 4-week - old males and females. because sox10 mice show increases in excitatory motor neurons (calretinin+) in the small intestine but no changes in inhibitory motor neurons (nnos+), we hypothesize that imbalances in motor neuron cell types cause changes in peristalsis coordination and/or neuron signaling. because other neuronal subtypes also affect motility, we can not at this time directly attribute these changes in gi motility to our findings in calretinin+ and nnos+ neurons. however, given that calretinin+ and nnos+ neurons comprise the majority of motor neurons in the myenteric plexus, our hypothesis provides a plausible and attractive explanation. in contrast with our results in young animals, mature sox10 and sox10 mice showed comparable small intestine transit rates. it could be that the sox10 intestine adapts or compensates for deficits as the ens matures or that we have selected for more mildly affected mice at this age, as many severely affected animals succumb to hscr megacolon near weaning. however, we also observed increased gastric emptying in older sox10 males that we did not see in females, a result that was unexpected. increased gastric emptying in hscr mouse models has not previously been reported, and the underlying physiologic basis for this effect in males is not clear. for many neurodevelopment diseases, females are postulated to be protected or differentially affected due to circulating sex hormones while males are more susceptible.33, 34 this tendency for males to be more severely affected by neurodevelopmental disorders may explain why males are afflicted more often with hscr than females (3:1) and could explain why 6-week - old sox10 males have increased gastric emptying rates, but not females. furthermore, increased gastric emptying rates may confound small intestine transit rates because gastric contents are more rapidly entering the small intestine. therefore, it is possible that our sox10 males still have a decreased small intestine transit rate compared with their wild - type counterparts but this phenotype is being masked by increased gastric emptying. our analysis is the first report of altered gastric emptying and small intestine transit in a hscr mouse model. not surprisingly, given the presence of distal bowel aganglionosis, prior studies have reported altered or absent colonic migratory complexes in gdnf, edn3, and ednrb hscr mutants.23, 45, 48, 49 additionally, while most studies limit their analysis to male mice, our studies identified novel deficits in gastric emptying as well as small intestine transit for the sox10 hscr mouse model that are age and sex dependent. whether alterations in gastric emptying or small intestine transit are present among other hscr mutant alleles remains to be seen. future analyses are required to determine the exact electrophysiologic changes within the ens in sox10 mice and other hscr mutants and to ascertain whether other cell types that contribute to motor activity (such as serotonergic neurons or interstitial cells of cajal) are perturbed. similarities and disparities in outcomes between hscr mutant models should help elucidate exactly when and where hscr genes act within hscr gene pathways. despite the fact that infection and inflammatory processes are known to affect gi transit speed, we saw no difference in colonic inflammation between sox10 and sox10 adult mice. this finding further suggests that the differences in gastric emptying and small intestine transit are most likely driven by neural mechanisms. it remains to be seen whether sox10 mice are more or less susceptible to inflammation when challenged by surgery, infection, or chemical treatment. some hscr patients and mouse models are susceptible to enterocolitis, but the mechanisms driving this susceptibility are still not well understood.7, 22, 35 collectively, this study demonstrates for the first time skewed enteric nc derivative proportions and altered gi motility in the small intestine of a hscr mouse model. these findings demonstrate a role for sox10 in nc lineage specification in vivo in the ens. moreover, our results suggest a novel role for sox10 in neuronal subtype choice and demonstrate that perturbations in sox10 can affect gi transit in ganglionated regions of the intestine. different regions of the sox10 intestine were found to have distinct abnormalities, and gi transit assays revealed sex- and age - dependent effects, suggesting that timing and environment play a key role in not only nc lineage segregation but ultimately functional outcomes. | background & aimsin hirschsprung disease (hscr), neural crest - derived progenitors (ncps) fail to completely colonize the intestine so that the enteric nervous system is absent from distal bowel. despite removal of the aganglionic region, many hscr patients suffer from residual intestinal dysmotility. to test the hypothesis that inappropriate lineage segregation of ncps in proximal ganglionated regions of the bowel could contribute to such postoperative disease, we investigated neural crest (nc)-derived lineages and motility in ganglionated, postnatal intestine of the sox10dom/+ hscr mouse model.methodscre-mediated fate - mapping was applied to evaluate relative proportions of nc - derived cell types. motility assays were performed to assess gastric emptying and small intestine motility while colonic inflammation was assessed by histopathology for sox10dom/+ mutants relative to wild - type controls.resultssox10dom/+ mice showed regional alterations in neuron and glia proportions as well as calretinin+ and neuronal nitric oxide synthase (nnos)+ neuronal subtypes. in the colon, imbalance of enteric nc derivatives correlated with the extent of aganglionosis. all sox10dom/+ mice exhibited reduced small intestinal transit at 4 weeks of age ; at 6 weeks of age, sox10dom/+ males had increased gastric emptying rates. sox10dom/+ mice surviving to 6 weeks of age had little or no colonic inflammation when compared with wild - type littermates, suggesting that these changes in gastrointestinal motility are neurally mediated.conclusionsthe sox10dom mutation disrupts the balance of nc - derived lineages and affects gastrointestinal motility in the proximal, ganglionated intestine of adult animals. this is the first report identifying alterations in enteric neuronal classes in sox10dom/+ mutants, which suggests a previously unrecognized role for sox10 in neuronal subtype specification. |
our study involved participants drawn from the whitehall ii epidemiological cohort (24) for psychophysiological testing between 2006 and 2008. the criteria for entry into the study included no history or objective signs of clinical or subclinical cvd and no previous diagnosis or treatment for hypertension, inflammatory diseases, allergies, or kidney disease. cvd was defined as prior mi, stable or unstable angina, revascularization procedure, heart failure, transient ischemic attack, stroke, or electrocardiographic abnormalities (resting 12-lead electrocardiograms were taken). this information was confirmed by a telephone interview and verified from clinical data collected from the previous 7 phases of the whitehall ii study. volunteers were of white european origin, aged 53 to 76 years ; 56.5% were in full - time employment. selection was stratified by grade of employment (current or most recent) to include higher and lower socioeconomic status participants. from the initially invited participants (n = 1,169), 27.6% were not eligible (mainly because of prescribed medications) and 25.9% declined to take part. participants were prohibited from using any antihistamine or anti - inflammatory medication for 7 days before testing and were rescheduled if they reported colds or other infections on the day of testing. participants gave full informed consent to participate in the study, and ethical approval was obtained from the university college london hospitals committee on the ethics of human research. we carried out psychophysiological stress testing in either the morning or afternoon in a light temperature - controlled laboratory. this procedure was based on a protocol previously used in this laboratory (25). participants were instructed to refrain from drinking caffeinated beverages and smoking for at least 2 h before the study and not to have performed vigorous physical activity or consumed alcohol the previous evening. after a 30-min rest period, baseline blood pressure (using an automated ua-779 digital monitor [a&d instruments ltd., oxford, united kingdom ]) and a saliva sample were taken. two behavioral tasks, designed to induce mental stress, were then administered in random order. the tasks were a computerized version of the stroop task and mirror tracing, both of which have been used extensively in psychophysiological research (26). the tasks each lasted for 5 min. saliva samples were collected immediately before and after the tasks for the assessment of salivary cortisol. the samples were collected using salivettes (sarsted, leicester, united kingdom), which were stored at 30c until analysis. levels of cortisol were assessed using a time - resolved immunoassay with fluorescence detection at the university of dresden (dresden, germany). the intra - assay and interassay coefficients of variation (cvs) were less than 8%. nonfasting blood samples were collected in edta tubes and centrifuged immediately at 2,500 rpm for 10 min at room temperature. plasma was removed from the tube and aliquoted into 0.5-ml portions and stored at 80c until analysis. we measured ctnt concentrations 75 min after the end of the mental stress test using a highly sensitive assay on an automated platform (elecsys-2010 troponin t hs stat, roche diagnostics, haywards heath, united kingdom), with a lower detection limit of 3 ng / l and a reported 99th percentile value in apparently healthy individuals of 13.5 ng / l, at which the cv is 9%, confirmed by in - house studies (1719). we assayed baseline plasma interleukin (il)-6 using a quantikine high - sensitivity 2-site enzyme - linked immunosorbent assay (elisa) from r&d systems (oxford, united kingdom). the sensitivity of the assay ranged from 0.016 to 0.110 pg / ml, with intra - assay and interassay cvs of 7.3% and 7.7%, respectively. baseline c - reactive protein (crp) level was measured using a high - sensitivity elisa (r&d systems). cac was assessed with electron - beam computed tomography (imatron c-150, general electric, san francisco, california) as previously described (27). in brief, 40 contiguous 3-mm slices were obtained during a single breath - hold starting at the carina and proceeding to the level of the diaphragm. scan time was 100 ms / slice, synchronized to 40% of the r - r interval. agatston and volumetric calcium scores were calculated to quantify the extent of cac by a single experienced investigator blinded to the psychophysiological and clinical data on an aquarius workstation (terarecon inc., san mateo, california). because calcified volume was highly correlated with agatston score (spearman rho 0.99), we present data for agatston score only. participants reported current smoking levels, weekly alcohol intake (units per week), employment grade (as a marker of social position), and hours of moderate or vigorous physical activity per week. we measured height and weight in light clothing for calculation of body mass index (bmi). total and high - density lipoprotein (hdl) cholesterol and triglycerides were measured within 72 h in serum stored at 4c using enzymatic colorimetric methods (28). low - density lipoprotein (ldl) cholesterol level was derived using the friedewald equation (29). glucose homeostasis was assessed from glycosylated hemoglobin (hba1c) concentration, assayed using boronate affinity chromatography, a combination of boronate affinity and liquid chromatography. we quantified the cortisol response to stress by subtracting the values of salivary cortisol concentration measured immediately after the behavioral tasks from the baseline. the resulting measure was normally distributed, and it was transformed for the main analyses into a binomial variable using a cut point at the value of 4 nmol / l, which corresponds to the mean value (0.54 nmol / l) + 1 sd (3.47 nmol / l). hs - ctnt was highly right skewed and was undetectable for 83.3% of the sample (below the lower detection limit of 3 ng / l) ; therefore, it was transformed into a binomial variable (detectable vs. undetectable). agatston score (cac) had a right - skewed distribution and was transformed for some analyses into a binomial variable by cutting at the value of zero (0 vs. > 0) or 100 (0) or 100 (35 the final analytic sample comprised 508 participants (mean age of 62.9 5.7 years and 55.1% men). the sample is described according to cortisol stress response in table 1 and according to hs - ctnt categories in table 2. older and male participants were more likely to have detectable hs - ctnt and higher salivary cortisol responses to stress tasks. hs - ctnt, cortisol response, and cac appeared to be associated with each other : participants with detectable levels of hs - ctnt were more likely to have higher cortisol responses and cac (table 2), and participants having high cortisol responses were more likely to have cac 100 (table 1). participants with cortisol responses < 4 nmol / l were more likely to be smokers, and those with detectable levels of hs - ctnt had higher il-6 plasma concentrations (tables 1 and 2). baseline cortisol was not associated with hs - ctnt either in bivariate or multivariate models. we found a robust association between cortisol response and detectable hs - ctnt (odds ratio [or ] : 3.83 ; 95% confidence interval [ci ] : 1.86 to 7.90 ; p < 0.001). after adjustment for demographic variables and cardiovascular risk factors, the association between cortisol response and detectable hs - ctnt did not differ from that in the unadjusted analysis. after further adjustments for crp and il-6, the association remained (or : 3.98 ; 95% ci : 1.60 to 9.92 ; p = 0.003). the adjustment for cac score as a binary variable did not change the effect estimates. in sensitivity analyses, the results remained unchanged after further adjustment for physical activity, bmi, alcohol consumption, and ldl cholesterol (data not shown). we also performed sensitivity analyses using different approaches to quantify the cortisol stress response, although the same pattern of results emerged. for example, after treating the stress response as a linear proportional change in cortisol, the fully adjusted or for hs - ctnt was 1.38 (95% ci : 1.10 to 1.73 ; p = 0.005) for each unit increase in change. when we restricted the analysis to participants without detectable coronary calcification, the evidence of association remained despite the 40% drop in sample size (n = 222 ; or : 4.77 ; 95% ci : 1.22 to 18.72 ; p = 0.025). when the analysis was restricted to participants with coronary calcification and adjusted for agatston cac score as a log - linear variable, the association between cortisol stress responses and ctnt concentration remained (n = 286 ; or : 7.39 ; 95% ci : 2.22 to 24.64 ; p = 0.001) (table 3). our results suggest that in healthy participants with no history of cvd, a heightened cortisol response to mental stress is associated with detectable concentrations of circulating ctnt when measured using a high - sensitivity assay. these findings add to previous data from our laboratory that demonstrate an association between cortisol reactivity and cac (12,13). however, importantly, although this study confirms the findings from other work that stress responsivity is associated with increased cac (12), the association between cortisol stress responses and circulating ctnt was independent of cac, a reliable indicator of subclinical coronary atherosclerosis. therefore, cortisol may be involved in structural and functional adaptations to the heart as well as in the atherosclerotic process. the prevalence of detectable hs - ctnt in our british sample was 16.7%, which is similar to levels reported (15.7%) in a nationally representative cvd - free population sample in the united states (20). to our knowledge, this is the first study to examine the association between mental stress and ctnt in humans. our data are consistent with research on stress - induced takotsubo cardiomyopathy, in which emotional stress increases troponin and cortisol levels in the absence of coronary artery disease (31,32) (33), who showed that mental stress in laboratory animals increases troponin levels. although stress responses seem to be positively correlated with troponin, evidence for a direct or indirect glucocorticoid modulation of troponin is still scarce. the troponin gene contains a transcription factor binding site (34,35), previously shown to bind the activated glucocorticoid receptor (36). despite the presence of this binding site, the effect of glucocorticoids on troponin levels does not seem to be via direct modulation of gene expression (3741). cortisol has a strong diurnal pattern that can cause difficulties in the interpretation of the data ; we dealt with this issue by considering stress response as the difference between the post - test and pre - test measurements and by adjusting for cortisol baseline level and day and time of testing at the data analysis stage. we also performed sensitivity analyses using different approaches to quantify the cortisol stress response, although the same pattern of results emerged. it is possible that the cortisol response to stress contributes to the increased levels of troponin t observed here by several indirect mechanisms. first, oxidative stress could play a role in cortisol - induced troponin release (42,43). supporting this hypothesis, the temporal change in serum troponin levels matches the increase in the concentration of myocardial malondialdehyde, a marker of free radical lipid peroxidation (44). second, stress - induced cortisol levels could increase troponin levels by modulating ion channels. for example, dexamethasone, a synthetic glucocorticoid, significantly increases the l - type ca currents in neonatal rat cardiomyocytes (45) and accelerates myocyte spontaneous contractions (46). finally, cortisol responses to stress could induce troponin levels by potentiation of adrenergic signaling. corticosteroid - potentiated adrenergic signaling increases mineralocorticoid and glucocorticoid receptor expression and function in cardiomyocytes (47). detectable hs - ctnt is associated with noncardiac conditions such as severe renal disease (48,49), and theoretically, our results could be due to confounding if patients with renal disease are more likely to test positive on mental stress tests. however, it is unlikely that this mechanism underlies our results because the study participants were free from any chronic conditions at the time of testing, as explained in the methods section. the effect of stress - related cortisol release on cardiomyocytes may be mediated by atherosclerosis and consequent ischemia, although the adjustments for cac, which is a recognized index of atherosclerosis, did not attenuate the findings. cac and hs - ctnt do not appear to lie on the same causal pathway because their effect was not diminished by mutual adjustment, despite being correlated with each other. noncalcified coronary plaques are not detectable using cardiac computed tomography, and that may partly explain why cac did not attenuate the association between cortisol and hs - ctnt. however, there is a direct relationship between the number of calcified plaques present and total plaque burden, and cac correlates highly with the severity of coronary artery disease ; therefore, the absence of calcification implies that there is probably little significant coronary artery disease (50). on the other hand, it has been argued that raised troponin t levels may be due to occult or undetected plaque rupture (51), and it is known that plaque rupture is a relatively common event that is usually not followed by an acute cardiac event (52). this process may have operated in our patients with minimal cac score levels and detectable hs - ctnt. a single measure of plasma hs - ctnt concentration can not be regarded as a robust test if it is not stable in time (i.e., if it shows remarkable intraindividual short - term variation). however, the results from the aric (atherosclerosis risk in communities) study showed that hs - ctnt intraindividual variability over 6 weeks is almost null, with a correlation coefficient of 0.94 (53). thus, although our study collected hs - ctnt after a brief and moderately stressful behavioral challenge, it is improbable that troponin t was released in response to this task. to the contrary, we hypothesized that high cortisol responders are individuals who are hyperreactive to mental stress in everyday life. if these responses are elicited on a regular basis over extended periods of time, they might lead to chronic elevations in hs - ctnt concentrations. this was a cross - sectional study, and therefore, we can not determine the causal sequence. heightened cortisol stress responsivity may contribute to early signs of cvd, or people at an early stage of cardiac disease may be more prone to disturbed stress responses. in fact, cardiac troponins are the most sensitive and specific biochemical markers of myocardial damage (54), but their elevation can be due to a variety of reasons such as pericarditis, myocarditis, pulmonary embolism, and others (55). however, it is unlikely that the undetected presence of those conditions can explain our findings because no participants reported any symptoms or signs of cardiac disease ; had any previous diagnosis of or treatment for hypertension, inflammatory disease, or allergies ; and did not show any electrocardiographic indications of congenital heart disease on tests carried out over more than 20 years in the whitehall ii study. moreover, we found a strong association in people with and without coronary calcification, which is consistent with another study showing that hs - ctnt is predictive of cvd in healthy people and of secondary events in patients with cvd (56). it is interesting to note that detectable levels of hs - ctnt were associated with salivary cortisol response to stress test but not with its baseline levels (pre - test), corroborating its relationship with stress - induced neuroendocrine dysregulation. heightened cortisol responses to mental stress were associated with detectable levels of ctnt using high - sensitivity assays in the plasma of healthy people. heightened stress - induced cortisol release may increase the risk of chd through several pathways, including atherosclerotic processes, or other indirect effects on the cardiomyocytes. further research is needed to understand the role of psychosocial stress in the pathophysiology of cardiac cell damage. | objectivesthe objective of this study was to examine the association between cortisol response to mental stress and high - sensitivity cardiac troponin t (hs - ctnt) in healthy older individuals without history of cardiovascular disease (cvd).backgroundmental stress is a recognized risk factor for cvd, although the mechanisms remain unclear. cortisol, a key stress hormone, is associated with coronary atherosclerosis and may accentuate structural and functional cardiac disease.methodsthis cross - sectional study involved 508 disease - free men and women aged 53 to 76 years drawn from the whitehall ii epidemiological cohort. we evaluated salivary cortisol response to standardized mental stress tests (exposure) and hs - ctnt plasma concentration using a high - sensitivity assay (outcome). we measured coronary calcification using electron - beam dual - source computed tomography and agatston scores.resultsafter adjustment for demographic and clinical variables associated with cvd as well as for inflammatory factors, we found a robust association between cortisol response and detectable hs - ctnt (odds ratio [or ] : 3.98 ; 95% confidence interval [ci ] : 1.60 to 9.92 ; p = 0.003). the association remained when we restricted the analysis to participants without coronary calcification (n = 222 ; or : 4.77 ; 95% ci : 1.22 to 18.72 ; p = 0.025) or when we further adjusted for coronary calcification in participants with positive agatston scores (n = 286 ; or : 7.39 ; 95% ci : 2.22 to 26.24 ; p = 0.001).conclusionswe found that heightened cortisol response to mental stress was associated with detectable plasma levels of ctnt using high - sensitivity assays in healthy participants, independently of coronary atherosclerosis. further research is needed to understand the role of psychosocial stress in the pathophysiology of cardiac cell damage. |
it is certain that the main cause of cardiovascular diseases (cvd) backs to early childhood (1 - 4). impairment in the metabolism of carbohydrates leads to increased mortality and morbidity of cardiovascular diseases (5). the number of type ii diabetic patients is increasing in the world, and many of them remain undiagnosed. the cardiovascular risk of undiagnosed diabetes is the same or higher than the previously diagnosed ones (6). metabolic syndrome is a set of major risk factors for cvd with high blood glucose being one of them (7 - 10). obesity, particularly central obesity is associated with insulin resistance (10 - 12). during recent decades, the prevalence of obesity in children is increasing and it is expected that impairment in carbohydrate metabolism would be more prevalent (8, 9, 13). therefore, identifying children susceptible to abnormal carbohydrate metabolism, which has a decisive role in cvd or diabetes, is of vital importance (14). those persons having impaired fasting glucose (ifg) and/or impaired glucose tolerance (igt), who are at higher risk of diabetes, are called " prediabetics " (15 - 17). a " prediabetic " state is an intermediary and returnable condition of carbohydrate metabolism disorder before getting diabetes ii (18). in other words, ifg and igt are intermediate stages of disordered carbohydrate metabolism between normal glucose homeostasis and diabetes (15). identifying children at risk and taking intervening measures can have an effective role in preventing cvd and reducing long - term mortality and morbidity (19). regarding that there was no documented data on blood glucose of birjandi children, the present study aimed at determining the prevalence of diabetes and prediabetes of this population. this cross - sectional and descriptive study was done on 1530 elementary students aged 6 - 11 years. proportional multiple cluster method was applied for choosing the samples. according to the socioeconomic levels, birjand city is divided into five regions. in following, state - run elementary schools of each region as well as private schools were evaluated. considering the distribution of schools in different districts of the city, 10 elementary schools for girls and boys were selected. then, with respect to the population of the respective school and the class, a number of students were chosen from each class. based on the above procedure, 1700 students were chosen and a demographic questionnaire together with a consent form was sent to their parents. the parents were asked to fill the questionnaire and the consent forms at home and return it to the school. we received 1530 completed questionnaires. according to the plan, the students were referred to a diagnostic clinic where a blood sugar sample after a 12-hour fasting was taken from each individual. the obtained samples were immediately centrifuged and sugar levels determined through enzymatic procedure using german rosh kits. the standard by which impairment in fbs would be identified was that of ada, i.e. fbs 100 mg / dl, but 126 mg / dl (mean : 151.8 15.4). mean fbs in the whole population was proportional to age, which was statistically significant (p 100 mg / dl, as one of the components of metabolic syndrome, was significantly higher than in the controls (30.6% of patients vs 14.3%, or = 2.65 (5.4 - 1.3), p = 0.006) (24). another study conducted on stroke patients by dehghani firoozabadi. showed a high (14.9%) prevalence of diabetes in these patients (25). according to our and other studies (18, 26) mean fbs of boys was higher, this causes them to be at higher risk for a prediabetic condition. puberty is associated with drastic changes in size, shape, and composition of the body. while girls have higher total body fat percentage during puberty, boys suffer more from central obesity (18). our study showed that girls fbs reached its peak at about the age of 10, but it suddenly declined afterward ; however, on the other side, boys ' fbs showed the monotonic increase all over the range of ages in this study (figure 1). the variation in blood glucose level at different ages and in both sexes is associated with pre and post pubertal hormonal changes (27). herein, we found the trend of fbs increasing in both sexes up to age 11 - 14 years. this increase in fbs is attributed to the child 's growth and multiple hormonal changes effective on different metabolic patterns. moreover, the effect of estrogen and androgen on carbohydrate metabolism and on serum lipoproteins has been confirmed by other investigators. proneness to decrease fbs around the time of puberty is probably due to the effect of sex and/or growth hormones on carbohydrate metabolism (28, 29). regarding that diabetes complications such as nephropathy and retinopathy are proportionate to the duration of diabetes, early diagnosis and proper control of high fbs in normoglycemic range during childhood and puberty can effectively prevent the incidence of diabetes ii or postpone it to the end of lifespan (18). although the present study shows that the population of children with fbs impairment and diabetic children is not significant, the relatively high percentage of children with high fbs but within normal limit can be predictive of following risk for developing diabetes during youth, middle age, and old age. this is a warning and can, as a principle element of metabolic syndrome, increase the probability of the problem and be an important factor in the epidemic of cvd during following years. in order to study the final outcome of children 's fbs impairment, prospective researches are required. the results of the present study can be used as a basis in following studies. in summery, some of the most important factors affecting reduction of long - term morbidity and mortality are screening and assessing of children at risk, then identifying precursors and controlling them, correcting life style and nutrition of children, periodic later studies, and warning families and state health planners. some limitations to the present study were : the study was cross - sectional because of the unavailability of information about nutrition and economic status of the subjects, determining the extent of influence of above factors on fbs was not possible. although for detecting abnormal carbohydrate metabolism, igt test is a better test than fbs, its application to such a large population of children to be screened was not possible. | background : diabetes is associated with increased cardiovascular disease, mortality and morbidity.objectives:the present study aimed at assessing fasting blood sugar (fbs) in elementary school students in birjand, 2012.materials and methods : this cross - sectional and descriptive study was done on 1530 elementary school students who had been selected through multiple cluster sampling. fbs of these students was tested applying the enzymatic process. the obtained data was analyzed by means of spss software (v15) and statistical tests t and x2.results:in this study, 833 girls and 697 boys were evaluated. mean fbs of the whole study population was 86.9 8.8 mg / dl ; fbs was higher in boys compared to girls. fbs of 1453 (95%) children was 126 mg / dl. mean fbs increased in proportion to age, which was statistically significant.conclusions:although the prevalence of diabetes is not considerable ; however, based on the relatively high portion of those children with high degree of blood glucose in the range in which the risk of diabetes and prediabetes in the following years rises dramatically, the need for further care of health authorities, an extensive screening activity, and undertaking intervening measures to prevent the epidemic of diabetes and consequently cardiovascular disease is emphasized. |
in total 99 isolates identified biochemically as members of the genus aeromonas randomly selected from a large collection of nearly 400 aeromonads isolated from different sources during the past two decades in tripoli, libya, were included in the present investigation. the strains were obtained from diarrheal children (n=23), non - diarrheal children (n=16), untreated drinking water from wells (n=32), and chicken carcasses (n=28). the organisms were isolated from stool, chicken, and water samples using standard bacteriological procedures as reported previously (11). all organisms were identified by biochemical tests and api 20e (biomerieux, marcy l'etoile, france). strains were then inoculated into semi - solid nutrient agar in duplicates and maintained at ambient temperature until further characterized. genospecies was determined using a combination of 16s rdna (12), and gyrb (13) sequencing analysis described previously (14). a loopful of a fresh overnight growth from each aeromonas isolate cultured on macconkey - lactose agar (oxoid, hampshire, united kingdom) was suspended in 400 l sterile deionized water, boiled for 10 min and transferred to ice for 5 min. cell debris was pelleted by centrifugation at 12,000g for 3 min (15), the supernatant was transferred to a new tube and refrigerated until use. pcr amplicons were purified using the pcr purification kit (qiagen, valencia, ca) according to the manufacturer 's specifications. nucleotide sequence was determined using dye terminator chemistry and cycle sequencing products were purified prior to loading on an abi prism 3,100 genetic analyzer (applied biosystems, foster city, ca) using a dyeex purification kit (qiagen). sequence files were assembled using bioedit version 7.0.1 (16) and aligned with clustal x (17). phylogenetic trees were constructed using the neighbor - joining method with genetic distance calculated using the kimura two - step algorithm. bootstrap analysis (19) was performed with 2,000 samplings and values below 70% were excluded as non - significant. in total 52 aeromonads (12 from diarrheal children, 12 from non - diarrheal children, 17 from chicken carcasses, and 11 from untreated drinking water from wells) were examined for the genes aer, act, ast, and alt using pcr techniques and sequencing as reported previously (8, 2022). in addition, isolates were tested for their cytotoxic activity in vero cell tissue culture using a previously described procedure (23). in total 99 isolates identified biochemically as members of the genus aeromonas randomly selected from a large collection of nearly 400 aeromonads isolated from different sources during the past two decades in tripoli, libya, were included in the present investigation. the strains were obtained from diarrheal children (n=23), non - diarrheal children (n=16), untreated drinking water from wells (n=32), and chicken carcasses (n=28). the organisms were isolated from stool, chicken, and water samples using standard bacteriological procedures as reported previously (11). all organisms were identified by biochemical tests and api 20e (biomerieux, marcy l'etoile, france). strains were then inoculated into semi - solid nutrient agar in duplicates and maintained at ambient temperature until further characterized. genospecies was determined using a combination of 16s rdna (12), and gyrb (13) sequencing analysis described previously (14). a loopful of a fresh overnight growth from each aeromonas isolate cultured on macconkey - lactose agar (oxoid, hampshire, united kingdom) was suspended in 400 l sterile deionized water, boiled for 10 min and transferred to ice for 5 min. cell debris was pelleted by centrifugation at 12,000g for 3 min (15), the supernatant was transferred to a new tube and refrigerated until use. pcr amplicons were purified using the pcr purification kit (qiagen, valencia, ca) according to the manufacturer 's specifications. nucleotide sequence was determined using dye terminator chemistry and cycle sequencing products were purified prior to loading on an abi prism 3,100 genetic analyzer (applied biosystems, foster city, ca) using a dyeex purification kit (qiagen). sequence files were assembled using bioedit version 7.0.1 (16) and aligned with clustal x (17). phylogenetic trees were constructed using the neighbor - joining method with genetic distance calculated using the kimura two - step algorithm. bootstrap analysis (19) was performed with 2,000 samplings and values below 70% were excluded as non - significant. a loopful of a fresh overnight growth from each aeromonas isolate cultured on macconkey - lactose agar (oxoid, hampshire, united kingdom) was suspended in 400 l sterile deionized water, boiled for 10 min and transferred to ice for 5 min. cell debris was pelleted by centrifugation at 12,000g for 3 min (15), the supernatant was transferred to a new tube and refrigerated until use. pcr amplicons were purified using the pcr purification kit (qiagen, valencia, ca) according to the manufacturer 's specifications. nucleotide sequence was determined using dye terminator chemistry and cycle sequencing products were purified prior to loading on an abi prism 3,100 genetic analyzer (applied biosystems, foster city, ca) using a dyeex purification kit (qiagen). sequence files were assembled using bioedit version 7.0.1 (16) and aligned with clustal x (17). phylogenetic trees were constructed using the neighbor - joining method with genetic distance calculated using the kimura two - step algorithm. bootstrap analysis (19) was performed with 2,000 samplings and values below 70% were excluded as non - significant. in total 52 aeromonads (12 from diarrheal children, 12 from non - diarrheal children, 17 from chicken carcasses, and 11 from untreated drinking water from wells) were examined for the genes aer, act, ast, and alt using pcr techniques and sequencing as reported previously (8, 2022). in addition, isolates were tested for their cytotoxic activity in vero cell tissue culture using a previously described procedure (23). of the 99 isolates, we identified 44 isolates (44%) as a. hydrophila (3 [3.0% ] subspecies anaerogenes, 23 [23% ] subspecies dhakensis, and 18 [18% ] subspecies ranae) ; 27 isolates (27%) as a. veronii ; 23 isolates (23%) as a. caviae ; and 5 isolates (5.1%) as other genospecies (table 1). a. hydrophila was common in water samples (84.4%) compared with diarrheal and non - diarrheal stool (33.3%) and chicken (14.3%) samples ; a. veronii in chicken samples (60.7%) compared with diarrheal and non - diarrheal stool (23.1%) and water (3.1%) samples ; and a. caviae in stool samples from diarrheal and non - diarrheal children (41.0%) compared with water (6.3%) and chicken (17.9%) samples. the genes aer, act, and ast were detected in 45 (87%), 4 (7.7%), and 9 (17%), respectively (table 2). cytotoxicity to vero cells was observed in 7 of 12 (58%) aeromonads from diarrheal, 4 of 12 (33%) from non - diarrheal children, 8 of 11 (73%) from water, and 10 of 17 (59%) from chicken carcasses. genospecies of aeromonads isolated from different sources in tripoli, libya significantly higher than prevalence among diarrheal stool isolates, non - diarrheal stool isolates and chicken isolates (p<0.0002, or=10.13 ; p<0.0003, or=11.88 and p<0.0000002, or=32.40, respectively). significantly higher than prevalence among water isolates (p<0.005, or=13.56). significantly higher than prevalence among diarrheal children stool isolates and water isolates (p<0.04, or=3.53 and p<000002, or=47.91, respectively). significantly higher among diarrheal stool isolates (p<0.007, or=8.00 and non - diarrheal stool isolates (p<0.0005, or=15.00) than among water isolates. virulence genes in aeromonas from libya aer = aerolysin, act = aeromonas hydrophila cytolytic enterotoxin, ast = aeromonas hydrophila isolate ssu enterotoxin, alt = aeromonas extracellular lipase. significantly higher than in diarrheal children, non - diarrheal children and chicken samples (p<0.03, odds ratio [or]=unidentified ; p<0.03, or = unidentified and p<0.08, or - undefined, respectively). significantly higher than diarrheal children, non - diarrheal children and chicken samples (p<0.003, or = unidentified ; p<0.003, or = unidentified and p<0.05, or=5.60, respectively). previous studies conducted in libya found aeromonas species in 4.2 to 14.6% of diarrheal children (2426). in one of these studies (24) phenotypic speciation using aerokey ii (27) showed predominance of a. caviae, followed by a. veronii, and a. hydrophila. abdullah. (28) genotyped eight aeromonads from diarrheal libyan children by pcr - restriction fragment length polymorphism (pcr - rflp) analysis of 16s rrna genes : four (50%) were a. caviae, three (37.5%) were a. veronii, and one (12.5%) was a. hydrophila. in the present investigation, the genospecies a. caviae predominated, followed by a. hydrophila (mainly subspecies dhakensis and subspecies ranae), and a. veronii, among aeromonads from diarrheal and non - diarrheal children. predominance of these three genospecies was also observed among aeromonads from chicken and water samples, accounting for 95% (94/99) of total isolates tested. these genospecies account for the majority of aeromonads reported from different sources in developed and developing countries (6, 7). the remaining 5% (5/99) of aeromonads investigated belonged to genospecies a. enteropelogenes clx204, a. culicicola, and a. allosaccharophila. these aeromonads are recognized aeromonas species with uncertain taxonomic status, with the latter two not being isolated from clinical material (29), indicating they may have no role in human disease. in agreement with our findings, a previous study reported the predominance of a. caviae genospecies among aeromonads from diarrheal and non - diarrheal children attending clinical research and service centre of the international centre for diarrhoeal disease research in dhaka, bangladesh (icddr - b) (30). recently, carvalho. (31) identified 80 distinct aeromonas strains by gyrb - based phylogenetic analysis among a collection of 206 isolates from untreated waters used for human consumption in portugal that were discriminated by random amplified polymorphic dna - pcr (rapd - pcr). the most common genospecies detected was a. hydrophila (26%) followed by a. media (23%). in agreement with their finding, we identified the majority of aeromonads in untreated well water as a. hydrophila, but at a much higher rate (84%). chicken carcasses may also become contaminated with aeromonads during the washing and cleaning of such carcasses with aeromonas - contaminated water. (32) found aeromonas species in more than 75% (218/290) of frozen chicken carcasses sold at retail outlets in tripoli, libya. there is lack of data on genospeciation of aeromonads from chicken by gyrb - based phylogenetic analysis. rflp analysis of 16s rrna genes, identified 30 of 32 (94%) isolates from chicken carcasses in libya as a. veronii. in the present study, more than 60% of isolates from chicken samples were a. veronii. therefore, it is important to detect virulence factors in aeromonads isolated from children in a matched case - control study of diarrhea in such countries. hemagglutination (ha) of erythrocytes is associated with the ability of enteric bacteria to adhere to human epithelial cells. burke. (33) reported that enterotoxigenic a. hydrophila isolates showed ha resistant to mannose and to fucose, whereas non - enterotoxigenic a. caviae commonly isolated from the environment or non - diarrheal individuals showed mannose - sensitive ha. examination of aeromonas isolated in libya for genes coding for virulence factors indicated that the aer gene was commonly present across all sample sources (86%). however, we did not find statistical significance between the presence of aer and sample source or genospecies (data not shown). aerolysin is a pore forming toxin and is regarded as the most important virulence factor in aeromonas food poisoning and one of the major virulence factors in gastroenteritis (8, 34, 35). a previous study from libya (28) reported aerolysin - like hemolysin gene sequences in 100% of 52 aeromonas isolates from children with diarrhea, chicken carcasses, and a hospital environment. ottaviani. (36) observed aer, act, alt, and ast in 50, 31, 31, and 34%, respectively, in 32 aeromonads from diarrheal patients. among the act, alt, ast, and aer genes, only aer (83%) was detected in stools of diarrheal and non - diarrheal children in the present study. albert. (30) examined alt, ast, and act genes in aeromonas isolates from children with diarrhea, children without diarrhea, and environmental sources (including surface water) in bangladesh. they found that aeromonads positive just for the alt gene had similar distributions in the three sources ; aeromonads positive just for the ast gene were significantly more prevalent among environmental specimens than among diarrheal children specimens ; and aeromonads positive just for the act gene were not found in any of the three sources. in agreement with their results we detected the ast gene significantly more frequently among aeromonads from water samples than among aeromonads from three other sources (i.e. diarrheal children, non - diarrheal children, and chicken). however, contrary to their findings we did not detect the alt gene in aeromonads from the four sources examined and detected the act gene in more than 36% of aeromonas isolates from water. differences in the reported rates of virulence genes among aeromonas species from different regions may be related to differences in geographical location. in conclusion, the majority of aeromonads from libya fall within three genospecies (i.e. a. hydrophila, a. veronii, and a. caviae). furthermore, genes coding for toxin production and cytotoxicity to vero cells are common features among aeromonas species isolated from food and water sources in libya, which may pose a health risk to users of such sources, particularly to immunocompromised individuals. the authors have not received any funding or benefits from industry or elsewhere to conduct this study. | introductionaeromonads of medical importance have been reported from numerous clinical, food, and water sources, but identification of genospecies and virulence factors of aeromonas species from countries in north africa and the middle east are few.methodsin total 99 aeromonas species isolates from different sources (diarrheal children [n=23 ], non - diarrheal children [n=16 ], untreated drinking water from wells [n=32 ], and chicken carcasses [n=28 ]) in tripoli, libya, were included in the present investigation. genus identification was confirmed by biochemical analysis, and genospecies were determined using a combination of 16s rdna variable region and gyrb sequence analysis. polymerase chain reaction (pcr) was used to detect genes encoding toxins from 52 of the isolates.resultswe identified 44 isolates (44%) as a. hydrophila (3 [3.0% ] subspecies anaerogenes, 23 [23% ] subspecies dhakensis, and 18 [18% ] subspecies ranae) ; 27 isolates (27%) as a. veronii ; 23 isolates (23%) as a. caviae ; and 5 isolates (5.0%) as other genospecies. the genes encoding aerolysin (aer), cytolytic enterotoxin (act), and a. hydrophila isolate ssu enterotoxin (ast) were detected in 45 (87%), 4 (7.7%), and 9 (17%) of the 52 isolates tested, respectively. the gene encoding an extracellular lipase (alt) was not detected.conclusionthe majority of aeromonads from libya fall within three genospecies (i.e. a. hydrophila, a. veronii, and a. caviae), and genes coding for toxin production are common among them. |
tumor cells disseminate to distant organs via the lymph or the blood stream during metastasis. the metastasis includes several critical pathogenic steps which are angiogenesis, invasion into the capillary venules, circulation in the blood stream, adherence to a new local extravasation and colonization. the arrest of metastasizing tumor cells within the blood stream is prerequisite for their extravasation. in the blood stream, tumor cells are exposed to flow - dependent shear forces, plasma proteins, blood cells, and platelets, all of which may affect tumor cell survival, arrest, and extravasation. mechanisms which mediate tumor cell arrest involve adhesive interactions of tumor cells with endothelial cells. recently, intense researches have unveiled an elaborate integrin network controlling the adhesion and migration of tumor cells [2, 3 ]. the integrin families overexpressed on the tumor cells have now been recognized as key regulators of various neoplastic processes by virtue of their ability to facilitating cancer cell adhesion and migration. the integrins are heterodimeric adhesion receptors formed by the noncovalent association of and subunits. v3 integrin mediates cell adhesion and migration on a variety of extracellular matrix proteins, including fibronectin, fibrinogen, laminin, collagen, osteopontin, and others. however, v3 integrin prefers to highly express on developing tissues rather than the normal or mature one. as a class of apparent malignantly developing tissue, the aberrant expression of v3 integrin has been demonstrated on various kinds of cancer including metastasis human melanoma, breast, prostate, and glioblastoma tumor cells. all these evidences lead to the confirmation that overexpression of v3 integrin may be cited as a reliable index to determine the malignancy of a specific tumor [79 ]. it has been demonstrated that prostate cancer cell adhesion and migration to vitronectin and osteopontin were v3-dependent. the similar pattern was also found in the model of ovarian cancer. in the normal physiological condition, platelets do not attach to intact endothelium unless the platelet - endothelium interaction has been disturbed due to the vascular damage. the mechanism of coagulation directed by the aggregation of activated platelets is now known to involve two specific glycoproteins, that is, gpib and gpiib / iiia (also called iib3), which is composed of two subunits which are gpiib and gpiiia [11, 12 ]. some disorders of gpiib / iiia such as glanzmann thrombasthenia show the importance of gpiib / iiia in mediating the natural physiological hemostasis and thrombosis. clinical statistics showed that half of cancer patients have accompanying platelet activation and thrombosis [1315 ]. investigators have long speculated that tumor cells can induce the aggregation of platelets which will coat the former and then reduce the possible immunological attack during the hematogenous metastasis. however, how gpiib / iiia mediates this process under dynamic fluid stress has not been confirmed. to investigate what are the roles of gpiib / iiia and v3 integrins for cancer cell adhesion, migration, and metastasis, our present study was designed to explore the behaviors of hela cell - endothelial cell interaction under the static and dynamic flow conditions. their contributions towards the metastasis of cervical cancer were also evaluated and to elucidate whether there exists synergistic relationship between gpiib / iiia and v3 during mediating the interaction process of hela cell - endothelial cell. cell culture medium rpmi1640 and newborn calf serum (ncs) were purchased from gibco (grand island, ny, usa). trypsin, hat (hypoxanthine, aminopterin, and thymidine) supplement, thrombin, gelatin, penicillin, and streptomycin were obtained from sigma - aldrich (st. louis, mo, usa). human eptifibatide and arg - gly - asp - trp - glu peptides (rgdwe peptides) were purchased from cali - bio (ca, usa) and sbs genetech (beijing, china), respectively. the huvec line ea.hy926 was obtained from the institute of biomedical engineering of western china medical college (sichuan, china). this cell line, a hybridoma of huvec and the human epithelial cell line a549, has been shown to retain a number of properties of endothelial cell, including the production of human factor viii - related antigen. the cells were cultured in rpmi 1640 containing 20 mm hepes, 10% ncs, 2% nahco3, 100 u / ml penicillin and 100 mg / ml streptomycin, and 2% hat supplement at the temperature of 37c in humidified 5% co2 atmosphere. were also cultured in rpmi1640 medium supplemented with 10% ncs and 100 units / ml penicillin and 100 g / ml streptomycin at 37c in a humidified atmosphere containing 5% co2. prior to adhesion assay, cells were detached from 25 cm culture flasks (corning, ny, usa) with 0.25% trypsin in phosphate buffered saline (pbs) (ph 7.4). platelet isolation was adopted from the method established by chiang and coworkers with some modifications. briefly, human blood was drawn by venipuncture from healthy volunteers into heparin sodium (1 u / ml) anticoagulant. platelet - rich plasma (prp) was prepared by centrifugation of whole blood at 120 g for 10 minutes. platelet - poor plasma (ppp) was obtained by further centrifugation of the blood at 500 g for 10 minutes. the final platelet count of the prp was adjusted to the desired levels (2 10/ml) with ppp. specimens were stored at 37c in capped polypropylene tubes and used for the following experiments. to potentiate platelet activation, platelets were treated for 30 minutes with thrombin (0.55 u / ml) at room temperature before incubation with hela cells. for inhibition studies, platelets and hela cells were also treated for 30 minutes with eptifibatide (0.65 g / ml) and rgdwe peptides (425 g / ml) to block the gpiib / iiia and v3 integrins, respectively. control experiments were performed in which platelets, and hela cells were treated exactly as stated above but in the absence of thrombin, eptifibatide, or rgdwe peptides. millicell cell culture insert (millipore, billerica, ma, usa) containing pet membrane with pore size of 8 m was used for huvecs migration experimental system as described previously (figure 1(a)). briefly, 1.5 ml of rpmi1640 culture medium was firstly added into each well of 12-well plates, then the millicell cell culture inserts were put in the plate wells, and 500 l cell suspension of hela (5 10 cells) was added into the each insert. the cells were allowed to migrate for 8 hours at 37c and 5% co2 in the presence of thrombin - activated platelets, eptifibatide, or rgdwe peptides. the culture media were removed and the nonmigrated hela cells inside the pet membranes were scraped by a cotton stick. the hela cells that migrated through the pores and adhered onto the outer side of pet membrane were fixed and dipped in a mixed solution (5 ml) of acetic acid and methyl alcohol (1 : 3 in volume ratio) for 30 minutes after the inserts were washed twice with pbs. the pet membranes were taken out using a scalpel and dyed for 1015 minutes with giemsa solution (0.9%) in a glass slide. the redundant giemsa were washed by milli - q water, and then the migrated hela cells (dyed into dark blue) were observed and recorded under an inverted microscope (te-2000u, nikon, japan). the migrated cell number was quantified by cell counting from more than six microscopic fields for each sample (magnification 20), and three pet membranes were used for each experimental group. the inner side of pet membrane (figure 1(a)) was modified to be precoated with 100 l gelatin (1 mg / ml) overnight. before cell invasion experiment, hela cells were firstly labelled with 10 m dio fluorescent dyes (beyotime, beijing, china) for 20 minutes, and washed three times by centrifugation at 1700 rpm, 6 minutes for each time, to remove the abundant dio fluorescent molecules. the labelled hela cell suspension of 500 l (5 10 cells) in rpmi 1640 with 10% ncs was seeded onto the inner side of pet membrane of the millicell cell culture insert. one and half milliliters of rpmi 1640 with 10% ncs culture medium were added into the wells of the 12-well plates. the culture media in the cell culture inserts were removed and washed three times with pbs. cells in the inner side of pet membrane were gently wiped away by cotton stick. hela cells that invaded to the outer side of the pet membrane were quantified by cell counting under an inverted fluorescent microscope te-2000u from more than five random microscopic fields (magnification 10). cell coculture parallel flow system, designed and presented by professor jeng - jiann chiu lab in the national health research institutes of taiwan, was used for transmembrane migration assay combining cell coculture and dynamic flow conditions (figure 1(b)). two sets of glass slides and silicone gaskets were fastened by vacuum suction through ports with a polycarbonate insert holder, which was machined precisely to allow the incorporation of the coculture module into a channel cut in the lower gasket. the chamber allows direct observation of the cells during flow experiment via the observation window opened in the upper gasket. the fluid medium entered at a port through slit into the channel, and exited through another slit. the huvecs side of the co - culture was subjected to shear flow, while the opposite side with hela cells was maintained in a static condition. a rectangular parallel plate perfusion chamber, also designed and presented by professor jeng - jiann chiu lab in the national health research institutes of taiwan, was used to examine adhesion of hela cells to cultured huvecs monolayer under shear flow condition (figure 1(c)). this system comprises a transparent polymethylmethacrylate plate, two silastic rubber gaskets, and a standard glass coverslip. the coverslip with near 90% confluent monolayer of huvecs was mounted over the groove with the cells facing the inside, and an approximate 500 m high gap was formed over the huvecs. the wall shear stress (w) is related to the volumetric flow rate (q) by w = 6q / w(h), where is the fluid viscosity, w is the width of the flow field, and h is the height. the shear stress can be regulated through flow rate of q. the chamber was placed on the stage of an inverted microscope. huvecs were seeded onto the outer side of the pet membrane at a density of 2 10 cells / ml. we kept the insert in an incubator at 37c for 6 hours to allow huvecs to adhere to the outer side of the pet membrane and then turned up the insert to seed dio labelled hela cells (500 l cell suspension containing 5 10 cells) onto the inner side of pet membrane. the cocultured insert was set into co - culture flow system to expose shear stress (8 dyn / cm) for 8 hours. the procedures for hela cell labeling and the counting of migrated hela cell numbers were mentioned above (see cell invasion assay). the migrated hela cells were quantified by cell counting from more than six random microscopic fields for each sample (magnification 10). the adhesion assay under flow was adopted from the method established by chiu and coworkers. huvecs were preseeded on a coverslip at a cell concentration of 2 10/ml and incubated for 48 hours. to facilitate their visualization against the background of monolayer endothelial cells, hela cells were labelled by the method as mentioned above (see cell invasion assay). dio - labelled hela cell suspension (1 ml) at the concentration of 1 10 cells / ml was also seeded to the same coverslip (with huvecs monolayer) and incubated for 6 hours. the co - cultured coverslip was fixed in the flow chamber for continuous shear stress exposure (1.84 dyn / cm, 1 hour). the adhesion capability was evaluated by calculating the ratio of the number of static adhesive cells (0 dyn / cm, control) to that of shear flow condition (1.84 dyn / cm, i hour) under fluorescent microscope. the adhered hela cell number on the huvecs monolayer was quantified by cell counting from more than ten random microscopic fields for each sample (magnification 10). the statistical significance of differences was tested using two - tailed student 's t - test, and p <.05 was considered to be significant. migrated hela cell number significantly increases in the presence of huvecs than the control (no huvecs culture on the bottom of wells) as shown in figure 2. we next examined how gpiib / iiia and v3 integrins affect hela cell migration in static condition. however, migrated cell number decreases after inhibition of gpiib / iiia and v3 integrins by eptifibatide and rgdwe peptides, respectively (figure 3). furthermore, we questioned whether the above - mentioned hela cell migrating phenomenon exists in dynamic flow condition, and whether shear flow also contributes to cell migration. therefore, huvecs were seeded onto the outer side of pet membrane and exposed to shear stress (8 dyn / cm, 8 hours) as shown in figure 1(b). the migrated hela cell number enhances under shear flow in the presence of huvecs monolayer (figure 4(a)), and migration also greatly augments when the platelets were activated by thrombin (figure 4(b)). the invaded hela cell number obviously increased comparing with the control (the sample of equal volume of cell culture medium added), and invasion ability of hela cells also enhanced in the presence of thrombin - activated platelets (figure 5). to further confirm the potential roles of platelet during hela cell invasion, eptifibatide, a specific inhibitor of platelet gpiib / iiia integrin, was added after platelet activation. it was found that the invaded number of hela cell decreased and recovered near to the level in the presence of (figure 5). in the prior experiments (figures 2 and 4(a)), it was demonstrated that endothelial cells could significantly enhance and induce hela cell migration regardless of huvecs seeded onto the well bottom of plate or the outer side of pet membrane. here, the transmembrane invasion ability of hela cells was also evaluated in the presence of huvecs seeded onto the outer side of pet membrane. it was shown that the invaded cell numbers of hela were relative higher than that of without huvecs, and the cell invasion tendency in the presence of huvecs was also very similar by comparing with figures 5 and 6. moreover, specific blocking of v3 integrin by rgdwe peptides led to a decrease of the invaded cell number (figure 6). to examine the possibility that gpiib / iiia and v3 integrins could also regulate hela cell adhesion on monolayer endothelial cells under shear flow, parallel flow chamber system was used to simulate the blood flow for the study of hela cell adhesion behavior. the number of adhered hela cells increased when platelets were present in the perfusion medium, and it enhanced remarkably (nearly 5-fold of the static case) after the platelets activation by thrombin under a low shear stress condition of 1.84 dyn / cm for 1 hour. by blocking the gpiib / iiia integrin on platelets and v3 integrin on hela cells using eptifibatide and rgdwe peptides, respectively, the adhered hela cells on monolayer huvecs significantly decreased (figure 7), which indicated that gpiib / iiia and v3 integrins participated in the adhesion interaction of cancer cells and endothelial cells. although the formation of metastasis requires the successful completion of several sequential interrelated steps by the cancer cells, interaction of cancer cells and host cells in blood vessel plays an important role in the final metastasis formation. so a thorough understanding of the mechanisms how the platelet - cancer cell interaction regulates cancer metastasis could help researchers develop new therapeutic interventions [2022 ]. in this study, our focus centers on the aggregation or not of cancer cells with platelets through gpiib / iiia and v3 integrins whether it contributes to hela cell migration, invasion, and adhesion both in static and dynamic flow conditions. in our present work, we used the millicell cell culture insert system to investigate hela cell transmigration and invasion in vitro. in static condition, hela cell transmembrane migration and invasion increased significantly in the presence of thrombin - activated platelets and recovered to normal after the platelet gpiib / iiia integrin was blocked by eptifibatide both in static and co - culture flow system conditions (figures 3, 4, and 5). these data provided strong evidences that platelet gpiib / iiia integrin participated and mediated hela cells migration. the number of hela cells that invade through gelatin matrix in the presence of platelets is approximately 10-fold higher than control condition while in the presence of thrombin - activated platelets is only near 12-fold of control (figure 5). these results suggest that hela cells may induce platelet activation through gpiib / iiia activation and therefore induce hela cell - platelet interaction or that other integrins might be involved [23, 24 ]. this interaction of cancer cells - platelets could promote not only platelet aggregation but also the expression of matrix metalloproteinases that are involved in the matrix degradation and invasion process. it was reported that v3 integrin overexpressed on the hela cell surfaces, and which could bind to gpiib / iiia integrin. further study showed that the number of migrated hela cells decreased after the v3 integrin was specifically blocked by rgdwe peptides (figures 3 and 6). it suggested that gpiib / iiia and v3 integrins will cooperate to mediate hela cell migration, or that there was a synergic effect when gpiib / iiia and v3 integrins were activated. because cancer cell does not only interact with platelets, leucocytes and endothelial cells were also involved. published data have provided evidence that leucocytes facilitated melanoma cell adhesion. here, we found that hela cell migration was remarkably affected whether the endothelial cells were cultured on plate wells or the outer side pet membrane (figures 2, 4, and 6). endothelial cells enhanced hela cell migration both in static and shear flow conditions, suggesting that endothelial cells could secrete some cytokines or chemoattractants to induce hela cell transmigration, for instance, basic fibroblast growth factor and vascular endothelial growth factor. we also used a laminar flow chamber to further assay hela cell adhesion under shear stress conditions to mimic the in vivo situation. under physiological conditions, tumor cells which are under the hematogenous metastasis are exposed to a wide range of mechanical shear stresses from blood flow. this dynamic fluid system definitely impinges on the motion of individual tumor cells, especially their behaviors of adhesion to the endothelium. the relevant reports which focus on the behavior of the cell adhesion under dynamic condition are rare. interestingly, results shown in figure 7 indicated that the capability of hela cell adhesion to endothelium is significantly affected by gpiib / iiia and v3 integrins. previous studies have shown that the activated platelets can also bind to the cancer cells via gpiib / iiia and v3 interaction through the bridges of fibronectin, fibrinogen, or von willebrand factor. so it could be speculated that more hela cells would be arrested on the endothelial cells via the p - selectin and its ligand psgl-1 is present on endothelium [28, 29 ]. our data support the hypothesis, and a new model that activated platelets will adhere to cancer cells via gpiib / iiia and v3 interaction to form a loosed platelet coating on cancer surface, which will lead to cancer cells to reduce or avoid shear stress exposure and also assist more cancer cell adhesion [30, 31 ]. on the other hand, the activated platelets aggregated to form tiny local thrombus, and resulting in local blood viscosity enhanced to provide more chance for cancer cell adhesion [3235 ]. moreover, cancer cell - induced platelet activation possibly amplifies cancer cell adhesion to endothelium to some extent. our investigation further demonstrated that cell migration, invasion, and adhesion were also highly regulated by v3 integrin on the hela cells. these results might add a new aspect why the majority of actively metastatic tumors were found to highly express v3 integrin. taken together, the present work demonstrates a novel role for gpiib / iiia and v3 integrins in supporting the hela cell migration, invasion, and adhesion. the presence of platelets and their activated state resulted in enhancement of hela cell transmigration and cell recruitment to huvecs monolayer under shear flow. these findings promote our understanding of the roles of gpiib / iiia and v3 integrins in cancer metastasis, which could be a new strategy to cancer treatment. | during their passage through the circulatory system, tumor cells undergo extensive interactions with various host cells including endothelial cells and platelets. mechanisms mediating tumor cell adhesion, migration, and metastasis to vessel wall under flow condition are largely unknown. the aim of this study was to investigate the potential roles of gpiib / iiia and v3 integrins underlying the hela - endothelium interaction in static and dynamic flow conditions. hela cell migration and invasion were studied by using millicell cell culture insert system. the numbers of transmigrated or invaded hela cells significantly increased by thrombin - activated platelets and reduced by eptifibatide, a platelet inhibitor. meanwhile, rgdwe peptides, a specific inhibitor of v3 integrin, also inhibited hela cell transmigration. interestingly, the presence of endothelial cells had significant effect on hela cell migration regardless of static or cocultured flow condition. the adhesion capability of hela cells to endothelial monolayer was also significantly affected by gpiib / iiia and v3 integrins. the arrested hela cells increased nearly 5-fold in the presence of thrombin - activated platelets at shear stress condition (1.84 dyn / cm2 exposure for 1 hour) than the control (static). our findings showed that gpiib / iiia and v3 integrins are important mediators in the pathology of cervical cancer and provide a molecular basis for the future therapy, and the efficient antitumor benefit should target multiple receptors on tumor cells and platelets. |
hypertrophic olivary degeneration (hod) is a transneuronal degeneration of the inferior olivary nucleus in which patients develop hypertrophy of the inferior olivary nucleus following a primary lesion in the dentato - rubro - olivary pathway. this degeneration is unique ; in that, it causes hypertrophy of the inferior olivary nucleus rather than atrophy. familiarity with this entity is important in avoiding mistaking it for one of the other differentials for t2-hyperintensities in the anterolateral medulla, particularly in postoperative patients where it could be mistaken for tumor recurrence. a 42-year - old male who had undergone suboccipital craniotomy and excision of a fourth ventricular epidermoid cyst was subjected to a magnetic resonance (mr) study of the brain for postoperative follow - up 5 months following the surgery. although the patient had no new neurological deficit, he had continuing dysarthria over the preceding 2 months. mr examination revealed postoperative changes in the posterior fossa with evidence of gliosis around 4 ventricle [figure 1 ]. mri also revealed focal, bilateral, symmetric, ill - defined, t2-hyperintensities involving the olivary region of the medulla with mild hypertrophy [figure 2 ]. the patient had rhythmic, involuntary contractions of the soft palate consistent with palatal myoclonus [video ]. a second mr examination of the brain done 19 months following surgery showed a reduction in the hypertrophy and hyperintensity of the olivary region [figure 3 ]. 42-year - old male with bilateral hypertrophic olivary degeneration following excision of a fourth ventricular epidermoid cyst axial. t2-weighted images through fourth ventricle (a and b) show postoperative gliosis (white arrows). 42-year - old male with bilateral hypertrophic olivary degeneration following excision of a fourth ventricular epidermoid cyst axial. t2-weighted images (a and b) through medulla show bilateral hyperintensities in olivary region with mild hypertrophy (white arrows). 42-year - old male with bilateral hypertrophic olivary degeneration following excision of a fourth ventricular epidermoid cyst. case 1. 42-year - old male with bilateral hypertrophic olivary degeneration following excision of a fourth ventricular epidermoid cyst. axial t2-weighted image 14 months later through same level as 2(b) shows reduction in hypertrophy and hyperintensity. a 49-year - old male presented with sudden onset left hemiparesis and slurring of speech. computed tomographic (ct) examination of the brain revealed an acute hemorrhage involving the pons and midbrain along with old lacunar infarcts and gliotic changes in the heads of both caudate nuclei. three months later, the patient presented with gradual worsening of dysarthria, which was intermittent, over the preceding 2 weeks. mr examination revealed hod as a small, ill - defined, nonenhancing t2-hyperintensity involving the olivary region of the medulla on the right side with mild hypertrophy [figures 4 and 5b ]. features of the primary lesion were also seen as chronic hemorrhage involving the pons, midbrain [figure 5 ], dorsal aspect of the right lentiform nucleus and the adjacent posterior limb of the internal capsule. although this patient had worsening dysarthria, palatal myoclonus was not demonstrated on video laryngoscopic examination. (a) and (b) t2-weighted axial images through medulla show ill - defined hyperintensities in olivary region on right side with mild hypertrophy (white arrows). (a) axial t2-weighted gradient image through midbrain shows susceptibility effect suggestive of chronic hemorrhage on right side involving the region of red nucleus (white arrow). (b) t2-weighted coronal images through medulla shows ill - defined hyperintensity in olivary region on right side (red arrow). evidence of hemorrhage is noted as heterogeneous hypointensity in right side of pons (white arrow). few cases of hod have been reported following surgery of a posterior fossa epidermoid cyst and few cases of bilateral involvement have been reported. a 42-year - old male who had undergone suboccipital craniotomy and excision of a fourth ventricular epidermoid cyst was subjected to a magnetic resonance (mr) study of the brain for postoperative follow - up 5 months following the surgery. although the patient had no new neurological deficit, he had continuing dysarthria over the preceding 2 months. mr examination revealed postoperative changes in the posterior fossa with evidence of gliosis around 4 ventricle [figure 1 ]. mri also revealed focal, bilateral, symmetric, ill - defined, t2-hyperintensities involving the olivary region of the medulla with mild hypertrophy [figure 2 ]. the patient had rhythmic, involuntary contractions of the soft palate consistent with palatal myoclonus [video ]. a second mr examination of the brain done 19 months following surgery showed a reduction in the hypertrophy and hyperintensity of the olivary region [figure 3 ]. 42-year - old male with bilateral hypertrophic olivary degeneration following excision of a fourth ventricular epidermoid cyst axial. t2-weighted images through fourth ventricle (a and b) show postoperative gliosis (white arrows). 42-year - old male with bilateral hypertrophic olivary degeneration following excision of a fourth ventricular epidermoid cyst axial. t2-weighted images (a and b) through medulla show bilateral hyperintensities in olivary region with mild hypertrophy (white arrows). 42-year - old male with bilateral hypertrophic olivary degeneration following excision of a fourth ventricular epidermoid cyst. case 1. 42-year - old male with bilateral hypertrophic olivary degeneration following excision of a fourth ventricular epidermoid cyst. axial t2-weighted image 14 months later through same level as 2(b) shows reduction in hypertrophy and hyperintensity. a 49-year - old male presented with sudden onset left hemiparesis and slurring of speech. computed tomographic (ct) examination of the brain revealed an acute hemorrhage involving the pons and midbrain along with old lacunar infarcts and gliotic changes in the heads of both caudate nuclei. three months later, the patient presented with gradual worsening of dysarthria, which was intermittent, over the preceding 2 weeks. mr examination revealed hod as a small, ill - defined, nonenhancing t2-hyperintensity involving the olivary region of the medulla on the right side with mild hypertrophy [figures 4 and 5b ]. features of the primary lesion were also seen as chronic hemorrhage involving the pons, midbrain [figure 5 ], dorsal aspect of the right lentiform nucleus and the adjacent posterior limb of the internal capsule. although this patient had worsening dysarthria, palatal myoclonus was not demonstrated on video laryngoscopic examination. (a) and (b) t2-weighted axial images through medulla show ill - defined hyperintensities in olivary region on right side with mild hypertrophy (white arrows). (a) axial t2-weighted gradient image through midbrain shows susceptibility effect suggestive of chronic hemorrhage on right side involving the region of red nucleus (white arrow). (b) t2-weighted coronal images through medulla shows ill - defined hyperintensity in olivary region on right side (red arrow). evidence of hemorrhage is noted as heterogeneous hypointensity in right side of pons (white arrow). few cases of hod have been reported following surgery of a posterior fossa epidermoid cyst and few cases of bilateral involvement have been reported. the guillain mollaret triangle is an anatomic triangle connecting the dentate nucleus of one side with the contralateral red nucleus and inferior olivary nucleus [figure 6 ]. the dentate nucleus is connected with the contralateral red nucleus by the dentato - rubral tract, while it is connected with the contralateral inferior olivary nucleus through the inferior cerebellar peduncle. mollaret triangle shows the inferior olivary nucleus (in blue), contralateral dentate nucleus of the cerebellum (in green) and the ipsilateral red nucleus (in red). (b) schematic diagram of guillain mollaret triangle, superimposed on t2w coronal image. transneuronal degeneration of the inferior olivary nucleus occurs following its deafferentation by interruption of the dentato - rubral or the rubro - olivary pathways [figure 6b ]. this degeneration is unique ; in that, it causes hypertrophy of the olivary nucleus rather than atrophy. patients generally develop slurring of speech following hod due to palatal tremors, although not all patients do. other symptoms include dentatorubral tremors related to the cranial nerve nuclei affected in the brainstem. the primary insults include primary hemorrhage, cavernous hemangioma, infarction, and trauma. most typically, they are hemorrhages following a hypertensive crisis. four different patterns are recognized based on the location of the primary lesion : ipsilateral hod with the primary lesion involving the brainstem, contralateral hod with the primary lesion involving the cerebellum or the cerebellar peduncle, bilateral hod with both central tegmental tracts affected by a midline lesion in region of brachium conjuctivum and bilateral hod with the primary lesion in the unilateral brainstem and cerebellum. six phases of pathologic changes have been described in the following sequence : (a) no olivary change, (b) olivary amiculum degeneration, (c) olivary hypertrophy, (d) maximum olivary enlargement, (e) olivary pseudohypertrophy, and (f) olivary atrophy. imaging findings relate to the changes in the inferior olivary nucleus and the causative primary lesion. changes of hod are not typically seen on ct and the findings seen on ct are related to the primary lesion. hod is primarily diagnosed by mri and the characteristic finding is a nonenhancing, t2-hyperintense enlargement of the inferior olivary nucleus. the findings depend on the stage of evolution of the degenerative process. on t2-weighted images, they characteristically go through three stages in the sequence of hyperintensity without hypertrophy, hyperintensity with hypertrophy followed by hyperintensity without hypertrophy again. the major pathologic changes seen are vacuolar degeneration of the enlarged neurons, hypertrophy of the astrocytes, and gliosis. the first stage typically occurs within the first month, the second between 6 and 18 months and the final stage persists indefinitely. similar changes are seen in t2-weighted fluid attenuation inversion recovery (flair) images and proton - density weighted images. on t1-weighted images, olivary enlargement that is isointense or hypointense to gray matter is seen. diffusion tensor imaging and mr fiber tractography have also been shown to be capable of demonstrating disruption of the pathways in the guillain the significance of recognizing hod lies in avoiding misdiagnosis of t2-hyperintensities in the anterolateral medulla in the appropriate clinical setting. the differential diagnosis for this includes tumors, infarction, infections, demyelinating lesions, and inflammatory processes among others. however, the lack of contrast enhancement is significant as it differentiates hod from inflammation and malignant tumors. the enlargement of the olives is not expected in diseases like multiple sclerosis and chronic stages of infarction. | hypertrophic olivary degeneration (hod) is seen following lesions in the guillain mollaret triangle. this is unique because the inferior olivary nucleus hypertrophies following degeneration unlike the typical atrophy seen in other structures. we report two cases of hod in two different clinical scenarios. |
gastrointestinal stromal tumors (gists) are the most common mesenchymal tumors of the gastrointestinal tract. gists originate from the interstitial cells of cajal (icc) or their stem cell - like precursors [1, 2 ]. most gists express a receptor tyrosine kinase, kit. kit is encoded by the c - kit gene and its ligand is stem cell factor (scf). gists frequently have a mutation of the c - kit gene which results in constitutive activation of kit without stimulation by scf. the median ages in the largest series of gists of different locations have ranged between 55 and 65 years. the malignant potential of gists varies from virtually benign to aggressive tumors. of all gists, the stomach and small intestine are the most commonly affected anatomic sites, accounting for about two thirds and one third of cases, respectively. gist is considered to be a solitary tumor and the occurrence of multiple primary lesions is very rare, restricted to familial gists, pediatric forms, or district syndromes such as type 1 neurofibromatosis (nf1) or von recklinghausen disease or carney 's syndrome. all these are well - defined entities that can be easily distinguished from common sporadic gists based on their peculiar clinicopathological features. multiple sporadic gists in different organs are rare [8, 9, 10 ]. this report presents a surgical case of sporadic synchronous gists in the stomach and jejunum. a 71-year - old japanese male presented with a 2-year history of occasional melena and general fatigue. computed tomography of the abdomen demonstrated an enhanced extramural tumor of the stomach, 4 cm in diameter (fig. an upper gastrointestinal series revealed a submucosal jejunal tumor near the treitz ligament, 2.5 cm in diameter (data not shown). the patient was referred to the surgical outpatient clinic for surgical treatment of an extramural tumor of the stomach and a submucosal tumor of the jejunum. physical examination revealed no conjunctival pallor, and there was no muscular rigidity or rebound tenderness in response to abdominal palpation. laboratory investigations revealed a white blood cell count of 3,200/mm, a hemoglobin of 8.3 g / dl with a hematocrit of 25.8%, 321,000/mm platelets, normal electrolytes, as well as normal blood urea nitrogen levels and normal liver function. cea was 1.0 ng / ml and ca19 - 9 was 6.0 u / ml. laparotomy revealed a nut - sized extramural tumor at the lesser curvature of the middle stomach (fig. 2a) that was white - yellow, elastic soft and had dilated vessels on the surface. a thumb 's head - sized tumor was also identified on the jejunum about 15 cm from the anal side of the treitz ligament (fig. histopathological examination with hematoxylin and eosin staining revealed that the gastric tumor was composed of a proliferation of spindle cells with spindle nuclei and eosinophilic fibrillar cytoplasm, arranged in fascicles with a hypercellular area (fig. 3a), and the jejunal tumor contained a proliferation of spindle cells with oval or spindle nuclei and occasional pleomorphic cells, arranged in a fascicular or haphazard fashion, alternating with areas of epithelioid features (fig. both gists were classified as low - risk, according to the nih risk classification of gist. the patient had an uneventful recovery and was discharged from the hospital on the 15th day after the operation and followed up in the outpatient clinic. the occurrence of multiple gists is an extraordinarily rare event restricted to familial gists, pediatric forms, or district syndromes such as nf1 or carney 's syndrome. the presentation of multiple synchronous lesions is commonly viewed as the result of the metastatic spreading of a single primary gist. the tumors of metastatic gist are generally located on the peritoneum, but not in the other portions of the gastrointestinal tract. moreover, the patterns of immunohistochemical and molecular analysis in metastatic gist are consistent with paired tumors. on the other hand, some reports indicate that the patterns of immunohistochemical and molecular analysis in multiple sporadic gists are often different [8, 9, 10, 12 ]. the immunohistochemical analysis in the present case revealed different patterns in the gastric and jejunal gists, though no molecular analysis was performed. therefore, this case was diagnosed as synchronous sporadic gists in the stomach and jejunum. familial gists patients have a germline mutation in the kit gene and diffuse hyperplasia of icc with direct continuity between the gist mass and the adjacent intestinal wall. multiple gists in nf1 patients are caused by a mutation of the nf1 gene and have focal or mild hyperplasia of icc. on the other hand, no hyperplasia of icc is noted in patients with multiple sporadic gists. moreover, the normal control mucosa of multiple sporadic gists retains the wild - type kit gene. this finding supports the finding that the present case was synchronous sporadic gists in the stomach and jejunum. complete gross resection of gists with negative margins is the standard primary treatment [10, 11, 12, 13 ]. the japanese clinical practice guidelines for gist recommend resection if the submucosal tumor is larger than 2 cm with clinically malignant signs, whereas observation may be chosen for a tumor smaller than 2 cm without symptoms or clinically malignant signs. nevertheless, tumors diagnosed as gists should be resected regardless of size because of their malignant potential. recently, the laparoscopic approach is considered effective and technically feasible when performed by skilled surgeons [10, 11, 12, 13, 15 ]. laparoscopic wedge resection enables most small (< 5 cm) tumors to be removed with clear margins. however, the laparoscopic approach was not performed in the present case because he was treated 12 years ago. in conclusion, this report presents the surgical case of a patient with synchronous sporadic gastric and jejunal gists. | this report describes a patient with synchronous sporadic gastrointestinal stromal tumors (gists) in the stomach and jejunum. a 71-year - old japanese male presented with a 2-year history of occasional melena and general fatigue. computed tomography of the abdomen demonstrated an enhanced extramural gastric tumor, 4 cm in diameter. endoscopic examination revealed a jejunal submucosal tumor. he was referred to the surgical outpatient clinic for surgical treatment of an extramural gastric tumor and a jejunal submucosal tumor. laparotomy allowed the identification of a nut - sized extramural tumor at the stomach and a thumb 's head - sized tumor on the jejunum. partial resections of the stomach and jejunum were performed. histopathological and immunohistochemical examination revealed that these tumors were gists. although no molecular analysis was performed, the immunohistochemical staining patterns of these two tumors were different from each other. therefore, the final diagnosis was synchronous sporadic gists in the stomach and jejunum. this patient has survived without recurrence for approximately 12 years since complete resection. |
between june 1996 and june 2002, ipmt of the pancreas was diagnosed in 64 of our patients on the basis of pathologic examination of surgical specimens. of these 64, 46 [m : f = 32:14 ; mean age, 61 (range, 40 - 77) years ] who underwent mrcp and mra during the month preceding surgery were included in this study. at our hospital, surgical planning requires that most patients in whom ipmt of the pancreas is suspected undergo mrcp and mra rather than dynamic mr imaging for evaluation of the extent of the disease and the relationship between affected parts and surrounding vessels and organs. these procedures showed that in our 46 patients, the pathologic diagnoses were benign ipmt in 19 patients, borderline ipmt in eight, and malignant ipmt in 19. a borderline lesion was defined as a tumor that was not overtly malignant but had some foci of severe cellular atypia, indicating that it should be treated as malignant. thus, an ipmt considered at imaging to be ' borderline ' was regarded as malignant. for mrcp examinations, a 1.5-t mr system (magnetom vision two mrcp techniques were applied : single - slab rapid acquisition with relaxation enhancement (rare) and multislice half - fourier acquisition single - shot turbo spin - echo (haste). the number of thick - slab acquisitions per patient ranged from three to ten (mean, six). typically, in order to simulate a right anterior oblique projection on direct cholangiography, the oblique plane was at an angle of 20 - 35 to the coronal plane. the imaging parameters for the single - shot rare and multislice haste sequences have been described in detail elsewhere (13). for mra, peak arterial enhancement time was calculated using a test bolus method and 1 ml of gadopentetate dimeglumine (gd - dtpa). three - dimensional (3-d) mra was performed in the coronal plane using two different sequences involving fast imaging with steady precession, the details of which are identical to those previously reported at our hospital (14). thirty ml (0.2 mmol / kg) of gd - dtpa were administrated with an automatic power injector (mrs-50 ; nemoto, tokyo, japan, or spectris ; medrad, pittsburgh, penn., u.s.a.) at a rate of 4 ml / sec, followed by 10 ml of saline flush. the arterial phase was automatically subtracted from precontrast images. in order to fit the portal venous and hepatic venous phases, these were set with a post - arterial phase inter - scan delay of 20 seconds. the mrcp and mra images obtained were reviewed retrospectively by two radiologists (k.w.k, s.w.p.) who were aware that the patients had ipmt of the pancreas but had no information regarding the histologic type. all mrcp and mra sequences in each patient were reviewed, but no attempt was made to evaluate separately the accuracy of individual acquisitions. in cases of interobserver disagreement, final decisions were reached by consensus. firstly, tumors were classified as main duct type, branch duct type, or combined type (7). the first of these was diagnosed when dilation of the main pancreatic duct (mpd) had increased its diameter to more than 5 mm. the presence of one or multiple cystic lesions in the pancreas, without dilatation of the mpd, indicated that a branch duct - type tumor was present, and the combined type was diagnosed when the pancreas contained one or more cystic lesions and the diameter of the dilated mpd was more than 5 mm. secondly, the reviewers were asked to record the maximum diameter of the mpd and the extent of mpd dilatation ; the latter was classified as ' 50% '. in addition, branch duct - type and combined - type lesions were evaluated in terms of their structure (multilocular or unilocular) and location (whether uncinate process and/or head, or body and/or tail), and the maximal diameter of the entire cystic lesion and the diameter of the largest locule were also determined. furthermore, decisions were made (subjectively, with regard to the first point) as to whether the lesion had an irregular thick or smooth thin septum, whether there was communication between the lesion and the mpd, and if so, the caliber of the connecting channel. lastly, for all types of ipmts, source and mip images obtained at mra were used to determine the presence and largest dimension of enhanced mural nodules, and whether narrowing of the portal vein had occurred. for each mr finding, we determined the statistical difference between benign and malignant ipmts by using the chi - square test for qualitative variables and the unpaired student 's t test for numeric values. a p value of less than 0.05 indicated statistical significance. between june 1996 and june 2002, ipmt of the pancreas was diagnosed in 64 of our patients on the basis of pathologic examination of surgical specimens. of these 64, 46 [m : f = 32:14 ; mean age, 61 (range, 40 - 77) years ] who underwent mrcp and mra during the month preceding surgery were included in this study. at our hospital, surgical planning requires that most patients in whom ipmt of the pancreas is suspected undergo mrcp and mra rather than dynamic mr imaging for evaluation of the extent of the disease and the relationship between affected parts and surrounding vessels and organs. these procedures showed that in our 46 patients, the pathologic diagnoses were benign ipmt in 19 patients, borderline ipmt in eight, and malignant ipmt in 19. a borderline lesion was defined as a tumor that was not overtly malignant but had some foci of severe cellular atypia, indicating that it should be treated as malignant. thus, an ipmt considered at imaging to be ' borderline ' was regarded as malignant. for mrcp examinations, a 1.5-t mr system (magnetom vision ; siemens, erlangen, germany) was used. two mrcp techniques were applied : single - slab rapid acquisition with relaxation enhancement (rare) and multislice half - fourier acquisition single - shot turbo spin - echo (haste). the number of thick - slab acquisitions per patient ranged from three to ten (mean, six). typically, in order to simulate a right anterior oblique projection on direct cholangiography, the oblique plane was at an angle of 20 - 35 to the coronal plane. the imaging parameters for the single - shot rare and multislice haste sequences have been described in detail elsewhere (13). for mra, peak arterial enhancement time was calculated using a test bolus method and 1 ml of gadopentetate dimeglumine (gd - dtpa). three - dimensional (3-d) mra was performed in the coronal plane using two different sequences involving fast imaging with steady precession, the details of which are identical to those previously reported at our hospital (14). thirty ml (0.2 mmol / kg) of gd - dtpa were administrated with an automatic power injector (mrs-50 ; nemoto, tokyo, japan, or spectris ; medrad, pittsburgh, penn., u.s.a.) at a rate of 4 ml / sec, followed by 10 ml of saline flush. the arterial phase was automatically subtracted from precontrast images. in order to fit the portal venous and hepatic venous phases, these were set with a post - arterial phase inter - scan delay of 20 seconds. the mrcp and mra images obtained were reviewed retrospectively by two radiologists (k.w.k, s.w.p.) who were aware that the patients had ipmt of the pancreas but had no information regarding the histologic type. all mrcp and mra sequences in each patient were reviewed, but no attempt was made to evaluate separately the accuracy of individual acquisitions. in cases of interobserver disagreement, final decisions were reached by consensus. firstly, tumors were classified as main duct type, branch duct type, or combined type (7). the first of these was diagnosed when dilation of the main pancreatic duct (mpd) had increased its diameter to more than 5 mm. the presence of one or multiple cystic lesions in the pancreas, without dilatation of the mpd, indicated that a branch duct - type tumor was present, and the combined type was diagnosed when the pancreas contained one or more cystic lesions and the diameter of the dilated mpd was more than 5 mm. secondly, the reviewers were asked to record the maximum diameter of the mpd and the extent of mpd dilatation ; the latter was classified as ' 50% '. in addition, branch duct - type and combined - type lesions were evaluated in terms of their structure (multilocular or unilocular) and location (whether uncinate process and/or head, or body and/or tail), and the maximal diameter of the entire cystic lesion and the diameter of the largest locule were also determined. furthermore, decisions were made (subjectively, with regard to the first point) as to whether the lesion had an irregular thick or smooth thin septum, whether there was communication between the lesion and the mpd, and if so, the caliber of the connecting channel. lastly, for all types of ipmts, source and mip images obtained at mra were used to determine the presence and largest dimension of enhanced mural nodules, and whether narrowing of the portal vein had occurred. for each mr finding, we determined the statistical difference between benign and malignant ipmts by using the chi - square test for qualitative variables and the unpaired student 's t test for numeric values. the mrcp findings for intraductal papillary mucinous tumors are summarized in table 1. among the 19 patients with benign ipmt, the main duct type occurred in two (11%) (fig. 3). for the 27 patients with malignant ipmt, the corresponding figures were three (11%), three (11%) (fig. the combind type was noticeably more common among malignant tumors (p < 0.05). dilatation affected more than 50% of the whole mpd in 59% of malignant ipmts (16/27) and 26% of benign ipmts (5/19). the caliber of the mpd ranged from 2 to 14 (6.8 4.2) mm in benign ipmts, and 4 to 43 (13.3 9.0) mm in malignant ipmts. the extent of mpd dilatation and the caliber of the mpd were significantly greater in malignant tumors than benign (p < 0.05). among branch duct - type and combined - type benign ipmts, 12 branch duct lesions (71%)were in the uncinate process and/or head, and five were in the body and/or tail. among these types of malignant ipmts, 19 lesions (79%) were found in the uncinate process and/or head, and five in the body and/or tail. there were no statistically significant differences in lesion location between benign and malignant ipmts (p = 0.55). for branch duct - type and combined - type tumors, the size of the entire cystic lesion was 38.4 17.7 mm if benign, and 55.1 27.2 mm if malignant. the average size of the largest locule, for benign and malignant nodules, respectively, was 19.1 9.0 mm and 21.2 10.5 mm. between benign and malignant ipmts, there was no statistically significant difference in the size of the largest locule, the structure of the cystic lesions (unilocular or multilocular) (p = 0.08), or the presence or absence of communication between the cystic lesion and the mpd (p = 0.08). in malignant ipmts, however, the caliber of the communicating tract was significantly larger than in benign ipmts (p < 0.05). (p < 0.001). with regard to the presence or absence of portal vein narrowing, however, the difference was not statistically significant (p = 1.6). only one of 15 benign multilocular branch duct - type lesions had a thick irregular septum, but this was present in 13 of 23 malignant multilocular lesions (57%) (p < 0.001). the mean diameter of mural nodules was 16 11 mm in malignant ipmts and 6 2 mm in benign ipmts, representing a statistically significant difference (p < 0.001) (fig. only one published report has described the use of mrcp in the differential diagnosis of ipmt : irie. (12) stated that the size and type of an ipmt, the diameter of a dilated main pancreatic duct, and the presence and size of mural nodules were related to malignancy. sugiyama and atomi (4) reported that compared with branch duct - type tumors, main duct and combined - type tumors were more frequently invasive carcinomas, and in our study, combined - type tumors were more often malignant than benign. for main duct types, however, the frequencies with which malignant and benign ipmts occurred were not significantly different, a finding which can probably be attributed to the small number of main duct - type tumors included in our study group. diffuse main pancreatic duct dilatation of greater than 15 mm accompanying main duct - type tumors, or main pancreatic duct dilatation accompanying branch duct - type tumors, is strongly associated with malignancy (12). communication between branch duct - type ipmt and the mpd was visualized in most benign and malignant ipmts, but the diameter of the communicating channel was greater in malignant ipmts than benign ipmts. in our study, there was a statistically significant difference between benign and malignant ipmts as regards both the presence and size of mural nodules. four benign tumors, however, contained mural nodules, and the presence of such nodules is, therefore, a strongly suggestive but non - specific sign of malignancy. (5) reported that a mural nodule larger than 10 mm strongly suggests malignancy, and in our study, the size of mural nodules in all four benign ipmts was less than 10 mm. however, 30% of malignant ipmts (7/23) also had mural nodules less than 10 mm in size. kobayashi. (15) noted that ductal wall or thickened septum - like structures were irregular in adenocarcinoma and adenoma, but not in hyperplasia. in our study, a thick irregular septum was almost always present in the multilocular cystic lesions arising in branch duct - type malignant ipmts. (12) reported that a cystic diameter of 30 mm or more may suggest malignancy, with considerable overlap between benign and malignant ipmts. (16) noted that the greatest diameter of a lesion was larger in malignant ipmts (50 mm) than benign ipmts (30 mm), and proposed a criterion of ' larger than 30 mm ' as a finding suggestive of malignancy. in our study, too, the average greatest diameter of malignant ipmts was more than that of benign ipmts, but because of considerable overlapping, the criterion of ' larger than 30 mm ' seemed difficult to apply. in evaluating mural nodules, we analyzed 3-d mra source images rather than conventional dynamic mr images ; our reason for this was that because of the thin - slice imaging technique employed, the former offer much better image resolution and more physiologic interpretation for evaluation of the entire pancreas and pancreatic duct. in our study, the presence or absence of portal vein narrowing, determined by means of 3-d mra, was not a statistically significant determinant of benignancy or malignancy. this result was due, we believe, to the low degree of malignancy in our ipmt patients. we consider, though, that in surgical planning for curative resection, the presence or absence of this narrowing is a crucial factor. in summary, ipmts are more commonly the combined type. in these and main duct - type tumors, mural nodules larger than 10 mm and a diffuse and markedly dilated mpd suggest malignancy. in branch - duct type ipmts, this is suggested by a larger cystic lesion, a thick and irregular septum, and a larger - diameter connective tract leading to the mpd. for the differential diagnosis of benign and malignant ipmts of the pancreas, the combined use of mrcp and mra might be useful. | objectiveto compare the usefulness of magnetic resonance cholangiopancreatography (mrcp) and mr angiography (mra) in differentiating malignant from benign intraductal papillary mucinous tumors of the pancreas (ipmts), and to determine the findings which suggest malignancy.materials and methodsduring a 6-year period, 46 patients with ipmt underwent mrcp. morphologically, tumor type was classified as main duct, branch duct, or combined. the diameter of the main pancreatic duct (mpd), the extent of the dilated mpd, and the location and size of the cystic lesion, septum, and communicating channel were assessed. for all types of ipmts, enhanced mural nodules and portal vein narrowing were evaluated at mra.resultscombined-type ipmts were more frequently malignant (78%) than benign (42%) (p < 0.05). compared with benign lesions, malignant lesions were larger, and the caliber of the communicating channel was also larger (p < 0.05). their dilated mpd was more extensive and of greater diameter (p < 0.05), and the presence of mural nodules was more frequent (p < 0.001).conclusioncombined mrcp and mra might be useful for the differential diagnosis of malignant and benign ipmts of the pancreas. |
tubo - ovarian abscess (toa) is a sequela of pelvic inflammatory disease (pid) that is comprised of an infectious, inflammatory complex encompassing the fallopian tube and ovary. the proposed pathophysologic mechanism for toa development includes ascending infection as well as hematogenous and lymphatic routes. the infectious source is typically polymicrobial and several reports have identified escherichia coli, neisseria gonorrhea, and chlamydia trachomatis and a variety of obligate anaerobic bacteria as commonly associated microorganisms [1, 2 ]. cases of toa involving endometriomas have been reported in the literature, and women with revised american society for reproductive medicine (asrm) stages iii - iv endometriosis have been found to have an increased occurrence of toa. e coli was more frequently cultured from aspirated abscesses in women with concomitant endometriosis than if no endometriosis was present. in addition, previous pelvic surgery was found to increase the risk of toa. we report a case of a woman with stage iv endometriosis with a toa involving an endometrioma, in the absence of cultured organisms, who had evidence of bacterial vaginosis (bv) on normal saline wet prep and culture. a 41-year old nulligravida presented to the university of michigan (um) reproductive endocrinology and infertility clinic for an evaluation of a six year history of primary infertility. her prior fertility evaluation and treatment history was significant for four previous cycles of ovulation augmentation with clomiphene citrate in conjunction with timed intercourse and a normal hysterosalpingogram several years earlier. her initial workup at um revealed normal ovarian reserve testing, normal values for tsh and prolactin, and her husband 's semen analysis was normal. transvaginal ultrasonography showed persistent bilateral 3.5 cm ovarian cysts that had a ground - glass appearance consistent with endometriomas. the patient underwent laparoscopic evaluation due to the large endometriomas at which time she was diagnosed with stage iv endometriosis. due to dense adhesive disease, the procedure was converted to an exploratory laparotomy. three right ovarian endometriomas were removed, and the cyst wall of each was excised with subsequent cauterization of the bases for hemostasis. the left ovarian endometrioma was approached ; however, it was not removed due to severe adhesions and the patient 's desire for fertility. five weeks after surgery, the patient underwent a hysterosalpingogram which showed a normal uterine cavity, right tubal patency, and left hydrosalpinx without spillage of dye. she subsequently underwent two cycles of gonadotropins in conjunction with intrauterine inseminations, but had suboptimal responses. nine months after surgery, the patient presented to the emergency room with fever and abdominal pain. her abdominal and pelvic exams showed moderate tenderness, small amount of vaginal discharge and bacterial vaginosis as evidenced by clue cells on a normal saline wet prep. transvaginal ultrasound showed a 7 cm left adnexal mass with uniform echogenicity (figure 1). her wbc was 16.7 k. she was admitted to the hospital for intravenous antibiotic administration but despite broad - spectrum coverage, high - grade fevers continued. on hospital day 3, after discussion of risks, benefits, and alternatives that included conservative management, she was consented for definitive surgical management and underwent a modified radical hysterectomy with bilateral salpingo - oophorectomy and lysis of adhesions. although all cervical, blood, and urine cultures were negative on hospital admission, the left ovary contained an ovarian abscess with gram negative rods within the left - sided endometrioma. histology of the left fallopian tube and ovary revealed an endometriotic cyst with massive edema, hemorrhage, acute inflammation, and marked eosinophilia (figure 2) with an associated pyosalpinx consistent with a toa. the development of toa among women with endometriomas may be due to an increased susceptibility to infection, particularly in the altered immune environment seen with ectopic endometrial glands and stroma, although there are no epidemiologic data available to support this theory. previous surgical procedures involving the pelvic organs have been found to increase the risk of toa formation in patients with endometriosis. interestingly, in this case report, the patient 's surgery took place nine months prior to clinical presentation and the presence of acute inflammatory cells in the endometrioma makes the probability of a long incubation period or superinfection of a chronic infectious process unlikely but not out of the realm of possibility. there is one case report of a 7 month period of time from surgery to superinfected endometrioma. similarly, in terms of the timeframe of events, although an hsg performed in the presence of an apparently dilated fallopian tube carries an increased risk of pelvic inflammatory disease, this patient 's procedure was performed eight months prior to the onset of her acute symptomatology and histologic findings. there was no known change in partners since the patient 's initial office visit until the time of presentation with symptoms of acute pelvic infection. although the association between bv and the increased risk of an ascending pid is well established, in the present case, the finding of bv in the absence of isolated organisms on cervical, blood, and urine cultures raises the question as to whether bv that has ascended to the upper genital tract is a predisposition to abscess formation in an endometrioma. more study is necessary to investigate this matter and to elucidate whether aggressive treatment of bv in patients with known advanced stage endometriosis, akin to screening and treatment in patients who are to undergo hysterectomy to prevent vaginal cuff abscesses, should be considered to prevent super - infected endometriomas. (a) transvaginal ultrasound image, shortly after initial evaluation, of persistent bilateral ovarian masses adjacent to uterus (ut). (b) ultrasound image of left ovarian cystic structure after patient presented with symptoms of acute pelvic inflammatory disease. endometrioma with associated edema, hemorrhage, acute inflammation, and marked eosinophilia (h & e, 40). | background. tubo - ovarian abscess involvement of an endometrioma has been reported in cases of patients with polymicrobial sources such as neisseria gonorrhoeae, chlamydia trachomatis, and obligate anaerobic bacteria ; however, bacterial vaginosis (bv) predisposing to abscess formation in an endometrioma has not been reported to date. case. superinfection of an endometrioma was surgically diagnosed in a patient with known advanced - stage endometriosis after she presented with acute pelvic inflammatory disease symptoms and was unresponsive to antibiotic therapy. gram - negative rods were cultured from the endometrioma. on admission, cervical, blood, and urine cultures were negative ; bv was diagnosed on normal saline wet prep and gram stain. conclusion. this case raises the possibility of bv ascension to the upper genital tract predisposing to abscess formation in endometriomas. therefore, aggressive treatment of bv in patients with known advanced - stage endometriosis may be considered to prevent superinfected endometriomas. |
in recent years, much focus has been placed on extrinsic causes of dental erosion, such as acidic dietary beverages and citric and phosphoric acids which are often added to soft drinks. only few studies have focused on the erosive effect of intrinsic acids such as gastric juices even though they have a higher erosive potential than soft drinks. prolonged exposure to gastric content can cause dental erosion and in severe cases result in pathological tooth wear with loss of both function and esthetics. it has been shown that people suffering from eating disorders or gastric reflux are at increased risk of developing dental erosion. hence, the use of procedures such as fluoride rinses and varnishes has been recommended ; however, these are presentably ineffective because at low ph fluorapatite gets dissolved. it was thought for many years that fluoride acted basically by its incorporation in the hydroxyapatite lattice and the reduced solubility of the so - formed fluoridated hydroxyapatite. on the contrary, it was shown that shark enamel, which consists of solid fluorapatite, also developed carious lesion in an in situ experiment in high caries challenge regimen. later, studies revealed that it was not the intrinsic fluoride content of tissues but rather the loosely bound fluoride present at the tooth oral fluid interface, which was responsible for effective inhibition of lesion formation. erosion progression can be diminished by application of fluoride preparations, such as acidic sodium, stannous, or amine fluoride preparations. the principle of its protective effect is the precipitation of caf2-like product on the tooth surface. one major disadvantage of this precipitate is that they readily get dissolved in acidic solutions. unlike above - mentioned agents, titanium tetrafluoride (tif4) the unique interaction of tif4 with tooth structure leads to the formation of a resistant tenacious coating (referred as a glaze - like layer) on the tooth surface. the advantage has been credited to the titanium group present in the compound, which synergizes the effect of fluoride. reed and bibby 's preliminary test in children showed that the topical application of tif4 (1%) was more effective in reducing enamel solubility and in preventing caries than the application of acidic phosphate fluoride (apf). these results along with stability, lack of irritating properties, and nontoxicity of titanium suggested its use in human beings. bykyilmaz and sen observed that the glaze formed after application of 4% tif4 on the occlusal surface of deciduous enamel retained in the area of pits and fissures even after a period of 12 months despite the masticatory and abrasive forces in the oral cavity. hence, in our present study, the effect of fluoridating agents on dentin has been evaluated. the study described here sought to comparatively investigate the effect of 1.23% apf and 4% tif4 on human coronal dentin using vickers microhardness test. thirty noncarious extracted premolars were collected and stored in distilled water after cleaning them out of their debris. teeth were sectioned buccolingually with the help of diamond disk (confident dental equipments ltd., india) in a micromotor straight handpiece (nsk, nakanishi inc, tochigi - ken, japan), at a speed of 20,000 rpm, using water spray as a coolant. among the two halves of the buccolingually sectioned tooth, the one with less surface aberrations on dentin was selected to prepare the sample. exposing the sectioned surface, teeth were embedded in self - cure acrylic, surrounded by a plastic pipe (sectioned to required thickness before the procedure) to give the specimen correct shape. exposed coronal dentin was polished with abrasive papers starting with 2205000 grit (coarse grit to fine grit). then, specimens were stored in a closed container in a dry environment to preserve the surface fineness. as a part of the evaluation of microhardness of coronal dentin, four indentations were given 100 m apart on each specimen by vickers microhardness indenter and average of four indentations was calculated to minimize the error. the load of 500 g was applied for 10 s. these readings stand as baseline values of microhardness of dentin. all the specimens were treated with hydrochloric acid at a ph of 1 for 5 min, followed by the evaluation of microhardness of treated coronal dentin. all the thirty samples were divided into two groups : group a - fifteen samples in the group on coronal dentin were applied carefully with 1.23% apf gel (dentsply, york, pa, usa) as an approximately 2 mm thick layer in one application, with the help of the cotton pellet by tweezers and were left undisturbed. after 4 min, it was gently removed with the help of smooth absorbent paper, followed by gentle rinsing with water and air driedgroup b - fifteen samples in the group on coronal dentin were applied carefully with freshly prepared 4% tif4 solution (sigma - aldrich co., st. it was prepared by dissolving 3.4 g of tif4 powder in 100 ml deionized distilled water. a solution of 4% tif4 was applied in drops for 4 min, the drop was left undisturbed till surface appeared dry, and the additional drops were applied in the same manner. after 4 min, the specimens were gently rinsed with water spray and air dried. group a - fifteen samples in the group on coronal dentin were applied carefully with 1.23% apf gel (dentsply, york, pa, usa) as an approximately 2 mm thick layer in one application, with the help of the cotton pellet by tweezers and were left undisturbed. after 4 min, it was gently removed with the help of smooth absorbent paper, followed by gentle rinsing with water and air dried group b - fifteen samples in the group on coronal dentin were applied carefully with freshly prepared 4% tif4 solution (sigma - aldrich co., st. it was prepared by dissolving 3.4 g of tif4 powder in 100 ml deionized distilled water. a solution of 4% tif4 was applied in drops for 4 min, the drop was left undisturbed till surface appeared dry, and the additional drops were applied in the same manner. after 4 min, the specimens were gently rinsed with water spray and air dried. change in microhardness of the dentin in both groups a and b after application of 1.23% apf gel and 4% tif4, respectively, was evaluated. it was followed by exposure of both group a and b specimens to the acidic protocol as mentioned above, and microhardness readings were recorded to evaluate the ability of 1.23% apf gel and 4% tif4 to resist demineralization in an acidic environment. table 1 represents the result of paired t - test between groups a and b after application of apf gel and 4% tif4 to demineralized dentin. represents result of paired t - test between group a and group b after application of apf gel and 4% tif4 to demineralized dentin table 2 represents the result of paired t - test between groups a and b after exposure of 1.23% apf gel- and 4% tif4-treated dentin to an acidic environment. represents result of paired t - test between group a and group b after exposure of apf gel and 4% tif4 treated dentin to low ph statistical analysis was performed using (graphpad prism, version 5, la jolla, ca, usa). paired t - test was used to compare the vickers microhardness values between groups a and b. group a has shown greater increase in microhardness of coronal dentin (p < 0.001), followed by application of apf gel than group b. greater resistance to decrease in microhardness of coronal dentin (p < 0.05) followed by exposure to acidic protocol was shown by group b. according to buyukyilmaz, 4% tif4-treated enamel surface is more resistant to crack formation and the glaze appears to be more tenacious and thicker, than with 1% tif4. few studies that evaluated the impact of tif4 solution on dentin in vitro have confirmed it was effective in reducing erosive dentin loss. jones. have demonstrated that concentrated fluoride gels were able to provide some degree of protection to enamel against endogenous erosion. mok. have demonstrated that these fluoride gels have shown the same level of protection against exogenous erosion. in both the studies wefel and wei have stated in their study that 4-min application time of 1.23% apf gel is better over 1-min application time. while ten cate jm have found no difference in application time of 1.23% apf gel. however, in the case of 4% tif4, various time periods of application have been used. reed and bibby, von rijkom., and exterkate and ten cate have considered 1-, 4-, 5-min application time, respectively, in their studies to evaluate the effect of tif4. hence, to standardize the application time of both fluoridating agents in the present study, 4-min application time was considered. in the case of endogenous erosion, the teeth exposed to acids from the gastrointestinal tract are most likely intermittent and for short periods but, on the other hand, may last for weeks or months. thus, the present direct acid exposure model is presumably more severe than exposure in the oral cavity. the relationship between microhardness and mineral structure of teeth has been documented as directly proportional. the hardness number is based on the surface area of the indent itself divided by the applied force, giving hardness units in kgf / mm. microindentation tests typically have forces of < 2 n and produce indentations of about 50 m. in addition, microhardness values vary with load and work - hardening effects of materials. the indentation has two measurements of the length of the diagonal (d1 and d2) which are measured in an optical microscope and reading of microhardness appears on the screen. results obtained were statistically evaluated by paired t - test ; all at p < 0.05 to find statistical significance of microhardness values. a t - test is any statistical hypothesis test in which the test statistic follows a student 's t - distribution if the null hypothesis is supported. it can be used to determine if two sets of data are significantly different from each other and are most commonly applied when the test statistic would follow a normal distribution if the value of a scaling term in the test statistic was known. comparison of results obtained between groups a and b after application of 1.23% apf gel and 4% tif4 solution to demineralized dentin has shown statistically significant (p < 0.001) difference in the increase of microhardness. the amount of increase in microhardness of group b less than group a was probably due to low ph of 4% tif4 solution (ph - 1.5). however, the mineral loss was considered partial and limited to outermost 810 m. on the other side, apf gel has a ph range of 33.5, which is comparatively less acidic to 4% tif4, thereby causes less surface mineral loss. comparison of results obtained between groups a and b after exposure of 1.23% apf gel- and 4% tif4-treated dentin to the acidic environment has shown statistically significant difference in the decrease in microhardness. the results confirmed that 4% tif4- and 1.23% apf gel - treated dentin was resistant to demineralization in an acidic environment. this might be due to glaze - like layer formed on the surface of dentin, which is a product of interaction between 4% tif4 and proteins on the surface of dentin. another explanation for this acid - resistant glaze - like layer includes ti ion reacts with oxygen groups on the tooth surface, i.e., phosphate - bound oxygen. this mechanism would provide covalently bound titanium on the enamel surface properties of the glaze. the protective action of 1.23% apf gel is the precipitation of caf2-like product on the eroded tooth surface and its major disadvantage is that they possibly readily dissolve in acidic solution, so the effectiveness of 1.23% apf gel in preventing dentinal erosion is limited. within confines of the study, it can be stated that both 1.23% apf gel and 4% tif4 solution are effective in resisting the demineralization of dentin in acidic environmenthowever, 4% tif4 has shown better efficacy than 1.23% apf gel. within confines of the study, it can be stated that both 1.23% apf gel and 4% tif4 solution are effective in resisting the demineralization of dentin in acidic environment however, 4% tif4 has shown better efficacy than 1.23% apf gel. | aim : the aim of this study was to comparatively evaluate the effect of 4% titanium tetrafluoride (tif4) and 1.23% acidic phosphate fluoride (apf) gel on the microhardness of human coronal dentin.materials and methods : thirty noncarious extracted premolars were collected and sectioned buccolingually with the help of diamond disk. exposing the sectioned surface, teeth were embedded in self - cure acrylic. exposed coronal dentin was polished with abrasive papers starting with 2205000 grit. microhardness was evaluated by vickers microhardness evaluator, at four different stages as follows - stage 1 : baseline values, stage 2 : exposure of specimens to acidic environment at a ph 1 for 5 min, stage 3 : application of 1.23% apf gel and 4% tif4 (after dividing the specimens into two groups, i.e., group a and b, respectively), and stage 4 : followed by exposure of fluoridated specimens to acidic protocol as mentioned above.results:paired t - test was used to compare the readings between groups a and b. group b has shown greater resistance to decrease in microhardness of coronal dentin (p < 0.05) on exposure to acidic protocol.conclusion:due to acidic ph (1.5) of 4% tif4, amount of increase in microhardness of dentin is < 1.23% apf gel. 4% tif4 was more effective in resisting demineralization than 1.23% apf gel. |
pure red cell anemia (prca) is a syndrome characterized by severe normocytic anemia, reticulocytopenia, and an absence of erythroblasts from an otherwise normal bone marrow. the acquired form of prca may present as a primary hematologic disorder in the absence of any other diseases, or secondary to various underlying diseases including parvovirus b19 infection, large granular lymphocyte (lgl) leukemia and other lymphoproliferative disorders, thymoma, autoimmune disease, the use of offensive drugs, and allogeneic hematopoietic stem cell transplantation (hsct). previously, prca following allogeneic hsct has been reported in patients after abo - incompatible allogeneic hsct. here, we describe the first case of prca, to our knowledge, following major abo - compatible allogeneic hsct for acute lymphoblastic leukemia (all) resolving completely after rituximab treatment. a 49-year - old woman with all underwent hla - matched related allogeneic hsct (containing 2.2 10 cd34 cells / kg) on december 23, 2009. there were no major abo - mismatch blood types between the donor (o) and the recipient (o). the duration from transplantation to an absolute neutrophil count > 0.5 10/l and to a platelet count > 20 10/l was 14 and 17 days. engraftment was confirmed by a bone marrow aspirate and biopsy on day + 23. on day + 265, she showed elevated aspartate transaminase (ast) and alanine transaminase (alt), and chronic graft - versus - host disease (gvhd) was confirmed by a liver biopsy. the prednisolone and mycophenolate mofetil were subsequently tapered to 5 and 500 mg on day + 452. there was no regular requirement of packed red cell (prc) until then. on day + 475, the patient 's hemoglobin level suddenly decreased from 10.3 g / dl to 6.7 g / dl. we started erythropoietin treatment (darbepoetin - a 120 g once weekly) on day + 492, but there was no improvement in her anemia. a bone marrow biopsy was performed on day + 545 and revealed a decreased erythroid series without abnormal findings of other cell components, showing a consistent finding of prca. in addition, we checked for parvovirus b19 and cytomegalovirus, and there was no evidence of viral infections. we started rituximab 375 mg / m once weekly for four weeks starting on day + 566. on day + 587, hemoglobin and reticulocyte began to rise from 6.7 g / dl and 0.4% (12,000/l) to 9.6 g / dl and 4.44% (150,500/l) (fig. currently (on day + 732), the patient has no transfusion requirement and her hemoglobin level has remained as high as 13.2 g / dl. prca following allogeneic hsct has been mostly reported in situations involving major abo incompatibility between donor and recipient [3, 4 ], with the exception of one case following major abo - matched allogeneic hsct. prca following abo - incompatible allogeneic hsct is associated with an interaction of recipient anti - a or anti - b isoagglutinins with donor erythroid precursors expressing a and/or b antigens. spontaneous remission has been noted but treatments such as plasma exchange, donor - derived leukocyte infusion, erythropoietin, and steroids may be necessary to avoid rbc transfusion and to decrease the risk of hemochromatosis [7, 8, 9, 10, 11 ]. the mechanism of prca following major abo - matched allogeneic hsct is unclear. in the case report by roychowdhury and linker, it is speculated that immune - mediated etiology such as the adoptive transfer of autoimmunity or antibodies to erythroid progenitors resulted in prca. in addition, non - abo antigens may be involved in prca following allogeneic hsct. our case was analyzed following allogeneic hsct between a major abo - matched donor - recipient pair. rituximab is a humanized, murine, monoclonal antibody directed against the cd20 antigen, expressed on pre - b lymphocytes and on mature b lymphocytes. rituximab has been showed to be highly effective for immune - mediated prca, autoimmune cytopenias, and prca following abo - incompatible allogeneic hsct [13, 14, 15 ]. after the third anti - cd20 monoclonal antibody infusion, the patient exhibited a striking rise in her reticulocyte count, and then had a progressive increase in her hemoglobin level. to our knowledge, this is the first report of rituximab use for the treatment of prca following major abo - matched allogeneic hsct. rituximab seems to be a promising therapeutic option for patients with prca following abo - matched and abo - mismatched allogeneic hsct. | pure red cell aplasia (prca) following allogeneic hematopoietic stem cell transplantation (hsct) has been mostly reported in situations involving major abo incompatibility between donor and recipient. conventional treatments such as plasma exchange, erythropoietin, and steroid are often unsatisfactory. rituximab has been reported to be highly effective for prca following major abo - incompatible allogeneic hsct. a 49-year - old woman with prca following abo - matched allogeneic hsct for acute lymphoblastic leukemia, refractory to erythropoietin treatment, received 4 doses of rituximab 375 mg / m2 weekly. after the 3rd dose of rituximab, she exhibited a striking rise in her reticulocyte count with an increase in her hemoglobin level. to our knowledge, this is the first case of prca following major abo - compatible allogeneic hsct resolving completely after rituximab treatment. |
all surgeries come with an attendant risk of infection, glaucoma filtration surgery being no exception. literature cites the follow up adjusted incidence (number of events per patient - year) of bleb related infection (bri) lying in the range of 0.4%6.9% with a follow up ranging from 1.7 years to > 8.5 years.110 while more recent papers are reporting significantly lower incidence rates of bri, they are still significantly higher than the reported incidence of acute postoperative endophthalmitis after other types of intraocular surgery. in general, bri after glaucoma filtering surgery can be divided into localized blebitis and bleb related endophthalmitis (bre) ; bre being a potentially devastating sight - threatening condition with poor visual prognosis. while nearly all studies agree that diabetes, inferior bleb position, bleb leak and bleb manipulation are strong risk factors for bri, dispute exists over others, such as age and gender.6,8,9,1113 it is therefore pertinent that our study examines the risk factors in our population and their impact on the development of bri. intraoperative use of anti - fibrotic agents mitomycin c (mmc) and 5-fluorouracil (5-fu) is becoming standard adjunctive therapy globally, as they reduce scarring and failure rates.4 unfortunately, their use is associated with spontaneous bleb leaks and thus also bri ; with some large scale studies estimating a worrying 5-year complication risk of up to 23%.1,14 at the singapore national eye centre, all trabeculectomies are performed with adjunctive anti - fibrotic agents, mmc being the preferred choice. rates of bre after using mmc have been reported at 1.1%3.2%.2,4,15,16 while mochizuki s study demonstrated similar bri rates of 1.3% and 1.1% with 5-fu and mmc, respectively.4 however, studies have not been able to demonstrate if either anti - fibrotic confers a greater risk for bri.6,16,17 previous reviews have mostly focused on bre1720 and largely overlooked blebitis, with the last review adequately discussing both bris published more than 5 years ago.21 our study compares demographic, ocular, systemic and microbiological characteristics of eyes with bri and bre. approval from the centralised institutional review board of singhealth was obtained and this retrospective, single - center study was conducted in adherence with the tenets of the declaration of helsinki. the review board did not require that written informed consent be obtained from the patients, as this was a retrospective study and all data was anonymous. patient notes were identified for review by the following means : (1) patients who had been flagged as having bre by our center s endophthalmitis audit from january 1996july 2013 ; (2) post - trabeculectomy patients with a history of a conjunctival swab on the microbiology laboratory database from april 2004july 2013 ; (3) patients who had been labeled as having bri in the glaucoma department s internal audit, available from january 2006july 2013. all cases diagnosed by the treating glaucoma consultant as having blebitis or bre, whether culture positive or negative, were included in the study. blebitis was defined as anterior segment inflammation with mucopurulent material in or around the bleb, usually with anterior chamber cells but no hypopyon. if a hypopyon or any vitreous inflammation was present, it was categorized as bre.1,2,5,16 data recorded included baseline characteristics : demographic data, systemic disease(s), type of glaucoma, coexisting eye disease and previous eye surgeries. surgical data : date of surgery and surgical procedure details (bleb location, forniceal- or limbal - based approach, use of anti - metabolites and timing of application, postoperative procedures and complications [eg, bleb leak, revision or manipulations ]). visual acuity at presentation and after resolution of the infection, intraocular pressure (iop) (throughout the infection period), treatment and functionality of the bleb after infection, and bleb morphology at presentation were also recorded. data on management of the infection included : time from onset of symptoms to presentation to the hospital, time before initial antibiotic treatment, type of antibiotic treatment, whether vitrectomy was performed, conjunctival swabs in all patients and vitreous culture results where applicable. statistical analysis was performed using the statistical package ibm spss statistics for windows (version 21.0 ; ibm corp, armonk, ny, usa). differences between the 2 groups were examined using the independent sample student s t - test for continuous variables and chi square tests for categorical variables. an appropriate bonferroni correction (/number of variables evaluated) was applied to correct for the number of variables that were evaluated. of the 39 patients identified as having bris, 29 patients had blebitis and 10 had bre. the baseline characteristics of subjects standard deviation of all subjects (n=39) was 68.413.3 with 29 (74.4%) men and 29 (74.4%) chinese. there was no significant difference in gender and ethnicity between those with blebitis compared with bre. the majority of subjects had primary open angle glaucoma (n=28, 71.8%) with 10 (25.6%) subjects having had previous cataract surgery. 18 (46.2%) subjects also had a coexisting eye condition such as lid or corneal disease. among the comorbidities examined, subjects with bre were more likely to be diabetic (60% vs 27.6%) but this did not reach significance (p=0.12). majority of the subjects had a superotemporal bleb (n=15, 38.5%) with a fornix - based scleral flap (n=14, 35.9%). 29 (74.4%) subjects had mmc 0.4% applied with 15 (38.5%) subjects having 23 minutes of application. a total of 14 (35.9%) subjects had concomitant cataract extraction with intraocular lens implantation. bleb location, type of scleral flap, type of anti - metabolite used and its duration of application, and whether other associated procedures were performed were not found to be statistically significant. further, we compared the eye with trabeculectomy and subsequent bri with the fellow eye that had also undergone trabeculectomy but without bri (n=13) and found no statistically significant differences in the intraoperative procedures (table 3). 7 (25%) blebitis subjects and 1 (11.1%) bre subject underwent bleb manipulation or anti - metabolite injection, which was statistically insignificant (p=0.65). postoperative complications in the form of bleb leaks were recorded more often in blebitis (n=6, 21.4%) than in bre (n=0, 0%) (p=0.3). none of the blebitis subjects evolved to having bre, nor did any of the bre subjects suffer from prior blebitis. other factors such as iop, visual acuity, and bleb vascularity at presentation are shown in table 4. subjects with bre had a higher iop on the day of presentation compared to those with blebitis (22.0 vs 8.9, p=0.011) and at days 27 (17.7 vs 11.0, p=0.002). bre was associated with significantly poorer visual acuity compared to blebitis at presentation (1.73 vs 0.53), days 27 (2.21 vs 0.78), day 14 (1.97 vs 0.62) and at 1-month postinfection (1.51 vs 0.44) (p<0.001 for all values). conjunctival cultures were performed on all subjects and sent for gram stain and culture on aerobic, anaerobic and fungal media. were the most frequently isolated microbe (15.4%), followed by haemophilus influenzae (12.8%) and coagulase - negative staphylococcus (10.2%) (table 5). of the 39 patients identified as having bris, 29 patients had blebitis and 10 had bre. the baseline characteristics of subjects standard deviation of all subjects (n=39) was 68.413.3 with 29 (74.4%) men and 29 (74.4%) chinese. there was no significant difference in gender and ethnicity between those with blebitis compared with bre. the majority of subjects had primary open angle glaucoma (n=28, 71.8%) with 10 (25.6%) subjects having had previous cataract surgery. 18 (46.2%) subjects also had a coexisting eye condition such as lid or corneal disease. among the comorbidities examined, subjects with bre were more likely to be diabetic (60% vs 27.6%) but this did not reach significance (p=0.12). majority of the subjects had a superotemporal bleb (n=15, 38.5%) with a fornix - based scleral flap (n=14, 35.9%). 29 (74.4%) subjects had mmc 0.4% applied with 15 (38.5%) subjects having 23 minutes of application. a total of 14 (35.9%) subjects had concomitant cataract extraction with intraocular lens implantation. bleb location, type of scleral flap, type of anti - metabolite used and its duration of application, and whether other associated procedures were performed were not found to be statistically significant. further, we compared the eye with trabeculectomy and subsequent bri with the fellow eye that had also undergone trabeculectomy but without bri (n=13) and found no statistically significant differences in the intraoperative procedures (table 3). 7 (25%) blebitis subjects and 1 (11.1%) bre subject underwent bleb manipulation or anti - metabolite injection, which was statistically insignificant (p=0.65). postoperative complications in the form of bleb leaks were recorded more often in blebitis (n=6, 21.4%) than in bre (n=0, 0%) (p=0.3). none of the blebitis subjects evolved to having bre, nor did any of the bre subjects suffer from prior blebitis. other factors such as iop, visual acuity, and bleb vascularity at presentation are shown in table 4. subjects with bre had a higher iop on the day of presentation compared to those with blebitis (22.0 vs 8.9, p=0.011) and at days 27 (17.7 vs 11.0, p=0.002). bre was associated with significantly poorer visual acuity compared to blebitis at presentation (1.73 vs 0.53), days 27 (2.21 vs 0.78), day 14 (1.97 vs 0.62) and at 1-month postinfection (1.51 vs 0.44) (p<0.001 for all values). conjunctival cultures were performed on all subjects and sent for gram stain and culture on aerobic, anaerobic and fungal media. were the most frequently isolated microbe (15.4%), followed by haemophilus influenzae (12.8%) and coagulase - negative staphylococcus (10.2%) (table 5). characteristics are similar in both groups even though the visual outcome and clinical course, in the form of iop findings and bleb vascularity, can diverge significantly. notably, none of the blebitis subjects progressed onto bre, conceivably due to timely intervention. while numerous studies have shown a male preponderance in the bri group,1,17,2224 most of these statistics have not reached significance. our study concurs with this, with both groups being overrepresented by males (73.3% and 77.8%, p=0.71) (table 1). most studies have been conducted in older populations with the average age of patients often being over 63. however, there is controversy over the degree of risk that age confers ; some report a tendency for younger patients (< 60 years of age) to develop bri,4,6,9,12,24 while others display a noticeably older distribution.1,16,18,25 our study supports the latter trend with bre subjects being on average 10.7 years older than the blebitis group (p=0.026). this itself may be mediated via more comorbidities such as diabetes, which causes delayed healing of spontaneous bleb leaks and hence an increased susceptibility to trans - conjunctival passage of microorganisms.9,17,18 as in many other studies, the majority of our subjects had primary open angle glaucoma (n=28, 71.8%) with nearly half (n=18, 46.2%) having a coexisting eye condition. this reflects the underlying prevalence of this type of glaucoma among our trabeculectomy patients.12,19 ocular conditions such as pigmentary glaucoma, juvenile glaucoma, nasolacrimal duct obstruction and ocular surface diseases have also been reported to increase the risk of bris but were not evaluated in our study.1,5,11,12,19 studies over the decades have shown that several patient- and surgeon - related factors contribute to bris. surgical practices such as limbal - based procedures produce higher, more avascular blebs, with a greater risk of infection.22 the approach used at our center was divided equally based on the surgeon s choice and was not found to be significant in our study, concurring with the findings of the collaborative bleb - related infection incidence and treatment study group.9 inferior limbal trabeculectomy blebs are associated with a higher risk of infection12,16,23 and this has shaped our current practice so that none were inferior trabeculectomies. the difference between superior nasally and superior temporally positioned blebs adjunctive anti - fibrotic use commonly produces blebs exhibiting epithelial breakdown with goblet cell depletion.26 this predisposes to thin walled, avascular blebs which lead to frank bleb leaks and have a decreased capacity for healing, possibly related to a limited blood supply causing ischemia.6,2629 neither anti - fibrotic agent was found to confer a greater risk for bri (tables 2 and 3), which concurs with other studies.5,8,12,13 the duration of exposure to the anti - fibrotic agent was also not significant (p=0.73). furthermore, comparison of eyes with blebitis and bre showed that both mmc and 5-fu displayed an almost identical risk profile in either group (table 3). a risk factor often implicated for bri is multiple postoperative manipulations, although our study did not show this trend ; possibly reflecting our relatively small sample size.12,16,22,28,30,31 postoperative complications and manipulations did occur more often in our blebitis subjects than in bre (21.4% vs 0%) but did not reach significance (table 4). blebitis subjects presented with the infection much later post - trabeculectomy, at 70.1 months vs 26.8 months in bre patients (p=0.038) (table 6). this may indicate that those with bre have a more aggressive and acute clinical course or could be linked to the patients of an older age having a reduced ability to mount a robust immune response, hence the rapid progression to endophthalmitis. whereas the younger blebitis subjects were able to suppress infection despite theoretically being at a higher risk and having more recorded instances of postoperative instrumentation. preinfective iop levels were similar between blebitis (12.83.2) and bre (12.14.9). however, at presentation, mean iops in patients with blebitis dropped, while those with bre almost doubled (8.9 mmhg vs 22.0 mmhg, p=0.011). the iop in both groups stabilized by the second week posttreatment and closely resembled preinfective levels (table 7). the lower iop in the blebitis eyes may stem from occult or frank bleb leaks and sweating blebs, which are thought to initiate events.16,17 compared to blebitis, bre has significantly greater inflammation which frequently extends into the vitreous cavity.31 this may cause scarring of the bleb or trabeculitis and result in a higher iop compared to blebitis. at 6 months postinfection, patient with blebitis on average had visual acuity that was similar to preinfective levels 0.38 vs 0.48 (logmar acuity). unfortunately, bre patients did not fare as well, with preinfective vs 6-month postinfective readings of 0.61 vs 1.58, respectively. given the clinical course, it is expected that patients with bre would have poorer visual acuity (table 7). having a positive culture, which is more common in bre, is also a significant risk factor for poor visual acuity.31 blebitis on the other hand is a limited infection, which normally responds well to intensive topical antibiotic treatment. our results indicate that while the mean iop eventually returns to preinfective levels in a timely manner, the inflammatory damage wrought on the eye in bre renders visual rehabilitation slow and likely with permanent impairment. bleb height was not a significant risk factor for either infection, with a relatively even distribution between the groups (p=0.32). perhaps counter - intuitively, we found the increasing vascularity of the bleb at the time of presentation conferred some risk toward developing bre (p=0.002) ; subjects with blebitis were more likely to have an avascular bleb (75.9%) than patients with bre who tended to have moderately vascular blebs (50.0%) (table 7). we postulate that while the poor blood supply in avascular blebs is compatible with the poor immune response to infection, it could also work in containing the infection for a period of time, slowing the intraocular progression of the infection. unsurprisingly, given the greater severity of inflammation, bre subjects were more likely to present with a purulent bleb than their blebitis counterparts (90.0% vs 20.7%, p<0.001). this suggests that pus is a harbinger of poor outcome and is a strong indicator of blebitis being an antecedent to bre.21,29 the distribution of microorganisms encountered in our study was slightly different to others (table 5), which mostly implicate streptococcus and staphylococcus spp. in the us and east asia, respectively.9,10,18,19,25,27,30 almost half of our patients with bris were culture negative. while a few studies have reported similar rates of negative cultures,4,18 the overwhelming majority have yielded larger numbers of culture positive subjects.4,13,14,24,29 when positive, the vitreous and conjunctival cultures were correlated. there are a few possibilities for this discrepancy : many of these studies utilized intraocular culture specimens,3,16,30,32 whereas our subjects had conjunctival swabs sent for gram stain and culture on aerobic, anaerobic and fungal mediums, and only bre patients who underwent vitrectomy had vitreous cultures taken. additionally, the initial culture was often performed in the emergency department by junior residents, employing nonstandardized methods. the distribution of the causative microorganisms between the blebitis and bre groups was very similar (table 5), implying that no particular microorganism had a greater propensity to cause bre. as with most related studies, limitations include the small sample size and retrospective case design and inadvertent poor documentation. as a single center report, there may be an inherent bias in the surgical techniques employed and geographic variability of microorganisms. the acquisition of cultures was not always systematic, standardized or timely and differed from many other studies. documentation in some areas was lacking in particular, surgical details and specific descriptions of the bleb on presentation. unfortunately, the timing of antibiotic commencement was also poorly documented and not shown to be significant in our study. this knowledge could have strengthened our hypothesis that a delay in treatment would result in bre. a prospective case control study in which more cases of infection would be collected could corroborate our current findings. our findings reinforced a previously identified risk factor age ; and suggested other risk factors, male gender and diabetes, may have some bearing though they did not reach significance. it would thus be prudent for clinicians to note particularly if patients have these risk factors, and adjust their management as necessary. our study also showed that there was no significant difference in the position of a superior bleb, anti - fibrotic agent used and time the anti - fibrotic agent was applied, hence clinician preference can be exercised without much concern. finally, with the strong suggestion that patients with blebitis often presented with a lower iop, clinicians should be particularly vigilant about a bleb leak or sweating bleb. similarly, clinicians must be attuned to the fact that bre patients often present with a higher iop and institute early and aggressive treatment where required. despite the potentially devastating effects of bre, timely and appropriate management can result in a good outcome. | purposecomparison of the demographic, ocular, systemic and microbiological characteristics of eyes with bleb related infection (bri) and bleb related endophthalmitis (bre).methodsretrospective chart review of patients with bri from january 1996july 2013. identification done via the center s longstanding endophthalmitis audit, bri audit and laboratory database identifying all conjunctival swabs from blebs. blebitis was defined as anterior segment inflammation with mucopurulent material in or around the bleb, with anterior chamber cells but no hypopyon. bre was defined by the presence of hypopyon or vitreous inflammation.resultstwenty-nine patients with blebitis and 10 with bre were identified. mean age of subjects (n=39) was 68.4 (13.3) with a preponderance of men (74.4%) and chinese ethnicity (74.4%). bre patients were 10.7 years older than blebitis patients (p=0.026). 28 (71.8%) subjects had primary open angle glaucoma. the presenting intraocular pressure (iop) dropped in blebitis but almost doubled in bre (p=0.011) compared to average preinfective iop. two weeks after treatment, iops in both groups returned to close to preinfective levels. subjects with blebitis more often had an avascular bleb (88.0%) while those with bre trended toward a moderately vascular bleb (50%). the distribution of causative microorganisms between the groups was similar.conclusionour study indicates that risk factors are similar in both groups even though the visual outcome and clinical course, in the form of iop findings and bleb vascularity, can diverge significantly. the decreased iop in blebitis subjects represents objective evidence of subclinical leaks or bleb sweating. |
alzheimer 's disease (ad) is the most prevalent form of dementia, being usually diagnosed in people over 65 years, although the less prevalent early - onset forms of ad develop at earlier ages. dementia prevalence rises exponentially, doubling the rate of ad every 5 years after the age of 60 with a 15-fold prevalence increment from - age-60 to 85 years. the pathophysiology of this dementia is characterized by the extracellular accumulation of amyloid- (a) and the intracellular formation of neurofibrillary tangles of the tau protein in neurons, in association with neuronal dysfunction and cell death in some brain areas as the hippocampus. although a has been considered to be the main agent implicated in ad pathogenesis, it is still uncertain if a plaques are causative for ad or a consequence of its pathological changes. there are several hypotheses that attempt to explain the origin of ad, although the most popular is still the a cascade hypothesis, which considers a as the key pathogenic factor. the inflammation hypothesis and the glial dysfunction hypothesis have lately gained increased support. with some differences, both of them state that a accumulation is a consequence of the dysregulated activation of glial cells, which in turn induce an inflammatory response, alter their a-clearance activity, and mediate the neurotoxic effects of a [7, 8 ]. it is widely known that aging, the most robust risk factor for ad, is also strongly associated with a progressive increment on the inflammatory state of the organism. inflammation induces a large amount of cell changes at multiple levels, including microglial cells, and, as it will be discussed in the next section, microglial cells also become more neurotoxic in response to inflammatory states. whereas the inflammation hypothesis considers that hyperreactive microglia is the major contributor to the adverse events associated with ad, the glial dysfunction hypothesis suggests that impairment of normal glial functions, meaning qualitative changes, and not only quantitative changes on microglial cell activation, are responsible for the synaptic dysfunction and the neurodegenerative process observed in ad. as it will be further discussed, glia are the scavenger cells of the brain. by having a reduced capability to clear a, a accumulates and microglial cells become activated and create a cytotoxic environment that induce a vicious circle that potentiates a neuroinflammatory state and neurotoxicity [12, 13 ]. because the impairment of a clearance induce the accumulation of the peptide even if there are no changes in a production, this hypothesis states that a accumulation would be a consequence and not a cause of the pathogenic changes leading to ad [14, 15 ]. there is robust evidence showing high levels of inflammatory mediators in the brain of ad patients. around senile plaques, a strong presence of tnf-, il-1, il-6, monocyte chemoattractant protein-1 (mcp-1), complement proteins as c1q, c1r, c2, c3, c4, c5, c6, c7, c8, and c9, c - reactive protein, and class ii major histocompatibility complex antigen hla - dr is observed [1620 ]. when the effect of inflammatory cytokines over the production of a was evaluated, it was demonstrated that exposure to cytokines such as il-6 and il-1, increase neuronal amyloid precursor protein (app) mrna expression. in addition, glial cultures obtained from rapid brain autopsies of ad patients stimulated with a show an increased release of prointerleukin-1 (pro - il-1), il-6, il-8, tnf-, mcp-1, macrophage inflammatory peptide-1 (mip-1), and macrophage colony - stimulating factor (m - csf), corroborating the inflammatory activation of glial cells as part of the physiopathology of ad. despite of this, in vitro studies have demonstrated that a potentiates inflammatory activation of microglia, with different forms of a showing distinct patterns of cytokine release ; for instance, soluble forms of a140 stimulate specifically the release of il-1, while a142 induces the release of il-1 and ifn-. also, immunohistochemical studies of the brain of ad patients have shown the presence of reactive microglia closely associated with senile plaques [20, 25 ]. the exposure of microglia to a soluble form of app (sapp) induces an increase of activation markers in microglia and enhances their production of neurotoxins. more specifically, a stimulates the nfb - dependent pathway, which in turn induces the cytokines production by microglia and initiates the neurotoxic effects mediated by these cells. using mouse models of ad, simard. showed that amyloid plaques are capable of chemoattracting immune cells from the bone marrow into the brain parenchyma, which adopt a microglial cell phenotype in the brain and suggested that these immigrant cells are the main responsible for a plaque clearance. microglial cell - associated a clearance was originally shown by incubating murine microglia with fluorescent - labeled a. the study also established the participation of scavenger receptors (srs) in this process by demonstrating that coincubation with an excess of srs ligands blocked the phagocytosis of a. also, the use of chinese hamster ovary (cho) cells transfected with scavenger receptors of class a (sr - a) and class b (sr - b) significantly potentiated the uptake of a, situating srs as the principal receptors responsible for senile plaques clearance. although the mechanistic factor involved in the association between ad and aging is still an unsolved question, there is evidence pointing out to microglial aging as well as other age - related changes as responsible for this correlation. studies of adult cortical cells have shown a reduced capacity of aged microglia to phagocytose a. in addition, it has been shown that a has cytotoxic effects only in aged individuals, with no a-induced neurodegeneration observed in the brain of young animals. all these microglial - mediated effects observed in ad are contrasted to the normally neuroprotective role of microglia, which involves the phagocytic capacity responsible for brain surveillance from infection and physical injuries, the supportive role implicated in neuronal survival by secreting nerve growth factors, and the contribution in creating a microenvironment for central nervous system (cns) regeneration [32, 33 ]. these changes in normal microglial cell functions are usually explained as a switch in the inflammatory state of the cell : during aging (and possibly also in ad), microglia change from an m2 activation state, characterized as an anti - inflammatory phenotype associated with wound healing, to an m1 state, which is a proinflammatory activation state related to the production of inflammatory cytokines, chemokines, and reactive intermediates. this evidence leads us to propose that aging, which is commonly associated with a progressive inflammatory state of the brain, can be one of the most important causes of the defective clearance of neurotoxic a, which in turn favors the overstimulation of the immune response, creating a positive feedback that leads to neuronal dysfunction, neurodegeneration, and the progressive development of neurodegenerative diseases like ad. as for microglia, astrocytes have also been observed in close proximity to senile plaques of ad patient brains. moreover, a is capable of stimulating the production of mcp-1 in astrocytes, having an important role in chemotaxis for attracting immune cells to the senile plaque. in ad patient brains, an upregulation of ifn- receptor (ifngr) on activated astrocytes has been observed, where treatment with inf- resulted in reduced cell viability, suggesting that activated astrocytes can become neurotoxic at least under certain conditions of inflammatory stimulation. under physiological conditions, astrocytes are the cells that maintain the brain integrity : they provide metabolic support for neurons ; are capable of sensing and modulate the neuronal environment ; regulate the synaptic levels of glutamate, ion concentrations, and the acid - base balance ; synthesize and release antioxidant molecules ; participate in the formation of the blood brain barrier ; and function as immune competent cells by acting in the clearance of cell debris and as antigen presenting cells. however, the effects mediated by astrocytes in ad are mainly harmful, which reveals the dual properties of astrocytes depending on the cellular context in which they are immersed. in ad animal models, it has been demonstrated that astrocytes surrounding a plaques are immunopositive for il-6. in the same line of evidence, in vitro experiments show that a exposure has differential immune effects in astrocytes depending on the peptide conformation : oligomeric a induce transient high levels of il-1 with a fast decrease, increasing nitric oxide (no) production, inducible nitric oxide synthase (inos) and tnf- expression, consistent with an early inflammatory response, while fibrillar a induces persistent increased levels of il-1 that remains over time, corresponding to a more chronic response. the release of il-1 by a-stimulated astrocytes promotes the release of il-1, il-6, and tnf- by microvascular endothelial cells, suggesting that astrocytes - cytokine release also plays a role in neuroinflammation and endothelial response that contribute to ad progression. in vitro studies have also shown that astrocytes exposed to a present sporadic cytoplasmic calcium signals that correlate with the death of adjacent neurons, an effect that is, abolished by pretreating cells with heavy - metal chelators. this effect suggests a neurotoxic effect mediated by intracellular calcium increase in astrocytes induced by a. in addition, it was found that astrocytes exposed to a have an increased glucose uptake and hydrogen peroxide production with no changes in intracellular antioxidants, both effects mediated by activation of the pi3k pathway, indicating that a induces alterations of astrocytes metabolism that could result in increased cytotoxicity. using specific deletion of the immune calcineurin / nuclear factor of activated t - cell (nfat) pathways in astrocytes, which mediates biochemical pathways leading to astrocytes activation, it has been shown in ad animal models that activated astrocytes are responsible for cognitive and synaptic function impairment mediated by amyloid depositions, confirming a deleterious role of activated astrocytes in ad. nevertheless, even though activated astrocytes appear to have a deleterious role in ad progression, there is also evidence showing that they are capable of ameliorating the cytotoxic effects of activated microglia in culture. conditioned media from microglia exposed to a induce apoptosis in hippocampal cells, but this effect is not observed when the media is obtained from mixed glial cultures exposed to a. many of the inflammatory activation changes of microglial cell induced by a are attenuated in the presence of astrocytes. moreover, astrocytes activation mediated by lps and ifn- induce the secretion of tgf-, a neuroprotective cytokine, which was capable of reducing apoptosis of hippocampal cells induced by a, suggesting that astrocytes have a pivotal role in the modulation of ad inflammation. although the mechanisms that mediate astrocytes changes induced by a are poorly understood, there is evidence showing that astrocytes are capable of phagocytosing a and that they interact with a through the srs, specifically pointing out to sr - a as responsible for this interaction [35, 44, 49 ], which allows one to infer that, as in microglia, the phagocytic activity by astrocytes could be impaired with aging. furthermore, given the high number of astrocytes in the brain parenchyma, even if the phagocytic activity of astrocytes appears to be less robust than that of microglia, changes in phagocytosis can be highly relevant for a decreased a clearance capability, as well as impairment of the regulation of microglial cells. cells mediating the immune response interact with multiple environmental compounds, and depending on receptors present on their surface, their response to those signals could be pro- or anti - inflammatory. many pattern recognition receptors (prr) have been described, like toll - like receptors (tlr) and nod - like receptors (nlr) that trigger the activation of specific inflammatory pathways according to the ligand they bind. in addition, many immune cells are able to phagocytose diverse compounds because of the presence of receptors that uptake various ligands such as cell debris and allow their removal through the lysosomal pathway. many of these receptors belong to the scavenger receptors (srs) family, a term that was first coined in 1979 to define high - affinity binding sites for acetylated low - density lipoproteins (acldl) on macrophages. these receptors share the capability of binding polyanionic ligands without differentiating exogenous ligands like those from pathogens and endogenous ligands, which have importance in the host defense response. whereas participation of srs has been widely described in atherosclerosis, their role in ad - associated immune response remains poorly understood. however, it has been shown that srs have an important role in the clearance of a, and that the expression of these receptors decreases in aging brains of animal models of ad, situating srs as important mediators of ad progression. until now 6 families of srs have been described, named from sr - a to sr - f, but there are still 3 srs that remain unclassified, which are rage, cd136, and sr - psox. it is unknown if the last two receptors are associated with the pathophysiology of ad, even though both are expressed in the cns. in this section we will discuss the main srs that appear to be involved in ad and their role in glial cell inflammatory activation (figure 1). the principal ligand of sr - bi is hdl, which has an important role in lipid and cholesterol mobilization in the reverse cholesterol transport. because of the delivery of cholesterol from peripheral tissue occurs in sr - bi - expressing cells participating in lipid metabolism, the main expression of this receptor can be found in the liver and in steroidogenic tissues. nevertheless, sr - bi can be also found in the brain parenchyma, especially on glial cells and cerebral arterial smooth muscle. it is believed that sr - bi has a role in host defense because of the upregulation of its expression during phagocytic and dendritic differentiation of monocytes and because of the suppression of its expression in monocytes and macrophages, exposed to proinflammatory stimuli. moreover, sr - bi - null mice have a 100% fatality induced by sepsis with increased levels of inflammatory cytokines released by macrophages, while overexpression of sr - bi attenuated the inflammatory response in these cells, suggesting a protective role of sr - bi through the modulation of the inflammatory response of macrophages. in astrocytes, the main role of sr - bi appears to be associated with clearance of apoptotic cells. however, it has also been reported that sr - bi is involved in the adhesion of microglia to a plaques. studies have shown that animal models for a accumulation have an increased expression of sr - bi in the brain, and partial or total deletion of sr - bi gene in those animals enhances a deposition associated with an impaired response of perivascular macrophages to a. however, if sr - bi has a direct role in a clearance and if the interaction between a and sr - bi activates specific signaling pathways remain as unanswered questions. cd36, another member of the sr - b family, was initially described in adipocytes and myocardium, where it participates in the transport of long - chain fatty acids (lcfa). the deficiency of cd36 leads to an increase in plasma levels of free fatty acids and triacylglycerol, with an abnormal myocardial lcfa uptake. cd36 is also expressed in immune cells, being associated with the clearance of apoptotic neutrophils by macrophages. in the brain, the expression of cd36 has been reported in capillary endothelium, astrocytes, and microglial cells, in which this receptor has been associated with the regulation of cell migration. cd36 appears to be involved in pathologies such as brain ischemia, where cd36 expression is increased mostly in cells expressing the microglia / macrophage marker cd11b. cd36-null mice have reduced infarct size after ischemia, improved neurological function, and, less ischemia - induced reactive oxygen species (ros) levels than wild - type animals. cd36-null mice also have an attenuated postischemic activation of nfb, suppressed glial activation, and an impaired astrocytes proliferation, all of which situate cd36 as an important mediator for brain inflammatory events. besides brain ischemia, coraci. detected reduced levels of cd36 in microglia obtained from patients with ad, multiple sclerosis, and parkinson 's disease. specifically, in ad, cd36 appears to have a major role in the binding of cells of the monocyte / macrophage lineage to a, which activates a signaling pathway associated with production of ros and cytokines [74, 75 ]. in cd36-null mice, microglia and macrophages have reduced secretion of cytokines, chemokines, and ros in response to treatment with a, in addition to showing a decreased macrophage and microglial recruitment into the brain., ricciarelli. reported high expression of cd36 in the cerebral cortex of ad patients and in normal subjects with diffuse amyloid plaques, compared with the amyloid - free brains of control individuals. also, by using cells in vitro, they demonstrated that a-induced cd36 overexpression in neurons was associated with an increase in nitrated proteins. nonetheless, cd36 expression by leukocytes is significantly reduced in ad patients, a phenomenon already observed at early preclinical stages as mild cognitive impairment. otherwise, in animal models of ad, it has been shown that old mice had a decreased expression of cd36 associated with an increased secretion of il-1 and tnf-, and an increased vascular amyloid deposition mediated by cd36. the ability of cd36 to participate in the clearance of a has been demonstrated by shimizu., who by using cho cells overexpressing cd36, showed a dose - dependent degradation of labeled a, during treatment with an anti - cd36 antibody blocked a degradation. in addition, astrocytes - mediated a clearance is also attenuated with neutralizing antibodies against cd36. although there are only few studies that associate cd36 with a clearance, it appears that this receptor is mostly associated with neurovascular dysfunction observed in ad. in animal models of ad, deficiency of cd36 prevents cerebrovascular effects and oxidative stress elicited by a [79, 82 ], suggesting that cd36 could be a therapeutical target mainly for the treatment of neurovascular dysfunction in ad patients. rage is a member of the immunoglobulin family and a cell surface receptor for advanced glycation endproducts (ages), which accumulate mainly in vascular tissues in aged individuals. rage protein expression can be found in vasculature, endothelium, smooth muscle, mononuclear cells, cardiac myocytes, and neural tissue. the interaction of rage with the ligand amphoterin, a polypeptide associated with the growth of cortical neurons derived from the developing brain, has been linked to cancer as the colocalization of both molecules has been shown to contribute to cellular migration and tumor invasion. blockade of this interaction leads to suppression of the activation of intracellular pathways linked to tumor proliferation. interaction of ages with rage expressed by endothelial cells has been usually related to vascular dysfunction, mainly because of ros induced by ages. this oxidative stress results in the activation of nfb pathway, an affect that has been also observed in inflamed gut biopsies with a significant upregulation of rage, situating rage as an important inflammatory mediator in ages mediated lesions. in relation to ad, the interaction of a with rage expressed by endothelial cells of the brain favors the transendothelial migration of monocytes from peripheral blood into the brain, indicating an important role of rage in ad - related vascular disorders. also, an increased expression of rage by neurons in the brain of ad patients has been observed. murine models of ad with overexpression of rage have an exacerbated impairment in spatial learning / memory and altered activation of synaptic plasticity markers, where the synaptic depression and ltd impairment induced by a could be rescued by functional suppression of rage activity in microglia. however, vodopivec. have shown that the absence of rage in animal models of ad does not ameliorate their cognitive deterioration, a accumulation, or microglial activation, suggesting that rage would have only a secondary role for the impairments observed in ad. scavenger receptor class a (sr - a) is a homotrimeric transmembrane glycoprotein containing extracellular c - terminal cysteine - rich domains, that was initially implicated in the development of atherosclerosis, because of its colocalization with macrophages of lipid - rich atherosclerotic lesions [92, 93 ]. the expression of this receptor has been detected in many tissues, including liver, placenta and brain. when discovered, the first function described for sr - a was to provide adhesiveness to monocytes and macrophages to glycated collagen - iv - coated surfaces, and to mediate the endocytosis of acldl. also, given the fact that macrophage srs are involved in the binding and internalization of lps, which is part of gram - negative bacteria, thomas. showed that sr - a - deficient mice were more susceptible to infection with pathogens, with an impaired ability to clear bacterial infection, confirming what was shown by suzuki, providing the first insight on the importance of sr - a in host defense [97, 98 ]. additionally, other researchers observed that these animals showed a reduced expression of il-1, which is associated with a reduced mortality in response to lps, showing that sr - a has a role in the macrophage activation induced by endotoxin shock [100104 ]. in addition, sr - a also plays a role in macrophage engulfment of apoptotic thymocytes [105, 106 ], and in atherosclerosis, observing that disruption of the sr - a gene results in a reduction in the size of atherosclerotic lesions. moreover, in left ventricular remodeling after myocardial infarction, sr - a has a role in attenuating cardiac remodeling by suppressing macrophage polarization toward a biased m1 phenotype, reducing the release of proinflammatory cytokines. it is important that in contrast to most srs, sr - a expression is not downregulated by chronic exposure to endogen ligands such as acldl. on the opposite, sr - a expression can be reversibly increased by incubating macrophages with sr - a ligands. in addition, binding of a ligand to sr - a activates pi3k recruits more receptors to the membrane surface, all of which are key functional characteristic to consider when sr - a is seen as a therapeutic target. in the normal brain, sr - a is expressed by microglia, perivascular cells, microvessels, stromal, epiplexus, and meningeal macrophages [110114 ]. furthermore, our group was the first to describe the expression of sr - a by astrocytes, showing that exposure to sr - a ligands activated mapks and nfb signaling pathways and increased the production of il-1 and no by astrocytes. in an animal model of cerebral ischemic injury, sr - a is upregulated in the brain, an effect that correlates with increased levels of proinflammatory markers in microglia / macrophages, and an increased activation of nfb ; whereas sr - a - deficient mice show a reduced infarct size and improved neuronal function, suggesting the participation of sr - a into the m1 microglia / macrophage polarization [116118 ]. in ad, sr - a has been observed in close association with senile plaques, presenting microglia positive for the receptor [114, 119 ]. sr - a has been related to rodent microglia and monocyte adhesion to a coated surfaces, leading to the production of ros and to a internalization mediated by endosomes in microglia [57, 121, 122 ]. more specifically, a internalized through sr - a is trafficked toward lysosomes inside the microglia and degraded by cathepsin b. to our knowledge, sr - a appears to be the most important scavenger receptor of the brain participating in a clearance. for this reason, sr the macrophage receptor with collagenous structure (marco) is a member of the srs class a family, localized mainly in macrophages of the spleen and lymph nodes, acting in the binding of bacterial antigens and phagocytosis, and having an important role in host defense. in the presence of pro - inflammatory stimuli like lps, sr marco expression is upregulated even in macrophages from liver and lungs, where normally it is not expressed. it is believed that sr marco has a direct effect in the morphology of activated macrophages, which is necessary for trapping pathogens, by mediating the formation of lamellipodia - like structures and dendritic processes. in fact, sr marco expression is essential for dendritic cells to acquire a mature phenotype. in the cns, sr marco is present in microglia and astrocytes ; sr marco expression in microglia is associated with a decrease of the antigen internalization capacity, while for both astrocytes and microglial cells it is believed that sr marco participates in their adhesion to a. there are other srs that have been involved in the signaling mediated by a, which we will briefly mention because of the scarce evidence that relates them directly to the pathophysiology of ad. this receptor, also known as macrosialin, is a member of the lysosomal - associated membrane protein (lamp) family, which is expressed in macrophages, osteoclasts, dendritic cells, and microglia, where its principal role is to bind and uptake oxidized lipoproteins and apoptotic cells.. showed that patients with haemodialysis - associated amyloidosis show an upregulated expression of cd68 by macrophages. the oxidized ldl receptor 1 (olr1) binds ldl, being an important sr associated with atherosclerosis, is mainly expressed by endothelial cells and monocytes, with minor expression by macrophages. even though it is unknown if olr1 is expressed by microglia, and if the receptor has a direct role in the immune response, it has been shown that olr1 is associated with a transport across the blood brain barrier [132, 133 ]. multiple egf - like domains 10 (megf10) is a type 1 transmembrane protein containing 17 egf - like domains in the extracellular portion and is mainly expressed in the brain, and it has been shown to be implicated in the uptake of a mediated by the lipid rafts endocytosis pathway. nevertheless, megf10 expression has not been observed in glial cells ; therefore, the mechanism by which this receptor could participate in a clearance is unknown. when ad is visualized as a pathology caused by a dysfunction of glial cells, which compromise several of their protective functions, including the phagocytosis of a, and favors potentially deleterious effects, as those observed in dysregulation of the inflammatory regulation, an objective target to generate potential treatments should be the recovery of the protective activation of glia, characteristics that appear to be lost in association with aging and chronic inflammatory activation. most of srs found in glia appear to be potentially involved in phagocytosis and inflammatory activation of glial cells. however, they have been poorly studied in terms of their interaction with the a peptide. as it was shown by hickman., the age progression associated with ad reduces the expression of sr - a in older individuals, an effect that is, also induced by treating microglial cells with pro - inflammatory cytokines. this robust evidence situates sr - a as one of the main receptors involved in the impaired clearance of a observed in ad and also could be the link between ad and the inflammatory state related to aging, suggesting that sr - a could be an interesting therapeutic target for ad. | it is widely accepted that cells serving immune functions in the brain, namely, microglia and astrocytes, are important mediators of pathological phenomena observed in alzheimer 's disease. however, it is unknown how these cells initiate the response that results in cognitive impairment and neuronal degeneration. here, we review the participation of the immune response mediated by glial cells in alzheimer 's disease and the role played by scavenger receptors in the development of this pathology, focusing on the relevance of class a scavenger receptor (sr - a) for a clearance and inflammatory activation of glial cell, and as a potential target for alzheimer 's disease therapy. |
epidemiological studies show that headache (ha) and back pain (bp) frequently occur in this age group and are often accompanied by psychological problems.1,2 dysfunctional stress coping strategies refer to maladaptive cognitive or behavioral reactions to stress and strain.3 postal surveys showed that children with recurrent ha (ha twice per week or more) used more dysfunctional stress coping strategies in stressful situations, such as passive avoidance, rumination, resignation, and irritable behavior, than did children without ha.4 however, the causal relationships between stress, dysfunctional stress coping, and ha are still far from understood. are stress and dysfunctional stress coping risk factors for the development of ha, or does ha increase the risk of stressful experiences and dysfunctional coping?5,6 with regard to bp, the situation is comparable. stress as a causative factor has rarely been investigated in children.7 many researchers have investigated to what extent certain appraisals, expectations, and beliefs regarding pain and body sensations, such as pain catastrophizing, anxiety sensitivity, and somatosensory amplification, are correlated with pain. catastrophizing denotes an exaggerated negative cognitive and behavioral preoccupation with pain,8 characterized by an increased attentional focus on pain cognitions, an overestimation of the negative consequences of pain (eg, damage), and the experience of helplessness with regard to pain.9 several cross - sectional studies8,10,11 and one prospective study12 have found correlations between pain and catastrophizing in children. the construct of anxiety sensitivity originated in the context of models of panic disorder and was only subsequently examined with respect to its role in pain experiences.13 anxiety sensitivity is the disposition of a person to be fearful regarding their own bodily reactions, which are experienced as threatening and dangerous. high anxiety sensitivity increases the fear of pain and may result in avoidance behavior, which may maintain the pain.14,15 somatosensory amplification16 denotes the disposition to focus one s attentions and perceptions on one s bodily sensations. the concept overlaps to a certain extent with the construct of anxiety sensitivity, but the former places greater emphasis on the perceptional and attentional focus than the latter. those with high somatosensory amplification may be more prone to chronic pain.17 in their review, duddu conclude that the evidence points to a complex, but still unclear, relationship between somatic symptoms and underlying cognitions and illness behaviors. the objective of the present study was the unidirectional analysis of potential causal factors for the development of pain by means of a longitudinal design. although temporal priority is not sufficient to establish a causal role for any factor, temporal priority is a necessary condition for such a causal role. we hypothesized that a dysfunctional cognitive processing style, operationalized as dysfunctional stress coping, catastrophizing, anxiety sensitivity, and somatosensory amplification, would increase the risk for the incidence of recurrent pain. in addition, the question of whether these factors exert a differential influence depending on the pain site (ha or bp) is addressed. since there is evidence of sex - specific effects,8,19 whether the potential risk factors had a different effect in boys and in girls was also investigated. the kijuko study consisted of a postal survey that was conducted in four waves (w1w4) in four consecutive years (20032006). in the first wave (w1 : 2003) the data presented here are based on the children s and adolescents questionnaires from the second (w2 : 2004) and third (w3 : 2005) waves. the average age of the children in w2 was 11.25 years (standard deviation 2.28 years ; range 815 years) and the proportion of boys was 49.5%.20 the kijuko questionnaire was developed on the basis of an extensive literature survey and clinical experience. whenever possible, the operationalization of the potential risk factors was based on established instruments (see table s1). detailed information regarding the development of the questionnaire and the procedures, as well as the results of the first wave, has already been published elsewhere.21 in order to predict the incidence of ha and bp, the questionnaires of all children who did not have ha or bp in w2, but who developed ha or bp 1 year later in w3, were selected for the logistic regression (incidence samples : ha, n=1,665 ; bp, n=2,040 ; see figures 2 and 3). in each wave, the reported ha frequencies within the last 6 months (based on the children s own reports) were allocated to one of four categories : no ha, ha less than once per month, ha at least once per month, and ha at least once per week. for the regression, the criterion variable was dichotomized in two groups : recurrent ha in w3 present, ie, ha once or more per month (n=368, 22.1%), and not present, ie, ha less than once per month (n=1,297, 77.9%). information on the frequency of bp was collected by means of a 5-point rating scale ranging from never to always. for bp, a dichotomous variable was generated in analogy to the dependent variable ha, with bp classed as recurrent bp if the child reported having experienced bp at least sometimes in the last 6 months. in w3, the number of children with recurrent bp was 719 (35.2%) and without recurrent bp was 1,321 (64.8%). (not present = 0) and rarely/a little (present = 1), because we assumed that younger children could distinguish more reliably between no, i never had ha / bp and yes, i have had ha / bp (independently of the frequency of the pain). as an added advantage, dichotomizing facilitates the interpretation of the results. apart from age and sex, potential predictors collected in w2 with the children s and adolescents questionnaires (tables 16) were the following variables : dysfunctional stress coping, pain catastrophizing, anxiety sensitivity, and somatosensory amplification. it should be noted that the pain catastrophizing items were only filled in by children 11 years and older, because pilot studies (data on file, 2003) had shown them to be too difficult for younger children. the satisfactory internal consistency (cronbach s alpha : 0.722 in this study from 0.71 to 0.88 ; see table s1) allowed an aggregation of the items belonging to one predictor into a mean scale score per predictor. for the analyses, the predictor variables were dichotomized in the same way as the criterion variables, ie, the reference category is no / never. the data were analyzed by means of a binary logistic regression following the recommendations of field.23 multicollinearity was excluded on the basis of variance inflation factors and tolerances.24 all variance inflation factor values lay within the range 12, indicating that no multicollinearity was present. in a first step, the predictive values of age and sex with regard to recurrent ha and bp were examined through univariable analyses. since, in these preliminary analyses, sex emerged as an important factor for the incidence of ha (p0.10). in the univariable analyses for boys, dysfunctional stress coping, anxiety sensitivity, and somatosensory amplification exerted an influence on the development of bp after 1 year (table 8). as in the case of ha in boys the results of the multivariable model pointed to the importance of dysfunctional stress coping and anxiety sensitivity. the risk of developing bp increased by 1.4 if boys reported dysfunctional stress coping (reference : boys who reported that they never used these strategies). age was shown to be relevant in the multivariable model (p<0.001 ; or = 1.17 ; 95% ci = 1.081.25), ie, with every year of a boy s life, the risk of developing bp increased by approximately 1.2. the model only explained a very small amount of variance (nagelkerke s r : 0.049). for girls, only somatosensory amplification was influential in univariable analyses. in the multivariable model, girls who focused more sensitively on bodily sensations had a 1.8-fold increased risk of reporting bp 1 year later. increased pain catastrophizing reduced the risk of developing bp. girls who reported a catastrophizing style of pain appraisal when they experienced pain had a reduced risk (0.5) of developing bp 1 year later. this model also explained a very small amount of variance (nagelkerke s r : 0.036). for boys, none of the variables contributed to the development of ha, as no significant ors were found in the univariable or multivariable analyses (table 7). age was included as a control variable in each univariable analysis, and it was found that regardless of the variable investigated the risk of developing ha decreased with increasing age (all ors for age in these analyses lay between 0.76 and 0.87, p<0.05). in the univariable analyses for girls, dysfunctional stress coping and somatosensory amplification emerged as influential factors for the incidence of ha 1 year later. for girls who used dysfunctional stress coping, the risk of developing ha was 2.1 times as great compared to girls who never used dysfunctional stress coping. girls who interpreted bodily sensations in the sense of somatosensory amplification had a 1.5-fold increased risk of developing ha 1 year later. however, both variables lost their significance when they were considered in a multivariable model. in the univariable analyses for boys, dysfunctional stress coping, anxiety sensitivity, and somatosensory amplification exerted an influence on the development of bp after 1 year (table 8). as in the case of ha in boys, age was relevant across all analyses (p<0.05 ; or = 1.071.21). the results of the multivariable model pointed to the importance of dysfunctional stress coping and anxiety sensitivity. the risk of developing bp increased by 1.4 if boys reported dysfunctional stress coping (reference : boys who reported that they never used these strategies). age was shown to be relevant in the multivariable model (p<0.001 ; or = 1.17 ; 95% ci = 1.081.25), ie, with every year of a boy s life, the risk of developing bp increased by approximately 1.2. the model only explained a very small amount of variance (nagelkerke s r : 0.049). for girls, only somatosensory amplification was influential in univariable analyses. in the multivariable model, girls who focused more sensitively on bodily sensations had a 1.8-fold increased risk of reporting bp 1 year later. increased pain catastrophizing reduced the risk of developing bp. girls who reported a catastrophizing style of pain appraisal when they experienced pain had a reduced risk (0.5) of developing bp 1 year later. this model also explained a very small amount of variance (nagelkerke s r : 0.036). the purpose of the study was to examine the role of cognitive processing styles for the new occurrence of ha and bp in youths in a 1-year follow - up. to the best of the authors knowledge, this is the first study to contrast potential risk factors for the incidence of bp and ha. in agreement with our expectations and the findings of existing research, several variables of those we examined proved to be predictors for the development of pediatric pain with differing risk profiles for the development of ha and bp. our results confirmed existing findings concerning sex - specific effects : more girls than boys experience (6 months prevalence)26 and develop (incidence) ha and bp.27 moreover, our results agree with reported findings19,28 that different factors seem to be relevant for girls and for boys. for boys, none of the variables examined was a risk factor for the incidence of ha. for girls, dysfunctional stress coping and somatosensory amplification showed an influence on the development of ha when analyzed individually, but not when entered into the multivariable model. for bp, univariable and multivariable analyses showed that dysfunctional stress coping and anxiety sensitivity predicted the development of bp 1 year later for boys. with respect to bp in girls, somatosensory amplification emerged as a factor increasing risk, while pain catastrophizing reduced the risk of developing recurrent bp 1 year later. in the following discussion, we only refer to the results of the multivariable models, since it is only in this way that the relative impact of the individual variables can be assessed. several authors found that children with recurrent ha exhibit more dysfunctional stress coping strategies than children without ha.4,29,30 it was the aim of this study to investigate whether the incidence of ha and bp can be predicted on the basis of dysfunctional stress coping, ie, whether children who showed more dysfunctional stress coping at the time of the first survey would go on to develop recurrent ha 1 year later ; clearly, this was not the case, as none of the variables investigated was a predictor for the development of ha. other studies investigated only correlations between these variables in a cross - sectional study design.30,31 studies that employed a longitudinal design investigated potential predictors that were not the focus of the present study.32,33 we used a strictly unidirectional design to assess whether cognitive processing styles influence the development of ha. taken together, our findings and the reports of studies4,29,30 that found an association between ha and dysfunctional coping suggest that ha possibly precedes dysfunctional cognitive processing styles. the causal direction may be from ha to dysfunctional cognitive processes, rather than vice versa. it is possible that repeated experiences of ha lead to children developing dysfunctional pain coping. for boys, thus, one can conclude, with some caution, that a dysfunctional stress coping style in the sample described is only predictive for bp in boys. the first longitudinal study in children for the new onset of pain symptoms (lower bp) found that children who reported high levels of psychosocial difficulties, especially conduct problems and hyperactivity, were 1.6 times more likely to develop lower bp.7 mustard found that the risk of the incidence of bp was associated with both low (or = 1.86 ; 95% ci = 1.143.03) and moderate / high (or = 1.85 ; 95% ci = 1.073.02) levels of psychological distress.34 on the other hand, brattberg reported that stress perceived in childhood / adolescence did not predict future pain or stress.35 in pediatric pain research, connections between catastrophizing and pain characteristics have been reported,10,12 with stronger catastrophizing in girls than in boys.8 in the present study, however, pain catastrophizing appeared to be relevant for the development of bp in girls, but, surprisingly, in the opposite direction : catastrophizing reduced the risk of reporting bp 1 year later. this unexpected result has to be considered in the context of the fact that only children of 11 years and older filled in the questionnaire, because pilot studies showed the questions to be too difficult for younger children. however, the response rate for the pain catastrophizing scale for children items was still lower than for other items, something which was observed throughout all waves. this could be due to the fact that the questions may still have been challenging for the children. therefore, this result will have to be confirmed in further longitudinal analyses before potential explanations can be sought. for boys, anxiety sensitivity played a role in the development of bp, whereas, for girls, no influence on the development of ha or bp was found.36 in line with existing research,28 we found that girls achieved higher scores for anxiety sensitivity index than boys. however, these scores do not appear to have a predictive role for bp ; such a role we found only for boys. for girls, somatosensory amplification maintains its risk - aggravating influence if it is considered in the comprehensive model. this result supports indications that those individuals who introspect and who have a tendency to select and focus on relatively weak or infrequent sensations (the main elements of somatosensory amplification) might be more prone to experiencing bp.37 what was unexpected was the fact that the variables examined did not have an effect regarding the incidence of ha, but only regarding the development of bp. future research will have to examine and replicate this result before definite conclusions can be reached. when considering the results in comparison to those reported in the literature, it has to be taken into account that the present data were collected from a population sample. the findings of nagel38 support the trend previously reported by crombez and vervoort,10 that catastrophizing is more pronounced in clinical samples than in population samples. this argument might also extend to the other psychological constructs and, in our view, may explain the diverging results. overall, only a small proportion of the observed variance (for bp : boys, 4.9%, girls, 3.6%) could be explained through the psychological variables we examined. for the prediction of the incidence of recurrent pain, other predictors, which were not considered in the present models, seem to be relevant (see, for example, krner - herwig). furthermore, it is conceivable that the factors investigated play a more prominent role in the maintenance or exacerbation of recurring pain than in its development. a particular strength of the present study is the collection of longitudinal data from a large population sample and its use of a strictly defined incidence sample. moreover, in its investigation of pediatric pain, it was not limited to a single pain site or to the isolated consideration of single psychological variables. the large population - based study design, however, necessitated the use of self - report measures and precluded any etiological, clinical diagnosis ; as a consequence, it is not possible to distinguish between the various subtypes of ha and bp, and, in particular, whether it was a primary or secondary type. this limitation should be taken into account when interpreting the results. in this study, the interval considered was 1 year. when interpreting the results, the possibility should be taken into account that the influence of certain risk factors may only be observable after a longer period of latency and may thus not be detectable on the basis of the 1-year follow - up data presented here. a further limitation is the reduction of the sample size that resulted from the fact that we restricted ourselves to the analysis of incidence. this constituted a very strict criterion and thus led to a considerable reduction in the sample size. however, our methodology followed the methodological demands with regard to the development of prognostic models40 that only those participants who do not exhibit a certain feature (eg, pain) at time t1, but develop this at a later time, t2, are included. in this study, we considered pain frequency. some researchers advocate the incorporation of pain intensity or impairment resulting from pain ; these aspects were not discussed in the present study. a particular strength of the present study is the collection of longitudinal data from a large population sample and its use of a strictly defined incidence sample. moreover, in its investigation of pediatric pain, it was not limited to a single pain site or to the isolated consideration of single psychological variables. the large population - based study design, however, necessitated the use of self - report measures and precluded any etiological, clinical diagnosis ; as a consequence, it is not possible to distinguish between the various subtypes of ha and bp, and, in particular, whether it was a primary or secondary type. this limitation should be taken into account when interpreting the results. in this study, when interpreting the results, the possibility should be taken into account that the influence of certain risk factors may only be observable after a longer period of latency and may thus not be detectable on the basis of the 1-year follow - up data presented here. a further limitation is the reduction of the sample size that resulted from the fact that we restricted ourselves to the analysis of incidence. this constituted a very strict criterion and thus led to a considerable reduction in the sample size. however, our methodology followed the methodological demands with regard to the development of prognostic models40 that only those participants who do not exhibit a certain feature (eg, pain) at time t1, but develop this at a later time, t2, are included. in this study, we considered pain frequency. some researchers advocate the incorporation of pain intensity or impairment resulting from pain ; these aspects were not discussed in the present study. in a longitudinal design using strictly defined incidence samples, we investigated whether cognitive processing styles played a role in the development of ha and bp in boys and girls. although the influence of the individual variables differed between ha and bp and between boys and girls, the overall role for cognitive styles on the initial development of these conditions was very small. instruments with which the predictor variables (wave 2) were measured abbreviations : svf - kj, german coping questionnaire for children and adolescents ; ssas, somatosensory amplification scale ; asi, anxiety sensitivity index ; pcs - c, pain catastrophizing scale for children. | backgroundprevious research has shown positive relationships between dysfunctional cognitive styles and different aspects of pain (eg, pain frequency). one goal of our longitudinal study was to investigate potential risk factors for the incidence of headache (ha) and back pain (bp).methodsin the first wave (2003), questionnaires were sent to 6,400 children between the ages of 9 and 14 years. those who answered in wave 1 were contacted again every year (four survey waves in total : 20032006). the data presented are based on the children s self - reports in the second wave (2004) and third wave (2005). potential risk factors (dysfunctional stress coping, pain catastrophizing, anxiety sensitivity, and somatosensory amplification) were collected in wave 2. binary logistic regression analyses for boys and girls were performed to assess the predictive value of the risk factors for ha and bp in wave 3.resultsin the comprehensive model, none of the examined variables predicted the incidence of ha. anxiety sensitivity increased the risk that boys would report bp after 1 year by 50% and dysfunctional stress coping increased the risk by 40%. for girls, somatosensory amplification increased the risk of the incidence of bp 1 year later by 80%, whereas pain catastrophizing reduced the risk by 50%.conclusionin this incidence sample, the amount of variance explained by the psychological variables investigated was very small. integrating this result with existing findings from cross - sectional studies suggests that dysfunctional cognitive processing styles may develop more as a consequence or a concomitant feature of bp or ha, but play a less important role in its initial development. |
the largest family of cancer testis antigens (ctas) and one of the most important is the family of melanoma antigen encoding genes (mage). members of the mage family are involved in resistance to apoptosis and cell cycle progression and have been associated with some features of neoplastic phenotype such as immortality, invasion, and immune evasion metastatic ability [13 ]. one of its members, mage a3, named melanoma antigen encoding gene a3 because it was first reported to encode a tumor - specific antigen on melanoma cell line, has been studied and used in trials of immunotherapy in various histological types of cancers because it is recognized by t - lymphocytes [5, 6 ]. in tumor cells abnormal expression of mage a3 gene has been observed in melanomas, lung carcinomas, head and neck cancers, leukemia, squamous cell carcinomas, breast cancers, multiple myelomas, astrocytomas, ovarian tumors, hepatocellular carcinomas, colorectal carcinomas, and thyroid carcinomas, and its abnormal expression is related to aggressive disease in most tumors, a fact that made many authors hypothesize on a possible role of mage a3 in malignant transformation and progression [4, 79 ]. although associated with features of aggressiveness, mage a3 might also play an important and beneficial role in tumors, acting as a stimulant of immune responses. in fact, this protein has been tested on several in vivo models, aiming to determine its efficacy as an immune response inducer, and these preliminary results point out to a positive role of mage a3 in inducing tumor attack [10, 11 ]. although these tests have been conducted in different types of malignancy, studies of mage a3 protein in thyroid cancers are scarce and do not relate this protein to immune responses. the present study aimed to investigate a possible role of mage a3 in thyroid malignancy, analyzing its utility as a diagnostic and prognostic marker. we also aimed to analyze whether mage a3 expression would be associated with the presence of infiltrated immune cells. we studied 314 patients who underwent thyroid resection for thyroid cancer or thyroid nodules at ac camargo cancer center, so paulo, brazil. regarding histological types, 154 out of the 195 malignant tissues were papillary thyroid carcinomas (ptc) and 41 follicular thyroid carcinomas (ftc). the most frequent histotype among papillary carcinomas was the classic variant (cptc) (101 cases), followed by the follicular variant (fvptc) (49 cases). we also obtained benign tissue from patients, including 51 follicular adenomas (fa) and 51 goiter (g), and 17 normal thyroid tissues obtained from the contralateral lobe of fa (nt) (figure 1). aggressiveness at diagnosis was ascertained using american joint committee on cancer (ajcc) tnm system for differentiated thyroid carcinomas. patients were managed according to lats and ata guidelines [12, 13 ] and followed for a period of 12 to 175 months (median = 35 ; mean = 41.1 ; sd = 26 months). this study protocol was approved by the research ethics committees of the institutions involved (1259/09-c). all the available clinical, surgical, and pathology reports, as well as follow - up data, were recorded. all tumors were carefully and independently reviewed by two experienced pathologists (jv and fas) for diagnostic confirmation, and cases presenting conflicting results or areas of poor differentiation were excluded. paraffin blocks of formalin - fixed tissues were collected and, in each case, the most representative area of the tumor, normal surrounding tissue, tumor areas of invasiveness, and metastatic tissue were selected and microdissected whenever available. tissue microarrays (tmas) were built using the semiautomated tmarrayer (beecher instruments, silver springs, md, usa). five micrometer sections of tma were placed on electrically charged slides, deparaffinized, and rehydrated in decreasing concentrations of alcohol. all tissue sections were subjected to heat - induced antigen retrieval using 10% citrate buffer (10 mm, ph 6.0) in a steamer (90c for 30 minutes). tissues sections were then incubated overnight at 6c, with anti - mage a3 rabbit polyclonal antibody (ls - b884 - 50ug, lifespan biosciences, seattle, wa, usa), diluted at 1 : 10 ; cd4 monoclonal 1f6 (novocastra, newcastle upon tyne, uk) diluted at 1 : 100 ; cd8 monoclonal sp16 (thermo scientific, rockford, il, usa) diluted at 1 : 100. the advanced biotin - free polymer detection system was used (dako, carpenteria, ca, usa). dab (3.3-diaminobenzidine - tetrahydrochloride ; sigma, st louis, ma, usa) was applied as chromogen for five minutes, at room temperature. slides were quantified by at least two of the authors (mbm and/or mam and ecm) and then submitted to other two independent experienced pathologists (jv and fas), both blinded to tumor features for the final score. an individual evaluation of each marker was completed for each spot tissue, estimating the number of positive cells per tma spot, considering an approximate area of 0.79 mm. cells were considered positive for mage a3 when a cut - brown staining was observed in the cytoplasm as demonstrated in figure 2. visual evaluation was made for each tissue spot, estimating the percentage of positive tumor cells and the staining intensity. the percentage of positive cells was graded as follows : 0 = no positive cell ; 1 = up to 25% positive cells ; 2 = 25 to 50% positive cells ; 3 = 50 to 75% positive cells ; 4 = more than 75% positive cells. intensity was graded as follows : 0 = negative ; 1 = faint staining ; 2 = moderate staining ; 3 = strong staining. a final score was calculated adding both percentage of positive cells and immunostaining intensity, which ranged from 0 to 7. for statistical purposes, cases scored from 0 to 2 were grouped as negative and cases scored from 3 to 7 were considered positive. in addition to visual evaluation, we also analyzed the immunohistochemical expression of mage a3 using the acis - iii automated cellular imaging system (chromavision medical systems, inc, dako). briefly, each tissue spot was digitized to the system software and a numerical value proportional to the intensity and extension of brown staining was attributed by the computer analysis. we considered the given numbers using the following formula : score = (intensity brown area)/(brown area + blue area). we considered staining median as negative, whereas all staining > median was considered positive in the survival analysis, as previously described [1416 ]. regarding tumor - infiltrating lymphocytes analyses were considered positive for immunohistochemical markers when a clear - cut brown staining was observed in the typical corresponding cellular localization. the cases were grouped into categories for statistical analysis : negative (no positive cell) and positive (presence of positive cells in each spot). the statistical analysis was carried out using the sas system for windows (statistical analysis system), version 9.1.3, service pack 3, institute inc., 2002 - 2003, cary, nc, usa. a multivariate logistic regression model was applied using tumor type as a dependent variable ; protein expression ; and clinical risk factors, including gender and age as explicative variables. recurrence - free survival was calculated using kaplan - meier survival curves with log - rank comparison. nonparametric analysis was performed using either chi - square or fisher 's exact test, as indicated. the mann - whitney test was used to compare continuous or arranged measures between two groups ; kruskal - wallis test was used to compare three or more groups. the predictive accuracy of mage a3 expression to predict malignancy was evaluated using receiver operating characteristic (roc) curve analysis based on predicted probabilities from logistic regression models. as expected, dtc patients were predominantly females (81.52%) with a mean age at diagnosis of 45.63 15.34 years (range : 15 to 88 years). dtc group did not differ from the individuals with benign thyroid diseases regarding gender or age at diagnosis. unfortunately, we did not obtain sufficient metastatic tissues to be included in the statistical analyses ; thus, these tissues were excluded from further analysis. the positivity of mage a3 protein was identified in the cytoplasm with a brown color. intensity and positivity differences were observed among tissue types, both in the quantitative and the semiquantitative analyses, as demonstrated in figure 3 and table 1. according to semiquantitative (visual) analysis, mage a3 was positive in 185 (94.87%) out of the 195 cases of dtc and 74 (62.18%) out of the nonmalignant thyroid samples analyzed (p 45 years than in patients aged 2 cm (p = 0.0034) (table 3). we did not find any correlation of mage a3 + cd8 + with outcome, although there was a trend of these tumors to evolve free of disease (p = 0.0634). our results did not evidence any association between mage a3 expression and infiltration of cd4 + til. many members of the mage family are normally expressed in the testis and placenta ; however, members of the a subfamily are found mainly in neoplastic tissues, leading some authors to identify the mage a family as a candidate of thyroid carcinogenesis mediator [17, 18 ]. although there are reports on the expression of members of mage family in thyroid cancers, reports concerning mage a3 are still insufficient [1821 ]. in this work, we demonstrated that mage a3 may help not only to identify malignancy in thyroid nodules but also to sort out follicular - patterned lesions (i.e., ftcs and fas). the authors showed that the expressions of mage a1 and mage1/2 detected in fine - needle aspiration biopsies (fnabs) by reverse transcriptase - polymerase chain reaction (rt - pcr) distinguished fvptc from papillary hyperplasia in nodular goiters, facilitating the diagnosis of thyroid nodules and providing additional information to delineate ptc from papillary hyperplasia in fnab. other functional studies reinforced these differences between mage expressions in thyroid lesions, suggesting that mage a3/6 and fgfr2-iiib participate in the development of thyroid cancer. although not exactly similar, other authors have also reported associations between mage a3 and clinical pathological features of thyroid tumors. demonstrated that mage a3 positivity was more frequent in ptcs smaller than 1 cm (microcarcinomas), suggesting that the loss of this protein expression could be related to tumor progression. using an antibody that recognized both mage a6/a3 in 375 cases of thyroid tissues and 53 of metastatic disease, cheng. demonstrated that mage proteins are overexpressed in primary and metastatic thyroid tumors when compared with their surrounding normal tissues furthermore, cytoplasmic mage score was related to tumor size and the number of lymph node metastases.. observed that there was a strong staining of this protein in large tumors and in metastasis, thus, providing additional evidence that this protein may be involved in the formation of metastasis and tumor progression. using an antibody that only recognized mage a we observed an increased expression of mage a3 in the presence of extrathyroidal invasion, and more advanced stages of disease pointed out to the same direction, leading us to believe that this protein is related to tumor progression and aggressiveness. furthermore, we demonstrated a possible clinical utility of mage a3 expression in the identification and characterization of malignancies of follicular lesions. although the real physiologic role of mage 3 gene has yet to be identified, the cancer specificity of this gene expression may be important because of its possible application in tumor - specific immunotherapy. in fact, mage a3 has been studied as a possible immune target in other types of tumors and may be interesting for differentiated thyroid cancers refractory to radioiodine therapy. furthermore, we demonstrated that although mage a3 has been related to some features of tumor aggressiveness, when tumors were mage a3 + and able to recruit cd8 + expression, aggressiveness not only disappeared but also was associated with better prognostic features such as stage i, smaller tumors (< 2 cm), younger age (45 years), and absence of extrathyroidal invasion. there was a trend of mage a3 + cd8 + tumors to evolve free of disease. these results reinforce the hypothesis of a role of mage a3 as a recruiter / inducer of cd8 + tumor infiltrating lymphocytes, a set of immune cells that our group had already associated with better outcome and less aggressive disease [15, 16 ]. as already mentioned, the members of the mage family have been recently considered as tumor antigens, therefore, able to induce and recruit several types of immune cells to attack tumors. in a recent study, grard. demonstrated that mage a3 may be an efficient inducer of long - lasting antitumor responses. in fact, several groups have demonstrated that vaccines using mage a3 as immune response inducer might work for different types of advanced cancers, such as lung cancers, melanomas, renal cancers, and esophageal and even head and neck cancers, all with a considerable efficacy [2427 ]. there are no reports on the usage of mage a3 as an immune vaccine in thyroid cancer until the present moment, but undoubtedly, our study opens this possibility for a promising future scenario, especially considering patients with metastatic or refractory disease. in conclusion, we demonstrated that although mage a3 does not seem to solve diagnostic problems, such as the diagnosis of follicular - patterned lesions, it may play an important role in malignant thyroid nodules, potentially discriminating cases of worse outcome and presenting an interesting perspective for new researches on differentiated thyroid cancer immunotherapy. | background. we aimed to investigate a possible role of mage a3 and its associations with infiltrated immune cells in thyroid malignancy, analyzing their utility as a diagnostic and prognostic marker. materials and methods. we studied 195 malignant tissues : 154 ptcs and 41 ftcs ; 102 benign tissues : 51 follicular adenomas and 51 goiter and 17 normal thyroid tissues. mage a3 and immune cell markers (cd4 and cd8) were evaluated using immunohistochemistry and compared with clinical pathological features. results. the semiquantitative analysis and acis iii analysis showed similar results. mage a3 was expressed in more malignant than in benign lesions (p < 0.0001), also helping to discriminate follicular - patterned lesions. it was also higher in tumors in which there was extrathyroidal invasion (p = 0.0206) and in patients with stage ii disease (p = 0.0107). mage a3 + tumors were more likely to present cd8 + til (p = 0.0346), and these tumors were associated with less aggressive features, that is, extrathyroidal invasion and small size. there was a trend of mage a3 + cd8 + tumors to evolve free of disease. conclusion. we demonstrated that mage a3 and cd8 + til infiltration may play an important role in malignant thyroid nodules, presenting an interesting perspective for new researches on dtc immunotherapy. |
an increasing number of patients are developing pelvic floor laxity. because of the presence of many collateral health problems, all of which vastly increase the risks of surgery, minimally invasive operations are preferable for safety and quality of life. furthermore, it is suggested that hysterectomy itself may be a cause of pelvic organ laxity, as the descending uterine artery is a major blood supply to the uterosacral and cardinal ligaments. there is no clear evidence supporting the role of hysterectomy in improving surgical outcome. in 2005, a new minimally invasive methodology that permits uterine conservation, the tissue fixation system (tfs) was reported (fig. 1). a 7-mm wide, non - stretch monofilament tfs tape is applied entirely via a single vaginal incision, thus avoiding perforation of suprapubic, or perineal skin. like tvt (tension - free vaginal tape), the tfs works by creating a foreign body collagenous tissue reaction that reinforces a weakened pelvic ligament. it has been successfully applied to reinforce pelvic ligaments and fascias for cystocele, vault prolapse, and perineal body repair [2, 4, 5 ] and stress incontinence [6, 7 ], according to an anatomical classification. the aim of this study was to assess the effectiveness and perioperative safety of the tissue fixation system (tfs) tensioned minisling used as a minimally invasive surgical repair in a day surgery clinic for the treatment of pelvic organ prolapse (pop).fig. the tfs consists of two anchors (an) joined by a polypropylene mesh tape (t) passing through a one - way trapdoor at each base, which allows tightening. the anchor is released into the tissues by activating the tfs applicator button (b) the tissue fixation system (tfs). the tfs consists of two anchors (an) joined by a polypropylene mesh tape (t) passing through a one - way trapdoor at each base, which allows tightening. the anchor is released into the tissues by activating the tfs applicator button (b) we studied prospectively 60 patients who had undergone 180 site - specific tfs pop operations on a day surgery basis between october 2008 and february 2010 at yokohama motomachi women s clinic luna. this study was approved by the ethics committees of the yokohama motomachi women s clinic luna in 2006. written informed consent was obtained from all patients. the prolapse was staged according to the ics popq classification [9, 10 ] as follows : 0no prolapse is demonstrated during maximal straining ; i the most distal portion (leading surface) of the prolapse is > 1 cm above the level of the hymen (1 cm below the hymen, but no further than 2 cm less than the tvl (there is not complete vaginal eversion ; > + 1 cm, but 1 cm above the level of the hymen during straining. secondary outcome measures were symptom change, blood loss, and report of complications. the results as reported concern only the 12-month review, which included the questionnaires. patient characteristics and symptoms were summarized using descriptive statistics for continuous variables presented with means and standard deviations as appropriate. surgical failure (relapse) was defined as the presence of prolapse stage 2 or more in the middle compartment with prolapse complaints and/or redo surgery at 1-year follow - up according to the popq classification., japan) to assess statistical significance at the two - sided 5 % level (p 1 cm above the level of the hymen during straining. secondary outcome measures were symptom change, blood loss, and report of complications. the results as reported concern only the 12-month review, which included the questionnaires. patient characteristics and symptoms were summarized using descriptive statistics for continuous variables presented with means and standard deviations as appropriate. were assessed by a pop - q examination considered to be the primary outcome. surgical failure (relapse) was defined as the presence of prolapse stage 2 or more in the middle compartment with prolapse complaints and/or redo surgery at 1-year follow - up according to the popq classification., japan) to assess statistical significance at the two - sided 5 % level (p < 0.05). fifty - four patients (a response rate of 90 %) agreed to attend for 12-month review. the average patient age was 67 years (range 44 to 87 years). levels of pop were stage 2 (n = 20 ; 37 %), stage 3 (n = 30 ; 55 %), and stage 4 (n = 4 ; 7 %). average operative time was 86 min (minimum 40 min, maximum 135 min) and average blood loss 21 g. (minimum 4 g, maximum 136 g). fifty - three patients (98 %) were discharged on the day of surgery. one patient with a hematoma was transferred to a neighboring hospital for observation purposes only. the total number of patients who had no complications, no symptoms of bulging, no surgical failures, no erosions, and no cervical protrusions was 47 (87 %). in addition, 2 patients developed cervical protrusions at the introitus 6 months after tfs surgery. there was no prolapse of the uterine body ; thus, only the elongated cervix was amputated. we found 2 cases of tape erosion and 3 tape / anchor extrusions associated with prolapse relapse in a total of 162 operations. we believe that 3 of the surgical failures were caused by inadequate application of the anchor, resulting in slippage and erosion of the tape. four of the 5 failed cases underwent re - operation and were cured by tfs pop operations. there were statistically significant improvements in pollakisuria (urinary frequency), urgency, urge urinary incontinence, and stress urinary incontinence. the average score of p - qol q2qol affected by pop changed between pre- and post - operation from 3.77 0.78 to 2.44 0.61 (p < 0.01).table 1improvement in urinary - related qolnumber of p - qolsymptomaverage points sd (pre - operation)average points sd (post - operation after 1 year) p valueq3pollakisuria (urinary frequency)3.34 1.042.74 0.79 < 0.01q4urgency3.05 0.992.66 0.67 < 0.05q5urge urinary incontinence2.89 0.832.62 0.67 < 0.05q6stress urinary incontinence3.22 0.972.82 0.79 < 0.05 improvement in urinary - related qol this is the first report of tfs pop repair under local anesthesia (la) with same - day patient discharge. the local anesthetic surgical technique we used was made possible by the minimally invasive nature of the tfs system and its anatomical accuracy. they are ideally suited to older women as there is minimal disruption of activities and because the surgical methodology minimizes serious post - operative complications such as deep vein thrombosis, pulmonary embolism, and complications from the intercurrent diseases associated with old age. of course an arrangement with neighboring hospitals is required for patient transfer in the case of an emergency. the primary outcome result on a patient operated basis (no complications, no surgical failures, no symptoms of bulging, no erosions, no cervical protrusions) was 87 %. this compares favorably with those of a large rct for cystocele reported by altman. who reported the primary outcome results (popq staging 01 plus no symptoms of prolapse) of 60.8 % in women treated with transvaginal mesh repair (n = 200) compared with 34.5 % in women treated with native tissue colporrhaphy (n = 189). mean operating time for our patients was 86 min for three site - specific tfs operations compared with 56 min for the cystocele mesh repair ; our patients lost slightly less blood and there were no bladder perforations. the eroded tfs tapes did not require surgical re - intervention : rather, the eroded part was trimmed, like an eroded tvt tape. we attribute our high cure rate to the novel surgical methodology of the tfs, which requires accurate diagnosis and precise anatomical restoration of damaged ligaments. the cardinal and uterosacral ligaments are the principal ligamentous supports of the uterus and these insert into the cervical ring. also, attached to the cervical ring is the pubocervical fascia (pcf) anteriorly and the rectovaginal fascia (rvf or the rvf inserts distally into the perineal body, and proximally into the cervical ring and levator plate muscles. normal fascial attachments between organs and the suspensory ligaments allow the pelvic muscles to stretch the upper part of the vagina and the uterus downward and backward for normal support and function of the organs. childbirth, age, and congenital collagen defects are major causes of the breakdown of this mechanism. the baby s head descending down the vagina stretches the connective tissue supporting structures (ligaments and fascia) laterally, thereby causing laxity. lateral displacement of ligaments and associated connective tissues may cause the bladder, uterus, and rectum to herniate through the levator hiatus as a cystocele, uterine prolapse, rectocele, with or without urinary and bowel symptoms [8, 12 ]. we attribute symptom improvement to the tensioning properties of the tfs, which restores the laterally displaced pelvic ligaments and fascias to their former condition, thereby restoring not only organ support, but function ; also, because the tfs tape traverses the levator hiatus transversely, as well as creating artificial collagenous neoligaments, we hypothesize that it re - glues the organs to the levator hiatal muscles, as demonstrated previously in experimental animals. this would limit the lateral ballooning of the hiatal muscles observed during straining. the importance of collagenous attachments of the organs to levator hiatus was first described by robert zacharin in 1963. in 1997, the infracoccygeal sacropexy, also known as the posterior - ivs (pivs), a minimally invasive procedure for the restoration of uterine or apical prolapse, was introduced. importantly, it preserved the uterus. however, pivs operation was not entirely anatomical, as it attached the apex to the levator muscles / sacrospinous ligament (ssl) rather than to the uterosacral ligaments, which were sited some 3 cm cranial to the ssls. nor did the pivs address anterior vaginal wall defects, leading to anterior wall prolapse (cystocele) in 16 % of patients, and it did not re - attach the organs to the levator hiatus. we believe that one factor in the tfs attaining a higher cure rate than large mesh is the potential ability of the tfs to re - attach the organs to the hiatus. all tfs sling operations are a direct evolution of the tvt procedure, in that they work by using only a short thin tape applied through a tunnel. by using the tfs, we were able to reinforce the cardinal ligament, pubocervical fascia, atfp and uterosacral ligaments, all major supports of the uterus and the anterior and posterior vaginal walls. the tfs sling s unique ability to tension, shorten, and reinforce weakened elongated ligaments (fig. 2), was an important factor in restoring the tension needed for the muscle forces to be able to restore function, as no muscle can contract efficiently against a loose connective tissue insertion. a cystocele may reoccur, or occur de novo following repair of uterine prolapse, even when a cystocele repair is performed at the same time by anterior colporrhaphy [11, 17 ]. because of this, many surgeons prefer to insert large meshes into the organ spaces to prevent organ descent. this glues the vagina to the bladder or rectum, causing scarring and contraction, and preventing distension during intercourse, all major causes of the dyspareunia reported with large mesh insertion [11, 19 ]. large volumes of mesh lead to more scarring, erosions, infections, hematomas, even organ perforation and fistulas, ultimately resulting in the recent fda warnings of major complications with such meshes. the tfs method uses a different bioengineering approach to that of large mesh implants : reinforcing existing suspensory ligaments with a precisely inserted tape via a tunnel adjacent to the ligament. the scar tissue created by tissue reaction to the implanted tape reinforces the damaged ligament. this explains how we were able to cure even 4th degree pops using small thin lengths of tape. tensioning the tape provides strength in the manner of a wire suspension bridge ; spanning with tapes (fig. 3) reinforces the anterior vaginal wall like joists of a ceiling reinforcing a plasterboard. unlike large sheets of mesh, thus, antero - posterior elasticity is largely maintained, allowing the antero - posterior movements so important for efficient vesico - urethral and anorectal closure (continence) and evacuation. adhesions are also potent causes of dyspareunia, as they prevent the vagina from stretching independently of the rectum. we believe that failure in 5 cases was due to a loose tape caused by incorrect placement of the anchor. this may have been because of learning curve issues, or weak pelvic connective tissues. because the subsequent tfs surgery was successful, we attribute the failure to the former, surgical error. our erosion rate, 5 per 162 tapes implanted, is consistent with published erosion rates for the tvt. it is also consistent with the differentiation between mid - urethral tapes for urinary stress incontinence (acceptable) and large mesh for pop (questionable) according to the recent 2011 warning by the fda. the tfs applies the same surgical principle for repair as the tvt, whereby a thin polypropylene tape is placed in a tunnel to reinforce a damaged (pubo - urethral) ligament. unlike native tissue repairs, which remove and suture centrally bulging defects, the tfs conserves vaginal tissue, attaches the organ to the pelvic side wall and to the hiatus. its one - way system shortens the elongated ligaments to elevate the organ. because the tape inserted is of such a small volume, the risk of erosion, contraction, dyspareunia, and system malfunction are likely to be decreased. | introduction and hypothesisin 2005, a new minimally invasive procedure, the tissue fixation system (tfs) was reported. like tvt (tension - free vaginal tape), the tfs works by creating a foreign body collagenous tissue reaction that reinforces a weakened pelvic ligament. the objective was to assess the effectiveness and perioperative safety of tfs in a day surgery clinic for the treatment of pelvic organ prolapse (pop).methodsthe tfs tape was applied in a tunnel adjacent to natural ligaments to repair the anterior cervical ring and cardinal ligament, paravaginal tissues and uterosacral ligaments under local anesthesia / sedation.we prospectively studied 60 patients, mean age 67, between october 2008 and february 2010 at women s clinic luna. levels of pop were grade 2 (n = 20 ; 7 %), grade 3 (n = 30 ; 55 %), and grade 4 (n = 4 ; 7 %) according to the ics popq classification. fifty - four patients (90 %) who underwent a total of 162 pop operations presented for review. follow - up was performed at 12 months. we defined surgical failure according to the ics popq classification. we used prolapse quality of life (p - qol) questions for qol measurement.resultsninety-eight percent of patients were discharged on the day of surgery. of the162 tfs operations reviewed, 157 were successful and 5 failed. the 5 failed operations comprised 4 cystoceles and 1 rectocele. two patients developed cervical protrusions at the introitus at 6 months with no prolapse of the uterine body. we found 5 cases of erosion in 162 tape insertions. the total number of patients who had no complications, no surgical failures, no erosions, no sensation of bulging, and no cervical protrusions was 47 (87 %).conclusionsthe tfs uses the same surgical principle for repair as the tvt ; this principle vastly minimizes the volume of mesh used, erosions, and other complications. |
chronic nonbacterial osteomyelitis (cno) (omim number 259680) is an autoinflammatory, noninfectious disorder that affects the skeletal system and has first been described in 1972. an association with further autoimmune and autoinflammatory disorders such as pustolusis palmoplantaris, chronic inflammatory bowel disease (ibd), psoriasis, c - anca positive vasculitis, takayasu 's arteriitis, and deficiency of il-1 receptor antagonist (dira) has been discussed [35 ]. cno covers a wide clinical spectrum from non- or oligo - symptomatic monofocal bony lesions to its most severe form chronic recurring multifocal osteomyelitis (crmo). however, metaphyses of long bones are predominantly involved with a predilection for the lower extremities (distal femur, proximal tibia, distal tibia, and distal fibula), followed by the clavicle and spine. systemic symptoms occur in a subset of patients and include low - grade fevers and malaise. even though scully et 2008) reported a predominance in females (up to 85%), larger studies did not confirm this. most research articles focus on clinical aspects of cno, and only few reports discuss putative pathomechanisms underlying this autoinflammatory disorder. autoinflammatory diseases are rare disorders, characterized by recurrent episodes of fever and inflammation, and mostly affect joints, serosal surfaces, eyes and skin in the absence of high - titer autoantibodies, autoreactive t lymphocytes, and underlying infection. in 2006, mcgonagle and mcdermott suggested a clinical continuum with autoimmune disorders on the one, and autoinflammatory diseases on the other end of the spectrum. disorders located towards the middle of the continuum exhibit features of both autoinflammatory as well as autoimmune diseases. according to this definition, cno has been classified as an autoinflammatory disorder. in cno the diagnosis relies on clinical symptoms, systemic inflammation, and elevated acute phase proteins during attacks. in very few cases, underlying mutations in the relevant genes can be detected (majeed syndrome, see below). cno needs to be differentiated from infectious osteomyelitis, including mycobacterial infections, and malignant neoplasms. laboratory and histopathological findings are nonspecific, with mildly elevated acute phase markers, and plasmacellular, granulocytic, and monocytic infiltrations respectively. however in a substantial number of patients, systemic inflammatory signs (such as low - grade fever and malaise and elevated acute phase proteins) can not be found, even during attacks. in these cases, the diagnosis of cno can be made, combining clinical findings (localized bone pain, swelling, and warmth in the affected areas) and laboratory tests (including testing for mycobacteria) with radiographic techniques. the presence of osteolytic lesions with surrounding sclerosis in x - ray imaging, supplemented by computerized tomography (ct) and/or magnetic resonance imaging (mri), is usually helpful (figure 1). silent asymptomatic lesions frequently appear on nuclear scans. even though cno has been treated with azithromycin in the past, it does generally not respond to antibiotics. treatment involves anti - inflammatory agents, including nsaids [13, 15, 16 ] and corticosteroids. in treatment restistant cases, bisphosphonates and biologicals, usually infliximab or etanercept (blocking tumor necrosis factor-) have been applied successfully, suggesting an involvement of tnf- in the pathophysiology of cno. most cases are self - limiting and eventually resolve without major sequelae. however, a subset of patients exhibit severe and prolonged disease courses and are at risk of developing bone deformities that can be caused by premature closure of the epiphyses, and kyphoscoliosis as a result of vertebral involvement [4, 6, 19 ]. disease onset at a young age and high numbers of inflammatory bone lesions at disease onset seem to be predictive of poor outcomes [4, 19 ]. imbalances in cytokine expression can cause a disruption of immune homeostasis, resulting in increased or reduced inflammatory responses that in turn may cause susceptibility to infections or autoimmune disorders. cytokine dysregulation can be caused on various levels, including (1) impaired transcription that can be caused by genomic variation and (2) epigenetic modifications. genomic variations, including single - nucleotide polymorphisms (snps), can influence gene expression by variable transcription factor binding or variation in genome organization. epigenetic modifications alter chromatin accessibility for transcription factors and/or rna polymerases [21, 22 ]. posttranslational histone modifications influence the transcriptional activity of genes and serve as markers of epigenetic changes. histone hypermethylation as repressing histone modification mediates dense packing of nucleosomes in transcriptionally silent, so - called heterochromatic regions. however, convincing evidence for the involvement of this locus in the pathophysiology of cno is still lacking. ferguson. [24, 25 ] described homozygous mutations in the lpin2 gene, causing a syndromic autosomal recessive form of cno known as majeed syndrome. the majeed syndrome 's classical triad includes early - onset crmo, congenital dyserythropoietic anemia and a neutrophilic dermatosis. it is an extremely rare disease and has only been identified in three unrelated arabic families [14, 26 ]. bone lesions in majeed syndrome occur within the first two years of life, and the course is more aggressive then in cno, with more relapses. lpin2 was mapped to chromosome 18p and found to be expressed in almost all tissues. it shares a lipin domain with the human ortholog of murine lpin1, which plays a role in fat metabolism. because of the dyserythropoesis in majeed syndrome, it has been proposed that lpin2 could also play a role in mitosis, and that an impaired function may lead to abnormal mitosis in rapidly dividing cells, including the red blood cell lineage in the bone marrow. it has further been hypothesised that mutations in lpin2 may play an etiologic role in psoriasis, since it localizes to a genomic region identified as a psoriasis susceptibility locus. mutations in the pstpip2 gene have been described in the murine form of cno. to date, there are two murine cno models, both carrying mutations in the pstpip2 gene : (1) cmo mice [2629 ] and (2) lupo mice. cmo (chronic multifocal osteomyelitis) mice have been reported to develop a phenotype that is similar to severe cases of human cno with multiple sites of inflammation. however, most cno patients present with less severe mono- or oligo - focal disease which does not completely resemble the disease in cmo mice that develop multifocal (systemic) inflammatory symptoms. the disease is inherited in an autosomal recessive manner, and the cmo locus has been mapped to the murine chromosome 18. within the refined region was the gene pstpip2, which shares significant sequence homology to human pstpip1. expression patterns of murine pstpip2, also called mayp (macrophage actin - associated tyrosine - phosphorylated protein), are discussed controversially. while pstpip2 mrna is ubiquitously expressed, western blot analysis revealed narrow protein expression patterns, with the highest pstpip2 expression in myeloid cells. pstpip2 plays a role in cytoskeletal reorganization, and localizes to the cytosol as an f - actin associated phosphoprotein that interacts with pest - type protein tyrosine phosphatases (ptp pest) [31, 32 ]. mutations in the pstpip1 gene have been documented to cause the autoinflammatory papa syndrome (pyogenic arthritis, pyoderma gangrenosum, and acne). demonstrated that the pstpip1 mutations found in the autoinflammatory papa syndrome are in the putative coil - coil domain of pstpip1, abolishing the capacity of pstpip1 to bind pest family ptps. this alteration results in enhanced pstpip1 tyrosine phosphorylation and is accompanied by augmented binding of pstpip1 to pyrin via an sh3 domain, resulting in constitutive activation of nlrp3, production of il-1, and inflammation (figure 2). some similarities in the phenotypes of cmo mice and (human) papa patients may suggest an involvement of the same or similar immunologic pathways. however, the absence of the sh3 domain in pstpip2 suggests that it does not bind pyrin directly. classical cno patients do not develop the characteristic pustulotic or pyogenic dermatitis that is seen in papa patients. even though cmo mice serve as an interesting model for bone inflammation, none of the reported cno patients carry mutation in the pstpip1 and pstpip2 genes, except for several known polymorphisms. the recent report of a condition, presenting with neonatal onset sterile multifocal osteomyelitis, periostosis, and pustulosis, that is caused by a deficiency of il-1 receptor antagonist (dira), is of special interest. because of similar clinical, radiological and histological features of cno and dira, both disorders might share common or similar autoinflammatory processes. however, in a recent study a heterozygous missense mutation c.281g > t (p.cys94phe) could only be found in one patient with cno. in the other patients, another hint towards the understanding of genetic contributors to the pathophysiology of cno may be the clinical similarities of cno patients and patients with hypophosphatasia [37, 38 ]. hypophosphatasia is a rare defect of bone metabolism that is caused by a number of mutations in the gene encoding for the tissue - nonspecific alkaline phosphatase (tnsalp) on chromosome 1p36.1. the mode of inheritance is mostly autosomal - recessive [37, 39, 40 ]. tnsalp mutations result in reduced enzyme activity and elevated concentrations of tnsalp substrates, including inorganic pyrophosphate, pyridoxal-50-phosphate and phosphoethanolamine [4143 ]. it has been documented that pyrophosphate crystals stimulate the nlrp3 inflammasome resulting in interleukin-1 production. an inflammatory process secondary to the metabolic defect in hypophosphatasia involving the nlrp3 inflammasome associations between cno and crohn 's disease, a multifactorial autoinflammatory disease, have been reported, morbach and colleagues analyzed cno patients for nod2/card15 mutations. in addition, susceptibility regions have been identified on chromosome 18 in two other diseases sharing similarities with cno : familial expansile osteolysis and familial paget 's disease of bone [26, 46, 47 ]. the phenotypes of both diseases have been linked to mutations in the tnfrsf11a gene at 18q22.1, which encodes the receptor activator of nuclear factor kappa b (rank) [46, 47 ]. recently, we reported an association of cno with il10 promoter polymorphisms [3, 8 ]. il-10 is an immune - regulatory cytokine that controls inflammation by limiting inflammatory cytokine expression and antigen presentation. dysregulation in il-10 expression, sometimes caused by single - nucleotide polymorphisms (snps) in the il10 promoter have been associated to autoimmune and infectious diseases, such as sle, asthma, chronic viral diseases, rheumatoid arthritis as well as transplantation complications and cancer [4951 ]. il10 promoter polymorphisms as an example for genomic variation, appear to play an important role in the interindividual variation of il-10 expression [8, 52 ]. the il10 promoter polymorphisms 1082g > a (rs1800869), 819c > t (rs1800871), and 592c > a (rs1800872) are in tight linkage disequilibrium and form three well - defined or ata is associated with low, acc with intermediate, and gcc with high levels of il-10 expression [48, 53, 54 ]. however, for the interindividual variability of il-10 expression, additional host factors seem to play an important role. as aforementioned, an association of il10 promoter polymorphisms with cno has been described, demonstrating an increased frequency of high il-10 expressing 1082g / g alleles, and resulting gcc haplotypes. interestingly, monocytes from cno patients failed to produce il-10 in response to stimulation with lps. this could be explained by (1) il10 promoter polymorphisms as part of larger haplotypes, extending several hundred kilobases over the entire cytokine cluster, develop cumulative effects in a genomic setting. this hypothesis is supported by a recent study that failed to find a link between il10 promoter snps and inflammatory bowel disease (ibd), but showed an association between a snp 3 to the il10 gene and ulcerative colitis. (2) since it is known that il-10 mediates the proliferation of various lymphocytic tissues, including b cells, and enhances antibody production. lymphocytes, but also plasma cells can be predominantly found in biopsies, taken from cno lesions. having the anti - inflammatory aspects of il-10 expression in mind, an association with gcc haplotypes could partly explain the lymphocyte expansion in affected tissues. (3) additional, namely, epigenetic mechanisms, could be involved in the dysregulation of cytokine expression in cno (see below). the expression of pro- and anti - inflammatory cytokines, including il-10, is considered to be under epigenetic control. zhang. reported histone - phosphorylation within the il10 proximal promoter to be associated with transcription. histone phosphorylation is particularly increased in regulatory regions that bind the transcription factor specificity protein 1 (sp1) and 3 (sp3) and mediate transcriptional activation in response to stimulation with lps [5861 ]. since the proximal promoter region of il10 displays multiple gc rich sequences, which bind sp - family transcription factors, the binding of the transcriptional regulatory factor sp1 (previously reported to play a role in the regulation of il-10 in monocytes and macrophages) to the il10 promoter has been investigated. a markedly reduced sp1 recruitment to the il10_636 sp1 element has been detected in monocytes from cno patients in response to lps stimulation. this was accompanied with reduced histone h3 serine 10 phosphorylation (h3s10p), an activating epigenetic mark. these findings indicate (1) reduced sp1 recruitment and (2) attenuated h3s10 phosphorylation around the il10_636 element within the il10 promoter. given that (1) lps stimulation induces map kinase (mapk) activation in monocytes and macrophages, including the p38, the erks 1 and 2, and the jnk mapk pathway, and (2) erks 1 and 2 are implicated in h3s10 phosphorylation, these reports could indicate a new pathophysiological mechanism in cno with impaired mapk signaling, resulting in reduced h3s10 phosphorylation, and sp1 recruitment to the il10 promoter and subsequently attenuated gene expression and immune homeostasis. tnf- and il-1 are implicated in the pathophysiology of various autoimmune and autoinflammatory disorders, including cno, where it has been documented to be increased in inflammatory lesions. furthermore, clinical response to anti - tnf or il-1 receptor antagonist (il-1ra) anakinra treatment has been documented in cno (summarized in). however, it remains unclear whether increased tnf- and il-1 expression is the pathophysiological cause of cno or a downstream event in the disease. the aforementioned reduced expression of il-10 in monocytes from cno patients may well contribute to a cytokine imbalance towards proinflammatory signals, including tnf-., they do not explain the pathophysiology of cno in the vast majority of cases. mutations in the tnf and il1ra genes in humans and the pstpip2 gene in mice appear to be promising in the search for pathomechanisms in cno. the most recently described pathophysiological mechanism in cno might involve impaired mapk signaling, reduced h3s10 phosphorylation, and attenuated sp1 recruitment to the il10 promoter that results in an impaired gene expression. | chronic nonbacterial osteomyelitis (cno) with its most severe form chronic recurrent multifocal osteomyelitis (crmo) is a non - bacterial osteitis of yet unknown origin. secondary to the absence of both high - titer autoantibodies and autoreactive t lymphocytes, and the association with other autoimmune diseases, it was recently reclassified as an autoinflammatory disorder of the musculoskeletal system. since its etiology is largely unknown, the diagnosis is based on clinical criteria, and treatment is empiric and not always successful. in this paper, we summarize recent advances in the understanding of possible etiopathogenetic mechanisms in cno. |
skeletal muscle function is dependent upon stable connections from the contractile elements that generate force to the bony skeleton that translates that force into movement. efficient transmission of that contractile force is enabled by a highly organized arrangement of support structures both within and around the actin - myosin array. through these supporting elements, the actin - myosin array within the cell is directly connected to the extracellular matrix (ecm). these connections occur both along the axis of contraction at the myotendinous junction (mtj), where the muscle inserts into a fibrous tendon that attaches to the bony skeleton, and radially at specialized membrane domains like the costameres [1, 2 ], where the muscle attaches to surrounding fibrous sheaths called the endomysium and the perimysium. the importance of muscle - ecm connections to muscle structure and function is evident from the number of myopathies and muscular dystrophies, including duchenne muscular dystrophy, that result from disturbance of the multiprotein complexes that support the linkage. the primary site of force transmission from the muscle to the ecm, and ultimately to the bony skeleton, occurs at the myotendinous junctions. despite the importance of the mtj to muscle function, relatively little what is known has been derived from studies in zebrafish where visualization of embryos during development has allowed direct observation of the dynamic process of mtj formation and skeletal muscle development. as with other vertebrates, truncal skeletal muscle in the zebrafish the mesenchymal cells of the somite give rise to the myotome, which will differentiate into skeletal myocytes that span the length of the somite and insert into the fibrous sheaths that form at the anterior and posterior somite boundaries. these muscle - matrix connections are the structural and functional equivalents of the mtjs that form in higher vertebrates. previous studies have determined that eph / ephrin signaling initiates integrin clustering along the nascent somite border concomitant with the earliest indication of border formation and shortly after that fibronectin matrix is assembled. integrins are cell - matrix adhesion molecules that form heterodimeric transmembrane units which bind to components of the extracellular matrix including collagen and fibronectin. laminin is secondarily deposited at the somite boundary where it serves as a ligand for -dystroglycan of the dystrophin - associated glycoprotein complex during progressive maturation of the mtj. a zebrafish model of duchenne muscular dystrophy, the sapje mutant which has a truncating mutation of dystrophin, forms mtjs at the somite boundary but these attachments are unstable, leading to muscle detachment and myocyte death. the finding of mtj instability in the zebrafish model of dmd suggested that this may be an important mechanism of muscle injury in patients with this disorder. this was a somewhat unexpected finding as mtjs had been difficult to study in dmd patients or mammalian animal models which had focused on the effects of dystrophin loss on the composition and function of lateral muscle - ecm attachments within the costameres. it also indicated that the formation and composition of myofibril - membrane attachments may be similar whether they form along the longitudinal axis of the cell at the mtj or along the lateral aspect of the myocyte, where dystrophin and the dystrophin - associated glycoprotein complex are enriched. the lateral connections occur primarily at the costameres overlying the sarcomere at the level of the z disk. as with the mtj, the transmembrane adhesive contacts at the costameres include the integrin - based and dystrophin - associated glycoprotein complexes. these transmembrane systems are linked to each other and to the actin cytoskeleton by an array of cytoskeletal adaptors including vinculin, talin, ilk, and filamin. the adaptor proteins regulate the adhesive properties of the connections and allow the scaffolding of signaling molecules at these sites. what is not well understood is how these myocyte - ecm attachments are positioned and assembled relative to the underlying myofibrils, and whether or not these processes are similar for axial (mtj) and radial (costameric) connections. in this paper, we used a zebrafish morphant phenotype with impaired mtj formation and skeletal muscle disorganization to examine the elements required for muscle - ecm attachment and for the coordination of myofibril organization across adjacent myocytes. we determined that the giant structural and signaling protein obscurin has an important role in promoting the organization of the extracellular matrix at the terminal ends of the myocyte and in supporting myofibril - membrane interactions that lead to alignment of myofibrils both within and across myocytes. as myocyte - extracellular matrix connections have critical roles in force transduction defining the processes that promote and sustain these connections will have important implications for the understanding the pathogenesis of, and developing new treatment strategies for, a range of myopathies and muscular dystrophies. wild - type adult zebrafish were maintained as described previously [10, 11 ]. the obscurin a antisense morpholino (mo2 from) targeting the 5utr site and a standard control morpholino (5-cctcttacctcagttacaatttata-3) were designed by gene tools, llc (philomath, ore, usa). the mos were dissolved to a stock concentration of 3 mm in distilled water and diluted to 1.5 and 3 ng / nl. a 2.5 nl aliquot of diluted morpholinos were injected into 14-cell - stage embryos using a nanoliter 2000 injector (world precision instruments). a leica mz16f dissecting microscope equipped with dfc340 fx camera was used to visualize the embryos. a lyn - gfp (pcs - memb - mcherry + lyn - egfp) phil elks (university of sheffield), was linearized with noti and capped mrna was generated using the mmessage mmachine sp6 kit (ambion, austin, tex, usa). the lyn - gfp mrna was injected at an amount of 62.5 pg / embryo alone and together with obscurin a morpholino. scott holley (yale university), was linearized with noti and transcribed with sp6 polymerase using the mmessage mmachine sp6 kit from ambion. the itga5-gfp mrna was injected at a 250 pg / embryo amount alone and together with obscurin a morpholino. embryos were fixed for 6 hr with 4% paraformaldehyde (pfa) in pbs and labeled with the following antibodies : obscurin (directed at the c terminal region where the small ankyrins bind (kindly provided by dr. robert bloch, university of maryland)) 1 : 10, fibronectin (sigma) 1 : 50, laminin (sigma) 1 : 50, f59 (developmental hybridoma bank, university of iowa) 1 : 10, -actinin (sigma) 1 : 100, vinculin (sigma) 1 : 50, talin (sigma) 1 : 50, dystrophin (clone mandra1, sigma) 1 : 50, and -dystroglycan (millipore) 1 : 20. secondary antibodies alexa 640, alexa 594, and alexa 488 from molecular probes were diluted to 1 : 150 to reveal staining. embryos were mounted onto slides using prolong gold antifade reagent (molecular probes) and visualized on an olympus fv-500 confocal microscope. digoxigenin - labeled antisense rna probes were synthesized from cdna clones of myod, notc5, notch6, and obscurin a by in vitro transcription using t3 and t7 polymerases and dig rna labeling kit (boehringer - mannheim). embryos were fixed in 4% pfa for 5 hours at room temperature and subjected to in situ hybridization with the above rna probes. stained embryos were visualized on an olympus bx-51 light microscope. to determine the onset of obscurin a expression, total rna was isolated from uninjected embryos at 3, 4.5, 6, 8.5, 10, 11.5, 13, 15, 24, 33, and 72 hours after fertilization (hpf) using qiagen rneasy mini kit (qiagen inc. rna concentration and purity was determined by optical density reading at 260 nm and the ratio of 260/280 nm absorbance, respectively. for all time points, with the exception of 8.5 hpf, a total of 75 ng rna was used in a 25-l reaction volume to synthesize cdna using the iscript one - step rt - pcr kit with sybr green (bio - rad laboratories, hercules, calif, usa). due to a very low rna concentration in the isolate, about 15 ng of rna was used in the reaction mix for 8 hpf time point. a 350 bp (forward primer, 5-gcctgacctgcgcgattgtga ; reverse primer, 5-gagcgctgggagagggaggac) and a 250 bp (forward primer, 5gcaccaaacccaccaaatcca ; reverse primer, 5gcgccctcctcatccacacg), zebrafish obscurin a cdna fragments were amplified by pcr. as a control, zebrafish -actin (forward primer, 5-ccgtgaacatcaaggagaagct ; reverse primer, 5-tcgtggataccgcaagattcc) was used as an internal control. briefly, embryos at 72 hpf were fixed with 2.5% glutaraldehyde and 2.0% paraformaldehyde and postfixed in 1% osmium tetroxide. after washing, they were stained with saturated uranyl acetate and embedded in epon 812. the sections were examined with a philips cm100 transmission electron microscope, at an accelerating voltage of 60 kv. the distance between the myofibrils in adjacent myocytes was measured from the transverse sections at the minimal distance between the two myofibrils. z disk offset was measured in superficial myofibrils from two adjacent myocytes. in both control- and obscurin - depleted embryos, to examine the relationship between the myofibril and the organization of specialized membrane compartments during muscle development, we used a previously described morphant model in which depletion of a myofibrillar protein, obscurin [13, 14 ], led to the impairment of the organization of the myotendinous junction, which is formed through the interactions of specialized membrane domain of the myocyte with the extracellular matrix. as previously noted, obscurin a morphant embryos were shorter, with marked abnormalities in tail and skeletal muscle morphology (figure 1). these included both abnormalities of tissue architecture (irregular and deficient somite boundaries) and cellular organization (impaired sr organization, increased incidence of breaks in the transverse alignment of adjacent myofibrils, and irregularities of myofibril bundling). in obscurin morphant embryos somite markers myod, notch5, and notch6 were expressed in both the control and obscurin - a - depleted embryos, but the periodicity of their expression, namely, the absence of expression at the future somite boundaries, was impaired in the obscurin a morphants (figure 1). since this defect in myotome organization would suggest an important role for obscurin a very early in skeletal muscle development, prior to the onset of myofibrillogenesis, we sought to precisely define the onset and localization of obscurin a expression very early in embryogenesis. using rt - pcr, rna in situ hybridization and whole mount immunostaining, we determined that obscurin a is expressed very early during somitogenesis and that it first localizes to the newly forming somite boundaries, see supplementary materials avaliable at doi:10.1155/2011/479135 (supplemental figure 1). to examine the role of obscurin a in promoting the changes in cell morphology that permit the formation of the somite boundary, control and obscurin a morphant embryos were injected with lyn - gfp mrna and fixed at 18, 24, and 48 hpf. lyn is a member of the src family of receptor tyrosine kinases that is associated with cell surface receptors and has been used to help track changes in cell morphology during development. lyn localized to the cell membranes of the developing myoblasts and accumulated at the nascent somite boundaries (figure 2(a)). in the younger somites, myoblasts (future fast - twitch skeletal muscle) were rounded and began to elongate after the development of the somite boundary (figure 2(b)), eventually spanning the distance between the anterior and posterior boundaries and inserting into the fibrous matrix forming at the boundary. in obscurin - a - depleted embryos, fewer nascent boundaries could be identified (figure 2(d)). in the more severely affected embryos, the cells remained rounded and no defined boundaries were noted (figure 2(g)). in the mildly affected embryos, irregular boundaries did form (figure 2(e)) and were associated with local elongation of the adjacent cells. in the absence of a defined boundary, cells initially remained rounded (figures 2(e) and 2(h)), eventually elongating in the more mature somites (figures 2(e) and 2(f)). this suggests that somite boundary formation (and the associated extracellular matrix organization) promotes cell elongation but that cell elongation can progress in the absence of the somite boundaries potentially as a result of positional cues from surrounding cells. previous studies have noted that integrin clustering precedes fibronectin matrix accumulation at the nascent somite boundary and helps facilitate tissue remodeling during development by translating cell contact - mediated signals into cellular cytoskeletal reorganization. therefore, we examined the localization of 5-integrin, which participates in somite boundary formation [18, 19 ] during early skeletal muscle differentiation. using a gfp - tagged 5-integrin expression construct, we noted that 5-integrin clustering at the nascent somite boundary closely preceded organization of the fibronectin matrix and elongation of the cells at the developing boundary (figure 3). as noted previously, depletion of the giant protein obscurin with a morpholino targeting the 5 untranslated region of the obscurin a isoform resulted in marked abnormalities of somite boundary and mtj formation. this provided unique opportunity to observe the progression of mtj maturation and define the elements required for the process. depletion of obscurin revealed that integrin clustering, fibronectin organization, and cellular remodeling are closely interrelated processes. in response to obscurin depletion, integrin clustering was impaired resulting in diminished fibronectin matrix organization and abnormalities of cell morphology. in those regions with preserved integrin clustering, a fibronectin matrix was organized and cells began to elongate. in the absence of integrin clustering, there was no organization of a fibronectin matrix and cells remained rounded. this is consistent with prior studies which have proposed that cytoskeletal actin reorganization and cellular remodeling during myoblast differentiation are dependent on the organization of the fibronectin matrix. the findings also suggest that obscurin, which is expressed at very low levels prior to myoblast differentiation, may have a role in supporting the early cellular events that lead to apical clustering of integrins. given the potential role of fibronectin in determining myocyte morphology and skeletal muscle organization, the relationship between fibronectin organization and new myofibril assembly was examined during early skeletal muscle differentiation. fibronectin was organized first immediately adjacent to the notochord, prior to the appearance of a clear striated pattern of myosin heavy chain or -actinin immunostaining in assembling myofibrils of slow - twitch skeletal muscle. alpha - actinin appeared first as closely and irregularly spaced punctuate spots that were gradually organized into distinct z disk structures in the more mature somites (data not shown). in contrast, very early in myofibrillogenesis, myosin heavy chain ii (sarcomeric myosin) was diffusely distributed along the length of the myofibril (figure 4). as myofibril assembly progressed, myosin becomes restricted to nascent a bands before demonstrating the double - banded pattern with mid - a - band clearing characteristic of mature f59 antibody - staining pattern which recognizes an epitope within the myosin motor domain. in response to obscurin depletion, there was a normal progression of m band organization despite the noted irregularities of fibronectin matrix deposition and myocyte morphology. of note, in response to obscurin depletion, there was delayed bundling of nascent myofibrils into larger units even at relatively advanced stages of myofibrillogenesis, a bands from adjacent myofibrils remained spatially distinct. the delayed structural integration of adjacent myofibrils is consistent with the abnormalities in the lateral alignment of myofibrils that was previously noted in response to obscurin depletion. therefore, fibronectin matrix organization precedes the formation of mature, striated myofibrils, and despite the effects of obscurin on the fibronectin matrix, the progression of thick filament organization proceeds to structural maturity. laminin deposition at the mtj closely followed fibronectin organization and persisted after fibronectin downregulation (figure 5). in embryos in contrast, while laminin deposition was irregular, it did accumulate normally in those regions where fibronectin was detected. this indicates that fibronectin matrix organization supports and may be required for laminin deposition as has been previously suggested. furthermore, although obscurin participates in integrin clustering and fibronectin matrix organization, the subsequent recruitment of laminin to areas of fibronectin accumulation is likely to be independent of obscurin a function. laminin deposition preceded formation of striated myofibrils in fast - twitch skeletal muscle. in the regions of reduced, fibronectin / laminin deposition, myofibrillogenesis appeared to be delayed, as regions with more abundant laminin deposition demonstrated more rapid development of mature myofibrils. however, by 72 hours, even those regions with markedly reduced laminin deposition demonstrated mature myofibril development. to determine the order of incorporation of other components of the adhesion complex and examine their relative distribution to mtj and costameric sites, immunolocalization of talin and vinculin, components of the adherens junctions, was performed. both talin and vinculin localized to the mtj nearly concurrently with the timing of laminin deposition (figure 6). however, as skeletal muscle differentiation proceeded their localization, patterns were distinct. talin was noted to localize very early to membrane domains, and potentially to cytoskeletal structures, overlying the z disk. in contrast, vinculin did not demonstrate significant striated patterning by 72 hours after - fertilization and instead became progressively more concentrated at the mtj. vinculin patterning in the obscurin morphant embryos was irregular in distribution but normal in its accumulation at the mtj. likewise, talin localized normally to domains overlying the z disk and to the mtj in obscurin morphant embryos. however, there were areas of laminin deposition that lacked significant talin accumulation suggesting a potential delay or irregularity in adhesion complex assembly in response to obscurin a depletion. dystrophin is a cytoskeletal protein that links the actin cytoskeleton to the membrane - bound dystrophin - associated glycoprotein complex (dgc). -dg, a member of dgc, is a cell surface receptor for various ecm molecules including laminins, agrin, and perlecan. previous studies indicate that the dgc participates in the organization of, and attachment of the myocyte to, laminin on the cell surface. since dystrophin and -dg are important components of the costameres and the myotendinous junctions, we examined their localization in control and obscurin a morphant embryos at 24 hpf (figure 7). in control morpholino - injected embryos, both dystrophin and -dg localized to the mtj as has been previously noted [21, 22 ]. in obscurin - a - depleted embryos, however, the localization of dystrophin is less distinct and -dg could not be detected at the somite boundaries. since even the most severely affected obscurin a morphant embryos form irregular somite boundaries, the marked decrease in -dg staining suggested a specific destabilization of the dgc in the obscurin morphants. it has been postulated that ankyrin within the sarcolemma and the subsarcolemmal spectrin cytoskeleton are involved in establishing the membrane microdomains overlying the superficial myofibrils. since obscurin a interacts with both ankyrin within the sarcolemma [12, 24, 25 ] and titin within the sarcomere [14, 26 ], it was a good candidate to link these two cellular compartments during early myofibril assembly. if obscurin a was required for this process, then its depletion might result in aberrant patterning of the sarcolemma overlying the myofibril and reduced association of the myofibril with the membrane. examination of transverse sections of zebrafish skeletal muscle by transmission electron microscopy revealed that, as in control embryos (figure 8(a)), new myofibril assembly in obscurin - a - depleted embryos occurred adjacent to the sarcolemma, preferentially at sites where three cells were in direct contact (figure 8(b)). however, there appeared to be reduced association of the myofibrils with the membrane, as new myofibril bundles were noted at a distance from the sarcolemma (figures 8(c) and 8(d)). patterning of internal membranes was also affected, as the sarcoplasmic reticulum was deficient, irregularly patterned and not consistently closely associated with the myofibrils in obscurin - depleted embryos. similar findings were noted on longitudinal sections. in control embryos, new myofibril assembly occurred in the subsarcolemmal space. interestingly, there was a relatively consistent relationship between the superficial myofibrils of two adjacent cells. although the distance from the myofibril to the membrane was variable, the distance between myofibrils in adjoining myocytes was within a relatively narrow range in control embryos (figures 9(a) and 10(a)). in obscurin - depleted embryos, the relationship was much more variable (figures 9(b)9(d)). by 72 hpf, myofibrils filled the sarcoplasm and the distance between the superficial myofibrils in adjoining cells had decreased in both control and obscurin - depleted embryos, although remained more variable in obscurin - depleted embryos (figure 10(b)). the coordination of myofibril assembly across myocytes included a consistent relationship between the level of the z disks. while the myofibrils were not aligned precisely in register, the offset in the level of z disks was within a relatively narrow range in control embryos but much more variable in obscurin - depleted muscle (figures 9(a) and 10(c)). by 72 hpf, the z disk offset had decreased in both control and obscurin - depleted embryos but remained more variable in the setting of diminished obscurin expression (figure 10(d)). impairment of the coordination of myofibrillar architecture across myocytes also resulted in an inconsistent relationship between the axis of contraction in adjacent myocytes (figure 11). in control embryos, the axis of contraction in adjacent myocytes was essentially parallel ; the difference in axis of orientation between two adjacent myocytes (a myocyte pair) was 1.7 1.8 in control embryos and 7.6 7.7 in obscurin depleted embryos (t - test : p < 0.01). the impaired myocyte - myocyte relationships resulted in significant myocyte and myofibril disorganization across the muscle unit (figures 11(b) and 11(c)). the assembly of new myofibrils within myocytes and the organization of the extracellular matrix surrounding the myocyte are dynamic and closely interrelated processes. using a morphant phenotype with impaired mtj formation and myofibril disarray we demonstrated that the organization of skeletal muscle during development is a highly orchestrated process that involves both outside - in and inside - out signals between the cell and the extracellular environment. outside - in signals from the extracellular environment result in changes to myocyte morphology and promote new myofibril assembly ; in return, inside - out signals organize the extracellular matrix and coordinate the assembly and organization of myofibrils across cells and tissues. obscurin a appears to have an important role in these processes in zebrafish skeletal muscle, potentially mediating interactions between integrins and the ecm that regulate transmembrane communication and translate internal cellular structure into tissue organization. obscurin a is expressed early in the development, before somitogenesis begins, and our data indicate that it is required for the initial somite boundary morphogenesis. in the developing myotome, it initially localizes to the future somite boundary before localizing to newly assembling myofibrils that is form in the subsarcolemmal space. expression patterns of myod, notch5, and notch6 indicate that loss of obscurin a disrupts somite segmentation but does not affect myotome specification or myoblast commitment. co - localization of integrins and obscurin a at the future somite boundary, where myofibril assembly initiates, and along the sarcolemma, where the initiation and propagation of new myofibril assembly occurs, suggests that there may be an important relationships between integrins and obscurin a in promoting new myofibril assembly and organization. it has been proposed that integrin adhesion complexes along the lateral sarcolemma help nucleate new myofibril assembly. protocostameres, since they will ultimately develop into the multicomponent linkage complexes characteristic of mature costameres. integrin signaling may be capable of coordinating the assembly process in neighboring cells, as suggested by the consistent relationship of z disks on either side of apposed sarcolemmal membranes very early in myofibrillogenesis. a coordinated patterning of the newly assembling myofibrils in neighboring cells mediated by integrin transmembrane contacts within the sarcolemma would account for consistent relationship of the sarcomeres from one myocyte to the next. the offset of the z disks in adjacent myocytes was more evident early in development and could not be correlated with distance to the mtj indicating that it was more likely to be an inherent property of the myocyte. the reason for the offset and the molecular mechanism that supports it is not known but integrins may have a role since transinhibition by integrins have been demonstrated to inhibit integrin clustering on neighboring cells. this transinhibition may inhibit integrin clustering overlying the z disk if it is at exactly the same level as the superficial z disk of the myofibril in the neighboring myocyte. the potential role of obscurin a in regulating integrin - based adhesion complexes is supported by studies on unc-89. c. elegans mutants lacking unc-89 have defects in m band assembly, thick filament organization and locomotion (leading to its classification as one of the uncoordinated family of proteins) [28, 29 ]. it has been noted to participate in the recruitment of actopaxin, a binding partner of the adherens junction adapter protein paxillin, to the sarcolemma. more recently, the kinase domains of unc-89 were determined to interact with scpl-1 [32, 33 ] which in turn has been demonstrated to complex with lim-9 to interact with unc-96 and unc-97 (pinch), components of a cytoskeletal network that links integrin adhesion complex assembly to thick filament organization in c. elegans. that these integrin - based adhesion complexes participate in the transmission of force from the sarcomere to the extracellular environment to elicit movement has been supported by the genetic characterization of c.elegans mutant embryos, known as pat (for paralyzed arrested at twofold) mutants, with a paralyzed phenotype. mutations of beta integrin (pat-3), alpha integrin (pat-2), integrin - linked kinase (pat-4), and actopaxin (pat-6) all impair the assembly of integrin adhesion complexes and all result in a paralyzed phenotype. in c.elegans, integrin complexes are found at the cytoplasmic interface of the dense bodies (corresponding to vertebrate z disks) and the m bands. in vertebrates, integrins are localized to the myotendinous junctions and to the costameres, sites of force transmission and signaling between the myocyte and the ecm. it is important to note that, although obscurin is primarily considered an m band protein, it localizes overlying the z disk early in myofibril assembly and some isoforms are noted at the z disk or z / i junction in mature myofibrils. the importance of the integrin - fibronectin attachments to myofibril organization was demonstrated in two zebrafish models. in zebrafish embryos depleted of tgfbi, an extracellular matrix protein that binds to integrins and is expressed in response to tgf - beta signaling, skeletal muscle formed normal appearing mtjs and myofibrils assembled in the subsarcolemmal space but the myofibrils did not remain closely attached to the sarcolemma, and there was markedly reduced myofibril content. similarly, zebrafish depleted of fibronectin demonstrated reduced myofibril content and organization further supporting the role of integrin - mediated ecm adhesion as an important regulator of myofibril organization. the obscurin - a - depleted embryos demonstrated very similar findings, consistent with disturbance of the fibronectin - integrin - tgfbi axis. as with the tgfbi embryos, obscurin - depleted myofibrils formed but did not consistently remain closely associated with the membrane, and the resulting myocyte / myofibril disorder was reminiscent of embryos lacking fibronectin. our studies are consistent with the previously described models of new myofibril assembly which have proposed a multistep process by which myofibrils organize along the sarcolemma [4042 ]. our studies suggest that formation of new myofibrils in the subsarcolemmal space promotes coordinated organization of the myofibril, the overlying sarcolemma, and surrounding extracellular matrix. these interactions, which depend in part on obscurin, facilitate organization of myofibrils and myocytes across the muscle permitting efficient muscle contraction and striated muscle function. such coordinate changes in myofibrillar and ecm remodeling will be important not only during development but in the adaptation of muscle (both cardiac and skeletal) to tissue injury or increases in physiologic demand. therefore, the role of obscurin in facilitating interactions between the myofibril and the ecm through the sarcolemma indicates that it may be an important therapeutic target in preventing muscle injury and promoting muscle repair. | during development, skeletal myoblasts differentiate into myocytes and skeletal myotubes with mature contractile structures that are precisely oriented with respect to surrounding cells and tissues. establishment of this highly ordered structure requires reciprocal interactions between the differentiating myocytes and the surrounding extracellular matrix to form correctly positioned and well - organized attachments from the skeletal muscle to the bony skeleton. using the developing zebrafish embryo as a model, we examined the relationship between new myofibril assembly and the organization of the membrane domains involved in cell - extracellular matrix interactions. we determined that depletion of obscurin, a giant muscle protein, resulted in irregular cell morphology and disturbed extracellular matrix organization during skeletal muscle development. the resulting impairment of myocyte organization was associated with disturbance of the internal architecture of the myocyte suggesting that obscurin participates in organizing the internal structure of the myocyte and translating those structural cues to surrounding cells and tissues. |
we evaluated the outcome of percutaneous vertebroplasty (pvp) in the treatment of painful vertebral hemangiomas refractory to medical management. 14 patients (four thoracic and ten lumbar vertebra) with painful vertebral hemangiomas presenting with severe back pain for more than 6 months not responding to medical therapy were treated by vertebroplasty. the pain intensity numeric rating scale (pi - nrs-11) of these patients was in the range of 7 - 10 (severe pain). after vertebroplasty 8 patients were completely free of pain (pi nrs score 0) while 6 were significantly relieved (pi - nrs score 1 - 3). pvp is a safe and effective procedure in patients with painful vertebral hemangiomas refractory to medical management. vertebral hemangiomas are benign, malformed vascular tumors composed of newly formed blood vessels with normal capillary, venous, or veno - capillary structure and without arterio - venous shunt. cavernous hemangiomas are composed of large dilated blood vessels closely clustered together and hence they are not separated by normal bone tissue. capillary hemangiomas are formed of thin walled capillary vessels of various sizes separated by normal bone tissue.1 percutaneous vertebroplasty (pvp) is the procedure of injecting bone cement i.e. polymethyl methacrylate (pmma) percutaneously into the vertebral body under fluoroscopic guidance. pvp was developed in france in the late 1980s, principally for treatment of vascular bone lesions such as hemangioma and subsequently found to be useful in treating painful vertebral metastasis and painful osteoporotic vertebral compression.234 after introduction of pvp in north america, the procedure has become increasingly popular during the past decade. pvp has proven successful in providing dramatic and prompt pain relief in most patients with painful vertebral hemangioma, allowing rapid patient mobilization. 14 patients with vertebral hemangiomas, four had associated vertebral osteoporotic compression fracture, presented between november 2006 and april 2013, were included in the study. back pain was diagnosed by the patient 's history, clinical examination and quantified by pain intensity numeric rating scale (pi - nrs) [table 1].5 patients previous medical records and imaging were reviewed. based on the history and clinical findings, relevant imaging including magnetic resonance (mr) was done [figure 1a ]. the pain intensity nrs (0 - 10) (a) magnetic resonance imaging t2w sagital view showing l4 vertebral hemangioma (b) needle position under fluoroscopy (antero - posterior and lateral view), (c) lateral view fluoroscopy after vertebroplasty demonstrating good cement filling the mr of the above 14 patients were normal except for vertebral hemangiomas in all and osteoporotic vertebral fractures in four of them. patients with vertebral hemangiomas with severe back pain for more than 6 months, not responding to medical therapy were included in the study. all these patients received adequate analgesic therapy with two or more analgesics for more than 6 months. informed, written consent obtained from all patient undergoing vertebroplasty after explaining the procedure in detail. all vertebroplasties were performed in the cathlab under high quality fluoroscopic guidance with patient positioned prone. the entire spine was examined with fluoroscopy in antero - posterior (ap) and lateral view and the level of hemangioma was marked with a metallic marker. the site of entry and the needle track was infiltrated with 10 ml of 2% xylocaine. the vertebra was approached with an 11 g or 13 g beveled cook bone biopsy needle from the trans - pedicular route. the needle was progressed into the vertebral body and positioned near the midline, approximately at the junction of the anterior one - third with the posterior two - third. the patient is asked to report any pain or discomfort especially in the ipsilateral leg during the progression of the needle from the skin to vertebra. ap and lateral fluoroscopic views confirmed the position of the needle [figure 1b ]. the bone cement (pmma) is cooled to 4 - 8 centigrade 1 h prior to injection. the cement is prepared by mixing pmma powder and liquid pmma (cook medical inc., usa) and is filled into 1 cc glass syringes then injected into the vertebra through the bone biopsy needle under constant fluoroscopic guidance in lateral view. as we inject, the cement fills the vertebra backward and we keep injecting till the cement comes to the posterior fourth of the vertebra [figure 1c ]. keeping a close watch on the movement of the cement is critical to avoid extra vasation either into the venous system, foramina, or other extra vertebral sites. leakage of cement leads to compression of adjacent structures like spinal nerve roots, spinal cord and may lead to neurological deficits. we inject around 4 - 7 cc of cement into each vertebra.678 the cement injection is completed within 60 - 90 s as the pmma polymerizes in quick time. we treated 14 patients of vertebral hemangioma with pvp. among these patients, five were males and nine females. the average age of patients was 68 years (range 24 - 79 years). their average pain score was 8.5 (range 7 - 10) [table 2 ]. list of patients underwent vertebroplasty after vertebroplasty pain was completely relieved in 8 (pi - nrs score 0), and significantly relieved in 6 (pi - nrs score 1 - 3) without any complications. these patients were simultaneously treated with pvp in the same sitting without any complication [figure 2a c ]. up to three level vertebras can be safely treated with pvp in the same sitting. as the amount of pmma injected into the vertebra is so small, that even if 3 level pvp does not pose a significant risk.9 (a) fluoroscopic view (lateral) showing vertebral hemangioma with trabeculations. (c) radiograph post vertebroplasty we had complex situations in two of our patients who underwent trans arterial embolization with poly vinyl particle polyvinyl alcohol (pva) prior to vertebroplasty. during attempted vertebroplasty in one of them, the cement started leaking into the epidural vein without opacifying the vertebra. the hemangioma was embolized and vertebroplasty was done in the next sitting [figure 3a c ]. the other patient presented with pain and paraparesis in her early postpartum period. she underwent trans - arterial embolization, vertebroplasty followed by laminectomy with a favorable outcome. (a) magnetic resonance imaging t2w sagittal view showing l3 vertebral hemangioma and osteoporotic compression fracture of d12, (b) fluoroscop ic view demonstrating needle position, (c) vertebroplasty of l3 hemangioma and osteoporotic d12 vertebra all the patients underwent immediate post procedure ct scan following vertebroplasty to look for cement leak to extra vertebral sites or fracture. these patients were followed up for 6 - 36 months with an average of 9 months with no recurrence of pain or any other complication. different series have reported the incidence of vertebral hemangioma to be 10 - 27% based on autopsy series and imaging reviews. they should be treated conservatively with analgesics and bed rest for at least 6 weeks. if they do not respond to the above therapies, more aggressive therapies such as surgical decompression, endovascular embolization, radiotherapy and vertebroplasty can be offered. embolization with pva particle alone is reported to produce usually transient remissions.10 - 12 two patients in this series underwent embolization with pva particles followed by vertebroplasty. however, during injection of pmma, the bone cement flew off into the epidural venous plexus, suggesting the blood flow to be very high inside the vertebra. hence, the procedures were abandoned and embolization was done in these patients to reduce excess vascularity. angiogram may not be performed in all patients of vertebral hemangiomas before vertebroplasty. however, if the bone cement flies off the vertebra during injection due to high flow, the procedure must be abandoned and angio - embolization may be done before reattempting vertebroplasty. radiation therapy can be used to treat lesions associated with pain.23 they are radiosensitive lesions and respond to administration of 3000 - 4000 cgy. yang.,13 and faria.,14 in their study have reported complete reversal of paraplegia of several weeks duration following radiation therapy alone. radiation therapy as the sole management modality for patients with progressive neurological deficits has however, been controversial. vertebroplasty has a low rate of clinical complications, but potential complications can be devastating. incidences of cement leakage are less in hemangioma due to intact cortex compared with osteoporotic fracture the relevance of this complication will be different in relation to the anatomical structure, which is invaded from the cement. cement invasion into the vena cava, lungs, heart have been described.1516 these major adverse events only occur in less than 1% of the patients,17 and require immediate management. pvp can be performed through unipedicular or bipedicular approach. however, in most instances a single injection through one pedicle is all that is required.1819 if there is insufficient filling of the vertebral bodies, a second puncture through the contralateral pedicle may be performed. a total of 14 patients with vertebral hemangiomas treated by unipedicular pmma injection, pain is completely relieved in 8 cases (pi - nrs score 0) and significantly relieved in 6 cases (pi - nrs score 1 - 3). high quality fluoroscopy and operator experience are important to avoid complications like neurologic deficits, fracture of vertebra and rib, hemorrhage, pneumothorax or hemothorax, and pulmonary embolus.202122 we conclude that it is possible to treat painful vertebral hemangioma at single or multiple vertebral levels with or without vertebral collapse in the same sitting with excellent clinical outcome. | background : painful vertebral hemangiomas are often inadequately managed medically. we evaluated the outcome of percutaneous vertebroplasty (pvp) in the treatment of painful vertebral hemangiomas refractory to medical management.materials and methods:14 patients (four thoracic and ten lumbar vertebra) with painful vertebral hemangiomas presenting with severe back pain for more than 6 months not responding to medical therapy were treated by vertebroplasty. cross sectional imaging of the spine with magnetic resonance was done. blood investigations were done to exclude coagulopathy excluded. pvp was performed under local anesthesia.results:the pain intensity numeric rating scale (pi - nrs-11) of these patients was in the range of 7 - 10 (severe pain). after vertebroplasty 8 patients were completely free of pain (pi nrs score 0) while 6 were significantly relieved (pi - nrs score 1 - 3). no complications were observed. two patients with associated radicular pain had good pain relief following pvp. no recurrence was found during 36 months of postoperative followup.conclusion:pvp is a safe and effective procedure in patients with painful vertebral hemangiomas refractory to medical management. |
, we describe the first case of fatal large bowel ischemia in the aftermath of laparoscopic incisional hernia repair. a literature search using pubmed was performed to identify all published cases of intestinal ischemia following laparoscopic procedures. our search revealed 13 cases of intestinal ischemia following various laparoscopic procedures. including this one, 10 of 14 cases reported on so far had impaired cardiovascular, hepatic or renal function or atherosclerosis. patient - related risk factors seem to play the most important role in the development of this rare but devastating complication. preventive measures and methods to identify patients at risk for developing intestinal ischemia during and after laparoscopy patient selection, an optimal hydration status, an optimized technique with lowest insufflation pressure possible, and intermittent decompressions of the abdomen when the procedure is lengthy are the measures that have a potential to prevent this complication. whatever laparoscopic procedure has been performed, intestinal ischemia should be considered in any patient with nonspecific abdominal symptoms. it has been described after laparoscopic cholecystectomy, inguinal hernia repair, gynecologic myolysis, and fundoplication. laparoscopic repair of ventral and incisional hernia (lrvih) is gaining popularity due to its low recurrence rate, short hospital stay, and low complication rate. in this report a 47-year - old obese woman (bmi of 42) with a large incisional hernia at midline laparotomy was referred for laparoscopic correction. her medical history was significant for hypertension, transabdominal gynecologic surgery, peripheral vascular disease, and included multiple angioplasties of the iliac arteries. a 15-minute break that included decompression of the abdomen was made halfway through the operation. this is locally a common practice during long operations and was not triggered by any specific adverse event. the hernia defect measured 20 cm 16 cm and correction required application of two 30cm20 cm expanded polytetrafluoroethylene meshes (dualmesh, wl gore, flagstaff, az, usa). the meshes were fixed both with tackers (protack, tycouss, norwalk, ct, usa) and transabdominal sutures. c - reactive protein was significantly raised. to evaluate the possibility of a missed bowel lesion, we decided on a relaparoscopy. intraabdominal pressure was maintained at 12 mm hg throughout this short procedure that took not more than 12 minutes. upon exploration, only bowel distension was found with no signs of contamination, perforation, or ischemia. given these findings postoperatively, the patient developed systemic inflammatory response syndrome, respiratory insufficiency, and required transfer to the intensive care unit. within the next few days, the patient slowly stabilized, required less and less support, and experienced no apparent infection. on postoperative day 9, she produced bloody diarrhea that prompted us to perform a colonoscopy. examination revealed severe ischemic colitis in the transverse colon. mesenteric angiography was performed showing an occluded superior mesenteric artery and a compensatory distended inferior mesenteric artery with a pinpoint stenosis at its origin. balloon angioplasty (figure 1) successfully dilated this stenosis, the patient was placed on anticoagulants and, afterward, the patient steadily improved. another colonoscopy was performed that showed multiple perforations of the ischemic transverse colon. at subsequent laparotomy, a fecal peritonitis due to multiple perforations of the ischemic postoperatively, the patient deteriorated further and died the next day, 16 days after the first operation. acute mesenteric ischemia is the result of a sudden reduction in intestinal blood flow that is insufficient to meet the metabolic demands of the bowel. specific risk factors include advanced age, atherosclerosis, low cardiac output states, cardiac arrhythmias, severe cardiac valvular disease, administration of medications known to reduce intestinal perfusion (such as diuretics, digoxin, alpha - adren - ergic agonists), various forms of shock, septicemia, dehydration, hypotension, and others. although a few cases of fatal bowel ischemia are described after open cholecystectomy, various cardiac and peripheral vascular procedures, cystectomy, esophagectomy, and others, the incidence of postoperative bowel ischemia is extremely low. this indicates that the effects of surgery on bowel perfusion are usually well tolerated and have no clinical consequences. a number of physiologic changes during laparoscopy create an additional risk of compromised mesenteric circulation. the intraabdominal hypertension created by the pneumoperitoneum reduces mesenteric perfusion, cardiac output, and mesenteric outflow. direct absorption of insufflated carbon dioxide into the circulation may also lead to mesenteric vasoconstriction. however, all these adverse physiological effects of pneumoperitoneum are obviously well tolerated in the vast majority of patients, because a clinically manifested bowel ischemia after laparoscopic procedures is an extremely rare complication. a literature search using pubmed revealed only 13 case reports before the present one (table 1). once it occurs though, intestinal ischemia following a laparoscopic procedure is a devastating complication. eleven of 14 patients including this one died as a consequence, creating an overall mortality of 79%. reported cases of intestinal ischemia after laparoscopic procedures ns = not specified ; iap = intraabdominal pressure. rapid diagnosis is essential to prevent the catastrophic events associated with mesenteric ischemia. because early signs and symptoms are nonspecific however, given the negligible incidence of intestinal ischemia amid the large number of laparoscopic procedures performed, the diagnosis is as a rule missed or delayed. in only one reported case was the diagnosis established clinically and relatively early. this patient was treated with high - dose anticoagulants and recovered. in all other reported cases, the risk seems to be particularly high in patients with impaired hepatic or renal function or atherosclerosis. including this one, 10 of 14 patients (71%) reported on so far had at least one of the previously mentioned risk factors present. it has been previously stated that the risk is higher when the laparoscopic procedure is lengthy. although in this case intestinal ischemia developed after an indeed very lengthy procedure, data from the literature do not provide strong support of that view. of 13 previously published reports, duration of surgery was specified in 10 of them on average equaling 67.5 minutes (median, 62.5, range 22 to 120), which is quite usual for procedures that were performed. we used decompression once halfway through this long procedure, but it did not prevent development of fatal intestinal ischemia. it is probably a futile endeavor to precisely determine the specific role of laparoscopy in the cascade of events that led to mortality in the patient we describe. long laparoscopy in the patient at risk with unknown preexisting compromised mesenteric circulation definitely carried a potential to further compromise bowel perfusion. it is also possible that development of postoperative ileus in combination with systemic inflammatory response syndrome played a triggering role in the development of this complication. no signs of intestinal ischemia at relaparoscopy and a relatively long clinical course in our patient might offer certain support to this second possibility. to the best of our knowledge, this is the first reported case of intestinal ischemia following lvihr and the only one we have experienced in a series of 401 lrvih performed so far (incidence of 0.25%). carbajo, reporting earlier on their experience with lvihr, mentioned in brief among postoperative complications a case of a small bowel leakage due to ischemia but did not provide any further details on this issue. patient selection, an optimal hydration status, an optimized technique using the lowest insufflation pressure possible, and intermittent decompressions of the abdomen when the procedure is lengthy are the measures that have a potential to prevent this rare complication. whatever a laparoscopic procedure has been performed, intestinal ischemia should be considered in any patient with nonspecific abdominal symptoms. | background and objectives : intestinal ischemia is a very rare complication of laparoscopic procedures. in this report, we describe the first case of fatal large bowel ischemia in the aftermath of laparoscopic incisional hernia repair.methods:a literature search using pubmed was performed to identify all published cases of intestinal ischemia following laparoscopic procedures.results:our search revealed 13 cases of intestinal ischemia following various laparoscopic procedures. including this one, 10 of 14 cases reported on so far had impaired cardiovascular, hepatic or renal function or atherosclerosis. none of these patients - at - risk survived. in this series, no indications of faulty operative technique could be identified.conclusion:patient-related risk factors seem to play the most important role in the development of this rare but devastating complication. preventive measures and methods to identify patients at risk for developing intestinal ischemia during and after laparoscopy are not completely clear. patient selection, an optimal hydration status, an optimized technique with lowest insufflation pressure possible, and intermittent decompressions of the abdomen when the procedure is lengthy are the measures that have a potential to prevent this complication. whatever laparoscopic procedure has been performed, intestinal ischemia should be considered in any patient with nonspecific abdominal symptoms. |
patients diagnosed with cancer today have improved five - year relative survival compared to just over a decade ago. treatment advances, including the introduction of targeted agents, continue to improve cancer survival. however, it is increasingly evident that targeted agents used in cancer therapy may negatively impact cardiovascular health. currently, cardiotoxicity is the second leading cause of morbidity and mortality in cancer survivors. this has led to increasing interest by health care providers (hcps) in developing multidisciplinary approaches to manage these patients. however, many issues in cardiac oncology remain unresolved, including a formally accepted definition of cardiac toxicity. there are few guidelines to assist in the management of patients with or at risk of cardiac toxicity. as a result, there are major knowledge gaps with limited consensus on the approach for diagnosis, management, and monitoring of cardiotoxicity. the objective of this international cardiac oncology survey was to gain a better understanding of current knowledge and practice patterns among hcps involved in the management of cancer patients exposed to potentially cardiotoxic drugs. additionally, we sought to obtain a census of clinical opinions concerning emerging cardiac oncology issues. ultimately, this information will be used to inform clinical guidelines and to better standardize the diagnosis, management, and monitoring of cardiac toxicity related to cancer therapy. between 2012 and 2013, we conducted an email - based survey of hcps involved in the management of cardiac disease in cancer patients. hcps were identified using email directories from the canadian association of medical oncologists (camo), the canadian cardiovascular society (ccs), the canadian cardiac oncology network (ccon), and the international cardioncology society (icos). the survey consisted of 14 base questions for international participants (icos) and an additional 30 questions for canadian participants (ccon) related to cancer treatment - induced cardiotoxicity. the icos and ccon questionnaires were initially prepared and administered separately ; the results were subsequently combined and analyzed together for this study. questions contained multiple - choice options ; some follow - up questions also allowed further elaboration. in addition to a series of short - stem questions, the ccon survey also contained two questions pertaining to a clinical case study. the case study described a 50-year - old female receiving trastuzumab for her2 positive metastatic breast cancer. her left ventricular ejection fraction (lvef) at baseline was 55% but on repeat echocardiogram decreased to 30% with no cardiac symptoms. a follow - up scenario was also included, where trastuzumab therapy was discontinued, and an angiotensin converting enzyme (ace) inhibitor was initiated. respondents were again asked to recommend appropriate management. the survey was developed and administered via the fluids online system. a total of 393 survey responses were received, of which 77 were from canadian respondents. the majority of icos survey respondents were from the usa ; there were also several respondents from australia, denmark, and switzerland. the majority of respondents were cardiologists (185/393, 47%), followed closely by medical oncologists (158/393, 40%) (table 1). overall, 55% of respondents were in academic practice (212/383). when considering the canadian (ccon) respondents alone, the majority (66/77, 89%) were in academic practice. thirty - five percent of respondents (26/77) had been practising for less than five years. fifty - two percent (40/77) indicated that they had a dedicated cardiac oncology centre at their institution. the majority of respondents agreed that cardiac issues are important to cancer patients (381/393, 97%). ninety - four percent felt that the diagnosis of cardiac disease had an impact on cancer prognosis (349/383) and 77% agreed that chemotherapy or radiation is an important risk factor for cardiac disease (301/393). however, only 36% of total respondents agreed with an accepted definition of cardiotoxicity (109/383). the majority of canadian cardiologists felt that there is no formal definition of cardiotoxicity, while the majority of canadian oncologists felt that there was an established definition (figure 1). in spite of the high percentage (78%) of respondents who felt that cardiac medications are protective during active treatment (307/393), only 51% would consider prescribing these medications up - front in cancer patients (199/393). (29/77, 38%) to the protective effect of cardiac medications (figure 2) and not sure (25/77, 32%) as to whether they would use them in clinical practice (figure 3). referring to the clinical case study of the patient with decreased lvef, the hcps were asked what would be your management of her trastuzumab therapy at this time ? twenty percent of cardiologists chose the response discontinue trastuzumab permanently, while only 7% of oncologists chose this response. however, the response discontinue trastuzumab, resume if ef normalizes was chosen by 74% of oncologists, but by only 48% of cardiologists. in the follow - up question of unchanged lvef in the presence of cancer progression, what management would you now recommend ? the results were scattered between the seven available options. the option optimize ace inhibitor, add beta blocker was chosen by 52% of cardiologists and 22% of oncologists. the option resume trastuzumab at reduced dose with serial ef was chosen by 24% of cardiologists and 4% of oncologists. the option other was selected by 20% of cardiologists and 41% of oncologists. this international cardiac oncology survey was conducted to gain a better understanding of the knowledge base and clinical opinions of hcps involved in the treatment of cancer patients being treated with potentially cardiotoxic therapy. to our knowledge, this is the first study of this kind in the field of cardiac oncology and highlights many controversial clinical issues within the field. the results affirm that opinions differ between cardiologists and oncologists regarding a formal definition of cardiotoxicity, as well as the diagnosis, management, and monitoring of oncology patients at risk of cardiovascular complications. at this time, there is no clear agreement in the literature on the definition of cancer therapy - related cardiotoxicity, and several historical definitions are in common use. recent consensus guidelines have recently been proposed in an attempt to clarify definitions ; however it will take time to incorporate these recommendations into clinical practice. additionally, this survey demonstrated that there is a clear knowledge gap between cardiologists and oncologists in the appropriate clinical management of cancer patients who develop cardiotoxicity secondary to their cancer treatment. in the presented case study, more oncologists chose the evidence - based option to discontinue trastuzumab, resume if ef normalizes. more concerning is that almost half (48%) of the cardiologists would not suggest resuming trastuzumab in these patients even with the normalization of their lvef, thus depriving these patients of potentially lifesaving therapy. the clinical opinions of the majority of respondents in this survey are supported by the available literature. the small percentage of respondents who felt that there is an established definition of cardiotoxicity (36%) is in agreement with work published by albini and colleagues. the finding that the majority of respondents agreed that chemotherapy or radiation is an important risk factor for cardiac disease is consistent with the conclusion by suter and ewer that cancer treatments may induce cardiac dysfunction (734%), heart failure (14%), and arterial hypertension (up to 23%). nearly four - fifths of respondents felt that cardiac medications may be protective during active treatment. previous work by yeh and colleagues reported that cardiac medications, such as ace inhibitors and beta blockers, may be effective in patients being treated for cancer. first, we were unable to compare results with other studies, as this survey was the first of its kind in cardiac oncology. despite use of the modified dillman total design survey method, response rates may be improved with use of personalized correspondence and monetary or unconditional incentives such as gift certificates. it is possible that nonresponding hcps may not consider cardiac issues to be important in cancer treatment. respondents were likely a highly selected sample of hcps, since over half (52%, 40/77) indicated that they had access to a dedicated cardiac oncology clinic at their institution. second, the survey design forced respondents to select answers in a multiple - choice format, and respondents were limited to the choices provided. some of the questions allowed for elaboration with free text, but these were not included in the analysis because the responses were so variable. additionally, the icos and ccon groups were provided with separate surveys. retrospectively combining these surveys proved difficult and limited the uniformity of results. for future investigations, it is encouraging to find a high level of concern for cardiac safety among health care providers treating cancer patients. strikingly, there continues to be a lack of consensus on the definition of cardiotoxicity and a discrepancy in clinical practice between cardiologists and oncologists, the two specialties mostly involved in caring for cardiac oncology patients. these differences in opinion will need to be resolved through more effective research collaboration, formulation of evidence - based guidelines, and educational strategies to standardize the diagnosis, management, and monitoring of cardiac toxicity. | cardiotoxicity is the second leading cause of morbidity and mortality in cancer survivors. the objective of this international cardiac oncology survey was to gain a better understanding of current knowledge and practice patterns among hcps involved in the management of cancer patients exposed to potentially cardiotoxic drugs. between 2012 and 2013, we conducted an email - based survey of hcps involved in the management of cardiac disease in cancer patients. 393 survey responses were received, of which 77 were from canadian respondents. the majority of respondents were cardiologists (47%), followed closely by medical oncologists. the majority of respondents agreed that cardiac issues are important to cancer patients (97%). however, only 36% of total respondents agreed with an accepted definition of cardiotoxicity. while 78% of respondents felt that cardiac medications are protective during active cancer treatment, only 51% would consider prescribing these medications up - front in cancer patients. although results confirm a high level of concern for cardiac safety, there continues to be a lack of consensus on the definition of cardiotoxicity and a discrepancy in clinical practice between cardiologists and oncologists. these differences in opinion require resolution through more effective research collaboration and formulation of evidence - based guidelines. |
balb / c mice were immunized with purified human pcna protein overexpressed in bl21 cells. after 3 injections of 0.1 mg protein / mouse mixed with poly i - poly c polymer, the spleen cells of the responding animals were fused with sp2/0-ag14. growing clones were screened by elisa using microtiter plates coated with pure pcna protein (0.5 g / well) and by cell staining using fixed hela cells. all antibodies were purified from either ascitic fluid or hybridoma supernatant on protein g sepharose (ge healthcare). they were subsequently dialysed against pbs and concentrated with centrifugal filtration units (merck millipore) to obtain antibody samples of 25 mg / ml. purified antibody (1 mg) in pbs was incubated with a 20-fold molar excess of sulfosuccinimidyl-4-(n - maleimidomethyl)- cyclohexane-1-carboxylate (sulfo - smcc ; thermo scientific) for 1 h at room temperature. excess crosslinker was removed using a zeba desalt spin column (2 ml ; thermo scientific). the antibodies recovered in the flow - trough were mixed with a 5- to 15-fold molar excess of the nls - encoding synthetic peptide (cagpkkkrkved) containing a cysteine residue at the n - terminal end. after incubation for 1 h at room temperature, the antibody - nls peptide conjugates were purified on desalting columns as described above and stored at 4c at a concentration of 2 mg / ml. the hela, caski, mel501 and u2os cell lines were grown according to atcc guidelines and maintained in dulbecco s modified eagle s tissue culture medium (dmem ; life technologies) supplemented with l - glutamine (2 mm), gentamicin (50 g / ml) and 10% heat - inactivated fetal calf serum at 37c in a humidified 5% co2 atmosphere. transduction experiments with purified mabs were performed according to the neon transfection system protocol (life technologies). typically, 10 cells in r buffer (provided in the kit) were mixed with 25 g of antibody in a total volume of 12 l. the mixture was then transferred in a neon pipette tip chamber (10 l) and subjected to electroporation in the system pipette station by applying the following optimized parameters : 1550 v, 10 ms and 3 pulses. the treated samples were deposited into 24-well plates containing sterile glass coverslips in 500 l pre - warmed culture medium without the antibiotic. after incubation for 24 h at 37c, the culture medium was replaced with complete medium. where indicated, the cells were irradiated with 20 j / m2 uvc 8 h before harvesting. for the electroporation of sirna (final concentration 50 nmol / l), settings were 1005 v, 35 ms and 2 pulses. the electroporated cells were fixed at the indicated time with 4% paraformaldehyde (w / v) for 30 min and washed twice with pbs. after permeabilization with 0.2% triton x100 for 5 min, they were incubated for 1 h with alexafluor 488 or 568 labeled - anti - mouse immunoglobulins (molecular probes, eugene, usa). following several washes with pbs, the coverslips were mounted with 4,6-diamino-2 phenylindole (dapi) fluoromount - g (southernbiotech). the cells were imaged with a leica dm5500 microscope equipped with fitc and cy3 filters. images were collected with a 63 or a 100 objective and analyzed with photoshop software. for the quantification of the delivered antibodies, cells were electroporated in the presence of varying amounts (0.5 to 5 g) of antibody and incubated for 24 h in 24-well plates as above. following recovery by trypsinization and counting, the cells were lysed in ripa buffer and soluble extracts corresponding to 5.10 cells were analyzed by western blotting, in parallel with calibrated antibody preparations. the heavy chain content of these extracts was finally quantitated after incubation with horseradish peroxidase - conjugated anti - mouse globulins and ecl reagent (ge healthcare) and analysis with the imagequantlas 4000 imager (ge healthcare). the analysis of the binding activity of the anti - pcna antibodies was essentially performed as above, except that extracts from untreated cells were used. the actin polypeptide was revealed with rabbit polyclonal antibody a206 (sigma - aldrich). briefly, caski cells were plated in triplicate in 12-well plates (10 cells / well) and, after 24 h, treated with sirna (25 pmol) or antibody (3 g) as described above. after 48 h of incubation at 37c, the cells were harvested by trypsinization and 1/30 of the pooled cell suspension was replated in triplicate in 60 mm - diameter tissue culture dishes. after 67 d of incubation in complete medium, the growing cells were counted manually. balb / c mice were immunized with purified human pcna protein overexpressed in bl21 cells. after 3 injections of 0.1 mg protein / mouse mixed with poly i - poly c polymer, the spleen cells of the responding animals were fused with sp2/0-ag14. growing clones were screened by elisa using microtiter plates coated with pure pcna protein (0.5 g / well) and by cell staining using fixed hela cells. all antibodies were purified from either ascitic fluid or hybridoma supernatant on protein g sepharose (ge healthcare). they were subsequently dialysed against pbs and concentrated with centrifugal filtration units (merck millipore) to obtain antibody samples of 25 mg / ml. purified antibody (1 mg) in pbs was incubated with a 20-fold molar excess of sulfosuccinimidyl-4-(n - maleimidomethyl)- cyclohexane-1-carboxylate (sulfo - smcc ; thermo scientific) for 1 h at room temperature. excess crosslinker was removed using a zeba desalt spin column (2 ml ; thermo scientific). the antibodies recovered in the flow - trough were mixed with a 5- to 15-fold molar excess of the nls - encoding synthetic peptide (cagpkkkrkved) containing a cysteine residue at the n - terminal end. after incubation for 1 h at room temperature, the antibody - nls peptide conjugates were purified on desalting columns as described above and stored at 4c at a concentration of 2 mg / ml. the hela, caski, mel501 and u2os cell lines were grown according to atcc guidelines and maintained in dulbecco s modified eagle s tissue culture medium (dmem ; life technologies) supplemented with l - glutamine (2 mm), gentamicin (50 g / ml) and 10% heat - inactivated fetal calf serum at 37c in a humidified 5% co2 atmosphere. transduction experiments with purified mabs were performed according to the neon transfection system protocol (life technologies). typically, 10 cells in r buffer (provided in the kit) were mixed with 25 g of antibody in a total volume of 12 l. the mixture was then transferred in a neon pipette tip chamber (10 l) and subjected to electroporation in the system pipette station by applying the following optimized parameters : 1550 v, 10 ms and 3 pulses. the treated samples were deposited into 24-well plates containing sterile glass coverslips in 500 l pre - warmed culture medium without the antibiotic. after incubation for 24 h at 37c, the culture medium was replaced with complete medium. where indicated, the cells were irradiated with 20 j / m2 uvc 8 h before harvesting. for the electroporation of sirna (final concentration 50 nmol / l), settings were 1005 v, 35 ms and 2 pulses. the electroporated cells were fixed at the indicated time with 4% paraformaldehyde (w / v) for 30 min and washed twice with pbs. after permeabilization with 0.2% triton x100 for 5 min, they were incubated for 1 h with alexafluor 488 or 568 labeled - anti - mouse immunoglobulins (molecular probes, eugene, usa). following several washes with pbs, the coverslips were mounted with 4,6-diamino-2 phenylindole (dapi) fluoromount - g (southernbiotech). the cells were imaged with a leica dm5500 microscope equipped with fitc and cy3 filters. images were collected with a 63 or a 100 objective and analyzed with photoshop software. for the quantification of the delivered antibodies, cells were electroporated in the presence of varying amounts (0.5 to 5 g) of antibody and incubated for 24 h in 24-well plates as above. following recovery by trypsinization and counting, the cells were lysed in ripa buffer and soluble extracts corresponding to 5.10 cells were analyzed by western blotting, in parallel with calibrated antibody preparations. the heavy chain content of these extracts was finally quantitated after incubation with horseradish peroxidase - conjugated anti - mouse globulins and ecl reagent (ge healthcare) and analysis with the imagequantlas 4000 imager (ge healthcare). the analysis of the binding activity of the anti - pcna antibodies was essentially performed as above, except that extracts from untreated cells were used. the actin polypeptide was revealed with rabbit polyclonal antibody a206 (sigma - aldrich)., caski cells were plated in triplicate in 12-well plates (10 cells / well) and, after 24 h, treated with sirna (25 pmol) or antibody (3 g) as described above. after 48 h of incubation at 37c, the cells were harvested by trypsinization and 1/30 of the pooled cell suspension was replated in triplicate in 60 mm - diameter tissue culture dishes. after 67 d of incubation in complete medium, the growing cells were counted manually. | antibodies are valuable tools for functional studies in vitro, but their use in living cells remains challenging because they do not naturally cross the cell membrane. here, we present a simple and highly efficient method for the intracytoplasmic delivery of any antibody into cultured cells. by following the fate of monoclonal antibodies that bind to nuclear antigens, it was possible to image endogenous targets and to show that inhibitory antibodies are able to induce cell growth suppression or cell death. our electrotransfer system allowed the cancer cells we studied to be transduced without loss of viability and may have applications for a variety of intracellular immuno - interventions. |
cerebral ischemia / reperfusion caused by stroke contributes to worsened neurological outcomes and poor prognosis. ischemia / reperfusion injury is triggered by a concert of pathological events, leading to inflammation, brain - blood barrier disruption, and neuronal cell death. current therapeutic strategies for ischemic stroke include pharmacological approaches and neuroprotective modalities (1, 2). preclinical studies have demonstrated that hypothermia effectively targets a multitude of ischemia - induced pathways including energy depletion, ion shifts, free radical formation, eaa release, and inflammation (3 - 5). brain cooling accelerates restoration of ionic homeostasis and inhibits ischemia - induced eaa release (6 - 8). moreover, free radical formation and inflammatory responses are suppressed upon hypothermia procedures (7). hypothermia intervenes in multiple steps of cell death pathway to reduce the ischemic progression following acute stroke (9, 10). death receptor - mediated apoptosis plays a critical role in neuronal death following ischemic stroke. fas (apo-1/cd95) belongs to the tumor necrosis factor receptor (tnfr) superfamily of cell - surface death receptors and is expressed in the nervous system. expression of fas and its ligand have been documented in the brain following ischemia (11), and neutralizing fasl with antibody treatment has been demonstrated to be neuroprotective in experimental in vivo models (12, 13). furthermore, fas knockout animals have smaller infarct areas than wild - type ones (14, 15). matrix metalloproteinases (mmps) can modulate fas activation by causing proteolytic shedding of fasl from the cell surface (16 - 18). several studies have demonstrated that therapeutic hypothermia altered mmp expression in stroke (19 - 21). moreover, release of soluble fas ligand (sfasl) has been reported to be reduced in response to hypothermia treatment (22). although several lines of evidence suggest that hypothermia reduces neuron death through alteration of apoptosis pathway, the mechanism underlying neuroprotective effect of mild hypothermia treatment for ischemic stroke remains sketchy. we hypothesized that mild hypothermia applied during ischemia modulates death receptor - mediated apoptosis and investigated the molecular mechanism in the ischemic brain. in the present study, we examined the neuroprotective effects of mild hypothemia on infarction, neurological deficits, and apoptosis in a rat mcao model. adult male wistar rats weighing 30020 g were purchased from vital river laboratories (beijing, china) and housed in animal centre of harbin medical university. protocol was approved by the animal ethics committee of harbin medical university. a middle cerebral artery occlusion (mcao) was performed as previously described (23). in brief, animals were initially anesthetized with 10% chloral hydrate. rectal temperature was maintained and monitored at 37c with a heating blanket. the right common carotid artery, external carotid artery (eca), and internal carotid artery were isolated. a nylon suture with its tip rounded by heating on flame was advanced from the eca into the lumen of the internal carotid artery until it blocked the origin of the middle cerebral artery (mca). a total of 78 rats were used and divided into 3 groups : sham - operated group (sham ; n=6), normothermia treatment (370.5) (nt ; n= 36), and hypothermia treatment (330.5) (ht ; n=36). for sham group, mcao rats received cooling immediately after ischemia for 6 hr and were subsequently maintained in normal body temperature. for nt group, animals were sacrificed at 6 hr, 12 hr, 24 hr, 48 hr, 72 hr, and 2 weeks post - ischemia. rats were sacrificed by carbon dioxide overdose, followed by perfusion with cold normal saline immediately. the brain was removed, fixed with 4% para- formaldehyde and sectioned into 2 mm thick slices. slices were immersed in 2% 2,3,5-triphenyl tetrazolium chloride (ttc, sigma) and incubated at 37c for 20 min. ttc - stained slices were photographed and analyzed by image - j analysis software (http://rsb.info.nih.gov/ij/). total infarct volume was calculated by summing the clot area in each section and multiplying by the distance between sections. neurological status of each rat was evaluated at indicated time points as previously described (25). rats were suspended by the tail 1 m above the floor and slowly lowered while observing their posture. rats were then placed on a flat surface and gently pushed from side to side. deficits were scored as follows : 0, no deficit ; 1, forelimb flexion while suspended by the tail ; 2, decreased resistance to lateral push. deficits were scored based on the scale : 0, steady posture with paws on top of beam ; 1, paws on side of beam or wavering ; 2, one or two limbs slip off beam ; 3, three limbs slip off beam ; 4, rat attempts to balance with paws on beam but falls ; 5, rat drapes over beam and falls without attempt. after deparaffinization, sections were blocked in 1% bovine serum albumin in pbs and incubated with primary antibodies against fas, fasl, and mmp-3 followed by treating with biotin - labeled anti - igg secondary antibody. antibody complexes were detected using the vector abc kit (elite vectastain abc kit, vector labs) and colorized with 0.05% diaminobenzidine (dab, vector labs). negative controls were run in parallel using adjacent sections incubated with igg instead of the primary antibody. student s t - test or dunnett t - test were used to compare the differences between treated groups and control groups, and differences were considered significant at p < 0.05. adult male wistar rats weighing 30020 g were purchased from vital river laboratories (beijing, china) and housed in animal centre of harbin medical university. protocol was approved by the animal ethics committee of harbin medical university. a middle cerebral artery occlusion (mcao) was performed as previously described (23). in brief, animals were initially anesthetized with 10% chloral hydrate. rectal temperature was maintained and monitored at 37c with a heating blanket. the right common carotid artery, external carotid artery (eca), and internal carotid artery were isolated. a nylon suture with its tip rounded by heating on flame was advanced from the eca into the lumen of the internal carotid artery until it blocked the origin of the middle cerebral artery (mca). a total of 78 rats were used and divided into 3 groups : sham - operated group (sham ; n=6), normothermia treatment (370.5) (nt ; n= 36), and hypothermia treatment (330.5) (ht ; n=36). for sham group, mcao rats received cooling immediately after ischemia for 6 hr and were subsequently maintained in normal body temperature. for nt group, animals were sacrificed at 6 hr, 12 hr, 24 hr, 48 hr, 72 hr, and 2 weeks post - ischemia. rats were sacrificed by carbon dioxide overdose, followed by perfusion with cold normal saline immediately. the brain was removed, fixed with 4% para- formaldehyde and sectioned into 2 mm thick slices. slices were immersed in 2% 2,3,5-triphenyl tetrazolium chloride (ttc, sigma) and incubated at 37c for 20 min. ttc - stained slices were photographed and analyzed by image - j analysis software (http://rsb.info.nih.gov/ij/). total infarct volume was calculated by summing the clot area in each section and multiplying by the distance between sections. neurological status of each rat was evaluated at indicated time points as previously described (25). rats were suspended by the tail 1 m above the floor and slowly lowered while observing their posture. rats were then placed on a flat surface and gently pushed from side to side. deficits were scored as follows : 0, no deficit ; 1, forelimb flexion while suspended by the tail ; 2, decreased resistance to lateral push. deficits were scored based on the scale : 0, steady posture with paws on top of beam ; 1, paws on side of beam or wavering ; 2, one or two limbs slip off beam ; 3, three limbs slip off beam ; 4, rat attempts to balance with paws on beam but falls ; 5, rat drapes over beam and falls without attempt. after deparaffinization, sections were blocked in 1% bovine serum albumin in pbs and incubated with primary antibodies against fas, fasl, and mmp-3 followed by treating with biotin - labeled anti - igg secondary antibody. antibody complexes were detected using the vector abc kit (elite vectastain abc kit, vector labs) and colorized with 0.05% diaminobenzidine (dab, vector labs). negative controls were run in parallel using adjacent sections incubated with igg instead of the primary antibody. the data are expressed as mean s.d. student s t - test or dunnett t - test were used to compare the differences between treated groups and control groups, and differences were considered significant at p < 0.05. to evaluate the effects of mild hypothermia on ischemic stroke, mcao rats were treated with different temperatures and analyzed by a set of histological tests. the mortality of sham, normothermia and hypothermia groups were 0%, 21%, and 13%, respectively. mild hypothermia treatment significantly reduced the infarct volume to 18.434.23%, compared with the normothermia - treated group (p < 0.01) (figure 1a). infarct areas of sham, normothermia - treated and mild hypothermia were analyzed by ttc staining. (a) infarct volume was expressed as percentage of infracted region in reference to contralateral hemisphere. (b) representative image of each experimental group. p<0.05, hypothermia group compared with normothermia group to investigate the effect of mild hypothermia on neurobehavioral deficits in maco rats, maco rats were treated with cooling procedures and examined using two behavioral tests. mild hypothermia treatment significantly improved neurological outcomes in maco rats compared with that of the normothermia - treated animals. the scores of balance beam test in normothermia and hypothermia groups were 2.170.41 and 0.830.75, respectively (p<0.05). using berderson test, differences in neurological scores between normothermia (1.830.75) and hypothermia groups (0.670.52) were significant (p < 0.01) (table 1). the neurobehavioral deficit scores of normothermia and hypothermia groups results are shown as meansd, p<0.05, normothermia group compared with hypothermia group we further examined the effect of mild hypothermia on expression levels of fas and fasl using immunohistochemistry. we observed the elevated expression of fas in the brain of maco rats after reperfusion. from the immunohistochemistry analysis, the number and intensity of fas immunoreactivity were higher in normothermia group than in hypothermia group over the designated time frame (table 2). in addition, ischemia - induced fasl level was significantly higher in hypothermia group than in normothermia group at 6 and 12 hr post reperfusion (p<0.05) (table 3). nevertheless, number and intensity of fasl - positive cells were higher in mild hypothermia group than in normothermia group over the designated time frame. percentage of fas - positive cells in brain of maco rat after reperfusion with different brain cooling processes results are shown as meansd, p<0.05, hypothermia group compared with normothermia group percentage of fasl - positive cells in brain of maco rat after reperfusion with different brain cooling processes results are shown as meansd, p<0.05, hypothermia group compared with normothermia group as fasl level is associated with the activity of mmp-3, we next determined the expression of mmp-3 in brain tissues of maco rats after reperfusion undergoing different temperature treatments. level of mmp-3 was significantly increased in response to reperfusion with its peak at 6 hr post - reperfusion (table 4). ischemia - induced mmp-3 expression was significantly lower in hypothermia group than in normothermia group at 6, 12, 24, and 48 hr post reperfusion (p<0.05). percentage of mmp-3 positive cells in brain of maco rat after reperfusion with different brain cooling processes results are shown as meansd, p<0.05, hypothermia group compared with normothermia group to evaluate the effects of mild hypothermia on ischemic stroke, mcao rats were treated with different temperatures and analyzed by a set of histological tests. the mortality of sham, normothermia and hypothermia groups were 0%, 21%, and 13%, respectively. mild hypothermia treatment significantly reduced the infarct volume to 18.434.23%, compared with the normothermia - treated group (p < 0.01) (figure 1a). infarct areas of sham, normothermia - treated and mild hypothermia were analyzed by ttc staining. (a) infarct volume was expressed as percentage of infracted region in reference to contralateral hemisphere. (b) representative image of each experimental group. p<0.05, hypothermia group compared with normothermia group to investigate the effect of mild hypothermia on neurobehavioral deficits in maco rats, maco rats were treated with cooling procedures and examined using two behavioral tests. mild hypothermia treatment significantly improved neurological outcomes in maco rats compared with that of the normothermia - treated animals. the scores of balance beam test in normothermia and hypothermia groups were 2.170.41 and 0.830.75, respectively (p<0.05). using berderson test, differences in neurological scores between normothermia (1.830.75) and hypothermia groups (0.670.52) were significant (p < 0.01) (table 1). the neurobehavioral deficit scores of normothermia and hypothermia groups results are shown as meansd, p<0.05, normothermia group compared with hypothermia group we further examined the effect of mild hypothermia on expression levels of fas and fasl using immunohistochemistry. we observed the elevated expression of fas in the brain of maco rats after reperfusion. from the immunohistochemistry analysis, the number and intensity of fas immunoreactivity were higher in normothermia group than in hypothermia group over the designated time frame (table 2). in addition, ischemia - induced fasl level was significantly higher in hypothermia group than in normothermia group at 6 and 12 hr post reperfusion (p<0.05) (table 3). nevertheless, number and intensity of fasl - positive cells were higher in mild hypothermia group than in normothermia group over the designated time frame. percentage of fas - positive cells in brain of maco rat after reperfusion with different brain cooling processes results are shown as meansd, p<0.05, hypothermia group compared with normothermia group percentage of fasl - positive cells in brain of maco rat after reperfusion with different brain cooling processes results are shown as meansd, p<0.05, hypothermia group compared with normothermia group as fasl level is associated with the activity of mmp-3, we next determined the expression of mmp-3 in brain tissues of maco rats after reperfusion undergoing different temperature treatments. level of mmp-3 was significantly increased in response to reperfusion with its peak at 6 hr post - reperfusion (table 4). ischemia - induced mmp-3 expression was significantly lower in hypothermia group than in normothermia group at 6, 12, 24, and 48 hr post reperfusion (p<0.05). percentage of mmp-3 positive cells in brain of maco rat after reperfusion with different brain cooling processes results are shown as meansd, p<0.05, hypothermia group compared with normothermia group in the present study, we demonstrate that mild hypothermia ameliorates neurological deficits in rat undergoing maco and reperfusion. the improvement is associated with a decrease in fas expression and elevated expression of fasl in comparison with those of normothermia treatment. moreover, our results show that level of mmp-3 is relatively lower in ischemic / reperfusion rats treated with mild hypothermia compared with that of normothermia - treated ones. according to clinical observations the window of thrombolytic therapy is considered to be 3 hr ; the experimental model was designed to have animals undergo ischemia for 2 hr followed by reperfusion (27). cerebral ischemic cascade is complex with spectrum of modulatory molecules, signaling pathways, and proteins that are involved in maintaining the micro - environment in aspect of fate of neuron cells. despite reperfusion restoring blood flow, it also leads to secondary brain damages resulting from edema, inflammation and oxidative stress. mild hypothermia has been demonstrated to be a robust treatment for cerebral ischemic injury, pre - clinically and clinically (2, 18). brain cooling is thought to manipulate metabolic stores and decelerate biological and biochemical reactions responding to ischemia (28, 29). several studies have reported that therapeutic hypothermia inhibits ischemia - induced apoptosis with results of decreased apoptotic cells and biochemical events associated with the intrinsic and extrinsic pathways (3034). in addition, hypothermia treatment leads to resistance of cell to apoptotic stimuli including fas ligation (35, 36). our findings are consistent with previous studies in which both fas and fasl were found localized in neurons and astrocytes of peri - ischemic areas, whereas the expressions were absent in sham - operated animals (14, 22). it has been documented that fas expression is increased in 30 min after ischemia and reaches a peak at 6 hr post ischemia (22, 37, 38). it has been reported that mmps cleave fasl to form sfasl that binds to fas triggering apoptosis (22, 39). given ameliorated neurobehavioral outcomes, it is suggested that elevated fasl in animals undergoing mild hypothermia remain membrane bound. mmps have been documented to be upregulated in response to cerebral ischemia (40, 41). they are involved in neuroinflammation, cleavage, and activation of other mmps and shedding of death receptors. increasing evidence has shown that mmp-3 plays a critical role in modulating inflammation and cell death (42). mmp-3 initiates inflammatory procedures in a parkinson s model with production of tnf- and other cytokines in microglial cells (43, 44). lps - induced inflammation leads to increased il1 stimulation and astrocyte expression of mmp-3 (45). a recent study has reported that mmp-3 is involved in neuron apoptosis after ischemia / reperfusion through fasl shedding (22). our data demonstrate an increase in the expression of mmp-3 parallel with worsened neurobehavioral outcome in ischemia / reperfusion animals. in addition, the elevated mmp-3 expression was suppressed by mild hypothermia and resulted in improved neurologic deficits, suggesting the absence of mmp-3 may lead to an improvement in neuron death. we demonstrate that mild hypothermia modulates expression of the fas and fasl that are involved in apoptotic pathway. mild hypothermia decreases mmp-3 activation leading to improved neurobehavioral outcomes due to less sfasl release. | objective(s):to investigate the effects of local mild hypothermia on the expression of fas, fasl and mmp-3 after cerebral ischemia - reperfusion in rats.materials and methods : male wistar rats were divided into sham - operated group (sham), normothermia group (nt), and hypothermia group (ht). mcao / r model was established by longa s method, and reperfusion was allowed after 2 hr occlusion. mild hypothermia (330.5c) for 6 hr was initiated at the start of reperfusion. immunohistochemistry was performed to determine expression fas, fasl, and mmp-3.results:infarct volume was reduced in the hypothermia group (18.434.23%) compared with the normothermia group (24.765.76%) (p<0.05). in mild hypothermia group, numbers of fas - positive and mmp-3 positive cells were significantly less than those of normothermia group (p<0.05). neurological functional scores of mild hypothermia were significantly improved (p<0.05).conclusion : mild hypothermia decreases infarct volume after cerebral ischemia - reperfusion, reduces fas and mmp-3 expression, but increases fasl in cerebral ischemia - reperfusion rats. |
able - bodied muslims abstain from food, fluids, smoking, and taking oral medications between the hours of sunrise and sunset, and usually eat a large meal after sunset and a lighter meal before sunrise. ramadan is observed by over 400 million of muslims spread across the globe ; and living under various geographical, climatic, social, cultural, and economic conditions. fasting the whole month of ramadan is obligatory for all healthy adults and adolescents. yet islam grants temporary or permanent exemption from fasting to those at extremes of age, the sick and ailing, the wayfarer and traveler, and the insane. it further grants similar additional exemptions to the women folk during their periods of menstruation, pregnancy, and lactation. despite that, many pregnant muslim women fast, against the standard medical advice. the length of fasting time varies with the geographical position of the country and the season in which the month of ramadan falls. therefore, the length of the fast may vary from 10 to 19 h a day. the practices and the food behaviors of the populations are not similar during this month of fasting by comparison to the remainder of the year. these modifications are accompanied by changes of the rhythm of life and disturbances of the cycle of sleep. modification of meal frequency and eating patterns during ramadan may affect different aspects of human health. apart from health issues of universal concern in relation to ramadan fasting, there are some issues pertaining exclusively to women which need to be addressed. these include the following : menstruationsexual obligations of married lifepregnancylactation / breast - feeding sexual obligations of married life lactation / breast - feeding islamic law is also very clear on the two areas of sexual relations and menstruation during the month of ramadan. fasting muslim women must abstain from sexual relationships from dawn to dusk for all the days of the month of ramadan. muslim women are exempt from fasting during the period of menstruation and up to 40 days following childbirth. however, they are expected to make up the missed fasting days before the following ramadan. to avoid this, many muslim women use oral contraceptives to postpone their menstrual cycle as they find it more difficult to fast alone at a later time to make up the missed days. pregnancy is a state of increased insulin resistance and insulin secretion and of reduced hepatic insulin extraction. fasting glucose concentrations are lower but postprandial glucose and insulin levels substantially higher in healthy pregnant women than those who are not pregnant. elevated blood glucose and a1c levels in pregnancy are associated with increased risk for major congenital malformations. fasting during pregnancy would be expected to carry a high risk of morbidity and mortality to the fetus and mother although controversy exists. this includes preconception care with emphasis on achieving near - normal blood glucose and a1c values, counseling about maternal and fetal complications associated with poor glycemic control, and education focussed on self - management skills. pregnant and lactating women should be reminded to utilize the concessions available to them and not to fast especially if doing so puts their own health or the health of their offspring in danger. there are reports which list some undesirable and harmful effects of fasting on the mother, fetus and the infant, whereas others do not report any such significant adverse effects.[57 ] adverse and undesirable effects reported include an increased risk of hyperemesis gravidarum during the early months of pregnancy, increased prevalence of urinary tract infections perhaps due to decreased fluid intake during fasting days, reduction in fetal breathing movements perhaps due to the prevailing relatively low levels of maternal blood glucose, fetal compromise as indicated by a reduction in the fetal biophysical profiles, and elevations in the maternal cortisol levels. exposure to fasting before birth is associated with poorer general health and a higher incidence of sickness at a later age. placental growth slows but efficiency is increased so that fetal growth is sustained, albeit with a reduced reserve capacity. changes in placental growth during ramadan could be associated with altered fetal programming, and may therefore have long - term implications for the health of the next generation. it also increases a person 's chances of developing symptoms that are indicatory for serious health problems such as coronary heart disease and type 2 diabetes and, among older people who had been exposed during certain stages of gestation, may lead to anemia. depending on the moment of exposure, the exposed on average are a bit smaller in body size and weigh less. the composition and amount of food is very likely to make a difference for the extent to which the fetus is affected. the more hypoglycemia and a calorie deficiency are avoided, the smaller the effects will arguably be. the ruling for patients with pregnancy is that they are prohibited from fasting to prevent harming themselves based on the certainty or the predominance of probability that harm will occur to these patients. however, some pregnant women insist on fasting despite repeated warnings regarding possible harm to the fetus. in such a situation, intensive education, possibly involving a religious educator, may prove to be of some benefit. there can be certain suggestions for them to avoid adverse outcomes : do intermittent fasting.always be ready to break the fast on appearance of warning symptoms (prior counseling should include this).if determined to fast, then logical changes in diet such as plenty of complex carbohydrates in saher (which will provide calories for longer duration) and simple carbohydrates at iftar along with adequate nutritional planning according to the stage of pregnancy. do intermittent fasting. always be ready to break the fast on appearance of warning symptoms (prior counseling should include this). if determined to fast, then logical changes in diet such as plenty of complex carbohydrates in saher (which will provide calories for longer duration) and simple carbohydrates at iftar along with adequate nutritional planning according to the stage of pregnancy. as in pregnancy, there is no clear mention of exemption in the quran for breastfeeding women from fasting ramadan. based on the quran, it is clear that muslim women who are breastfeeding during postpartum are exempt from fasting during this period, as in menstruation. despite this clear exemption there is a lack of knowledge about the actual effects of fasting while breastfeeding on the mother - infant relationship and consequently the infant 's health. a study by ertem found that 22% of breastfeeding mothers perceived a decrease in their breast milk production and 23% reported increasing the amount of infant supplements during ramadan fasting. it is well established that breastfeeding of infants is associated with their better biological, psychological and intellectual development. the additional metabolic stress of ramadan fasting in pregnancy and during lactation has the potential to cause retardation of foetal and neonatal growth and development, respectively. in saudi arabia, the ratio of low - birth weight babies born during the festival months of ramadan and hajj was significantly higher than in the non - festival months. however, a study conducted in the uae concluded that there was no significant effect of ramadan fasting on breast milk quality and composition in nursing mothers. the practice of fasting during ramadan by mothers of infants and young children should not be viewed solely from the perspective of feeding and nutrition. research states that fasting causes physiological changes such as sleepiness, lack of concentration, weakness, exaggerated responsiveness, irritability, nervousness, and aggressiveness. the development of the infant depends most on interactions and relationships with his / her mother. the effect of such changes on the breastfeeding mother, mother - child interactions, and the production of breast milk needs to be investigated. thus, it is imperative that child health care providers find religious and culturally appropriate methods to combat the possible unfavorable effects of intermittent fasting for infants and children. lactating mothers who are determined to fast need to be counseled enough prior to fast regarding adequate nutrition and possible problems so that they take up fast initially on trial basis and if it works smoothly and does not result in significant decrease in milk secretion she can be permitted to fast cautiously under regular supervision of a pediatrician. however, they should be discouraged to fast if child is less than 6 months old and exclusively breast fed. traditionally, muslim women are not ordained with difficult, heinous, or hazardous occupations outside their household limit and all such responsibilities rested with their male counterparts. this was based on the belief that men and women have complimentary roles and obligations in society, which are commensurate with their natural physical, psychological, and social inclinations and differences. presently, women while still retaining most of their traditional householder 's role have ventured beyond it and have sought employment and careers outside the house. this taken as a whole has not only increased their work load and responsibilities but also has put them under tremendous tension, stress, and strain. many of the muslim women perhaps due to the family and societal pressures or lack of proper information hesitate and fail to avail themselves of the generous provisions of temporary or permanent exemptions from fasting available in islam, the religion of the muslims. the religion of islam values life. although fasting during ramadan is one of the obligations of the religion, flexibility exists. differences of perception and practice exist among muslim women of different ethnic groups and among muslim patients in general. there is a need for health professionals to have standard guidelines regarding health and fasting during ramadan in the context of such diversity. many of the muslims who undertake ramadan fasting might be requiring daily medication for their ailments and they might omit these during fasting in the day time. these persons should be offered alternative drug regimes like once daily formulations or night time medications where ever feasible. all in all, careful management of fasting during pregnancy may reduce problems, but it is unlikely that it reduces them to negligible levels. for women who insist to fast, it is imperative that knowledge is assembled and a consensus is reached on the conditions under which a woman can keep on fasting. it should become clear which consumption patterns are desirable and which ones are not. also, the women need to be monitored well on a number of variables on which physicians should get consensus. suitable working hour schedule adjustments for those ladies who are engaged in employment / careers outside their homes.attention to vitamin d needs.remind deserving women to make use of the generously available provisions for the very old, sick, pregnant, and lactating women.in religious matters, individuals should be at liberty to discuss and decide how best they want to discharge their religious obligations without compromising their health, safety, and well-being.counseling should be individualized.remind those fasting in ramadan of the holy prophet mohammed 's saying, no one will be allowed to move from his position on the day of judgment until he has been asked how he spent his life, how he used his knowledge, how he earned and spent his money and in what pursuits he used his health. suitable working hour schedule adjustments for those ladies who are engaged in employment / careers outside their homes. provisions for the very old, sick, pregnant, and lactating women. in religious matters, individuals should be at liberty to discuss and decide how best they want to discharge their religious obligations without compromising their health, safety, and well - being. remind those fasting in ramadan of the holy prophet mohammed 's saying, no one will be allowed to move from his position on the day of judgment until he has been asked how he spent his life, how he used his knowledge, how he earned and spent his money and in what pursuits he used his health. | fasting during ramadan, the holy month of islam, is mandatory for all healthy adult muslims. it is estimated that there are 1.1 - 1.5 billion muslims worldwide, comprising 18 - 25% of the world population. about 62% of the world 's muslim population resides in asia. women comprise approximately 50% of this population. there is great religious fervor and enthusiasm in the majority of muslims the world over for observing the religious fasting. many of the muslim women perhaps due to the family and societal pressures or lack of proper information hesitate and fail to avail themselves of the generous provisions of temporary or permanent exemptions from fasting available in islam. it is therefore important that medical professionals as well as the general population be aware of potential risks that may be associated with fasting during ramadan. this familiarity and knowledge is as important in south asia and the middle east as it is in europe, north america, new zealand, and australia. there has not yet been any statement of consensus regarding women 's health issues during ramadan, namely menstruation, sexual obligations of married life, pregnancy, and lactation. this document aims to put forward some of the general guidelines for these issues especially for the south asian muslim women. |
the essential trace element selenium is believed to exert beneficial influence on human health, mainly based on the antioxidant capacity of selenoproteins such as glutathione peroxidases (gpx) and thioredoxin reductases (trxr) containing the 21 proteinogenic amino acid, selenocysteine, in their active center. potential selenium - mediated health benefits include prevention of cardiovascular and neurodegenerative diseases, delay of aging, functioning of the immune system, and prevention of certain forms of cancer. a wide range of dietary selenium sources comprise cereals, garlic, brazil nuts, meat and fish. even though overt selenium deficiency is observed rarely, consumers in industrialised countries habitually ingest high amounts of selenium - enriched dietary supplements. however, it has long been known that the therapeutic window of selenium is narrow, and adverse health effects may occur due to supranutritional selenium intake even below the levels required for intoxication. in this regard, an ongoing discussion on the safety of dietary selenium supplementation has arisen from a coincidental and unexpected finding of the nutritional prevention of cancer (npc) trial : participants of the trial, who received a daily dose of 200 g selenium over 12 years, were more likely to develop type 2 diabetes mellitus than those assigned to placebo. moreover, the diabetes risk of the participants increased with higher baseline plasma selenium levels. since then several epidemiological studies have reported that high plasma selenium levels were associated with increased prevalence of type 2 diabetes as well as hyperglycemia and enhanced plasma levels of total and low - density lipoprotein (ldl) cholesterol and triacylglycerols in the selenium - replete us - american population. on the other hand, the outcome of similar recent studies in europe was rather ambiguous, ranging from adverse to slightly beneficial effects of selenium on carbohydrate and/or lipid metabolism. these divergent results might be explained by a generally lower selenium intake in most european countries in comparison to the usa, but differences in lifestyle and genotype between us - american and european populations as well as varied dietary selenium sources may also contribute. given the rising numbers of patients suffering from morbid obesity and diabetes as well as increasing world - wide trends in dietary selenium supplementation, the molecular mechanisms underlying a potential adverse effect of selenium compounds on carbohydrate and/or lipid metabolism need to be addressed. an important unresolved issue, which can not be answered by epidemiological studies, is the cause - and - effect - relationship of those associations : does selenium oversupply contribute to development of type 2 diabetes by disturbing insulin signalling and/or secretion, or conversely, may a dysregulated carbohydrate metabolism influence selenium homeostasis ? experimental evidence on these issues is available, and to make the picture more complex and somewhat paradoxical, selenium may act as an insulin - mimetic under certain circumstances. diabetes mellitus is affecting over 170 million people world - wide with more than 90% of the patients suffering from type 2 diabetes. the onset of type 2 diabetes is hallmarked by resistance of liver, skeletal muscle and fat tissue to insulin, thereby causing dyslipidemia, hyperglycemia and a reactive increase in insulin secretion by pancreatic beta cells for compensation of the poor insulin response of major target tissues. binding of insulin to its receptor initiates the intracellular insulin signalling cascade, whose components have been reviewed comprehensively elsewhere. among them, the insulin receptor substrate (irs)-2, the protein tyrosine phosphatase (ptp)-1b and the protein kinase b (serine / threonine kinase akt) as well as the forkhead box class (fox) o1a transcription factor and its coactivator peroxisomal proliferator - activated receptor gamma coactivator (pgc)-1 have received particular attention in diabetes research. at present, it is evident from in vitro and in vivo studies that dysregulated expression, localisation and/or activity of one or more of those proteins may result in insulin resistance. besides selenium, a number of metal ions (e.g., vanadium, copper, zinc and cadmium) are capable of eliciting insulin - mimetic effects by activation of akt and other kinases of the insulin signaling cascade such as p70 s6 kinase. the insulin - like phosphorylation of akt upon exposure of cells to micromolar (10 m, 100 m) doses of heavy metal ions at oxidation number + ii (cu, zn, cd) is interpreted primarily as a stress response, because signaling through phosphoinositide-3-kinase (pi3k) and akt also promotes anti - apoptotic and cytoprotective pathways. with regard to regulation of carbohydrate metabolism, insulin - mimetic properties of selenium compounds at oxidation numbers + iv (sodium selenite) and + vi (sodium selenate) have been reported in close resemblance to such effects of vanadium at oxidation number + iv (vanadyl sulphate). early studies have been performed in isolated rat adipocytes, and found that sodium selenate stimulated glucose uptake through translocation of glucose transporters to the plasma membrane and activated serine / threonine kinases including the p70 s6 kinase. as these insulin - like actions were observed only at the very high dose of 1 mm sodium selenate, an anti - diabetic application in humans appears to be difficult or impossible. the results of animal studies are somewhat conflicting : a cautious view is corroborated by a study in genetically obese zucker rats, whose glucose tolerance was transiently improved during acute selenate exposure, rapidly followed by progressive development of hyperglycemia indicating toxicity of high selenate doses. on the other hand, whole - body insulin sensitivity was improved in type 2 diabetic db / db mice by dietary supplementation with supranutritional sodium selenate doses. streptozotocin causes necrosis of pancreatic beta cells through dna alkylation and, to a minor extent, generation of nitric oxide and reactive oxygen species (ros), resulting in insulin deficiency and hyperglycemia. the anti - diabetic effects of selenate in streptozotocin - treated rats were attributed to partial reversal of abnormal expression and activity of glycolytic and gluconeogenic liver enzymes, whereas plasma insulin levels did not increase upon selenate administration. similar to heavy metal ions, sodium selenite at low micromolar doses induced a cytoprotective response in vitro, thereby counteracting apoptotic cell death following serum withdrawal or exposure to hydrogen peroxide (h2o2) ; survival of both huh7 hepatoma cells and ht1080 fibrosarcoma cells was mediated through selenite - induced akt activation. an insulin - like action of selenite on carbohydrate metabolism was observed in the isolated perfused rat liver, where glucagon - stimulated glycogen breakdown was inhibited by infusion of 10 m sodium selenite. consistent with the narrow therapeutic range of selenium, higher doses of selenite (500 m) severely impaired the metabolic function of the liver, causing degeneration and necrosis of periportal hepatocytes. in vivo, oral selenite administration failed to improve insulin sensitivity in type 2 diabetic db / db mice, presumably due to formation of different intermediary selenium metabolites in peripheral organs compared to sodium selenate. an anti - diabetic impact of dietary selenium supplementation would be expected, given both the long track record of selenium as insulin - mimetic micronutrient and its antioxidant capacity as constituent of ros - detoxifying selenoenzymes, suggesting a protective role against oxidative stress - related chronic complications in the progression of diabetes. contrarily to those expectations, recent epidemiological and intervention studies revealed a surprising association between high plasma selenium levels and type 2 diabetes, hyperglycemia and dyslipidemia. the clue to answer the pivotal question of whether and how selenium exerts adverse effects on insulin - regulated metabolic pathways in humans may lie in the apparent redox paradox of insulin signalling, a concept that refers to facilitated insulin action by insulin - stimulated reactive oxygen species. upon binding to its receptor at the plasma membrane of adipocytes insulin activates the nad(p)h oxidase (nox) 4 to generate superoxide, which is subsequently converted to h2o2. these insulin - stimulated small amounts of h2o2 serve as second messengers, which attenuate the activity of phosphatases with redox - sensitive cysteine residues and thereby enhance the phosphorylation of components downstream in the insulin signalling cascade. thus, high supranutritional doses of antioxidants may have the capability to impair insulin sensitivity, as it has recently been shown in humans administered a combination of vitamin c (1,000 mg / day) and vitamin e (400 iu / day). inorganic and organic selenium compounds have been reported to induce expression and activity of several antioxidant selenoproteins ; the most pronounced stimulation was obtained for the selenoenzyme cytosolic gpx1, which degrades h2o2 and other hydroperoxides. a high gpx1 activity has been hypothesized to interfere with insulin signaling. indeed, pregnancy - associated mild insulin resistance was shown to be accompanied by increased erythrocyte gpx activity in humans, and transgenic mice overexpressing gpx1 developed at older age a type 2 diabetes - like phenotype characterised by insulin resistance, hyperglycemia, hyperinsulinemia and obesity. gpx1 overexpression affected both pancreatic insulin production and insulin sensitivity of target cells ; insulin resistance of liver and/or skeletal muscle was obvious from impaired insulin receptor and akt phosphorylation. intriguingly, obesity together with insulin resistance and hyperglycemia could be prevented in the gpx1-overexpressing mice by dietary restriction, whereas the chronic hyperinsulinemia persisted, even at dietary selenium deficiency. the authors conclude that dysregulation of pancreatic insulin biosynthesis and secretion is the primary outcome of transgenic gpx1 overproduction in their experimental model. insulin - producing pancreatic beta cells are among the worst - endowed cells in terms of intrinsic enzymatic antioxidants : expression and activity of the h2o2-degrading enzymes catalase and gpx1 in beta cells reach only 1% of the values in hepatocytes. for this reason, beta cells are very susceptible to damage caused by hyperglycemia or proinflammatory cytokines, and overexpression of antioxidant enzymes including gpx1 has been applied to protect insulinoma cell lines and pancreatic islets from oxidative injury. on the other hand, development of hyperinsulinemia in gpx1 overexpressing mice points to detrimental effects of high gpx1 activity on beta cell function in vivo, impairing the tight control of insulin release. an adverse effect of high gpx1 activity on components of the insulin signalling cascade has been further substantiated by an in vitro study in mcf-7 human breast cancer cells, where gpx1 overexpression was associated with decreased phosphorylation of p70 s6 kinase and akt. an alternative approach to increase gpx1 in a more physiological manner was done by dietary supplementation of rats with sodium selenate : the higher gpx1 activity in livers of selenium - supplemented rats was associated with increased activity of protein tyrosine phosphatase 1b (ptp-1b), which antagonizes insulin - induced signaling by dephosphorylation of the insulin receptor (ir) and the irs-1. conversely and in good agreement with the experimental models of gpx1 overexpression, knock - out of gpx1 in mice resulted in improved insulin sensitivity due to increased ros generation, causing oxidation (inactivation) of the dual specificity protein phosphatase pten. pten dephosphorylates the product of pi3k, phosphatidylinositol-3,4,5-triphosphate (pip3), thus counteracting insulin - induced pi3k / akt signalling. in line with elevated pi3k / akt signaling, insulin - induced glucose uptake was increased in skeletal muscles of gpx mice, and most compelling, knock - out of gpx1 protected the rodents from insulin resistance provoked by high - fat diet. these results are supported by observations of increased site - specific phosphorylation of both akt and p70 s6 kinase in transgenic mice with an overall decreased biosynthesis of selenoproteins, caused by a mutant form of selenocysteine transfer rna (trna). despite the compelling evidence from transgenic animal models of gpx1 overexpression and knock - down, results from intervention studies with selenium supplements in several human populations argue against the idea that glutathione peroxidases are the only mediators of adverse effects of high dietary selenium intake under physiological conditions : plasma gpx activity in humans has been found to be saturated at selenium dietary supplement doses and total plasma selenium levels well below the values associated with increased risk for type 2 diabetes. human plasma contains selenium in form of the selenoenzyme gpx3, a low - molecular - weight selenium pool and most notably the selenium transporter selenoprotein p (sep), which accounts for 5060% of circulating selenium. compared to gpx activity, both sep and the remaining non - selenoprotein plasma selenium pool require a higher dietary selenium intake for their optimization and saturation. it is tempting to speculate that sep and/or low - molecular - weight selenium compounds may affect insulin - induced signalling pathways related to carbohydrate and lipid metabolism. 1 schematically summarizes current experimental evidence and hypotheses concerning an influence of selenium on the insulin signalling cascade. the epidemiological association between high plasma selenium levels and hyperglycemia might also be explained by a disturbance of selenium homeostasis as side - effect of a dysregulated carbohydrate metabolism. the major fraction of total selenium in human plasma is present as sep, which is mainly secreted by the liver and supplies peripheral tissues with selenium. sep represents a suitable biomarker for selenium status, because its plasma concentration increases in response to different dietary forms and to a wide range of doses in selenium supplementation studies. this obvious importance of sep for selenium homeostasis prompted us to investigate the regulation of hepatic sep production by factors related to carbohydrate metabolism. in the human sep promoter, we identified a motif consisting of a binding site for the foxo1a transcription factor, located in close proximity to a binding site for hepatocyte nuclear factor 4 (hnf-4). this motif is conserved in the sep promoters of humans, rats and mice, and it mediates high - level expression of sep in the liver as well as the hormonal regulation of hepatic sep transcription. both transcription factors are co - activated by the pgc-1, which acts as molecular switch in response to hormones such as insulin, glucagon and glucocorticoids, well - known for their control of hepatic glucose production and blood glucose levels. insulin inhibited sep transcription via the pi3k / akt / foxo1a axis, whereas the pgc-1-inducing glucocorticoid dexamethasone strongly enhanced sep mrna levels and protein secretion in cultured rat hepatocytes. oral administration of dexamethasone has been reported to give rise to a redistribution of selenium in mice, causing a decrease of liver gpx in favor of elevated plasma selenium levels ; these earlier results can be explained by enhanced hepatic secretion of sep induced by dexamethasone treatment. the complex between foxo1a and its coactivator pgc-1 is of crucial importance for transcriptional regulation of the gluconeogenic enzymes glucose-6-phosphatase (g6pase) and phosphoenolpyruvate carboxykinase (pep - ck). our observation that the selenium transporter sep is regulated virtually like a gluconeogenic enzyme provides a rationale for the hypothesized link between selenium and carbohydrate metabolism. moreover, pgc-1 is elevated in livers of animal diabetes models, and has been demonstrated to promote insulin resistance. a vicious circle is observed when diabetes is not treated accurately : high glucose up - regulates expression of pgc-1 and gluconeogenic enzymes in the liver, resulting in overproduction of hepatic glucose and increased hyperglycemia. we cultivated rat hepatocytes in the presence of high glucose (25 mm), and found an increase in sep production paralleled by elevated pgc-1 mrna levels. thus, elevated hepatic pgc-1 may trigger not only hyperglycemia, but also a disturbance in selenium homeostasis. the anti - hyperglycemic drug metformin is widely described for treatment of type 2 diabetes, because it suppresses hepatic glucose production and improves peripheral insulin sensitivity. in parallel with gluconeogenesis, metformin attenuated hepatic biosynthesis and secretion of sep in vitro, which might decrease selenium bioavailability in extrahepatic tissues and thereby impair expression and activity of selenoenzymes in vivo : a two - week metformin treatment resulted in decreased gpx activity in erythrocytes of obese patients with type 2 diabetes. | the essential trace element selenium has long been considered to exhibit anti - diabetic and insulin - mimetic properties, but recent epidemiological studies indicated supranutritional selenium intake and high plasma selenium levels as possible risk factors for development of type 2 diabetes, pointing to adverse effects of selenium on carbohydrate metabolism in humans. however, increased plasma selenium levels might be both a consequence and a cause of diabetes. we summarize current evidence for an interference of selenium compounds with insulin - regulated molecular pathways, most notably the phosphoinositide-3-kinase / protein kinase b signaling cascade, which may underlie some of the pro- and anti - diabetic actions of selenium. furthermore, we discuss reports of hyperinsulinemia, hyperglycemia and insulin resistance in mice overexpressing the selenoenzyme glutathione peroxidase 1. the peroxisomal proliferator - activated receptor gamma coactivator 1 represents a key regulator for biosynthesis of the physiological selenium transporter, selenoprotein p, as well as for hepatic gluconeogenesis. as proliferator - activated receptor gamma coactivator 1 has been shown to be up - regulated in livers of diabetic animals and to promote insulin resistance, we hypothesize that dysregulated pathways in carbohydrate metabolism and a disturbance of selenium homeostasis are linked via proliferator - activated receptor gamma coactivator 1. |
l4777, specification:5000 u g) was purchased from sigma aldrich ; lipase ak (pseudomonas fruorescens) was from amano pharmaceuticals. lipase psim (burkholderia cepacia immobilized on diatomaceous earth) was from amano enzyme europe ltd. reactions in the continuousflow system were carried out in the hcube from thalesnano inc (budapest, hungary). the stainlesssteel cartridges used (70 mm in length, 4 mm in internal diameter and 0.75 ml in volume), were also from thalesnano inc. with calb (230 mg) as enzyme charge and a flow rate of 0.1 ml min (toluene), the experimentally determined (staining procedure) residence time within the packed bed of the reactor was 7 min and 40 s. the hcube was used in no h2 mode. the h nmr and c nmr spectra were recorded with a bruker avance drx 400 instrument (billerica, ma, usa). elemental analyses were performed with a perkinelmer chns2400 ser ii elemental analyzer (waltham, ma, usa). microwave (mw) reactions were performed in a cem discover mw reactor (matthews, nc, usa). the ee values of the nbocprotected amino alcohols [(r)7(r)9) and (s)7(s)9 ] and amino esters [(s)10(s)12) ] were determined directly, while those of the deprotected enantiomers [(r)4(r)6 and (s)4(s)6 ] were determined after derivatization with boc2o by using highperformance liquid chromatography (hplc) with a chiralpak odh column (4.6 mm250 mm), eluent : nhexane : isopropyl alcohol (93:7), flow rate : 0.5 ml min, detection at 260 nm, at rt. retention times (min) : for (r)7 : 27.7, (s)7 : 16.6, (r)8 : 38.6, (s)8 : 21.9, (r)9 : 28.8, (s)9 : 15.6, (s)10 : 13.8, (r)10 : 18.8, (s)11 : 17.0, (r)11 : 25.3, (s)12 : 12.6, and (r)12 : 19.9. the ee value of nacetyl amino alcohol (r)13 was determined with a chiralpak ia column (4.6 mm250 mm), eluent : nhexane : isopropyl alcohol (95:5), flow rate : 0.5 ml min, detection at 210 nm, at rt. retention times (min) : for (r)13 : 92.8 and (s)13 : 88.2. smallscale experiments in the continuousflow system : the racemic substrate [()7, 0.0125 mmol ] and the acyl donor (1.1 equiv) were dissolved in the solvent (1 ml), and the mixtures were pumped with an hplc pump through the heated (45 c, 60 c, 70 c, and 80 c) and compressed (1 bar, 20 bar, 40 bar, 60 bar, 80 bar, and 100 bar) cartridge filled with enzyme (flow rate : 0.1 ml min). smallscale experiments in batch mode : the racemic compound [()7, ()8, or ()9, 0.0125 mmol ] was dissolved in the solvent (1 ml), and the enzyme (30 mg ml) and acyl donor (2, 6, or 8 equiv of acetic anhydride) were then added. tryptamine hydrochloride (1, 5.9 g, 0.03 mol) was dissolved in a mixture of water and 2 n hcl (15 ml). the solution was cooled to 0 c, and a solution of glycolaldehyde dimer (2.3 g, 0.02 mol, dissolved in 5 ml water) was added. the reaction mixture was stirred at 90 c for 4 h. the cooled solution was treated with activated carbon, and then extracted with diethyl ether. to the aqueous layer, 20 % naoh was added until ph 10, and the mixture was then extracted with etoac (330 ml). the product ()4 was purified by column chromatography (5.2 g, yield : 87 %, m.p.=146147 c, lightyellow crystals, r f=0.27, eluent : meoh). alcohol ()4 (3.0 g, 0.015 mol) was dissolved in 80 ml 1,4dioxane and cooled to 0 c, and a solution of naoh (0.62 g, 0.016 mol, in 5 ml water) and then a solution of ditertbutyl dicarbonate (3.56 g, 0.016 mol, in 10 ml 1,4dioxane) were added. the reaction was carried out at 1 h under icecooling, and then at room temperature for 24 h. the reaction mixture was extracted with dichloromethane (330 ml) and the extract was dried on anhydrous na2so4 and evaporated. the resulting nbocprotected amino alcohol ()7 (3.6 g, yield : 81 %, m.p.=115117 c, lightyellow crystals from with diethyl ether.) was purified by column chromatography [r f=0.23, eluent : nhexane : etoac (2:1) ]. h nmr (400 mhz, cdcl3) for ()4 : =8.128.26 (br s, 1 h, nh), 7.497.56 (d, j=7.69 hz, 1 h, ar h), 7.327.39 (d, j=8.14 hz, 1 h, ar h), 7.107.23 (m, 2 h, ar h), 4.184.26 (t, j=2.30 hz, 1 h, ch), 3.773.96 (m, 2 h, ch2), 3.113.36 (m, 2 h, ch2), 2.712.87 ppm (m, 2 h, ch2) ; c nmr (400 mhz, [d4]meoh) for ()4 : =135.35, 131.43, 125.98, 119.67, 117.22, 116.13, 109.46, 107.18, 62.11, 53.19, 40.17, 20.35 ppm ; anal. calcd. for c12h14n2o : c 71.26, h 6.98, n 13.85, found : c 71.21, h 6.93, n 13.79. h nmr (400 mhz, dmso) for ()7 : =10.6610.87 (br s, 1 h, nh), 7.357.43 (d, j=7.6 hz, 1 h, ar h), 7.287.35 (d, j=8.0 hz, 1 h, ar h), 7.017.09 (t, h), 6.916.99 (t, j=7.2 hz, 1 h, ar h),), 4.885.24 (m, 2 h, ch2), 4.104.43 (m, 1 h, ch), 3.693.84 (m, 2 h, ch2), 2.572.74 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr (400 mhz, cdcl3) for ()7 : =136.68, 132.30, 127.01, 122.24, 119.76, 118.50, 111.56, 81.10, 64.62, 53.32, 28.94, 21.91 ppm ; anal. calcd. for c17h22n2o3 : c 67.53, h 7.33, n 9.26, found : c 67.43, h 7.39, n 9.22. with the procedure described above [5methoxytryptamine hydrochloride (2, 1.0 g, 4.4 mmol), water (40 ml), 2 n hcl (2.8 ml), glycolaldehyde dimer (0.52 g, 4.3 mmol) ], the reaction resulted in ()5 [0.52 g, yield : 51 %, m.p.=152153 c, r f=0.25, eluent : meoh ] as yellow crystals. to a solution of ()5 (0.52 g, 2.26 mmol) in 1,4dioxane (35 ml), naoh (0.09 g, 2.25 mmol) in water (5 ml) and ditertbutyl dicarbonate (0.54 g, 2.47 mmol) in 1,4dioxane (5 ml) ()8 [0.65 g, yield : 87 %, m.p.=155156 c from nhexane, r f=0.34, eluent : nhexane : etoac (2:1) ] was obtained as lightyellow crystals. h nmr (400 mhz, cdcl3) for ()5 : =8.088.24 (br s, 1 h, nh), 7.227.24 (d, 1 h, j=8.80 hz, ar h), 6.786.88 (d, j=8 hz, 1 h, ar h), 4.134.26 (m, 1 h, ch), 3.753.97 (m, 2 h, ch2 overlapping with s, 3 h, ch3), 3.043.37 (m, 2 h, ch2), 2.632.88 ppm (m, 2 h, ch2) ; c nmr (400 mhz, [d4]meoh) for ()5 : =152.55, 132.38, 130.56, 126.30, 110.07, 109.48, 107.05, 98.70, 62.12, 53.90, 53.27, 40.23, 20.42 ppm ; anal. c 67.22, h 6.94, n 12.06, found : c 67.20, h 6.88, n 12.14. h nmr (400 mhz, dmso) for ()8 : =10.4910.72 (br s, 1 h, nh), 7.167.31 (d, 1 h, j=8.48 hz, ar h), 6.88 (s, 1 h, arh), 6.616.77 (dd, h), 4.905.23 (m, 2 h, ch2), 4.084.43 (m, 1 h, ch), 3.703.85 (m, 2 h, ch2 overlapping with s, 3 h, ch3), 2.512.61 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr (400 mhz, cdcl3) for ()8 : =154.45, 133.12, 131.80, 127.37, 112.18, 100.91, 81.05, 64.68, 56.42, 53.32, 28.90, 21.92 ppm ; anal. : c 65.04, h 7.28, n 8.43, found : c 65.07, h 7.19, n 8.49. with the procedure described above [5fluorotryptamine hydrochloride (3, 1.0 g, 4.6 mmol), water (40 ml), 2 n hcl (2.5 ml), glycolaldehyde dimer (0.55 g, 4.6 mmol) ], the reaction resulted in ()6 [0.93 g, yield : 91 %, m.p.=138141 c, r f=0.15, eluent : toluene : meoh (1:1) ] as yellow crystals. to a solution of ()6 (0.83 g, 3.77 mmol) in 1,4dioxane (30 ml), naoh (0.15 g, 3.75 mmol) in water (5 ml) and ditertbutyl dicarbonate (0.91 g, 4.17 mmol) in 1,4dioxane (5 ml) the product ()9 [0.88 g, yield : 73 %, m.p.=124125 c from nhexane, r f=0.26, eluent : nhexane : etoac (2:1) ] was obtained as lightyellow crystals. h nmr (400 mhz, [d4]meoh) for ()6 : =7.167.28 (q, j=4.44 hz, 1 h, ar h), 7.007.08 (dd, j=2.48 hz, 9.68 hz, 1 h, ar h), 6.726.85 (dt, h), 4.034.15 (m, 1 h, ch), 3.783.92 (m, 1 h, ch2), 3.563.66 (m, 1 h, ch2), 3.253.32 (m, 1 h, ch2), 2.933.03 (m, 1 h, ch2), 2.622.78 ppm (m, 2 h, ch2) ; c nmr : (400 mhz, [d4]meoh) for ()6 : =157.62, 155.31, 133.72, 131.84, 126.26, 110.07, 107.34, 100.86, 62.02, 47.39, 40.16, 20.28 ppm ; anal. calcd. for c12h13fn2o : c 65.44, h 5.95, n 12.72, found : c 65.27, h 5.99, n 12.85. h nmr (400 mhz, dmso) for ()9 : =10.7810.92 (br s, 1 h, nh), 7.257.34 (q, h), 4.955.19 (m, 2 h, ch2), 4.114.39 (m, 1 h, ch), 3.693.81 (m, 2 h, ch2), 2.562.69 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for ()9 : =159.37, 157.04, 134.25, 133.13, 127.32, 112.03 110.33, 103.54, 81.22, 64.49, 53.24, 40.36, 28.89, 21.85 ppm ; anal. c 63.74, h 6.61, n 8.74, found : c 63.70, h 6.71, n 8.68. to ()7 (0.5 g, 1.66 mmol) in toluene (30 ml), lipase calb (900 mg) and acetic anhydride (2 equiv, 310 l) were added, and the reaction mixture was shaken in an incubator shaker at 60 c for 1.5 h. the reaction was stopped at 50 % conversion (ee=98 %) by filtering off the enzyme, and the solvent was then evaporated off. the products were separated by column chromatography on silica [eluent : nhexane : etoac (2:1) ], resulting in the unreacted amino alcohol (r)7 as lightyellow crystals [235 mg, yield : 47 %, []d = + 107.5 (c=0.34 in etoh), m.p.=136137 c, r f=0.24 ] and the product amino ester (s)10 as white crystals [263 mg, yield : 46 %, []d = 102.2 (c=0.32 in etoh), m.p.=124125 c, r f=0.76 ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)7 were similar to those for ()7. h nmr (400 mhz, cdcl3) for (s)10 : =7.988.15 (br s, 1 h, nh), 7.527.54 (d, 1 h, j=8.0 hz, ar h), 7.377.39 (d, 1 h, j=7.6 hz, ar h), 7.27.26 (t, h), 5.315.69 (m, 1 h, ch), 4.294.47 (m, 1 h, ch2 overlapping with m, 2 h, ch2), 3.473.56 (m, 1 h, ch2), 2.712.96 (m, 2 h, ch2), 2.15 (s, 3 h, ch3), 1.46 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)10 : =171.30, 136.70, 130.76, 127.06, 122.57, 120.00, 118.66, 111.47, 80.81, 65.16, 50.09, 39.90 28.87, 21.90, 21.37 ppm ; anal. c 66.26, h 7.02, n 8.13, found : c 66.29, h 7.12, n 8.04. with the procedure described above, the reaction of ()8 (200 mg, 0.6 mmol), in toluene (25 ml), calb (750 mg) and acetic anhydride (8 equiv, 466 l) after 2.5 h resulted in (r)8 as white crystals [93 mg, yield : 47 %, []d = + 82 (c=0.23 in etoh), m.p.=196198 c, ee=98 %, r f=0.20, eluent : nhexane : etoac (2:1) ] and (s)11 as a yellow oil [98 mg, yield : 43 %, []d = 92.3 (c=0.61 in etoh), ee=98 %, r f=0.63, eluent : nhexane : etoac (2:1) ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)8 were similar to those for ()8. h nmr (400 mhz, dmso) for (s)11 : =10.7210.88 (d, 1h j=14.04 hz, nh), 7.187.25 (d, 1 h, j=8.4 hz, ar h), 6.896.94 (d, 1 h, j=2.12 hz, ar h), 6.696.75 (dd, 1 h, j=2.34 hz, 8.84 hz, ar h), 5.285.47 (m, 1 h, ch), 4.104.50 (m, 2 h, ch2 overlapping with m, 2 h, ch2), 3.75 (s, 3 h, ch3), 2.552.73 (m, 2 h, ch2), 1.952.10 (m, 3 h, ch3), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)11 : =171.36, 154.56, 131.84, 127.45, 112.19, 100.96, 80.78, 65.07, 56.39, 50.17, 28.87, 21.93, 21.35 ppm ; anal. c 64.15, h 7.00, n 7.48, found : c 64.26, h 7.02, n 7.39. similarly, the preparativescale reaction of ()9 (500 mg, 1.56 mmol) in toluene (50 ml), calb (1500 mg) and acetic anhydride (6 equiv, 885 l) resulted after 2 h in (r)9 as lightyellow crystals [234 mg, isolated yield : 47 %, []d = + 97 (c=0.21 in etoh), m.p.=99100 c, ee=96 %, r f=0.12, eluent : nhexane : etoac (3:1) ] and (s)12 as white crystals [255 mg, isolated yield : 45 %, []d = 131.8 (c=0.38 in etoh), m.p.=143145 c, ee=98 %, r f=0.49, eluent : nhexane : etoac (3:1) ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)9 were similar to those for ()9. h nmr (400 mhz, dmso) for (s)12 : =10.9911.21 (d, 1 h, j=16 hz, nh), 7.277.35 (2d, h), 7.157.21 (dd, 1 h, j=2.4 hz, 9.82 hz, ar h), 5.315.53 (d, 1 h, j=27.4 hz, ch), 4.104.59 (m, 2 h, ch2 overlapping with m, 2 h, ch2), 2.552.70 (m, 2 h, ch2), 1.942.12 (m, 3 h, ch3), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)12 : =171.31, 159.46, 157.12, 133.17, 132.64, 127.45, 111.98, 110.79, 103.73, 80.94, 65.07, 50.13, 28.85, 21.82, 21.35 ppm ; anal. c 62.97, h 6.40, n 7.73, found : c 62.89, h 6.44, n 7.78. enantiomeric (s)10 (30 mg, 0.09 mmol), (s)11 (40 mg, 0.11 mmol), or (s)12 (50 mg, 0.14 mmol) was dissolved in meoh (10 ml). k2co3 (50 mg, 0.36 mmol) was added, and the reaction mixture was shaken at 60 c for 10 min. the following products were obtained as white crystals : (s)7 [24 mg, yield : 90 %, []d = 108.8 (c=0.33 in etoh), m.p.=135137 c, ee=98 %, r f=0.48, eluent : nhexane : etoac (1:1) ], (s)8 [31 mg, yield : 88 %, []d = 81 (c=0.12 in etoh), m.p.=195197 c, ee=98 %, r f=0.47, eluent : nhexane : etoac (1:1) ], or (s)9 [33 mg, yield : 75 %, []d = 105 (c=0.195 in etoh), m.p.=98100 c, ee=98 %, r f=0.20, eluent : nhexane : etoac (3:1) ]. (r)7 (50 mg, 0.16 mmol), (r)8 (30 mg, 0.09 mmol), (r)9 (30 mg, 0.09 mmol), (s)10 (50 mg, 0.15 mmol), (s)11 (40 mg, 0.1 mmol), or (s)12 (30 mg, 0.08 mmol) was suspended in water (5 ml) in a tube, and stirred at 100 c for 1 h under maximum mw irradiation of 150 w. the solvent was evaporated off, and the residue was purified by column chromatography with toluene : meoh (1:1) as eluent. the following products were crystallized from nhexane : (r)4 as yellow crystals [26 mg, yield : 79 %, []d = 37.8 (c=0.41 in etoh), m.p.=145147 c, ee=98 %, r f=0.15 ], (s)4 as yellow crystals [15 mg, yield : 52 %, []d = + 36.1 (c=0.4 in etoh), m.p.=146147 c, ee=98 %, r f=0.16 ], (r)5 as lightyellow crystals [8 mg, yield : 38 %, []d = 22.0 (c=0.4 in etoh), m.p.=167168 c, ee=98 %, r f=0.18 ], (s)5 as lightyellow crystals [9 mg, yield : 38 %, []d = + 21.8 (c=0.45 in etoh), m.p.=168170 c, ee=98 %, r f=0.21 ], (r)6 as lightyellow crystals [11 mg, yield : 52 %, []d = 29 (c=0.155 in etoh), m.p.=9698 c, ee=96 %, r f=0.14 ], or (s)6 as lightyellow crystals [5 mg, yield : 28 %, []d = + 29 (c=0.25 in etoh), m.p.=99101 c, ee=98 %, r f=0.18 ]. a mixture of ()4 (30 mg, 0.13 mmol), 6 equiv acetic anhydride (75 l, 0.8 mmol) and naoh (100 mg, 2.5 mmol) in ch2cl2 (20 ml) and water (20 ml) was stirred for 48 h at rt. the reaction mixture was then extracted with ch2cl2 (315 ml). the organic phase was dried on anhydrous na2so4 and evaporated. the resulting darkyellow oil was purified by column chromatography with ch2cl2:meoh (30:1) as eluent. the product ()13 (18 mg, yield : 49 %, m.p.=191192 c, r f=0.10) was obtained as white crystals from etoh and diisopropyl ether (1:9). h nmr (400 mhz, cdcl3) for ()13 : =8.588.71 (br s, 1 h, nh), 7.447.49 (d, j=7.72 hz, 1 h, ar h), 7.317.35 (d, j=8.36 hz, 1 h, ar h), 7.137.20 (dt, h), 5.745.82 (t, j=6.56 hz, 1 h, ch), 3.964.11 (m, 2 h, ch2), 3.843.93 (m, 1 h, ch2), 3.433.55 (m, 1 h, ch2), 2.792.96 (m, 2 h, ch2), 2.29 ppm (s, 3 h, ch3). with the above procedure, the reaction of (r)4 (26 mg, 0.11 mmol) resulted in the desired product (r)13 as white crystals [22 mg, yield : 70 %, []d = + 164 (c=0.2 in etoh), m.p.=201203 c, ee=98 % ]. the h nmr (400 mhz, cdcl3) spectroscopic data for (r)13 were similar to those for ()13. l4777, specification:5000 u g) was purchased from sigma aldrich ; lipase ak (pseudomonas fruorescens) was from amano pharmaceuticals. lipase psim (burkholderia cepacia immobilized on diatomaceous earth) was from amano enzyme europe ltd. reactions in the continuousflow system were carried out in the hcube from thalesnano inc (budapest, hungary). the stainlesssteel cartridges used (70 mm in length, 4 mm in internal diameter and 0.75 ml in volume), were also from thalesnano inc. with calb (230 mg) as enzyme charge and a flow rate of 0.1 ml min (toluene), the experimentally determined (staining procedure) residence time within the packed bed of the reactor was 7 min and 40 s. the hcube was used in no h2 mode. the h nmr and c nmr spectra were recorded with a bruker avance drx 400 instrument (billerica, ma, usa). elemental analyses were performed with a perkinelmer chns2400 ser ii elemental analyzer (waltham, ma, usa). microwave (mw) reactions were performed in a cem discover mw reactor (matthews, nc, usa). the ee values of the nbocprotected amino alcohols [(r)7(r)9) and (s)7(s)9 ] and amino esters [(s)10(s)12) ] were determined directly, while those of the deprotected enantiomers [(r)4(r)6 and (s)4(s)6 ] were determined after derivatization with boc2o by using highperformance liquid chromatography (hplc) with a chiralpak odh column (4.6 mm250 mm), eluent : nhexane : isopropyl alcohol (93:7), flow rate : 0.5 ml min, detection at 260 nm, at rt. retention times (min) : for (r)7 : 27.7, (s)7 : 16.6, (r)8 : 38.6, (s)8 : 21.9, (r)9 : 28.8, (s)9 : 15.6, (s)10 : 13.8, (r)10 : 18.8, (s)11 : 17.0, (r)11 : 25.3, (s)12 : 12.6, and (r)12 : 19.9. the ee value of nacetyl amino alcohol (r)13 was determined with a chiralpak ia column (4.6 mm250 mm), eluent : nhexane : isopropyl alcohol (95:5), flow rate : 0.5 ml min, detection at 210 nm, at rt. retention times (min) : for (r)13 : 92.8 and (s)13 : 88.2. smallscale experiments in the continuousflow system : the racemic substrate [()7, 0.0125 mmol ] and the acyl donor (1.1 equiv) were dissolved in the solvent (1 ml), and the mixtures were pumped with an hplc pump through the heated (45 c, 60 c, 70 c, and 80 c) and compressed (1 bar, 20 bar, 40 bar, 60 bar, 80 bar, and 100 bar) cartridge filled with enzyme (flow rate : 0.1 ml min). smallscale experiments in batch mode : the racemic compound [()7, ()8, or ()9, 0.0125 mmol ] was dissolved in the solvent (1 ml), and the enzyme (30 mg ml) and acyl donor (2, 6, or 8 equiv of acetic anhydride) were then added. tryptamine hydrochloride (1, 5.9 g, 0.03 mol) was dissolved in a mixture of water and 2 n hcl (15 ml). the solution was cooled to 0 c, and a solution of glycolaldehyde dimer (2.3 g, 0.02 mol, dissolved in 5 ml water) was added. the reaction mixture was stirred at 90 c for 4 h. the cooled solution was treated with activated carbon, and then extracted with diethyl ether. to the aqueous layer, 20 % naoh was added until ph 10, and the mixture was then extracted with etoac (330 ml). the product ()4 was purified by column chromatography (5.2 g, yield : 87 %, m.p.=146147 c, lightyellow crystals, r f=0.27, eluent : meoh). alcohol ()4 (3.0 g, 0.015 mol) was dissolved in 80 ml 1,4dioxane and cooled to 0 c, and a solution of naoh (0.62 g, 0.016 mol, in 5 ml water) and then a solution of ditertbutyl dicarbonate (3.56 g, 0.016 mol, in 10 ml 1,4dioxane) were added. the reaction was carried out at 1 h under icecooling, and then at room temperature for 24 h. the reaction mixture was extracted with dichloromethane (330 ml) and the extract was dried on anhydrous na2so4 and evaporated. the resulting nbocprotected amino alcohol ()7 (3.6 g, yield : 81 %, m.p.=115117 c, lightyellow crystals from with diethyl ether.) was purified by column chromatography [r f=0.23, eluent : nhexane : etoac (2:1) ]. h nmr (400 mhz, cdcl3) for ()4 : =8.128.26 (br s, 1 h, nh), 7.497.56 (d, j=7.69 hz, 1 h, ar h), 7.327.39 (d, j=8.14 hz, 1 h, ar h), 4.184.26 (t, j=2.30 hz, 1 h, ch), 3.773.96 (m, 2 h, ch2), 3.113.36 (m, 2 h, ch2), 2.712.87 ppm (m, 2 h, ch2) ; c nmr (400 mhz, [d4]meoh) for ()4 : =135.35, 131.43, 125.98, 119.67, 117.22, 116.13, 109.46, 107.18, 62.11, 53.19, 40.17, 20.35 ppm ; anal. c 71.26, h 6.98, n 13.85, found : c 71.21, h 6.93, n 13.79. h nmr (400 mhz, dmso) for ()7 : =10.6610.87 (br s, 1 h, nh), 7.357.43 (d, j=7.6 hz, 1 h, ar h), 7.287.35 (d, j=8.0 hz, 1 h, ar h), 7.017.09 (t, h), 6.916.99 (t, j=7.2 hz, 1 h, ar h),), 4.885.24 (m, 2 h, ch2), 4.104.43 (m, 1 h, ch), 3.693.84 (m, 2 h, ch2), 2.572.74 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr (400 mhz, cdcl3) for ()7 : =136.68, 132.30, 127.01, 122.24, 119.76, 118.50, 111.56, 81.10, 64.62, 53.32, 28.94, 21.91 ppm ; anal. : c 67.53, h 7.33, n 9.26, found : c 67.43, h 7.39, n 9.22. with the procedure described above [5methoxytryptamine hydrochloride (2, 1.0 g, 4.4 mmol), water (40 ml), 2 n hcl (2.8 ml), glycolaldehyde dimer (0.52 g, 4.3 mmol) ], the reaction resulted in ()5 [0.52 g, yield : 51 %, m.p.=152153 c, r f=0.25, eluent : meoh ] as yellow crystals. to a solution of ()5 (0.52 g, 2.26 mmol) in 1,4dioxane (35 ml), naoh (0.09 g, 2.25 mmol) in water (5 ml) and ditertbutyl dicarbonate (0.54 g, 2.47 mmol) in 1,4dioxane (5 ml) were added. ()8 [0.65 g, yield : 87 %, m.p.=155156 c from nhexane, r f=0.34, eluent : nhexane : etoac (2:1) ] was obtained as lightyellow crystals. h nmr (400 mhz, cdcl3) for ()5 : =8.088.24 (br s, 1 h, nh), 7.227.24 (d, 1 h, j=8.80 hz, ar h), 6.786.88 (d, j=8 hz, 1 h, ar h), 4.134.26 (m, 1 h, ch), 3.753.97 (m, 2 h, ch2 overlapping with s, 3 h, ch3), 3.043.37 (m, 2 h, ch2), 2.632.88 ppm (m, 2 h, ch2) ; c nmr (400 mhz, [d4]meoh) for ()5 : =152.55, 132.38, 130.56, 126.30, 110.07, 109.48, 107.05, 98.70, 62.12, 53.90, 53.27, 40.23, 20.42 ppm ; anal. c 67.22, h 6.94, n 12.06, found : c 67.20, h 6.88, n 12.14. h nmr (400 mhz, dmso) for ()8 : =10.4910.72 (br s, 1 h, nh), 7.167.31 (d, 1 h, j=8.48 hz, ar h), 6.88 (s, 1 h, arh), 6.616.77 (dd, j=2.2 hz, 8.7 hz, 1 h, ar h), 4.905.23 (m, 2 h, ch2), 4.084.43 (m, 1 h, ch), 3.703.85 (m, 2 h, ch2 overlapping with s, 3 h, ch3), 2.512.61 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr (400 mhz, cdcl3) for ()8 : =154.45, 133.12, 131.80, 127.37, 112.18, 100.91, 81.05, 64.68, 56.42, 53.32, 28.90, 21.92 ppm ; anal. calcd. for c18h24n2o4 : c 65.04, h 7.28, n 8.43, found : c 65.07, h 7.19, n 8.49. with the procedure described above [5fluorotryptamine hydrochloride (3, 1.0 g, 4.6 mmol), water (40 ml), 2 n hcl (2.5 ml), glycolaldehyde dimer (0.55 g, 4.6 mmol) ], the reaction resulted in ()6 [0.93 g, yield : 91 %, m.p.=138141 c, r f=0.15, eluent : toluene : meoh (1:1) ] as yellow crystals. to a solution of ()6 (0.83 g, 3.77 mmol) in 1,4dioxane (30 ml), naoh (0.15 g, 3.75 mmol) in water (5 ml) and ditertbutyl dicarbonate (0.91 g, 4.17 mmol) in 1,4dioxane (5 ml) the product ()9 [0.88 g, yield : 73 %, m.p.=124125 c from nhexane, r f=0.26, eluent : nhexane : etoac (2:1) ] was obtained as lightyellow crystals. h nmr (400 mhz, [d4]meoh) for ()6 : =7.167.28 (q, j=4.44 hz, 1 h, ar h), 4.034.15 (m, 1 h, ch), 3.783.92 (m, 1 h, ch2), 3.563.66 (m, 1 h, ch2), 3.253.32 (m, 1 h, ch2), 2.933.03 (m, 1 h, ch2), 2.622.78 ppm (m, 2 h, ch2) ; c nmr : (400 mhz, [d4]meoh) for ()6 : =157.62, 155.31, 133.72, 131.84, 126.26, 110.07, 107.34, 100.86, 62.02, 47.39, 40.16, 20.28 ppm ; anal. c 65.44, h 5.95, n 12.72, found : c 65.27, h 5.99, n 12.85. h nmr (400 mhz, dmso) for ()9 : =10.7810.92 (br s, 1 h, nh), 7.257.34 (q, h), 4.955.19 (m, 2 h, ch2), 4.114.39 (m, 1 h, ch), 3.693.81 (m, 2 h, ch2), 2.562.69 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for ()9 : =159.37, 157.04, 134.25, 133.13, 127.32, 112.03 110.33, 103.54, 81.22, 64.49, 53.24, 40.36, 28.89, 21.85 ppm ; anal. for c17h21fn2o3 : c 63.74, h 6.61, n 8.74, found : c 63.70, h 6.71, n 8.68. tryptamine hydrochloride (1, 5.9 g, 0.03 mol) was dissolved in a mixture of water and 2 n hcl (15 ml). the solution was cooled to 0 c, and a solution of glycolaldehyde dimer (2.3 g, 0.02 mol, dissolved in 5 ml water) was added. the reaction mixture was stirred at 90 c for 4 h. the cooled solution was treated with activated carbon, and then extracted with diethyl ether. to the aqueous layer, 20 % naoh was added until ph 10, and the mixture was then extracted with etoac (330 ml). the product ()4 was purified by column chromatography (5.2 g, yield : 87 %, m.p.=146147 c, lightyellow crystals, r f=0.27, eluent : meoh). alcohol ()4 (3.0 g, 0.015 mol) was dissolved in 80 ml 1,4dioxane and cooled to 0 c, and a solution of naoh (0.62 g, 0.016 mol, in 5 ml water) and then a solution of ditertbutyl dicarbonate (3.56 g, 0.016 mol, in 10 ml 1,4dioxane) were added. the reaction was carried out at 1 h under icecooling, and then at room temperature for 24 h. the reaction mixture was extracted with dichloromethane (330 ml) and the extract was dried on anhydrous na2so4 and evaporated. the resulting nbocprotected amino alcohol ()7 (3.6 g, yield : 81 %, m.p.=115117 c, lightyellow crystals from with diethyl ether.) was purified by column chromatography [r f=0.23, eluent : nhexane : etoac (2:1) ]. h nmr (400 mhz, cdcl3) for ()4 : =8.128.26 (br s, 1 h, nh), 7.497.56 (d, j=7.69 hz, 1 h, ar h), 7.327.39 (d, j=8.14 hz, 1 h, ar h), 4.184.26 (t, j=2.30 hz, 1 h, ch), 3.773.96 (m, 2 h, ch2), 3.113.36 (m, 2 h, ch2), 2.712.87 ppm (m, 2 h, ch2) ; c nmr (400 mhz, [d4]meoh) for ()4 : =135.35, 131.43, 125.98, 119.67, 117.22, 116.13, 109.46, 107.18, 62.11, 53.19, 40.17, 20.35 ppm ; anal. c 71.26, h 6.98, n 13.85, found : c 71.21, h 6.93, n 13.79. h nmr (400 mhz, dmso) for ()7 : =10.6610.87 (br s, 1 h, nh), 7.357.43 (d, j=7.6 hz, 1 h, ar h), 7.287.35 (d, j=8.0 hz, 1 h, ar h), 7.017.09 (t, h), 6.916.99 (t, j=7.2 hz, 1 h, ar h),), 4.885.24 (m, 2 h, ch2), 4.104.43 (m, 1 h, ch), 3.693.84 (m, 2 h, ch2), 2.572.74 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr (400 mhz, cdcl3) for ()7 : =136.68, 132.30, 127.01, 122.24, 119.76, 118.50, 111.56, 81.10, 64.62, 53.32, 28.94, 21.91 ppm ; anal. : c 67.53, h 7.33, n 9.26, found : c 67.43, h 7.39, n 9.22. with the procedure described above [5methoxytryptamine hydrochloride (2, 1.0 g, 4.4 mmol), water (40 ml), 2 n hcl (2.8 ml), glycolaldehyde dimer (0.52 g, 4.3 mmol) ], the reaction resulted in ()5 [0.52 g, yield : 51 %, m.p.=152153 c, r f=0.25, eluent : meoh ] as yellow crystals. to a solution of ()5 (0.52 g, 2.26 mmol) in 1,4dioxane (35 ml), naoh (0.09 g, 2.25 mmol) in water (5 ml) and ditertbutyl dicarbonate (0.54 g, 2.47 mmol) in 1,4dioxane (5 ml) were added. ()8 [0.65 g, yield : 87 %, m.p.=155156 c from nhexane, r f=0.34, eluent : nhexane : etoac (2:1) ] was obtained as lightyellow crystals. h nmr (400 mhz, cdcl3) for ()5 : =8.088.24 (br s, 1 h, nh), 7.227.24 (d, 1 h, j=8.80 hz, ar h), 6.786.88 (d, j=8 hz, 1 h, ar h), 4.134.26 (m, 1 h, ch), 3.753.97 (m, 2 h, ch2 overlapping with s, 3 h, ch3), 3.043.37 (m, 2 h, ch2), 2.632.88 ppm (m, 2 h, ch2) ; c nmr (400 mhz, [d4]meoh) for ()5 : =152.55, 132.38, 130.56, 126.30, 110.07, 109.48, 107.05, 98.70, 62.12, 53.90, 53.27, 40.23, 20.42 ppm ; anal. : c 67.22, h 6.94, n 12.06, found : c 67.20, h 6.88, n 12.14. h nmr (400 mhz, dmso) for ()8 : =10.4910.72 (br s, 1 h, nh), 7.167.31 (d, 1 h, j=8.48 hz, ar h), 6.88 (s, 1 h, arh), 6.616.77 (dd, h), 4.905.23 (m, 2 h, ch2), 4.084.43 (m, 1 h, ch), 3.703.85 (m, 2 h, ch2 overlapping with s, 3 h, ch3), 2.512.61 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr (400 mhz, cdcl3) for ()8 : =154.45, 133.12, 131.80, 127.37, 112.18, 100.91, 81.05, 64.68, 56.42, 53.32, 28.90, 21.92 ppm ; anal. c 65.04, h 7.28, n 8.43, found : c 65.07, h 7.19, n 8.49. with the procedure described above [5fluorotryptamine hydrochloride (3, 1.0 g, 4.6 mmol), water (40 ml), 2 n hcl (2.5 ml), glycolaldehyde dimer (0.55 g, 4.6 mmol) ], the reaction resulted in ()6 [0.93 g, yield : 91 %, m.p.=138141 c, r f=0.15, eluent : toluene : meoh (1:1) ] as yellow crystals. to a solution of ()6 (0.83 g, 3.77 mmol) in 1,4dioxane (30 ml), naoh (0.15 g, 3.75 mmol) in water (5 ml) and ditertbutyl dicarbonate (0.91 g, 4.17 mmol) in 1,4dioxane (5 ml) the product ()9 [0.88 g, yield : 73 %, m.p.=124125 c from nhexane, r f=0.26, eluent : nhexane : etoac (2:1) ] was obtained as lightyellow crystals. h nmr (400 mhz, [d4]meoh) for ()6 : =7.167.28 (q, j=4.44 hz, 1 h, ar h), 4.034.15 (m, 1 h, ch), 3.783.92 (m, 1 h, ch2), 3.563.66 (m, 1 h, ch2), 3.253.32 (m, 1 h, ch2), 2.933.03 (m, 1 h, ch2), 2.622.78 ppm (m, 2 h, ch2) ; c nmr : (400 mhz, [d4]meoh) for ()6 : =157.62, 155.31, 133.72, 131.84, 126.26, 110.07, 107.34, 100.86, 62.02, 47.39, 40.16, 20.28 ppm ; anal. : c 65.44, h 5.95, n 12.72, found : c 65.27, h 5.99, n 12.85. h nmr (400 mhz, dmso) for ()9 : =10.7810.92 (br s, 1 h, nh), 7.257.34 (q, h), 6.836.91 (dt, j=2.8 hz, 9.4 hz, 1 h, ar h), 4.955.19 (m, 2 h, ch2), 4.114.39 (m, 1 h, ch), 3.693.81 (m, 2 h, ch2), 2.562.69 (m, 2 h, ch2), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for ()9 : =159.37, 157.04, 134.25, 133.13, 127.32, 112.03 110.33, 103.54, 81.22, 64.49, 53.24, 40.36, 28.89, 21.85 ppm ; anal. c 63.74, h 6.61, n 8.74, found : c 63.70, h 6.71, n 8.68. to ()7 (0.5 g, 1.66 mmol) in toluene (30 ml), lipase calb (900 mg) and acetic anhydride (2 equiv, 310 l) were added, and the reaction mixture was shaken in an incubator shaker at 60 c for 1.5 h. the reaction was stopped at 50 % conversion (ee=98 %) by filtering off the enzyme, and the solvent was then evaporated off. the products were separated by column chromatography on silica [eluent : nhexane : etoac (2:1) ], resulting in the unreacted amino alcohol (r)7 as lightyellow crystals [235 mg, yield : 47 %, []d = + 107.5 (c=0.34 in etoh), m.p.=136137 c, r f=0.24 ] and the product amino ester (s)10 as white crystals [263 mg, yield : 46 %, []d = 102.2 (c=0.32 in etoh), m.p.=124125 c, r f=0.76 ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)7 were similar to those for ()7. h nmr (400 mhz, cdcl3) for (s)10 : =7.988.15 (br s, 1 h, nh), 7.527.54 (d, 1 h, j=8.0 hz, ar h), 7.377.39 (d, 1 h, j=7.6 hz, ar h), 5.315.69 (m, 1 h, ch), 4.294.47 (m, 1 h, ch2 overlapping with m, 2 h, ch2), 3.473.56 (m, 1 h, ch2), 2.712.96 (m, 2 h, ch2), 2.15 (s, 3 h, ch3), 1.46 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)10 : =171.30, 136.70, 130.76, 127.06, 122.57, 120.00, 118.66, 111.47, 80.81, 65.16, 50.09, 39.90 28.87, 21.90, 21.37 ppm ; anal. c 66.26, h 7.02, n 8.13, found : c 66.29, h 7.12, n 8.04. with the procedure described above, the reaction of ()8 (200 mg, 0.6 mmol), in toluene (25 ml), calb (750 mg) and acetic anhydride (8 equiv, 466 l) after 2.5 h resulted in (r)8 as white crystals [93 mg, yield : 47 %, []d = + 82 (c=0.23 in etoh), m.p.=196198 c, ee=98 %, r f=0.20, eluent : nhexane : etoac (2:1) ] and (s)11 as a yellow oil [98 mg, yield : 43 %, []d = 92.3 (c=0.61 in etoh), ee=98 %, r f=0.63, eluent : nhexane : etoac (2:1) ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)8 were similar to those for ()8. h nmr (400 mhz, dmso) for (s)11 : =10.7210.88 (d, 1h j=14.04 hz, nh), 7.187.25 (d, 1 h, j=8.4 hz, ar h), 6.896.94 (d, 1 h, j=2.12 hz, ar h), 6.696.75 (dd, 1 h, j=2.34 hz, 8.84 hz, ar h), 5.285.47 (m, 1 h, ch), 4.104.50 (m, 2 h, ch2 overlapping with m, 2 h, ch2), 3.75 (s, 3 h, ch3), 2.552.73 (m, 2 h, ch2), 1.952.10 (m, 3 h, ch3), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)11 : =171.36, 154.56, 131.84, 127.45, 112.19, 100.96, 80.78, 65.07, 56.39, 50.17, 28.87, 21.93, 21.35 ppm ; anal. c 64.15, h 7.00, n 7.48, found : c 64.26, h 7.02, n 7.39. similarly, the preparativescale reaction of ()9 (500 mg, 1.56 mmol) in toluene (50 ml), calb (1500 mg) and acetic anhydride (6 equiv, 885 l) resulted after 2 h in (r)9 as lightyellow crystals [234 mg, isolated yield : 47 %, []d = + 97 (c=0.21 in etoh), m.p.=99100 c, ee=96 %, r f=0.12, eluent : nhexane : etoac (3:1) ] and (s)12 as white crystals [255 mg, isolated yield : 45 %, []d = 131.8 (c=0.38 in etoh), m.p.=143145 c, ee=98 %, r f=0.49, eluent : nhexane : etoac (3:1) ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)9 were similar to those for ()9. h nmr (400 mhz, dmso) for (s)12 : =10.9911.21 (d, 1 h, j=16 hz, nh), 7.277.35 (2d, h), 7.157.21 (dd, 1 h, j=2.4 hz, 9.82 hz, ar h), 5.315.53 (d, 1 h, j=27.4 hz, ch), 4.104.59 (m, 2 h, ch2 overlapping with m, 2 h, ch2), 2.552.70 (m, 2 h, ch2), 1.942.12 (m, 3 h, ch3), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)12 : =171.31, 159.46, 157.12, 133.17, 132.64, 127.45, 111.98, 110.79, 103.73, 80.94, 65.07, 50.13, 28.85, 21.82, 21.35 ppm ; anal. : c 62.97, h 6.40, n 7.73, found : c 62.89, h 6.44, n 7.78. enantiomeric (s)10 (30 mg, 0.09 mmol), (s)11 (40 mg, 0.11 mmol), or (s)12 (50 mg, 0.14 mmol) was dissolved in meoh (10 ml). k2co3 (50 mg, 0.36 mmol) was added, and the reaction mixture was shaken at 60 c for 10 min. the following products were obtained as white crystals : (s)7 [24 mg, yield : 90 %, []d = 108.8 (c=0.33 in etoh), m.p.=135137 c, ee=98 %, r f=0.48, eluent : nhexane : etoac (1:1) ], (s)8 [31 mg, yield : 88 %, []d = 81 (c=0.12 in etoh), m.p.=195197 c, ee=98 %, r f=0.47, eluent : nhexane : etoac (1:1) ], or (s)9 [33 mg, yield : 75 %, []d = 105 (c=0.195 in etoh), m.p.=98100 c, ee=98 %, r f=0.20, eluent : nhexane : etoac (3:1) ]. (r)7 (50 mg, 0.16 mmol), (r)8 (30 mg, 0.09 mmol), (r)9 (30 mg, 0.09 mmol), (s)10 (50 mg, 0.15 mmol), (s)11 (40 mg, 0.1 mmol), or (s)12 (30 mg, 0.08 mmol) was suspended in water (5 ml) in a tube, and stirred at 100 c for 1 h under maximum mw irradiation of 150 w. the solvent was evaporated off, and the residue was purified by column chromatography with toluene : meoh (1:1) as eluent. the following products were crystallized from nhexane : (r)4 as yellow crystals [26 mg, yield : 79 %, []d = 37.8 (c=0.41 in etoh), m.p.=145147 c, ee=98 %, r f=0.15 ], (s)4 as yellow crystals [15 mg, yield : 52 %, []d = + 36.1 (c=0.4 in etoh), m.p.=146147 c, ee=98 %, r f=0.16 ], (r)5 as lightyellow crystals [8 mg, yield : 38 %, []d = 22.0 (c=0.4 in etoh), m.p.=167168 c, ee=98 %, r f=0.18 ], (s)5 as lightyellow crystals [9 mg, yield : 38 %, []d = + 21.8 (c=0.45 in etoh), m.p.=168170 c, ee=98 %, r f=0.21 ], (r)6 as lightyellow crystals [11 mg, yield : 52 %, []d = 29 (c=0.155 in etoh), m.p.=9698 c, ee=96 %, r f=0.14 ], or (s)6 as lightyellow crystals [5 mg, yield : 28 %, []d = + 29 (c=0.25 in etoh), m.p.=99101 c, ee=98 %, r f=0.18 ]. a mixture of ()4 (30 mg, 0.13 mmol), 6 equiv acetic anhydride (75 l, 0.8 mmol) and naoh (100 mg, 2.5 mmol) in ch2cl2 (20 ml) and water (20 ml) was stirred for 48 h at rt. the reaction mixture was then extracted with ch2cl2 (315 ml). the resulting darkyellow oil was purified by column chromatography with ch2cl2:meoh (30:1) as eluent. the product ()13 (18 mg, yield : 49 %, m.p.=191192 c, r f=0.10) was obtained as white crystals from etoh and diisopropyl ether (1:9). h nmr (400 mhz, cdcl3) for ()13 : =8.588.71 (br s, 1 h, nh), 7.447.49 (d, j=7.72 hz, 1 h, ar h), 7.317.35 (d, j=8.36 hz, 1 h, ar h), 5.745.82 (t, j=6.56 hz, 1 h, ch), 3.964.11 (m, 2 h, ch2), 3.843.93 (m, 1 h, ch2), 3.433.55 (m, 1 h, ch2), 2.792.96 (m, 2 h, ch2), 2.29 ppm (s, 3 h, ch3). with the above procedure, the reaction of (r)4 (26 mg, 0.11 mmol) resulted in the desired product (r)13 as white crystals [22 mg, yield : 70 %, []d = + 164 (c=0.2 in etoh), m.p.=201203 c, ee=98 % ]. the h nmr (400 mhz, cdcl3) spectroscopic data for (r)13 were similar to those for ()13. to ()7 (0.5 g, 1.66 mmol) in toluene (30 ml), lipase calb (900 mg) and acetic anhydride (2 equiv, 310 l) were added, and the reaction mixture was shaken in an incubator shaker at 60 c for 1.5 h. the reaction was stopped at 50 % conversion (ee=98 %) by filtering off the enzyme, and the solvent was then evaporated off. the products were separated by column chromatography on silica [eluent : nhexane : etoac (2:1) ], resulting in the unreacted amino alcohol (r)7 as lightyellow crystals [235 mg, yield : 47 %, []d = + 107.5 (c=0.34 in etoh), m.p.=136137 c, r f=0.24 ] and the product amino ester (s)10 as white crystals [263 mg, yield : 46 %, []d = 102.2 (c=0.32 in etoh), m.p.=124125 c, r f=0.76 ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)7 were similar to those for ()7. h nmr (400 mhz, cdcl3) for (s)10 : =7.988.15 (br s, 1 h, nh), 7.527.54 (d, 1 h, j=8.0 hz, ar h), 7.377.39 (d, 1 h, j=7.6 hz, ar h), 5.315.69 (m, 1 h, ch), 4.294.47 (m, 1 h, ch2 overlapping with m, 2 h, ch2), 3.473.56 (m, 1 h, ch2), 2.712.96 (m, 2 h, ch2), 2.15 (s, 3 h, ch3), 1.46 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)10 : =171.30, 136.70, 130.76, 127.06, 122.57, 120.00, 118.66, 111.47, 80.81, 65.16, 50.09, 39.90 28.87, 21.90, 21.37 ppm ; anal. c 66.26, h 7.02, n 8.13, found : c 66.29, h 7.12, n 8.04. with the procedure described above, the reaction of ()8 (200 mg, 0.6 mmol), in toluene (25 ml), calb (750 mg) and acetic anhydride (8 equiv, 466 l) after 2.5 h resulted in (r)8 as white crystals [93 mg, yield : 47 %, []d = + 82 (c=0.23 in etoh), m.p.=196198 c, ee=98 %, r f=0.20, eluent : nhexane : etoac (2:1) ] and (s)11 as a yellow oil [98 mg, yield : 43 %, []d = 92.3 (c=0.61 in etoh), ee=98 %, r f=0.63, eluent : nhexane : etoac (2:1) ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)8 were similar to those for ()8. h nmr (400 mhz, dmso) for (s)11 : =10.7210.88 (d, 1h j=14.04 hz, nh), 7.187.25 (d, 1 h, j=8.4 hz, ar h), 6.896.94 (d, 1 h, j=2.12 hz, ar h), 6.696.75 (dd, 1 h, j=2.34 hz, 8.84 hz, ar h), 5.285.47 (m, 1 h, ch), 4.104.50 (m, 2 h, ch2 overlapping with m, 2 h, ch2), 3.75 (s, 3 h, ch3), 2.552.73 (m, 2 h, ch2), 1.952.10 (m, 3 h, ch3), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)11 : =171.36, 154.56, 131.84, 127.45, 112.19, 100.96, 80.78, 65.07, 56.39, 50.17, 28.87, 21.93, 21.35 ppm ; anal. c 64.15, h 7.00, n 7.48, found : c 64.26, h 7.02, n 7.39. similarly, the preparativescale reaction of ()9 (500 mg, 1.56 mmol) in toluene (50 ml), calb (1500 mg) and acetic anhydride (6 equiv, 885 l) resulted after 2 h in (r)9 as lightyellow crystals [234 mg, isolated yield : 47 %, []d = + 97 (c=0.21 in etoh), m.p.=99100 c, ee=96 %, r f=0.12, eluent : nhexane : etoac (3:1) ] and (s)12 as white crystals [255 mg, isolated yield : 45 %, []d = 131.8 (c=0.38 in etoh), m.p.=143145 c, ee=98 %, r f=0.49, eluent : nhexane : etoac (3:1) ]. the h nmr (400 mhz, dmso) spectroscopic data for (r)9 were similar to those for ()9. h nmr (400 mhz, dmso) for (s)12 : =10.9911.21 (d, 1 h, j=16 hz, nh), 7.277.35 (2d, h), 7.157.21 (dd, 1 h, j=2.4 hz, 9.82 hz, ar h), 6.876.96 (dt, h), 5.315.53 (d, 1 h, j=27.4 hz, ch), 4.104.59 (m, 2 h, ch2 overlapping with m, 2 h, ch2), 2.552.70 (m, 2 h, ch2), 1.942.12 (m, 3 h, ch3), 1.44 ppm (s, 9 h, c(ch3)3) ; c nmr : (400 mhz, cdcl3) for (s)12 : =171.31, 159.46, 157.12, 133.17, 132.64, 127.45, 111.98, 110.79, 103.73, 80.94, 65.07, 50.13, 28.85, 21.82, 21.35 ppm ; anal. c 62.97, h 6.40, n 7.73, found : c 62.89, h 6.44, n 7.78. enantiomeric (s)10 (30 mg, 0.09 mmol), (s)11 (40 mg, 0.11 mmol), or (s)12 (50 mg, 0.14 mmol) was dissolved in meoh (10 ml). k2co3 (50 mg, 0.36 mmol) was added, and the reaction mixture was shaken at 60 c for 10 min. the following products were obtained as white crystals : (s)7 [24 mg, yield : 90 %, []d = 108.8 (c=0.33 in etoh), m.p.=135137 c, ee=98 %, r f=0.48, eluent : nhexane : etoac (1:1) ], (s)8 [31 mg, yield : 88 %, []d = 81 (c=0.12 in etoh), m.p.=195197 c, ee=98 %, r f=0.47, eluent : nhexane : etoac (1:1) ], or (s)9 [33 mg, yield : 75 %, []d = 105 (c=0.195 in etoh), m.p.=98100 c, ee=98 %, r f=0.20, eluent : nhexane : etoac (3:1) ]. (r)7 (50 mg, 0.16 mmol), (r)8 (30 mg, 0.09 mmol), (r)9 (30 mg, 0.09 mmol), (s)10 (50 mg, 0.15 mmol), (s)11 (40 mg, 0.1 mmol), or (s)12 (30 mg, 0.08 mmol) was suspended in water (5 ml) in a tube, and stirred at 100 c for 1 h under maximum mw irradiation of 150 w. the solvent was evaporated off, and the residue was purified by column chromatography with toluene : meoh (1:1) as eluent. the following products were crystallized from nhexane : (r)4 as yellow crystals [26 mg, yield : 79 %, []d = 37.8 (c=0.41 in etoh), m.p.=145147 c, ee=98 %, r f=0.15 ], (s)4 as yellow crystals [15 mg, yield : 52 %, []d = + 36.1 (c=0.4 in etoh), m.p.=146147 c, ee=98 %, r f=0.16 ], (r)5 as lightyellow crystals [8 mg, yield : 38 %, []d = 22.0 (c=0.4 in etoh), m.p.=167168 c, ee=98 %, r f=0.18 ], (s)5 as lightyellow crystals [9 mg, yield : 38 %, []d = + 21.8 (c=0.45 in etoh), m.p.=168170 c, ee=98 %, r f=0.21 ], (r)6 as lightyellow crystals [11 mg, yield : 52 %, []d = 29 (c=0.155 in etoh), m.p.=9698 c, ee=96 %, r f=0.14 ], or (s)6 as lightyellow crystals [5 mg, yield : 28 %, []d = + 29 (c=0.25 in etoh), m.p.=99101 c, ee=98 %, r f=0.18 ]. a mixture of ()4 (30 mg, 0.13 mmol), 6 equiv acetic anhydride (75 l, 0.8 mmol) and naoh (100 mg, 2.5 mmol) in ch2cl2 (20 ml) and water (20 ml) was stirred for 48 h at rt. the reaction mixture was then extracted with ch2cl2 (315 ml). the organic phase was dried on anhydrous na2so4 and evaporated. the resulting darkyellow oil was purified by column chromatography with ch2cl2:meoh (30:1) as eluent. the product ()13 (18 mg, yield : 49 %, m.p.=191192 c, r f=0.10) was obtained as white crystals from etoh and diisopropyl ether (1:9). h nmr (400 mhz, cdcl3) for ()13 : =8.588.71 (br s, 1 h, nh), 7.447.49 (d, j=7.72 hz, 1 h, ar h), 7.317.35 (d, j=8.36 hz, 1 h, ar h), 7.137.20 (dt, h), 5.745.82 (t, j=6.56 hz, 1 h, ch), 3.964.11 (m, 2 h, ch2), 3.843.93 (m, 1 h, ch2), 3.433.55 (m, 1 h, ch2), 2.792.96 (m, 2 h, ch2), 2.29 ppm (s, 3 h, ch3). with the above procedure, the reaction of (r)4 (26 mg, 0.11 mmol) resulted in the desired product (r)13 as white crystals [22 mg, yield : 70 %, []d = + 164 (c=0.2 in etoh), m.p.=201203 c, ee=98 % ]. the h nmr (400 mhz, cdcl3) spectroscopic data for (r)13 were similar to those for ()13. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors. | abstractmany alkaloids containing a tetrahydrocarboline skeleton have wellknown therapeutic effects, leading to increased interest in the synthesis of these natural products. enantiomers of nbocprotected 1hydroxymethyl1,2,3,4tetrahydrocarboline [()7 ], 1hydroxymethyl6methoxy1,2,3,4tetrahydrocarboline [()8 ], and 1hydroxymethyl6fluoro1,2,3,4tetrahydrocarboline [()9 ] were prepared through enzymecatalyzed asymmetric acylation of their primary hydroxyl group. the preliminary experiments were performed in a continuousflow system, while the preparativescale resolutions were done as batch reactions. excellent enantioselectivities (e>200) were obtained with candida antarctica lipase b (calb) and acetic anhydride in toluene at 60 c. the recovered alcohols and the produced esters were obtained with high enantiomeric excess values (ee96 %). the oacylated enantiomers [(s)10(s)12) ] were transformed into the corresponding amino alcohols [(s)7(s)9) ] with methanolysis. microwaveassisted boc removals were also performed and resulted in the corresponding compounds (r)4(r)6 and (s)4(s)6 without a drop in the enantiomeric excess values (ee96 %). |
metabolic disorders as defined by the world health organization include disease conditions whose prevalence is reported to be on the increase more so in the developing countries. based on the results of some epidemiological and clinical investigations in the past few decades, a number of studies have supported the beneficial effects of marine derived omega-3 polyunsaturated fatty acids (pufas) in cardiovascular diseases [13 ]. indeed, low incidence of inflammatory diseases attributed to large consumption of cold water marine fish that contain omega-3 fatty acids has been observed in greenland eskimos and japanese people [46 ]. since evidence from experimental and clinical studies has proved the beneficial effects of omega-3 fatty acid consumption during diabetes, nutritional strategies have been proposed [7, 8 ]. although the mechanism of action of omega-3 fatty acids remains unclear, many reports postulated that the beneficial effects on diabetes and diabetes outcomes may be due to the lipid - lowering action of the fats. however, controversies still exist regarding the beneficial effects of omega-3 pufa in normal pregnancy or in the treatment and prevention of diabetes during pregnancy and its outcomes on the offspring. the results from most clinical trials performed in type 2 diabetes patients suggest that omega-3 pufas have no or marginal effects on metabolic control, while effectively reducing hypertriglyceridemia in these patients. some authors have recently demonstrated that erythrocyte dha enrichment with dha+epa treatment substantially decreases liver fat percentage in nonalcoholic fatty liver disease patients. similarly, consumption of lean fish (75100 g / day) has exhibited beneficial effects by reducing the risk of type 2 diabetes mellitus compared to zero intake in norwegian women. in contrast, other results have shown that omega-3 pufa did not provide any benefit on hepatic steatosis and insulin resistance in diabetic patients with nonalcoholic steatohepatitis. numerous studies have recommended the use of omega-3 pufa supplementation during human pregnancy and lactation for the prevention of preterm birth, beneficial effects on fetal development, visual and cognitive development, and other functional outcomes of the infants [1316 ]. while other authors have found that dha supplementation (800 mg / day) during the second half of human pregnancy does not reduce the risk of gestational diabetes mellitus or preeclampsia in mothers, others have shown that dha supplementation can reduce the risk of perinatal death and neonatal convulsions in newborns. other authors did not find any associations between maternal fatty acid intake or food consumption during human pregnancy and the development of type 1 diabetes in the offspring. despite these controversial reports on the effects of omega-3 pufa, guidelines from the polish gynecological association recommended the use of omega-3 pufa either as supplements or through dietary counseling for women who are planning pregnancy and for patients with normal and/or gestational diabetes and during lactation [19, 20 ]. have published the consensus statement and recommendations of several international research bodies on fatty acids. the adopted conclusions included dietary fat intake in human pregnancy and lactation and recommended that pregnant and lactating women should aim to achieve an average dietary intake of at least 200 mg dha / day. in addition, since intakes of up to 1 g / day dha or 2.7 g / day omega-3 long - chain pufa have been used in randomized clinical trials without significant adverse effects, therefore, women of childbearing age should aim to consume one to two portions of sea fish per week, including oily fish. moreover, the american pregnancy association reports the recommendation of the international society for the study of fatty acids and lipids (issfal) that pregnant women should take 300 mg minimum to support themselves and the fetus for dha requirements on a daily basis [22, 23 ]. the institute of medicine food and nutritional board has developed what is considered as the recommended minimum adequate intake levels for the omega-3 pufa group. the recommended adequate intakes for omega-3 pufa are 1.3 g / day for nursing women, 1.1 g / day for adult women, 1.4 g / day for pregnant women, 1.3 g / day for girls ages 14 and above, 1.6 g / day for boys ages 14 and above and adult men, 0.5 g / day for infants, 0.7 g / day for children (1 to 3 years old), and a dosage of 0.9 g / day for children (4 to 8 years old) [22, 23 ]. the scientific evidence for cardioprotective effects of food sources of omega-3 pufa, eicosapentaenoic acid (epa), and docosahexaenoic acid (dha), beyond the effect of changes in serum lipid profiles, has been recognized by the american heart association (aha) dietary guidelines. the aha recommended consumption of at least two servings of fish per week to confer cardioprotective effects. in the same line the us food and drug administration has approved administration of omega-3 fatty acids only as triglyceride - lowering agents in patients with hypertriglyceridemia ; and some european regulatory agencies have approved the use of omega-3 for the treatment of cardiovascular risk. the aim of the present paper is to review data on the beneficial effects of omega-3 pufas on major metabolic disorders and immune system disruption observed during gestational diabetes and macrosomia. details of outcomes of maternal diabetes in pregnancy on offspring have been reviewed elsewhere and, therefore, will only be briefly discussed before focusing on beneficial effects of pufa during gestational diabetes and evaluating the consequences on the macrosomia in newborns that become obese in adulthood. gestational diabetes mellitus (gdm, which refers to diabetes only during pregnancy) and obesity during pregnancy are both complications which significantly influence the development of offspring during fetal life and postnatal. indeed, animal and human studies indicated that fetuses from mothers with gestational diabetes are at high risk of developing fetal macrosomia [26, 27 ], and they are prone to adverse side effects strongly associated with prematurity, birth trauma, respiratory distress syndrome, and fetal death. effectively, our observations are in agreement with previous epidemiological and clinical trials that have shown that either preexisting maternal diabetes (type 1 and type 2) or gdm appears to be important risk factor for fetal overnutrition and macrosomia [2932 ]. several modes exist for inducing experimental maternal diabetes with streptozotocin in animal models and the consequences on fetus and adult progeny are variable with each model [33, 34 ]. the streptozotocin, when administered at a high single dose, induces diabetes by the direct toxic effects on pancreatic -islet cells. the fetus is confronted with severe intrauterine hyperglycemia which induces fetal islet hypertrophy and -cell hyperactivity and may result in early hyperinsulinemia. the increased insulin secretion dramatically and rapidly decreases due to the overstimulation of fetal cells which are depleted of insulin granules, resulting in fetal hypoinsulinemia [33, 34 ]. the growth of fetal protein mass is then suppressed, leading to fetal microsomia (small birth weight). postnatal development is affected and retarded, and the offspring remain small at adulthood but develop insulin resistance [33, 35 ]. the animal model reported in this review concerns mild streptozotocin - induced type 1 diabetic pregnancy which also leads to macrosomia in newborns [36, 37 ]. streptozotocin, administered at low doses during 5 consecutive days, induces mild type 1 diabetes, following a t - lymphocyte - dependent process, an autoimmune destruction of pancreatic cells, mediated by both cd4 and cd8 t cells [38, 39 ] and this represents a good model of diabetes development for several reasons [38, 40, 41 ]. when the streptozotocin is administrated at five low doses, starting on day 5 of gestation to preserve gestation in pregnant rats, the infiltration of pancreatic islet -cells by autoreactive t lymphocytes is observed two days after the last injection ; the hyperglycemia occurs one week (7 days) after the last injection. diabetes (hyperglycemia) becomes maximal around 10 - 11 days after the last stz injection (i.e., second trimester of gestation) [3841 ] and it persists after delivery. we have previously shown that the progenies of pregnant diabetic rats are prone to develop macrosomia at birth, obesity, type 2 diabetes, and impaired glucose tolerance in adulthood [27, 42 ]. studies in humans with gdm revealed that diabetes determined by oral glucose tolerance test according to the criteria of the world health organization, as reviewed by the international association of diabetes and pregnancy study groups (iadpsg) based on the hyperglycemia and adverse pregnancy outcomes (hapo) study, appeared at second or third trimester of pregnancy [28, 29 ], as we described elsewhere. gdm patients are hyperglycemic and hyperinsulinemic at the diagnosis of the disease [28, 29 ], reflecting a decrease in insulin sensitivity in diabetic pregnant women. maternal diabetes is characterized by an increased placental transport of glucose and other nutrients from the mother to the fetus, resulting in macrosomia. convincing evidence from our studies and others has shown that either preexisting diabetes (type 1 and type 2 diabetes) or gdm (diabetes only during pregnancy) appears to be important risk factor for fetal overnutrition and macrosomia in newborns and for the development of diabetes and adulthood obesity that results from macrosomia [26, 2932, 4446 ]. macrosomia, the most commonly reported effect of maternal diabetes in newborns, is usually defined in humans as birth weight above either 4 kg or birth weight above the 95th percentile of the gestational age. babies from gdm patients whose birth weight was 2.0 sd greater than the mean birth weight of control infants were considered as macrosomic babies [26, 46, 47 ]. the risk of diabetes in the offspring of type 2 diabetes genitors is significantly higher when the mother rather than the father is diabetic. moreover, the risk of insulin resistance is higher in children of mothers with gdm (diabetes only during pregnancy) than in children from mothers developing diabetes after pregnancy. therefore, diabetic pregnancy appears to induce macrosomia that results in obesity in adulthood and these pathologies are associated with several metabolic disorders, implicating lipid metabolism, altered antioxidant status, and disrupted immune defense system. regarding metabolic processes, maternal diabetes induces alterations in the lipid metabolism which contribute to macrosomia in newborns. indeed, we have previously shown in animal and human studies that diabetic pregnancy induces maternal hyperlipidemia which predisposed the fetus to macrosomia [26, 27, 42 ]. in fact, high levels of triglyceride in the maternal circulation of diabetic rats tend to create a steep concentration gradient across the placenta which accelerates the transport and deposition of the lipids in fetal tissues. in addition, maternal hyperglycemia also leads to fetal hyperglycemia, which stimulates pancreatic islet cells and induces fetal hyperinsulinemia in animals and humans [26, 3335, 37, 42, 46, 47 ]. animal studies also showed that in macrosomic newborns hypertriglyceridemia exists and persists with age and is linked to the development of insulin resistance and hyperlipogenesis at adulthood. our observations are confirmed by several recent studies which have shown that maternal diabetes in human and rat is associated with increased risk of hyperlipidaemia [5054 ] and metabolic syndrome and type 2 diabetes in the offspring [53, 54 ]. in human studies as well as in experimental animal models, we have observed that maternal diabetes significantly alters the total antioxidant status as demonstrated by decreased antioxidant molecules (vitamins a and e), enzyme activities (superoxide dismutase (sod), glutathione peroxidase (gsh - px), and glutathione reductase (gssg - red)), and increased serum thiobarbituric acid - reactive substances (tbars) [27, 46 ]. the altered antioxidant system is also observed and persists with age in the macrosomic rat and human newborns that became obese adults [27, 46 ]. these observations are recently supported by several investigators who have observed increased oxidative stress in gestational diabetic women and animals [5558 ] and their infants and rat adult offspring. in fact, our findings suggest that there is an increased oxidative stress in diabetic pregnant women and rats and their adult obese offspring that were macrosomic as newborns [27, 46 ], in agreement with the results of previous studies [6164 ]. in animal as well as in human studies, the immune system is also shown to be modulated during maternal diabetes which induces macrosomia in newborns. several studies have implicated a pathological role of the immune system and inflammation in type 1 diabetes, type 2 diabetes, and gdm. indeed, t cell - derived cytokines are involved in the autoimmune destruction of pancreatic islet cells leading to type 1 diabetes while type 2 diabetes is associated with a generalized activation of the innate immune system, in which there is a chronic, cytokine - mediated state of low - grade inflammation [6668 ]. normal pregnancy or pregnancy complicated with diabetes is known to influence t helper cell differentiation. evidence from our studies revealed that in normal pregnancy th1 cytokines are downregulated whereas th2 cytokines are upregulated in animals as well as in humans [65, 69 ] (figure 1). our observations were in agreement with the results of previous studies [70, 71 ]. interestingly, we have observed that in diabetic pregnancy th1 cytokines decrease and il-10, a th2 cytokine, increases [26, 65, 69 ] as presented in figure 1. therefore, evidence has shown that th2 cytokines may be beneficial for successful pregnancy in diabetic animals and gdm patients. indeed, the shift of th1/th2 ratio to a protective th2 phenotype during pregnancy has been shown to promote humoral immunity with high production of antibodies which contribute to the fight against infections during pregnancy and offer passive immunity to fetus. however, animal and human studies have shown that, in macrosomic newborns and obese adult animals that were macrosomic as newborns, the th1/th2 balance is shifted to a proinflammatory th1 phenotype [26, 65 ] (figure 1). this upregulated - th1 profile in obese adult animals that were macrosomic as newborns may confer to these animals a potential diabetogenic status, as revealed by the hyperglycemia and hyperinsulinemia observed in these animals in the adulthood [42, 65 ]. we have previously examined in animal model the effects of omega-3 pufa on the incidence of macrosomia in diabetic pregnancy in rats [27, 42, 65 ]. the model of diabetic pregnancy was established through administration of five low doses of streptozotocin to pregnant wistar rats starting on day 5 of gestation as described above [27, 37, 38, 42, 65 ]. pups from diabetic pregnant rats whose birth weights were 1.7 sd greater than the mean birth weight of the control pups were considered as macrosomic newborns [27, 37, 38, 42, 65 ]. we observed that 62% to 75% of pups of diabetic pregnant rats were macrosomic at birth [27, 42, 65 ]. these macrosomic newborns were hyperglycemic at birth and, when compared to offspring of control rats, they maintained an accelerated weight gain and become obese at adulthood (3 months of age) [27, 42, 65 ]. interestingly, we observed that omega-3 pufa diet consumption significantly reduced the incidence of gestational diabetes on macrosomia by decreasing the rate of macrosomic newborns by 1625% [27, 65 ]. however, omega-3 pufa diet did not show any effect on the hyperglycemia of macrosomic newborns that become obese at adulthood. in the animal model, while diabetic pregnancy associated with hyperlipidemia [27, 49, 73 ] has been reported to induce hypercholesterolemia and hypertriglyceridemia in adult obese offspring from macrosomic newborns born to diabetic animals [27, 37, 74, 75 ], our studies have demonstrated that omega-3 pufa diet significantly reduced the levels of cholesterol and triglyceride in diabetic pregnant animals and attenuated hyperlipidemia in their adult obese offspring from macrosomic newborns [27, 42, 65 ]. the hypolipidemic effects of omega-3 pufa diet have also been demonstrated in animals [27, 42, 65 ] as the same findings have previously been reported in human studies by other researchers [4, 7, 8 ]. the hypocholesterolemic effects of omega-3 pufa diet have been observed not only in the serum but also in the liver of diabetic pregnant animals and their adult obese offspring from macrosomic newborns. it has been reported that fish oil induces changes in cholesterol metabolism in rat liver leading to an increase in the biliary excretion of cholesterol. in our study, it also has been established in rat dams and their breastfed macrosomic pups that become obese in the adulthood that dietary intake of omega-3 pufa induces a large increase in plasma omega-3 pufa levels followed by a large decrease in omega-6 pufa (la and aa in particular), in agreement with previous results. thus, we concluded that omega-3 pufa exerts its beneficial effects on lipid metabolism observed in diabetic pregnant animals and their macrosomic newborns that become obese adults by attenuating the hyperlipidemia associated with these pathologies. in human studies as well as in animal models, we and several authors have previously reported that diabetes, diabetic pregnancy, macrosomia, and adulthood obesity that results from macrosomia are associated with increased oxidative stress related to decreased antioxidant molecules (vitamins a and e), decreased antioxidant enzyme activities (superoxide dismutase (sod), glutathione peroxidase (gsh - px), and glutathione reductase (gssg - red)), and increased serum thiobarbituric acid - reactive substances (tbars) [25, 25, 27, 6164, 79, 80 ]. high blood glucose has been shown to induce an oxidative stress which in turn induces the production of highly reactive oxygen species toxic to cells particularly the plasma membranes where the radicals interact with the lipid bilayer. under normal conditions, endogenous antioxidant enzymes and vitamins thus, treatment with antioxidants may prevent or reverse the abnormalities associated with diabetes and its complications. some studies have reported that dietary supplements with vitamins and minerals prevent or at least attenuate the organic deterioration caused by an excessive oxidative stress associated with diabetes in humans and animals [81, 82 ]. nonetheless, no consensus has been reached on this subject as shown in table 1. it has been argued that excessive intake of omega-3 pufa may affect antioxidant status [8, 8386 ] and enhance the susceptibility to oxidative damage. while some investigators [8789 ] could not find any changes in the antioxidant status in humans and rats treated with omega-3 fatty acid - rich diet, we and other researchers have demonstrated that treating diabetic patients or gestational diabetic rats and their adult obese offspring that were macrosomic as newborns with omega-3 fatty acids significantly improves their antioxidant status. the details of fatty acid compositions of control and omega-3 pufa diets used in our previous studies [27, 65, 91 ] are presented in table 2. from the results presented in table 1, we concluded that a moderate level of omega-3 pufa dietary intake could be beneficial for improving the antioxidant status. this argument is supported by the findings that dietary fish oil modulates the composition of plasma membrane phospholipids by increasing omega-3 pufa contents (epa and dha in particular) at the expense of arachidonic acid (aa, an omega-6 pufa) levels. similarly, we have previously reported that feeding an omega-3-enriched diet to animals leads to an increased incorporation of epa and dha into the plasma membrane phospholipids of t lymphocytes and a decrease in arachidonic acid level (table 3) [77, 91 ]. hence, we have concluded that omega-3 fatty acids influence t cell activity by being incorporated into their plasma membranes (see table 3). the incorporation of omega-3 pufa into the cell plasma membranes may diminish or counterbalance the negative effects of aa (n-6 pufa) on antioxidant status and consequently modulate cell activation. evidence in the literature shows that essential fatty acids influence the physical properties of cell membranes in terms of fluidity and permeability, activity of membrane receptors, enzymes and ion channels, and cell response to various stimuli through the production of secondary messengers. therefore, the beneficial effect of omega-3-diet on antioxidant status likely involves dha and epa because epa is known to give rise to eicosanoids of omega-3 fatty acid series which exert opposite effects to those of omega-6 series derived from linoleic acid (la) and arachidonic acid (aa). in addition, epa may also be converted into dha which, along with dietary dha, may further contribute to the beneficial effects. it has also been shown that dha may give rise to some discovered derivatives like docosatrienes or resolvins which exert beneficial effects on the antioxidant status. similarly, the fatty acids have been shown to modulate cell signaling mechanisms via their incorporation in the plasma membrane phospholipids. although the exact mechanism by which epa / dha exert antioxidant action is not well understood, das. have suggested that epa / dha supplementation inhibits free radical generation and suppresses lipid peroxidation and no synthesis in patients with nephritic syndrome. this finding suggests that epa or dha may be involved in scavenging of free radicals and no. in support of the finding, yazu. reported that in aqueous micellar dispersions composed of methyl esters of epa or linoleate (la), the oxidizability of the methyl ester of epa (omega-3) was lower than that of methyl linoleate (omega-6). the epa micelle had 2 molecules of oxygen in the peroxyl radical while the linoleate micelle had only one molecule suggesting that epa is more polar than linoleate and the oxygen species polar radicals may migrate from the lipophilic core of the micelle to the polar surface. due to this migration, an environment was created that favoured the termination and reduced the propagation of oxidation reactions. this ability of epa to behave as peroxyl and free radical scavenger is one of the mechanisms which may be used to explain the antioxidant properties of the fatty acid. with regard to the antioxidant properties of epa / dha, it has recently been proposed that dha inhibited more efficiently than epa the protein degradation by regulating nfb (nuclear factor kappa b) signaling pathway in mouse c2c12 myotubes through activating ppar gene expression. in addition, other authors have found that dha and genistein exert complementary actions whilst genistein is antagonistic to arachidonic acid (an omega-6 pufa) for controlling prostaglandin e2 production as well as invasiveness of mda - mb-231 human breast cancer cells in culture by modulating the level of nfb expression. as stated above, the immune system plays a preponderant role in the pathogenesis of maternal diabetes in pregnancy and macrosomia and both pathologies involve t cell activation. many investigators have shown interest in the effects of omega-3 fatty acids on several diseases including diabetic pregnancy and obesity. it has been established that omega-3 pufas exert immunosuppressive effects [92, 94 ]. being immune modulator agents, omega-3 pufas are thought to play an important role in the modulation of immune cell activation by exerting action through th1/th2 dichotomy in diabetic pregnancy and macrosomia. consequently, the fatty acids are being used in the management of diabetes mellitus in human beings and experimental models and also in several inflammatory and autoimmune diseases including rheumatoid arthritis and multiple sclerosis. physiologically, n-3 pufa suppresses mitogen - stimulated proliferation of lymphocytes isolated from lymph nodes. it has also been shown that dietary epa and dha are equipotent in inhibiting il-2 production in rodents [102, 103 ]. hence, it can be argued that the exhibited potential action of the fatty acids on cytokine secretion is attributed to eicosapentaenoic acid (epa) and docosahexaenoic acid (dha) which appear as the most potent immunomodulators of omega-3 pufa family. with regard to the effects of omega-3 pufa on diabetic pregnancy, previous studies have established that feeding omega-3-enriched diet to pregnant healthy animals potentiates the increase of the th2 phenotype in the lymphoid organ (spleen) and peripheral blood of the animals on standard diet [65, 105 ]. in diabetic pregnancy however, omega-3-enriched diet increases th2 cytokines and decreases th1 cytokines at both expressing and circulating levels. in animal and human studies, a shift of th1/th2 balance to a proinflammatory th1 phenotype has been observed in macrosomic newborns and adult obese animals that were macrosomic as newborns of diabetic dams [26, 65 ]. as compared to animals fed on a standard diet, feeding the omega-3 pufa enriched diet to adult obese rats from macrosomic newborns significantly diminishes the mrna expression of th1 cytokines and increases that of il-4 but not that of il-10 (figure 1). while the circulating high concentrations of ifn- observed in adult obese rats from macrosomic newborns are lowered by omega-3 pufa diet, the il-4 level observed in the animals is increased by the omega-3 pufa diet (figure 1). these findings suggest that omega-3 pufa diet exerts beneficial effects in obese rats from macrosomic newborns by significantly shifting the th1/th2 (ifn-/il-4) ratio to a th2 phenotype (figure 1). however, the omega-3 pufa diet could not significantly influence glycaemia in macrosomic newborns and obese rats, suggesting that macrosomia may be a multifactorial pathology. gestational diabetes mellitus and macrosomia that results in adulthood obesity are pathologies associated with several metabolic disorders, implicating lipid metabolism, altered antioxidant status, and disrupted immune defense system. based on the evidence available in animal studies, feeding omega-3 pufa diet not only decreases the high rate of macrosomia induced by diabetic pregnancy but also exerts a lipid - lowering action in both pathologies. omega-3 pufa also contributes to the protection against oxidative stress during gestational diabetes and adulthood obesity that results from macrosomia and restores the immune defense system disrupted by diabetes. the protection is by enhancing th2 phenotype in diabetic pregnancy and therefore shifting the th1/th2 phenotype from a deleterious proinflammatory th1 phenotype to a protective anti - inflammatory th2 phenotype in offspring that were macrosomic at birth and became obese in the adulthood. further studies targeting humans are recommended to further explore application of the fatty acids as supplements in the management of gestational diabetes and inflammatory and immune disease conditions. | omega-3 polyunsaturated fatty acids (pufas) are increasingly being used to prevent cardiovascular diseases, including diabetes and obesity. in this paper, we report data on the observed effects of omega-3 pufa on major metabolic disorders and immune system disruption during gestational diabetes and their consequences on macrosomia. while controversies still exist about omega-3 pufa effects on antioxidant status regarding the level of omega-3 pufa in diet supplementation, their lipid - lowering effects are unanimously recognized by researchers. animal studies have shown that omega-3 pufa contributes to the maintenance of the immune defense system by promoting the differentiation of t helper (th) cell to a th2 phenotype in diabetic pregnancy and by shifting the th1/th2 ratio from a deleterious proinflammatory th1 phenotype to a protective anti - inflammatory th2 phenotype in macrosomia and in adulthood obesity that results from macrosomia at birth. based on the available evidence, international nutritional and food agencies recommend administration of omega-3 pufa as triglyceride - lowering agents, for the prevention of cardiovascular disease risk and during human pregnancy and lactation. furthermore, studies targeting humans are still required to explore application of the fatty acids as supplement in the management of gestational diabetes and inflammatory and immune diseases. |
it is easier to judge the mind of a man by his questions rather than his answers.pierre-marc-gaston, duc de lvis (17641830) i get it ; science is just like spelling. you just have to memorize it and it does n't make any sense.anonymous u.s. elementary school student the juxtaposition of these quotes illustrates a serious shortcoming of k12 science education. the foundation of science is to ask questions about the natural world and then seek answers. if a student sees spelling and learning science as similar experiences, then we are failing to communicate the fundamental reason why science exists as a discipline and what it has to offer. the student 's quote, sadly, reflects our approach to teaching science : learn the facts and do n't deviate from that script. however, before organizing scientific data into facts, science begins by asking questions as a form of intellectual exploration. young children are full of questions, spawned by true curiosity rather than a desire to impress. but over the course of their education, students and adults ask fewer questions and more passively accept facts as the way things are. however, i would like to think that it is not an inevitable outcome of the educational pipeline. thus it is worthwhile to ask whether we could be doing more to promote questioning as a fundamental tool for science education and in the practice of professional science. you ca n't expect to wake up one morning and run a marathon without training. similarly, asking good questions is a skill that requires practice, training, and mentoring. if a child (or adult) is placed in an environment that does not encourage active questioning, then that skill will not become an active habit of mind. socrates is well known for using questioning to probe the validity of an assumption, analyze the logic of an argument, and explore the unknown. questions were a means to educate his students by drawing out their understanding of a subject and then leading them to discover a set of logical conclusions instead of lecturing them on what is true or false. socratic questioning is still advocated as a powerful contemporary teaching method (brill and yarden, 2003). questioning is a core principle of eastern philosophies as well. in the prashna - upanishad, one of the earliest of the upanishad texts that serve as a foundation of hinduism, pupils pose six great questions to a wise teacher (prashna means question in sanskrit). the buddha also encouraged questioning by his disciples, and a fundamental role for questioning is still embraced in the practices of modern buddhism. i recently had the pleasure of visiting dharamsala, india, where i watched tibetan buddhist monks debate a daily practice that involves one monk continually questioning another monk for an hour, often on esoteric points of buddhist thought. the impressive aspect of this practice is how the monks use this method of questioning / answering to hone their skills in logic and to probe complex questions. the questioning involves great mental concentration and intense exchange, punctuated by episodes of laughter and joy. interestingly, the use of questioning for intellectual exploration and teaching evolved independently in socratic and buddhist schools of thought, and both developed this skill through a high degree of discipline and practice. philosophy and science grew up together and were inseparably intertwined ; logical argument and inductive thinking were ways of exploring / explaining the natural world. facts to memorize, and the framework of using experimentation / data gathering to formulate scientific theories gained hold only in the middle of the second millennium. since that point, science and philosophy have grown steadily apart in subject areas and methodologies. it would be rare to find a scientist and philosopher exchanging ideas with one another at a meeting. however, the art of questioning is practiced by scientists, philosophers, and educators, and these disciplines might learn from one another and explore and exploit each other 's practices and ideas. virtually all educators agree that teaching science should involve more inquiry - based learning and less fact - based memorization (committee on a conceptual framework for new k-12 science education standards, 2012). many educators are now developing experimental modules that engage students in the practice of scientific inquiry in a laboratory setting and are trying to export these experimental modules and ideas to many schools. pursued properly, a good question also can be an excellent vehicle with which to start a process of inquiry. investigating an answer to a question need not require a laboratory, special equipment, or money. the goal of asking and answering a question is not necessarily to probe a completely untouched area of science (which is unrealistic for k12). rather, it should be a personal quest to resolve a curiosity and grapple with trying to understand the answer. furthermore, researching one question often results in a further round of questions that dig deeper into a phenomenon. alan alda, the famous actor / director / writer, who is now on the advisory board of the center for communicating science at stony brook university, posed a challenge in science of answering the question, what is a flame ? (alda, 2012). this challenge was based on his experience as an 11-year - old asking his teacher this same question and receiving the disappointing, few - syllabic answer, last spring, alda received more than 800 answers to that question from scientists, and the answers were judged by 6000 11-year - olds. this example illustrates that a lot of thought is required to understand and explain simple questions about our everyday experiences. why is the sky blue ? can be used to learn an enormous amount about light and the atmosphere. what evidence supports light 's behavior as a wave ? why do we say that it is a particle ? and for more advanced students, how can single photons aimed at a pair of slits create interference patterns on the other side, as though they passed through both slits simultaneously ? by posing questions, one appreciates that science is not all about filling in the correct bubble with a # 2 pencil. that might frustrate a subset of teachers and students who want clear - cut answers. cooler and better prepare students to think about evidence and to navigate in a complex world that does not always have precise answers. questioning can be used to promote independent learning in a school setting in a variety of ways. the key ingredients are that students should have some freedom to choose a question in which they are interested, have an opportunity to research the answer on their own, and then have an opportunity to teach others (peers and the teacher) what they learned. i witnessed one especially successful example of spontaneous, curiosity - driven questioning in the katta, a volunteer science discussion group for college students led by milind watve, then at garware college, pune, india (jog, 2009). a katta in marathi (the regional indian language) means a place where people can meet, talk, and exchange ideas. in watve 's katta however, in some instances, students begin to swarm around a question, wanting to know more. this experience often ignites a student, or a group of students, to investigate the question more deeply on their own and then present what they discovered at a later katta. sometimes the group of students decides to investigate the question in a scientific manner, using tools of a laboratory, math, field studies, and so on, as appropriate. in several cases, those investigations went all the way to publications in well - known journals. watve 's role is as a catalyst, providing a safe environment where students can feel free to ask a question without worrying about whether it is good, bad, intelligent, or crazy. usually, no one in the room (including watve) is an expert in the subject. but he encourages them to pursue the question regardless, stimulating them to take ownership of the question and think in new ways that possibly may not have occurred to scientists in the field. when i was a child and needed to research a topic for school or find an answer to a question, i pulled out the world book encyclopedia, our family 's prized possession. i did not always have to go the library ; i was fortunate to have a source of knowledge at home. how different the world has become for my teenage kids. through the internet, they have unprecedented access to information encompassing virtually the entire scope of human knowledge. this information is now available on a time scale of seconds, as if it has become a virtual extension of our cerebral cortex. if an interesting question pops into one 's mind, one can research it immediately and from multiple sources, rather than visit the library tomorrow or next week. furthermore, global connections can now be made between a child in india with a question and a scholar in england who can provide a response. however, the rapid blooming of the internet into a vast, thick jungle of information poses a couple of problems our time is limited, and there is no easy formula for integrating information. thus the most important skill for the twenty - first century, in my opinion, is learning how to judge and integrate information from multiple sources to generate conceptual understanding or a new idea. although integrating information is becoming increasingly important for future success, the educational community has not fully grappled with how to teach students these skills. many teachers, for example, say that wikipedia is unreliable and can not be used as a resource. some make blanket statements that.org or.gov sites are good and.com sites are bad. kids are savvy enough to know that such statements are too simplistic and not true. yes, one can find errors in wikipedia, although several studies suggest that there are relatively few (giles, 2005). but a state - approved high school biology textbook also can have out - of - date information and incorrect simplifications. it is also folly to think that teenagers who seek an answer to one of their own questions will go to their textbook or their teacher ; they will head straight to the internet, and with some judgment, they will find a good resource in short time. in addition, we are already living in a world where most adults are turning to the internet as a source of information about science (brossard and scheufele, 2013). rather than severely restricting kids from internet research, more attention needs to paid to teaching them best practices, such as directing them to good internet sources, teaching them how to identify potentially flawed information, how to integrate information from multiple sources, and how to reference them. categorically stating that wikipedia is unreliable is insufficient ; rather specific pages or examples on wikipedia where information might be incomplete or inaccurate need to be illustrated (and these are rare from my experiences with bigger scientific topics). students also need to gain a more mature view of knowledge, understanding that it is dynamic and that there are points of contention that demand judgment rather than blind memorization. importantly, there is no need to create two camps of scholarship by creating separate instruction manuals for what kids need to do to get the best grade for a classroom assignment versus how they should assimilate knowledge beyond school. most schools have mottos about teaching students to become life - long learners, but this will not happen unless students see connections between how they research a question for school and how they would research a question on their own. questioning may seem like a good educational approach, so why is it not a more common practice in science education ? first is the perception that the teacher is an almighty vessel of knowledge who imparts information to students. in that formulation, a difficult question with no immediate answer or an uncertain answer can be threatening to a teacher and disappointing to a student. i do not know the answer to that question, but let me look it up or let 's look it up together. many questions do not have quick, easy answers and thus become seeds for investigation. students also should be able to teach their peers when they look up an answer to a question. in this model, teachers and students become partners in their mutual education. a second impediment to using questioning as an educational tool. it can be hard to plan around such uncertainty. with state - mandated curricula the ability to ask a question, research the answer, and present it to the class requires some degree of flexibility in the weekly lesson plan. most teachers, particularly in state - run schools, do not have that luxury. a third impediment to using questioning i already discussed that ancient greeks and contemporary buddhists practice this skill for many years. similarly, teacher training would be required to implement such ideas in a classroom. as discussed in recent editorials by bruce alberts (2012a, b), at the root of all three obstacles is the lack of time in k12 education for in - depth investigation by students or teachers. state science curricula mandate a list of required topics and information that is so long that it becomes quite difficult for teachers to pack it all in during a school year. this comprehensive, memorization - based approach is great for testing but poor for producing kids who are interested in science or even know what science is truly about. a conceptual understanding of how cells use and make energy is more important than regurgitating all of the steps in glycolysis, which can be quickly relearned online. state educators need to reduce the amount of required material in their science curricula to allow more the time for in - depth learning, teacher initiative and professional development, and exploration of questions. finland is adopting such strategies, with substantially better educational outcomes than the united states (sahlberg, 2011). identifying a good question and being able to articulate it well is not just an exercise for high school students, but is also a key skill in becoming a successful scientist. a grant proposal often receives a poor score not because the proposed experiments are poorly conceived, but because the questions being asked are not interesting or not clearly articulated. it is easy to fall into this trap, because specific aims are often written in terms of achieving a specific technical goal rather than from the standpoint of framing and answering a compelling question. weaving good questions into the text of a grant can be a way to communicate the goals of a project. many seminars are lackluster because they are swimming in data but lack a captivating question to motivate the data collection. raising questions throughout a seminar engages the audience and involves them in the thought process. posing a single question on a slide also can be an effective means of framing the steps involved in answering that question in subsequent slides. in summary, asking questions is a part of the joy of science. even much later, as a seasoned, well - educated scientist, one can continually learn from and strive to perfect this gift of human intellect. | science begins by asking questions and then seeking answers. young children understand this intuitively as they explore and try to make sense of their surroundings. however, science education focuses upon the end game of facts rather than the exploratory root of the scientific process. encouraging questioning helps to bring the true spirit of science into our educational system, and the art of asking good questions constitutes an important skill to foster for practicing scientists. |
the speakers at this summit included many of the movement 's high profile leaders, including dean ornish, mehmet oz and kenneth pelletier. evidence of the interest in the broad field of integrative medicine was the inclusion of the program of thomas donahue (the ceo of the us chamber of commerce), george halvorson (chairman and ceo, kaiser foundation health plan), senator tom harkin (iowa), bill novelli (ceo, aarp), and reed tuckson [chief of medical affairs, united health group, a major health maintenance organization (hmo) and former senior vice president, ama ]. other speakers included mimi guarneri, (cardiologist and medical director of the scripps center for integrative medicine), david katz (internist and founder of yale 's prevention research center), victor sierpina (university of texas), victoria maizes (university of arizona), tracy gaudet (duke university) and josephine briggs (director, nih 's national center for complementary and alternative medicine). the chairperson of the planning committee for the conference was the eminent ralph snyderman, chancellor emeritus, duke university. perhaps most impressive of all was the audience itself who consisted of many health and medical experts who often serve as keynoters at health conferences, including jeffrey bland, jon kabat - zinn, larry dossey, woodson merrill and wayne jonas, as well as dozens of professors of medicines who teach at leading medical schools, naturopathic, nursing, acupuncture and chiropractic colleges. harvey fineberg, the president of the iom, welcomed attendees and acknowledged that integrative medicine is a bit like a rorschach blot test because it meaning seems so varied. he asserted, no other industry holds its customers in such high disregard, except perhaps the airline industry. he described health care today as uncoordinated, disease - oriented, reactive, physician - directed, not personalized or safe, and extremely expensive. snyderman expressed his strong appreciation for modern medical science, but he humbly acknowledged that most drugs and technologies have not been proven efficacious and that at best it may only impact 25% of modern health concerns. reed tuckson, who represents one of the large hmos, warned attendees that we all may want health care reform, but whatever changes we want must have evidence of benefit. he, however, also noted that the enemy of the good is the perfect, and we can not wait until all of the evidence is in or that there is wide consensus before we begin to make serious changes. tuckson also reminded the audience that virtually every patient wants every treatment that they receive to be covered by their insurance, and yet, third party payers will always insist upon seeing this requirement is not only reasonable but also necessary, and yet, later discussion noted the great number of conventional medical interventions that are both very expensive and do not have adequate evidence of benefit. kenneth pelletier echoed a similar viewpoint by asserting, trust in god, but everyone else must present data. pelletier noted that we may not necessarily need new monies in health care but just better allocation of present resources. because so many high - tech methods presently used have not yet been proven efficacious, there are great savings to be obtained by no longer providing reimbursement for questionably effective (and expensive) health interventions. pelletier has served as a consultant to many major american corporations who have developed various disease prevention and health promotion programs for their employees. he noted that 62 of 63 studies of cost - effectiveness, cost benefit and return on investment have shown positive results (1). according to his review of this research, furthermore, evidence - based return on investment ranges from $ 3.50 to $ 4.90 for every $ 1.00 invested. bill george, a professor of business management at harvard business school, was the ceo, president and chairman of the board at medtronic, inc., the largest medical technology company in the world that began by creating heart pacemakers. his wife, penny george, was past president of the bravewell collaboration, co - sponsor of this summit, and the george family foundation has been a leading supporter of many bravewell efforts. he insisted that it was important for employers to reward good healthy behaviors rather than punish bad ones. he noted that his company gave employees $ 50/month ($ 600/year) for complying with some healthy behaviours. he also noted that a gym is not a perk of an office but is a necessary component of it. dean ornish made what many attendees considered to be the most powerful presentation of the summit, as was evidenced by the largest number of people in attendance giving him a standing ovation for a prolonged period of time. he described his and many others research that showed significant changes in the health status of people suffering from many of the leading causes of mortality in the usa. ornish 's own research has shown that significant changes in dietary and exercise were substantially effective in improving health status in people suffering from cardiovascular disease and prostate cancer. furthermore, he noted that the minor dietary and exercise recommendations of the american heart association and the national cancer society were simply inadequate to create significant positive results, thereby leading to poor compliance due to the small health improvements. ornish noted that the world health organization ranked the us health care system in 2000 first in both responsiveness and expenditure, but 37th in overall performance (2). this ranking suggests that simply spending more money on what we are doing now or making minor changes in health reform will not provide the real improvements that americans want and need today. ornish also made reference to one study in which curcumin (an active ingredient in the herb, turmeric) was found to have 2000% increase in bioavailability and therefore significant better health benefits when used with a type of pepper used in curries. ornish sought to warn attendees to avoid looking at studies that test simply one ingredient. many recent studies, for instance, have found little or no results from using vitamin c or e or a single type of multivitamin, when, in fact, most nutritional - oriented physicians and practitioners do not limit themselves to such single ingredient treatments. body treatment programs, including certain meditative, visualization and yoga practices, to improve health status and quality of life for people suffering from a host of serious ailments. he also noted their importance for soldiers as they return from combat operations, usually suffering from post - traumatic stress disorders. many speakers made reference to the challenge in health care today in which physicians and other primary care clinicians do not have the time or expertise to be their patients health coach. there seems to be a real need for a person on the health care team who works personally with the patient to help enact behavioral changes that are health enriching. some attendees thought that psychologists might fill this role ; others thought nurses may be best, and others wondered if a new type of health professional was needed. furthermore, ornish reported on genetic research on telomeres, a gene associated with long life. ornish 's research published in lancet oncology discovered that significant dietary changes had direct effects on telomeres, thereby verifying that our genetic heritage can be influenced and changed (3). while our genes may indeed have powerful effects upon our health and life, such influences are not in stone but can be transformed. ornish 's expansive message also included reference to the provocative notion that a vegetarian diet is not only healthier for people but also for our planet. he noted that livestock production leads to more global warming effects than all transportation sources combined. in recognition of the potential significance of the iom summit on integrative medicine, two hearings on integrative medicine were held 2 days before the summit and on one of the days of the summit itself. the senate sub - committee on health, education, labor and pensions held a hearing chaired by maryland senator barbara mikulski, and heard testimony from wayne jonas, james gordon, sister charlotte kerr, mary jo kreitzer and cathy baase, corporate medical director for dow chemical company. senator harkin chaired the second hearing of this same sub - committee with what some of us referred to as the integrative health dream team, including dean ornish, andrew weil, mehmet oz and mark hyman. the third day of the summit began with a rousing presentation from senator tom harkin. harkin reported on these senate hearings noting that just that week president obama had asserted that health reform was a major priority for him and for the american people and that prevention and wellness programs have to have an important place in this health reform. president obama has also designated that over us$1 billion would be devoted to outcomes evaluation for health and medical treatment programs to begin to be evaluated to determine what really works. after they have tried everything else. indeed, harkin has been a long - term advocate for integrative health (although he originally expressed interest and support for integrative medicine, an attendee suggested to him what others at this summit had previously expressed : integrative health is more comprehensive a term than integrative medicine ; within the remaining time of the q&a session with harkin, he referred to integrative health). harkin was the primary sponsor that created the office of alternative medicine, as well as the national center for complementary and alternative medicine. harkin also noted that the status quo (which he also called the stagnant quo) has reimbursement and incentive priorities in the wrong place. the very concept of integrative health is quite comprehensive, and yet, with respect to getting the biggest bang for the buck, we must honor the hippocratic tradition that asserts first, do no harm. how this translates into health improvements is that we should explore and exhaust safer methods first before resorting to the big (and expensive) guns of medicine and medical technology. also, there is general recognition that we need to move our thinking about health care where the physician is at the center to where the person is at the center. data. during audience participation moments at this summit, i voiced my concurrence, but i also voiced a warning. in homeopathic and naturopathic thought and practice, there is a profound respect for the wisdom of the body. if we set up clinical trials that simply evaluate whether a treatment is effective in getting rid of a symptom, we may be discovering that this treatment is effective but only in suppressing a symptom and sometimes creating a more serious chronic ailment rather than enacting a true cure. we therefore need to have clinical trials, but they must not only evaluate specific symptoms but also overall health status. they must not ignore side effects because such new symptoms are not side effects at all ; they are usually the direct result of a drug 's toxicity or its ability to suppress the disease to deeper and more serious levels. furthermore, when we seek evidence, we should not only evaluate evidence obtained from randomized double - blind trials, but we should also evaluate evidence from outcome studies, cost - effectiveness studies, and when possible and appropriate, basic science trials. we need to remember that we today accept most surgical practices even though the vast majority of them have not been proven to be effective based on double - blind placebo - controlled trials. few people consider surgery to be unscientific just because it is not viable to conduct placebo - controlled trials. and yet, many physicians, scientists and health policy analysts assume certain that some alternative treatment methods are unscientific because they too can not be evaluated in placebo - controlled trials (how does one give a placebo meditation or a placebo yoga posture ?). likewise, many treatments that integrative practitioners use comprise a package of treatments that include various dietary changes, vitamin and mineral supplements, herbal remedies, homeopathic medicines, yoga practice, stress management methods and so on. evaluations of the outcomes of such packages of treatment are truly necessary. at this summit, there were several professors of genetics and other basic sciences who discussed the most recent scientific discoveries in their fields. genetic causes of illness and to new (and old) infective agents that cause this or that disease. my concern here is that because language is so important, it is necessary that we draw from systems biology and systems thinking to realize that it is more accurate to say that these influences are co - factors to diseases, not causes of them. the concept of causality tends to be linear, when, in fact, cause is rarely so simple. the susceptibility of the host always influences whether infective agent leads to disease or not, and as dean ornish and others have now noted, even genetic status of an individual can be altered. finally, we must be more humble in how we all make use of the words and concepts of scientific medicine. an iom special report, informing the future : critical issues in health (published in 2007), noted that one - third of americans today take five or more medications. and yet, even if all of these drugs have been proven scientifically to work, each drug was tested individually, not in combination with one or two, five, drugs. furthermore, most of the studies conducted have not been on children or the elderly, and yet, the high quantities of drugs are prescribed them. still further disconcerting is that most medication is tested for very short periods of time, even though many drugs are used over years or decades. while such evaluations are complex and difficult to conduct, these issues simply mean that we must remain humble in our sense of which drugs work, when, and for whom. a report from the iom on this summit is expected to be published in late 2009. because president barack obama has placed health care reform as a major priority of his administration, the timeliness of this summit is significant, though it is uncertain what role integrative health thinking and practices will become a part of obama 's initiatives. obama did, however, give us some insight into his present thinking when, in may 2009, he responded to a question about acupuncture 's role in his health care reform plans, obama said, [m]y attitude is that we should we should do what works. so i think it is pretty well documented through scientific studies that acupuncture, for example, can be very helpful in relieving certain things like migraines and other ailments or are at least as effective as more intrusive interventions. to see agenda and presentation slides of the iom summit, to watch the web cast of the summit, and to access the commissioned papers that were available prior to the start of the summit, please visit : http://www.iom.edu/?id=52555 the us senate hearing on integrative medicine by the committee on health, education, labor and pensions in which testimony was provided by dr andrew weil, dr mehmet oz, dr dean ornish and dr mark hyman, can be watched at http://help.senate.gov/hearings/2009_02_26/2009_02_26.html | the us institute of medical sponsors a summit on integrative medicine and the health of the public on february 2527, 2009. a prestigious body of speakers and attendees created a dynamic conference in which the content and discussions provided vital information for transforming the us health care system. topics included : patient - centered care, the scientific basis of integrative medicine, health care financing reform and value - driven care, and mind - body relationships and health. |
between 1960 and 1990, several studies evaluated the relationship between the shape and function of the temporomandibular joints (tmjs) and concluded that they were intimately related ; therefore, eventual functional loads applied to them exert considerable influence on their morphology. however, the role of occlusion on articular morphology is still not completely elucidated [13 ]. katsavrias and halazonetis suggested that both the condyle and the mandibular fossa differ in shape among patients with various types of malocclusion. several studies showed a significant relationship between occlusal factors and joint morphology whereas others failed to demonstrate a correlation [68 ]. burley evaluated the tmj structures in class i, class ii, and class iii malocclusions and showed that these malocclusions do not produce functional stimuli capable of altering the contour of the anterior wall of the mandibular fossa. most of these pioneer studies used conventional radiographic examination, which have limited ability to accurately demonstrate the anatomic characteristics of tmjs. this is because the tmj is a small joint with complex morphology and is surrounded by osseous tissues that produce superimposition of images, particularly the petrous region of the temporal bone, the mastoid process, and the articular eminence. the development of computed tomography (ct) techniques has improved the diagnosis of tmj pathologies because it is an accurate, efficient, noninvasive, and fast diagnostic procedure. the use of ct scans in tmj studies allows real and precise measurements of the structures under analysis. some ct studies were performed with the purpose of evaluating the symmetry between the condyles and to compare the condyle - fossa relationship between the right and left sides in samples with specific types of malocclusion [1418 ]. in a sample of normal occlusion, vitral. demonstrated that the largest mediolateral diameter of the mandibular condylar processes and the posterior joint spaces showed a statistically significant difference between the right and left sides. in the class. found that only the posterior articular space had a statistically significant difference between the right and left sides. there was a higher mean for posterior articular space on the right temporomandibular joint. in the class ii division 1 malocclusion sample, the distance of condylar process / midsagittal plane and posterior articular space showed a significant difference between the right and left sides. in the class iii and class ii subdivision samples [1618 ] one important conclusion that can be drawn from those studies is that in all samples the evaluation of the concentric position of the condyles in their respective mandibular fossae showed a non - centralized position for the right and left sides, demonstrating a statistically significant anteriorly positioned condyle [1416,18 ]. although recent papers have demonstrated that condylar centralization is not observed in most samples studied, a matter not yet completely resolved is whether this condylar positioning differs between groups with different occlusal characteristics. a correct comparison of the condylar centralization in the articular fossa between distinct groups should use a relative or proportional measurement, which is the ratio between the anterior and the posterior joint spaces. a representative number of studies concerning the adequate condyle - fossa relationship have been published and some researchers stated that there was a direct relationship between internal derangements of the tmj and condylar position [1922 ]. studies on the ideal position of the condyles have suggested that the healthiest condyle - fossa relationship is that in which the condyle is centralized anteroposteriorly in the mandibular fossa [2326 ]. most of these studies were carried out at a time in which ct scans were not yet available. in addition, there was no specific analysis of the relationship between the variables, symptomatology, occlusion, and condylar position. the present study aimed, therefore, to determine and compare the position of the condyle in the mandibular fossa between asymptomatic subjects with normal occlusion and asymptomatic subjects with class i, class ii division 1, and class iii malocclusions. the present study included ct scans of the tmjs of 30 persons with normal occlusion, 30 with class i, 30 with class ii division 1, and 30 with class iii malocclusion. the participants of the sample were selected among individuals who sought dental treatment involving images of the craniofacial region. the study was been approved by the federal university of juiz de fora, human research ethics committee. exam results are available at the archives of the department of orthodontics of the federal university of juiz de fora all participants met the following requirements : all permanent teeth erupted, except third molars ; and no functional mandibular deviations, crossbites (except for the class iii sample), open bites, evident facial asymmetry, or symptoms of temporomandibular disorders. in the normal occlusion group, the following additional requirements were included : first molars and canines in class i relationship, canine guidance without working or nonworking side interferences on lateral excursions, anterior guidance with no posterior interferences, normal overbite and overjet, and no crossbite. the ct images were obtained with the patients in maximum dental intercuspation and their heads were positioned so that the frankfort and midsagittal planes were perpendicular to the floor. the helicoidal / multislice ct was performed with a somaton spirit device (siemens, xangai, china) at 120 kv and 160 ma. we obtained 1-mm thick slices spaced at 1 mm intervals, using the helicoidal technique. because this procedure provides images on the axial plane, the following measurements were assessed on the sagittal plane : anterior joint space : expressed by the shortest distance between the most anterior point of the condyle and the posterior wall of the articular tubercle (figure 1, ajs). posterior joint space : represented by the shortest distance between the most posterior point of the condyle and the posterior wall of the mandibular fossa (figure 1, pjs). for the subjects of the 4 groups, the anterior / posterior (a / p) joint space ratio was calculated by dividing the anterior joint space by the posterior joint space. an a / p ratio of greater than 1.0 represented a posterior condylar position, whereas an a / p ratio of less than 1.0 represented an anteriorly displaced condyle. the further the value from 1, the greater the decentralization of the condyle in the mandibular fossa. the following tests were applied : paired t test for the relationships between the right and left sides for each group. anova test between the measurements of the right side for all groups and also between the measurements of the left side for all groups. in case of statistically significant difference, the dunnett s t test was applied, which treated normal occlusion as the control, and compared all other groups against it. for the subjects of the 4 groups, the anterior / posterior (a / p) joint space ratio was calculated by dividing the anterior joint space by the posterior joint space. an a / p ratio of greater than 1.0 represented a posterior condylar position, whereas an a / p ratio of less than 1.0 represented an anteriorly displaced condyle. the further the value from 1, the greater the decentralization of the condyle in the mandibular fossa. the following tests were applied : paired t test for the relationships between the right and left sides for each group. anova test between the measurements of the right side for all groups and also between the measurements of the left side for all groups. in case of statistically significant difference, the dunnett s t test was applied, which treated normal occlusion as the control, and compared all other groups against it. table 1 shows the mean and standard deviation for the ajs / pjs relationships of each group for the right and left tmjs, as well as the result of the paired t test between the ajs / pjs relationships of the right and left sides for the normal occlusion (p value 0.390), class i (p value 0.168), class ii, division 1 (p value 0.662) and class iii (p value 0.991) groups table 2 shows the result of the anova test with p value of 0.445 for the comparisons of the right side and p value of 0.040 for the left side. the dunnett s t test was performed and a statistically significant difference was found, on the left side, between the class ii group and the normal occlusion group (p value 0.026) the morphology and relationship of tmj structures in different occlusal conditions, as well as the role of condylar position on tmj internal derangements have been studied during the last decades [14,8,1925, ] but several questions are yet to be completely elucidated and findings from various studies are contradictory. as for the analysis of the condyle position within the articular fossa, and thus evaluating condylar centralization, since ct scans allow the acquisition of different cutting planes, the one that showed the greatest anteroposterior diameter of the condylar processes was selected. in the studies mentioned previously [1418 ] in which the same technique for image acquisition was used, it can be noted that the evaluation of the anteroposterior position of the condyles in the different groups was made through the comparison between absolute measurements of the anterior and posterior joint spaces and was expressed in millimeters. however, for an adequate comparison to be made, condylar centralization in the mandibular fossa between the right and left sides or between distinct groups should be evaluated by means of a proportionality ratio between the posterior and anterior joint spaces, instead of simple linear measurements. by analyzing the ajs / pjs ratio, it can be observed that condylar decentralization has occurred in both the right and left tmjs in all groups, showing an anterior joint space smaller than the posterior joint space. however, there was no statistically significant difference between the sides for the paired t test, what suggests anteroposterior condylar symmetry in the normal occlusion and malocclusion samples. the lack of centralization of the condylar processes has been reported in both normal occlusion and malocclusion samples in ct studies [1418 ], which is in agreement with the results obtained in this study, despite the different mathematical criteria used for such determination. from the results obtained, it is possible to verify that the use of simple morphologic criteria for classifying malocclusions does not seem to influence the sagittal relationship of the condyle in the mandibular fossa. similar results were found by ikeda and kawamura in patients with optimal joints without displacement using cone beam computed tomography. in the present study, an increasing decentralization can be noted in the following order when groups are compared : normal occlusion (right ajs / pjs 0.770, left ajs / pjs 0.860), class i (right ajs / pjs 0.721, left ajs / pjs 0.809), class iii (right ajs / pjs 0.660, left ajs / pjs 0.660), and class ii division 1 (right ajs / pjs 0.613, left ajs / pjs 0.581). in spite of that, the anova and dunnett s t test did not show statistically significant differences between the groups of malocclusions and the normal occlusion group in the right tmjs. in the left side, a significant difference was found only between the normal occlusion and the class ii groups, which showed the least and the greatest decentralization, respectively. most previous observations were of morphological character. from a clinical standpoint, it appears that, contrary to what was observed in the results of studies conducted in the 1970 s and 1980 s [2326 ], centralization of the condyles was not a characteristic found in the asymptomatic samples of this study. such a finding is probably due to the different image acquisition techniques that were used, and the arbitrarily selected amplitude of variation accepted for a condyle to be considered centralized in those studies. modern ct techniques allow precise and reliable evaluation of condylar position. even more important than condylar centralization, symmetric condylar relationships, as shown in table 1, may play a relevant role in the articular balance and, consequently, in the absence of tmd. in all groups evaluated in this study, in both normal occlusion and malocclusion samples, a symmetrical condylar relationship was a common characteristic when the right and left sides were compared. the lack of centralization of the condylar processes in their respective mandibular fossae was a common characteristic in the asymptomatic normal occlusion group, as well as in all asymptomatic malocclusion groups. a statistically significant difference was found in the left tmjs between the normal occlusion group and the class ii division 1 group. there was no statistically significant difference between the sides for the paired t test, which suggests bilateral condylar symmetry in the normal occlusion and malocclusion samples. | backgroundthe present study aimed to determine and compare the anteroposterior position of the condyle in the mandibular fossa between groups of asymptomatic subjects with normal occlusion and asymptomatic subjects with class i, class ii division 1, and class iii malocclusions.material/methodsthirty persons with normal occlusion, 30 with class i malocclusion, 30 with class ii division 1, and 30 with class iii had computed tomography scans of their temporomandibular joints. the anterior joint space / posterior joint space (ajs / pjs) ratio was determined for the right and left joints. the paired t test was used to analyze the ajs / pjs ratio between both sides for each group. the anova test was applied to verify the differences between the groups for the measurements of the right and left sides. in case the anova test confirmed significance, the dunnett s t test was performed to compare the groups of malocclusion with that of normal occlusion.resultsthe paired t test between the ajs / pjs relationships in the right and left sides showed the following p values : class i (0.168), class ii division 1 (0.662), class iii (0.991), and normal occlusion (0.390). the anova test showed a p value of 0.445 for the comparisons of the right side and 0.040 for the left side. the dunnett s t test demonstrated a statistically significant difference between the class ii group and the normal occlusion group (p value of 0.026) in the joints of the left side.conclusionsbilateral symmetry and lack of condyle centralization were common characteristics among all groups. the greatest condylar decentralization was observed in the class ii group, whereas the least condylar decentralization was found in the normal occlusion group. |
overweight and obesity are exceedingly difficult to reverse. despite the widespread use of conventional management strategies low - calorie diets, physical activity, behavioral interventions, and pharmacological agents an estimated 65% of all us adults were either overweight or obese during 2007 - 2008. overweight and obesity increase the risk for comorbidities such as diabetes and atherosclerosis and are associated with reduced quality of life and life expectancy [2, 3 ]. clearly, alternative approaches are needed. one potentially promising alternative approach is glucomannan, a dietary supplement widely promoted and used for its weight loss properties. despite its widespread use, the safety and efficacy of glucomannan have not been adequately studied. glucomannan is a water - soluble, fermentable dietary fiber extracted from the tuber or root of the elephant yam, also known as konjac (amorphophallus konjac or amorphophallus rivieri). glucomannan consists of a polysaccharide chain of beta - d - glucose and beta - d - mannose with attached acetyl groups in a molar ratio of 1 : 1.6 with beta 14 linkages (see figure 1) [46 ]. because human salivary and pancreatic amylase can not split beta 1, 4 linkages, glucomannan passes relatively unchanged into the colon, where it is highly fermented by colonic bacteria. it has a high molecular weight (average : 1,000,000 daltons) and can absorb up to 50 times its weight in water, making it one of the most viscous dietary fibers known. the mechanisms that mediate the weight reduction effects of glucomannan are thought to be similar to those of other water - soluble, fermentable fibers. with its low energy density and bulking properties, glucomannan seems to promote weight loss by displacing the energy of other nutrients and producing satiety and satiation as it absorbs water and expands in the gastrointestinal tract. in addition, glucomannan seems to reduce total cholesterol and low - density lipoprotein (ldl) cholesterol levels by stimulating fecal excretion of cholesterol and bile acids and decreasing intestinal absorption of cholesterol [79 ]. also, glucomannan may improve glycemic parameters by inhibiting appetite and slowing intestinal absorption due to increased viscosity [1013 ]. glucomannan has been associated with reductions in body weight and plasma lipid and glucose levels in adults in a few clinical trials [1419 ]. but these trials have been limited by weak designs, small sample sizes, heterogeneous diagnoses, variable formulations and dosages of glucomannan, and short duration of follow - up. in contrast to these studies, we used a randomized, double - blind, placebo - controlled design to evaluate the safety and efficacy of 3.99 g / day of glucomannan capsules in a sample of 53 healthy overweight and moderately obese adults consuming self - selected diets and maintaining usual physical activity levels during an 8-week study period. men and women were recruited from a clinic within an urban academic medical center, located in a health resources and services administration (hrsa) designated medically underserved area. individuals were eligible for inclusion in the study if they were between the ages of 18 and 65 years and had body mass index (bmi) 25 and 35 at study entry. individuals were not eligible if they were currently using fiber supplements or had intolerance to fiber supplements, had untreated / unstable metabolic conditions known to influence weight status (e.g., hypothyroidism, type 2 diabetes mellitus), had gastrointestinal disorders that might cause complications or influence motility or satiety (e.g., diverticulitis, inflammatory bowel disease, irritable bowel syndrome, intestinal narrowing or obstruction, and difficulty swallowing), were using medications or complementary and alternative medicine (cam) therapies that might affect weight or food absorption (e.g., diuretics, glucocorticoids, anorexigenic agents, orlistat, acupuncture, and hoodia), had an eating disorder, or were participating in a weight loss program. other exclusion criteria were stage ii hypertension (160/100 mmhg) or dyslipidemia (fasting ldl cholesterol 160 mg / dl ; total cholesterol 240 mg / dl ; triglycerides > 200 mg / dl ; hdl 40 mg / dl), fasting serum glucose > 126 mg / dl, renal or liver disease, history of depression, abuse of illicit drugs or alcohol, use of cigarettes, or pregnant, less than 6 months postpartum, or lactating. based on a previous placebo - controlled trial of glucomannan, we planned to recruit 50 participants and follow them up for 8 weeks to have 80% power to adequately detect changes in weight and other metabolic variables. eligible individuals who consented to participate in the study were randomly assigned to receive capsules containing glucomannan or a matching placebo filled with inactive microcrystalline cellulose. a random number generator was used to create a randomization sequence ; boxes containing each participant 's supply of capsules were packaged according to this sequence. both the glucomannan and placebo capsules were prepared by an external pharmacy, which had no other role in the study. to ensure that the glucomannan supplement used during the study period met quality control standards, it was purchased from the same lot, and a sample was submitted to consumerlab.com for compositional and purity analyses, which indicated appropriate composition and purity. participants were instructed to take two 666 mg (1.33 g) glucomannan or placebo capsules with 236.6 ml (8 oz.) of water one hour before breakfast, lunch, and dinner for 8 weeks (for a total of 3.99 g / day). study participants returned at 2 weeks and 8 weeks to return any unused study supplement or placebo from the previous visit, receive a new supply of the study supplement or placebo for the remaining 6 weeks, report on side effects, and have blood drawn. all data were collected by study research personnel and uploaded to teleform (electronic scanning) database by a research assistant. all participants provided written informed consent before enrollment. an independent data and safety monitoring committee monitored the trial and reviewed the interim results. the primary efficacy outcome was weight loss from baseline to 2 weeks and 8 weeks after randomization. body weight was measured to the nearest 1/10 kg using a calibrated electronic scale, with participants wearing light clothing without shoes. secondary efficacy outcomes included changes in body composition (waist / hip circumference, body fat, and fat - free mass), hunger and fullness, and fasting lipids and blood glucose parameters. waist and hip circumference were determined using standardized procedures and body fat and fat - free mass were measured using tanita ultimate scale (tanita corp., subjective sensations of hunger and fullness were assessed using standardized 100 mm visual analog scales (vas). the hunger scale was anchored by the words, not at all hungry and extremely hungry and the fullness scale was anchored by not at all full and extremely full. participants were asked to make a vertical mark across the line corresponding to their feelings during the past four hours on the day of their scheduled clinic visit (total = three days during the 8-week study period). to score the scales, the distance in mm from 0 for each scale a standard lipid panel was used to quantify triglycerides, total cholesterol, and hdl cholesterol ; ldl cholesterol levels were calculated using the friedewald equation. key safety outcomes were gastrointestinal symptoms and tolerability and laboratory assessment of liver and renal function. gastrointestinal symptoms and tolerance were determined by asking participants about difficulty swallowing, abdominal distention, diarrhea, belching, and other gastrointestinal - related symptoms using standard methods of nondirected questioning, including when symptoms started and whether they were thought to be related to the study supplement. liver enzymes were considered elevated with an aspartate aminotransferase level > 275 u / l and/or an alanine transferase > 250 u / l ; for serum creatinine, a level > 4.5 mg / dl was considered elevated. other measures included dietary intake, physical activity, supplement compliance, and credibility / expectancy perceptions of the study treatment. to assess for changes over the 8-week study period, dietary intake was measured using 3-day food records completed at baseline, 2 weeks, and 8 weeks and analyzed using nutribase clinical data analysis software (http://www.nutribase.com/). the international physical activity questionnaire (ipaq) was administered at baseline, 2 weeks and 8 weeks to characterize any changes in usual activity level during the study period that could affect study outcomes. supplement compliance was measured by capsule counts and self - report of percentage of capsules taken. calculated compliance was defined as the percentage of prescribed doses taken from baseline through the 8-week study period. since differences in participants ' perceptions of credibility of the treatment rationale and their expectancy could confound the findings, we administered the credibility / expectancy questionnaire (ceq) to participants in both groups on the first and last days of the treatment. nominal data were analyzed by the use of the chi - square test, whereas continuous data were analyzed by the use of pearson 's correlation analyses, independent sample t - tests, and one - way analysis of variance. figure 2 depicts the screening, enrollment, and follow - up of participants in the trial. of the 124 adults screened, a total of 53 met eligibility criteria and were enrolled in the study. twenty - six participants were randomly assigned to the glucomannan group and twenty - seven participants to the placebo group. three participants in each group were either lost to follow - up or discontinued the study for personal reasons, resulting in a final sample of 47 participants. baseline demographic and clinical characteristics were similar between the two groups (table 1). participants were predominately female (~85%), represented a mix of racial and ethnic groups, and had a mean age of 40.6 years. for the 47 participants who completed the study, the calculated compliance was 81.3% 4.5% in the glucomannan group and 82.7% 5% in the placebo group. for the primary outcome, there was no significant difference in the amount of weight loss between the participants in the glucomannan group and those in the placebo group at either two weeks (.32.04 and.11.02, resp.) or eight weeks (.40.06 and.43.07, resp.) after randomization (table 2). there were no significant differences in body composition measures, hunger / fullness, and fasting lipid and glucose levels. belching (13.4% versus 4.1%), bloating (12.7% versus 3.7%), and stomach fullness (11.9% versus 2.4%) occurred more frequently in participants on glucomannan than those on placebo, but these symptoms were transient, lasting for only 1 - 2 hours after taking glucomannan on the first 13 study days, and did not lead to study discontinuation. hepatic and renal safety outcomes remained normal throughout the study and did not significantly differ between the control and treatment groups. other measures, including dietary intake, physical activity, supplement compliance, and credibility / expectancy, also did not differ significantly between the groups. in our study, supplementation with glucomannan did not result in significant weight loss at either 2 or 8 weeks after randomization. also, there was no evidence of benefit of glucomannan supplementation with respect to any of the secondary outcomes. this is in contrast to several other studies that have found beneficial effects of glucomannan on body weight, body composition, and plasma lipid and glucose levels [20, 26 ]. unlike previous studies, we enrolled only healthy overweight and moderately obese individuals consuming self - selected diets and maintaining usual physical activity levels., the beneficial effects of glucomannan on weight loss may be enhanced by dietary modifications, such as hypocaloric diets. additionally, past studies have focused on obese patients, so it is possible that glucomannan may exert differential effects on these individuals compared to the overweight or moderately obese (mean bmi = 31) participants in the present study. the lack of body composition changes may be due to the absence of an exercise intervention as part of the study design. other trials suggest that glucomannan in conjunction with resistance and endurance exercise is necessary to promote changes in body composition, including waist and hip circumference, fat mass, and fat - free mass. a possible explanation is that we enrolled only healthy individuals and excluded those with dyslipidemia or elevated serum glucose. thus, floor effects may have precluded detecting any effects of glucomannan on these parameters. another possible explanation is the lack of weight loss in our sample and its effects on these parameters. irregular eating patterns also may provide an explanation for our results. rather than eating 3 meals, many participants reported that they grazed throughout the day and ate the majority of their calories in the evening, possibly circumventing our dosing schedule of 2 capsules one hour before breakfast, lunch, and dinner. similarly, irregular eating patterns may explain the lack of difference in hunger and fullness sensations between the two groups. to effectively coordinate dosing and eating schedules, while the dosage (3.99 g / day) of glucomannan used in our study was similar to or at the lower range of those used in other studies, a higher dosage of glucomannan should be tested in future studies. of special interest would be whether higher doses of glucomannan might be more effective in this population. first, our final sample size (n = 47) was relatively modest. given the type ii error that can occur with small sample sizes, this might be a possible explanation for lack of treatment effects. second, the moderate duration of our study did not permit either long - term safety or efficacy evaluation. glucomannan was generally well tolerated and liver enzymes and serum creatinine levels remained favorable during the 8-week study period ; however, few studies have examined the long - term safety of glucomannan, and this should be a focus of future trials since extended use may impact intestinal absorption of key nutrients, particularly fat - soluble vitamins, carotenoids, and phytosterols. similarly, glucomannan may be more beneficial over the long term when used with healthy overweight and moderately obese individuals. while participants in both groups reported a slightly greater than 80% compliance rate, it is possible that physiologic measures of compliance such as end product metabolites of glucomannan coupled with the use of electronic capsule monitoring systems would have resulted in more precise measures of compliance. in addition to phone and e - mail reminders, other technological measures to improve compliance such as text message reminders and tweets would be of interest in future studies. in summary, glucomannan supplements (3.99 g daily) were well tolerated but did not promote weight loss in overweight and moderately obese individuals consuming self - selected diets and maintaining usual physical activity patterns. other outcomes such as body composition, hunger / fullness, and lipid and glucose parameters also were not significantly altered. these results are inconsistent with the results of previous studies. given the growing epidemic of obesity, additional studies to assess the safety and efficacy of this widely used alternative weight loss approach are needed. future trials should evaluate glucomannan using larger numbers of participants, longer study follow - up periods, flexible dosing schedules, and higher dosages and should continue to include diverse populations of overweight and obese individuals. | background. few safe and effective dietary supplements are available to promote weight loss. we evaluated the safety and efficacy of glucomannan, a water - soluble fiber supplement, for achieving weight loss in overweight and moderately obese individuals consuming self - selected diets. methods. participants were randomly assigned to take 1.33 grams of glucomannan or identically looking placebo capsules with 236.6 ml (8 ounces) of water one hour before breakfast, lunch, and dinner for 8 weeks. the primary efficacy outcome was change in body weight after 8 weeks. other efficacy outcomes were changes in body composition, hunger / fullness, and lipid and glucose concentrations. safety outcomes included gastrointestinal symptoms / tolerance and serum liver enzymes and creatinine levels. results. a total of 53 participants (1865 years of age ; bmi 2535 kg / m2) were enrolled and randomized. the two groups did not differ with respect to baseline characteristics and compliance with the study supplement. at 8 weeks, there was no significant difference between the glucomannan and placebo groups in amount of weight loss (.40.06 and.43.07, resp.) or other efficacy outcomes or in any of the safety outcomes. conclusions. glucomannan supplements administered over 8 weeks were well tolerated but did not promote weight loss or significantly alter body composition, hunger / fullness, or lipid and glucose parameters. this trial is registered with nct00613600. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.